Directory of Open Access Journals (Sweden)
Marli Camassola
2013-01-01
Full Text Available Pleurotus species secrete phenol oxidase enzymes: laccase (Lcc and manganese peroxidase (MnP. New genotypes of these species show potential to be used in processes aiming at the degradation of phenolic compounds, polycyclic aromatic hydrocarbons and dyes. Hence, a screening of some strains of Pleurotus towards Lcc and MnP production was performed in this work. Ten strains were grown through solid-state fermentation on a medium based on Pinus spp. sawdust, wheat bran and calcium carbonate. High Lcc and MnP activities were found with these strains. Highest Lcc activity, 741 ± 245 U gdm-1 of solid state-cultivation medium, was detected on strain IB11 after 32 days, while the highest MnP activity occurred with strains IB05, IB09, and IB11 (5,333 ± 357; 4,701 ± 652; 5,999 ± 1,078 U gdm-1, respectively. The results obtained here highlight the importance of further experiments with lignocellulolytic enzymes present in different strains of Pleurotus species. Such results also indicate the possibility of selecting more valuable strains for future biotechnological applications, in soil bioremediation and biological biomass pre-treatment in biofuels production, for instance, as well as obtaining value-added products from mushrooms, like phenol oxidase enzymes.
Morphology and mycelial growth rate of Pleurotus spp. strains from the Mexican mixtec region
Guadarrama-Mendoza, P.C.; del Toro, G. Valencia; Ramírez-Carrillo, R.; Robles-Martínez, F.; Yáñez-Fernández, J.; Garín-Aguilar, M.E.; Hernández, C.G.; Bravo-Villa, G.
2014-01-01
Two native Pleurotus spp. strains (white LB-050 and pale pink LB-051) were isolated from rotten tree trunks of cazahuate (Ipomoea murucoides) from the Mexican Mixtec Region. Both strains were chemically dedikaryotized to obtain their symmetrical monokaryotic components (neohaplonts). This was achieved employing homogenization time periods from 60 to 65 s, and 3 day incubation at 28 °C in a peptone-glucose solution (PGS). Pairing of compatible neohaplonts resulted in 56 hybrid strains which were classified into the four following hybrid types: (R1-nxB1-n, R1-nxB2-1, R2-nxB1-n and R2-nxB2-1). The mycelial growth of Pleurotus spp. monokaryotic and dikaryotic strains showed differences in texture (cottony or floccose), growth (scarce, regular or abundant), density (high, regular or low), and pigmentation (off-white, white or pale pink). To determine the rate and the amount of mycelium growth in malt extract agar at 28 °C, the diameter of the colony was measured every 24 h until the Petri dish was completely colonized. A linear model had the best fit to the mycelial growth kinetics. A direct relationship between mycelial morphology and growth rate was observed. Cottony mycelium presented significantly higher growth rates (p < 0.01) in comparison with floccose mycelium. Thus, mycelial morphology can be used as criterion to select which pairs must be used for optimizing compatible-mating studies. Hybrids resulting from cottony neohaplonts maintained the characteristically high growth rates of their parental strains with the hybrid R1-nxB1-n being faster than the latter. PMID:25477920
Assessment of Genetic Diversity among Pleurotus spp. Isolates from Jordan
Directory of Open Access Journals (Sweden)
Hanan Aref Hasan
2018-04-01
Full Text Available Pleurotus is considered an important genus that belongs to the family Pleurotaceae and includes the edible King Oyster mushroom (Pleurotus eryngii. In the present study, 19 Pleurotus isolates were collected from two locations in the north of Jordan (Tell ar-Rumman and Um-Qais. The morphological characteristics among collected isolates revealed that there was a morphological similarity among the collected isolates. Nucleotide sequence analysis of the internal transcribed spacer (ITS1–5.8S rDNA–ITS4 region and 28S nuclear large subunit (nLSU in the ribosomal DNA gene of the isolated stains showed that all of them share over 98% sequence similarity with P. eryngii. Genetic diversity among the collected strains was assessed using inter simple sequence repeat (ISSR analysis using 18 different primer pairs. Using this approach, 141 out of 196 bands obtained were considered polymorphic and the highest percentage of polymorphism was observed using primer UBC827 (92.3% with an overall Polymorphism Information Content (PIC value of 70.56%. Cluster analysis showed that the Jordanian Pleurotus isolates fall into two main clades with a coefficient of similarity values ranging from 0.59 to 0.74 with a clear clustering based on collection sites. The results of the present study reveal that molecular techniques of ISSR and rDNA sequencing can greatly aid in classification and identification of Pleurotus spp. in Jordan.
Cultivation Techniques and Medicinal Properties of Pleurotus spp.
Directory of Open Access Journals (Sweden)
Andrej Gregori
2007-01-01
Full Text Available The genus Pleurotus (oyster mushroom comprises some most popular edible mushrooms due to their favourable organoleptic and medicinal properties, vigorous growth and undemanding cultivation conditions. It can be cultivated on log and a wide variety of agroforestry (by-products, weeds and wastes for the production of food, feed, enzymes and medicinal compounds, or for waste degradation and detoxification. Many different techniques and substrates have been successfully utilized for mushroom cultivation and biomass production by means of solid-state and submerged liquid fermentation. However, in contrast to submerged liquid fermentation, solid-state fermentation is not often used in large scale due to severe engineering problems. Various Pleurotus species have been shown to possess a number of medicinal properties, such as antitumour, immunomodulatory, antigenotoxic, antioxidant, anti-inflammatory, hypocholesterolaemic, antihypertensive, antiplatelet-aggregating, antihyperglycaemic, antimicrobial and antiviral activities. These therapeutic activities are exhibited by extracts or isolated compounds from Pleurotus spp. fermentation broth, mycelia and fruiting bodies. In particular, polysaccharides appear to be potent antitumour and immuno-enhancing substances, besides possessing other beneficial activities. However, the biochemical mechanisms of these therapeutic activities still remain largely unknown. This review focuses on recent advances in the biotechnology of Pleurotus spp., with emphasis on the production of fruiting bodies, the production of mycelium and bioactive compounds by solid-state and submerged liquid fermentation. The medicinal properties of this mushroom are also outlined.
Economou, Christina N; Diamantopoulou, Panagiota A; Philippoussis, Antonios N
2017-06-01
Spent mushroom substrate (SMS) of Pleurotus ostreatus was supplemented with wheat bran and soybean flour in various proportions to obtain C/N ratios of 10, 20, and 30, and their effect was evaluated in successive cultivation of Pleurotus ostreatus, Pleurotus pulmonarius, Ganoderma adspersum, Ganoderma resinaceum, and Lentinula edodes strains with respect to mycelium growth rate, biomass concentration, recovery of the enzyme laccase and crude exopolysaccharides, and also with additional fruiting body production. All fungi showed the highest growth rate on unamended SMS (C/N 30), with G. resinaceum being the fastest colonizer (Kr = 9.84 mm day -1 ), while biomass concentration maximized at C/N 10. Moreover, supplementation affected positively laccase activity, with P. pulmonarius furnishing the highest value (44,363.22 U g -1 ) at C/N 20. On the contrary, L. edodes growth, fruiting, and laccase secretion were not favored by SMS supplementation. Fruiting body formation was promoted at C/N 30 for Ganoderma and at C/N 20 for Pleurotus species. Exopolysaccharide production of further studied Pleurotus strains was favored at a C/N 20 ratio, at the initial stage of SMS colonization. The obtained results support the potential effective utilization of supplemented SMS for laccase production from Ganoderma spp. and for new fruiting body production of Pleurotus spp.
Laccase Enzymes in Inocula Pleurotus spp
Directory of Open Access Journals (Sweden)
Nora García-Oduardo
2017-01-01
Full Text Available The cultivation of edible and medicinal mushrooms Pleurotus has been aimed at promoting alternative management for agricultural products. This basidiomicete has been the subject of numerous studies because of its fruiting body constitutes a food, being a producer of enzymes with industrial interest and for its ability of biotransformation of lignocellulosic substrates. Pleurotus inocula in the established technology for growing edible and medicinal mushrooms in the CEBI Research- Production Plant were performed using sorghum or wheat. However, it is possible to expand the possibilities with other substrates. In this paper, the results of laccase enzymes production in inocula prepared with sorghum, corn and coffee pulp with two strains Pleurotus ostreatus CCEBI 3021 and Pleurotus ostreatus CCEBI 3024 are presented. The period of preparation of seed reaches 15-21 days, the measurements of laccase activity were performed in periods of seven days. Extraction of crude enzyme was performed in aqueous phase, the determination of the laccase enzyme activity, using guaiacol as substrate. The results obtained in this work with studies in previous work using sorghum as inocula are compared. It is found that higher yields are obtained laccase in coffee pulp. This study contributes to the theoretical knowledge and to provide alternatives for securing the production process of the plant.
International Nuclear Information System (INIS)
Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.
2016-01-01
Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)
International Nuclear Information System (INIS)
Khan, N. A.; Awan, F. S.; Khan, A. I.; Waseem, M.
2017-01-01
The Oyster mushroom (Pleurotus) cultivation is a profitable agribusiness and having high significance due its nutritive and therapeutic value. Due to deficient knowledge on Pleurotus mushroom genetics seven strains of Oyster mushroom, two local and five exotic were studied for their genetic diversity through RAPD markers. It was clear from similarity matrix that similarity index ranges from 45 to 72%. The cluster analysis of combined data set of all the markers resulted in three major clades, while isolate P-17 remains ungrouped and shown to be the most diverse strain of the seven. During amplification of genomic DNA yielded 70 fragments that could be scored, of which 41 were polymorphic, with an average of 2.73 polymorphic fragments per primer. Number of amplified fragments with random primers ranged from three to six. Polymorphism ranged from 0% to 83.33%, with an overall 58% polymorphism. The allele frequency of RAPD primers ranged from 0.71 to 1.00 while the polymorphic information content highest for the primer GL-C-20 (0.29) followed by the primers GL A-20 and GL C-16 that is zero, indicating medium level of polymorphism among the strains of Oyster mushroom. The objective of the study was to characterize Pleurotus strains collected from different origins and to find out the variability at molecular level. (author)
Loss, Edenes; Royer, Andrea Rafaela; Barreto-Rodrigues, Marcio; Barana, Ana Claudia
2009-07-30
This study evaluated the Pleurotus spp. mushroom production process using an effluent from the maize agroindustrial process as a carbon and nitrogen source and as a wetting agent. A complete experimental design based on factorial planning was used to optimize the biological efficiency and evaluate the effect of the concentration of effluent, pH and species of Pleurotus. The results indicated that the effluent affects the biological efficiency for the production of both species of mushrooms at all pH values studied. The maximum biological efficiency predicted by the model (81.36%) corresponded to the point defined by the effluent contents (X(1)=1), pH (X(2)=-1) and fungus species (X(3)=1), specifically 50%, 5.0 and P. floridae, respectively. The results demonstrated that the effluent is a good alternative for the production of Pleurotus mushrooms.
Renata Zawirska-Wojtasiak; Marek Siwulski; Sylwia Mildner-Szkudlarz; Erwin Wąsowicz
2009-01-01
The aroma of several strains of Pleurotus ostreatus, Pleurotus citrinopileatus and Pleurotus djamor was studied by GC/MS. Three main mushrooms aroma constituents: 3-octanol, 3-octanone and 1-octen-3-ol were taken into account for quantitative measurements. The highest amount of 1-octen-3-ol was recorded in P. ostreatus, while considerably lower amounts in P. citrinopileatus. Sensory profile analysis as well as the electronic nose also varied between the three species of Pleurotus. Chiral gas ...
Directory of Open Access Journals (Sweden)
Hamid Akbarirad
2013-06-01
Full Text Available Mushrooms are consider as a nutritional and health beneficial product. Three most cultivated mushrooms worldwide are Agaricus bisporus, Lentinus edodes and Pleurotus spp. Mushrooms are highly perishable. They tend to lose quality after harvest, mainly because of their high respiration rate and the fact that they have no barrier to protect them from water loss. Mushrooms’ shelf-life is limited to a few days under normal refrigeration conditions, which is a constraint on the distribution and marketing of fresh product, making extension of mushroom’s shelf life a constant quest. Modified atmosphere packaging provides an affordable packaging system that partly avoids enzymatic browning, fermentation and other biochemical processes by maintaining a controlled gas atmosphere. However, modified atmosphere packaging conditions should be carefully designed. Inappropriate modified atmosphere conditions may be ineffective or even shorten the shelf life of the product due to damage of tissues. Preservation techniques and specially use of MAP, specifically for Agaricus, Lentinus edodes and Pleurotus, is reviewed.
[Use of ITS and ISSR markers in the molecular characterisation of Pleurotus djamor hybrid strains].
Aguilar Doroteo, Leticia; Zárate Segura, Paola Berenice; Villanueva Arce, Ramón; Yáñez Fernández, Jorge; Garín Aguilar, María Eugenia; Guadarrama Mendoza, Paula Cecilia; Valencia Del Toro, Gustavo
Molecular characterisation of wild type Pleurotus species is important for germplasm conservation and its further use for genetic improvement. No molecular studies have been performed with monokaryons used for producing hybrid strains, either with the reconstituted strains obtained by pairing those monokaryons. The molecular characterisation of parental dikaryons, hybrid, and reconstituted strains as well as monokaryotic strains, is therefore of utmost importance. To carry out the molecular identification of Pleurotus djamor strains, i.e. dikaryotic wild type strains, hybrid strains, and the monokaryotic strains used for the hybrid formation. Five wild type strains of P. djamor from different states in Mexico were collected and molecularly identified by sequencing the ITS1-5.8-ITS2 region using ITS1 and ITS4 universal oligonucleotides. Four hybrid strains were obtained by pairing neohaplonts of two wild type strains selected. Six ISSR markers were used for the molecular characterisation of monokaryotic and dikaryotic strains. Using the ITS markers, an amplified product of 700bp was obtained in five wild type strains, with a 99-100% similarity with P. djamor. A total of 95 fragments were obtained using the ISSR markers, with 99% of polymorphism. Wild type strains were identified as P. djamor, and were clearly grouped with Mexican strains from other states of Mexico. ISSR markers allowed the generation of polymorphic bands in monokaryotic and dikaryotic strains, splitting both types of strains. The high degree of polymorphism indicates the genetic diversity of P. djamor, an advantage in mushroom production and in the improving of the species. Copyright © 2017 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.
International Nuclear Information System (INIS)
Chen Henglei; Wan Honggui; Lv Changwu; Zeng Xianxian
2010-01-01
Pleurotus polysaccharide high-yield strains were selected through a method of auxotrophic primary screening and Shake-flask fermentation re-screening after low-energy heavy ions (the fluence of 1.2 x 10 16 N + /cm 2 at the energy of 15 keV) stepwise implantation. Two Pleurotus polysaccharide high-yield strains, PFPH-1 and PFPH-2, were selected with stable mycelium polysaccharide yield. The mycelium polysaccharide yield of PFPH-1 and PFPH-2 increased by 46.55% and 75.14%, respectively, compared to the original strain. The accumulation of mycelium biomass and intracellular polysaccharides were monitored in the submerged fermentation of Pleurotus ferulae by supplementation of various carbon and nitrogen sources as well as inorganic salts and pH alteration. The optima1 submerged fermentation medium favoring the accumulation of mycelium biomass and intracellular polysaccharides of PFPH-2 consisted of 1.0% wheat flour, 2.0% sucrose, 2.0% soybean flour, 1.5% bran extract, 0.2% K 2 HPO 4 , and 0.15% MgSO 4 ·7H 2 O, with a fittest pH value of 5.64. The orthogonal combination of the optimal carbon and nitrogen sources with inorganic salts indicates a synergistic effect on the accumulation of mycelium biomass and intracellular polysaccharides in the submerged fermentation of PFPH-2. The yield of mycelium polysaccharides of PFPH-2 increased to 903.73 ± 1.23 mg·L -1 by the end of fermentation. (authors)
Moonmoon, Mahbuba; Uddin, Md Nazim; Ahmed, Saleh; Shelly, Nasrat Jahan; Khan, Md Asaduzzaman
2010-10-01
Pleurotus eryngii is a popular mushroom due to its excellent consistency of cap and stem, culinary qualities and longer shelf life. In Bangladesh, where Pleurotus mushrooms are very popular, P. eryngii may take position among the consumers, but currently this mushroom is not cultivated in large scale there. In this study, 3 strains of P. eryngii such as Pe-1 (native to Bangladesh), Pe-2 (germplasm collected from China) and Pe-3 (germplasm collected from Japan) were cultivated on saw dust and rice straw and their growth and yield parameters were investigated. Pe-1 on saw dust showed the highest biological yield and efficiency (73.5%) than other strains. Also, the mycelium run rate and number of fruiting bodies were higher in Pe-1 than other two strains. The quality of mushroom strains was near about similar. On saw dust, the yield and efficiency were better than those cultivated on rice straw, however, on straw; the mushroom fruiting bodies were larger in size. This study shows the prospects of P. eryngii cultivation in Bangladesh and suggests further study in controlled environment for higher yield and production.
International Nuclear Information System (INIS)
Wang Lianfeng; Chen Henglei; Zhang Jun; Zeng Xianxian
2009-01-01
In order to screen pleurotus mycelium polysaccharide high-yield strains, the comparative study was made by use of ion beam implantation and composite mutagenesis before screening. The treating mycelium pellet of pleurotus ferulae tentatively with ion beam implantation was performed at the first. Two polysaccharide high-yield strains, PFPH-1and PFPH-2, were selected using fermentation quantitative screening after auxotrophy qualitative primary screening. It has been found that the polysaccharide yield of the mutants is 551.80mg/L and 659.46mg/L respectively,which increases by 46.55% and 75.14% respectively compared to that of initial strain. Then PFPH-1and PFPH-2, as the original strain, is exposed to ultraviolet light and is suffered by additive of LiCl respectively. The results indicate that the polysaccharide yield of strains 1,9 and 10 decreases by 27%, 38% and 37% respectively compared to that of PFPH-1 meanwhile the polysaccharide yield of strain 17 decreases by 28% compared to that of PFPH-2 after high-flux qualitative primary screening. In this study, composite mutagenesis with exposure of ultra-violet and additive of lithium chloride shows some negative effects. (authors)
Diseases and pests noxious to Pleurotus spp. mushroom crops.
Bellettini, Marcelo B; Bellettini, Sebastião; Fiorda, Fernanda A; Pedro, Alessandra C; Bach, Fabiane; Fabela-Morón, Miriam F; Hoffmann-Ribani, Rosemary
The Pleurotus genus is one of most extensively studied white-rot fungi due to its exceptional ligninolytic properties. It is an edible mushroom that possesses biological effects, as it contains important bioactive molecules. It is a rich source of nutrients, particularly proteins, minerals as well as vitamins B, C and D. In basidiomycete fungi, intensive cultivations of edible mushrooms can often be affected by some bacterial, mold and virus diseases that rather frequently cause dramatic production loss. These infections are facilitated by the particular conditions under which mushroom cultivation is commonly carried out such as warm temperatures, humidity, carbon dioxide (CO 2 ) levels and presence of pests. There is not much bibliographic information related to pests of mushrooms and their substrates. The updated review presents a practical checklist of diseases and pests of the Pleurotus genus, providing useful information that may help different users. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.
Directory of Open Access Journals (Sweden)
Katarzyna Wińska
2016-06-01
Full Text Available The aim of the study was to obtain new compounds during biotransformation of two halocompounds, the δ-bromo and δ-iodo-γ-bicyclolactones 1 and 2. Unexpectedly Pleurotus ostreatus produced together with the hydroxylactone, 2-hydroxy-4,4-dimethyl-9-oxabicyclo[4.3.0]nonane-8-one (3, its own metabolite (3S,9S,15S-(6E,12E-3,9,15-trimethyl-4,10,16-trioxacyclohexa-deca-6,12-diene-1,5,8,11,14-pentaone (4. The method presented here, in which this macrosphelide 4 was obtained by biotransformation, has not been previously described in the literature. To the best of our knowledge, this compound has been prepared only by chemical synthesis to date. This is the first report on the possibility of the biosynthesis of this compound by the Pleurotus ostreatus strain. The conditions and factors, like temperature, salts, organic solvents, affecting the production of this macrosphelide by Pleurotus ostreatus strain were examined. The highest yield of macroshphelide production was noticed for halolactones, as well with iodide, bromide, iron and copper (2+ ions as inductors.
[TYPING OF LEPTOSPIRA SPP. STRAINS BASED ON 16S rRNA].
Ostankova, Yu V; Semenov, A V; Stoyanova, N A; Tokarevich, N K; Lyubimova, N E; Petrova, O A; Ananina, Yu V; Petrov, E M
2016-01-01
Comparative typing of Leptospira spp. strain collection based on analysis of 16S RNA fragment. 2 pairs of primers were used for PCR, that jointly flank 1423b.p. sized fragment. Sequences of Leptospira spp. strain 16S rRNA, presented in the international database, were used for phylogenetic analysis. A high similarity, including interspecies, of the 16S fragment in Leptospira spp. strains was shown independently of the source, serovar and serogroup. Heterogeneity of the primary matrix, spontaneous mutations of hotspots and erroneous nucleotide couplings, characteristic for 16S sequence of pathogenic Leptospira spp. strains, are discussed. Molecular-genetic characteristic of certain reference Leptospira spp. strains by 16S sequence is obtained. Results of the studies give evidence on expedience of introduction into clinical practice of identification of Leptospira spp. by 16S sequence directly from the clinical material, that would allow to significantly reduce identification time, dismiss complex type-specific sera and other labor-intensive methods.
Directory of Open Access Journals (Sweden)
Carol Daniela Coello-Loor
2017-12-01
Full Text Available La velocidad de crecimiento radial (VCR (mm.h-1 y la producción de biomasa (PB (g.g-1 de sustrato seco son técnicas que puedan establecer el grado de adaptación y desarrollo de los hongos del género Pleurotus spp., a distintos sustratos que podrían emplearse en una fermentación en medio sólido. Las especies fueron Pleurotus sapidus (Ps y Pleurotus ostreatus IE8 (Po. El medio de cultivo sintético empleado fue el papa dextrosa agar (PDA, con un pH que va de 5.6 a 5.9, ideal para el crecimiento de hongos, tiene todos los componentes nutritivos, y ligera acidez que logran la inhibición del desarrollo de bacterias; diluido en 4 diferentes soluciones preparadas con los materiales residuales (solución cascarilla de arroz CaPDA, solución cáscara de maracuyá CmPDA, solución mezcla 50% Cascarilla de arroz+50% Cáscara de maracuyá CaCmPDA y agua destilada+PDA con el propósito de observar el crecimiento radial cada 24 horas y la producción de biomasa fúngica de estos hongos lignocelulósicos por su periodo de incubación y la adaptación a nivel in vitro. Los tratamientos que presentaron mejor comportamiento VCR fueron el PoCaPDA (0.569 y el PoCaCmPDA (0.549; la cepa que reporto valores más altos en VCR y PB fue el Pleurotus ostreatus y el mejor medio de cultivo fue el CaPDA, en ambas variables; mientras, la mayor producción de biomasa fue en Pleurotus sapidus en CaPDA (0.1727 y el Pleurotus ostreatus IE8 en CmPDA (0.1722, CaPDA (0.1706 y PDA (0.1694.
Omarini, Alejandra B; Plagemann, Ina; Schimanski, Silke; Krings, Ulrich; Berger, Ralf G
2014-11-01
Several hundred monokaryotic and new dikaryotic strains derived thereof were established from (+)-valencene tolerant Pleurotus species. When grouped according to their growth rate on agar plates and compared to the parental of Pleurotus sapidus 69, the slowly growing monokaryons converted (+)-valencene more efficiently to the grapefruit flavour compound (+)-nootkatone. The fast growing monokaryons and the slow×slow and the fast×fast dikaryotic crosses showed similar or inferior yields. Some slow×fast dikaryons, however, exceeded the biotransformation capability of the parental dikaryon significantly. The activity of the responsible enzyme, lipoxygenase, showed a weak correlation with the yields of (+)-nootkatone indicating that the determination of enzyme activity using the primary substrate linoleic acid may be misleading in predicting the biotransformation efficiency. This exploratory study indicated that a classical genetics approach resulted in altered and partly improved terpene transformation capability (plus 60%) and lipoxygenase activity of the strains. Copyright © 2014 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
M. Kolář
2008-01-01
Full Text Available The study aimed at determining the level of resistance of selected bacterial species (Staphylococcus spp., Enterococcus spp., Escherichia coli isolated from rectal swabs of pigs to antimicrobial agents. The tested strains were isolated from piglets aged 7 to 30 days. Bacterial species were identified by standard microbiological techniques and susceptibility to antibiotics was determined quantitatively by the standard microdilution method. Resistance of the Staphylococcus aureus strain to oxacillin was confirmed by detection of the mecA gene and PBP2a. A total of 115 Staphylococcus spp. isolates were collected. In the case of Staphylococcus aureus, the methicillin-resistant strain (MRSA was identified. Moreover, higher frequency of coagulase-negative staphylococci with minimum inhibitory concentration of oxacillin ≥ 0.5 mg/l was noticed. Inducible resistance to clindamycin in the Staphylococcus hominis strain was also detected. The strains of Enterococcus spp. (61 isolates exhibited high resistance to tetracycline (98.5%, erythromycin (86.8% and chloramphenicol (54.4%. Vancomycin-resistant enterococci were not isolated. In the case of Escherichia coli strains (111 isolates, higher frequency of resistant strains to tetracycline (81.1% and ampicillin (62.2% was documented. Resistance to fluoroquinolones and production of broad-spectrum β-lactamases was not noticed. The presented study may be considered as a pilot project assessing the prevalence of resistant bacteria in piglets kept on a single farm. It demonstrated the presence of resistant strains of Staphylococcus spp., including one MRSA strain, Enterococcus spp. and Escherichia coli. These strains may be present as a result of postnatal colonization with both bacterial microflora of dams and environmental microflora.
Directory of Open Access Journals (Sweden)
Eduardo Bernardi
2009-01-01
Full Text Available O objetivo deste trabalho foi avaliar a produtividade, eficiência biológica, massa fresca, composição centesimal dos cogumelos Pleurotus ostreatus (BF24 e Pleurotus sajor-caju (PSC96/03 e PSC01/06 produzidos no substrato capim-elefante (Pennisetum purpureum pasteurizado e a relação Carbono/Nitrogênio inicial e final do substrato. O substrato seco e particulado a 2 cm foi umedecido por 24 horas e pasteurizado a 100 ºC durante 30 minutos. Adicionaram-se 3% de inóculo de cada linhagem, sendo acondicionado em embalagens de polipropileno com 1 kg cada uma. Os substratos foram incubados a 26 ºC e na fase de frutificação a 23±3 ºC e umidade relativa de 75% a 90%. Na linhagem BF24 observou-se maior massa fresca (281,19g, eficiência biológica (112,46% e produtividade (28,11%. O substrato com relação Carbono:Nitrogênio inicial de 162:1 foi o de menor relação (68:1 após o cultivo do P. sajor-caju (PSC01/06. A linhagem PSC96/03 proporcionou maior teor de proteína em relação às demais, tendo a BF24 maior teor de lipídios. Quanto ao teor de carboidratos e cinzas, nas diferentes espécies e linhagens não houve diferenças significativas; já para a quantidade de fibras, as linhagens BF24 e PSC01/06 foram similares, porém superiores a PSC96/03. As duas espécies de Pleurotus podem ser cultivadas em capim-elefante pasteurizado, suprimindo o processo de compostagem.The objective of this work was to evaluate the productivity, biological efficiency, fresh matter, and centesimal composition of mushroom Pleurotus ostreatus (BF24 and Pleurotus sajor-caju (PSC96/03 and PSC01/06 grown in pasteurized elephant grass substrate (Pennisetum purpureum. It was also assessed the initial and final Carbon/Nitrogen ratio. The dried 2-cm-particulate substrate was moist for 24 hours and pasteurized at 100ºC during 30 minutes. Then, it was added 3% of inoculum of each strain. The substrate was placed into 1-kg polypropylene bags. The bags were incubated
Sivolapova, A.B.; Shnyreva, A.V.; Sonnenberg, A.S.M.; Baars, J.J.P.
2012-01-01
Fungi of the genus Pleurotus, in particular, species Pleurotus ostreatus (common oyster mushroom) are among most cultivated fungi in the world. Due to intense rates of development of studies in this field, efficient breeding programs are highly required in the search for new P. ostreatus strains.
Yield and nutritional composition of oyster mushroom strains newly introduced in Bangladesh
Directory of Open Access Journals (Sweden)
Mostak Ahmed
2013-02-01
Full Text Available The objective of this work was to evaluate yield and chemical composition of oyster mushroom strains newly introduced in Bangladesh. Strains of Pleurotus high‑king (strain PHK, P. ostreatus (strain PO2, and P. geesteranus (strains PG1 and PG3 were evaluated as to yield components and proximate composition. Pleurotus ostreatus was used as control. Pleurotus high‑king showed fastest growth of primordia, but moderate flush of effective fruiting bodies. Pleurotus geesteranus (PG1 showed higher economic yield and biological performance, and better chemical composition, especially in terms of protein and mineral contents. Pleurotus geesteranus (PG1 shows better performance than P. ostreatus (PO2, the most commercially cultivated edible species in Bangladesh, and, therefore, it should be recommended for commercial cultivation.
Mintesnot, Birara; Ayalew, Amare; Kebede, Ameha
2014-01-15
This study assessed the bioconversion of Agriculture wastes like invasive weeds species (Lantana camara, Prosopis juliflora, Parthenium hysterophorus) as a substrate for oyster mushroom (Pleurotus species) cultivation together with wheat straw as a control. The experiment was laid out in factorial combination of substrates and three edible oyster mushroom species in a Completely Randomized Design (CRD) with three replications. Pleurotus ostreatus gave significantly (p mushroom cultivation could contribute to alleviating ecological impact of invasive weed species while offering practical option to mitigating hunger and malnutrition in areas where the invasive weeds became dominant.
Albuquerque, Margeli Pereira de
2010-01-01
As espécies de Pleurotus, popularmente conhecidas por cogumelos ostra, são decompositoras primárias de madeira e outros resíduos vegetais biodegradáveis. Estes fungos apresentam propriedades nutricionais com elevados teores de proteínas aminoácidos essenciais, ácidos graxos insaturados, vitaminas e minerais, por isso estão tornando-se cada vez mais importantes como um recurso alimentar. A identificação de substratos que permitam o rápido desenvolvimento do micélio fúngico é uma...
Identification and characterization of Trichoderma species aggressive to Pleurotus in Italy
Institute of Scientific and Technical Information of China (English)
Woo S L; Di Benedetto P; Senatore M; Abadi K; Gigante S; Soriente I; Ferraioli S; Scala F; Lorito M
2004-01-01
@@ In the late 1980's the development of a severe epidemic of green mold caused by Trichoderma spp.was noted in the commercial production of Agaricus bisporus (champignon) in the United Kingdom,North America, Spain and Holland, which caused extensive economic losses. The parasitic fungi isolated from the edible mushroom belonged to four biotypes, Thl, Th2, Th3 and Th4 of T.harzianum. However, among these biotypes, only Th2 (since classified as T. aggressivum f.europaeum) and Th4 (T. aggressivum f. aggressivum) were identified as the fungi causing problems in Agaricus production. In general, mushroom compost hosts both aggressive and innocuous isolates of Trichoderma, which are not morphologically distinguishable. About four years ago, a problem with green mold became apparent in the production of Pleurotus ostreatus in Northern Italy,which eventually developed to a crisis situation in the South two years later and threatened to seriously compromise the Pleurotus market. This study was initiated to: isolate and identify the aggressive fungi, then morphologically, physiologically and genetically characterize the isolates, determine the source and phases of infection, and study methods of control. Samples were obtained from different phases of compost preparation at the locality of a major producer and supplier of compost to the mushroom industry in Southern Italy, and microbial counts were conducted. Although the presence of Trichoderma was detected in the initial stages of composting, this value was reduced to zero from the phase of pasteurization to seeding with Pleurotus. Trichoderma infestations were noted in the packaged Pleurotus bales at various times during the incubation phase (7-15 days after seeding) and after shipping to the mushroom greenhouses, where the pathogen infestations greatly reduced the quality and quantity of the mushroom yield, as well as the number of potential harvest cycles.Preliminary results from the morphological and genetic
Directory of Open Access Journals (Sweden)
Savic Milena
2012-01-01
Full Text Available The activity of organic selenium against pathogenic molds and its use as a potential selenium source in the production of enriched mushrooms were examined. The effect of commercial selenized yeast on mycelia growth was examined using a method with mycelia disks and a well diffusion method. For mushroom enrichment, different concentrations of selenium were added to a growth substrate. The results presented in this paper suggest that the most suitable concentration of selenized yeast that inhibits the growth of the mycopathogenic molds is 70-100 mg/kg of selenium. With the addition of this concentration to the substrate, mushroom fruit bodies will uptake a high level of selenium, about 100 μg/g for Pleurotus spp., and 200 μg/g for Agaricus bisporus in dry weight of the mushroom. Thereby a double effect in the cultivation of mushrooms is achieved. [Projekat Ministarstva nauke Republike Srbije, br. III 46010 and br. III46001
Urbanelli, S; Della Rosa, V; Punelli, F; Porretta, D; Reverberi, M; Fabbri, A A; Fanelli, C
2007-03-01
Wild populations of edible species are important source of genetic variability for cultivated lines that can undergo a drastic loss of diversity resulting from man's selection. The development of tools aimed at the clear-cut and safe identification and assessment of genetic variability of the wild and cultivated strains is thus a fundamental goal of molecular genetic research. In this study, we used two polymerase chain reaction (PCR)-based fingerprinting methods-amplified fragment length polymorphism (AFLP) and restriction fragment length polymorphism (RFLP) of laccase and manganese peroxidase genes-to assess genetic differences among strains and independently evolving lineages belonging to the Pleurotus eryngii complex. Both laccase RFLP and AFLP have been proved to distinguish unambiguously the three taxa studied: Pleurotus ferulae, P. eryngii, and P. eryngii var. nebrodensis. AFLP also showed enough sensitivity to detect polymorphisms among the strains, proving to be an efficient DNA fingerprinting tool in studies of strain assignment. The divergent RFLP laccase and manganese peroxidase patterns are also discussed in relation to the role played by these genes in the interaction between these fungi and their host plants.
In vitro effects of various xenobiotics on Fusarium spp. strains isolated from cereals.
Wolny-Koładka, Katarzyna A
2014-01-01
This study aimed to determine the susceptibility of Fusarium spp. strains isolated from cereals to selected heavy metals, fungicides and silver nanoparticles. The experiments were conducted using 50 Fusarium strains belonging to five species: F. graminearum, F. culmorum, F. oxysporum, F. sporotrichioides and F. avenaceum. The strains were found to be highly resistant to Pb(2+) and Zn(2+). Medium resistance to Cu(2+) and Mn(2+) and low resistance to Cd(2+) and Fe(3+) was also observed. Among the tested fungicides, formulations containing azoxystrobin, prochloraz and tebuconazole proved to be the most effective in inhibiting the growth of fungi, as they affected fungal growth in each of the applied doses. Susceptibility of Fusarium spp. to nanosilver, demonstrated in this study, shows the legitimacy of using nanostructures as fungicidal agents. The results confirm high diversity of the analyzed fungal species in terms of susceptibility to the tested substances, and encourage to continue research on the resistance of Fusarium spp. to various fungicidal agents.
Directory of Open Access Journals (Sweden)
Min Keun Kim
2017-06-01
Full Text Available RcsA is a positive activator of extracellular polysaccharide (EPS synthesis in the Enterobacteriaceae. The rcsA gene of the soft rot pathogen Pantoea sp. strain PPE7 in Pleurotus eryngii was cloned by PCR amplification, and its role in EPS synthesis and virulence was investigated. The RcsA protein contains 3 highly conserved domains, and the C-terminal end of the open reading frame shared significant amino acid homology to the helix-turn-helix DNA binding motif of bacterial activator proteins. The inactivation of rcsA by insertional mutagenesis created mutants that had decreased production of EPS compared to the wild-type strain and abolished the virulence of Pantoea sp. strain PPE7 in P. eryngii. The Pantoea sp. strain PPE7 rcsA gene was shown to strongly affect the formation of the disease symptoms of a mushroom pathogen and to act as the virulence factor to cause soft rot disease in P. eryngii.
Effect of Antimicrobials on Salmonella Spp. Strains Isolated from Poultry Processing Plants
Directory of Open Access Journals (Sweden)
L Mion
Full Text Available ABSTRACT The routine use of antimicrobials in animal production for the treatment of infections, disease prevention, or as growth promoters is a predisposing factor for the development and dissemination of antimicrobial resistance. In food industries, sanitizers are used for the control of microbial colonization, and their efficacy depends on contact time and on the dilution of the products used. The present study assessed the effect of 12 antimicrobials and four commercial sanitizers on 18 Salmonella spp. strains isolated from poultry processing plants. None of the evaluated antimicrobials was 100% effective against the tested Salmonella spp. strains; however, 94% of the isolates were susceptible to ciprofloxacin, 77% to amoxicillin + clavulanic acid and to ampicillin, and 72% to enrofloxacin, whereas 100% of the isolates were resistant to penicillin G, 16% to tetracycline, and 11% to sulfonamide. The tested Salmonella spp. strains were 100% inhibited by peracetic acid after five minutes of contact, 0.5% by quaternary ammonium after 15 minutes, and 85.7% by chlorhexidine after 15 minutes. The results indicate the importance of testing of efficacy of antimicrobials used in animal production and in public health to monitor their action and the development of resistance.
Nan, Wenlong; Tan, Pengfei; Wang, Yong; Xu, Zouliang; Mao, Kairong; Peng, Daxin; Chen, Yiping
2014-09-01
Immunisation with attenuated Brucella spp. vaccines prevents brucellosis, but may also interfere with diagnosis. In this study, a duplex PCR was developed to distinguish Brucella suis vaccine strain S2 from field strains of B. suis biovar 1 and other Brucella spp. The PCR detected 60 fg genomic DNA of B. suis S2 or biovar 1 field strains and was able to distinguish B. suis S2 and wild-type strains of B. suis biovar 1 among 76 field isolates representing all the common species and biovars, as well as four vaccine strains, of Brucella. Copyright © 2014 Elsevier Ltd. All rights reserved.
Interaction of uranium with Pleurotus sp
International Nuclear Information System (INIS)
Ohnuki, Toshihiko; Sakamoto, Fuminori; Kozaki, Naofumi; Ozaki, Takuro; Samadfam, Mohammad
2002-01-01
Uptake of uranium by higher fungi, such as mushroom is little elucidated. We have studied the interaction of uranium with Pleurotus sp. (a mushroom) in pure culture over a wide range of U concentration (50-3000 mg/L). The Pleurotus sp. was cultured in two different media. One was rice bran medium, and the other was agar (yeast extract, peptone and dextrose) medium. The uptake of uranium in Pleurotus sp. was examined by alpha ray autoradiography (A,A), X-ray fluorescence spectroscopy (XRF) and scanning microcopy (SEM) equipped with EDS. In the agar medium, the higher uranium concentration gave lower growth of mycelia, and no fruiting body was observed. In the rice bran medium, the fruiting body was grown at U concentrations up to 1000 mg/L. The AA and XRF analysis showed that uranium taken up in the fruiting body was below the detection limit. The SEM-EDS analysis indicated that U was distributed in the limited region and was not transported to the mycelia far from U containing medium. It is concluded that uranium affects the growth of Pleurotus sp., and little uranium is taken up by Pleurotus sp. during the growth of both mycelia and fruiting body. (author)
Directory of Open Access Journals (Sweden)
Mileidy Cruz-Martín
2016-01-01
Full Text Available The search for alternatives to agricultural pesticides used for the management of black Sigatoka (Mycosphaerella fijiensis Morelet includes the selection of microorganisms strains with potential for the control of this pathogen. The objective of the work was to characterize bacterial strains isolated from the phylosphere of Musa spp. with antifungal effect against M. fijiensis. A morphological, cultural, physiological and molecular characterization of the strains was performed and the antifungal activity of these strains was quantified by dual culture. It was verified the diversity of bacteria with antifungal properties against M. fijiensis present in the phylosphere of Musa spp. In addition, it was found that the phyllosphere of these crops can be used as a source of obtaining possible biological controls of M. fijiensis. Keywords: bacteria, biocontrol, Black Sigatoka, epiphytes
Directory of Open Access Journals (Sweden)
Nelson Menolli Junior
2010-04-01
Full Text Available The species of Pleurotus have great commercial importance and adaptability for growth and fructification within a wide variety of agro-industrial lignocellulosic wastes. In this study, two substrates prepared from ground corncobs supplemented with rice bran and charcoal were tested for mycelium growth kinetics in test tubes and for the cultivation of four Pleurotus commercial isolates in polypropylene bags. The identification of the isolates was based on the morphology of the basidiomata obtained and on sequencing of the LSU rDNA gene. Three isolates were identified as P. ostreatus, and one was identified as P. djamor. All isolates had better in-depth mycelium development in the charcoal-supplemented substrate. In the cultivation experiment, the isolates reacted differently to the two substrates. One isolate showed particularly high growth on the substrate containing charcoal.Espécies de Pleurotus têm grande importância comercial e adaptabilidade para crescimento e frutificação em uma ampla variedade de resíduos agro-industriais lignocelulósicos. Neste trabalho foram testados dois substratos à base de sabugo de milho triturado, suplementados com farelo de arroz e carvão vegetal, para avaliação da cinética de crescimento micelial em tubos de ensaio e produção em sacos de polipropileno, utilizando quatro isolados comerciais. O estudo taxonômico foi realizado com a análise da morfologia dos basidiomas obtidos em cultivo e pelo seqüenciamento do gene nLSU do DNAr, para certificar a identificação taxonômica. Os isolados tiveram melhor desenvolvimento micelial em profundidade no substrato suplementado com carvão vegetal. Em relação à produção, os isolados reagiram de formas distintas em função dos substratos, sendo significativamente melhor o substrato contendo carvão. Três isolados foram identificados como P. ostreatus e o outro foi identificado como P. djamor.
Beta-Glucan Synthase Gene Expression in Pleurotus sp
International Nuclear Information System (INIS)
Azhar Mohamad; Nie, H.J.
2016-01-01
Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)
International Nuclear Information System (INIS)
Mohammed, H.M; Soliman, S.S.A; Shawky, A.S.H; Mahgoub, E.M.I
2013-01-01
The present study aimed to understand the effect of gamma rays on three strains of white oyster mushroom Pleurotus ostreatus and induction of new benefit mutants. Five different doses, i.e., 0.25,0.5,0.75, and 1.00 KGy of gamma rays were used. Twelve morphological criteria were measured. The result confirmed the existence of different response of three strains to different doses of radiation. The 21 strain as a control, the first flush was misshapen, but the second flush gave normal fruit, while mutant Po 21-3 gave excellent growth performance for the shape, colour, fruit diameter and stem length, while slightly decrease in wet and dry total matter per bag and flushes numbers were found.The po 21-2 mutant considered as important mutant because slightly increased in wet and dry total matter than the control, and had short stem length. This mutant Po 21 -2 gave spores, while the control was sporeless. Control of strain 22 possessed good performance for fruit characterization but it forms fruits less than its primordial it formed (semi maturation less strain) per bag, While po 22-l and Po 22-2 appeared good performance, in addition high yielding as wet and dry total matter and faster flushing. The control of strain 66 had a good growth performance, and the four mutants for this strain is very good too they had excellent growth performance; Po 66-1 and Po 66-3 mutants had significant and highly significant values for wet matter than the control (21.04, 21.64 and 12.27) for (Po 66-1, Po 66-4, control). As well as more important criteria there were taken as short fruit stem length and fruit number/bag. These results confirmed the important of Po 66-4 followed by po 66-1 in next breeding and production programs for white oyster mushroom (Pleurotus ostreatus).the RAPD PCR results showed the oligonucleotide OPB-10, OPA-05 and OPC-02 presented the highest percentage of RAPD polymorphism (80⁒, 80⁒, 66.6⁒). The pattern obtained with OPB-10 oligonucleotide for strains
Dose Response for Monokaryon mycelium of Pleurotus pulmonarius After Acute Gamma Radiation
International Nuclear Information System (INIS)
Wan Safina Wan Abdul Razak; Azhar Mohamad; Nie, H.J.
2016-01-01
Pleurotus pulmonarius is locally known as Grey oyster. The species is popular and widely cultivated throughout the world mostly in Asia Europe as their simple and low cost production technology and higher biological efficiency. Mutation induction is an alternative ways for improving available commercial strain for better quality traits. Dose response is important in evaluating effects of mutagenesis via acute gamma radiation. Monokaryon mycelium of Pleurotus pulmonarius was exposed to acute gamma radiation ranged from 0 Gy, 0.1 kGy, 0.2 kGy, 0.3 kGy, 0.4 kGy, 0.5 kGy, 0.6 kGy, 0.7 kGy, 0.8 kGy, 0.9 kGy, 1.0 kGy, 1.5 Gy, 2.0 kGy, 3.0 kGy and 4.0 kGy at dose rate 0.013 kGy/ min. growth performance was measured at 2 days interval to get the LD_5_0. Increasing of the irradiation dose found to decrease the growth performance of the monokaryon mycelium. LD_5_0 was revealed at 1.56 kGy for mono karyon mycelium. Discoveries of the works are important for the improvement of Pleurotus species via acute gamma radiation and benefiting to growers and mushroom industries. (author)
Directory of Open Access Journals (Sweden)
Laila Goudarzi
2017-02-01
Full Text Available Background: Proteus spp. belongs to the family of Enterobacteriaceae. These bacteria are Gram-negative and motile microorganisms and known as the third most common causes of urinary tract infections. The aim of the current study was to investigate the effects of some secondary metabolites from probiotic strains of Lactobacillus spp. on swarming and growth of Proteus mirabilis and P. vulgaris. Methods: After determination of optimal conditions for the growth and production of antimicrobials, bacteriocins and biosurfactants were partially purified from Lactobacillus culture supernatants. Then, effects of the purified compounds on growth and swarming migration of Proteus spp. were examined in the presence of various concentrations of semi-purified compounds. Results: Results showed that the partially purified bacteriocins inhibited Proteus spp. swarming distance and had a significant reduction on the bacterial growth curves. Biosurfactants in a solvent form did not have any considerable effects on factors produced by Proteus spp. Conclusion: According to the results, the secondary metabolites, especially bacteriocins or bacteriocin-like substances derived from Lactobacillus strains, can inhibit or reduce growth and swarming migration of Proteus spp. which are considered as the bacteria major virulence factors.
Urease-positive thermophilic strains of Campylobacter isolated from seagulls (Larus spp.).
Kaneko, A; Matsuda, M; Miyajima, M; Moore, J E; Murphy, P G
1999-07-01
Three strains of urease-positive thermophilic Campylobacter (UPTC), designated A1, A2 and A3, were identified by biochemical characterization after isolation from faeces of seagulls in Northern Ireland in 1996. The biochemical characteristics of the strains were identical to those of strains described previously. Analysis by pulsed-field gel electrophoresis (PFGE) after separate digestion with ApaI and SmaI demonstrated that the respective PFGE profiles were indistinguishable. The PFGE analysis also suggested that the genomes were approximately 1810 kb in length. This is the first example of the isolation of UPTC from flying homoiothermal animals, i.e. from seagulls (Larus spp.).
DEHYDRATION OF EDIBLE MUSHROOMS (PLEUROTUS OSTREATUS)
Salas de la Torre, N.; Bazán, D.; Osorio, A.; Cornejo, O.; Carrero, E.
2014-01-01
The edible mushroom Pleurotus ostreatus have been subjected to thermal, chemical and thermal-chemical treatment. The results show that the chemical treatment produces a more effective enzymatic inactivation compared to the other two treatments. Also, the experimental study of fungi dehydration carried out at 55 ° C reveals that the critical moisture content is 10.4 kg water / kg dry solids, the equilibrium moisture is 0.22 kg water / kg of solid . Los hongos comestibles Pleurotus ostreatus...
Directory of Open Access Journals (Sweden)
Mostak Ahmed
2013-02-01
Full Text Available The objective of this work was to evaluate yield and chemical composition of oyster mushroom strains newly introduced in Bangladesh. Strains of Pleurotus high‑king (strain PHK, P. ostreatus (strain PO2, and P. geesteranus (strains PG1 and PG3 were evaluated as to yield components and proximate composition. Pleurotus ostreatus was used as control. Pleurotus high‑king showed fastest growth of primordia, but moderate flush of effective fruiting bodies. Pleurotus geesteranus (PG1 showed higher economic yield and biological performance, and better chemical composition, especially in terms of protein and mineral contents. Pleurotus geesteranus (PG1 shows better performance than P. ostreatus (PO2, the most commercially cultivated edible species in Bangladesh, and, therefore, it should be recommended for commercial cultivation.O objetivo deste trabalho foi avaliar a produtividade e a composição química de linhagens de cogumelo‑ostra introduzidas recentemente em Bangladesh. Linhagens de Pleurotus high‑king (linhagem PHK, P. ostreatus (linhagem PO2 e P. geesteranus (linhagens PG1 e PG3 foram avaliadas quanto aos componentes da produção e à composição proximal. Pleurotus ostreatus foi utilizado como controle. Pleurotus high‑king apresentou rápido crescimento de primórdios, mas fluxo moderado de corpos de frutificação efetivos. Pleurotus geesteranus (PG1 apresentou maior produtividade econômica e desempenho biológico, além de melhor composição química, especialmente em termos de conteúdos de proteína e minerais. Pleurotus geesteranus (PG1 apresenta melhor desempenho que P. ostreatus (linhagem PO2, a espécie comestível mais cultivada comercialmente em Bangladesh, e, portanto, deve ser recomendado para plantio comercial.
[Investigation of some virulence factors in Trichosporon spp. strains].
Demir, Feyza; Kuştimur, Semra
2014-10-01
The frequency of fungal infections have increased recently in parallel to prolonged survival of patients with chronical infections, common use of the broad-spectrum antibiotics and cytotoxic drugs and surgical interventions. Fungi such as Trichosporon, Fusarium and Geotrichum that were previously evaluated as contaminant/colonization, become important causes of morbidity and mortality especially in neutropenic patients. The aim of this study was to investigate the presence of virulence factors such as acid proteinase, phospholipase, esterase, coagulase and hemolytic activity among Trichosporon species. A total of 40 Trichosporon strains, of them 24 (60%) were T.asahii, 6 (15%) were T.inkin and 10 (25%) were the other species (one of each of T.aquatile, T.asteroides, T.coremiiforme, T.cutaneum, T.dermatis, T.faecale, T.japonicum, T.montevideense, T.mucoides, T.ovoides) were included in the study. Identification of the isolates was performed according to microscopic morphology (blastospores, arthrospores, pseudohyphae and true hyphae) on corn meal agar media, and carbohydrate assimilation patterns (API ID32C; bioMérieux, France). Secretory acid proteinase, phospholipase and esterase activities of the strains were evaluated by 1% bovine serum albumin containing agar, by egg yolk containing solid medium, and by Tween 80 containing solid medium, respectively. Hemolytic activity of the isolates were evaluated by 5-10% sheep blood Sabouraud dextrose agar. Coagulase enzyme activity was determined by using human and rabbit plasma. In our study, all of the 40 Trichosporon spp. strains were found negative in terms of acid proteinase and phospholipase enzyme activity, however all were positive for esterase enzyme activity. Hemolytic enzyme activity were identified in a total of 15 (37.5%) strains, being "+++" in three strains (2 T.asahii, 1 T.japonicum), and "++" in 12 isolates (9 T.asahii, 1 T.inkin, 1 T.asteroides, 1 T.mentevideense). Although 11 of those 15 positive
Antioxidant, antifungal and anticancer activities of se-enriched Pleurotus spp. mycelium extracts
Directory of Open Access Journals (Sweden)
Milovanović Ivan
2014-01-01
Full Text Available The goal of this study was the evaluation of antifungal, antioxidant and anticancer potentials of Pleurotus eryngii, P. ostreatus and P. pulmonarius mycelial extracts, and the influence of mycelium enrichment with selenium on these activities. Both Se-amended and non-amended extracts showed the same or similar minimal inhibitory concentration for 14 studied micromycetes, while a fungicidal effect was not noted, contrary to ketoconazole, which had inhibitory and fungicidal effects at very low concentrations. Se-non-amended extracts exhibited antioxidant activity, especially at higher concentrations. Selenium enrichment influenced activity, its effects decreasing in P. eryngii and P. pulmonarius, while in P. ostreatus no effect was noted. The DPPH• radical scavenging capacity of the extracts was in direct correlation with their phenol and flavonoid contents. Cytotoxic activity against both HeLa and LS174 cell lines was very low compared with cis-DDP. These features suggest that mycelium should be an object of intensive studies. [Projekat Ministarstva nauke Republike Srbije, br. 173032
Directory of Open Access Journals (Sweden)
Martha Lucía Ortiz Moreno
2010-12-01
Full Text Available El objetivo de este trabajo fue identificar aislamientos de hongos ligninolíticos y celulolíticos que pudieran degradar desechos de cosecha y mejorar las características del suelo en los Llanos Orientales, se realizó un muestreo siguiendo la metodología de transepto y muestras integradas. Se obtuvo una cepa ligninolítica (005L Verticillium spp. y 72 cepas celulolíticas. La comparación de los usos del suelo (sabana de pastoreo y bosque secundario mostró que no existía una relación entre el número de géneros obtenidos y las características del suelo. Posteriormente, se realizó la cuantificación de la actividad celulolítica y ligninolítica de los aislamientos para identificar las cepas que posteriormente serían evaluadas en el sustrato natural pasto seco (Brachiaria spp.. Se encontraron dos cepas con alta actividad exoglucanasa (055C y 061C Penicillium spp. y una cepa con alta actividad endoglucanasa (019C Trichoderma spp. respecto al control Trichoderma viride. En el sustrato natural se evaluaron los consorcios de las cepas seleccionadas formados por pares: una ligninolítica y una celulolítica. Las pruebas mostraron que los aislamientos promisorios aumentaron su actividad enzimática en el sustrato pasto superando a los controles positivos (Pleurotus ostreatus para lignina y T. viride para celulosa y que los consorcios no afectaron la capacidad enzimática de las cepas que los formaban. Por lo tanto, se recomienda utilizar estos consorcios para el desarrollo de biofertilizantes acondicionadores del suelo, empleando especialmente el consorcio formado por las cepas 005L (Verticillium spp. y 055C (Penicillium spp., que mostró alta actividad ligninolítica y celulolítica.The aim of this work was to identify lignolytic and cellulolytic fungal strains capable of degrading harvest waste and thereby improving the soil characteristics of the eastern Llanos of Colombia. Sampling was carried out using the transept methodology and
African Journals Online (AJOL)
Administrator
The influence of fungus treatment on the biochemical composition and degradation patter of sawdust and cotton plant by-products (cotton burns and cotton gin trash) by Pleurotus sajor caju were evaluated. Lignin degradation increased as the incubation period progressed while the highest loss of hemicellulose, cellulose ...
Jones, Ronald N; Stilwell, Matthew G
2013-06-01
Dalbavancin is an investigational lipoglycopeptide having an extended serum elimination half-life allowing once-weekly dosing. Data from testing 1357 strains of uncommonly isolated species expand the dalbavancin spectrum details as follows (MIC50/90): β-haemolytic streptococcal serogroups C, F, and G (≤0.03/≤0.03 μg/mL), 7 viridans group of streptococci (≤0.03/≤0.03-0.06 μg/mL), 5 Corynebacterium spp. (0.06/0.12 μg/mL), Listeria monocytogenes (0.06/0.12 μg/mL), and Micrococcus spp. (≤0.03/≤0.03 μg/mL). Among all reported isolates, 99.8% of tested strains were inhibited at dalbavancin MIC values at ≤0.12 μg/mL. Dalbavancin remains very potent against rarer Gram-positive pathogens, using in vitro test experience with organisms cultured through 2011. Copyright © 2013 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Inam-ul-Haq, M.; Khan, M.N.; Khan, M.A.; Khan, M.A.; Javed, N.; Binyamin, R.; Irshad, G.
2010-01-01
Different of concentration of four medicinal plants viz., Eucalyptus camaldulensis, Azadirachta indica, Citrus lemon, Cymbopogon marginatus were investigated for the effect of certain active components in their parts, capable of increasing mushroom yield and controlling mushrooms pathogenic microbes which cause great loss in mushroom yield. Four strains of Oyster mushroom were selected on the basis of their well mycelial growth on MEA. For selection of best compost simple composts were also prepared without any medicinal plant products i.e., cotton, wheat, paddy straw. Corn stover composts and cotton compost gave the maximum yield. The dried leaves of the Citrus lemons, lemon grass and Neem cake (dried) were crushed, and the sawdust of the logs of Eucalyptus were incorporated with different doses of 2%, 3%, 4%, 5% w/w of substrates with cotton substrate before compost fermentation. Each of the compost bag having specific medicinal plant product with specific concentration were spawned with selected four strains of Oyster mushroom i.e., two local strain Pleurotus florida (P-17), Pleurotus ostreatus (P- 19) and two exotic strains Pleurotus (florida) ostreatus (WC536), Pleurotus ostreatus (WC-522). Spawn running and mushroom fruitification were allowed to develop under optimum environmental condition. The mushroom yield data of compost bags with different concentration of medicinal plant products plants were calculated. The results showed that presence of Neem cake and Citrus lemon in the substrate increased the yield of Oyster mushroom strains i.e. Pleurotus florida) ostreatus (WC-536) followed by P. ostreatus (WC-522) strain. Neem cake and Citrus lemon were more promising in improving yield of mushroom. These results led to the conclusion that addition of specific medicinal plants concentration to compost increases the yield of Oyster mushroom by reducing the incidence of microbes and is more preferable than chemicals due to their lethal effects during human
Combining fluorescent Pseudomonas spp. strains to enhance suppression of fusarium wilt of radish
Boer, Marjan de; Sluis, Ientse van der; Loon, L.C. van; Bakker, P.A.H.M.
1999-01-01
Fusarium wilt diseases, caused by the fungus Fusarium oxysporum, lead to significant yield losses of crops. One strategy to control fusarium wilt is the use of antagonistic, root-colonizing Pseudomonas spp. It has been demonstrated that different strains of these bacteria suppress disease by
Directory of Open Access Journals (Sweden)
Andrés Noya Cabaña
2010-01-01
Full Text Available OBJETIVO: Determinar la incidencia de cepas del género Staphylococcus aisladas de exudados conjuntivales y analizar su resistencia frente a diferentes antimicrobianos. MÉTODOS: Se realizó un estudio observacional descriptivo retrospectivo en el que se revisaron 3554 exudados conjuntivales a pacientes que acudieron en el período comprendido entre enero de 2002 a diciembre de 2003 y desde enero de 2005 hasta diciembre de 2007 al Instituto Cubano de Oftalmología «Ramón Pando Ferrer» por presentar un diagnóstico de infección ocular externa. RESULTADOS: Se aislaron 874 cepas de Staphylococcus aureus para un 47,5 % y 965 cepas de Staphylococcus spp. coagulasa negativa con prueba de patogenicidad positiva para un 52,4 %. En 69 de esos exudados los cultivos presentaron etiología mixta con dos bacterias diferentes, para el 3,7 %. Se determinaron los porcentajes de resistencia a las cepas aisladas pertenecientes al género Staphylococcus. CONCLUSIONES: Se encontró una alta incidencia de las especies del género Staphylococcus en las infecciones oculares, así como se pudo apreciar que la menor fármaco-resistencia para Staphylococcus aureus y Staphylococcus spp. coagulasa negativa correspondieron a los antimicrobianos ciprofloxacina y amikacina. La mayor fármaco-resistencia de las cepas de Staphylococcus aureus correspondió a eritromicina y tetraciclina y en Staphylococcus spp coagulasa negativa fue frente a la tetraciclina.OBJECTIVE: To determine the incidence of Staphylococcus strains isolated from conjunctival swaps and their resistance to several antimicrobial agents. METHODS: A retrospective, descriptive and observational study was performed to review 3554 conjunctival swabs from patients who went to "Ramón Pando Ferrer" Institute of Ophthalmology in the period from January 2002 to December 2009 due to a diagnosis of external ocular infection. RESULTS: From the total of conjunctival swabs, 874 Staphylococcus aureus strains (47.5 % and
Directory of Open Access Journals (Sweden)
Priscila Moraga-Suazo
2011-09-01
Full Text Available The fungus Fusarium circinatum Nirenberg & O’Donnell causes pine pitch canker, an important disease for conifers worldwide. F. circinatum was first detected in Chile in 2001 and to date is present in nurseries and clonal hedges from Libertador General Bernardo O’Higgins Region to Los Rios Region. The purpose of this study was to evaluate the potential of Trichoderma spp. and Clonostachys spp. strains to control F. circinatum in Pinus radiata D. Don seedlings in the absence of other effective control methods. Eighty-one Trichoderma spp. and Clonostachys spp. strains were evaluated through in vitro assays to determine their ability to act as antagonists of F. circinatum and 21 strains were tested for their ability to reduce post-emergence mortality and increase P. radiata survival under greenhouse conditions. During in vitro experiments, 15 strains of Trichoderma inhibited mycelial growth of the pathogen by more than 60% and one strain of Clonostachys showed parasitism of F. circinatum hyphae. Greenhouse experiments showed no control of the disease when the antagonists were added to substrate after the pathogen. However, when the antagonists were added before the pathogen, four strains (Clonostachys UDC-32 and UDC-222 and Trichoderma UDC-23 and UDC-408 reduced post-emergence mortality between 80 and 100%. Among these strains, only Clonostachys UDC-222 significantly increased the survival of P. radiata seedlings. These results showed that Clonostachys UDC-222 has the potential to be used as a biocontrol agent against F. circinatum in the production of P. radiata plants.Fusarium circinatum Nirenberg & O’Donnell es el hongo que causa el cancro resinoso del pino, una enfermedad de importancia mundial en coníferas. En Chile, F. cicirnatum fue detectado por primera vez el año 2001 y a la fecha se encuentra presente en algunos viveros y huertos clonales desde la Región del Libertador General Bernardo O’Higgins hasta la Región de Los R
International Nuclear Information System (INIS)
Rosnani Abdul Rashid; Mat Rasol Awang; Hassan Hamdani Hassan Mutaat; Meswan Maskom
2006-01-01
This paper aimed at comparing the mushroom yield of Pleurotus sajor caju and Pleurotus florida which was harvested in five flushes. The γ-irradiated empty fruit bunch (EFB) at 25kGy was used as cultivation substrate. About 1 to 2% liquid seed of P. sajor caju and P. florida was inoculated into cultivation substrate. After 30 days, the inoculated substrate was opened for fruiting. For both species, the maximum mushroom yield was obtained in first flush and the lowest yield from the fifth flush. This show the mushroom yield is affected by number of flush. From analysis, the mushroom yield of P. florida was much better compared to P. sajor caju for all flushes. (Author)
Bukholderia strains promote Mimosa spp. growth but not Macroptilium atropurpureum
Directory of Open Access Journals (Sweden)
Kaliane Sírio Araújo
Full Text Available ABSTRACT The aim of this study was to evaluate the relationship and symbiotic efficiency of 14 strains of Burkholderia isolated from rupestrian grasslands, using M. atropurpureum and Mimosa tenuiflora as trap plants, with the species M. atropurpureum, Mimosa bimucronata and M. foliolosa. For the nodulation and symbiotic efficiency test in M. atropurpureum, long-neck bottles containing nutrient solution were used. The experiments with Mimosa spp. were carried out in tubes containing vermiculite (160 cm3 and sand (80 cm3 (2:1. The parameters under evaluation were number of nodules, nodules dry matter production, shoots dry matter, roots dry matter, and total dry matter production for all the species analyzed; and plant height, diameter, and the Dickson quality index for Mimosa species. Of the 14 tested strains, two nodulated M. atropurpureum; however, they were ineffective in promoting plant growth. All the tested strains established symbiosis with M. bimucronata, and 12 strains nodulated M. foliolosa. Of these, six promoted growth in M. bimucronata, and seven presented symbiotic efficiency in M. foliolosa. The strains UFLA 01-739, UFLA 01-748 and UFLA 01-751, isolated from M. tenuiflora, and UFLA 04-260 and UFLA 04-405, isolated from M. atropurpureum, stood out as potential inoculants for the Mimosa species evaluated in this study.
INK128 Exhibits Synergy with Azoles against Exophiala spp. and Fusarium spp.
Gao, Lujuan; Sun, Yi; He, Chengyan; Li, Ming; Zeng, Tongxiang; Lu, Qiaoyun
2016-01-01
Infections of Exophiala spp. and Fusarium spp. are often chronic and recalcitrant. Systemic disseminations, which mostly occur in immunocompromised patients, are often refractory to available antifungal therapies. The conserved target of rapamycin (TOR) orchestrates cell growth and proliferation in response to nutrients and growth factors, which are important for pathogenicity and virulence. INK128 is a second-generation ATP-competitive TOR inhibitor, which binds the TOR catalytic domain and selectively inhibits TOR. In the present study, we investigated the in vitro activities of INK128 alone and the interactions of INK128 with conventional antifungal drugs including itraconazole, voriconazole, posaconazole, and amphotericin B against 18 strains of Exophiala spp. and 10 strains of Fusarium spp. via broth microdilution checkerboard technique system adapted from Clinical and Laboratory Standards Institute broth microdilution method M38-A2. INK128 alone was inactive against all isolates tested. However, favorable synergistic effects between INK128 and voriconazole were observed in 61% Exophiala strains and 60% Fusarium strains, despite Fusarium strains exhibited high MIC values (4-8 μg/ml) against voriconazole. In addition, synergistic effects of INK128/itraconazole were shown in 33% Exophiala strains and 30% Fusarium strains, while synergy of INK128/posaconazole were observed in 28% Exophiala strains and 30% Fusarium strains. The effective working ranges of INK128 were 0.125-2 μg/ml and 1-4 μg/ml against Exophiala isolates and Fusarium isolates, respectively. No synergistic effect was observed when INK128 was combined with amphotericin B. No antagonism was observed in all combinations. In conclusion, INK128 could enhance the in vitro antifungal activity of voriconazole, itraconazole and posaconazole against Exophiala spp. and Fusarium spp., suggesting that azoles, especially voriconazole, combined with TOR kinase inhibitor might provide a potential strategy to
Koutrotsios, Georgios; Zervakis, Georgios I.
2014-01-01
Olive mill wastewater (OMW) constitutes a major cause of environmental pollution in olive-oil producing regions. Sixty wood-rot macrofungi assigned in 43 species were evaluated for their efficacy to colonize solidified OMW media at initially established optimal growth temperatures. Subsequently eight strains of the following species were qualified: Abortiporus biennis, Ganoderma carnosum, Hapalopilus croceus, Hericium erinaceus, Irpex lacteus, Phanerochaete chrysosporium, Pleurotus djamor, and P. pulmonarius. Fungal growth in OMW (25%v/v in water) resulted in marked reduction of total phenolic content, which was significantly correlated with the effluent's decolorization. A. biennis was the best performing strain (it decreased phenolics by 92% and color by 64%) followed by P. djamor and I. lacteus. Increase of plant seeds germination was less pronounced evidencing that phenolics are only partly responsible for OMW's phytotoxicity. Laccase production was highly correlated with all three biodegradation parameters for H. croceus, Ph. chrysosporium, and Pleurotus spp., and so were manganese-independent and manganese dependent peroxidases for A. biennis and I. lacteus. Monitoring of enzymes with respect to biomass production indicated that Pleurotus spp., H. croceus, and Ph. chrysosporium shared common patterns for all three activities. Moreover, generation of enzymes at the early biodegradation stages enhanced the efficiency of OMW treatment. PMID:24987685
Directory of Open Access Journals (Sweden)
Georgios Koutrotsios
2014-01-01
Full Text Available Olive mill wastewater (OMW constitutes a major cause of environmental pollution in olive-oil producing regions. Sixty wood-rot macrofungi assigned in 43 species were evaluated for their efficacy to colonize solidified OMW media at initially established optimal growth temperatures. Subsequently eight strains of the following species were qualified: Abortiporus biennis, Ganoderma carnosum, Hapalopilus croceus, Hericium erinaceus, Irpex lacteus, Phanerochaete chrysosporium, Pleurotus djamor, and P. pulmonarius. Fungal growth in OMW (25%v/v in water resulted in marked reduction of total phenolic content, which was significantly correlated with the effluent’s decolorization. A. biennis was the best performing strain (it decreased phenolics by 92% and color by 64% followed by P. djamor and I. lacteus. Increase of plant seeds germination was less pronounced evidencing that phenolics are only partly responsible for OMW’s phytotoxicity. Laccase production was highly correlated with all three biodegradation parameters for H. croceus, Ph. chrysosporium, and Pleurotus spp., and so were manganese-independent and manganese dependent peroxidases for A. biennis and I. lacteus. Monitoring of enzymes with respect to biomass production indicated that Pleurotus spp., H. croceus, and Ph. chrysosporium shared common patterns for all three activities. Moreover, generation of enzymes at the early biodegradation stages enhanced the efficiency of OMW treatment.
Slawiak, M.; Beckhoven, van J.R.C.M.; Speksnijder, A.G.C.L.; Czajkowski, R.L.; Grabe, G.; Wolf, van der J.M.
2009-01-01
Sixty-five potato strains of the soft rot-causing plant pathogenic bacterium Dickeya spp., and two strains from hyacinth, were characterised using biochemical assays, REP-PCR genomic finger printing, 16S rDNA and dnaX sequence analysis. These methods were compared with nineteen strains representing
Characterization of Bacillus spp. strains for use as probiotic additives in pig feed
DEFF Research Database (Denmark)
Larsen, Nadja; Thorsen, Line; Kpikpi, Elmer Nayra
2014-01-01
for use as probiotic additives in pig feed. A total of 245 bacterial isolates derived from African fermented food, feces and soil were identified by 16S rRNA gene sequencing and screened for antimicrobial activity and growth in the presence of antibiotics, bile salts and at pH 4.0. Thirty-three Bacillus......Bacillus spp. are commonly used as probiotic species in the feed industry, however, their benefits need to be confirmed. This study describes a high throughput screening combined with the detailed characterization of endospore-forming bacteria with the aim to identify new Bacillus spp. strains...
International Nuclear Information System (INIS)
Ribeiro, Jessika Mara Martins
2008-01-01
Maize flour samples, soy crumb and feed were collected directly from the production line of a poultry farm in Avelar, RJ, and exposed to doses of 0,3.5, 0,8 and 15 kGy of gamma irradiation. Counting, isolation and identification of the contaminant mycoflora were performed before and after irradiation. The radiosensitivity of strains of reference of Aspergillus spp. was determined in CYA medium and in corn for doses ranging from 0 to 8 kGy. Comparison between the morphologies of control and irradiated strains were performed by using macroscopy, optical microscopy and transmission electron microscopy. Toxigenic profile determination and genetic evaluation by RAPD were also carried out. Higher doses have been found to reduce the number of active colonies, causing elimination of the mycoflora at 8 kGy. A larger radiosensitivity of yeasts was observed in comparison with filamentous fungi. A significant reduction in fungi population occurred at 3.5 kGy to levels below the limit that ensures the hygienic quality of ingredients and poultry feeds. The residual mycoflora was found to decrease with post-irradiation time and included mostly Cladosporium spp., Curvularia spp., Fusarium spp. and Aspergillus spp. and sterility of mycelium prevented further identification of the surviving species of Aspergillus spp. Differences in radioresistance were found among species of Aspergillus and the highest tolerance to radiation was observed for A. parasiticus. Initial morphologic changes were found to be more severe during the first isolation after irradiation than in later ones, with the fungi gradually recovering their normal growth rate. Ultrastructural changes in the irradiated strains were observed mostly in the plasmatic membrane and membranous organelles of nuclei and mitochondria. An increase in the rate of production of toxins by the irradiated strains has been found, however no significant alterations have been observed in their genotypes. Such findings apparently indicate
Genotypes of Leptospira spp. strains isolated from dogs in Buenos Aires, Argentina.
Grune Loffler, Sylvia; Passaro, Diego; Samartino, Luis; Soncini, Analía; Romero, Graciela; Brihuega, Bibiana
2014-01-01
Leptospirosis is an infectious disease of wide global distribution, which is endemic in Argentina. The objective of this study was to obtain the genetic profiles of Leptospira spp. strains isolated from clinical cases of dogs in the province of Buenos Aires by the multiple-locus variable-number tandem repeat analysis (MLVA). Eight isolated canine strains were genotyped by MLVA, obtaining the identical profile of Leptospira interrogans serovar Canicola Hond Utrecht IV in the strains named Dogy and Mayo. The strains named Bel, Sarmiento, La Plata 4581 and La Plata 5478 were identical to the profile of the genotype of L. interrogans serovar Portlandvere MY 1039.The strain named Avellaneda was identical to the genotype profile of L. interrogans serovar Icterohaemorrhagiae RGA and the strain named SB had the same profile as the L. interrogans serovar Pomona Baires genotype and was similar to the profile of serovar Pomona Pomona genotype. It would be useful to include a larger number of isolates from different dog populations in various provinces of Argentina and to characterize the genetic profiles of the strains circulating in the country. The information obtained will be useful for the control of leptospirosis in the dog population. Copyright © 2014 Asociación Argentina de Microbiología. Publicado por Elsevier España. All rights reserved.
Presence of Staphylococcus spp. and Candida spp. in the human oral cavity
Directory of Open Access Journals (Sweden)
Martins Clélia Aparecida de Paiva
2002-01-01
Full Text Available The presence of yeasts and staphylococci in the oral cavity is important because they can act as supplementary microbiota and in certain situations can cause oral or systemic diseases. The aim of this work was to study the prevalence of Candida spp. and Staphylococcus spp. in the human oral cavity. Oral rinses were collected from sixty-eight individuals according to the technique described by Samaranayake and MacFarlane and then cultured on Sabouraud medium supplemented with chloramphenicol and Baird-Parker agar. After the incubation period, the microorganisms were isolated and identified through biochemical tests. The data obtained were statistically analysed by ANOVA. Candida spp. were isolated from 61.76% of the examined individuals and C. albicans was the more frequently isolated specie. Staphylococcus spp. were isolated from 95.60% of the individuals and 41 strains were coagulase negative (63%. Among the coagulase positive strains, nine were S. aureus, 11 S. hyicus and 4 S. schleiferi subspecie coagulans. No correlation was observed between the counts (cfu of the isolated Candida spp. and Staphylococcus spp.
Directory of Open Access Journals (Sweden)
Leila Goudarzi
2017-10-01
Full Text Available Background: Nowadays, the use of probiotic bacteria for the prevention and treatment of urinary tract infections is growing. Lactobacillus, as probiotic bacterial genus, is well known for its benefits for the human health.Methods: The effects of partially purified antimicrobial compounds (bacteriocins and biosurfactants of Lactobacillus strains was assessed and their capacity to in vitro inhibit growth and urease production of various strains of Proteus spp, was studied. Inhibition of the urease production of Proteus spp. at sub-MIC levels was screened using spectrophotometry method. Results: Results revealed that semi-purified bacteriocins of L. acidophilus and L. plantarum showed a greater inhibitory activity on the bacterial urease, compared to biosurfactants of L. rhamnosus, L. casei and L. fermentum (P < 0.05.Conclusion: It can be concluded that bacteriocins may affect Proteus pathogenesis by inhibition of the bacterial urease activity and therefore eliminate the stone formation by these bacteria.
Banana (Musa. spp.) strain HD-1 appraisal
International Nuclear Information System (INIS)
Longyan, G.; Xinguo, L.; Lingxia, W.; Xuefei, J.
2016-01-01
Being one of the important tropical and subtropical fruit trees, banana (Musa spp.) belongs to the family Musaceae and the order Scitaminae with two genera, Musa and Ensete. In a field survey, research team has discovered a potential banana mutant strain HD-1 with a sound economic value. The results of the finding are as follows: based on Simmonds classification, the pseudostem of banana strain HD-1 is relatively short and purplish red; its upright outward petiole groove has red edges and wraps its pseudostem loosely. Its ploidy is 3, AAA type. Karyotype analysis shows that the number of chromosomes is 33, the karyotype formula is 2n=3x=33=2L + 3 M2 + 4 M1 + 2 S, HD-1 is classified as 1B type. With the help of ISSR molecular markers, we find thatbanana HD-1 has the closest relationship with Pubei and Tianbao dwarf banana; the similarity coefficient is 0.81. In an artificial simulation tests of cold, drought and salt resistance environment changes of physiological and biochemical indexes indicate that HD-1 exhibits stronger defense capability than Brazil banana. By way of inoculation with injury of root dipping method, we respectively treat two kinds of banana seedlings inoculated Banana Fusarium wilt race 4 small species. The results show that their resistance evaluation scores are 3 and 4, disease levels are susceptible and high sensitivity respectively. We conclude that HD-1 has stronger resistance ability to Fusarium wilt than Brazil banana. (author)
Jacobsen, C. N.; Rosenfeldt Nielsen, V.; Hayford, A. E.; Møller, P. L.; Michaelsen, K. F.; Pærregaard, A.; Sandström, B.; Tvede, M.; Jakobsen, M.
1999-01-01
The probiotic potential of 47 selected strains of Lactobacillus spp. was investigated. The strains were examined for resistance to pH 2.5 and 0.3% oxgall, adhesion to Caco-2 cells, and antimicrobial activities against enteric pathogenic bacteria in model systems. From the results obtained in vitro, five strains, Lactobacillus rhamnosus 19070-2, L. reuteri DSM 12246, L. rhamnosus LGG, L. delbrueckii subsp. lactis CHCC 2329, and L. casei subsp. alactus CHCC 3137, were selected for in vivo studi...
Screening of Gibberellic Acid Production by Pseudomonas SPP
International Nuclear Information System (INIS)
Khine Zar Wynn Myint; Khin Mya Lwin; Myo Myint
2010-12-01
The microbial gibberellic acid (GA3) production of Pseudomonas spp., was studied and qualitatively indentified by UV spectrophotometer. 20 strains of Pseudomonas spp., were isolated and screened the gibberellic acid productivily in King's B medium. Among them, only four strains can produce microbial gibberellic acid. The Rf values and colour appearance under UV were the same as authentic gibberellic acid. Moreover, the gibberellic acid producer strains were identified as Pseudomonas spp., by cultural, biochemical and drug sensitivity pattern.
