Improving the feeding value of straws with Pleurotus ostreatus

NARCIS (Netherlands)

Khan, N.A.; Hussain, S.; Ahmad, N.; Alam, S.; Bezabhi, M.; Hendriks, W.H.; Yu, P.; Cone, J.W.

2015-01-01

The high content of lignin in cell walls is the major limiting factor in the digestion and utilisation of cereal crop residues by ruminants. The aim of this study was to evaluate the effectiveness of the white rot fungus, Pleurotus ostreatus (P. ostreatus), to degrade lignin and to enhance the rumen

EVALUACIÓN DE LOS PARÁMETROS PRODUCTIVOS DE LA SEMILLA DE Pleurotus ostreatus PROPAGADA EN DIFERENTES MEDIOS DE CULTIVO AVALIAÇÃO DOS PARÂMETROS DE PRODUÇÃO DA SEMENTÉ DE Pleurotus ostreatus DISSEMINADAS EM DIFERENTES MEIOS DE CULTURA EVALUATION OF PARAMETERS PRODUCTION OF THE SEED Pleurotus ostreatus SPREED IN DIFFERENT CULTURE MEDIA

Directory of Open Access Journals (Sweden)

MARÍA DEL PILAR RÍOS

2010-12-01

3 inteiramente casualizado. Na terceira seção avaliada, se avaliou a colonização e frutificação do fungo em bagaço de cana utilizando parâmetros biológicos, tais como desempenho, eficiência e taxa de produção de sementes, com o inteiramente casualizado 3x3. 0 meio alternativo em pH 5,0 foi o mais adequado para o crescimento de Pleurotus ostreatus, demonstrando sua adaptabilidade a meios com alto conteúdo de carboidrato, cujos níveis de renda foram adequados para a produção competitiva e fruticultura diminuindo o tempo de incubação e colheita.Alternative media were evaluated for the propagation of Pleurotus ostreatus and its behavior was compared with that of a commercial media. The response to these media was measured through the adaptation of the fungus in barley for obtaining the commercial seed and this one in its turn in the response to a substratum based on cane bagasse for obtaining oyster mushrooms. In the first phase the fungus was obtained and planted in a solid media of potato extract at two concentrations and three pH values using a factorial design 2x3 (pH vs. concentration of potato extract. In the second phase was measured the growth of Pleurotus ostreatus inoculated in sterilized hydrated barley through a completely random design 3x3. In the third phase was evaluated the colonization and fructification of the fungus in cane bagasse using parameters as biológical efficiency performance and seed production rate, with a completely random design 3x3. The alternative media with pH 5,0 was the most adequate for the growth of Pleurotus ostreatus, displaying its adaptability to media with high carbohydrates content which performances were appropiate to obtain competitive production levels in growth and fructification, diminishing thus the incubation and harvesting time.

Komparasi Laju Pertumbuhan Miselium Jamur Tiram Putih (Pleurotus ostreatus (Jacq. ex Fr Kummer pada Komposisi Media Bibit (F3 dan Baglog yang Berbeda

Directory of Open Access Journals (Sweden)

I MADE SUDARMA

2015-09-01

Full Text Available The growth rate comparison of white oyster mushroom (Pleurotus ostreatus (Jacq. ex FrKummer mycelium in the composition of different seed (F3 and baglog media . Cultivation ofoyster mushroom (Pleurotus ostreatus (Jacq. ex Fr Kummer has grown rapidly along with the increasein income and health awareness. Oyster mushrooms growing need for media with a particular compositionin order to grow optimally. Oyster mushroom production is determined by the quality of the seeds (F3is used, which is sourced from the media with good quality and composition. The research aimed todetermine the rate of growth of white oyster mushroom mycelium in the different composition of seedmedium (F3 (sawdust: fine bran: corn flour: CaCO3 . The experiments was conducted at nurseriesand oyster mushroom development, Jl. Siulan Gang Zella No. 7 Denpasar, from June to August 2013.Each treatment contained 50 bottles, and 10 bottles only used as a sample, in environmental conditionswith temperature and humidity ranges, 20-29oC and 59-86% respectively . T-test was used todifferentiate the growth rate of white oyster mushroom mycelium with different compositions. Theresults showed that seeds (F3 derived from the growing media composition, sawdust (1 week old:fine bran: corn flour: CaCO3 (10:4:2:0,5 significantly different and better than the composition sawdust(age 1 month : fine bran: corn flour (20:2:1:0.5, with a growth rate of mycelium in a mean 6.14±0.56cm/week and 1,81±0,82 cm/week, respectively. Spawn running in baglog with media composition10:4:2:0.5 was 2.77±1.22cm/week, but with composition media 20:2:1:0.5 mycelium could not grow.Effect of temperature and humidity on the growth rate of white oyster mushroom mycelium in seedmedia (F3 is not significantly.

DESIGN OF OYSTER (PLEUROTUS OSTREATUS PRODUCTION UNIT TAKING INTO ACCOUNT ITS AGROTECHNIC OF GROWIGN AND QUALITY AND QUANTITY OF ITS PRODUCTION

Directory of Open Access Journals (Sweden)

Marcel Golian

2015-02-01

Full Text Available According to influence of population increasing followed by agricultural soils decreasing there is noticed a necessity of individual food commodities production intensification. There is also needed to think about some new unconventional and alternative sort of food-stuff. An edible mushroom growing is one of the relatively new agricultural branches, whereby on a large scale there are grown species which belong to saprophytic group. The aim of task was the building – technological and equipment – technological proposal of oyster (Pleurotus ostreatus, Jacq. P. Kumm production unit with taking account to its specific agro technical requirements and valid legislative. In the next part of task there were evaluated and compared qualitative and quantitative parameters of sporocarps from two variants which were collected in the first growth wave and accuracy of the proposed oyster production unit. In case of variant A there were used sacks with substrates, which have been exposed to cold shock by 6°C temperature for 4 days and in variant B were used substrates without cold shock. According to reached results the cold shock had almost neither influence on production quantity. There was found out an important fact that crop height from first growth wave wasn´t identical with well-known literature sources. The low crop is connected with high CO2 content in oyster production unit room, according to our opinion. Other equipment aimed to air humidity regulation, air temperature regulation and room lights was designed correctly.

Economic benefit analysis of cultivating Pleurotus ostreatus with rape straw

Science.gov (United States)

Guan, Qinlan; Gong, Mingfu; Tang, Mei

2018-04-01

The cultivation of Pleurotus ostreatus with rape straw not only can save the cultivation cost of P. ostreatus, but also can reuse the resources and protect the environment. By adding different proportion of rape straw to the cultivation material of P. ostreatus, the reasonable amount of rape straw was selected and the economic benefit of P. ostreatus cultivated with the optimum amount of rape straw was analyzed. The results showed that adding 10% to 40% rape straw to the cultivation material of P. ostreatus did not affect the yield and biological conversion rate of P. ostreatus, and the ratio of production and investment of the amount of rape straw in the range of 10% to 50% was higher than of cottonseed husk alone as the main material of the formula.

Researches on Pleurotus ostreatus mushroom’s quality cultivated on coffee grounds

Directory of Open Access Journals (Sweden)

Sorina Ropciuc

2016-10-01

Full Text Available The objectives of this work were to evaluate the possibility of using coffee grounds for cultivating Pleurotus ostreatus mushrooms and determine the nutritional composition of Pleurotus ostreatus mushrooms produced on coffee grounds substrate. The results revealed a good fruiting of the fungus on coffee grounds and the biological effectiveness (weight of fresh mushroom reached about 97% after 30 days. We determined the total protein content in vitamin C, the total polyphenols and the activity of Polyphenol oxidases (PPOs enzyme on 32 samples of fresh Pleurotus ostreatus mushroom (top and bottom and subjected to heat treatments (blanching, boiling and freezing. The protein content was ranged between the values of 16.9 and 25.1g/ 100g and the Vitamin C content within the range of values presented 64.32-564.95 mg/100g. The polyphenol content results varied significantly in the analyzed samples varying between 1.887 – 7.667 mg GAE / 100 g vegetable product. The determination of the polyphenol oxidase enzyme responsible for enzymatically blackening of the fungus presented values in the range 0.274- 0.610mg / 100g.

Yield and nutritional composition of oyster mushroom strains newly introduced in Bangladesh

Directory of Open Access Journals (Sweden)

Mostak Ahmed

2013-02-01

Full Text Available The objective of this work was to evaluate yield and chemical composition of oyster mushroom strains newly introduced in Bangladesh. Strains of Pleurotus high‑king (strain PHK, P. ostreatus (strain PO2, and P. geesteranus (strains PG1 and PG3 were evaluated as to yield components and proximate composition. Pleurotus ostreatus was used as control. Pleurotus high‑king showed fastest growth of primordia, but moderate flush of effective fruiting bodies. Pleurotus geesteranus (PG1 showed higher economic yield and biological performance, and better chemical composition, especially in terms of protein and mineral contents. Pleurotus geesteranus (PG1 shows better performance than P. ostreatus (PO2, the most commercially cultivated edible species in Bangladesh, and, therefore, it should be recommended for commercial cultivation.

Optimization of substrate preparation for oyster mushroom (Pleurotus ostreatus) cultivation by studying different raw materials and substrate preparation conditions (composting: phases I and II).

Science.gov (United States)

Vieira, Fabrício Rocha; de Andrade, Meire Cristina Nogueira

2016-11-01

In recent years, oyster mushroom (Pleurotus ostreatus) has become one of the most cultivated mushrooms in the world, mainly in Brazil. Among many factors involved in a mushroom production, substrate preparation is the most critical step, which can be influenced by composting management techniques. Looking forward to optimizing the substrate preparation process, were tested different composting conditions (7 and 14 days of composting with or without conditioning), potential raw materials (decumbens grass, brizantha grass and sugarcane straw) and nitrogen supplementation (with or without wheat bran) on oyster mushroom yield and biological efficiency (BE). The substrate composted for 7 days with conditioning showed higher yield and biological efficiency of mushroom (24.04 and 100.54 %, respectively). Substrates without conditioning (7 and 14 days of composting) showed smaller mushroom yield and biological efficiency. Among the raw materials tested, brizantha grass showed higher mushroom yield followed by decumbens grass, sugarcane straw and wheat straw (28.5, 24.32, 23.5 and 19.27 %, respectively). Brizantha grass also showed higher biological efficiency followed by sugarcane straw, decumbens grass and wheat straw (123.95, 103.70, 96.90 and 86.44 %, respectively). Supplementation with wheat bran improved yield and biological efficiency in all substrate formulations tested; thus, oyster mushroom yield and biological efficiency were influenced by substrate formulation (raw materials), supplementation and composting conditions.

Degradation of Green Polyethylene by Pleurotus ostreatus.

Directory of Open Access Journals (Sweden)

José Maria Rodrigues da Luz

Full Text Available We studied the biodegradation of green polyethylene (GP by Pleurotus ostreatus. The GP was developed from renewable raw materials to help to reduce the emissions of greenhouse gases. However, little information regarding the biodegradation of GP discarded in the environment is available. P. ostreatus is a lignocellulolytic fungus that has been used in bioremediation processes for agroindustrial residues, pollutants, and recalcitrant compounds. Recently, we showed the potential of this fungus to degrade oxo-biodegradable polyethylene. GP plastic bags were exposed to sunlight for up to 120 days to induce the initial photodegradation of the polymers. After this period, no cracks, pits, or new functional groups in the structure of GP were observed. Fragments of these bags were used as the substrate for the growth of P. ostreatus. After 30 d of incubation, physical and chemical alterations in the structure of GP were observed. We conclude that the exposure of GP to sunlight and its subsequent incubation in the presence of P. ostreatus can decrease the half-life of GP and facilitate the mineralization of these polymers.

Degradation of Green Polyethylene by Pleurotus ostreatus.

Science.gov (United States)

da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Ribeiro, Karla Veloso Gonçalves; Mendes, Igor Rodrigues; Kasuya, Maria Catarina Megumi

2015-01-01

We studied the biodegradation of green polyethylene (GP) by Pleurotus ostreatus. The GP was developed from renewable raw materials to help to reduce the emissions of greenhouse gases. However, little information regarding the biodegradation of GP discarded in the environment is available. P. ostreatus is a lignocellulolytic fungus that has been used in bioremediation processes for agroindustrial residues, pollutants, and recalcitrant compounds. Recently, we showed the potential of this fungus to degrade oxo-biodegradable polyethylene. GP plastic bags were exposed to sunlight for up to 120 days to induce the initial photodegradation of the polymers. After this period, no cracks, pits, or new functional groups in the structure of GP were observed. Fragments of these bags were used as the substrate for the growth of P. ostreatus. After 30 d of incubation, physical and chemical alterations in the structure of GP were observed. We conclude that the exposure of GP to sunlight and its subsequent incubation in the presence of P. ostreatus can decrease the half-life of GP and facilitate the mineralization of these polymers.

Use of medicinal plants in different composts for yield improvement of various strains of oyster mushroom

International Nuclear Information System (INIS)

Inam-ul-Haq, M.; Khan, M.N.; Khan, M.A.; Khan, M.A.; Javed, N.; Binyamin, R.; Irshad, G.

2010-01-01

Different of concentration of four medicinal plants viz., Eucalyptus camaldulensis, Azadirachta indica, Citrus lemon, Cymbopogon marginatus were investigated for the effect of certain active components in their parts, capable of increasing mushroom yield and controlling mushrooms pathogenic microbes which cause great loss in mushroom yield. Four strains of Oyster mushroom were selected on the basis of their well mycelial growth on MEA. For selection of best compost simple composts were also prepared without any medicinal plant products i.e., cotton, wheat, paddy straw. Corn stover composts and cotton compost gave the maximum yield. The dried leaves of the Citrus lemons, lemon grass and Neem cake (dried) were crushed, and the sawdust of the logs of Eucalyptus were incorporated with different doses of 2%, 3%, 4%, 5% w/w of substrates with cotton substrate before compost fermentation. Each of the compost bag having specific medicinal plant product with specific concentration were spawned with selected four strains of Oyster mushroom i.e., two local strain Pleurotus florida (P-17), Pleurotus ostreatus (P- 19) and two exotic strains Pleurotus (florida) ostreatus (WC536), Pleurotus ostreatus (WC-522). Spawn running and mushroom fruitification were allowed to develop under optimum environmental condition. The mushroom yield data of compost bags with different concentration of medicinal plant products plants were calculated. The results showed that presence of Neem cake and Citrus lemon in the substrate increased the yield of Oyster mushroom strains i.e. Pleurotus florida) ostreatus (WC-536) followed by P. ostreatus (WC-522) strain. Neem cake and Citrus lemon were more promising in improving yield of mushroom. These results led to the conclusion that addition of specific medicinal plants concentration to compost increases the yield of Oyster mushroom by reducing the incidence of microbes and is more preferable than chemicals due to their lethal effects during human

BIODEGRADATION OF SUGARCANE VINASSES BY THE WHITE-ROT FUNGI Pleurotus ostreatus IN A PACKED BED REACTOR

Directory of Open Access Journals (Sweden)

W.A. Tapie

2016-08-01

Full Text Available Sugarcane vinasses are considered a complex effluent because of its organic load, low pH, high temperature, and by the presence of recalcitrant substances such as melanoidins and phenolic compounds. The aim of this work was to evaluate the potential of the fungus Pleurotus ostreatus to carry out the biodegradation of sugarcane vinasses in a fixed-bed bioreactor. The experiments evidence the potential of the fungus Pleurotus ostreatus to carry out the decolorization (83%, the removal of the Chemical Oxygen Demand (COD=87% and the Biochemical Oxygen Demand (BOD5=92%, the reduction of total suspended solids (83% and volatile suspended solids (72% of vinasses. The technical simplicity of the proposed alternative as well as process performance reveals the potential of the fungus Pleurotus ostreatus for the treatment of sugarcane mill effluents.

High protein complementation with high fiber substrates for oyster ...

African Journals Online (AJOL)

Agricultural residues have been world widely accepted for oyster mushroom culture. In this study, we used wheat straw, barley straw, maize stem residue, and lawn residue as substrates coupled with wheat bran, rice bran and soybean powder as complements for the growth of Pleurotus florida and Pleurotus ostreatus as ...

Effect of β-1.3/1.6-D-glucan derived from oyster mushroom Pleurotus ostreatus on biometrical, haematological, biochemical, and immunological indices in rainbow trout (Oncorhynchus mykiss).

Science.gov (United States)

Dobsikova, Radka; Blahova, Jana; Franc, Ales; Jakubik, Juraj; Mikulikova, Ivana; Modra, Helena; Novotna, Kamila; Svobodova, Zdenka

2012-01-01

Effect of long-term oral administration of three different concentrations (0.5, 1.0, and 2.0%) of micronized β-1.3/1.6-D-glucan derived from oyster mushroom (Pleurotus ostreatus, Hiratake) on biometrical, haematological, biochemical, and immunological indices of half-year-old rainbow trout (Oncorhynchus mykiss) was assessed in the study. Rainbow trout were feed commercial feed pellets containing β-1.3/1.6-D-glucan in the concentrations of 0.5, 1.0, and 2.0% for 85 days. Biometrical indices consisted in total and standard length, body and liver weight, from which derived somatic parameters such as Fulton´s condition factor and hepatosomatic index were calculated. Haematological parameters were evaluated according to unified methods for haematological examination in fish. Plasma biochemical profile was analysed using biochemical analyser Konelab 20i and Easy Lyte Analyzer. A phagocyte cells metabolic activity (induced chemiluminescence of phagocytes) was determined as an immunological parameter by a microplate luminometric method on Immunotech LM-01T. No clinical signs of behavioral, respiratory, or neurologic distress were observed in rainbow trout. Fish showed normal feeding behavior. As for biometric parameters, no significant changes in total and standard length, body weight, liver weight, as well as in condition factor and hepatosomatic index of experimental and control fish were found. In the course of the study, weight gains in rainbow trout were similar and continuous. Shifts in PCV (pglucose, lactate, total protein, cholesterol, calcium, natrium, potassium (all p<0.05), albumins and chlorides (both p<0.01), as well as catalytic activities of ALT and AST (both p<0.05) were changed in the course of the study. A phagocyte cells metabolic activity (luminol-induced chemiluminescence) in rainbow trout was not altered by oyster mushroom β-1.3/1.6-D-glucan administration. After long-term oral administration of three concentrations of micronized β-1.3/1.6-D

Establishment of an efficient transformation system for Pleurotus ostreatus.

Science.gov (United States)

Lei, Min; Wu, Xiangli; Zhang, Jinxia; Wang, Hexiang; Huang, Chenyang

2017-11-21

Pleurotus ostreatus is widely cultivated worldwide, but the lack of an efficient transformation system regarding its use restricts its genetic research. The present study developed an improved and efficient Agrobacterium tumefaciens-mediated transformation method in P. ostreatus. Four parameters were optimized to obtain the most efficient transformation method. The strain LBA4404 was the most suitable for the transformation of P. ostreatus. A bacteria-to-protoplast ratio of 100:1, an acetosyringone (AS) concentration of 0.1 mM, and 18 h of co-culture showed the best transformation efficiency. The hygromycin B phosphotransferase gene (HPH) was used as the selective marker, and EGFP was used as the reporter gene in this study. Southern blot analysis combined with EGFP fluorescence assay showed positive results, and mitotic stability assay showed that more than 75% transformants were stable after five generations. These results showed that our transformation method is effective and stable and may facilitate future genetic studies in P. ostreatus.

Cultivation of mushroom ( Pleurotus ostreatus ) using corn cobs and ...

African Journals Online (AJOL)

An investigation was carried out on the cultivation of mushroom (Pleurotus ostreatus) using corn cobs and saw dust as the main substrates. Lignocellulosic wastes such as corn cobs and saw dust were packaged inside heat – resistant polythene bags and pasteurized before being seeded with 7.5% w/w millet spawn of ...

Decolourisation of mushroom farm wastewater by Pleurotus ostreatus.

Science.gov (United States)

Rodríguez Pérez, Suyén; García Oduardo, Nora; Bermúdez Savón, Rosa C; Fernández Boizán, Maikel; Augur, Christopher

2008-07-01

Mushroom production on coffee pulp as substrate generates an intense black residual liquid, which requires suitable treatment. In the present study, Pleurotus ostreatus growth in wastewater from mushroom farm was evaluated as a potential biological treatment process for decolourisation as well as to obtain biomass (liquid inoculum). Culture medium components affecting mycelial growth were determined, evaluating colour removal. Laccase activity was monitored during the process. P. ostreatus was able to grow in non diluted WCP. Highest biomass yield was obtained when glucose (10 g/l) was added. The addition of this carbon source was necessary for efficient decolourisation. Agitation of the culture improved biodegradation of WCP as well as fungal biomass production. Laccase and manganese-independent peroxidase activities were detected during fungal treatment of the WCP by P. ostreatus CCEBI 3024. The laccase enzyme showed good correlation with colour loss. Both wastewater colour and pollution load (as chemical oxygen demand) decreased more than 50% after 10 days of culture. Phenols were reduced by 92%.

Performance of Pleurotus ostreatus mushroom grown on maize stalk residues supplemented with various levels of maize flour and wheat bran

Directory of Open Access Journals (Sweden)

Senzosenkosi Surprise MKHIZE

Full Text Available Abstract Improving the performance of mushroom in terms of high production and fast growth rate is essential in mushroom cultivation. In the present study the performance of Pleurotus ostreatus was evaluated using varying levels of wheat bran (WB and maize flour (MF. The results indicated that Pleurotus ostreatus was highly influenced by different levels of supplementation, with 8% WB, 18% WB and 2% MF having higher contamination rate. The low levels of supplementation gave significantly better mycelial growth rate (MGR and shorter colonisation period as observed that the control had highest MGR whereby 20% MF had lowest MGR. The pinning time (TP was shortest at the first flush with minimum of 3 days (12% MF. The higher levels of supplementation showed maximum biological efficiency (BE such as 14% MF, 12% WB and 14% WB. The yield was also higher at high levels of supplementation such as 20% MF and 8% MF being the exception in the lower levels. Based on the results it was observed that for fast production of oyster mushroom there is no need to supplement the maize stalk substrate but for improved productivity supplements can be added up to certain limits such as 14% MF and 12 WB.

Variability of Laccase Activity in the White-Rot Basidiomycete Pleurotus ostreatus

Czech Academy of Sciences Publication Activity Database

Baldrian, Petr; Gabriel, Jiří

2002-01-01

Roč. 47, č. 4 (2002), s. 385-390 ISSN 0015-5632 R&D Projects: GA ČR GP204/02/P100 Institutional research plan: CEZ:AV0Z5020903 Keywords : laccase * pleurotus ostreatus Subject RIV: EE - Microbiology, Virology Impact factor: 0.979, year: 2002

The effect of repair inhibitor on radiation damages of pleurotus ostreatus

International Nuclear Information System (INIS)

Yang Zongqu; Wang Bonan; Li Xuzhao

1996-01-01

The growth rate and enzyme activities significantly decreased when dikaryotic hypha of Pleurotus ostreatus were irradiated with γ-rays and subsequently treated with either caffeine or Na 2 -EDTA in comparison with γ-rays treatment alone. The inhibition effect of treatment with either caffeine or Na 2 -EDTA before irradiation was more obvious than that after irradiation. Treatment with either caffeine or Na 2 -EDTA could cause biological damages on hypha when the concentrations of caffeine and Na 2 -EDTA were up to 0.5 and 1.0 mg/ml respectively. It is suggested that either caffeine or Na 2 -EDTA be used to suppress the repair of radiation damage in order to increase mutation efficiency of Pleurotus ostreatus and that 0.2 mg/ml caffeine and 0.5 mg/ml Na 2 -EDTA might be the proper concentrations of treatment both before and after irradiation. The effect of caffeine is better than that of Na 2 -EDTA

Polluting macrophytes Colombian lake Fúquene used as substrate by edible fungus Pleurotus ostreatus.

Science.gov (United States)

Martínez-Nieto, Patricia; García-Gómez, Gustavo; Mora-Ortiz, Laura; Robles-Camargo, George

2014-01-01

Invasive aquatic plants from Lake Fúquene (Cundinamarca, Colombia), water hyacinth (Eichhornia crassipes C. Mart.) and Brazilian elodea (Egeria densa Planch.) have been removed mechanically from the lake and can be used for edible mushrooms production. The growth of the oyster mushroom (Pleurotus ostreatus) on these aquatic macrophytes was investigated in order to evaluate the possible use of fruiting bodies and spent biomass in food production for human and animal nutrition, respectively. Treatments included: water hyacinth, Brazilian elodea, sawdust, rice hulls and their combinations, inoculated with P. ostreatus at 3%. Water hyacinth mixed with sawdust stimulated significantly fruiting bodies production (P = 3.3 × 10(-7)) with 71% biological efficacy, followed by water hyacinth with rice husk (55%) and elodea with rice husk (48%), all of these have protein contents between 26 and 47%. Loss of lignin (0.9-21.6%), cellulose (3.7-58.3%) and hemicellulose (1.9-53.8%) and increment in vitro digestibility (16.7-139.3%) and reducing sugars (73.4-838.4%) were observed in most treatments. Treatments spent biomass presented Relative Forage Values (RFV) from 46.1 to 232.4%. The results demonstrated the fungus degrading ability and its potential use in aquatic macrophytes conversion biomass into digestible ruminant feed as added value to the fruiting bodies production for human nutrition.

Biodegradation of 2,4 dichlorophenol by Pleurotus ostreatus DSM 1833

Directory of Open Access Journals (Sweden)

Heloisa Helena Batista da Silva

2009-12-01

Full Text Available This work aimed to investigate the capacity of Pleurotus ostreatus DSM 1833 to degrade 2,4-dichlorophenol, important pollutant found in the wastewaters of the paper and cellulose industry. Using a factorial design 2², the concentrations of glucose and 2,4-dichlorophenol varied between 0 and 10g.L-1 and 5 and 30mg.L-1, respectively. The best global biodegradation rate was obtained using 30 mg.L-1 of 2,4- dichlorophenol in the absence of glucose. This culture medium was used for scaling up the process, resulting in a global biodegradation rate of 0.47mg.L-1.h-1. A comparative test between an inoculated medium and an abiotic control demonstrated that 54.1% of 2,4- dichlorophenol degradation could be attributed to the presence of P. ostreatus.A indústria de papel e celulose contribui para a contaminação ambiental devido aos resíduos gerados, especialmente, no processo de branqueamento da polpa Kraft, realizada com cloro. Basideomicetos saprófitas têm a capacidade de degradar compostos organoclorados como cloroligninas e clorofenóis. Este trabalho teve como objetivo investigar a capacidade de Pleurotus ostreatus DSM 1833 em degradar 2,4-diclorofenol, importante poluente encontrado nos efluentes da indústria de papel e celulose. Utilizando um planejamento fatorial 2², as concentrações de glicose e de 2,4-diclorofenol variaram entre 0 e 10 g.L-1 e 5 e 30 mg.L-1, respectivamente. A melhor taxa global de degradação foi obtida usando-se 30 mg.L-1 de 2,4-diclorofenol na ausência de glicose. Este meio de cultura foi utilizado para a ampliação da escala do processo, resultando em uma taxa global de biodegradação de 0,47 mg.L-1.h-1. Um teste comparativo entre o meio inoculado e o controle abiótico demonstrou que 54,1% da degradação do 2,4-diclorofenol pode ser atribuída à presença de Pleurotus ostreatus.

Selective adhesion of wastewater bacteria to Pleurotus ostreatus mycelium in a trickle-bed bioreactor

Czech Academy of Sciences Publication Activity Database

Svobodová, Kateřina; Petráčková, Denisa; Szabad, Hana; Novotný, Čeněk

2016-01-01

Roč. 3, č. 3 (2016), s. 395-407 ISSN 2372-0344 Institutional support: RVO:61388971 Keywords : Pleurotus ostreatus * activated sludge * fungal/bacterial co-cultur Subject RIV: EE - Microbiology, Virology

Biodegradation of oxytetracycline by Pleurotus ostreatus mycelium: a mycoremediation technique

International Nuclear Information System (INIS)

Migliore, Luciana; Fiori, Maurizio; Spadoni, Anna; Galli, Emanuela

2012-01-01

Highlights: ► Oxytetracycline uptake and degradation by Pleurotus ostreatus mycelium were measured. ► The role of extracellular laccase in degradation was evaluated. ► The almost complete OTC removal was obtained. ► A possible degradation product was identified in mycelia (ADOTC). ► The system can be considered the first step of an useful mycoremediation technique. - Abstract: Oxytetracycline (OTC) is administered in high doses to livestocks and enters the environmental compartments as a consequence of animal waste disposal. As a first step in setting up a useful mycoremediation technique, an OTC lab degradation test was performed in liquid medium using the ligninolytic fungus Pleurotus ostreatus. OTC disappearance in culture medium was clearly evident as early as the third day of exposure onwards, with an almost complete removal after 14 d. The drug removal was mediated by fungal absorption in the mycelia, where the OTC molecule underwent a degradation step, as demonstrated by mass spectrometry analyses. A putative degradation product, ADOTC (2-acetyl-2-decarboxamido-oxytetracycline) is proposed. Experimental conditions excluded OTC abiotic degradation; the degradation by extracellular laccase was also experimentally discarded.

Biodegradation of oxytetracycline by Pleurotus ostreatus mycelium: a mycoremediation technique

Energy Technology Data Exchange (ETDEWEB)

Migliore, Luciana [Dept. Biology, Tor Vergata University, Via della Ricerca Scientifica, 00133 Rome (Italy); Fiori, Maurizio [Dept. Veterinary Public Health and Food Safety, Istituto Superiore di Sanita, Viale Regina Elena 299, 00161 Rome (Italy); Spadoni, Anna [Dept. Biology, Tor Vergata University, Via della Ricerca Scientifica, 00133 Rome (Italy); Institute of Agro-Environment and Forest Biology, National Research Council, Research Area Rome 1, Via Salaria km 29.300, 00015 Monterotondo Rome (Italy); Galli, Emanuela [Institute of Agro-Environment and Forest Biology, National Research Council, Research Area Rome 1, Via Salaria km 29.300, 00015 Monterotondo Rome (Italy)

2012-05-15

Highlights: Black-Right-Pointing-Pointer Oxytetracycline uptake and degradation by Pleurotus ostreatus mycelium were measured. Black-Right-Pointing-Pointer The role of extracellular laccase in degradation was evaluated. Black-Right-Pointing-Pointer The almost complete OTC removal was obtained. Black-Right-Pointing-Pointer A possible degradation product was identified in mycelia (ADOTC). Black-Right-Pointing-Pointer The system can be considered the first step of an useful mycoremediation technique. - Abstract: Oxytetracycline (OTC) is administered in high doses to livestocks and enters the environmental compartments as a consequence of animal waste disposal. As a first step in setting up a useful mycoremediation technique, an OTC lab degradation test was performed in liquid medium using the ligninolytic fungus Pleurotus ostreatus. OTC disappearance in culture medium was clearly evident as early as the third day of exposure onwards, with an almost complete removal after 14 d. The drug removal was mediated by fungal absorption in the mycelia, where the OTC molecule underwent a degradation step, as demonstrated by mass spectrometry analyses. A putative degradation product, ADOTC (2-acetyl-2-decarboxamido-oxytetracycline) is proposed. Experimental conditions excluded OTC abiotic degradation; the degradation by extracellular laccase was also experimentally discarded.

Decolorization of Synthetic Dyes by Pleurotus ostreatus Isolates Differing in Ligninolytic Properties

Czech Academy of Sciences Publication Activity Database

Eichlerová, Ivana; Homolka, Ladislav; Nerud, František

2002-01-01

Roč. 47, č. 6 (2002), s. 691-695 ISSN 0015-5632 R&D Projects: GA MŠk LN00B030 Institutional research plan: CEZ:AV0Z5020903 Keywords : pleurotus ostreatus * ligninolytic properties Subject RIV: EE - Microbiology, Virology Impact factor: 0.979, year: 2002

Shake flask decolourization of direct dye solar golden yellow R by pleurotus ostreatus

International Nuclear Information System (INIS)

Jilani, K.; Asghar, M.; Bhatti, H.N.; Mushtaq, Z.

2011-01-01

Different on site treatment technologies are in practice for industrial wastewaters but bioremediation using white rot fungi is the most attractive option due to complete degradation of the pollutants to non toxic end products. Three direct dyes (Solar golden yellow R, Solar brilliant red BA and Solar orange RSN) were decolourized using white rot fungus (WRF) Pleurotus ostreatus. The best decolourized dye Solar golden yellow R was selected for subsequent optimization studies for decolourization. Under optimum conditions Pleurotus ostreatus caused 90.32 % decolourization of 0.01 % Solar golden yellow R solution within two days of shake flask incubation at pH 3.5 and 30 deg. C temperature in Kirk's basal nutrient medium with added 1 % starch and 0.01 % ammonium sulphate as carbon and nitrogen sources, respectively. Ligninolytic enzyme activities were correlated to dye decolourization and maximum laccase activity of 356.23 U/ml was also noted in the maximally decolourized medium. (author)

UTILIZACIÓN DE CHONTADURO (Bactris gasipaes ENRIQUECIDA CON Pleurotus ostreatus EN POLLOS

Directory of Open Access Journals (Sweden)

JOSE MIGUEL CAMPO GAVIRIA

2017-12-01

Full Text Available In commercial poultry production, 70% of the production costs are related to feeding, this is a limiting factor affecting the profitability. This study aimed to evaluate the inclusion of chontaduro peel (Bactris gasipaes, enriched with the (Pleurotus ostreatus fungus, in the feeding of broilers; using a completely randomized design, with five treatments and three repetitions per treatment, with inclusion levels of 0,10% and 20% of chontaduro fruit peel, and 10 and 20% of chontaduro fruit peel enriched with the fungus (Pleurotus ostreatus. The productive behavior of the lot was determined by the feed intake, weight gain, feed conversion, skin pigmentation and cost benefit ratio of the portions. In this regard, no statistical differences (p <0,05 between treatments for all production variables evaluated were found, except for pigmentation, which was higher with levels of 20% of inclusion; as well as the positive effect in economic terms where the addition of a 20% of chontaduro peel flour enriched with the fungus is favorable because of the better cost-benefit ratio, without significantly affectingthe productive behavior.

Influence of calcium and silicon supplementation into Pleurotus ostreatus substrates on quality of fresh and canned mushrooms.

Science.gov (United States)

Thongsook, T; Kongbangkerd, T

2011-08-01

Supplements of gypsum (calcium source), pumice (silicon source) and pumice sulfate (silicon and calcium source) into substrates for oyster mushrooms (Pleurotus ostreatus) were searched for their effects on production as well as qualities of fresh and canned mushrooms. The addition of pumice up to 30% had no effect on total yield, size distribution and cap diameters. The supplementation of gypsum at 10% decreased the total yield; and although gypsum at 5% did not affect total yield, the treatment increased the proportion of large-sized caps. High content (>10%) of pumice sulfate resulted in the lower yield. Calcium and silicon contents in the fruit bodies were not influenced by supplementations. The centrifugal drip loss values and solid content of fresh mushrooms, and the percentage of weight gained and firmness of canned mushrooms, cultivated in substrates supplemented with gypsum, pumice and pumice sulfate were significantly (p≤0.05) higher than those of the control. Scanning electron micrographs revealed the more compacted hyphae of mushroom stalks supplemented with silicon and/or calcium after heat treatment, compared to the control. Supplementation of P. ostreatus substrates with 20% pumice was the most practical treatment because it showed no effect on yield and the most cost-effective.

Caracterización de la lacasa obtenida por dos métodos de producción con Pleurotus ostreatus Characterising laccase obtained by two production methods using Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Martínez César

2003-12-01

Full Text Available El objetivo de este trabajo fue caracterizar y evaluar diferentes métodos de purificación y separación cromatográfica de un caldo rico en enzima lacasa, producida por una variedad del basidiomycete Pleurotus ostreatus. Se llevaron a cabo dos procesos de producción, a saber: a FES (Fermentación en Estado Sólido; b fermentación en sumergido. El proceso de FES se basó en la producción de un extracto de caldo crudo rico en enzima lacasa a partir del crecimiento micelial sobre salvado con vinaza en relación 1:1 w/v duran te 20 días. Se obtuvo un caldo crudo con una actividad promedio de 20 U/ml. En el caso del proceso de fermentación en sumergido, se trabajó con el medio reportado por Hublick y Schinner (2000 con algunas modificaciones, y se obtuvo un crecimiento del hongo en forma de pellets, en un período de 15 días, con actividad promedio de 10 U/ml en el caldo crudo. Las isoenzimas aisladas en los procesos cromatográficos se caracterizaron de acuerdo a sus propiedades moleculares y cinéticas, se determinó su peso molecular por electroforesis de placa vertical (SDS-PAGE y sus parámetros cinéticos, por ejemplo estabilidad, en un rango de temperatura y pH. Palabras clave: lacasa; Pleurotus ostreatus; fermentación en estado sólido (FES; fermentación en sumergido; isoenzimas; laccase; Pleurotus ostreatus; Solid State Fermentation (SSF; Submerged Fermentation; isoenzymesThis project was designed for characterising and evaluating different methods of chromatographic separation and purification regarding a laccase enzyme-rich broth produced by Pleurotus ostreatus, a variety of basidiomycetes. SSF (Solid State Fermentation and Submerged Fermentation production processes were employed. The SSF process was based on producing a raw broth rich in laccase enzyme from mycelium grown on bran with 1:1 vinasse w/v for 20 days. A raw broth was obtained having an average 20 U/ml activity. The medium reported by Hublick and Schinner (2000

Bioprospecting of powdered pineapple rind as an organic supplement of composted sawdust for Pleurotus ostreatus mushroom cultivation.

Science.gov (United States)

Narh Mensah, Deborah L; Addo, Peter; Dzomeku, Matilda; Obodai, Mary

2018-03-01

Pineapple rind is a by-product of the pineapple processing industry and contains nutrients and other compounds which must be utilized as a bioresource for socio-economic benefits while preventing the potential problems of improper agroindustrial biomass disposal methods. Pleurotus ostreatus is an edible oyster mushroom with medicinal properties and can be cultivated on various agroindustrial biomass, including sawdust containing supplements. Pineapple rind was powdered and used as a supplement of composted sawdust at 2%, 5%, 10%, 12%, 15%, and 20% (w/w) on dry weight basis. A control treatment consisted of composted sawdust supplemented with rice bran at 12% (the most utilized composition in Ghana). P. ostreatus strain EM-1 was cultivated on these treatments. Factors investigated included the spawn run period, yield, fruiting body weight and size, biological efficiency, and nutritional composition (proximate composition and Copper, Zinc and Lead content) of fruiting bodies harvested from selected high-yielding treatments and the control treatment. Full colonization of all treatments occurred by the 34th day of incubation. Enhanced yield, fruiting body weight and size, and biological efficiency were generally recorded with supplementation at lower concentrations (2% and 5%) compared to treatments supplemented at higher concentrations. There was also a supplement concentration-dependent alteration of the nutritional composition of the mushroom. Powdered pineapple rind can be utilized as an organic supplement at relatively low concentrations in composted sawdust for P. ostreatus strain EM-1 cultivation. The use of lower concentrations of powdered pineapple rind in composted sawdust is advantageous as relatively less input will be required to produce higher P. ostreatus strain EM-1 yields. Utilization of pineapple rind for mushroom cultivation will extend the pineapple plant value chain, intensify mushroom production in a sustainable way, and minimize agricultural

Water-Soluble Polysaccharide Extracts from the Oyster Culinary-Medicinal Mushroom Pleurotus ostreatus (Agaricomycetes) with HMGCR Inhibitory Activity.

Science.gov (United States)

Gil-Ramirez, Alicia; Smiderle, Fhernanda R; Morales, Diego; Govers, Coen; Synytsya, Andriy; Wichers, Harry J; Iacomini, Marcello; Soler-Rivas, Cristina

2017-01-01

Water extracts from Pleurotus ostreatus containing no statins showed 3-hydroxy-3-methyl-glutaryl CoA reductase (HMGCR) inhibitory activity (in vitro) that might be due to specific water-soluble polysaccharides (WSPs); when isolated and deproteinized, increasing concentrations of the WSP extract induced higher inhibition. The WSP extract contained mainly β-glucans, mannogalactans, and glycogen (e.g., α-glucans), although derivatives or fragments with lower molecular weights (between 14 and 3.5 kDa) were present and were able to induce the inhibitory activity. The extract contained more β-(1→3)-glucans than β-(11→3),(11→6)-glucans, and they partially survived digestion and managed to pass through Caco2 cell monolayers to the lower compartment after in vitro digestion and transport experiments. The WSP might also modulate Caco2 membrane integrity.

Optimum Condition of Ecologic Feed Fermentation by Pleurotus ostreatus Using Soybean Curd Residue as Raw Materials

OpenAIRE

Shi, Min; Yang, Yingnan; Li, Yiting; Wang, Yuepeng; Zhang, Zhenya

2011-01-01

A novel approach by utilizing soybean curd residue, to produce polysaccharide from the edible mushroom Pleurotus ostreatus in solid-state culture, was developed. Firstly, the significant effect of fermented conditions on P. ostreatus polysaccharide production were screened out to be inoculum size, moisture content and C/N ratio by using a single factor experiment. Secondly, the three factors were optimized using central composite design in response surface methodology. As results, a quadratic...

Production of ligninolytic enzymes by solid state fermentation using Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Seyma Ozcirak Ergun

2017-06-01

Full Text Available Solid state fermentation (SSF stands out in the production of lignocellulolytic and other industrially important enzymes. SSF, an alternative culture method, has several advantages over the conventional submerged ones, like higher yields of enzymes. The production of ligninolytic enzymes, such as laccase (Lac, manganese peroxidase (MnP, lignin peroxidase (LiP and aryl alcohol oxidase (AAO by Pleurotus ostreatus (Jacq. Pleurotus Kumm. (MCC16 was investigated under SSF, which was performed using a support-substrate from potato peel waste (PPW. PPW as dry and fresh was pretreated with base to neutralize organic acids and distilled water. Chemical content of PPW was investigated. Ligninolytic enzyme production patterns were investigated during the growth of the organism for a period of 23 days at 25 °C in the stationary SSF using pretreated PPW. The highest Lac and MnP activities were determined in dry PPW, pretreated with distilled water as 6708.3 ± 75 U/L and 2503.6 ± 50 U/L on day 17, respectively. In addition, amylase and protease enzyme activities were detected under same conditions. According to the results, PPW has a potential as supports for ligninolytic enzyme production by P. ostreatus under SSF.

Production of exopolysaccharides in submerged cultures of gamma irradiation pleurotus ostreatus

International Nuclear Information System (INIS)

Khalaf, M.A.; Atia, A.I.

2009-01-01

Mushrooms have become attractive as a functional food and as a source for the development of drugs and nutraceuticals. Pleurotus ostreatus is considered as the best among them. The exopolysaccharides (EPS) of mushrooms demonstrated a strong antitumor and antioxidant action. However, there is little information available in the literature about the optimization of fermentation conditions for production of EPS by P. ostreatus. So, the effect of medium composition and fermentation parameters on mycelial growth and EPS production by gamma irradiated isolate of P. ostreatus were investigated in shake-flask cultures. The economical optimum fermentation parameters for the highest EPS production 5.73 g/l and mycelial growth rate 11.8 g/l were achieved at initial ph 6, cultivation temperature 28 C(degree), 20 g/l sucrose, 4 g/l yeast extract, 50 ml of medium working volume in a 250 ml flask, and 6% (v/v) of inoculum size after 10 and 12 days, respectively. EPS produced, in this study, showed strong antioxidant activity (96.3%) at concentration 10 mg/ml.

Pengaruh jamur tiram putih (pleurotus ostreatus terhadap kadar glukosa darah, profil lipid dan kadar MDA pada tikus (rattus norvegicus diabetes melitus

Directory of Open Access Journals (Sweden)

Purbowati Purbowati

2016-06-01

Full Text Available Background : Diabetes mellitus is a chronic disease caused by acquired deficiency in insulin production by the pancreas, or by the ineffectiveness of using the produced insulin. Oyster mushroom (Pleurotus ostreatus can help lower blood glucose levels, improve lipid profile and reduce levels of MDA. Objective : to analyze the effect of oyster mushroom on blood glucose levels, lipid profile and MDA levels in STZ induced rats as type 1 DM model. Methods : thirty Sprague Dawley rats were randomly divided into 3 groups: one positive group (1 and two treated group which received 100 mg/kgBB (2 and 200 mg/kgBB (3 oyster mushroom extract, respectively. The interventions were carried out for 30 days. The examination of blood glucose levels, lipid profile and MDA levels was before and after the intervention. The differences inthe datapre-post interventions were analyzed by paired t-test, whereas the differences between the groups were analyzed by one-way ANOVA and kruskal wallis followed by post hoc analysis. Results : the treatment group experienced a decrease in blood glucose levels, total cholesterol, LDL cholesterol, triglycerides, MDA and an increase in HDL cholesterol levels post-intervention (p < 0,001. Oyster mushroom extract with the dose of 200 mg/kg was more effective in lowering blood glucose levels, MDA levels and improving lipid profiles (p < 0,001. Conclusion : Oyster mushrooms administration lowers blood glucose levels, total cholesterol, LDL cholesterol, triglycerides, MDA and increases HDL cholesterol levels.

Antimicrobial Activity of Extracts of the Oyster Culinary Medicinal Mushroom Pleurotus ostreatus (Higher Basidiomycetes) and Identification of a New Antimicrobial Compound.

Science.gov (United States)

Younis, Ahmed M; Wu, Fang-Sheng; El Shikh, Hussien H

2015-01-01

Pleurotus ostreatus is an edible mushroom that also has high medicinal values. In this study, P. ostreatus was tested for its ability to inhibit the growth of fungi and bacteria. The freeze-dried fruiting body, broth from submerged culture, and mycelial biomass of P. ostreatus were extracted using alcohols and water as solvents. The extracts were then tested for their antimicrobial activity against the growth of fungi and bacteria. It was observed that the water extract from fruiting bodies had the strongest effect in inhibiting the growth of most fungi. The most sensitive test microfungi to the inhibition were Candida albicans, Cryptococcus humicola, and Trichosporon cutaneum, and the most sensitive test bacteria were Staphylococcus aureus followed by Escherichia coli. Water extracts from culture broth or mycelial biomass were moderately inhibitive to the growth of fungi and bacteria. The alcohol-based solvents from all samples had much less antimicrobial activity against most test microorganisms. An antimicrobial compound was purified from the water extracts of fruiting bodies with Sephadex G 100 column chromatography and characterized by infrared absorption spectrum (IR), nuclear magnetic resonance (NMR), and mass spectroscopic analysis. We have identified this compound to be 3-(2-aminopheny1thio)-3-hydroxypropanoic acid. This purified compound had a minimum inhibitory concentration of 30 µg/mL and 20 µg/mL against the growth of fungi and bacteria, respectively.

Glucans from fruit bodies of cultivated mushrooms Pleurotus ostreatus and Pleurotus eryngii: Structure and potential prebiotic activity

Czech Academy of Sciences Publication Activity Database

Synytsya, Andriy.; Míčková, K.; Synytsya, A.; Jablonský, I.; Spěváček, Jiří; Erban, V.; Kováříková, E.; Čopíková, J.

2009-01-01

Roč. 76, č. 4 (2009), s. 548-556 ISSN 0144-8617 R&D Projects: GA ČR GA525/05/0273 Institutional research plan: CEZ:AV0Z40500505 Keywords : glucans * oyster mushroom Pleurotus * isolation Subject RIV: CD - Macromolecular Chemistry Impact factor: 3.167, year: 2009

Increase of the productivity of pleurotus ostreatus and their use in the petroleum biodegradation

International Nuclear Information System (INIS)

Cardona U, Fernando; Restrepo R, Dora Patricia; Nino, Pilar; Gonzalez, Raul

2002-01-01

This work is divided in two phases: in the first one a substrate what help to increase productivity of the white-rot fungi pleurotus ostreatus was looked, this was reached combining different kinds of substrates; in the second phase, the contribution in biodegradation of pleurotus ostreatus into the substrate obtained in the first phase and contaminated with heavy part of Cusiana oil was looked. The quantification in the augmentation of productivity was obtained taking the weight of fungi collected of each substrate and comparing it between the, until finding the best one. To quantify the biodegradation the method of determination of greases, oils, and hydrocarbons of petroleum in solids by Soxhlet method was used. The highest substrate in productivity was the mix of 70% of cotton quinine and 30% of hay with 3- 5% of seed, thiamine and vegetable oil. For the biodegradation study concentration less than 25% were used, at higher concentrations a partial inhibition was detected. When the substrate was contaminated with 10% of Cusiana oil the biodegradation was more efficient

A Macrosphelide as the Unexpected Product of a Pleurotus ostreatus Strain-Mediated Biotransformation of Halolactones Containing the gem-Dimethylcyclohexane Ring. Part 1

Directory of Open Access Journals (Sweden)

Katarzyna Wińska

2016-06-01

Full Text Available The aim of the study was to obtain new compounds during biotransformation of two halocompounds, the δ-bromo and δ-iodo-γ-bicyclolactones 1 and 2. Unexpectedly Pleurotus ostreatus produced together with the hydroxylactone, 2-hydroxy-4,4-dimethyl-9-oxabicyclo[4.3.0]nonane-8-one (3, its own metabolite (3S,9S,15S-(6E,12E-3,9,15-trimethyl-4,10,16-trioxacyclohexa-deca-6,12-diene-1,5,8,11,14-pentaone (4. The method presented here, in which this macrosphelide 4 was obtained by biotransformation, has not been previously described in the literature. To the best of our knowledge, this compound has been prepared only by chemical synthesis to date. This is the first report on the possibility of the biosynthesis of this compound by the Pleurotus ostreatus strain. The conditions and factors, like temperature, salts, organic solvents, affecting the production of this macrosphelide by Pleurotus ostreatus strain were examined. The highest yield of macroshphelide production was noticed for halolactones, as well with iodide, bromide, iron and copper (2+ ions as inductors.

Abiotic and biotic degradation of oxo-biodegradable plastic bags by Pleurotus ostreatus.

Directory of Open Access Journals (Sweden)

José Maria Rodrigues da Luz

Full Text Available In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as substrates for P. ostreatus. We observed that physical treatment alone was not sufficient to initiate degradation. Instead, mechanical modifications and reduced titanium oxide (TiO2 concentrations caused by sunlight exposure triggered microbial degradation. The low specificity of lignocellulolytic enzymes and presence of endomycotic nitrogen-fixing microorganisms were also contributing factors in this process.

Abiotic and biotic degradation of oxo-biodegradable plastic bags by Pleurotus ostreatus.

Science.gov (United States)

da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Bazzolli, Denise Mara Soares; Tótola, Marcos Rogério; Demuner, Antônio Jacinto; Kasuya, Maria Catarina Megumi

2014-01-01

In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as substrates for P. ostreatus. We observed that physical treatment alone was not sufficient to initiate degradation. Instead, mechanical modifications and reduced titanium oxide (TiO2) concentrations caused by sunlight exposure triggered microbial degradation. The low specificity of lignocellulolytic enzymes and presence of endomycotic nitrogen-fixing microorganisms were also contributing factors in this process.

Abiotic and Biotic Degradation of Oxo-Biodegradable Plastic Bags by Pleurotus ostreatus

Science.gov (United States)

da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Bazzolli, Denise Mara Soares; Tótola, Marcos Rogério; Demuner, Antônio Jacinto; Kasuya, Maria Catarina Megumi

2014-01-01

In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as substrates for P. ostreatus. We observed that physical treatment alone was not sufficient to initiate degradation. Instead, mechanical modifications and reduced titanium oxide (TiO2) concentrations caused by sunlight exposure triggered microbial degradation. The low specificity of lignocellulolytic enzymes and presence of endomycotic nitrogen-fixing microorganisms were also contributing factors in this process. PMID:25419675

Optimization of Arundo donax Saccharification by (Hemicellulolytic Enzymes from Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Rossana Liguori

2015-01-01

Full Text Available An enzymatic mixture of cellulases and xylanases was produced by Pleurotus ostreatus using microcrystalline cellulose as inducer, partially characterized and tested in the statistical analysis of Arundo donax bioconversion. The Plackett-Burman screening design was applied to identify the most significant parameters for the enzymatic hydrolysis of pretreated A. donax. As the most significant influence during the enzymatic hydrolysis of A. donax was exercised by the temperature (°C, pH, and time, the combined effect of these factors in the bioconversion by P. ostreatus cellulase and xylanase was analyzed by a 33 factorial experimental design. It is worth noting that the best result of 480.10 mg of sugars/gds, obtained at 45°C, pH 3.5, and 96 hours of incubation, was significant also when compared with the results previously reached by process optimization with commercial enzymes.

Abiotic and Biotic Degradation of Oxo-Biodegradable Plastic Bags by Pleurotus ostreatus

OpenAIRE

da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Bazzolli, Denise Mara Soares; Tótola, Marcos Rogério; Demuner, Antônio Jacinto; Kasuya, Maria Catarina Megumi

2014-01-01

In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as su...

Yield and nutritional composition of oyster mushroom strains newly introduced in Bangladesh Produtividade e composição nutricional de linhagens de cogumelo‑ostra recentemente lançadas em Bangladesh

Directory of Open Access Journals (Sweden)

Mostak Ahmed

2013-02-01

Full Text Available The objective of this work was to evaluate yield and chemical composition of oyster mushroom strains newly introduced in Bangladesh. Strains of Pleurotus high‑king (strain PHK, P. ostreatus (strain PO2, and P. geesteranus (strains PG1 and PG3 were evaluated as to yield components and proximate composition. Pleurotus ostreatus was used as control. Pleurotus high‑king showed fastest growth of primordia, but moderate flush of effective fruiting bodies. Pleurotus geesteranus (PG1 showed higher economic yield and biological performance, and better chemical composition, especially in terms of protein and mineral contents. Pleurotus geesteranus (PG1 shows better performance than P. ostreatus (PO2, the most commercially cultivated edible species in Bangladesh, and, therefore, it should be recommended for commercial cultivation.O objetivo deste trabalho foi avaliar a produtividade e a composição química de linhagens de cogumelo‑ostra introduzidas recentemente em Bangladesh. Linhagens de Pleurotus high‑king (linhagem PHK, P. ostreatus (linhagem PO2 e P. geesteranus (linhagens PG1 e PG3 foram avaliadas quanto aos componentes da produção e à composição proximal. Pleurotus ostreatus foi utilizado como controle. Pleurotus high‑king apresentou rápido crescimento de primórdios, mas fluxo moderado de corpos de frutificação efetivos. Pleurotus geesteranus (PG1 apresentou maior produtividade econômica e desempenho biológico, além de melhor composição química, especialmente em termos de conteúdos de proteína e minerais. Pleurotus geesteranus (PG1 apresenta melhor desempenho que P. ostreatus (linhagem PO2, a espécie comestível mais cultivada comercialmente em Bangladesh, e, portanto, deve ser recomendado para plantio comercial.

Degradation of oxo-biodegradable plastic by Pleurotus ostreatus.

Science.gov (United States)

da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Nunes, Mateus Dias; da Silva, Marliane de Cássia Soares; Kasuya, Maria Catarina Megumi

2013-01-01

Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV) or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W) plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate.

Degradation of oxo-biodegradable plastic by Pleurotus ostreatus.

Directory of Open Access Journals (Sweden)

José Maria Rodrigues da Luz

Full Text Available Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate.

Degradation of Oxo-Biodegradable Plastic by Pleurotus ostreatus

Science.gov (United States)

da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Nunes, Mateus Dias; da Silva, Marliane de Cássia Soares; Kasuya, Maria Catarina Megumi

2013-01-01

Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV) or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W) plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate. PMID:23967057

New lipases by mining of Pleurotus ostreatus genome.

Directory of Open Access Journals (Sweden)

Alessandra Piscitelli

Full Text Available The analysis of Pleurotus ostreatus genome reveals the presence of automatically annotated 53 lipase and 34 carboxylesterase putative coding-genes. Since no biochemical or physiological data are available so far, a functional approach was applied to identify lipases from P. ostreatus. In the tested growth conditions, four lipases were found expressed, with different patterns depending on the used C source. Two of the four identified proteins (PleoLip241 and PleoLip369, expressed in both analysed conditions, were chosen for further studies, such as an in silico analysis and their molecular characterization. To overcome limits linked to native production, a recombinant expression approach in the yeast Pichia pastoris was applied. Different expression levels were obtained: PleoLip241 reached a maximum activity of 4000 U/L, whereas PleoLip369 reached a maximum activity of 700 U/L. Despite their sequence similarity, these enzymes exhibited different substrate specificity and diverse stability at pH, temperature, and presence of metals, detergents and organic solvents. The obtained data allowed classifying PleoLip241 as belonging to the "true lipase" family. Indeed, by phylogenetic analysis the two proteins fall in different clusters. PleoLip241 was used to remove the hydrophobic layer from wool surface in order to improve its dyeability. The encouraging results obtained with lipase treated wool led to forecast PleoLip241 applicability in this field.

Biodegradation of remazol brilliant blue R by ligninolytic enzymatic complex produced by Pleurotus ostreatus Biodegradação do azul brilhante de remazol R pelo complexo enzimático ligninolítico produzido por Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Kátia Maria Gomes Machado

2006-12-01

Full Text Available Pleurotus ostreatus ("shimeji" is produced in Brazil on a commercial scale using various lignocellulosic residues. Efforts have been made to reuse the culture residue to obtain products of greater aggregate value such as enzymes or in processes of bioremediation. We evaluated the Remazol brilliant blue R (RBBR degradation potential of extracts from solid substrate colonized by P. ostreatus and extracts from residue of the "shimeji" mushroom yield. Colonized substrates and residue were provided by Toyobo do Brasil Ltda. Extraction was performed with sodium acetate buffer (50 mM, pH 4.6. RBBR decolorization was monitored at 592 nm and peroxidase and laccase activities were measured by monitoring the oxidation of ABTS. Horseradish peroxidase was used as reference. The time of growth of P. ostreatus influenced RBBR degradation and peroxidase and laccase activities. Concentration of 1 mM H2O2 and pH 4.0 were the best for RBBR decolorization. Complete RBBR decolorization was obtained with the addition of only one aliquot of 50 µL of 1 mM H2O2. The stability of the extracts was higher when they were kept under refrigeration than when stored frozen. The potential application of the ligninolytic complex derived from P. ostreatus and mushroom residue for xenobiotic degradation was demonstrated.Pleurotus ostreatus ("shimeji" é produzido no Brasil em escala comercial empregando-se vários resíduos lignocelulósicos. Esforços têm sido feitos para reaproveitamento do resíduo do cultivo em produtos de maior valor agregado, como enzimas ou sua aplicação em processos de biorremediação. Foi feita avaliação do potencial de degradação do azul brilhante de remazol (RBBR por extratos obtidos de substratos sólidos colonizados por P. ostreatus e por extratos do resíduo da produção do cogumelo "shimeji". Substratos colonizados e o resíduo foram fornecidos pela Toyobo do Brasil Ltda. Extração foi feita com tampão acetato de sódio (50 mM, pH 4

EFEKTIVITAS PEMBERIAN AIR LERI TERHADAP PERTUMBUHAN DAN HASIL JAMUR TIRAM PUTIH (Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Ummu Kalsum

2011-09-01

Full Text Available White oyster mushroom is kind of consumed mushroom that has delicious taste and efficacious drug. Mushroom need nutrition addition to increase growth and development so that better production, like nutrition from rice washing water. The contain are carbon element, nitrogen, mineral and vitamin B. This experiment aim to determine addition of rice washing water effect, optimal volume and time interval on growth and yield of white oyster mushroom (Pleurotus ostreatus. This experiment is carried out at mushroom’s house Maduraya Agro Kamal. The research design used was factorial completely randomized design with two factors. First factor is addition rice washing water volume with 4 level, that is without addition rice washing water (A0, addition rice washing water as much as 20 ml/1000 g substrat (A1, 40 ml/1000 g substrat (A2 and 60 ml/1000 g substrat (A3. Second factor is addition time interval that consists of 2 level, that is 2 days (B1 and 4 days (B2. Experiment result shows that interaction between volume treatment and addition time interval give effect on fruit body total. Addition rice washing water volume treatment give real effect on maximal pileus fruit width. While addition time interval treatment does not give significant difference on all parameters but it can increase pileus fruit width, total weight and biological efficiency. Interaction of volume treatment and addition time interval is the best combination is volume treatment 40 ml/1000 g substrat with time interval 2 days (A2B1, this matter is showed in lot fruit body total as big as 8,871 fruit. Addition rice washing water volume 40 ml/1000 g substrat is the best volume that indicated from first bud appear, first harvest time, total weight and biological efficiency.

Effect of supplementing crop substrate with defatted pistachio meal on Agaricus bisporus and Pleurotus ostreatus production.

Science.gov (United States)

Pardo-Giménez, Arturo; Catalán, Luis; Carrasco, Jaime; Álvarez-Ortí, Manuel; Zied, Diego; Pardo, José

2016-08-01

This work assesses the agronomic performance of defatted pistachio meal, after oil extraction, as a nutritional substrate supplement when growing the mushroom species Agaricus bisporus (Lange) Imbach and Pleurotus ostreatus (Jacq.) P. Kumm. Materials were applied at different doses at spawning. Along with non-supplemented substrates, commercial nutritional supplements were used as controls. Proximate analysis of mushrooms is also considered. For the cultivation of champignon, defatted pistachio meal has provided larger mushrooms (unitary weight and cap diameter) with firmer texture and greater content in dry weight and protein, without significant alterations in quantitative parameters. For Pleurotus ostreatus, the supplement led to significant yield increase, even providing up to 34.4% of increment compared to non-supplementation with meal, reaching a biological efficiency of 129.9 kg dt(-1) , when applied to the 15 g kg(-1) compost dose. Supplementation has also been conducted to increase dry weight, protein and fibre within carpophores and to decrease the energy value. Defatted pistachio meal has similar or better results compared to the commercial supplements used as reference. Compost supplementation with defatted pistachio meal in A. bisporus concerns mainly the quantitative parameters (size, texture, dry weight and protein). Based on the results obtained, this technique has greater potential of development for P. ostreatus commercial crops, basically due to expected increases in production, with a direct impact on benefits and crop profitability. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

Laccase production by Pleurotus ostreatus and its application in synthesis of gold nanoparticles

Directory of Open Access Journals (Sweden)

Ahmed I. El-Batal

2015-03-01

Optimization of production conditions yielded an enzyme with activity over 32,450 IU/g of fermented substrate. Factorial design was capable of establishing the conditions that multiplied the activity of the enzyme several folds, consequently, reducing the cost of production. The enzyme was capable of decolorizing several dyes with over 80% reduction in color confirming the aromatic degrading capability of laccase. The enzyme was also used in the synthesis of gold nanoparticles, proving that laccase from Pleurotus ostreatus has a strong potential in several industrial applications.

Electrical stimulation in white oyster mushroom (Pleurotus florida) production

Science.gov (United States)

Roshita, I.; Nurfazira, K. M. P.; Fern, C. Shi; Ain, M. S. Nur

2017-09-01

White oyster mushroom (Pleurotus florida) is an edible mushroom that gained popularity due to its nutritional values, low production cost and ease of cultivation. There are several research reported on the mushroom fruiting bodies which were actively developed when applying electrical shock treatment. This study was aimed to investigate the effects of different electrical voltages on the growth and yield of white oyster mushroom (Pleurotus florida). Five different electrical voltages had been applied during spawning period which were 6V, 9V, 12V, 15V and mushroom bags without any treatment served as control. Treatment at 6V showed the highest rate for mycelium growth while 15V took the shortest time for fruiting body formation. However, no significant different (P>0.05) among all the treatments was observed for the time taken for the mycelium to fill-up the bag and pinhead emergence. The total fresh weight and percentage of biological efficiency for treatment at 9V showed higher values compared to control. Treatment at 9V also showed the largest pileus diameter and the most firm in the pileus texture. Meanwhile, treatment at 6V showed the highest a* value (redness). In addition, different electrical voltage treatments applied did not show any significant effect on substrate utilization efficiency, colour L* and b* values. In conclusion, among all the electrical treatments applied, 9V could be considered as the best treatment to enhance the yield of white oyster mushroom.

Lignocellulolytic enzyme production of Pleurotus ostreatus growth in agroindustrial wastes

Directory of Open Access Journals (Sweden)

José Maria Rodrigues da Luz

2012-12-01

Full Text Available The mushroom Pleurotus ostreatus has nutritional and medicinal characteristics that depend on the growth substrate. In nature, this fungus grows on dead wood, but it can be artificially cultivated on agricultural wastes (coffee husks, eucalyptus sawdust, corncobs and sugar cane bagasse. The degradation of agricultural wastes involves some enzyme complexes made up of oxidative (laccase, manganese peroxidase and lignin peroxidase and hydrolytic enzymes (cellulases, xylanases and tanases. Understanding how these enzymes work will help to improve the productivity of mushroom cultures and decrease the potential pollution that can be caused by inadequate discharge of the agroindustrial residues. The objective of this work was to assess the activity of the lignocellulolytic enzymes produced by two P. ostreatus strains (PLO 2 and PLO 6. These strains were used to inoculate samples of coffee husks, eucalyptus sawdust or eucalyptus bark add with or without 20 % rice bran. Every five days after substrate inoculation, the enzyme activity and soluble protein concentration were evaluated. The maximum activity of oxidative enzymes was observed at day 10 after inoculation, and the activity of the hydrolytic enzymes increased during the entire period of the experiment. The results show that substrate composition and colonization time influenced the activity of the lignocellulolytic enzymes.

Valorization of spent oyster mushroom substrate and laccase recovery through successive solid state cultivation of Pleurotus, Ganoderma, and Lentinula strains.

Science.gov (United States)

Economou, Christina N; Diamantopoulou, Panagiota A; Philippoussis, Antonios N

2017-06-01

Spent mushroom substrate (SMS) of Pleurotus ostreatus was supplemented with wheat bran and soybean flour in various proportions to obtain C/N ratios of 10, 20, and 30, and their effect was evaluated in successive cultivation of Pleurotus ostreatus, Pleurotus pulmonarius, Ganoderma adspersum, Ganoderma resinaceum, and Lentinula edodes strains with respect to mycelium growth rate, biomass concentration, recovery of the enzyme laccase and crude exopolysaccharides, and also with additional fruiting body production. All fungi showed the highest growth rate on unamended SMS (C/N 30), with G. resinaceum being the fastest colonizer (Kr = 9.84 mm day -1 ), while biomass concentration maximized at C/N 10. Moreover, supplementation affected positively laccase activity, with P. pulmonarius furnishing the highest value (44,363.22 U g -1 ) at C/N 20. On the contrary, L. edodes growth, fruiting, and laccase secretion were not favored by SMS supplementation. Fruiting body formation was promoted at C/N 30 for Ganoderma and at C/N 20 for Pleurotus species. Exopolysaccharide production of further studied Pleurotus strains was favored at a C/N 20 ratio, at the initial stage of SMS colonization. The obtained results support the potential effective utilization of supplemented SMS for laccase production from Ganoderma spp. and for new fruiting body production of Pleurotus spp.

Content of Chemical Elements in Wood-Destroying Fungi

Directory of Open Access Journals (Sweden)

Strapáč I.

2016-12-01

Full Text Available The aim of this study was to examine the content of chemical elements in the dried fruiting bodies of edible wood decaying fungi such as Honey mushrooms (Armillaria mellea, Shiitakes (Lentinus edodes and Oyster mushrooms (Pleurotus ostreatus. Powdered samples of fungi were mineralized in a microwave digestion. Twenty-one (21 chemical elements were detected in the plasma of the device ICP-MS AGILENT 7500c by accredited methods with the aid of calibration curves. The content of individual elements varied within a considerable range. The highest contents of K, Mn, Cu and Cd were found in the fruiting bodies of Honey mushrooms (Armillaria mellea. Shiitakes (Lentinus edodes had the highest content of B and Mo. Significant differences were found in the content of elements in the Oyster mushrooms (Pleurotus ostreatus from Slovakia, Hungary and China. The highest content of Al was found in the Oyster mushrooms (Pleurotus ostreatus from Hungary. The Chinese oysters had a maximum contents of Ca, Mg, Co, Pb, As and U. The Oyster mushrooms (Pleurotus ostreatus from Lemešany (Slovakia had the highest contents of Na, Zn, Fe, Se, Ag, Hg and Cr. The difference of chemical element content could be influenced by the genotype of the fungus and by the composition of substrate on which mushroom grow up.

Biosorption of malachite green from aqueous solutions by Pleurotus ostreatus using Taguchi method

Science.gov (United States)

2014-01-01

Dyes released into the environment have been posing a serious threat to natural ecosystems and aquatic life due to presence of heat, light, chemical and other exposures stable. In this study, the Pleurotus ostreatus (a macro-fungus) was used as a new biosorbent to study the biosorption of hazardous malachite green (MG) from aqueous solutions. The effective disposal of P. ostreatus is a meaningful work for environmental protection and maximum utilization of agricultural residues. The operational parameters such as biosorbent dose, pH, and ionic strength were investigated in a series of batch studies at 25°C. Freundlich isotherm model was described well for the biosorption equilibrium data. The biosorption process followed the pseudo-second-order kinetic model. Taguchi method was used to simplify the experimental number for determining the significance of factors and the optimum levels of experimental factors for MG biosorption. Biosorbent dose and initial MG concentration had significant influences on the percent removal and biosorption capacity. The highest percent removal reached 89.58% and the largest biosorption capacity reached 32.33 mg/g. The Fourier transform infrared spectroscopy (FTIR) showed that the functional groups such as, carboxyl, hydroxyl, amino and phosphonate groups on the biosorbent surface could be the potential adsorption sites for MG biosorption. P. ostreatus can be considered as an alternative biosorbent for the removal of dyes from aqueous solutions. PMID:24620852

Rice straw addition as sawdust substitution in oyster mushroom (Pleurotus ostreatus) planted media

Science.gov (United States)

Utami, Christine Pamardining; Susilawati, Puspita Ratna

2017-08-01

Oyster mushroom is favorite by the people because of the high nutrients. The oyster mushroom cultivation usually using sawdust. The availability of sawdust become difficult to find. It makes difficulties of mushroom cultivation. Rice straw as an agricultural waste can be used as planted media of oyster mushroom because they contain much nutrition needed to the mushroom growth. The aims of this research were to analysis the influence of rice straw addition in a baglog as planted media and to analysis the concentration of rice straw addition which can substitute sawdust in planted media of oyster mushroom. This research used 4 treatment of sawdust and rice straw ratio K = 75 % : 0 %, P1 = 60 % : 15 %, P2 = 40 % : 35 %, P3 = 15 % : 60 %. The same material composition of all baglog was bran 20%, chalk 5%, and water 70%. The parameters used in this research were wet weight, dry weight, moisture content and number of the mushroom fruit body. Data analysis was used ANOVA test with 1 factorial. The results of this research based on statistical analysis showed that there was no influence of rice straw addition in a planted media on the oyster mushroomgrowth. 15% : 60% was the concentrationof rice straw additionwhich can substitute the sawdust in planted media of oyster mushroom.

Optimization of King Oyster Mushroom (Pleurotus eryngii Substrate Using Lignocellulosic Affordable Wastes

Directory of Open Access Journals (Sweden)

javad janpoor

2018-03-01

Full Text Available Introduction: King oyster mushroom (Pleurotus eryngii belongs to Basidiomycota division, Agaricomycetes class and Pleurotaceae family. This mushroom generally grows on wood wastes of Apiaceae family. The Pleurotus eryngii is found in pastures, meadows, gardens and seldom in grassy forest clearings and hilly areas. The Pleurotus of the Umbellifers occupy an area in the Northern hemisphere between the 30 and 50º N. These species are mainly found in the subtropical regions of the Mediterranean, Central Europe, Russia, Ukraine, Central Asia and Iran. The P. eryngii sensulato is the only taxon within the genus, which grows in association with plants. P. eryngii has distinguishable characteristics such as coherent texture, unique form, favorable taste and high durability. Mushroom cultivation represents the only current economically viable biotechnology process for the conversion of waste plant residues from forests and agriculture. The species of these genera show much diversity in their adaptation the varying agro-climatic condition which makes more cultivated species than other mushrooms. Special ability of Pleurotus family is growing in lingocellulosic plant or agricultural wastes without needing to prepared compost and casing soil. Pleurotus is an efficient lignin- degrading mushroom and can grow and yield well on different types of lignocellulolosic materials. Type of substrates for mushroom growing depends on available plant or agricultural wastes. In Europe, wheat straw is used for mushroom growing; whereas in Asian South-East countries sawdust is more popular. Different materials for cultivating of P. eryngii have been suggested in different regions of the world; but a few studies have been done on suitability of various lignocellulosic affordable wastes for P. eryngii production in Iran. Therefore, the current study aims to evaluate effects of various locally available agro wastes on the growth characteristics of King oyster mushroom (P

Utilization following of bioremediation attributes using oyster mushrooms - Pleurotus ostreatus

International Nuclear Information System (INIS)

Galanda, D.; Matel, L.

2007-01-01

The mushrooms are not only rich food products, but also a specific component of forest biogeocenoses playing an important role in their functioning, including radionuclide migration. The reason why fungi work as such good indicators for radioactivity and pollution in general is connected to their structure. Using absorption to obtain their nutrition, fungi lack water-conducting organs like stems and roots. They absorb moisture and nutrients from the soil background through surface cells. Dissolved or airborne materials, which include pollutants, move freely through the compartments of hyphae. What is more, radiation released during nuclear testing or accidents is absorbed, especially in areas where it rained heavily shortly after the incident. The present work is devoted to an estimation of the transfer coefficient between reared oyster mushrooms and their support die, which was injected with known activity of 241 Am and 242 Pu. After 2 months when we get the reared mushrooms of cane oyster mushrooms were dried and prepared by liquid extraction with Aliquat 336. The samples were measured by alpha-spectrometry. The results of activity 241 Am and 242 Pu in the mushrooms body and residual activity in the support was detected and calculated (authors)

Selective adhesion of wastewater bacteria to Pleurotus ostreatus mycelium in a trickle-bed bioreactor

Directory of Open Access Journals (Sweden)

Čeněk Novotný

2016-07-01

Full Text Available The work is focused on spontaneous colonization of fungal mycelium by invading microorganisms in a trickle-bed fungal bioreactor operating under semi-sterile conditions. Pleurotus ostreatus was grown under the flow of synthetic wastewater containing activated sludge bacteria and the microbial consortium developed in the reactor was characterized. Genotype and phenotype profile of the reactor-invading, bacterial consortium was clearly distinctive from that of the original activated sludge. The bacterial consortium from the reactor contained a higher portion of bacteria capable of cellobiose utilization and a small amount of bacteria with the ability to utilize benzoic acids. The invading bacteria had no effect on the dye decolorization performance of the fungal reactor. Five bacterial strains colonizing P. ostreatus reactor cultures were isolated and identified as species of the genera Pseudomonas and Bacillus. Except for Bacillus cereus all strains displayed a potential to inhibit fungal growth on solid media (14 to 51 % inhibition which was comparable or higher than that of the reference bacterial strains. The pH- and media composition-dependence of the growth inhibition was demonstrated.

Biodegradation of endocrine disruptors in urban wastewater using Pleurotus ostreatus bioreactor.

Science.gov (United States)

Křesinová, Zdena; Linhartová, Lucie; Filipová, Alena; Ezechiáš, Martin; Mašín, Pavel; Cajthaml, Tomáš

2018-07-25

The white rot fungus Pleurotus ostreatus HK 35, which is also an edible industrial mushroom commonly cultivated in farms, was tested in the degradation of typical representatives of endocrine disrupters (EDCs; bisphenol A, estrone, 17β-estradiol, estriol, 17α-ethinylestradiol, triclosan and 4-n-nonylphenol); its degradation efficiency under model laboratory conditions was greater than 90% within 12 days and better than that of another published strain P. ostreatus 3004. A spent mushroom substrate from a local farm was tested for its applicability in various batch and trickle-bed reactors in degrading EDCs in model fortified and real communal wastewater. The reactors were tested under various regimes including a pilot-scale trickle-bed reactor, which was finally tested at a wastewater treatment plant. The result revealed that the spent substrate is an efficient biodegradation agent, where the fungus was usually able to remove about 95% of EDCs together with suppression of the estrogenic activity of the sample. The results showed the fungus was able to operate in the presence of bacterial microflora in wastewater without any substantial negative effects on the degradation abilities. Finally, a pilot-scale trickle-bed reactor was installed in a wastewater treatment plant and successfully operated for 10days, where the bioreactor was able to remove more than 76% of EDCs present in the wastewater. Copyright © 2017 Elsevier B.V. All rights reserved.

Influence of xylem ray integrity and degree of polymerization on bending strength of beech wood decayed by Pleurotus ostreatus and Trametes versicolor

Science.gov (United States)

Ehsan Bari; Reza Oladi; Olaf Schmidt; Carol A. Clausen; Katie Ohno; Darrel D. Nicholas; Mehrdad Ghodskhah Daryaei; Maryam Karim

2015-01-01

The scope of this research was to evaluate the influence of xylem ray (XR) and degree of polymerization (DP) of holocellulose in Oriental beech wood (Fagus orientalis Lipsky.) on impact bending strength against two white-rot fungi. Beech wood specimens, exposed to Pleurotus ostreatus and Trametes versicolor, were evaluated for...

High temperature induced disruption of the cell wall integrity and structure in Pleurotus ostreatus mycelia.

Science.gov (United States)

Qiu, Zhiheng; Wu, Xiangli; Gao, Wei; Zhang, Jinxia; Huang, Chenyang

2018-05-30

Fungal cells are surrounded by a tight cell wall to protect them from harmful environmental conditions and to resist lysis. The synthesis and assembly determine the shape, structure, and integrity of the cell wall during the process of mycelial growth and development. High temperature is an important abiotic stress, which affects the synthesis and assembly of cell walls. In the present study, the chitin and β-1,3-glucan concentrations in the cell wall of Pleurotus ostreatus mycelia were changed after high-temperature treatment. Significantly higher chitin and β-1,3-glucan concentrations were detected at 36 °C than those incubated at 28 °C. With the increased temperature, many aberrant chitin deposition patches occurred, and the distribution of chitin in the cell wall was uneven. Moreover, high temperature disrupts the cell wall integrity, and P. ostreatus mycelia became hypersensitive to cell wall-perturbing agents at 36 °C. The cell wall structure tended to shrink or distorted after high temperature. The cell walls were observed to be thicker and looser by using transmission electron microscopy. High temperature can decrease the mannose content in the cell wall and increase the relative cell wall porosity. According to infrared absorption spectrum, high temperature broke or decreased the glycosidic linkages. Finally, P. ostreatus mycelial cell wall was easily degraded by lysing enzymes after high-temperature treatment. In other words, the cell wall destruction caused by high temperature may be a breakthrough for P. ostreatus to be easily infected by Trichoderma.

Identification of pyrG Used as an Endogenous Reference Gene in Qualitative and Real-Time Quantitative PCR Detection of Pleurotus ostreatus.

Science.gov (United States)

Zheng, Shi; Shan, Luying; Zhuang, Yongliang; Shang, Ying

2018-03-01

As a well-known edible fungus rich in nutrients, Pleurotus ostreatus has been used as an alternative to expensive wild edible fungi. Specifically, the fact that using P. ostreatus instead of other expensive wild edible fungi has damaged the rights and interests of consumers. Among the existing methods for detection of food adulteration, the amplification of endogenous reference gene is the most accurate method. However, an ideal endogenous reference gene for P. ostreatus has yet to be developed. In this study, a DNA extraction method for P. ostreatus was optimized, and pyrG was selected as a species-specific gene through sequence alignment. This gene was subsequently subjected to qualitative and quantitative Polymerase Chain Reaction (PCR) assays with 3 different P. ostreatus varieties and 7 other species. A low detection limit of 5 pg/μL was obtained by TaqMan quantitative PCR, and no pyrG amplification product was observed in the 7 other species. No allelic variation was detected in P. ostreatus varieties. These experiments confirmed that pyrG was an ideal endogenous reference gene for the qualitative and real-time quantitative PCR detection of P. ostreatus. This method was also suitable for the examination of processed P. ostreatus samples and determination of adulteration in wild mushrooms. The pyrG gene was chosen as an ideal endogenous reference gene for the qualitative and real-time quantitative PCR detection of P. ostreatus, and the detection limit was 5 pg/μL for the quantification. This method is used not only for raw materials but also for processed P. ostreatus products and other processed mushroom foods. © 2018 Institute of Food Technologists®.

Assessment of Gardening Wastes as a Co-Substrate for Diapers Degradation by the Fungus Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Rosa María Espinosa-Valdemar

2015-05-01

Full Text Available Waste with high biomass content generated in cities in developing countries is sent to landfills or open dumps. This research aims to degrade biomass content in urban waste through cultivation, at pilot scale, of the edible mushroom Pleurotus ostreatus. First, the number of diapers used by one baby per week was measured with a survey in day care facilities. Then, cellulose content of diapers was assessed. Finally, cultivation of P. ostreatus was carried out using as substrate a mixture of diapers with gardening waste, a co-substrate readily available at urban settings. The factors assessed were strain of P. ostreatus (grey BPR-81, white BPR-5, conditioning of the substrate (diapers with and without plastic and co-substrate (wheat straw, grass, and withered leaves. Results show that diapers are a valuable source of biomass, as generation of diapers with urine is 15.3 kg/child/month and they contain 50.2% by weight of cellulose. The highest reductions in dry weight and volume (>64% of substrates was achieved with the substrate diaper without plastic and co-substrate wheat straw. Although diapers with plastic and grass and leaves showed lower degradation, they achieved efficiencies that make them suitable as a co-substrate (>40%, considering that their biomass is currently confined in landfills.

Evaluation of the Synergistic Effect of Mixed Cultures of White-Rot Fungus Pleurotus ostreatus and Biosurfactant-Producing Bacteria on DDT Biodegradation.

Science.gov (United States)

Purnomo, Adi Setyo; Ashari, Khoirul; Hermansyah, Farizha Triyogi

2017-07-28

DDT (1,1,1-trichloro-2,2- bis (4-chlorophenyl) ethane) is one of the organic synthetic pesticides that has many negative effects for human health and the environment. The purpose of this study was to investigate the synergistic effect of mixed cutures of white-rot fungus, Pleurotus ostreatus , and biosurfactant-producing bacteria, Pseudomonas aeruginosa and Bacillus subtilis , on DDT biodegradation. Bacteria were added into the P. ostreatus culture (mycelial wet weight on average by 8.53 g) in concentrations of 1, 3, 5, and 10 ml (1 ml ≈ 1.25 × 10 9 bacteria cells/ml culture). DDT was degraded to approximately 19% by P. ostreatus during the 7-day incubation period. The principal result of this study was that the addition of 3 ml of P. aeruginosa into P. ostreatus culture gave the highest DDT degradation rate (approximately 86%) during the 7-day incubation period. This mixed culture combination of the fungus and bacteria also gave the best ratio of optimization of 1.91. DDD (1,1-dichloro-2,2- bis (4-chlorophenyl) ethane), DDE (1,1-dichloro-2,2- bis (4-chlorophenyl) ethylene), and DDMU (1-chloro-2,2- bis (4-chlorophenyl) ethylene) were detected as metabolic products from the DDT degradation by P. ostreatus and P. aeruginosa . The results of this study indicate that P. aeruginosa has a synergistic relationship with P. ostreatus and can be used to optimize the degradation of DDT by P. ostreatus .

Effect of substrate on the growth, nutritional and bioactive ...

African Journals Online (AJOL)

rosemary

2016-07-06

Jul 6, 2016 ... growth, determining nutritional and bioactive components of two oyster mushroom, Pleurotus ostreatus and. Pleurotus ... and the method of cultivation are of major importance ..... rendered alkaline with a few drops of ammonia solution. 5 ..... production and non-enzymatic antioxidant activity of Pleurotus.

Biological transformation of anthracene in soil by Pleurotus ostreatus under solid-state fermentation conditions using wheat bran and compost

International Nuclear Information System (INIS)

Vargas, M C; Rodriguez, R; Sanchez, F; Ramirez, N

2001-01-01

Pleurotus ostreatus was grown in a soil mixture contaminated with anthracene, wheat bran and compost, in varying combinations. Assays with added bacteria and reinoculation of the fungus were also included. The results indicated that in many of the combinations, most of the anthracene was removed at the earliest sample time, 15 days. The most effective combination was spiked (anthracene-added) soil, fungus and compost and the addition of acclimated bacteria to this mixture inhibited anthracene removal. Analyses of extract by high-pressure liquid chromatography HPLC indicated that - anthraquinone, was the major metabolite formed. The results of this study indicate that solid-state fermentation of anthracene-contaminated soils using P. ostreatus in combination with wheat bran and compost additives can produce an accelerated rate of biological removal of anthracene from the soil

USO DEL BAGAZO ENRIQUECIDO CON EL HONGO Pleurotus ostreatus, EN DIETAS PARA BOVINOS ESTABULADOS EN CEBA UTILIZAÇÃO DO BAGAÇO ENRIQUECIDO COMO FUNGO Pleurotus ostreatus, EM DIETAS PARA BOVINOS ESTABULADOS EM ENGORDA Pleurotus ostreatus ENRICHED SUGAR CANEHUSKS UTILIZATION ON INDOOR CATTLEFATTENING DIETS

Directory of Open Access Journals (Sweden)

NATALIA LIZETTE CASTAÑO

2012-12-01

Full Text Available En la elaboración de la panela, entre el 40 y 54% es bagazo, el cual se caracteriza portener baja proteína y energía, altos compuestos lignocelulósicos, acompañado de una baja digestibilidad, por ello, tradicionalmente ha sido utilizado como combustiblepara las hornillas. El presente trabajo, evaluó el uso del bagazo enriquecido con el hongo Pleurotus ostreatus, como suplemento en dietas para bovinos, frente a otros tratamientos con y sin suplementación comercial. A todos los animales se les suministró una dieta balanceada que consistía en 18 Kg de pasto king grass (Saccharum sinense, 6 Kg de caña (Saccharum officinarum, 3 Kg de cogollo de caña (Saccharum officinarum, 3 Kg de gallinaza y 0,6 Kg de miel de panela, y suplemento ofrecido ad libitum a los tratamientos que lo requerían. Se analizaron las variables ganancia diaria de peso, conversión alimenticia, consumo de materiaseca y el efecto costo beneficio de la suplementación. No se presentaron diferencias significativas (PNa elaboração da rapadura, entre o 40% e 54% é bagaço, o qual se caracteriza por ter baixa proteína e energia, alto composto lignocelulósicos, acompanhado por uma baixa digestibilidade, portanto, tradicionalmente tem sido usado como combustível para os queimadores. Este trabalho avaliou o uso do bagaço enriquecido com o fungo Pleurotus ostreatus como suplemento em dietas para bovinos, comparado com outros tratamentos com e sem suplementação comercial. Aos animais todos foi subministrado uma dieta equilibrada que consistia de 18 Kg de grama king grass (Saccharum sinense, 6 Kg de cana (Saccharum officinarum, 3 Kg de broto de cana (Saccharum officinarum, 3 Kg de estrume e 0,6 Kg de mel de rapadura e suplemento oferecido ad libitum aos tratamentos que o requeiram. Analisaram-se as variáveis: ganho diário de peso, conversão alimentar e consumo de matéria seca e o efeito de custo benefício da suplementação. Não apresentaram diferen

Growth and yield performance of Pleurotus ostreatus (Jacq. Fr.) Kumm (oyster mushroom) on different substrates.