Functional expression of a valencene dioxygenase from Pleurotus sapidus in E. coli.
Zelena, Kateryna; Krings, Ulrich; Berger, Ralf G
2012-03-01
Valencene dioxygenase (ValOx) from the edible basidiomycete Pleurotus sapidus converted the sesquiterpene (+)-valencene to the valuable grapefruit flavour (+)-nootkatone and to nootkatols through intermediate hydroperoxides. Expression of the enzyme was carried out in the cytosol and periplasm of Escherichia coli. The heterologous production led to high yields of inclusion bodies. The poor yield of soluble recombinant protein was improved by various strategies including cold shock expression, chaperone co-expression, and employment of mutant E. coli strains. Up to 60 mg of the biologically active, soluble ValOx was produced by cold shock under control of the cspA promoter at 8 °C in the BL21(DE3)Star strain and co-expression of the E. coli trigger factor. The recombinant enzyme, purified using the N-terminal His tag, showed the catalytic properties of the wild-type enzyme, as was confirmed by the LC-MS analysis of hydroperoxide intermediates and GC-MS analysis of the volatile products. Copyright © 2011 Elsevier Ltd. All rights reserved.
Czech Academy of Sciences Publication Activity Database
Synytsya, Andriy.; Míčková, K.; Synytsya, A.; Jablonský, I.; Spěváček, Jiří; Erban, V.; Kováříková, E.; Čopíková, J.
2009-01-01
Roč. 76, č. 4 (2009), s. 548-556 ISSN 0144-8617 R&D Projects: GA ČR GA525/05/0273 Institutional research plan: CEZ:AV0Z40500505 Keywords : glucans * oyster mushroom Pleurotus * isolation Subject RIV: CD - Macromolecular Chemistry Impact factor: 3.167, year: 2009
Parola, Philippe; Cornet, Jean-Paul; Sanogo, Yibayiri Osée; Miller, R Scott; Thien, Huynh Van; Gonzalez, Jean-Paul; Raoult, Didier; Telford III, Sam R; Wongsrichanalai, Chansuda
2003-04-01
A total of 650 ticks, including 13 species from five genera, were collected from animals, from people, or by flagging of the vegetation at sites on the Thai-Myanmar border and in Vietnam. They were tested by PCR to detect DNA of bacteria of the order RICKETTSIALES: Three Anaplasma spp. were detected in ticks collected in Thailand, including (i) Anaplasma sp. strain AnDa465, which was considered a genotype of Anaplasma platys (formerly Ehrlichia platys) and which was obtained from Dermacentor auratus ticks collected from dogs; (ii) Anaplasma sp. strain AnAj360, which was obtained from Amblyomma javanense ticks collected on a pangolin; and (iii) Anaplasma sp. strain AnHl446, which was closely related to Anaplasma bovis and which was detected in Haemaphysalis lagrangei ticks collected from a bear. Three Ehrlichia spp. were identified, including (i) Ehrlichia sp. strain EBm52, which was obtained from Boophilus microplus ticks collected from cattle from Thailand; (ii) Ehrlichia sp. strain EHh324, which was closely related to Ehrlichia chaffeensis and which was detected in Haemaphysalis hystricis ticks collected from wild pigs in Vietnam; and (iii) Ehrlichia sp. strain EHh317, which was closely related to Ehrlichia sp. strain EBm52 and which was also detected in H. hystricis ticks collected from wild pigs in Vietnam. Two Rickettsia spp. were detected in Thailand, including (i) Rickettsia sp. strain RDla420, which was detected in Dermacentor auratus ticks collected from a bear, and (ii) Rickettsia sp. strain RDla440, which was identified from two pools of Dermacentor larvae collected from a wild pig nest. Finally, two bacteria named Eubacterium sp. strain Hw124 and Eubacterium sp. strain Hw191 were identified in Haemaphysalis wellingtoni ticks collected from chicken in Thailand; these strains could belong to a new group of bacteria.
Effect of oyster mushroom ( Pleurotus ostreatus ) mycelia on ...
African Journals Online (AJOL)
Effect of oyster mushroom ( Pleurotus ostreatus ) mycelia on petroleum ... of chains of hydrocarbon in a petroleum-hydrocarbon-contaminated substrate over time. ... Keywords: Mycoremediation, Mycelia, Contaminated Soil, Oyster Mushroom ...
Keşli, Recep; Bilgin, Hüseyin; Yılmaz, Halim
2017-07-01
Brucellosis is a worldwide zoonotic disease and still continuous to be a major public health problem. In this study, it was aimed to identify the Brucella strains to the species level isolated from blood cultures, and to determine the rate of antimicrobial susceptibility against eleven antibacterial agents. A total of 106 Brucella spp. strains were included in the study, which were isolated from blood cultures in University of Health Sciences, Konya Training and Research Hospital, Medical Microbiology Laboratory between January 2011 and June 2013. Identification of the isolated strains were mainly based on conventional methods. In vitro antibacterial susceptibilities of azithromycin, ciprofloxacin, doxycycline, gentamicin, levofloxacin, moxifloxacin, rifampicin, streptomycin, tetracycline, tigecycline, and trimethoprim/sulfamethoxazole, were evaluated by using the gradient (E-test, bioMerieux, France) strip method. The bacterial suspensions adjusted to 0.5 McFarland turbidity was inoculated to Mueller Hinton agar plates, supplemented with 5% sheep blood, and E-test strips of selected antibacterial were applied. The plates were incubated in ambient air 48 hours at 37ºC and Escherichia coli ATCC 25922 and Staphylococcus aureus ATCC 29213 were used as quality control strains for antimicrobial susceptibility testing. Minimum inhibitors concentration (MIC) values were interpreted according to Clinical and Laboratory Standards Institute (CLSI) guidelines for slow-growing bacteria such as Haemophilus spp. Of the 106 Brucella spp. strains included in to the study, 90 were identified as Brucella melitensis, and 16 were Brucella abortus. MIC90 values of azithromycin, ciprofloxacin, doxycycline, gentamicin, levofloxacin, moxifloxacin, rifampicin, streptomycin, tetracycline, tigecycline, and trimethoprim/sulfamethoxazole were determined as 1 µg/ml, 0.25 µg/ml, 0.19 µg/ml, 0.25 µg/ml, 0.19 µg/ml, 0.75 µg/ml, 0.25 µg/ml, 0.75 µg/ml, 0.38 µg/ml, 0.64 µg/ml, and 0
Directory of Open Access Journals (Sweden)
Oscar Eduardo Checa Coral
2017-07-01
Full Text Available The antagonistic effectiveness of native strains of Trichoderma spp. on Fusarium oxysporum f. sp. pisi. in vitro, greenhouse and field conditions, were evaluated. in vitro conditions, the antagonistic capacity of 12 strains of Trichoderma spp., C2, C7, C12 and C21 strains, exhibited a better behavior measured by the following variables: inhibition halo and mycelial growth. In greenhouse conditions, the four strains, which showed the best in vitro antagonistic behavior, were evaluated using a DIA experimental design with factorial arrangement for three factors, which corresponded to strain, concentration and dose. The results of this evaluation, showed that C12 and C21 strains at doses of 20 mL, and at concentrations of 108 and 106 conidia.mL-1, respectively. The best antagonistic response was determined by variables as follows: plant height, fresh root weight and incidence. Under field conditions, the evaluations were carried out in the municipalities of Ipiales, Pupiales and Gualmatán, in the department of Nariño, Colombia. In each location, a BCA experimental design was used with four treatments and five replicates, treatments were as follows: C12 strains at 108 concentration, C21 at 106 concentration, chemical control and absolute control. In Gualmatan location, C12 and C21 strains, showed no antagonistic capacity, whereas in Ipiales and Pupiales locations, strain C12, presented a lower incidence of F. oxysporum than the control, but with no effect on yields. In Pupiales location, C21 strain surpassed in performance to the control treatment, even though the two treatments had similar incidence.
Directory of Open Access Journals (Sweden)
Sebastián D´Ippólito
2011-06-01
Full Text Available In this study, two halophilic bacterial strains isolated from saline habitats in Argentina grew in the presence of gas oil. They were identified as Halomonas spp. and Nesterenkonia sp. by 16S ribosomal RNA sequencing. Chemotaxis towards gas oil was observed in Halomonas spp. by using swimming assays.En el presente trabajo se aislaron dos cepas bacterianas halofílicas a partir de muestras obtenidas en ambientes salinos de Argentina, que crecieron en presencia de gasoil como única fuente de carbono. Las cepas aisladas se identificaron como Halomonas spp. y Nesterenkonia sp. mediante secuenciación del gen del ARN ribosomal 16S. En ensayos de swimming, las cepas del genero Halomonas spp. mostraron una respuesta quimiotáctica hacia el gas oil.
Directory of Open Access Journals (Sweden)
Čeněk Novotný
2016-07-01
Full Text Available The work is focused on spontaneous colonization of fungal mycelium by invading microorganisms in a trickle-bed fungal bioreactor operating under semi-sterile conditions. Pleurotus ostreatus was grown under the flow of synthetic wastewater containing activated sludge bacteria and the microbial consortium developed in the reactor was characterized. Genotype and phenotype profile of the reactor-invading, bacterial consortium was clearly distinctive from that of the original activated sludge. The bacterial consortium from the reactor contained a higher portion of bacteria capable of cellobiose utilization and a small amount of bacteria with the ability to utilize benzoic acids. The invading bacteria had no effect on the dye decolorization performance of the fungal reactor. Five bacterial strains colonizing P. ostreatus reactor cultures were isolated and identified as species of the genera Pseudomonas and Bacillus. Except for Bacillus cereus all strains displayed a potential to inhibit fungal growth on solid media (14 to 51 % inhibition which was comparable or higher than that of the reference bacterial strains. The pH- and media composition-dependence of the growth inhibition was demonstrated.
Establishment of an efficient transformation system for Pleurotus ostreatus.
Lei, Min; Wu, Xiangli; Zhang, Jinxia; Wang, Hexiang; Huang, Chenyang
2017-11-21
Pleurotus ostreatus is widely cultivated worldwide, but the lack of an efficient transformation system regarding its use restricts its genetic research. The present study developed an improved and efficient Agrobacterium tumefaciens-mediated transformation method in P. ostreatus. Four parameters were optimized to obtain the most efficient transformation method. The strain LBA4404 was the most suitable for the transformation of P. ostreatus. A bacteria-to-protoplast ratio of 100:1, an acetosyringone (AS) concentration of 0.1 mM, and 18 h of co-culture showed the best transformation efficiency. The hygromycin B phosphotransferase gene (HPH) was used as the selective marker, and EGFP was used as the reporter gene in this study. Southern blot analysis combined with EGFP fluorescence assay showed positive results, and mitotic stability assay showed that more than 75% transformants were stable after five generations. These results showed that our transformation method is effective and stable and may facilitate future genetic studies in P. ostreatus.
ANTIMICROBIAL PROPERTIES OF PLEUROTUS ERYNGII AND LENTINUS EDODES HYDRO-ALCOHOLIC EXTRACTS
Directory of Open Access Journals (Sweden)
Gabriela Popa
2016-11-01
Full Text Available Besides superior nutritional values mushrooms posed significant medicinal properties. Hydro-alcoholic extracts of several isolates of Pleurotus eryngii and Lentinus edodes mushroom species were investigated for their antimicrobial activities against pathogenic microorganisms with medicinal importance. Antimicrobial activities of the extracts were evaluated by the agar disk diffusion method. Results revealed that the 70% ethylic alcohol extracts have significant inhibitory activities against Bacillus subtilis var. spizizinii, Escherichia coli and Staphylococcus aureus. The results showed that the 70% ethanol extracts of Pleurotus eryngii and Lentinus edodes mushroom isolates may have biopharmaceutical potentiality.
Directory of Open Access Journals (Sweden)
javad janpoor
2018-03-01
Full Text Available Introduction: King oyster mushroom (Pleurotus eryngii belongs to Basidiomycota division, Agaricomycetes class and Pleurotaceae family. This mushroom generally grows on wood wastes of Apiaceae family. The Pleurotus eryngii is found in pastures, meadows, gardens and seldom in grassy forest clearings and hilly areas. The Pleurotus of the Umbellifers occupy an area in the Northern hemisphere between the 30 and 50º N. These species are mainly found in the subtropical regions of the Mediterranean, Central Europe, Russia, Ukraine, Central Asia and Iran. The P. eryngii sensulato is the only taxon within the genus, which grows in association with plants. P. eryngii has distinguishable characteristics such as coherent texture, unique form, favorable taste and high durability. Mushroom cultivation represents the only current economically viable biotechnology process for the conversion of waste plant residues from forests and agriculture. The species of these genera show much diversity in their adaptation the varying agro-climatic condition which makes more cultivated species than other mushrooms. Special ability of Pleurotus family is growing in lingocellulosic plant or agricultural wastes without needing to prepared compost and casing soil. Pleurotus is an efficient lignin- degrading mushroom and can grow and yield well on different types of lignocellulolosic materials. Type of substrates for mushroom growing depends on available plant or agricultural wastes. In Europe, wheat straw is used for mushroom growing; whereas in Asian South-East countries sawdust is more popular. Different materials for cultivating of P. eryngii have been suggested in different regions of the world; but a few studies have been done on suitability of various lignocellulosic affordable wastes for P. eryngii production in Iran. Therefore, the current study aims to evaluate effects of various locally available agro wastes on the growth characteristics of King oyster mushroom (P
Zhao, A-Na; Ding, Wan-Long; Zhu, Dian-Long
2006-10-01
To screen the Trichodenna spp. for strong antagonist against ginseng root pathogens. The biological characters of ten Trichoderma strains were compared by culturing on different media. And their antagonistic activity against Phytophthora cactorum, Cylindrocarpon destructans and Rhizoctonia solani were measured on PDA. Tv04-2 and Th3080 showed a good growth on soil solution medium and PDA, and also showed high inhibitory efficacy to the three pathogens. The two Trichoderma strains showed different growth rate under light conditions and pH. Trichoderma strains were sensitive to most fungicides used in ginseng root disease controlling, however Tv04-2 was not sensitive to the fungicide Junchong Jueba.
International Nuclear Information System (INIS)
Chen Henglei; Wan Honggui; Zhang Jun; Zeng Xianxian
2008-01-01
In order to obtain Pleurotus ferulae with high temperature tolerance, mycelium mono-cells of wild type strain ACK was treated by nitrogen ion (5-30 keV, 1.5x10 15 -1.5x10 16 cm -2 ) implantation, and mutant CGMCC1762 was selected through auxotrophy screening method, which was Lys, VB6 auxotrophy stress with high temperature. We found that during riper period the surface layer mycelium of the mutant was not aging neither grew tegument even above 30 degree C. The mycelium endurable temperature of the mutant was increased 7 degree C compared with that of the wild type strain. The fruiting bodies growth temperature of the mutant was 16-20 degree C in daytime and was 6-12 degree C at night. The highest growth temperature of fruiting bodies of the mutant was increased by 5 degree C than that of original strain. Through three generation investigation, we found that the mutant CGMCC1762 was stable with high temperature tolerance. (authors)
Lignocellulolytic enzyme production of Pleurotus ostreatus growth in agroindustrial wastes
Directory of Open Access Journals (Sweden)
José Maria Rodrigues da Luz
2012-12-01
Full Text Available The mushroom Pleurotus ostreatus has nutritional and medicinal characteristics that depend on the growth substrate. In nature, this fungus grows on dead wood, but it can be artificially cultivated on agricultural wastes (coffee husks, eucalyptus sawdust, corncobs and sugar cane bagasse. The degradation of agricultural wastes involves some enzyme complexes made up of oxidative (laccase, manganese peroxidase and lignin peroxidase and hydrolytic enzymes (cellulases, xylanases and tanases. Understanding how these enzymes work will help to improve the productivity of mushroom cultures and decrease the potential pollution that can be caused by inadequate discharge of the agroindustrial residues. The objective of this work was to assess the activity of the lignocellulolytic enzymes produced by two P. ostreatus strains (PLO 2 and PLO 6. These strains were used to inoculate samples of coffee husks, eucalyptus sawdust or eucalyptus bark add with or without 20 % rice bran. Every five days after substrate inoculation, the enzyme activity and soluble protein concentration were evaluated. The maximum activity of oxidative enzymes was observed at day 10 after inoculation, and the activity of the hydrolytic enzymes increased during the entire period of the experiment. The results show that substrate composition and colonization time influenced the activity of the lignocellulolytic enzymes.
Creation of the Probiotic Consortium on the Base of Strains of Bifidobacterium spp.
Directory of Open Access Journals (Sweden)
Kozhakhmetov, S. S.
2009-01-01
Full Text Available Nowadays, a widespread circulation of disbiotic conditions among the population of all ages in Kazakhstan requires an active development in industry for both preparations and products with probiotic properties. The gained bacterial isolates, Bifidobacterium adolescentis 180, B. breve 204, B. breve 584 and B. breve 587 were used in our researches and screening showed they possess high probiotic properties. The consortium possesses strong antimicrobial activity to pathogenic and potentially-pathogenic microflora, insulated during disbacteriosis, as well as from vagina and urea. They are able to produce vitamin B12 and also have antimutagenic activity. As a result, the consortium on the base of strains of Bifidobacterium spp. was received, possessing the following advantages: contains live mass of microbial, antagonistically active strains B. breve and B. adolescentis; contains more than 10^9 alive Bifidobacteria; does not contain plasmids, which means that it could not be a carrier of antibiotic stability for Gram-positive receptive pathogenic and potentially-pathogenic microflora.
Researches on Pleurotus ostreatus mushroom’s quality cultivated on coffee grounds
Directory of Open Access Journals (Sweden)
Sorina Ropciuc
2016-10-01
Full Text Available The objectives of this work were to evaluate the possibility of using coffee grounds for cultivating Pleurotus ostreatus mushrooms and determine the nutritional composition of Pleurotus ostreatus mushrooms produced on coffee grounds substrate. The results revealed a good fruiting of the fungus on coffee grounds and the biological effectiveness (weight of fresh mushroom reached about 97% after 30 days. We determined the total protein content in vitamin C, the total polyphenols and the activity of Polyphenol oxidases (PPOs enzyme on 32 samples of fresh Pleurotus ostreatus mushroom (top and bottom and subjected to heat treatments (blanching, boiling and freezing. The protein content was ranged between the values of 16.9 and 25.1g/ 100g and the Vitamin C content within the range of values presented 64.32-564.95 mg/100g. The polyphenol content results varied significantly in the analyzed samples varying between 1.887 – 7.667 mg GAE / 100 g vegetable product. The determination of the polyphenol oxidase enzyme responsible for enzymatically blackening of the fungus presented values in the range 0.274- 0.610mg / 100g.
Antinociceptive effect of Pleurotus ostreatus (Oyster Mushroom ...
African Journals Online (AJOL)
PROF HORSFALL
pattern by comparing it with a standard drug and a control using the hot water based flick tail test. Thirty five ... groups two, three and four were treated with 100, 200 and 400 mg/kg of Pleurotus ostreatus aqueous ... Abnormalities in the nervous system may also cause ... During this period, they were covered with wire gauze,.
Directory of Open Access Journals (Sweden)
Bandana Baniya
2017-11-01
Full Text Available Abstract Introduction Pseudomonas aeruginosa and Acinetobacter spp. are found to be associated with biofilm and metallo-β-lactamase production and are the common causes of serious infections mainly in hospitalized patients. So, the main aims of this study were to determine the rates of biofilm production and metallo beta-lactamase production (MBL among the strains of Pseudomonas aeruginosa and Acinetobacter spp. isolated from hospitalized patients. Methods A total of 85 P. aeruginosa isolates and 50 Acinetobacter spp. isolates isolated from different clinical specimens from patients admitted to Shree Birendra Hospital, Kathmandu, Nepal from July 2013 to May 2014 were included in this study. The bacterial isolates were identified with the help of biochemical tests. Modified Kirby-Bauer disc diffusion technique was used for antimicrobial susceptibility testing. Combined disc diffusion technique was used for the detection of MBL production, while Congo red agar method and tube adherence method were used for detection of biofilm production. Results Around 16.4% of P. aeruginosa isolates and 22% of the strains of Acinetobacter spp. were metallo β-lactamase producers. Out of 85 P. aeruginosa isolates, 23 (27.05% were biofilm producers according to tube adherence test while, only 13 (15.29% were biofilm producers as per Congo red agar method. Similarly, out of 50 Acinetobacter spp. 7 (14% isolates were biofilm producers on the basis of tube adherence test, while only 5 (10% were positive for biofilm production by Congo red agar method. Highest rates of susceptibility of P. aeruginosa as well as Acinetobacter spp. were seen toward colistin. Conclusion In our study, biofilm production and metallo beta-lactamase production were observed among Pseudomonas aeruginosa and Acinetobacter spp. However, no statistically significant association could be established between biofilm production and metallo beta-lactamase production.
Bendjelloul, M; Boucherit-Otmani, Z; Boucherit, K
2016-09-01
The increasing incidence of Candida spp., and the vital prognosis often compromise for patients with Candida species make urgent the exact knowledge of their distribution worldwide and exhaust action antifungals currently used in clinical. That why we carry out an epidemiological study of Candida species and testing their susceptibility against two antifungals: amphotericin B and caspofungin. Samplings of peripheral venous catheters (PVC) were carried out from during 8months on the services of Internal medicine, Surgery A and Neonatology of Oran's University Hospital Center (UHC). The study of the susceptibility of Candida species to antifungal agents was performed according to the Clinical Laboratory Standards Institute (CLSI 2008). From 300 samples, 25 yeasts were isolated. The rate of colonization PVC was 8.33% by Candida spp. The most isolated strains were Candida parapsilosis with 64% of cases, followed by Candida albicans (12%) then 8% for Candida glabrata and Candida krusei. However, only 4% of isolates were Candida famata or Candida lusitaniae. Furthermore all isolated strains were susceptible to amphotericin B with Minimum Inhibitory Concentrations (MIC) ranging from 0.25 to 1μg/mL. MIC obtained with caspofungin vary from 0.0625 to 2μg/mL for all strains. Moreover, one strain of C. krusei is resistant to caspofungin with a MIC superior to 8μg/mL. All though caspofungin is at least as effective as amphotericin B, it is better tolerated for the treatment of invasive fungal infections. Copyright © 2016. Published by Elsevier Masson SAS.
Activation of bovine neutrophils by Brucella spp.
Keleher, Lauren L; Skyberg, Jerod A
2016-09-01
Brucellosis is a globally important zoonotic infectious disease caused by gram negative bacteria of the genus Brucella. While many species of Brucella exist, Brucella melitensis, Brucella abortus, and Brucella suis are the most common pathogens of humans and livestock. The virulence of Brucella is largely influenced by its ability to evade host factors, including phagocytic killing mechanisms, which are critical for the host response to infection. The aim of this study was to characterize the bovine neutrophil response to virulent Brucella spp. Here, we found that virulent strains of smooth B. abortus, B. melitensis, B. suis, and virulent, rough, strains of Brucella canis possess similar abilities to resist killing by resting, or IFN-γ-activated, bovine neutrophils. Bovine neutrophils responded to infection with a time-dependent oxidative burst that varied little between Brucella spp. Inhibition of TAK1, or SYK kinase blunted the oxidative burst of neutrophils in response to Brucella infection. Interestingly, Brucella spp. did not induce robust death of bovine neutrophils. These results indicate that bovine neutrophils respond similarly to virulent Brucella spp. In addition, virulent Brucella spp., including naturally rough strains of B. canis, have a conserved ability to resist killing by bovine neutrophils. Copyright © 2016 Elsevier B.V. All rights reserved.
nutrient composition of pleurotus tuberregium (fr) sing's sclerotia
African Journals Online (AJOL)
DJFLEX
The amino acid and mineral profile of Pleurotus tuberregium sclerotia, was investigated. Every 100g ... sample was dried to a constant weight, defatted (by placing a ... (67%), millet, soy bean (74%), peanuts (65%), African ... sodium content to cashew nut (5-13.02mg/100g) [Nandi, .... sclerotia Flour and Protein Concentrate.
Directory of Open Access Journals (Sweden)
Maura Téllez-Téllez
2016-03-01
Full Text Available Crude extract samples of Pleurotus pulmonarius and Pycnoporus cinnabarinus were taken during growth in liquid broth in an airlift reactor. Growth was monitored indirectly by sugar consumption and pH profile. During growth Pleurotus pulmonarius consumed glucose more slowly than Pycnoporus cinnabarinus, reaching a final pH of 8.0. In contrast, Pycnoporus cinnabarinus started consuming glucose faster from the beginning to the end with a pH of 3.6, suggesting the production of different metabolites while they grow in the same culture broth. Additionally, antioxidant activity, polyphenol and flavonoid contents, as well as laccase and hydrolase activities were quantified in the culture extracts during the fermentation. Pleurotus pulmonarius showed higher antioxidant activity than Pycnoporus cinnabarinus. Both fungi have a very low polyphenol and flavonoid content. Values of amylase and pectinase activities were similar in crude extracts of both fungi; however, cellulase, xylanase, invertase, and laccase activities showed higher levels in crude extract of Pleurotus pulmonarius. Antimicrobial and insecticidal activities were also evaluated in each crude extract. In fact, Pycnoporus cinnabarinus presented a very strong bacteriostatic and bactericidal effect against Escherichia coli and Staphylococcus aureus and reliably killed Diatraea magnifactella larvae, while Pleurotus pulmonarius did not showed any negative effect on the growth of these bacteria or larvae.
Growth inhibition of Listeria spp. on Camembert cheese by bacteria producing inhibitory substances.
Sulzer, G; Busse, M
1991-12-01
Bacterial strains exhibiting antimicrobial activity towards other bacteria are quite common in nature. During the past few years several genera have been shown to exert inhibitory action against Listeria. spp. In the present work strains of Enterococcus, Lactobacillus and Lactococcus were tested for their influence on the development of Listeria spp. on Camembert cheese. Partial or complete inhibition of growth of Listeria spp. was observed using various inhibitory bacteria. Complete inhibition occurred when the inhibitory strain was used as a starter culture and there was a low level of contamination with Listeria spp. during the first stage of ripening. Very little inhibition occurred if the inhibitory strain was added together with the starter culture.
Amylolytic studies of pleurotus tuber-regium | Monago | Global ...
African Journals Online (AJOL)
The alpha amylase of the sclerotium of Pleurotus tuber-regium was studied. The enzyme was purified from the fresh sclerotium through dialysis, ammonium sulphate fractionation and column chromatography of CM sephadex. The enzyme showed 70% of it's optimal activity between p.H 4.0 to 8.0. Acid and thermal stability ...
Directory of Open Access Journals (Sweden)
Mejdi Snoussi
2015-08-01
Full Text Available Chemical composition, antioxidant and anti-Vibrio spp. activities of the essential oil isolated from the aerial parts of Mentha spicata L. (spearmint are investigated in the present study. The effect of the essential oil on Vibrio spp. biofilm inhibition and eradication was tested using the XTT assay. A total of 63 chemical constituents were identified in spearmint oil using GC/MS, constituting 99.9% of the total identified compounds. The main components were carvone (40.8% ± 1.23% and limonene (20.8% ± 1.12%. The antimicrobial activity against 30 Vibrio spp. strains (16 species was evaluated by disc diffusion and microdilution assays. All microorganisms were strongly affected, indicating an appreciable antimicrobial potential of the oil. Moreover, the investigated oil exhibited high antioxidant potency, as assessed by four different tests in comparison with BHT. The ability of the oil, belonging to the carvone chemotype, to inhibit or reduce Vibrio spp. biofilm warrants further investigation to explore the use of natural products in antibiofilm adhesion and reinforce the possibility of its use in the pharmaceutical or food industry as a natural antibiotic and seafood preservative against Vibrio contamination.
Directory of Open Access Journals (Sweden)
Luján Roca DA
2013-01-01
Full Text Available INFECTION - LIMA, PERU Introduction: Urinary tract infection (UTI is one of the most common infections in clinical practice. Gram negative bacteria as Klebsiella pneumoniae, Serratia spp. and Acinetobacter spp. can cause UTI. Objective: To study antibiotic resistance in K. pneumoniae, Serratia spp. and Acinetobacter spp. strains isolated from UTI Material and methods: Urine cultures were collected from January 2003 to December 2003. Identification of isolated bacteria included biochemical characteristics. Bauer-Kirby disc diffusion test was performed. Results: A total of 106 strains were evaluated (41 of K. pneumoniae, 28 of Serratia spp. and 37 of Acinetobacter spp.. Among K. pneumoniae isolates resistance to ampicillin (83% was remarkable. The Serratia spp. isolates displayed a high level of resistance to nalidixic acid (79% and gentamicin (75%. In Acinetobacter spp. isolates high resistance rates were observed against amikacin (81%, gentamicin (67% and trimethoprim/sulfamethoxazole(71%. Conclusions: In general, antibiotic resistance patterns were high. Acinetobacter spp. showed elevated resistance rates (>50% against antibiotics included.
Evaluation of Trichoderma spp. strains for control yellowing pea caused by Fusarium oxysporum
Directory of Open Access Journals (Sweden)
Christian Eraso Insuasty
2014-07-01
Full Text Available The yellowing of pea caused by the fungus Fusarium oxysporum f. sp. pisi is considered the most damaging disease of this crop. This study took place at the plant health laboratory and greenhouse of the Universidad de Nariño, and the experimental stage was conducted at the Granja experimental Botana. Its purpose was to evaluate the antagonistic ability of the fungi Trichoderma spp. to F. oxysporum. Isolation of F. oxysporum was made from diseased tissue; Trichoderma strains were obtained from the rhizosphere of healthy plants (collected in the towns of Potosi, Córdoba, Gualmatán, Ipiales and Puerres in the state of Nariño, Colombia, and a commercial strain from laboratory Perkins Ltda. In laboratory, unrestrictedly randomized design with 21 treatments (strains was used. Mycelial growth and inhibition zone were evaluated in dual plantings, which served as selection criteria for greenhouse test where plant height, root length, root dry matter and percentage of incidence were evaluated. In the field, a randomized block design was used to evaluate yield components, plant height and root length with the best strains. In the laboratory, C2 (Córdoba 2, C7 (Gualmatán 3, C14 (Puerres 2, C20 (Potosi 4 and C21 (Perkins Lab. showed antagonistic activity in the greenhouse, C7, C14 and C21 were the best; in field, significant differences between C14 and C21, compared to C7 and the control, were obtained. Strains C14 and C21 have consistent antagonistic capacity and can be used to control F. oxysporum in pea.
Aeromonas spp.: an emerging pathogen?
Directory of Open Access Journals (Sweden)
Andrea Bartolini
2015-12-01
Full Text Available The aim of this study is to identify and monitor the presence of Aeromonas spp. strains in stool cultures. We analyzed 5564 stool cultures from September 2012 to August 2013. Sixty-three patients were positive for Aeromonas spp. The most frequent symptoms were: diarrhea (46.0% and abdominal pain (12.7%. Pediatric subjects were 28. Samples’ microscopic examination showed leukocytes in 38.1% of cases. It is still controversial whether Aeromonas are responsible for human gastroenteritis, but their presence in faecies of symptomatic patients supports their etiologic role. We propose search for toxins by polymerase chain reaction to identify strains that require an antibiotic therapy.
Directory of Open Access Journals (Sweden)
W.A. Tapie
2016-08-01
Full Text Available Sugarcane vinasses are considered a complex effluent because of its organic load, low pH, high temperature, and by the presence of recalcitrant substances such as melanoidins and phenolic compounds. The aim of this work was to evaluate the potential of the fungus Pleurotus ostreatus to carry out the biodegradation of sugarcane vinasses in a fixed-bed bioreactor. The experiments evidence the potential of the fungus Pleurotus ostreatus to carry out the decolorization (83%, the removal of the Chemical Oxygen Demand (COD=87% and the Biochemical Oxygen Demand (BOD5=92%, the reduction of total suspended solids (83% and volatile suspended solids (72% of vinasses. The technical simplicity of the proposed alternative as well as process performance reveals the potential of the fungus Pleurotus ostreatus for the treatment of sugarcane mill effluents.
(Pleurotus pulmonarius) grown on cotton waste and cassava peel
African Journals Online (AJOL)
This work evaluated the yield of Pleurotus pulmonarius on different mixtures of cotton waste and cassava peel. P. pulmonarius demonstrated significantly higher colonization rate on cotton waste substrate (100 g cotton waste) 3 weeks after inoculation of spawn than any other substrate mixtures. Cotton waste had the ...
Phenotypic characterization and ecological features of Coccidioides spp. from Northeast Brazil.
Cordeiro, R A; Brilhante, R S N; Rocha, M F G; Fechine, M A B; Camara, L M C; Camargo, Z P; Sidrim, J J C
2006-11-01
This study extends phenotypic and ecological knowledge of Coccidioides spp., by describing its recovery from soils of Ceará State (Northeast Brazil) and analyzing the in vitro features of the growth of its vegetative phase. Following a human coccidioidomycosis case, Coccidioides spp. strains were isolated from 3 of 14 soil samples collected in an armadillo's burrow. Mycological analysis showed colonies with glabrous, velvety or cottony texture and an increasing quantity of arthroconidia. The overall growth rates of the strains were slower in 8% NaCl medium, maximum growth rate was obtained at 30 degrees C, and their pH tolerance ranged from 4.0 to 11.0. Several carbohydrates and polyalcohol sources could be efficiently metabolized by Coccidioides spp. strains in the mycelial form. Total absence of growth was observed in media supplemented with either L-aspartic acid or L-histidine. Whereas intense growth was found when strains were incubated with any other aminoacid sources studied. Coccidioides spp. strains did not grow in the presence of Tween 60 and Tween 80, but exhibited intense growth in Tween 20. Nicotinic acid and the toxic compounds caffeic acid and phenol could not be metabolized by any strain. All of the strains were positive for urease production and displayed intense growth in media containing cycloheximide concentrations ranging from 0.01 and 0.05%, but did not grow at 0.1 and 0.2%. The present findings confirm the importance of armadillos burrows in the ecology of Coccidioides spp. in Northeast Brazil and indicate that the fungus is a very physiologically versatile organism.
Improving the feeding value of straws with Pleurotus ostreatus
Khan, N.A.; Hussain, S.; Ahmad, N.; Alam, S.; Bezabhi, M.; Hendriks, W.H.; Yu, P.; Cone, J.W.
2015-01-01
The high content of lignin in cell walls is the major limiting factor in the digestion and utilisation of cereal crop residues by ruminants. The aim of this study was to evaluate the effectiveness of the white rot fungus, Pleurotus ostreatus (P. ostreatus), to degrade lignin and to enhance the rumen
Oil palm empty fruit bunch as media for mushroom cultivation
International Nuclear Information System (INIS)
Mat Rasol Awang; Wan Badrin Wan Husin; Tajuddin Osman; Tamikazu Kume; Shinpei Matsuhashi
1998-01-01
The mushroom strains Pleurotus sajor caju(grey oyster mushroom), Pleurotus flavellatus((pink oyster mushroom), Pleurotus cystidiosus(abalone mushroom) and Auricularia polytricha (black jelly mushroom) grow satisfactorily on the EFB media treated with lime. Based on their Biological Efficiency (BE) or yield, the strain Pleurotus sajor caju was selected for further investigation. The BE of the Pleurotus sajor caju was 73.8 %. The lime treatment, aeration and four weeks incubation period was necessary for fruiting
Performance of different strains of Pleurotus species under ...
African Journals Online (AJOL)
P. citrinopileatus strain PCB did not produce any fruiting bodies during the period of study. Significant differences (P<0.05) in yield of the different species of mushrooms were recorded. Keywords: Mushrooms, flushes, biological efficiency. J Food Tech in Africa (2002) 7, 98-100. http://dx.doi.org/10.4314/jfta.v7i3.19240.
Cultivation of mushroom ( Pleurotus ostreatus ) using corn cobs and ...
African Journals Online (AJOL)
An investigation was carried out on the cultivation of mushroom (Pleurotus ostreatus) using corn cobs and saw dust as the main substrates. Lignocellulosic wastes such as corn cobs and saw dust were packaged inside heat – resistant polythene bags and pasteurized before being seeded with 7.5% w/w millet spawn of ...
Preliminary investigation into the use of Pleurotus tuber-regium ...
African Journals Online (AJOL)
The swelling capacity was three times that of maize starch BP Tablets prepared with P. tuber-regium powder disintegrated faster than those prepared with maize starch BP at concentrations below 10% w/w. At the disintegrant concentration of 10% w/w paracetamol tablets made from both Pleurotus powder and maize starch ...
Development of a selective agar plate for the detection of Campylobacter spp. in fresh produce.
Yoo, Jin-Hee; Choi, Na-Young; Bae, Young-Min; Lee, Jung-Su; Lee, Sun-Young
2014-10-17
This study was conducted to develop a selective medium for the detection of Campylobacter spp. in fresh produce. Campylobacter spp. (n=4), non-Campylobacter (showing positive results on Campylobacter selective agar) strains (n=49) isolated from fresh produce, indicator bacteria (n=13), and spoilage bacteria isolated from fresh produce (n=15) were plated on four Campylobacter selective media. Bolton agar and modified charcoal cefoperazone deoxycholate agar (mCCDA) exhibited higher sensitivity for Campylobacter spp. than did Preston agar and Hunt agar, although certain non-Campylobacter strains isolated from fresh produce by using a selective agar isolation method, were still able to grow on Bolton agar and mCCDA. To inhibit the growth of non-Campylobacter strains, Bolton agar and mCCDA were supplemented with 5 antibiotics (rifampicin, polymyxin B, sodium metabisulfite, sodium pyruvate, ferrous sulfate) and the growth of Campylobacter spp. (n=7) and non-Campylobacter strains (n=44) was evaluated. Although Bolton agar supplemented with rifampicin (BR agar) exhibited a higher selectivity for Campylobacter spp. than did mCCDA supplemented with antibiotics, certain non-Campylobacter strains were still able to grow on BR agar (18.8%). When BR agar with various concentrations of sulfamethoxazole-trimethoprim were tested with Campylobacter spp. (n=8) and non-Campylobacter (n=7), sulfamethoxazole-trimethoprim was inhibitory against 3 of 7 non-Campylobacter strains. Finally, we validated the use of BR agar containing 50mg/L sulfamethoxazole (BRS agar) or 0.5mg/L ciprofloxacin (BRCS agar) and other selective agars for the detection of Campylobacter spp. in chicken and fresh produce. All chicken samples were positive for Campylobacter spp. when tested on mCCDA, BR agar, and BRS agar. In fresh produce samples, BRS agar exhibited the highest selectivity for Campylobacter spp., demonstrating its suitability for the detection of Campylobacter spp. in fresh produce. Copyright
Silva, Evânia Geralda; Dias, Eustáquio Souza; Siqueira, Félix Gonçalves; Schwan, Rosane Freitas
2007-01-01
Os cogumelos do gênero Pleurotus normalmente crescem bem em substratos mais pobres em nitrogênio, ao contrário dos cogumelos Agaricus que requerem substratos com relação C/N mais estreita. Por outro lado, os valores nutricionais do cogumelo dependem da composição química do substrato utilizado e das condições de cultivo. Este trabalho teve como objetivo avaliar o teor de proteína dos corpos de frutificação do cogumelo Pleurotus sajor-caju cultivado em capim coast-cross, bagaço de cana-de-açúc...
Directory of Open Access Journals (Sweden)
Alméciga-Díaz Carlos Javier
2005-07-01
Full Text Available El principal inconveniente en la combustión de los hidrocarburos es la conversión del azufre y el nitrógeno a sus respectivos óxidos, los cuales participan en la formación de lluvia acida y deterioran el medio ambiente e infraestructuras. La remoción de azufre a partir de compuestos órgano-azufrados mediante el uso de microorganismos ha surgido como una alternativa frente al proceso catalítico de hidrodesulfurización (HDS. En el presente trabajo se evaluó la actividad desulfurizadora de veintitrés aislados nativos de Pseudomonas spp. sobre dibenzotiofeno (DBT, usando un sistema de fermentación con igual proporción de fase acuosa y orgánica (n-hexano en presencia de oleato de etanolamina. Los aislados 02,05 y 06 conservaron su viabilidad en este medio y presentaron una remoción de azufre entre 6,0 y 9,4%, generando los metabolitos DBT-sulfona, DBT-sulfóxido, 2-hidroxibifenilo (2-HBP y sulfato presentes en la ruta metabólica 4S. Con estos aislados se evaluó la actividad desulfurizadora sobre keroseno y se observó una remoción de azufre entre 19,9 y 62,6% y una disminución del poder calorífico entre 0,45 y 5,55%. Palabras clave: dibenzotiofeno, desulfurización, Pseudomonas spp., keroseno.The main difficulty with fossil fuel combustión lies in sulphur and nitrogen becoming converted to their respective oxides, forming part of the acid rain which deteriorates the environment and infrastructure. Removing sulphur from organo-sulfur compounds by using micro-organisms has become an alternative to hydrodesulphurisation (HDS. Twenty-three Pseudomonas spp. native strains' desulphurisation activity on dibenzothiophene (DBT was evaluated by using a fermentation system having equal proportions of aqueous and organic (n-hexane phases in the presence of ethanolamine oléate. The 02, 05 and 06 strains maintained their viability in this médium, presenting 6,0% to 9,4% sulphur removal, producing DBT-sulphone, DBT-sulphoxide, 2
Energy Technology Data Exchange (ETDEWEB)
Ribeiro, Jessika Mara Martins
2008-07-01
Maize flour samples, soy crumb and feed were collected directly from the production line of a poultry farm in Avelar, RJ, and exposed to doses of 0,3.5, 0,8 and 15 kGy of gamma irradiation. Counting, isolation and identification of the contaminant mycoflora were performed before and after irradiation. The radiosensitivity of strains of reference of Aspergillus spp. was determined in CYA medium and in corn for doses ranging from 0 to 8 kGy. Comparison between the morphologies of control and irradiated strains were performed by using macroscopy, optical microscopy and transmission electron microscopy. Toxigenic profile determination and genetic evaluation by RAPD were also carried out. Higher doses have been found to reduce the number of active colonies, causing elimination of the mycoflora at 8 kGy. A larger radiosensitivity of yeasts was observed in comparison with filamentous fungi. A significant reduction in fungi population occurred at 3.5 kGy to levels below the limit that ensures the hygienic quality of ingredients and poultry feeds. The residual mycoflora was found to decrease with post-irradiation time and included mostly Cladosporium spp., Curvularia spp., Fusarium spp. and Aspergillus spp. and sterility of mycelium prevented further identification of the surviving species of Aspergillus spp. Differences in radioresistance were found among species of Aspergillus and the highest tolerance to radiation was observed for A. parasiticus. Initial morphologic changes were found to be more severe during the first isolation after irradiation than in later ones, with the fungi gradually recovering their normal growth rate. Ultrastructural changes in the irradiated strains were observed mostly in the plasmatic membrane and membranous organelles of nuclei and mitochondria. An increase in the rate of production of toxins by the irradiated strains has been found, however no significant alterations have been observed in their genotypes. Such findings apparently indicate
Effect of Pleurotus ostreatus fermentation on cocoa pod husk ...
African Journals Online (AJOL)
Cocoa pod husk (CPH) is a major agro-industrial residue in Ghana with a potential value as a low-cost unconventional feedstuff for livestock. However, its effective use is limited by poor nutrient composition, mainly due to its high lignocellulose or fibre and also low protein levels. White–rot fungi such as Pleurotus species ...
Directory of Open Access Journals (Sweden)
María Sepúlveda
2016-03-01
Full Text Available Aegorhinus superciliosus is an important pest on blueberry (Vaccinium corymbosum L. and other fruit trees. The use of entomopathogenic fungi as Metarhizium spp. has been evaluated for the control of this insect, but variability has been observed among different strains. The aim of this study was to characterize six promising strains of Metarhizium spp. for the control of A. superciliosus. The studied strains were QuM173c, Qu-M363, Qu-M171a, Qu-M156a, Qu-M421, and Qu-M430, all of which belonged to the Chilean Collection of Microbial Genetic Resources (ChCMGR of the Institute de Investigaciones Agropecuarias (INIA, Chile. Molecular characterization was made by sequencing the ITS region (Internal Transcribed Spacers, ITS-5.8S rDNA. The morphology of conidia was evaluated through scanning electron microscopy and radial colony growth was evaluated in potato dextrose agar (PDA, Sabouraud dextrose agar (SDA, agar enriched with larvae of Galleria mellonella (Lepidoptera: Pyralidae (GA, and agar enriched with adults of A. superciliosus (AA. Pathogenicity was studied based on mortality of adults of A. superciliosus inoculated with conidia. Sequencing of the ITS-5.8S rDNA region indicates that the strains belong to the clade of M. anisopliae var. anisopliae, except for Qu-M171a, which was identified as M. anisopliae var. lepidiotum. Conidia average length for the six strains was 5.09 pm and average conidia width was 1.92 pm. Radial colony growth differences were observed between strains (p < 0.01 and between different growth media (p < 0.01. The strains exhibited the highest colony growth in the GA medium, while in the AA medium they showed the lowest (p < 0.01. Pathogenicity tests show that Qu-M430 reached a 90% mortality rate (p < 0.01. Results show that there is variability between the studied strains, which is expressed in their morphology, molecular characteristics and pathogenicity towards A. superciliosus.
Directory of Open Access Journals (Sweden)
Carmen Paz Oplustil
Full Text Available Surveillance programs are essential to detect the increase of antimicrobial resistance, and several different programs are being conducted in many countries. The RESISTNET is a surveillance program for bacterial resistance against several antimicrobial agents initiated in 1998 among Latin American countries. In Brazil, several centers were invited to join this surveillance and a total of 11 centers (6 from São Paulo and 5 from other states participated in the study. All results were analyzed using the WHONET program. A total of 894 Escherichia coli, 386 Klebsiella pneumoniae, 70 Shigella spp and 57 Salmonella spp strains were analyzed in this study from April, 1998, to April, 1999. Susceptibility testing was performed by the disk diffusion method using NCCLS 1998 guidelines for several different drugs. For all strains, imipenem was the most effective drug (100% of the strains were susceptible. Klebsiella pneumoniae presented a high resistance rate to ampicillin (96.4%. The rate of probable ESBL producers among K. pneumoniae strains was 36.3%, most of them being isolated from catheters (58.8%. Among all Escherichia coli strains analyzed, the highest resistance rate was found for trimethoprim/sulfamethoxazole (46.9% and the majority of the resistant strains were isolated from urine samples (47.8%. Among Salmonella spp, the resistance rates were low for all antibiotics tested. For Shigella spp strains there was a high resistance to trimethoprim/sulfamethoxazole (80.0%. No resistance to ceftriaxone was observed in these strains. Surveillance of antimicrobial resistance is critical for the successful management of infectious diseases. The results of this survey show significant resistance rates among these bacteria which are responsible for several types of human infections.
Effect of mushroom ( Pleurotus tuber-regium ) inoculums on crude ...
African Journals Online (AJOL)
Pollution of soils by crude oil in Niger-Delta of Nigeria has brought untold hardship to the inhabitants of the region. This study was carried out in 2010/2011 and 2011/2012 to determine the effect of Pleurotus tuber-regium (mushroom) inoculums on crude oil polluted soil on stover and grain yields and as well as cob length ...
Furuhata, Katsunori; Ishizaki, Naoto; Sogawa, Kazuyuki; Kawakami, Yasushi; Lee, Shin-Ichi; Sato, Masahiro; Fukuyama, Masafumi
2016-01-01
From May 2014 to February 2015, 319 university students (male, n=173; female n=146) of 18 to 24 years of age who carried mobile phones or computer tablets were selected as subjects. Staphylococcus spp. were detected in 101 of 319 samples (31.7%). In the present study, 11 strains of S. aureus were isolated and identified, not all of which were methicillin-resistant Staphylococcus aureus (MRSA). Overall, 14 species were identified, with 11 strains (10.9%) of S. xylosus being isolated at the highest frequency. Following this were eight strains (7.9%) of S. cohnii and seven strains (6.9%) each of S. capitis and S. haemolyticus. Staphylococcus spp. isolation was performed with bacterial samples obtained from the mobile phones of 22 specific subjects (males, n=12; females, n=10). Staphylococcus spp. isolation was performed on days -1, 7 and 30 of the experiment. Staphylococcus spp. were positively detected one or more times in 12 subjects (54.5%). In one subject (8.3%), all three tests were positive. Furthermore, two tests were positive in three (25.0%). In the eight remaining subjects (66.7%) Staphylococcus spp. were detected only once. For the three abovementioned tests, we investigated the pulsed-field gel electrophoresis (PFGE) patterns of the strains derived from the mobile phone and from the fingers of three subjects in whom the same bacterial species were isolated twice. From the cases with similarities between strains derived from the fingers and the mobile phones and cases, with consistency in the strains derived from the mobile phone at different times, commonality was observed in the strains derived from the fingers and mobile phones along with chronological uniformity in the strains derived from the mobile phones. A total of 101 Staphylococcus spp. strains were isolated from mobile phones. According to drug susceptibility tests, 99 strains (98.0%) were found to have some degree of resistance to drugs (excluding one strain each of S. aureus and S. haemolyticus
Energy Technology Data Exchange (ETDEWEB)
Kamra, D.N.; Zadrazil, F.
1986-01-01
Wheat straw was fermented in the solid state with Pleurotus sajor-caju and P. eryngii at 25 degrees C under different concentrations of oxygen and carbon dioxide. Lower than 20% oxygen in the gaseous phase adversely affected the loss of organic matter, the lignin degradation and the change in straw digestibility with both species of Pleurotus. Higher concentrations (10%-30%) of carbon dioxide, with 20% oxygen in the atmospshere, slightly decreased the loss of lignin and organic matter when compared with the losses under oxygen or air. In spite of better lignin degradation by P. sajor-caju, the process efficiency with P. eryngii was higher, because of lower loss of organic matter during the fermentation. Fruit-bodies were not formed by P. eryngii during the period of experiment in any of the treatments. In P. sajor-caju, fruit-bodies were only formed either in flasks closed with cotton plugs or supplied with a continuous flow of sterile air. Carbon dioxide inhibited the process of primordia initiation and fruit-body development. A short exposure (20 minutes per day) to light was essential for primordia and fruit-body formation. The substrate changes and process efficiency with respect to increase in digestibility were much higher in darkness than in light. Light leads to intensive fruit-body production and a different pattern of substrate degradation. The indigenous microflora of wheat straw inhibited fruit-body formation and caused a higher organic matter loss, accompanied by a decrease in digestibility of the fermented wheat straw. 33 references.
Directory of Open Access Journals (Sweden)
Itamar Soares de Melo
2000-03-01
Full Text Available Rhizoctonia solani causes serious diseases in a wide range of plant species. The fungus Trichoderma has been shown to be particularly effective in the control of the pathogen. Thus, this research was carried out to screen fourteen Trichoderma strains against R. solani in vitro. All strains tested inhibited the growth of R. solani. Three T. koningii strains produced toxic metabolites with strong activity against R. solani, inhibiting the mycelial growth by 79%. T. harzianum, Th-9 reduced the viability of sclerotia of R. solani by 81.8% and T. koningii, TK-5 reduced by 53%. Electron microscopic observations revealed that all T. harzianum strains interacted with R. solani. Th-9 grew toward and coiled around the host cells, penetrating and destroying the hyphae. Penetration of host cells was apparently accomplished by mechanical activity.Rhizoctonia solani é um dos mais destrutivos patógenos de plantas cultivadas. Métodos alternativos de controle têm sido empregados com sucesso, particularmente, utilizando-se o fungo Trichoderma. Este trabalho visou, portanto, selecionar linhagens efetivas desse micoparasita contra o patógeno. Onze linhagens de T. harzianum e três de T. koningii foram testadas in vitro com relação ao parasitismo de hifas e de escleródios e produção de metabólitos tóxicos. Todas as linhagens de Trichoderma spp. inibiram o crescimento miceliano de R. solani e as três linhagens de T. koningii produziram potentes antibióticos, que inibiram mais de 79% o crescimento do patógeno. Uma linhagem de T. harzianum, Th-9, reduziu a viabilidade dos escleródios em 81,8% e uma de T. koningii em 53%. Microscopia eletrônica de varredura revelou que todas as linhagens de T. harzianum parasitaram R. solani enquanto nenhuma linhagem de T. koningii interagiu com R. solani, possivelmente, devido à forte inibição causada pelos metabólitos que impediu o contato entre os dois fungos. T. harzianum, Th-9, cresceu ao redor, penetrou e
VALOR NUTRICIONAL DE PLEUROTUS DJAMOR CULTIVADO EM PALHA DE BANANEIRA
Directory of Open Access Journals (Sweden)
Jamile Rosa RAMPINELLI
2010-11-01
Full Text Available
Cogumelos do gênero Pleurotus representam um alimento de custo baixo, com teor elevado de proteínas, aminoácidos essenciais, proporção elevada de ácidos graxos insaturados, diversas vitaminas e minerais, além de teores baixos de gorduras, ácidos nucléicos, açúcares e calorias. Assim, o objetivo deste trabalho foi avaliar o valor nutricional de basidiomas de Pleurotus djamor de 1o e 2o fluxo produtivo, cultivados em palha de bananeira, em termos de teores de carboidratos, proteínas, fi bras, gorduras, cinzas, vitaminas, fósforo e potássio. Os teores de carboidratos totais, proteína bruta, fi bra bruta e cinzas diminuíram do 1o para o 2o fl uxo produtivo de 32,7 para 27,4g/100g, de 20,5 para 19,8g/100g, de 22,4 para 12,7g/100g e de 7,4 para 6,3g/100g, respectivamente. Os valores de gordura bruta e umidade não variaram, permanecendo em torno de 1,1 e 90g/100g, respectivamente. Os teores de vitamina B1 foram superiores aos de vitamina B2, independentemente do fluxo produtivo, e foi encontrada maior quantidade de potássio do que de fósforo. Pleurotus djamor, de 1o fl uxo produtivo, pode ser considerado fonte de fósforo e potássio, além de apresentar baixo teor de açúcar e não conter gordura.
Directory of Open Access Journals (Sweden)
Yueting Dai
2017-11-01
Full Text Available Identification of monokaryons and their mating types and discrimination of hybrid offspring are key steps for the crossbreeding of Pleurotus tuoliensis (Bailinggu. However, conventional crossbreeding methods are troublesome and time consuming. Using RNA-seq technology, we developed new expressed sequence tag-simple sequence repeat (EST-SSR markers for Bailinggu to easily and rapidly identify monokaryons and their mating types, genetic diversity and hybrid offspring. We identified 1110 potential EST-based SSR loci from a newly-sequenced Bailinggu transcriptome and then randomly selected 100 EST-SSRs for further validation. Results showed that 39, 43 and 34 novel EST-SSR markers successfully identified monokaryons from their parent dikaryons, differentiated two different mating types and discriminated F1 and F2 hybrid offspring, respectively. Furthermore, a total of 86 alleles were detected in 37 monokaryons using 18 highly informative EST-SSRs. The observed number of alleles per locus ranged from three to seven. Cluster analysis revealed that these monokaryons have a relatively high level of genetic diversity. Transfer rates of the EST-SSRs in the monokaryons of closely-related species Pleurotus eryngii var. ferulae and Pleurotus ostreatus were 72% and 64%, respectively. Therefore, our study provides new SSR markers and an efficient method to enhance the crossbreeding of Bailinggu and closely-related species.
Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii
Directory of Open Access Journals (Sweden)
Sharon Avni
2017-07-01
Full Text Available Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe of the fruit body contained higher glucan content then the caps (pileus. Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate.
Dai, Yueting; Su, Wenying; Song, Bing; Li, Yu; Fu, Yongping
2017-01-01
Identification of monokaryons and their mating types and discrimination of hybrid offspring are key steps for the crossbreeding of Pleurotus tuoliensis (Bailinggu). However, conventional crossbreeding methods are troublesome and time consuming. Using RNA-seq technology, we developed new expressed sequence tag-simple sequence repeat (EST-SSR) markers for Bailinggu to easily and rapidly identify monokaryons and their mating types, genetic diversity and hybrid offspring. We identified 1110 potential EST-based SSR loci from a newly-sequenced Bailinggu transcriptome and then randomly selected 100 EST-SSRs for further validation. Results showed that 39, 43 and 34 novel EST-SSR markers successfully identified monokaryons from their parent dikaryons, differentiated two different mating types and discriminated F1 and F2 hybrid offspring, respectively. Furthermore, a total of 86 alleles were detected in 37 monokaryons using 18 highly informative EST-SSRs. The observed number of alleles per locus ranged from three to seven. Cluster analysis revealed that these monokaryons have a relatively high level of genetic diversity. Transfer rates of the EST-SSRs in the monokaryons of closely-related species Pleurotus eryngii var. ferulae and Pleurotus ostreatus were 72% and 64%, respectively. Therefore, our study provides new SSR markers and an efficient method to enhance the crossbreeding of Bailinggu and closely-related species. PMID:29149037
Directory of Open Access Journals (Sweden)
Gisele Martini Borges
2013-12-01
Full Text Available Polysaccharides with medicinal properties can be obtained from fruiting bodies, mycelium and culture broth of several fungus species. This work was carried out in batch culture using a stirred tank reactor with two different initial glucose concentrations (40-50 g/L and pH values (3.0-4.0 to enhance extracellular polysaccharides production by Pleurotus djamor UNIVILLE 001 and evaluate antitumor effect of intraperitonial administration of Pleurotus djamor extract on sarcoma 180 animal model. According to factorial design, the low pH value (pH 3.0 led to a gain of 1.6 g/L on the extracellular polysaccharide concentration, while glucose concentration in the tested range had no significant effect on the concentration of polysaccharide. With 40 g/L initial glucose concentration and pH 3.0, it was observed that yield factor of extracellular polysaccharide on substrate (Y P/S = 0.072 and maximum extracellular polysaccharide productivity (Q Pmax = 11.26 mg/L.h were about 188% and 321% respectively higher than those obtained in the experiment performed at pH 4.0. Under these conditions, the highest values of the yield factor of biomass on substrate (Y X/S = 0.24 and maximal biomass productivity (Q Xmax = 32.2 mg/L.h were also reached. In tumor response study, mean tumor volume on the 21th day was 35.3 cm³ in untreated group and 1.6 cm³ in treated group (p = 0.05 with a tumor inhibition rate of 94%. These impressive results suggests an inhibitory effect of P.djamor extract on cancer cells.
Potential of Bacillus spp produces siderophores insuppressing thewilt disease of banana plants
Kesaulya, H.; Hasinu, J. V.; Tuhumury, G. NC
2018-01-01
In nature, different types of siderophore such as hydroxymate, catecholets and carboxylate, are produced by different bacteria. Bacillus spp were isolated from potato rhizospheric soil can produce siderophore of both catecholets and salicylate type with different concentrations. Various strains of Bacillus spp were tested for pathogen inhibition capability in a dual culture manner. The test results showed the ability of inhibition of pathogen isolated from banana wilt disease. From the result tested were found Bacillus niabensis Strain PT-32-1, Bacillus subtilis Strain SWI16b, Bacillus subtilis Strain HPC21, Bacillus mojavensis Strain JCEN3, and Bacillus subtilis Strain HPC24 showed different capabilities in suppressing pathogen.
Directory of Open Access Journals (Sweden)
Li Fen
2014-01-01
Full Text Available In order to screen lignocellulose-degrading superior mushroom strains ten strains of mushrooms (Lentinus edodes939, Pholiota nameko, Lentinus edodes868, Coprinus comatus, Macrolepiota procera, Auricularia auricula, Hericium erinaceus, Grifola frondosa, Pleurotus nebrodensis, and Shiraia bambusicola were inoculated onto carboxymethylcellulose agar-Congo red plates to evaluate their ability to produce carbomethyl cellulase (CMCase. The results showed that the ratio of transparent circle to mycelium circle of Hericium erinaceus was 8.16 (P<0.01 higher than other strains. The filter paper culture screening test showed that Hericium erinaceus and Macrolepiota procera grew well and showed extreme decomposition of the filter paper. When cultivated in guaiacol culture medium to detect their abilities to secrete laccase, Hericium erinaceus showed the highest ability with the largest reddish brown circles of 4.330 cm. CMCase activity determination indicated that Coprinus comatus and Hericium erinaceus had the ability to produce CMCase with 33.92 U/L on the 9th day and 22.58 U/L on the 10th day, respectively, while Coprinus comatus and Pleurotus nebrodensis had the ability to produce laccase with 496.67 U/L and 489.17 U/L on the 16th day and 18th day. Based on the results, Coprinus comatus might be the most promising lignocellulose-degrading strain to produce both CMCase and laccase at high levels.
Bioremediation of engine-oil polluted soil by Pleurotus tuber-regium ...
African Journals Online (AJOL)
White-rot fungi have been used in various parts of the world for bioremediation of polluted sites. Pleurotus tuber-regium was noted to have the ability to increase nutrient contents in soils polluted with 1 - 40% engine-oil concentration after six months of incubation. P. tuber-regium increased organic matter, carbon and ...
Directory of Open Access Journals (Sweden)
A. Laciar
2006-04-01
Full Text Available In this study, a total of 24 Listeria spp. strains were analyzed. Twenty-two isolates were obtained in San Luis (Argentina from human, animal, and food samples. Two types of strains, Listeria monocytogenes CLIP 22762 and Listeria innocua CLIP 74915, were included as reference strains. All isolates were biochemically identified and characterized by serotyping, phage typing, and amplification of the flaA gene by polymerase chain reaction (PCR. Repetitive intergenic consensus (ERIC sequence-based PCR was used to generate DNA fingerprints. On the basis of ERIC-PCR fingerprints, Listeria spp. strains were divided into three major clusters matching origin of isolation. ERIC-PCR fingerprints of human and animal isolates were different from those of food isolates. In addition, groups I and II included ten L. monocytogenes strains, and only one Listeria seeligeri strain. Group III included nine L. innocua strains and four L. monocytogenes strains. Computer evaluation of ERIC-PCR fingerprints allowed discrimination between the tested serotypes 1/2b, 4b, 6a, and 6b within each major cluster. The index of discrimination calculated was 0.94. This study suggests that the ERIC-PCR technique provides an alternative method for the identification of Listeria species and the discrimination of strains within one species.En este estudio se analizaron 24 cepas de Listeria spp. De ellas, 22 fueron obtenidas en San Luis (Argentina, a partir de muestras humanas, de animales y alimentos. Se incluyeron 2 cepas de referencia Listeria monocytogenes CLIP 22762 y Listeria innocua CLIP 74915. Todos los aislamientos fueron identificados bioquímicamente y caracterizados por serotipificación, fagotipificación y detección del gen flaA por reacción en cadena de la polimerasa (PCR. Se generaron perfiles de bandas de ADN mediante la amplificación de secuencias repetitivas de consenso intergénico de enterobacterias (ERIC-PCR. De acuerdo a los resultados obtenidos por ERIC
Directory of Open Access Journals (Sweden)
Ceci Sales-Campos
2009-12-01
Full Text Available Os cogumelos do gênero Pleurotus são cultivados em diversos substratos lignocelulósicos, dada a atividade decompositora desses organismos proveniente de seu metabolismo enzimático. O presente estudo teve como objetivo analisar a composição mineral de Pleurotus ostreatus e dos substratos de cultivo preparados à base de resíduos madeireiros e agroindustriais da região amazônica. Foram analisados macro (P, K, Ca e Mg e micronutrientes (Fe, Zn, Cu, Mn e Na dos cogumelos e dos substratos. Os substratos foram formulados a partir da serragem de Simarouba amara Aubl. (marupá, Ochroma piramidale Cav. ex. Lam. (pau de balsa e de bagaços de Bactris gasipaes Kunth (pupunheira e de Saccharum officinarum (cana-de-açúcar. As amostras foram solubilizadas mediante digestão ácida (nítrico-peridrol. Os elementos Ca, Mg, Fe, Cu, Zn e Mn foram determinados por espectrometria de absorção atômica; o Na e K, por emissão atômica e o P, por colorimetria. A composição mineral do cogumelo variou com o substrato de cultivo. Os diferentes substratos possibilitaram a produção de um cogumelo rico em K, P, Mg e Fe, essenciais à nutrição e à saúde humana. O potássio foi o mineral de maior teor no cogumelo em todos os substratos testados (36,83-42,18 g.kg-1, seguido de fósforo (6,95-10,60 g.kg-1 e do magnésio (1,57-2,50 g.kg-1.Mushrooms belonging to the Pleurotus gender are grown in several lignocellulosic substrates due to the decomposing activity of these organisms that result from their enzymatic metabolism. The objective of the present study was to analyze the mineral composition of Pleurotus ostreatus and the cultivation substrates prepared with wood and agroindustrial residues from the Amazon region. Macro (P, K, Ca and Mg and micronutrients (Fe, Zn, Cu, Mn and Na of mushroom and substrates were analyzed. Substrates were formulated from Simarouba amara Aubl. and Ochroma piramidale Cav. ex. Lam. sawdust and crushed Bactris gasipaes Kunth
Directory of Open Access Journals (Sweden)
MARÍA DEL PILAR RÍOS
2010-12-01
Full Text Available Se evaluaron medios alternativos para la propagación de Pleurotus ostreatus y se comparó su comportamiento frente a un medio comercial. La respuesta a estos medios fue medida mediante la adaptación del hongo en cebada para la obtención de semilla comercial, y ésta a su vez en la respuesta a un sustrato a base de bagazo de caña para la obtención de orellanas. En la primera fase se obtuvo y sembró el hongo en un medio sólido de extracto de papa a dos concentraciones y tres valores de pH, utilizando un diseño factorial 2x3 (pH vs concentración de extracto de papa. En la segunda fase se midió el crecimiento de Pleurotus ostreatus inoculado en cebada hidratada esterilizada mediante un diseño completamente al azar 3x3. En la tercera se evaluó la colonización y fructificación del hongo en bagazo de caña usando parámetros como eficiencia biológica, rendimiento y tasa de producción semilla, con un diseño completamente al azar 3x3. El medio alternativo con pH 5,0 fue el más adecuado para el crecimiento del Pleurotus ostreatus, demostrando su adaptabilidad a medios con alto contenido de carbohidratos, cuyos rendimientos fueron apropiados para obtener niveles de producción competitivos en crecimiento y fructificación, disminuyendo así el tiempo de incubación y cosecha.Foram avaliados os meios alternativos para a propagação de fungos Pleurotus ostreatus e se comparou o seu comportamento em um ambiente comercial. A resposta a esses meios foi medida pela adaptação do fungo em cevada para a obtenção de sementes comerciais e este por sua vez, em resposta a um substrato a base de bagaço de cana para a produção de "Orellana". Na primeira fase foi obtida e plantou o fungo em meio sólido de extrato de batata a duas concentrações e três valores de pH, utilizando um design fatorial 2x3 (pH vs concentração de extrato de batata. Na segunda fase, mediu o crescimento de Pleurotus ostreatus inoculadas em cevada estéril úmida em 3x
Bioremediation of engine-oil polluted soil by Pleurotus tuber-regium ...
African Journals Online (AJOL)
SERVER
2008-01-04
Jan 4, 2008 ... White-rot fungi have been used in various parts of the world for bioremediation of polluted sites. Pleurotus tuber-regium was noted to have the ability to increase nutrient contents in soils polluted with. 1 - 40% engine-oil concentration after six months of incubation. P. tuber-regium increased organic matter ...
Variability of Laccase Activity in the White-Rot Basidiomycete Pleurotus ostreatus
Czech Academy of Sciences Publication Activity Database
Baldrian, Petr; Gabriel, Jiří
2002-01-01
Roč. 47, č. 4 (2002), s. 385-390 ISSN 0015-5632 R&D Projects: GA ČR GP204/02/P100 Institutional research plan: CEZ:AV0Z5020903 Keywords : laccase * pleurotus ostreatus Subject RIV: EE - Microbiology, Virology Impact factor: 0.979, year: 2002
The effect of repair inhibitor on radiation damages of pleurotus ostreatus
International Nuclear Information System (INIS)
Yang Zongqu; Wang Bonan; Li Xuzhao
1996-01-01
The growth rate and enzyme activities significantly decreased when dikaryotic hypha of Pleurotus ostreatus were irradiated with γ-rays and subsequently treated with either caffeine or Na 2 -EDTA in comparison with γ-rays treatment alone. The inhibition effect of treatment with either caffeine or Na 2 -EDTA before irradiation was more obvious than that after irradiation. Treatment with either caffeine or Na 2 -EDTA could cause biological damages on hypha when the concentrations of caffeine and Na 2 -EDTA were up to 0.5 and 1.0 mg/ml respectively. It is suggested that either caffeine or Na 2 -EDTA be used to suppress the repair of radiation damage in order to increase mutation efficiency of Pleurotus ostreatus and that 0.2 mg/ml caffeine and 0.5 mg/ml Na 2 -EDTA might be the proper concentrations of treatment both before and after irradiation. The effect of caffeine is better than that of Na 2 -EDTA
Directory of Open Access Journals (Sweden)
Xiao-Qin Liu
2017-02-01
Full Text Available The multi-resistance gene cfr is widely distributed among various gram-positive and gram-negative species in livestock in China. To better understand the epidemiology of cfr among Staphylococcus spp. and E. coli isolates, 254 Staphylococcus spp. and 398 E. coli strains collected from six swine farms in China were subjected to prevalence and genetic analysis. Forty (15.7% Staphylococcus spp. isolates, including 38 Staphylococcus sciuri strains, one Staphylococcus chromogenes strain, and one Staphylococcus lentus strain, and two (0.5% E. coli isolates were found to contain the cfr gene. Most of the 38 S. sciuri strains were clonally unrelated; however, clonal dissemination of cfr-positive S. sciuri was detected at the same farm. In eight randomly selected cfr-positive staphylococci, a cfr-harboring module (IS21-558-cfr-ΔtnpB was detected in six S. sciuri isolates; cfr was bracketed by two copies of ISEnfa4 or IS256 in the remaining two S. sciuri isolates. In the two E. coli isolates, EP25 and EP28, cfr was flanked by two IS26 elements in the same or opposite orientation, respectively. Complete sequence analysis of the novel F43:A-:B- plasmid pHNEP28 revealed that it contains two multi-resistance regions: cfr together with floR, qnrS1 interspersed with IS26, ΔISCR2 and ISKpn19, and blaTEM-1 together with tet(M interspersed with IS26, ISApl1, ΔTn2, and ΔIS1B. The coexistence of cfr with other resistance genes on a conjugative plasmid may contribute to the dissemination of these genes by co-selection. Thus, rational drug use and continued surveillance of cfr in swine farms are warranted.
Liu, Xiao-Qin; Wang, Jing; Li, Wei; Zhao, Li-Qing; Lu, Yan; Liu, Jian-Hua; Zeng, Zhen-Ling
2017-01-01
The multi-resistance gene cfr is widely distributed among various gram-positive and gram-negative species in livestock in China. To better understand the epidemiology of cfr among Staphylococcus spp. and E. coli isolates, 254 Staphylococcus spp. and 398 E. coli strains collected from six swine farms in China were subjected to prevalence and genetic analysis. Forty (15.7%) Staphylococcus spp. isolates, including 38 Staphylococcus sciuri strains, one Staphylococcus chromogenes strain, and one Staphylococcus lentus strain, and two (0.5%) E. coli isolates were found to contain the cfr gene. Most of the 38 S. sciuri strains were clonally unrelated; however, clonal dissemination of cfr -positive S. sciuri was detected at the same farm. In eight randomly selected cfr -positive staphylococci, a cfr -harboring module (IS 21-558-cfr- Δ tnpB ) was detected in six S. sciuri isolates; cfr was bracketed by two copies of IS Enfa4 or IS 256 in the remaining two S. sciuri isolates. In the two E. coli isolates, EP25 and EP28, cfr was flanked by two IS 26 elements in the same or opposite orientation, respectively. Complete sequence analysis of the novel F43:A-:B- plasmid pHNEP28 revealed that it contains two multi-resistance regions: cfr together with floR , qnrS1 interspersed with IS 26 , ΔIS CR2 and IS Kpn19 , and bla TEM-1 together with tet (M) interspersed with IS 26 , IS Apl1 , ΔTn 2 , and ΔIS 1B . The coexistence of cfr with other resistance genes on a conjugative plasmid may contribute to the dissemination of these genes by co-selection. Thus, rational drug use and continued surveillance of cfr in swine farms are warranted.
Desmodus rotundus and Artibeus spp. bats might present distinct rabies virus lineages
Directory of Open Access Journals (Sweden)
Willian Oliveira Fahl
Full Text Available In Brazil, bats have been assigned an increasing importance in public health as they are important rabies reservoirs. Phylogenetic studies have shown that rabies virus (RABV strains from frugivorous bats Artibeus spp. are closely associated to those from the vampire bat Desmodus rotundus, but little is known about the molecular diversity of RABV in Artibeus spp. The N and G genes of RABV isolated from Artibeus spp. and cattle infected by D. rotundus were sequenced, and phylogenetic trees were constructed. The N gene nucleotides tree showed three clusters: one for D. rotundus and two for Artibeus spp. Regarding putative N amino acid-trees, two clusters were formed, one for D. rotundus and another for Artibeus spp. RABV G gene phylogeny supported the distinction between D. rotundus and Artibeus spp. strains. These results show the intricate host relationship of RABV's evolutionary history, and are invaluable for the determination of RABV infection sources.
Desmodus rotundus and Artibeus spp. bats might present distinct rabies virus lineages
Directory of Open Access Journals (Sweden)
Willian Oliveira Fahl
2012-12-01
Full Text Available In Brazil, bats have been assigned an increasing importance in public health as they are important rabies reservoirs. Phylogenetic studies have shown that rabies virus (RABV strains from frugivorous bats Artibeus spp. are closely associated to those from the vampire bat Desmodus rotundus, but little is known about the molecular diversity of RABV in Artibeus spp. The N and G genes of RABV isolated from Artibeus spp. and cattle infected by D. rotundus were sequenced, and phylogenetic trees were constructed. The N gene nucleotides tree showed three clusters: one for D. rotundus and two for Artibeus spp. Regarding putative N amino acid-trees, two clusters were formed, one for D. rotundus and another for Artibeus spp. RABV G gene phylogeny supported the distinction between D. rotundus and Artibeus spp. strains. These results show the intricate host relationship of RABV's evolutionary history, and are invaluable for the determination of RABV infection sources.
Desmodus rotundus and Artibeus spp. bats might present distinct rabies virus lineages.
Fahl, Willian Oliveira; Carnieli, Pedro; Castilho, Juliana Galera; Carrieri, Maria Luiza; Kotait, Ivanete; Iamamoto, Keila; Oliveira, Rafael Novaes; Brandão, Paulo Eduardo
2012-01-01
In Brazil, bats have been assigned an increasing importance in public health as they are important rabies reservoirs. Phylogenetic studies have shown that rabies virus (RABV) strains from frugivorous bats Artibeus spp. are closely associated to those from the vampire bat Desmodus rotundus, but little is known about the molecular diversity of RABV in Artibeus spp. The N and G genes of RABV isolated from Artibeus spp. and cattle infected by D. rotundus were sequenced, and phylogenetic trees were constructed. The N gene nucleotides tree showed three clusters: one for D. rotundus and two for Artibeus spp. Regarding putative N amino acid-trees, two clusters were formed, one for D. rotundus and another for Artibeus spp. RABV G gene phylogeny supported the distinction between D. rotundus and Artibeus spp. strains. These results show the intricate host relationship of RABV's evolutionary history, and are invaluable for the determination of RABV infection sources. Copyright © 2012 Elsevier Editora Ltda. All rights reserved.
Directory of Open Access Journals (Sweden)
Sandhya Vardharajula
2014-08-01
Full Text Available Exopolysaccharides (EPS of microbial origin with novel functionality, reproducible physico-chemical properties, are important class of polymeric materials. EPS are believed to protect bacterial cells from dessication, produce biofilms, thus enhancing the cells chances of bacterial colonizing special ecological niches. In rhizosphere, EPS are known to be useful to improve the moisture-holding capacity. Three Bacillus spp. strains identified by 16s rDNA sequence analysis as B. amyloliquefaciens strain HYD-B17; B. licheniformis strain HYTAPB18; B. subtilis strain RMPB44 were studied for the ability to tolerate matric stress and produce EPS under different water potentials. EPS production in all the three Bacillus spp strains increased with increasing water stress indicating correlation between drought stress tolerance and EPS production. Among the isolates, strain HYD-17 showed highest production of EPS. The exopolysaccharide composition of the three strains was further analyzed by HPLC. Drought stress influenced the ratio of sugars in EPS and glucose was found as major sugar in strains HYTAPB18 and RMPB44 whereas raffinose was major sugar found in strain HYD-B17. Inoculation of EPS producing Bacillus spp. strains in soil resulted in good soil aggregation under drought stress conditions at different incubation periods. This study shows that exposure to water stress conditions affects the composition and ratios of sugars in EPS produced by Bacillus spp. strains HYD-B17, HYTAPB18 and RMPB44 influencing abiotic stress tolerance of the microorganisms.
Czech Academy of Sciences Publication Activity Database
Svobodová, Kateřina; Petráčková, Denisa; Szabad, Hana; Novotný, Čeněk
2016-01-01
Roč. 3, č. 3 (2016), s. 395-407 ISSN 2372-0344 Institutional support: RVO:61388971 Keywords : Pleurotus ostreatus * activated sludge * fungal/bacterial co-cultur Subject RIV: EE - Microbiology, Virology
Enrichment of Acinetobacter spp. from food samples.
Carvalheira, Ana; Ferreira, Vânia; Silva, Joana; Teixeira, Paula
2016-05-01
Relatively little is known about the role of foods in the chain of transmission of acinetobacters and the occurrence of different Acinetobacter spp. in foods. Currently, there is no standard procedure to recover acinetobacters from food in order to gain insight into the food-related ecology and epidemiology of acinetobacters. This study aimed to assess whether enrichment in Dijkshoorn enrichment medium followed by plating in CHROMagar™ Acinetobacter medium is a useful method for the isolation of Acinetobacter spp. from foods. Recovery of six Acinetobacter species from food spiked with these organisms was compared for two selective enrichment media (Baumann's enrichment and Dijkshoorn's enrichment). Significantly (p enrichment. Next, the Dijkshoorn's enrichment followed by direct plating on CHROMagar™ Acinetobacter was applied to detect Acinetobacter spp. in different foods. Fourteen different presumptive acinetobacters were recovered and assumed to represent nine different strains on the basis of REP-PCR typing. Eight of these strains were identified by rpoB gene analysis as belonging to the species Acinetobacter johnsonii, Acinetobacter calcoaceticus, Acinetobacter guillouiae and Acinetobacter gandensis. It was not possible to identify the species level of one strain which may suggests that it represents a distinct species. Copyright © 2015 Elsevier Ltd. All rights reserved.