Science.gov (United States)

Girmay, Zenebe; Gorems, Weldesemayat; Birhanu, Getachew; Zewdie, Solomon

2016-12-01

Mushroom cultivation is reported as an economically viable bio-technology process for conversion of various lignocellulosic wastes. Given the lack of technology know-how on the cultivation of mushroom, this study was conducted in Wondo Genet College of Forestry and Natural Resource, with the aim to assess the suitability of selected substrates (agricultural and/or forest wastes) for oyster mushroom cultivation. Accordingly, four substrates (cotton seed, paper waste, wheat straw, and sawdust) were tested for their efficacy in oyster mushroom production. Pure culture of oyster mushroom was obtained from Mycology laboratory, Department of Plant Biology and Biodiversity Management, Addis Ababa University. The pure culture was inoculated on potato dextrose agar for spawn preparation. Then, the spawn containing sorghum was inoculated with the fungal culture for the formation of fruiting bodies on the agricultural wastes. The oyster mushroom cultivation was undertaken under aseptic conditions, and the growth and development of mushroom were monitored daily. Results of the study revealed that oyster mushroom can grow on cotton seed, paper waste, sawdust and wheat straw, with varying growth performances. The highest biological and economic yield, as well as the highest percentage of biological efficiency of oyster mushroom was obtained from cotton seed, while the least was from sawdust. The study recommends cotton seed, followed by paper waste as suitable substrates for the cultivation of oyster mushroom. It also suggests that there is a need for further investigation on various aspects of oyster mushroom cultivation in Ethiopia to promote the industry.

Bio-remediation of colored industrial wastewaters by the white-rot fungi Phanerochaete chrysosporium and Pleurotus ostreatus and their enzymes.

Science.gov (United States)

Faraco, V; Pezzella, C; Miele, A; Giardina, P; Sannia, G

2009-04-01

The effect of Phanerochaete chrysosporium and Pleurotus ostreatus whole cells and their ligninolytic enzymes on models of colored industrial wastewaters was evaluated. Models of acid, direct and reactive dye wastewaters from textile industry have been defined on the basis of discharged amounts, economic relevance and representativeness of chemical structures of the contained dyes. Phanerochaete chrysosporium provided an effective decolourization of direct dye wastewater model, reaching about 45% decolourization in only 1 day of treatment, and about 90% decolourization within 7 days, whilst P. ostreatus was able to decolorize and detoxify acid dye wastewater model providing 40% decolourization in only 1 day, and 60% in 7 days. P. ostreatus growth conditions that induce laccase production (up to 130,000 U/l) were identified, and extra-cellular enzyme mixtures, with known laccase isoenzyme composition, were produced and used in wastewater models decolourization. The mixtures decolorized and detoxified the acid dye wastewater model, suggesting laccases as the main agents of wastewater decolourization by P. ostreatus. A laccase mixture was immobilized by entrapment in Cu-alginate beads, and the immobilized enzymes were shown to be effective in batch decolourization, even after 15 stepwise additions of dye for a total exposure of about 1 month.

Radiocesium concentrations in wild mushrooms and characteristics of cesium accumulation by the edible mushroom (Pleurotus ostreatus)

International Nuclear Information System (INIS)

Sugiyama, Hideo; Terada, Hiroshi; Shibata, Hisashi; Morita, Yohoji; Kato, Fumio

2000-01-01

Mushrooms collected from a sub-alpine forest of Mt. Fuji and some other locations in Japan in 1996 were analyzed for radiocesium. The 137 Cs concentrations in 37 mushrooms varied widely from 1.6 to 783 Bqkg -1 fresh wt. The characteristics of Cs accumulation were analyzed by culturing fruiting bodies of the edible mushroom Pleurotus ostreatus (Fr.) Kummer Y-1 (P. ostreatus Y-1). The 137 Cs and stable Cs accumulation expressed as the concentration ratio (CR, 137 Cs or Cs concentration in the dried fruiting body/ 137 Cs or Cs concentration in the fresh medium) were in good agreement, indicating similar migration. The CR of Cs grown on medium containing both 0.1% Cs and 0.1% K, 10.2, showed a decrease of about 30 percent as compared with that containing 0.1% Cs only. These CR values suggested that Cs accumulation by the fruiting bodies of P. ostreatus Y-1 is affected by the presence of K similarly to previous observations in the mycelia. The 133 Cs-NMR spectra from the fruiting bodies of P. ostreatus Y-1 showed two resonance signals, whereas those from the media after harvesting of fruiting bodies showed only one signal. Just before growth of the fruiting bodies, bunches consisting of many mycelia were observed by scanning electron microscopy (SEM). No significant differences in the elemental distribution (Cs, K, P and C) were detected in the mycelium surface by SEM equipped with an energy dispersive X-ray microanalyzer. (author)

Investigation of Pleurotus ostreatus pretreatment on switchgrass for ethanol production

Science.gov (United States)

Slavens, Shelyn Gehle

Fungal pretreatment using the white-rot fungus Pleurotus ostreatus on switchgrass for ethanol production was studied. In a small-scale storage study, small switchgrass bales were inoculated with fungal spawn and automatically watered to maintain moisture. Sampled at 25, 53, and 81 d, the switchgrass composition was determined and liquid hot water (LHW) pretreatment was conducted. Fungal pretreatment significantly decreased the xylan and lignin content; glucan was not significantly affected by fungal loading. The glucan, xylan, and lignin contents significantly decreased with increased fungal pretreatment time. The effects of the fungal pretreatment were not highly evident after the LHW pretreatment, showing only changes based on sampling time. Although other biological activity within the bales increased cellulose degradation, the fungal pretreatment successfully reduced the switchgrass lignin and hemicellulose contents. In a laboratory-scale nutrient supplementation study, copper, manganese, glucose, or water was added to switchgrass to induce production of ligninolytic enzymes by P. ostreatus. After 40 d, ligninolytic enzyme activities and biomass composition were determined and simultaneous saccharification and fermentation (SSF) was conducted to determine ethanol yield. Laccase activity was similar for all supplements and manganese peroxidase (MnP) activity was significantly less in copper-treated samples than in the other fungal-inoculated samples. The fungal pretreatment reduced glucan, xylan, and lignin content, while increasing extractable sugars content. The lowest lignin contents occurred in the water-fungal treated samples and produced the greatest ethanol yields. The greatest lignin contents occurred in the copper-fungal treated samples and produced the lowest ethanol yields. Manganese-fungal and glucose-fungal treated samples had similar, intermediate lignin contents and produced similar, intermediate ethanol yields. Ethanol yields from switchgrass

High-Temperature Induced Changes of Extracellular Metabolites in Pleurotus ostreatus and Their Positive Effects on the Growth of Trichoderma asperellum.

Science.gov (United States)

Qiu, Zhiheng; Wu, Xiangli; Zhang, Jinxia; Huang, Chenyang

2018-01-01

Pleurotus ostreatus is a widely cultivated edible fungus in China. Green mold disease of P. ostreatus which can seriously affect yield is a common disease during cultivation. It occurs mostly after P. ostreatus mycelia have been subjected to high temperatures. However, little information is available on the relationship between high temperature and green mold disease. The aim of this study is to prove that extracellular metabolites of P. ostreatus affected by high temperature can promote the growth of Trichoderma asperellum . After P. ostreatus mycelia was subjected to high temperature, the extracellular fluid of P. ostreatus showed a higher promoting effect on mycelial growth and conidial germination of T. asperellum . The thiobarbituric acid reactive substance (TBARS) content reached the maximum after 48 h at 36°C. A comprehensive metabolite profiling strategy involving gas chromatography-mass spectrometry (GC/MS) combined with liquid chromatography-mass spectrometry (LC/MS) was used to analyze the changes of extracellular metabolites in response to high temperature. A total of 141 differential metabolites were identified, including 84.4% up-regulated and 15.6% down-regulated. Exogenous metabolites whose concentrations were increased after high temperature were randomly selected, and nearly all of them were able to promote the mycelial growth and conidial germination of T. asperellum . The combination of all selected exogenous metabolites also has the promotion effects on the mycelial growth and conidial germination of T. asperellum in a given concentration range in vitro . Overall, these results provide a first view that high temperature affects the extracellular metabolites of P. ostreatus , and the extensive change in metabolites promotes T. asperellum growth.

Effect of Edible Mushroom (Pleurotus ostreatus on Type-2 Diabetics

Directory of Open Access Journals (Sweden)

M. Abu Sayeed

2014-01-01

Full Text Available The prevalence of non-communicable diseases (NCD like diabetes, hypertension, dyslipidemia and atherosclerotic cardiovascular diseases (CVD are on the increase globally and predominantly in the South East Asian Region (SEAR. The increasing NCD and its complications burdened the health cost of Bangladesh. The available literatures suggest that edible mushrooms are effective in controlling metabolic risks like hyperglycemia and hypercholesterolemia. The study addressed the metabolic effects of edible oyster mushroom (Pleurotus ostreatus in diabetic individuals and to assess the undesirable effects of mushroom. A total of 5000 newly registered diabetic women were screened for eligible participants (urban housewives, age 30 – 50y, BMI 22 – 27, FBG 8 – 12 mmol/l; free from complications or systemic illnesses and agreed to adhere to the study for 360 days. The investigations included weight and height for BMI, waist- and hip-girth for WHR, BP, FBG, 2ABF, T-chol, TG, HDL, LDL, ALT and Creatinine starting from the day 0 (baseline and each subsequent follow-up days: 60, 120, 180, 240, 300 and 360 for comparison between placebo and mushroom groups and also within group (baseline vs. follow up days, individually for placebo and mushroom. The daily intake of mushroom was 200g for the mushroom group and an equivalent calorie of vegetables for the placebo group. Overall, 73 diabetic housewives (mushroom / placebo = 43 /30 volunteered. The mean (with SEM values of BMI, WHR, BP, FBG, 2ABF, T-chol, TG, HDL, LDL, ALT and Creatinine of the placebo group were compared with the mushroom group. Compared with the placebo, the mushroom group showed significant reductions of FBG (p<0.001, 2ABF (p<0.001, T-chol (p<0.001, TG (p=0.03 and LDL (p<0.001; whereas, no difference was observed for BMI, SBP, DBP, HDL, Hb, creatinine and ALT. The comparison within groups (baseline vs. follow-up there were significant reduction of these variables in mushroom but not in the

Substratum formulation for laccase and mycelial biomass production of Pleurotus ostreatusFormulação de substratos na produção de biomassa micelial e de lacase de Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Juliana Silveira do Valle

2012-10-01

Full Text Available Pleurotus ostreatus is a producer of biomass and laccase, an enzyme used in fermentation processes for the hydrolysis of lignocellulosic substrate, with potential use in biofuel production and animal feed. Thus, there is a need to seek more appropriate regional substrate for the production of mycelial biomass and laccase. Hence, the aim of this study was to evaluate the effect of physical and chemical characteristics of agro-industrial byproducts in a substratum formulation for the mycelial growth and laccase production by P. ostreatus. The experiment was conducted with the milled raw materials: soy fiber, wheat bran, rice bran, corn grain and corn cob that were separated according to size and analyzed for carbon/nitrogen (C/N ratio. Mycelial growth was evaluated on substratum in cylindrical tubes of borosilicate. Then laccase production was assessed using a 26-2 fractional factorial design with the variables: raw material granulometry and addition of minerals (copper, zinc, iron, cadmium and magnesium in the substrate. The production of laccase was determined by oxidation of ABTS (2,2’-bisazin-(3-ethylbenzothiazoline-6-sulfonic acid. The results indicate that the most important factor for mycelial growth is the holding capacity of oxygen in the substratum. For mycelial growth of P. ostreatus the corn cob and wheat bran are the best components for the substrate. The other raw materials reduced the mycelial growth. However the most important factor for the induction of laccase production is the reduction of particle size, increasing the contact area between the mycelium and the substratum. Pleurotus ostreatus é um produtor de biomassa e lacase, enzima utilizada em processos fermentativos para a hidrólise de substratos lignocelulósicos, com potencial de utilização na produção de biocombustíveis e na alimentação animal. Desta forma, há a necessidade de buscar substratos regionais mais apropriados para a produção de biomassa micelial

Pengaruh Campuran Ampas Tebu Dan Alang-Alang (Imperata Cylindrica) Sebagai Media Pertumbuhan Terhadap Kandungan Nutrisi Jamur Tiram Putih (Pleurotus Ostreatus)

OpenAIRE

Naila, Ishmatun; Purnomo, Adi Setyo

2016-01-01

Penelitian ini bertujuan untuk mengetahui pengaruh ampas tebu dan alang-alang (Imperata cylindrica) sebagai media pertumbuhan jamur tiram putih (Pleurotus ostreatus) terhadap kandungan nutrisinya. Ampas tebu dan alang-alang dipilih sebagai media pertumbuhan alternatif, karena tidak hanya mengandung lignoseluosa, tapi juga tersedia berlimpah di lingkungan. Variasi komposisi ampas tebu:alang-alang yang digunakan adalah 75:25 (A1); 50:50 (A2); 25:75 (A3); 0:100 (A4); dan 100:0 (A5). Pada penelit...

The Removal of Turbidity and TSS of the Domestic Wastewater by Coagulation-Flocculation Process Involving Oyster Mushroom as Biocoagulant

Science.gov (United States)

Pardede, Astrid; Budihardjo, Mochamad Arief; Purwono

2018-02-01

Oyster mushroom (Pleurotus ostreatus) can be utilized as biocoagulant since it has chitin cell wall. Chitin has characteristics of bioactivity, biodegradability, absorption and could bind the metal ions. In this study, Oyster Mushroom is micronized and mixed with wastewater to treat turbidity and Total Suspended Solid (TSS) using coagulation-flocculation process employed jartest method. Various doses of Oyster mushroom, 600 mg/l, 1000 mg/l, and 2000 mg/l were tested in several rapid mixing rates which were 100 rpm, 125 rpm, and 150 rpm for 3 minutes followed by 12 minutes of slow mixing at 45 rpm. The mixture then was settled for 60 minutes with pH level maintained at 6-8. The result showed that the Oyster mushroom biocoagulant was able to remove 84% of turbidity and 90% of TSS. These reductions were achieved with biocoagulant dose of 600 mg/ L at 150 rpm mixing rate.

Lentinula edodes and Pleurotus ostreatus: functional food with antioxidant -antimicrobial activityand an important source of Vitamin D and medicinal compounds

Directory of Open Access Journals (Sweden)

Simone Parola

2017-10-01

Full Text Available Background: Mushrooms produce a large amount of medicinal compounds, and are also an optimal source of fibres, proteins, vitamins (like groups B and D, and other micronutrients including potassium, magnesium, etc. Consequently, mushrooms are commonly considered to be functional foods. Many works report the high biological potentials of medicinal mushrooms involving their antibacterial, hypoglycaemic, anticholesterolemic, radical scavenging, and anti-inflammatory effects. Context and purpose of this study: First off, this work aimed to find strains of Lentinula edodes and Pleurotus ostreatus from a bank of edible mushrooms bought from international strain banks (Table I that could possess health benefit related properties, such as a radical scavenging activity (antioxidant effect, antibacterial effects against common pathogenic bacteria, and being able to produce interesting nutrients and secondary metabolites. As the fungal bank comprises of 20 strains of L. edodes and 20 strains of P. ostreatus, a first screening was made by the selection of 13 strains for each mushroom able to grow in multiple wood types or that were particularly productive and had proved good growth reproducibility over the last 5 years. This work also studied the correlation between culture conditions and mushroom quality in terms of the previously reported properties. Comparison among the selected strains was operated by the assessment of antioxidant and antimicrobial activities after different sample treatments. Furthermore, an initial optimization of the analytic techniques was produced for the direct estimation of important secondary metabolites and nutrients by means of HPLC-MS/MS technique. Further research will encompass an evaluation of transformation processes (drying, freezing, rehydration, cooking, etc. impact on radical scavenging, antibacterial activity, and possible degradation/loss of nutraceutically important substances such as vitamin D2, ergothioneine

Investigation of antioxidative, antityrosinase and cytotoxic effects of extract of irradiated oyster mushroom

Directory of Open Access Journals (Sweden)

Nutsuda Banlangsawan

2016-02-01

Full Text Available Oyster mushroom (Pleurotus ostreatus Fries. is rich in nutrition and has many medicinal properties such as antioxidant and anticancer activities. It also contains a high amount of ergosterol which can be converted to vitamin D2 when exposing to UV light. Oyster mushroom powder was irradiated with UV-B for 180 min and extracted with 95% ethanol. Mushroom extract was determined for vitamin D2 concentration, total phenolic compound, antioxidative activity, tyrosinase inhibitory property and cytotoxicity effect on human keratinocytes (HaCaT and murine melanoma cells (B16F10 by MTT assay. The results demonstrated that the concentration of vitamin D2 of irradiated oyster mushroom extract was 153.96 µg/g, which is 13 times higher than that of non-irradiated mushroom extract. Total phenolic content, antioxidative and tyrosinase inhibitory activities of the two mushroom extracts were not significantly different. Neither oyster mushroom extract had a cytotoxic effect on keratinocytes, but on the other hand both inhibited the growth of murine melanoma cells.

Studies on the aroma of different species and strains of Pleurotus measured by GC/MS, sensory analysis and electronic nose

OpenAIRE

Renata Zawirska-Wojtasiak; Marek Siwulski; Sylwia Mildner-Szkudlarz; Erwin Wąsowicz

2009-01-01

The aroma of several strains of Pleurotus ostreatus, Pleurotus citrinopileatus and Pleurotus djamor was studied by GC/MS. Three main mushrooms aroma constituents: 3-octanol, 3-octanone and 1-octen-3-ol were taken into account for quantitative measurements. The highest amount of 1-octen-3-ol was recorded in P. ostreatus, while considerably lower amounts in P. citrinopileatus. Sensory profile analysis as well as the electronic nose also varied between the three species of Pleurotus. Chiral gas ...

Integration of Artificial Neural Network Modeling and Genetic Algorithm Approach for Enrichment of Laccase Production in Solid State Fermentation by Pleurotus ostreatus

OpenAIRE

Potu Venkata Chiranjeevi; Moses Rajasekara Pandian; Sathish Thadikamala

2014-01-01

Black gram husk was used as a solid substrate for laccase production by Pleurotus ostreatus, and various fermentation conditions were optimized based on an artificial intelligence method. A total of six parameters, i.e., temperature, inoculum concentration, moisture content, CuSO4, glucose, and peptone concentrations, were optimized. A total of 50 experiments were conducted, and the obtained data were modeled by a hybrid of artificial neural network (ANN) and genetic algorithm (GA) approaches...

SYNTHESIS OF AROMA COMPOUNDS BY Pleurotus ostreatus (Jacq.:Fr. Kumm. CULTURED ON VARIOUS SUBSTRATES E. N. Vlasenko, J. V. Stepnevskaya, O. V.

Directory of Open Access Journals (Sweden)

E. N. Vlasenko

2017-08-01

Full Text Available The aim of the study was to determine the intensity of synthesis of volatile aroma compounds by Pleurotus ostreatus (oyster mushroom on sunflower husks and barley straw using sensory profile analysis and UV spectroscopy. The main cultural and morphological characteristics of the mycelial growth and development of fruiting bodies are determined: the period of mycelial development on the substrate, the time of primordial formation, the number of mushroom bunches per unit volume of substrate, the morphology of carpophores. Characteristic attributes of the aroma of dried fruiting bodies (mushroom, woody, sweet, herbaceous, fish, meat, floral, earthy, acidic, putrescent are established and their aroma profiles are built. Sensory profile analysis of flavor of dried samples showed that the mushroom flavor of fungi cultivated on the sunflower husk is more pronounced than of those grown on barley straw. The light absorption maxima are recorded in the ranges 204–210 and 250–290 nm according to UV absorption spectra. Optimal conditions for extracting aromatics from dried fungi samples are the extraction time of 20–35 min at the boiling point of the solvent. Analysis of the UV spectra of fungal alcohol and hexane extracts showed that the intensity of the synthesis of volatile compounds is higher for strains cultivated on sunflower husks than for samples obtained on barley straw.

Laccase Enzymes in Inocula Pleurotus spp

Directory of Open Access Journals (Sweden)

Nora García-Oduardo

2017-01-01

Full Text Available The cultivation of edible and medicinal mushrooms Pleurotus has been aimed at promoting alternative management for agricultural products. This basidiomicete has been the subject of numerous studies because of its fruiting body constitutes a food, being a producer of enzymes with industrial interest and for its ability of biotransformation of lignocellulosic substrates. Pleurotus inocula in the established technology for growing edible and medicinal mushrooms in the CEBI Research- Production Plant were performed using sorghum or wheat. However, it is possible to expand the possibilities with other substrates. In this paper, the results of laccase enzymes production in inocula prepared with sorghum, corn and coffee pulp with two strains Pleurotus ostreatus CCEBI 3021 and Pleurotus ostreatus CCEBI 3024 are presented. The period of preparation of seed reaches 15-21 days, the measurements of laccase activity were performed in periods of seven days. Extraction of crude enzyme was performed in aqueous phase, the determination of the laccase enzyme activity, using guaiacol as substrate. The results obtained in this work with studies in previous work using sorghum as inocula are compared. It is found that higher yields are obtained laccase in coffee pulp. This study contributes to the theoretical knowledge and to provide alternatives for securing the production process of the plant.

Tratamento do feno de braquiária pelo fungo Pleurotus ostreatus Pretreatment effects on fiber degradation of brachiaria hay by Pleurotus ostreatus fungus

Directory of Open Access Journals (Sweden)

Patrick Schmidt

2003-12-01

Full Text Available A inoculação de forragens com fungos lignocelulolíticos é uma opção para melhorar a qualidade destas sem adição de produtos químicos. O tratamento do substrato influencia a ação do fungo e a qualidade final do produto. Neste experimento, aplicaram-se quatro tratamentos (compostagem do feno inteiro, compostagem do feno picado, hidratação do feno em água fria e hidratação do feno em água quente a um feno de Brachiaria decumbens. Aos tratamentos seguiu-se inoculação com o fungo Pleurotus ostreatus e incubação por 35 dias, sob temperatura controlada. Usou-se o delineamento inteiramente casualizado, com quatro repetições e medidas repetidas. Amostras foram colhidas semanalmente para acompanhar a degradação do substrato, mediante a análise química do feno. Observou-se aumento linear, com o decorrer do tempo, no teor de proteína bruta (PB e na proporção de lignina na parede celular (LIG-FDN, e decréscimo linear nos valores de fibra em detergente neutro (FDN, celulose e hemicelulose. Não se observou efeito de tratamento no teor de FDA. Os tratamentos com compostagem apresentaram maiores valores de PB, lignina e LIG-FDN e menores de FDN e hemicelulose. Não se observou diferença entre os tratamentos com hidratação. O tratamento do feno de braquiária com o fungo propiciou degradação da fração fibrosa e aumento no teor de PB, com efeito mais intenso nos tratamentos que usaram compostagem. A ação do fungo foi mais efetiva sobre a hemicelulose que sobre os demais componentes da fibra.The innoculation of forages with lignocellulolytic fungi is an option for improving quality without adding chemical products. Substrate quality influences fungal activity and endproduct quality. The effects of four treatments (composting of whole hay, composting of chopped hay, soaking in cool water and soaking in hot water on a Brachiaria decumbens hay were evaluated. The treatments were followed by innoculation with Pleurotus ostreatus

Anti-Growth Factors Associated with Pleurotus ostreatus in a Submerged Liquid Fermentation

Directory of Open Access Journals (Sweden)

Juliet B. Akinyele

2012-09-01

Full Text Available Aims: Previous studies had revealed that cultivation of Pleurotus ostreatus is often met with a lot of challenges ranging from environmental to biological factors which adversely affect the successful cultivation of the mushroom. Hence, a need to determine factors against mycelia colonization of substrate during mushroom’s cultivation.Methodology and Result: Conventional streak method was employed to establish the percentage inhibition as well as intercolony distance between the test organisms obtained from the infected substrate and mycelia of the mushroom during substrate colonization. The test organisms are: a fungus, Kutilakesopsis macalpineae and a bacterium,Pseudomonas tolaasii. The effect of pH and temperature on the mycelia growth of P. ostreatus was also investigated. There was a gradual increase in the percentage inhibition from 33.3 % at 24 h to 75.0 % at 168 h for K. macalpineae and 37.5 % at 24 h to 70.0 at 168 h for P. tolaasii. The inter-colony distance between the antagonists and the mushroom mycelium gradually decreased. Optical density of the mycelium growth was at its optimum at pH 4.5 and temperature of25 °C respectively. In vitro study also showed a significant increase in the optical density from 0.855±0.03 at 24 h to 1.316±0.02 at 168 h in the absence of test antagonist as against 0.812±0.06 and 0.79±0.02 at 24 h to 1.103±0.03 and 0.902±0.03 at 168 h when K. macalpineae and P.tolaasii were used as test antagonistic respectively.Conclusion, significance and impact of study: Sterilization of substrate is essential to avoid contamination during mycelia colonization. Also, slightly acidic medium and temperature control is necessary for high yield of fruit bodies.

Isolation and characterization of differentially expressed genes in ...

African Journals Online (AJOL)

USER

Through reverse transcriptase-polymerase chain reaction analysis, priA homologue and AP-1 like transcription factor ... The oyster mushroom, Pleurotus ostreatus, and white button mushroom ..... differential display of RAPD. FEMS Microbiol.

Risk of alpha radionuclides presence in cultivating substrate of oyster mushrooms - Pleurotus ostreatus

International Nuclear Information System (INIS)

Galanda, D.

2006-01-01

The mushrooms are not only rich food products, but also a specific component of forest biogeocenoses playing an important role in their functioning, including radionuclide migration. The reason why fungi work as such good indicators for radioactivity and pollution in general is connected to their structure. Using absorption to obtain their nutrition, fungi lack water-conducting organs like stems and roots. They absorb moisture and nutrients from the soil background through surface cells. Dissolved or airborne materials, which include pollutants, move freely through the compartments of hyphae. What is more, radiation released during nuclear testing or accidents is absorbed, especially in areas where it rained heavily shortly after the incident. The present work is devoted to an estimation of the transfer coefficient between reared oyster mushrooms and their support die, which was injected with known activity of 241 Am and 242 Pu. After 2 months when we get the reared mushrooms of cane oyster mushrooms were dried and prepared by liquid extraction with Aliquat 336. The samples were measured by ? -spectrometry. The results of activity 241 Am and 242 Pu in the mushrooms body and residual activity in the support was detected and calculated. (author)

Total Phenolics, Flavonoids, Tannin Contents and Antioxidant Properties of Pleurotus ostreatus Cultivated on Different Wastes and Sawdust

Directory of Open Access Journals (Sweden)

Ayşenur Yılmaz

2017-01-01

Full Text Available In this study, the usage possibilities of some agro-industrial wastes such as; peanut wastes, potatoes farm wastes, walnut and orange tree sawdust in Pleurotus ostreatus cultivation were investigated and total phenolic, flavonoid, condensed tannin content and antioxidant properties of these methanolic mushroom extracts were examined. For the determination of the total phenolic contents, the Folin-Ciocalteau procedure was used. The content of total flavonoid present in the methanolic extracts was measured using a spectrophotometric assay. Condensed tannins were determined according to the method by Julkunen-Tıtto. The antioxidant capacity was determined using ferric reducing antioxidant power (FRAP and free radical scavenging activity of DPPH. The highest total phenolic content (2.672 ± 0.003 mg GAE/g was found in mushroom cultivated on walnut sawdust. The highest condensed tannin (1.011 ± 0.088 CE mg/g and ferric reducing antioxidant power (FRAP (12.332 ± 0.017 μmol FeSO4.7H2O/g were observed in the same mushroom extract. The highest total flavonoid and free radical scavenging activity of DPPH were found in extract of mushroom cultivated on potatoes handle. Bioactive properties of P. ostreatus cultivated on walnut tree sawdust were generally exhibited remarkable results.

Characterization and in vitro antioxidant activities of polysaccharides from Pleurotus ostreatus.

Science.gov (United States)

Zhang, Yunxia; Dai, Ling; Kong, Xiaowei; Chen, Liangwen

2012-10-01

Two polysaccharide fractions (PSPO-1a and PSPO-4a) were isolated from the fruiting bodies of Pleurotus ostreatus using ethanol precipitation, anion-exchange chromatography and gel permeation chromatography. Both fractions were heteropolysaccharide containing protein and uronic acid. PSPO-1a was composed of mannose, glucose, galactose, xylose and rhamnose with a molar ratio of 2.47:0.91:1.00:1.66:3.87. PSPO-4a was composed of only three monosaccharides: rhamnose, mannose and galactose with a molar ratio of 0.92:2.69:1.00. The average molecular weight of PSPO-1a and PSPO-4a determined by HPLC were estimated to be 1.8 × 10(4)Da and 1.1 × 10(6)Da respectively. The in vitro tests revealed that two polysaccharides were natural potential antioxidant. Both polysaccharides presented stronger DPPH radical and superoxide anion radical scavenging activity with increasing concentrations, but less effective on scavenging hydroxyl radical. Compared with PSPO-4a, PSPO-1a was the more effective free-radical scavenger. In conclusion, the two polysaccharides may be useful as a naturally potential antioxidant agent for application in food and medicinal fields. Copyright © 2012 Elsevier B.V. All rights reserved.

Oyster mycelium on the liquid medium

Directory of Open Access Journals (Sweden)

Mariusz Gapiński

2013-12-01

Full Text Available The research presents the results of oyster mycelium growth on the liquid medium. The growth of 4-mycelium genius: Pleurotus citrinopileatus Singer, Pleurotus djamor Fries, Boedjin, Pleurotus erynii Fr. Kumm. and Pleurotus precoce Fr. Quel was tested. The quality and quantity of mycelium was assumed.

USO DE HOJARASCA DE ROBLE y BAGAZO DE CAÑA EN LA PRODUCCIÓN DE Pleurotus ostreatus USO DA SERAPILHEIRA DE CARVALHO E BAGAÇO DA CANA NA PRODUÇÃO DO Pleurotus ostreatus USE OF THE OAK DEAD LEAVES AND SUGAR CANE BAGASSE IN THE Pleurotus ostreatus PRODUCTION

Directory of Open Access Journals (Sweden)

PILAR SUDIANY VARGAS

2012-06-01

Full Text Available Se evaluó hojarasca de roble en un relicto de bosque en la Vereda La Capilla de Cajibío (Cauca durante 6 meses, como sustrato para el crecimiento del hongo Pleurotus ostreatus, eligiendo árboles maduros con DAP entre 35 y 37 cm, obteniéndose un promedio de 7,41 kg de hojarasca por árbol. Se evaluó el crecimiento del hongo en hojarasca mezclada con bagazo de caña y 5 sustratos: T1: bagazo 100%, T2: roble 100%, T3: roble 75% y 25% de bagazo, T4: roble 50% y 50% bagazo y T5: roble 25% y 75% bagazo, logrando eficiencias biológicas de 221,1%, 44,35%, 52,78%, 90,30% y 109,12% respectivamente. Se observó relación inversa entre el contenido de hoja de roble y las eficiencias debido a la naturaleza coriácea y cerosa de la hoja. La mayoría de los carpóforos presentaron 5 a 12 cm de diámetro y contaminación causada por hongos competidores del género Trichoderma sp. Se detectaron cambios en la composición del sustrato agotado, principalmente incremento de minerales y proteínas y disminución de fibra en el bagazo de caña y en la hojarasca de roble, siendo apto para alimentación de animales poligástricos por el contenido de proteína micelial, presencia de celulosa y menor contenido de lignina.Avaliamos a produção de serapilheira em uma floresta na aldeia La Capilla de Cajibío, (Cauca, por 6 meses, como substrato para o crescimento do fungo Pleurotus ostreatus, escolhendo árvores maduras com DAP entre 35 e 37 cm, produzindo uma media de 7,41 kg de lixo por árvore. Avaliou-se o crescimento do fungo em folhas misturadas com bagaço de cana e 5 substratos: T1: bagaço de 100%, T2: carvalho de 100%, T3: carvalho 75% e 25% de bagaço, T4: carvalho 50% e bagaço 50% e T5: carvalho de 25% e 75% do bagaço, alcançando eficiências biológicas de 221,1%, 44,35%, 52,78%, 90,30% e 109,12%, respectivamente. Era uma associação inversa entre o conteúdo de folha de carvalho e eficiência devido à natureza de couro, folha waxy. A maioria dos

A novel stirrer design and its application in submerged fermentation of the edible fungus Pleurotus ostreatus.

Science.gov (United States)

Zhu, Hu; Sun, Jiao; Tian, Baozhen; Wang, Honglin

2015-03-01

In this study, a straight diagonal-pitched blade stirrer was designed, built and characterized in a 5-L fermenter. Compared with the six straight blade Rushton turbine, the power consumption of the new stirrer is lower at a given speed under conditions of no ventilation. The oxygen transference is poorer at the same agitation speed in the cultivation conditions and scales investigated, which confirms that the shear stress of the new stirrer is lower and the gas dispersion is weaker. The new stirrer was installed in a 5-L bioreactor and evaluated in submerged fermentation of the edible fungus Pleurotus ostreatus. The results showed that the maximum dry weight of mycelium is increased by 47 % and reached 7.47 g/L, and the maximum laccase activity is increased by 15 % up to 2,277 U/L. Glucose consumption was also found to be relatively faster. The power consumption is 2.8 % lower than that of the Rushton turbine.

Anti-Fungal activity of essential oil from Baeckea frutescens L against Pleuratus ostreatus

Science.gov (United States)

Jemi, Renhart; Barus, Ade Irma; Nuwa, Sarinah, Luhan, Gimson

2017-11-01

Ujung Atap is an herb that have distinctive odor on its leaves. The plant's essential oil contains bioactive compounds but has not been investigated its anti-fungal activity against Pleurotus ostreatus. Essential oil from Ujung Atap leaves is one environmentally friendly natural preservative. This study consisted of distillation Ujung Atap leaves with boiled method, determining the number of acid, essential oil ester, and anti-fungal activity against Pleurotus ostreatus. Analysis of the data to calculate anti-fungal activity used probit analysis method to determine the IC50. Results for the distillation of leaves Ujung Atap produce essential oil yield of 0.071% and the average yield of the acid number and the ester of essential oils Ujung Atap leaves are 5.24 and 12.15. Anti-fungal activity Pleurotus ostreatus at a concentration of 1000 µg/mL, 100 µg/mL, 75 µg/mL, 50 µg/mL and 100 µg/mL BA defunct or fungi was declared dead, while at a concentration of 25 µg/mL, 10 µg/mL and 5 µg/mL still occur inhibitory processes. Results obtained probit analysis method IC50 of 35.48 mg/mL; means the essential oil of Ujung Atap leaf can inhibit fungal growth by 50 percent to 35.48 µg/mL concentration.

Enzyme-assisted extraction enhancing the umami taste amino acids recovery from several cultivated mushrooms

DEFF Research Database (Denmark)

Poojary, Mahesha Manjunatha; Orlien, Vibeke; Passamonti, Paolo

2017-01-01

In this study, enzyme-assisted extraction was performed to extract umami taste and total free amino acids (FAAs) from the six different mushrooms including shiitake (Lentinus edodes), oyster (Pleurotus ostreatus), tea tree (Agrocybe aegerita) and, white, brown and portobello champignons (Agaricus...

The Amoebicidal Effect of Ergosterol Peroxide Isolated from Pleurotus ostreatus.

Science.gov (United States)

Meza-Menchaca, Thuluz; Suárez-Medellín, Jorge; Del Ángel-Piña, Christian; Trigos, Ángel

2015-12-01

Dysentery is an inflammation of the intestine caused by the protozoan parasite Entamoeba histolytica and is a recurrent health problem affecting millions of people worldwide. Because of the magnitude of this disease, finding novel strategies for treatment that does not affect human cells is necessary. Ergosterol peroxide is a sterol particularly known as a major cytotoxic agent with a wide spectrum of biological activities produced by edible and medicinal mushrooms. The aim of this report is to evaluate the amoebicidal activity of ergosterol peroxide (5α, 8α-epidioxy-22E-ergosta-6,22-dien-3β-ol isolated from 5α, 8α-epidioxy-22E-ergosta-6,22-dien-3β-ol) (Jacq.) P. Kumm. f. sp. Florida. Our results show that ergosterol peroxide produced a strong cytotoxic effect against amoebic growth. The inhibitory concentration IC50 of ergosterol peroxide was evaluated. The interaction between E. histolytica and ergosterol peroxide in vitro resulted in strong amoebicidal activity (IC50  = 4.23 nM) that may be due to the oxidatory effect on the parasitic membrane. We also tested selective toxicity of ergosterol peroxide using a cell line CCL-241, a human epithelial cell line isolated from normal human fetal intestinal tissue. To the best of our knowledge, this is the first report on the cytotoxicity of ergosterol peroxide against E. histolytica, which uncovers a new biological property of the lipidic compound isolated from Pleurotus ostreatus (Jacq.) P. Kumm. f. sp. Florida. Copyright © 2015 John Wiley & Sons, Ltd.

Composição mineral de uma linhagem de Pleurotus ostreatus cultivada em resíduos madeireiros e agroindustriais da região amazônica Mineral composition of Pleurotus ostreatus strain grown in wood and agroindustrial residues from the Amazon region

Directory of Open Access Journals (Sweden)

Ceci Sales-Campos

2009-12-01

Full Text Available Os cogumelos do gênero Pleurotus são cultivados em diversos substratos lignocelulósicos, dada a atividade decompositora desses organismos proveniente de seu metabolismo enzimático. O presente estudo teve como objetivo analisar a composição mineral de Pleurotus ostreatus e dos substratos de cultivo preparados à base de resíduos madeireiros e agroindustriais da região amazônica. Foram analisados macro (P, K, Ca e Mg e micronutrientes (Fe, Zn, Cu, Mn e Na dos cogumelos e dos substratos. Os substratos foram formulados a partir da serragem de Simarouba amara Aubl. (marupá, Ochroma piramidale Cav. ex. Lam. (pau de balsa e de bagaços de Bactris gasipaes Kunth (pupunheira e de Saccharum officinarum (cana-de-açúcar. As amostras foram solubilizadas mediante digestão ácida (nítrico-peridrol. Os elementos Ca, Mg, Fe, Cu, Zn e Mn foram determinados por espectrometria de absorção atômica; o Na e K, por emissão atômica e o P, por colorimetria. A composição mineral do cogumelo variou com o substrato de cultivo. Os diferentes substratos possibilitaram a produção de um cogumelo rico em K, P, Mg e Fe, essenciais à nutrição e à saúde humana. O potássio foi o mineral de maior teor no cogumelo em todos os substratos testados (36,83-42,18 g.kg-1, seguido de fósforo (6,95-10,60 g.kg-1 e do magnésio (1,57-2,50 g.kg-1.Mushrooms belonging to the Pleurotus gender are grown in several lignocellulosic substrates due to the decomposing activity of these organisms that result from their enzymatic metabolism. The objective of the present study was to analyze the mineral composition of Pleurotus ostreatus and the cultivation substrates prepared with wood and agroindustrial residues from the Amazon region. Macro (P, K, Ca and Mg and micronutrients (Fe, Zn, Cu, Mn and Na of mushroom and substrates were analyzed. Substrates were formulated from Simarouba amara Aubl. and Ochroma piramidale Cav. ex. Lam. sawdust and crushed Bactris gasipaes Kunth

Effect of agroforestry residues partially biodegraded by pleurotus ostreatus (pleurotaceae) on tomato seedlings development

International Nuclear Information System (INIS)

Luna Fontalvo, Jorge Alberto; Cordoba Lopez, Laura Sofia; Gil Pertuz, Karina Isabel; Romero Borja, Isaac Manuel

2013-01-01

It was evaluated the development of tomato seedlings (plant bioindicator of toxicity) in soils with sawdust and rice husk partially biodegraded by Pleurotus ostreatus in greenhouse conditions. Both organic compounds (carbon, cellulose, lignin, extractives, and organic matter), and inorganic compounds (nitrogen, phosphorus and pH) were determined, before and after fungus inoculation on sawdust and rice husk. Mixtures were held of each substrate with a nutrient poor soil in equal proportions (1:1) and the moisture content was determined. The experiment consisted of a completely randomized, with two groups of six treatments for each substrate, and 30 days later, parameters of growth and development were identified. biodegraded substrates presented low C, N and P. bsa + sf treatment (biodegraded sawdust + fertilized soil) presented the best results in the number of leaves (12.9), plant height (25.94 cm), root length (5.92 cm), dry weight (0.138 g), and fresh weight (1.012 g). bsa + sf substrate can work as favorable substrate for growing tomato seedlings, bsa + sf substrate can work as favorable substrate for growing of tomato seedlings, since it provides the nutrients necessary for a good growth. Plants in rice bran did not grow adequately for transplanting.

In Vitro Antimicrobial and Antioxidant Activities of Ethanolic Extract of Lyophilized Mycelium of Pleurotus ostreatus PQMZ91109

Directory of Open Access Journals (Sweden)

Emanuel Vamanu

2012-03-01

Full Text Available The antioxidant and antimicrobial potential of the ethanolic extract of Pleurotus ostreatus PQMZ91109 mycelium was determined based on inorganic and organic nitrogen sources in the culture medium. The presence of ammonium sulfate resulted in a greater accumulation of bioactive compounds compared with the organic ones. This finding was also confirmed by the low values of the ascertained EC50 and minimum inhibitory concentration (MICs. Among the organic sources, peptone followed by corn extract, led to a more important radical-scavenging activity. The extracts selectively inhibited the tested strains, mainly the two of the genus Candida, at an MIC value of 1.25 mg/mL. The antioxidant potential was evaluated by the inhibition capacity of the 2,2-diphenyl-1-picrylhydrazyl (DPPH radical, β-carotene-linoleic acid, which is the reducing power. In addition, the quantity of the compounds with antioxidant effects confirmed the data obtained, they being present in the extracts.

Co-cultivation of mutant Penicillium oxalicum SAU(E)-3.510 and Pleurotus ostreatus for simultaneous biosynthesis of xylanase and laccase under solid-state fermentation.

Science.gov (United States)

Dwivedi, Pallavi; Vivekanand, V; Pareek, Nidhi; Sharma, Amit; Singh, Rajesh P

2011-10-01

Co-cultivation of mutant Penicillium oxalicum SAU(E)-3.510 and Pleurotus ostreatus MTCC 1804 was evaluated for the production of xylanase-laccase mixture under solid-state fermentation (SSF) condition. Growth compatibility between mutant P. oxalicum SAU(E)-3.510 and white rot fungi (P. ostreatus MTCC 1804, Trametes hirsuta MTCC 136 and Pycnoporus sp. MTCC 137) was analyzed by growing them on potato dextrose agar plate. Extracellular enzyme activities were determined spectrophotometrically. Under derived conditions, paired culturing of mutant P. oxalicum SAU(E)-3.510 and P. ostreatus MTCC 1804 resulted in 58% and 33% higher levels of xylanase and laccase production, respectively. A combination of sugarcane bagasse and black gram husk in a ratio of 3:1 was found to be the most ideal solid substrate and support for fungal colonization and enzyme production during co-cultivation. Maximum levels of xylanase (8205.31 ± 168.31 IU g(-1)) and laccase (375.53 ± 34.17 IU g(-1)) during SSF were obtained by using 4 g of solid support with 80% of moisture content. Furthermore, expressions of both xylanase and laccase were characterized during mixed culture by zymogram analysis. Improved levels of xylanase and laccase biosynthesis were achieved by co-culturing the mutant P. oxalicum SAU(E)-3.510 and P. ostreatus MTCC 1804. This may be because of efficient substrate utilization as compared to their respective monocultures in the presence of lignin degradation compounds because of synergistic action of xylanase and laccase. Understanding and developing the process of co-cultivation appears productive for the development of mixed enzyme preparation with tremendous potential for biobleaching. Copyright © 2011 Elsevier B.V. All rights reserved.

Growth and yield performance of Pleurotus ostreatus (Jacq. Fr.) Kumm (oyster mushroom) on different substrates

OpenAIRE

Girmay, Zenebe; Gorems, Weldesemayat; Birhanu, Getachew; Zewdie, Solomon

2016-01-01

Mushroom cultivation is reported as an economically viable bio-technology process for conversion of various lignocellulosic wastes. Given the lack of technology know-how on the cultivation of mushroom, this study was conducted in Wondo Genet College of Forestry and Natural Resource, with the aim to assess the suitability of selected substrates (agricultural and/or forest wastes) for oyster mushroom cultivation. Accordingly, four substrates (cotton seed, paper waste, wheat straw, and sawdust) ...

Differential response of oyster shell powder on enzyme profile and nutritional value of oyster mushroom Pleurotus florida PF05.

Science.gov (United States)

Naraian, Ram; Narayan, Om Prakash; Srivastava, Jatin

2014-01-01

Oyster mushroom Pleurotus florida was cultivated on different combinations of wheat straw (WS) as basal substrate and oyster shell powder (OSP) supplement. The OSP supplementation considerably responded to different cultivation phases. The mycelium grew fast and showed rapid growth rate (8.91 mmd(-1)) in WS + OSP (97 + 3) combination while WS + OSP (92 + 8) showed maximum laccase (3.133 U/g) and Mn peroxidase (MnP) activities (0.091 U/g). The climax level of laccase (5.433 U/g) and MnP (0.097 U/g) was recorded during fruit body initiation in WS + OSP (97 + 3) and WS + OSP (98 + 2) combinations, respectively. The WS + OSP (97 + 3) combination represented the best condition for mushroom cultivation and produced the highest biological efficiency (147%). In addition, protein and lipid contents in fruit bodies were slightly improved in response to OSP. The carbohydrate was significantly increased by raising concentration of OSP. The highest values of protein, carbohydrate, and lipid noted were 31.3 μg/g, 0.0639 (g/g), and 0.373 (g/g) correspondingly. Conclusively it was evident that lower concentrations of OSP acted positively and relatively to higher concentrations and improved nutritional content which may suitably be used to enhance both yield and nutritional values of mushroom.

Heavy metal and proximate composition associated with the ...

African Journals Online (AJOL)

Changes in the heavy metal content and proximate composition during the 28 day composting of cassava peels used in the cultivation of the oyster mushrooms Pleurotus ostreatus strain EM-1 was studied. Significant dry weight variations of cellulose, hemicellulose and fat contents were observed from day 0 to 12.

Crystallization and preliminary X-ray crystallographic analysis of the small subunit of the heterodimeric laccase POXA3b from Pleurotus ostreatus

Science.gov (United States)

Ferraroni, Marta; Scozzafava, Andrea; Ullah, Sana; Tron, Thierry; Piscitelli, Alessandra; Sannia, Giovanni

2014-01-01

Laccases are multicopper oxidases of great biotechnological potential. While laccases are generally monomeric glycoproteins, the white-rot fungus Pleurotus ostreatus produces two closely related heterodimeric isoenzymes composed of a large subunit, homologous to the other fungal laccases, and a small subunit. The sequence of the small subunit does not show significant homology to any other protein or domain of known function and consequently its function is unknown. The highest similarity to proteins of known structure is to a putative enoyl-CoA hydratase/isomerase from Acinetobacter baumannii, which shows an identity of 27.8%. Diffraction-quality crystals of the small subunit of the heterodimeric laccase POXA3b (sPOXA3b) from P. ostreatus were obtained using the sitting-drop vapour-diffusion method at 294 K from a solution consisting of 1.8 M sodium formate, 0.1 M Tris–HCl pH 8.5. The crystals belonged to the tetragonal space group P41212 or P43212, with unit-cell parameters a = 126.6, c = 53.9 Å. The asymmetric unit contains two molecules related by a noncrystallographic twofold axis. A complete data set extending to a maximum resolution of 2.5 Å was collected at 100 K using a wavelength of 1.140 Å. PMID:24419623

Author Details - African Journals Online

African Journals Online (AJOL)

Shan, L. Vol 6, No 23 (2007) - Articles Seasonal and spatial root biomass and water use efficiency of four forage legumes in semiarid northwest China Abstract PDF · Vol 10, No 46 (2011) - Articles Extension of the shelf-life of fresh oyster mushrooms (Pleurotus ostreatus) by modified atmosphere packaging with chemical ...

Rare earth elements concentration in mushroom cultivation substrates affects the production process and fruit-bodies content of Pleurotus ostreatus and Cyclocybe cylindracea.

Science.gov (United States)

Koutrotsios, Georgios; Danezis, Georgios P; Georgiou, Constantinos A; Zervakis, Georgios I

2018-04-20

Concentrations of 16 rare earth elements (REEs) and two actinides were determined for the first time both in cultivated mushrooms and in their production substrates by inductively coupled plasma mass spectroscopy. Moreover, the effect of REEs on cultivation parameters and composition of the final product was assessed, together with their potential use for authentication purposes. The concentrations of REEs varied greatly among seven cultivation substrates and correlated with measurements in Cyclocybe cylindracea mushrooms; no such correlation was established in Pleurotus ostreatus. Reduction of hemicellulose, cellulose, and lignin in substrates during P. ostreatus cultivation was positively correlated with REE concentrations, which also affected the production performance depending on the species examined. In all cases, a negative correlation was established between bioconcentration factors (BCF) in mushrooms and REE content in substrates, while the effect of substrate composition on BCF values varied according to the element studied. The estimated daily intake values of REEs through mushroom consumption was at much lower levels than those reported as potentially harmful for human health. The content of REEs in cultivation substrates and in mushrooms revealed that the bioaccumulation of elements differed in each fungus. The nature/origin of substrates seemed to affect the concentration of REEs in mushrooms to a considerable extent. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

Preliminary study of platinum accumulation in the fruitbodies of a model fungal species: king oyster mushroom (Pleurotus eryngii)

International Nuclear Information System (INIS)

Urban, P.L.; Bazala, M.A.; Bystrzejewska-Piotrowska, G.; Pianka, D.; Steborowski, R.; Asztemborska, M.; Kowalska, J.; Manjon, J.L.; Kuthan, R.T.

2005-01-01

A model species of saprophytic fungus, king oyster mushroom (Pleurotus eryngii), was cultivated on barley substrate supplied with [Pt(NH 3 ) 4 ](NO 3 ) 2 , under well defined conditions. The samples of the collected fruiting bodies were digested and analyzed for total platinum content by means of ICP-MS. The results proved that platinum is not accumulated in the fruitbodies of Pleurotus eryngii for a wide range of Pt concentrations in the culture substrate (100-1000 ppb Pt in 50 ml of water solution added to ca. 450 g of hydrated barley seeds per container). Observable levels of Pt were only found in the fruitbodies obtained from the medium contaminated with 10000 ppb (10 ppm) platinum solution. This demonstrates significant difference in the effectiveness of platinum extraction in fungi and plants, which are capable to accumulate platinum even when supplied at lower concentration (<500 ppb). It also shows different physiological pathways of platinum and other elements which are easily accumulated in the fruitbodies of the same species. (author)

VALOR NUTRICIONAL DEL HENO DE TRANSVALA INOCULADO CON EL HONGO Pleurotus ostreatus sp

Directory of Open Access Journals (Sweden)

Rodolfo WingChing-Jones

2009-01-01

Full Text Available Se analizó el valor nutricional del heno de Transvala utilizado en la producción del hongo comestible Pleurotus ostreatus. El heno fue analizado antes de inocular el hongo y después de la cosecha. Se determinó: materia seca (MS, proteína cruda (PC, extracto etéreo (EE, ceniza (Ce, digestibilidad in vitro de la MS (DIVMS, carbohidratos no fibrosos (CNF, fibra detergente neutro (FDN, fibra detergente ácido (FDA, lignina, nitrógeno ligado a la fibra detergente neutro (N-FDN y a la fibra detergente ácida (N-FDA, nutrimentos digestibles totales (NDT (1X, energía digestible (ED, energía metabolizable (EM, energía neta de lactancia (ENl, energía de mantenimiento (ENm y energía neta de ganancia (ENg. Sobresalen niveles bajos de PC, DIVMS y NDT; y valores altos de lignina, FDN y FDA. El contenido de MS, FDN, hemicelulosa (He, lignina, CNF y EE presentó diferencias significativas, debidas al crecimiento del hongo. La variación en calidad en estas variables fue de (- 48,75%, (- 24,76%, (- 80,22%, (- 27,94%, (+ 51,52% y (- 26,13%, respectivamente. La mejoría en la calidad nutricional del heno, después de la cosecha del hongo, no es tan significativa como para cambiar la perspectiva en su uso dentro de la ración total de rumiantes, por lo que el beneficio del heno se basa más en aspectos físicos que nutricionales.

An examination of antibacterial and antifungal properties of constituents of Shiitake (Lentinula edodes) and oyster (Pleurotus ostreatus) mushrooms.

Science.gov (United States)

Hearst, Rachel; Nelson, David; McCollum, Graham; Millar, B Cherie; Maeda, Yasunori; Goldsmith, Colin E; Rooney, Paul J; Loughrey, Anne; Rao, J R; Moore, John E

2009-02-01

Antibiotic agents have been in widespread and largely effective therapeutic use since their discovery in the 20th century. However, the emergence of multi-drug resistant pathogens now presents an increasing global challenge to both human and veterinary medicine. It is now widely acknowledged that there is a need to develop novel antimicrobial agents to minimize the threat of further antimicrobial resistance. With this in mind, a study was undertaken to examine the antimicrobial properties of aqueous extracts of 'exotic' Shiitake and Oyster mushrooms on a range of environmental and clinically important microorganisms. Several batches of Shiitake and oyster mushrooms were purchased fresh from a local supermarket and underwent aqueous extraction of potential antimicrobial components. After reconstitution, aqueous extracts were tested qualitatively against a panel of 29 bacterial and 10 fungal pathogens, for the demonstration of microbial inhibition. Our data quantitatively showed that Shiitake mushroom extract had extensive antimicrobial activity against 85% of the organisms it was tested on, including 50% of the yeast and mould species in the trial. This compared favourably with the results from both the Positive control (Ciprofloxacin) and Oyster mushroom, in terms of the number of species inhibited by the activity of the metabolite(s) inherent to the Shiitake mushroom. This small scale study shows the potential antimicrobial effects of Shitake extracts, however further work to isolate and identify the active compound(s) now requires to be undertaken. Once these have been identified, suitable pharmaceutical delivery systems should be explored to allow concentrated extracts to be prepared and delivered optimally, rather than crude ingestion of raw material, which could promote further bacterial resistance.

Cambios en las propiedades físicas de un Inceptisol por la adición de substrato degradado con el hongo Pleurotus ostreatus Changes on physical properties of an Inceptisol influence of the degraded substrate by Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Herminio Paredes Valencia

2010-01-01

Full Text Available Para evaluar el efecto del substrato orgánico (aserrín de madera y 'estopa' de coco enriquecido con 40% de volúmenes iguales de hojas de plátano (Mussa sp., kudzú tropical (Pueraria phaseoloides y botón de oro (Tithonia diversifolia degradado por el hongo Pleurotus ostreatus (SDP sobre algunas propiedades físicas de un Inceptisol de Buenaventura, Valle del Cauca, Colombia, se incorporaron dosis crecientes de éste (0, 1.25, 2.5, 5, 10, 20, 40 y 80 g/kg en el suelo tamizado en malla de 2 mm. La mezcla se utilizó en materos sembrados con maíz durante 4 meses, momento en el cual se tomaron muestras para determinar los cambios en las propiedades del suelo. Se usó un diseño completamente al azar, con ocho tratamientos, cuatro repeticiones y dos profundidades de muestreo. La correlación entre la cantidad de SDP incorporado y la mayoría de propiedades físicas evaluadas fue altamente significativa. Comparadas con el control (sin SDP, las dosis de 20, 40 y 80 g/kg redujeron significativamente la densidad aparente del suelo, al tiempo que incrementaron la porosidad total, la macroporosidad, la retención de humedad a bajas tensiones y el contenido de materia orgánica. En las dosis de 40 y 80 g/kg se observó una reducción significativa de la susceptibilidad a la compactación, lo mismo que un incremento en el diámetro promedio ponderado de los agregados estables al agua. Los incrementos de la conductividad hidráulica saturada y la permeabilidad al aire no fueron significativos en relación con el control.To evaluate the effect of the degraded substrate by the mushroom Pleurotus ostreatus (DSP on some physical properties of an Inceptisol from Buenaventura, Colombia, different doses of DSP (0, 1.25, 2.5, 5, 10, 20, 40 and 80 g.kg-1 were incorporated in 2 mm-sieved soil. The mixtures were placed in pots and planted with maize during four months in a green house until the sampling time. Complete randomized design, with eight treatments, four

Effect of Pleurotus ostreatus fermentation on cocoa pod husk ...

African Journals Online (AJOL)

Cocoa pod husk (CPH) is a major agro-industrial residue in Ghana with a potential value as a low-cost unconventional feedstuff for livestock. However, its effective use is limited by poor nutrient composition, mainly due to its high lignocellulose or fibre and also low protein levels. White–rot fungi such as Pleurotus species ...

Oyster mushroom (Pleurotus spp.) cultivation technique using re ...

African Journals Online (AJOL)

SARAH

2014-08-31

Aug 31, 2014 ... using re-usable substrate containers and comparison of ... oyster mushrooms in combination with other vegetables complements availability of various essential ..... higher than from oyster mushrooms produced from any.

PRODUKTIVITAS JAMUR TIRAM PUTIH (Pleurotus ostreatus PADA MEDIA LIMBAH SEKAM PADI DAN DAUN PISANG KERING SEBAGAI MEDIA ALTERNATIF

Directory of Open Access Journals (Sweden)

Suparti Suparti

2015-08-01

Full Text Available Jamur tiram putih (Pleurotus ostreatus merupakan jenis jamur pangan yang banyak dikonsumsi mengandung protein 27%. Kandungan protein pada jamur tiram putih dapat dipengaruhi oleh komposisi media tanam seperti selulosa, hemiselulosa, lignin dan nutrisi tambahan. Sekam padi dan daun pisang kering merupakan salah satu limbah organik yang dapat digunakan sebagai media alternatif untuk meningkatkan produktivitas jamur tiram putih.Tujuan penelitian ini adalah untuk mengetahui produktivitas jamur tiram putih yang ditumbuhkan pada media  limbah sekam padi dan daun pisang kering sebagai media alternatif. Jenis penelitian eksperimen dengan metode rancangan acak lengkap (RAL dua faktor yaitu faktor 1 penambahan sekam padi dan faktor 2 daun pisang kering (0%, 5%, 10%, 15%, masing-masing  dengan empat perlakuan dan dua kali ulangan.  Hasil analisis data menunjukkan bahwa penambahan sekam padi dan daun pisang kering  15% (S3T3 memberikan pengaruh nyata terhadap lama penyebaran miselium, jumlah badan buah dan berat segar jamur tiram putih.Perlakuan yang paling baik untuk pertumbuhan jamur pada perlakuan S3T3, dengan rata-rata lama penyebaran miselium 25,5 hari, jumlah badan buah 64,5 buah dan berat segar yang dihasilkan 402,5. Hasil data tersebut lebih tinggi dibandingkan dengan perlakuan yang lain.

Effect of Agroforestry Residues Partially Biodegraded by Pleurotus Ostreatus (Pleurotaceae on Tomato Seedlings Development

Directory of Open Access Journals (Sweden)

Jorge Alberto Luna Fontalvo

2013-05-01

Se evaluó el desarrollo de plántulas de tomate (planta bioindicadora de toxicidad en suelos con aserrín y cascarilla de arroz parcialmente biodegradados por Pleurotus Ostreatus bajo condiciones de invernadero. Se determinaron los componentes orgánicos (carbono, celulosa, lignina, extraíbles y materia orgánica e inorgánicos (nitrógeno, fósforo y pH antes y después de inocular el hongo en el aserrín y la cascarilla de arroz. Se realizaron mezclas de cada sustrato con un suelo pobre en nutrientes en proporciones iguales (1:1 y se les determinó el porcentaje de humedad. El experimento estuvo constituido por un diseño completamente aleatorio, con dos grupos de seis tratamientos para cada sustrato, a los 30 días se determinaron los parámetros de crecimiento y desarrollo de las plántulas. Los sustratos biodegradados reportaron bajo contenido de C, N y P. El tratamiento aserrín biodegradado + suelo fertilizado (ASB + SF, presentó los mejores resultados en número de hojas (12,9, altura de las plantas (25,94 cm, longitud radical (5,92 cm, peso seco (0,138 g y peso fresco (1,012 g. El sustrato ASB + SF puede funcionar como sustrato favorable para el cultivo de plántulas de tomate debido a que aporta los nutrientes necesarios para el buen crecimiento de las plántulas. En la cascarilla de arroz las plantas no crecieron adecuadamente para conseguir ser trasplantadas.

Bioconversion of lignocellulosic residues by Agrocybe cylindracea and Pleurotus ostreatus mushroom fungi--assessment of their effect on the final product and spent substrate properties.

Science.gov (United States)

Koutrotsios, Georgios; Mountzouris, Konstantinos C; Chatzipavlidis, Iordanis; Zervakis, Georgios I

2014-10-15

Nine agro-industrial and forestry by-products were subjected to solid-state fermentation by Agrocybe cylindracea and Pleurotus ostreatus, and the process and end-products were comparatively evaluated. Grape marc waste plus cotton gin trash was the best performing medium for both fungi, while substrate composition had a marked effect on most cultivation parameters. Biological efficiency was positively correlated with nitrogen, lignin and ash, and negatively with hemicelluloses and carbohydrate content of substrates. Spent substrates demonstrated high reductions in hemicelluloses and cellulose in contrast to lignin; fibre fractions were correlated with nitrogen, fat and ash content of initial materials, while residual mycelial biomass was affected by mushroom productivity. Mushroom proximate analysis revealed significant variations of constituents depending on the substrate. Crude protein and fat were correlated with substrates nitrogen for both species. Alternative cultivation substrates of high potential are proposed, while spent material could be exploited as animal feed due to its upgraded properties. Copyright © 2014 Elsevier Ltd. All rights reserved.

Diversity Profile and Dynamics of Peptaibols Produced by Green Mould Trichoderma Species in Interactions with Their Hosts Agaricus bisporus and Pleurotus ostreatus.

Science.gov (United States)

Marik, Tamás; Urbán, Péter; Tyagi, Chetna; Szekeres, András; Leitgeb, Balázs; Vágvölgyi, Máté; Manczinger, László; Druzhinina, Irina S; Vágvölgyi, Csaba; Kredics, László

2017-06-01

Certain Trichoderma species are causing serious losses in mushroom production worldwide. Trichoderma aggressivum and Trichoderma pleuroti are among the major causal agents of the green mould diseases affecting Agaricus bisporus and Pleurotus ostreatus, respectively. The genus Trichoderma is well-known for the production of bioactive secondary metabolites, including peptaibols, which are short, linear peptides containing unusual amino acid residues and being synthesised via non-ribosomal peptide synthetases (NRPSs). The aim of this study was to get more insight into the peptaibol production of T. aggressivum and T. pleuroti. HPLC/MS-based methods revealed the production of peptaibols closely related to hypomurocins B by T. aggressivum, while tripleurins representing a new group of 18-residue peptaibols were identified in T. pleuroti. Putative NRPS genes enabling the biosynthesis of the detected peptaibols could be found in the genomes of both Trichoderma species. In vitro experiments revealed that peptaibols are potential growth inhibitors of mushroom mycelia, and that the host mushrooms may have an influence on the peptaibol profiles of green mould agents. © 2017 Wiley-VHCA AG, Zurich, Switzerland.

Molecular and Antibacterial Profile of Edible Oyster Mushrooms ...

African Journals Online (AJOL)

2012r

2014-09-24

Sep 24, 2014 ... Phenol/Chloroform DNA extraction protocol and the DNA was ... DNA from oyster mushroom fermentation broth, mycelia or fruiting bodies. .... Sample preparation: The different strains of Pleurotus were obtained in test- tubes.

Growth and fruit body formation of Pleurotus ostreatus on media supplemented with inorganic selenium

Directory of Open Access Journals (Sweden)

Savić Milena D.

2009-01-01

Full Text Available Selenium is a trace mineral chemically related to sulfur and tellurium. In the body selenium combines with protein molecules to form selenoproteins and it is distributed in low concentrations and unequally in air, soil and water all over the world. Edible mushrooms are known to be selenium accumulators. Since mushrooms contain relatively high protein levels, and they can accumulate large amounts of selenium, it is reasonable to expect that selenium could be incorporated into proteins. The growth of mycelia and fruit body formation of different medicinal mushroom strains of Pleurotus ostreatus (Hk-35 and P70 over the wide range of concentrations of inorganic form of selenium were examined. Mushrooms were cultivated on agar base media and on substrates based on sawdust. Vegetative growths of mycelium were measured as colony diameter in pure cultures supplemented with inorganic form of Se supplements, prepared as Na2SeO4 and Na2SeO3 in concentrations of: 1, 10, 25, 50, 75, 100 and 150 mg/l. Inorganic form of Se supplements, showed stimulation effects (in concentration of 1-50 mg/l and toxic effects in higher concentration. On the standard industrial sawdust based substrate, supplemented with 100 mg/kg Na2SeO4 and Na2SeO3, accumulation of Se in fruit bodies was determined by the method of flameless atomic absorption spectrophotometer. The readings were performed on Varian SpectrAA-10 spectrophotometer equipped with VGA-76. Se as Na2SeO4 and Na2SeO3 was effectively taken up from substrates and accumulated in fruit bodies. Mushrooms accumulated selenium between 120 and 250 mg/kg dry weight. In mushrooms cultivated without Se supplement, Se contents were only about 1 mg/kg and in substrate about 0.1 mg/kg.

Evaluación del crecimiento y producción de biomasa de dos cepas del género Pleurotus spp., cultivadas en un medio agar con diferentes sustratos

Directory of Open Access Journals (Sweden)

Carol Daniela Coello-Loor

2017-12-01

Full Text Available La velocidad de crecimiento radial (VCR (mm.h-1 y la producción de biomasa (PB (g.g-1 de sustrato seco son técnicas que puedan establecer el grado de adaptación y desarrollo de los hongos del género Pleurotus spp., a distintos sustratos que podrían emplearse en una fermentación en medio sólido. Las especies fueron Pleurotus sapidus (Ps y Pleurotus ostreatus IE8 (Po. El medio de cultivo sintético empleado fue el papa dextrosa agar (PDA, con un pH que va de 5.6 a 5.9, ideal para el crecimiento de hongos, tiene todos los componentes nutritivos, y ligera acidez que logran la inhibición del desarrollo de bacterias; diluido en 4 diferentes soluciones preparadas con los materiales residuales (solución cascarilla de arroz CaPDA, solución cáscara de maracuyá CmPDA, solución mezcla 50% Cascarilla de arroz+50% Cáscara de maracuyá CaCmPDA y agua destilada+PDA con el propósito de observar el crecimiento radial cada 24 horas y la producción de biomasa fúngica de estos hongos lignocelulósicos por su periodo de incubación y la adaptación a nivel in vitro. Los tratamientos que presentaron mejor comportamiento VCR fueron el PoCaPDA (0.569 y el PoCaCmPDA (0.549; la cepa que reporto valores más altos en VCR y PB fue el Pleurotus ostreatus y el mejor medio de cultivo fue el CaPDA, en ambas variables; mientras, la mayor producción de biomasa fue en Pleurotus sapidus en CaPDA (0.1727 y el Pleurotus ostreatus IE8 en CmPDA (0.1722, CaPDA (0.1706 y PDA (0.1694.

Biotransformation of 1,8-cineole by solid-state fermentation of Eucalyptus waste from the essential oil industry using Pleurotus ostreatus and Favolus tenuiculus.

Science.gov (United States)

Omarini, Alejandra; Dambolena, José Sebastián; Lucini, Enrique; Jaramillo Mejía, Santiago; Albertó, Edgardo; Zygadlo, Julio A

2016-03-01

Biotechnological conversion of low-cost agro-industrial by-products, such as industrial waste or terpenes from the distillation of essential oils from plants into more valuable oxygenated derivatives, can be achieved by using microbial cells or enzymes. In Argentina, the essential oil industry produces several tons of waste each year that could be used as raw materials in the production of industrially relevant and value-added compounds. In this study, 1,8-cineole, one of the components remaining in the spent leaves of the Eucalyptus cinerea waste, was transformed by solid-state fermentation (SSF) using the two edible mushrooms Pleurotus ostreatus and Favolus tenuiculus. As a result, two new oxygenated derivatives of 1,8-cineole were identified: 1,3,3-trimethyl-2-oxabicyclo [2.2.2]octan-6-ol and 1,3,3-trimethyl-2-oxabicyclo [2.2.2]octan-6-one. Additionally, changes in the relative percentages of other aroma compounds present in the substrate were observed during SSF. Both fungal strains have the ability to produce aroma compounds with potential applications in the food and pharmaceutical industries.

Genetic diversity of edible mushroom pleurotus spp. revealed by randomly amplified polymorphic dna fingerprinting

International Nuclear Information System (INIS)

Khan, N. A.; Awan, F. S.; Khan, A. I.; Waseem, M.

2017-01-01

The Oyster mushroom (Pleurotus) cultivation is a profitable agribusiness and having high significance due its nutritive and therapeutic value. Due to deficient knowledge on Pleurotus mushroom genetics seven strains of Oyster mushroom, two local and five exotic were studied for their genetic diversity through RAPD markers. It was clear from similarity matrix that similarity index ranges from 45 to 72%. The cluster analysis of combined data set of all the markers resulted in three major clades, while isolate P-17 remains ungrouped and shown to be the most diverse strain of the seven. During amplification of genomic DNA yielded 70 fragments that could be scored, of which 41 were polymorphic, with an average of 2.73 polymorphic fragments per primer. Number of amplified fragments with random primers ranged from three to six. Polymorphism ranged from 0% to 83.33%, with an overall 58% polymorphism. The allele frequency of RAPD primers ranged from 0.71 to 1.00 while the polymorphic information content highest for the primer GL-C-20 (0.29) followed by the primers GL A-20 and GL C-16 that is zero, indicating medium level of polymorphism among the strains of Oyster mushroom. The objective of the study was to characterize Pleurotus strains collected from different origins and to find out the variability at molecular level. (author)

Molecular identification and artificial cultivation of a wild isolate of oyster mushroom in Albania

Directory of Open Access Journals (Sweden)

Jordan Merkuri

2016-03-01

Full Text Available Basidiomata of a wild mushroom macroscopically recognised as Pleurotus ostreatus were observed on an oak trunk in a mixed wood of northern Albania. Pure cultures of the fungus were then obtained on potato-dextrose-agar medium. Molecular analyses of genomic DNA of the fungus confirmed its identification. The rDNA ITS region nucleotide sequence of the studied Pleurotacea matched at 99% those of two P. ostreatus strains already present in NCBI GenBank database. The rDNA ITS nucelotide sequences of two pure cultures of the Albanian P. ostreatus were deposited in EMBL database under the accession numbers LN849458 and LN849459. One of the fungus isolates was subsequently cultivated under protected and semi-natural conditions. Productivity and biological efficiency of the Albanian P. ostreatus ranged from about 10% to 16% and from 33 to 53.33%, respectively. This seems to be the first report on the artificial cultivation of P. ostreatus in Albania and could have, in the next future, a high economic impact on development and diffusion of this important edible mushroom over the country.

Yield and size of oyster mushroom grown on rice/wheat straw basal substrate supplemented with cotton seed hull.

Science.gov (United States)

Yang, Wenjie; Guo, Fengling; Wan, Zhengjie

2013-10-01

Oyster mushroom (Pleurotus ostreatus) was cultivated on rice straw basal substrate, wheat straw basal substrate, cotton seed hull basal substrate, and wheat straw or rice straw supplemented with different proportions (15%, 30%, and 45% in rice straw substrate, 20%, 30%, and 40% in wheat straw substrate) of cotton seed hull to find a cost effective substrate. The effect of autoclaved sterilized and non-sterilized substrate on growth and yield of oyster mushroom was also examined. Results indicated that for both sterilized substrate and non-sterilized substrate, oyster mushroom on rice straw and wheat basal substrate have faster mycelial growth rate, comparatively poor surface mycelial density, shorter total colonization period and days from bag opening to primordia formation, lower yield and biological efficiency, lower mushroom weight, longer stipe length and smaller cap diameter than that on cotton seed hull basal substrate. The addition of cotton seed hull to rice straw and wheat straw substrate slowed spawn running, primordial development and fruit body formation. However, increasing the amount of cotton seed hull can increase the uniformity and white of mycelium, yield and biological efficiency, and increase mushroom weight, enlarge cap diameter and shorten stipe length. Compared to the sterilized substrate, the non-sterilized substrate had comparatively higher mycelial growth rate, shorter total colonization period and days from bag opening to primordia formation. However, the non-sterilized substrate did not gave significantly higher mushroom yield and biological efficiency than the sterilized substrate, but some undesirable characteristics, i.e. smaller mushroom cap diameter and relatively long stipe length.

Cultivation of oyster mushroom ( Pleurotus spp.) on palm oil ...

African Journals Online (AJOL)

Oyster mushroom is a popular mushroom due to its nutritional, medicinal and potential commercial value. In Malaysia, the fungus is currently cultivated on sawdust and rice husk. In this study, the efficiency of cultivating oyster mushroom was assessed using palm oil mesocarp fibre as a substrate. The experiment consisted ...

Performance of oyster mushroom (Pleurotus ostreatus) in different ...

African Journals Online (AJOL)

USER

2012-05-08

May 8, 2012 ... These mixtures were compressed by pressing down with bottle in transparent poly bags ... The bags were then opened after two weeks and left open for mushroom ..... results of this work are within the range they reported.The.

An environmentally friendly and cost effective technique for the commercial cultivation of oyster mushroom [Pleurotus florida (Mont.) Singer].

Science.gov (United States)

Panjikkaran, Seeja Thomachan; Mathew, Deepu

2013-03-15

The existing protocol for the cultivation of oyster mushroom (Pleurotus florida) in polyethylene bags leads to environmental pollution amounting to 18 g of polyethylene per 450 g of mushroom, which is the average biological efficiency achieved from a bag. Thus the projected annual global pollution amounts to 2 million tones, corresponding to the production of 48 million tones. Experiments were conducted at Kerala Agricultural University, India, to formulate an oyster mushroom cultivation strategy that reduces this pollution level. Pooled results of experiments at the institute's and farmers' units have shown that reusable plastic buckets having perforations of 1.5 cm × 1.0 cm throughout the side walls could be used to substitute polyethylene bags, while following the standard cultivation protocols. Cultivation in perforated buckets has recorded a biological efficiency of 435.69 ± 56.75 g in 47.07 ± 5.22 days against 459.11 ± 53.52 g in 38.05 ± 4.54 days in polyethylene bags. The rate of contamination in buckets was significantly lower than that in bags: 9.28 ± 2.12 and 12.60 ± 3.73% respectively. Reusable plastic buckets with perforations on the side walls could be used to substitute the conventional polyethylene bags in oyster mushroom cultivation, with no significant difference in yield. Losses due to slight increase in crop duration in buckets will be compensated with a lower rate of contamination. For a unit having a daily output of 100 kg, it was estimated that during 10 years of permanent cultivation following this technique, the cost of cultivation could be reduced to one-tenth and the environmental pollution reduced by at least 730 000 non-degradable polyethylene bags. © 2012 Society of Chemical Industry.

Ligninolytic peroxidase genes in the oyster mushroom genome: heterologous expression, molecular structure, catalytic and stability properties, and lignin-degrading ability

Science.gov (United States)

Elena Fernández-Fueyo; Francisco J Ruiz-Dueñas; María Jesús Martinez; Antonio Romero; Kenneth E Hammel; Francisco Javier Medrano; Angel T. Martínez

2014-01-01

Background: The genome of Pleurotus ostreatus, an important edible mushroom and a model ligninolytic organism of interest in lignocellulose biorefineries due to its ability to delignify agricultural wastes, was sequenced with the purpose of identifying and characterizing the enzymes responsible for lignin degradation. ...

Characterization of a novel single-stranded RNA mycovirus in pleurotus ostreatus

International Nuclear Information System (INIS)

Yu, Hyun Jae; Lim, Dongbin; Lee, Hyun-Sook

2003-01-01

A mycovirus, named oyster mushroom spherical virus (OMSV), was isolated from cultivated oyster mushrooms with a severe epidemic of oyster mushroom Die-back disease. OMSV was a 27-nm spherical virus encapsidating a single-stranded RNA (ssRNA) of 5.784 kb with a coat protein of approximately 28.5 kDa. The nucleotide sequence of the virus revealed that its genomic RNA was positive strand, containing 5784 bases with seven open reading frames (ORF). ORF1 had the motifs of RNA-dependent RNA polymerases (RdRp) and helicase. ORF2 encoded a coat protein. ORF3 to 7 could encode putative polypeptides of approximately 12, 12.5, 21, 14.5, and 23 kDa, respectively, but none of them showed significant similarity to any other known polypeptides. The 5' end of the viral RNA was uncapped and the 3' end was polyadenylated with 74 bases. Genomic structure and organization and the derived amino acid sequence of RdRp and helicase domain were similar to those of tymoviruses, a plant virus group

Anti-inflammatory activity of edible oyster mushroom is mediated through the inhibition of NF-κB and AP-1 signaling

Directory of Open Access Journals (Sweden)

Simon James

2011-05-01

Full Text Available Abstract Background Mushrooms are well recognized for their culinary properties as well as for their potency to enhance immune response. In the present study, we evaluated anti-inflammatory properties of an edible oyster mushroom (Pleurotus ostreatus in vitro and in vivo. Methods RAW264.7 murine macrophage cell line and murine splenocytes were incubated with the oyster mushroom concentrate (OMC, 0-100 μg/ml in the absence or presence of lipopolysacharide (LPS or concanavalin A (ConA, respectively. Cell proliferation was determined by MTT assay. Expression of cytokines and proteins was measured by ELISA assay and Western blot analysis, respectively. DNA-binding activity was assayed by the gel-shift analysis. Inflammation in mice was induced by intraperitoneal injection of LPS. Results OMC suppressed LPS-induced secretion of tumor necrosis factor-α (TNF-α, interleukin-6 (IL-6, and IL-12p40 from RAW264.7 macrophages. OMC inhibited LPS-induced production of prostaglandin E2 (PGE2 and nitric oxide (NO through the down-regulation of expression of COX-2 and iNOS, respectively. OMC also inhibited LPS-dependent DNA-binding activity of AP-1 and NF-κB in RAW264.7 cells. Oral administration of OMC markedly suppressed secretion of TNF-α and IL-6 in mice challenged with LPS in vivo. Anti-inflammatory activity of OMC was confirmed by the inhibition of proliferation and secretion of interferon-γ (IFN-γ, IL-2, and IL-6 from concanavalin A (ConA-stimulated mouse splenocytes. Conclusions Our study suggests that oyster mushroom possesses anti-inflammatory activities and could be considered a dietary agent against inflammation. The health benefits of the oyster mushroom warrant further clinical studies.

PROSES PENGELOLAHAN MENINGKATKAN AKTIVITAS HIPOLIPIDEMIK JAMUR TIRAM (PLEUROTUS OSTREATUS PADA TIKUS (RATTUS NORVEGICUS SPRGUE-DAWLEY HIPERKOLESTEROL

Directory of Open Access Journals (Sweden)

Eni Harmayani, Deera Army Pramana, Sri Anggrahini dan Sutikarini

2012-12-01

Full Text Available Oyster mushroom is considered to have hypocholesterolemic and hypolipidemic activities. Therefore, it is classifiedas functional food. Prior to serving and consumption, oyster mushroom can be processed in various ways. Thisresearch studied the effect of three kinds of processing commonly used in cooking oyster mushroom; boiling,frying, and roasting. Thirty Sprague-Dawley male rats, 8 weeks old, were acclimated to laboratory condition,and then induced with high lipid diet. The rats were divided into five experiment groups; high-lipid diet (K,high-lipid diet + raw oyster mushroom (M, high-lipid diet + fried oyster mushroom (G, high-lipid diet + roastedoyster mushroom (P, and high-lipid diet + boiled oyster mushroom (R. Blood samples were obtained from orbitalplexus after acclimation, hypercholesterolemic induction, and 21 days of feeding. The blood serum was examinedfor total cholesterol (TC, triglyceride (TG, low-density lipoprotein cholesterol (LDL-c, dan high-densitylipoprotein cholesterol (HDL-c. The result showed that cooked oyster mushroom had better hypocholesterolemicand hypolipidemic activity than raw oyster mushroom. Among the three, the roasted oyster mushroom reduced thetotal cholesterol the most, while boiled oyster mushroom reduced triglyceride the most.

Molecular Identification and Phylogenetic Relationships of Pleurotus spp. Diversity in Malaysia by ITS Marker

International Nuclear Information System (INIS)

Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.

2016-01-01

Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)

Electrochemistry Combined with LC-HRMS: Elucidating Transformation Products of the Recalcitrant Pharmaceutical Compound Carbamazepine Generated by the White-Rot Fungus Pleurotus ostreatus.

Science.gov (United States)

Seiwert, Bettina; Golan-Rozen, Naama; Weidauer, Cindy; Riemenschneider, Christina; Chefetz, Benny; Hadar, Yitzhak; Reemtsma, Thorsten

2015-10-20

Transformation products (TPs) of environmental pollutants must be identified to understand biodegradation processes and reaction mechanisms and to assess the efficiency of treatment processes. The combination of oxidation by an electrochemical cell (EC) with analysis by liquid chromatography-high-resolution mass spectrometry (LC-HRMS) is a rapid approach for the determination and identification of TPs generated by natural microbial processes. Electrochemically generated TPs of the recalcitrant pharmaceutical carbamazepine (CBZ) were used for a target screening for TPs formed by the white-rot fungus Pleurotus ostreatus. EC with LC-HRMS facilitates detection and identification of TPs because the product spectrum is not superimposed with biogenic metabolites and elevated substrate concentrations can be used. A group of 10 TPs formed in the microbial process were detected by target screening for molecular ions, and another 4 were detected by screening on the basis of characteristic fragment ions. Three of these TPs have never been reported before. For CBZ, EC with LC-HRMS was found to be more effective than software tools in defining targets for the screening and faster than nontarget screening alone in TP identification. EC with LC-HRMS may be used to feed MS databases with spectra of possible TPs of larger numbers of environmental contaminants for an efficient target screening.

Extraction and Application of Laccases from Shimeji Mushrooms (Pleurotus ostreatus Residues in Decolourisation of Reactive Dyes and a Comparative Study Using Commercial Laccase from Aspergillus oryzae

Directory of Open Access Journals (Sweden)

Ricardo Sposina S. Teixeira

2010-01-01

Full Text Available Oxidases are able to degrade organic pollutants; however, high costs associated with biocatalysts production still hinder their use in environmental biocatalysis. Our study compared the action of a commercial laccase from Aspergillus oryzae and a rich extract from Pleurotus ostreatus cultivation residues in decolourisation of reactive dyes: Drimaren Blue X-3LR (DMBLR, Drimaren Blue X-BLN (DMBBLN, Drimaren Rubinol X-3LR (DMR, and Drimaren Blue C-R (RBBR. The colour removal was evaluated by considering dye concentration, reaction time, absence or presence of the mediator ABTS (2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid, and the source of laccase. The presence of ABTS was essential for decolourisation of DMR (80–90%, 1 h and RBBR (80–90%, 24 h with both laccases. The use of ABTS was not necessary in reactions containing DMBLR (85–97%, 1 h and DMBBLN (63–84%, 24 h. The decolourisation of DMBBLN by commercial laccase showed levels near 60% while the crude extract presented 80% in 24 h.

Cultivo e características nutricionais de Pleurotus em substrato pasteurizado Cultivation and nutritional characteristics of Pleurotus grown in pasteurized substrate

Directory of Open Access Journals (Sweden)

Eduardo Bernardi

2009-01-01

Full Text Available O objetivo deste trabalho foi avaliar a produtividade, eficiência biológica, massa fresca, composição centesimal dos cogumelos Pleurotus ostreatus (BF24 e Pleurotus sajor-caju (PSC96/03 e PSC01/06 produzidos no substrato capim-elefante (Pennisetum purpureum pasteurizado e a relação Carbono/Nitrogênio inicial e final do substrato. O substrato seco e particulado a 2 cm foi umedecido por 24 horas e pasteurizado a 100 ºC durante 30 minutos. Adicionaram-se 3% de inóculo de cada linhagem, sendo acondicionado em embalagens de polipropileno com 1 kg cada uma. Os substratos foram incubados a 26 ºC e na fase de frutificação a 23±3 ºC e umidade relativa de 75% a 90%. Na linhagem BF24 observou-se maior massa fresca (281,19g, eficiência biológica (112,46% e produtividade (28,11%. O substrato com relação Carbono:Nitrogênio inicial de 162:1 foi o de menor relação (68:1 após o cultivo do P. sajor-caju (PSC01/06. A linhagem PSC96/03 proporcionou maior teor de proteína em relação às demais, tendo a BF24 maior teor de lipídios. Quanto ao teor de carboidratos e cinzas, nas diferentes espécies e linhagens não houve diferenças significativas; já para a quantidade de fibras, as linhagens BF24 e PSC01/06 foram similares, porém superiores a PSC96/03. As duas espécies de Pleurotus podem ser cultivadas em capim-elefante pasteurizado, suprimindo o processo de compostagem.The objective of this work was to evaluate the productivity, biological efficiency, fresh matter, and centesimal composition of mushroom Pleurotus ostreatus (BF24 and Pleurotus sajor-caju (PSC96/03 and PSC01/06 grown in pasteurized elephant grass substrate (Pennisetum purpureum. It was also assessed the initial and final Carbon/Nitrogen ratio. The dried 2-cm-particulate substrate was moist for 24 hours and pasteurized at 100ºC during 30 minutes. Then, it was added 3% of inoculum of each strain. The substrate was placed into 1-kg polypropylene bags. The bags were incubated

Antioxidant, antifungal and anticancer activities of se-enriched Pleurotus spp. mycelium extracts

Directory of Open Access Journals (Sweden)

Milovanović Ivan

2014-01-01

Full Text Available The goal of this study was the evaluation of antifungal, antioxidant and anticancer potentials of Pleurotus eryngii, P. ostreatus and P. pulmonarius mycelial extracts, and the influence of mycelium enrichment with selenium on these activities. Both Se-amended and non-amended extracts showed the same or similar minimal inhibitory concentration for 14 studied micromycetes, while a fungicidal effect was not noted, contrary to ketoconazole, which had inhibitory and fungicidal effects at very low concentrations. Se-non-amended extracts exhibited antioxidant activity, especially at higher concentrations. Selenium enrichment influenced activity, its effects decreasing in P. eryngii and P. pulmonarius, while in P. ostreatus no effect was noted. The DPPH• radical scavenging capacity of the extracts was in direct correlation with their phenol and flavonoid contents. Cytotoxic activity against both HeLa and LS174 cell lines was very low compared with cis-DDP. These features suggest that mycelium should be an object of intensive studies. [Projekat Ministarstva nauke Republike Srbije, br. 173032

Cultivation Techniques and Medicinal Properties of Pleurotus spp.