Ashimoto, A; Hamada, T; Adachi, A; Tanigawa, T; Tanaka, Y
1995-01-01
Staphylococcus spp. were isolated from the ward environment and antibiotic susceptibility tests were performed. Twenty-nine strains out of 274 isolates were S. aureus, and 41.4% of the S. aureus strains were methicillin resistant (MRSA). All 12 strains of MRSA were also resistant to oxacillin, ceftizoxime, ampicillin and clindamycin. Among the coagulase-negative staphylococci (CNS), methicillin-resistant (MR) strains of S. epidermidis, S. capitis, S. warneri, S. haemolyticus, S. hominis, S. auricularis, S. saprophyticus and S. cohnii were isolated. Eight of the 10 S. Haemolyticus strains were methicillin resistant. The femA gene was detected in S. aureus (MSSA and MRSA), but not in CNS by polymerase chain reaction (PCR) analysis and Southern blot analysis. The mecA gene was found in all the MRSA and MR-S. epidermidis strains tested, and one of the two MR-S. hominis strains, but not in MSSA, MS-S. epidermidis, MS-S. hominis, or MS-S. haemolyticus. DNA from one strain of MR-S. hominis and 2 strains of MR-S. haemolyticus was not amplified by PCR using the mecA gene primer, or hybridized by Southern blotting. The ambiguity that mecA was detected in some MR-CNS strains, but not in others is discussed.
High Milk-Clotting Activity Expressed by the Newly Isolated Paenibacillus spp. Strain BD3526
Directory of Open Access Journals (Sweden)
Feng Hang
2016-01-01
Full Text Available Paenibacillus spp. BD3526, a bacterium exhibiting a protein hydrolysis circle surrounded with an obvious precipitation zone on skim milk agar, was isolated from raw yak (Bos grunniens milk collected in Tibet, China. Phylogenetic analysis based on 16S rRNA and whole genome sequence comparison indicated the isolate belong to the genus Paenibacillus. The strain BD3526 demonstrated strong ability to produce protease with milk clotting activity (MCA in wheat bran broth. The protease with MCA was predominantly accumulated during the late-exponential phase of growth. The proteolytic activity (PA of the BD3526 protease was 1.33-fold higher than that of the commercial R. miehei coagulant. A maximum MCA (6470 ± 281 SU mL−1 of the strain BD3526 was reached under optimal cultivation conditions. The protease with MCA was precipitated from the cultivated supernatant of wheat bran broth with ammonium sulfate and purified by anion-exchange chromatography. The molecular weight of the protease with MCA was determined as 35 kDa by sodium dodecyl sulfate-polyacrylamide gels electrophoresis (SDS-PAGE and gelatin zymography. The cleavage site of the BD3526 protease with MCA in κ-casein was located at the Met106–Ala107 bond, as determined by mass spectrometry analysis.
Favier, Gabriela Isabel; Lucero Estrada, Cecilia; Cortiñas, Teresa Inés; Escudero, María Esther
2014-01-01
Shiga toxin producing Escherichia coli (STEC), Salmonella spp., and Yersinia species was investigated in humans, animals, and foods in San Luis, Argentina. A total of 453 samples were analyzed by culture and PCR. The antimicrobial susceptibility of all the strains was studied, the genomic relationships among isolates of the same species were determined by PFGE, and the potencial virulence of Y. enterocolitica strains was analyzed. Yersinia species showed higher prevalence (9/453, 2.0%, 95% CI, 0.7–3.3%) than STEC (4/453, 0.9%, 95% CI, 0–1.8%) and Salmonella spp. (3/453, 0.7%, 95% CI, 0–1.5%). Y. enterocolitica and Y. intermedia were isolated from chicken carcasses (6/80, 7.5%, 95% CI, 1.5–13.5%) and porcine skin and bones (3/10, 30%, 95% CI, 0–65%). One STEC strain was recovered from human feces (1/70, 1.4%, 95% CI, 0–4.2%) and STEC stx1/stx2 genes were detected in bovine stools (3/129, 2.3%, 95% CI, 0–5.0%). S. Typhimurium was isolated from human feces (1/70, 1.4%, 95% CI, 0–4.2%) while one S. Newport and two S. Gaminara strains were recovered from one wild boar (1/3, 33%, 95% CI, 0–99%). The knowledge of prevalence and characteristics of these enteropathogens in our region would allow public health services to take adequate preventive measures. PMID:25177351
Antimicrobial sensitivity profile of Staphylococcus spp. Isolated from clinical mastitis
Directory of Open Access Journals (Sweden)
Thamires Martins
2012-12-01
Full Text Available Inflammation of the mammary gland, which is also known as mastitis, occupies a prominent place among the diseases that affect dairy cattle, having a great economic importance in the dairy sector. Mastitis may have different origins, however, infectious mastitis is the most frequent and represents a risk to public health due to the propagation of microorganisms through milk. Staphylococcus spp. are considered the microorganisms that cause the greatest losses in milk production, being that Staphylococcus aureus is the pathogen of major importance because they present high resistence to antimicrobials. Empirical treatment, without prior identification of the pathogens and their resistance profile, may contribute to the emergence of multidrug-resistant strains and risk the efficiency of the antimicrobial. In that scenery, the study aimed to evaluate the resistance profile of Staphylococcus spp. against some antimicrobials used in the treatment of cows with clinical mastitis. The study was conducted on a property in the state of São Paulo from January 2011 to June 2012. We evaluated 29 lactating cows that present clinical mastitis in, at least, one mammary quarter. The diagnosis of clinical mastitis was performed by evaluating the clinical signs and also by Tamis test. Samples of milk from mammary quarters were collected aseptically in sterile tubes for microbiological evaluation. Microorganisms were isolated on sheep blood agar 5% and Sabouraud agar with chloramphenicol. The sensitivity profile of Staphylococcus spp. to the antibiotics ampicillin, cephalexin, ceftiofur, cefaclor, gentamicin, kanamycin, neomycin, penicillin G and oxacillin, was tested by disk diffusion test on Mueller-Hinton agar. From a total of 106 samples of milk analyzed, 64 (60.38% presented microbiological growth, being observed isolation of Streptococcus spp. 29 (34.52%, Staphylococcus spp. 28 (33.33%, Corynebacterium spp. 17 (20.24%, filamentous fungi 4 (4.76%, yeast 4 (4
Directory of Open Access Journals (Sweden)
Nualsri, C.
2005-01-01
Full Text Available A total of 174 strains of bacteria antagonistic against the green mold (Trichoderma harzianum, isolated from cultivating bags and fruiting bodies of the mushrooms, were screened for effects on mushroom mycelia and ability to control the green mold disease. Twenty-eight of them promoted the primodia formation of the Pleurotus pulmonarius mycelia on agar plates. Twenty-two isolates were selected and further tested in a mushroom house. Cell suspension of each isolate was prepared and sprayed onto the spawn surface of P. pulmonarius. Fifteen isolates shortened the times required from watering to 2nd and 3rd flushing and increased yield of the basidiocarps by 1.1-34.3% over 30 days. Six isolates of bacteria which showed an inhibitory effect against T. harzianum, enhanced primordia formation and increased yield of P. pulmonarius were selected and used for control testing in a cultivation house. The suspension of each isolate was sprayed onto the spawn surface immediately after exposure to the air in the mushroom house, followed by spore suspension of T. harzianum two days later. The number of infected bags was counted at 30 days after inoculation and the cumulative yield was compared after 60 days. The results showed that bacteria isolate B012-022 was highly effective in suppressing the green mold disease.Only 6.7% of the cultivating bags were found to be infected by T. harzianum when bacteria isolate B012-022 was applied. Cumulative yield obtained from 900 g of 94% sawdust + 5% rice bran + 1% Ca(OH2 was 300.0 g/bag after 60 days, 71.1% higher than the bags infected by the green mold and without bacterial spraying. Identification of the six bacterial isolates showed all to be Bacillus spp.
Biodegradation of oxytetracycline by Pleurotus ostreatus mycelium: a mycoremediation technique
International Nuclear Information System (INIS)
Migliore, Luciana; Fiori, Maurizio; Spadoni, Anna; Galli, Emanuela
2012-01-01
Highlights: ► Oxytetracycline uptake and degradation by Pleurotus ostreatus mycelium were measured. ► The role of extracellular laccase in degradation was evaluated. ► The almost complete OTC removal was obtained. ► A possible degradation product was identified in mycelia (ADOTC). ► The system can be considered the first step of an useful mycoremediation technique. - Abstract: Oxytetracycline (OTC) is administered in high doses to livestocks and enters the environmental compartments as a consequence of animal waste disposal. As a first step in setting up a useful mycoremediation technique, an OTC lab degradation test was performed in liquid medium using the ligninolytic fungus Pleurotus ostreatus. OTC disappearance in culture medium was clearly evident as early as the third day of exposure onwards, with an almost complete removal after 14 d. The drug removal was mediated by fungal absorption in the mycelia, where the OTC molecule underwent a degradation step, as demonstrated by mass spectrometry analyses. A putative degradation product, ADOTC (2-acetyl-2-decarboxamido-oxytetracycline) is proposed. Experimental conditions excluded OTC abiotic degradation; the degradation by extracellular laccase was also experimentally discarded.
Biodegradation of oxytetracycline by Pleurotus ostreatus mycelium: a mycoremediation technique
Energy Technology Data Exchange (ETDEWEB)
Migliore, Luciana [Dept. Biology, Tor Vergata University, Via della Ricerca Scientifica, 00133 Rome (Italy); Fiori, Maurizio [Dept. Veterinary Public Health and Food Safety, Istituto Superiore di Sanita, Viale Regina Elena 299, 00161 Rome (Italy); Spadoni, Anna [Dept. Biology, Tor Vergata University, Via della Ricerca Scientifica, 00133 Rome (Italy); Institute of Agro-Environment and Forest Biology, National Research Council, Research Area Rome 1, Via Salaria km 29.300, 00015 Monterotondo Rome (Italy); Galli, Emanuela [Institute of Agro-Environment and Forest Biology, National Research Council, Research Area Rome 1, Via Salaria km 29.300, 00015 Monterotondo Rome (Italy)
2012-05-15
Highlights: Black-Right-Pointing-Pointer Oxytetracycline uptake and degradation by Pleurotus ostreatus mycelium were measured. Black-Right-Pointing-Pointer The role of extracellular laccase in degradation was evaluated. Black-Right-Pointing-Pointer The almost complete OTC removal was obtained. Black-Right-Pointing-Pointer A possible degradation product was identified in mycelia (ADOTC). Black-Right-Pointing-Pointer The system can be considered the first step of an useful mycoremediation technique. - Abstract: Oxytetracycline (OTC) is administered in high doses to livestocks and enters the environmental compartments as a consequence of animal waste disposal. As a first step in setting up a useful mycoremediation technique, an OTC lab degradation test was performed in liquid medium using the ligninolytic fungus Pleurotus ostreatus. OTC disappearance in culture medium was clearly evident as early as the third day of exposure onwards, with an almost complete removal after 14 d. The drug removal was mediated by fungal absorption in the mycelia, where the OTC molecule underwent a degradation step, as demonstrated by mass spectrometry analyses. A putative degradation product, ADOTC (2-acetyl-2-decarboxamido-oxytetracycline) is proposed. Experimental conditions excluded OTC abiotic degradation; the degradation by extracellular laccase was also experimentally discarded.
Czech Academy of Sciences Publication Activity Database
Eichlerová, Ivana; Homolka, Ladislav; Nerud, František
2002-01-01
Roč. 47, č. 6 (2002), s. 691-695 ISSN 0015-5632 R&D Projects: GA MŠk LN00B030 Institutional research plan: CEZ:AV0Z5020903 Keywords : pleurotus ostreatus * ligninolytic properties Subject RIV: EE - Microbiology, Virology Impact factor: 0.979, year: 2002
Investigation on Pleurotus ferulae potential for the sorption of Pb(II ...
African Journals Online (AJOL)
Pleurotus ferulae obtained from rotten tree was collected, washed, dried, ground and sieved to appropriate particle size. Infra-red spectrometry was used to determine functional groups on the biomass while biosorption of Pb(II) from aqueous solution was studied using the biomass in a batch system. The effect of pH (1-7.5), ...
In vitro probiotic potential of Lactobacillus spp. isolated from fermented milks
Directory of Open Access Journals (Sweden)
A.F. Cunha
2013-12-01
Full Text Available The potential of in vitro probiotic Lactobacillus spp. was evaluated in fermented milks marketed in Belo Horizonte, MG, Brazil. Of the samples analyzed, 86.7% had at least 10(6 CFU/mL of Lactobacillus spp., complying with the Brazilian quality standards for fermented milks. Furthermore, 56.7% had minimum count ranging from 10(8 to 10(9 CFU/mL, which is in accordance with legal parameters. The remaining 43.3% would not be able to satisfactorily guarantee benefits to consumers. The amount of Lactobacillus spp. varied between batches of products, which may indicate failures in monitoring during manufacture, transport or storage. All strains of Lactobacillus spp. showed some inhibitory activity against the indicator microorganisms, being more pronounced against pathogenic microorganisms than against non-pathogenic (P<0.05. Samples of Lactobacillus spp. showed different profiles of antimicrobial susceptibility, with an occurrence of cases of multidrug resistance. All strains tested showed sensitivity to bile salts (0.3% and resistance to gastric pH (2.0. Lactobacillus spp. of commercial fermented milks should be present in higher amounts in some brands, be resistant to bile salts and have no multiple resistance to antimicrobials.
van Bruggen, A H; Jochimsen, K N; Steinberger, E M; Segers, P; Gillis, M
1993-01-01
Thermal melting profiles of hybrids between 3H-labeled rRNA of Rhizomonas suberifaciens, the causal agent of corky root of lettuce, and chromosomal DNAs from 27 species of gram-negative bacteria indicated that the genus Rhizomonas belongs to superfamily IV of De Ley. On the basis of the melting temperatures of DNA hybrids with rRNAs from the type strains of R. suberifaciens, Sphingomonas paucimobilis, and Sphingomonas capsulata, Rhizomonas strains constitute a separate branch in superfamily IV, which is closely related to but separate from branches containing Zymomonas mobilis, Sphingomonas spp., and S. capsulata. Sphingomonas yanoikuyae and Rhizomonas sp. strain WI4 are located toward the base of the Rhizomonas rRNA branch. DNA-DNA hybridization indicated that S. yanoikuyae is equidistant from Rhizomonas sp. strain WI4 and S. paucimobilis. Sequences of 270 bp of 16S ribosomal DNAs from eight strains of Rhizomonas spp., eight strains of Sphingomonas spp., and Agrobacterium tumefaciens indicated that S. yanoikuyae and Rhizomonas sp. strains WI4 and CA16 are genetically more closely related to R. suberifaciens than to Sphingomonas spp. Thus, S. yanoikuyae may need to be transferred to the genus Rhizomonas on the basis of the results of further study.
Chen, Shih-Yu; Ho, Kung-Jui; Liang, Chih-Hung; Tsai, Ching-Hsuan; Huang, Ling-Yi; Mau, Jeng-Leun
2012-01-01
Pleurotus eryngii (DC. : Fr.) Ouel. was used in solid-state fermentation to develop novel mushroom products with a high amount of ergothioneine. The correlation coefficients between ergothioneine content and biomass were 0.8878 and 0.9206 for fermented adlay and buckwheat, respectively. Using optimal conditions, Pleurotus-fermented adlay and buckwheat (PFA and PFB) with the ergothioneine contents of 795.5 and 786.1 mg/ kg, respectively, were prepared. However, mycelia contained the highest ergothioneine content of 1514.6 mg/kg. As a result of SSF by P. eryngii, PFA and PFB contained more taste components than adlay and buckwheat, as evidenced by higher contents of total sugars and polyols, total free amino acids and monosodium glutamate-like components, and total and flavor 5'-nucleotides. In addition, PFB and buckwheat showed comparable equivalent umami concentration (EUC) values, whereas PFA showed a higher EUC value than adlay. Overall, Pleurotus-fermented products with a high amount of ergothioneine will be a novel functional food.
Gao, Lujuan; Jiang, Shaojie; Sun, Yi; Deng, Meiqi; Wu, Qingzhi; Li, Ming; Zeng, Tongxiang
2016-01-01
Infections of Fusarium spp. and Exophiala spp. are often chronic, recalcitrant, resulting in significant morbidity, causing discomfort, disfigurement, social isolation. Systemic disseminations happen in compromised patients, which are often refractory to available antifungal therapies and thereby lead to death. The antimicrobial photodynamic therapy (aPDT) has been demonstrated to effectively inactivate multiple pathogenic fungi and is considered as a promising alternative treatment for mycoses. In the present study, we applied methylene blue (8, 16, and 32 μg/ml) as a photosensitizing agent and light emitting diode (635 ± 10 nm, 12 and 24 J/cm(2)), and evaluated the effects of photodynamic inactivation on five strains of Fusarium spp. and five strains of Exophiala spp., as well as photodynamic effects on in vitro susceptibility to itraconazole, voriconazole, posaconazole and amphotericin B, both planktonic and biofilm forms. Photodynamic therapy was efficient in reducing the growth of all strains tested, exhibiting colony forming unit-reductions of up to 6.4 log10 and 5.6 log10 against planktonic cultures and biofilms, respectively. However, biofilms were less sensitive since the irradiation time was twice longer than that of planktonic cultures. Notably, the photodynamic effects against Fusarium strains with high minimal inhibitory concentration (MIC) values of ≥16, 4-8, 4-8, and 2-4 μg/ml for itraconazole, voriconazole, posaconazole and amphotericin B, respectively, were comparable or even superior to Exophiala spp., despite Exophiala spp. showed relatively better antifungal susceptibility profile. MIC ranges against planktonic cells of both species were up to 64 times lower after aPDT treatment. Biofilms of both species showed high sessile MIC50 (SMIC50) and SMIC80 of ≥16 μg/ml for all azoles tested and variable susceptibilities to amphotericin B, with SMIC ranging between 1 and 16 μg/ml. Biofilms subjected to aPDT exhibited a distinct reduction in
Directory of Open Access Journals (Sweden)
I WAYAN EKA DHARMAWAN
2014-04-01
Full Text Available An exploration study of natural resources soil bacteria antibiotic-producer, Streptomyces spp. was done in two steps. The first step was isolation of Streptomyces and the second involved testing their inhibition activities against five strains diarrheagenic Escherichia coli. Soil samples were collected from ten forest areas in Bali. As many as 55 isolates were collected with various macroscopic dan microscopic characters. Most isolates (eight Streptomyces isolates were collected from forest area in Penulisan, Kintamani (RTK. 20. The diversities of isolates are influenced by environment condition. All Streptomyces isolated were tested against five strains diarrheagenic Escherichia coli to check antibiotic activity for inhibit growth of E. coli. Streptomycine was used as a control. The result showed that the largest inhibition zones of Streptomyces against E. coli strains EHEC, ETEC, EIEC, EPEC and DAEC were produced by Streptomyces PK5 (48,67 ± 0,58 mm, Streptomyces GAA4 (29,00 ± 2,00 mm, Streptomyces GBK3 (42,67 ± 2,08 mm, Streptomyces SkBB5 (29,00 ± 2,65 mm and Streptomyces GM3 (33,67 ± 3,21 mm respectively.
Determination of Cr, Cu, Fe, Ni, Pb and Zn by ICP-OES in mushroom samples from Sakarya, Turkey
Directory of Open Access Journals (Sweden)
Esra Altıntığ
2017-06-01
Full Text Available Russula cyanoxantha, Russula delica, Lactarius salmonicolor, Lactarius deliciosus, Pleurotus eryngii, Pleurotus ostreatus, Agaricus bisporus, Suillus luteus, Pleurotus spp and Boletus edulis were collected from Sakarya-Turkey respectively. Also canned food in the form of the Pleurotus eryngii, Pleurotus ostreatus, and Lactarius salmonicolor mushrooms were used for the examination. Trace metal concentrations found in these mushrooms were determined inductively using coupled plasma optic emission spectrometry microwave processes. The results were obtained for (Cr 0.3-26.65, (Cu 17.38-132.75, (Fe 26.3-225.40, (Ni 2.57-39.28, (Pb 11.52-185.20, and (Zn 22.86-126.84 mg/kg. The accuracy of the method was checked by the standard reference material; tea leaves (INCY-TL-1 and tomato leaves (1573a.
Biological control of Egyptian broomrape (Orobanche aegyptiaca using Fusarium spp.
Directory of Open Access Journals (Sweden)
I. Ghannam
2007-08-01
Full Text Available The broomrape (Orobanche spp. is an obligate holoparasitic weed that causes severe damage to many important vegetable crops. Many broomrape control strategies have been tested over the years. In this investigation, 125 Fusarium spp. isolates were recovered from diseased broomrape spikes collected from fields in agricultural areas near Hebron. The pathogenicity of isolates on broomrape was evaluated using an inoculum suspension containing mycelia and conidia. The most effective Fusarium isolates significantly increased the dead spikes of broomrape by 33.6–72.7% compared to the control; there was no obvious pathogenic effect on the tomato plants. Fusarium spp. isolates Fu 20, 25 and 119 were identified as F. solani, while Fu 30, 52, 59, 87 and 12-04 were F. oxysporum. In addition, the two previously known Fusarium strains, F. oxysporum strain EId (CNCM-I-1622 (Foxy and F. arthrosporioides strain E4a (CNCM-I-1621 (Farth were equally effective in controlling broomrape parasitizing tomato plants grown in pots, where the dead spikes of broomrape increased by 50.0 and 51.6%, respectively.
Soler-Rivas, C.; Garcia-Rosado, A.; Polonia, I.; Junca-Blanch, G.; Marin, F.R.; Wichers, H.J.
2006-01-01
When olive mill wastes (OMWs) and vegetation waters (VWs) obtained during the manufacture of olive oil were added as substrate supplements for the cultivation of Pleurotus pulmonarius the material modified growth of the mushroom and the endemic microbiota of the substrate, in particular the
Directory of Open Access Journals (Sweden)
N. I. Gabrielan
2011-01-01
Full Text Available Antibiotic and fagosensitivity most etiologically important nosocomial strains of bacteria – Pseudomonas aeru- ginosa, Klebsiella pneumoniae, E. coli, Proteus spp., Staphylococcus spp. were studied. Multiple drug-resistant bacteria as gram-positive and gram-negative, isolated from 8 substrates, had been demonstrated. With regard to the sensitivity of Pseudomonas aeruginosa >40% was observed in 40–50% of the strains to aminoglycosides – aztreonam, amikacin, netilmicin, and only 23–25% of the strains – to gentamicin and levofloxacin (an average of antibiotic susceptibility was 27%. All strains of ESBL Klebsiella drew up and were sensitive only to imipenem, meropenem and aminoglycosides. Specific phages lysed 43–48% of the strains Pseudomonas aeruginosa and Klebsiella pneumoniae, E. coli, Pro- teus spp., multidrug resistant strains of Staphylococcus spp. It is proposed to introduce the use of phages in clinical practice.
Leushkin, Evgeny V; Logacheva, Maria D; Penin, Aleksey A; Sutormin, Roman A; Gerasimov, Evgeny S; Kochkina, Galina A; Ivanushkina, Natalia E; Vasilenko, Oleg V; Kondrashov, Alexey S; Ozerskaya, Svetlana M
2015-05-21
Pseudogymnoascus spp. is a wide group of fungi lineages in the family Pseudorotiaceae including an aggressive pathogen of bats P. destructans. Although several lineages of P. spp. were shown to produce ascospores in culture, the vast majority of P. spp. demonstrates no evidence of sexual reproduction. P. spp. can tolerate a wide range of different temperatures and salinities and can survive even in permafrost layer. Adaptability of P. spp. to different environments is accompanied by extremely variable morphology and physiology. We sequenced genotypes of 14 strains of P. spp., 5 of which were extracted from permafrost, 1 from a cryopeg, a layer of unfrozen ground in permafrost, and 8 from temperate surface environments. All sequenced genotypes are haploid. Nucleotide diversity among these genomes is very high, with a typical evolutionary distance at synonymous sites dS ≈ 0.5, suggesting that the last common ancestor of these strains lived >50 Mya. The strains extracted from permafrost do not form a separate clade. Instead, each permafrost strain has close relatives from temperate environments. We observed a strictly clonal population structure with no conflicting topologies for ~99% of genome sequences. However, there is a number of short (~100-10,000 nt) genomic segments with the total length of 67.6 Kb which possess phylogenetic patterns strikingly different from the rest of the genome. The most remarkable case is a MAT-locus, which has 2 distinct alleles interspersed along the whole-genome phylogenetic tree. Predominantly clonal structure of genome sequences is consistent with the observations that sexual reproduction is rare in P. spp. Small number of regions with noncanonical phylogenies seem to arise due to some recombination events between derived lineages of P. spp., with MAT-locus being transferred on multiple occasions. All sequenced strains have heterothallic configuration of MAT-locus.
Enterobacter Strains Might Promote Colon Cancer.
Yurdakul, Dilşad; Yazgan-Karataş, Ayten; Şahin, Fikrettin
2015-09-01
Many studies have been performed to determine the interaction between bacterial species and cancer. However, there has been no attempts to demonstrate a possible relationship between Enterobacter spp. and colon cancer so far. Therefore, in the present study, it is aimed to investigate the effects of Enterobacter strains on colon cancer. Bacterial proteins were isolated from 11 Enterobacter spp., one Morganella morganii, and one Escherichia coli strains, and applied onto NCM460 (Incell) and CRL1790 (ATCC) cell lines. Cell viability and proliferation were determined in MTS assay. Flow Cytometry was used to detect CD24 level and apoptosis. Real-Time PCR studies were performed to determine NFKB and Bcl2 expression. Graphpad Software was used for statistical analysis. The results showed that proteins, isolated from the Enterobacter spp., have significantly increased cell viability and proliferation, while decreasing the apoptosis of the cell lines tested. The data in the present study indicated that Enterobacter strains might promote colon cancer. Moreover, Enterobacter spp. could be a clinically important factor for colon cancer initiation and progression. Studies can be extended on animal models in order to develop new strategies for treatment.
A simple method for DNA isolation from Xanthomonas spp.
Directory of Open Access Journals (Sweden)
Gomes Luiz Humberto
2000-01-01
Full Text Available A simple DNA isolation method was developed with routine chemicals that yields high quality and integrity preparations when compared to some of the most well known protocols. The method described does not require the use of lysing enzymes, water bath and the DNA was obtained within 40 minutes The amount of nucleic acid extracted (measured in terms of absorbancy at 260 nm from strains of Xanthomonas spp., Pseudomonas spp. and Erwinia spp. was two to five times higher than that of the most commonly used method.
Grimaldi, A; Bartowsky, E; Jiranek, V
2005-01-01
To assess glycosidase activities from a range of Lactobacillus and Pediococcus species and characterize these activities under conditions pertinent to the wine industry. Lactic acid bacteria were cultured in MRS broth supplemented with apple juice before being harvested, washed and assayed for glycosidase activity using p-nitrophenol-linked substrates. All strains exhibited a detectable capacity for the hydrolysis of the beta- and alpha-d-glucopyranosides. The magnitude of these activities and their response to the physico-chemical parameters investigated varied in a strain-dependent manner. The use of an assay buffer with a pH below 4 generally resulted in a reduced hydrolysis of both substrates while temperature optima ranged between 35 and 45 degrees C. The effect of the inclusion of ethanol in the assay buffer (up to 12%, v/v) ranged from near complete inhibition to increases in activity approaching 80%. With the clear exception of a single strain, glucose and fructose (0.1-20 g l(-1)) acted as inhibitors. An assessment of glycosidase activity during simultaneous exposure to glucose and ethanol at a pH of 3.5 suggested that ethanol decreased loss of activity under these wine-like conditions. Lactobacillus spp. and Pediococcus spp. possess varying degrees of beta- and alpha-d-glucopyranosidase activities, which in turn are influenced differently by exposure to ethanol and/or sugars, temperature and pH. Several strains appeared suited for further evaluation under winemaking conditions. This work highlights the fact that strains of Lactobacillus and Pediococcus have the potential to influence the glycoside composition of wine. Tailoring of wine may therefore be possible through selective application of strains or enzymatic extracts thereof.
Directory of Open Access Journals (Sweden)
Chia-Wei Phan
2014-01-01
Full Text Available Two strains of Pleurotus giganteus (commercial and wild were tested for their ability to induce neurite outgrowth in rat pheochromocytoma (PC12 and mouse neuroblastoma-2a (N2a cells. Treatment with the mushroom extracts resulted in neuronal differentiation and neuronal elongation, but not nerve growth factor (NGF production. Linoleic acid (4.5–5.0%, w/w which is a major fatty acid present in the ethanol extract promoted NGF biosynthesis when augmented with low concentration of NGF (5 ng/mL. The two strains of mushroom were found to be high in protein (154–192 g kg−1, total polysaccharides, phenolics, and flavonoids as well as vitamins B1, B2, and B3. The total phenolics present in the mushroom extracts were positively correlated to the antioxidant activity (free radical scavenging, ferric reducing power, and lipid peroxidation inhibition. To conclude, P. giganteus could potentially be used in well-balanced diet and as a source of dietary antioxidant to promote neuronal health.
Directory of Open Access Journals (Sweden)
Leonora González Mesa
2005-12-01
Cuba , there was no updated data either on the rate of infection by methicilline-resistant Staphylococcus spp or on the circulation of this germ in the community; neither are there reports on vancomycin-resistant Enterococcus spp presence. In this study, 774 strains collected from hospitals in the country were analyzed. The mechanism of resistance was determined by the methods suggested in the NCCLS guidelines. The 9.3 % (23 and 4.0 % (7 of S. aureus isolates from the hospitals and the community respectively were methicilline-resistant carriers of mecA gen whereas 69.9 %(72 of negative Staphylococcus coagulase isolates showed resistance to oxacillin. Also, a vancomycin-resistant Enterococcus spp-carrying strain was detected. Our results revealed that in Cuba the methicilline-resistant S. aureus is not a problem neither at hospitals nor at the community setting. Despite the fact that the circulation of these germs in the community setting and also the circulation of vancomycin-resistant Enterococcus spp at hospital setting have been reported for the first time, their frequency is very low as a consequence of the advances in the implementation of policies aimed at a more rational use and consumption of antibiotics.
Genome Sequences of Apibacter spp., Gut Symbionts of Asian Honey Bees
Kwong, Waldan K; Steele, Margaret I; Moran, Nancy A
2018-01-01
Abstract Honey bees have distinct gut microbiomes consisting almost entirely of several host-specific bacterial species. We present the genomes of three strains of Apibacter spp., bacteria of the Bacteroidetes phylum that are endemic to Asian honey bee species (Apis dorsata and Apis cerana). The Apibacter strains have similar metabolic abilities to each other and to Apibacter mensalis, a species isolated from a bumble bee. They use microaerobic respiration and fermentation to catabolize a limited set of monosaccharides and dicarboxylic acids. All strains are capable of gliding motility and encode a type IX secretion system. Two strains and A. mensalis have type VI secretion systems, and all strains encode Rhs or VgrG proteins used in intercellular interactions. The characteristics of Apibacter spp. are consistent with adaptions to life in a gut environment; however, the factors responsible for host-specificity and mutualistic interactions remain to be uncovered. PMID:29635372
Directory of Open Access Journals (Sweden)
Abdelfattah M. Selim
2014-12-01
Full Text Available Abortion among dairy cattle is one of the major causes of economic losses in the livestock industry. This study describes a 1-step multiplex real-time polymerase chain reaction (PCR to detect Brucella spp., Leptospira spp. and Campylobacter foetus, these are significant bacteria commonly implicated in bovine abortion. ß-actin was added to the same PCR reaction as an internal control to detect any extraction failure or PCR inhibition. The detection limit of multiplex real-time PCR using purified DNA from cultured organisms was set to 5 fg for Leptospira spp. and C. foetus and to 50 fg for Brucella spp. The multiplex real-time PCR did not produce any non-specific amplification when tested with different strains of the 3 pathogens. This multiplex real-time PCR provides a valuable tool for diagnosis, simultaneous and rapid detection for the 3 pathogens causing abortion in bovine.
Multilocus Sequence Analysis of Cercospora spp. from Different Host Plant Families
Directory of Open Access Journals (Sweden)
Floreta Fiska Yuliarni
2014-06-01
Full Text Available Identification of the genus Cercospora is still complicated due to the host preferences often being used as the main criteria to propose a new name. We determined the relationship between host plants and multilocus sequence variations (ITS rDNA including 5.8S rDNA, elongation factor 1-α, and calmodulin in Cercospora spp. to investigate the host specificity. We used 53 strains of Cercospora spp. infecting 12 plant families for phylogenetic analysis. The sequences of 23 strains of Cercospora spp. infecting the plant families of Asteraceae, Cucurbitaceae, and Solanaceae were determined in this study. The sequences of 30 strains of Cercospora spp. infecting the plant families of Fabaceae, Amaranthaceae, Apiaceae, Plumbaginaceae, Malvaceae, Cistaceae, Plantaginaceae, Lamiaceae, and Poaceae were obtained from GenBank. The molecular phylogenetic analysis revealed that the majority of Cercospora species lack host specificity, and only C. zinniicola, C. zeina, C. zeae-maydis, C. cocciniae, and C. mikaniicola were found to be host-specific. Closely related species of Cercospora could not be distinguished using molecular analyses of ITS, EF, and CAL gene regions. The topology of the phylogenetic tree based on the CAL gene showed a better topology and Cercospora species separation than the trees developed based on the ITS rDNA region or the EF gene.
Directory of Open Access Journals (Sweden)
Jayaseelan Murugaiyan
2016-12-01
Full Text Available Microalgae of the genus Prototheca (P. spp are associated with rare algal infections of invertebrates termed protothecosis. Among the seven generally accepted species, P. zopfii genotype 2 (GT2 is associated with a severe form of bovine mastitis while P. blaschkeae causes the mild and sub-clinical form of mastitis. The reason behind the infectious nature of P. zopfii GT2, while genotype 1 (GT1 remains non-infectious, is not known. Therefore, in the present study we investigated the protein expression level difference between the genotypes of P. zopfii and P. blaschkeae. Cells were cultured to the mid-exponential phase, harvested, and processed for LC-MS analysis. Peptide data was acquired on an LTQ Orbitrap Velos, raw spectra were quantitatively analyzed with MaxQuant software and matching with the reference database of Chlorella variabilis and Auxenochlorella protothecoides resulted in the identification of 226 proteins. Comparison of an environmental strain with infectious strains resulted in the identification of 51 differentially expressed proteins related to carbohydrate metabolism, energy production and protein translation. The expression level of Hsp70 proteins and their role in the infectious process is worth further investigation. All mass spectrometry data are available via ProteomeXchange with identifier PXD005305.
Shake flask decolourization of direct dye solar golden yellow R by pleurotus ostreatus
International Nuclear Information System (INIS)
Jilani, K.; Asghar, M.; Bhatti, H.N.; Mushtaq, Z.
2011-01-01
Different on site treatment technologies are in practice for industrial wastewaters but bioremediation using white rot fungi is the most attractive option due to complete degradation of the pollutants to non toxic end products. Three direct dyes (Solar golden yellow R, Solar brilliant red BA and Solar orange RSN) were decolourized using white rot fungus (WRF) Pleurotus ostreatus. The best decolourized dye Solar golden yellow R was selected for subsequent optimization studies for decolourization. Under optimum conditions Pleurotus ostreatus caused 90.32 % decolourization of 0.01 % Solar golden yellow R solution within two days of shake flask incubation at pH 3.5 and 30 deg. C temperature in Kirk's basal nutrient medium with added 1 % starch and 0.01 % ammonium sulphate as carbon and nitrogen sources, respectively. Ligninolytic enzyme activities were correlated to dye decolourization and maximum laccase activity of 356.23 U/ml was also noted in the maximally decolourized medium. (author)
International Nuclear Information System (INIS)
Onbasli, Dilsad; Aslim, Belma
2009-01-01
[in MSM medium with 1% (v/v) BTX] contained neutral sugars (98.2%) and acetylated amino sugars (1.8%). Lastly, in NB medium by strain B15 was found to contain neutral sugars (99.9%) and acetylated amino sugars (0.1%) while in MSM medium in the presence of 1% (v/v) gasoline it was found to contain neutral sugars (83.6%), acetylated amino sugars (16.4%). Monomer composition of control EPSs changed to different structures in the presence of various organic pollutants. Diversities of organic compounds as carbon source affected the monomer composition of EPS produced by some Pseudomonas spp. cultures.
UTILIZACIÓN DE CHONTADURO (Bactris gasipaes ENRIQUECIDA CON Pleurotus ostreatus EN POLLOS
Directory of Open Access Journals (Sweden)
JOSE MIGUEL CAMPO GAVIRIA
2017-12-01
Full Text Available In commercial poultry production, 70% of the production costs are related to feeding, this is a limiting factor affecting the profitability. This study aimed to evaluate the inclusion of chontaduro peel (Bactris gasipaes, enriched with the (Pleurotus ostreatus fungus, in the feeding of broilers; using a completely randomized design, with five treatments and three repetitions per treatment, with inclusion levels of 0,10% and 20% of chontaduro fruit peel, and 10 and 20% of chontaduro fruit peel enriched with the fungus (Pleurotus ostreatus. The productive behavior of the lot was determined by the feed intake, weight gain, feed conversion, skin pigmentation and cost benefit ratio of the portions. In this regard, no statistical differences (p <0,05 between treatments for all production variables evaluated were found, except for pigmentation, which was higher with levels of 20% of inclusion; as well as the positive effect in economic terms where the addition of a 20% of chontaduro peel flour enriched with the fungus is favorable because of the better cost-benefit ratio, without significantly affectingthe productive behavior.
Isolation, Purification, and Characterization of Fungal Laccase from Pleurotus sp.
Directory of Open Access Journals (Sweden)
Sunil S. More
2011-01-01
Full Text Available Laccases are blue copper oxidases (E.C. 1.10.3.2 benzenediol: oxygen oxidoreductase that catalyze the one-electron oxidation of phenolics, aromatic amines, and other electron-rich substrates with the concomitant reduction of O2 to H2O. They are currently seen as highly interesting industrial enzymes because of their broad substrate specificity. A positive strain was isolated and characterized as nonspore forming Basidiomycetes Pleurotus sp. Laccase activity was determined using ABTS as substrate. Laccase was purified by ionexchange and gel filtration chromatography. The purified laccase was a monomer showed a molecular mass of 40±1 kDa as estimated by SDS-PAGE and a 72-fold purification with a 22% yield. The optimal pH and temperature were 4.5 and 65°C, respectively. The Km and Vmax values are 250 (mM and 0.33 (μmol/min, respectively, for ABTS as substrate. Metal ions like CuSO4, BaCl2, MgCl2, FeCl2, ZnCl2 have no effect on purified laccase whereas HgCl2 and MnCl2 moderately decrease enzyme activity. SDS and sodium azide inhibited enzyme activity, whereas Urea, PCMB, DTT, and mercaptoethanol have no effect on enzyme activity. The isolated laccase can be used in development of biosensor for detecting the phenolic compounds from the effluents of paper industries.
Directory of Open Access Journals (Sweden)
Ceci Sales-Campos
2008-11-01
Full Text Available O objetivo deste trabalho foi avaliar o crescimento micelial do cogumelo Pleurotus ostreatus, cultivado na serragem da espécie madeireira Simarouba amara. Avaliaram-se: o efeito das temperaturas de 22, 25, 27, 30 e 35ºC sobre o crescimento micelial de P. ostreatus, nos meios malte-ágar 3% e SDA-MA (infusão da serragem de S. amara, enriquecida com farelo de soja-dextrose-ágar; e o crescimento micelial em substrato de cultivo de serragem de S. amara, com e sem suplementação de farelo de soja, a 25 e 30ºC. O melhor desenvolvimento de P. ostreatus ocorreu em meio malte-ágar 3% a 25ºC. A suplementação de farelo de soja na serragem de S. amara favorece o crescimento micelial.The objective of this work was to assess the mycelial growth of oyster mushroom (Pleurotus ostreatus cultivated in sawdust of Simarouba amara. Evaluations were made for the effect of temperatures 22, 25, 27, 30 and 35ºC on the mycelial growth of P. ostreatus in 3% malt-agar and SDA-MA (infusion of S. amara sawdust, enriched with soybean meal-dextrose-agar media; and the mycelial growth in cultivation substrate of S. amara sawdust, with and without supplementation of soybean meal, at 25 and 30ºC. The best development of P. ostreatus was in 3% malt-agar medium at 25ºC. Soybean meal supplementation on S. amara sawdust promoted mycelial growth.
Directory of Open Access Journals (Sweden)
V. Coimbra-e-Souza
Full Text Available ABSTRACT Mastitis is an inflammation of the mammary gland that affects dairy cattle worldwide causing economic losses. Coagulase-negative staphylococci (CNS are the predominant cause of this type of infection. We have recently showed that coagulase-positive staphylococci could be misidentified. So, the aim of this study was to characterize the Staphylococcus spp. strains initially classified as coagulase-negative Staphylococci, isolated from buffalo with subclinical mastitis. Milk of buffaloes with mastitis in herds was collected and 9 strains were identified as CNS by phenotypic tests. Molecular methodologies latter identified the strains as coagulase-negative Staphylococcus chromogenes (5, coagulase-positive Staphylococcus hyicus (2 and coagulase-positive Staphylococcus aureus (2. Our results strongly support the need to identify the isolates to a species level in order to avoid misidentification and to be aware of the classification using the coagulase test alone.
Towards Added Value Attieke Production in Côte d’Ivoire Using Bacillus spp. as Starters
Directory of Open Access Journals (Sweden)
Charlotte Ayawovi Ehon
2016-12-01
Full Text Available In Côte d’Ivoire, the most fermented cassava food product is “attiéké”. Various microorganisms involved in this fermentation process. Bacillus spp. are well-known for their multi-potential enzymatic activities. In this study, Bacillus spp. strains were studied for their ability of growing in environmental stress as follow: NaCl (2 to 9% and lactic acid (0.1 to 1%. The growth of the studied strains was inhibited at 5% (1 strain, 7% (2 strains and 8% (7 strains for NaCl and beyond 0.25% for lactic acid. The ability of the isolated Bacillus strains to ferment cassava dough for “attiéké” production was also tested. The results of sensory tests showed that “attiéké” produced with Bacillus spp. strains was quite similar to “attiéké” control (traditional “attiéké” except for the brilliance and granulation for which the control obtained the highest scores. The present research indicated that cassava dough fermentation, initiated by the inoculation of Bacillus strains associated with or without lactic acid bacteria should be useful to improve and standardize the quality of “attiéké” produced in Côte d’Ivoire.
Biodegradation of 2,4 dichlorophenol by Pleurotus ostreatus DSM 1833
Directory of Open Access Journals (Sweden)
Heloisa Helena Batista da Silva
2009-12-01
Full Text Available This work aimed to investigate the capacity of Pleurotus ostreatus DSM 1833 to degrade 2,4-dichlorophenol, important pollutant found in the wastewaters of the paper and cellulose industry. Using a factorial design 2², the concentrations of glucose and 2,4-dichlorophenol varied between 0 and 10g.L-1 and 5 and 30mg.L-1, respectively. The best global biodegradation rate was obtained using 30 mg.L-1 of 2,4- dichlorophenol in the absence of glucose. This culture medium was used for scaling up the process, resulting in a global biodegradation rate of 0.47mg.L-1.h-1. A comparative test between an inoculated medium and an abiotic control demonstrated that 54.1% of 2,4- dichlorophenol degradation could be attributed to the presence of P. ostreatus.A indústria de papel e celulose contribui para a contaminação ambiental devido aos resíduos gerados, especialmente, no processo de branqueamento da polpa Kraft, realizada com cloro. Basideomicetos saprófitas têm a capacidade de degradar compostos organoclorados como cloroligninas e clorofenóis. Este trabalho teve como objetivo investigar a capacidade de Pleurotus ostreatus DSM 1833 em degradar 2,4-diclorofenol, importante poluente encontrado nos efluentes da indústria de papel e celulose. Utilizando um planejamento fatorial 2², as concentrações de glicose e de 2,4-diclorofenol variaram entre 0 e 10 g.L-1 e 5 e 30 mg.L-1, respectivamente. A melhor taxa global de degradação foi obtida usando-se 30 mg.L-1 de 2,4-diclorofenol na ausência de glicose. Este meio de cultura foi utilizado para a ampliação da escala do processo, resultando em uma taxa global de biodegradação de 0,47 mg.L-1.h-1. Um teste comparativo entre o meio inoculado e o controle abiótico demonstrou que 54,1% da degradação do 2,4-diclorofenol pode ser atribuída à presença de Pleurotus ostreatus.
Multiplication of Legionella spp. in tap water containing Hartmannella vermiformis.
Wadowsky, R M; Wilson, T M; Kapp, N J; West, A J; Kuchta, J M; States, S J; Dowling, J N; Yee, R B
1991-07-01
A model was developed to study the multiplication of various Legionella spp. in tap water containing Hartmannella vermiformis. Tap water cultures prepared with the following components were suitable for the multiplication studies: Legionella spp., 10(3) CFU/ml; H. vermiformis, 10(4.4) cysts per ml; and killed Pseudomonas paucimobilis, 10(9) cells per ml. Cocultures were incubated at 37 degrees C for at least 1 week. The following legionellae multiplied in tap water cocultures in each replicate experiment: L. bozemanii (WIGA strain), L. dumoffii (NY-23 and TX-KL strains), L. micdadei (two environmental strains), and L. pneumophila (six environmental strains and one clinical isolate). Growth yield values for these strains were 0.6 to 3.5 log CFU/ml. Legionellae which did not multiply in replicate cocultures included L. anisa (one strain), L. bozemanii (MI-15 strain), L. micdadei (a clinical isolate), L. longbeachae, (one strain), and L. pneumophila (Philadelphia 1 strain). L. gormanii and an environmental isolate of L. pneumophila multiplied in only one of three experiments. None of the legionellae multiplied in tap water containing only killed P. paucimobilis. The mean growth yield (+/- standard deviation) of H. vermiformis in the cocultures was 1.2 +/- 0.1 log units/ml. H. vermiformis supports multiplication of only particular strains of legionellae, some of which are from diverse origins.
Jacobsen, C N; Rosenfeldt Nielsen, V; Hayford, A E; Møller, P L; Michaelsen, K F; Paerregaard, A; Sandström, B; Tvede, M; Jakobsen, M
1999-11-01
The probiotic potential of 47 selected strains of Lactobacillus spp. was investigated. The strains were examined for resistance to pH 2.5 and 0.3% oxgall, adhesion to Caco-2 cells, and antimicrobial activities against enteric pathogenic bacteria in model systems. From the results obtained in vitro, five strains, Lactobacillus rhamnosus 19070-2, L. reuteri DSM 12246, L. rhamnosus LGG, L. delbrueckii subsp. lactis CHCC 2329, and L. casei subsp. alactus CHCC 3137, were selected for in vivo studies. The daily consumption by 12 healthy volunteers of two doses of 10(10) freeze-dried bacteria of the selected strains for 18 days was followed by a washout period of 17 days. Fecal samples were taken at days 0 and 18 and during the washout period at days 5 and 11. Lactobacillus isolates were initially identified by API 50CHL and internal transcribed spacer PCR, and their identities were confirmed by restriction enzyme analysis in combination with pulsed-field gel electrophoresis. Among the tested strains, L. rhamnosus 19070-2, L. reuteri DSM 12246, and L. rhamnosus LGG were identified most frequently in fecal samples; they were found in 10, 8, and 7 of the 12 samples tested during the intervention period, respectively, whereas reisolations were less frequent in the washout period. The bacteria were reisolated in concentrations from 10(5) to 10(8) cells/g of feces. Survival and reisolation of the bacteria in vivo appeared to be linked to pH tolerance, adhesion, and antimicrobial properties in vitro.
Electrical stimulation in white oyster mushroom (Pleurotus florida) production
Roshita, I.; Nurfazira, K. M. P.; Fern, C. Shi; Ain, M. S. Nur
2017-09-01
White oyster mushroom (Pleurotus florida) is an edible mushroom that gained popularity due to its nutritional values, low production cost and ease of cultivation. There are several research reported on the mushroom fruiting bodies which were actively developed when applying electrical shock treatment. This study was aimed to investigate the effects of different electrical voltages on the growth and yield of white oyster mushroom (Pleurotus florida). Five different electrical voltages had been applied during spawning period which were 6V, 9V, 12V, 15V and mushroom bags without any treatment served as control. Treatment at 6V showed the highest rate for mycelium growth while 15V took the shortest time for fruiting body formation. However, no significant different (P>0.05) among all the treatments was observed for the time taken for the mycelium to fill-up the bag and pinhead emergence. The total fresh weight and percentage of biological efficiency for treatment at 9V showed higher values compared to control. Treatment at 9V also showed the largest pileus diameter and the most firm in the pileus texture. Meanwhile, treatment at 6V showed the highest a* value (redness). In addition, different electrical voltage treatments applied did not show any significant effect on substrate utilization efficiency, colour L* and b* values. In conclusion, among all the electrical treatments applied, 9V could be considered as the best treatment to enhance the yield of white oyster mushroom.
Antimicrobial Resistance of Shigella spp. isolated in the State of Pará, Brazil
Directory of Open Access Journals (Sweden)
Flávia Corrêa Bastos
2011-10-01
Full Text Available INTRODUCTION: Shigella spp. are Gram-negative, nonsporulating, rod-shaped bacteria that belong to the family Enterobacteriaceae and are responsible for shigellosis or bacillary dysentery, an important cause of worldwide morbidity and mortality. METHODS: We studied the antibiotic resistance profiles of 122 Shigella spp. strains (81 S. flexneri, 41 S. sonnei, 1 S. boydii isolated from patients (female and male from 0 to 80 years of age presenting diarrhea in different districts of the State of Pará, in the North of Brazil. The antibiotic resistance of the strains, isolated from human fecal samples, was determined by the diffusion disk method and by using the VITEK-2 system. RESULTS: The highest resistance rate found was the resistance rate to tetracycline (93.8%, followed by the resistance rate to chloramphenicol (63.9% and to trimethoprim/sulfamethoxazole (63.1%. Resistance to at least three drugs was more common among S. flexneri than S. sonnei (39.5% vs. 10%. Six (4.9% strains were susceptible to all the antibiotics tested. All strains were susceptible to cefotaxime, ceftazidime, ciprofloxacin, nalidixic acid and nitrofurantoin. CONCLUSIONS: High rates of multidrug resistance in Shigella spp. are a serious public health concern in Brazil. It is extremely important to continuously monitor the antimicrobial resistances of Shigella spp. for effective therapy and control measures against shigellosis.
This paper highlighted the antioxidant and antibacterial activities of Lentinus tigrinus and Pleurotus djamour. Extracts of mushroom fruiting bodies were obtained using hexane and acetonitrile solvents. Acetonitrile extracts of both mushrooms exhibited higher biological activities than hexane extrac...
Directory of Open Access Journals (Sweden)
Eustáquio Souza Dias
2003-12-01
Full Text Available Diferentes resíduos agrícolas disponíveis na região sul de Minas Gerais foram testados para o cultivo do cogumelo Pleurotus sajor-caju. Foram avaliados os seguintes substratos: palha de feijão pura (PFP, palha de milho pura (PMP, casca de café pura (CCP, palha de feijão enriquecida com 2% de calcário, 2% de gesso e 10% de farelo de trigo (PFE, palha de milho enriquecida (PME e casca de café enriquecida (CCE. Todos os substratos receberam 2% de inoculante e foram incubados a 24°C. Após a colonização, os sacos foram mantidos abertos em ambiente a 24°C e umidade a 80%. PFP, PFE e PME apresentaram os melhores resultados na produção de cogumelos, com uma eficiência biológica de 85,7; 81,4 e 83,4%, respectivamente. A palha de feijão foi considerada o melhor resíduo para a produção do cogumelo P. sajor-caju, porque apresentou a melhor eficiência biológica sem necessidade de enriquecimento.Several agricultural residues available in the South of Minas Gerais were tested for cultivation of the mushroom Pleurotus sajor-caju. The following substrates were investigated: Bean (BS, Corn (CS straws and Coffee husk (CH without nutrient supplementation and straws of bean (BSS, corn (CSS and coffee husk (CHS supplemented with 2% of CaCO3, 2% of gypsum and 10% of wheat flour. All the substrates were inoculated with 2% of spawn and incubated at 24ºC. After the fungi had colonized the substrate, the plastic bags were open and maintained at room temperature with 80% of humidity. BS, BSS and CSS showed higher mushroom production than the others, showing a biological efficiency of 85.7, 81.4 and 83.6% respectively. The beans straw (BS without nutrient supplementation was considered the best residue for the growth and cultivation of the mushroom Pleurotus sajor-caju. This substrate showed higher levels of biological efficiency than the others substrates analysed.
Directory of Open Access Journals (Sweden)
Martínez César
2003-12-01
Full Text Available El objetivo de este trabajo fue caracterizar y evaluar diferentes métodos de purificación y separación cromatográfica de un caldo rico en enzima lacasa, producida por una variedad del basidiomycete Pleurotus ostreatus. Se llevaron a cabo dos procesos de producción, a saber: a FES (Fermentación en Estado Sólido; b fermentación en sumergido. El proceso de FES se basó en la producción de un extracto de caldo crudo rico en enzima lacasa a partir del crecimiento micelial sobre salvado con vinaza en relación 1:1 w/v duran te 20 días. Se obtuvo un caldo crudo con una actividad promedio de 20 U/ml. En el caso del proceso de fermentación en sumergido, se trabajó con el medio reportado por Hublick y Schinner (2000 con algunas modificaciones, y se obtuvo un crecimiento del hongo en forma de pellets, en un período de 15 días, con actividad promedio de 10 U/ml en el caldo crudo. Las isoenzimas aisladas en los procesos cromatográficos se caracterizaron de acuerdo a sus propiedades moleculares y cinéticas, se determinó su peso molecular por electroforesis de placa vertical (SDS-PAGE y sus parámetros cinéticos, por ejemplo estabilidad, en un rango de temperatura y pH. Palabras clave: lacasa; Pleurotus ostreatus; fermentación en estado sólido (FES; fermentación en sumergido; isoenzimas; laccase; Pleurotus ostreatus; Solid State Fermentation (SSF; Submerged Fermentation; isoenzymesThis project was designed for characterising and evaluating different methods of chromatographic separation and purification regarding a laccase enzyme-rich broth produced by Pleurotus ostreatus, a variety of basidiomycetes. SSF (Solid State Fermentation and Submerged Fermentation production processes were employed. The SSF process was based on producing a raw broth rich in laccase enzyme from mycelium grown on bran with 1:1 vinasse w/v for 20 days. A raw broth was obtained having an average 20 U/ml activity. The medium reported by Hublick and Schinner (2000
Di Gioia, Diana; Mazzola, Giuseppe; Nikodinoska, Ivana; Aloisio, Irene; Langerholc, Tomaz; Rossi, Maddalena; Raimondi, Stefano; Melero, Beatriz; Rovira, Jordi
2016-10-17
In meat fermented foods, Clostridium spp. growth is kept under control by the addition of nitrite. The growing request of consumers for safer products has led to consider alternative bio-based approaches, the use of protective cultures being one of them. This work is aimed at checking the possibility of using two Lactobacillus spp. strains as protective cultures against Clostridium spp. in pork ground meat for fermented salami preparation. Both Lactobacillus strains displayed anti-clostridia activity in vitro using the spot agar test and after co-culturing them in liquid medium with each Clostridium strain. Only one of them, however, namely L. plantarum PCS20, was capable of effectively surviving in ground meat and of performing anti-microbial activity in carnis in a challenge test where meat was inoculated with the Clostridium strain. Therefore, this work pointed out that protective cultures can be a feasible approach for nitrite reduction in fermented meat products. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Ira Djajanegara
2012-02-01
Full Text Available Irradiation aplied to living organisms may have positive or negative effects on physiological and morphological properties of the organisms. One way to gain genetic variation with better properties than the parental strain is by Gamma (Co 60 radiation application. During this experiment, Gama (Co 60 rays was applied to the grey oyster (Pleurotus sajur-caju mushroom mycellia during exponential phase. Radiation was applied at 0.75 KGray with dose velocity of 1.149 KGray. Analysis of mushroom productivity performances indicate that diameter of mycellia, fresh weight, dry weight, diameter of fruit body and the amount of fruit body of the mutant and control were not significantly different. However, the isozyme pattern showed a different pattern between the mutant and the control which indicates that mutation process has already occured. These data show that mutation did not affect the productivity of the mushroom. Therefore, mutation may affect the nutritional quality of the mushroom instead. Further experiment to verify this possibility is suggested.
Directory of Open Access Journals (Sweden)
Emanuel Vamanu
2012-03-01
Full Text Available The antioxidant and antimicrobial potential of the ethanolic extract of Pleurotus ostreatus PQMZ91109 mycelium was determined based on inorganic and organic nitrogen sources in the culture medium. The presence of ammonium sulfate resulted in a greater accumulation of bioactive compounds compared with the organic ones. This finding was also confirmed by the low values of the ascertained EC50 and minimum inhibitory concentration (MICs. Among the organic sources, peptone followed by corn extract, led to a more important radical-scavenging activity. The extracts selectively inhibited the tested strains, mainly the two of the genus Candida, at an MIC value of 1.25 mg/mL. The antioxidant potential was evaluated by the inhibition capacity of the 2,2-diphenyl-1-picrylhydrazyl (DPPH radical, β-carotene-linoleic acid, which is the reducing power. In addition, the quantity of the compounds with antioxidant effects confirmed the data obtained, they being present in the extracts.
The lipid peroxidation intensity of fungi strains from the orders Agaricales and Polyporales
Directory of Open Access Journals (Sweden)
O. V. Fedotov
2016-07-01
Full Text Available This article is devoted to investigation of the dynamics of growth and level of spontaneous and induced lipid peroxidation intensity of Basidiomycetes strains grown by surface cultivation on a glucose-peptone medium. The materials of the research are mycelium and culture filtrates (CF of 57 strains (5 belong to 5 species from the order Polyporales s.l., and 52 belong to 7 species of the order Agaricales s.l.. To study the dynamics of growth we used a weighing method for determining the accumulation of absolutely dry biomass. Intensity of lipid peroxidation was determined by a modified spectrophotometric method for content of active to thiobarbituric acid products. It was found that the most productive in absolutely dry biomass accumulation were the strains Flammulina velutipes (Curt.: Fr. Sing. F-610 and Pleurotus eryngii (DC.: Fr. Quél. P-er. The level of spontaneous and induced LPO intensity in mycelia of all strains was higher than this figure in the culture filtrate and increased with the duration of cultivation. Dependencies between the content of lipid peroxidation products in the mycelia and CF were not established. The lowest values were recorded for biomass accumulation by the strains Pleurotus ostreatus (Jacq.: Fr. P. Kumm. P-14, P-192 and P. citrinopileatus Singer. Р-сіtr. Groups of basidiomycete cultures with different levels of TBA-AP were identified. Spontaneous and induced intensivity of lipid peroxidation in all studied strains of mycelia was higher than the figure in the culture filtrate. The intensity of lipid peroxidation in both mycelia and culture filtrate constantly increased, which can be explained by the growing shortage of certain nutrients (primarily carbon and increased concentration of metabolic products in the medium. The ratio of spontaneous and induced lipid peroxidation intensity is specific to each strain and is independent of its systematic position. Shifting of prooxidant-antioxidant balance to a
Mendoza, José Luis Hernández; Pérez, María Isabel Sánchez; Prieto, Juan Manuel González; Velásquez, Jesús DiCarlo Quiroz; Olivares, Jesús Gerardo García; Langarica, Homar Rene Gill
2015-01-01
Abstract Sampling of agricultural soils from the Mexican northeastern region was performed to detect Trichoderma spp., genetically characterize it, and assess its potential use as a biologic control agent against Macrophomina phaseolina. M. phaseolina is a phytopathogen that attacks over 500 species of cultivated plants and causes heavy losses in the regional sorghum crop. Sampling was performed immediately after sorghum or corn harvest in an area that was approximately 170 km from the Mexico-USA border. Sixteen isolates were obtained in total. Using colony morphology and sequencing the internal transcribed spacers (ITS) 1 and 4 of 18S rDNA, 14 strains were identified as Trichoderma harzianum, T. koningiopsis and T. virens. Subsequently, their antagonistic activity against M. phaseolina was evaluated in vitro, and 11 isolates showed antagonism by competition and stopped M. phaseolina growth. In 4 of these isolates, the antibiosis phenomenon was observed through the formation of an intermediate band without growth between colonies. One strain, HTE808, was identified as Trichoderma koningiopsis and grew rapidly; when it came into contact with the M. phaseolina colony, it continued to grow and sporulated until it covered the entire petri dish. Microscopic examination confirmed that it has a high level of hyperparasitism and is thus considered to have high potential for use in the control of this phytopathogen. PMID:26691467
Gondim, Leane S Q; Jesus, Rogério F; Ribeiro-Andrade, Müller; Silva, Jean C R; Siqueira, Daniel B; Marvulo, Maria F V; Aléssio, Felipe M; Mauffrey, Jean-François; Julião, Fred S; Savani, Elisa San Martin Mouriz; Soares, Rodrigo M; Gondim, Luís F P
2017-08-30
Sarcocystis neurona and Neospora spp. are protozoan parasites that induce neurological diseases in horses and other animal species. Opossums (Didelphis albiventris and Didelphis virginiana) are definitive hosts of S. neurona, which is the major cause of equine protozoal myeloencephalitis (EPM). Neospora caninum causes abortion in cattle and infects a wide range of animal species, while N. hughesi is known to induce neurologic disease in equids. The aims of this study were to investigate S. neurona and N. caninum in tissues from opossums in the northeastern Brazil, and to isolate Brazilian strains of Sarcocystis spp. from wild opossums for comparison with previously isolated strains. Carcasses of 39 opossums from Bahia state were available for molecular identification of Sarcocystis spp. and N. caninum in their tissues, and for sporocyst detection by intestinal scraping. In addition, Sarcocystis-like sporocysts from nine additional opossums, obtained in São Paulo state, were tested. Sarcocystis DNA was found in 16 (41%) of the 39 opossums' carcasses; N. caninum DNA was detected in tissues from three opossums. The sporocysts from the nine additional opossums from São Paulo state were tested by bioassay and induced infection in nine budgerigars, but in none of the gamma-interferon knockout mice. In vitro isolation was successful using tissues from all nine budgerigars. The isolated strains were maintained in CV-1 and Vero cells. Three of nine isolates presented contamination in cell culture and were discarded. Analysis of six isolates based on five loci showed that these parasites were genetically different from each other and also distinct from S. neurona, S. falcatula, S. lindsayi, and S. speeri. In conclusion, opossums in the studied regions were infected with N. caninum and Sarcocystis spp. and represent a potential source of infection to other animals. This is the first report of N. caninum infection in tissues from black-eared opossum (D. aurita or D
Production of ligninolytic enzymes by solid state fermentation using Pleurotus ostreatus
Directory of Open Access Journals (Sweden)
Seyma Ozcirak Ergun
2017-06-01
Full Text Available Solid state fermentation (SSF stands out in the production of lignocellulolytic and other industrially important enzymes. SSF, an alternative culture method, has several advantages over the conventional submerged ones, like higher yields of enzymes. The production of ligninolytic enzymes, such as laccase (Lac, manganese peroxidase (MnP, lignin peroxidase (LiP and aryl alcohol oxidase (AAO by Pleurotus ostreatus (Jacq. Pleurotus Kumm. (MCC16 was investigated under SSF, which was performed using a support-substrate from potato peel waste (PPW. PPW as dry and fresh was pretreated with base to neutralize organic acids and distilled water. Chemical content of PPW was investigated. Ligninolytic enzyme production patterns were investigated during the growth of the organism for a period of 23 days at 25 °C in the stationary SSF using pretreated PPW. The highest Lac and MnP activities were determined in dry PPW, pretreated with distilled water as 6708.3 ± 75 U/L and 2503.6 ± 50 U/L on day 17, respectively. In addition, amylase and protease enzyme activities were detected under same conditions. According to the results, PPW has a potential as supports for ligninolytic enzyme production by P. ostreatus under SSF.
Effect of 60Co γ-irradiation on postharvest quality of pleurotus nebrodensis stored at 4 degree C
International Nuclear Information System (INIS)
Xiong Qiaoling; Huazhong Agriculture Univ., Wuhan; Xing Zengtao; Feng Zhiyong; Buswell, J.; Bian Yinbing
2007-01-01
The effect of γ-rays irradiation on the fresh-keeping of Pleurotus nebrodensis fruit bodies was reported in this paper. Fresh harvested fruit bodies of Pleurotus nebrodensis were irradiate at different doses levels (0.8-2.0 kGy) and stored for 22 days at 4 degree C. The fruit bodies treated with 1.2 kGy irradiation retained the highest soluble protein contents, and exhibited less postharvest softening throughout the storage period. Regression analysis plots of fruit body hardness versus soluble protein content were linear (t>0.05). Increases in mushroom cell permeability observed throughout the storage period were directly related to irradiation dose. Too higher dose(≥2.0 kGy) of irradiation will accelerate the nutrition degradation and rotting of the fruit bodies. (authors)
Antimicrobial resistance profile of Enterococcus spp isolated from food in Southern Brazil
Riboldi, Gustavo Pelicioli; Frazzon, Jeverson; d’Azevedo, Pedro Alves; Frazzon, Ana Paula Guedes
2009-01-01
Fifty-six Enterococcus spp. strains were isolated from foods in Southern Brazil, confirmed by PCR and classified as Enterococcus faecalis (27), Enterococcus faecium (23) and Enterococcus spp (6). Antimicrobial susceptibility tests showed resistance phenotypes to a range of antibiotics widely administrated in humans such as gentamycin, streptomycin, ampicillin and vancomycin. PMID:24031330
Cai, Dongbo; Wang, Hao; He, Penghui; Zhu, Chengjun; Wang, Qin; Wei, Xuetuan; Nomura, Christopher T; Chen, Shouwen
2017-04-24
Signal peptide peptidases play an important role in the removal of remnant signal peptides in the cell membrane, a critical step for extracellular protein production. Although these proteins are likely a central component for extracellular protein production, there has been a lack of research on whether protein secretion could be enhanced via overexpression of signal peptide peptidases. In this study, both nattokinase and α-amylase were employed as prototypical secreted target proteins to evaluate the function of putative signal peptide peptidases (SppA and TepA) in Bacillus licheniformis. We observed dramatic decreases in the concentrations of both target proteins (45 and 49%, respectively) in a sppA deficient strain, while the extracellular protein yields of nattokinase and α-amylase were increased by 30 and 67% respectively in a strain overexpressing SppA. In addition, biomass, specific enzyme activities and the relative gene transcriptional levels were also enhanced due to the overexpression of sppA, while altering the expression levels of tepA had no effect on the concentrations of the secreted target proteins. Our results confirm that SppA, but not TepA, plays an important functional role for protein secretion in B. licheniformis. Our results indicate that the sppA overexpression strain, B. licheniformis BL10GS, could be used as a promising host strain for the industrial production of heterologous secreted proteins.
Biodegradation of endocrine disruptors in urban wastewater using Pleurotus ostreatus bioreactor.
Křesinová, Zdena; Linhartová, Lucie; Filipová, Alena; Ezechiáš, Martin; Mašín, Pavel; Cajthaml, Tomáš
2018-07-25
The white rot fungus Pleurotus ostreatus HK 35, which is also an edible industrial mushroom commonly cultivated in farms, was tested in the degradation of typical representatives of endocrine disrupters (EDCs; bisphenol A, estrone, 17β-estradiol, estriol, 17α-ethinylestradiol, triclosan and 4-n-nonylphenol); its degradation efficiency under model laboratory conditions was greater than 90% within 12 days and better than that of another published strain P. ostreatus 3004. A spent mushroom substrate from a local farm was tested for its applicability in various batch and trickle-bed reactors in degrading EDCs in model fortified and real communal wastewater. The reactors were tested under various regimes including a pilot-scale trickle-bed reactor, which was finally tested at a wastewater treatment plant. The result revealed that the spent substrate is an efficient biodegradation agent, where the fungus was usually able to remove about 95% of EDCs together with suppression of the estrogenic activity of the sample. The results showed the fungus was able to operate in the presence of bacterial microflora in wastewater without any substantial negative effects on the degradation abilities. Finally, a pilot-scale trickle-bed reactor was installed in a wastewater treatment plant and successfully operated for 10days, where the bioreactor was able to remove more than 76% of EDCs present in the wastewater. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Valéria Maria Lara
2016-01-01
Full Text Available This study evaluated the in vitro antibacterial activity of essential oils from Lippia graveolens (Mexican oregano, Origanum vulgaris (oregano, Thymus vulgaris (thyme, Rosmarinus officinalis (rosemary, Cymbopogon nardus (citronella, Cymbopogon citratus (lemongrass, and Eucalyptus citriodora (eucalyptus against Escherichia coli (n=22 strains isolated from Alouatta spp. feces. Minimum inhibitory concentration (MIC and minimum bactericidal concentration (MBC were determined for each isolate using the broth microdilution technique. Essential oils of Mexican oregano (MIC mean = 1818 μg mL−1; MBC mean = 2618 μg mL−1, thyme (MIC mean = 2618 μg mL−1; MBC mean = 2909 μg mL−1, and oregano (MIC mean = 3418 μg mL−1; MBC mean = 4800 μg mL−1 showed the best antibacterial activity, while essential oils of eucalyptus, rosemary, citronella, and lemongrass displayed no antibacterial activity at concentrations greater than or equal to 6400 μg mL−1. Our results confirm the antimicrobial potential of some essential oils, which deserve further research.
Carregaro, Adriano Bonfim; Santurio, Deise Flores; de Sá, Mariangela Facco; Santurio, Janio Moraes; Alves, Sydney Hartz
2016-01-01
This study evaluated the in vitro antibacterial activity of essential oils from Lippia graveolens (Mexican oregano), Origanum vulgaris (oregano), Thymus vulgaris (thyme), Rosmarinus officinalis (rosemary), Cymbopogon nardus (citronella), Cymbopogon citratus (lemongrass), and Eucalyptus citriodora (eucalyptus) against Escherichia coli (n = 22) strains isolated from Alouatta spp. feces. Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) were determined for each isolate using the broth microdilution technique. Essential oils of Mexican oregano (MIC mean = 1818 μg mL−1; MBC mean = 2618 μg mL−1), thyme (MIC mean = 2618 μg mL−1; MBC mean = 2909 μg mL−1), and oregano (MIC mean = 3418 μg mL−1; MBC mean = 4800 μg mL−1) showed the best antibacterial activity, while essential oils of eucalyptus, rosemary, citronella, and lemongrass displayed no antibacterial activity at concentrations greater than or equal to 6400 μg mL−1. Our results confirm the antimicrobial potential of some essential oils, which deserve further research. PMID:27313638
International Nuclear Information System (INIS)
Ramachandra, M.; Crawford, D.L.; Pometto, A.L. III
1987-01-01
The wild-type ligninolytic actinomycete Streptomyces viridosporus T7A and two genetically manipulated strains with enhanced abilities to produce a water-soluble lignin degradation intermediate, an acid-precipitable polymeric lignin (APPL), were grown on lignocellulose in solid-state fermentation cultures. Culture filtrates were periodically collected, analyzed for APPL, and assayed for extracellular lignocellulose-catabolizing enzyme activities. Two APPL-overproducing strains, UV irradiation mutant T7A-81 and protoplast fusion recombinant SR-10, had higher and longer persisting peroxidase, esterase, and endoglucanase activities than did the wild-type strain T7A. Results implicated one or more of these enzymes in lignin solubilization. Only mutant T7A-81 had higher xylanase activity than the wild type. The peroxidase was induced by both lignocellulose and APPL. This extracellular enzyme has some similarities to previously described ligninases in fungi. This is the first report of such an enzyme in Streptomyces spp. Four peroxidase isozymes were present, and all catalyzed the oxidation of 3,4-dihydroxyphenylalanine, while one also catalyzed hydrogen peroxide-dependent oxidation of homoprotocatechuic acid and caffeic acid. Three constitutive esterase isozymes were produced which differed in substrate specificity toward α-naphthyl acetate and α-naphthyl butyrate. Three endoglucanase bands, which also exhibited a low level of xylanase activity, were identified on polyacrylamide gels as was one xylanase-specific band. There were no major differences in the isoenzymes produced by the different strains. The probable role of each enzyme in lignocellulose degradation is discussed
Er, Buket; Demirhan, Burak; Onurdag, Fatma Kaynak; Ozgacar, Selda Özgen; Oktem, Aysel Bayhan
2014-03-01
Salmonella spp. are widespread foodborne pathogens that contaminate egg and poultry meats. Attachment, colonization, as well as biofilm formation capacity of Salmonella spp. on food and contact surfaces of food may cause continuous contamination. Biofilm may play a crucial role in the survival of salmonellae under unfavorable environmental conditions, such as in animal slaughterhouses and processing plants. This could serve as a reservoir compromising food safety and human health. Addition of antimicrobial preservatives extends shelf lives of food products, but even when products are supplemented with adequate amounts of preservatives, it is not always possible to inhibit the microorganisms in a biofilm community. In this study, our aims were i) to determine the minimum inhibitory concentrations (MIC) and minimum biofilm inhibitory concentrations (MBIC) of selected preservatives against planktonic and biofilm forms of Salmonella spp. isolated from chicken samples and Salmonella Typhimurium SL1344 standard strain, ii) to show the differences in the susceptibility patterns of same strains versus the planktonic and biofilm forms to the same preservative agent, and iii) to determine and compare antimicrobial and antibiofilm effects of selected food preservatives against Salmonella spp. For this purpose, Salmonella Typhimurium SL1344 standard strain and 4 Salmonella spp. strains isolated from chicken samples were used. Investigation of antimicrobial and antibiofilm effects of selected food preservatives against Salmonella spp. was done according to Clinical and Laboratory Standards Institute M100-S18 guidelines and BioTimer assay, respectively. As preservative agents, pure ciprofloxacin, sodium nitrite, potassium sorbate, sodium benzoate, methyl paraben, and propyl paraben were selected. As a result, it was determined that MBIC values are greater than the MIC values of the preservatives. This result verified the resistance seen in a biofilm community to food
Directory of Open Access Journals (Sweden)
RBA Almeida
2013-01-01
Full Text Available Medicinal plants with fungicide action, antibacterial and anti-inflammatory effects are under investigation. The main purpose of this work was to evaluate the antimicrobial activity of the essential oil from Cymbopogon citratus (DC Stapf. on strains of Staphylococcus spp., Streptococcus mutans and Candida spp. with planktonic and biofilm growth. To study the micro-organisms in planktonic cells, the minimal inhibitory concentration (MIC and minimal bactericidal concentration (MBC were determined by using 9 clinical strains for each species and 1 ATCC (American Type Culture Collection from C. albicans, C. tropicalis, C. glabrata, S. aureus, S. epidermidis and S. mutans. In order to evaluate the effects of the essential oils on biofilms, strains of S. aureus (ATCC 6538, S. mutans (ATCC 35688 and C. albicans (ATCC 18804 were used. The biofilm was formed on acrylic resin discs with isolated micro-organisms or in associations. The number of colony-forming-units (CFU obtained in each biofilm (CFU/ml was submitted to Student's t statistical test. The results demonstrated that the essential oil of Cymbopogon citratus showed microbiostatic and microbicidal activity against all tested strains. The average CFU/ml for the biofilm of S. aureus, S. mutans and C. albicans, whether isolated or in association, was lower in the group treated with essential oil than in the control group.
Vaginal Candida spp. genomes from women with vulvovaginal candidiasis.