Directory of Open Access Journals (Sweden)

Andrej Gregori

2007-01-01

Full Text Available The genus Pleurotus (oyster mushroom comprises some most popular edible mushrooms due to their favourable organoleptic and medicinal properties, vigorous growth and undemanding cultivation conditions. It can be cultivated on log and a wide variety of agroforestry (by-products, weeds and wastes for the production of food, feed, enzymes and medicinal compounds, or for waste degradation and detoxification. Many different techniques and substrates have been successfully utilized for mushroom cultivation and biomass production by means of solid-state and submerged liquid fermentation. However, in contrast to submerged liquid fermentation, solid-state fermentation is not often used in large scale due to severe engineering problems. Various Pleurotus species have been shown to possess a number of medicinal properties, such as antitumour, immunomodulatory, antigenotoxic, antioxidant, anti-inflammatory, hypocholesterolaemic, antihypertensive, antiplatelet-aggregating, antihyperglycaemic, antimicrobial and antiviral activities. These therapeutic activities are exhibited by extracts or isolated compounds from Pleurotus spp. fermentation broth, mycelia and fruiting bodies. In particular, polysaccharides appear to be potent antitumour and immuno-enhancing substances, besides possessing other beneficial activities. However, the biochemical mechanisms of these therapeutic activities still remain largely unknown. This review focuses on recent advances in the biotechnology of Pleurotus spp., with emphasis on the production of fruiting bodies, the production of mycelium and bioactive compounds by solid-state and submerged liquid fermentation. The medicinal properties of this mushroom are also outlined.

Radiosensitivity study and radiation effects on morphology characterization of grey oyster mushroom Pleurotus sajor-caju

Energy Technology Data Exchange (ETDEWEB)

Rashid, Rosnani Abdul; Awang, Mat Rasol; Mohamad, Azhar; Mutaat, Hassan Hamdani; Maskom, Mohd Meswan [Bioprocess Group, Agrotechnology and Biosciences Division, Malaysian Nuclear Agency, Bangi 43600, Selangor (Malaysia); Daud, Fauzi; Senafi, Sahidan [School of Bioscience and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, Bangi 43600, Selangor (Malaysia)

2014-09-03

Radiosensitive dosage and morphology characterization of irradiated grey oyster mushroom Pleurotus sajor-caju by gamma rays was investigated due to effects of irradiation. In order to establish the effect, mycelium of P. sajor-caju was irradiated by gamma rays at dose 0.1 to 8.0 kGy with dose rate 0.227 Gy sec{sup −1}. The irradiation of mycelia was carried out at the radiation facility in Malaysian Nuclear Agency. The radiosensitivity study was performed by evaluating the percentage of survival irradiated mycelia. The lethal dose of the mycelium P. sajor-caju was determined at 4.0 kGy and LD{sub 50} to be equal at 2.2 kGy. The radiation effects on morphology were evaluated based on growth rate of irradiated mycelia, mycelia types, colonization period on substrate, morphology of fruit bodies and yields. The results shown growth rate of irradiated mycelium was slightly lower than the control and decreased as the dose increased. Irradiation was found can induced the primordia formation on PDA and the BE of irradiated seed is higher than to control. The irradiation is proven to be useful for generating new varieties of mushroom with commercial value to the industry.

Evaluación de la capacidad productiva de Pleurotus ostreatus utilizando hoja de plátano deshidratada (Musa paradisiaca L., en relación con otros sustratos agrícolas

Directory of Open Access Journals (Sweden)

Omar Romero

2010-01-01

Full Text Available El objetivo de este estudio fue evaluar la producción de la cepa CP-50 de P. ostreatus en residuos de hoja de plátano deshidratada en contraste con otros sustratos agrícolas de desecho del Municipio de Tetela de Ocampo-Puebla. Las hojas de plátano (M. paradisiaca fueron colectadas en la zona de Martínez de la Torre, Veracruz- México y los demás sustratos agrícolas como paja de trigo (T. aestivum, paja de cebada (H. vulgare, pajilla de frijol (P. vulgaris y rastrojo de maíz (Z. mays se adquirieron en la región de Tetela de Ocampo, Puebla, México, para la obtención de fructificaciones en condiciones rurales. La cepa CP-50 demostró un adecuado crecimiento de aéreas miceliales sobre la hoja de plátano deshidratada con una tasa de producción de 1,5±0,1%. La mayor eficiencia biológica (EB se obtuvo en el sustrato paja de trigo, con 129,34±9,1%, la hoja de plátano deshidratada con 123,30±0,7%, y la pajilla de frijol obtuvo la EB más baja de 82,91±0,4%. Los resultados demostraron la factibilidad de cultivar la cepa CP-50 de Pleurotus ostreatus bajo condiciones rústicas en la sierra norte del estado de Puebla, al aprovechar los residuos de la cosecha de plátano de las regiones aledañas del municipio.

EPR investigation of some desiccated Ascomycota and Basidiomycota gamma-irradiated mushrooms

Energy Technology Data Exchange (ETDEWEB)

Bercu, V., E-mail: vbercu@gmail.co [University of Bucharest, Department of Atomic and Nuclear Physics, P.O. Box MG-11, 077125 Magurele (Ilfov) (Romania); Negut, C.D., E-mail: dnegut@nipne.r [University of Bucharest, Department of Atomic and Nuclear Physics, P.O. Box MG-11, 077125 Magurele (Ilfov) (Romania); Horia Hulubei National Institute for Physics and Nuclear Engineering, P.O. Box MG-6, 077125 Magurele (Ilfov) (Romania); Duliu, O.G., E-mail: duliu@b.astral.r [University of Bucharest, Department of Atomic and Nuclear Physics, P.O. Box MG-11, 077125 Magurele (Ilfov) (Romania)

2010-12-15

The suitability of the EPR spectroscopy for detection of {gamma}-irradiation in five species of dried mushroom, currently used in gastronomy: yellow morel-Morchella esculenta, (L.) Pers. (Phylum Ascomycota), button mushroom-Agaricus bisporus (J.E.Lange), Agaricus haemorrhoidarius Fr., golden chantarelle-Cantharellus cibarius Fr., as well as oyster mushroom-Pleurotus ostreatus (Jacq. ex Fr.) (Phylum Basidiomycota) is presented and discussed. Although after irradiation at doses up to 11 kGy, all specimens presented well defined EPR spectra, only A. bisporus EPR signal was enough stable to make detection possible after 18 months.

EPR investigation of some desiccated Ascomycota and Basidiomycota gamma-irradiated mushrooms

Science.gov (United States)

Bercu, V.; Negut, C. D.; Duliu, O. G.

2010-12-01

The suitability of the EPR spectroscopy for detection of γ-irradiation in five species of dried mushroom, currently used in gastronomy: yellow morel— Morchella esculenta, (L.) Pers. (Phylum Ascomycota), button mushroom— Agaricus bisporus (J.E.Lange), Agaricus haemorrhoidarius Fr., golden chantarelle— Cantharellus cibarius Fr., as well as oyster mushroom— Pleurotus ostreatus (Jacq. ex Fr.) (Phylum Basidiomycota) is presented and discussed. Although after irradiation at doses up to 11 kGy, all specimens presented well defined EPR spectra, only A. bisporus EPR signal was enough stable to make detection possible after 18 months.

EPR investigation of some desiccated Ascomycota and Basidiomycota gamma-irradiated mushrooms

International Nuclear Information System (INIS)

Bercu, V.; Negut, C.D.; Duliu, O.G.

2010-01-01

The suitability of the EPR spectroscopy for detection of γ-irradiation in five species of dried mushroom, currently used in gastronomy: yellow morel-Morchella esculenta, (L.) Pers. (Phylum Ascomycota), button mushroom-Agaricus bisporus (J.E.Lange), Agaricus haemorrhoidarius Fr., golden chantarelle-Cantharellus cibarius Fr., as well as oyster mushroom-Pleurotus ostreatus (Jacq. ex Fr.) (Phylum Basidiomycota) is presented and discussed. Although after irradiation at doses up to 11 kGy, all specimens presented well defined EPR spectra, only A. bisporus EPR signal was enough stable to make detection possible after 18 months.

Physicochemical and sensorial characteristics of noodle enriched with oyster mushroom (Pleorotus ostreatus) powder

Science.gov (United States)

Wahyono, A.; Novianti; Bakri, A.; Kasutjianingati

2018-01-01

Oyster Mushroom is a mushroom that can be used for food and medicine. It contains highly nutritious and functional substances such as statins and beta-glucan. A comprehensive evaluation of noodle-enriched with Oyster Mushroom powder has not been performed so far. In this study, we performed a comprehensive evaluation of noodle-enriched with Oyster Mushroom powder. The aim of this study was to assess the effects of enrichment of Oyster Mushroom Powder (OMP) on the quality of noodle. The quality of noodle was evaluated based on physical, chemical and sensorial characteristics. This study was done by substituting wheat flour with OMP at the level of 0 (control); 5; 7.5; 10; 12.5; and 15%. The results showed that OMP significantly affected (Pvalues of noodle.

Assessment of Genetic Diversity among Pleurotus spp. Isolates from Jordan

Directory of Open Access Journals (Sweden)

Hanan Aref Hasan

2018-04-01

Full Text Available Pleurotus is considered an important genus that belongs to the family Pleurotaceae and includes the edible King Oyster mushroom (Pleurotus eryngii. In the present study, 19 Pleurotus isolates were collected from two locations in the north of Jordan (Tell ar-Rumman and Um-Qais. The morphological characteristics among collected isolates revealed that there was a morphological similarity among the collected isolates. Nucleotide sequence analysis of the internal transcribed spacer (ITS1–5.8S rDNA–ITS4 region and 28S nuclear large subunit (nLSU in the ribosomal DNA gene of the isolated stains showed that all of them share over 98% sequence similarity with P. eryngii. Genetic diversity among the collected strains was assessed using inter simple sequence repeat (ISSR analysis using 18 different primer pairs. Using this approach, 141 out of 196 bands obtained were considered polymorphic and the highest percentage of polymorphism was observed using primer UBC827 (92.3% with an overall Polymorphism Information Content (PIC value of 70.56%. Cluster analysis showed that the Jordanian Pleurotus isolates fall into two main clades with a coefficient of similarity values ranging from 0.59 to 0.74 with a clear clustering based on collection sites. The results of the present study reveal that molecular techniques of ISSR and rDNA sequencing can greatly aid in classification and identification of Pleurotus spp. in Jordan.

Development of Novel Polymorphic EST-SSR Markers in Bailinggu (Pleurotus tuoliensis for Crossbreeding

Directory of Open Access Journals (Sweden)

Yueting Dai

2017-11-01

Full Text Available Identification of monokaryons and their mating types and discrimination of hybrid offspring are key steps for the crossbreeding of Pleurotus tuoliensis (Bailinggu. However, conventional crossbreeding methods are troublesome and time consuming. Using RNA-seq technology, we developed new expressed sequence tag-simple sequence repeat (EST-SSR markers for Bailinggu to easily and rapidly identify monokaryons and their mating types, genetic diversity and hybrid offspring. We identified 1110 potential EST-based SSR loci from a newly-sequenced Bailinggu transcriptome and then randomly selected 100 EST-SSRs for further validation. Results showed that 39, 43 and 34 novel EST-SSR markers successfully identified monokaryons from their parent dikaryons, differentiated two different mating types and discriminated F1 and F2 hybrid offspring, respectively. Furthermore, a total of 86 alleles were detected in 37 monokaryons using 18 highly informative EST-SSRs. The observed number of alleles per locus ranged from three to seven. Cluster analysis revealed that these monokaryons have a relatively high level of genetic diversity. Transfer rates of the EST-SSRs in the monokaryons of closely-related species Pleurotus eryngii var. ferulae and Pleurotus ostreatus were 72% and 64%, respectively. Therefore, our study provides new SSR markers and an efficient method to enhance the crossbreeding of Bailinggu and closely-related species.

Development of Novel Polymorphic EST-SSR Markers in Bailinggu (Pleurotus tuoliensis) for Crossbreeding

Science.gov (United States)

Dai, Yueting; Su, Wenying; Song, Bing; Li, Yu; Fu, Yongping

2017-01-01

Identification of monokaryons and their mating types and discrimination of hybrid offspring are key steps for the crossbreeding of Pleurotus tuoliensis (Bailinggu). However, conventional crossbreeding methods are troublesome and time consuming. Using RNA-seq technology, we developed new expressed sequence tag-simple sequence repeat (EST-SSR) markers for Bailinggu to easily and rapidly identify monokaryons and their mating types, genetic diversity and hybrid offspring. We identified 1110 potential EST-based SSR loci from a newly-sequenced Bailinggu transcriptome and then randomly selected 100 EST-SSRs for further validation. Results showed that 39, 43 and 34 novel EST-SSR markers successfully identified monokaryons from their parent dikaryons, differentiated two different mating types and discriminated F1 and F2 hybrid offspring, respectively. Furthermore, a total of 86 alleles were detected in 37 monokaryons using 18 highly informative EST-SSRs. The observed number of alleles per locus ranged from three to seven. Cluster analysis revealed that these monokaryons have a relatively high level of genetic diversity. Transfer rates of the EST-SSRs in the monokaryons of closely-related species Pleurotus eryngii var. ferulae and Pleurotus ostreatus were 72% and 64%, respectively. Therefore, our study provides new SSR markers and an efficient method to enhance the crossbreeding of Bailinggu and closely-related species. PMID:29149037

The Management of Humidifying Treatment for Low Contamination Risks During Indoor Cultivation of Grey Oyster Mushroom (Pleurotus pulmonarius

Directory of Open Access Journals (Sweden)

Islam Md. Tariqul

2017-01-01

Full Text Available In this study, grey oyster mushroom (Pleurotus pulmonarius was cultivated in indoor controlled environment to seeking out the possible risks of contamination and ways of treatment to avoid the contamination. For this, mushroom was cultivated in providing artificial humidifying and ventilation system to ensure optimum humidity (80-90% and fresh air recirculation in different ways of treatment. The ways of treatment were included as in position of humidifier, frequency of humidifying, plastic cork of bags opening part and cleaning of humidifier water container. Maximum percentages of bag contamination (2.5-25.30%, cap contamination (5.6-30.75%, stalk contamination (4.75-23.25% and root contamination (2.6-18.45% were found in front to front humidifier position, long humidifying with long interval frequency, without plastic cork, without cleaning and bi-monthly cleaning of humidifier water container treatment but no diseases and pest infection was found. Whereas, very low percentages of contamination (0.1-0.5% were found in surrounding humidifying position, short humidifying duration with short interval frequency, with plastic cork and weekly cleaning of humidifier water container treatment.

Antiproliferative and apoptotic effect of Pleurotus ostreatus on human mammary carcinoma cell line (michigan cancer foundation-7

Directory of Open Access Journals (Sweden)

Krishnamoorthy Deepalakshmi

2016-01-01

Conclusion: The study demonstrates a potent anticancer property of P. ostreatus against human mammary carcinoma cells which might be of value in nutraceutical industry. Further investigations are essential to establish it as a treatment against breast cancer.

Cultivation of the culinary-medicinal Lung Oyster mushroom, Pleurotus pulmonarius (Fr.) Quél. (Agaricomycetideae) on grass plants in Taiwan.

Science.gov (United States)

Liang, Zeng-Chin; Wu, Kuan-Jzen; Wang, Jinn-Chyi; Lin, Chorng-Horng; Wu, Chiu-Yeh

2011-01-01

Cultivation of the culinary-medicinal Lung Oyster mushroom, Pleurotus pulmonarius, on the stalks of three grass plants, i.e., Panicum repens, Pennisetum purpureum, and Zea mays were investigated. The effects of various combinatorial substrates on mushroom mycelial growth and yield calculated as biological efficiency (BE) were determined. Among 9 experimental substrates, the most suitable substrate for mycelial growth was 45ZMS:45S, followed by 45PRS:45S; their mycelial growth rates were obviously quicker than that of the control substrate. The BEs of all the experimental substrates respectively containing P. repens stalk, P. purpureum stalk and Z. mays stalk were higher than that of the control (39.55%) during the 2.5 months of cultivation period. The best substrate in terms of BE was 60ZMS:30S (58.33%), followed by 45PRS:45S (57.16%), 45ZMS:45S (49.86%), and 30ZMS:60S (47.20%). Based on the BE of the tested substrates, Z mays stalk appeared to be the best alternative material for the production of P. pulmonarius.

Computational analysis and low-scale constitutive expression of laccases synthetic genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris.

Directory of Open Access Journals (Sweden)

Claudia M Rivera-Hoyos

Full Text Available Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range

Effect of light and atmosphere on the cultivation of the golden oyster culinary-medicinal mushroom, Pleurotus citrinopileatus (higher Basidiomycetes).

Science.gov (United States)

Hu, Shu-Hui; Wu, Chiu-Yeh; Chen, Yu-Kuei; Wang, Jinn-Chyi; Chang, Sue-Joan

2013-01-01

With an aim to explore the productivity and quality of the fruiting body of culinary-medicinal golden oyster mushroom Pleurotus citrinopileatus, the carbon dioxide (CO₂) concentration of the ambient atmosphere was adjusted and a light-emitting diode panel was used to illuminate the colonized mycelium at different wavelengths. Biological efficiency and yield were higher at CO₂ levels of 0.05 and 0.1% than other tested CO₂ levels, and the mature fruiting body showed the highest yellow value at a CO₂ level of 0.1% (of all tested CO₂ levels). The highest biological efficiency and yield was obtained at the 720-nm wavelength. The ergosterol content of the pileus of the fruiting body was higher than that of the stipe in any flush time at a 720-nm wavelength of light and a CO₂ concentration of 0.1%. The decreased percentages of cellulose and lignin at the appearance of primordia were larger than those of mycelial growth duration. The fruiting quality of P. citrinopileatus might thus be enhanced by 720-nm illumination and an atmosphere with a CO₂ concentration of 0.1 to 0.15%.

Submerged Cultivation of Mycelium with High Ergothioneine Content from the Culinary-Medicinal Golden Oyster Mushroom, Pleurotus citrinopileatus (Higher Basidiomycetes).

Science.gov (United States)

Lin, Shin-Yi; Chien, Shih-Chang; Wang, Sheng-Yang; Mau, Jeng-Leun

2015-01-01

The optimization of submerged culture of the culinary-medicinal golden oyster mushroom, Pleurotus citrinopileatus, was studied using a one-factor-at-a-time, two-stage stimulation and central composite rotatable design to produce mycelia with high ergothioneine content. The optimal culture conditions for mycelia harvested at day 22 were a temperature of 25°C, an inoculation ratio of 5%, 2% glucose, 0.5% yeast extract, and adjustment of the initial pH value to 10. The biomass and ergothioneine content were 8.28 g/L and 10.65 mg/g dry weight (dw), respectively. The addition of an amino acid precursor increased the ergothioneine content of mycelia; cysteine was the most effective. In addition, the results obtained from central composite rotatable design showed that the recommended combination for cysteine, histidine, and methionine was 8, 4, and 0.5 mmol/L, respectively. The predicted ergothioneine content was 13.90 mg/g dw, whereas the experimental maximal ergothioneine content was 14.57 mg/g dw. With the addition of complex precursors and under optimal culture conditions, mycelia harvested at days 16-20 had higher ergothioneine content. Accordingly, the information obtained could be used to produce mycelia with high ergothioneine content.

Decolourization and degradation of azo Dye, Synozol Red HF6BN ...

African Journals Online (AJOL)

Decolourization and degradation of azo Dye, Synozol Red HF6BN, by Pleurotus ostreatus. Sidra Ilyas, Skinder Sultan Sultan, Abdul Rehman. Abstract. The present paper focuses on the use of fungus, Pleurotus ostreatus, to decolorize and degrade azo dye, Synazol Red HF6BN. Decolorization study showed that P.

Morphological and molecular identification of four Brazilian commercial isolates of Pleurotus spp. and cultivation on corncob

Directory of Open Access Journals (Sweden)

Nelson Menolli Junior

2010-04-01

Full Text Available The species of Pleurotus have great commercial importance and adaptability for growth and fructification within a wide variety of agro-industrial lignocellulosic wastes. In this study, two substrates prepared from ground corncobs supplemented with rice bran and charcoal were tested for mycelium growth kinetics in test tubes and for the cultivation of four Pleurotus commercial isolates in polypropylene bags. The identification of the isolates was based on the morphology of the basidiomata obtained and on sequencing of the LSU rDNA gene. Three isolates were identified as P. ostreatus, and one was identified as P. djamor. All isolates had better in-depth mycelium development in the charcoal-supplemented substrate. In the cultivation experiment, the isolates reacted differently to the two substrates. One isolate showed particularly high growth on the substrate containing charcoal.Espécies de Pleurotus têm grande importância comercial e adaptabilidade para crescimento e frutificação em uma ampla variedade de resíduos agro-industriais lignocelulósicos. Neste trabalho foram testados dois substratos à base de sabugo de milho triturado, suplementados com farelo de arroz e carvão vegetal, para avaliação da cinética de crescimento micelial em tubos de ensaio e produção em sacos de polipropileno, utilizando quatro isolados comerciais. O estudo taxonômico foi realizado com a análise da morfologia dos basidiomas obtidos em cultivo e pelo seqüenciamento do gene nLSU do DNAr, para certificar a identificação taxonômica. Os isolados tiveram melhor desenvolvimento micelial em profundidade no substrato suplementado com carvão vegetal. Em relação à produção, os isolados reagiram de formas distintas em função dos substratos, sendo significativamente melhor o substrato contendo carvão. Três isolados foram identificados como P. ostreatus e o outro foi identificado como P. djamor.

Identification and characterization of Trichoderma species aggressive to Pleurotus in Italy

Institute of Scientific and Technical Information of China (English)

Woo S L; Di Benedetto P; Senatore M; Abadi K; Gigante S; Soriente I; Ferraioli S; Scala F; Lorito M

2004-01-01

@@ In the late 1980's the development of a severe epidemic of green mold caused by Trichoderma spp.was noted in the commercial production of Agaricus bisporus (champignon) in the United Kingdom,North America, Spain and Holland, which caused extensive economic losses. The parasitic fungi isolated from the edible mushroom belonged to four biotypes, Thl, Th2, Th3 and Th4 of T.harzianum. However, among these biotypes, only Th2 (since classified as T. aggressivum f.europaeum) and Th4 (T. aggressivum f. aggressivum) were identified as the fungi causing problems in Agaricus production. In general, mushroom compost hosts both aggressive and innocuous isolates of Trichoderma, which are not morphologically distinguishable. About four years ago, a problem with green mold became apparent in the production of Pleurotus ostreatus in Northern Italy,which eventually developed to a crisis situation in the South two years later and threatened to seriously compromise the Pleurotus market. This study was initiated to: isolate and identify the aggressive fungi, then morphologically, physiologically and genetically characterize the isolates, determine the source and phases of infection, and study methods of control. Samples were obtained from different phases of compost preparation at the locality of a major producer and supplier of compost to the mushroom industry in Southern Italy, and microbial counts were conducted. Although the presence of Trichoderma was detected in the initial stages of composting, this value was reduced to zero from the phase of pasteurization to seeding with Pleurotus. Trichoderma infestations were noted in the packaged Pleurotus bales at various times during the incubation phase (7-15 days after seeding) and after shipping to the mushroom greenhouses, where the pathogen infestations greatly reduced the quality and quantity of the mushroom yield, as well as the number of potential harvest cycles.Preliminary results from the morphological and genetic

KAJIAN MACAM LIMBAH DAN PENAMBAHAN TEPUNG TONGKOL JAGUNG TERHADAP PERTUMBUHAN DAN HASIL JAMUR TIRAM (Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Agung Setyarini

2016-12-01

Full Text Available One limiting for factor the production of oyster mushrooms was difficult to obtain the raw material of sengon wood sawdust, meanwhile, the production of oyster mushroom necessary need the nutrients in the form of bran or cornmeal. The purpose of this study was to study planting medium, the concentration of corn cob flour, and to find the effective interaction of these two factors on growth and yield of oyster mushroom. This study used a completely randomized design (CRD with two factors, concentration of media and corn cob flour. The media used in this study are sengon sawdust, glugu sawdust, acacia wood sawdust, rice straw and bagasse, while the concentration of corn cob flour was 0% per baglog, 1% per baglog, 2% per baglog, 3% per baglog and 4% per baglog. Data analysis was using F test level 5% and continued with Duncan test. The results of this study showed that sawdvst sengon media generally give better effect to the growth and yield of oyster mushroom, while corn cob flour treatment concentration was not known exactly in enhancing the growth and yield of oyster mushroom. Treatment of media accelerate the deployment of mycelium old, when appearing pin head, increasing the number of fruiting bodies in a single clump and increasing the mushroom fruit body weight. Extra flour treatment corncob accelerate as emerging pin head, increasing the number of fruiting bodies in a clump and increase total body weight of mushrooms.

Malachite Green and Crystal Violet Decolorization by Ganoderma lucidum and Pleurotus ostreatus Supernatant and by rGlLCC1 and rPOXA 1B Concentrates: Molecular Docking Analysis.

Science.gov (United States)

Morales-Álvarez, Edwin D; Rivera-Hoyos, Claudia M; Poveda-Cuevas, Sergio A; Reyes-Guzmán, Edwin A; Pedroza-Rodríguez, Aura M; Reyes-Montaño, Edgar A; Poutou-Piñales, Raúl A

2018-03-01

Laccases catalyze the oxidation of various aromatic organic compounds concomitantly with molecular oxygen reduction to water. Triphenylmethane dyes are synthetic compounds widely used in diverse industries. Their removal from effluents is difficult, due to their high degree of structural complexity; hence, their high concentration in effluents cause a negative impact on the environment. In the present work, molecular docking was used to evaluate interactions between rGlLCC1 or rPOXA 1B enzymes with Crystal Violet (CV) or Malachite Green (MG) dyes. In addition, removal tests of the two dyes were performed. Van der Waals interactions were obtained for only the CV dye for both GlLCC1 and POXA 1B enzymes. Nevertheless, in the GlLCC1 model, two π-π interactions were observed. For the MG dye only, Van der Waals interactions were obtained. Moreover, amino acid composition interacting in each model with each dye was similar. It is important to highlight that by molecular docking, none of the estimated ligand configurations generated hydrogen bonds. Thus, explaining the difficulty to degrade CV and MG. Regarding CV, maximum decolorization percentage was 23.6 ± 1.0% using Ganoderma lucidum supernatant and 5.0 ± 0.5% with Pleurotus ostreatus supernatant. When using recombinant laccase enzyme concentrates, decolorization percentages were 9.9 ± 0.1 and 7.5 ± 1.0% for rGlLCC1 and rPOXA 1B, respectively. On the other hand, for the MG dye, maximum decolorization percentages were 52.1 ± 5.1 and 2.3 ± 0.2% using G. lucidum and P. ostreatus concentrates, respectively. Whereas with recombinant laccase enzymatic concentrates, values of 9.4 ± 0.8% were obtained, with rGlLCC1, and 2.1 ± 0.1% when using rPOXA 1B. These findings represent an important step in bioremediation processes improvement and efficiency of industry-generated products, using environmentally friendly alternatives.

Submerged cultivation of mycelium with high ergothioneine content from the culinary-medicinal king oyster mushroom Pleurotus eryngii (higher Basidiomycetes) and its composition.

Science.gov (United States)

Liang, Chih-Hung; Huang, Ling-Yi; Ho, Kung-Jui; Lin, Shin-Yi; Mau, Jeng-Leun

2013-01-01

The culinary-medicinal king oyster mushroom, Pleurotus eryngii, was used to produce mycelia with high ergothioneine content using a one-factor-at-a-time method. The optimal culture conditions for mycelia harvested at day 14 were 25°C, 10% inoculation rate, 2% glucose, 0.5% yeast extract, and no adjustment to the initial pH value. With histidine or amino acid mix added, biomasses and the ergothioneine content of mycelia were higher than those of the control. The ergothioneine content of mycelia harvested at days 16-20 were higher than that of mycelia harvested at day 14. In addition, the ergothioneine content of mycelia from the fermentor (5.84-5.76 mg/g) was much higher than that of mycelia from the shaken flask (4.93-5.04 mg/g). Mycelia with high ergothioneine content showed a profile of proximate composition similar to that of regular mycelia but lost its characteristic umami taste. Overall, mycelia high in ergothioneine could be prepared by optimal culture conditions, the addition of precursors, prolonged harvest, and aeration in the fermentor.

Pleurotus ostreatus Yetiştiriciliğinde Katkı Maddesi Olarak Mısır Silajının Kullanımı

Directory of Open Access Journals (Sweden)

Beyhan Kibar

2016-05-01

Full Text Available Bu çalışma Pleurotus ostreatus mantarı yetiştiriciliğinde mısır silajının katkı maddesi olarak kullanım durumunu belirlemek amacıyla yapılmıştır. Çalışmada buğday samanına farklı oranlarda (%5, 10, 15 ve 20 mısır silajı ilave edilerek hazırlanan yetiştirme ortamları, verim ve morfolojik özellikler bakımından kontrol ile (%95 buğday samanı+%5 buğday kepeği karşılaştırılmıştır. Yetiştirme ortamlarının hazırlanmasında kullanılan materyallerin her birinin başlangıçtaki ve hazırlanan yetiştirme ortamlarının sterilizasyondan sonraki pH, karbon (C ve azot (N miktarı, C:N oranı ve mineral madde (K, P, Mg, Zn, Fe ve Mn içerikleri tespit edilmiştir. Verim bakımından kontrol ve farklı oranlarda mısır silajı ilave edilerek hazırlanan yetiştirme ortamları arasındaki farklılık istatistiki olarak önemli (P<0.05, morfolojik özellikler (şapka uzunluğu, sap uzunluğu ve sap kalınlığı bakımından ise önemsiz bulunmuştur. En yüksek verim (220.13 g kg-1 ortam buğday samanına %10 oranında mısır silajının ilave edilmesiyle hazırlanan yetiştirme ortamından, en düşük verim (153.75 g kg-1 ortam ise kontrol ortamından elde edilmiştir. Mısır silajının P. ostreatus yetiştiriciliğinde buğday kepeğine alternatif iyi ve ucuz bir katkı maddesi olarak kullanılabileceği sonucuna varılmıştır.

Potential applications of the white rot fungus Pleurotus in bioregenerative life support systems

Science.gov (United States)

Manukovsky, N. S.; Kovalev, V. S.; Yu, Ch.; Gurevich, Yu. L.; Liu, H.

Earlier we demonstrated the possibility of using soil-like substrate SLS for plant cultivation in bioregenerative life support systems BLSS We suggest dividing the process of SLS bioregeneration at BLSS conditions into two stages At the first stage plant residues should be used for growing of white rot fungus Pleurotus ostreatus Pleurotus florida etc The fruit bodies could be used as food Spent mushroom compost is carried in SLS and treated by microorganisms and worms at the second stage The possibility of extension of human food ration is only one of the reasons for realization of the suggested two-stage SLS regeneration scheme people s daily consumption of mushrooms is limited to 200 -250 g of wet weight or 20 -25 g of dry weight Multiple tests showed what is more important is that inclusion of mushrooms into the system cycle scheme contributes through various mechanisms to the more stable functioning of vegetative cenosis in general Taking into account the given experimental data we determined the scheme of mushroom module material balance The technological peculiarities of mushroom cultivation at BLSS conditions are being discussed

Bioconversion of apple pomace into a nutritionally enriched substrate by Candida utilis and Pleurotus ostreatus

DEFF Research Database (Denmark)

Villas-Bôas, Silas Granato; Esposito, E.; de Mendonca, M.M.

2003-01-01

, into an enriched substrate with increased digestibility for use as ruminant feed. After C. utilis fermentation, the protein level increased 100% and the mineral content 60%, accompanied by 8.2% of increase in the digestibility. The level of free sugars decreased 97% after substrate supplementation with ammonium...... the fermentation with P. ostreatus alone due to pectin and hemicellulose degradation. Considering the time required for fermentation, the C. utilis treatment was the most efficient treatment to convert apple pomace into a more nutritive substrate for ruminant feed....

Extension of the shelf-life of fresh oyster mushrooms ( Pleurotus ...

African Journals Online (AJOL)

The objective of this study was to improve the preservation of fresh oyster mushrooms by modified atmosphere packaging (MAP) and chemical treatments. The MAP effects and treatments on organoleptic quality, weight loss, cell permeability, texture changes and polyphenol oxidase (PPO) activity were studied. In addition ...

Dose Response for Monokaryon mycelium of Pleurotus pulmonarius After Acute Gamma Radiation

International Nuclear Information System (INIS)

Wan Safina Wan Abdul Razak; Azhar Mohamad; Nie, H.J.

2016-01-01

Pleurotus pulmonarius is locally known as Grey oyster. The species is popular and widely cultivated throughout the world mostly in Asia Europe as their simple and low cost production technology and higher biological efficiency. Mutation induction is an alternative ways for improving available commercial strain for better quality traits. Dose response is important in evaluating effects of mutagenesis via acute gamma radiation. Monokaryon mycelium of Pleurotus pulmonarius was exposed to acute gamma radiation ranged from 0 Gy, 0.1 kGy, 0.2 kGy, 0.3 kGy, 0.4 kGy, 0.5 kGy, 0.6 kGy, 0.7 kGy, 0.8 kGy, 0.9 kGy, 1.0 kGy, 1.5 Gy, 2.0 kGy, 3.0 kGy and 4.0 kGy at dose rate 0.013 kGy/ min. growth performance was measured at 2 days interval to get the LD_5_0. Increasing of the irradiation dose found to decrease the growth performance of the monokaryon mycelium. LD_5_0 was revealed at 1.56 kGy for mono karyon mycelium. Discoveries of the works are important for the improvement of Pleurotus species via acute gamma radiation and benefiting to growers and mushroom industries. (author)

Bioremediation of aflatoxin B1-contaminated maize by king oyster mushroom (Pleurotus eryngii.

Directory of Open Access Journals (Sweden)

Maria Teresa Branà

Full Text Available Aflatoxin B1 (AFB1 is the most harmful mycotoxin that occurs as natural contaminant of agricultural commodities, particularly maize. Practical solutions for detoxification of contaminated staples and reduction of agricultural wastes are scarce. We investigated the capability of the white-rot and edible fungus Plerotus eryngii (king oyster mushroom to degrade AFB1 both in vitro and in a laboratory-scale mushroom cultivation, using a substrate similar to that routinely used in mushroom farms. In malt extract broth, degradation of AFB1 (500 ng/mL by nine isolates of P. eryngii ranged from 81 to 99% after 10 days growth, and reached 100% for all isolates after 30 days. The growth of P. eryngii on solid medium (malt extract-agar, MEA was significantly reduced at concentrations of AFB1 500 ng/mL or higher. However, the addition of 5% wheat straw to the culture medium increased the tolerance of P. eryngii to AFB1 and no inhibition was observed at a AFB1 content of 500 ng/mL; degradation of AFB1 in MEA supplemented with 5% wheat straw and 2.5% (w/v maize flour was 71-94% after 30 days of growth. Further, AFB1 degradation by P. eryngii strain ITEM 13681 was tested in a laboratory-scale mushroom cultivation. The mushroom growth medium contained 25% (w/w of maize spiked with AFB1 to the final content of 128 μg/kg. Pleurotus eryngii degraded up to 86% of the AFB1 in 28 days, with no significant reduction of either biological efficiency or mushroom yield. Neither the biomass produced on the mushroom substrate nor the mature basidiocarps contained detectable levels of AFB1 or its metabolite aflatoxicol, thus ruling out the translocation of these toxins through the fungal thallus. These findings make a contribution towards the development of a novel technology for remediation of AFB1- contaminated corn through the exploitation of the degradative capability of P. eryngii and its bioconversion into high nutritional value material intended for feed production.

Mycelial growth observation of Pleurotus eryngii (Higher Basidiomycota In Vitro

Directory of Open Access Journals (Sweden)

Mustafa Nadhim Owaid

2016-09-01

Full Text Available Five agro-substrates including date palm fibers (fibrillum, wheat straw, white sawdust and their combinations were investigated to grow Pleurotus eryngii. The longer mycelium complete time within bags was 20 days on sawdust (S4, in contrast, the shorter time for mycelium overgrew was completed after 15 days on date palm fiber (S5. In significant (p<0.05, S5 showed the higher growth intensity level (vigorous growth than other substrates. Thus use of date palm wastes (S5 medium may be useful for successfully cultivation king oyster mushroom in farm.International Journal of Environment Vol.5(3 2016, pp.1-10

Determination of Cr, Cu, Fe, Ni, Pb and Zn by ICP-OES in mushroom samples from Sakarya, Turkey

Directory of Open Access Journals (Sweden)

Esra Altıntığ

2017-06-01

Full Text Available Russula cyanoxantha, Russula delica, Lactarius salmonicolor, Lactarius deliciosus, Pleurotus eryngii, Pleurotus ostreatus, Agaricus bisporus, Suillus luteus, Pleurotus spp and Boletus edulis were collected from Sakarya-Turkey respectively. Also canned food in the form of the Pleurotus eryngii, Pleurotus ostreatus, and Lactarius salmonicolor mushrooms were used for the examination. Trace metal concentrations found in these mushrooms were determined inductively using coupled plasma optic emission spectrometry microwave processes. The results were obtained for (Cr 0.3-26.65, (Cu 17.38-132.75, (Fe 26.3-225.40, (Ni 2.57-39.28, (Pb 11.52-185.20, and (Zn 22.86-126.84 mg/kg. The accuracy of the method was checked by the standard reference material; tea leaves (INCY-TL-1 and tomato leaves (1573a.

Disease control by chemical and biological fungicides in cultivated mushrooms: Button mushroom, oyster mushroom and shiitake

OpenAIRE

Potočnik, Ivana; Stepanović, Miloš; Rekanović, Emil; Todorović, Biljana; Milijašević-Marčić, Svetlana

2015-01-01

The most commonly cultivated basidiomycetes worldwide and in Serbia are button mushroom (Agaricus bisporus), oyster mushroom (Pleurotus sp.) and shiitake (Lentinus edodes). Production of their fruiting bodies is severely afflicted by fungal, bacterial, and viral pathogens that are able to cause diseases which affect yield and quality. Major A. bisporus fungal pathogens include Mycogone perniciosa, Lecanicillium fungicola, and Cladobotryum spp., the causal a...

Dose of Biocoagulant-Mixing Rate Combinations for Optimum Reduction of COD in Wastewater

Science.gov (United States)

Patricia, Maria Faustina; Purwono; Budihardjo, Mochamad Arief

2018-02-01

Chemical oxygen demand (COD) in domestic wastewater can be treated using flocculation-coagulation process with addition of Oyster mushroom (Pleurotus ostreatus) in powder form as biocoagulant. The fungal cell wall of Oyster mushroom comprises of chitin that is high polyelectrolyte and can be function as an absorbent of heavy metals in wastewater. The effectiveness of flocculation-coagulation process in treating wastewater depends on dose of coagulant and mixing rate. Therefore, this study aims to determine the best combination of three variation of dose of biocoagulant which are 600 mg/l, 1000 mg/l, and 2000 mg/l and mixing rate which are 100 rpm, 125 rpm, and 150 rpm that give the most reduction of COD in the wastewater. The result indicates that the combination of 1000 mg/l of biocoagulant and 100 rpm of mixing rate were found to be the most optimum combination to treat COD in the wastewater with COD reduction of 47.7%.

Dose of Biocoagulant-Mixing Rate Combinations for Optimum Reduction of COD in Wastewater

Directory of Open Access Journals (Sweden)

Faustina Patricia Maria

2018-01-01

Full Text Available Chemical oxygen demand (COD in domestic wastewater can be treated using flocculation-coagulation process with addition of Oyster mushroom (Pleurotus ostreatus in powder form as biocoagulant. The fungal cell wall of Oyster mushroom comprises of chitin that is high polyelectrolyte and can be function as an absorbent of heavy metals in wastewater. The effectiveness of flocculation-coagulation process in treating wastewater depends on dose of coagulant and mixing rate. Therefore, this study aims to determine the best combination of three variation of dose of biocoagulant which are 600 mg/l, 1000 mg/l, and 2000 mg/l and mixing rate which are 100 rpm, 125 rpm, and 150 rpm that give the most reduction of COD in the wastewater. The result indicates that the combination of 1000 mg/l of biocoagulant and 100 rpm of mixing rate were found to be the most optimum combination to treat COD in the wastewater with COD reduction of 47.7%.

Cambios en las propiedades físicas de un Inceptisol por la adición de substrato degradado con el hongo Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Gómez Carabalí Arnulfo

2010-03-01

Full Text Available Para evaluar el efecto del substrato orgánico (aserrín de madera y ‘estopa’ de coco enriquecido con 40% de volúmenes iguales de hojas de plátano (Mussa sp., kudzú tropical (Pueraria phaseoloides y botón de oro (Tithonia diversifolia degradado por el hongo Pleurotus ostreatus (SDP sobre algunas propiedades físicas de un Inceptisol de Buenaventura, Valle del Cauca, Colombia, se incorporaron dosis crecientes de éste (0, 1.25, 2.5, 5, 10, 20, 40 y 80 g/kg en el suelo tamizado en malla de 2 mm. La mezcla se utilizó en materos sembrados con maíz durante 4 meses, momento en el cual se tomaron muestras para determinar los cambios en las propiedades del suelo. Se usó un diseño completamente al azar, con ocho tratamientos, cuatro repeticiones y dos profundidades de muestreo. La correlación entre la cantidad de SDP incorporado y la mayoría de propiedades físicas evaluadas fue altamente significativa. Comparadas con el control (sin SDP, las dosis de 20, 40 y 80 g/kg redujeron significativamente la densidad aparente del suelo, al tiempo que incrementaron la porosidad total, la macroporosidad, la retención de humedad a bajas tensiones y el contenido de materia orgánica. En las dosis de 40 y 80 g/kg se observó una reducción significativa de la susceptibilidad a la compactación, lo mismo que un incremento en el diámetro promedio ponderado de los agregados estables al agua. Los incrementos de la conductividad hidráulica saturada y la permeabilidad al aire no fueron significativos en relación con el control.

Cambios en las propiedades físicas de un Inceptisol por la adición de substrato degradado con el hongo Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Herminio Paredes Valencia

2010-01-01

Full Text Available Para evaluar el efecto del substrato orgánico (aserrín de madera y 'estopa' de coco enriquecido con 40% de volúmenes iguales de hojas de plátano (Mussa sp., kudzú tropical (Pueraria phaseoloides y botón de oro (Tithonia diversifolia degradado por el hongo Pleurotus ostreatus (SDP sobre algunas propiedades físicas de un Inceptisol de Buenaventura, Valle del Cauca, Colombia, se incorporaron dosis crecientes de éste (0, 1.25, 2.5, 5, 10, 20, 40 y 80 g/kg en el suelo tamizado en malla de 2 mm. La mezcla se utilizó en materos sembrados con maíz durante 4 meses, momento en el cual se tomaron muestras para determinar los cambios en las propiedades del suelo. Se usó un diseño completamente al azar, con ocho tratamientos, cuatro repeticiones y dos profundidades de muestreo. La correlación entre la cantidad de SDP incorporado y la mayoría de propiedades físicas evaluadas fue altamente significativa. Comparadas con el control (sin SDP, las dosis de 20, 40 y 80 g/kg redujeron significativamente la densidad aparente del suelo, al tiempo que incrementaron la porosidad total, la macroporosidad, la retención de humedad a bajas tensiones y el contenido de materia orgánica. En las dosis de 40 y 80 g/kg se observó una reducción significativa de la susceptibilidad a la compactación, lo mismo que un incremento en el diámetro promedio ponderado de los agregados estables al agua. Los incrementos de la conductividad hidráulica saturada y la permeabilidad al aire no fueron significativos en relación con el control.