Bradford, L Latéy; Chibucos, Marcus C; Ma, Bing; Bruno, Vincent; Ravel, Jacques
2017-08-31
Candida albicans is the predominant cause of vulvovaginal candidiasis (VVC). Little is known regarding the genetic diversity of Candida spp. in the vagina or the microvariations in strains over time that may contribute to the development of VVC. This study reports the draft genome sequences of four C. albicans and one C. glabrata strains isolated from women with VVC. An SNP-based whole-genome phylogeny indicates that these isolates are closely related; however, phylogenetic distances between them suggest that there may be genetic adaptations driven by unique host environments. These sequences will facilitate further comparative analyses and ultimately improve our understanding of genetic variation in isolates of Candida spp. that are associated with VVC. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Jafar Bekloo, Ahmad; Ramzgouyan, Maryam Roya; Shirian, Sadegh; Faghihi, Faezeh; Bakhshi, Hassan; Naseri, Fatemeh; Sedaghat, Mehdi; Telmadarraiy, Zakkyeh
2018-05-01
Anaplasma/Ehrlichia species are tick-transmitted pathogens that cause infections in humans and numerous domestic and wild animal species. There is no information available on the molecular characteristics and phylogenetic position of Anaplasma/Ehrlichia spp. isolated from tick species from different geographic locations in Iran. The aim of this study was to determine the prevalence, molecular characteristics, and phylogenetic relationship of both Anaplasma spp. and Ehrlichia spp. in tick species isolated from different domestic animals from two different geographical locations of Iran. A total of 930 ticks were collected from 93 cattle, 250 sheep, and 587 goats inhabiting the study areas. The collected ticks were then investigated for the presence of Anaplasma/Ehrlichia spp. using nested PCR based on the 16S rRNA gene, followed by sequencing. Sequence analysis was done based on the data published in the GenBank on Anaplasma/Ehrlichia spp. isolates using bioinformatic tools such as the standard nucleotide BLAST. Genome of Anaplasma or Ehrlichia spp. was detected in 14 ticks collected in Heris, including 5 Dermacentor marginatus, 1 Haemaphysalis erinacei, 3 Hyalomma anatolicum, and 4 Rhipicephalus sanguineus, also in 29 ticks collected in Chabahar, including 14 R. sanguineus, 8 D. marginatus, 3 Hyalomma Anatolicum, and 4 Hyalomma dromedarii. Partial analysis of the 16S rRNA gene sequence of positive samples collected from goats and sheep showed that they were infected with Anaplasma/Ehrlichia spp. that were 94-98% identical to ovine Anaplasma and 91-96% identical to Neoehrlichia and Ehrlichia spp. The various ticks identified in this study suggest the possible emergence of tick-borne diseases in animals and humans in these regions. R. sanguineus and D. marginatus seem to be predominant vectors responsible for anaplasmosis in these regions. Partial sequence analysis of the 16S rRNA gene showed that A. ovis is genetically polymorphic in these regions. Furthermore, an
Directory of Open Access Journals (Sweden)
I. Pisano
2009-09-01
Full Text Available A case control study was performed in the Parco Nazionale dei Monti Sibillini, Italy, to find out whether roe deer (Capreolus capreolus and red deer (Cervus elaphus were more likely to harbour antibiotic resistant Escherichia coli in their faeces, compared to Enterococcus spp. Ten areas were selected and samples were collected during a fourmonths (May to August, 2008 sampling period. Samples of water (n=12 and feces (n=59, collected at 10 different sites, were cultured for E. coli and Enterococcus spp. The resulting colonies were screened for tetracycline, ampicillin and kanamycin resistance using the Lederberg Replica Plating method (breakpoint 4 μg/ml. All resistant isolates were then selected, and subjected to the CLSI antimicrobial plate susceptibility test (7. Among the water specimens contaminated by E. coli, 80% were found to be resistant to ampicillin, 80% to tetracycline and 40% to kanamycin. Among the water specimens contaminated by Enterococcus spp., 14.29% were found to be resistant to ampicillin, 14.29% to tetracycline and 71.3% to kanamycin. Among the 39 strains of E. coli isolated from red deer feces, 12 were resistant to ampicillin (30.77%, 5 to tetracycline (12,82% and 3 to kanamycin (7.69%. Among the 19 strains of Enterococcus spp. isolated from red deer feces, 0 were resistant to ampicillin (0%, 1 to tetracycline (5.26% and 19 to kanamycin (100. These are significant findings, indicating that antibiotic resistance can be found in naïve animal populations and that red deer and fallow deer could act as sentinels for antimicrobial resistance. Key words Antibiotic-resistance, red deer, fallow deer, Escherichia
Esterase and protease activities of Bacillus spp. from afitin, iru and ...
African Journals Online (AJOL)
The electrophoretic profiles of fermented African locust bean protein (ALBP), using strains presenting the highest protease activities in casein agar, were analyzed by SDS-PAGE to select strains with good ability to be used as starter cultures. All the Bacillus spp. tested showed esterase activity against tributyrin with high ...
Parola, Philippe; Cornet, Jean-Paul; Sanogo, Yibayiri Osée; Miller, R. Scott; Thien, Huynh Van; Gonzalez, Jean-Paul; Raoult, Didier; Telford III, Sam R.; Wongsrichanalai, Chansuda
2003-01-01
A total of 650 ticks, including 13 species from five genera, were collected from animals, from people, or by flagging of the vegetation at sites on the Thai-Myanmar border and in Vietnam. They were tested by PCR to detect DNA of bacteria of the order Rickettsiales. Three Anaplasma spp. were detected in ticks collected in Thailand, including (i) Anaplasma sp. strain AnDa465, which was considered a genotype of Anaplasma platys (formerly Ehrlichia platys) and which was obtained from Dermacentor ...
Increase of the productivity of pleurotus ostreatus and their use in the petroleum biodegradation
International Nuclear Information System (INIS)
Cardona U, Fernando; Restrepo R, Dora Patricia; Nino, Pilar; Gonzalez, Raul
2002-01-01
This work is divided in two phases: in the first one a substrate what help to increase productivity of the white-rot fungi pleurotus ostreatus was looked, this was reached combining different kinds of substrates; in the second phase, the contribution in biodegradation of pleurotus ostreatus into the substrate obtained in the first phase and contaminated with heavy part of Cusiana oil was looked. The quantification in the augmentation of productivity was obtained taking the weight of fungi collected of each substrate and comparing it between the, until finding the best one. To quantify the biodegradation the method of determination of greases, oils, and hydrocarbons of petroleum in solids by Soxhlet method was used. The highest substrate in productivity was the mix of 70% of cotton quinine and 30% of hay with 3- 5% of seed, thiamine and vegetable oil. For the biodegradation study concentration less than 25% were used, at higher concentrations a partial inhibition was detected. When the substrate was contaminated with 10% of Cusiana oil the biodegradation was more efficient
Directory of Open Access Journals (Sweden)
Lívia Viganor da Silva
2011-02-01
Full Text Available Methicillin-resistant Staphylococcus aureus (MRSA and coagulase-negative Staphylococcus spp (CNS are the most common pathogens that cause serious long term infections in patients. Despite the existence of new antimicrobial agents, such as linezolid, vancomycin (VAN remains the standard therapy for the treatment of infections caused by these multidrug-resistant strains. However, the use of VAN has been associated with a high frequency of therapeutic failures in some clinical scenarios, mainly with decreasing concentration of VAN. This work aims to evaluate the synergic potential of VAN plus sulfamethoxazole/trimethoprim (SXT, VAN plus rifampin (RIF and VAN plus imipenem (IPM in sub-minimum inhibitory concentrations against 22 clinical strains of MRSA and CNS. The checkerboard method showed synergism of VAN/RIF and VAN/SXT against two and three of the 22 strains, respectively. The combination of VAN with IPM showed synergistic effects against 21 out of 22 strains by the E-test method. Four strains were analyzed by the time-kill curve method and synergistic activity was observed with VAN/SXT, VAN/RIF and especially VAN/IPM in sub-inhibitory concentrations. It would be interesting to determine if synergy occurs in vivo. Evidence of in vivo synergy could lead to a reduction of the standard VAN dosage or treatment time.
Potential applications of the white rot fungus Pleurotus in bioregenerative life support systems
Manukovsky, N. S.; Kovalev, V. S.; Yu, Ch.; Gurevich, Yu. L.; Liu, H.
Earlier we demonstrated the possibility of using soil-like substrate SLS for plant cultivation in bioregenerative life support systems BLSS We suggest dividing the process of SLS bioregeneration at BLSS conditions into two stages At the first stage plant residues should be used for growing of white rot fungus Pleurotus ostreatus Pleurotus florida etc The fruit bodies could be used as food Spent mushroom compost is carried in SLS and treated by microorganisms and worms at the second stage The possibility of extension of human food ration is only one of the reasons for realization of the suggested two-stage SLS regeneration scheme people s daily consumption of mushrooms is limited to 200 -250 g of wet weight or 20 -25 g of dry weight Multiple tests showed what is more important is that inclusion of mushrooms into the system cycle scheme contributes through various mechanisms to the more stable functioning of vegetative cenosis in general Taking into account the given experimental data we determined the scheme of mushroom module material balance The technological peculiarities of mushroom cultivation at BLSS conditions are being discussed
Directory of Open Access Journals (Sweden)
Flávia Corrêa Bastos
2011-10-01
Full Text Available INTRODUCTION: Shigella spp. are Gram-negative, nonsporulating, rod-shaped bacteria that belong to the family Enterobacteriaceae and are responsible for shigellosis or bacillary dysentery, an important cause of worldwide morbidity and mortality. METHODS: We studied the antibiotic resistance profiles of 122 Shigella spp. strains (81 S. flexneri, 41 S. sonnei, 1 S. boydii isolated from patients (female and male from 0 to 80 years of age presenting diarrhea in different districts of the State of Pará, in the North of Brazil. The antibiotic resistance of the strains, isolated from human fecal samples, was determined by the diffusion disk method and by using the VITEK-2 system. RESULTS: The highest resistance rate found was the resistance rate to tetracycline (93.8%, followed by the resistance rate to chloramphenicol (63.9% and to trimethoprim/sulfamethoxazole (63.1%. Resistance to at least three drugs was more common among S. flexneri than S. sonnei (39.5% vs. 10%. Six (4.9% strains were susceptible to all the antibiotics tested. All strains were susceptible to cefotaxime, ceftazidime, ciprofloxacin, nalidixic acid and nitrofurantoin. CONCLUSIONS: High rates of multidrug resistance in Shigella spp. are a serious public health concern in Brazil. It is extremely important to continuously monitor the antimicrobial resistances of Shigella spp. for effective therapy and control measures against shigellosis.INTRODUÇÃO: Shigella spp. são bactérias Gram-negativas, não esporuladas, em forma de bastonete, pertencentes a família Enterobacteriaceae responsáveis pela shigelose ou disenteria bacilar, uma importante causa de mortalidade e morbidade mundial. MÉTODOS: Foi estudado o perfil de resistência a antimicrobianos de 122 amostras de Shigella spp. (81 S. flexneri, 41 sonnei, 1 S. boydii isoladas de pacientes (sexo feminino e masculino com faixa etária de 0 a 80 anos com distúrbios gastrointestinais em diferentes municípios no Estado do Par
Fungicidal effect of bacteriocins harvested from Bacillus spp.
Directory of Open Access Journals (Sweden)
Adetunji, V. O.
2013-01-01
Full Text Available Aims: This study investigated the ability of bacteriocins isolated from Bacillus spp. (Bacillus species to inhibit fourdifferent yeast isolates obtained from common food products (nono, yoghurt, ogi and cheese commonly consumed byNigerians with minimal heat treatment.Methodology and results: Forty-five Bacillus spp. was isolated and identified from common food products usingcultural, morphological, physiological and biochemical characteristics. These isolates were tested for antimicrobialactivity against Salmonella enteritidis (3, Micrococcus luteus (1 and Staphylococcus aureus (2. Eight bacteriocinproducing strains were identified from an over- night broth culture centrifugated at 3500 revolutions for five minutes.Fungicidal effects of these bacteriocins were tested against four yeast strains using the Agar Well Diffusion method. Thebacteriocins produced wide zones of inhibition ranging from 5.9±0.000 to 24.00±0.000 mm against the 4 yeast strainstested. There was a significant difference (at p<0.05 between the yeast organisms and the bacteriocins from theBacillus spp.Conclusion, significance and impact of study: The study reveals the antifungal property of bacteriocins from Bacillusspp. and serves therefore as a base for further studies in its use in the control of diseases and extension of shelf-life ofproducts prone to fungi contamination.
Directory of Open Access Journals (Sweden)
F. Bettin
2014-06-01
Full Text Available Laccase enzymes are now commercially available, and a laccase/mediator combination is currently marketed for indigo dye bleaching in textile manufacturing; replacing traditional chemical-based processes with enzymatic technology reduces the need for effluent treatment. However, an inexpensive source of these enzymes will be needed to enable wider application of this technology. In the present work, the main objective was to increase laccase production by the mushroom Pleurotus sajor-caju strain PS-2001 grown on sucrose derived from sugar cane, one of most economical carbon sources known, by the addition of compounds that are known to affect laccase production. High laccase activities (45-62 U mL-1 were obtained with additions of syringaldazine, benzoic acid, gallic acid, and vanillin. When CuSO4 was used in conjunction with these aromatic compounds, the levels of laccase activity were further improved, reaching 58-80 U mL-1. These laccase activities indicate the potential of this strain as an enzyme producer, which has also been detected in media containing glucose, but with activity lower than that observed with sucrose.
Directory of Open Access Journals (Sweden)
Dušica Delić
2010-04-01
Full Text Available In pot experiment, one isolate Knj from a Serbian soil, four strains of Bradyrhizobium japonicum and three strains of Bradyrhizobium spp. were examined for the effect on adzuki bean nodulation and effectiveness in symbiotic N2 fixation. All the tested strains produced root nodules in adzuki bean. Strains of B. japonicum showed high potential of N2 fixation, particularly 525 and 542. B. japonicum strains resulted 65-71% shoot dry weight and 99-138% total N content of uninoculated control with full N content (100%. No significant difference was found between the plants inoculated with Bradyrhizobium spp. strains and uninoculated control plants without N (40-42 and 42% shoot dry weight, respectively, which indicated symbiotic N2 fixation inactivity of the Bradyrhizobium spp. strains. Knj strain had the middle position (56% shoot dry weight. These data showed that B. japonicum 525 and 542 strains could be used in further investigations in order to apply them as inoculants in microbiological N fertilizers.
Di Vito, Maura; Mattarelli, Paola; Modesto, Monica; Girolamo, Antonietta; Ballardini, Milva; Tamburro, Annunziata; Meledandri, Marcello; Mondello, Francesca
2015-10-01
The aim of this work is to evaluate the in vitro microbicidal activity of vaginal suppositories (VS) containing tea tree oil (TTO-VS) towards Candida spp. and vaginal probiotics. A total of 20 Candida spp. strains, taken from patients with vaginitis and from an established type collection, including reference strains, were analysed by using the CLSI microdilution method. To study the action of VS towards the beneficial vaginal microbiota, the sensitivity of Bifidobacterium animalis subsp. lactis (DSM 10140) and Lactobacillus spp. (Lactobacillus casei R-215 and Lactobacillus acidophilus R-52) was tested. Both TTO-VS and TTO showed fungicidal activity against all strains of Candida spp. whereas placebo-VS or the Aloe gel used as controls were ineffective. The study of fractional fungicidal concentrations (FFC) showed synergistic interaction with the association between Amphotericin B and TTO (0.25 to 0.08 µg/ml, respectively) against Candida albicans. Instead, the probiotics were only affected by TTO concentration ≥ 4% v/v, while, at concentrations vaginal microbiota. In vivo studies are needed to confirm the efficacy to prevent acute or recurrent vaginal candidiasis. Copyright © 2015 John Wiley & Sons, Ltd.
Iodine from bacterial iodide oxidization by Roseovarius spp. inhibits the growth of other bacteria.
Zhao, Dan; Lim, Choon-Ping; Miyanaga, Kazuhiko; Tanji, Yasunori
2013-03-01
Microbial activities in brine, seawater, or estuarine mud are involved in iodine cycle. To investigate the effects of the microbiologically induced iodine on other bacteria in the environment, a total of 13 bacteria that potentially participated in the iodide-oxidizing process were isolated from water or biofilm at a location containing 131 μg ml(-1) iodide. Three distinct strains were further identified as Roseovarius spp. based on 16 S rRNA gene sequences after being distinguished by restriction fragment length polymorphism analysis. Morphological characteristics of these three Roseovarius spp. varied considerably across and within strains. Iodine production increased with Roseovarius spp. growth when cultured in Marine Broth with 200 μg ml(-1) iodide (I(-)). When 10(6) CFU/ml Escherichia coli, Pseudomonas aeruginosa, and Bacillus pumilus were exposed to various concentrations of molecular iodine (I(2)), the minimum inhibitory concentrations (MICs) were 0.5, 1.0, and 1.0 μg ml(-1), respectively. However, fivefold increases in the MICs for Roseovarius spp. were obtained. In co-cultured Roseovarius sp. IOB-7 and E. coli in Marine Broth containing iodide (I(-)), the molecular iodine concentration was estimated to be 0.76 μg ml(-1) after 24 h and less than 50 % of E. coli was viable compared to that co-cultured without iodide. The growth inhibition of E. coli was also observed in co-cultures with the two other Roseovarius spp. strains when the molecular iodine concentration was assumed to be 0.52 μg ml(-1).
Lépesová, Kristína; Kraková, Lucia; Pangallo, Domenico; Medveďová, Alžbeta; Olejníková, Petra; Mackuľak, Tomáš; Tichý, Jozef; Grabic, Roman; Birošová, Lucia
2018-03-28
Urban wastewater contains different micropollutants and high number of different microorganisms. Some bacteria in wastewater can attach to the surfaces and form biofilm, which gives bacteria advantage in fight against environmental stress. This work is focused on bacterial community analysis in biofilms isolated from influent and effluent sewerage of wastewater treatment plant in Bratislava. Biofilm microbiota detection was performed by culture-independent and culture-dependent approaches. Composition of bacterial strains was detected by denaturing gradient gel electrophoresis fingerprinting coupled with the construction of 16S rRNA clone libraries. The biofilm collected at the inlet point was characterized primarily by the presence of Pseudomonas sp., Acinetobacter sp. and Janthinobacterium sp. clones, while in the biofilm isolated at outflow of wastewater treatment plant members of Pseudomonas genus were largely detected. Beside this analysis prevalence of antibiotics and resistant coliforms, Enterococcus spp. and Staphylococcus spp. in sewerage was studied. In influent wastewater were dominant antibiotics like azithromycin, clarithromycin and ciprofloxacin. Removal efficiency of these antibiotics notably azithromycin and clarithromycin were 30% in most cases. The highest number of resistant bacteria with predominance of coliforms was detected in sample of effluent biofilm. Multidrug resistant strains in effluent biofilm showed very good ability to form biofilm. Copyright © 2018. Published by Elsevier Ltd.
Energy Technology Data Exchange (ETDEWEB)
Haarjorg, A.
1976-01-01
Seedlings of Acer platanoides approximately 2 m tall were produced in southern Norway in one year by seed stratification indoors. Similar results were obtained with Fraxinus excelsior, Quercus robus and Sorbus spp. Trails were also carried out with Betula verrucose (B. pendula), Populus trichocarpa, Picea spp., Abies spp., and other conifers. In all trials growth was increased when plants were raised in a plastic house, and depended on the time that Spring growth was started or whether supplementary light was given and also depended on the seed strain. For northern and high altitude strains it was important to maintain critical day length.
Abiotic and Biotic Degradation of Oxo-Biodegradable Plastic Bags by Pleurotus ostreatus
da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Bazzolli, Denise Mara Soares; Tótola, Marcos Rogério; Demuner, Antônio Jacinto; Kasuya, Maria Catarina Megumi
2014-01-01
In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as su...
Goldstein, Ellie J C; Citron, Diane M; Merriam, C Vreni; Warren, Yumi A; Tyrrell, Kerin L; Fernandez, Helen T
2004-06-01
Telavancin is a new semisynthetic glycopeptide anti-infective with multiple mechanisms of action, including inhibition of bacterial membrane phospholipid synthesis and inhibition of bacterial cell wall synthesis. We determined the in vitro activities of telavancin, vancomycin, daptomycin, linezolid, quinupristin-dalfopristin, imipenem, piperacillin-tazobactam, and ampicillin against 268 clinical isolates of anaerobic gram-positive organisms and 31 Corynebacterium strains using agar dilution methods according to National Committee for Clinical Laboratory Standards procedures. Plates with daptomycin were supplemented with Ca(2+) to 50 mg/liter. The MICs at which 90% of isolates tested were inhibited (MIC(90)s) for telavancin and vancomycin were as follows: Actinomyces spp. (n = 45), 0.25 and 1 microg/ml, respectively; Clostridium difficile (n = 14), 0.25 and 1 microg/ml, respectively; Clostridium ramosum (n = 16), 1 and 4 microg/ml, respectively; Clostridium innocuum (n = 15), 4 and 16 microg/ml, respectively; Clostridium clostridioforme (n = 15), 8 and 1 microg/ml, respectively; Eubacterium group (n = 33), 0.25 and 2 microg/ml, respectively; Lactobacillus spp. (n = 26), 0.5 and 4 microg/ml, respectively; Propionibacterium spp. (n = 34), 0.125 and 0.5 microg/ml, respectively; Peptostreptococcus spp. (n = 52), 0.125 and 0.5 microg/ml, respectively; and Corynebacterium spp. (n = 31), 0.03 and 0.5 microg/ml, respectively. The activity of TD-6424 was similar to that of quinupristin-dalfopristin for most strains except C. clostridioforme and Lactobacillus casei, where quinupristin-dalfopristin was three- to fivefold more active. Daptomycin had decreased activity (MIC > 4 microg/ml) against 14 strains of Actinomyces spp. and all C. ramosum, Eubacterium lentum, and Lactobacillus plantarum strains. Linezolid showed decreased activity (MIC > 4 microg/ml) against C. ramosum, two strains of C. difficile, and 15 strains of Lactobacillus spp. Imipenem and piperacillin
Directory of Open Access Journals (Sweden)
Dony Chacko Mathew
Full Text Available Though heavy metal such as mercury is toxic to plants and microorganisms, the synergistic activity between them may offer benefit for surviving. In this study, a mercury-reducing bacterium, Photobacterium spp. strain MELD1, with an MIC of 33 mg x kg(-1 mercury was isolated from a severely mercury and dioxin contaminated rhizosphere soil of reed (Phragmites australis. While the whole genome sequencing of MELD1 confirmed the presence of a mer operon, the mercury reductase MerA gene showed 99% sequence identity to Vibrio shilloni AK1 and implicates its route resulted from the event of horizontal gene transfer. The efficiency of MELD1 to vaporize mercury (25 mg x kg(-1, 24 h and its tolerance to toxic metals and xenobiotics such as lead, cadmium, pentachlorophenol, pentachloroethylene, 3-chlorobenzoic acid, 2,3,7,8-tetrachlorodibenzo-p-dioxin and 1,2,3,7,8,9-hexachlorodibenzo-p-dioxin is promising. Combination of a long yard bean (Vigna unguiculata ssp. Sesquipedalis and strain MELD1 proved beneficial in the phytoprotection of mercury in vivo. The effect of mercury (Hg on growth, distribution and tolerance was examined in root, shoot, leaves and pod of yard long bean with and without the inoculation of strain MELD1. The model plant inoculated with MELD1 had significant increases in biomass, root length, seed number, and increased mercury uptake limited to roots. Biolog plate assay were used to assess the sole-carbon source utilization pattern of the isolate and Indole-3-acetic acid (IAA productivity was analyzed to examine if the strain could contribute to plant growth. The results of this study suggest that, as a rhizosphere-associated symbiont, the synergistic activity between the plant and MELD1 can improve the efficiency for phytoprotection, phytostabilization and phytoremediation of mercury.
Mathew, Dony Chacko; Ho, Ying-Ning; Gicana, Ronnie Gicaraya; Mathew, Gincy Marina; Chien, Mei-Chieh; Huang, Chieh-Chen
2015-01-01
Though heavy metal such as mercury is toxic to plants and microorganisms, the synergistic activity between them may offer benefit for surviving. In this study, a mercury-reducing bacterium, Photobacterium spp. strain MELD1, with an MIC of 33 mg x kg(-1) mercury was isolated from a severely mercury and dioxin contaminated rhizosphere soil of reed (Phragmites australis). While the whole genome sequencing of MELD1 confirmed the presence of a mer operon, the mercury reductase MerA gene showed 99% sequence identity to Vibrio shilloni AK1 and implicates its route resulted from the event of horizontal gene transfer. The efficiency of MELD1 to vaporize mercury (25 mg x kg(-1), 24 h) and its tolerance to toxic metals and xenobiotics such as lead, cadmium, pentachlorophenol, pentachloroethylene, 3-chlorobenzoic acid, 2,3,7,8-tetrachlorodibenzo-p-dioxin and 1,2,3,7,8,9-hexachlorodibenzo-p-dioxin is promising. Combination of a long yard bean (Vigna unguiculata ssp. Sesquipedalis) and strain MELD1 proved beneficial in the phytoprotection of mercury in vivo. The effect of mercury (Hg) on growth, distribution and tolerance was examined in root, shoot, leaves and pod of yard long bean with and without the inoculation of strain MELD1. The model plant inoculated with MELD1 had significant increases in biomass, root length, seed number, and increased mercury uptake limited to roots. Biolog plate assay were used to assess the sole-carbon source utilization pattern of the isolate and Indole-3-acetic acid (IAA) productivity was analyzed to examine if the strain could contribute to plant growth. The results of this study suggest that, as a rhizosphere-associated symbiont, the synergistic activity between the plant and MELD1 can improve the efficiency for phytoprotection, phytostabilization and phytoremediation of mercury.
Mathew, Dony Chacko; Ho, Ying-Ning; Gicana, Ronnie Gicaraya; Mathew, Gincy Marina; Chien, Mei-Chieh; Huang, Chieh-Chen
2015-01-01
Though heavy metal such as mercury is toxic to plants and microorganisms, the synergistic activity between them may offer benefit for surviving. In this study, a mercury-reducing bacterium, Photobacterium spp. strain MELD1, with an MIC of 33 mg . kg-1 mercury was isolated from a severely mercury and dioxin contaminated rhizosphere soil of reed (Phragmites australis). While the whole genome sequencing of MELD1 confirmed the presence of a mer operon, the mercury reductase MerA gene showed 99% sequence identity to Vibrio shilloni AK1 and implicates its route resulted from the event of horizontal gene transfer. The efficiency of MELD1 to vaporize mercury (25 mg . kg-1, 24 h) and its tolerance to toxic metals and xenobiotics such as lead, cadmium, pentachlorophenol, pentachloroethylene, 3-chlorobenzoic acid, 2,3,7,8-tetrachlorodibenzo-p-dioxin and 1,2,3,7,8,9-hexachlorodibenzo-p-dioxin is promising. Combination of a long yard bean (Vigna unguiculata ssp. Sesquipedalis) and strain MELD1 proved beneficial in the phytoprotection of mercury in vivo. The effect of mercury (Hg) on growth, distribution and tolerance was examined in root, shoot, leaves and pod of yard long bean with and without the inoculation of strain MELD1. The model plant inoculated with MELD1 had significant increases in biomass, root length, seed number, and increased mercury uptake limited to roots. Biolog plate assay were used to assess the sole-carbon source utilization pattern of the isolate and Indole-3-acetic acid (IAA) productivity was analyzed to examine if the strain could contribute to plant growth. The results of this study suggest that, as a rhizosphere-associated symbiont, the synergistic activity between the plant and MELD1 can improve the efficiency for phytoprotection, phytostabilization and phytoremediation of mercury. PMID:25816328
Directory of Open Access Journals (Sweden)
Balayogan Sivasankari
2014-01-01
Full Text Available Vermicompost was prepared from leaf materials of Gliricidia sepium + Cassia auriculata + Leucaena leucocephala with cow dung (1 : 1 : 2 using Eudrilus eugeniae (Kinberg and Eisenia fetida for 60 days. Nineteen bacterial strains which have the capability to fix nitrogen, solubilize inorganic phosphate, and produce phytohormones were isolated from vermicompost, vermisources, and earthworm (fore, mid, and hind guts and tested for plant growth studies. Among the bacterial strains only five strains had both activities; among the five Bacillus spp. showed more nitrogen fixing activity and Pseudomonas spp. showed more phosphate solubilizing activity. Hence these bacterial strains were selected for further molecular analysis and identified Bacillus cereus GGBSTD1 and Pseudomonas spp. GGBSTD3. Plant growth studies use these two organisms separately and as consortium (Bacillus cereus + Pseudomonas spp. in (1 : 1 ratio at different concentrations using Vigna unguiculata (L. Walp. at different day intervals. The germination percent, shoot length, root length, leaf area, chlorophyll a content of the leaves, chlorophyll b content of the leaves, total chlorophyll content of the leaves, fresh weight of the whole plant, and dry weight of the whole plant were significantly enhanced by the consortium (Bacillus cereus + Pseudomonas spp. of two organisms at 5 mL concentrations on the 15th day compared to others.
Pathogenicity of isolates of Colletotrichum spp.: The causal agents of anthracnose
Živković, Svetlana; Dolovac, Nenad; Popović, Tatjana; Stojanović, Saša
2012-01-01
The pathogenic characteristics of 20 isolates of Colletotrichum spp. originating from pear, apple, sour cherry and tomato fruits, as well as reference strains of C. acutatum (CBS 294.67) and C. gloeosporioides (CBS 516.97) are presented in this paper. In the studies of host range of isolates of Colletotrichum spp. were included 17 plant species. Nine days after artificial inoculation all tested isolates were caused anthracnose lesion on fruits of apple, pear, peach, apricot, sour cherry, swee...
Directory of Open Access Journals (Sweden)
Álvaro Menin
2008-09-01
Full Text Available As enterites infecciosas bacterianas provocam severas perdas para a indústria suína em todo o mundo. Os objetivos deste trabalho foram determinar os agentes bacterianos, associados com a ocorrência de diarréia em suínos, em diferentes faixas etárias, no Estado de Santa Catarina, Brasil, e verificar o perfil de resistência das cepas de Escherichia coli e Salmonella spp, frente aos principais antimicrobianos utilizados em granjas de suínos. Os principais gêneros/espécies bacterianos diagnosticados foram Escherichia coli, Clostridium spp, Salmonella spp Brachyspira hyodysenteriae, Brachyspira pilosicoli e Lawsonia intracellularis. Os fatores de virulência de E. coli mais prevalentes na fase de maternidade foram F5 / (K99 20%, F6 / (987P 16,3%, F42 6,8% e F41 5,7%, já nas fases de creche e terminação, predominaram cepas com fimbrias F4 (K88 11,2% e 5,4%, respectivamente. Para E. coli os maiores índices de resistência foram encontrados para oxitetraciclina (94% e tetraciclina (89,5% e os menores índices de resistência para neomicina (55%, ceftiofur (57,4%. Quanto às amostras de Salmonella spp, estas apresentaram maior resistência à oxitetraciclina (77%, e à tetraciclina (42,1% e menor à gentamicina (3,5% e amoxicilina (4,8%.Infectious bacterial enteritis causes severe losses to the swine industry worldwide. The objective of this study was to determine the epidemiology of bacterial agents that are associated with the occurrence of diarrhea in pigs at different age groups, and to verify the profile of resistance of strains of Escherichia coli and Salmonella spp to the main antimicrobial agents. The main bacterial species diagnosed were Escherichia coli, Clostridium spp, Salmonella spp, Brachyspira hyodysenteriae, Brachyspira pilosicoli and Lawsonia intracellularis. The E. coli virulence factors of higher prevalence in preweaning piglets were F5 / (K99 20%, F6 / (987P 16.3%, F42 6.8% and F41 5.7%, whereas at the nursery and with
Nogueira, Keite da Silva; Paganini, Maria Cristina; Conte, Andréia; Cogo, Laura Lúcia; Taborda de Messias Reason, Iara; da Silva, Márcio José; Dalla-Costa, Libera Maria
2014-02-01
Extended-spectrum β-lactamases (ESBLs) are increasingly prevalent in Enterobacter spp., posing a challenge to the treatment of infections caused by this microorganism. The purpose of this retrospective study was to evaluate the prevalence, risk factors, and clinical outcomes of inpatients with bacteremia caused by ESBL and non ESBL-producing Enterobacter spp. in a tertiary hospital over the period 2004-2008. The presence of blaCTX-M, blaTEM, blaSHV, and blaPER genes was detected by polymerase chain reaction (PCR) and nucleotide sequence analysis. Genetic similarity between strains was defined by pulsed-field gel electrophoresis (PFGE). Enterobacter spp. was identified in 205 of 4907 of the patients who had positive blood cultures during hospitalization. Of those cases, 41 (20%) were ESBL-producing Enterobacter spp. Nosocomial pneumonia was the main source of bacteremia caused by ESBL-producing Enterobacter spp. The presence of this microorganism was associated with longer hospital stays. The ESBL genes detected were: CTX-M-2 (23), CTX-M-59 (10), CTX-M-15 (1), SHV-12 (5), and PER-2 (2). While Enterobacter aerogenes strains showed mainly a clonal profile, Enterobacter cloacae strains were polyclonal. Although no difference in clinical outcomes was observed between patients with infections by ESBL-producing and non-ESBL-producing strains, the detection of ESBL in Enterobacter spp. resulted in the change of antimicrobials in 75% of cases, having important implications in the decision-making regarding adequate antimicrobial therapy. Copyright © 2012 Elsevier España, S.L. All rights reserved.
DEFF Research Database (Denmark)
Adimpong, David Bichala
African indigenous fermented food products are characterized by complex and diverse groups of microorganisms and therefore offer a rich source for selection of microbial strains for various applications in the biotechnology and food bio-processing sectors. There is however, a global public health...... of these strains to assess their potential industrial applications. This Thesis provided strong evidence on a high level of genomic heterogeneity among members of the Lb. delbrueckii spp. for which a new subspecies was proposed (Appendix II). The data on antimicrobial susceptibility profiles of the 3 Bacillus...... species strains (Appendix III) will enable regulatory and public health authorities to accurately proposevii antimicrobial breakpoint values for these species as this Thesis has provided evidence on the inadequacy of the antimicrobial breakpoint values recommended by EFSA for the Bacillus genus...
Slippers, B.; Fourie, G.; Crous, P.W.; Coutinho, T.A.; Wingfield, B.D.; Carnegie, A.J.; Wingfield, M.J.
2004-01-01
Botryosphaeria spp. are important canker and die-back pathogens that affect Eucalyptus spp. They also occur endophytically in Eucalyptus leaves and stems. For the purpose of this study, Botryosphaeria strains were isolated from diseased and symptomless Eucalyptus material from Australia and South
Directory of Open Access Journals (Sweden)
Evânia Geralda Silva
2007-03-01
Full Text Available Os cogumelos do gênero Pleurotus normalmente crescem bem em substratos mais pobres em nitrogênio, ao contrário dos cogumelos Agaricus que requerem substratos com relação C/N mais estreita. Por outro lado, os valores nutricionais do cogumelo dependem da composição química do substrato utilizado e das condições de cultivo. Este trabalho teve como objetivo avaliar o teor de proteína dos corpos de frutificação do cogumelo Pleurotus sajor-caju cultivado em capim coast-cross, bagaço de cana-de-açúcar, farelo de trigo e diferentes teores de nitrogênio. Apenas os substratos com teores de nitrogênio de 0,65 a 1,30% foram colonizados, enquanto que nos substratos com 1,75 e 2,20% de nitrogênio não houve colonização. Não houve diferença significativa na produção de cogumelos, porém o teor de proteína dos cogumelos produzidos no substrato com 1,30% de N foi significativamente superior em relação aos substratos com menor teor de N.Mushrooms of Pleurotus genus usually grow well in substrates containing low amounts of nitrogen, whereas Agaricus mushrooms require substrates with a high content of nitrogen. On the other hand, the nutritional values of mushrooms depend on the chemical composition of the substrate in use and the conditions of cultivation. The aim of this work is to measure the protein content of the fructification bodies of Pleurotus sajor-caju cultivated in coast-cross grass, sugar cane bagasse, whole wheat meal and various nitrogen concentrations. Only the substrates with nitrogen content ranging from 0.65 to 1.30% were colonized, while in the substrates with 1.75 and 2.20% of nitrogen, colonization did not occur. There was no significant difference in the production of mushrooms, however the protein content of the mushrooms produced on the substrate with 1.30% of N was considerably higher in relation to those mushrooms grown in substrates with a reduced nitrogen content.
Isolation of a Seawater Tolerant Leptospira spp. from a Southern Right Whale (Eubalaena australis).
Grune Loffler, Sylvia; Rago, Virginia; Martínez, Mara; Uhart, Marcela; Florin-Christensen, Monica; Romero, Graciela; Brihuega, Bibiana
2015-01-01
Leptospirosis is the most widespread zoonotic disease in the world. It is caused by pathogenic spirochetes of the genus Leptospira spp. and is maintained in nature through chronic renal infection of carrier animals. Rodents and other small mammals are the main reservoirs. Information on leptospirosis in marine mammals is scarce; however, cases of leptospirosis have been documented in pinniped populations from the Pacific coast of North America from southern California to British Columbia. We report the isolation of a Leptospira spp. strain, here named Manara, from a kidney sample obtained from a Southern Right Whale (Eubalaena australis) calf, which stranded dead in Playa Manara, Península Valdés, Argentina. This strain showed motility and morphology typical of the genus Leptospira spp. under dark-field microscopy; and grew in Ellinghausen-McCullough-Johnson-Harris (EMJH) medium and Fletcher medium after 90 days of incubation at 28°C. Considering the source of this bacterium, we tested its ability to grow in Fletcher medium diluted with seawater at different percentages (1%, 3%, 5%, 7% and 10% v/v). Bacterial growth was detected 48 h after inoculation of Fletcher medium supplemented with 5% sea water, demonstrating the halophilic nature of the strain Manara. Phylogenetic analysis of 16S rRNA gene sequences placed this novel strain within the radiation of the pathogenic species of the genus Leptospira spp., with sequence similarities within the range 97-100%, and closely related to L. interrogans. Two different PCR protocols targeting genus-specific pathogenic genes (G1-G2, B64I-B64II and LigB) gave positive results, which indicates that the strain Manara is likely pathogenic. Further studies are needed to confirm this possibility as well as determine its serogroup. These results could modify our understanding of the epidemiology of this zoonosis. Until now, the resistance and ability to grow in seawater for long periods of time had been proven for the strain
Isolation of a Seawater Tolerant Leptospira spp. from a Southern Right Whale (Eubalaena australis.
Directory of Open Access Journals (Sweden)
Sylvia Grune Loffler
Full Text Available Leptospirosis is the most widespread zoonotic disease in the world. It is caused by pathogenic spirochetes of the genus Leptospira spp. and is maintained in nature through chronic renal infection of carrier animals. Rodents and other small mammals are the main reservoirs. Information on leptospirosis in marine mammals is scarce; however, cases of leptospirosis have been documented in pinniped populations from the Pacific coast of North America from southern California to British Columbia. We report the isolation of a Leptospira spp. strain, here named Manara, from a kidney sample obtained from a Southern Right Whale (Eubalaena australis calf, which stranded dead in Playa Manara, Península Valdés, Argentina. This strain showed motility and morphology typical of the genus Leptospira spp. under dark-field microscopy; and grew in Ellinghausen-McCullough-Johnson-Harris (EMJH medium and Fletcher medium after 90 days of incubation at 28°C. Considering the source of this bacterium, we tested its ability to grow in Fletcher medium diluted with seawater at different percentages (1%, 3%, 5%, 7% and 10% v/v. Bacterial growth was detected 48 h after inoculation of Fletcher medium supplemented with 5% sea water, demonstrating the halophilic nature of the strain Manara. Phylogenetic analysis of 16S rRNA gene sequences placed this novel strain within the radiation of the pathogenic species of the genus Leptospira spp., with sequence similarities within the range 97-100%, and closely related to L. interrogans. Two different PCR protocols targeting genus-specific pathogenic genes (G1-G2, B64I-B64II and LigB gave positive results, which indicates that the strain Manara is likely pathogenic. Further studies are needed to confirm this possibility as well as determine its serogroup. These results could modify our understanding of the epidemiology of this zoonosis. Until now, the resistance and ability to grow in seawater for long periods of time had been proven
Mycelial growth observation of Pleurotus eryngii (Higher Basidiomycota In Vitro
Directory of Open Access Journals (Sweden)
Mustafa Nadhim Owaid
2016-09-01
Full Text Available Five agro-substrates including date palm fibers (fibrillum, wheat straw, white sawdust and their combinations were investigated to grow Pleurotus eryngii. The longer mycelium complete time within bags was 20 days on sawdust (S4, in contrast, the shorter time for mycelium overgrew was completed after 15 days on date palm fiber (S5. In significant (p<0.05, S5 showed the higher growth intensity level (vigorous growth than other substrates. Thus use of date palm wastes (S5 medium may be useful for successfully cultivation king oyster mushroom in farm.International Journal of Environment Vol.5(3 2016, pp.1-10
Biomass production of pleurotus sajor-caju by submerged culture fermentation
International Nuclear Information System (INIS)
Kausar, T.; Nasreen, Z.; Nadeem, M.; Baig, S.
2006-01-01
The effect of different carbon sources, namely, sawdust and powder of agro wastes (as such, or water soluble extracts), and inorganic/natural nitrogen sources on the biomass production of Pleurotus sajor-caju by submerged culture fermentation was studied. Supplementation of the fermentation medium with 2% molasses, 2% wheat spike powder, extract of 2% wheat spike powder, and com gluten meal resulted in 12.85, 10.85, 12.35 and 13.92 g/sub l/ biomass production of P. sajor-caju, respectively. The fungal hyphae biomass contained 8.28% moisture, 21.18% crude protein, 1.55% fat, 3.59% ash, 2.32% crude fibre, and 63.48% nitrogen-free extract. (author)
African Journals Online (AJOL)
Items 7451 - 7500 of 11090 ... ... Listeria monocytogenes- A high risk food pathogen by multiplex PCR, Abstract PDF ... and molecular characterization of Oyster mushroom (Pleurotus spp.) ... Vol 14, No 15 (2015), Morphological and RAPD-marker ...
PREVALENCE AND IDENTIFICATION OF VIBRIO SPP. ISOLATED ON AQUACULTURED GILTHEAD SEA BREAM
Directory of Open Access Journals (Sweden)
C. Scarano
2011-01-01
Full Text Available The aim of the study was to investigate the prevalence of Vibrio spp isolated from gilthead sea bream (Sparus aurata farmed on sea cages and to identify and characterize the pathogen by molecular techniques. Eighty fish were collected from two hatcheries located on the North-Est Sardinian Mediterranean coast, and microbiological analysis were performed on different body parts such as skin, gills, muscle and intestinal tract. Subsequently 100 pure colonies with typical morphology and phenotypic characteristics were selected and submitted to the molecular identification. The analysis on the prevalence of Vibrio spp showed the effect of the hatchery rearing system (P<0.001, of the date of sampling (P<0.001, and of the body part (P<0.001. All the strains selected were confirmed to be members of the genus Vibrio spp by the molecular method/techinique/identification, whereas the rpoA gene sequence analyses allowed to identify 89 strains belonging to the species Vibrio harveyi, 6 to V. diabolicus, 2 to V. parahaemolyticus and 1 to V. mediterranei.
Biological response of Azospirillum spp. to different types of stress
Directory of Open Access Journals (Sweden)
Carlos Alberto Sangoquiza Caiza
2018-01-01
Full Text Available Azospirillum is one of the most studied free-living rhizobacteria currently of great agricultural interest because of its ability to bind biological nitrogen and produce phytohormones. The present research aimed at the biological response of Azospirillum spp. facing different types of stress. For this purpose, the micro and macro morphological characterization of Azospirillum spp. And its biological response to stress temperature, pH, salinity. The results revealed that the isolates (C2, C3 and C4 of Azospirillum spp. Grow in greater abundance at temperatures between 28-38 °C and pH between 7-8. The C2 and C3 isolates showed good growth up to 3.5 % (m / v NaCl, whereas the C4 strain was less tolerant. These results have biotechnological applicability and are of great importance when defining and controlling the mass production conditions of Azospirillum spp. for future formulations as biofertilizer in several crops of interest in Ecuador.
Growth of Listeria spp. in shredded cabbage is enhanced by a mild heat treatment.
Ells, Timothy C; Truelstrup Hansen, Lisbeth
2010-03-01
Mild thermal processing can enhance the shelf life of cut fruits and vegetables by delaying the onset of spoilage and preserving the organoleptic properties of shredded cabbage. However, food safety issues related to this process have not been fully investigated. Therefore, the survival and growth of Listeria spp. on cabbage treated in this manner was examined. Experimentally, 24 strains of Listeria spp. (including L. monocytogenes) were inoculated onto cut and intact cabbage tissues and stored at 5 degrees C. All strains on intact tissues exhibited a moderate decline in numbers (up to 1.0 log CFU/cm(2)) over the 28-day storage period. Conversely, cut tissue supported growth of most strains during the first 7 to 14 days of incubation with maximum increases of 1.2 log CFU/cm(2). Subsequently, the survival or growth on heat-treated (50 degrees C for 3 min) and untreated shredded cabbage of four L. monocytogenes and four nonpathogenic Listeria spp. strains were compared during storage for 21 days at 5 degrees C. Growth on untreated shred for all strains was similar to the results observed on cut tissue with a maximum increase of approximately 1.0 log CFU/g. However, in the heat-treated cabbage shred all strains displayed a rapid increase in growth (up to 2.5 log CFU/g) during the first 7 days of incubation, which may be indicative of the destruction of an endogenous growth-inhibiting compound within the cabbage. In conclusion, this study shows that mild thermal treatments of cut cabbage may promote pathogen growth if other inimical barriers are not implemented downstream of the thermal treatment.
DEFF Research Database (Denmark)
Petersen, Karen Mee; Westall, Signe; Jespersen, Lene
2002-01-01
to be the dominant yeast species throughout the ripening period, whereas other yeast species such as Trichosporon spp., Rhodotorula spp., and Candida spp. were found in minor concentrations during early stages of cheese ripening. Mitochondrial DNA RFLP was used to show that several strains of D. hansenii were...
Reassessment of MLST schemes for Leptospira spp. typing worldwide.
Varni, Vanina; Ruybal, Paula; Lauthier, Juan José; Tomasini, Nicolás; Brihuega, Bibiana; Koval, Ariel; Caimi, Karina
2014-03-01
Leptospirosis is a neglected zoonosis of global importance. Several multilocus sequence typing (MLST) methods have been developed for Leptospira spp., the causative agent of leptospirosis. In this study we reassessed the most commonly used MLST schemes in a set of worldwide isolates, in order to select the loci that achieve the maximum power of discrimination for typing Leptospira spp. Global eBURST algorithm was used to detect clonal complexes among STs and phylogenetic relationships among concatenated and individual sequences were inferred through maximum likelihood (ML) analysis. The evaluation of 12 loci combined to type a subset of strains rendered 57 different STs. Seven of these loci were selected into a final scheme upon studying the number of alleles and polymorphisms, the typing efficiency, the discriminatory power and the ratio dN/dS per nucleotide site for each locus. This new 7-locus scheme was applied to a wider collection of worldwide strains. The ML tree constructed from concatenated sequences of the 7 loci identified 6 major clusters corresponding to 6 Leptospira species. Global eBURST established 8 CCs, which showed that genotypes were clearly related by geographic origin and host. ST52 and ST47, represented mostly by Argentinian isolates, grouped the higher number of isolates. These isolates were serotyped as serogroups Pomona and Icterohaemorrhagiae, showing a unidirectional correlation in which the isolates with the same ST belong to the same serogroup. In summary, this scheme combines the best loci from the most widely used MLST schemes for Leptospira spp. and supports worldwide strains classification. The Argentinian isolates exhibited congruence between allelic profile and serogroup, providing an alternative to serological methods. Published by Elsevier B.V.
Narh Mensah, Deborah L; Addo, Peter; Dzomeku, Matilda; Obodai, Mary
2018-03-01
Pineapple rind is a by-product of the pineapple processing industry and contains nutrients and other compounds which must be utilized as a bioresource for socio-economic benefits while preventing the potential problems of improper agroindustrial biomass disposal methods. Pleurotus ostreatus is an edible oyster mushroom with medicinal properties and can be cultivated on various agroindustrial biomass, including sawdust containing supplements. Pineapple rind was powdered and used as a supplement of composted sawdust at 2%, 5%, 10%, 12%, 15%, and 20% (w/w) on dry weight basis. A control treatment consisted of composted sawdust supplemented with rice bran at 12% (the most utilized composition in Ghana). P. ostreatus strain EM-1 was cultivated on these treatments. Factors investigated included the spawn run period, yield, fruiting body weight and size, biological efficiency, and nutritional composition (proximate composition and Copper, Zinc and Lead content) of fruiting bodies harvested from selected high-yielding treatments and the control treatment. Full colonization of all treatments occurred by the 34th day of incubation. Enhanced yield, fruiting body weight and size, and biological efficiency were generally recorded with supplementation at lower concentrations (2% and 5%) compared to treatments supplemented at higher concentrations. There was also a supplement concentration-dependent alteration of the nutritional composition of the mushroom. Powdered pineapple rind can be utilized as an organic supplement at relatively low concentrations in composted sawdust for P. ostreatus strain EM-1 cultivation. The use of lower concentrations of powdered pineapple rind in composted sawdust is advantageous as relatively less input will be required to produce higher P. ostreatus strain EM-1 yields. Utilization of pineapple rind for mushroom cultivation will extend the pineapple plant value chain, intensify mushroom production in a sustainable way, and minimize agricultural
International Nuclear Information System (INIS)
Rosnani Abdul Rashid; Azhar Mohamad; Mat Rasol Awang; Hassan Hamdani Mutaat; Shaiful Azuar Mohamad; Affrida Abu Hasan; Mohd Meswan Maskom; Siti Khadijah Mohd Nahar
2013-01-01
Mushroom can be used as a biological indicator in assessing radiological impact on the environment. Radiological effect would be reflected through morphological changes as well as those changes at molecular level. For this purpose, a preliminary work was conducted, which included DNA isolation, optimization of PCR parameters for Inter-Simple Sequence Repeat (ISSR) and primers screening on Pleurotus sajor caju mushroom strains from Nuclear Malaysia's Sterifeed Mushrooms Collection Centre. In this work, DNA isolation technique from cap and stalk of fruit body were optimized and quantified. It was found that stalk produced highest amount of genomic DNA at 304.01 ng/ μl and cap at 149.00 ng/ μl. A total of 100 ISSR primers were tested and 51 primers were successfully amplified. These primers will be used further for dose response evaluation and molecular profiling in mushroom species. (author)
High Prevalence of Intermediate Leptospira spp. DNA in Febrile Humans from Urban and Rural Ecuador.
Chiriboga, Jorge; Barragan, Verónica; Arroyo, Gabriela; Sosa, Andrea; Birdsell, Dawn N; España, Karool; Mora, Ana; Espín, Emilia; Mejía, María Eugenia; Morales, Melba; Pinargote, Carmina; Gonzalez, Manuel; Hartskeerl, Rudy; Keim, Paul; Bretas, Gustavo; Eisenberg, Joseph N S; Trueba, Gabriel
2015-12-01
Leptospira spp., which comprise 3 clusters (pathogenic, saprophytic, and intermediate) that vary in pathogenicity, infect >1 million persons worldwide each year. The disease burden of the intermediate leptospires is unclear. To increase knowledge of this cluster, we used new molecular approaches to characterize Leptospira spp. in 464 samples from febrile patients in rural, semiurban, and urban communities in Ecuador; in 20 samples from nonfebrile persons in the rural community; and in 206 samples from animals in the semiurban community. We observed a higher percentage of leptospiral DNA-positive samples from febrile persons in rural (64%) versus urban (21%) and semiurban (25%) communities; no leptospires were detected in nonfebrile persons. The percentage of intermediate cluster strains in humans (96%) was higher than that of pathogenic cluster strains (4%); strains in animal samples belonged to intermediate (49%) and pathogenic (51%) clusters. Intermediate cluster strains may be causing a substantial amount of fever in coastal Ecuador.
Directory of Open Access Journals (Sweden)
Edda Díaz Ruíz
2016-08-01
Full Text Available The aim of this research was to evaluate the antimicrobial susceptibility of Staphylococcus spp. strains isolated in nostrils and hands from 19 nursing professionals, associated to the neonatology unit of the University Hospital “Antonio Patricio de Alcalá”, Cumana, Sucre state, during the period July - August 2009. The bacterial identification was carried out by conventional microbiological methods. To determine the antimicrobial susceptibility, the disk diffusion method was used, according to the Clinical Laboratory and Standards Institute guideline. Results showed that 21.05% of individual samples were of Staphylococcus aureus and 78.95% were coagulase negative Staphylococcus (CNS. Most isolations were obtained from the nostrils (50.00%. Regarding the antimicrobial susceptibility, strains of S. aureus from the nostrils were resistant to Oxacilline 66.67% and 33.33% to Ciprofloxacin and Erythromycin. CNS were resistant to Erythromycin (90.00%, Clindamycin (50.00%, Ciprofloxacin (40.00% and Oxacilline (30.00%. The S. aureus strains isolated from hands resulted resistant to all the studied antibiotics (50.00%, and in the CNS isolated from hands, most resistance was related to Erythromycin (91.67%, while Clindamycin, Oxacilline and Ciprofloxacin showed resistance percentages of 58.33%, 50.00% and 41.67%, respectively. This study reveals the presence of methicillin-resistant strains of Staphylococcus spp. among the nursing personnel of the neonatal unit, and the colonization of these bacteria increases the likelihood of transmission of strains from staff to patient, and among them and the community.
Kuo, C.; Hsu, B.; Shen, T.; Tseng, S.; Tsai, J.; Huang, K.; Kao, P.; Chen, J.
2013-12-01
Salmonella spp. is a common water-borne pathogens and its genus comprises more than 2,500 serotypes. Major pathogenic genotypes which cause typhoid fever, enteritis and other intestinal-type diseases are S. Typhimurium, S. Enteritidis, S. Stanley, S. Agona, S.Albany, S. Schwarzengrund, S. Newport, S. Choleraesuis, and S. Derby. Hence, the identification of the serotypes of Salmonella spp. is important. In the present study, the analytical procedures include direct concentration method, non-selective pre-enrichment method and selective enrichment method of Salmonella spp.. Both selective enrichment method and cultured bacteria were detected with specific primers of Salmonella spp. by polymerase chain reaction (PCR). At last, the serotypes of Salmonella were confirmed by using MLST (multilocus sequence typing) with aroC, dnaN, hemD, hisD, purE, sucA, thrA housekeeping genes to identify the strains of positive samples. This study contains 121 samples from three different types of water sources including the drinking water (51), streams (45), and swine wastewater (25). Thirteen samples with positive invA gene are separated from culture method. The strains of these positive samples which identified from MLST method are S. Albany, S. Typhimurium, S. Newport, S. Bareilly, and S. Derby. Some of the serotypes, S. Albany, S. Typhimurium and S. Newport, are highly pathogenic which correlated to human diarrhea. In our results, MLST is a useful method to identify the strains of Salmonella spp.. Keywords: Salmonella, PCR, MLST.
Diversity of naturally occurring Ambler class B metallo-β-lactamases in Erythrobacter spp.
Girlich, Delphine; Poirel, Laurent; Nordmann, Patrice
2012-11-01
In silico analysis identified a metallo-β-lactamase (MBL) in Erythrobacter litoralis HTCC2594, sharing 55% amino acid identity with NDM-1. The aim of this work was to characterize the chromosomally encoded MBLs from several Erythrobacter spp. that may represent potential reservoirs of acquired MBLs. Erythrobacter citreus, Erythrobacter flavus, Erythrobacter longus, Erythrobacter aquimaris and Erythrobacter vulgaris were from the Pasteur Institute collection, France. DNA was extracted and used for shotgun cloning, and β-lactamases were expressed in Escherichia coli. MICs for resulting E. coli recombinant strains were determined by Etest. The deduced amino acid sequences were analysed and compared with BLASTP. Enzymatic activity of bacterial extracts from recombinant E. coli strains was determined by UV spectrophotometry with imipenem (100 μM) as substrate. Resulting E. coli recombinant strains harboured hypothetical MBL-encoding genes. MICs of β-lactams showed decreased susceptibility to carbapenems only for E. coli (pFLA-1) and E. coli (pLON-1), expressing the MBL from E. flavus and E. longus, respectively. MBLs from different Erythrobacter spp. shared weak amino acid identity, ranging from 45% to75% identity. They differed greatly from that of E. litoralis HTCC2594 (and NDM-1), sharing only 11%-23% identity. Enzymatic activity against imipenem was detectable but weak in all these recombinant E. coli strains, except E. coli (pFLA-1), in which specific activity was significantly higher. Several chromosomally located MBLs have been identified from Erythrobacter spp. They share weak amino acid identity and are very weakly related to other acquired MBLs (10%-23%).
Uji Infeksi Mycosphaerella spp Terhadap Bibit Eucalyptus spp
Lidya Morita Sondang
2009-01-01
Tujuan penelitian ini adalah untuk mengetahui tingkat ketahanan 2 klon Eucalyptus spp yaitu Eucalyptus grandis x Eucalyptus pellita dan Eucalyptus grandis x Eucalyptus urophylla terhadap Mycosphaerella spp serta mengetahui virulensi Mycospaherella spp pada 2 kelas umur (2 dan 3 bulan) pada tanaman Eucalyptus spp. Penelitian ini dilaksanakan dengan pengambilan sampel bibit tanaman Eucalyptus grandis x Eucalyptus pellita dan Eucalyptus grandis x Eucalyptus urophylla dari pembibitan PT.Toba Pulp...
Gomółka-Pawlicka, M; Uradziński, J
2003-01-01
The aim of this study was to determine of influence of 15 strains of lactic acid bacteria on the growth of 7 Salmonella spp. strains in model set-ups, and in meat and ripened fermented sausages. The investigations were performed within the framework of three alternate stages which differed in respect to the products studied, the number of Lactobacillus spp. strains and, partly, methodological approach. The ratio between lactic acid bacteria and Salmonella strains studied was, depending on the alternate, 1:1, 1:2 and 2:1, respectively. The investigations also covered the water activity (a(w)) and pH of the tested products. The results obtained are shown in 12 figures and suggest that all the lactic acid bacteria strains used within the framework of the model set-ups showed antagonistic effect on all the Salmonella spp. strains. However, these abilities were not observed with respect to some lactic acid bacteria strains in meat and fermented sausage. The temperature and length of the incubation period of sausages, but not a(w) and pH, were found to have a distinct influence on the antagonistic interaction between the bacteria.
Laccase production by Pleurotus ostreatus and its application in synthesis of gold nanoparticles
Directory of Open Access Journals (Sweden)
Ahmed I. El-Batal
2015-03-01
Optimization of production conditions yielded an enzyme with activity over 32,450 IU/g of fermented substrate. Factorial design was capable of establishing the conditions that multiplied the activity of the enzyme several folds, consequently, reducing the cost of production. The enzyme was capable of decolorizing several dyes with over 80% reduction in color confirming the aromatic degrading capability of laccase. The enzyme was also used in the synthesis of gold nanoparticles, proving that laccase from Pleurotus ostreatus has a strong potential in several industrial applications.
Jayakumar, Asha; Widenmaier, Robyn; Ma, Xiaojing; McDowell, Mary Ann
2009-01-01
To establish and persist within a host, Leishmania spp. parasites delay the onset of cell-mediated immunity by suppressing interleukin-12 (IL-12) production from host macrophages. Although it is established that Leishmania spp.-infected macrophages have impaired IL-12 production, the mechanisms that account for this suppression remain to be completely elucidated. Using a luciferase reporter assay assessing IL-12 transcription, we report here that Leishmania major, Leishmania donovani, and Leishmania chagasi inhibit IL-12 transcription in response to interferon-gamma, lipopolysaccharide, and CD40 ligand and that Leishmania spp. lipophosphoglycan, phosphoglycans, and major surface protein are not necessary for inhibition. In addition, all the Leishmania spp. strains and life-cycle stages tested inhibited IL-12 promoter activity. Our data further reveal that autocrine-acting host factors play no role in the inhibitory response and that phagocytosis signaling is necessary for inhibition of IL-12. PMID:18372625
Directory of Open Access Journals (Sweden)
Rosa María Espinosa-Valdemar
2015-05-01
Full Text Available Waste with high biomass content generated in cities in developing countries is sent to landfills or open dumps. This research aims to degrade biomass content in urban waste through cultivation, at pilot scale, of the edible mushroom Pleurotus ostreatus. First, the number of diapers used by one baby per week was measured with a survey in day care facilities. Then, cellulose content of diapers was assessed. Finally, cultivation of P. ostreatus was carried out using as substrate a mixture of diapers with gardening waste, a co-substrate readily available at urban settings. The factors assessed were strain of P. ostreatus (grey BPR-81, white BPR-5, conditioning of the substrate (diapers with and without plastic and co-substrate (wheat straw, grass, and withered leaves. Results show that diapers are a valuable source of biomass, as generation of diapers with urine is 15.3 kg/child/month and they contain 50.2% by weight of cellulose. The highest reductions in dry weight and volume (>64% of substrates was achieved with the substrate diaper without plastic and co-substrate wheat straw. Although diapers with plastic and grass and leaves showed lower degradation, they achieved efficiencies that make them suitable as a co-substrate (>40%, considering that their biomass is currently confined in landfills.
Strain-Level Diversity of Secondary Metabolism in Streptomyces albus
Seipke, Ryan F.
2015-01-01
Streptomyces spp. are robust producers of medicinally-, industrially- and agriculturally-important small molecules. Increased resistance to antibacterial agents and the lack of new antibiotics in the pipeline have led to a renaissance in natural product discovery. This endeavor has benefited from inexpensive high quality DNA sequencing technology, which has generated more than 140 genome sequences for taxonomic type strains and environmental Streptomyces spp. isolates. Many of the sequenced streptomycetes belong to the same species. For instance, Streptomyces albus has been isolated from diverse environmental niches and seven strains have been sequenced, consequently this species has been sequenced more than any other streptomycete, allowing valuable analyses of strain-level diversity in secondary metabolism. Bioinformatics analyses identified a total of 48 unique biosynthetic gene clusters harboured by Streptomyces albus strains. Eighteen of these gene clusters specify the core secondary metabolome of the species. Fourteen of the gene clusters are contained by one or more strain and are considered auxiliary, while 16 of the gene clusters encode the production of putative strain-specific secondary metabolites. Analysis of Streptomyces albus strains suggests that each strain of a Streptomyces species likely harbours at least one strain-specific biosynthetic gene cluster. Importantly, this implies that deep sequencing of a species will not exhaust gene cluster diversity and will continue to yield novelty. PMID:25635820
Berthold-Pluta, Anna; Garbowska, Monika; Stefańska, Ilona; Pluta, Antoni
2017-08-01
Bacteria of the genus Cronobacter are emerging food-borne pathogens. Foods contaminated with Cronobacter spp. may pose a risk to infants or adults with suppressed immunity. This study was aimed at determining the microbiological quality of ready-to-eat (RTE) plant-origin food products available on the Polish market with special emphasis on the prevalence of Cronobacter genus bacteria. Analyses were carried out on 60 samples of commercial RTE type plant-origin food products, including: leaf vegetables (20 samples), sprouts (20 samples) and non-pasteurized vegetable, fruit and fruit-vegetable juices (20 samples). All samples were determined for the total count of aerobic mesophilic bacteria (TAMB) and for the presence of Cronobacter spp. The isolates of Cronobacter spp. were subjected to genetic identification and differentiation by 16S rDNA sequencing, PCR-RFLP analysis and RAPD-PCR and evaluation of antibiotic susceptibility by the disk diffusion assay. The TAMB count in samples of lettuces, sprouts and non-pasteurized fruit, vegetable and fruit-vegetable juices was in the range of 5.6-7.6, 6.7-8.4 and 2.9-7.7 log CFU g -1 , respectively. The presence of Cronobacter spp. was detected in 21 (35%) samples of the products, including in 6 (30%) samples of leaf vegetables (rucola, lamb's lettuce, endive escarola and leaf vegetables mix) and in 15 (75%) samples of sprouts (alfalfa, broccoli, small radish, lentil, sunflower, leek and sprout mix). No presence of Cronobacter spp. was detected in the analyzed samples of non-pasteurized fruit, vegetable and fruit-vegetable juices. The 21 strains of Cronobacter spp. isolated from leaf vegetable and sprouts included: 13 strains of C. sakazakii, 4 strains of C. muytjensii, 2 strains of C. turicensis, one strain of C. malonaticus and one strain of C. condimenti. All isolated C. sakazakii, C. muytjensii, C. turicensis and C. malonaticus strains were sensitive to ampicillin, cefepime, chloramphenicol, gentamycin
International Nuclear Information System (INIS)
Afify, A.E.M.R.; Ibrahim, G.M.; Abo El Seoud, M.A.; Helal, I.M.M.; Kassem, B.W.
2012-01-01
This work has been conducted to study the possibility of making use of fungi for degrading insecticide-carbofuran. Trichoderma spp. were showed highly potentiality to metabolize carbofuran (200 mg/ kg) to 3-ketocarbofuran in soil as a sole carbon and energy source within 14 days. Carbofuran and its main metabolite were analyzed by high performance liquid chromatography (HPLC). Studies on biodegradation in the soil showed that 81.5 % and 86 % of carbofuran degraded within 14 days of incubation by T. harzianum and T. viride strains, respectively. The lowest dose of gamma irradiation 0.25 KGy enhanced the mycelial dry weight by 22.8 % and 16.2 % for T. harzianum and T. viride strains, respectively. This indicated that the isolates of Trichoderma spp. were potentially useful for carbofuran bioremediation.
Directory of Open Access Journals (Sweden)
Cristina Ramos
2011-01-01
Full Text Available A utilização de substratos vegetais à base de palha tem vindo a assumir uma importância crescente na cultura de cogumelos sapróbios, principalmente do género Pleurotus. Estes cogumelos são considerados muito interessantes do ponto de vista comercial, não só pelas suas características organolépticas e nutricionais, mas também pela sua fácil adaptação e manutenção, crescimento rápido e relativo baixo custo de cultura. No entanto, por se tratar de alimentos perecíveis, devido sobretudo à sua composição e elevada taxa respiratória, podem apresentar reduzido valor comercial, caso a conservação não seja efectuada nas melhores condições. No sentido de minimizar estas alterações, os cogumelos frescos devem ser submetidos a um processamento mínimo com utilização combinada de embalagem em atmosfera modificada, de forma a manter a qualidade e estabilidade no período de conservação. Neste trabalho foram efectuados ensaios de produção de três espécies do género Pleurotus, cultivadas em palha de trigo, com a finalidade de determinar a espécie mais produtiva e avaliar a qualidade dos mesmos durante a conservação quando processados e embalados em atmosfera modificada. Os resultados permitem concluir que a espécie mais produtiva foi a P. ostreatus, seguida da P. sajor-caju e P. eryngii, tendo sido a P. eryngii a que mostrou maior resistência à degradação no período de conservação estabelecido.The use of substrates straw has been increasing importance in mushroom saprophytic species grown, especially of Pleurotus genus. They are considered very interesting from the commercial point of view, not only for its nutritional and organoleptic characteristics, but also for its easy adaptation, rapid growth and relatively low culture cost. Mushrooms have a short shelf life when compared to most vegetables at ambient temperatures mainly due to its composition and high respiration rate. After yield and to reduce losses and
Directory of Open Access Journals (Sweden)
Carolina de Souza Gusatti
2009-04-01
Full Text Available Acinetobacter spp é um importante patógeno causador de infecções nosocomiais que acomete pacientes imunocomprometidos e capaz de adquirir resistência a antimicrobianos com facilidade. Os esgotos hospitalares são importantes disseminadores de genes de resistência a antimicrobianos para a microbiota ambiental. Neste contexto, 30 cepas de Acinetobacter spp provenientes de efluente de um hospital em Porto Alegre, RS, foram analisados quanto ao perfil de susceptibilidade a β-lactamases, quinolonas e aminoglicosídeos através de antibiograma e testes de triagem para metalo beta-lactamases e β-lactamases de espectro estendido. O perfil encontrado revela cepas multi-resistentes e que mecanismos de resistência como a produção de β-lactamases de espectro estendido e bombas de efluxo podem estar presentes nesses isolados.Acinetobacter spp is an important pathogen that is responsible for nosocomial infections affecting immunocompromised patients, and it can easily acquire resistance to antimicrobial agents. Hospital sewage is an important means for disseminating genes for resistance to antimicrobial agents, to the microbiota of the environment. Within this context, 30 strains of Acinetobacter spp from the sewage of a hospital in Porto Alegre, Rio Grande do Sul, were analyzed regarding their profile of susceptibility to β-lactams, quinolones and aminoglycosides, by means of an antibiogram and tests to screen for metallo-β-lactamases and extended-spectrum β-lactamases. The profile obtained revealed the presence of multidrug-resistant strains and showed that resistance mechanisms such as the production of extended-spectrum β-lactamases and efflux pumps may be present in these strains.
Genotyping of Indian antigenic, vaccine, and field Brucella spp. using multilocus sequence typing.
Shome, Rajeswari; Krithiga, Natesan; Shankaranarayana, Padmashree B; Jegadesan, Sankarasubramanian; Udayakumar S, Vishnu; Shome, Bibek Ranjan; Saikia, Girin Kumar; Sharma, Narendra Kumar; Chauhan, Harshad; Chandel, Bharat Singh; Jeyaprakash, Rajendhran; Rahman, Habibur
2016-03-31
Brucellosis is one of the most important zoonotic diseases that affects multiple livestock species and causes great economic losses. The highly conserved genomes of Brucella, with > 90% homology among species, makes it important to study the genetic diversity circulating in the country. A total of 26 Brucella spp. (4 reference strains and 22 field isolates) and 1 B. melitensis draft genome sequence from India (B. melitensis Bm IND1) were included for sequence typing. The field isolates were identified by biochemical tests and confirmed by both conventional and quantitative polymerase chain reaction (qPCR) targeting bcsp 31Brucella genus-specific marker. Brucella speciation and biotyping was done by Bruce ladder, probe qPCR, and AMOS PCRs, respectively, and genotyping was done by multilocus sequence typing (MLST). The MLST typing of 27 Brucella spp. revealed five distinct sequence types (STs); the B. abortus S99 reference strain and 21 B. abortus field isolates belonged to ST1. On the other hand, the vaccine strain B. abortus S19 was genotyped as ST5. Similarly, B. melitensis 16M reference strain and one B. melitensis field isolate were grouped into ST7. Another B. melitensis field isolate belonged to ST8 (draft genome sequence from India), and only B. suis 1330 reference strain was found to be ST14. The sequences revealed genetic similarity of the Indian strains to the global reference and field strains. The study highlights the usefulness of MLST for typing of field isolates and validation of reference strains used for diagnosis and vaccination against brucellosis.
Occurrence of Campylobacter spp. and Cryptosporidium spp. in seagulls (Larus spp.).
Moore, John E; Gilpin, Deidre; Crothers, Elizabeth; Canney, Anne; Kaneko, Aki; Matsuda, Motoo
2002-01-01
An investigation was carried out into the prevalence of thermophilic Campylobacter subspecies (spp.) and Cryptosporidium spp. in fresh fecal specimens collected from members of the gull family (Larus spp.) from three coastal locations of Northern Ireland. A total of 205 fresh fecal specimens were collected from gulls, of which 28 of 205 (13.7%) were positive for Campylobacter spp. and none of 205 for Cryptosporidium spp. Of these campylobacters, 21 of 28 (75%) isolates obtained belonged to the urease-positive thermophilic Campylobacter (UPTC) taxon, followed by five of 28 (17.9%) Campylobacter lari and 2/28 (7.1%) Campylobacter jejuni. It is significant that seagulls are the sole warm-blooded animal host of this bacterial taxon in Northern Ireland. It is proposed that physiological adaptation to starvation by gulls may lead to increased concentrations of urea through energy production from protein, yielding increased levels of urea for metabolism by UPTC organisms. In general, the possibility exists that environmental contamination of surface waters with campylobacters might be mediated by wild birds (such as gulls), where such waters are used for recreational purposes or where such waters are consumed untreated, might represent a risk to public health.
Efimochkina, N R; Bykova, I B; Stetsenko, V V; Minaeva, L P; Pichugina, T V; Markova, Yu M; Korotkevich, Yu V; Kozak, S S; Sheveleva, S A
2016-01-01
The purpose of the work was to study the nature of the Campylobacter spp. contamination during the processing of food products of plant and animal origin (raw poultry and beef meat, raw milk, leafy salads, sliced raw vegetables). In the study of 148 samples 50 strains of Campylobacter spp. (33.8%) were found. For the main phenotypic characteristics they were identified as C. jejuni spp. jejuni and C. jejuni spp. doylei (over 75%). The highest level of detection of campylobacteria (over 45%) was set for raw poultry, including the carcasses of chickens broilers, quails, turkeys and their semi-finished products. 19 of the 27 strains from poultry were identified as C. jejuni. Among the strains isolated from the environment, including swabs from equipment surfaces, 91% of the isolates were also presented by C. jejuni. It was found that the investigated foodstuffs were characterized by high levels of contamination with bacteria of the family Enterobacteriaceae, the content of which was comparable with the identified values of total viable bacteria (cfu). Salmonella was detected in 19% of the investigated poultry samples and in 14.3% of raw cow milk. In the study of swabs from surfaces of poultry processing equipment, the frequency of detection of Campylobacter strains was 38.7%, Salmonella - 12.9%. Most commonly Campylobacter and Salmonella were detected in the zones of primary processing of poultry: the frequency of isolation of Salmonella in slaughter corner was 25%, Campylobacter - 43%. When testing the swabs taken in the cooking zone of «fast food» restaurants Campylobacter and Salmonella were not detected. For studying the swabs from equipment surfaces and the environment for the presence of Campylobacter spp. a modified technique of sampling was developed. The method includes a comprehensive analysis in the test area with the use of three types of media for transportation and incubation of Campylobacter spp. (Preston broth with blood, Brucella broth, Cary
Production of a Functional Frozen Yogurt Fortified with Bifidobacterium spp.
Abdelazez, Amro; Muhammad, Zafarullah; Zhang, Qiu-Xue; Zhu, Zong-Tao; Abdelmotaal, Heba; Sami, Rokayya; Meng, Xiang-Chen
2017-01-01
Frozen dairy products have characteristics of both yogurt and ice cream and could be the persuasive carriers of probiotics. Functions of the frozen yogurt containing viable bifidobacterial cells are recognized and favored by the people of all ages. We developed a kind of yogurt supplemented by Bifidobacterium species. Firstly, five strains of Bifidobacterium spp. ( Bifidobacterium bifidum ATCC 11547, Bifidobacterium longum ATCC 11549, Bifidobacterium infantis ATCC 11551, Bifidobacterium adolescentis ATCC 11550, and Bifidobacterium breve ATCC 11548) were evaluated based on the feasibility criteria of probiotics, comprising acid production, bile tolerance, and adhesion to epithelial cells. Formerly, we combined the optimum strains with yogurt culture ( Lactobacillus delbrueckii subsp. bulgaricus EMCC 11102 and Streptococcus salivarius subsp. thermophilus EMCC 11044) for producing frozen yogurt. Finally, physiochemical properties and sensory evaluation of the frozen yogurt were investigated during storage of 60 days at -18°C. Results directed that Bifidobacterium adolescentis ATCC 11550 and Bifidobacterium infantis ATCC 11551 could be utilized with yogurt culture for producing frozen yogurt. Moreover, the frozen yogurt fermented by two bifidobacterial strains and yogurt culture gained the high evaluation in the physiochemical properties and sensory evaluation. In summary, our results revealed that there was no significant difference between frozen yogurt fermented by Bifidobacterium spp. and yogurt culture and that fermented by yogurt culture only.
Degradation of Green Polyethylene by Pleurotus ostreatus.
Directory of Open Access Journals (Sweden)
José Maria Rodrigues da Luz
Full Text Available We studied the biodegradation of green polyethylene (GP by Pleurotus ostreatus. The GP was developed from renewable raw materials to help to reduce the emissions of greenhouse gases. However, little information regarding the biodegradation of GP discarded in the environment is available. P. ostreatus is a lignocellulolytic fungus that has been used in bioremediation processes for agroindustrial residues, pollutants, and recalcitrant compounds. Recently, we showed the potential of this fungus to degrade oxo-biodegradable polyethylene. GP plastic bags were exposed to sunlight for up to 120 days to induce the initial photodegradation of the polymers. After this period, no cracks, pits, or new functional groups in the structure of GP were observed. Fragments of these bags were used as the substrate for the growth of P. ostreatus. After 30 d of incubation, physical and chemical alterations in the structure of GP were observed. We conclude that the exposure of GP to sunlight and its subsequent incubation in the presence of P. ostreatus can decrease the half-life of GP and facilitate the mineralization of these polymers.
Degradation of Green Polyethylene by Pleurotus ostreatus.
da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Ribeiro, Karla Veloso Gonçalves; Mendes, Igor Rodrigues; Kasuya, Maria Catarina Megumi
2015-01-01
We studied the biodegradation of green polyethylene (GP) by Pleurotus ostreatus. The GP was developed from renewable raw materials to help to reduce the emissions of greenhouse gases. However, little information regarding the biodegradation of GP discarded in the environment is available. P. ostreatus is a lignocellulolytic fungus that has been used in bioremediation processes for agroindustrial residues, pollutants, and recalcitrant compounds. Recently, we showed the potential of this fungus to degrade oxo-biodegradable polyethylene. GP plastic bags were exposed to sunlight for up to 120 days to induce the initial photodegradation of the polymers. After this period, no cracks, pits, or new functional groups in the structure of GP were observed. Fragments of these bags were used as the substrate for the growth of P. ostreatus. After 30 d of incubation, physical and chemical alterations in the structure of GP were observed. We conclude that the exposure of GP to sunlight and its subsequent incubation in the presence of P. ostreatus can decrease the half-life of GP and facilitate the mineralization of these polymers.
DEFF Research Database (Denmark)
Nielsen, T.H.; Sørensen, D.; Tobiasen, C.
2002-01-01
Cyclic lipopeptides (CLPs) with antibiotic and biosurfactant properties are produced by a number of soil bacteria, including fluorescent Pseudomonas spp. To provide new and efficient strains for the biological control of root-pathogenic fungi in agricultural crops, we isolated approximately 600...... fluorescent Pseudomonas spp. from two different agricultural soils by using three different growth media. CLP production was observed in a large proportion of the strains (approximately 60%) inhabiting the sandy soil, compared to a low proportion (approximately 6%) in the loamy soil. Chemical structure...... in the peptide moiety. Production of specific CLPs could be affiliated with Pseudomonas fluorescens strain groups belonging to biotype I, V, or VI. In vitro analysis using both purified CLPs and whole-cell P. fluorescens preparations demonstrated that all CLPs exhibited strong biosurfactant properties...
Mello, Priscila Luiza; Pinheiro, Luiza; Martins, Lisiane de Almeida; Brito, Maria Aparecida Vasconcelos Paiva; Ribeiro de Souza da Cunha, Maria de Lourdes
2017-08-01
The use of antimicrobial agents has led to the emergence of resistant bacterial strains over a relatively short period. Furthermore, Staphylococcus spp. can produce β-lactamase, which explains the survival of these strains in a focus of infection despite the use of a β-lactam antibiotic. The aim of this study was to evaluate the resistance of Staphylococcus spp. isolated from bovine subclinical mastitis to oxacillin and vancomycin (by minimum inhibitory concentration) and to detect vancomycin heteroresistance by a screening method. We also evaluated β-lactamase production and resistance due to hyperproduction of this enzyme and investigated the mecA and mecC genes and performed staphylococcal cassette chromosome mec typing. For this purpose, 181 Staphylococcus spp. isolated from mastitis subclinical bovine were analyzed. Using the phenotypic method, 33 (18.2%) of Staphylococcus spp. were resistant to oxacillin. In contrast, all isolates were susceptible to vancomycin, and heteroresistance was detected by the screening method in 13 isolates. Production of β-lactamase was observed in 174 (96%) of the Staphylococcus spp. isolates. The mecA gene was detected in 8 isolates, all of them belonging to the species Staphylococcus epidermidis, and staphylococcal cassette chromosome mec typing revealed the presence of type I and type IV isolates. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Venturella, Giuseppe; Zervakis, Georgios I; Polemis, Elias; Gargano, Maria Letizia
2016-01-01
An updated overview of the outcome of studies conducted on the culinary-medicinal mushroom Pleurotus nebrodensis is presented by placing emphasis on the clarification of the taxonomic identity of P. nebrodensis and other related taxa possessing entirely white to cream basidiomes, which grow in association with different plants of the family Apiaceae. Cultivation techniques, quality of the product sold and sales price, as well as nutritional and medicinal aspects are discussed. Taking also into consideration the high economic importance of P. nebrodensis, it is essential to proceed with the verification of the commercial strains currently available in the international market under the name of "P. nebrodensis" since it is very probable that many (or most) of them do not represent the real P. nebrodensis. TO confirm this hypothesis, an in silico analysis was conducted on a large of number of ITS1-5.8S-ITS2 rRNA sequences deposited in the National Center for Biotechnology Information database under the name P. nebrodensis. Results demonstrated that all "P nebrodensis" material examined from China (plus several sequences of no reported origin) corresponded to P. eryngii subsp. tuoliensis, with only 2 exceptions, which were grouped within P. eryngii sensu stricto. The real P. nebrodensis biological material from Italy and Greece is certified and is available upon request by the authors at the University of Palermo and the Agricultural University of Athens.
β-Carotene from Yeasts Enhances Laccase Production of Pleurotus eryngii var. ferulae in Co-culture.
Guo, Chaolin; Zhao, Liting; Wang, Feng; Lu, Jian; Ding, Zhongyang; Shi, Guiyang
2017-01-01
Laccase is widely used in several industrial applications and co-culture is a common method for enhancing laccase production in submerged fermentation. In this study, the co-culture of four yeasts with Pleurotus eryngii var. ferulae was found to enhance laccase production. An analysis of sterilization temperatures and extraction conditions revealed that the stimulatory compound in yeasts was temperature-sensitive, and that it was fat-soluble. An LC-MS analysis revealed that the possible stimulatory compound for laccase production in the four yeast extracts was β-carotene. Moreover, the addition of 4 mg β-carotene to 150 mL of P. eryngii var. ferulae culture broth improved laccase production by 2.2-fold compared with the control (i.e., a monoculture), and was similar to laccase production in co-culture. In addition, the enhanced laccase production was accompanied by an increase of lac gene transcription, which was 6.2-time higher than the control on the fifth day. Therefore, it was concluded that β-carotene from the co-cultured yeasts enhanced laccase production in P. eryngii var. ferulae , and strains that produce β-carotene could be selected to enhance fungal laccase production in a co-culture. Alternatively, β-carotene or crude extracts of β-carotene could be used to induce high laccase production in large scale.
Decolourisation of mushroom farm wastewater by Pleurotus ostreatus.
Rodríguez Pérez, Suyén; García Oduardo, Nora; Bermúdez Savón, Rosa C; Fernández Boizán, Maikel; Augur, Christopher
2008-07-01
Mushroom production on coffee pulp as substrate generates an intense black residual liquid, which requires suitable treatment. In the present study, Pleurotus ostreatus growth in wastewater from mushroom farm was evaluated as a potential biological treatment process for decolourisation as well as to obtain biomass (liquid inoculum). Culture medium components affecting mycelial growth were determined, evaluating colour removal. Laccase activity was monitored during the process. P. ostreatus was able to grow in non diluted WCP. Highest biomass yield was obtained when glucose (10 g/l) was added. The addition of this carbon source was necessary for efficient decolourisation. Agitation of the culture improved biodegradation of WCP as well as fungal biomass production. Laccase and manganese-independent peroxidase activities were detected during fungal treatment of the WCP by P. ostreatus CCEBI 3024. The laccase enzyme showed good correlation with colour loss. Both wastewater colour and pollution load (as chemical oxygen demand) decreased more than 50% after 10 days of culture. Phenols were reduced by 92%.
Cultivation of Pleurotus ostreatus and other edible mushrooms.
Sánchez, Carmen
2010-02-01
Pleurotus ostreatus is the second most cultivated edible mushroom worldwide after Agaricus bisporus. It has economic and ecological values and medicinal properties. Mushroom culture has moved toward diversification with the production of other mushrooms. Edible mushrooms are able to colonize and degrade a large variety of lignocellulosic substrates and other wastes which are produced primarily through the activities of the agricultural, forest, and food-processing industries. Particularly, P. ostreatus requires a shorter growth time in comparison to other edible mushrooms. The substrate used for their cultivation does not require sterilization, only pasteurization, which is less expensive. Growing oyster mushrooms convert a high percentage of the substrate to fruiting bodies, increasing profitability. P. ostreatus demands few environmental controls, and their fruiting bodies are not often attacked by diseases and pests, and they can be cultivated in a simple and cheap way. All this makes P. ostreatus cultivation an excellent alternative for production of mushrooms when compared to other mushrooms.
Food, medicinal and environmental values of mushrooms Pleurotus ostreatus
Directory of Open Access Journals (Sweden)
O. M. Alekseenko
2010-07-01
Full Text Available We present the literature review describing food, medicinal and ecological properties of the fungus Pleurotus ostreatus (oyster mushroom. It is shown that the mushroom is adequate foodstuff for human beings. It provides with proteins, carbohydrates, fats, vitamins and mineral salts. Protein of the oyster mushrooms’ mycothallus contains 18 amino acids, eight of which were essential (isoleucine, leucine, lysine, methionine, phenylalanine, tryptophan, threonine, and valine. Therapeutic value of the mushroom is characterised by a content of water-soluble (thiamine B1, riboflavin B2, niacin, B5, PP, pyridoxine B6, biotin B7, ascorbic and pantothenic acid and liposoluble (calciferol, ergosterol, tocopherol vitamins. The considerable gains from the farm wastes use for the mushrooms raising with subsequent application of the substrate in plant cultivation and animal husbandry are stated.
International Nuclear Information System (INIS)
Urban, P.L.; Bazala, M.A.; Bystrzejewska-Piotrowska, G.; Pianka, D.; Steborowski, R.; Asztemborska, M.; Kowalska, J.; Manjon, J.L.; Kuthan, R.T.
2005-01-01
A model species of saprophytic fungus, king oyster mushroom (Pleurotus eryngii), was cultivated on barley substrate supplied with [Pt(NH 3 ) 4 ](NO 3 ) 2 , under well defined conditions. The samples of the collected fruiting bodies were digested and analyzed for total platinum content by means of ICP-MS. The results proved that platinum is not accumulated in the fruitbodies of Pleurotus eryngii for a wide range of Pt concentrations in the culture substrate (100-1000 ppb Pt in 50 ml of water solution added to ca. 450 g of hydrated barley seeds per container). Observable levels of Pt were only found in the fruitbodies obtained from the medium contaminated with 10000 ppb (10 ppm) platinum solution. This demonstrates significant difference in the effectiveness of platinum extraction in fungi and plants, which are capable to accumulate platinum even when supplied at lower concentration (<500 ppb). It also shows different physiological pathways of platinum and other elements which are easily accumulated in the fruitbodies of the same species. (author)
Rojas, E Saalau; Dixon, P M; Batzer, J C; Gleason, M L
2013-09-01
The causal agent of cucurbit bacterial wilt, Erwinia tracheiphila, has a wide host range in the family Cucurbitaceae, including economically important crops such as muskmelon (Cucumis melo), cucumber (C. sativus), and squash (Cucurbita spp.). Genetic variability of 69 E. tracheiphila strains was investigated by repetitive-element polymerase chain reaction (rep-PCR) using BOXA1R and ERIC1-2 primers. Fingerprint profiles revealed significant variability associated with crop host; strains isolated from Cucumis spp. were clearly distinguishable from Cucurbita spp.-isolated strains regardless of geographic origin. Twelve E. tracheiphila strains isolated from muskmelon, cucumber, or summer squash were inoculated onto muskmelon and summer squash seedlings, followed by incubation in a growth chamber. Wilt symptoms were assessed over 3 weeks, strains were reisolated, and rep-PCR profiles were compared with the inoculated strains. Wilting occurred significantly faster when seedlings were inoculated with strains that originated from the same crop host genus (P<0.001). In the first run of the experiment, cucumber and muskmelon strains caused wilting on muskmelon seedlings at a median of 7.8 and 5.6 days after inoculation (dai), respectively. Summer squash seedlings wilted 18.0, 15.7, and 5.7 dai when inoculated with muskmelon-, cucumber-, and squash-origin strains, respectively. In a second run of the experiment, cucumber and muskmelon strains caused wilting on muskmelon at 7.0 and 6.9 dai, respectively, whereas summer squash seedlings wilted at 23.6, 29.0 and 9.0 dai when inoculated with muskmelon-, cucumber-, and squash-origin strains, respectively. Our results provide the first evidence of genetic diversity within E. tracheiphila and suggest that strain specificity is associated with plant host. This advance is a first step toward understanding the genetic and population structure of E. tracheiphila.
Suárez-Segundo, J.L.; Vázquez-López, D.; Torres-García, J.L.; Ahuactzin-Perez, M.; Montiel-Martínez, N.; Tlecuitl-Beristain, S.; Sánchez, C.
2013-01-01
Phthalates are compounds that give fl exnbíüty to the plastics and are considered mutagens and teratogens. Mycelial growth rate, biomass production and hyphal diameter of the young and mature zones of colonies of Fusarium oxysporum, Mortierella alpina, Pleurotuspulmonarius, two strains of Pleurotus ostreatus (Po 37 and Po 83) and one strain of Pleurotus florida grown on glucose, di(2-ethylhexyl) phthalate (DEHP) and dibutyl phthalate were studied. F oxysporum had the highest mycelial growth r...
EFFECT OF USING VARIOUS SUBSTRATES ON CULTIVATION OF PLEUROTUS SAJOR-CAJU
Directory of Open Access Journals (Sweden)
S. N. FASEHAH
2017-04-01
Full Text Available The unmanageable agricultural waste comprises of structural polymers, cellulose, hemicellulose and lignin can be led to pollutions, thus it can be used as a mushroom substrate. Lignocellulosic materials are most favorable feedstock as renewable and natural resource. Forestry and agricultural practices generated a large amount of ligncelluosic waste and promoted to serious problematic environmental pollution. It can be easily broken down by lignocellulotic enzymes. In this study, an attempt was made to evaluate the effect of various substrates on cultivation of Pleurotus sajor-caju. The substrates used in this study were tissue paper, rice husk ash and rubber sawdust. All of the substrates were added with rice bran and calcium carbonate (CaCO3. Then, the mixtures were transferred into plastic sized 8 cm × 4.5 cm and were pasteurized in the steamer for 1 hour at60 °C - 100 °C. After that they were cooled overnight at 25 °C - 30 °C. The spawn were inoculated into the bag and incubated in incubation room. The media bags were incubated until mycelium fully colonized and watering was done twice a day. The parameters studies were included spawn running, number of fruit body, total of stipe length, weight of fruit body and biological efficiency. Results showed that the fastest spawn running and highest number of fruits body, total of stipe length, weight of fruit body and biological efficiency are found using tissue paper substrates. In contrast the rubber sawdust showed the lowest values of spawn running, total of stipe length, weight of fruit body and biological efficiency. It can be concluded that the tissue paper is one of promising substrate which can be used in growing of Pleurotus sajor-caju due to lower cost and easy to purchase as compared to other substrates.
Directory of Open Access Journals (Sweden)
João Carlos Pereira
1999-01-01
Full Text Available Este trabalho teve por objetivo avaliar o espectro antibiótico de actinomicetos provenientes de solos de Cerrados e a sua influência na nodulação da soja. As estirpes BR 29, BR 33, BR 40, BR 85, BR 86, BR 96, 47/587, 3B-7 e 4A-5 de Bradyrhizobium spp. apresentaram comportamento diferenciado em relação à resistência natural aos antibióticos produzidos por 204 actinomicetos. As estirpes BR 29 e BR 96 foram sensíveis a 5,2 e 9,9% dos antibióticos produzidos, respectivamente, enquanto a BR 33 apresentou sensibilidade a 20,3%. O antagonismo exercido pelos actinomicetos exclusivamente à BR 29 e BR 33 foi de 1,6 e 5,7%, respectivamente. Esse efeito não foi observado nas estirpes BR 40 e BR 96. Inoculações simples e em mistura das estirpes na presença de actinomicetos influenciaram a nodulação da soja. A co-inoculação da BR 33 e BR 29 com o isolado 370 reduziu o percentual de ocorrência média, nos nódulos, da BR 29, de 94,1% para 83,7%, com conseqüente aumento da BR 33 de 6,7% para 17,2%. Os resultados evidenciam a importância de estudos ecológicos desses microrganismos, visando avaliar o seu papel no estabelecimento de uma nodulação eficiente.The aim of this work was to evaluate the antibiotic spectrum of actinomycetes from Cerrado soils and their influence on soybean nodulation. Strains BR 29, BR 33, BR 40, BR 85, BR 86, BR 96, 47/587, 3B-7 and 4A-5 of Bradyrhizobium spp. were characterized by their natural resistence to antibiotics produced by 204 actinomycete isolates. The strains BR 29 and BR 96 of B. elkanii were sensitive to 5.2% and 9.9% the products of actinomycete isolates, respectively, while BR 33 was sensitive up to 20.3%. The antagonistic effects caused by actinomycete exclusively to BR 29 and BR 33 were 1.6% and 5.7% respectively. This effect was not observed for strains BR 40 and BR 96. Single and multistrains inoculations in the presence or absence of actinomycetes affected soybean nodulation. On double
Directory of Open Access Journals (Sweden)
Stephen A. Jackson
2018-02-01
Full Text Available The genus Streptomyces produces secondary metabolic compounds that are rich in biological activity. Many of these compounds are genetically encoded by large secondary metabolism biosynthetic gene clusters (smBGCs such as polyketide synthases (PKS and non-ribosomal peptide synthetases (NRPS which are modular and can be highly repetitive. Due to the repeats, these gene clusters can be difficult to resolve using short read next generation datasets and are often quite poorly predicted using standard approaches. We have sequenced the genomes of 13 Streptomyces spp. strains isolated from shallow water and deep-sea sponges that display antimicrobial activities against a number of clinically relevant bacterial and yeast species. Draft genomes have been assembled and smBGCs have been identified using the antiSMASH (antibiotics and Secondary Metabolite Analysis Shell web platform. We have compared the smBGCs amongst strains in the search for novel sequences conferring the potential to produce novel bioactive secondary metabolites. The strains in this study recruit to four distinct clades within the genus Streptomyces. The marine strains host abundant smBGCs which encode polyketides, NRPS, siderophores, bacteriocins and lantipeptides. The deep-sea strains appear to be enriched with gene clusters encoding NRPS. Marine adaptations are evident in the sponge-derived strains which are enriched for genes involved in the biosynthesis and transport of compatible solutes and for heat-shock proteins. Streptomyces spp. from marine environments are a promising source of novel bioactive secondary metabolites as the abundance and diversity of smBGCs show high degrees of novelty. Sponge derived Streptomyces spp. isolates appear to display genomic adaptations to marine living when compared to terrestrial strains.
Quecine, Maria Carolina; Kidarsa, Teresa A.; Goebel, Neal C.; Shaffer, Brenda T.; Henkels, Marcella D.; Zabriskie, T. Mark
2015-01-01
Pseudomonas protegens strain Pf-5 is a rhizosphere bacterium that suppresses soilborne plant diseases and produces at least seven different secondary metabolites with antifungal properties. We derived mutants of Pf-5 with single and multiple mutations in biosynthesis genes for seven antifungal metabolites: 2,4-diacetylphoroglucinol (DAPG), pyrrolnitrin, pyoluteorin, hydrogen cyanide, rhizoxin, orfamide A, and toxoflavin. These mutants were tested for inhibition of the pathogens Fusarium verticillioides and Fusarium oxysporum f. sp. pisi. Rhizoxin, pyrrolnitrin, and DAPG were found to be primarily responsible for fungal antagonism by Pf-5. Previously, other workers showed that the mycotoxin fusaric acid, which is produced by many Fusarium species, including F. verticillioides, inhibited the production of DAPG by Pseudomonas spp. In this study, amendment of culture media with fusaric acid decreased DAPG production, increased pyoluteorin production, and had no consistent influence on pyrrolnitrin or orfamide A production by Pf-5. Fusaric acid also altered the transcription of biosynthetic genes, indicating that the mycotoxin influenced antibiotic production by Pf-5 at the transcriptional level. Addition of fusaric acid to the culture medium reduced antibiosis of F. verticillioides by Pf-5 and derivative strains that produce DAPG but had no effect on antibiosis by Pf-5 derivatives that suppressed F. verticillioides due to pyrrolnitrin or rhizoxin production. Our results demonstrated the importance of three compounds, rhizoxin, pyrrolnitrin, and DAPG, in suppression of Fusarium spp. by Pf-5 and confirmed that an interspecies signaling system mediated by fusaric acid had parallel effects on antifungal metabolite production and antibiosis by the bacterial biological control organism. PMID:26655755
Identification and antifungal activity of an actinomycete strain against Alternaria spp.
Directory of Open Access Journals (Sweden)
Fen Gao
2014-10-01
Full Text Available Alternaria alternata (Fries Keissler is a phytopathogenic fungus responsible for tobacco brown spot disease. This study aims to evaluate the antifungal activity of strain 163 against A. alternata and clarify its taxonomic status. The evaluation of the antifungal activity of strain 163 and its bacteria-free filtrate of fermentation broth was done through measuring the diameters of inhibition zones, and testing the antimicrobial spectrum and the inhibition effect on mycelial growth in vitro. The biocontrol activity of the bacteria-free filtrate in vivo was evaluated by using detached tobacco leaves method and assaying the inhibition rate to disease incidence in growth chamber. A polyphasic approach was taken in the identification of strain 163. The bacterial strain 163 showed inhibitory effect in vitro against A. alternata. The bacteria-free filtrate of the strain 163 fermentation broth showed a 56.7% inhibition rate in a detached leaf assay. In growth chamber conditions, it showed greater biocontrol activity when applied before plants being inoculated with A. alternata than after, the inhibition rate being 46.05%. Investigations into the morphological, cultural, physiological and biochemical properties of strain 163 found it to be most similar to Streptomyces microflavus. Its classification into cell wall type I and sugar type C further confirmed its Streptomyces characteristics. Construction of a phylogenetic tree based on 16S rDNA verified that strain 163 was most closely related to Streptomyces microflavus. From polyphasic taxonomical analysis, strain 163 was found to be identical to S. microflavus.
Directory of Open Access Journals (Sweden)
Nova Nayarit-Ballesteros
2016-05-01
Full Text Available Objective. To determine the serotype and antibiotic resistance profile of Salmonella spp. isolated from retail ground beef in Mexico City. Materials and methods. A total of 100 samples of ground beef were analyzed. The pathogen was isolated by conventional methods and confirmed by PCR (invA gene, 284 bp. The antibiotic resistance profile was determined by the Kirby-Bauer method while serotyping was performed according to the Kauffman-White scheme. Results. We isolated a total of 19 strains of Lomita (6, Derby (4, Senftenberg (2, Javiana and Cannsttat (1 and undeter- mined (5 serotypes. The strains showed a high resistance rate to ampicillin (18/19, carbenicillin (16/19, tetracyclin (13/19, and trimethoprim-sulfamethoxazole (13/19. Multidrug resistance was observed in 14 isolates. Conclusions. Several Salmonella spp. serotypes of public health significance are circulating in ground beef sold in the major Mexican city. Some of these strains are multi-drug resistance.
AFLP analysis of genetic diversity in main cultivated strains of ...
African Journals Online (AJOL)
Ganoderma mushroom is one of the most prescribed traditional medicines, which has been used for medicinal purposes for centuries particularly in China, Japan, Korea and other Asian countries. In this article, the different strains of Ganoderma spp. used in production and their genetic relations of the closely related strains ...
Molecular identification and characterization of Fusarium spp. associated with sorghum seeds.
Divakara, Shetty Thimmappa; Santosh, Parthasarathy; Aiyaz, Mohammed; Ramana, Mudili Venkata; Hariprasad, Puttaswamy; Nayaka, Siddaih Chandra; Niranjana, Siddapura Ramachandrappa
2014-04-01
Fusarium spp. are not only pathogenic to plants but are also known as toxin producers that negatively affect animal and human health. The identification of Fusarium spp. remains one of the most critical issues in fungal taxonomy. In this study, different strains of Fusarium spp. were isolated from sorghum seed samples and identified at the molecular level by tef-1α gene amplification. A multiplex polymerase chain reaction (mPCR) assay was developed to differentiate toxigenic and non-toxigenic Fusarium spp. by designing a primer for the Fum21 gene along with the Fum1 and Fum8 genes. A competitive direct enzyme-linked immunosorbent assay (CD-ELISA) was employed to assess the fumonisin-producing ability of Fusarium spp. Phylogenetic analyses were performed using partial sequences of tef-1α and inter-simple sequence repeat (ISSR) markers of different Fusarium spp. All 27 isolates of Fusarium spp. were positive for the tef-1α gene and revealed the presence of F. verticillioides, F. thapsina and F. cf. incarnatum-equiseti complex. The standardized mPCR assay distinguished toxigenic and non-toxigenic F. verticillioides. Further, mPCR fumonisin-positive F. verticillioides isolates were also positive by CD-ELISA. The tef-1α gene sequence was found to be useful in revealing intraspecific polymorphism to some extent. ISSR markers revealed a high level of polymorphism among different isolates of Fusarium spp., and the dendrogram of ISSR analyses grouped the 27 isolates into two major clusters. The present method provided rapid and reliable detection of fumonisin-producing Fusarium spp. The mPCR assay could be an alternative strategy to current conventional mycotoxin analytical techniques and a reliable tool for high-throughput monitoring of major mycotoxin-producing fungi during the processing steps of food and feed commodities. © 2013 Society of Chemical Industry.
Directory of Open Access Journals (Sweden)
Luis A. Merino
2004-04-01
Full Text Available OBJETIVOS: Evaluar la resistencia a antibióticos de cepas de Shigella spp. aisladas de muestras de heces en el nordeste argentino y caracterizarlas desde el punto de vista de su epidemiología molecular. MÉTODOS: Se estudiaron 132 aislamientos de Shigella spp. obtenidos de las heces de igual número de pacientes con diarrea que asistieron a diferentes laboratorios privados y estatales de las provincias del Chaco y Corrientes, Argentina, durante el período de 1998 a 2002. Cada cepa se caracterizó según su serotipo, su resistencia a 13 antibióticos individuales o combinados y su sensibilidad a las piocinas. A 52 cepas seleccionadas en función de sus perfiles de susceptibilidad antimicrobiana se les determinaron la dotación plasmídica mediante lisis alcalina y las secuencias repetitivas palindrómicas extragénicas mediante la amplificación de segmentos repetitivos de ADN con la reacción en cadena de la polimerasa (REP-RCP. Se aplicó la prueba de ji al cuadrado para comparar proporciones. El nivel de significación estadística fue de 0,05. RESULTADOS: Shigella flexneri fue la especie más frecuente (78%, seguida de S. sonnei (22%. En general, la resistencia de S. flexneri a los antibióticos estudiados fue mayor que la de S. sonnei y esta diferencia fue estadísticamente significativa (P OBJECTIVES: To evaluate the antibiotic resistance of strains of Shigella spp. isolated from feces samples from northeastern Argentina and to characterize the strains in terms of their molecular epidemiology. METHODS: We studied 132 isolates of Shigella spp. obtained from feces samples from 132 patients with diarrhea who were seen at various private and public laboratories in the Argentine provinces of Chaco and Corrientes during the period of 1998 to 2002. Each strain was characterized according to its serotype, its resistance to 13 individual or combination antibiotics, and its sensitivity to pyocins. With 52 strains selected in relation to their
Economic benefit analysis of cultivating Pleurotus ostreatus with rape straw
Guan, Qinlan; Gong, Mingfu; Tang, Mei
2018-04-01
The cultivation of Pleurotus ostreatus with rape straw not only can save the cultivation cost of P. ostreatus, but also can reuse the resources and protect the environment. By adding different proportion of rape straw to the cultivation material of P. ostreatus, the reasonable amount of rape straw was selected and the economic benefit of P. ostreatus cultivated with the optimum amount of rape straw was analyzed. The results showed that adding 10% to 40% rape straw to the cultivation material of P. ostreatus did not affect the yield and biological conversion rate of P. ostreatus, and the ratio of production and investment of the amount of rape straw in the range of 10% to 50% was higher than of cottonseed husk alone as the main material of the formula.
Behnamian, Mahdi; Mohammadi, Seyed A.; Sonnenberg, A.S.M.; Goltapeh, Ebrahim M.; Hendrickx, P.M.
2010-01-01
In the present study, a set of 68 P. eryngii wild strains collected from nine locations in northwest and west of Iran along with six commercial strains were studied using universal rice primers (URP). The wild strains were isolated from Ferula ovina, F. haussknechtii, Cachrys ferulacea, Kellusia
Shi, Min; Yang, Yingnan; Li, Yiting; Wang, Yuepeng; Zhang, Zhenya
2011-01-01
A novel approach by utilizing soybean curd residue, to produce polysaccharide from the edible mushroom Pleurotus ostreatus in solid-state culture, was developed. Firstly, the significant effect of fermented conditions on P. ostreatus polysaccharide production were screened out to be inoculum size, moisture content and C/N ratio by using a single factor experiment. Secondly, the three factors were optimized using central composite design in response surface methodology. As results, a quadratic...
Directory of Open Access Journals (Sweden)
Alfonso Soto-Sánchez
2015-09-01
Full Text Available Barley (Hordeum vulgare L., and its derivatives, ranks fourth in cereal production worldwide, and the Pleurotus species are among the most efficient types of lignocellulolytic white-rot fungi. The objective of this research study was to evaluate the degradation of barley straw and barley rootless with an inoculum of Pleurotus to improve their nutritional availability as a food source for ruminants. Two experiments were conducted; the first was to determine the effects of inoculation of Pleurotus sapidus (Schulzer Sacc. (PS in barley straw (BS, barley rootless (BR, and a 75% BS and 25% BR mixture (M. The second experiment was to evaluate the same substrates in vitro ruminal fermentation. Barley rootless had better organic matter (OM degradability than BS after 24 h incubation with PS. The protein content in BR was higher than in BS (P < 0.01. Enzyme activities had the highest concentration from the start of fermentation, and in vitro dry matter (DM degradability in BS and BR increased after 8 and 24 d fermentation, respectively (P < 0.05. Propionic acid concentration was enhanced after 16 d fermentation in BR (P < 0.5. The use of BS combined with BR exhibited better fermentation; this result provides relevant information for integrating BR with other substrates and improving the use of straw, which can be more nutritionally available for feeding ruminants.
IDENTIFICATION OF DIFFERENT FUSARIUM SPP. IN ALLIUM SPP. IN GERMANY.
Boehnke, B; Karlovsky, P; Pfohl, K; Gamliel, A; Isack, Y; Dehne, H W
2015-01-01
In 2013 Allium cepa bulbs from different fields in Northern and Southern Germany, seeds and sets from onion breeders were analysed for infestation with Fusarium species. The same investigation was done in 2014 with different edible Allium spp. from local markets. Different Fusarium spp. were isolated and identified by morphological characterisation. 24 different Fusarium spp. were identified. The diversity of Fusarium spp. and the intensity of infestation was higher on edible bulbs compared to the younger sets and seeds. The analysed onions and other edible Allium spp. from local markets showed also high contents of different Fusarium species. The most prevalent identified Fusarium sp. in the analysed Allium spp. in Germany was Fusarium oxysporum which can cause the Fusarium Basal Rot, followed by Fusarium solani. Fusarium proliferatum, which can cause the Fusarium Salmon Blotch in onions, could be detected in about half of the sampled onion fields and in approximately 10% of all analysed onions from fields. Also in the onion sets, on the surface of the seeds and in other edible Allium spp. F. proliferatum could be identified. Besides F. proliferatum, further mycotoxin producing Fusarium spp. like Fusarium equiseti or Fusarium tricinctum were identified. Other Fusarium spp. like Fusarium sporotrichioides and Fusarium poae were first described in Allium sp. in this study. The two most prevalent Fusarium spp. F. oxysporum and F. solani are able to produce mycotoxins like enniatins, fumonisins, moniliformin and T-2 toxins. Fusarium sp. like F. proliferatum, F. equiseti and F. tricinctum are able to produce additional toxins like beauvericins, zearalenone and diacetoscirpenol. This high number of Fusarium spp., which are able to produce a broad spectrum of different mycotoxins, could be a potential health risk for human beings and livestock.
Directory of Open Access Journals (Sweden)
Ewa M. Furmanczyk
2017-11-01
Full Text Available Due to their particular properties, detergents are widely used in household cleaning products, cosmetics, pharmaceuticals, and in agriculture as adjuvants tailoring the features of pesticides or other crop protection agents. The continuously growing use of these various products means that water soluble detergents have become one of the most problematic groups of pollutants for the aquatic and terrestrial environments. Thus it is important to identify bacteria having the ability to survive in the presence of large quantities of detergent and efficiently decompose it to non-surface active compounds. In this study, we used peaty soil sampled from a surface flow constructed wetland in a wastewater treatment plant to isolate bacteria that degrade sodium dodecyl sulfate (SDS. We identified and initially characterized 36 Pseudomonas spp. strains that varied significantly in their ability to use SDS as their sole carbon source. Five isolates having the closest taxonomic relationship to the Pseudomonas jessenii subgroup appeared to be the most efficient SDS degraders, decomposing from 80 to 100% of the SDS present in an initial concentration 1 g/L in less than 24 h. These isolates exhibited significant differences in degree of SDS degradation, their resistance to high detergent concentration (ranging from 2.5 g/L up to 10 g/L or higher, and in chemotaxis toward SDS on a plate test. Mass spectrometry revealed several SDS degradation products, 1-dodecanol being dominant; however, traces of dodecanal, 2-dodecanol, and 3-dodecanol were also observed, but no dodecanoic acid. Native polyacrylamide gel electrophoresis zymography revealed that all of the selected isolates possessed alkylsulfatase-like activity. Three isolates, AP3_10, AP3_20, and AP3_22, showed a single band on native PAGE zymography, that could be the result of alkylsulfatase activity, whereas for isolates AP3_16 and AP3_19 two bands were observed. Moreover, the AP3_22 strain exhibited a band
Production of a Functional Frozen Yogurt Fortified with Bifidobacterium spp.
Muhammad, Zafarullah; Zhang, Qiu-Xue; Zhu, Zong-Tao
2017-01-01
Frozen dairy products have characteristics of both yogurt and ice cream and could be the persuasive carriers of probiotics. Functions of the frozen yogurt containing viable bifidobacterial cells are recognized and favored by the people of all ages. We developed a kind of yogurt supplemented by Bifidobacterium species. Firstly, five strains of Bifidobacterium spp. (Bifidobacterium bifidum ATCC 11547, Bifidobacterium longum ATCC 11549, Bifidobacterium infantis ATCC 11551, Bifidobacterium adolescentis ATCC 11550, and Bifidobacterium breve ATCC 11548) were evaluated based on the feasibility criteria of probiotics, comprising acid production, bile tolerance, and adhesion to epithelial cells. Formerly, we combined the optimum strains with yogurt culture (Lactobacillus delbrueckii subsp. bulgaricus EMCC 11102 and Streptococcus salivarius subsp. thermophilus EMCC 11044) for producing frozen yogurt. Finally, physiochemical properties and sensory evaluation of the frozen yogurt were investigated during storage of 60 days at −18°C. Results directed that Bifidobacterium adolescentis ATCC 11550 and Bifidobacterium infantis ATCC 11551 could be utilized with yogurt culture for producing frozen yogurt. Moreover, the frozen yogurt fermented by two bifidobacterial strains and yogurt culture gained the high evaluation in the physiochemical properties and sensory evaluation. In summary, our results revealed that there was no significant difference between frozen yogurt fermented by Bifidobacterium spp. and yogurt culture and that fermented by yogurt culture only. PMID:28691028
Production of a Functional Frozen Yogurt Fortified with Bifidobacterium spp.
Directory of Open Access Journals (Sweden)
Amro Abdelazez
2017-01-01
Full Text Available Frozen dairy products have characteristics of both yogurt and ice cream and could be the persuasive carriers of probiotics. Functions of the frozen yogurt containing viable bifidobacterial cells are recognized and favored by the people of all ages. We developed a kind of yogurt supplemented by Bifidobacterium species. Firstly, five strains of Bifidobacterium spp. (Bifidobacterium bifidum ATCC 11547, Bifidobacterium longum ATCC 11549, Bifidobacterium infantis ATCC 11551, Bifidobacterium adolescentis ATCC 11550, and Bifidobacterium breve ATCC 11548 were evaluated based on the feasibility criteria of probiotics, comprising acid production, bile tolerance, and adhesion to epithelial cells. Formerly, we combined the optimum strains with yogurt culture (Lactobacillus delbrueckii subsp. bulgaricus EMCC 11102 and Streptococcus salivarius subsp. thermophilus EMCC 11044 for producing frozen yogurt. Finally, physiochemical properties and sensory evaluation of the frozen yogurt were investigated during storage of 60 days at −18°C. Results directed that Bifidobacterium adolescentis ATCC 11550 and Bifidobacterium infantis ATCC 11551 could be utilized with yogurt culture for producing frozen yogurt. Moreover, the frozen yogurt fermented by two bifidobacterial strains and yogurt culture gained the high evaluation in the physiochemical properties and sensory evaluation. In summary, our results revealed that there was no significant difference between frozen yogurt fermented by Bifidobacterium spp. and yogurt culture and that fermented by yogurt culture only.
AI-2 signalling is induced by acidic shock in probiotic strains of Lactobacillus spp.
Moslehi-Jenabian, Saloomeh; Gori, Klaus; Jespersen, Lene
2009-11-15
Survival and ability to respond to various environmental stresses such as low pH are important factors for lactobacilli for their function as probiotics. LuxS-mediated quorum sensing mechanism, which is based on the production of universal signal molecule called autoinducer-2 (AI-2), regulates important physiological traits and a variety of adaptive processes in different bacteria. The aim of this study was to investigate the effect of acidic stress on LuxS-mediated quorum sensing (AI-2 signalling) in four probiotic strains of different Lactobacillus species. Initially, the production of AI-2-like molecule was investigated in four strains of Lactobacillus spp. at standard growth conditions using Vibrio harveyi bioluminescence assay. Species variation in AI-2 activity was observed. AI-2 activity started at early-exponential growth phase and increased during the mid-exponential phase concomitant with the reduction of pH, reaching maximum at late exponential phase (L. rhamnosus GG) or at stationary phase (L. salivarius UCC118, L. acidophilus NCFM and L. johnsonii NCC533). Acidic shock experiments were conducted on L. rhamnosus GG and L. acidophilus NCFM after exposure to different acidic shocks (pH 5.0, 4.0 and 3.0) and to pH 6.5 as control, measuring AI-2 activity and transcription of the luxS gene. AI-2 activity increased by lowering the pH in a dose dependent manner and was negatively influenced by acid adaptation. In both species, the luxS gene was repressed after exposure to pH 6.5 as control. However, after acidic shock (pH 4.0) a transient response of luxS gene was observed and the transcription augmented over time, reaching a maximum level and decreased subsequently. Acid adaptation of cells attenuated the transcription of this gene. Based on the observations done in the present study, the luxS gene appears to have a clear role in acidic stress response in probiotic lactobacilli. This might be important in the survival of these bacteria during the passage
Evolution of the RNase P RNA structural domain in Leptospira spp
Ravishankar, Vigneshwaran; Ahmed, Ahmed; Sivagnanam, Ulaganathan; Muthuraman, Krishnaraja; Karthikaichamy, Anbarasu; Wilson, Herald A.; Devendran, Ajay; Hartskeerl, Rudy A.; Raj, Stephen M. L.
2014-01-01
We have employed the RNase P RNA (RPR) gene, which is present as single copy in chromosome I of Leptospira spp. to investigate the phylogeny of structural domains present in the RNA subunit of the tRNA processing enzyme, RNase P. RPR gene sequences of 150 strains derived from NCBI database along
Comparison of some indigenous bacterial strains of pseudomonas ssp. for production of biosurfactants
International Nuclear Information System (INIS)
Sahafeeq, M.; Kokub, D.; Khalid, Z.M.; Malik, K.A.
1991-01-01
Some indigenous pseudomonas spp. were found to have the ability of emulsification, lowering the surface and interfacial tensions, and formation of high reciprocal CMCs. Six strains of Pseudomonas spp were compared for biosurfactant production grown on hexadecane. Supernatant from whole culture broth of these strains could lower surface tension from 65 mN/m to 28-32 nM/m, interfacial tension from 40 nM/m to 1-3 mN/m and had high reciprocal CMCs. When compared for emulsification ability by the culture broth of these strains, the emulsification index (E24) was found to range between 60-65. Biosurfactant containing culture broth of some strains could retain the property up to 80 C, pH of 13 and sodium chloride concentration for 17% which indicates their possible role in some depleted oil well. (author)
Virulotyping of Shigella spp. isolated from pediatric patients in Tehran, Iran.
Ranjbar, Reza; Bolandian, Masomeh; Behzadi, Payam
2017-03-01
Shigellosis is a considerable infectious disease with high morbidity and mortality among children worldwide. In this survey the prevalence of four important virulence genes including ial, ipaH, set1A, and set1B were investigated among Shigella strains and the related gene profiles identified in the present investigation, stool specimens were collected from children who were referred to two hospitals in Tehran, Iran. The samples were collected during 3 years (2008-2010) from children who were suspected to shigellosis. Shigella spp. were identified throughout microbiological and serological tests and then subjected to PCR for virulotyping. Shigella sonnei was ranking first (65.5%) followed by Shigella flexneri (25.9%), Shigella boydii (6.9%), and Shigella dysenteriae (1.7%). The ial gene was the most frequent virulence gene among isolated bacterial strains and was followed by ipaH, set1B, and set1A. S. flexneri possessed all of the studied virulence genes (ial 65.51%, ipaH 58.62%, set1A 12.07%, and set1B 22.41%). Moreover, the pattern of virulence gene profiles including ial, ial-ipaH, ial-ipaH-set1B, and ial-ipaH-set1B-set1A was identified for isolated Shigella spp. strains. The pattern of virulence genes is changed in isolated strains of Shigella in this study. So, the ial gene is placed first and the ipaH in second.
Directory of Open Access Journals (Sweden)
B.M. Borelli
2011-04-01
Full Text Available The population dynamics of Staphylococcus spp. was studied during the ripening of Canastra Minas cheese at three farms located in the State of Minas Gerais, Brazil. The presence of coagulase (coa, thermonuclease (nuc, and enterotoxin (sea, seb, sec, and sed genes was investigated in Staphylococcus strains isolated during the 60-day cheese-ripening period. The presence of the staphylococcal enterotoxins A, C, and D was also investigated in the cheese samples. Cheese samples that were matured for 0, 7, 15, 30, and 45 days presented staphylococci counts from 10³ to 10(8cfu/g. All isolates considered coagulase-positive by physiological tests had the coa gene. However, no association was observed between the results obtained with biochemical tests and those obtained by PCR using gene-specific primers for coagulase-negative strains. Coagulase and thermonuclease genes occurred simultaneously in 41.3% of Staphylococcus spp. tested. None of the investigated Staphylococcus strains expressed enterotoxins SEA, SEB, SEC, and SED. Enterotoxins A, C, and D were not detected in any of the cheese samples.
Detection of antibiotic resistance in clinical bacterial strains from pets
Poeta, P.; Rodrigues, J.
2008-01-01
The identification of different bacterial strains and the occurrence of antibiotic resistance were investigated in several infection processes of pets as skin abscess with purulent discharge, bronco alveolar fluid, earwax, urine, mammary, and eye fluid. Streptococcus spp. and Staphylococcus spp. were the most detected in the different samples. A high frequency of antimicrobial resistance has been observed and this could reflect the wide use of antimicrobials in pets, making the effectiveness ...
Ud-Din, Abu; Wahid, Syeda
2014-01-01
Shigellosis produces inflammatory reactions and ulceration on the intestinal epithelium followed by bloody or mucoid diarrhea. It is caused by enteroinvasive E. coli (EIEC) as well as any species of the genus Shigella, namely, S. dysenteriae, S. flexneri, S. boydii, and S. sonnei. This current species designation of Shigella does not specify genetic similarity. Shigella spp. could be easily differentiated from E. coli, but difficulties observed for the EIEC-Shigella differentiation as both show similar biochemical traits and can cause dysentery using the same mode of invasion. Sequencing of multiple housekeeping genes indicates that Shigella has derived on several different occasions via acquisition of the transferable forms of ancestral virulence plasmids within commensal E. coli and form a Shigella-EIEC pathovar. EIEC showed lower expression of virulence genes compared to Shigella, hence EIEC produce less severe disease than Shigella spp. Conventional microbiological techniques often lead to confusing results concerning the discrimination between EIEC and Shigella spp. The lactose permease gene (lacY) is present in all E. coli strains but absent in Shigella spp., whereas β-glucuronidase gene (uidA) is present in both E. coli and Shigella spp. Thus uidA gene and lacY gene based duplex real-time PCR assay could be used for easy identification and differentiation of Shigella spp. from E. coli and in particular EIEC.
Nutriceutical potential of Pleurotus tuber-regium sclerotium
Directory of Open Access Journals (Sweden)
R. C. Ohiri
2018-04-01
Full Text Available The aim of the study was to determine the composition of the sclerotium of Pleurotus tuber-regium and to analyze its nutritional potential. Major minerals and micronutrients content of the P. tuber-regium sclerotium were determined. The study has shown fairly high concentrations of potassium and magnesium as major minerals with values of 60.66 ± 4.13 and 41.79 ± 3.14 mg/kg, while manganese and zinc were micronutrients with the highest values of 1.20 ± 0.10 and 0.95 ± 0.07 mg/kg. Glutamic acid and aspartic acid were also observed in high concentrations with values of 11.51 ± 1.01 and 5.52 ± 0.86 mg/kg. The mushroom powder of P. tuber-regium was a source for production of oil, which was analyzed by GC-MS method. Benzenedicarboxylic acid mono-(2-ethylhexyl ester and benzenedicarboxylic acid butyl-cyclohexyl ester were volatile constituents predominating with percentage total of 78.7 and 5.2, respectively. It is concluded that the presence of mineral elements, amino acids and volatile components observed in this fungus indicated the presence of the nutritional potential in the sclerotia of P. tuber-regium.
Shi, Shengjing; Bending, Gary D
2007-04-01
The phenyl-urea herbicide isoproturon is a major contaminant of surface and ground-water in agricultural catchments. Earlier work suggested that within-field spatial variation of isoproturon degradation rate resulted from interactions between catabolizing Sphingomonas spp. and pH. In the current study, changes to the structure of Sphingomonas communities during isoproturon catabolism were investigated using Sphingomonas-specific 16S rRNA gene primers. Growth-linked catabolism at high-pH (>7.5) sites was associated with the appearance of multiple new denaturing gradient gel electrophoresis (DGGE) bands. At low-pH sites, there was no change in DGGE banding at sites in which there was cometabolism, but at sites in which there was growth-linked catabolism, degradation was associated with the appearance of a new band not present at high pH sites. Sequencing of DGGE bands indicated that a strain related to Sphingomonas mali proliferated at low pH sites, while strain Sphingomonas sp. SRS2, a catabolic strain identified in earlier work, together with several further Sphingomonas spp., proliferated at high-pH sites. The data indicate that degradation was associated with complex changes to the structure of Sphingomonas spp. communities, the precise nature of which was spatially variable.
Gabriele-Rivet, Vanessa; Fairbrother, Julie-Hélène; Tremblay, Donald; Harel, Josée; Côté, Nathalie; Arsenault, Julie
2016-01-01
Feral pigeons (Columbia livia) can harbor a range of zoonotic pathogens. A transversal study was undertaken to estimate the prevalence of feral pigeons infected by various pathogens in public areas in Montreal, Quebec. Cloacal swabs from captured birds were cultured for Salmonella spp. and Campylobacter spp. and tested by real-time polymerase chain reaction (RT-PCR) for the detection of Coxiella burnetii. An oropharyngeal swab was also submitted to real-time reverse-transcription polymerase chain reaction (RRT-PCR) for the detection of Newcastle disease virus. Among the 187 pigeons tested from 10 public areas, 9.1% (95% CI: 3.0 to 15.2) were positive for Campylobacter spp. with all strains identified as Campylobacter jejuni. The Campylobacter status of birds was not associated with individual characteristics of birds, with the exception of body score. None of the pigeons tested positive for the other pathogens. Direct or indirect contacts with feral pigeons may constitute a potential risk for Campylobacter infection in humans. PMID:26733736
Metal adsorption capabilities of clinoptilolite and selected strains of bacteria from mine water
Mamba, B. B.; Dlamini, N. P.; Nyembe, D. W.; Mulaba-Bafubiandi, A. F.
Small-scale mining has socio-economic advantages such as the reduction of unemployment and the general improvement of the economy. However, these operations if not properly managed or controlled have a potential to cause environmental damage, particularly with respect to the contamination of groundwater and water supplies that are not distant from where these mining activities take place. This paper focuses on metal removal from water contaminated by heavy metals emanating from small-scale mining operations using clinoptilolite and bacteria. Removal of As, Ni, Mn, Au, Co, Cu and Fe was carried out on mine water samples using original and HCl-activated (in 0.02 M and 0.04 M) natural clinoptilolite and bacterial strains (a mixed consortia of Bacillus strains ( Bacillus subtilis, Bacillus cereus, Bacillus firmus, Bacillus fusiformis, Bacillus macroides and Bacillus licheniformis), Pseudomonas spp., Shewanella spp. and a mixed consortia of Acidithiobcillus caldus, Leptospirillum spp., Ferroplasma spp. and Sulphobacillus spp.). The purpose of the study was to compare the removal efficiencies of the bacterial strains versus natural clinoptilolite adsorbents for metal cations. The Bacillus consortia removed most of the metals up to 98% metal removal efficiency with the exception of nickel where clinoptilolite showed good removal efficiency. The 0.02 M HCl-activated clinoptilolite also demonstrated excellent removal capabilities with Cu, Co and Fe removal efficiency of up to 98%. Both clinoptilolite and bacteria demonstrated capabilities of removing Cu 2+, Co 2+, Fe 2+, Mn 2+, As 3+ and Au from solution which augurs well for metal recovery from mining and mineral processing solutions, as well as in water decontamination.
Quecine, Maria Carolina; Kidarsa, Teresa A; Goebel, Neal C; Shaffer, Brenda T; Henkels, Marcella D; Zabriskie, T Mark; Loper, Joyce E
2015-12-11
Pseudomonas protegens strain Pf-5 is a rhizosphere bacterium that suppresses soilborne plant diseases and produces at least seven different secondary metabolites with antifungal properties. We derived mutants of Pf-5 with single and multiple mutations in biosynthesis genes for seven antifungal metabolites: 2,4-diacetylphoroglucinol (DAPG), pyrrolnitrin, pyoluteorin, hydrogen cyanide, rhizoxin, orfamide A, and toxoflavin. These mutants were tested for inhibition of the pathogens Fusarium verticillioides and Fusarium oxysporum f. sp. pisi. Rhizoxin, pyrrolnitrin, and DAPG were found to be primarily responsible for fungal antagonism by Pf-5. Previously, other workers showed that the mycotoxin fusaric acid, which is produced by many Fusarium species, including F. verticillioides, inhibited the production of DAPG by Pseudomonas spp. In this study, amendment of culture media with fusaric acid decreased DAPG production, increased pyoluteorin production, and had no consistent influence on pyrrolnitrin or orfamide A production by Pf-5. Fusaric acid also altered the transcription of biosynthetic genes, indicating that the mycotoxin influenced antibiotic production by Pf-5 at the transcriptional level. Addition of fusaric acid to the culture medium reduced antibiosis of F. verticillioides by Pf-5 and derivative strains that produce DAPG but had no effect on antibiosis by Pf-5 derivatives that suppressed F. verticillioides due to pyrrolnitrin or rhizoxin production. Our results demonstrated the importance of three compounds, rhizoxin, pyrrolnitrin, and DAPG, in suppression of Fusarium spp. by Pf-5 and confirmed that an interspecies signaling system mediated by fusaric acid had parallel effects on antifungal metabolite production and antibiosis by the bacterial biological control organism. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Nieto-Jacobo, Maria F.; Steyaert, Johanna M.; Salazar-Badillo, Fatima B.; Nguyen, Dianne Vi; Rostás, Michael; Braithwaite, Mark; De Souza, Jorge T.; Jimenez-Bremont, Juan F.; Ohkura, Mana; Stewart, Alison
2017-01-01
Trichoderma species are soil-borne filamentous fungi widely utilized for their many plant health benefits, such as conferring improved growth, disease resistance and abiotic stress tolerance to their hosts. Many Trichoderma species are able to produce the auxin phytohormone indole-3-acetic acid (IAA), and its production has been suggested to promote root growth. Here we show that the production of IAA is strain dependent and diverse external stimuli are associated with its production. In in vitro assays, Arabidopsis primary root length was negatively affected by the interaction with some Trichoderma strains. In soil experiments, a continuum effect on plant growth was shown and this was also strain dependent. In plate assays, some strains of Trichoderma spp. inhibited the expression of the auxin reporter gene DR5 in Arabidopsis primary roots but not secondary roots. When Trichoderma spp. and A. thaliana were physically separated, enhancement of both shoot and root biomass, increased root production and chlorophyll content were observed, which strongly suggested that volatile production by the fungus influenced the parameters analyzed. Trichoderma strains T. virens Gv29.8, T. atroviride IMI206040, T. sp. “atroviride B” LU132, and T. asperellum LU1370 were demonstrated to promote plant growth through volatile production. However, contrasting differences were observed with LU1370 which had a negative effect on plant growth in soil but a positive effect in plate assays. Altogether our results suggest that the mechanisms and molecules involved in plant growth promotion by Trichoderma spp. are multivariable and are affected by the environmental conditions. PMID:28232840
Intra, Bungonsiri; Mungsuntisuk, Isada; Nihira, Takuya; Igarashi, Yasuhiro; Panbangred, Watanalai
2011-04-01
Colletotrichum is one of the most widespread and important genus of plant pathogenic fungi worldwide. Various species of Colletotrichum are the causative agents of anthracnose disease in plants, which is a severe problem to agricultural crops particularly in Thailand. These phytopathogens are usually controlled using chemicals; however, the use of these agents can lead to environmental pollution. Potential non-chemical control strategies for anthracnose disease include the use of bacteria capable of producing anti-fungal compounds such as actinomycetes spp., that comprise a large group of filamentous, Gram positive bacteria from soil. The aim of this study was to isolate actinomycetes capable of inhibiting the growth of Colletotrichum spp, and to analyze the diversity of actinomycetes from plant rhizospheric soil. A total of 304 actinomycetes were isolated and tested for their inhibitory activity against Colletotrichum gloeosporioides strains DoA d0762 and DoA c1060 and Colletotrichum capsici strain DoA c1511 which cause anthracnose disease as well as the non-pathogenic Saccharomyces cerevisiae strain IFO 10217. Most isolates (222 out of 304, 73.0%) were active against at least one indicator fungus or yeast. Fifty four (17.8%) were active against three anthracnose fungi and 17 (5.6%) could inhibit the growth of all three fungi and S. cerevisiae used in the test. Detailed analysis on 30 selected isolates from an orchard at Chanthaburi using the comparison of 16S rRNA gene sequences revealed that most of the isolates (87%) belong to the genus Streptomyces sp., while one each belongs to Saccharopolyspora (strain SB-2) and Nocardiopsis (strain CM-2) and two to Nocardia (strains BP-3 and LK-1). Strains LC-1, LC-4, JF-1, SC-1 and MG-1 exerted high inhibitory activity against all three anthracnose fungi and yeast. In addition, the organic solvent extracts prepared from these five strains inhibited conidial growth of the three indicator fungi. Preliminary analysis of crude
Omarini, Alejandra; Dambolena, José Sebastián; Lucini, Enrique; Jaramillo Mejía, Santiago; Albertó, Edgardo; Zygadlo, Julio A
2016-03-01
Biotechnological conversion of low-cost agro-industrial by-products, such as industrial waste or terpenes from the distillation of essential oils from plants into more valuable oxygenated derivatives, can be achieved by using microbial cells or enzymes. In Argentina, the essential oil industry produces several tons of waste each year that could be used as raw materials in the production of industrially relevant and value-added compounds. In this study, 1,8-cineole, one of the components remaining in the spent leaves of the Eucalyptus cinerea waste, was transformed by solid-state fermentation (SSF) using the two edible mushrooms Pleurotus ostreatus and Favolus tenuiculus. As a result, two new oxygenated derivatives of 1,8-cineole were identified: 1,3,3-trimethyl-2-oxabicyclo [2.2.2]octan-6-ol and 1,3,3-trimethyl-2-oxabicyclo [2.2.2]octan-6-one. Additionally, changes in the relative percentages of other aroma compounds present in the substrate were observed during SSF. Both fungal strains have the ability to produce aroma compounds with potential applications in the food and pharmaceutical industries.
Chin, Pui San; Ang, Geik Yong; Yu, Choo Yee; Tan, Eng Lee; Tee, Kok Keng; Yin, Wai Fong; Chan, Kok Gan; Tan, Geok Yuan Annie
2018-02-01
Listeria spp. are ubiquitous in nature and can be found in various environmental niches such as soil, sewage, river water, plants, and foods, but the most frequently isolated species are Listeria monocytogenes and Listeria innocua. In this study, the presence of Listeria spp. in raw chicken meat and chicken-related products sold in local markets in Klang Valley, Malaysia was investigated. A total of 44 Listeria strains (42 L. innocua and 2 L. welshimeri) were isolated from 106 samples. Antibiotic susceptibility tests of the L. innocua strains revealed a high prevalence of resistance to clindamycin (92.9%), ceftriaxone (76.2%), ampicillin (73.8%), tetracycline (69%), and penicillin G (66.7%). Overall, 31 L. innocua and 1 L. welshimeri strain were multidrug resistant, i.e., nonsusceptible to at least one antimicrobial agent in three or more antibiotic classes. The majority of the L. innocua strains were placed into five AscI pulsogroups, and overall 26 distinct AscI pulsotypes were identified. The detection of multidrug-resistant Listeria strains from different food sources and locations warrants attention because these strains could serve as reservoirs for antimicrobial resistance genes and may facilitate the spread and emergence of other drug-resistant strains.
Directory of Open Access Journals (Sweden)
Filioussis George
2007-03-01
Full Text Available Abstract Background A goal for the food industry has always been to improve strains of Lactococcus lactis and stabilize beneficial traits. Genetic engineering is used extensively for manipulating this lactic acid bacterium, while electropolation is the most widely used technique for introducing foreign DNA into cells. The efficiency of electrotransformation depends on the level of electropermealization and pretreatment with chemicals which alter cell wall permeability, resulting in improved transformation efficiencies is rather common practice in bacteria as in yeasts and fungi. In the present study, treatment with lithium acetate (LiAc and dithiothreitol (DTT in various combinations was applied to L. lactis spp. lactis cells of the early-log phase prior to electroporation with plasmid pTRKH3 (a 7.8 kb shuttle vector, suitable for cloning into L. lactis. Two strains of L. lactis spp. lactis were used, L. lactis spp. lactis LM0230 and ATCC 11454. To the best of our knowledge these agents have never been used before with L. lactis or other bacteria. Results Electrotransformation efficiencies of up to 105 transformants per μg DNA have been reported in the literature for L. lactis spp.lactis LM0230. We report here that treatment with LiAc and DDT before electroporation increased transformation efficiency to 225 ± 52.5 × 107 transformants per μg DNA, while with untreated cells or treated with LiAc alone transformation efficiency approximated 1.2 ± 0.5 × 105 transformants per μg DNA. Results of the same trend were obtained with L. lactis ATCC 11454, although transformation efficiency of this strain was significantly lower. No difference was found in the survival rate of pretreated cells after electroporation. Transformation efficiency was found to vary directly with cell density and that of 1010 cells/ml resulted in the highest efficiencies. Following electrotransformation of pretreated cells with LiAc and DDT, pTRKH3 stability was examined
Raaijmakers, J M; Weller, D M
2001-06-01
The genotypic diversity that occurs in natural populations of antagonistic microorganisms provides an enormous resource for improving biological control of plant diseases. In this study, we determined the diversity of indigenous 2,4-diacetylphloroglucinol (DAPG)-producing Pseudomonas spp. occurring on roots of wheat grown in a soil naturally suppressive to take-all disease of wheat. Among 101 isolates, 16 different groups were identified by random amplified polymorphic DNA (RAPD) analysis. One RAPD group made up 50% of the total population of DAPG-producing Pseudomonas spp. Both short- and long-term studies indicated that this dominant genotype, exemplified by P. fluorescens Q8r1-96, is highly adapted to the wheat rhizosphere. Q8r1-96 requires a much lower dose (only 10 to 100 CFU seed(-1) or soil(-1)) to establish high rhizosphere population densities (10(7) CFU g of root(-1)) than Q2-87 and 1M1-96, two genotypically different, DAPG-producing P. fluorescens strains. Q8r1-96 maintained a rhizosphere population density of approximately 10(5) CFU g of root(-1) after eight successive growth cycles of wheat in three different, raw virgin soils, whereas populations of Q2-87 and 1M1-96 dropped relatively quickly after five cycles and were not detectable after seven cycles. In short-term studies, strains Q8r1-96, Q2-87, and 1M1-96 did not differ in their ability to suppress take-all. After eight successive growth cycles, however, Q8r1-96 still provided control of take-all to the same level as obtained in the take-all suppressive soil, whereas Q2-87 and 1M1-96 gave no control anymore. Biochemical analyses indicated that the superior rhizosphere competence of Q8r1-96 is not related to in situ DAPG production levels. We postulate that certain rhizobacterial genotypes have evolved a preference for colonization of specific crops. By exploiting diversity of antagonistic rhizobacteria that share a common trait, biological control can be improved significantly.
Giles, Courtney D; Hsu, Pei-Chun Lisa; Richardson, Alan E; Hurst, Mark R H; Hill, Jane E
2015-12-01
Organic phosphorus (P) is abundant in most soils but is largely unavailable to plants. Pseudomonas spp. can improve the availability of P to plants through the production of phytases and organic anions. Gluconate is a major component of Pseudomonas organic anion production and may therefore play an important role in the mineralization of insoluble organic P forms such as calcium-phytate (CaIHP). Organic anion and phytase production was characterized in 2 Pseudomonas spp. soil isolates (CCAR59, Ha200) and an isogenic mutant of strain Ha200, which lacked a functional glucose dehydrogenase (Gcd) gene (strain Ha200 gcd::Tn5B8). Wild-type and mutant strains of Pseudomonas spp. were evaluated for their ability to solubilize and hydrolyze CaIHP and to promote the growth and assimilation of P by tobacco plants. Gluconate, 2-keto-gluconate, pyruvate, ascorbate, acetate, and formate were detected in Pseudomonas spp. supernatants. Wild-type pseudomonads containing a functional gcd could produce gluconate and mineralize CaIHP, whereas the isogenic mutant could not. Inoculation with Pseudomonas improved the bioavailability of CaIHP to tobacco plants, but there was no difference in plant growth response due to Gcd function. Gcd function is required for the mineralization of CaIHP in vitro; however, further studies will be needed to quantify the relative contribution of specific organic anions such as gluconate to plant growth promotion by soil pseudomonads.
Directory of Open Access Journals (Sweden)
Georgios I. Zervakis
2013-01-01
Full Text Available Two-phase olive mill waste (TPOMW, “alperujo” is a highly biotoxic sludge-like effluent of the olive-oil milling process with a huge seasonal production. One of the treatment approaches that has so far received little attention is the use of TPOMW as substrate for the cultivation of edible mushrooms. Fifteen fungal strains belonging to five species (Basidiomycota, that is, Agrocybe cylindracea, Pleurotus cystidiosus, P. eryngii, P. ostreatus, and P. pulmonarius, were evaluated for their efficacy to colonize media composed of TPOMW, which was used either raw or composted in mixtures with wheat straw in various ratios. Qualified strains exhibited high values of biological efficiency (e.g., 120–135% for Pleurotus spp. and 125% for A. cylindracea and productivity in subsequent cultivation experiments on substrates supplemented with 20–40% composted TPOMW or 20% raw TPOMW. Only when supplementation exceeded 60% for raw TPOMW, a negative impact was noted on mushroom yields which could be attributed to the effluent's toxicity (otherwise alleviated in the respective composted TPOMW medium. Earliness and mushroom size as well as quality parameters such as total phenolic content and antioxidant activity did not demonstrate significant differences versus the control wheat-straw substrate. The substrates hemicellulose content was negatively correlated with mycelium growth rates and yields and positively with earliness; in addition, cellulose: lignin ratio presented a positive correlation with mycelium growth and mushroom weight for A. cylindracea and with earliness for all species examined. TPOMW-based media revealed a great potential for the substitution of traditional cultivation substrates by valorizing environmentally hazardous agricultural waste.
Zervakis, Georgios I; Koutrotsios, Georgios; Katsaris, Panagiotis
2013-01-01
Two-phase olive mill waste (TPOMW, "alperujo") is a highly biotoxic sludge-like effluent of the olive-oil milling process with a huge seasonal production. One of the treatment approaches that has so far received little attention is the use of TPOMW as substrate for the cultivation of edible mushrooms. Fifteen fungal strains belonging to five species (Basidiomycota), that is, Agrocybe cylindracea, Pleurotus cystidiosus, P. eryngii, P. ostreatus, and P. pulmonarius, were evaluated for their efficacy to colonize media composed of TPOMW, which was used either raw or composted in mixtures with wheat straw in various ratios. Qualified strains exhibited high values of biological efficiency (e.g., 120-135% for Pleurotus spp. and 125% for A. cylindracea) and productivity in subsequent cultivation experiments on substrates supplemented with 20-40% composted TPOMW or 20% raw TPOMW. Only when supplementation exceeded 60% for raw TPOMW, a negative impact was noted on mushroom yields which could be attributed to the effluent's toxicity (otherwise alleviated in the respective composted TPOMW medium). Earliness and mushroom size as well as quality parameters such as total phenolic content and antioxidant activity did not demonstrate significant differences versus the control wheat-straw substrate. The substrates hemicellulose content was negatively correlated with mycelium growth rates and yields and positively with earliness; in addition, cellulose: lignin ratio presented a positive correlation with mycelium growth and mushroom weight for A. cylindracea and with earliness for all species examined. TPOMW-based media revealed a great potential for the substitution of traditional cultivation substrates by valorizing environmentally hazardous agricultural waste.
Kim, Kyung-Hee; Kang, Young Min; Im, Chak Han; Ali, Asjad; Kim, Sun Young; Je, Hee-Jeong; Kim, Min-Keun; Rho, Hyun Su; Lee, Hyun Sook; Kong, Won-Sik; Ryu, Jae-San
2014-01-01
Pleurotus eryngii has recently become a major cultivated mushroom; it uses tetrapolar heterothallism as a part of its reproductive process. Sexual development progresses only when the A and B mating types are compatible. Such mating incompatibility occasionally limits the efficiency of breeding programs in which crossing within loci-shared strains or backcrossing strategies are employed. Therefore, understanding the mating system in edible mushroom fungi will help provide a short cut in the development of new strains. We isolated and identified pheromone and receptor genes in the B3 locus of P. eryngii and performed a functional analysis of the genes in the mating process by transformation. A genomic DNA library was constructed to map the entire mating-type locus. The B3 locus was found to contain four pheromone precursor genes and four receptor genes. Remarkably, receptor PESTE3.3.1 has just 34 amino acid residues in its C-terminal cytoplasmic region; therefore, it seems likely to be a receptor-like gene. Real-time quantitative RT-PCR (real-time qRT-PCR) revealed that most pheromone and receptor genes showed significantly higher expression in monokaryotic cells than dikaryotic cells. The pheromone genes PEphb3.1 and PEphb3.3 and the receptor gene PESTE3.3.1 were transformed into P5 (A3B4). The transformants were mated with a tester strain (A4B4), and the progeny showed clamp connections and a normal fruiting body, which indicates the proposed role of these genes in mating and fruiting processes. This result also confirms that PESTE3.3.1 is a receptor gene. In this study, we identified pheromone and receptor genes in the B3 locus of P. eryngii and found that some of those genes appear to play a role in the mating and fruiting processes. These results might help elucidate the mechanism of fruiting differentiation and improve breeding efficiency.
International Nuclear Information System (INIS)
Thanaboripat, Dusanee; Piadiang, Nattaya; Qian, Yang
2006-09-01
Various strains of Trichoderma spp. were screened from soils and irradiated by gamma ray. After the irradiation all strains were tested for an ability to inhibit the growth of aflatoxin producing fungi (A. parasiticus IMI 105266 and A. flavus IMI 24268). The results indicate that Trichoderma virde S84-1 480526 I08(1) was the most effective strain in controlling the growth of these two fungi on PDA.
Kostas Papanotas; Petros A. Kokkinos; Panos G. Ziros; Apostolos Vantarakis
2012-01-01
The objective of this study was the application and evaluation of a loop-mediated isothermal amplification (LAMP) method for the detection of Salmonella spp. strains isolated from food samples. Salmonella specific invA gene sequences (50 strains, 15 serotypes) were amplified at 65oC in 60 min. All of the strains of Salmonella subsp. Enterica were shown to be positive using the LAMP reaction assay, whereas, all other bacteria, virus and yeasts tested in this study were negative. LAMP products ...
LONGITUDINAL RESIDUAL AND TANGENTIAL STRAIN (LRS and LRT IN SIX Eucalyptus spp. CLONES
Directory of Open Access Journals (Sweden)
Paulo Fernando Trugilho
2006-09-01
Full Text Available The species of Eucalyptus genus present high levels of growth stress. These stresses are mechanical efforts generated during the tree growth to help maintaining the balance of the cup, in response to environmental (light, wind and inclination of the land and silvicultural agents (pruning, thinning and planting density. The growth stresses are responsible for the cracks of tops, in logs and boards, and for the warp after the breaking down. This research evaluated the level of growth stress, measured by the longitudinal residual and tangential strain (DRL and DRT, around the circumference of the trunks of alive trees of six clones of Eucalyptus spp., at the age of 10.5 years, and verified the effect of the planting parcel. The clones belong to VMM-AGRO, and they are coming from a clonal test area implanted in the Bom Sucesso farm, located in Vazante-MG. For evaluating the experiment, the model adopted was the completely randomized one disposed in factorial outline with two factors (clone and portion in three repetitions. The results indicated that the average LRS was 0.093 mm and that the average LRT was 0.025 mm. It was verified that, for LRS, the clone effects and planting parcel were significant, while the interaction effect was not significant. For LRT the parcel and interaction effect were significant, while clone effect was not significant. Clones 44, 58 and 47 presented the smallest levels and better distributions of LRS, while, the clones 27, 44 and 58 presented the highest LRS levels. The clones 44 and 58 presented the best distribution and the smallest level of growth stress and may be considered potentially apt for producing sawn wood or solid wood.
Directory of Open Access Journals (Sweden)
Paulo Teixeira Lacava
2008-04-01
Full Text Available The objective of this work was to study the production of siderophores by endophytic bacteria Methylobacterium spp., which occupy the same ecological niche as Xylella fastidiosa subsp. pauca (Xfp in citrus plants. The siderophore production of Methylobacterium strains was tested according to chromeazurol agar assay test (CAS, Csáky test (hydroxamate-type and Arnow test (catechol-type. In addition, the ability of Xfp to use siderophores, in vitro, produced by endophytic bacteria as source of iron, was evaluated. All 37 strains of Methylobacterium spp. tested were CAS-positive for siderophore production. Methylobacterium spp. produced hydroxamate-type, but not catechol-type siderophores. In vitro growth of Xfp was stimulated by the presence of supernatant siderophores of endophytic Methylobacterium mesophilicum.O objetivo deste trabalho foi estudar a produção de sideróforos pelas bactérias endofíticas Methylobacterium spp., que ocupam o mesmo nicho ecológico que Xylella fastidiosa subsp. pauca (Xfp, em plantas cítricas. A produção de sideróforos, pelas linhagens de Methylobacterium, foi testada por meio do ensaio de cromoazarol-ágar (chromeazurol agar assay-CAS, teste de Csáky (tipo hidroxamato e do teste de Arnow (tipo catecol. Além disso, a habilidade de Xfp em utilizar sideróforos produzidos por bactérias endofíticas, como fonte de ferro, in vitro, foi avaliada. Todas as 37 linhagens de Methylobacterium spp. testadas foram positivas para a produção de sideróforos, pelo teste CAS-ágar. Methylobacterium spp. foram capazes de produzir sideróforos do tipo hidroxamato, mas não do tipo catecol. O crescimento in vitro de Xfp foi estimulado pela presença de sideróforos no sobrenadante de Methylobacterium mesophilicum endofítica.
[Characteristic of clinical strains of gram-negative obligate anaerobes].
Kadzielska, Joanna; Kierzkowska, Marta; Sawicka-Grzelak, Anna; Rokosz, Alicja; Łuczak, Mirosław
2007-01-01
The aim of the study was to assess prevalence and antibiotic susceptibility profiles ofGram-negative strictly anaerobic bacteria isolated from clinical specimens taken from hospitalized patients in 2005-2006. Biochemical identification and antibiotic susceptibility were done in an automated system ATB Expression (bioMerieux sa). From 12262 specimens examined 867 strains of obligate anaerobes were isolated. Gram-negative strictly anaerobic bacteria were cultured in number of 138 strains (15,9%). All cultures were performed on Columbia agar and Schaedler agar media (bioMerieux sa) supplemented with 5% sheep blood and incubated at 37 degrees C for 48-120 h in 85% N2, 10% H2, 5% CO2. Most frequently isolated was Bacteroides spp. (41,3%). For this group beta-lactamase activity was evaluated by using nitrocefin disc test (Cefinase BBL, Becton Dickinson and Co., Cockeysville, MD, USA). Production of ESBLs was detected with the use of two disc diffusion methods: the double-disc synergy test (DDST) according to Jarlier et al. and the diagnostic disc (DD) test according to Appleton. ESBLs were produced by 5,3% strains of Bacteroides spp. For all Bacteroides spp. strains MIC values were determined by gradient diffusion method Etest (AB BIODISK, Sweden). ESBLs and MIC were performed on Wilkins-Chalgren solid medium supplemented with 5% sheep blood (Difco Lab., USA) and all plates were incubated at 35 degrees C for 48 hours in 85% N2, 10% H2, 5% CO2. Most Gram-negative obligate anaerobes isolated from clinical specimens are still susceptible to imipenem (100%), metronidazole (99,3%) and beta-lactam antibiotics with beta-lactamase inhibitors: piperacillin/tazobactam (99,3%), ticarcillin/clavulanate (99.3%), amoxicillin/clavulanate (97.8%).
Mathara, Julius Maina; Schillinger, Ulrich; Guigas, Claudia; Franz, Charles; Kutima, Phillip Museve; Mbugua, Samuel K; Shin, H-K; Holzapfel, Wilhelm H
2008-08-15
In this study functional characteristics of 23 representative Lactobacillus strains isolated from the Maasai traditional fermented milk 'Kule naoto' were determined. The Lb. acidophilus group strains showed resistance to gastric juice and bile. In addition, some Lb. acidophilus strains expressed bile salt hydrolase activity, and had ability to assimilate cholesterol in vitro. In-vitro adhesion to HT29 MTX cells of up to 70% was recorded. Lb. fermentum strains showed almost 100% survival under simulated stomach acidic conditions and physiological salt concentrations of bile salts, hydrophobicity values were over 80%. Most strains of the Lb. casei and Lb. acidophilus groups showed aggregation abilities of above 50%. Many strains expressed a protective effect against N-methyl-N'-nitro-N-nitrosoguanidine induced DNA damage according to the 'comet assay' and none was virulent. The antibiotic minimum inhibitory concentration of selected strains was established. According to these results, the Lactobacillus spp associated with 'Kule naoto', contain potentially probiotic (functional) strains.
Serotypes and Antimicrobial Susceptibility of Salmonella spp. Isolated from Farm Animals in China
Directory of Open Access Journals (Sweden)
Yuan Zong Hui
2015-06-01
Full Text Available Salmonella spp. can indirectly infect humans via transfer from animals and animal-derived food products, and thereby cause potentially fatal diseases. Therefore, gaining an understanding of Salmonella infection in farm animals is increasingly important. The aim of this study was to identify the distribution of serotypes in Salmonella samples isolated from chickens (n = 837, pigs (n = 930, and dairy cows (n = 418 in central China (Henan, Hubei, and Hunan provinces in 2010–2011, and investigate the susceptibility of strains to antimicrobial agents. Salmonella isolates were identified by PCR amplification of the invA gene, serotypes were determined by using a slide agglutination test for O and H antigens, and susceptibility to 24 antimicrobials was tested using the agar dilution method. In total, 248 Salmonella strains were identified: 105, 105, and 38 from chickens, dairy cows, and pigs, respectively. Additionally, 209 strains were identified in unhealthy pigs from the Huazhong Agricultural University veterinary hospital. Among these 457 strains, the dominant serotypes were Typhimurium in serogroup B, IIIb in serogroup C, and Enteritidis in serogroup D. In antimicrobial susceptibility tests, 41.14% of Salmonella spp. were susceptible to all antimicrobial agents, 48.14% were resistant to at least one, and 34.72% were resistant to more than three classes. Strains were highly resistant to sulfamethoxazole-trimethoprim (39.61%, nalidixic acid (39.17%, doxycycline (28.22%, and tetracycline (27.58%. Resistance to cephalosporins and fluoroquinolones ranged from 5.25% to 7.44% and 19.04% to 24.51%, respectively. Among penicillin-resistant and cephalosporin-resistant strains, 25 isolates produced extended-spectrum β-lactamases (ESBLs. The multidrug-resistant and ESBL-producing Salmonella strains identified in healthy animals here will present a challenge for veterinary medicine and farm animal husbandry, and could also pose a threat to public health
Directory of Open Access Journals (Sweden)
Cynthia Annes Rubião
2017-08-01
Full Text Available ABSTRACT The aim of this study was to determine and compare the Most Probable Number (MPN of Total Coliforms (TC, Escherichia coli and Enterococcus spp. and to characterize the antimicrobial resistance profiles of Enterococcus spp. isolated from oysters collected in the Barra de Guaratiba Mangrove, Rio de Janeiro, Brazil. The enumeration of E. coli has been used to indicate fecal contamination and hygienic-sanitary conditions of bivalve molluscs. Enterococci are capable to transfer several antimicrobial resistance genes to pathogenic bacteria, including those from Gram-negative group. The oysters were bought from local fishermen and a total of 123 individuals were analyzed. The TC, E. coli and Enterococcus spp. MPN mean were 26,300/100 g, 3,260/100 g and 2,820/100 g, respectively. The only correlation found was between TC and E. coli. Two strains of Enterococcus spp. were resistant to three different antimicrobial categories, including a high level resistance to streptomycin. One strain presented intermediate resistance to vancomycin. The E. coli levels exceeded the limits established by international legislation. This microbiological contamination in oysters reflects the water pollution and indicates a probable contamination of other seafood species from this mangrove, which can represent a risk for consumers and a threat to the environment and public health.
Biofilm formation by Salmonella spp. in catfish mucus extract under industrial conditions
The objective of this study was to determine the effect of strain and temperature on the growth and biofilm formation of Salmonella spp. in high and low concentrations of catfish mucus extract on different food-contact surfaces at 22°C and 10°C. The second objective of this study was to evaluate the...
Plazomicin is a next-generation aminoglycoside with a potentially improved safety profile compared to other aminoglycosides. This study assessed plazomicin MICs and MBCs in four Brucella spp. reference strains. Like other aminoglycosides and aminocyclitols, plazomicin MBC values equaled MIC values ...
Methylobacterium spp. as an indicator for the presence or absence of Mycobacterium spp.
Falkinham III, Joseph O.; Williams, Myra D.; Kwait, Rebecca; Lande, Leah
2016-01-01
Objective/Background: A published survey of bacteria in showerhead biofilm samples revealed that Methylobacterium spp. and Mycobacterium spp. seldom coexisted in biofilms. Method: To confirm that information, biofilm samples were collected from household plumbing of Mycobacterium avium patients and Methylobacterium spp. and M. avium numbers were measured by direct colony counts. Results: The results demonstrated that if Methylobacterium spp. were present, Mycobacterium spp. were absent,...