Produção de três espécies de cogumelos Pleurotus e avaliação da qualidade em atmosfera modificada Production of three species of Pleurotus mushrooms and quality evaluation in modified atmosphere

Directory of Open Access Journals (Sweden)

Cristina Ramos

2011-01-01

Full Text Available A utilização de substratos vegetais à base de palha tem vindo a assumir uma importância crescente na cultura de cogumelos sapróbios, principalmente do género Pleurotus. Estes cogumelos são considerados muito interessantes do ponto de vista comercial, não só pelas suas características organolépticas e nutricionais, mas também pela sua fácil adaptação e manutenção, crescimento rápido e relativo baixo custo de cultura. No entanto, por se tratar de alimentos perecíveis, devido sobretudo à sua composição e elevada taxa respiratória, podem apresentar reduzido valor comercial, caso a conservação não seja efectuada nas melhores condições. No sentido de minimizar estas alterações, os cogumelos frescos devem ser submetidos a um processamento mínimo com utilização combinada de embalagem em atmosfera modificada, de forma a manter a qualidade e estabilidade no período de conservação. Neste trabalho foram efectuados ensaios de produção de três espécies do género Pleurotus, cultivadas em palha de trigo, com a finalidade de determinar a espécie mais produtiva e avaliar a qualidade dos mesmos durante a conservação quando processados e embalados em atmosfera modificada. Os resultados permitem concluir que a espécie mais produtiva foi a P. ostreatus, seguida da P. sajor-caju e P. eryngii, tendo sido a P. eryngii a que mostrou maior resistência à degradação no período de conservação estabelecido.The use of substrates straw has been increasing importance in mushroom saprophytic species grown, especially of Pleurotus genus. They are considered very interesting from the commercial point of view, not only for its nutritional and organoleptic characteristics, but also for its easy adaptation, rapid growth and relatively low culture cost. Mushrooms have a short shelf life when compared to most vegetables at ambient temperatures mainly due to its composition and high respiration rate. After yield and to reduce losses and

Pleurotus ostreatus

African Journals Online (AJOL)

badr

2011-11-07

Nov 7, 2011 ... Evaluation of nutritional substrate and physical stress. (gamma ... cows. Lavi et al. (2010) stated that mushroom poly- saccharides are potent substances that exhibit anti-tumor ...... A brief history of heat, chemical and radiation.

Perbandingan Pertumbuhan Jamur Tiram Putih di Kumbung Ciseeng dan Universitas Al-Azhar Indonesia

Directory of Open Access Journals (Sweden)

Putri Kenanga

2016-03-01

Full Text Available White oyster mushroom (Pleurotus ostreatus is one of wood fungi which easy to grow at rotting wood and organic waste. White oyster mushroom is rich in protein, carbohydrates, minerals, and vitamins. Environmental factors affecting the growth of white oyster mushrooms is temperature and humidity. The study aims to compare the growth and production of white oyster mushroom in different location, Ciseeng and University of Al-Azhar Indonesia (UAI. Cultivation in UAI done in a controlled situation using autoclave sterilization, inoculation using enkas and the treatment is watering on gunny sack in the mushroom house regularly. Whereas, cultivation in Ciseeng less controlled by traditional cultivation using steam sterilization and inoculation process at open space. Wet weight, dry weight, and biological efficiency results is higher in UAI than Ciseeng at 7.95%, 14.5%, and 7.34% higher, respectively. Morphological parameter such as number of fruiting body, mushroom cap diameters, and stem lenght also show better in UAI than Ciseeng at 23.67%, 8.75%, 54.96% higher, respectively. Better result of mushroom cultivation at UAI supported by 28.3oC average temperature and 93.95% humidity, meanwhile in Ciseeng average temperature and humidity was 29.25oC and 82.15%.

Phenol oxidation of petrol refinery wastewater catalyzed by Laccase

International Nuclear Information System (INIS)

Vargas, Maria Carolina; Ramirez, Nubia E.

2002-01-01

Laccase has been obtained through two different production systems, the first using Pleurotus ostreatus in solid-state fermentation, the second one using Trametes versicolor in submerged culture. Different substrates (by products from yeast, flour and beverage industries) have been evaluated in both systems. Maximum laccase yield with Pleurotus ostreatus (25 u/ml) was obtained in a wheat bran medium. The maximum enzyme concentration level using Trametes versicolor (25 u/ml) was achieved in a submerged system, containing 10% vinasse, 4,5% wheat bran and 0,2% molasses per liter of waste. Culture filtrate extracted from Pleurotus ostreatus was used to remove phenol from wastewater. The enzymatic treatment is effective over a wide pH and temperature range. The Laccase treatment has been successfully used to dephenolize industrial petrol refinery wastewater. The advantage of Laccase dephenolization is that this enzyme uses molecular oxygen as an oxidant

Analisis Faktor-Faktor yang Mempengaruhi Pendapatan Usahatani Jamur Tiram (Pleurotus ostreatus) di Kota Medan dan Kabupaten Deli Serdang

OpenAIRE

Ginting, Nina Maksimiliana

2015-01-01

Oyster mushroom is a horticultural crop which is very good for health and has high economic value. Therefore, how big the economic value that can be gained is needs to be studied. The purpose of this study was to analyze the factors influencing the income of oyster mushroom farming in the City of Medan and Deli Serdang District. The data used in this study conducted in 2012 were primary and secondary data. The data obtained were analyzed through multiple linear regression tests using SPSS ...

The potential of Pleurotus-treated olive mill solid waste as cattle feed.

Science.gov (United States)

Shabtay, Ariel; Hadar, Yitzhak; Eitam, Harel; Brosh, Arieh; Orlov, Alla; Tadmor, Yaakov; Izhaki, Ido; Kerem, Zohar

2009-12-01

The aims of the current study were to follow: (1) the capability of the edible mushroom Pleurotus ostreatus to degrade cell wall components and soluble phenols of the olive mill solid waste (OMSW), and improve it for ruminant nutrition (2) the fate of oil and the lipid-soluble compounds tocopherols, squalene and beta-sitosterol in the fermented OMSW. A significant decrease in oil and lipid-soluble compounds with a concomitant shift in the fatty acid profile and degradation of soluble phenols took place already after 14 d. The utilization of lipids by the fungus shifted the degradation of the structural carbohydrates to a later stage, and significantly reduced the metabolizable energy of the OMSW. We propose that edible fungi with reduced lipase activity would preserve the energy and health promoting ingredients of the oil, and force the fungus to degrade structural carbohydrates, thus improving its digestibility.

Preparation of culinary-medicinal king oyster mushroom Pleurotus eryngii-fermented products with high ergothioneine content and their taste quality.

Science.gov (United States)

Chen, Shih-Yu; Ho, Kung-Jui; Liang, Chih-Hung; Tsai, Ching-Hsuan; Huang, Ling-Yi; Mau, Jeng-Leun

2012-01-01

Pleurotus eryngii (DC. : Fr.) Ouel. was used in solid-state fermentation to develop novel mushroom products with a high amount of ergothioneine. The correlation coefficients between ergothioneine content and biomass were 0.8878 and 0.9206 for fermented adlay and buckwheat, respectively. Using optimal conditions, Pleurotus-fermented adlay and buckwheat (PFA and PFB) with the ergothioneine contents of 795.5 and 786.1 mg/ kg, respectively, were prepared. However, mycelia contained the highest ergothioneine content of 1514.6 mg/kg. As a result of SSF by P. eryngii, PFA and PFB contained more taste components than adlay and buckwheat, as evidenced by higher contents of total sugars and polyols, total free amino acids and monosodium glutamate-like components, and total and flavor 5'-nucleotides. In addition, PFB and buckwheat showed comparable equivalent umami concentration (EUC) values, whereas PFA showed a higher EUC value than adlay. Overall, Pleurotus-fermented products with a high amount of ergothioneine will be a novel functional food.

Oil palm empty fruit bunch as media for mushroom cultivation

International Nuclear Information System (INIS)

Mat Rasol Awang; Wan Badrin Wan Husin; Tajuddin Osman; Tamikazu Kume; Shinpei Matsuhashi

1998-01-01

The mushroom strains Pleurotus sajor caju(grey oyster mushroom), Pleurotus flavellatus((pink oyster mushroom), Pleurotus cystidiosus(abalone mushroom) and Auricularia polytricha (black jelly mushroom) grow satisfactorily on the EFB media treated with lime. Based on their Biological Efficiency (BE) or yield, the strain Pleurotus sajor caju was selected for further investigation. The BE of the Pleurotus sajor caju was 73.8 %. The lime treatment, aeration and four weeks incubation period was necessary for fruiting

Pleurotus ostreatus and Pleurotus pulmonarius

African Journals Online (AJOL)

STORAGESEVER

2010-03-15

Mar 15, 2010 ... was maintained on plate of potato dextrose agar (PDA). Degradation of ... 40% concentrate feed (40% corn, 10% wheat offal, 10% palm kernel cake, 20% ... meal) and 60% Pannicum maximum at 5% body weight. The rumen.

The first report on mushroom green mould disease in Croatia.

Science.gov (United States)

Hatvani, Lóránt; Sabolić, Petra; Kocsubé, Sándor; Kredics, László; Czifra, Dorina; Vágvölgyi, Csaba; Kaliterna, Joško; Ivić, Dario; Đermić, Edyta; Kosalec, Ivan

2012-12-01

Green mould disease, caused by Trichoderma species, is a severe problem for mushroom growers worldwide, including Croatia. Trichoderma strains were isolated from green mould-affected Agaricus bisporus (button or common mushroom) compost and Pleurotus ostreatus (oyster mushroom) substrate samples collected from Croatian mushroom farms. The causal agents of green mould disease in the oyster mushroom were T. pleurotum and T. pleuroticola, similar to other countries. At the same time, the pathogen of A. bisporus was exclusively the species T. harzianum, which is different from earlier findings and indicates that the range of mushroom pathogens is widening. The temperature profiles of the isolates and their hosts overlapped, thus no range was found that would allow optimal growth of the mushrooms without mould contamination. Ferulic acid and certain phenolic compounds, such as thymol showed remarkable fungistatic effect on the Trichoderma isolates, but inhibited the host mushrooms as well. However, commercial fungicides prochloraz and carbendazim were effective agents for pest management. This is the first report on green mould disease of cultivated mushrooms in Croatia.

Fungal treatment of lignocellulosic biomass: Importance of fungal species, colonization and time on chemical composition and in vitro rumen degradability

NARCIS (Netherlands)

Kuijk, van S.J.A.; Sonnenberg, A.S.M.; Baars, J.J.P.; Hendriks, W.H.; Cone, J.W.

2015-01-01

The aim of this study is to evaluate fungal treatments to improve in vitro rumen degradability of lignocellulosic biomass. In this study four selective lignin degrading fungi, Ganoderma lucidum, Lentinula edodes, Pleurotus eryngii and Pleurotus ostreatus, were used to pre-treat lignocellulosic

Nutrient Digestibility, Ruminal Fermentation Activities, Serum Parameters and Milk Production and Composition of Lactating Goats Fed Diets Containing Rice Straw Treated with Pleurotus ostreatus.

Science.gov (United States)

Kholif, A E; Khattab, H M; El-Shewy, A A; Salem, A Z M; Kholif, A M; El-Sayed, M M; Gado, H M; Mariezcurrena, M D

2014-03-01

The study evaluated replacement of Egyptian berseem clover (BC, Trifolium alexandrinum) with spent rice straw (SRS) of Pleurotus ostreatus basidiomycete in diets of lactating Baladi goats. Nine lactating homo-parity Baladi goats (average BW 23.8±0.4 kg) at 7 d postpartum were used in a triplicate 3×3 Latin square design with 30 d experimental periods. Goats were fed a basal diet containing 0 (Control), 0.25 (SRS25) and 0.45 (SRS45) (w/w, DM basis) of SRS. The Control diet was berseem clover and concentrate mixture (1:1 DM basis). The SRS45 had lowered total feed intake and forages intake compared to Control. The SRS25 and SRS45 rations had the highest digestibilities of DM (p = 0.0241) and hemicellulose (p = 0.0021) compared to Control which had higher (p<0.01) digestibilities of OM (p = 0.0002) and CP (p = 0.0005) than SRS25 and SRS45. Ruminal pH and microbial protein synthesis were higher (p<0.0001) for SRS25 and SRS45 than Control, which also had the highest (p<0.0001) concentration of TVFA, total proteins, non-protein N, and ammonia-N. All values of serum constituents were within normal ranges. The Control ration had higher serum globulin (p = 0.0148), creatinine (p = 0.0150), glucose (p = 0.0002) and cholesterol (p = 0.0016). Both Control and SRS25 groups had the highest (p<0.05) milk (p = 0.0330) and energy corrected milk (p = 0.0290) yields. Fat content was higher (p = 0.0373) with SRS45 and SRS25 groups compared with Control. Replacement of BC with SRS in goat rations increased milk levels of conjugated linoleic acid and unsaturated fatty acids compared with Control. It was concluded that replacing 50% of Egyptian berseem clover with SRS in goat rations improved their productive performance without marked effects on metabolic indicators health.

Nutrient Digestibility, Ruminal Fermentation Activities, Serum Parameters and Milk Production and Composition of Lactating Goats Fed Diets Containing Rice Straw Treated with Pleurotus ostreatus

Science.gov (United States)

Kholif, A. E.; Khattab, H. M.; El-Shewy, A. A.; Salem, A. Z. M.; Kholif, A. M.; El-Sayed, M. M.; Gado, H. M.; Mariezcurrena, M. D.

2014-01-01

The study evaluated replacement of Egyptian berseem clover (BC, Trifolium alexandrinum) with spent rice straw (SRS) of Pleurotus ostreatus basidiomycete in diets of lactating Baladi goats. Nine lactating homo-parity Baladi goats (average BW 23.8±0.4 kg) at 7 d postpartum were used in a triplicate 3×3 Latin square design with 30 d experimental periods. Goats were fed a basal diet containing 0 (Control), 0.25 (SRS25) and 0.45 (SRS45) (w/w, DM basis) of SRS. The Control diet was berseem clover and concentrate mixture (1:1 DM basis). The SRS45 had lowered total feed intake and forages intake compared to Control. The SRS25 and SRS45 rations had the highest digestibilities of DM (p = 0.0241) and hemicellulose (p = 0.0021) compared to Control which had higher (p<0.01) digestibilities of OM (p = 0.0002) and CP (p = 0.0005) than SRS25 and SRS45. Ruminal pH and microbial protein synthesis were higher (p<0.0001) for SRS25 and SRS45 than Control, which also had the highest (p<0.0001) concentration of TVFA, total proteins, non-protein N, and ammonia-N. All values of serum constituents were within normal ranges. The Control ration had higher serum globulin (p = 0.0148), creatinine (p = 0.0150), glucose (p = 0.0002) and cholesterol (p = 0.0016). Both Control and SRS25 groups had the highest (p<0.05) milk (p = 0.0330) and energy corrected milk (p = 0.0290) yields. Fat content was higher (p = 0.0373) with SRS45 and SRS25 groups compared with Control. Replacement of BC with SRS in goat rations increased milk levels of conjugated linoleic acid and unsaturated fatty acids compared with Control. It was concluded that replacing 50% of Egyptian berseem clover with SRS in goat rations improved their productive performance without marked effects on metabolic indicators health. PMID:25049962

Studies on the enzymes produced by Basidiomycetes. Part 1. The production of crude enzymes

Energy Technology Data Exchange (ETDEWEB)

Hong, J. S.; Kim, D.H.

1981-01-01

Cellulase, protease, and xylanase, formation by the basidiomycetes, Pleurotus ostreatus 301 and Lentinus edodes 3-1 in growth on rice straw medium were studied. Cultural conditions adequate for enzyme production and effects of various materials and inorganic salts added to the rice straw media were investigated. Lentinus edodes 3-1 was an excellent producer of cellulase and xylanase, and Pleurotus ostreatus 301 of protease. The optimum conditions for enzyme production were 30 degrees for cellulase production and at 25 degrees for xylanase and protease production, with 75% moisture content and initial pH of 5.0-6.0. The appropriate incubation times for enzyme production were 30 days and 35 days for Pleurotus ostreatus 301 and Lentinus edodes 3-1, respectively. Among the various materials added, defatted soybean, defatted rape seed, or defatted sesame were all effective in enzyme production but reduced mycelial growth. Rice bran was also effective, particularly at a 30% concentration. The addition of inorganic salts enhanced enzyme production. Among inorganic salts, the optimum concentration of CaCO3 was 5%, and that of CaSO4 was 2%.

African Journal of Biotechnology - Vol 14, No 8 (2015)

African Journals Online (AJOL)

Biodegradation of polycyclic aromatic hydrocarbons (PAHs) in spent and fresh cutting fluids contaminated soils by Pleurotus pulmonarius (Fries). Quelet and Pleurotus ostreatus (Jacq.) Fr. P. Kumm · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. CO Adenipekun, AR ...

The effects of composting on the nutritional composition of fibrous bio-regenerative life support systems (BLSS) plant waste residues and its impact on the growth of Nile tilapia ( Oreochromis niloticus)

Science.gov (United States)

Gonzales, John M.; Lowry, Brett A.; Brown, Paul B.; Beyl, Caula A.; Nyochemberg, Leopold

2009-04-01

Utilization of bio-regenerative life support systems (BLSS) plant waste residues as a nutritional source by Nile tilapia ( Oreochromis niloticus) has proven problematic as a result of high concentrations of fibrous compounds in the plant waste residues. Nutritional improvement of plant waste residues by composting with the oyster mushroom ( Pleurotus ostreatus), and the effects on growth and nutrient utilization of Nile tilapia fed such residues were evaluated. Five Nile tilapia (mean weight = 70.9 ± 3.1 g) were stocked in triplicate aquaria and fed one of two experimental diets, cowpea (CP) and composted cowpea (CCP), twice daily for a period of 8 weeks. Composting of cowpea residue resulted in reduced concentrations of nitrogen-free extract, hemi-cellulose and trypsin inhibitor activity, though trypsin inhibitor activity remained high. Composting did not reduce crude fiber, lignin, or cellulose concentrations in the diet. No significant differences ( P tilapia fed CP and CCP. These results suggest that P. ostreatus is not a suitable candidate for culture in conjunction with the culture of Nile tilapia. Additional work is needed to determine what, if any, benefit can be obtained from incorporating composted residue as feed for Nile tilapia.

Güney Kore’de Mantar Yetiştiriciliği

Directory of Open Access Journals (Sweden)

Mustafa Kemal Soylu

2016-03-01

Full Text Available Güney Kore’de son yıllarda mantar üretimi çok hızlı bir şekilde artmaktadır. Güney Kore mantar üretimi 173577 ton olup, bu üretimden yıllık 800 milyon dolar gelir elde edilmektedir. Farklı mantar türlerinin üretimi yapılmakta olup, üretim miktarının %31’ni kış mantarı (Flammulina velutipes, %26’sını kulacık mantarı (Pleurotus eryngii, %26’sını kayın mantarı (Pleurotus ostreatus, %13’ünü beyaz şapkalı kültür mantar (Agaricus bisporus, kalan %4’ünü ise Lentinula edodes, Ganoderma lucidum ve Phellinus vb. mantarlar oluşturmaktadır. 764ha’lık bir alanda mantar üretimi yapılmaktadır. Üretim alanının %31’inde kayın mantarı (Pleurotus ostreatus, %14’ünde kulacık mantarı (Pleurotus eryngii, %6’sında kış mantarı (Flummulina velutipes, %16’sında beyaz şapkalı kültür mantarı (Agaricus bisporus, %3’ünde Phellinus, %3’ünde ölümsüzlük mantarı (Ganoderma lucidum, %27’sı ise diğer mantar türlerinden oluşmaktadır. Kore’de mantar sıkça tüketilen bir gıda olup, kişi başına mantar tüketimi 4.2 kg’dır. Kütüklerde (meşe mantarı, ölümsüzlük mantarı ve Phellinus yetiştiricilik, ranzalarda yetiştiricilik (Agaricus bisporus ve Pleurotus ostreatus ve şişe kültürü (Flummulina velutipes, Pleurotus ostreatus, Pleurotus eryngii yaygın olarak yapılan yetiştirme sistemleridir.

Effect of fungal treatments of fibrous agricultural by-products on chemical composition and in vitro rumen fermentation and methane production

NARCIS (Netherlands)

Tuyen, D.V.; Phuong, H.N.; Cone, J.W.; Baars, J.J.P.; Sonnenberg, A.S.M.; Hendriks, W.H.

2013-01-01

Maize stover, rice straw, oil palm fronds and sugarcane bagasse were treated with the white-rot fungi Ceriporiopsis subvermispora, Lentinula edodes, Pleurotus eryngii, or Pleurotus ostreatus at 24 °C for 0–6 weeks. The fungi increased total gas production from oil palm fronds by 68–132%, but none of

Evaluation of the Efficacy of Fermented By-product of Mushroom, Pleurotus ostreatus, as a Fish Meal Replacer in Juvenile Amur Catfish, Silurus asotus: Effects on Growth, Serological Characteristics and Immune Responses

Science.gov (United States)

Katya, Kumar; Yun, Yong-hyun; Park, Gunhyun; Lee, Jeong-Yeol; Yoo, Gwangyeol; Bai, Sungchul C.

2014-01-01

The present experiment was conducted to evaluate the efficacy of dietary fermented by-product of mushroom, Pleurotus ostreatus, (FBPM) as a fish meal (FM) replacer in juvenile Amur catfish, Silurus asotus. A total number of 225 fish averaging 5.7±0.1 g (mean±standard deviation) were fed one of the five experimental diets formulated to replace FM with FBPM at 0%, 5%, 10%, 20%, and 30% (FBPM0, FBPM5, FBPM10, FBPM20, and FBPM30, respectively). At the end of eight weeks of the experiment, average weight gain (WG) of fish fed FBPM0 or FBPM5 were significantly higher than those of fish fed FBPM20 or FBPM30 diets (p<0.05). However, there was no significant differences in WG among the fish fed FBPM0, FBPM5 or FBPM10, and between fish fed FBPM10 or FBPM20, and also between those fed FBPM20 or FBPM30 diets. Lysozyme activity of fish fed FBPM0 or FBPM5 were significantly higher than those of fish fed FBPM10, FBPM20 or FBPM30 diets (p<0.05). The chemiluminescent response of fish fed FBPM5 was significantly higher than those of fish fed FBPM0, FBPM20 or FBPM30 diets (p<0.05). Broken line regression analysis of WG suggested that the maximal dietary inclusion level for FBPM as a FM replacer could be 6.3% without any adverse effects on whole body composition and on serological characteristics. Therefore, these results may indicate that the maximal dietary inclusion level of FBPM as a FM replacer could be 6.3% in juvenile Amur catfish. PMID:25178300

Usage of Edible Mushrooms in Various Food Products

Directory of Open Access Journals (Sweden)

Özge Süfer

2016-03-01

Full Text Available Using of edible mushrooms which are generally consumed in houses in dried form is based on mainly instant soup and sauce formulations. Recently, the cultivations of Agaricus bisporus and Pleurotus ostreatus species have become widespread. Utilization of these cultivated mushrooms in recipes would bring added value to related food products. For this purpose, Agaricus bisporus and Pleurotus ostreatus species farmed in Osmaniye Korkut Ata University Mushroom House were dried and then pulverized. Firstly, a snack was prepared with Agaricus bisporus powder. Agaricus bisporus powder was substituted for wheat flour at the rates of 5 %, 10 %, 20 % and 30 % and thus the potential of food product which had relatively lower carbohydrate and fat level and higher fiber content was investigated. In the second part of the study, either 5 %, 10 % of Agaricus bisporus powder or 5 %, 10 % of Pleurotus ostreatus powder were added into traditional Turkish meatball (beef mince, salt which was cooked in conventional oven, so meat flavor could be replaced by herbal flavor coming from mushroom. This property mat obey the purpose that, the created new product will be consumed fondly especially by children. Sensory and physical (colour and texture analysis were performed in both snack and meatball samples and the results were evaluated statistically.

Cultivation of different strains of king oyster mushroom (Pleurotus eryngii) on saw dust and rice straw in Bangladesh.

Science.gov (United States)

Moonmoon, Mahbuba; Uddin, Md Nazim; Ahmed, Saleh; Shelly, Nasrat Jahan; Khan, Md Asaduzzaman

2010-10-01

Pleurotus eryngii is a popular mushroom due to its excellent consistency of cap and stem, culinary qualities and longer shelf life. In Bangladesh, where Pleurotus mushrooms are very popular, P. eryngii may take position among the consumers, but currently this mushroom is not cultivated in large scale there. In this study, 3 strains of P. eryngii such as Pe-1 (native to Bangladesh), Pe-2 (germplasm collected from China) and Pe-3 (germplasm collected from Japan) were cultivated on saw dust and rice straw and their growth and yield parameters were investigated. Pe-1 on saw dust showed the highest biological yield and efficiency (73.5%) than other strains. Also, the mycelium run rate and number of fruiting bodies were higher in Pe-1 than other two strains. The quality of mushroom strains was near about similar. On saw dust, the yield and efficiency were better than those cultivated on rice straw, however, on straw; the mushroom fruiting bodies were larger in size. This study shows the prospects of P. eryngii cultivation in Bangladesh and suggests further study in controlled environment for higher yield and production.

78 FR 62293 - Safety Zone, Oyster Festival 30th Anniversary Fireworks Display, Oyster Bay; Oyster Bay, NY

Science.gov (United States)

2013-10-15

... Safety Zone, Oyster Festival 30th Anniversary Fireworks Display, Oyster Bay; Oyster Bay, NY AGENCY: Coast... zone on the navigable waters of Oyster Bay near Oyster Bay, NY for the Oyster Festival 30th Anniversary... Oyster Festival 30th Anniversary Fireworks Display is scheduled for October 19, 2013 and is one of...

The use of residual geothermal energy in an edible mushroom production plant, Los Humeros geothermal fields (Mexico): Achievements and alternatives; El uso de la energia geotermica residual en la planta productora de hongos comestibles del campo geotermico Los Humeros (Mexico): Logros y alternativas

Energy Technology Data Exchange (ETDEWEB)

Rangel Rangel, Maria Elena [Proteccion ambiental, Puebla (Mexico)

2000-12-01

A plant for raising edible mushrooms with residual geothermal energy is a project of the Comision Federal de Electricidad (CFE). The results reflect important achievements in the development of technology for the productions of wholesome and available food with geothermal heat instead of conventional energy sources. The installations have an enormous technological and commercial potential- demonstrated by the cultivation of oyster mushrooms (Pleurotus ostreatus), which success has awakened the interest of research institutions. The Instituto of Ecologia, A.C., has begun a joint project with CFE cultivating shiitake mushrooms (Lentinula edodes) with geothermal energy. These achievements mark a clear trend toward the integral use of facilities, the establishment of a crop with greater economic advantages, and the diffusion of this project. [Spanish] La planta productora de hongos comestibles es un proyecto de la Comision Federal de Electricidad (CFE) para dar un uso alterno a la energia geotermica residual. Los resultados obtenidos hasta el momento reflejan logros importantes en la generacion de tecnologia propia para la produccion de un alimento sano y accesible, sustituyendo la energia proveniente de combustibles convencionales por calor geotermico. Las instalaciones creadas cuentan con un enorme potencial tecnologico y comercial demostrando con el cultivo de las setas (Pleurotus ostreatus) con un exito tal que ha despertado el interes de instituciones dedicadas a la investigacion. Tal es el caso de Instituto de Ecologia, A.C que acualmente se encuentra involucrado en un proyecto conjunto sobre el cultivo del hongo Lentinula edodes (shiitake) utilizando energia geotermica en su proceso productivo. Con lo anterior, se esta marcando una clara tendencia hacia el aprovechamiento integral de las instalaciones, el establecimiento de un cultivo con mayores ventajas economicas y la difusion de este proyecto.

FORMULASI SOSIS ANALOG SUMBER PROTEIN BERBASIS TEMPE DAN JAMUR TIRAM SEBAGAI PANGAN FUNGSIONAL KAYA SERAT PANGAN

Directory of Open Access Journals (Sweden)

Dewi Pratiwi Ambari

2014-08-01

Full Text Available ABSTRACTThe purpose of this study was to develop formula of sausage based on tempeh flour with the addition of oyster mushroom (Pleurotus ostreatus as functional food rich in protein and dietary fiber as healthy snack product for children. Sausage was formulated by addition of oyster mushroom used trial and error method. A selected formula was determined based on semi trained panelist preference. Acceptance of the selected sausage formula was examine by children using hedonic test. The contribution of protein and dietary fiber contained in sausage per serving size (50 g was calculated for general consumer. The accepted sausage with 20% oyster mushroom addition contained 24% of protein and can be claimed as source of protein and 7.64 g of dietary fiber per 100 g and can be claimed rich in dietary fiber.Keywords: dietary fiber, oyster mushroom, protein, sausage, tempehABSTRAKTujuan penelitian ini adalah untuk mengembangkan formula sosis berbasis tempe dengan penambahan jamur tiram sebagai pangan fungsional kaya protein dan serat pangan untuk produk camilan sehat bagi anak-anak. Sosis diformulasikan dengan penambahan jamur tiram melalui metode trial dan error. Formula terpilih ditentukan berdasarkan kesukaan panelis semi terlatih. Penerimaan sosis formula terpilih dilakukan terhadap anak-anak melalui uji hedonik. Kontribusi protein dan serat pangan pada sosis per takaran saji (50 g dihitung untuk konsumen umum. Sosis terpilih dengan penambahan 20% jamur tiram mengandung 24% protein sehingga dapat diklaim sebagai sumber protein dan 7.64 g serat pangan per 100 g sehingga dapat diklaim kaya serat pangan.Kata kunci: jamur tiram, protein, serat pangan, sosis, tempe

Interaction of uranium with Pleurotus sp

International Nuclear Information System (INIS)

Ohnuki, Toshihiko; Sakamoto, Fuminori; Kozaki, Naofumi; Ozaki, Takuro; Samadfam, Mohammad

2002-01-01

Uptake of uranium by higher fungi, such as mushroom is little elucidated. We have studied the interaction of uranium with Pleurotus sp. (a mushroom) in pure culture over a wide range of U concentration (50-3000 mg/L). The Pleurotus sp. was cultured in two different media. One was rice bran medium, and the other was agar (yeast extract, peptone and dextrose) medium. The uptake of uranium in Pleurotus sp. was examined by alpha ray autoradiography (A,A), X-ray fluorescence spectroscopy (XRF) and scanning microcopy (SEM) equipped with EDS. In the agar medium, the higher uranium concentration gave lower growth of mycelia, and no fruiting body was observed. In the rice bran medium, the fruiting body was grown at U concentrations up to 1000 mg/L. The AA and XRF analysis showed that uranium taken up in the fruiting body was below the detection limit. The SEM-EDS analysis indicated that U was distributed in the limited region and was not transported to the mycelia far from U containing medium. It is concluded that uranium affects the growth of Pleurotus sp., and little uranium is taken up by Pleurotus sp. during the growth of both mycelia and fruiting body. (author)

The effect of polythene colour container and three spawn rates on ...

African Journals Online (AJOL)

Pleurotus ostreatus), experiment was carried out to investigate the cultivation on barely straws substrate. This cultivation system can improve the economic status of the farmer. Field experiment was conducted at College of Agriculture, ...

Beta-Glucan Synthase Gene Expression in Pleurotus sp

International Nuclear Information System (INIS)

Azhar Mohamad; Nie, H.J.

2016-01-01

Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

Antonella Amore | NREL

Science.gov (United States)

Pleurotus ostreatus," Biotechnol. Appl. Biochem. (2014) "Enzymes for Food and Beverage Industries and beverage processing fermentations," in Fermentation Processes Engineering in the Food : Current Situation, Challenges and Perspectives" in Advances in Food Biotechnology (2013) "

Noroviruses in oysters from local markets and oyster farms in southern Thailand.

Science.gov (United States)

Kittigul, Leera; Pombubpa, Kannika; Sukonthalux, Suntharee; Rattanatham, Tippawan; Utrarachkij, Fuangfa

2011-01-01

One hundred and eighteen oyster samples collected from local markets and oyster farms in southern Thailand were examined for noroviruses (NoVs) and bacterial indicators of fecal contamination (fecal coliforms and Escherichia coli). Using a virus concentration procedure followed by RT-nested PCR, NoVs were detected in 38% of the samples. Oysters collected from oyster farms were found with NoVs at a higher detection rate (25/53 samples) than oysters from local markets (20/65 samples). Of the 45 NoV-positive oyster samples, 67% belonged to NoV genogroup I (GI), 15% to GII, and 18% to both GI and GII. DNA sequencing showed that 2 NoVs belonged to NoV GI-2 genotype. Fecal coliforms in NoV-positive oyster samples were in the range of oyster samples contained fecal coliforms within the standard acceptable level of raw shellfish (oyster samples were within acceptable levels of E. coli contamination (oysters obtained from both markets and oyster farms might pose a potential risk of acute gastroenteritis associated with raw oyster consumption. Examination for both fecal bacterial indicators and enteric viruses should be conducted for microbiological food safety of shellfish.

Simultaneously upgrading biogas and purifying biogas slurry using cocultivation of Chlorella vulgaris and three different fungi under various mixed light wavelength and photoperiods.

Science.gov (United States)

Cao, Weixing; Wang, Xue; Sun, Shiqing; Hu, Changwei; Zhao, Yongjun

2017-10-01

In order to purify biogas slurry and biogas simultaneously, three different fungi, Pleurotus geesteranus (P. geesteranus), Ganoderma lucidum (G. lucidum), and Pleurotus ostreatus (P. ostreatus) were pelletized with Chlorella vulgaris (C. vulgaris). The results showed that the optimal light wavelength ratio for red:blue was 5:5 for these three different fungi-assisted C. vulgaris, resulting in higher specific growth rate as well as nutrient and CO 2 removal efficiency compared with other ratios. G. lucidum/C. vulgaris was screened as the best fungi-mialgae for biogas slurry purification and biogas upgrading with light/dark ratio of 14h:10h, which was also confirmed by the economic efficiency analysis of the energy consumptions. These results will provide a theoretical foundation for large-scale biogas slurry purifying and biogas upgrading using microalgae. Copyright © 2017 Elsevier Ltd. All rights reserved.

Books received by the Rijksherbarium library

NARCIS (Netherlands)

NN,

1993-01-01

Pleurotus ostreatus and P. pulmonarius, wood-destroying and edible basidiomycetes, were the subject of an ecophysiological study with regard to the connection between water household in the fruitbody and sporulation. Field observations were combined with controlled laboratory experiments on

Growth of colonies and hyphal ultrastructure of filamentous fungi grown on dibutyl phthalate and di(2-ethylhexyl)phthalate

OpenAIRE

Suárez-Segundo, J.L.; Vázquez-López, D.; Torres-García, J.L.; Ahuactzin-Perez, M.; Montiel-Martínez, N.; Tlecuitl-Beristain, S.; Sánchez, C.

2013-01-01

Phthalates are compounds that give fl exnbíüty to the plastics and are considered mutagens and teratogens. Mycelial growth rate, biomass production and hyphal diameter of the young and mature zones of colonies of Fusarium oxysporum, Mortierella alpina, Pleurotuspulmonarius, two strains of Pleurotus ostreatus (Po 37 and Po 83) and one strain of Pleurotus florida grown on glucose, di(2-ethylhexyl) phthalate (DEHP) and dibutyl phthalate were studied. F oxysporum had the highest mycelial growth r...

African Journal of Biotechnology - Vol 11, No 88 (2012)

African Journals Online (AJOL)

Decolourization and degradation of azo Dye, Synozol Red HF6BN, by Pleurotus ostreatus · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Sidra Ilyas, Skinder Sultan Sultan, Abdul Rehman, 15422-15429 ...

Effect of inclusion of oyster mushroom substrate on the in vitro fermentation kinetics of Brachiaria brizantha hay

Directory of Open Access Journals (Sweden)

Ricardo da Silva Oliveira

2015-07-01

Full Text Available The objective of this study was to evaluate the effect of inclusion of exhausted substrate of Pleurotus ostreatus on the in vitro fermentation of Brachiaria brizantha hay-based diets. The experiment was conducted using the semi-automated gas production technique. The ruminal inoculum was collected from three fistulated cattle kept on Brachiaria brizantha pasture. Brachiaria brizantha hay and exhausted substrate of Pleurotus production were used for composition of the diets: ES (100% exhausted substrate, BH (100% Brachiaria brizantha hay, ES5 (5% ES + 95% BH, ES20 (20% ES + 80% BH, and ES30 (30% ES + 70% BH. The experimental design was a 5x3 factorial scheme consisting of five treatments and three ruminal inocula. The degradation kinetics of dry matter (DM was determined after 96 hours of fermentation [D (96h]. No significant differences in the cumulative volume of gas (A were observed between BH (262.6 mL/g DM, ES5 (284.3 mL/g MS, ES20 (256.6 mL/g MS and ES30 (261.7 mL/g MS, indicating that inclusion of the substrate did not affect hay fermentation. A lower gas volume (165.9 mL and lower degradability (52% were observed for the ES diet, showing a lower nutritional value of this substrate compared to Brachiaria brizantha hay, probably due to the action of enzymes that degrade structural carbohydrates found in the mycelia of Pleurotus. The ES diet exhibited a shorter colonization time (L=2.6 h; P<0.05, a finding that may be attributed to the interaction between the mycelium and substrate, facilitating initial colonization. The inclusion of exhausted substrate did not increase microbial growth or degradation compared to the BH diet, but seems to have favored initial colonization of this substrate. The use of ES does not negatively affect colonization and may be used as an ingredient of ruminant diets.

The hot oyster: levels of virulent Vibrio parahaemolyticus strains in individual oysters.

Science.gov (United States)

Klein, Savannah L; Lovell, Charles R

2017-02-01

Vibrio parahaemolyticus is the leading cause of seafood-associated gastroenteritis and is most commonly transmitted by raw oysters. Consequently, detection of virulent strains of this organism in oysters is a primary concern for seafood safety. Vibrio parahaemolyticus levels were determined in 110 individual oysters harvested from two sampling sites in SC, USA. The majority of oysters (98%) contained low levels of presumptive V. parahaemolyticus However, two healthy oysters contained presumptive V. parahaemolyticus numbers that were unusually high. These two 'hot' oysters contained levels of presumptive V. parahaemolyticus within the gills that were ∼100-fold higher than the average for other oysters collected at the same date and location. Current V. parahaemolyticus detection practices require homogenizing a dozen oysters pooled together to determine V. parahaemolyticus numbers, a procedure that would dilute out V. parahaemolyticus in these 'hot' oysters. This study demonstrates the variability of V. parahaemolyticus densities taken from healthy, neighboring individual oysters in the environment. Additionally, environmental V parahaemolyticus isolates were screened for the virulence-related genes, tdh and trh, using improved polymerase chain reaction primers and protocols. We detected these genes, previously thought to be rare in environmental isolates, in approximately half of the oyster isolates. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Composted oyster shell as lime fertilizer is more effective than fresh oyster shell.

Science.gov (United States)

Lee, Young Han; Islam, Shah Md Asraful; Hong, Sun Joo; Cho, Kye Man; Math, Renukaradhya K; Heo, Jae Young; Kim, Hoon; Yun, Han Dae

2010-01-01

Physio-chemical changes in oyster shell were examined, and fresh and composted oyster shell meals were compared as lime fertilizers in soybean cultivation. Structural changes in oyster shell were observed by AFM and FE-SEM. We found that grains of the oyster shell surface became smoother and smaller over time. FT-IR analysis indicated the degradation of a chitin-like compound of oyster shell. In chemical analysis, pH (12.3+/-0.24), electrical conductivity (4.1+/-0.24 dS m(-1)), and alkaline powder (53.3+/-1.12%) were highest in commercial lime. Besides, pH was higher in composted oyster shell meal (9.9+/-0.53) than in fresh oyster shell meal (8.4+/-0.32). The highest organic matter (1.1+/-0.08%), NaCl (0.54+/-0.03%), and moisture (15.1+/-1.95%) contents were found in fresh oyster shell meal. A significant higher yield of soybean (1.33 t ha(-1)) was obtained by applying composted oyster shell meal (a 21% higher yield than with fresh oyster shell meal). Thus composting of oyster shell increases the utility of oyster shell as a liming material for crop cultivation.

Oysters and Oyster Reef Communities in Florida.

Science.gov (United States)

Knight, Jean; Bly, Joe

1989-01-01

The habitat, life history, feeding, classification, anatomy and pearl production of the American oyster (Crassostrea virginica) are presented. A list of other oyster reef inhabitants and predators is provided. Harvest and habitat loss are discussed. (CW)

Biodegradation of hydrocarbons exploiting spent substrate from ...

African Journals Online (AJOL)

SAM

2014-08-13

Aug 13, 2014 ... Key words: Bioremediation, diesel, laccase, veratryl alcohol oxidase, Pleurotus ostreatus. ... Abbreviations: Lac, Laccases; MnP, Manganese peroxidases; VP, versatile peroxidases; VAO, veratryl alcohol oxidases; SMS, ..... Hacia un desarrollo sostenible del sistema de producción-consumo de los hongos ...

Pleurotus sajor caju

African Journals Online (AJOL)

Administrator

The influence of fungus treatment on the biochemical composition and degradation patter of sawdust and cotton plant by-products (cotton burns and cotton gin trash) by Pleurotus sajor caju were evaluated. Lignin degradation increased as the incubation period progressed while the highest loss of hemicellulose, cellulose ...

Mechanical properties and chemical composition of beech wood exposed for 30 and 120 days to white-rot fungi

Science.gov (United States)

Ehsan Bari; Hamid Reza Taghiyari; Behbood Mohebby; Carol A. Clausen; Olaf Schmidt; Mohammad Ali Tajick Ghanbary; Mohammad Javad Vaseghi

2015-01-01

The effects of exposing specimens of Oriental beech [Fagus sylvatica subsp. orientalis (Lipsky) Greuter and Burdet] to the white-rot fungi Pleurotus ostreatus (Jacq.: Fr.) Kummer and Trametes versicolor (L.: Fr.) Pilát strain 325 have been studied concerning the mechanical properties and...

SACCHARIFICATION WITH Phanerochaete chrysosporium and ...

African Journals Online (AJOL)

cantocanche

2011-05-09

May 9, 2011 ... and Pleurotus ostreatus enzymatic extracts of pretreated banana ... reduction in the cost of production (Hahn-Hägerdal et al., ... economy, the saccharification of these materials is necessary ... To efficiently process lignocellulosic wastes, the lignin ..... industries depend on the success in saccharification.