Zhang, Huaning; Hou, Peibin; Lv, Hui; Chen, Yuzhen; Li, Xinpeng; Ren, Yanyan; Wang, Mei; Tan, Hailian; Bi, Zhenwang
2017-05-01
Infection with Cronobacter spp. leads to neonatal meningitis, necrotizing enterocolitis and bacteremia. Cronobacter spp. are reported to comprise an important pathogen contaminating powdered infant formula (PIF) and follow-up formula (FUF), although little is known about the contamination level of Cronobacter spp. in PIFs and FUFs in China. In total, 1032 samples were collected between 2011 and 2013. Forty-two samples were positive, including 1.6% in PIFs and 6.5% in FUFs. The strains were susceptible to most antibiotics except for cefoxitin. Pulsed-field gel electrophoresis after XbaI digestion produced a total of 36 banding patterns. The 38 strains were found in 27 sequence types (STs), of which nine types (ST454 to ST462) had not been reported in other countries. The clinically relevant strains obtained from the 38 isolates in the present study comprised three ST3, two ST4, two ST8 and one ST1. The contamination rate in the PIF and FUF has stayed at a relatively high level. The contamination rate of PIF was significantly lower than FUF. The isolates had high susceptibility to the antibiotics tested, except cefoxitin. There were polymorphisms between the Cronobacter spp. as indicated by pulsed-field gel electrophoresis and multilocus sequence typing. Therefore, contamination with Cronobacter spp. remains a current issue for commercial infant formulas in China. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Directory of Open Access Journals (Sweden)
Evelise Moncaio Moda
2005-04-01
Full Text Available Traditionally, the cultivation of Pleurotus sajor-caju is performed on different composted and pasteurized agricultural residues. The objective of this study was to investigate whether traditional composting and pasteurization processes could be replaced by washed and supplemented (mineral or organic sugarcane bagasse. In one experiment, fresh sugarcane bagasse was immersed in hot water at 80°C for two hours (control or washed in fresh water for one hour using an adapted machine for residue treatment. In another experiment, fresh sugarcane bagasse was washed in fresh water (control, and supplemented with corn grits (organic supplementation, or supplemented with nutrient solution (mineral supplementation. In the first experiment, the washed bagasse presented a average biological efficiency (ABE of 19.16% with 44% contamination, and the pasteurized bagasse presented a ABE of 13.86% with 70% contamination. In the second experiment, corn grits presented the poorest performance, with a ABE of 15.66% and 60% contamination, while supplementation with the nutrient solution presented a ABE of 30.03%, whereas the control of 26.62%. Washing fresh sugarcane bagasse could suppress the pasteurized substrate in Pleurotus sajor-caju production, compensating a reduced ABE with a faster process.Tradicionalmente, o cultivo do Pleurotus sajor-caju é realizado utilizando-se diversos resíduos agrícolas, precedido dos processos de compostagem e pasteurização. O presente trabalho teve por objetivo comparar o processo de pasteurização com a lavagem do bagaço de cana-de-açúcar e avaliar formas de suplementação do bagaço, visando aumento na produtividade. No primeiro experimento, os colmos da cana-de-açúcar passaram por moenda para a extração do caldo, sendo em seguida desfibrados. No tratamento controle, o bagaço fresco foi pasteurizado em água a 80°C durante 2 horas e o outro tratamento consistiu na lavagem do bagaço fresco em centrífuga com
Bialvaei, Abed Zahedi; Kafil, Hossein Samadi; Asgharzadeh, Mohammad; Aghazadeh, Mohammad; Yousefi, Mehdi
2016-01-01
This study was conducted in Iran in order to assess the distribution of CTX-M type ESBLs producing Enterobacteriaceae. From January 2012 to December 2013, totally 198 E. coli, 139 Klebsiella spp, 54 Salmonella spp and 52 Shigella spp from seven hospitals of six provinces in Iran were screened for resistance to extended-spectrum cephalosporins. After identification and susceptibility testing, isolates presenting multiple-drug resistance (MDR) were evaluated for ESBL production by the disk combination method and by Etest using (cefotaxime and cefotaxime plus clavulanic acid). All isolates were also screened for blaCTX-M using conventional PCR. A total of 42.92%, 33.81%, 14.81% and 7.69% of the E. coli, Klebsiella spp, Salmonella spp and Shigella spp isolates were MDR, respectively. The presence of CTX-M enzyme among ESBL-producing isolates was 85.18%, 77.7%, 50%, and 66.7%, in E. coli, Klebsiella spp, Salmonella spp and Shigella spp respectively. The overall presence of CTX-M genes in Enterobacteriaceae was 15.4% and among the resistant isolates was 47.6%. This study indicated that resistance to β-lactams mediated by CTX-M enzymes in Iran had similar pattern as in other parts of the world. In order to control the spread of resistance, comprehensive studies and programs are needed. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
Occurrence of Fusarium spp. and fumonisins in stored wheat grains marketed in Iran.
Chehri, Khosrow; Jahromi, Saeed Tamadoni; Reddy, Kasa R N; Abbasi, Saeed; Salleh, Baharuddin
2010-12-01
Wheat grains are well known to be invaded by Fusarium spp. under field and storage conditions and contaminated with fumonisins. Therefore, determining Fusarium spp. and fumonisins in wheat grains is of prime importance to develop suitable management strategies and to minimize risk. Eighty-two stored wheat samples produced in Iran were collected from various supermarkets and tested for the presence of Fusarium spp. by agar plate assay and fumonisins by HPLC. A total of 386 Fusarium strains were isolated and identified through morphological characteristics. All these strains belonged to F. culmorum, F. graminearum, F. proliferatum and F.verticillioides. Of the Fusarium species, F. graminearum was the most prevalent species, followed by F. verticillioides, F. proliferatum and then F. culmorum. Natural occurrence of fumonisin B1 (FB1) could be detected in 56 (68.2%) samples ranging from 15-155 μg/kg, fumonisin B2 (FB2) in 35 (42.6%) samples ranging from 12-86 μg/kg and fumonisin B3 (FB3) in 26 (31.7%) samples ranging from 13-64 μg/kg. The highest FB1 levels were detected in samples from Eilam (up to 155 μg/kg) and FB2 and FB3 in samples from Gilan Gharb (up to 86 μg/kg and 64 μg/kg).
Occurrence of Fusarium spp. and Fumonisins in Stored Wheat Grains Marketed in Iran
Directory of Open Access Journals (Sweden)
Baharuddin Salleh
2010-12-01
Full Text Available Wheat grains are well known to be invaded by Fusarium spp. under field and storage conditions and contaminated with fumonisins. Therefore, determining Fusarium spp. and fumonisins in wheat grains is of prime importance to develop suitable management strategies and to minimize risk. Eighty-two stored wheat samples produced in Iran were collected from various supermarkets and tested for the presence of Fusarium spp. by agar plate assay and fumonisins by HPLC. A total of 386 Fusarium strains were isolated and identified through morphological characteristics. All these strains belonged to F. culmorum, F. graminearum, F. proliferatum and F. verticillioides. Of the Fusarium species, F. graminearum was the most prevalent species, followed by F. verticillioides, F. proliferatum and then F. culmorum. Natural occurrence of fumonisin B1 (FB1 could be detected in 56 (68.2% samples ranging from 15–155 μg/kg, fumonisin B2 (FB2 in 35 (42.6% samples ranging from 12–86 μg/kg and fumonisin B3 (FB3 in 26 (31.7% samples ranging from 13–64 μg/kg. The highest FB1 levels were detected in samples from Eilam (up to 155 μg/kg and FB2 and FB3 in samples from Gilan Gharb (up to 86 μg/kg and 64 μg/kg.
Occurrence of Fusarium spp. and Fumonisins in Stored Wheat Grains Marketed in Iran
Chehri, Khosrow; Jahromi, Saeed Tamadoni; Reddy, Kasa R. N.; Abbasi, Saeed; Salleh, Baharuddin
2010-01-01
Wheat grains are well known to be invaded by Fusarium spp. under field and storage conditions and contaminated with fumonisins. Therefore, determining Fusarium spp. and fumonisins in wheat grains is of prime importance to develop suitable management strategies and to minimize risk. Eighty-two stored wheat samples produced in Iran were collected from various supermarkets and tested for the presence of Fusarium spp. by agar plate assay and fumonisins by HPLC. A total of 386 Fusarium strains were isolated and identified through morphological characteristics. All these strains belonged to F. culmorum, F. graminearum, F. proliferatum and F. verticillioides. Of the Fusarium species, F. graminearum was the most prevalent species, followed by F. verticillioides, F. proliferatum and then F. culmorum. Natural occurrence of fumonisin B1 (FB1) could be detected in 56 (68.2%) samples ranging from 15–155 μg/kg, fumonisin B2 (FB2) in 35 (42.6%) samples ranging from 12–86 μg/kg and fumonisin B3 (FB3) in 26 (31.7%) samples ranging from 13–64 μg/kg. The highest FB1 levels were detected in samples from Eilam (up to 155 μg/kg) and FB2 and FB3 in samples from Gilan Gharb (up to 86 μg/kg and 64 μg/kg). PMID:22069576
Directory of Open Access Journals (Sweden)
Tito Del Gaudio
2009-03-01
Full Text Available Ureaplasma spp. and Mycoplasma hominis are frequently isolated from urogenital samples. Ureaplasma spp is responsible for cervicovaginitis, salpingitis, urethritis, epididymitis, male and female infertility, spontaneous abortion, and during pregnancy, for the premature rupture of the membranes, because of chorionamnionitis. Our study aimed to establish the pattern of antimicrobial resistance among Ureaplasma spp isolated in the area of Andria,Apulia Region, from January 2002 to December 2007. 240/781 (30.7% of the urogenital samples examined were found Ureaplasma spp.-positive. 152/240 (63.3 % were >104 UFC/ml and 88/240 (36.7 % were <104 UFC/ml. With regard to the resistance rate, we observed significant increase in resistance to ciprofloxacin, ofloxacin, erythromycin, clarithromycin, and azithromycin. While we did not observe resistance to doxycycline, strains resistant to tetracycline, josamycin, and pristinamycins, were isolated during last years of investigation. Our data may help improve the management of these infections above all in consideration of the differences among isolates in different geographic regions.
Protoplast preparation from monokaryotic mycelium of Pleurotus sajor-caju using lysing enzyme
International Nuclear Information System (INIS)
Hassan Hamdani Mutaat; Mat Rasol Awang
2004-01-01
The objective of this study was to determine the optimum parameters of the factors influencing protoplast isolation from monokaryotic mycelium of Pleurotus sajor-caju using lysing enzyme from Trichoderma harzianurm. The study was conducted by manipulating the variables of the factors affecting protoplast isolation, such as age of mycelium culture, period for lysing of mycelium, concentration of lysing enzyme and concentration of osmotic stabilizer. The highest protoplast yield of 8.3 x 104 protoplast/ml was achieved when a 3-day P. sajor-caju mycelium, cultured statically, was incubated for 3 hours in a lytic mixture containing 7.5 mg/ml lysing enzyme and 1.2 M ammonium sulfate as osmotic stabilizer. This protoplast yield, however, is insufficient for regeneration and protoplast fusion works. (Author)
Directory of Open Access Journals (Sweden)
Mahling Monia
2011-07-01
Full Text Available Abstract Background Only limited information is available about the occurrence of ticks and tick-borne pathogens in public parks, which are areas strongly influenced by human beings. For this reason, Ixodes ricinus were collected in public parks of different Bavarian cities in a 2-year survey (2009 and 2010 and screened for DNA of Babesia spp., Rickettsia spp. and Bartonella spp. by PCR. Species identification was performed by sequence analysis and alignment with existing sequences in GenBank. Additionally, coinfections with Anaplasma phagocytophilum were investigated. Results The following prevalences were detected: Babesia spp.: 0.4% (n = 17, including one pool of two larvae in 2009 and 0.5 to 0.7% (n = 11, including one pool of five larvae in 2010; Rickettsia spp.: 6.4 to 7.7% (n = 285, including 16 pools of 76 larvae in 2009. DNA of Bartonella spp. in I. ricinus in Bavarian public parks could not be identified. Sequence analysis revealed the following species: Babesia sp. EU1 (n = 25, B. divergens (n = 1, B. divergens/capreoli (n = 1, B. gibsoni-like (n = 1, R. helvetica (n = 272, R. monacensis IrR/Munich (n = 12 and unspecified R. monacensis (n = 1. The majority of coinfections were R. helvetica with A. phagocytophilum (n = 27, but coinfections between Babesia spp. and A. phagocytophilum, or Babesia spp. and R. helvetica were also detected. Conclusions I. ricinus ticks in urban areas of Germany harbor several tick-borne pathogens and coinfections were also observed. Public parks are of particularly great interest regarding the epidemiology of tick-borne pathogens, because of differences in both the prevalence of pathogens in ticks as well as a varying species arrangement when compared to woodland areas. The record of DNA of a Babesia gibsoni-like pathogen detected in I. ricinus suggests that I. ricinus may harbor and transmit more Babesia spp. than previously known. Because of their high recreational value for human beings, urban green
Schorn, Sabine; Pfister, Kurt; Reulen, Holger; Mahling, Monia; Silaghi, Cornelia
2011-07-15
Only limited information is available about the occurrence of ticks and tick-borne pathogens in public parks, which are areas strongly influenced by human beings. For this reason, Ixodes ricinus were collected in public parks of different Bavarian cities in a 2-year survey (2009 and 2010) and screened for DNA of Babesia spp., Rickettsia spp. and Bartonella spp. by PCR. Species identification was performed by sequence analysis and alignment with existing sequences in GenBank. Additionally, coinfections with Anaplasma phagocytophilum were investigated. The following prevalences were detected: Babesia spp.: 0.4% (n = 17, including one pool of two larvae) in 2009 and 0.5 to 0.7% (n = 11, including one pool of five larvae) in 2010; Rickettsia spp.: 6.4 to 7.7% (n = 285, including 16 pools of 76 larvae) in 2009. DNA of Bartonella spp. in I. ricinus in Bavarian public parks could not be identified. Sequence analysis revealed the following species: Babesia sp. EU1 (n = 25), B. divergens (n = 1), B. divergens/capreoli (n = 1), B. gibsoni-like (n = 1), R. helvetica (n = 272), R. monacensis IrR/Munich (n = 12) and unspecified R. monacensis (n = 1). The majority of coinfections were R. helvetica with A. phagocytophilum (n = 27), but coinfections between Babesia spp. and A. phagocytophilum, or Babesia spp. and R. helvetica were also detected. I. ricinus ticks in urban areas of Germany harbor several tick-borne pathogens and coinfections were also observed. Public parks are of particularly great interest regarding the epidemiology of tick-borne pathogens, because of differences in both the prevalence of pathogens in ticks as well as a varying species arrangement when compared to woodland areas. The record of DNA of a Babesia gibsoni-like pathogen detected in I. ricinus suggests that I. ricinus may harbor and transmit more Babesia spp. than previously known. Because of their high recreational value for human beings, urban green areas are likely to remain in the research focus on
Ehsan Bari; Reza Oladi; Olaf Schmidt; Carol A. Clausen; Katie Ohno; Darrel D. Nicholas; Mehrdad Ghodskhah Daryaei; Maryam Karim
2015-01-01
The scope of this research was to evaluate the influence of xylem ray (XR) and degree of polymerization (DP) of holocellulose in Oriental beech wood (Fagus orientalis Lipsky.) on impact bending strength against two white-rot fungi. Beech wood specimens, exposed to Pleurotus ostreatus and Trametes versicolor, were evaluated for...
Molecular characterization of Shigella spp. from patients in Gabon 2011-2013.
Schaumburg, Frieder; Alabi, Abraham S; Kaba, Harry; Lell, Bertrand; Becker, Karsten; Grobusch, Martin P; Kremsner, Peter G; Mellmann, Alexander
2015-04-01
Shigella spp. dysentery is widespread in developing countries; the incidence is particularly high in children between 1-2 years of age. In sub-Saharan Africa, there is a paucity of epidemiological data on Shigella spp., with possible negative consequences for recognition and correct treatment choice for this life-threatening bacterial infection. We therefore characterized Shigella spp. isolates from Gabon. The antimicrobial resistance, virulence factors, genotypes and mobile genetic elements of Shigella isolates (29 S. flexneri; 5 S. boydii; 3 S. sonnei) from a retrospective strain collection were analyzed. High resistance rates were found for gentamicin and tetracycline (100%, 37/37), cotrimoxazole (92%, 34/37) and ampicillin (84%, 31/37). All isolate harbored ial and ipaH; no isolate produced Shiga toxins (stx1/2); enterotoxins (set1A/B) were only found in S. flexneri (n=19). Multilocus sequence types (MLST) clustered with global clones. A high prevalence of atypical class 1 integrons harboring blaOXA30 and aadA1 were detected in S. flexneri, while all S. sonnei carried class 2 integrons. There is a strong link of Gabonese Shigella spp. isolates with pandemic lineages as they cluster with major global clones and frequently carry atypical class 1 integrons which are frequently reported in Shigella spp. from Asia. © The Author 2014. Published by Oxford University Press on behalf of Royal Society of Tropical Medicine and Hygiene. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Production of a Functional Frozen Yogurt Fortified with Bifidobacterium spp.
Abdelazez, Amro; Muhammad, Zafarullah; Zhang, Qiu-Xue; Zhu, Zong-Tao; Abdelmotaal, Heba; Sami, Rokayya; Meng, Xiang-Chen
2017-01-01
Frozen dairy products have characteristics of both yogurt and ice cream and could be the persuasive carriers of probiotics. Functions of the frozen yogurt containing viable bifidobacterial cells are recognized and favored by the people of all ages. We developed a kind of yogurt supplemented by Bifidobacterium species. Firstly, five strains of Bifidobacterium spp. (Bifidobacterium bifidum ATCC 11547, Bifidobacterium longum ATCC 11549, Bifidobacterium infantis ATCC 11551, Bifidobacterium adoles...
Resistance gene pool to co-trimoxazole in non-susceptible Nocardia strains.
Directory of Open Access Journals (Sweden)
Sylvia eValdezate
2015-04-01
Full Text Available The soil-borne pathogen Nocardia spp. causes severe cutaneous, pulmonary and central nervous system infections. Against them, co-trimoxazole (SXT constitutes the mainstay of antimicrobial therapy. However, some Nocardia strains show resistance to SXT, but the underlying genetic basis is unknown. We investigated the presence of genetic resistance determinants and class 1-3 integrons in 76 SXT-resistant Nocardia strains by PCR and sequencing. By E-test, these clinical strains showed SXT MICs of ≥32:608 mg/L (ratio of 1:19 for trimethoprim: sulfamethoxazole. They belonged to 12 species, being the main representatives N. farcinica (32%, followed by N. flavorosea (6.5%, N. nova (11.8%, N. carnea (10.5%, N. transvalensis (10.5% and Nocardia spp. (6.5%. The prevalence of resistance genes in the SXT-resistant strains was as follows: sul1 and sul2 93.4% and 78.9% respectively, dfrA(S1 14.7%, blaTEM-1 and blaZ 2.6% and 2.6% respectively, VIM-2 1.3%, aph(3´-IIIa 40.8%, ermA, ermB, mefA and msrD 2.6%, 77.6%, 14.4%, and 5.2% respectively, and tet(O, tet(M, and tet(L 48.6%, 25.0% and 3.9% respectively. Detected amino acid changes in GyrA were not related to fluoroquinolone resistance, but probably linked to species polymorphism. Class 1 and 3 integrons were found in 93.42% and 56.57% strains, respectively. Class 2 integrons and sul3 genes were not detected. Other mechanisms, different than dfrA(S1, dfrD, dfrF, dfrG and dfrK, could explain the strong trimethoprim resistance shown by the other 64 strains. For first time, resistance determinants commonly found in clinically important bacteria were detected in Nocardia spp. sul1, sul2, erm(B and tet(O were the most prevalent in the SXT-resistant strains. The similarity in their resistome could be due to a common genetic platform, in which these determinants are co-transferred
Becker, S.; Singh, A.K.; Postius, C.; Böger, P.; Ernst, A.
2004-01-01
In various water depths of the littoral zone of Lake Constance (Bodensee) cyanobacteria of the Synechococcus-type were isolated from biofilms (periphyton) on three natural substrates and an artificial one (unglazed tiles). From one tile three strains of phycoerythrin (PE)-rich Synechococcus spp.
Efficacy of a variety of disinfectants against Listeria spp.
Best, M; Kennedy, M E; Coates, F
1990-01-01
The efficacy of 14 disinfectants against Listeria innocua and two strains of Listeria monocytogenes in the presence of organic matter was studied. Quantitative efficacy tests were used. Many of the disinfectants tested were not as effective on Listeria spp. when the test organisms were dried onto the surface of steel disks (carrier tests) as they were when the organisms were placed in suspension (suspension test). The presence of whole serum and milk (2% fat) further reduced the disinfectant ...
Mallick, Pijush; Chattaraj, Shruti; Sikdar, Samir Ranjan
2017-10-01
The 12 pfls somatic hybrids and 2 parents of Pleurotus florida and Lentinus s quarrosulus were characterized by ISSR and sequencing of rRNA-ITS genes. Five ISSR primers were used and amplified a total of 54 reproducible fragments with 98.14% polymorphism among all the pfls hybrid populations and parental strains. UPGMA-based cluster exhibited a dendrogram with three major groups between the parents and pfls hybrids. Parent P . florida and L . squarrosulus showed different degrees of genetic distance with all the hybrid lines and they showed closeness to hybrid pfls 1m and pfls 1h , respectively. ITS1(F) and ITS4(R) amplified the rRNA-ITS gene with 611-867 bp sequence length. The nucleotide polymorphisms were found in the ITS1, ITS2 and 5.8S rRNA region with different number of bases. Based on rRNA-ITS sequence, UPGMA cluster exhibited three distinct groups between L. squarrosulus and pfls 1p , pfls 1m and pfls 1s , and pfls 1e and P. florida .
International Nuclear Information System (INIS)
Ali, M. S.; Latif, Z.
2016-01-01
Various molecular techniques like analysis of the amplified rDNA internal transcribed spacers (ITS), intragenic spacers and total ITS region analysis by restriction fragment length polymorphism (RFLP) has been introduced for yeast identification but there are limited databases to identify yeast species on the basis of 5.8S rDNA. In this study, twenty nine yeast strains from various sources including spoiled fruits, vegetables, foodstuffs, and concentrated juices were characterized by PCR-RFLP. PCR-RFLP has been used to characterize yeasts present in different spoiled food samples after isolation of the yeasts. By using this technique, the isolated yeast strains were characterized by direct 5.8S-ITS rDNA region amplification. RFLP analysis was applied to each of the amplification products (varied from 400bp to 800bp) detected, and the corresponding yeast identifications were made according to each specific restriction patterns obtained after treatment with two endonucleases TaqI and HaeIII which yielded a specific banding pattern for each species. For further confirmation amplified products of eleven selected isolates were sequenced and blast on NCBI. Both RFLP and sequence analyses of the strains with accession nos. KF472163, KF472164, KF472165, KF472166, KF472167, KF472168, KF472169, KF472170, KF472171, KF472172, KF472173 gave significantly similar results. The isolates were found to belong five different yeast species including; Candida spp., Pichia spp., Kluyveromyces spp., Clavispora spp. and Hanseniaspora spp. This method provides a fast, easy, reliable and authentic way for determining yeast population present in different type of samples, as compared to traditional characterization technique. (author)
Dwiastuti, Mutia Erti; Fajri, Melisa N; Yunimar, Yunimar
2015-01-01
Layu yang disebabkan oleh Fusarium spp. merupakan salah satu penyakit penting tanaman stroberi (Fragaria x ananassa Dutch.) di daerah subtropika, yang dapat menggagalkan panen. Penelitian bertujuan untuk mempelajari potensi Trichoderma spp. dalam mengendalikan Fusarium spp. Isolat Trichoderma spp. diisolasi dari rizosfer tanaman stroberi dan Fusarium spp. diisolasi dari tanaman stroberi yang mengalami layu fusarium. Isolat cendawan dimurnikan, dikarakterisasi, dan dibandingkan dengan isolat c...
Pardo-Giménez, Arturo; Catalán, Luis; Carrasco, Jaime; Álvarez-Ortí, Manuel; Zied, Diego; Pardo, José
2016-08-01
This work assesses the agronomic performance of defatted pistachio meal, after oil extraction, as a nutritional substrate supplement when growing the mushroom species Agaricus bisporus (Lange) Imbach and Pleurotus ostreatus (Jacq.) P. Kumm. Materials were applied at different doses at spawning. Along with non-supplemented substrates, commercial nutritional supplements were used as controls. Proximate analysis of mushrooms is also considered. For the cultivation of champignon, defatted pistachio meal has provided larger mushrooms (unitary weight and cap diameter) with firmer texture and greater content in dry weight and protein, without significant alterations in quantitative parameters. For Pleurotus ostreatus, the supplement led to significant yield increase, even providing up to 34.4% of increment compared to non-supplementation with meal, reaching a biological efficiency of 129.9 kg dt(-1) , when applied to the 15 g kg(-1) compost dose. Supplementation has also been conducted to increase dry weight, protein and fibre within carpophores and to decrease the energy value. Defatted pistachio meal has similar or better results compared to the commercial supplements used as reference. Compost supplementation with defatted pistachio meal in A. bisporus concerns mainly the quantitative parameters (size, texture, dry weight and protein). Based on the results obtained, this technique has greater potential of development for P. ostreatus commercial crops, basically due to expected increases in production, with a direct impact on benefits and crop profitability. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.
Trimoulinard, A; Beral, M; Henry, I; Atiana, L; Porphyre, V; Tessier, C; Leclercq, A; Cardinale, E
2017-06-05
One of the most popular meat products of the local "cuisine" is sausage composed with 100% chicken or 100% pork. In this study, we aimed to determine the presence of Salmonella spp., Campylobacter spp. and Listeria spp. in chicken- and pork-sausages, quantify Salmonella spp. population and identify the factors that could be associated with contamination in the outlets. Two hundred and three batches of pork and chicken sausages were randomly collected from 67 local outlets (supermarkets, groceries and butcher shops). Salmonella spp. was detected in 11.8% (95% confidence interval (CI): [10.0; 13.5]) of samples, Campylobacter spp. in 1.5% [0.7; 4.2] and Listeria monocytogenes in 5.9% [4.4; 7.3]. Most probable number of Salmonella spp. varied between 6cfu per gram to 320cfu per gram. Salmonella serotypes isolated from pork and chicken sausages were S. Typhimurium (45.8%), S. London (20.8%), S. Derby (16.7%), S. Newport (8.33%), S. Blockley (4.2%) and S. Weltevreden (4.17%). Using a logistic (mixed-effect) regression model, we found that Salmonella spp. contamination was positively associated with sausages sold in papers or plastic bags and no control of rodents. Chicken sausages were associated with a decreasing risk of Salmonella contamination. Listeria monocytogenes contamination was positively associated with the presence of fresh rodent droppings in the outlet and negatively when the staff was cleaning regularly their hands with soap and water or water only. All the sampled outlets of Reunion Island were not equivalent in terms of food safety measures. Increasing awareness of these traders remains a cornerstone to limit the presence of Salmonella spp. and Listeria spp. in sausages, particularly in a tropical context (high temperature and humidity). Copyright © 2017 Elsevier B.V. All rights reserved.
Tulumoğlu, Şener; Erdem, Belgin; Şimşek, Ömer
2018-05-22
This study aims to determine the effects of inulin and fructo-oligosaccharide (FOS) on the probiotic properties of five Lactobacillus spp. isolated from human milk. Lactobacillus spp. were isolated and identified, and the growth characteristics, acid and bile salt tolerance, antagonistic effects, and cholesterol assimilation of Lactobacillus strains were investigated in the presence of inulin and FOS. Lactobacillus casei L1 was able to utilize inulin and FOS as carbon source as well as glucose even other strains were able to use, including Lactobacillus rhamnosus GG. This strain also showed high tolerance to acid and bile salt, even at pH 2.5 and 0.5% bile salt levels, respectively. Inulin and FOS promoted the antimicrobial activity of L. casei L1 against pathogenic bacteria. Cholesterol assimilation was higher than in the other and control probiotic strains in the presence inulin and FOS, which were measured as 14 and 25 mg/dL, respectively. In conclusion, L. casei L1 can use both inulin and FOS to maintain its viability both at digestive conditions and also the relevant prebiotics, and show broad antagonistic activity and cholesterol assimilation.
Sumathi, C; Dillibabu, V; Madhuri, Dash-Koney; Priya, D Mohana; Nagalakshmi, C; Sekaran, G
2014-04-01
Abstract: This study stresses the key role which can be played by Tannery Fleshing (TF) hydrolyzing probiotic Pontibacter spp. in aqua feed formulation and identifies the probiotic strains in the fish gut capable of enhancing the overall growth and immune responses. Probiotics included are Pontibacter species (Pb) and Bacillus megaterium (BM) wherein Lactobacillus (LB) served as control. Experimental diets includes tannery fleshing (TF1), TF+LB strain (TF2), TF+BM strain (TF3), TF+Pb strain (TF4), Fishmeal+BM(TF5), Fishmeal+Pb and Control fish meal based diet (TF6). Compared with control, total weight gain (TWG), Specific Growth Rate (SGR), Feed Conversion Ratio (FCR) and Protein Efficiency Ratio (PER) in fish fed with diets supplemented with probiotics were significantly increased (p survival and TF1 lowest survival in comparison with the control. Growth and related parameters reveals the effective utilization potential of tannery fleshing probiotic as a feed source. Comparative studies with standard fish meal diets reveals that the fish fed with Pontibacter spp. and Bacillus megaterium included feeds enhanced both assimilating capacity and immunological responses in Labeo rohita.
Abiotic and biotic degradation of oxo-biodegradable plastic bags by Pleurotus ostreatus.
Directory of Open Access Journals (Sweden)
José Maria Rodrigues da Luz
Full Text Available In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as substrates for P. ostreatus. We observed that physical treatment alone was not sufficient to initiate degradation. Instead, mechanical modifications and reduced titanium oxide (TiO2 concentrations caused by sunlight exposure triggered microbial degradation. The low specificity of lignocellulolytic enzymes and presence of endomycotic nitrogen-fixing microorganisms were also contributing factors in this process.
Abiotic and biotic degradation of oxo-biodegradable plastic bags by Pleurotus ostreatus.
da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Bazzolli, Denise Mara Soares; Tótola, Marcos Rogério; Demuner, Antônio Jacinto; Kasuya, Maria Catarina Megumi
2014-01-01
In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as substrates for P. ostreatus. We observed that physical treatment alone was not sufficient to initiate degradation. Instead, mechanical modifications and reduced titanium oxide (TiO2) concentrations caused by sunlight exposure triggered microbial degradation. The low specificity of lignocellulolytic enzymes and presence of endomycotic nitrogen-fixing microorganisms were also contributing factors in this process.
Abiotic and Biotic Degradation of Oxo-Biodegradable Plastic Bags by Pleurotus ostreatus
da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Bazzolli, Denise Mara Soares; Tótola, Marcos Rogério; Demuner, Antônio Jacinto; Kasuya, Maria Catarina Megumi
2014-01-01
In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as substrates for P. ostreatus. We observed that physical treatment alone was not sufficient to initiate degradation. Instead, mechanical modifications and reduced titanium oxide (TiO2) concentrations caused by sunlight exposure triggered microbial degradation. The low specificity of lignocellulolytic enzymes and presence of endomycotic nitrogen-fixing microorganisms were also contributing factors in this process. PMID:25419675
Optimization of Arundo donax Saccharification by (Hemicellulolytic Enzymes from Pleurotus ostreatus
Directory of Open Access Journals (Sweden)
Rossana Liguori
2015-01-01
Full Text Available An enzymatic mixture of cellulases and xylanases was produced by Pleurotus ostreatus using microcrystalline cellulose as inducer, partially characterized and tested in the statistical analysis of Arundo donax bioconversion. The Plackett-Burman screening design was applied to identify the most significant parameters for the enzymatic hydrolysis of pretreated A. donax. As the most significant influence during the enzymatic hydrolysis of A. donax was exercised by the temperature (°C, pH, and time, the combined effect of these factors in the bioconversion by P. ostreatus cellulase and xylanase was analyzed by a 33 factorial experimental design. It is worth noting that the best result of 480.10 mg of sugars/gds, obtained at 45°C, pH 3.5, and 96 hours of incubation, was significant also when compared with the results previously reached by process optimization with commercial enzymes.
Interaction of bacteria-feeding soil flagellates and Pseudomonas spp
DEFF Research Database (Denmark)
Pedersen, Annette; Ekelund, Flemming; Johansen, Anders
2010-01-01
Pseudomonas strains may be used as alternatives to fungicides as some of them produce secondary metabolites, which can inhibit growth of plant pathogenic fungi. Increased knowledge of non-target effects of the antagonistic bacteria on other soil organisms as well as of the survival and predation...... resistance of the antagonistic bacteria is necessary for risk assessment and increased performance of antagonistic bacteria as biological control agents. In the present study, we aimed to investigate the difference between Pseudomonas spp. with respect to their predation resistance to and effects...... on the three different and common soil flagellates Bodo caudatus, Cercomonas longicauda, and Neocercomonas jutlandica. Two antagonistic Pseudomonas: Pseudomonas fluorescens CHA0 and P. fluorescens DR54 and two positive control strains: P. fluorescens DSM 50090T and Pseudomonas chlororaphis ATCC 43928 were...
Krawiec, Marta; Woźniak-Biel, Anna; Bednarski, Michał; Wieliczko, Alina
2017-11-01
Campylobacter spp. is the most commonly reported, bacterial cause of human foodborne infection worldwide. Commercial poultry and free-living birds are natural reservoirs of three particular species: Campylobacter jejuni, Campylobacter coli, and Campylobacter lari. The aim of this study was to determine the genotypic characteristics and antibiotic susceptibility of 43 Campylobacter strains, obtained from free-living birds, in Poland. In total, 700 birds were examined. The strains were isolated from 43 birds (6.14%) from the feces of 7 wild bird species: Mallard ducks Anas platyrhynchos (29 positive/121 tested), great cormorants Phalacrocorax carbo (5/77), velvet scoters Melanitta fusca (4/30), tawny owls Strix aluco (2/5), common buzzard Buteo buteo (1/3), rook Corvus frugilegus (1/6), and Eurasian tree sparrow Passer montanus (1/30). Thirty-eight (88.37%) of obtained strains belonged to C. jejuni and five (11.63%) to C. coli. Other 428 examined birds from different bird species were Campylobacter negative. The antimicrobial susceptibility to nine antimicrobials was also studied in investigated isolates of Campylobacter spp. Sixteen of the examined strains (37.21% of all positive samples) showed susceptibility to all of the nine antimicrobials. Moreover, the prevalence of selected virulence genes, such as flaA, cadF, ceuE, virB11, cdtA, cdtB, and cdtC were all analyzed. The virulence gene that was found most frequently in total number of Campylobacter strains was ceuE (72.10%) and other genes, such as flaA, cadF, cdtA, cdtB, and cdtC, were found in over 60% of all examined strains. Variable antimicrobial susceptibility and the presence of different virulence genes of examined strains, isolated from free-living birds, suggest that special attention should be given to wild birds and any potential approaches to the control of antibiotic-resistant Campylobacter should be discussed.
Directory of Open Access Journals (Sweden)
Paula Fernanda Bomfim Oliveira Cogorni
2014-06-01
Full Text Available The aim of this study was to evaluate of Pleurotus sajor-caju production in peach palm leaves and the addition of different fractions of mushroom powder to wheat flour to increase its nutritional value without changing its characteristics. The best yield (48.4%, biologic efficiency (4.5%, and Pr (0.36 g/day values were obtained using 20% inoculum fraction and 10% rice bran fraction. The Pleurotus sajor-caju fruiting body cultivated under these conditions had the following composition in 100 g: 29.91 g (carbohydrates, 42.92 g (proteins, 1.24 g (lipids, 15.93 g (fibers, 7.42 g (ashes, 1.6 g (phosphorus, 2.7 g (potassium, 8.73 mg (iron, 23.75 mg (sodium, 0.34 mg (thiamine, and 0.57 mg (riboflavin. The wheat flour with mushroom powder had reduced sugar content, but it did not have increased fat content. The fiber, protein, phosphorus, potassium, iron, and riboflavin contents were increased mainly when 10% mushroom powder was added to the wheat flour. Furthermore, this flour does not undergo drastic alterations in its physicochemical characteristics such as in moisture, wet gluten, color, and falling number.
Plazinski, Jacek; Zheng, Qi; Taylor, Rona; Croft, Lynn; Rolfe, Barry G.; Gunning, Brian E. S.
1990-01-01
Twenty-two isolates of Anabaena azollae derived from seven Azolla species from various geographic and ecological sources were characterized by DNA-DNA hybridization. Cloned DNA fragments derived from the genomic sequences of three different A. azollae isolates were used to detect restriction fragment length polymorphism among all symbiotic anabaenas. DNA clones were radiolabeled and hybridized against southern blot transfers of genomic DNAs of different isolates of A. azollae digested with restriction endonucleases. Eight DNA probes were selected to identify the Anabaena strains tested. Two were strain specific and hybridized only to A. azollae strains isolated from Azolla microphylla or Azolla caroliniana. One DNA probe was section specific (hybridized only to anabaenas isolated from Azolla ferns representing the section Euazolla), and five other probes gave finer discrimination among anabaenas representing various ecotypes of Azolla species. These cloned genomic DNA probes identified 11 different genotypes of A. azollae isolates. These included three endosymbiotic genotypes within Azolla filiculoides species and two genotypes within both A. caroliniana and Azolla pinnata endosymbionts. Although we were not able to discriminate among anabaenas extracted from different ecotypes of Azolla nilotica, Azolla mexicina, Azolla rubra and Azolla microphylla species, each of the endosymbionts was easily identified as a unique genotype. When total DNA isolated from free-living Anabaena sp. strain PCC7120 was screened, none of the genomic DNA probes gave detectable positive hybridization. Total DNA of Nostoc cycas PCC7422 hybridized with six of eight genomic DNA fragments. These data imply that the dominant symbiotic organism in association with Azolla spp. is more closely related to Nostoc spp. than to free-living Anabaena spp. Images PMID:16348182
Yulistiani, R.; Praseptiangga, D.; Supyani; Sudibya; Raharjo, D.; Shirakawa, T.
2017-04-01
Antibiotic resistance in bacteria from the family Enterobacteriaceae is an important indicator of the emergence of resistant bacterial strains in the community. This study investigated the prevalence of antibiotic-resistant Enterobacteriaceae isolated from chicken meat sold at traditional markets in Surabaya Indonesia. In all, 203 isolates (43 Salmonella spp., 53 Escherichia coli, 16 Shigella spp., 22 Citrobacter spp., 13 Klebsiella spp, 24 Proteus spp., 15 Yersinia spp., 7 Enterobacter spp., 6 Serratia spp., 3 Edwardsiella spp. were resistant to tetracycline (69.95 %), nalidixid acid (54.19 %), sulfamethoxazole/sulfamethizole (42.36 %), chloramphenicol (12.81%), cefoxitin (6.40 %), gentamicin (5.91 %). Tetracycline was the antimicrobial that showed the highest frequency of resistance among Salmonella, E. coli, Citrobacter, Proteus and Erdwardsiella isolates, and nalidixid acid was second frequency of resistance. Overall, 124 (61.08 %) out of 203 isolates demonstrated multidrug resistance to at least two unrelated antimicrobial agents. The high rate of antimicrobial resistance in bacterial isolates from chicken meat may have major implications for human and animal health with adverse economic implications.
Sun, Xiaoyu; Liu, Bin; Chen, Yan; Huang, Honglan; Wang, Guoqing; Li, Fan; Ni, Zhaohui
2016-12-01
The prevalence of various Ambler class A to D β-lactamases, ISAba1, and class 1 and 2 integrons as well as the clonal relatedness in 105 Acinetobacter spp. isolates found in northeastern China was investigated. All 105 Acinetobacter spp. isolates were determined to be multidrug resistant (MDR), and the resistance rates to carbapenem agents were approximately 50%. PER, IMP, AmpC, and OXA-23 were found to be dominant β-lactamases belonging to different classes, respectively. This is the first report of the coexistence of bla PER , bla IMP , bla AmpC , and bla OXA-23-like genes in Acinetobacter spp. isolates from northeastern China. ISAba1 was found upstream of the bla OXA-23-like gene in 87.8% (36/41) strains and upstream of the bla OXA-51-like gene in 26.5% (13/49) strains. ISAba3-like element was found upstream of the bla OXA-58-like gene in one bla OXA-58-like -positive strain. The presence of IntI1 was detected in 63.8% (67/105) of the isolates and the most prevalent gene cassettes were aacA4, aadA1, and catB8. The highly prevalent isolates belong to international clonal lineage (ICL)-II. These results indicate that the wide horizontal and clonal spread of MDR Acinetobacter spp. isolates harbouring multiple β-lactamase genes has become a serious problem in northeastern China.
Microbial inoculants for the biocontrol of Fusarium spp. in durum wheat.
Baffoni, Loredana; Gaggia, Francesca; Dalanaj, Nereida; Prodi, Antonio; Nipoti, Paola; Pisi, Annamaria; Biavati, Bruno; Di Gioia, Diana
2015-10-30
Fusarium head blight (FHB) is a severe disease caused by different Fusarium species, which affects a wide range of cereal crops, including wheat. It determines from 10 to 30% of yield loss in Europe. Chemical fungicides are mainly used to reduce the incidence of FHB, but low environmental impact solutions are looked forward. Applications of soil/rhizobacteria as biocontrol agents against FHB in wheat are described in literature, whereas the potential use of lactobacilli in agriculture has scarcely been explored. The aim of this work was to study the inhibitory effect of two bacterial strains, Lactobacillus plantarum SLG17 and Bacillus amyloliquefaciens FLN13, against Fusarium spp. in vitro and to assess their efficacy in field, coupled to the study of the microbial community profile of wheat seeds. Antimicrobial assays were performed on agar plates and showed that the two antagonistic strains possessed antimicrobial activity against Fusarium spp. In the field study, a mixture of the two strains was applied to durum wheat i) weekly from heading until anthesis and ii) at flowering, compared to untreated and fungicide treated plots. The FHB index, combining both disease incidence and disease severity, was used to evaluate the extent of the disease on wheat. A mixture of the two microorganisms, when applied in field from heading until anthesis, was capable of reducing the FHB index. Microbial community profile of seeds was studied via PCR-DGGE, showing the presence of L. plantarum SLG17 in wheat seeds and thus underlining an endophytic behavior of the strain. L. plantarum SLG17 and B. amyloliquefaciens FLN13, applied as biocontrol agents starting from the heading period until anthesis of wheat plants, are promising agents for the reduction of FHB index.
Directory of Open Access Journals (Sweden)
NATALIA LIZETTE CASTAÑO
2012-12-01
Full Text Available En la elaboración de la panela, entre el 40 y 54% es bagazo, el cual se caracteriza portener baja proteína y energía, altos compuestos lignocelulósicos, acompañado de una baja digestibilidad, por ello, tradicionalmente ha sido utilizado como combustiblepara las hornillas. El presente trabajo, evaluó el uso del bagazo enriquecido con el hongo Pleurotus ostreatus, como suplemento en dietas para bovinos, frente a otros tratamientos con y sin suplementación comercial. A todos los animales se les suministró una dieta balanceada que consistía en 18 Kg de pasto king grass (Saccharum sinense, 6 Kg de caña (Saccharum officinarum, 3 Kg de cogollo de caña (Saccharum officinarum, 3 Kg de gallinaza y 0,6 Kg de miel de panela, y suplemento ofrecido ad libitum a los tratamientos que lo requerían. Se analizaron las variables ganancia diaria de peso, conversión alimenticia, consumo de materiaseca y el efecto costo beneficio de la suplementación. No se presentaron diferencias significativas (PNa elaboração da rapadura, entre o 40% e 54% é bagaço, o qual se caracteriza por ter baixa proteína e energia, alto composto lignocelulósicos, acompanhado por uma baixa digestibilidade, portanto, tradicionalmente tem sido usado como combustível para os queimadores. Este trabalho avaliou o uso do bagaço enriquecido com o fungo Pleurotus ostreatus como suplemento em dietas para bovinos, comparado com outros tratamentos com e sem suplementação comercial. Aos animais todos foi subministrado uma dieta equilibrada que consistia de 18 Kg de grama king grass (Saccharum sinense, 6 Kg de cana (Saccharum officinarum, 3 Kg de broto de cana (Saccharum officinarum, 3 Kg de estrume e 0,6 Kg de mel de rapadura e suplemento oferecido ad libitum aos tratamentos que o requeiram. Analisaram-se as variáveis: ganho diário de peso, conversão alimentar e consumo de matéria seca e o efeito de custo benefício da suplementação. Não apresentaram diferen
Gómez-Lama Cabanás, Carmen; Legarda, Garikoitz; Ruano-Rosa, David; Pizarro-Tobías, Paloma; Valverde-Corredor, Antonio; Niqui, José L.; Triviño, Juan C.; Roca, Amalia; Mercado-Blanco, Jesús
2018-01-01
The use of biological control agents (BCA), alone or in combination with other management measures, has gained attention over the past decades, driven by the need to seek for sustainable and eco-friendly alternatives to confront plant pathogens. The rhizosphere of olive (Olea europaea L.) plants is a source of bacteria with potential as biocontrol tools against Verticillium wilt of olive (VWO) caused by Verticillium dahliae Kleb. A collection of bacterial isolates from healthy nursery-produced olive (cultivar Picual, susceptible to VWO) plants was generated based on morphological, biochemical and metabolic characteristics, chemical sensitivities, and on their in vitro antagonistic activity against several olive pathogens. Three strains (PIC25, PIC105, and PICF141) showing high in vitro inhibition ability of pathogens' growth, particularly against V. dahliae, were eventually selected. Their effectiveness against VWO caused by the defoliating pathotype of V. dahliae was also demonstrated, strain PICF141 being the rhizobacteria showing the best performance as BCA. Genotypic and phenotypic traits traditionally associated with plant growth promotion and/or biocontrol abilities were evaluated as well (e.g., phytase, xylanase, catalase, cellulase, chitinase, glucanase activities, and siderophore and HCN production). Multi-locus sequence analyses of conserved genes enabled the identification of these strains as Pseudomonas spp. Strain PICF141 was affiliated to the “Pseudomonas mandelii subgroup,” within the “Pseudomonas fluorescens group,” Pseudomonas lini being the closest species. Strains PIC25 and PIC105 were affiliated to the “Pseudomonas aeruginosa group,” Pseudomonas indica being the closest relative. Moreover, we identified P. indica (PIC105) for the first time as a BCA. Genome sequencing and in silico analyses allowed the identification of traits commonly associated with plant-bacteria interactions. Finally, the root colonization ability of these olive
Yersinia spp. in Wild Rodents and Shrews in Finland.
Joutsen, Suvi; Laukkanen-Ninios, Riikka; Henttonen, Heikki; Niemimaa, Jukka; Voutilainen, Liina; Kallio, Eva R; Helle, Heikki; Korkeala, Hannu; Fredriksson-Ahomaa, Maria
2017-05-01
Yersinia enterocolitica and Yersinia pseudotuberculosis are important zoonotic bacteria causing human enteric yersiniosis commonly reported in Europe. All Y. pseudotuberculosis strains are considered pathogenic, while Y. enterocolitica include both pathogenic and nonpathogenic strains which can be divided into six biotypes (1A, 1B, and 2-5) and about 30 serotypes. The most common types causing yersiniosis in Europe are Y. enterocolitica bioserotypes 4/O:3 and 2/O:9. Strains belonging to biotype 1A are considered as nonpathogenic because they are missing important virulence genes like the attachment-invasion-locus (ail) gene in the chromosome and the virulence plasmid. The role of wild small mammals as a reservoir of enteropathogenic Yersinia spp. is still obscure. In this study, the presence of Yersinia spp. was examined from 1840 wild small mammals, including voles, mice, and shrews, trapped in Finland during a 7-year period. We isolated seven Yersinia species. Y. enterocolitica was the most common species, isolated from 8% of the animals; while most of these isolates represented nonpathogenic biotype 1A, human pathogenic bioserotype 2/O:9 was also isolated from a field vole. Y. pseudotuberculosis of bioserotype 1/O:2 was isolated from two shrews. The ail gene, which is typically only found in the isolates of biotypes 1B and 2-5 associated with yersiniosis, was frequently (23%) detected in the nonpathogenic isolates of biotype 1A and sporadically (6%) in Yersinia kristensenii isolates. Our results suggest that wild small mammals, especially voles, may serve as carriers for ail-positive Y. enterocolitica 1A and Y. kristensenii. We also demonstrate that voles and shrews sporadically excrete pYV-positive Y. enterocolitica 2/O:9 and Y. pseudotuberculosis 1/O:2, respectively, in their feces and, thus, can serve as a contamination source for vegetables by contaminating the soil.
Harada, Kazuki; Shimizu, Takae; Mukai, Yujiro; Kuwajima, Ken; Sato, Tomomi; Kajino, Akari; Usui, Masaru; Tamura, Yutaka; Kimura, Yui; Miyamoto, Tadashi; Tsuyuki, Yuzo; Ohki, Asami; Kataoka, Yasushi
2017-01-01
The emergence of antimicrobial resistance among Enterobacter spp., including resistance to extended-spectrum cephalosporins (ESC), is of great concern in both human and veterinary medicine. In this study, we investigated the prevalence of antimicrobial resistance among 60 isolates of Enterobacter spp., including E. cloacae (n = 44), E. aerogenes (n = 10), and E. asburiae (n = 6), from clinical specimens of dogs and cats from 15 prefectures in Japan. Furthermore, we characterized the resistance mechanisms harbored by these isolates, including extended-spectrum β-lactamases (ESBLs) and plasmid-mediated quinolone resistance (PMQR); and assessed the genetic relatedness of ESC-resistant Enterobacter spp. strains by multilocus sequence typing (MLST) and pulsed-field gel electrophoresis (PFGE). Antimicrobial susceptibility testing demonstrated the resistance rates to ampicillin (93.3%), amoxicillin-clavulanic acid (93.3%), cefmetazole (93.3%), chloramphenicol (46.7%), ciprofloxacin (43.3%), tetracycline (40.0%), ceftazidime (33.3%), cefotaxime (33.3%), trimethoprim/sulfamethoxazole (28.3%), gentamicin (23.3%), and meropenem (0%). Phenotypic testing detected ESBLs in 16 of 18 ESC-resistant E. cloacae isolates but not in the other species. The most frequent ESBL was CTX-M-15 (n = 8), followed by SHV-12 (n = 7), and CTX-M-3 (n = 1). As for AmpC β-lactamases, CMY-2 (n = 2) and DHA-1 (n = 2) were identified in ESC-resistant E. cloacae strains with or without ESBLs. All of the ESC-resistant E. cloacae strains also harbored one or two PMQRs, including qnrB (n = 15), aac(6')-Ib-cr (n = 8), and qnrS (n = 2). Based on MLST and PFGE analysis, E. cloacae clones of ST591-SHV-12, ST171-CTX-M-15, and ST121-CTX-M-15 were detected in one or several hospitals. These results suggested intra- and inter-hospital dissemination of E. cloacae clones co-harboring ESBLs and PMQRs among companion animals. This is the first report on the large-scale monitoring of antimicrobial-resistant isolates
Diversity of Cronobacter spp. isolates from the vegetables in the middle-east coastline of China.
Chen, Wanyi; Yang, Jielin; You, Chunping; Liu, Zhenmin
2016-06-01
Cronobacter spp. has caused life-threatening neonatal infections mainly resulted from consumption of contaminated powdered infant formula. A total of 102 vegetable samples from retail markets were evaluated for the presence of Cronobacter spp. Thirty-five presumptive Cronobacter isolates were isolated and identified using API 20E and 16S rDNA sequencing analyses. All isolates and type strains were characterized using enterobacterial repetitive intergenic consensus sequence PCR (ERIC-PCR), and genetic profiles of cluster analysis from this molecular typing test clearly showed that there were differences among isolates from different vegetables. A polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) based on the amplification of the gyrB gene (1258 bp) was developed to differentiate among Cronobacter species. A new PCR-RFLP assay based on the amplification of the gyrB gene using Alu I and Hinf I endonuclease combination is established and it has been confirmed an accurate and rapid subtyping method to differentiate Cronobacter species. Sequence analysis of the gyrB gene was proven to be suitable for the phylogenetic analysis of the Cronobacter strains, which has much better resolution based on SNPs in the identification of Cronobacter species specificity than PCR-RFLP and ERIC-PCR. Our study further confirmed that vegetables are one of the most common habitats or sources of Cronobacter spp. contamination in the middle-east coastline of China.
Evolution of the RNase P RNA structural domain in Leptospira spp.
Ravishankar, Vigneshwaran; Ahmed, Ahmed; Sivagnanam, Ulaganathan; Muthuraman, Krishnaraja; Karthikaichamy, Anbarasu; Wilson, Herald A; Devendran, Ajay; Hartskeerl, Rudy A; Raj, Stephen M L
2014-12-01
We have employed the RNase P RNA (RPR) gene, which is present as single copy in chromosome I of Leptospira spp. to investigate the phylogeny of structural domains present in the RNA subunit of the tRNA processing enzyme, RNase P. RPR gene sequences of 150 strains derived from NCBI database along with sequences determined from 8 reference strains were examined to fathom strain specific structural differences present in leptospiral RPR. Sequence variations in the RPR gene impacted on the configuration of loops, stems and bulges found in the RPR highlighting species and strain specific structural motifs. In vitro transcribed leptospiral RPR ribozymes are demonstrated to process pre-tRNA into mature tRNA in consonance with the positioning of Leptospira in the taxonomic domain of bacteria. RPR sequence datasets used to construct a phylogenetic tree exemplified the segregation of strains into their respective lineages with a (re)speciation of strain SH 9 to Leptospira borgpetersenii, strains Fiocruz LV 3954 and Fiocruz LV 4135 to Leptospira santarosai, strain CBC 613 to Leptospira kirschneri and strain HAI 1536 to Leptospira noguchii. Furthermore, it allowed characterization of an isolate P2653, presumptively characterized as either serovar Hebdomadis, Kremastos or Longnan to Leptospira weilii, serovar Longnan. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Simone Parola
2017-10-01
Full Text Available Background: Mushrooms produce a large amount of medicinal compounds, and are also an optimal source of fibres, proteins, vitamins (like groups B and D, and other micronutrients including potassium, magnesium, etc. Consequently, mushrooms are commonly considered to be functional foods. Many works report the high biological potentials of medicinal mushrooms involving their antibacterial, hypoglycaemic, anticholesterolemic, radical scavenging, and anti-inflammatory effects. Context and purpose of this study: First off, this work aimed to find strains of Lentinula edodes and Pleurotus ostreatus from a bank of edible mushrooms bought from international strain banks (Table I that could possess health benefit related properties, such as a radical scavenging activity (antioxidant effect, antibacterial effects against common pathogenic bacteria, and being able to produce interesting nutrients and secondary metabolites. As the fungal bank comprises of 20 strains of L. edodes and 20 strains of P. ostreatus, a first screening was made by the selection of 13 strains for each mushroom able to grow in multiple wood types or that were particularly productive and had proved good growth reproducibility over the last 5 years. This work also studied the correlation between culture conditions and mushroom quality in terms of the previously reported properties. Comparison among the selected strains was operated by the assessment of antioxidant and antimicrobial activities after different sample treatments. Furthermore, an initial optimization of the analytic techniques was produced for the direct estimation of important secondary metabolites and nutrients by means of HPLC-MS/MS technique. Further research will encompass an evaluation of transformation processes (drying, freezing, rehydration, cooking, etc. impact on radical scavenging, antibacterial activity, and possible degradation/loss of nutraceutically important substances such as vitamin D2, ergothioneine
Frequency of serovars and antimicrobial resistance in Shigella spp. from Brazil
Directory of Open Access Journals (Sweden)
Gisele Peirano
2006-05-01
Full Text Available A total of 296 Shigella spp. were received from State Public Health Laboratories, during the period from 1999 to 2004, by National Reference Laboratory for Cholera and Enteric Diseases (NRLCED - IOC/Fiocruz, Rio de Janeiro, Brazil. The frequency of Shigella spp. was: S. flexneri (52.7%, S. sonnei (44.2%, S. boydii (2.3%, and S. dysenteriae (0.6%. The most frequent S. flexneri serovars were 2a and 1b. The highest incidence rates of Shigella isolation were observed in the Southeast (39% and Northeast (34% regions and the lowest rate in the South (3% of Brazil. Strains were further analyzed for antimicrobial susceptibility by disk diffusion method as part of a surveillance program on antimicrobial resistance. The highest rates of antimicrobial resistance were to trimethoprim-sulfamethozaxole (90%, tetracycline (88%, ampicillin (56%, and chloramphenicol (35%. The patterns of antimicrobial resistance among Shigella isolates pose a major difficulty in the determination of an appropriate drug for shigellosis treatment. Continuous monitoring of antimicrobial susceptibilities of Shigella spp. through a surveillance system is thus essential for effective therapy and control measures against shigellosis.
Directory of Open Access Journals (Sweden)
Senzosenkosi Surprise MKHIZE
2017-10-01
Full Text Available Abstract The use of supplemented agricultural waste in mushroom cultivation can be one of the environmentally friendly strategies for poverty alleviation. The study evaluated the performance of Pleurotus pulmonarius mushroom grown on maize stalk supplemented with varying levels of wheat bran (WB and maize flour (MF. A completely random design was used for the experiments. It was observed that Pleurotus pulmonarius was significantly affected by varying levels of supplementation, as 20% WB supplementation encountered higher contamination. The lower supplementation levels gave significantly shorter colonisation period with better mycelial growth rate (MGR. The 2% MF, 2% WB and 4% WB gave significantly higher MGR and faster colonisation. The shortest pinning time (TP was observed at the first flush with the minimum of 2 days. Higher supplementation levels gave maximum yield and biological efficiency (BE. With further increase of supplementation above a 12% WB and 14% MF, the BE and yield declined. Lower supplementation levels resulted in quicker colonisation period and improved growth rate, whereas high supplementation gave better production in terms of yield and BE. Therefore, for the purpose of maximum production, 12% WB and 14% MF may be recommended while for fast production time, 2% MF and 2% WB are recommended.
Directory of Open Access Journals (Sweden)
Senzosenkosi Surprise MKHIZE
Full Text Available Abstract Improving the performance of mushroom in terms of high production and fast growth rate is essential in mushroom cultivation. In the present study the performance of Pleurotus ostreatus was evaluated using varying levels of wheat bran (WB and maize flour (MF. The results indicated that Pleurotus ostreatus was highly influenced by different levels of supplementation, with 8% WB, 18% WB and 2% MF having higher contamination rate. The low levels of supplementation gave significantly better mycelial growth rate (MGR and shorter colonisation period as observed that the control had highest MGR whereby 20% MF had lowest MGR. The pinning time (TP was shortest at the first flush with minimum of 3 days (12% MF. The higher levels of supplementation showed maximum biological efficiency (BE such as 14% MF, 12% WB and 14% WB. The yield was also higher at high levels of supplementation such as 20% MF and 8% MF being the exception in the lower levels. Based on the results it was observed that for fast production of oyster mushroom there is no need to supplement the maize stalk substrate but for improved productivity supplements can be added up to certain limits such as 14% MF and 12 WB.
Prevalence of Legionella spp. in water systems of hospitals and hotels in South Western Greece.
Fragou, K; Kokkinos, P; Gogos, C; Alamanos, Y; Vantarakis, A
2012-01-01
The aim of the present study was to determine the prevalence of Legionella spp. in water systems of hospitals and hotels located in South Western Greece, to study the molecular epidemiology of the isolated strains and their possible association with bacterial contamination (total count and Pseudomonas aeruginosa), the water pH, and temperature. A prevalence survey for Legionella spp. by culturing techniques in water distribution systems of eight hospitals and nine hotels occurred in South Western Greece. Water sampling and microbiological analysis were carried out following the ISO methods. Legionella pneumophila was detected in 33% and 36% of the distribution systems of hospitals and hotels, respectively. Our survey results suggest a frequent prevalence of elevated concentrations of Legionella spp. in water systems of hospitals and hotels. Our investigation has confirmed the need to regularly monitor the microbiological condition of water systems in hospitals and hotels.
Sosa, Vanessa; Zunino, Pablo
2013-11-15
Infectious bovine keratoconjunctivitis (IBK) is the most common ocular disease that affects cattle throughout the world and it has a very significant economic impact. IBK is caused by members of the genus Moraxella and therapeutic and preventive measures have shown limited success. Vaccines, most of them chemically inactivated bacterins, generally induce a limited protection. In this study, the genetic diversity of Uruguayan clinical Moraxella bovis and Moraxella bovoculi isolates was assessed by RAPD-PCR, ERIC-PCR and BOX-PCR fingerprinting. Also, antibiotic resistance of the Moraxella spp. isolates was assessed utilizing the disk diffusion method. When interspecific molecular diversity was assessed, different bands patterns were observed even within a single outbreak of IBK, showing the coexistence of different genotypes of Moraxella spp. The high genetic diversity within M. bovis and M. bovoculi isolates did not permit to correlate isolates DNA fingerprints with geographical origins, dates or even with both different Moraxella species. Antibiotics resistance patterns showed significant differences between M. bovis and M. bovoculi. This is the first study of diversity that includes M. bovis and M. bovoculi associated to IBK cases. Genetic diversity did not allow to correlate DNA fingerprints of the isolates with geographical origins, isolation dates or even both different Moraxella species. Antibiotics resistance patterns showed differences between M. bovis and M. bovoculi. This remarkable variation within isolates could explain the partial protection induced by commercial vaccines. All these findings could be important for the design of prevention or treatment strategies against IBK.
Oliveira, Jana Luíza Toscano Mendes de; Diniz, Margareth de Fátima Melo; Lima, Edeltrudes de Oliveira; Souza, Evandro Leite de; Trajano, Vinícius Nogueira; Santos, Bernadete Helena Cavalcante
2009-01-01
This study aimed to evaluate the antibacterial activity of Origanum vulgare L. and O. majorana L. essential oils on Staphylococcus aureus, S. coagulase negative, Enterobacter spp., Proteus spp., Acinetobacter spp., Klebsiella spp. isolated from the patients with conjunctivitis. The results showed a prominent inhibitory effect of both the essential oils on all the bacterial strains, noted by the large bacterial growth inhibition zones (15-32mm). The Minimum Inhibitory Concentrations (MIC) valu...
Directory of Open Access Journals (Sweden)
Zineb Benmechernene
2013-01-01
Full Text Available Two strains (B7 and Z8 of the Leuconostoc mesenteroides subspecies mesenteroides that were isolated from Algerian camel milk from an initial pool of 13 strains and demonstrated a high ability to inhibit the growth of Listeria spp. were selected and characterised at the phenotypic and genotypic levels. Probiotic profiling and inhibition spectra against food borne pathogens in mixed cultures were also investigated. The bacteriocin produced by L. mesenteroides strain B7 was identified as leucocin B by specific PCR. In vitro studies demonstrated that both Leuconostoc mesenteroides strains exhibited a marked probiotic profile, showing high survival at low pH (2-3 and 4 in the presence of 0.5%, 1%, and 2% of bile salts and at pH 3 in the presence of 3 mg/mL pepsin. Susceptibility testing against antimicrobial agents was also performed for both strains. When tested in a mixed culture with Listeria innocua, Listeria ivanovii, or Staphylococcus aureus, strain B7 reduced the numbers of these species by 1.87, 1.78, and 1.38 log units, respectively. Consequently, these two strains were found to possess good probiotic properties in vitro and a high capacity for Listeria spp. inhibition in mixed cultures. Therefore, these strains have a favourable technological aptitude and a potential application as novel probiotic starters.
Directory of Open Access Journals (Sweden)
Realpe-Delgado, María Elena
2016-10-01
Full Text Available Salmonella spp., Campylobacter spp., and L. monocytogenes are zoonotic foodborne pathogens, associated with the consumption of contaminated foods of animal origin. In this study we determined the prevalence and risk factors associated with the presence of these microorganisms at all stages of the production system, in two Colombian poultry companies (EI-EI-I and II. In EI-I, Campylobacter spp., and Salmonella spp., were isolated from 10 % and 4.4 % of the specimens, and S. Heidelberg was the predominant serotype. Salmonella spp., was found in 6 % of hands and stool samples of workers. S. Saphra was the most prevalent serotype. In EI-II, the prevalence of Campylobacter spp., and Salmonella spp., from animal specimens was 7 % and 17 %, respectively. L. monocytogenes was not detected. This study established the prevalence of these zoonotic pathogens through the production chain and showed the presence of pathogen carriers among workers/food handlers. “Lack of medical examination of employees in the previous year” was found to be a possible risk factor for carriage of Salmonella spp.
The Ciprofloxacin Impact on Biofilm Formation by Proteus Mirabilis and P. Vulgaris Strains
Kwiecinska-Pirog, Joanna; Skowron, Krzysztof; Bartczak, Wojciech; Gospodarek-Komkowska, Eugenia
2016-01-01
Background Proteus spp. bacilli belong to opportunistic human pathogens, which are primarily responsible for urinary tract and wound infections. An important virulence factor is their ability to form biofilms that greatly reduce the effectiveness of antibiotics in the site of infection. Objectives The aim of this study was to determine the value of the minimum concentration of ciprofloxacin that eradicates a biofilm of Proteus spp. strains. Materials and Methods A biofilm formation of 20 strains of P. mirabilis and 20 strains of P. vulgaris were evaluated by a spectrophotometric method using 0.1% 2, 3, 5-Triphenyl-tetrazolium chloride solution (TTC, AVANTORTM). On the basis of the results of the absorbance of the formazan, a degree of reduction of biofilm and minimum biofilm eradication (MBE) values of MBE50 and MBE90 were determined. Results All tested strains formed a biofilm. A value of 1.0 μg/mL ciprofloxacin is MBE50 for the strains of both tested species. An MBE90 value of ciprofloxacin for isolates of P. vulgaris was 2 μg/mL and for P. mirabilis was 512 μg/mL. Conclusions Minimum biofilm eradication values of ciprofloxacin obtained in the study are close to the values of the minimal inhibition concentration (MIC). PMID:27303616
Genome sequence of the Lotus spp. microsymbiont Mesorhizobium loti strain R7A.
Kelly, Simon; Sullivan, John; Ronson, Clive; Tian, Rui; Bräu, Lambert; Munk, Christine; Goodwin, Lynne; Han, Cliff; Woyke, Tanja; Reddy, Tatiparthi; Huntemann, Marcel; Pati, Amrita; Mavromatis, Konstantinos; Markowitz, Victor; Ivanova, Natalia; Kyrpides, Nikos; Reeve, Wayne
2014-01-01
Mesorhizobium loti strain R7A was isolated in 1993 in Lammermoor, Otago, New Zealand from a Lotus corniculatus root nodule and is a reisolate of the inoculant strain ICMP3153 (NZP2238) used at the site. R7A is an aerobic, Gram-negative, non-spore-forming rod. The symbiotic genes in the strain are carried on a 502-kb integrative and conjugative element known as the symbiosis island or ICEMlSym(R7A). M. loti is the microsymbiont of the model legume Lotus japonicus and strain R7A has been used extensively in studies of the plant-microbe interaction. This report reveals that the genome of M. loti strain R7A does not harbor any plasmids and contains a single scaffold of size 6,529,530 bp which encodes 6,323 protein-coding genes and 75 RNA-only encoding genes. This rhizobial genome is one of 100 sequenced as part of the DOE Joint Genome Institute 2010 Genomic Encyclopedia for Bacteria and Archaea-Root Nodule Bacteria (GEBA-RNB) project.
Oyster mushroom (Pleurotus spp.) cultivation technique using re ...
African Journals Online (AJOL)
SARAH
2014-08-31
Aug 31, 2014 ... using re-usable substrate containers and comparison of ... oyster mushrooms in combination with other vegetables complements availability of various essential ..... higher than from oyster mushrooms produced from any.
Growth and fruit body formation of Pleurotus ostreatus on media supplemented with inorganic selenium
Directory of Open Access Journals (Sweden)
Savić Milena D.
2009-01-01
Full Text Available Selenium is a trace mineral chemically related to sulfur and tellurium. In the body selenium combines with protein molecules to form selenoproteins and it is distributed in low concentrations and unequally in air, soil and water all over the world. Edible mushrooms are known to be selenium accumulators. Since mushrooms contain relatively high protein levels, and they can accumulate large amounts of selenium, it is reasonable to expect that selenium could be incorporated into proteins. The growth of mycelia and fruit body formation of different medicinal mushroom strains of Pleurotus ostreatus (Hk-35 and P70 over the wide range of concentrations of inorganic form of selenium were examined. Mushrooms were cultivated on agar base media and on substrates based on sawdust. Vegetative growths of mycelium were measured as colony diameter in pure cultures supplemented with inorganic form of Se supplements, prepared as Na2SeO4 and Na2SeO3 in concentrations of: 1, 10, 25, 50, 75, 100 and 150 mg/l. Inorganic form of Se supplements, showed stimulation effects (in concentration of 1-50 mg/l and toxic effects in higher concentration. On the standard industrial sawdust based substrate, supplemented with 100 mg/kg Na2SeO4 and Na2SeO3, accumulation of Se in fruit bodies was determined by the method of flameless atomic absorption spectrophotometer. The readings were performed on Varian SpectrAA-10 spectrophotometer equipped with VGA-76. Se as Na2SeO4 and Na2SeO3 was effectively taken up from substrates and accumulated in fruit bodies. Mushrooms accumulated selenium between 120 and 250 mg/kg dry weight. In mushrooms cultivated without Se supplement, Se contents were only about 1 mg/kg and in substrate about 0.1 mg/kg.
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
Directory of Open Access Journals (Sweden)
Clenderson Corradi de Mattos Gonçalves
2010-02-01
Full Text Available O resíduo proveniente do beneficiamento do algodão em lixadeiras na indústria têxtil é um material rico em lignocelulose, tem baixa digestibilidade e é pobre em proteínas e minerais, o que dificulta seu uso 'in natura' na alimentação de ruminantes. Neste tarbalho, objetivou-se avaliar a produtividade e eficiência biológica deste resíduo de algodão na produção do cogumelo comestível Pleurotus sajor-caju e avaliar as alterações promovidas no resíduo para alimentação de ruminantes. Foram realizados 5 tratamentos: T1- 80% de serragem de eucalipto + 20% de farelo de trigo (testemunha; T2- 50% de resíduo de algodão + 50% de serragem; T3- 45% de resíduo + 45% serragem + 10% de farelo; T4- 40% de resíduo + 40% serragem + 20% de farelo e T5- 80% de resíduo + 20% de farelo. O T5 apresentou os melhores resultados para produtividade (22,46% e eficiência biológica (71,48% do Pleurotus sajor-caju. O fungo alterou a constituição dos substratos nos estágios de produção do cogumelo, principalmente os constituintes da fibra e agregou N ao substrato. Dessa forma, o uso do resíduo de lixadeira de algodão no cultivo de Pleurotus sajor-caju pode se tornar uma alternativa viável para produção de cogumelo e melhorar a qualidade deste resíduo para alimentação animal.The waste coming from cotton processing in mills in the textile industry is a lignocellulose-rich material, but has low digestibility, and is poor in proteins and minerals, making it inappropriate for ruminant feeding. This study was intended to evaluate the productivity and biologic efficiency of cotton textile mill waste in the production of the edible mushroom Pleurotus sajor-caju, and to evaluate the alterations brought about in the waste for use in ruminant feeding. Five treatments were undertaken in the following manner: T1- 80% eucalyptus sawdust + 20% wheat bran (control; T2- 50% waste + 50% sawdust; T3- 45% waste + 45% sawdust + 10% wheat bran; T4- 40% waste
Directory of Open Access Journals (Sweden)
Seyyedeh Hoorieh Fallah
2013-01-01
Full Text Available Background: Salmonellosis is one of the most common food borne diseases in industrial and developing countries. In recent years, an increase in antimicrobial drug resistance, among non-typhoid Salmonella spp has been observed. Objectives: The aim of this study was to isolate and determine antibiotic resistance pattern in non-typhoid Salmonella spp. Materials and Methods: This descriptive study was done on 100 samples of chickens collected from 196 retail markets and was examined for the presence of Salmonella using standard bacteriological procedures and stereotyping kit. Antimicrobial susceptibility testing was performed by disk diffusion methods according to the National Committee for Clinical Laboratory Standards (CLSI. The data were analyzed by using the SPSS software version 18. Result: Forty- four percent of samples were contaminated with Salmonella infection and 56% didn’t have any contamination. The stereotyping results showed that 34 of 44 isolates of Salmonella belonged to Salmonella infantis (79.5 %, one strain (2.3% of group C and 8 strain (18.2% of group D. However, all these strains were sensitive to Cefotaxime and Ciprofloxacin, and 100% were resistant to Nalidixic acid, Tetracyclin and Sterptomycin. The most common resistance pattern (34.1% was towards six antibiotics, and 6.8% of strains were resistant to at least three antibiotics. Conclusion: High levels of resistance to antibiotics that are used commonly for human and poultry can be a warning for our community health and this information must be used to form important strategies for improvement of infection control.
Expression of Heterologous Cellulases in Thermotoga sp. Strain RQ2
Directory of Open Access Journals (Sweden)
Hui Xu
2015-01-01
Full Text Available The ability of Thermotoga spp. to degrade cellulose is limited due to a lack of exoglucanases. To address this deficiency, cellulase genes Csac_1076 (celA and Csac_1078 (celB from Caldicellulosiruptor saccharolyticus were cloned into T. sp. strain RQ2 for heterologous overexpression. Coding regions of Csac_1076 and Csac_1078 were fused to the signal peptide of TM1840 (amyA and TM0070 (xynB, resulting in three chimeric enzymes, namely, TM1840-Csac_1078, TM0070-Csac_1078, and TM0070-Csac_1076, which were carried by Thermotoga-E. coli shuttle vectors pHX02, pHX04, and pHX07, respectively. All three recombinant enzymes were successfully expressed in E. coli DH5α and T. sp. strain RQ2, rendering the hosts with increased endo- and/or exoglucanase activities. In E. coli, the recombinant enzymes were mainly bound to the bacterial cells, whereas in T. sp. strain RQ2, about half of the enzyme activities were observed in the culture supernatants. However, the cellulase activities were lost in T. sp. strain RQ2 after three consecutive transfers. Nevertheless, this is the first time heterologous genes bigger than 1 kb (up to 5.3 kb in this study have ever been expressed in Thermotoga, demonstrating the feasibility of using engineered Thermotoga spp. for efficient cellulose utilization.
Wu, Qingzhong; McFee, Wayne E; Goldstein, Tracey; Tiller, Rebekah V; Schwacke, Lori
2014-05-01
Rapid detection of Brucella spp. in marine mammals is challenging. Microbiologic culture is used for definitive diagnosis of brucellosis, but is time consuming, has low sensitivity and can be hazardous to laboratory personnel. Serological methods can aid in diagnosis, but may not differentiate prior exposure versus current active infection and may cross-react with unrelated Gram-negative bacteria. This study reports a real-time PCR assay for the detection of Brucella spp. and application to screen clinical samples from bottlenose dolphins stranded along the coast of South Carolina, USA. The assay was found to be 100% sensitive for the Brucella strains tested, and the limit of detection was 0.27fg of genomic DNA from Brucella ceti B1/94 per PCR volume. No amplification was detected for the non-Brucella pathogens tested. Brucella DNA was detected in 31% (55/178) of clinical samples tested. These studies indicate that the real-time PCR assay is highly sensitive and specific for the detection of Brucella spp. in bottlenose dolphins. We also developed a second real-time PCR assay for rapid identification of Brucella ST27, a genotype that is associated with human zoonotic infection. Positive results were obtained for Brucella strains which had been identified as ST27 by multilocus sequence typing. No amplification was found for other Brucella strains included in this study. ST27 was identified in 33% (18/54) of Brucella spp. DNA-positive clinical samples. To our knowledge, this is the first report on the use of a real-time PCR assay for identification of Brucella genotype ST27 in marine mammals. Copyright © 2014 Elsevier B.V. All rights reserved.
Genetic diversity of Hepatozoon spp. in coyotes from the south-central United States.
Starkey, Lindsay A; Panciera, Roger J; Paras, Kelsey; Allen, Kelly E; Reiskind, Michael H; Reichard, Mason V; Johnson, Eileen M; Little, Susan E
2013-04-01
To better define the strains and species of Hepatozoon that infect coyotes in the south-central United States, whole blood and muscle samples were collected from 44 coyotes from 6 locations in Oklahoma and Texas. Samples were evaluated by a nested polymerase chain reaction (PCR) using primers amplifying a variable region of the apicomplexan 18S rRNA gene as well as histopathology (muscle only) for presence of tissue cysts. Hepatozoon spp. infections were identified in 79.5% (35/44) of coyotes tested including 27 of 44 (61.4%) whole blood samples and 17 of 44 (38.6%) muscle samples tested by PCR and 23 of 44 (52.3%) muscle samples evaluated by histological examination. Analysis revealed 19 distinct sequences comprising 3 major clusters of Hepatozoon spp., i.e., 1 most closely related to Hepatozoon americanum, another most closely related to Hepatozoon canis , and the third an intermediate between the 2 groups. The diversity of Hepatozoon spp. in wild canids appears greater than previously recognized and warrants further investigation.
Fouad, A F; Kum, K-Y; Clawson, M L; Barry, J; Abenoja, C; Zhu, Q; Caimano, M; Radolf, J D
2003-08-01
Eubacterium spp. and Streptococcus spp. are virulent, commonly identified microorganisms in endodontic infections. The purpose of this study was to use molecular methods to identify these organisms in 22 infected root canals that include eight cases with preoperative clinical symptoms and five cases with a history of diabetes mellitus. The presence of Streptococcus spp. and Eubacterium spp. was examined using two sets of PCR primers specific with multiple species within the respective genera. Positive specimens had their PCR products sequenced and phylogenetically analyzed to identify the specific species. Sixteen specimens (73%) contained Eubacterium spp. and nine (41%) were positive for Streptococcus spp. Eubacterium infirmum was the most prevalent Eubacterium sp. This organism was significantly associated with a history of diabetes (OR = 9.6; P = 0.04). Streptococcus anginosus was the most common Streptococcus sp., but neither it nor any of the other streptococci were significantly associated with the clinical parameters evaluated.
Das, Sarbashis; Pettersson, B M Fredrik; Behra, Phani Rama Krishna; Ramesh, Malavika; Dasgupta, Santanu; Bhattacharya, Alok; Kirsebom, Leif A
2015-06-16
We provide the genome sequences of the type strains of the polychlorophenol-degrading Mycobacterium chlorophenolicum (DSM43826), the degrader of chlorinated aliphatics Mycobacterium chubuense (DSM44219) and Mycobacterium obuense (DSM44075) that has been tested for use in cancer immunotherapy. The genome sizes of M. chlorophenolicum, M. chubuense, and M. obuense are 6.93, 5.95, and 5.58 Mb with GC-contents of 68.4%, 69.2%, and 67.9%, respectively. Comparative genomic analysis revealed that 3,254 genes are common and we predicted approximately 250 genes acquired through horizontal gene transfer from different sources including proteobacteria. The data also showed that the biodegrading Mycobacterium spp. NBB4, also referred to as M. chubuense NBB4, is distantly related to the M. chubuense type strain and should be considered as a separate species, we suggest it to be named Mycobacterium ethylenense NBB4. Among different categories we identified genes with potential roles in: biodegradation of aromatic compounds and copper homeostasis. These are the first nonpathogenic Mycobacterium spp. found harboring genes involved in copper homeostasis. These findings would therefore provide insight into the role of this group of Mycobacterium spp. in bioremediation as well as the evolution of copper homeostasis within the Mycobacterium genus. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
[MALDI-TOF MASS-SPECTROMETRIC ANAIYSIS OF LEPTOSPIRA SPP. USED IN SERODIAGNOSTICS OF LEPTOSPIROSIS].
Zyeva, E V; Stoyanova, N A; Tokarevich, N K; Totolyan, Areg A
2015-01-01
Creation of a classification model of Leptospira spp. serovar model using ClinProTools 3.0 software and evaluation of use of MALDI-TOF MS as a method of quality control of reference strains of leptospira. 10 reference strains of Leptospira spp. were used in the study according to microscopic agglutination reaction from the collection of Pasteur RIEM. All the strains were cultivated for 10 days in Terskikh medium at 28 degrees C. Cell extracts were obtained by ethanol/formic acid method. α-cyano-4-hydroxycinnamic acid solution was used as a matrix. Mass-spectra were obtained in Microflex mass-spectrometer (Bruker Daltonics, Germany). External validation of the test-model was carried out using novel spectra of every reference strain during their repeated reseeding. Values of cross-validation and confirmatory ability of the optimal model, built on a genetic algorithm, was 99.14 and 100%, respectively. This model contained 11 biomarker peaks (m/z 2959, 3447, 3548, 3764, 3895, 5221, 5917, 6173, 6701, 7013, 8364) for serovar classification. Results of the external validation have shown a 100% correct classification in serovar classesin Sejroe, Ballum, Tarassovi; Copenhageni, Mozdoc, Grippotyphosa and Patoc, that indicates a high prognostic ability of the model in these classes. However, data from verification matrix have shown, that 50%.of the spectra from Canicola and Pomona serovars were classified as Patoc class, that could be associated with cross serological activity of Patoc serovar L. biflexa with pathogenic leptospirae. MALDI-TOF mass-spectrometry method combined with building and using the classification model could be a useful instrument for intra-laboratory control of leptospira reseeding.
Villarruel-López, Angélica; Fernández-Rendón, Elizabeth; Mota-de-la-Garza, Lydia; Ortigoza-Ferado, Jorge
2005-01-01
The frequency of Aeromonas spp in three wastewater-treatment plants (WWTPs) and two drinking-water plants (DWPs) in México City was determined. Samples were taken throughout a year by the Moore's swab technique. A total of 144 samples were obtained from WWTPs and 96 from DWPs of both incoming and outflowing water. Aeromonas spp was isolated in 31% of the samples, from both kinds of sources. The technique used for the isolation of the pathogen was suitable for samples with high associate microbiota content and for those with a scarce microbial content. The presence of mesophilic-aerobic, coliform, and fecal-coliform organisms was investigated to determine whether there was any correlation with the presence of Aeromonas spp. Most samples from WWTP, which did not comply with the Mexican standards, had the pathogen, and some of the samples from the outflow of the DWP, which were within the limits set by the Mexican standards, also had Aeromonas spp. Most samples containing Aeromonas spp. had concentrations below 0.1 ppm residual chlorine, and the strains were resistant to 0.3 ppm, which supports the recommendation to increase the residual chlorine concentration to 0.5 to 1.0 ppm, as recommended by the Mexican standards.
Chavda, Kalyan D; Chen, Liang; Fouts, Derrick E; Sutton, Granger; Brinkac, Lauren; Jenkins, Stephen G; Bonomo, Robert A; Adams, Mark D; Kreiswirth, Barry N
2016-12-13
Knowledge regarding the genomic structure of Enterobacter spp., the second most prevalent carbapenemase-producing Enterobacteriaceae, remains limited. Here we sequenced 97 clinical Enterobacter species isolates that were both carbapenem susceptible and resistant from various geographic regions to decipher the molecular origins of carbapenem resistance and to understand the changing phylogeny of these emerging and drug-resistant pathogens. Of the carbapenem-resistant isolates, 30 possessed bla KPC-2 , 40 had bla KPC-3 , 2 had bla KPC-4 , and 2 had bla NDM-1 Twenty-three isolates were carbapenem susceptible. Six genomes were sequenced to completion, and their sizes ranged from 4.6 to 5.1 Mbp. Phylogenomic analysis placed 96 of these genomes, 351 additional Enterobacter genomes downloaded from NCBI GenBank, and six newly sequenced type strains into 19 phylogenomic groups-18 groups (A to R) in the Enterobacter cloacae complex and Enterobacter aerogenes Diverse mechanisms underlying the molecular evolutionary trajectory of these drug-resistant Enterobacter spp. were revealed, including the acquisition of an antibiotic resistance plasmid, followed by clonal spread, horizontal transfer of bla KPC -harboring plasmids between different phylogenomic groups, and repeated transposition of the bla KPC gene among different plasmid backbones. Group A, which comprises multilocus sequence type 171 (ST171), was the most commonly identified (23% of isolates). Genomic analysis showed that ST171 isolates evolved from a common ancestor and formed two different major clusters; each acquiring unique bla KPC -harboring plasmids, followed by clonal expansion. The data presented here represent the first comprehensive study of phylogenomic interrogation and the relationship between antibiotic resistance and plasmid discrimination among carbapenem-resistant Enterobacter spp., demonstrating the genetic diversity and complexity of the molecular mechanisms driving antibiotic resistance in this
Misharina, T A; Mukhutdinova, S M; Zharikova, G G; Terenina, M B; Krikunova, N I
2009-01-01
The composition of aroma compounds in cooked and canned cepe (Boletus edulis) and in cooked oyster mushrooms (Pleurotus ostreatus) is studied using capillary gas chromatography and chromatography-mass spectrometry. It is found that unsaturated alcohols and ketones containing eight atoms of carbon determine the aroma of raw mushrooms and take part in the formation of the aroma of cooked mushrooms as well. The content of these compounds was the highest in canned cepes. In oyster mushrooms, the concentration of these alcohols and ketones was lower in comparison with cepes. The content of aliphatic and aromatic aldehydes was much higher in oyster mushrooms. Volatile aliphatic and heterocyclic Maillard reaction products and isomeric octenols and octenones formed the aroma of cooked and canned mushrooms.
Potočnik, Ivana; Stepanović, Miloš; Rekanović, Emil; Todorović, Biljana; Milijašević-Marčić, Svetlana
2015-01-01
The most commonly cultivated basidiomycetes worldwide and in Serbia are button mushroom (Agaricus bisporus), oyster mushroom (Pleurotus sp.) and shiitake (Lentinus edodes). Production of their fruiting bodies is severely afflicted by fungal, bacterial, and viral pathogens that are able to cause diseases which affect yield and quality. Major A. bisporus fungal pathogens include Mycogone perniciosa, Lecanicillium fungicola, and Cladobotryum spp., the causal a...
Directory of Open Access Journals (Sweden)
Chih-Yuan eChiang
2015-07-01
Full Text Available Burkholderia is a diverse genus of Gram-negative bacteria that cause high mortality rate in humans and cattle. The lack of effective therapeutic treatments poses serious public health threats. Insights toward host-Burkholderia spp. interaction are critical in understanding the pathogenesis of the infection as well as identifying therapeutic targets for drug development. Reverse-phase protein microarray (RPMA technology was previously proven to characterize novel biomarkers and molecular signatures associated with infectious diseases and cancers. In the present study, this technology was utilized to interrogate changes in host protein expression and post-translational phosphorylation events in macrophages infected with a collection of geographically diverse strains of Burkholderia spp. The expression or phosphorylation state of 25 proteins was altered during Burkholderia spp. infections and of which eight proteins were selected for further validation by immunoblotting. Kinetic expression patterns of phosphorylated AMPK-α1, Src, and GSK3β suggested the importance of their roles in regulating Burkholderia spp. mediated innate immune responses. Modulating inflammatory responses by perturbing AMPK-α1, Src, and GSK3β activities may provide novel therapeutic targets for future treatments.
Shi, Jun-yan; Xu, Ying-chun; Shi, Yi; Lü, Huo-xiang; Liu, Yong; Zhao, Wang-sheng; Chen, Dong-mei; Xi, Li-yan; Zhou, Xin; Wang, He; Guo, Li-na
2010-10-01
During recent years, the incidence of serious infections caused by opportunistic fungi has increased dramatically due to alterations of the immune status of patients with hematological diseases, malignant tumors, transplantations and so forth. Unfortunately, the wide use of triazole antifungal agents to treat these infections has lead to the emergence of Aspergillus spp. resistant to triazoles. The present study was to assess the in vitro activities of five antifungal agents (voriconazole, itraconazole, posaconazole, amphotericin B and caspofungin) against different kinds of Aspergillus spp. that are commonly encountered in the clinical setting. The agar-based Etest MIC method was employed. One hundred and seven strains of Aspergillus spp. (5 species) were collected and prepared according to Etest Technique Manuel. Etest MICs were determined with RPMI agar containing 2% glucose and were read after incubation for 48 hours at 35°C. MIC(50), MIC(90) and MIC range were acquired by Whonet 5.4 software. The MIC(90) of caspofungin against A. fumigatus, A. flavus and A. nidulans was 0.094 µg/ml whereas the MIC(90) against A. niger was 0.19 µg/ml. For these four species, the MIC(90) of caspofungin was the lowest among the five antifungal agents. For A. terrus, the MIC(90) of posaconazole was the lowest. For A. fumigatus and A. flavus, the MIC(90) in order of increasing was caspofungin, posaconazole, voriconazole, itraconazole, and amphotericin B. The MIC of amphotericin B against A. terrus was higher than 32 µg/ml in all 7 strains tested. The in vitro antifungal susceptibility test shows the new drug caspofungin, which is a kind of echinocandins, has good activity against the five species of Aspergillus spp. and all the triazoles tested have better in vitro activity than traditional amphotericin B.
Effect of storage temperatures and stresses on the survival of Salmonella spp. in halva.
Osaili, T M; Al-Nabulsi, A A; Nazzal, D S; Shaker, R R
2017-11-01
The presence of Salmonella spp. in halva has been associated with foodborne illnesses and product recalls from the markets. This study investigated the effect of environmental stresses on the survival of Salmonella spp. in halva during storage for 12 months at 10 and 25°C (log (N 0 /N) g -1 ). Halva samples were inoculated with a cocktail of four strains of unstressed, desiccation stressed or heat stressed Salmonella (10 6 -10 7 CFU per gram). In general, survival of Salmonella spp. in halva decreased significantly (P ˂ 0·05) as storage time and temperature increased. At the end of halva shelf life at 10°C, the initial populations of unstressed, desiccation stressed or heat stressed Salmonella spp. decreased by 2·7, 2·6 or 2·8 log CFU per gram (reduction rate c. 0·2 log CFU per month), respectively. While at 25°C, the populations decreased 5·2, 6·7 or 6·3 log CFU per gram, respectively (reduction rate c. 0·4-0·5 log CFU per month). The populations of stressed Salmonella spp. in halva samples were not significantly different (P ≥ 0·05) from populations of unstressed cells during storage at 10 and 25°C, except during the last 3 months of storage at 25°C when populations of unstressed cells were higher (P Salmonella spp. to desiccation or heat stress prior product contamination may play a role in Salmonella spp. survival in halva during storage. Contamination of halva (tahini halva) with Salmonella from raw materials or during production was documented. Halva and tahini have been involved in salmonellosis outbreaks in different countries. The study demonstrated enhanced survivability of stressed and unstressed Salmonella spp. in halva over a 12-month storage period at 10 and 25°C with lower log reductions than expected. Exposing Salmonella spp. to desiccation or heat stress prior product contamination may play a role in microbial survival in halva during storage. These findings serve as a model to halva producers to implement control
The potential of Pleurotus-treated olive mill solid waste as cattle feed.
Shabtay, Ariel; Hadar, Yitzhak; Eitam, Harel; Brosh, Arieh; Orlov, Alla; Tadmor, Yaakov; Izhaki, Ido; Kerem, Zohar
2009-12-01
The aims of the current study were to follow: (1) the capability of the edible mushroom Pleurotus ostreatus to degrade cell wall components and soluble phenols of the olive mill solid waste (OMSW), and improve it for ruminant nutrition (2) the fate of oil and the lipid-soluble compounds tocopherols, squalene and beta-sitosterol in the fermented OMSW. A significant decrease in oil and lipid-soluble compounds with a concomitant shift in the fatty acid profile and degradation of soluble phenols took place already after 14 d. The utilization of lipids by the fungus shifted the degradation of the structural carbohydrates to a later stage, and significantly reduced the metabolizable energy of the OMSW. We propose that edible fungi with reduced lipase activity would preserve the energy and health promoting ingredients of the oil, and force the fungus to degrade structural carbohydrates, thus improving its digestibility.
Colony Dimorphism in Bradyrhizobium Strains
Sylvester-Bradley, Rosemary; Thornton, Philip; Jones, Peter
1988-01-01
Ten isolates of Bradyrhizobium spp. which form two colony types were studied; the isolates originated from a range of legume species. The two colony types differed in the amount of gum formed or size or both, depending on the strain. Whole 7-day-old colonies of each type were subcultured to determine the proportion of cells which had changed to the other type. An iterative computerized procedure was used to determine the rate of switching per generation between the two types and to predict proportions reached at equilibrium for each strain. The predicted proportions of the wetter (more gummy) or larger colony type at equilibrium differed significantly between strains, ranging from 0.9999 (strain CIAT 2383) to 0.0216 (strain CIAT 2469), because some strains switched faster from dry to wet (or small to large) and others switched faster from wet to dry (or large to small). Predicted equilibrium was reached after about 140 generations in strain USDA 76. In all but one strain (CIAT 3030) the growth rate of the wetter colony type was greater than or similar to that of the drier type. The mean difference in generation time between the two colony types was 0.37 h. Doubling times calculated for either colony type after 7 days of growth on the agar surface ranged from 6.0 to 7.3 h. The formation of two persistent colony types by one strain (clonal or colony dimorphism) may be a common phenomenon among Bradyrhizobium strains. Images PMID:16347599
Genetic and phenotypic characterization of Saccharomyces spp. strains isolated in distillery plants.
Úbeda, Juan F; Chacón-Ocaña, Maria; Díaz-Hellín, Patricia; Ramírez-Pérez, Hector; Briones, Ana
2016-06-01
In this study, the biodiversity and some interesting phenotypic properties of Saccharomyces wild yeasts isolated in distilleries, at least 100 years old, located in La Mancha (Spain), were determined. Strains were genetically characterized by RFLP-mtDNA, which confirmed a great genetic biodiversity with 73% of strains with different mtDNA profiles, highlighting the large variability found in sweet and fermented piquette substrata. The predominant species identified was S. cerevisiae, followed by S. paradoxus and S. bayanus Due to the residual sugar-alcohol extraction process using warm water, a great number of thermophilic Saccharomyces strains with a great cell vitality were found to have potential use as starters in distillery plants. Interesting technological properties such as cell vitality and growth rate at different temperatures were studied. The thermal washing process for the extraction of alcohol and reducing sugars of some raw materials contributes to the presence of Saccharomyces strains with technologically interesting properties, especially in terms of vitality and resistance to high temperatures. Due to the fact that fermentation is spontaneous, the yeast biota of these environments, Saccharomyces and non-Saccharomyces, is very varied so these ecological niches are microbial reserves of undoubted biotechnological interest. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Naila, Ishmatun; Purnomo, Adi Setyo
2016-01-01
Penelitian ini bertujuan untuk mengetahui pengaruh ampas tebu dan alang-alang (Imperata cylindrica) sebagai media pertumbuhan jamur tiram putih (Pleurotus ostreatus) terhadap kandungan nutrisinya. Ampas tebu dan alang-alang dipilih sebagai media pertumbuhan alternatif, karena tidak hanya mengandung lignoseluosa, tapi juga tersedia berlimpah di lingkungan. Variasi komposisi ampas tebu:alang-alang yang digunakan adalah 75:25 (A1); 50:50 (A2); 25:75 (A3); 0:100 (A4); dan 100:0 (A5). Pada penelit...
Response of ligninolytic macrofungi to the herbicide atrazine: dose-response bioassays.
Cupul, Wilberth Chan; Abarca, Gabriela Heredia; Vázquez, Refugio Rodríguez; Salmones, Dulce; Hernández, Rigoberto Gaitán; Gutiérrez, Enrique Alarcón
2014-01-01
The effect of atrazine concentrations on mycelial growth and ligninolytic enzyme activities of eight native ligninolytic macrofungi isolated in Veracruz, México, were evaluated in a semi-solid culture medium. Inhibition of mycelial growth and growth rates were significantly affected (p=0.05) by atrazine concentrations (468, 937, 1875, and 3750 mg/l). In accordance with the median effective concentration (EC50), Pleurotus sp. strain 1 proved to be the most tolerant isolate to atrazine (EC50=2281.0 mg/l), although its enzyme activity was not the highest. Pycnoporus sanguineus strain 2, Daedalea elegans and Trametes maxima showed high laccase activity (62.7, 31.9, 29.3 U mg/protein, respectively) without atrazine (control); however, this activity significantly increased (p<0.05) (to 191.1, 83.5 and 120.6 U mg/protein, respectively) owing to the effect of atrazine (937 mg/l) in the culture medium. Pleurotus sp. strain 2 and Cymatoderma elegans significantly increased (p<0.05) their manganese peroxidase (MnP) activities under atrazine stress at 468 mg/l. The isolates with high EC50 (Pleurotus sp. strain 1) and high enzymatic activity (P. sanguineus strain 2 and T. maxima) could be considered for future studies on atrazine mycodegradation. Furthermore, this study confirms that atrazine can increase laccase and MnP activities in ligninolytic macrofungi. Copyright © 2014 Asociación Argentina de Microbiología. Publicado por Elsevier España. All rights reserved.
Guglielmo, F; Bergemann, S E; Gonthier, P; Nicolotti, G; Garbelotto, M
2007-11-01
The goal of this research was the development of a PCR-based assay to identify important decay fungi from wood of hardwood tree species in northern temperate regions. Eleven taxon-specific primers were designed for PCR amplification of either nuclear or mitochondrial ribosomal DNA regions of Armillaria spp., Ganoderma spp., Hericium spp., Hypoxylon thouarsianum var. thouarsianum, Inonotus/Phellinus-group, Laetiporus spp., Perenniporia fraxinea, Pleurotus spp., Schizophyllum spp., Stereum spp. and Trametes spp. Multiplex PCR reactions were developed and optimized to detect fungal DNA and identify each taxon with a sensitivity of at least 1 pg of target DNA in the template. This assay correctly identified the agents of decay in 82% of tested wood samples. The development and optimization of multiplex PCRs allowed for reliable identification of wood rotting fungi directly from wood. Early detection of wood decay fungi is crucial for assessment of tree stability in urban landscapes. Furthermore, this method may prove useful for prediction of the severity and the evolution of decay in standing trees.
Zarnowiec, Paulina; Mizera, Andrzej; Chrapek, Magdalena; Urbaniak, Mariusz; Kaca, Wieslaw
2016-07-01
Proteus spp. strains are some of the most important pathogens associated with complicated urinary tract infections and bacteremia affecting patients with immunodeficiency and long-term urinary catheterization. For epidemiological purposes, various molecular typing methods have been developed for this pathogen. However, these methods are labor intensive and time consuming. We evaluated a new method of differentiation between strains. A collection of Proteus spp. strains was analyzed by attenuated total reflectance Fourier transform infrared (ATR FT-IR) spectroscopy in the mid-infrared region. ATR FT-IR spectroscopy used in conjunction with a diamond ATR accessory directly produced the biochemical profile of the surface chemistry of bacteria. We conclude that a combination of ATR FT-IR spectroscopy and mathematical modeling provides a fast and reliable alternative for discrimination between Proteus isolates, contributing to epidemiological research. © The Author(s) 2016.
Kuo, Chun Wei; Hao Huang, Kuan; Hsu, Bing Mu; Tsai, Hsien Lung; Tseng, Shao Feng; Kao, Po Min; Shen, Shu Min; Chou Chiu, Yi; Chen, Jung Sheng
2013-04-01
Salmonella is one of the most important pathogens of waterborne diseases with outbreaks from contaminated water reported worldwide. In addition, Salmonella spp. can survive for long periods in aquatic environments. To realize genotypes and serovars of Salmonella in aquatic environments, we isolated the Salmonella strains by selective culture plates to identify the serovars of Salmonella by serological assay, and identify the genotypes by Multilocus sequence typing (MLST) based on the sequence data from University College Cork (UCC), respectively. The results show that 36 stream water samples (30.1%) and 18 drinking water samples (23.3%) were confirmed the existence of Salmonella using culture method combined PCR specific invA gene amplification. In this study, 24 cultured isolates of Salmonella from water samples were classified to fifteen Salmonella enterica serovars. In addition, we construct phylogenetic analysis using phylogenetic tree and Minimum spanning tree (MST) method to analyze the relationship of clinical, environmental, and geographical data. Phylogenetic tree showed that four main clusters and our strains can be distributed in all. The genotypes of isolates from stream water are more biodiversity while comparing the Salmonella strains genotypes from drinking water sources. According to MST data, we can found the positive correlation between serovars and genotypes of Salmonella. Previous studies revealed that the result of Pulsed field gel electrophoresis (PFGE) method can predict the serovars of Salmonella strain. Hence, we used the MLST data combined phylogenetic analysis to identify the serovars of Salmonella strain and achieved effectiveness. While using the geographical data combined phylogenetic analysis, the result showed that the dominant strains were existed in whole stream area in rainy season. Keywords: Salmonella spp., MLST, phylogenetic analysis, PFGE
Directory of Open Access Journals (Sweden)
Paola Mendes Milanesi
2013-12-01
Full Text Available This study aimed i to quantify the occurrence of Fusarium spp. and Trichoderma spp. in rhizospheric soil, with and without symptoms of Sudden Death Syndrome (SDS in eight soybean genotypes; ii morphologically identify isolates of Fusarium spp. from roots with SDS; iii evaluate the antagonism between Trichoderma spp. and Fusarium spp. isolates from rhizospheric soil and roots from with and without SDS, respectively; and iv characterize through the ITS1-5.8S-ITS2 region of rDNA the isolates of Trichoderma spp. with better performance in the direct confrontation. The sampling of soil and roots was performed in an experimental area located in Cruz Alta, RS, Brazil. In the laboratory, serial dilutions of soil samples, counting of the number of Colony Forming Units (UFCs/g-1 of rhizospheric soil were performed as well as isolation for identification of isolates of Fusarium spp. and Trichoderma spp. and testing of direct confrontation. There were significant differences between the population of Trichoderma spp. in the rhizosphere of plants with and without symptoms of SDS. For the population of Fusarium spp., significant difference was observed only in the rhizosphere of plants without symptoms of SDS. In diseased roots the following species were identified: F. solani, F. avenaceum, F. graminearum, F. oxysporum and F. verticillioides. In the test of direct confrontation, eight isolates of Trichoderma spp. achieved the best performance in the antagonism to Fusarium spp. and Trichoderma spp. from areas with symptoms of SDS had a higher control efficiency in vitro. These isolates showed high similarity to the species of T. koningii agregate.
Degradation of oxo-biodegradable plastic by Pleurotus ostreatus.
da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Nunes, Mateus Dias; da Silva, Marliane de Cássia Soares; Kasuya, Maria Catarina Megumi
2013-01-01
Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV) or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W) plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate.
Degradation of oxo-biodegradable plastic by Pleurotus ostreatus.
Directory of Open Access Journals (Sweden)
José Maria Rodrigues da Luz
Full Text Available Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate.
Degradation of Oxo-Biodegradable Plastic by Pleurotus ostreatus
da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Nunes, Mateus Dias; da Silva, Marliane de Cássia Soares; Kasuya, Maria Catarina Megumi
2013-01-01
Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV) or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W) plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate. PMID:23967057
New lipases by mining of Pleurotus ostreatus genome.
Directory of Open Access Journals (Sweden)
Alessandra Piscitelli
Full Text Available The analysis of Pleurotus ostreatus genome reveals the presence of automatically annotated 53 lipase and 34 carboxylesterase putative coding-genes. Since no biochemical or physiological data are available so far, a functional approach was applied to identify lipases from P. ostreatus. In the tested growth conditions, four lipases were found expressed, with different patterns depending on the used C source. Two of the four identified proteins (PleoLip241 and PleoLip369, expressed in both analysed conditions, were chosen for further studies, such as an in silico analysis and their molecular characterization. To overcome limits linked to native production, a recombinant expression approach in the yeast Pichia pastoris was applied. Different expression levels were obtained: PleoLip241 reached a maximum activity of 4000 U/L, whereas PleoLip369 reached a maximum activity of 700 U/L. Despite their sequence similarity, these enzymes exhibited different substrate specificity and diverse stability at pH, temperature, and presence of metals, detergents and organic solvents. The obtained data allowed classifying PleoLip241 as belonging to the "true lipase" family. Indeed, by phylogenetic analysis the two proteins fall in different clusters. PleoLip241 was used to remove the hydrophobic layer from wool surface in order to improve its dyeability. The encouraging results obtained with lipase treated wool led to forecast PleoLip241 applicability in this field.
Zbrun, María V; Romero-Scharpen, Analía; Olivero, Carolina; Zimmermann, Jorge A; Rossler, Eugenia; Soto, Lorena P; Astesana, Diego M; Blajman, Jesica E; Berisvil, Ayelén; Frizzo, Laureano S; Signorini, Marcelo L
The objective of this study was to investigate a clonal relationship among thermotolerant Campylobacter spp. isolates from different stages of the poultry meat supply chain in Argentina. A total of 128 thermotolerant Campylobacter spp. (89 C. jejuni and 39 C. coli) isolates from six poultry meat chains were examined. These isolates were from: a) hens from breeder flocks, b) chickens on the farm (at ages 1 wk and 5 wk), c) chicken carcasses in the slaughterhouse, and d) chicken carcasses in the retail market. Chickens sampled along each food chain were from the same batch. Campylobacter spp. isolates were analyzed using pulsed-field gel electrophoresis to compare different profiles according to the source. Clustering of C. jejuni isolates resulted in 17 profiles, with four predominant genotypes and many small profiles with just a few isolates or unique patterns, showing a very high degree of heterogeneity among the C. jejuni isolates. Some clusters included isolates from different stages within the same chain, which would indicate a spread of strains along the same poultry meat chain. Moreover, twenty-two strains of C. coli clustered in seven groups and the remaining 17 isolates exhibited unique profiles. Evidence for transmission of thermotolerant Campylobacter spp. through the food chain and cross contamination in the slaughterhouses were obtained. This collective evidence should be considered as the scientific basis to implement risk management measures to protect the public health. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.
Directory of Open Access Journals (Sweden)
Rahat Abdul Rehman
2015-11-01
Full Text Available Background: The microbial PHB production is a promising tool for the plastic industry for the synthesis of environmental friendly, biodegradable plastic in contrast to the conventional petro-chemical based non-degradable plastics. The selection of potent bacterial strains, inexpensive carbon source, efficient fermentation and recovery processes are important aspects that were taken into account during this study. Methods: Different bacterial strains i.e. Bacillus Spp, P. putida and P. fluorescens were screened for maximum PHB production. Under media optimization, various carbon and nitrogen sources (alone or in combination were used to achieve the maximum PHB production. Finally the degradation tests of the PHB sheet were also performed to test its biodegradability potential. Results: Shake flask studies have shown the PHB concentrations upto 7.02, 4.50 and 34.4 mg/g of dry cell mass of P. putida, P. fluorescens and Bacillus Spp. respectively. Almost same results were observed at laboratory scale production of PHB in 10 L fermenter i.e. 6.28, 6.23 and 39.5 mg/g of dry cell mass by P. putida, P. fluorescens and Bacillus Spp. respectively. On the basis of these observations, Bacillus Spp. was chosen for laboratory scale PHB production. Corn steep liquor (4% was chosen as the best medium to achieve the highest PHB contents. Isolated PHB has shown biodegradation in soil up to 86.7% at 37oC. Conclusion: The Bacillus Spp. Proved to be the best strain for PHB production on only 4% CSL which is cheapest and easily available.
Anti- Sporothrix spp. activity of medicinal plants
Directory of Open Access Journals (Sweden)
Stefanie Bressan Waller
Full Text Available ABSTRACT Cases of sporotrichosis in humans and animals without satisfactory clinical response have increased, a warning sign of strains resistant to conventional antifungal agents. The urgent search for alternative therapies was an incentive for research on medicinal plants with anti-Sporothrix spp. properties. A bibliographic survey was performed based on scientific papers about in vitro and in vivo antifungal activity of essential oils and extracts of plants in differents solvents against the fungal of the Sporothrix schenckii complex. The study methodology consisted of a literature review in Google Scholar, Science Direct, Pubmed, Bireme and Springer link with papers from 1986 to 2015. We found 141 species of plants that were investigated, of which 100 species were concentrated in 39 botanical families that had confirmed anti-Sporothrix activity. Combretaceae, Asteraceae and Lamiaceae represented the botanical families with the greatest number of plants species with antifungal potential, using different methodologies. However, there are few studies with medicinal plants in experimental infection in animals that prove their activity in the treatment of sporotrichosis. It reinforces the need for further research related to standardization of in vitro methodologies and in vivo studies related to safety and to toxicity potential of these plants with anti-Sporothrix spp. activity.
Directory of Open Access Journals (Sweden)
P. Sechi
2011-04-01
Full Text Available In summer 2010 a large outbreak of anomalous blue coloration of mozzarella cheese was recorded in Italy and some northern European countries. Official laboratory analysis and health authorities linked the outbreak to the contamination of processing water with strains of Pseudomonas fluorescens, although several expert raised the question of how to unequivocally link the blue coloring to the presence of the micro-organism. In an attempt to set-up a method to determine whether a given Pseudomonas spp. strain is responsible of the defect, an in vitro system for the evaluation of blue colouring of mozzarella cheese intentionally contaminated with strains of Pseudomonas fluorescens. was developed The system is aimed to ascertain whether P. fluorescens strains, isolated from mozzarella cheese with anomalous blue coloration, are able to reproduce the blue coloration under controlled experimental condition. 96 trials of experimental inoculation of mozzarella cheese in different preservation liquids, were conducted using various suspension of Pseudomonas spp. (P. fluorescens ATCC 13525, P. fluorescens CFBP 3150, one P. fluorescens field strain isolated from blue-colored mozzarella cheese and P. aeruginosa ATCC 10145 as positive control at different concentrations and incubated at different temperatures. Growth curve of all Pseudomonas spp. strains tested demonstrated that after three days of incubation the concentration was generally higher than 106 CFU/g of mozzarella cheese incubated in Tryptic Soy Broth (TSB, and higher than 105 CFU/g of mozzarella cheese incubated in preservation liquid. All mozzarella cheeses inoculated with the field strain of Pseudomonas fluorescens showed the characteristic anomalous blue coloration, which is often associated with Pseudomonas fluorescens contamination of water used during mozzarella cheesemaking. With the proposed system, which enabled a considerable amount of samples to be analysed under controlled experimental
Methylobacterium spp. as an indicator for the presence or absence of Mycobacterium spp.
Falkinham, Joseph O; Williams, Myra D; Kwait, Rebecca; Lande, Leah
2016-06-01
A published survey of bacteria in showerhead biofilm samples revealed that Methylobacterium spp. and Mycobacterium spp. seldom coexisted in biofilms. To confirm that information, biofilm samples were collected from household plumbing of Mycobacterium avium patients and Methylobacterium spp. and M. avium numbers were measured by direct colony counts. The results demonstrated that if Methylobacterium spp. were present, Mycobacterium spp. were absent, and the opposite. The data demonstrate that microbial populations in biofilms can influence the presence or absence of opportunistic premise plumbing pathogens and, thereby, increase the range of strategies to reduce exposure to waterborne pathogens. Finally, by assessing for the visual presence of methylobacteria as pink pigmentation on showers and shower curtains, homeowners and managers of hospitals and other buildings can quickly determine whether a premise plumbing biofilm sample has mycobacteria with a high degree of assurance. Copyright © 2016 Asian African Society for Mycobacteriology. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Danuser Jürg
2003-12-01
Full Text Available Abstract Background The world-wide increase of foodborne infections with antibiotic resistant pathogens is of growing concern and is designated by the World Health Organization as an emerging public health problem. Thermophilic Campylobacter have been recognised as a major cause of foodborne bacterial gastrointestinal human infections in Switzerland and in many other countries throughout the world. Poultry meat is the most common source for foodborne cases caused by Campylobacter. Because all classes of antibiotics recommended for treatment of human campylobacteriosis are also used in veterinary medicine, in view of food safety, the resistance status of Campylobacter isolated from poultry meat is of special interest. Methods Raw poultry meat samples were collected throughout Switzerland and Liechtenstein at retail level and examined for Campylobacter spp. One strain from each Campylobacter-positive sample was selected for susceptibility testing with the disc diffusion and the E-test method. Risk factors associated with resistance to the tested antibiotics were analysed by multiple logistic regression. Results In total, 91 Campylobacter spp. strains were isolated from 415 raw poultry meat samples. Fifty-one strains (59% were sensitive to all tested antibiotics. Nineteen strains (22% were resistant to a single, nine strains to two antibiotics, and eight strains showed at least three antibiotic resistances. Resistance was observed most frequently to ciprofloxacin (28.7%, tetracycline (12.6%, sulphonamide (11.8%, and ampicillin (10.3%. One multiple resistant strain exhibited resistance to five antibiotics including ciprofloxacin, tetracycline, and erythromycin. These are the most important antibiotics for treatment of human campylobacteriosis. A significant risk factor associated with multiple resistance in Campylobacter was foreign meat production compared to Swiss meat production (odds ratio = 5.7. Conclusion Compared to the situation in other
Directory of Open Access Journals (Sweden)
Lukáš Hleba
2014-02-01
Full Text Available Honey bees play important role in agricultural environment as main pollinators. Its important for many agricultural and wild plants. Also honey bee are producers of honey, which is consumed directly and it should be not a heat treatment. Many bacteria can be survive in honey for long time. Some of these bacteria are human and animal facultative pathogens, including Enterobactericaeae genera. If these bacteria contain antibiotic resistant genes than it can to leads to troubles in healing of some of bacterial infections. Lactobacillus spp. can be a reservoir of resistant genes for pathogenic bacterial strains. In this study we isolated Enterobacteriaceae strains from digestive tracts of honey bees. These strains was tested to the eight selected antibiotics by disc diffusion method and strains were indentified by MALDI TOF MS Biotyper. From this study we determined resistance to piperacillin in the highest level. Equally, we determined that Citrobacter gillenii was resistant to three antibiotics (piperacillin, chloramphenicol and levofloxacin from eight. Resistance to other antibiotics were determined in low levels and other indentified bacteria were resistant to one antibiotic, if any. Also we detected resistance in Lactobacillus spp. and determined MICs distribution for some selected antibiotics. For absence of similar studies we could not to discuss our results and we think that further experiments and studies are needed.
DEFF Research Database (Denmark)
Nielsen, T H; Sørensen, D; Tobiasen, C
2002-01-01
Cyclic lipopeptides (CLPs) with antibiotic and biosurfactant properties are produced by a number of soil bacteria, including fluorescent Pseudomonas spp. To provide new and efficient strains for the biological control of root-pathogenic fungi in agricultural crops, we isolated approximately 600...... in the peptide moiety. Production of specific CLPs could be affiliated with Pseudomonas fluorescens strain groups belonging to biotype I, V, or VI. In vitro analysis using both purified CLPs and whole-cell P. fluorescens preparations demonstrated that all CLPs exhibited strong biosurfactant properties...
Guerra, Diogo Ribeiro Almeida
2012-01-01
Dissertação de Mestrado Integrado em Medicina Veterinária Echinococcus spp., Taenia spp. and Toxocara spp. are important parasites of domestic and wild canids and neglected zoonotic helminths. Despite their relevance in Public Health, little is known about their prevalence in Portugal. An epidemiological study was conducted to clarify the role of canids in the sylvatic and synanthropic cycles of these pathogens in our country. Fecal samples from dog (n = 51), red fox (n = 62) and Iberia...
Avcı, Mine; Özden Tuncer, Banu
2017-07-06
The purpose of this study was to determine the antimicrobial activity and occurrence of bacteriocin structural genes in Enterococcus spp. isolated from different cheeses and also investigate some of their virulence factors. Enterococcus strains were isolated from 33 different cheeses. Enterococcus faecium (6 strains) and Enterococcus faecalis (5 strains) enterocin-producing strains were identified by 16S rDNA analyses. Structural genes entA, entB, entP and entX were detected in some isolates. Multiple enterocin structural genes were found in 7 strains. None of the tested enterococci demonstrated anyβ-haemolytic activity and only one strain had gelatinase activity. Six strains showed multiple antibiotic resistance patterns and in addition, vanA and several virulence genes were detected in many strains. Only E. faecalis MBE1-9 showed tyrosine decarboxylase activity and tdc gene was detected only in this strain.
Commensal Staphylococcus spp., Acinetobacter spp. and ...
African Journals Online (AJOL)
ANTHONY
2012-07-31
Jul 31, 2012 ... Intermittent assessment of resistance genes in the ecosystem should be ..... among resistant Acinetobacter spp. isolated from integrated fish .... independent studies on the emerging phylogenetic view of bacterial .... Functional.
Effect of some heavy metals on the growth and development of Pleurotus tuber-regium.
Directory of Open Access Journals (Sweden)
Akpaja EO
2012-02-01
Full Text Available The effects of five heavy metals (cadmium, copper, mercury, lead and zinc on the growth and fruit body production in Pleurotus tuber-regium was investigated. Lead sulphate, zinc sulphate, copper sulphate, cadmium nitrate and mercury chloride were added to garden soil at concentrations of 0, 0.125, 0.25, 0.5, 1.0, and 2.0 mmol per 3 kg of soil. Sclerotia of the test mushroom were used to inoculate the artificially contaminated soil. Mercury prevented growth and fruit body production in P. tuber-regium. Fungal morphometry was greatly affected by lead. The heavy metal content in the fungal biomass complex increased with increase of heavy metal concentration in the soil. The highest concentration (183.06 mg/kg was found in zinc at 2 mmol/L.
Commercially laid eggs vs. discarded hatching eggs: contamination by Salmonella spp.
Kottwitz, Luciana B M; Leão, Joice Aparecida; Back, Alberto; Rodrigues, Dalia dos P; Magnani, Marciane; de Oliveira, Tereza C R M
2013-01-01
Salmonella enterica is frequently associated with outbreaks of human salmonellosis, and products of avian origin, such as eggs and chicken meat, are the main vehicles of its transmission. The present study describes the occurrence of different serovars of Salmonella enterica and phagotypes of S. enterica serovar Enteritidis in eggs destined for human consumption. Four thousand eggs obtained from commercial egg laying farms and one thousand discarded hatching eggs from broiler farms, which were acquired at farmers' markets and informal shops, were analyzed. Salmonella spp. was isolated from 52.0% of the discarded hatching eggs, in which the predominant serovar was Enteritidis (84.6%), and the predominant Salmonella Enteritidis phagotype (PT) was PT7 (26.9%). Salmonella spp. was not isolated from eggs obtained from commercial egg laying farms. The antimicrobial resistance profile showed that 23.1% (n = 6) of the SE strains were resistant to nalidixic acid. The results suggest that the consumption of discarded hatching eggs represents an important source of Salmonella transmission to humans.
Howell, Charles R
2007-01-01
ABSTRACT Good quality seeds of cotton cultivars often escaped pre-emergence damping-off incited by Pythium spp. and Rhizopus oryzae, and they were resistant to postemergence damping-off incited by Rhizoctonia solani. Poor quality seeds, however, were highly susceptible to both phases of seedling disease and required seed treatment in order to survive. Pre-emergence damping-off incited by Pythium spp. and Rhizopus oryzae could be controlled by seed treatment with biocontrol preparations of a number of Trichoderma spp., but these treatments were much less effective in controlling postemergence disease incited by Rhizoctonia solani. Postemergence seedling disease can be controlled by fungicides, but they were much less effective in controlling the pre-emergence phase of the disease. Combination seed treatments of poor quality cotton seeds with fungicides and Trichoderma spp. preparations, followed by planting in pathogen-infested soil, indicated that this technique will control both phases of seedling disease. Seed treatment with either the fungicides or the biocontrol agents alone did not achieve this goal. The optimum combination treatment for disease control was that of chloroneb plus Trichoderma spp., followed by chloroneb plus metalaxyl (Deltacoat AD) plus T. virens strain G-6.
Paola Mendes Milanesi; Elena Blume; Marlove Fátima Brião Muniz; Lia Rejane Silveira Reiniger; Zaida Inês Antoniolli; Emanuele Junges; Manoeli Lupatini
2013-01-01
This study aimed i) to quantify the occurrence of Fusarium spp. and Trichoderma spp. in rhizospheric soil, with and without symptoms of Sudden Death Syndrome (SDS) in eight soybean genotypes; ii) morphologically identify isolates of Fusarium spp. from roots with SDS; iii) evaluate the antagonism between Trichoderma spp. and Fusarium spp. isolates from rhizospheric soil and roots from with and without SDS, respectively; and iv) characterize through the ITS1-5.8S-ITS2 region of rDNA the isolate...
Bioremediation of aflatoxin B1-contaminated maize by king oyster mushroom (Pleurotus eryngii.
Directory of Open Access Journals (Sweden)
Maria Teresa Branà
Full Text Available Aflatoxin B1 (AFB1 is the most harmful mycotoxin that occurs as natural contaminant of agricultural commodities, particularly maize. Practical solutions for detoxification of contaminated staples and reduction of agricultural wastes are scarce. We investigated the capability of the white-rot and edible fungus Plerotus eryngii (king oyster mushroom to degrade AFB1 both in vitro and in a laboratory-scale mushroom cultivation, using a substrate similar to that routinely used in mushroom farms. In malt extract broth, degradation of AFB1 (500 ng/mL by nine isolates of P. eryngii ranged from 81 to 99% after 10 days growth, and reached 100% for all isolates after 30 days. The growth of P. eryngii on solid medium (malt extract-agar, MEA was significantly reduced at concentrations of AFB1 500 ng/mL or higher. However, the addition of 5% wheat straw to the culture medium increased the tolerance of P. eryngii to AFB1 and no inhibition was observed at a AFB1 content of 500 ng/mL; degradation of AFB1 in MEA supplemented with 5% wheat straw and 2.5% (w/v maize flour was 71-94% after 30 days of growth. Further, AFB1 degradation by P. eryngii strain ITEM 13681 was tested in a laboratory-scale mushroom cultivation. The mushroom growth medium contained 25% (w/w of maize spiked with AFB1 to the final content of 128 μg/kg. Pleurotus eryngii degraded up to 86% of the AFB1 in 28 days, with no significant reduction of either biological efficiency or mushroom yield. Neither the biomass produced on the mushroom substrate nor the mature basidiocarps contained detectable levels of AFB1 or its metabolite aflatoxicol, thus ruling out the translocation of these toxins through the fungal thallus. These findings make a contribution towards the development of a novel technology for remediation of AFB1- contaminated corn through the exploitation of the degradative capability of P. eryngii and its bioconversion into high nutritional value material intended for feed production.
Infection of California sea lions (Zalophus californianus) with terrestrial Brucella spp.
Avalos-Téllez, Rosalía; Ramírez-Pfeiffer, Carlos; Hernández-Castro, Rigoberto; Díaz-Aparicio, Efrén; Sánchez-Domínguez, Carlos; Zavala-Norzagaray, Alan; Arellano-Reynoso, Beatriz; Suárez-Güemes, Francisco; Aguirre, A Alonso; Aurioles-Gamboa, David
2014-10-01
Infections with Brucella ceti and pinnipedialis are prevalent in marine mammals worldwide. A total of 22 California sea lions (Zalophus californianus) were examined to determine their exposure to Brucella spp. at San Esteban Island in the Gulf of California, Mexico, in June and July 2011. Although samples of blood, vaginal mucus and milk cultured negative for these bacteria, the application of rose Bengal, agar gel immunodiffusion, PCR and modified fluorescence polarization assays found that five animals (22.7%) had evidence of exposure to Brucella strains. The data also suggested that in two of these five sea lions the strains involved were of terrestrial origin, a novel finding in marine mammals. Further work will be required to validate and determine the epidemiological significance of this finding. Copyright © 2014 Elsevier Ltd. All rights reserved.
Jiang, Juan; Liu, Hongying; Li, Qiao; Gao, Ni; Yao, Yuan; Xu, Heng
2015-10-01
Remediation of soil co-contaminated with heavy metals and PAHs by mushroom and bacteria is a novel technique. In this study, the combined remediation effect of mushroom (Pleurotus cornucopiae) and bacteria (FQ1, Bacillus thuringiensis) on Cd and phenanthrene co-contaminated soil was investigated. The effect of bacteria (B. thuringiensis) on mushroom growth, Cd accumulation, phenanthrene degradation by P. cornucopiae and antioxidative responses of P. cornucopiae were studied. P. cornucopiae could adapt easily and grow well in Cd-phenanthrene co-contaminated soil. It was found that inoculation of FQ1 enhanced mushroom growth (biomass) and Cd accumulation with the increment of 26.68-43.58% and 14.29-97.67% respectively. Up to 100% and 95.07% of phenanthrene were removed in the bacteria-mushroom (B+M) treatment respectively spiked with 200mg/kg and 500mg/kg phenanthrene. In addition, bacterial inoculation alleviated oxidative stress caused by co-contamination with relative decreases in lipid peroxidation and enzyme activity, including malondialdehyde (MDA), superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD). This study demonstrated that the integrated remediation strategy of bacteria and mushroom is an effective and promising method for Cd-phenanthrene co-contaminated soil bioremediation. Copyright © 2015 Elsevier Inc. All rights reserved.
Kaczorek, E; Małaczewska, J; Wójcik, R; Rękawek, W; Siwicki, A K
2017-08-01
Mastitis of dairy cattle is one of the most frequently diagnosed diseases worldwide. The main etiological agents of mastitis are bacteria of the genus Streptococcus spp., in which several antibiotic resistance mechanisms have been identified. However, detailed studies addressing this problem have not been conducted in northeastern Poland. Therefore, the aim of our study was to analyze, on phenotypic and genotypic levels, the antibiotic resistance pattern of Streptococcus spp. isolated from clinical cases of mastitis from dairy cattle in this region of Poland. The research was conducted using 135 strains of Streptococcus (Streptococcus uberis, n = 53; Streptococcus dysgalactiae, n = 41; Streptococcus agalactiae, n = 27; other streptococci, n = 14). The investigation of the antimicrobial susceptibility to 8 active substances applied in therapy in the analyzed region, as well as a selected bacteriocin (nisin), was performed using the minimum inhibitory concentration method. The presence of selected resistance genes (n = 14) was determined via PCR. We also investigated the correlation between the presence of resistance genes and the antimicrobial susceptibility of the examined strains in vitro. The highest observed resistance of Streptococcus spp. was toward gentamicin, kanamycin, and tetracycline, whereas the highest susceptibility occurred toward penicillin, enrofloxacin, and marbofloxacin. Additionally, the tested bacteriocin showed high efficacy. The presence of 13 analyzed resistance genes was observed in the examined strains [gene mef(A) was not detected]. In most strains, at least one resistance gene, mainly responsible for resistance to tetracyclines [tet(M), tet(K), tet(L)], was observed. However, a relationship between the presence of a given resistance gene and antimicrobial susceptibility on the phenotypic level was not always observed. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Molecular detection of Bartonella spp. and Rickettsia spp. in bat ectoparasites in Brazil.
do Amaral, Renan Bressianini; Lourenço, Elizabete Captivo; Famadas, Kátia Maria; Garcia, Amanda Barbosa; Machado, Rosangela Zacarias; André, Marcos Rogério
2018-01-01
The family Streblidae comprises a monophyletic group of Hippoboscoidea, hematophagous dipterans that parasitize bats. Bartonella spp. and Rickettsia spp. have been reported in bats sampled in Europe, Africa, Asia, North, Central and South America. However, there are few reports on the Bartonella and Rickettsia bacteria infecting Hippoboscoidea flies and mites. While Spinturnicidae mites are ectoparasites found only in bats, those belonging to the family Macronyssidae comprise mites that also parasitize other mammal species. This study investigates the occurrence and assesses the phylogenetic positioning of Bartonella spp. and Rickettsia spp. found in Streblidae flies and Spinturnicidae and Macronyssidae mites collected from bats captured in Brazil. From May 2011 to April 2012 and September 2013 to December 2014, 400 Streblidae flies, 100 Macronyssidaes, and 100 Spinturnicidae mites were collected from bats captured in two sites in northeastern Nova Iguaçu, Rio de Janeiro, southeastern Brazil. Forty (19.8%) out of 202 Streblidae flies were positive for Bartonella spp. in qPCR assays based on the nuoG gene. Among the flies positive for the bacterium, six (18%) were Paratrichobius longicrus, seven (29%) Strebla guajiro, two (40%) Aspidoptera phyllostomatis, five (11%) Aspidoptera falcata, one (10%) Trichobius anducei, one (25%) Megistopoda aranea, and 18 (32%) Trichobius joblingi, and collected from bats of the following species: Artibeus lituratus, Carollia perspicillata, Artibeus planirostris, Sturnira lilium, and Artibeus obscurus. Six sequences were obtained for Bartonella (nuoG [n = 2], gltA [n = 2], rpoB [n = 1], ribC = 1]). The phylogenetic analysis based on gltA (750pb) gene showed that the Bartonella sequences clustered with Bartonella genotypes detected in bats and ectoparasites previously sampled in Latin America, including Brazil. Only one sample (0.49%) of the species Trichobius joblingi collected from a specimen of Carollia perspicillata was positive
Production of exopolysaccharides in submerged cultures of gamma irradiation pleurotus ostreatus
International Nuclear Information System (INIS)
Khalaf, M.A.; Atia, A.I.
2009-01-01
Mushrooms have become attractive as a functional food and as a source for the development of drugs and nutraceuticals. Pleurotus ostreatus is considered as the best among them. The exopolysaccharides (EPS) of mushrooms demonstrated a strong antitumor and antioxidant action. However, there is little information available in the literature about the optimization of fermentation conditions for production of EPS by P. ostreatus. So, the effect of medium composition and fermentation parameters on mycelial growth and EPS production by gamma irradiated isolate of P. ostreatus were investigated in shake-flask cultures. The economical optimum fermentation parameters for the highest EPS production 5.73 g/l and mycelial growth rate 11.8 g/l were achieved at initial ph 6, cultivation temperature 28 C(degree), 20 g/l sucrose, 4 g/l yeast extract, 50 ml of medium working volume in a 250 ml flask, and 6% (v/v) of inoculum size after 10 and 12 days, respectively. EPS produced, in this study, showed strong antioxidant activity (96.3%) at concentration 10 mg/ml.
Production of ligninolytic enzymes by solid-state fermentation using Pleurotus eryngii.
Akpinar, Merve; Urek, Raziye Ozturk
2012-01-01
Pleurotus eryngii (DC.) Gillet (MCC58) was investigated for its ability to produce various ligninolytic enzymes such as laccase (Lac), manganese peroxidase (MnP), aryl alcohol oxidase (AAO), and lignin peroxidase (LiP) by solid-state fermentation (SSF), which was carried out using a support substrate from the fruit juice industry. The chemical content of grape waste from this industry was studied. Also, the production patterns of these extracellular enzymes were researched during the growth of the organism for a period of 20 days and the protein, reducing sugar, and nitrogen levels were monitored during the stationary cultivation. The highest Lac activity was obtained as 2247.62 ± 75 U/L on day 10 in the presence of 750 µM Mn²⁺, while the highest MnP activity was attained as 2198.44 ± 65 U/L on day 15 in the presence of 500 µM Mn²⁺. Decolorization of methyl orange and reactive red 2 azo dyes was also achieved with ligninolytic enzymes, produced in SSF of P. eryngii.
Potu Venkata Chiranjeevi; Moses Rajasekara Pandian; Sathish Thadikamala
2014-01-01
Black gram husk was used as a solid substrate for laccase production by Pleurotus ostreatus, and various fermentation conditions were optimized based on an artificial intelligence method. A total of six parameters, i.e., temperature, inoculum concentration, moisture content, CuSO4, glucose, and peptone concentrations, were optimized. A total of 50 experiments were conducted, and the obtained data were modeled by a hybrid of artificial neural network (ANN) and genetic algorithm (GA) approaches...
Babesia spp. in ticks and wildlife in different habitat types of Slovakia.
Hamšíková, Zuzana; Kazimírová, Mária; Haruštiaková, Danka; Mahríková, Lenka; Slovák, Mirko; Berthová, Lenka; Kocianová, Elena; Schnittger, Leonhard
2016-05-20
Babesiosis is an emerging and potentially zoonotic disease caused by tick-borne piroplasmids of the Babesia genus. New genetic variants of piroplasmids with unknown associations to vectors and hosts are recognized. Data on the occurrence of Babesia spp. in ticks and wildlife widen the knowledge on the geographical distribution and circulation of piroplasmids in natural foci. Questing and rodent-attached ticks, rodents, and birds were screened for the presence of Babesia-specific DNA using molecular methods. Spatial and temporal differences of Babesia spp. prevalence in ticks and rodents from two contrasting habitats of Slovakia with sympatric occurrence of Ixodes ricinus and Haemaphysalis concinna ticks and co-infections of Candidatus N. mikurensis and Anaplasma phagocytophilum were investigated. Babesia spp. were detected in 1.5 % and 6.6 % of questing I. ricinus and H. concinna, respectively. Prevalence of Babesia-infected I. ricinus was higher in a natural than an urban/suburban habitat. Phylogenetic analysis showed that Babesia spp. from I. ricinus clustered with Babesia microti, Babesia venatorum, Babesia canis, Babesia capreoli/Babesia divergens, and Babesia odocoilei. Babesia spp. amplified from H. concinna segregated into two monophyletic clades, designated Babesia sp. 1 (Eurasia) and Babesia sp. 2 (Eurasia), each of which represents a yet undescribed novel species. The prevalence of infection in rodents (with Apodemus flavicollis and Myodes glareolus prevailing) with B. microti was 1.3 % in an urban/suburban and 4.2 % in a natural habitat. The majority of infected rodents (81.3 %) were positive for spleen and blood and the remaining for lungs and/or skin. Rodent-attached I. ricinus (accounting for 96.3 %) and H. concinna were infected with B. microti, B. venatorum, B. capreoli/B. divergens, Babesia sp. 1 (Eurasia), and Babesia sp. 2 (Eurasia). All B. microti and B. venatorum isolates were identical to known zoonotic strains from Europe. Less than 1
We report the draft genome of two Sphingopyxis spp. strains isolated from a chloraminated drinking water distribution system simulator. Both strains are ubiquitous residents and early colonizers of water distribution systems. Genomic annotation identified a class 1 integron (in...
Directory of Open Access Journals (Sweden)
Schachtner Joachim
2008-12-01
Full Text Available Abstract Background Toxin complex (Tc proteins termed TcaABC, TcdAB, and TccABC with insecticidal activity are present in a variety of bacteria including the yersiniae. Results The tc gene sequences of thirteen Yersinia strains were compared, revealing a high degree of gene order conservation, but also remarkable differences with respect to pseudogenes, sequence variability and gene duplications. Outside the tc pathogenicity island (tc-PAIYe of Y. enterocolitica strain W22703, a pseudogene (tccC2'/3' encoding proteins with homology to TccC and similarity to tyrosine phosphatases at its C-terminus was identified. PCR analysis revealed the presence of the tc-PAIYe and of tccC2'/3'-homologues in all biotype 2–5 strains tested, and their absence in most representatives of biotypes 1A and 1B. Phylogenetic analysis of 39 TccC sequences indicates the presence of the tc-PAIYe in an ancestor of Yersinia. Oral uptake experiments with Manduca sexta revealed a higher larvae lethality of Yersinia strains harbouring the tc-PAIYe in comparison to strains lacking this island. Following subcutaneous infection of Galleria mellonella larvae with five non-human pathogenic Yersinia spp. and four Y. enterocolitica strains, we observed a remarkable variability of their insecticidal activity ranging from 20% (Y. kristensenii to 90% (Y. enterocolitica strain 2594 dead larvae after five days. Strain W22703 and its tcaA deletion mutant did not exhibit a significantly different toxicity towards G. mellonella. These data confirm a role of TcaA upon oral uptake only, and suggest the presence of further insecticidal determinants in Yersinia strains formerly unknown to kill insects. Conclusion This study investigated the tc gene distribution among yersiniae and the phylogenetic relationship between TccC proteins, thus contributing novel aspects to the current discussion about the evolution of insecticidal toxins in the genus Yersinia. The toxic potential of several Yersinia
Enzymatic Activity of Candida spp. from Oral Cavity and Urine in Children with Nephrotic Syndrome.
Olczak-Kowalczyk, Dorota; Roszkowska-Blaim, Maria; Dąbkowska, Maria; Swoboda-Kopeć, Ewa; Gozdowski, Dariusz; Mizerska-Wasiak, Małgorzata; Demkow, Urszula; Pańczyk-Tomaszewska, Małgorzata
2017-01-01
Oral colonization with Candida spp. is not synonymous with a systemic active infection. The aim of the study was to evaluate enzymatic activity of Candida strains isolated from the oral cavity in patients with nephrotic syndrome (NS) and to compare it with the activity determined in urine. We studied 32 children with NS and 26 control healthy children. Children with NS were treated with glucocorticosteroids, cyclosporin A, mycophenolate mofetil or azathioprine. In all children, API-ZYM enzymatic tests were performed to evaluate hydrolytic enzymes of Candida isolated from the oral cavity and in urine. Candida spp. were isolated from the oral cavity in 11 patients with NS (34.4%), all receiving immunosuppressive treatment. All strains produced valine arylamidase, 9 alpha-glucosidase (E16), and 9 N-acetyl-beta-glucosaminidase (E18). A positive correlation between the presence of Candida in the oral cavity and E16 and E18 enzymatic activity in both oral cavity and urine was found. A dose of cyclosporin A had an effect on the enzymatic activity (p Candida invasion. The results of this study suggest that oral candida infection should be monitored in children with nephrotic syndrome, particularly those treated with immunosuppressive agents.
Mohanty, Srujana; Maurya, Vijeta; Gaind, Rajni; Deb, Monorama
2013-11-15
Pseudomonas aeruginosa and Acinetobcter spp. are important nosocomial pathogens and carbapenem resistance is an emerging threat. Therapeutic options for infections with these isolates include colistin. This study was conducted to determine the prevalence of carbapenem resistance in P. aeruginosa and Acinetobacter spp. bloodstream isolates, phenotypically characterize the resistance mechanisms and evaluate the in vitro activity of colistin. Consecutive 145 (95 P.aeruginosa and 50 Acinetobacter spp.) non-repeat isolates were included. Antibiotic susceptibility testing was performed per CLSI guidelines. MIC for carbapenems and colistin was performed using Etest. Isolates showing reduced susceptibility or resistance to the carbapenems were tested for metallo-β-lactamase (MBL) production using imipenem-EDTA combined disk and MBL Etest. Carbapenem resistance was observed in 40% P. aeruginosa and 66.0% Acinetobacter spp. Carbapenem-resistant (CA-R) isolates were significantly (p carbapenem-susceptible isolates. Approximately half of the CA-R strains were multidrug-resistant, and 3.1-5.5% were resistant to all antibiotics tested. MBL was found in 76.3% and 69.7% of the P. aeruginosa and Acinetobacter spp., respectively. Colistin resistance was observed in three (6.0%) Acinetobacter isolates and eight (8.4%) P. aeruginosa. MIC50 for carbapenems were two to four times higher for MBL-positive compared to MBL-negative isolates, but no difference was seen in MIC for colistin. Carbapenem resistance was observed to be mediated by MBL in a considerable number of isolates. Colistin is an alternative for infections caused by CA-R isolates; however, MIC testing should be performed whenever clinical use of colistin is considered.
Directory of Open Access Journals (Sweden)
E. N. Vlasenko
2017-08-01
Full Text Available The aim of the study was to determine the intensity of synthesis of volatile aroma compounds by Pleurotus ostreatus (oyster mushroom on sunflower husks and barley straw using sensory profile analysis and UV spectroscopy. The main cultural and morphological characteristics of the mycelial growth and development of fruiting bodies are determined: the period of mycelial development on the substrate, the time of primordial formation, the number of mushroom bunches per unit volume of substrate, the morphology of carpophores. Characteristic attributes of the aroma of dried fruiting bodies (mushroom, woody, sweet, herbaceous, fish, meat, floral, earthy, acidic, putrescent are established and their aroma profiles are built. Sensory profile analysis of flavor of dried samples showed that the mushroom flavor of fungi cultivated on the sunflower husk is more pronounced than of those grown on barley straw. The light absorption maxima are recorded in the ranges 204–210 and 250–290 nm according to UV absorption spectra. Optimal conditions for extracting aromatics from dried fungi samples are the extraction time of 20–35 min at the boiling point of the solvent. Analysis of the UV spectra of fungal alcohol and hexane extracts showed that the intensity of the synthesis of volatile compounds is higher for strains cultivated on sunflower husks than for samples obtained on barley straw.
Isolation and characterization of wild-type lipoxygenase LOX(Psa)1 from Pleurotus sapidus.
Plagemann, Ina; Krings, Ulrich; Berger, Ralf G
2014-01-01
The lipoxygenase LOX(Psa) 1 of Pleurotus sapidus, originally investigated because of its ability to oxidize (+)-valencene to the valuable grapefruit aroma (+)-nootkatone, was isolated from the peptidase-rich lyophilisate using a three-step purification scheme including preparative isoelectric focusing and chromatographic techniques. Nano-liquid chromatography electrospray ionization tandem mass spectrometry (nLC-ESI-MS/MS) of the purified enzyme and peptide mass fingerprint analysis gave 38 peptides of the lipoxygenase from P. sapidus. Nearly 50% of the 643 amino acids long sequence encoded by the cDNA was covered. Both terminal peptides of the native LOX(Psa) 1 were identified by de novo sequencing, and the postulated molecular mass of 72.5 kDa was confirmed. With linoleic acid as the substrate, the LOX(Psa)1 showed a specific activity of 113 U mg(-1) and maximal activity at pH 7.0 and 30 degrees C, respectively.
Potential of Trichoderma spp. strains for the bioremediation of soils contaminated with petroleum
Directory of Open Access Journals (Sweden)
Marcia Pesántez
2016-10-01
Full Text Available Fungi species can degrade xenobiotic compounds contaminating the soil, including hydrocarbons. The objective of this work was to determine the potential of three strains of Trichoderma, isolated from soil contaminated with petroleum, for bioremediation. Trichoderma harzianum CCECH-Te1, Trichoderma viride CCECH-Te2 and Trichoderma psedokoningii CCECH-Te3 were included in one assay with each independent strain. The inoculum was adjusted to a concentration of 1x1010 conidia ml-1 which was applied to soil contaminated by an oil spill. After 96 days of inoculation, soil samples were taken at 10 and 15 cm depth. The content of total hydrocarbons, polycyclic aromatic hydrocarbons and heavy metals such as cadmium, nickel and lead were determined. With the data, it was calculated the percentage of removal of the analyzed compounds by each strain. At 10 cm and 15 cm depth, it was observed the removal of the compounds in percentages that reached between 47 and 69.1% in the hydrocarbons and up to 53.72% in the heavy metals. It which denoted the potential of the three strains for bioremediation in contaminated soils. Keywords: heavy metals, polycyclic aromatic hydrocarbons, xenobiotic compounds
Directory of Open Access Journals (Sweden)
Jonatas Campos Almeida
Full Text Available The purpose of this study was to investigate the occurrence of Cryptosporidium spp. and Giardia spp. in a public water-treatment system. Samples of raw and treated water were collected and concentrated using the membrane filtration technique. Direct Immunofluorescence Test was performed on the samples. DNA extraction using a commercial kit was performed and the DNA extracted was submitted to a nested-PCR reaction (n-PCR and sequencing. In the immunofluorescence, 2/24 (8.33% samples of raw water were positive for Giardia spp.. In n-PCR and sequencing, 2/24 (8.33% samples of raw water were positive for Giardia spp., and 2/24 (8.33% samples were positive for Cryptosporidium spp.. The sequencing showed Cryptosporidium parvum and Giardia duodenalis DNA. In raw water, there was moderate correlation among turbidity, color and Cryptosporidium spp. and between turbidity and Giardia spp.. The presence of these protozoans in the water indicates the need for monitoring for water-treatment companies.
Directory of Open Access Journals (Sweden)
Liangquan Zhu
2018-01-01
Full Text Available Avian tuberculosis is a chronic, contagious zoonotic disease affecting birds, mammals, and humans. The disease is most often caused by Mycobacterium avium spp. avium (MAA. Strain resources are important for research on avian tuberculosis and vaccine development. However, there has been little reported about the newly identified MAA strain in recent years in China. In this study, a new strain was isolated from a fowl with symptoms of avian tuberculosis by bacterial culture. The isolated strain was identified to be MAA by culture, staining, and biochemical and genetic analysis, except for different colony morphology. The isolated strain was Ziehl-Zeelsen staining positive, resistant to p-nitrobenzoic acid, and negative for niacin production, Tween-80 hydrolysis, heat stable catalase and nitrate production. The strain had the DnaJ gene, IS1245, and IS901, as well. Serum agglutination indicated that the MAA strain was of serotype 1. The MAA strain showed strong virulence via mortality in rabbits and chickens. The prepared tuberculin of the MAA strain had similar potency compared to the MAA reference strain and standard tuberculin via a tuberculin skin test. Our studies suggested that this MAA strain tends to be a novel subtype, which might enrich the strain resource of avian tuberculosis.
Musumeci, Rosario; Calaresu, Enrico; Gerosa, Jolanda; Oggioni, Davide; Bramati, Simone; Morelli, Patrizia; Mura, Ida; Piana, Andrea; Are, Bianca Maria; Cocuzza, Clementina Elvezia
2016-10-01
Linezolid is the main representative of the oxazolidinones, introduced in 2000 in clinical practice to treat severe Gram-positive infections. This compound inhibits protein synthesis by binding to the peptidyl transferase centre of the 50S bacterial ribosomal subunit. The aim of this study was to characterize 12 clinical strains of linezolid-resistant Staphylococcus spp. isolated in Northern Italy. All isolates of Staphylococcus spp. studied showed a multi-antibiotic resistance phenotype. In particular, all isolates showed the presence of the mecA gene associated with SSCmec types IVa, V or I. Mutations in domain V of 23S rRNA were shown to be the most prevalent mechanism of linezolid resistance: among these a new C2551T mutation was found in S. aureus, whilst the G2576T mutation was shown to be the most prevalent overall. Moreover, three S. epidermidis isolates were shown to have linezolid resistance associated only with alterations in both L3 and L4 ribosomal proteins. No strain was shown to harbor the previously described cfr gene. These results have shown how the clinical use of linezolid in Northern Italy has resulted in the selection of multiple antibiotic-resistant clinical isolates of Staphylococcus spp., with linezolid resistance in these strains being associated with mutations in 23S rRNA or ribosomal proteins L3 and L4.
Phenotypic characterisation of Saccharomyces spp. for tolerance to 1-butanol.
Zaki, A M; Wimalasena, T T; Greetham, D
2014-11-01
Biofuels are expected to play a role in replacing crude oil as a liquid transportation fuel, and research into butanol has highlighted the importance of this alcohol as a fuel. Butanol has a higher energy density than ethanol, butanol-gasoline blends do not separate in the presence of water, and butanol is miscible with gasoline (Szulczyk, Int J Energy Environ 1(1):2876-2895, 40). Saccharomyces cerevisiae has been used as a fermentative organism in the biofuel industry producing ethanol from glucose derived from starchy plant material; however, it typically cannot tolerate butanol concentrations greater than 2 % (Luong, Biotechnol Bioeng 29 (2):242-248, 27). 90 Saccharomyces spp. strains were screened for tolerance to 1-butanol via a phenotypic microarray assay and we observed significant variation in response with the most tolerant strains (S. cerevisiae DBVPG1788, S. cerevisiae DBVPG6044 and S. cerevisiae YPS128) exhibiting tolerance to 4 % 1-butanol compared with S. uvarum and S. castelli strains, which were sensitive to 3 % 1-butanol. Response to butanol was confirmed using traditional yeast methodologies such as growth; it was observed that fermentations in the presence of butanol, when using strains with a tolerant background, were significantly faster. Assessing for genetic rationale for tolerance, it was observed that 1-butanol-tolerant strains, when compared with 1-butanol-sensitive strains, had an up-regulation of RPN4, a transcription factor which regulates proteasome genes. Analysing for the importance of RPN4, we observed that a Δrpn4 strain displayed a reduced rate of fermentation in the presence of 1-butanol when compared with the BY4741 background strain. This data will aid the development of breeding programmes to produce better strains for future bio-butanol production.
A duplex PCR assay for the detection of Ralstonia solanacearum phylotype II strains in Musa spp.
Directory of Open Access Journals (Sweden)
Gilles Cellier
Full Text Available Banana wilt outbreaks that are attributable to Moko disease-causing strains of the pathogen Ralstonia solanacearum (Rs remain a social and economic burden for both multinational corporations and subsistence farmers. All known Moko strains belong to the phylotype II lineage, which has been previously recognized for its broad genetic basis. Moko strains are paraphyletic and are distributed among seven related but distinct phylogenetic clusters (sequevars that are potentially major threats to Musaceae, Solanaceae, and ornamental crops in many countries. Although clustered within the Moko IIB-4 sequevar, strains of the epidemiologically variant IIB-4NPB do not cause wilt on Cavendish or plantain bananas; instead, they establish a latent infection in the vascular tissues of plantains and demonstrate an expanded host range and high aggressiveness toward Solanaceae and Cucurbitaceae. Although most molecular diagnostic methods focus on strains that wilt Solanaceae (particularly potato, no relevant protocol has been described that universally detects strains of the Musaceae-infecting Rs phylotype II. Thus, a duplex PCR assay targeting Moko and IIB-4NPB variant strains was developed, and its performance was assessed using an extensive collection of 111 strains representing the known diversity of Rs Moko-related strains and IIB-4NPB variant strains along with certain related strains and families. The proposed diagnostic protocol demonstrated both high accuracy (inclusivity and exclusivity and high repeatability, detected targets on either pure culture or spiked plant extracts. Although they did not belong to the Moko clusters described at the time of the study, recently discovered banana-infecting strains from Brazil were also detected. According to our comprehensive evaluation, this duplex PCR assay appears suitable for both research and diagnostic laboratories and provides reliable detection of phylotype II Rs strains that infect Musaceae.
International Nuclear Information System (INIS)
El-Shafey, H.M.; Matar, Z.A.I.; Ghanem, S.M.A.
2007-01-01
Fungal strains were isolated from degraded banana waste including leaves, pseudo stems and skins. Many isolated strains showed cellulolytic activities using the plate screening medium. The hyper cellulolytic isolates were selected on the basis of the diameter of the hydrolysis zone surrounding the colonies and identified to the genus level. The identified strains were found to belong to one of the genera Trichoderma, Aspergillus, Pleurotus or Penicillium. The strain with the larger diameter of the hydrolysis zone was found to belong to the genus Trichoderma. It was further identified to be Trichoderma harzianum, which was selected to be studied. Banana waste including leaves and pseudo stems were inoculated by the selected fungus and the production of the carboxymethyl cellulase (CMCase) and filter paper cellulase (FPCase) was followed during changes of the growth conditions under solid state fermentation. It was found that the two enzymes shared the same incubation temperature (25 degree C) and incubation period (18 days) for the maximum enzyme production. The gamma radiation dose of 1.5 KGy increased the production of CMCase produced on leaves by 4.0% and on pseudo stems by 5.6% and the production of FPCase produced on leaves by 2.4% and on pseudo stems by 2.3%. The results also suggest that FPCase and CMCase enzymes produced on leaves were higher than those produced from pseudo stems and the level of CMCase enzyme produced was higher than that of FPCase
Molecular study on some antibiotic resistant genes in Salmonella spp. isolates
Nabi, Ari Q.
2017-09-01
Studying the genes related with antimicrobial resistance in Salmonella spp. is a crucial step toward a correct and faster treatment of infections caused by the pathogen. In this work Integron mediated antibiotic resistant gene IntI1 (Class I Integrase IntI1) and some plasmid mediated antibiotic resistance genes (Qnr) were scanned among the isolated non-Typhoid Salmonellae strains with known resistance to some important antimicrobial drugs using Sybr Green real time PCR. The aim of the study was to correlate the multiple antibiotics and antimicrobial resistance of Salmonella spp. with the presence of integrase (IntI1) gene and plasmid mediated quinolone resistant genes. Results revealed the presence of Class I Integrase gene in 76% of the isolates with confirmed multiple antibiotic resistances. Moreover, about 32% of the multiple antibiotic resistant serotypes showed a positive R-PCR for plasmid mediated qnrA gene encoding for nalidixic acid and ciprofloxacin resistance. No positive results could be revealed form R-PCRs targeting qnrB or qnrS. In light of these results we can conclude that the presence of at least one of the qnr genes and/or the presence of Integrase Class I gene were responsible for the multiple antibiotic resistance to for nalidixic acid and ciprofloxacin from the studied Salmonella spp. and further studies required to identify the genes related with multiple antibiotic resistance of the pathogen.
FIRST REPORT OF METALLO-β-LACTAMASES PRODUCING Enterobacter spp. STRAINS FROM VENEZUELA
Martínez, Dianny; Rodulfo, Hectorina E.; Rodríguez, Lucy; Caña, Luisa E.; Medina, Belkis; Guzman, Militza; Carreño, Numirin; Marcano, Daniel; Donato, Marcos De
2014-01-01
Clinical strains of Enterobacter were isolated from Cumana's Central Hospital in Venezuela, and classified as E. cloacae (21), E. aerogenes (7), E. intermedium (1), E. sakazakii (1) and three unclassified. The strains showed high levels of resistance, especially to SXT (58.1%), CRO (48.8%), CAZ (46.6%), PIP (46.4%), CIP (45.2%) and ATM (43.3%). This is the first report for South America of bla VIM-2 in two E. cloacae and one Enterobacter sp., which also showed multiple mechanisms of resistance. Both E. cloacae showed bla TEM-1, but only one showed bla CTX-M-15 gene, while no bla SHV was detected. PMID:24553611
Venturella, Giuseppe; Palazzolo, Eristanna; Saiano, Filippo; Gargano, Maria Letizia
2015-01-01
In this paper, the authors provide data on a culinary-medicinal, host-specific variety of P. eryngii species-complex that is known in Italy as "cardoncello". A species description, the techniques of isolation of a new strain (C-142-c), and the preparation of the substratum are illustrated. Data on the productivity of substratum inoculated with C-142-c strain and the nutritional value of cultivated "cardoncello" mushrooms are also provided.
Hellin, Pierre; Dedeurwaerder, Géraldine; Duvivier, Maxime; Scauflaire, Jonathan; Huybrechts, Bart; Callebaut, Alfons; Munaut, Françoise; Legrève, Anne
2016-07-01
Over a 4-year period (2010-13), a survey aiming at determining the occurrence of Fusarium spp. and their relations to mycotoxins in mature grains took place in southern Belgium. The most prevalent species were F. graminearum, F. avenaceum, F. poae and F. culmorum, with large variations between years and locations. An even proportion of mating type found for F. avenaceum, F. culmorum, F. cerealis and F. tricinctum is usually a sign of ongoing sexual recombination. In contrast, an unbalanced proportion of mating type was found for F. poae and no MAT1-2 allele was present in the F. langsethiae population. Genetic chemotyping indicates a majority of deoxynivalenol (DON)-producing strains in F. culmorum (78%, all 3-ADON producers) and F. graminearum (95%, mostly 15-ADON producers), while all F. cerealis strains belong to the nivalenol (NIV) chemotype. Between 2011 and 2013, DON, NIV, enniatins (ENNs) and moniliformin (MON) were found in each field in various concentrations. By comparison, beauvericin (BEA) was scarcely detected and T-2 toxin, zearalenone and α- and β-zearalenols were never detected. Principal component analysis revealed correlations of DON with F. graminearum, ENNs and MON with F. avenaceum and NIV with F. culmorum, F. cerealis and F. poae. BEA was associated with the presence of F. tricinctum and, to a lesser extent, with the presence of F. poae. The use of genetic chemotype data revealed that DON concentrations were mostly influenced by DON-producing strains of F. graminearum and F. culmorum, whereas the concentrations of NIV were influenced by the number of NIV-producing strains of both species added to the number of F. cerealis and F. poae strains. This study emphasises the need to pay attention to less-studied Fusarium spp. for future Fusarium head blight management strategies, as they commonly co-occur in the field and are associated with a broad spectrum of mycotoxins.
Léon-Kloosterziel, K.M.; Verhagen, B.W.M.; Keurentjes, J.J.B.; Pelt, J.A. van; Rep, M.; Loon, L.C. van; Pieterse, C.M.J.
2005-01-01
Plants of which the roots are colonized by selected strains of non-pathogenic, fluorescent Pseudomonas spp. develop an enhanced defensive capacity against a broad spectrum of foliar pathogens. In Arabidopsis thaliana, this rhizobacteria-induced systemic resistance (ISR) functions independently of
Colavolpe, María Belén; Mejía, Santiago Jaramillo; Albertó, Edgardo
2014-01-01
Trichoderma spp is the cause of the green mold disease in mushroom cultivation production. Many disinfection treatments are commonly applied to lignocellulose substrates to prevent contamination. Mushroom growers are usually worried about the contaminations that may occur after these treatments during handling or spawning. The aim of this paper is to estimate the growth of the green mold Trichoderma sp on lignocellulose substrates after different disinfection treatments to know which of them is more effective to avoid contamination during spawning phase. Three different treatments were assayed: sterilization (121 °C), immersion in hot water (60 and 80 °C), and immersion in alkalinized water. Wheat straw, wheat seeds and Eucalyptus or Populus sawdust were used separately as substrates. After the disinfection treatments, bagged substrates were sprayed with 3 mL of suspension of conidia of Trichoderma sp (10(5) conidia/mL) and then separately spawned with Pleurotus ostreatus or Gymnopilus pampeanus. The growth of Trichoderma sp was evaluated based on a qualitative scale. Trichoderma sp could not grow on non-sterilized substrates. Immersions in hot water treatments and immersion in alkalinized water were also unfavorable treatments for its growth. Co- cultivation with mushrooms favored Trichoderma sp growth. Mushroom cultivation disinfection treatments of lignocellulose substrates influence on the growth of Trichoderma sp when contaminations occur during spawning phase. The immersion in hot water at 60 °C for 30 min or in alkalinized water for 36 h, are treatments which better reduced the contaminations with Trichoderma sp during spawning phase for the cultivation of lignicolous species.