Uptake of cadmium from Pacific oysters (Crassostrea gigas) in British Columbia oyster growers

International Nuclear Information System (INIS)

Copes, Ray; Clark, Nina Annika; Rideout, Karen; Palaty, Jan; Teschke, Kay

2008-01-01

Background: Pacific oysters along the North American coast from Washington to Alaska contain concentrations of cadmium (Cd) that are high by comparison with Atlantic oysters, frequently exceeding 2 μg/g wet weight, but it is unclear whether this Cd is absorbed by consumers. Objectives: To determine the effect of oyster consumption on Cd in blood and urine among a group with high oyster consumption. Methods: Sixty-one non-smoking oyster growers and family members with a mean age of 47.3±7.6 years (range 33-64) were interviewed by telephone to assess their oyster consumption and other sources of Cd exposure at present and 5 years prior to the start of oyster farming. Their blood and urine Cd concentrations were measured. Results: The geometric mean Cd concentration in blood was 0.83 μg/L and in urine was 0.76 μg/g creatinine. Thirty-six percent of participants had urinary Cd levels above 1 μg/g creatinine and 5% were above 2 μg/g creatinine. Recent (last 12 months) and long-term oyster consumptions were positive predictors of blood Cd but did not directly predict urinary Cd. The optimal model for predicting the variance in blood Cd included recent intake of oyster-derived Cd, serum iron concentration and recent ketchup consumption (R 2 =0.34, p=0.00004), with the latter two variables showing a protective effect. The factors found to predict urinary Cd were blood Cd concentration and duration of oyster farming. A rise in blood Cd was observed after 12 years of farming oysters, likely caused by higher consumption of oysters during this period. Conclusions: Oyster-derived Cd is bioavailable and affects body stores of the metal

Calculation of Oyster Benefits with a Bioenergetics Model of the Virginia Oyster

Science.gov (United States)

2014-11-01

soft tissue, and reproduction. Inorganic carbon incorporated into shell CaCO3 is considered separately. The organic carbon sequestered in biomass ...oyster biomass (dry tissue weight); • oyster age vs. shell length; • standing stock (population and biomass ); • shell accretion rates; • age...that found use in model parameterization and validation included: • individual oyster biomass (dry tissue weight); • oyster age vs. shell length

Pengaruh mutasi dengan radiasi sinar gamma (CO₆₀ terhadap produktivitas jamur tiram abu-abu (Pleurotus sajur-caju

Directory of Open Access Journals (Sweden)

Ira Djajanegara

2012-02-01

Full Text Available Irradiation aplied to living organisms may have positive or negative effects on physiological and morphological properties of the organisms. One way to gain genetic variation with better properties than the parental strain is by Gamma (Co 60 radiation application. During this experiment, Gama (Co 60 rays was applied to the grey oyster (Pleurotus sajur-caju mushroom mycellia during exponential phase. Radiation was applied at 0.75 KGray with dose velocity of 1.149 KGray. Analysis of mushroom productivity performances indicate that diameter of mycellia, fresh weight, dry weight, diameter of fruit body and the amount of fruit body of the mutant and control were not significantly different. However, the isozyme pattern showed a different pattern between the mutant and the control which indicates that mutation process has already occured. These data show that mutation did not affect the productivity of the mushroom. Therefore, mutation may affect the nutritional quality of the mushroom instead. Further experiment to verify this possibility is suggested.

Decolourization of remazol brilliant blue R by enzymatic extract and ...

African Journals Online (AJOL)

Ezedom Theresa

2013-09-25

Sep 25, 2013 ... extract and submerged cultures of a newly isolated. Pleurotus ostreatus ... stable to light, temperature, and microbial attack, making them recalcitrant ... was also cultivated in media formulated with inducers to increase laccase ... performed by using heat inactivated enzymes after incubation at. 100°C for 10 ...

Comparison of mushroom yield for Pleurotus Sajor Caju and Pleurotus Florida in different number of flushes

International Nuclear Information System (INIS)

Rosnani Abdul Rashid; Mat Rasol Awang; Hassan Hamdani Hassan Mutaat; Meswan Maskom

2006-01-01

This paper aimed at comparing the mushroom yield of Pleurotus sajor caju and Pleurotus florida which was harvested in five flushes. The γ-irradiated empty fruit bunch (EFB) at 25kGy was used as cultivation substrate. About 1 to 2% liquid seed of P. sajor caju and P. florida was inoculated into cultivation substrate. After 30 days, the inoculated substrate was opened for fruiting. For both species, the maximum mushroom yield was obtained in first flush and the lowest yield from the fifth flush. This show the mushroom yield is affected by number of flush. From analysis, the mushroom yield of P. florida was much better compared to P. sajor caju for all flushes. (Author)

21 CFR 161.136 - Olympia oysters.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Olympia oysters. 161.136 Section 161.136 Food and... oysters. Olympia oysters, raw Olympia oysters, shucked Olympia oysters, are of the species Ostrea lurida and conform to the definition and standard of identity prescribed for oysters in § 161.130. ...

DOI: 10.18697/ajfand.79.16235 12243 PROXIMATE COMPOSITION ...

African Journals Online (AJOL)

Native rice husk (NRH) was fermented with Pleurotus ostreatus for 7, 14 and 21 days to improve the nutritional values. The proximate composition and amino acid profiles were determined. The results showed that crude fibre (CF), nitrogen free extract (NFE), acid detergent fibre (ADF), and neutral detergent fibre (NDF) were ...

Browse Title Index

African Journals Online (AJOL)

Items 101 - 150 of 11090 ... Asma Murtaza, Shazia Shafique, Tehmina Anjum, Sobiya Shafique. Vol 12, No 46 (2013), In vitro cultivation of Pleurotus ostreatus and Lentinula edodes in lignocellulosic residues from Amazon, Abstract PDF. Ceci Sales-Campos, Diego A. Pires, Samira R. L. Barbosa, Raimunda Liége S. Abreu, ...

African Journal of Biotechnology - Vol 12, No 46 (2013)

African Journals Online (AJOL)

In vitro cultivation of Pleurotus ostreatus and Lentinula edodes in lignocellulosic residues from Amazon · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Ceci Sales-Campos, Diego A. Pires, Samira R. L. Barbosa, Raimunda Liége S. Abreu, Meire C. N. Andrade, 6526- ...

Proximate composition and amino acid profile of rice husk ...

African Journals Online (AJOL)

Native rice husk (NRH) was fermented with Pleurotus ostreatus for 7, 14 and 21 days to improve the nutritional values. The proximate composition and amino acid profiles were determined. The results showed that crude fibre (CF), nitrogen free extract (NFE), acid detergent fibre (ADF), and neutral detergent fibre (NDF) were ...

INFLUENCIA DE LA ADICIÓN DE UNA FUENTE DE NITRÓGENO EN LA PRODUCCIÓN DE LIGNINASAS INFLUENÇA DA ADIÇÃO DE UMA FONTE DE NITRÔGENIO NA PRODUÇÃO DE LIGNINASE INFLUENCE THE ADDITION OF NITROGEN SOURCE ON PRODUCTION OF LIGNINASES

Directory of Open Access Journals (Sweden)

LINA MARCELA GIL

2012-06-01

Full Text Available Durante el proceso de extracción de aceite de palma se producen grandes cantidades de residuos ricos en lignina y hemicelulosa denominados 'raquis', los cuales fueron un buen sustrato para el crecimiento del hongo Pleurotus ostreatus en fase solida durante 10 días de fermentación y a una temperatura de 28°C. Este trabajo se enfoco en evaluar la actividad enzimática de la lacasa, manganeso peroxidasa y lignina peroxidasa a partir del cultivo de Pleurotus ostreatus sobre residuos de palma modificando las condiciones de tamaño de partícula del sustrato (2, 3 y 4 cm y la fuente de nitrógeno (NH4Cl y KNO3. La actividad de la lignina peroxidasa fue casi nula en el sustrato sin suplemento. Por otro lado, las mejores condiciones encontradas para la producción de lacasa (7,42 U/L fue en cultivo sin suplemento con tamaño de partícula de 3cm, y para manganeso peroxidasa (20,29 U/L fue en el cultivo suplementado con nitrato de amonio (NH4Cl en una relación de carbono/nitrógeno de 20 y un tamaño de partícula de 3cm.Durante o processo de extração de óleo de palma são produzidas grandes quantidades de resíduos que são ricos em lignina e hemicelulose, os quais foram um bom substrato para o crescimento do fungo Pleurotus ostreatus na fermentação durante 10 dias a uma temperatura de 28 ° C na fase sólida. Este trabalho concentrou-se em avaliar a atividade enzimática da lacase, manganese peroxidase e lignina peroxidase de Pleurotus ostreatus em resíduos de palma de óleo mudando as condições do tamanho das partículas do substrato (2, 3 e 4 cm e fonte de nitrogênio (NH4Cl e KNO3. Os resultados mostraram que a atividade da peroxidase lignina foi quase zero no substrato sem adição de suplemento. Para a produção de lacase (7,42 U/L a melhor condição foi encontrada para um tamanho de partícula de três centímetros sem adição de suplemento, e para manganese peroxidasa (20,29 U/L a melhor condição é para uma cultura com nitrato

Cloning and sequencing of phenol oxidase 1 (pox1) gene from ...

African Journals Online (AJOL)

The gene (pox1) encoding a phenol oxidase 1 from Pleurotus ostreatus was sequenced and the corresponding pox1-cDNA was also synthesized, cloned and sequenced. The isolated gene is flanked by an upstream region called the promoter (399 bp) prior to the start codon (ATG). The putative metalresponsive elements ...

Author Details

African Journals Online (AJOL)

Osafo, E L. Vol 47, No 1 (2014) - Articles Some blood indices in finisher broiler chickens fed cocoa pod husk (Theobroma cacao L.) fermented with Pleurotus ostreatus or treated with enzymes as ingredients in their diets. Abstract. ISSN: 0855-0042. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for ...

Oyster radiation sensitivity

International Nuclear Information System (INIS)

Marchese, Sandra R.M.; Mastro, Nelida L. del

1996-01-01

Various food products like oysters, crabs and shrimps have been described as possible Vibrio spp. transmitting agents. Seafood irradiation is been presented as an alternative among the different public health intervention measures to control food borne diseases. The objective of this work was to establish, firstly, the radioresistance of Crassostrea brasiliana oysters. The oysters were irradiated with Co-60 radiation with doses of 0, 1.5,3 and 6 kGy. Survival curves a function of time showed that 100% of samples irradiated with 3 kGy survived at least 6 days; among those irradiated with 6 kGy, 100% survived 3 days. These results are encouraging since a dose of 2 kGy is already effective in diminishing oyster bioburden. (author)

Recycling of Date-Palm Fiber to Produce Pleurotus Cornucopiae Var. Citrinopileatus Mushroom

Directory of Open Access Journals (Sweden)

Mustafa Nadhim Owaid

2017-01-01

Full Text Available In this study, some local available organic matters, which are including wheat straw (Triticum aestivum, sawdust, and fiber of date palm (Phoenix dactylifera L., were used for growing and cultivating of bright yellow oyster mushroom Pleurotus cornucopiae var. citrinopileatus. The possibility of using date palm fiber (in mixtures with other organic residues as a substrate for the cultivation and production of fruiting bodies of P. cornucopiae var. citrinopileatus was investigated. This mushroom is capable of biorecycling and utilization of some mixtures of lignocellulosic substrates successfully, especially the mixture S3 (50% wheat straw, 30% sawdust, and 20% date palm fiber. The lower mycelia completion time was 17 days, that shown in bags of the S3 substrate. Date-palm fiber substrate exhibited best growth intensity level (moderate significantly (p<0.05. The total yield and biological efficiency percent recorded approx. 90 g and 23% on the S3 substrate respectively, as a higher percent significantly (p<0.05, while sawdust substrate alone was an unsuitable medium for cultivation and production of this mushroom. Finally, the use of date-palm fibers in mixtures is usefulness in producing a fresh edible and medicinal mushroom.INTERNATIONAL JOURNAL OF ENVIRONMENTVolume-5, Issue-4, Sep-Nov 2016, page: 56-65

Oyster mushroom cultivation with rice and wheat straw.

Science.gov (United States)

Zhang, Ruihong; Li, Xiujin; Fadel, J G

2002-05-01

Cultivation of the oyster mushroom, Pleurotus sajor-caju, on rice and wheat straw without nutrient supplementation was investigated. The effects of straw size reduction method and particle size, spawn inoculation level, and type of substrate (rice straw versus wheat straw) on mushroom yield, biological efficiency, bioconversion efficiency, and substrate degradation were determined. Two size reduction methods, grinding and chopping, were compared. The ground straw yielded higher mushroom growth rate and yield than the chopped straw. The growth cycles of mushrooms with the ground substrate were five days shorter than with the chopped straw for a similar particle size. However, it was found that when the straw was ground into particles that were too small, the mushroom yield decreased. With the three spawn levels tested (12%, 16% and 18%), the 12% level resulted in significantly lower mushroom yield than the other two levels. Comparing rice straw with wheat straw, rice straw yielded about 10% more mushrooms than wheat straw under the same cultivation conditions. The dry matter loss of the substrate after mushroom growth varied from 30.1% to 44.3%. The straw fiber remaining after fungal utilization was not as degradable as the original straw fiber, indicating that the fungal fermentation did not improve the feed value of the straw.

Oysters and Vibriosis

Science.gov (United States)

... this? Submit What's this? Submit Button Past Emails Oysters and Vibriosis Language: English (US) Español (Spanish) Recommend ... is to cook them properly. Tips for Cooking Oysters & Other Shellfish Before cooking, throw out any shellfish ...

Bioremediation of long-term PCB-contaminated soil by white-rot fungi

Czech Academy of Sciences Publication Activity Database

Stella, Tatiana; Covino, Stefano; Čvančarová, Monika; Filipová, Alena; Petruccioli, M.; D´Annibale, A.; Cajthaml, Tomáš

2017-01-01

Roč. 324, FEB 15 PART B (2017), s. 701-710 ISSN 0304-3894 R&D Projects: GA TA ČR TE01020218; GA ČR(CZ) GA15-02328S Institutional support: RVO:61388971 Keywords : Pleurotus ostreatus * Ligninolytic fungi * Polychlorinated biphenyls Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 6.065, year: 2016

Growth of the mycelium of different basidiomycetes on various media

International Nuclear Information System (INIS)

Nasreen, Z.; Kausar, T.; Baig, S.; Bajwa, R.

2008-01-01

Potato dextrose extract as solid or liquid static media was found best medium tested for both rate and amount of fungal growth of Pleurotus ostreatus, Ganoderma lucidum, Coriolus versicolor and Schizophyllum commune strains. Malt, Yeast and kirk + glucose making second and third respectively, for rate and amount of fungal growth. Kirk+ molasses was the fourth best medium. Addition of sucrose, glucose and molasses as carbon sources, increased the mycelial growth in each fungal species. Similarly, the Highest fresh and dry weight in submerged fermentation was observed for P.ostreatus, G.lucidum. C.versicolor and S.commune in sucrose and glucose as compared to molasses media. (author)

High-pressure treatment for shelf-life extension and quality improvement of oysters cooked in a traditional Taiwanese oyster omelet.

Science.gov (United States)

Lai, Kung-Ming; Chi, Hsin-Yi; Hsu, Kuo-Chiang

2010-01-01

Whole oysters were processed using high-pressure (HP) treatment at 250 and 300 MPa for 0 to 10 min and stored at 4 degrees Celsius for up to 28 days. HP-treated oysters and untreated oysters were evaluated for lipid oxidation, growth of microorganisms, and sensory characteristics after cooking at 160 degrees Celsius for 90 s. Microbial counts after HP treatment revealed that the bacterial load was initially reduced at all pressures. HP-treated oysters had significantly higher pH and moisture (P oysters during storage. HP treatment increased lipid oxidation with unpleasant odor during storage compared with the control. HP treatment decreased redness but did not significantly affect the brightness and yellowness of cooked oysters. From tests of mechanical properties, 300 MPa-treated oysters after cooking had significantly increased toughness as measured by cutting force. HP-treated oysters after cooking received higher quality scores than did the control during the storage trial. Results indicated that 300 MPa for 2 min is the optimum HP treatment that results in oysters most acceptable for oyster omelets during storage at 4 degrees Celsius, and this treatment may extend the shelf life of these oysters to 21 days.

A microbial spoilage profile of half shell Pacific oysters (Crassostrea gigas) and Sydney rock oysters (Saccostrea glomerata).

Science.gov (United States)

Madigan, Thomas L; Bott, Nathan J; Torok, Valeria A; Percy, Nigel J; Carragher, John F; de Barros Lopes, Miguel A; Kiermeier, Andreas

2014-04-01

This study aimed to assess bacterial spoilage of half shell Pacific and Sydney rock oysters during storage using microbial culture and 16S rRNA pyrosequencing. Odour and pH of oyster meats were also investigated. Estimation of microbiological counts by microbial culture highlighted growth of psychrotrophic bacteria. During storage, odour scores (a score describing deterioration of fresh odours where a score of 1 is fresh and 4 is completely spoiled) increased from 1.0 to 3.0 for Pacific oysters and from 1.3 to 3.4 for Sydney rock oysters. pH results obtained for both species fluctuated during storage (range 6.28-6.73) with an overall increase at end of storage. Pyrosequencing revealed that the majority of bacteria at Day 0 represented taxa from amongst the Proteobacteria, Tenericutes and Spirochaetes that have not been cultured and systematically described. During storage, Proteobacteria became abundant with Pseudoalteromonas and Vibrio found to be dominant in both oyster species at Day 7. Analysis of the pyrosequencing data showed significant differences in bacterial profiles between oyster species and storage time (both P = 0.001). As oysters spoiled, bacterial profiles between oyster species became more similar indicating a common spoilage profile. Data presented here provides detailed insight into the changing bacterial profile of shucked oysters during storage and has identified two genera, Pseudoalteromonas and Vibrio, as being important in spoilage of shucked oysters. Copyright © 2013 Elsevier Ltd. All rights reserved.

Feeding traits of the European flat oyster, Ostrea edulis, and the invasive Pacific oyster, Crassostrea gigas

DEFF Research Database (Denmark)

Nielsen, Mette; Hansen, Benni Winding; Vismann, Bent

2017-01-01

Two oysters, the native flat oyster, Ostrea edulis, and the non-indigenous Pacific oyster, Crassostrea gigas, have partially overlapping distributions in European waters. Relatively little is known about particle selection by O. edulis, and the goal of the present study was to establish baselines...... for particle selection by both oyster species under controlled conditions in the laboratory. The study was carried out with adult oysters of similar shell size collected in the Limfjord estuary, Denmark (56°47′N, 08°51′E), in November 2011. The feeding traits of both species [clearance rate (CR), retention...... efficiency (RE) and lower threshold for clearance (LTC)] were compared using five algal species with different cell sizes (5−32 µm ESD) (Isochrysis galbana, Rhodomonas salina, Thalassiosira weissflogii, Prorocentrum micans and Akashiwo sanguinea). Oysters were acclimated to an experimental temperature of 22...

7 CFR 701.54 - Oysters.

Science.gov (United States)

2010-01-01

... 7 Agriculture 7 2010-01-01 2010-01-01 false Oysters. 701.54 Section 701.54 Agriculture Regulations... ADMINISTERED UNDER THIS PART § 701.54 Oysters. (a) Notwithstanding § 701.5(b), but otherwise subject to the... be made available under this section for the eligible cost of refurbishing public or private oyster...

SUPPLEMENTATION OF COFFEE HUSK FERMENTED WITH Pleurotus ostreatus: EFFECT ON PERFORMANCE AND BLOOD PROFILE OF GASTROINTESTINAL NEMATODES INFECTED GOAT

Directory of Open Access Journals (Sweden)

I. Badarina

2016-03-01

Full Text Available The aim of this study was to investigate the potency of coffee husk fermented with P.ostreatus as a natural anthelmintic supplement by measuring the performance and blood profile of goat suffered gastrointestinal nematodes infection. Eighteen local male goats of Kacang goat with body weight of 9.23 ± 1.71 kg and aged at ± 10 months were arranged into three treatments in completely randomized design. The treatments were T0 (group without chemical anthelmintic treatment and no supplementation of fermented coffee husk, T1 (without chemical anthelmintic treatment, but supplied with fermented coffee husk and T2 (group with chemical anthelmintic and no supplementation of fermented coffee husk. All goats were offered a basal diet in the ratio of 60% natural grasses along with 40% concentrate. Fermented coffee husk was added in the diet as much as 6% from the dry matter need. The result showed that there were no significant effect to dry matter intake, daily weight gain, PCV value and eosinophil counts (P>0.05. The supplementation of fermented coffee husk (T1 enhanced Hb and red blood cell (RBC value (P<0.05 while no significant difference to T2. There were no nematodes infection in T1 and T2 with the eggs count were zero while the animals in T0 were still infected. This result indicated that fermented coffee husk can be used as a promising natural anthelmintic supplement with the improvement of Hb value, RBC, egg counts and daily weight gain.

Hyperspectral remote sensing of wild oyster reefs

Science.gov (United States)

Le Bris, Anthony; Rosa, Philippe; Lerouxel, Astrid; Cognie, Bruno; Gernez, Pierre; Launeau, Patrick; Robin, Marc; Barillé, Laurent

2016-04-01

The invasion of the wild oyster Crassostrea gigas along the western European Atlantic coast has generated changes in the structure and functioning of intertidal ecosystems. Considered as an invasive species and a trophic competitor of the cultivated conspecific oyster, it is now seen as a resource by oyster farmers following recurrent mass summer mortalities of oyster spat since 2008. Spatial distribution maps of wild oyster reefs are required by local authorities to help define management strategies. In this work, visible-near infrared (VNIR) hyperspectral and multispectral remote sensing was investigated to map two contrasted intertidal reef structures: clusters of vertical oysters building three-dimensional dense reefs in muddy areas and oysters growing horizontally creating large flat reefs in rocky areas. A spectral library, collected in situ for various conditions with an ASD spectroradiometer, was used to run Spectral Angle Mapper classifications on airborne data obtained with an HySpex sensor (160 spectral bands) and SPOT satellite HRG multispectral data (3 spectral bands). With HySpex spectral/spatial resolution, horizontal oysters in the rocky area were correctly classified but the detection was less efficient for vertical oysters in muddy areas. Poor results were obtained with the multispectral image and from spatially or spectrally degraded HySpex data, it was clear that the spectral resolution was more important than the spatial resolution. In fact, there was a systematic mud deposition on shells of vertical oyster reefs explaining the misclassification of 30% of pixels recognized as mud or microphytobenthos. Spatial distribution maps of oyster reefs were coupled with in situ biomass measurements to illustrate the interest of a remote sensing product to provide stock estimations of wild oyster reefs to be exploited by oyster producers. This work highlights the interest of developing remote sensing techniques for aquaculture applications in coastal

High pressure inactivation of HAV within oysters: comparison of shucked oysters with whole in shell meats

Science.gov (United States)

High pressure inactivation of hepatitis A virus (HAV) within oysters bioaccumulated under simulated natural conditions to levels >106 PFU/oyster has been evaluated. Five min treatments at 20C were administered at 350, 375, and 400 MegaPascals (MPa). Shucked and whole-in-shell oysters were directly...

Crosses between monokaryons of Pleurotus sapidus or Pleurotus florida show an improved biotransformation of (+)-valencene to (+)-nootkatone.

Science.gov (United States)

Omarini, Alejandra B; Plagemann, Ina; Schimanski, Silke; Krings, Ulrich; Berger, Ralf G

2014-11-01

Several hundred monokaryotic and new dikaryotic strains derived thereof were established from (+)-valencene tolerant Pleurotus species. When grouped according to their growth rate on agar plates and compared to the parental of Pleurotus sapidus 69, the slowly growing monokaryons converted (+)-valencene more efficiently to the grapefruit flavour compound (+)-nootkatone. The fast growing monokaryons and the slow×slow and the fast×fast dikaryotic crosses showed similar or inferior yields. Some slow×fast dikaryons, however, exceeded the biotransformation capability of the parental dikaryon significantly. The activity of the responsible enzyme, lipoxygenase, showed a weak correlation with the yields of (+)-nootkatone indicating that the determination of enzyme activity using the primary substrate linoleic acid may be misleading in predicting the biotransformation efficiency. This exploratory study indicated that a classical genetics approach resulted in altered and partly improved terpene transformation capability (plus 60%) and lipoxygenase activity of the strains. Copyright © 2014 Elsevier Ltd. All rights reserved.

Thermoluminescence analysis of irradiated oyster shells

International Nuclear Information System (INIS)

Cruz-Zaragoza, E.; Marcazzó, J.; Della Monaca, S.; Boniglia, C.; Gargiulo, R.; Bortolin, E.

2012-01-01

This paper reports the thermoluminescence (TL) analysis performed on the oyster shells powder. TL response of 60 Co gamma-rays irradiated samples were studied in the range from 80 Gy to 8 kGy doses. TL signal of irradiated shell powder was higher as compared to the unirradiated control samples, which allowed to identify the irradiated oysters. Results show that the oyster shells have good TL properties and can be useful for the identification of irradiated seafood as well as for the evaluation of the treatment dose. - Highlights: ► TL properties of irradiated oyster shell powder were studied. ► The SEM analysis shows that several elements are present in oyster shell powder. ► Calcite is the main component in the samples and β-calcite is also present. ► Following the European Standard EN 1788, the irradiated oyster can be identified. ► Determination of absorbed dose is possible by performing a preheat treatment.

Evaluation on the effects of P. ostreatus spent mushroom compost ...

African Journals Online (AJOL)

Realization in minimizing production cost for in vitro culture had brought to a study on application of P. ostreatus spent mushroom compost (SMC). Sterile nodal explants was inoculated on different treatments with 15 replicates each. Treatments were MS medium supplemented with different concentrations of SMC (1 and 2 ...

Temperature-dependent stress response in oysters, Crassostrea virginica: Pollution reduces temperature tolerance in oysters

International Nuclear Information System (INIS)

Lannig, Gisela; Flores, Jason F.; Sokolova, Inna M.

2006-01-01

Combined effects of temperature and a toxic metal, cadmium (Cd), on energy metabolism were studied in a model marine bivalve, the eastern oyster Crassostrea virginica, acclimated at 20, 24 and 28 deg. C and exposed to 50 μg l -1 of Cd. Both increasing temperature and Cd exposure led to a rise in standard metabolic rates, and combined stressors appeared to override the capability for aerobic energy production resulting in impaired stress tolerance. Oysters exposed to elevated temperature but not Cd showed no significant change in condition, survival rate and lipid peroxidation, whereas those exposed to both Cd and temperature stress suffered high mortality accompanied by low condition index and elevated lipid peroxidation. Furthermore, RNA/DNA ratios indicative of protein synthesis rate, and levels of glutathione, which is involved in metal detoxification, increased in Cd-exposed oysters at 20 deg. C but not at 28 deg. C. Implications of the synergism between elevated temperatures and cadmium stress on energy metabolism of oysters are discussed in the light of the potential effects of climate change on oyster populations in polluted areas

Radiopasteurization of sawdust media used in propagation of mushrooms

International Nuclear Information System (INIS)

Ito, Hitoshi; Sato, Tomotaro

1975-01-01

In our country, cultivation of mushrooms such as Pleurotus ostreatus, Kuehneromyces nameko, and Lentinus edodes (Cortinellus shiitake) are expanding, and has reached considerable amounts. These mushrooms are cultivated generally on decaying logs of broad leaf trees. Recently, these mushrooms are also cultivated artificially on the sawdust-media containing rice bran and other nutrient in the room of which temperature is controlled. However, these artificial culture media must be germicidated for 2 or 6 hours at 100 to 120 0 C before inoculation of mushroom spawn. In this study, attempts were made to cultivate Pleurotus ostreatus on the sawdust-media pasteurized by ionizing radiation. Inhibition of mushrooms growth were caused mainly by multiplication of Citrobacter and Fusarium, and these organisms were eliminated by a dose of 0.5 Mrad gamma irradiation. A surprising result was that many of sawdust media subjected to 0.5, 1.0 and 2.0 Mrad increased mycelial growth rates more than heat treatments, and also mushroom yields were enhanced. The multiplication of remaining microorganisms such as Bacillus and yeasts after irradiation with a dose of 0.5 Mrad or 1.0 Mrad did not inhibit the mycelial growth of mushrooms. (auth.)

Survival of Salmonella Newport in oysters.

Science.gov (United States)

Morrison, Christopher M; Armstrong, Alexandra E; Evans, Sanford; Mild, Rita M; Langdon, Christopher J; Joens, Lynn A

2011-08-02

Salmonella enterica is the leading cause of laboratory-confirmed foodborne illness in the United States and raw shellfish consumption is a commonly implicated source of gastrointestinal pathogens. A 2005 epidemiological study done in our laboratory by Brands et al., showed that oysters in the United States are contaminated with Salmonella, and in particular, a specific strain of the Newport serovar. This work sought to further investigate the host-microbe interactions between Salmonella Newport and oysters. A procedure was developed to reliably and repeatedly expose oysters to enteric bacteria and quantify the subsequent levels of bacterial survival. The results show that 10 days after an exposure to Salmonella Newport, an average concentration of 3.7 × 10(3)CFU/g remains within the oyster meat, and even after 60 days there still can be more than 10(2)CFU/g remaining. However, the strain of Newport that predominated in the market survey done by Brands et al. does not survive within oysters or the estuarine environment better than any other strains of Salmonella we tested. Using this same methodology, we compared Salmonella Newport's ability to survive within oysters to a non-pathogenic strain of E. coli and found that after 10 days the concentration of Salmonella was 200-times greater than that of E. coli. We also compared those same strains of Salmonella and E. coli in a depuration process to determine if a constant 120 L/h flux of clean seawater could significantly reduce the concentration of bacteria within oysters and found that after 3 days the oysters retained over 10(4)CFU/g of Salmonella while the oysters exposed to the non-pathogenic strain of E. coli contained 100-times less bacteria. Overall, the results of this study demonstrate that any of the clinically relevant serovars of Salmonella can survive within oysters for significant periods of time after just one exposure event. Based on the drastic differences in survivability between Salmonella and a non

Persistence of Caliciviruses in Artificially Contaminated Oysters during Depuration▿

OpenAIRE

Ueki, You; Shoji, Mika; Suto, Atsushi; Tanabe, Toru; Okimura, Yoko; Kikuchi, Yoshihiko; Saito, Noriyuki; Sano, Daisuke; Omura, Tatsuo

2007-01-01

The fate of calicivirus in oysters in a 10-day depuration was assessed. The norovirus gene was persistently detected from artificially contaminated oysters during the depuration, whereas feline calicivirus in oysters was promptly eliminated. The prolonged observation of norovirus in oysters implies the existence of a selective retention mechanism for norovirus within oysters.

PCB in the environment: bio-based processes for soil decontamination and management of waste from the industrial production of Pleurotus ostreatus.

Science.gov (United States)

Siracusa, Giovanna; Becarelli, Simone; Lorenzi, Roberto; Gentini, Alessandro; Di Gregorio, Simona

2017-10-25

Polychlorinated biphenyls (PCBs) are hazardous soil contaminants for which a bio-based technology for their recovery is essential. The objective of this study was to validate the exploitation of spent mushroom substrate (SMS), a low or null cost organic waste derived from the industrial production of P. ostreatus, as bulking agent in a dynamic biopile pilot plant. The SMS shows potential oxidative capacity towards recalcitrant compounds. The aim was consistent with the design of a process of oxidation of highly chlorinated PCBs, which is independent from their reductive dehalogenation. Feasibility was verified at a mesocosm scale and validated at pilot scale in a dynamic biopile pilot plant treating ten tons of a historically contaminated soil (9.28±0.08mg PCB/kg soil dry weight). Mixing of the SMS with the soil was required for the depletion of the contaminants. At the pilot scale, after eight months of incubation, 94.1% depletion was recorded. A positive correlation between Actinobacteria and Firmicutes active metabolism, soil laccase activity and PCB removal was observed. The SMS was found to be exploitable as a versatile low cost organic substrate capable of activating processes for the oxidation of highly chlorinated PCBs. Moreover, its exploitation as bulking agent in biopiles is a valuable management strategy for the re-utilisation of an organic waste deriving from the industrial cultivation of edible mushrooms. Copyright © 2017 Elsevier B.V. All rights reserved.

Optimization of humidifying procedure in controlled environment for ...

African Journals Online (AJOL)

hp

2016-11-09

Nov 9, 2016 ... humidifying treatment had influenced the mushroom growth in ..... small water which is heavier than vapour and condense on floor very .... Indoor Mushroom Cultivation of Grey Oyster (Pleurotus pulmonarius) by Different ...

Mapping Oyster Reef Habitats in Mobile Bay

Science.gov (United States)

Bolte, Danielle

2011-01-01

Oyster reefs around the world are declining rapidly, and although they haven t received as much attention as coral reefs, they are just as important to their local ecosystems and economies. Oyster reefs provide habitats for many species of fish, invertebrates, and crustaceans, as well as the next generations of oysters. Oysters are also harvested from many of these reefs and are an important segment of many local economies, including that of Mobile Bay, where oysters rank in the top five commercial marine species both by landed weight and by dollar value. Although the remaining Mobile Bay oyster reefs are some of the least degraded in the world, projected climate change could have dramatic effects on the health of these important ecosystems. The viability of oyster reefs depends on water depth and temperature, appropriate pH and salinity levels, and the amount of dissolved oxygen in the water. Projected increases in sea level, changes in precipitation and runoff patterns, and changes in pH resulting from increases in the amount of carbon dioxide dissolved in the oceans could all affect the viability of oyster reefs in the future. Human activities such as dredging and unsustainable harvesting practices are also adversely impacting the oyster reefs. Fortunately, several projects are already under way to help rebuild or support existing or previously existing oyster reefs. The success of these projects will depend on the local effects of climate change on the current and potential habitats and man s ability to recognize and halt unsustainable harvesting practices. As the extent and health of the reefs changes, it will have impacts on the Mobile Bay ecosystem and economy, changing the resources available to the people who live there and to the rest of the country, since Mobile Bay is an important national source of seafood. This project identified potential climate change impacts on the oyster reefs of Mobile Bay, including the possible addition of newly viable

and extracellular laccase isoenzymes from Pleurotus ostreatus

African Journals Online (AJOL)

ZMG

Colonia Vicentina, Delegación Iztapalapa, 09340 México D.F., México. 3Centro de .... mechanic homogenization of the mycelium in physiological solution, with the help of an electric ..... pubescens and regulation of its synthesis by metal ions.

ANTIMICROBIAL PROPERTIES OF PLEUROTUS ERYNGII AND LENTINUS EDODES HYDRO-ALCOHOLIC EXTRACTS

Directory of Open Access Journals (Sweden)

Gabriela Popa

2016-11-01

Full Text Available Besides superior nutritional values mushrooms posed significant medicinal properties. Hydro-alcoholic extracts of several isolates of Pleurotus eryngii and Lentinus edodes mushroom species were investigated for their antimicrobial activities against pathogenic microorganisms with medicinal importance. Antimicrobial activities of the extracts were evaluated by the agar disk diffusion method. Results revealed that the 70% ethylic alcohol extracts have significant inhibitory activities against Bacillus subtilis var. spizizinii, Escherichia coli and Staphylococcus aureus. The results showed that the 70% ethanol extracts of Pleurotus eryngii and Lentinus edodes mushroom isolates may have biopharmaceutical potentiality.

Browse Title Index - AJOL

African Journals Online (AJOL)

Items 7451 - 7500 of 11090 ... ... Listeria monocytogenes- A high risk food pathogen by multiplex PCR, Abstract PDF ... and molecular characterization of Oyster mushroom (Pleurotus spp.) ... Vol 14, No 15 (2015), Morphological and RAPD-marker ...

Eating oysters without risk of vibriosis: application of a bacteriophage against Vibrio parahaemolyticus in oysters.

Science.gov (United States)

Jun, Jin Woo; Kim, Hyoun Joong; Yun, Sae Kil; Chai, Ji Young; Park, Se Chang

2014-10-01

Vibrio parahaemolyticus is a major cause of foodborne illness and related with the consumption of raw contaminated seafood, especially oysters. To evaluate the effectiveness of various applications of a bacteriophage (phage), pVp-1, against a multiple-antibiotic-resistant V. parahaemolyticus pandemic strain (CRS 09-17), we designed artificial contamination models that are most likely to be encountered during oyster processing. When live oysters were treated with bath immersion with pVp-1 after CRS 09-17 challenge, the growth of bacterial strain was significantly reduced. After 72h of phage application with bath immersion, bacterial growth reduction was observed to be 8.9×10(6)CFU/ml (control group) to 1.4×10CFU/ml (treatment group). When pVp-1 was surface-applied on the flesh of oysters after CRS 09-17 inoculation, bacterial growth was properly inhibited. After 12h of phage application on the surface of oysters, bacterial growth inhibition was revealed to be 1.44×10(6)CFU/ml (control group) to 1.94CFU/ml (treatment group). This is the first report, to the best of our knowledge, of oyster surface-application of a phage against a multiple-antibiotic-resistant V. parahaemolyticus pandemic strain, and our successful phage application to various situations emphasizes the potential use of the phage to avoid V. parahaemolyticus infection from aquaculture to consumption. Copyright © 2014 Elsevier B.V. All rights reserved.

Diversity of edible mushrooms in pakistan

International Nuclear Information System (INIS)

Sultana, K.; Shinwari, Z.K.; Iftikhar, F.

2007-01-01

Fifty six edible species of mushrooms are reported from Pakistan including four from Balochistan, three from Sindh, five from Punjab and 44 from NWFP and Azad Kashmir. Some of species being commercially exploited in the world are Agaricus bisporus, Auricularia spp. Coprinus comatus, Flammulina vellutipes, Lentinus edodes, Phellorina inquinans, Pleurotus ostreatus, Stropharia rugosoannulata, Volvariella volvacea. Because of over collection, urbanization and deforestation, some of species are threatened of extinction. (author)

Sensitivity of oysters (Crassostrea Brasiliana) to radiation

International Nuclear Information System (INIS)

Mattiolo Marchese, S.R.; Mastro, N.L. del

1997-01-01

Various foods including oysters, crabs and shrimps have been shown to be possible transmitters of Vibrio ssp. Irradiation of sea-foods is being considered an alternative to intervention measures in Public Health against food borne diseases. The aim of this work was to establish, the radiation resistance of the oysters Crassostrea brasiliana. The oysters were irradiated with Co-60 radiation with doses of 0, 1.5, 3 and 6 kGy. Survival curves as a function of time showed that 100% of the oysters irradiated with doses of 3 kGy survived at least 6 days. 100% those irradiated with 6 kGy survived 3 days. The obtained results are auspicious considering that a dose of 2 kGy is already effective in the diminishing of the microbial load on oysters. (author)

Disease control by chemical and biological fungicides in cultivated mushrooms: button mushroom, oyster mushroom and shiitake

Directory of Open Access Journals (Sweden)

Ivana Potočnik

2015-12-01

Full Text Available The most commonly cultivated basidiomycetes worldwide and in Serbia are button mushroom (Agaricus bisporus, oyster mushroom (Pleurotus sp. and shiitake (Lentinus edodes. Production of their fruiting bodies is severely afflicted by fungal, bacterial, and viral pathogens that are able to cause diseases which affect yield and quality. Major A. bisporus fungal pathogens include Mycogone perniciosa, Lecanicillium fungicola, and Cladobotryum spp., the causal agents of dry bubble, wet bubble, and cobweb disease, respectively. Various Trichoderma species, the causal agents of green mould, also affect all three kinds of edible mushrooms. Over the past two decades, green mould caused by T. aggressivum has been the most serious disease of button mushroom. Oyster mushroom is susceptible to T. pleurotum and shiitake to T. harzianum. The bacterial brawn blotch disease, caused by Pseudomonas tolaasii, is distributed globally. Disease control on mushroom farms worldwide is commonly based on the use of fungicides. However, evolution of pathogen resistance to fungicides after frequent application, and host sensitivity to fungicides are serious problems. Only a few fungicides are officially recommended in mushroom production: chlorothalonil and thiabendazol in North America and prochloraz in the EU and some other countries. Even though decreased sensitivity levels of L. fungicola and Cladobotryum mycophilum to prochloraz have been detected, disease control is still mainly provided by that chemical fungicide. Considering such resistance evolution, harmful impact to the environment and human health, special attention should be focused on biofungicides, both microbiological products based on Bacillus species and various natural substances of biological origin, together with good programs of hygiene. Introduction of biofungicides has created new possibilities for crop protection with reduced application of chemicals.

Characteristics of radiocesium concentration by mushrooms and microorganisms

International Nuclear Information System (INIS)

Sugiyama, Hideo; Terada, Hiroshi; Kuwahara, Chikako; Shibata, Hisashi; Maeda, Yoko; Kato, Fumio

2000-01-01

The 137 Cs values in cultured edible fruiting bodies of Pleurotus ostreatus (Fr.) Kummer Y-1 (P. ostreatus) were 2-3 orders of magnitude higher than those in the wild mushrooms. The concentration ratio (CR, 137 Cs or Cs concentration in the dried cultured fruiting bodies or mycelia/ 137 Cs or Cs concentration in the fresh medium) suggested that 137 Cs in the medium actively migrated into the mushroom. The 137 Cs and stable Cs uptake by the cultured fruiting bodies of P. ostreatus were affected by the presence of K the same as the mycelia. Streptomyces lividans TK24 (S.lividans) and Streptomyces sp. TOHO-2 (Streptomyces sp.), one of the soil microorganisms, grown in the presence of Cs showed high accumulation of Cs in the mycelia. Elementary analysis of P. ostreatus and S. lividans were performed using a scanning electron microscopy-energy dispersive X-ray microanalyzer. The ratio of Cs in the stationary phase to that in the proliferation phase at the mycelial root of P. ostreatus formed in the early stage was about five times that at the mycelial tip. S. lividans and Streptomyces sp. grown on the YM agar plate containing CsCl showed white spots locating at a similar intervals. Concentrations of Cs, P, O and Mg in the white spots were higher than those in other regions. (author)

Sensory and Chemical Characteristics of Eastern Oysters(Crassostrea virginica)

OpenAIRE

Chen, Luman

2011-01-01

Eastern Oysters, or Crassostrea virginica, are an important dietary component in the Chesapeake region and have supported a major fishery in the Chesapeake for more than 100 years. Virginia oysters do not always receive attention in up-scale markets. It is possible that the lack of information on sensory characteristics of Chesapeake oysters may contribute to this problem. In order to differentiate Chesapeake oysters from other oysters, a descriptive sensory test (n=8) was conducted and chemi...

21 CFR 161.130 - Oysters.

Science.gov (United States)

2010-04-01

... water. Before packing into the containers for shipment or other delivery for consumption the oysters are... FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION FISH AND SHELLFISH Requirements for Specific Standardized Fish and Shellfish § 161.130 Oysters. (a...

Effect of branding Gulf oysters on consumers willingness to pay

OpenAIRE

Acquah, Sarah; Petrolia, Daniel

2014-01-01

Using a choice experiment this study found that raw oyster consumers are more likely to buy oysters harvested from their region over those harvested outside the region. Consumers are more likely to buy wild-caught oysters over cultivated oysters. Non-Gulf consumers are more likely to buy medium or large size oysters over small size.

OYSTER POPULATUION ESTIMATION IN SUPPORT OF THE TEN-YEAR GOAL FOR OYSTER RESOTRATION IN THE CHESAPEAKE BAY: DEVELOPING STRATEGIES FOR RESTORING AND MANAGING THE EASTERN OYSTER

Science.gov (United States)

Mann, Roger, Steve Jordan, Gary Smith, Kennedy Paynter, James Wesson, Mary Christman, Jessica Vanisko, Juliana Harding, Kelly Greenhawk and Melissa Southworth. 2003. Oyster Population Estimation in Support of the Ten-Year Goal for Oyster Restoration in the Chesapeake Bay: Develop...