Haldar, Lopamudra; Gandhi, D N
2016-07-01
To investigate the effect of oral administration of two Bacillus strains on fecal coliforms, Lactobacillus and Bacillus spp. in rat animal model. An in vivo experiment was conducted for 49-day period on 36 adult male albino Wister rats divided equally into to four groups. After 7-day adaptation period, one group (T1) was fed on sterile skim milk along with basal diet for the next 28 days. Second (T2) and (T3) groups received spore biomass of Bacillus coagulans B37 and Bacillus pumilus B9, respectively, suspended in sterilized skim milk at 8-9 log colony-forming units/ml plus basal diet for 28 days, while control group (T4) was supplied with clean water along with basal diet. There was a 14-day post-treatment period. A total of 288 fecal samples (8 fecal collections per rat) were collected at every 7-day interval starting from 0 to 49 days and subjected to the enumeration of the counts of coliforms and lactobacilli and Bacillus spores using respective agar media. In vitro acid and bile tolerance tests on both the strains were performed. The rats those (T2 and T3) received either B. coagulans B37 or B. pumilus B9 spore along with non-fermented skim milk showed decrease (pBacillus spore counts as compared to the control group (T4) and the group fed only skim milk (T1). In vitro study indicated that both the strains were found to survive at pH 2.0 and 3.0 even up to 3 h and tolerate bile up to 2.0% concentration even after 12 h of exposure. This study revealed that oral administration of either B. coagulans B37 or B. pumilus B9 strains might be useful in reducing coliform counts accompanied by concurrent increase in lactobacilli counts in the intestinal flora in rats.
Directory of Open Access Journals (Sweden)
Lopamudra Haldar
2016-07-01
Full Text Available Aim: To investigate the effect of oral administration of two Bacillus strains on fecal coliforms, Lactobacillus and Bacillus spp. in rat animal model. Materials and Methods: An in vivo experiment was conducted for 49-day period on 36 adult male albino Wister rats divided equally into to four groups. After 7-day adaptation period, one group (T1 was fed on sterile skim milk along with basal diet for the next 28 days. Second (T2 and (T3 groups received spore biomass of Bacillus coagulans B37 and Bacillus pumilus B9, respectively, suspended in sterilized skim milk at 8-9 log colony-forming units/ml plus basal diet for 28 days, while control group (T4 was supplied with clean water along with basal diet. There was a 14-day post-treatment period. A total of 288 fecal samples (8 fecal collections per rat were collected at every 7-day interval starting from 0 to 49 days and subjected to the enumeration of the counts of coliforms and lactobacilli and Bacillus spores using respective agar media. In vitro acid and bile tolerance tests on both the strains were performed. Results: The rats those (T2 and T3 received either B. coagulans B37 or B. pumilus B9 spore along with non-fermented skim milk showed decrease (p<0.01 in fecal coliform counts and increase (p<0.05 in both fecal lactobacilli and Bacillus spore counts as compared to the control group (T4 and the group fed only skim milk (T1. In vitro study indicated that both the strains were found to survive at pH 2.0 and 3.0 even up to 3 h and tolerate bile up to 2.0% concentration even after 12 h of exposure. Conclusions: This study revealed that oral administration of either B. coagulans B37 or B. pumilus B9 strains might be useful in reducing coliform counts accompanied by concurrent increase in lactobacilli counts in the intestinal flora in rats.
Furustrand Tafin, U.; Meis, J.F.G.M.; Trampuz, A.
2012-01-01
We evaluated isothermal microcalorimetry for real-time susceptibility testing of non-Aspergillus molds. MIC and minimal effective concentration (MEC) values of Mucorales (n = 4), Fusarium spp. (n = 4), and Scedosporium spp. (n = 4) were determined by microbroth dilution according to the Clinical
Diversity of edible mushrooms in pakistan
International Nuclear Information System (INIS)
Sultana, K.; Shinwari, Z.K.; Iftikhar, F.
2007-01-01
Fifty six edible species of mushrooms are reported from Pakistan including four from Balochistan, three from Sindh, five from Punjab and 44 from NWFP and Azad Kashmir. Some of species being commercially exploited in the world are Agaricus bisporus, Auricularia spp. Coprinus comatus, Flammulina vellutipes, Lentinus edodes, Phellorina inquinans, Pleurotus ostreatus, Stropharia rugosoannulata, Volvariella volvacea. Because of over collection, urbanization and deforestation, some of species are threatened of extinction. (author)
Tao, Qiao-Qiao; Ma, Ke; Bao, Li; Wang, Kai; Han, Jun-Jie; Zhang, Jin-Xia; Huang, Chen-Yang; Liu, Hong-Wei
2016-06-01
Nine new sesquiterpenoids, clitocybulol derivatives, clitocybulols G-O (1-9) and three known sesquiterpenoids, clitocybulols C-E (10-12), were isolated from the solid culture of the edible fungus Pleurotus cystidiosus. The structures of compounds 1-12 were determined by spectroscopic methods. The absolute configurations of compounds 1-9 were assigned via the circular dichroism (CD) data analysis. Compounds 1, 6 and 10 showed moderate inhibitory activity against protein tyrosine phosphatase-1B (PTP1B) with IC50 values of 49.5, 38.1 and 36.0μM, respectively. Copyright © 2016. Published by Elsevier B.V.
Chegwin Angarita, Carolina
2014-01-01
El cultivo biotecnológico empleando fermentaciones en estado líquido de hongos del género Pleurotus, usando salvado de trigo y harinas de cereales y leguminosas como fuentes de carbono no convencionales, en busca de evaluar el efecto del cambio de algunas condiciones del proceso sobre la composición tanto de los micelios como de los caldos agotados y por ende del potencial como nutriceútico del mismo, para posteriormente evaluar la aplicabilidad de dicho producto en la obtención de fructifica...
Zielińska, Dorota; Rzepkowska, Anna; Radawska, Anna; Zieliński, Konrad
2015-02-01
Most important during probiotic selection are gastric acid and bile tolerance, the adhesion to the luminal epithelium to colonize the lower gastrointestinal tract of a human and safety for human consumption. The aim of this study was to evaluate the selected probiotic in vitro properties of Lactobacillus spp. Strains isolated from traditional fermented food. A total 38 strains were isolated from the pickled samples and 14 were identified as Lactobacillus spp. The survival of almost all strains after incubation at pH 2.5 did not change markedly, and remained at above 90 % (10(9) CFU/mL). The strains also exhibited a high survival rate at pH 3.5 (>90 %), whereas pH 1.5 all were died. Just four strains could survive 90 min. at pH 1.5 (survival rates of 81-94 % after 24 h, whereas after incubation in 2 and 4 % bile salt solution it was 59-94 %. All tested strains showed very good and good resistance to 0.4 % phenol addition, however only Lb. johnsonii K4 was able to multiply. The hydrophobic nature of the cell surface of the tested strains was moderated recording hydrophobicity of Lb. johnsonii K4 and Lb. rhamnosus K3 above 60 %. Safety evaluation excluded four of tested strains as candidate probiotics, according to antibiotic resistance patterns and certain metabolic activities. On the basis on the results 10 of the selected Lactobacillus strains are safe and can survive under gastrointestinal conditions, which requires them to future in vitro and in vivo probiotic studies.
Anandharaj, Marimuthu; Sivasankari, Balayogan; Santhanakaruppu, Rajendran; Manimaran, Muthusamy; Rani, Rizwana Parveen; Sivakumar, Subramaniyan
2015-06-01
This study sought to evaluate the probiotic potential of lactic acid bacteria (LAB) isolated from traditionally fermented south Indian koozh and gherkin (cucumber). A total of 51 LAB strains were isolated, among which four were identified as Lactobacillus spp. and three as Weissella spp. The strains were screened for their probiotic potential. All isolated Lactobacillus and Weissella strains were capable of surviving under low pH and bile salt conditions. GI9 and FKI21 were able to survive at pH 2.0 and 0.50% bile salt for 3 h without losing their viability. All LAB strains exhibited inhibitory activity against tested pathogens and were able to deconjugate bile salt. Higher deconjugation was observed in the presence of sodium glycocholate (P Strain FKI21 showed maximum auto-aggregation (79%) and co-aggregation with Escherichia coli MTCC 1089 (68%). Exopolysaccharide production of LAB strains ranged from 68.39 to 127.12 mg/L (P Lactobacillus crispatus and Weissella koreensis, respectively. This is the first study to report isolation of W. koreensis FKI21 from fermented koozh and demonstrates its cholesterol-reducing potential. Copyright © 2015 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
Probiotic attributes of autochthonous Lactobacillus rhamnosus strains of human origin.
Pithva, Sheetal; Shekh, Satyamitra; Dave, Jayantilal; Vyas, Bharatkumar Rajiv Manuel
2014-05-01
The study was aimed at evaluating the probiotic potential of indigenous autochthonous Lactobacillus rhamnosus strains isolated from infant feces and vaginal mucosa of healthy female. The survival of the selected strains and the two reference strains (L. rhamnosus GG and L. casei Actimel) was 67-81 % at pH 2 and 70-80 % after passage through the simulated gastrointestinal fluid. These strains are able to grow in the presence of 4 % bile salt, 10 % NaCl, and 0.6 % phenol. The cell surface of L. rhamnosus strains is hydrophilic in nature as revealed by bacterial adhesion to hydrocarbons (BATH) assay. Despite this, L. rhamnosus strains showed mucin adherence, autoaggregation and coaggregation properties that are strain-specific. In addition, they produce bile salt hydrolase (BSH) and β-galactosidase activities. L. rhamnosus strains exhibit antimicrobial activity against food spoilage organisms and gastrointestinal pathogens, as well as Candida and Aspergillus spp. L. rhamnosus strains have similar antibiotic susceptibility pattern, and resistance to certain antibiotics is intrinsic or innate. The strains are neither haemolytic nor producer of biogenic amines such as histamine, putrescine, cadaverine and tyramine. Lyophilized cells of L. rhamnosus Fb exhibited probiotic properties demonstrating potential of the strain for technological suitability and in the preparation of diverse probiotic food formulations.
Directory of Open Access Journals (Sweden)
Jin-Wen Shen
2013-01-01
Full Text Available Culture conditions for exopolysaccharide (EPS production by Pleurotus pulmonarius in submerged culture are optimized. The suggested medium composition was as follows: 60 g/L of xylose, 6 g/L of soy extract, 5 mM of KH2PO4 and 5 mM of MgSO4. Under the optimized culture conditions in a 5-litre stirred tank fermentor, the maximum concentration of EPS was 6.36 g/L. Furthermore, the morphological parameters (i.e. average diameter, circularity, roughness and compactness of the pellets and the broth viscosity are characterized. It has been proven that mycelial morphology and broth viscosity may be the critical parameters affecting the EPS yield. After deproteinization using Sevag method, a group of EPS (designated as fraction was obtained from the culture filtrates by gel filtration chromatography. FT-IR analysis of the purified EPS revealed prominent characteristic groups corresponding to polyhydric alcohols. GC analysis showed that the purified EPS were mainly composed of galactose and glucose. Furthermore, thermogravimetric analysis indicated that the degradation temperature of the purified EPS was 217 °C. Finally, the antioxidant activity of the EPS fraction was investigated and the relationship with molecular properties was discussed as well.
Transferability of SSR and RGA markers developed in Cynodon spp. to Zoysia spp.
Bermudagrass (Cynodon spp.) and zoysiagrass (Zoysia spp.), which are both used as warm-season turfgrasses in the United States, are members of subfamily Chloridoideae and are reported to be at least 55% genetically similar. To assess if molecular tools between the two species can be interchanged, 93...
Directory of Open Access Journals (Sweden)
José Luis Ochoa
2015-09-01
Full Text Available The present study was done in order to identify the fungus invading some of the supralittoral ponds used for shrimp aquaculture in the CIBNOR facilities in La Paz, Baja California Sur (BCS, México during the summer season. From the walls and bottoms of the ponds, two strains of Geotrichum spp. were isolated and morphologically identified. Fungal adhesion towards hemocytes and primary cultures of various white shrimp (Litopeneaus vannamei tissues (gill, tegument, and gut was analyzed to determine infectivity. Extracellular protease, lipase, and amylase activity were evaluated as virulence factors. Survival of shrimp post-larvae (PL8 exposed to fungal culture supernatant or to their filaments was also investigated. The results showed that shrimp tegument cells and hemocytes were very susceptible to Geotrichum spp. invasion, and that this fungus provokes great mortality of post-larvae. Hence, Geotrichum spp. could be considered an opportunistic pathogen that might represent a serious health risk to shrimp in culture.
Directory of Open Access Journals (Sweden)
El Semary, NA.
2011-01-01
Full Text Available A polyphasic approach was applied to describe a colony-forming Desmodesmus species collected from the Nile River, Maadi area, Helwan district, Egypt. The isolate grows best at moderate temperature and relatively high light intensity. The phenotypic features revealed the presence of both unicellular and colonial forms of the isolate and the latter form was either 2-4 celled. Cells were 4-6 mm ± 0.5 at their widest point and 11-15 mm ± 0.48 in their length with spiny projections that encircled the cells. Cells were heavily-granulated and enclosed within common mucilaginous sheath. Colonial forms were developed through production of daughter cells within mother cell. Molecular analysis using 18S rRNA gene showed some similarity to its nearest relative (Desmodesmus communis whereas the phylogenetic analyses clustered it together with other Desmodesmus spp. and away from Scenedesmus spp. from the database. However, the use of ITS-2 as a phylotaxonomic marker proved to be more resolving and confirmed the generic identity of the isolate as Desmodesmus spp. The fatty acid composition revealed the presence of saturated palmitic fatty acid as the most abundant component followed by monounsaturated palmitoleic acid whereas the polyunsaturated fatty acids were in relatively low abundance. The palmitoleic acid in particular is suggested to be involved in active defense mechanism. The phytochemical screening revealed the presence of alkaloids and saponins and absence of tannins. Fractions of methanolic extracts showed antimicrobial activities against pathogenic bacterial strains including multi-drug resistant ones. This study documents the presence of this strain in the River Nile and highlights its biotechnological potential as a source of bioactive compounds.
Yasin, Ina-salwany Md; Razak, Nabilah Fatin; Natrah, F M I; Harmin, Sharr Azni
2016-07-01
A total of 58 Gram-positive bacteria strains were isolated from the marine environment and screened for potential probiotics for disease prevention and improving the productivity of tiger grouper Epinephelus fuscoguttatus larvae and juveniles. The bacteria were identified as Bacillus licheniformis, B. subtilis, B. circulans, B. sphaericus, B. cereus, Brevibacillus brevis, Corynebacterium propinquum, Leifsonia aquatica and Paenibacillus macerans. Only 24 strains showed antagonistic activities against four pathogenic strains; Vibrio alginolyticus, V. harveyi, V. parahaemolyticus and Aeromonas hydrophila, where two of the Bacillus strains, B12 and B45 demonstrated intermediate to highest level of inhibitory activity against these pathogenic strains, respectively. Further assessment by co-culture assay showed that Bacillus strain B12 exhibited a total inhibition of V. alginolyticus, while B45 strain displayed no inhibitory activity. Mixed culture of Bacillus B12 and B45 strains to outcompete V. alginolyticus was observed at a cell density of 10(7) CFU ml(-1). Molecular identification and phylogenetic tree analysis have categorized Bacillus strain B12 to the reference strains GQ340480 and JX290193 of? B. amyloliquafaciens, and Bacillus strain B45 with a reference strain JF496522 of B. subtilis. Safety tests of probionts by intraperitoneal administration of B12 and B45 strains at cell densities of 103, 105 and 10(7) CFU ml(-1) revealed no abnormalities and cent percent survival for healthy Epinephelus fuscoguttatus juveniles within 15 days of experimental period. Overall, the study revealed that Bacillus B12 strain possesses tremendous probiotic potential that could be used as a feed supplement in tiger grouper diets. ?
Sørensen, Kim I.; Thorsen, Line; Stuer-Lauridsen, Birgitte; Abdelgadir, Warda S.; Nielsen, Dennis S.; Derkx, Patrick M. F.; Jespersen, Lene
2012-01-01
Bacillus spp. are widely used as feed additives and probiotics. However, there is limited information on their resistance to various antibiotics, and there is a growing concern over the transfer of antibiotic resistance genes. The MIC for 8 antibiotics was determined for 85 Bacillus species strains, Bacillus subtilis subsp. subtilis (n = 29), Bacillus licheniformis (n = 38), and Bacillus sonorensis (n = 18), all of which were isolated from starters for Sudanese bread production. All the strains were sensitive to tetracycline (8.0 mg/liter), vancomycin (4.0 mg/liter), and gentamicin (4.0 mg/liter) but resistant to streptomycin. Sensitivity to clindamycin, chloramphenicol, and kanamycin was species specific. The erythromycin resistance genes ermD and ermK were detected by PCR in all of the erythromycin-resistant (MIC, ≥16.0 mg/liter) B. licheniformis strains and one erythromycin-sensitive (MIC, 4.0 mg/liter) B. licheniformis strain. Several amino acid changes were present in the translated ermD and ermK nucleotide sequences of the erythromycin-sensitive strain, which could indicate ErmD and ErmK protein functionalities different from those of the resistance strains. The ermD and ermK genes were localized on an 11.4-kbp plasmid. All of the B. sonorensis strains harbored the bacitracin synthetase gene, bacA, and the transporter gene bcrA, which correlated with their observed resistance to bacitracin. Bacitracin was produced by all the investigated species strains (28%), as determined by ultra-high-definition quadrupole time-of-flight liquid chromatography-mass spectrometry (UHD-QTOF LC/MS). The present study has revealed species-specific variations in the antimicrobial susceptibilities of Bacillus spp. and provides new information on MIC values, as well as the occurrence of resistance genes in Bacillus spp., including the newly described species B. sonorensis. PMID:22941078
Dynamics of sterol synthesis during development of Leishmania spp. parasites to their virulent form.
Yao, Chaoqun; Wilson, Mary E
2016-04-12
The Leishmania spp. protozoa, the causative agents of the "neglected" tropical disease leishmaniasis, are transmitted to mammals by sand fly vectors. Within the sand fly, parasites transform from amastigotes to procyclic promastigotes, followed by development of virulent (metacyclic) promastigote forms. The latter are infectious to mammalian hosts. Biochemical components localized in the parasite plasma membrane such as proteins and sterols play a pivotal role in Leishmania pathogenesis. Leishmania spp. lack the enzymes for cholesterol synthesis, and the dynamics of sterol acquisition and biosynthesis in parasite developmental stages are not understood. We hypothesized that dynamic changes in sterol composition during metacyclogenesis contribute to the virulence of metacyclic promastigotes. Sterols were extracted from logarithmic phase or metacyclic promastigotes grown in liquid culture with or without cholesterol, and analyzed qualitatively and quantitatively by gas chromatograph-mass spectrometry (GC-MS). TriTrypDB was searched for identification of genes involved in Leishmania sterol biosynthetic pathways. In total nine sterols were identified. There were dynamic changes in sterols during promastigote metacyclogenesis. Cholesterol in the culture medium affected sterol composition in different parasite stages. There were qualitative and relative quantitative differences between the sterol content of virulent versus avirulent parasite strains. A tentative sterol biosynthetic pathway in Leishmania spp. promastigotes was identified. Significant differences in sterol composition were observed between promastigote stages, and between parasites exposed to different extracellular cholesterol in the environment. These data lay the foundation for further investigating the role of sterols in the pathogenesis of Leishmania spp. infections.
Cultivation of oyster mushroom ( Pleurotus spp.) on palm oil ...
African Journals Online (AJOL)
Oyster mushroom is a popular mushroom due to its nutritional, medicinal and potential commercial value. In Malaysia, the fungus is currently cultivated on sawdust and rice husk. In this study, the efficiency of cultivating oyster mushroom was assessed using palm oil mesocarp fibre as a substrate. The experiment consisted ...
Lafi, Feras Fawzi; Alam, Intikhab; Bisseling, Ton; Geurts, Rene; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged
2017-01-01
Acinetobacter radioresistens strain SA188 is a plant endophytic bacterium, isolated from root nodules of the desert plants Indigofera spp., collected in Jizan, Saudi Arabia. Here, we report the 3.2-Mb draft genome sequence of strain SA188, highlighting characteristic pathways for plant growth–promoting activity and environmental adaptation.
Lafi, Feras Fawzi
2017-03-03
Acinetobacter radioresistens strain SA188 is a plant endophytic bacterium, isolated from root nodules of the desert plants Indigofera spp., collected in Jizan, Saudi Arabia. Here, we report the 3.2-Mb draft genome sequence of strain SA188, highlighting characteristic pathways for plant growth–promoting activity and environmental adaptation.
Stabel, J R; Hurd, S; Calvente, L; Rosenbusch, R F
2004-07-01
The 2002 NAHM's Dairy Survey indicated that 87.2% of dairy farms in the United States feed waste milk to their neonatal calves. Although cost-effective, this practice can lead to increased calf morbidity and mortality due to ingestion of pathogenic agents. In an effort to reduce the risk of infection, dairy producers are implementing on-farm pasteurization of the waste milk as a control procedure before feeding the milk to calves. In the present study, the efficacy of a commercial high-temperature, short-time (HTST) on-farm pasteurizer unit to destroy Mycobacterium paratuberculosis, Salmonella enterica spp., and Mycoplasma spp. in raw milk was evaluated. Replicate experiments were run for 3 isolates of M. paratuberculosis, 3 serovars of Salmonella (derby, dublin, typhimurium); and 4 species of Mycoplasma (bovis, californicum, canadense, serogroup 7) at 2 different levels of experimental inoculation. In addition, HTST pasteurization experiments were performed on colostrum experimentally inoculated with M. paratuberculosis. After culture of the pasteurized milk samples, no viable M. paratuberculosis, Salmonella, or Mycoplasma were recovered, regardless of species, strain, or isolate. Pasteurization of colostrum was also effective in the destruction of M. paratuberculosis but resulted in an average 25% reduction in colostral immunoglobulin. These results suggest that HTST pasteurization is effective in generating a safer product to feed to young calves.
Song, Wonkeun; Hong, Seong Geun; Yong, Dongeun; Jeong, Seok Hoon; Kim, Hyun Soo; Kim, Han-Sung; Kim, Jae-Seok; Bae, Il Kwon
2015-03-01
We evaluated the combined use of the modified Hodge test (MHT) and carbapenemase inhibition test (CIT) using phenylboronic acid (PBA) and EDTA to detect carbapenemase-producing Enterobacteriaceae (CPE) and metallo-β-lactamase (MBL)-producing Pseudomonas spp. A total of 49 isolates of CPE (15 Klebsiella pneumoniae carbapenemase [KPC], 5 Guiana extended-spectrum β-lactamase [GES]-5, 9 New Delhi metallo-β-lactamase [NDM]-1, 5 Verona integron-encoded metallo-β-lactamase [VIM]-2, 3 imipenem-hydrolyzing β-lactamase [IMP], and 12 oxacillinase [OXA]-48-like), 25 isolates of MBL-producing Pseudomonas spp. (14 VIM-2 and 11 IMP), and 35 carbapenemase-negative controls were included. The MHT was performed for all isolates as recommended by the Clinical and Laboratory Standards Institute. Enhanced growth of the indicator strain was measured in mm with a ruler. The CIT was performed by directly dripping PBA and EDTA solutions onto carbapenem disks that were placed on Mueller-Hinton agar plates seeded with the test strain. Considering the results of the MHT with the ertapenem disk in Enterobacteriaceae and Pseudomonas spp., the CIT with the meropenem disk in Enterobacteriaceae, and the imipenem disk in Pseudomonas spp., three combined disk tests, namely MHT-positive plus PBA-positive, EDTA-positive, and MHT-positive plus PBA-negative plus EDTA-negative, had excellent sensitivity and specificity for the detection of KPC- (100% sensitivity and 100% specificity), MBL- (94% sensitivity and 100% specificity), and OXA-48-like-producing isolates (100% sensitivity and 100% specificity), respectively. Combined use of the MHT and CIT with PBA and EDTA, for the detection of CPE and MBL-producing Pseudomonas spp., is effective in detecting and characterizing carbapenemases in routine laboratories.
Directory of Open Access Journals (Sweden)
Patrick Schmidt
2003-12-01
Full Text Available A inoculação de forragens com fungos lignocelulolíticos é uma opção para melhorar a qualidade destas sem adição de produtos químicos. O tratamento do substrato influencia a ação do fungo e a qualidade final do produto. Neste experimento, aplicaram-se quatro tratamentos (compostagem do feno inteiro, compostagem do feno picado, hidratação do feno em água fria e hidratação do feno em água quente a um feno de Brachiaria decumbens. Aos tratamentos seguiu-se inoculação com o fungo Pleurotus ostreatus e incubação por 35 dias, sob temperatura controlada. Usou-se o delineamento inteiramente casualizado, com quatro repetições e medidas repetidas. Amostras foram colhidas semanalmente para acompanhar a degradação do substrato, mediante a análise química do feno. Observou-se aumento linear, com o decorrer do tempo, no teor de proteína bruta (PB e na proporção de lignina na parede celular (LIG-FDN, e decréscimo linear nos valores de fibra em detergente neutro (FDN, celulose e hemicelulose. Não se observou efeito de tratamento no teor de FDA. Os tratamentos com compostagem apresentaram maiores valores de PB, lignina e LIG-FDN e menores de FDN e hemicelulose. Não se observou diferença entre os tratamentos com hidratação. O tratamento do feno de braquiária com o fungo propiciou degradação da fração fibrosa e aumento no teor de PB, com efeito mais intenso nos tratamentos que usaram compostagem. A ação do fungo foi mais efetiva sobre a hemicelulose que sobre os demais componentes da fibra.The innoculation of forages with lignocellulolytic fungi is an option for improving quality without adding chemical products. Substrate quality influences fungal activity and endproduct quality. The effects of four treatments (composting of whole hay, composting of chopped hay, soaking in cool water and soaking in hot water on a Brachiaria decumbens hay were evaluated. The treatments were followed by innoculation with Pleurotus ostreatus
Directory of Open Access Journals (Sweden)
Szacawa Ewelina
2016-12-01
Full Text Available Introduction: Mycoplasma bovis is one of the main pathogens involved in cattle pneumonia. Other mycoplasmas have also been directly implicated in respiratory diseases in cattle. The prevalence of different Mycoplasma spp. in cattle affected by respiratory diseases and molecular characteristics of M. bovis field strains were evaluated. Material and Methods: In total, 713 nasal swabs from 73 cattle herds were tested. The uvrC gene fragment was amplified by PCR and PCR products were sequenced. PCR/DGGE and RAPD were performed. Results: It was found that 39 (5.5% samples were positive for M. bovis in the PCR and six field strains had point nucleotide mutations. Additionally, the phylogenetic analysis of 20 M. bovis field strains tested with RAPD showed two distinct groups of M. bovis strains sharing only 3.8% similarity. PCR/DGGE analysis demonstrated the presence of bacteria belonging to the Mollicutes class in 79.1% of DNA isolates. The isolates were identified as: Mycoplasma bovirhinis, M. dispar, M. bovis, M. canis, M. arginini, M. canadense, M. bovoculi, M. alkalescens, and Ureaplasma diversum. Conclusion: Different Mycoplasma spp. strains play a crucial role in inducing respiratory diseases in cattle.
Optimization of medium for antimycotic production by Streptomyces spp.
Directory of Open Access Journals (Sweden)
Bajić Bojana Ž.
2013-01-01
Full Text Available Numerous species of the genus Streptomyces, on the appropriate cultivation medium in the process of submerged biosynthesis, as a product of the secondary metabolism, and under aerobic conditions synthesize pharmacologically active compounds. The aim of presented study was optimization of different nitrogen sources in the cultivation medium for the production of antimycotics using a strain of Streptomyces spp. isolated from the environment. Experiments were carried out in accordance with Box-Behnken design with three factors at three levels (peptone: 3.0 g/l, 7.0 g/l and 11.0 g/l; yeast extract: 1.0 g/l, 3.0 g/l and 5.0 g/l; soybean meal: 5.0 g/l, 15.0 g/l and 25.0 g/l and three repetitions in the central point. Cultivation mediums were analyzed for determination of residual sugar, residual nitrogen, pellet diameter and RNA. Also, antimycotic activity of the obtained cultivation mediums was determined using diffusion disc method on the Aspergillus spp. as the test microorganism. For the optimization of selected parameters, a Response Surface Methodology was used and the obtained data were analyzed using the software package DESIGN EXPERT 8.1. Achieved model with a coefficient of determination (R of 0.952 predicted that the maximum inhibition zone diameter (24.0 mm against microorganism Aspergillus spp. and the minimum amount of residual sugar (0.551528 g/l under applied experimental conditions was produced when the contents of varied nitrogen sources were: peptone 11.0 g/l, yeast extract 4.32 g/l and soybean meal 25.00 g/l.
Directory of Open Access Journals (Sweden)
Kátia Maria Gomes Machado
2006-12-01
Full Text Available Pleurotus ostreatus ("shimeji" is produced in Brazil on a commercial scale using various lignocellulosic residues. Efforts have been made to reuse the culture residue to obtain products of greater aggregate value such as enzymes or in processes of bioremediation. We evaluated the Remazol brilliant blue R (RBBR degradation potential of extracts from solid substrate colonized by P. ostreatus and extracts from residue of the "shimeji" mushroom yield. Colonized substrates and residue were provided by Toyobo do Brasil Ltda. Extraction was performed with sodium acetate buffer (50 mM, pH 4.6. RBBR decolorization was monitored at 592 nm and peroxidase and laccase activities were measured by monitoring the oxidation of ABTS. Horseradish peroxidase was used as reference. The time of growth of P. ostreatus influenced RBBR degradation and peroxidase and laccase activities. Concentration of 1 mM H2O2 and pH 4.0 were the best for RBBR decolorization. Complete RBBR decolorization was obtained with the addition of only one aliquot of 50 µL of 1 mM H2O2. The stability of the extracts was higher when they were kept under refrigeration than when stored frozen. The potential application of the ligninolytic complex derived from P. ostreatus and mushroom residue for xenobiotic degradation was demonstrated.Pleurotus ostreatus ("shimeji" é produzido no Brasil em escala comercial empregando-se vários resíduos lignocelulósicos. Esforços têm sido feitos para reaproveitamento do resíduo do cultivo em produtos de maior valor agregado, como enzimas ou sua aplicação em processos de biorremediação. Foi feita avaliação do potencial de degradação do azul brilhante de remazol (RBBR por extratos obtidos de substratos sólidos colonizados por P. ostreatus e por extratos do resíduo da produção do cogumelo "shimeji". Substratos colonizados e o resíduo foram fornecidos pela Toyobo do Brasil Ltda. Extração foi feita com tampão acetato de sódio (50 mM, pH 4
Directory of Open Access Journals (Sweden)
Hllytchaikra Ferraz Fehlberg
Full Text Available The objective of this study was to standardize the high-resolution melting method for identification and discrimination of Toxoplasma gondii, Sarcocystis spp., Neospora spp., and Cryptosporidium spp. by amplification of 18S ribosomal DNA (rDNA using a single primer pair. The analyses were performed on individual reactions (containing DNA from a single species of a protozoan, on duplex reactions (containing DNA from two species of protozoa in each reaction, and on a multiplex reaction (containing DNA of four parasites in a single reaction. The proposed method allowed us to identify and discriminate the four species by analyzing the derivative, normalized, and difference melting curves, with high reproducibility among and within the experiments, as demonstrated by low coefficients of variation (less than 2.2% and 2.0%, respectively. This is the first study where this method is used for discrimination of these four species of protozoa in a single reaction.
Molecular and Antibacterial Profile of Edible Oyster Mushrooms ...
African Journals Online (AJOL)
2012r
2014-09-24
Sep 24, 2014 ... Phenol/Chloroform DNA extraction protocol and the DNA was ... DNA from oyster mushroom fermentation broth, mycelia or fruiting bodies. .... Sample preparation: The different strains of Pleurotus were obtained in test- tubes.
Directory of Open Access Journals (Sweden)
Marlon Corrêa Pereira
2015-12-01
Full Text Available Cyrtopodium glutiniferum is an endemic orchid of Brazil with potential medicinal and ornamental applications. As mycorrhizal fungi are essential for the initiation of the orchid life cycle, the aim of this study was to determine the strains of mycorrhizal fungi suitable for seed germination and protocorm development of C. glutiniferum and to characterize the symbiotic development of protocorms. Seeds of C. glutiniferum were inoculated with nine mycorrhizal fungi, Epulorhiza spp., Ceratorhiza spp., Rhizoctonia sp., originally isolated from Brazilian neotropical orchids. Only Epulorhiza isolates promoted seed germination and protocorm development. Three Epulorhiza isolates (M1, M6 = E. epiphytica, M20 = Epulorhiza sp. promoted protocorm development until leaf production at 63 days. The protocorms are comprised of parenchyma cells delimited by a unistratified epidermis; the parenchyma cells of the upper part of the protocorms are smaller than those located more towards the base. Intact and digested pelotons were observed inside of protocorms implying that the seedlings were capable of mycotrophy. Additionally, the development of a bud primordium only occurred after colonization by fungus. This study suggests that C. glutiniferum has a preference for strains of Epulorhiza and that fungus digestion is essential to protocorm development.
Prevalence of food contamination with Listeria spp. in Kermanshah, Islamic Republic of Iran.
Akya, A; Najafi, A; Moradi, J; Mohebi, Z; Adabagher, S
2013-05-01
Listeria monocytogenes is a human pathogen causing serious diseases. We aimed to determine food contamination with Listeria spp. in Kermanshah, Islamic Republic of Iran. Samples (185 dairy, 187 meat products and 158 ready-to-eat foods such as salads) were randomly collected from markets. After processing, samples were cultured in half-Fraser and Fraser broth followed by cultivation on PALCAM and Oxford media. Confirmatory tests including carbohydrate utilization were performed on isolates to determine species. Bacteria were isolated from 66/530 samples (12.5%). Meat products showed the highest (27.2%) and dairy products the lowest (3.8%) contamination rates. L. innocua was found in 56 (10.6%) samples, but L. monocytogenes was only found in 3 samples (0.6%). The results indicate that the rate of contamination with L. monocytogenes, even for ready-to-eat foods, was low but for other Listeria spp., in particular strains of L. innocua, the rate of contamination was higher, suggesting that more control on food sanitation is required.
Directory of Open Access Journals (Sweden)
R.M. Dornas
2014-02-01
Full Text Available Lactobacillus spp. isolated from different portions of chickens' gastrointestinal tract were evaluated concerning their ability to survive in a water-in-oil (W/0 emulsion containing sesame and sunflower oil. After sixty days of emulsion storage under refrigeration, three of five strains tested survived in number equal to or higher than 10(6cfu/g. Lactobacillus reuteri 2M14C, which presented the highest survival in W/O emulsion (10(7cfu/g, was tested for its capacity to resist throughout the passage through gnotobiotic mice gastrointestinal tract and for the ability to stimulate murine peritoneal macrophages phagocytosis. This strain remained at a number above 10(9cfu/g feces during ten days of monoassociation, and monoassociated mice showed phagocytic activity significantly greater than the germ-free controls (P<0.05. The results suggest that the formulation can be used to incorporate viable Lactobacillus spp. cells in animal feed. Moreover, the results suggest that L. reuteri 2M14C is a strong candidate to be incorporated in probiotic formulations for use in chicken.
Jayakumar, T; Ramesh, E; Geraldine, P
2006-12-01
This study was undertaken to investigate the putative antioxidant activity of the oyster mushroom Pleurotus ostreatus on CCl(4)-induced liver damage in male Wistar rats. Intraperitoneal administration of CCl(4) (2ml/kg) to rats for 4 days resulted in significantly elevated (pSALP) compared to controls. In the liver, significantly elevated levels (pSALP levels reverted to near normal, while the hepatic concentration of GSH, CAT, SOD and Gpx were significantly increased (p<0.05) and that of MDA significantly (p<0.05) lowered, when compared to CCl(4)-exposed untreated rats. Histopathological studies confirmed the hepatoprotective effect conferred by the extract of P. ostreatus. These results suggest that an extract of P. ostreatus is able to significantly alleviate the hepatotoxicity induced by CCl(4) in the rat.
Directory of Open Access Journals (Sweden)
Ahmad Muslim
2014-08-01
Full Text Available Soil microbes associated with rhizosphere are important for promoting plant growth and inducing resistance to diseases. The research was conducted to study the ability of Trichoderma spp. and Penicillium spp. isolated from rhizosphere in lowland swampy area for controlling damping-off disease caused by Rhizoctonia solani Khun. Trichoderma spp. and Penicillium spp. were cultured in bran, corn meal, and rice straw containing media and applied as inoculum to 2-weeks old seedlings. Application of two fungi isolates effectively induced resistance of chili plants to damping-off disease. Trichoderma spp. and Penicillium spp. were significantly reduced disease incidence by 61.5–100% to 46.2–100%, respectively and disease severity by 50–100% and 30–95.9%, respectively. This experiment showed the potential of Trichoderma spp. and Penicillium spp. as biocontrol agents to control damping-off disease on chili.
Potter, Amina; Ceotto, Hilana; Giambiagi-Demarval, Marcia; dos Santos, Kátia Regina Netto; Nes, Ingolf F; Bastos, Maria do Carmo de Freire
2009-06-01
This study analyzed ten strains of coagulase-negative staphylococci (CNS) involved in nosocomial infections in three Brazilian hospitals. Their antibiotic susceptibility profile showed that most strains exhibited multiple antibiotic resistance and possessed the mecA gene. The ability of these strains to adhere to polystyrene microtiter plates was also tested and nine of them proved to be biofilm producers at least in one of the three conditions tested: growth in TSB, in TSB supplemented with NaCl, or in TSB supplemented with glucose. The presence of the bap gene, which codes for the biofilm-associated protein (Bap), was investigated in all ten strains by PCR. AU strains were bop-positive and DNA sequencing experiments confirmed that the fragments amplified were indeed part of a bap gene. The presence of the icaA gene, one of the genes involved in polysaccharide intercellular adhesin (PIA) formation, was also detected by PCR in eight of the ten strains tested. The two icaA-negative strains were either weak biofilm producer or no biofilm producer, although they were bop-positive. To our knowledge, this is the first report demonstrating the presence of the bap gene in nosocomial isolates of CNS, being also the first report on the presence of this gene in Staphylococcus haemolyticus and S. cohnii.
González-Vázquez, R; Azaola-Espinosa, A; Mayorga-Reyes, L; Reyes-Nava, L A; Shah, N P; Rivera-Espinoza, Y
2015-12-01
The aim of this study was to isolate, from pulque, Lactobacillus spp. capable of survival in simulated gastrointestinal stress conditions. Nine Gram-positive rods were isolated; however, only one strain (J57) shared identity with Lactobacillus and was registered as Lactobacillus casei J57 (GenBank accession: JN182264). The other strains were identified as Bacillus spp. The most significant observation during the test of tolerance to simulated gastrointestinal conditions (acidity, gastric juice and bile salts) was that L. casei J57 showed a rapid decrease (p ≤ 0.05) in the viable population at 0 h. Bile salts were the stress condition that most affected its survival, from which deoxycholic acid and the mix of bile salts (oxgall) were the most toxic. L. casei J57 showed bile salt hydrolase activity over primary and secondary bile salts as follows: 44.91, 671.72, 45.27 and 61.57 U/mg to glycocholate, taurocholate, glycodeoxycholate and taurodeoxycholate. In contrast, the control strain (L. casei Shirota) only showed activity over tauroconjugates. These results suggest that L. casei J57 shows potential for probiotic applications.
Lu, J; Struewing, I; Vereen, E; Kirby, A E; Levy, K; Moe, C; Ashbolt, N
2016-02-01
This study investigated waterborne opportunistic pathogens (OPs) including potential hosts, and evaluated the use of Legionella spp. for indicating microbial water quality for OPs within a full-scale operating drinking water distribution system (DWDS). To investigate the occurrence of specific microbial pathogens within a major city DWDS we examined large volume (90 l drinking water) ultrafiltration (UF) concentrates collected from six sites between February, 2012 and June, 2013. The detection frequency and concentration estimates by qPCR were: Legionella spp. (57%/85 cell equivalent, CE l(-1) ), Mycobacterium spp. (88%/324 CE l(-1) ), Pseudomonas aeruginosa (24%/2 CE l(-1) ), Vermamoeba vermiformis (24%/2 CE l(-1) ) and Acanthamoeba spp. (42%/5 cyst equivalent, CE l(-1) ). There was no detection of the following microorganisms: human faecal indicator Bacteroides (HF183), Salmonella enterica, Campylobacter spp., Escherichia coli O157:H7, Giardia intestinalis, Cryptosporidium spp. or Naegleria fowleri. There were significant correlations between the qPCR signals of Legionella spp. and Mycobacterium spp., and their potential hosts V. vermiformis and Acanthamoeba spp. Sequencing of Legionella spp. demonstrated limited diversity, with most sequences coming from two dominant groups, of which the larger dominant group was an unidentified species. Other known species including Legionella pneumophila were detected, but at low frequency. The densities of Legionella spp. and Mycobacterium spp. were generally higher (17 and 324 folds, respectively) for distal sites relative to the entry point to the DWDS. Legionella spp. occurred, had significant growth and were strongly associated with free-living amoebae (FLA) and Mycobacterium spp., suggesting that Legionella spp. could provide a useful DWDS monitoring role to indicate potential conditions for non-faecal OPs. The results provide insight into microbial pathogen detection that may aid in the monitoring of microbial water
Free-living and captive turtles and tortoises as carriers of new Chlamydia spp.
Mitura, Agata; Niemczuk, Krzysztof; Zaręba, Kinga; Zając, Magdalena; Laroucau, Karine; Szymańska-Czerwińska, Monika
2017-01-01
A variety of Chlamydia species belonging to the Chlamydiaceae family have been reported in reptilian hosts but scarce data about their occurrence in turtles and tortoises are available. In this study, research was conducted to acquire information on invasive alien species (IAS) of turtles and indigenous turtles and tortoises, living both free and in captivity, as possible reservoirs of Chlamydiaceae. Analysis of specimens (pharyngeal and cloacal swabs and tissues) from 204 turtles and tortoises revealed an overall Chlamydiaceae prevalence of 18.3% and 28.6% among free-living and captive animals respectively, with variable levels of shedding. Further testing conducted with a species-specific real-time PCR and microarray test was unsuccessful. Subsequently sequencing was applied to genotype the Chlamydiaceae-positive samples. Almost the full lengths of the 16S rRNA and ompA genes as well as the 16S-23S intergenic spacer (IGS) and 23S rRNA domain I were obtained for 14, 20 and 8 specimens respectively. Phylogenetic analysis of 16S rRNA amplicons revealed two distinct branches. Group 1 (10 specimens), specific to freshwater turtles and reported here for the first time, was most closely related to Chlamydia (C.) pneumoniae strains and the newly described Candidatus C. sanzinia. Group 2 (four specimens), detected in Testudo spp. samples, showed highest homology to C. pecorum strains but formed a separate sub-branch. Finally, molecular analysis conducted on positive samples together with their geographical distribution in places distant from each other strongly suggest that Group 1 specimens correspond to a new species in the Chlamydiaceae family. In-depth studies of Chlamydia spp. from turtles and tortoises are needed to further characterise these atypical strains and address arising questions about their pathogenicity and zoonotic potential.
Free-living and captive turtles and tortoises as carriers of new Chlamydia spp.
Directory of Open Access Journals (Sweden)
Agata Mitura
Full Text Available A variety of Chlamydia species belonging to the Chlamydiaceae family have been reported in reptilian hosts but scarce data about their occurrence in turtles and tortoises are available. In this study, research was conducted to acquire information on invasive alien species (IAS of turtles and indigenous turtles and tortoises, living both free and in captivity, as possible reservoirs of Chlamydiaceae. Analysis of specimens (pharyngeal and cloacal swabs and tissues from 204 turtles and tortoises revealed an overall Chlamydiaceae prevalence of 18.3% and 28.6% among free-living and captive animals respectively, with variable levels of shedding. Further testing conducted with a species-specific real-time PCR and microarray test was unsuccessful. Subsequently sequencing was applied to genotype the Chlamydiaceae-positive samples. Almost the full lengths of the 16S rRNA and ompA genes as well as the 16S-23S intergenic spacer (IGS and 23S rRNA domain I were obtained for 14, 20 and 8 specimens respectively. Phylogenetic analysis of 16S rRNA amplicons revealed two distinct branches. Group 1 (10 specimens, specific to freshwater turtles and reported here for the first time, was most closely related to Chlamydia (C. pneumoniae strains and the newly described Candidatus C. sanzinia. Group 2 (four specimens, detected in Testudo spp. samples, showed highest homology to C. pecorum strains but formed a separate sub-branch. Finally, molecular analysis conducted on positive samples together with their geographical distribution in places distant from each other strongly suggest that Group 1 specimens correspond to a new species in the Chlamydiaceae family. In-depth studies of Chlamydia spp. from turtles and tortoises are needed to further characterise these atypical strains and address arising questions about their pathogenicity and zoonotic potential.
Skinner, Delaina; Mitcham, Jessica R; Starkey, Lindsay A; Noden, Bruce H; Fairbanks, W Sue; Little, Susan E
2017-10-01
American black bears (Ursus americanus) are commonly infested with ticks throughout their range, but there are few surveys for tick-borne disease agents in bears. To characterize tick infestations and determine the prevalence of current infection with Babesia spp. and past or current infection with Ehrlichia spp. in newly re-established populations of black bears in east central and southeastern Oklahoma, US, we identified adult (n=1,048) and immature (n=107) ticks recovered from bears (n=62). We evaluated serum and whole blood samples from a subset (n=49) for antibodies reactive to, and characteristic DNA fragments of, Ehrlichia spp., as well as characteristic DNA fragments of Babesia spp. Amblyomma americanum, the most common tick identified, was found on a majority (56/62; 90%) of bears and accounted for 697/1,048 (66.5%) of all ticks recovered. Other ticks included Dermacentor variabilis (338/1,048; 32.3%) from 36 bears, Amblyomma maculatum (9/1,048; 0.9%) from three bears, and Ixodes scapularis (4/1,048; 0.4%) from three bears. Antibodies reactive to Ehrlichia spp. were detected in every bear tested (49/49; 100%); maximum inverse titers to Ehrlichia chaffeensis ranged from 64-4,096 (geometric mean titer 1,525). However, PCR failed to identify active infection with E. chaffeensis, Ehrlichia ewingii, or an Ehrlichia ruminantium-like agent. Infection with Babesia spp. was detected by PCR in 3/49 (6%) bears. Together these data confirm that tick infestations and infection with tick-borne disease agents are common in bears in the southern US. The significance of these infestations and infections to the health of bears, if any, and the identity of the Ehrlichia spp. responsible for the antibody reactivity seen, warrant further evaluation.
Directory of Open Access Journals (Sweden)
Pilar eMartínez-Hidalgo
2015-09-01
Full Text Available Micromonospora is a Gram positive bacterium that can be isolated from nitrogen fixing nodules from healthy leguminous plants, where they could be beneficial to the plant. Their plant growth promoting activity in legume and non-legume plants has been previously demonstrated. The present study explores the ability of Micromonospora strains to control fungal pathogens and to stimulate plant immunity. Micromonospora strains isolated from surface sterilized nodules of alfalfa showed in vitro antifungal activity against several pathogenic fungi. Moreover, root inoculation of tomato plants with these Micromonospora strains effectively reduced leaf infection by the fungal pathogen Botrytis cinerea, despite spatial separation between both microorganisms. This induced systemic resistance, confirmed in different tomato cultivars, is long lasting. Gene expression analyses evidenced that Micromonospora stimulates the plant capacity to activate defense mechanisms upon pathogen attack. The defensive response of tomato plants inoculated with Micromonospora spp. differs from that of non-inoculated plants, showing a stronger induction of jasmonate-regulated defenses when the plant is challenged with a pathogen. The hypothesis of jasmonates playing a key role in this defense priming effect was confirmed using defense-impaired tomato mutants, since the JA-deficient line def1 was unable to display a long term induced resistance upon Micromonospora spp. inoculation.In conclusion, nodule isolated Micromonospora strains should be considered excellent candidates as biocontrol agents as they combine both direct antifungal activity against plant pathogens and the ability to prime plant immunity.
Analysis of pan-genome to identify the core genes and essential genes of Brucella spp.
Yang, Xiaowen; Li, Yajie; Zang, Juan; Li, Yexia; Bie, Pengfei; Lu, Yanli; Wu, Qingmin
2016-04-01
Brucella spp. are facultative intracellular pathogens, that cause a contagious zoonotic disease, that can result in such outcomes as abortion or sterility in susceptible animal hosts and grave, debilitating illness in humans. For deciphering the survival mechanism of Brucella spp. in vivo, 42 Brucella complete genomes from NCBI were analyzed for the pan-genome and core genome by identification of their composition and function of Brucella genomes. The results showed that the total 132,143 protein-coding genes in these genomes were divided into 5369 clusters. Among these, 1710 clusters were associated with the core genome, 1182 clusters with strain-specific genes and 2477 clusters with dispensable genomes. COG analysis indicated that 44 % of the core genes were devoted to metabolism, which were mainly responsible for energy production and conversion (COG category C), and amino acid transport and metabolism (COG category E). Meanwhile, approximately 35 % of the core genes were in positive selection. In addition, 1252 potential essential genes were predicted in the core genome by comparison with a prokaryote database of essential genes. The results suggested that the core genes in Brucella genomes are relatively conservation, and the energy and amino acid metabolism play a more important role in the process of growth and reproduction in Brucella spp. This study might help us to better understand the mechanisms of Brucella persistent infection and provide some clues for further exploring the gene modules of the intracellular survival in Brucella spp.
Directory of Open Access Journals (Sweden)
Marta Piotrowska
2017-05-01
Full Text Available Members of the genus Aeromonas that commonly occur in various aquatic ecosystems are taken into account as vectors spreading antibiotic resistance genes (ARGs in the environment. In our study strains of Aeromonas spp. (n = 104 not susceptible to ampicillin were isolated from municipal sewage of different levels of purification – raw sewage, activated sludge and treated wastewater. The crucial step of the study was the identification of β-lactamase resistance genes. The identified genes encode β-lactamases from 14 families – blaTEM, blaOXA, blaSHV, blaCTX-M, blaMOX, blaACC, blaFOX, blaGES, blaPER, blaV EB, blaKPC, cphA, imiH, and cepH. There were no significant differences in number of identified ARGs between isolation points. BlaOXA, blaFOX variants and, characteristic for Aeromonas genus, metallo-β-lactamase cphA-related genes were the most commonly identified types of β-lactam resistance determinants. Moreover, we found four extended-spectrum β-lactamases (blaSHV -11, blaCTX-M-27, blaCTX-M-98, and blaPER-4 – and seven AmpC (blaACC, blaFOX-2-like, blaFOX-3, blaFOX-4-like, blaFOX-9, blaFOX-10-like, and blaFOX-13-like types and variants of genes that had never been found among Aeromonas spp. before. Five of the β-lactamases families (blaTEM, blaOXA, blaFOX, blaV EB, and cphA were identified in all three isolation sites, which supports the hypothesis that wastewater treatment plants (WWTPs are hot spots of ARGs dissemination. The obtained ARGs sequences share high identity with previously described β-lactamases, but new variants of those genes have to be considered as well. Characterization of antibiotic susceptibility was performed using disk the diffusion method with 12 different antibiotics according to CLSI guidelines. Over 60% of the strains are unsusceptible to cefepime and chloramphenicol and the majority of the strains have a multidrug resistance phenotype (68%. Finally, analysis of plasmid profiles among the resistant strains
Development of novel Alicyclobacillus spp. isolation medium.
Chang, S; Kang, D-H
2005-01-01
To develop a new isolation medium with higher recovery rates of Alicyclobacillus spp. SK agar was developed with optimized incubation temperature, pH, acidulant, Tween 80 concentration and divalent cation addition. Results indicate that detection of Alicyclobacillus spp. by SK agar was significantly higher (P > 0.05) than those obtained by K agar, orange serum agar, and potato dextrose agar. Current media used for Alicyclobacillus spp. isolation still resulted in high numbers of false negative products. The sensitivity of SK agar to Alicyclobacillus spp. allows detection of low numbers of Alicyclobacillus spp. and also provides a more higher isolation results compared with currently used media. SK agar will be useful to the fruit juice industry to obtain more accurate numbers of contaminant Alicyclobacillus spp. With this media, false negative samples can be reduced, and the likelihood of exported products being rejected can be greatly reduced.
Anti-biofilm Properties of the Fecal Probiotic Lactobacilli Against Vibrio spp.
Directory of Open Access Journals (Sweden)
Sumanpreet Kaur
2018-04-01
Full Text Available Diarrheal disease caused by Vibrio cholerae is endemic in developing countries including India and is associated with high rate of mortality especially in children. V. cholerae is known to form biofilms on the gut epithelium, and the biofilms once formed are resistant to the action of antibiotics. Therefore agents that prevent the biofilm formation and disperse the preformed biofilms are associated with therapeutic benefits. The use of antibiotics for the treatment of cholera is associated with side effects such as gut dysbiosis due to depletion of gut microflora, and the increasing problem of antibiotic resistance. Thus search for safe alternative therapeutic agents is warranted. Herein, we screened the lactobacilli spp. isolated from the fecal samples of healthy children for their abilities to prevent biofilm formation and to disperse the preformed biofilms of V. cholerae and V. parahaemolyticus by using an in vitro assay. The results showed that the culture supernatant (CS of all the seven isolates of Lactobacillus spp. used in the study inhibited the biofilm formation of V. cholerae by more than 90%. Neutralization of pH of CS completely abrogated their antimicrobial activities against V. cholera, but had negligible effects on their biofilm inhibitory potential. Further, CS of all the lactobacilli isolates caused the dispersion of preformed V. cholerae biofilms in the range 62–85%; however, pH neutralization of CS reduced the biofilm dispersal potential of the 4 out of 7 isolates by 19–57%. Furthermore, the studies showed that CS of none of the lactobacilii isolates had antimicrobial activity against V. parahaemolyticus, but 5 out of 7 isolates inhibited the formation of its biofilm in the range 62–82%. However, none of the CS dispersed the preformed biofilms of V. parahaemolyticus. The ability of CS to inhibit the adherence of Vibrio spp. to the epithelial cell line was also determined. Thus, we conclude that the biofilm dispersive
Directory of Open Access Journals (Sweden)
Jelesić Zora Z.
2011-01-01
Full Text Available Candidemia is an important emerging nosocomial infection in patients with risk factors. Candida species from nonsterile sites can give insight into the characteristics of strains that may cause invasive disease. The aim of this study was to evaluate antifungal susceptibility of Candida blood and fecal isolates in Novi Sad, Vojvodina. During a 3-year period (2008 to 2010, 424 isolates of Candida spp. were collected, 30 bloodstream isolates and 394 strains from fecal samples. In vitro susceptibility of these isolates to five antifungal agents was established using commercial ATB FUNGUS 3 (Bio-Mérieux. Predominant species was Candida albicans (6 isolates from blood and 269 from feces. Resistance to one or more antifungal agents was less common in Candida albicans (3.63% than in other species (24.83%. Resistance to itraconazole was the most commonly found in both groups of isolates, 9.64% strains from feces and 20% from blood samples. Twelve isolates were multiply resistant, usually to fluconazole, itraconazole, and voriconazole. Resistance to amphotericine B was extremely rare. Although resistance to antimycotics of Candida spp. is rare at present, continued surveillance of antifungal susceptibility is necessary in order to monitor trends, and to choose the right empiric therapy.
Sisti, Maurizio; Brandi, Giorgio; De Santi, Mauro; Rinaldi, Laura; Schiavano, Giuditta F
2012-03-01
The aim of the present study was to evaluate the fungicidal activity of chlorine and peracetic acid in drinking water against various pathogenic Aspergillus spp. and Candida albicans strains. A. nidulans exhibited the greatest resistance, requiring 10 ppm of chlorine for 30 min contact time for a complete inactivation. Under the same experimental conditions, peracetic acid was even less fungicidal. In this case, A. niger proved to be the most resistant species (50 ppm for 60 min for complete inactivation). All Aspergillus spp. were insensitive to 10 ppm even with extended exposure (>5 h). The combination of chlorine and peracetic acid against Aspergillus spp. did not show synergistic effects except in the case of A. flavus. Complete growth inhibition of C. albicans was observed after about 3 h contact time with 0.2 ppm. C. albicans was less sensitive to peracetic acid. Hence the concentrations of chlorine that are usually present in drinking water distribution systems are ineffective against several Aspergillus spp. and peracetic acid cannot be considered an alternative to chlorine for disinfecting drinking water. The combination of the two biocides is not very effective in eliminating filamentous fungi at the concentrations permitted for drinking water disinfection.
Prevalence and Antimicrobial Resistance of Vibrio spp. in Retail and Farm Shrimps in Ecuador.
Sperling, L; Alter, T; Huehn, S
2015-11-01
The aim of this study was to investigate the prevalence of Vibrio spp. in shrimp at retail and in shrimp farms in Ecuador and to determine the antimicrobial agent resistance patterns of farm isolates. The presence of genes linked to early mortality syndrome (EMS) or acute hepatopancreatic necrosis disease (AHPND) also was evaluated. Vibrio spp. were isolated from retail shrimps in Cuenca, Ecuador, and farm shrimps originating from provinces El Oro and Guayas, Ecuador. A total of 229 shrimp samples were collected, of which 71 originated from retail markets in Cuenca and 158 came from shrimp farms. Overall, 219 (95.6%) samples tested positive for Vibrio spp. Vibrio parahaemolyticus (80.8%) was the most common species detected, followed by Vibrio alginolyticus (50.2%), Vibrio cholerae (11.3%), and Vibrio vulnificus (3.5%). None of the V. parahaemolyticus isolates carried the virulence-associated tdh and trh genes. In V. parahaemolyticus shrimp farm isolates, high resistance was found to ampicillin (92.2%), and intermediate resistance was found to tetracycline (51.3%) and amikacin (22.1%). Of the V. parahaemolyticus strains, 68 were resistant to at least three antimicrobial agents, and 2 were resistant to seven antimicrobial agents simultaneously. Up to 18 resistant isolates were found for V. alginolyticus, whereas V. vulnificus and V. cholerae isolates were more susceptible. None of the V. parahaemolyticus isolates carried the EMS-AHPND plasmid. The results of this study revealed the ubiquitous occurrence of Vibrio spp. in shrimps at retail and on shrimp farms in Ecuador.
Nova Nayarit-Ballesteros; María Salud Rubio-Lozano; Enrique Delgado-Suárez; Danilo Méndez-Medina; Diego Braña-Varela; Oscar Rodas-Suárez
2016-01-01
Objective. To determine the serotype and antibiotic resistance profile of Salmonella spp. isolated from retail ground beef in Mexico City. Materials and methods. A total of 100 samples of ground beef were analyzed. The pathogen was isolated by conventional methods and confirmed by PCR (invA gene, 284 bp). The antibiotic resistance profile was determined by the Kirby-Bauer method while serotyping was performed according to the Kauffman-White scheme. Results. We isolated a total of 19 strains o...
Fu, B; Jiang, Q; Liu, H-B; Liu, H
2015-10-01
The presence of viable but nonculturable (VBNC) bacterial pathogens which often fail to be detected by cultivation and can regain the cultivability if the living conditions improve were reported. The objective of this study was to determine the occurrence of VBNC Salmonella spp. and Shigella spp. in the biosolids during anaerobic digestion and its reactivation during the cake storage. The occurrence of VBNC Salmonella spp. and Shigella spp. during mesophilic, temperature-phased, thermophilic anaerobic digestion of sewage sludge and the subsequent storage were studied by RT-qPCR and most probable number (MPN) method. The VBNC incidence of Salmonella spp. and Shigella spp. during thermophilic digestion was four orders of magnitude higher than those of mesophilic digestion. Accordingly, higher resuscitation ratio of VBNC pathogens was also achieved in thermophilic digested sludge. As a result, the culturable Salmonella typhimurium contents in thermophilic digested sludge after cake storage were two orders of magnitude higher than mesophilic digestion. Both quantitative PCR and reverse transcription quantitative PCR assay results showed the two bacterial counting numbers remained stable throughout the cake storage. The results indicate that the increase in the culturable Salmonella spp. and Shigella spp. after centrifugal dewatering was attributed to the resuscitation from the VBNC state to the culturable state. Thermophilic anaerobic digestion mainly induced Salmonella spp. and Shigella spp. into VBNC state rather than killed them, suggesting that the biological safety of sewage sludge by temperature-phased anaerobic digestion should be carefully assessed. © 2015 The Society for Applied Microbiology.
Wigmann, Évelin Francine; Moreira, Rafael Chelala; Alvarenga, Verônica Ortiz; Sant'Ana, Anderson S; Copetti, Marina Venturini
2016-05-01
This study aimed at determining whether Penicillium spp. strains could survive through the heat treatment applied during the processing of frozen chicken nuggets. Firstly, it was found that the conidia of Penicillium were not able to survive the heat shock in phosphate buffer at pH 7.2 in thermal death tubes (TDT) at 80 °C/30 min. Subsequently, each Penicillium strain was inoculated in frozen chicken nuggets, which were subjected to the following treatments: i) only deep frying (frying oil at 195-200 °C), ii) only baking (120-130 °C until the internal temperature reached 70 °C) and iii) deep frying followed by baking (frying oil temperature of 195-200 °C and baking temperature of 120-130 °C, until the internal temperature reached 70 °C). The results indicated that Penicillium polonicum NGT 23/12, Penicillium commune NGT 16/12, Penicillium solitum NGT 30/12 and Penicillium crustosum NGT 51/12 were able to survive after the combined treatment (deep frying followed by baking) when inoculated in chicken nuggets. P. polonicum NGT 23/12 was the most resistant strain to the combined treatment (deep frying and baking), as its population was reduced by 3 log cycles CFU/g, when the internal temperature reached 78 °C after 10 min and 30 s of baking. The present data show that if Penicillium spp. is present in high numbers in raw materials, such as breading flours, it will survive the thermal processing applied during chicken nuggets production. Copyright © 2015 Elsevier Ltd. All rights reserved.
Fermentability of an enzymatically modified solubilised potato polysaccharide (SPP)
DEFF Research Database (Denmark)
Olesen, M.; Gudmund-Høyer, E.; Norsker, Merete
1998-01-01
: Seven healthy volunteers ingested in random order on seven different days: 20 g SPP; bread made of 180 g wheat flour served with 20 g raw SPP; bread baked of 180 g wheat flour and 20 g SPP; bread made from 180 g what flour; 20 g lactulose; 20 g oat bran; and 20 g wheat bran. The hydrogen breath test...... was used to evaluate oro-coecal transit time (OCTT) and fermentation. RESULTS: Fermentation of SPP yielded a measurable increase in end-expiratory H2. The total incremental increase in end expiratory H2 due to SPP was unaffected of whether SPP was served alone, as the raw flour served with bread, or baked...... into bread. The OCTT for raw SPP was significantly delayed compared to lactulose (P = 0.01). The OCTT for SPP baked into bread was significantly delayed compared to raw SPP (P = 0.01), indicating that SPP may be used as a marker of oro-coecal transit time for as well the fluid phase as the solid phase...
Furustrand Tafin, Ulrika; Meis, Jacques F; Trampuz, Andrej
2012-08-01
We evaluated isothermal microcalorimetry for real-time susceptibility testing of non-Aspergillus molds. MIC and minimal effective concentration (MEC) values of Mucorales (n = 4), Fusarium spp. (n = 4), and Scedosporium spp. (n = 4) were determined by microbroth dilution according to the Clinical Laboratory Standard Institute M38-A2 guidelines. Heat production of molds was measured at 37 °C in Sabouraud dextrose broth inoculated with 2.5 × 10(4) spores/mL in the presence of amphotericin B, voriconazole, posaconazole, caspofungin, and anidulafungin. As determined by microcalorimetry, amphotericin B was the most active agent against Mucorales (MHIC 0.06-0.125 μg/mL) and Fusarium spp. (MHIC 1-4 μg/mL), whereas voriconazole was the most active agent against Scedosporium spp. (MHIC 0.25 to 8 μg/mL). The percentage of agreement (within one 2-fold dilution) between the MHIC and MIC (or MEC) was 67%, 92%, 75%, and 83% for amphotericin B, voriconazole, posaconazole, and caspofungin, respectively. Microcalorimetry provides additional information on timing of antifungal activity, enabling further investigation of drug-mold and drug-drug interaction, and optimization of antifungal treatment. Copyright © 2012 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Cristina Delcaru
2017-05-01
Full Text Available Acute bacterial prostatitis is one of the frequent complications of urinary tract infection (UTI. From the approximately 10% of men having prostatitis, 7% experience a bacterial prostatitis. The purpose of this study was to investigate the prevalence of uropathogens associated with UTIs in older patients with benign prostatic hyperplasia and to assess their susceptibility to commonly prescribed antibiotics as well as the relationships between microbial virulence and resistance features. Uropathogenic Escherichia coli was found to be the most frequent bacterial strain isolated from patients with benign prostatic hyperplasia, followed by Enterococcus spp., Enterobacter spp., Klebsiella spp., Proteus spp., Pseudomonas aeruginosa, and Serratia marcescens. Increased resistance rates to tetracyclines, quinolones, and sulfonamides were registered. Besides their resistance profiles, the uropathogenic isolates produced various virulence factors with possible implications in the pathogenesis process. The great majority of the uropathogenic isolates revealed a high capacity to adhere to HEp-2 cell monolayer in vitro, mostly exhibiting a localized adherence pattern. Differences in the repertoire of soluble virulence factors that can affect bacterial growth and persistence within the urinary tract were detected. The Gram-negative strains produced pore-forming toxins—such as hemolysins, lecithinases, and lipases—proteases, siderophore-like molecules resulted from the esculin hydrolysis and amylases, while Enterococcus sp. strains were positive only for caseinase and esculin hydrolase. Our study demonstrates that necessity of investigating the etiology and local resistance patterns of uropathogenic organisms, which is crucial for determining appropriate empirical antibiotic treatment in elderly patients with UTI, while establishing correlations between resistance and virulence profiles could provide valuable input about the clinical evolution and
Cui, Yanyan; Zhang, Yan; Jian, Fuchun; Zhang, Longxian; Wang, Rongjun; Cao, Shuxuan; Wang, Xiaoxing; Yan, Yaqun; Ning, Changshen
2017-05-01
Theileria spp. and Anaplasma spp., which are important tick-borne pathogens (TBPs), impact the health of humans and animals in tropical and subtropical areas. Theileria and Anaplasma co-infections are common in sheep and goats. Following alignment of the relevant DNA sequences, two primer sets were designed to specifically target the Theileria spp. 18S rRNA and Anaplasma spp. 16S rRNA gene sequences. Genomic DNA from the two genera was serially diluted tenfold for testing the sensitivities of detection of the primer sets. The specificities of the primer sets were confirmed when DNA from Anaplasma and Theileria (positive controls), other related hematoparasites (negative controls) and ddH 2 O were used as templates. Fifty field samples were also used to evaluate the utility of single PCR and duplex PCR assays, and the detection results were compared with those of the PCR methods previously published. An optimized duplex PCR assay was established from the two primer sets based on the relevant genes from the two TBPs, and this assay generated products of 298-bp (Theileria spp.) and 139-bp (Anaplasma spp.). The detection limit of the assay was 29.4 × 10 -3 ng per μl, and there was no cross-reaction with the DNA from other hematoparasites. The results showed that the newly developed duplex PCR assay had an efficiency of detection (P > 0.05) similar to other published PCR methods. In this study, a duplex PCR assay was developed that can simultaneously identify Theileria spp. and Anaplasma spp. in sheep and goats. This duplex PCR is a potentially valuable assay for epidemiological studies of TBPs in that it can detect cases of mixed infections of the pathogens. Copyright © 2017 Elsevier Inc. All rights reserved.
Sakaridis, I; Soultos, N; Dovas, C I; Papavergou, E; Ambrosiadis, I; Koidis, P
2012-02-01
This study was conducted to isolate psychrotrophic lactic acid bacteria (LAB) from chicken carcasses with inhibitory activity against strains of Salmonella spp. and Listeria monocytogenes. A total of 100 broiler samples were examined for the presence of LAB. Ninety-two LAB isolates that showed antimicrobial effects against Salmonella spp. and L. monocytogenes were further analysed to examine their LAB (Gram-positive, catalase negative, oxidase negative) and psychrotrophic characteristics (ability to grow at 7 °C). Fifty isolates were further selected and identified initially using standard biochemical tests in miniature (Micro-kits API CH 50) and then by sequencing of the 16s-23s rRNA gene boundary region (Intergenic Spacer Region). By molecular identification, these isolates were classified into 5 different LAB species: Lactobacillus salivarius, Lactobacillus reuteri, Lactobacillus johnsonii, Pediococcus acidilactici, and Lactobacillus paralimentarius. None of the isolates produced tyramine or histamine. Copyright © 2011 Elsevier Ltd. All rights reserved.
Phenotypic and molecular analysis of a pasteuria strain parasitic to the sting nematode.
Bekal, S; Borneman, J; Springer, M S; Giblin-Davis, R M; Becker, J O
2001-06-01
Pasteuria strain S-1 was found to parasitize the sting nematode Belonolaimus longicaudatus. S-1 spores attached to several strains of B. longicaudatus from different geographical locations within the United States. However, they did not adhere to any of the following species: Heterodera schachtii, Longidorus africanus, Meloidogyne hapla, M. incognita, M. javanica, Pratylenchus brachyurus, P. scribneri, P. neglectus, P. penetrans, P. thornei, P. vulnus, and Xiphinema spp. The 16S rRNA genes from Pasteuria strain S-1 and P. penetrans strain Pp from Senegal were obtained by PCR amplification. A DNA sequence analysis showed that the S-1 16S rRNA had 96% or less similarity to the 16S rRNA genes from all previously reported Pasteuria species. Diverse phylogenetic methods all provided robust support for an association of Pasteuria strain S-1, Pasteuria strain NA parasitic to H. glycines, and P. penetrans strain Pp, to the exclusion of P. ramosa. In addition, our study showed intraspecific variation within P. penetrans as inferred by its 98% similarity to P. penetrans strain Pp.
Isolation of saprophytic Leptospira spp. from a selected environmental water source of Argentina.
Scialfa, Exequiel; Grune, Sylvia; Brihuega, Bibiana; Aguirre, Pablo; Rivero, Marina
2017-11-29
Ten Leptospira spp. strains were isolated from water samples from Nievas stream, Olavarría, Buenos Aires province (Argentina). The isolates showed the typical motility and morphology of the genus Leptospira under dark field microscopy, developing in liquid EMJH medium after eight days of incubation at 13°C and 30°C. All isolates were negative by the Multiple Locus Variable Number Tandem Repeat Analysis (MLVA). Molecular identification by 16S rRNA gene sequencing identified all isolates as nonpathogenic leptospires. Four isolates showed a genetic profile identical to that of the reference strain Leptospira biflexa serovar Patoc, and six isolates revealed sequence similarities within the 97-98% range, closely related to Leptospira yanagawae and Leptospira meyeri, respectively. Strains ScialfaASA42, ScialfaASA45, ScialfaASA44, ScialfaASA47, ScialfaASA49, ScialfaASA50 and ScialfaASA51 possibly represent a novel species of the genus Leptospira. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.
Paulo Teixeira Lacava; Maria Estela Silva-Stenico; Welington Luiz Araújo; Ana Valéria Colnaghi Simionato; Emanuel Carrilho; Siu Mui Tsai; João Lúcio Azevedo
2008-01-01
The objective of this work was to study the production of siderophores by endophytic bacteria Methylobacterium spp., which occupy the same ecological niche as Xylella fastidiosa subsp. pauca (Xfp) in citrus plants. The siderophore production of Methylobacterium strains was tested according to chromeazurol agar assay test (CAS), Csáky test (hydroxamate-type) and Arnow test (catechol-type). In addition, the ability of Xfp to use siderophores, in vitro, produced by endophytic bacteria as source ...
Characterization and in vitro antioxidant activities of polysaccharides from Pleurotus ostreatus.
Zhang, Yunxia; Dai, Ling; Kong, Xiaowei; Chen, Liangwen
2012-10-01
Two polysaccharide fractions (PSPO-1a and PSPO-4a) were isolated from the fruiting bodies of Pleurotus ostreatus using ethanol precipitation, anion-exchange chromatography and gel permeation chromatography. Both fractions were heteropolysaccharide containing protein and uronic acid. PSPO-1a was composed of mannose, glucose, galactose, xylose and rhamnose with a molar ratio of 2.47:0.91:1.00:1.66:3.87. PSPO-4a was composed of only three monosaccharides: rhamnose, mannose and galactose with a molar ratio of 0.92:2.69:1.00. The average molecular weight of PSPO-1a and PSPO-4a determined by HPLC were estimated to be 1.8 × 10(4)Da and 1.1 × 10(6)Da respectively. The in vitro tests revealed that two polysaccharides were natural potential antioxidant. Both polysaccharides presented stronger DPPH radical and superoxide anion radical scavenging activity with increasing concentrations, but less effective on scavenging hydroxyl radical. Compared with PSPO-4a, PSPO-1a was the more effective free-radical scavenger. In conclusion, the two polysaccharides may be useful as a naturally potential antioxidant agent for application in food and medicinal fields. Copyright © 2012 Elsevier B.V. All rights reserved.
Occurrence of Aspergillus spp. and aflatoxin B1 in Malaysian foods used for human consumption.
Reddy, Kasa R N; Farhana, Nazira I; Salleh, Baharuddin
2011-05-01
Malaysian population widely consumes the cereal-based foods, oilseeds, nuts, and spices in their daily diet. Mycotoxigenic fungi are well known to invade food products under storage conditions and produce mycotoxins that have threat to human and animal health. Therefore, determining toxigenic fungi and aflatoxin B(1) (AFB1) in foods used for human consumption is of prime importance to develop suitable management strategies and to minimize risk. Ninety-five food products marketed in Penang, Malaysia were randomly collected from different supermarkets and were analyzed for presence of Aspergillus spp. by agar plate assay and AFB1 by enzyme-linked immunosorbent assay (ELISA). A. flavus was the dominant fungi in all foods followed by A. niger. Fifty-five A. flavus strains were tested for their ability to produce aflatoxins on rice grain substrate. Thirty-six (65.4%) strains out of 55 produced AFB1 ranging from 1700 to 4400 μg/kg and 17 strains (31%) produced AFB2 ranging from 620 to 1670 μg/kg. Natural occurrence of AFB1 could be detected in 72.6% food products ranging from 0.54 to 15.33 μg/kg with a mean of 1.95 μg/kg. Maximum AFB1 levels were detected in peanut products ranging from 1.47 to 15.33 μg/kg. AFB1 levels detected in all food products were below the Malaysian permissible limits (<35 μg/kg). Aspergillus spp. and AFB1 was not detected in any cookies tested. Although this survey was not comprehensive, it provides valuable information on aflatoxin levels in foods marketed in Malaysia. © 2011 Institute of Food Technologists®
A survey of Babesia spp. and Hepatozoon spp. in wild canids in Israel.
Margalit Levi, Maayan; Nachum-Biala, Yaarit; King, Roni; Baneth, Gad
2018-03-20
Babesia spp. and Hepatozoon spp. are apicomplexan parasites that infect a variety of animals, including canids. Their life-cycle includes an invertebrate hematophagous vector as a definitive host and vertebrates as intermediate hosts. The aims of this study were to investigate the prevalence and risk factors for Babesia spp. and Hepatozoon spp. infections in wild golden jackals (Canis aureus) and red foxes (Vulpes vulpes) in Israel and to compare spleen with blood sample polymerase chain reaction (PCR) for the detection of infection. Blood and spleen samples from 109 golden jackals and 21 red foxes were tested by PCR for the detection of Babesia spp. and Hepatozoon spp. using primers for the 18S ribosomal (r) RNA gene. Hepatozoon canis was detected in 50/109 (46%) of the jackals and 9/21 (43%) of the foxes. "Babesia vulpes" (the Babesia microti-like piroplasm) was detected in 4/21 (19%) of the foxes and in none of the jackals. A previously unknown genotype termed Babesia sp. MML related to Babesia lengau (96-97% identity) was detected in 1/109 (1%) of the jackals and 4/21 (19%) of the foxes. Further characterization of this genotype carried out by PCR of the rRNA internal transcribed spacer 2 (ITS2) indicated that it had only 87% identity with the B. lengau ITS2. Sex (male or female), age (juvenile or adult) and geographic zone (North, Central or South Israel) were not found to be significant risk factors for these protozoan infections. The prevalence of "B. vulpes" and Babesia sp. MML infections was significantly higher in foxes compared to jackals (χ 2 = 15.65, df = 1, P < 0.005), while there was no statistically significant difference in the rate of H. canis infection between these two canid species. A fair agreement beyond chance between identification in the blood and spleen of H. canis was found in 21 animals from which both blood and spleen samples were available (k = 0.33). This study describes a high prevalence of H. canis infection in
Directory of Open Access Journals (Sweden)
Vienna R Brown
Full Text Available Francisella tularensis is a highly virulent bacterium that is capable of causing severe disease (tularemia in a wide range of species. This organism is characterized into two distinct subspecies: tularensis (type A and holarctica (type B which vary in several crucial ways, with some type A strains having been found to be considerably more virulent in humans and laboratory animals. Cottontail rabbits have been widely implicated as a reservoir species for this subspecies; however, experimental inoculation in our laboratory revealed type A organisms to be highly virulent, resulting in 100% mortality following challenge with 50-100 organisms. Inoculation of cottontail rabbits with the same number of organisms from type B strains of bacteria was found to be rarely lethal and to result in a robust humoral immune response. The objective of this study was to characterize the protection afforded by a prior challenge with type B strains against a later inoculation with a type A strain in North American cottontail rabbits (Sylvilagus spp. Previous infection with a type B strain of organism was found to lengthen survival time and in some cases prevent death following inoculation with a type A2 strain of F. tularensis. In contrast, inoculation of a type A1b strain was uniformly lethal in cottontail rabbits irrespective of a prior type B inoculation. These findings provide important insight about the role cottontail rabbits may play in environmental maintenance and transmission of this organism.