Microbiological decomposition of bagasse after radiation pasteurization

International Nuclear Information System (INIS)

Ito, Hitoshi; Ishigaki, Isao

1987-01-01

Microbiological decomposition of bagasse was studied for upgrading to animal feeds after radiation pasteurization. Solid-state culture media of bagasse were prepared with addition of some amount of inorganic salts for nitrogen source, and after irradiation, fungi were infected for cultivation. In this study, many kind of cellulosic fungi such as Pleurotus ostreatus, P. flavellatus, Verticillium sp., Coprinus cinereus, Lentinus edodes, Aspergillus niger, Trichoderma koningi, T. viride were used for comparison of decomposition of crude fibers. In alkali nontreated bagasse, P. ostreatus, P. flavellatus, C. cinereus and Verticillium sp. could decompose crude fibers from 25 to 34 % after one month of cultivation, whereas other fungi such as A. niger, T. koningi, T. viride, L. edodes decomposed below 10 %. On the contrary, alkali treatment enhanced the decomposition of crude fiber by A. niger, T. koningi and T. viride to be 29 to 47 % as well as Pleurotus species or C. cinereus. Other species of mushrooms such as L. edodes had a little ability of decomposition even after alkali treatment. Radiation treatment with 10 kGy could not enhance the decomposition of bagasse compared with steam treatment, whereas higher doses of radiation treatment enhanced a little of decomposition of crude fibers by microorganisms. (author)

Microbiological decomposition of bagasse after radiation pasteurization

Energy Technology Data Exchange (ETDEWEB)

Ito, Hitoshi; Ishigaki, Isao

1987-11-01

Microbiological decomposition of bagasse was studied for upgrading to animal feeds after radiation pasteurization. Solid-state culture media of bagasse were prepared with addition of some amount of inorganic salts for nitrogen source, and after irradiation, fungi were infected for cultivation. In this study, many kind of cellulosic fungi such as Pleurotus ostreatus, P. flavellatus, Verticillium sp., Coprinus cinereus, Lentinus edodes, Aspergillus niger, Trichoderma koningi, T. viride were used for comparison of decomposition of crude fibers. In alkali nontreated bagasse, P. ostreatus, P. flavellatus, C. cinereus and Verticillium sp. could decompose crude fibers from 25 to 34 % after one month of cultivation, whereas other fungi such as A. niger, T. koningi, T. viride, L. edodes decomposed below 10 %. On the contrary, alkali treatment enhanced the decomposition of crude fiber by A. niger, T. koningi and T. viride to be 29 to 47 % as well as Pleurotus species or C. cinereus. Other species of mushrooms such as L. edodes had a little ability of decomposition even after alkali treatment. Radiation treatment with 10 kGy could not enhance the decomposition of bagasse compared with steam treatment, whereas higher doses of radiation treatment enhanced a little of decomposition of crude fibers by microorganisms.

Human enteroviruses in oysters and their overlying waters.

Science.gov (United States)

Goyal, S M; Gerba, C P; Melnick, J L

1979-03-01

The presence of enteroviruses in oysters and oyster-harvesting waters of the Texas Gulf coast was monitored over a period of 10 months. Viruses were detected in water and oyster samples obtained from areas both open and closed to shellfish harvesting. Viruses were detected periodically in waters that met current bacteriological standards for shellfish harvesting. No significant statistical relationship was demonstrated between virus concentration in oysters and the bacteriological and physiochemical quality of water and shellfish. Viruses in water were, however, moderately correlated with total coliforms in water and oysters and with fecal coliforms in oysters. Total coliforms in water were realted to total coliforms in sediment were related only to total coliforms in sediment. Among the physiochemical characteristics of water, turbidity was related statistically to the organic matter content of water and to fecal coliforms in water. There was a marked effect of rainfall on the bacteriological quality of water. Of a total of 44 water samples, 26 yielded virus in concentrations from 4 to 167 plaque-forming units per 100-gallon (ca. 378.5-liter) sample. Of a total of 40 pools of 10 to 12 oysters each, virus was found in 14 pools at a concentration of 6 to 224 plaque-forming units per 100 g of oyster meat. On five occasions, virus was found in water samples when no virus could be detected in oysters harvested from the same sites. This study indicates that current bacteriological standards for determining the safety of shellfish and shellfish-growing waters do no reflect the occurrence of enteroviruses.

Flow-sediment-oyster interaction around degraded, restored, and reference oyster reefs in Florida's Indian River Lagoon

Science.gov (United States)

Kitsikoudis, V.; Kibler, K. M.; Spiering, D. W.

2017-12-01

This study analyzes flow patterns and sediment distributions around three oyster reefs in a bar-built estuarine lagoon. We studied a degraded reef, a recently restored reef, and a reference condition reef with a healthy live oyster community. The restored reef had been regraded and restored with oyster shell mats to aid in recruitment of oyster spat, with the goal of reestablishing a healthy oyster community. Despite the fact that flow-biota-sediment interaction constitutes a blossoming research field, actual field data are sparse and current knowledge emanates from flume studies and numerical modeling. Moreover, the hydraulic effect of restored oyster reefs has not been thoroughly investigated and it is not clear if the flow field and sediment erosion/deposition are similar or diverge from natural reefs. Instantaneous three-dimensional flow velocities were collected on reefs using a Nortek Vectrino Profiler and an acoustic Doppler current profiler (Nortek Aquadopp). The former measured a 2 - 3 cm velocity profile above the oyster bed, while the latter quantified incoming velocities across the flow profile approximately 10 m from the edge of the reef. Flow measurements were conducted during rising tides and are coupled with simultaneous wind speed and direction data. In addition, 20 cm deep sediment cores were retrieved on and off the investigated reefs. Sediment grain size distributions were determined after individual cores were processed for loss on ignition. Incoming flow velocities were as high as 10 cm/s, relatively higher than those recorded close to reefs. Mean and turbulent flow velocities close to the reefs, varied among the investigated sites, despite the similar wind flow conditions offshore. For instance, the measurements at the degraded reef showed decreased wave attenuation and augmented flow velocities compared to the other sites. Boat wakes exhibited a very distinct signal in the flow velocity time-series and significantly increased the approaching

A study of mechanisms responsible for incorporation of cesium and radiocesium into fruitbodies of king oyster mushroom (Pleurotus eryngii)

Energy Technology Data Exchange (ETDEWEB)

Bystrzejewska-Piotrowska, Grazyna [Isotope Laboratory, Faculty of Biology, Warsaw University, 02-096 Warsaw, Miecznikowa 1 (Poland)], E-mail: byst@biol.uw.edu.pl; Bazala, Michal A. [Isotope Laboratory, Faculty of Biology, Warsaw University, 02-096 Warsaw, Miecznikowa 1 (Poland)

2008-07-15

Ex vitro cultures of Pleurotus eryngii were carried out under controlled conditions using sterile medium composed of barley seeds. The influence of alkali and alkaline earth element salts (CsCl, KCl, NaCl, RbCl, and CaCl{sub 2}) and tetraethylammonium chloride on incorporation of cesium, potassium, sodium, rubidium and calcium, and their distribution within fruitbodies, was examined. The results show that incorporation of cesium into fruitbodies was not suppressed by Na{sup +} and Rb{sup +} or tetraethylammonium chloride. However, it was inhibited by Ca{sup 2+} and stimulated by high concentrations of K{sup +}. The inhibition of cesium incorporation by Ca{sup 2+}, lack of influence of tetraethylammonium chloride and stimulation by high K{sup +} concentrations suggest that there may exist two pathways of passive transport of cesium in mycelium: (i) uptake mediated by a non-specific potassium channel localised in plasmalemma (similar to voltage-insensitive cation channel, VICC) followed by diffusive transport inside hyphae and (ii) extracellular transport from the medium through inter-hyphal cavities into fruitbodies. The results highlight distinctiveness of mechanisms responsible for the uptake and incorporation of cesium in mushrooms and plants.

Treatment of micropollutants in municipal wastewater: study of a sequential batch biofilter

OpenAIRE

Contijoch Culleré, Andreu

2014-01-01

All the experimental part of this final project was done at Laboratoire de Biotechnologie Environnementale (LBE) from the École Polytechnique Fédérale de Lausanne (EPFL), Switzerland, during 6 months (November 2013- May 2014). A fungal biofilter composed of woodchips was designed in order to remove micropollutants from the effluents of waste water treatment plants. Two fungi were tested: Pleurotus ostreatus and Trametes versicolor in order to evaluate their efficiency for the r...

Flat oysters in the Eierlandse Gat, Wadden Sea

NARCIS (Netherlands)

Have, van der T.M.; Kamermans, P.; Zee, van der E.M.

2018-01-01

This report presents the results of a short survey of flat oysters (Ostrea edulis) in the Western Wadden Sea. Ten sites were visited and flat oysters were found on nine locations in the Eijerlandse gat. Empty cockleshells and live and dead Pacific oysters provided the main settlement substrate. The

Pyrosequencing Analysis of Norovirus Genogroup II Distribution in Sewage and Oysters: First Detection of GII.17 Kawasaki 2014 in Oysters.

Science.gov (United States)

Pu, Jian; Kazama, Shinobu; Miura, Takayuki; Azraini, Nabila Dhyan; Konta, Yoshimitsu; Ito, Hiroaki; Ueki, You; Cahyaningrum, Ermaya Eka; Omura, Tatsuo; Watanabe, Toru

2016-12-01

Norovirus GII.3, GII.4, and GII.17 were detected using pyrosequencing in sewage and oysters in January and February 2015, in Japan. The strains in sewage and oyster samples were genetically identical or similar, predominant strains belonging to GII.17 Kawasaki 2014 lineage. This is the first report of GII.17 Kawasaki 2014 in oysters.

Immune and stress responses in oysters with insights on adaptation.

Science.gov (United States)

Guo, Ximing; He, Yan; Zhang, Linlin; Lelong, Christophe; Jouaux, Aude

2015-09-01

Oysters are representative bivalve molluscs that are widely distributed in world oceans. As successful colonizers of estuaries and intertidal zones, oysters are remarkably resilient against harsh environmental conditions including wide fluctuations in temperature and salinity as well as prolonged air exposure. Oysters have no adaptive immunity but can thrive in microbe-rich estuaries as filter-feeders. These unique adaptations make oysters interesting models to study the evolution of host-defense systems. Recent advances in genomic studies including sequencing of the oyster genome have provided insights into oyster's immune and stress responses underlying their amazing resilience. Studies show that the oyster genomes are highly polymorphic and complex, which may be key to their resilience. The oyster genome has a large gene repertoire that is enriched for immune and stress response genes. Thousands of genes are involved in oyster's immune and stress responses, through complex interactions, with many gene families expanded showing high sequence, structural and functional diversity. The high diversity of immune receptors and effectors may provide oysters with enhanced specificity in immune recognition and response to cope with diverse pathogens in the absence of adaptive immunity. Some members of expanded immune gene families have diverged to function at different temperatures and salinities or assumed new roles in abiotic stress response. Most canonical innate immunity pathways are conserved in oysters and supported by a large number of diverse and often novel genes. The great diversity in immune and stress response genes exhibited by expanded gene families as well as high sequence and structural polymorphisms may be central to oyster's adaptation to highly stressful and widely changing environments. Copyright © 2015 Elsevier Ltd. All rights reserved.

Oyster Reef Communities in the Chesapeake Bay: A Brief Primer. VORTEX: Virginia's Oyster Reef Teaching EXperience.

Science.gov (United States)

Harding, Juliana M.; Mann, Roger; Clark, Vicki P.

This document introduces Virginia's Oyster Reef Teaching EXperience (VORTEX), which is an interdisciplinary program focusing on the importance of oyster reef communities in the Chesapeake Bay ecosystem. The VORTEX program uses field and laboratory experience supported by multimedia instruction. This document presents an overview on the biology of…

Raw oysters can be a risk for infections

Directory of Open Access Journals (Sweden)

Regine Helena Silva dos Fernandes Vieira

Full Text Available The aims of this study were to count and identify sucrose positive and negative vibrios isolated from cultivated Crassostrea rhizophorae oysters during their growing cycle. Every month for 12 months, 10 to 18 oysters were collected for study. Collections occurred at the Center for Studies of Coastal Aquaculture (CSCA, which is associated with the Institute of Marine Science, Labomar, located in Euzebio, Ceará, Brazil. Approximately 150 oysters and their intervalvular liquor were studied. Vibrio Standard Plates Counts (SPC from oyster meat and their intervalvular liquor varied from 25 to 59,000,000 CFU/g. For most of the 12 months of the oysters' life, it was possible to identify Vibrio parahaemolyticus. Vibrio carchariae was identified in four collections. Among other isolated species, the most important, considering public health risks, was V. vulnificus, although only one strain was confirmed. We concluded that retail purchased oysters should never be eaten raw or undercooked because many species of the genus Vibrio are known to be pathogenic to humans and live naturally on and in shellfish throughout their life cycle.

Microcontroller based automatic temperature control for oyster mushroom plants

Science.gov (United States)

Sihombing, P.; Astuti, T. P.; Herriyance; Sitompul, D.

2018-03-01

In the cultivation of Oyster Mushrooms need special treatment because oyster mushrooms are susceptible to disease. Mushroom growth will be inhibited if the temperature and humidity are not well controlled because temperature and inertia can affect mold growth. Oyster mushroom growth usually will be optimal at temperatures around 22-28°C and humidity around 70-90%. This problem is often encountered in the cultivation of oyster mushrooms. Therefore it is very important to control the temperature and humidity of the room of oyster mushroom cultivation. In this paper, we developed an automatic temperature monitoring tool in the cultivation of oyster mushroom-based Arduino Uno microcontroller. We have designed a tool that will control the temperature and humidity automatically by Android Smartphone. If the temperature increased more than 28°C in the room of mushroom plants, then this tool will turn on the pump automatically to run water in order to lower the room temperature. And if the room temperature of mushroom plants below of 22°C, then the light will be turned on in order to heat the room. Thus the temperature in the room oyster mushrooms will remain stable so that the growth of oyster mushrooms can grow with good quality.

nutrient composition of pleurotus tuberregium (fr) sing's sclerotia

African Journals Online (AJOL)

DJFLEX

The amino acid and mineral profile of Pleurotus tuberregium sclerotia, was investigated. Every 100g ... sample was dried to a constant weight, defatted (by placing a ... (67%), millet, soy bean (74%), peanuts (65%), African ... sodium content to cashew nut (5-13.02mg/100g) [Nandi, .... sclerotia Flour and Protein Concentrate.

Calcium, strontium and fluorine patterns in shells of Pacific Oyster and Rock Oyster

International Nuclear Information System (INIS)

Coote, G.E.

1996-01-01

The IGNS proton microprobe has been applied in a study of the distribution of Calcium, Strontium and Fluorine in the calcite shells of Pacific Oyster (Crassostrea gigas) and the native Rock oyster (Crassostrea glomerata). The ultimate aim is to derive information which could have application in such fields as archaeology, biology, palaeontology, aquaculture and environmental studies. Calcium and strontium were determined from their emissions of K X-rays under proton bombardment, and fluorine from the 19 F (p,alpha gamma) 16 O nuclear reaction. The three elements were determined simultaneously at points no more than 20 micrometres apart. A total of 14 one and 17 two-dimensional scans were performed on sections of the shells embedded in epoxy resin. We studied shells from nine Pacific oysters (five transferred from the Marlborough Sounds to Wellington Harbour and four from the Bay of Islands). (author). 11 refs.; 5 figs

Development of Genetic Markers for Triploid Verification of the Pacific Oyster,

Directory of Open Access Journals (Sweden)

Jung-Ha Kang

2013-07-01

Full Text Available The triploid Pacific oyster, which is produced by mating tetraploid and diploid oysters, is favored by the aquaculture industry because of its better flavor and firmer texture, particularly during the summer. However, tetraploid oyster production is not feasible in all oysters; the development of tetraploid oysters is ongoing in some oyster species. Thus, a method for ploidy verification is necessary for this endeavor, in addition to ploidy verification in aquaculture farms and in the natural environment. In this study, a method for ploidy verification of triploid and diploid oysters was developed using multiplex polymerase chain reaction (PCR panels containing primers for molecular microsatellite markers. Two microsatellite multiplex PCR panels consisting of three markers each were developed using previously developed microsatellite markers that were optimized for performance. Both panels were able to verify the ploidy levels of 30 triploid oysters with 100% accuracy, illustrating the utility of microsatellite markers as a tool for verifying the ploidy of individual oysters.

Using of gamma rays in stimulation and improvement of mushroom spawns plerotus ostreatus

International Nuclear Information System (INIS)

Hussein, O.S.; Atia, A.I.

2009-01-01

The objective of this work was activation and stimulation of plerotus ostreatus growth and increasing their yields by using of gamma rays, in addition to improvement of mushroom quality and shelf life.Exposing plerotus ostreatus to different doses of gamma rays 2.5, 5, 10 and 15 Gy to determine some of the basic composition of mushroom fruits achieved significant increase in yields and basic composition of resulted mushrooms. Also, increase in carbohydrates content, most of amino acids content and fatty acids content, mainly unsaturated fatty acid i.e., (C 16:1) and (C 18:1,2), which are essential for human nutrition as antioxidant. Whereas, there was a significant decrease in the total phenols content of the resulted fruits, which affected the quality and shelf life of mushroom fruits. All gamma rays doses used increased mushroom yield in fresh and dry wt basis. The recommended dose for spawn irradiation was 10 Gy to increase mushroom yields and its chemical components

Millennial-scale sustainability of the Chesapeake Bay Native American oyster fishery.

Science.gov (United States)

Rick, Torben C; Reeder-Myers, Leslie A; Hofman, Courtney A; Breitburg, Denise; Lockwood, Rowan; Henkes, Gregory; Kellogg, Lisa; Lowery, Darrin; Luckenbach, Mark W; Mann, Roger; Ogburn, Matthew B; Southworth, Melissa; Wah, John; Wesson, James; Hines, Anson H

2016-06-07

Estuaries around the world are in a state of decline following decades or more of overfishing, pollution, and climate change. Oysters (Ostreidae), ecosystem engineers in many estuaries, influence water quality, construct habitat, and provide food for humans and wildlife. In North America's Chesapeake Bay, once-thriving eastern oyster (Crassostrea virginica) populations have declined dramatically, making their restoration and conservation extremely challenging. Here we present data on oyster size and human harvest from Chesapeake Bay archaeological sites spanning ∼3,500 y of Native American, colonial, and historical occupation. We compare oysters from archaeological sites with Pleistocene oyster reefs that existed before human harvest, modern oyster reefs, and other records of human oyster harvest from around the world. Native American fisheries were focused on nearshore oysters and were likely harvested at a rate that was sustainable over centuries to millennia, despite changing Holocene climatic conditions and sea-level rise. These data document resilience in oyster populations under long-term Native American harvest, sea-level rise, and climate change; provide context for managing modern oyster fisheries in the Chesapeake Bay and elsewhere around the world; and demonstrate an interdisciplinary approach that can be applied broadly to other fisheries.

Prevalence of Salmonella spp. in oysters in the United States.

Science.gov (United States)

Brands, Danielle A; Inman, Allison E; Gerba, Charles P; Maré, C John; Billington, Stephen J; Saif, Linda A; Levine, Jay F; Joens, Lynn A

2005-02-01

Food-borne diseases such as salmonellosis can be attributed, in part, to the consumption of raw oysters. To determine the prevalence of Salmonella spp. in oysters, oysters harvested from 36 U.S. bays (12 each from the West, East, and Gulf coasts in the summer of 2002, and 12 bays, four per coast, in the winter of 2002-2003) were tested. Salmonella was isolated from oysters from each coast of the United States, and 7.4% of all oysters tested contained Salmonella. Isolation tended to be bay specific, with some bays having a high prevalence of Salmonella, while other bays had none. Differences in the percentage of oysters from which Salmonella was isolated were observed between the summer and winter months, with winter numbers much lower probably due to a variety of weather-related events. The vast majority (78/101) of Salmonella isolates from oysters were Salmonella enterica serovar Newport, a major human pathogen, confirming the human health hazard of raw oyster consumption. Contrary to previous findings, no relationship was found between the isolation of fecal coliforms and Salmonella from oysters, indicating a necessity for specific monitoring for Salmonella and other pathogens rather than the current reliance on fecal coliform testing.

Enzymatic, Antioxidant, Antimicrobial, and Insecticidal Activities of Pleurotus pulmonarius and Pycnoporus cinnabarinus Grown Separately in an Airlift Reactor

Directory of Open Access Journals (Sweden)

Maura Téllez-Téllez

2016-03-01

Full Text Available Crude extract samples of Pleurotus pulmonarius and Pycnoporus cinnabarinus were taken during growth in liquid broth in an airlift reactor. Growth was monitored indirectly by sugar consumption and pH profile. During growth Pleurotus pulmonarius consumed glucose more slowly than Pycnoporus cinnabarinus, reaching a final pH of 8.0. In contrast, Pycnoporus cinnabarinus started consuming glucose faster from the beginning to the end with a pH of 3.6, suggesting the production of different metabolites while they grow in the same culture broth. Additionally, antioxidant activity, polyphenol and flavonoid contents, as well as laccase and hydrolase activities were quantified in the culture extracts during the fermentation. Pleurotus pulmonarius showed higher antioxidant activity than Pycnoporus cinnabarinus. Both fungi have a very low polyphenol and flavonoid content. Values of amylase and pectinase activities were similar in crude extracts of both fungi; however, cellulase, xylanase, invertase, and laccase activities showed higher levels in crude extract of Pleurotus pulmonarius. Antimicrobial and insecticidal activities were also evaluated in each crude extract. In fact, Pycnoporus cinnabarinus presented a very strong bacteriostatic and bactericidal effect against Escherichia coli and Staphylococcus aureus and reliably killed Diatraea magnifactella larvae, while Pleurotus pulmonarius did not showed any negative effect on the growth of these bacteria or larvae.

Amylolytic studies of pleurotus tuber-regium | Monago | Global ...

African Journals Online (AJOL)

The alpha amylase of the sclerotium of Pleurotus tuber-regium was studied. The enzyme was purified from the fresh sclerotium through dialysis, ammonium sulphate fractionation and column chromatography of CM sephadex. The enzyme showed 70% of it's optimal activity between p.H 4.0 to 8.0. Acid and thermal stability ...

Immunochromatographic assay of cadmium levels in oysters.

Science.gov (United States)

Nishi, Kosuke; Kim, In-Hae; Itai, Takaaki; Sugahara, Takuya; Takeyama, Haruko; Ohkawa, Hideo

2012-08-15

Oysters are one of foodstuffs containing a relatively high amount of cadmium. Here we report on establishment of an immunochromatographic assay (ICA) method of cadmium levels in oysters. Cadmium was extracted with 0.l mol L(-1) HCl from oysters and cleaned up from other metals by the use of an anion-exchange column. The behavior of five metals Mn, Fe, Cu, Zn, and Cd was monitored at each step of extraction and clean-up procedure for the ICA method in an inductively coupled plasma-mass spectrometry (ICP-MS) analysis. The results revealed that a simple extraction method with the HCl solution was efficient enough to extract almost all of cadmium from oysters. Clean-up with an anion-exchange column presented almost no loss of cadmium adsorbed on the column and an efficient removal of metals other than cadmium. When a spiked recovery test was performed in the ICA method, the recovery ranged from 98% to 112% with relative standard deviations between 5.9% and 9.2%. The measured values of cadmium in various oyster samples in the ICA method were favorably correlated with those in ICP-MS analysis (r(2)=0.97). Overall results indicate that the ICA method established in the present study is an adequate and reliable detection method for cadmium levels in oysters. Copyright © 2012 Elsevier B.V. All rights reserved.

Papel de la vitamina C y los β-glucanos sobre el sistema inmunitario: revisión

OpenAIRE

Ismael San Mauro-Martín; Elena Garicano Vilar

2016-01-01

Existe un creciente interés en conocer herramientas nutricionales al alcance de profesionales para el manejo de la modulación del sistema inmunitario del humano. Esta revisión bibliográfica se centra en los potenciales efectos beneficiosos sobre el sistema inmune atribuidos a productos alimenticios compuestos por β-glucanos de Pleurotus ostreatus, y/o Vitamina C. Este trabajo muestra el resultado obtenido en diferentes estudios con la ingesta de estos componentes sobre el sistema inmunitario,...

Papel de la vitamina C y los β-glucanos sobre el sistema inmunitario: revisión

OpenAIRE

San Mauro-Martín, Ismael; Garicano-Vilar, Elena

2015-01-01

Existe un creciente interés en conocer herramientas nutricionales al alcance de profesionales para el manejo de la modulación del sistema inmunitario del humano. Esta revisión bibliográfica se centra en los potenciales efectos beneficiosos sobre el sistema inmune atribuidos a productos alimenticios compuestos por β-glucanos de Pleurotus ostreatus, y/o Vitamina C. Este trabajo muestra el resultado obtenido en diferentes estudios con la ingesta de estos componentes sobre el sistema inmunitario,...

Prevalence of Salmonella spp. in Oysters in the United States

OpenAIRE

Brands, Danielle A.; Inman, Allison E.; Gerba, Charles P.; Maré, C. John; Billington, Stephen J.; Saif, Linda A.; Levine, Jay F.; Joens, Lynn A.

2005-01-01

Food-borne diseases such as salmonellosis can be attributed, in part, to the consumption of raw oysters. To determine the prevalence of Salmonella spp. in oysters, oysters harvested from 36 U.S. bays (12 each from the West, East, and Gulf coasts in the summer of 2002, and 12 bays, four per coast, in the winter of 2002-2003) were tested. Salmonella was isolated from oysters from each coast of the United States, and 7.4% of all oysters tested contained Salmonella. Isolation tended to be bay spe...

Predicting the effects of proposed Mississippi River diversions on oyster habitat quality; application of an oyster habitat suitability index model

Science.gov (United States)

Soniat, Thomas M.; Conzelmann, Craig P.; Byrd, Jason D.; Roszell, Dustin P.; Bridevaux, Joshua L.; Suir, Kevin J.; Colley, Susan B.

2013-01-01

In an attempt to decelerate the rate of coastal erosion and wetland loss, and protect human communities, the state of Louisiana developed its Comprehensive Master Plan for a Sustainable Coast. The master plan proposes a combination of restoration efforts including shoreline protection, marsh creation, sediment diversions, and ridge, barrier island, and hydrological restoration. Coastal restoration projects, particularly the large-scale diversions of fresh water from the Mississippi River, needed to supply sediment to an eroding coast potentially impact oyster populations and oyster habitat. An oyster habitat suitability index model is presented that evaluates the effects of a proposed sediment and freshwater diversion into Lower Breton Sound. Voluminous freshwater, needed to suspend and broadly distribute river sediment, will push optimal salinities for oysters seaward and beyond many of the existing reefs. Implementation and operation of the Lower Breton Sound diversion structure as proposed would render about 6,173 ha of hard bottom immediately east of the Mississippi River unsuitable for the sustained cultivation of oysters. If historical harvests are to be maintained in this region, a massive and unprecedented effort to relocate private leases and restore oyster bottoms would be required. Habitat suitability index model results indicate that the appropriate location for such efforts are to the east and north of the Mississippi River Gulf Outlet.

Photosynthetic epibionts and endobionts of Pacific oyster shells from oyster reefs in rocky versus mudflat shores.

Directory of Open Access Journals (Sweden)

Laurent Barillé

Full Text Available The Pacific oyster, Crassostrea gigas (Thunberg, is the main bivalve species cultivated in the world. With global warming enabling its reproduction and larval survival at higher latitudes, this species is now recognized as invasive and creates wild oyster reefs globally. In this study, the spatial distribution of photosynthetic assemblages colonizing the shells of wild C. gigas was investigated on both a large scale (two contrasting types of reefs found in mudflats and rocky areas and a small scale (within individual shells using a hyperspectral imager. The microspatial distribution of all phototrophs was obtained by mapping the Normalized Difference Vegetation Index (NDVI. Second derivative (δδ analyses of hyperspectral images at 462, 524, 571 and 647 nm were subsequently applied to map diatoms, cyanobacteria, rhodophytes and chlorophytes, respectively. A concomitant pigment analysis was carried out by high performance liquid chromatography and completed by taxonomic observations. This study showed that there was high microalgal diversity associated with wild oyster shells and that there were differences in the structure of the phototropic assemblages depending on the type of reef. Namely, vertically-growing oysters in mudflat areas had a higher biomass of epizoic diatoms (hyperspectral proxy at δδ462 nm and were mainly colonized by species of the genera Navicula, Nitzschia and Hippodonta, which are epipelic or motile epipsammic. The assemblages on the horizontal oysters contained more tychoplanktonic diatoms (e.g. Thalassiosira pseudonana, T. proschkinae and Plagiogrammopsis vanheurckii. Three species of boring cyanobacteria were observed for both types of reef: Mastigocoleus testarum, Leptolyngbya terrebrans, and Hyella caespistosa, but the second derivative analysis at 524 nm showed a significantly higher biomass for the horizontally-growing oysters. There was no biomass difference for the boring chlorophyte assemblages (δδ647 nm, with

In vivo effects of metaldehyde on Pacific oyster, Crassostrea gigas: comparing hemocyte parameters in two oyster families.

Science.gov (United States)

Moreau, Pierrick; Burgeot, Thierry; Renault, Tristan

2015-06-01

Pollutants via run-off into the ocean represent a potential threat to marine organisms, especially bivalves such as oysters living in coastal environments. These organisms filter large volumes of seawater and may accumulate contaminants within their tissues. Pesticide contamination in water could have a direct or indirect toxic action on tissues or cells and could induce alteration of immune system. Bivalve immunity is mainly supported by hemocytes and participates directly by phagocytosis to eliminate pathogens. Some studies have shown that pesticides can reduce immune defences and/or modify genomes in vertebrates and invertebrates. Metaldehyde is used to kill slugs, snails and other terrestrial gastropods. Although metaldehyde has been detected in surface waters, its effects on marine bivalves including the Pacific oyster, Crassostrea gigas, have never been studied. Given the mode of action of this molecule and its targets (molluscs), it could be potentially more toxic to oysters than other pesticides (herbicides, fungicides, insecticides, etc.). Effects of metaldehyde on oyster hemocyte parameters were thus monitored through in vivo experiments based on a short-term exposure. In this work, metaldehyde at 0.1 μg/L, which corresponds to an average concentration detected in the environment, modulated hemocyte activities of Pacific oysters after an in vivo short-term contact. Individuals belonging to two families showed different behaviours for some hemocyte activities after contamination by metaldehyde. These results suggested that effects of pollutants on oysters may differ from an individual to another in relation to genetic diversity. Finally, it appears essential to take an interest in the effects of metaldehyde on a wide variety of aquatic invertebrates including those that have a significant economic impact.

Prevalence and characterization of Salmonella serovars isolated from oysters served raw in restaurants.

Science.gov (United States)

Brillhart, Crystal D; Joens, Lynn A

2011-06-01

To determine if Salmonella-contaminated oysters are reaching consumer tables, a survey of raw oysters served in eight Tucson restaurants was performed from October 2007 to September 2008. Salmonella spp. were isolated during 7 of the 8 months surveyed and were present in 1.2% of 2,281 oysters tested. This observed prevalence is lower than that seen in a previous study in which U.S. market oysters were purchased from producers at bays where oysters are harvested. To test whether the process of refrigerating oysters in restaurants for several days reduces Salmonella levels, oysters were artificially infected with Salmonella and kept at 4°C for up to 13 days. Direct plate counts of oyster homogenate showed that Salmonella levels within oysters did not decrease during refrigeration. Six different serovars of Salmonella enterica were found in the restaurant oysters, indicating multiple incidences of Salmonella contamination of U.S. oyster stocks. Of the 28 contaminated oysters, 12 (43%) contained a strain of S. enterica serovar Newport that matched by pulsed-field gel electrophoresis a serovar Newport strain seen predominantly in the study of bay oysters performed in 2002. The repeated occurrence of this strain in oyster surveys is concerning, since the strain was resistant to seven antimicrobials tested and thus presents a possible health risk to consumers of raw oysters.

Suspension of oysters reduces the populations of Vibrio parahaemolyticus and Vibrio vulnificus.

Science.gov (United States)

Cole, K M; Supan, J; Ramirez, A; Johnson, C N

2015-09-01

Vibrio parahaemolyticus (Vp) and Vibrio vulnificus (Vv) are associated with the consumption of raw oysters and cause illnesses ranging from simple gastroenteritis to life-threatening septicaemia. These halophilic bacteria are frequently found in marine and estuarine systems, accumulating within the tissues of a number of aquatic organisms and passing on to humans after consumption, through contaminated water, or via open wounds. As benthic organisms capable of filtering 40 gallons of water per hour, sediment is an important source of potentially pathogenic vibrios in oysters destined for raw consumption. This research used off-bottom oyster culture to reduce vibrio concentrations in oysters. Colony hybridization was used to enumerate Vp and Vv in bottom and suspended oysters. Vv and Vp concentrations were generally lower in oysters suspended off-bottom, and suspension decreased vibrio loads in oysters by an average of 13%. Suspension of oysters reduced vibrio concentrations. This study found that oyster suspension significantly reduced some populations of potentially pathogenic vibrios. These results indicate that oyster suspension could be a viable approach for preharvest treatment to reduce illness in consumers of raw oysters. © 2015 The Society for Applied Microbiology.

Diseases and pests noxious to Pleurotus spp. mushroom crops.

Science.gov (United States)

Bellettini, Marcelo B; Bellettini, Sebastião; Fiorda, Fernanda A; Pedro, Alessandra C; Bach, Fabiane; Fabela-Morón, Miriam F; Hoffmann-Ribani, Rosemary

The Pleurotus genus is one of most extensively studied white-rot fungi due to its exceptional ligninolytic properties. It is an edible mushroom that possesses biological effects, as it contains important bioactive molecules. It is a rich source of nutrients, particularly proteins, minerals as well as vitamins B, C and D. In basidiomycete fungi, intensive cultivations of edible mushrooms can often be affected by some bacterial, mold and virus diseases that rather frequently cause dramatic production loss. These infections are facilitated by the particular conditions under which mushroom cultivation is commonly carried out such as warm temperatures, humidity, carbon dioxide (CO 2 ) levels and presence of pests. There is not much bibliographic information related to pests of mushrooms and their substrates. The updated review presents a practical checklist of diseases and pests of the Pleurotus genus, providing useful information that may help different users. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

screening of pleurotus ostreatus and gleophylum sepiarium strains ...

African Journals Online (AJOL)

USER

sawdust dump-site were screened for protease enzyme production. High yields of protease ... glass spreader, sterilized by dipping in 95% ethanol and flaming. .... because higher temperatures led to a sharp decrease in activity. The result is ...

Respiratory Tract Infections and the Role of Biologically Active Polysaccharides in Their Management and Prevention.

Science.gov (United States)

Jesenak, Milos; Urbancikova, Ingrid; Banovcin, Peter

2017-07-20

Respiratory tract infections (RTIs) are the most common form of infections in every age category. Recurrent respiratory tract infections (RRTIs), a specific form of RTIs, represent a typical and common problem associated with early childhood, causing high indirect and direct costs on the healthcare system. They are usually the consequence of immature immunity in children and high exposure to various respiratory pathogens. Their rational management should aim at excluding other severe chronic diseases associated with increased morbidity (e.g., primary immunodeficiency syndromes, cystic fibrosis, and ciliary dyskinesia) and at supporting maturity of the mucosal immune system. However, RRTIs can also be observed in adults (e.g., during exhausting and stressful periods, chronic inflammatory diseases, secondary immunodeficiencies, or in elite athletes) and require greater attention. Biologically active polysaccharides (e.g., β-glucans) are one of the most studied natural immunomodulators with a pluripotent mode of action and biological activity. According to many studies, they possess immunomodulatory, anti-inflammatory, and anti-infectious activities and therefore could be suggested as an effective part of treating and preventing RTIs. Based on published studies, the application of β-glucans was proven as a possible therapeutic and preventive approach in managing and preventing recurrent respiratory tract infections in children (especially β-glucans from Pleurotus ostreatus ), adults (mostly the studies with yeast-derived β-glucans), and in elite athletes (studies with β-glucans from Pleurotus ostreatus or yeast).

Use of Edible and Medicinal Oyster Mushroom (Pleurotus ostreatus(Jacq.: Fr.) Kumm.) Spent Compost in Remediation of Chemically Polluted Soils

Czech Academy of Sciences Publication Activity Database

Eggen, T.; Šašek, Václav

2002-01-01

Roč. 4, č. 3 (2002), s. 255-261 ISSN 1521-9437 Grant - others:GA of the Center for Molecular and Gene Biotechnology(XC) LN00B030; Norwegian Research Founding grant(NO) 113788/720 Program:LN Institutional research plan: CEZ:AV0Z5020903 Keywords : biodegradation * bioremediation * contaminated soil Subject RIV: EE - Microbiology, Virology

Seasonal dynamics and diversity of bacteria in retail oyster tissues.

Science.gov (United States)

Wang, Dapeng; Zhang, Qian; Cui, Yan; Shi, Xianming

2014-03-03

Oysters are one of the important vehicles for the transfer of foodborne pathogens. It was reported that bacteria could be bio-accumulated mainly in the gills and digestive glands. In artificially treated oysters, bacterial communities have been investigated by culture-independent methods after harvest. However, little information is available on the seasonal dynamics of bacterial accumulation in retail oyster tissues. In this study, retail oysters were collected from local market in different seasons. The seasonal dynamics and diversity of bacteria in oyster tissues, including the gills, digestive glands and residual tissues, were analyzed by denaturing gradient gel electrophoresis (DGGE). It was interesting that the highest bacterial diversity appeared in the Fall season, not in summer. Our results indicated that Proteobacteria was the predominant member (23/46) in oyster tissues. Our results also suggested that bacterial diversity in gills was higher than that in digestive glands and other tissues. In addition, not all the bacteria collected from surrounding water by gills were transferred to digestive glands. On the other hand, few bacteria were found in oyster tissues except in the gills. Therefore, the gills could be the best candidate target tissue for monitoring of pathogenic bacteria either to human or to oyster. Copyright © 2013 Elsevier B.V. All rights reserved.

(Pleurotus pulmonarius) grown on cotton waste and cassava peel

African Journals Online (AJOL)

This work evaluated the yield of Pleurotus pulmonarius on different mixtures of cotton waste and cassava peel. P. pulmonarius demonstrated significantly higher colonization rate on cotton waste substrate (100 g cotton waste) 3 weeks after inoculation of spawn than any other substrate mixtures. Cotton waste had the ...

Defining optimal freshwater flow for oyster production: effects of freshet rate and magnitude of change and duration on eastern oysters and Perkinsus marinus infection

Science.gov (United States)

LaPeyre, Megan K.; Gossman, B.; La Peyre, Jerome F.

2009-01-01

In coastal Louisiana, the development of large-scale freshwater diversion projects has led to controversy over their effects on oyster resources. Using controlled laboratory experiments in combination with a field study, we examined the effects of pulsed freshwater events (freshet) of different magnitude, duration, and rate of change on oyster resources. Laboratory and field evidence indicate that low salinity events (oyster growth was positively correlated with salinity. To maximize oyster production, data indicate that both low and high salinity events will be necessary.

Norwalk virus gastroenteritis following raw oyster consumption.

Science.gov (United States)

Gunn, R A; Janowski, H T; Lieb, S; Prather, E C; Greenberg, H B

1982-03-01

In January, 1980, six out of 13 persons (46%) attending a party in a small northwest Florida town near the Gulf of Mexico became ill with Norwalk virus gastroenteritis after eating raw oysters. Symptoms experienced by the ill persons were principally nausea (100%), vomiting (83%) and diarrhea (50%) and were of brief duration. The symptom complex and epidemiology of Norwalk virus infection closely resemble the gastrointestinal illness commonly referred to as the 24-hour intestinal flu or "stomach flu." Norwalk virus infection was identified in this outbreak by application of a recently developed sensitive and specific serologic radioimmunoassay. Oysters from the incriminated batch had fecal coliform levels above recommended standards; however, recent studies of oyster-harvesting waters have shown only a weak correlation between fecal coliforms and the presence of enteric viruses. Further studies are needed to determine whether modifications of monitoring modalities for oyster-harvesting waters are needed.

Oyster radiation sensitivity; Sensibilidade de ostras a radiacao

Energy Technology Data Exchange (ETDEWEB)

Marchese, Sandra R.M. [Centro Tecnologico da Marinha em Sao Paulo (CTMSP), SP (Brazil); Mastro, Nelida L. del [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil)

1996-07-01

Various food products like oysters, crabs and shrimps have been described as possible Vibrio spp. transmitting agents. Seafood irradiation is been presented as an alternative among the different public health intervention measures to control food borne diseases. The objective of this work was to establish, firstly, the radioresistance of Crassostrea brasiliana oysters. The oysters were irradiated with Co-60 radiation with doses of 0, 1.5,3 and 6 kGy. Survival curves a function of time showed that 100% of samples irradiated with 3 kGy survived at least 6 days; among those irradiated with 6 kGy, 100% survived 3 days. These results are encouraging since a dose of 2 kGy is already effective in diminishing oyster bioburden. (author)

ANTAGONISTIC EFFECT OF EDIBLE MUSHROOM EXTRACT ON CANDIDA ALBICANS GROWTH

Directory of Open Access Journals (Sweden)

Paccola Edneia A. de Souza

2001-01-01

Full Text Available Five species of edible mushrooms, Lentinula edodes, Pleurotus ostreatus, Pholiota nameko, Macrolepiota bonaerensis and Agaricus blazei, were tested for their potential to inhibit the in vitro growth of the pathogenic yeast Candida albicans. Only L. edodes had a fungistatic effect on this human pathogen. The inhibitory compound was produced intra and extracellularly in submersed L. edodes culture, and was also present in fresh and dehydrated mushroom basidiocarps. The fungistatic compound was heat sensitive and lost activity after 72 hours.

Exploring Proteomic Variation in Pacific Oysters (Crassostrea gigas)

OpenAIRE

Venkataraman, Yaamini

2017-01-01

150 sibling Pacific oysters (Crassostrea gigas) were outplanted at five different sites around Puget Sound. Oysters were placed in exclusion cages either inside or outside of eelgrass beds. After a month of environmental exposure, gill tissue samples were collected for proteomic analyses. Initial DIA mass spectrometry methods on a subset of oysters (one per site and eelgrass condition, 10 total) provide data for upwards of 6,000 proteins. A subset of stress-related proteins reveal site-specif...

Factors affecting the uptake and retention of Vibrio vulnificus in oysters.

Science.gov (United States)

Froelich, Brett A; Noble, Rachel T

2014-12-01

Vibrio vulnificus, a bacterium ubiquitous in oysters and coastal water, is capable of causing ailments ranging from gastroenteritis to grievous wound infections or septicemia. The uptake of these bacteria into oysters is often examined in vitro by placing oysters in seawater amended with V. vulnificus. Multiple teams have obtained similar results in studies where laboratory-grown bacteria were observed to be rapidly taken up by oysters but quickly eliminated. This technique, along with suggested modifications, is reviewed here. In contrast, the natural microflora within oysters is notoriously difficult to eliminate via depuration. The reason for the transiency of exogenous bacteria is that those bacteria are competitively excluded by the oyster's preexisting microflora. Evidence of this phenomenon is shown using in vitro oyster studies and a multiyear in situ case study. Depuration of the endogenous oyster bacteria occurs naturally and can also be artificially induced, but both of these events require extreme conditions, natural or otherwise, as explained here. Finally, the "viable but nonculturable" (VBNC) state of Vibrio is discussed. This bacterial torpor can easily be confused with a reduction in bacterial abundance, as bacteria in this state fail to grow on culture media. Thus, oysters collected from colder months may appear to be relatively free of Vibrio but in reality harbor VBNC cells that respond to exogenous bacteria and prevent colonization of oyster matrices. Bacterial-uptake experiments combined with studies involving cell-free spent media are detailed that demonstrate this occurrence, which could explain why the microbial community in oysters does not always mirror that of the surrounding water. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Perkinsus beihaiensis (Perkinsozoa in oysters of Bahia State, Brazil

Directory of Open Access Journals (Sweden)

M. S. A. Luz

2017-08-01

Full Text Available Abstract This study reports the pathogen Perkinsus beihaiensis in oysters of the genus Crassostrea on the coast of the State of Bahia (Brazil, its prevalence, infection intensity and correlation with salinity. Oysters (n = 240 were collected between October and December 2014 at eight sampling stations between latitudes 13°55'S and 15°42'S. The laboratory procedures included macroscopic analysis, histology, culture in Ray's fluid thioglycollate medium (RFTM, Polymerase Chain Reaction (PCR and DNA sequencing. PCR and sequencing have been used for the genetic identification of oysters as well. Two species of oysters have been identified: Crassostrea rhizophorae and C. brasiliana. In both oyster species P. beihaiensis was the only Perkinsus species detected. In C. rhizophorae, the average prevalence was 82.8% by histology and 65.2% by RFTM. In C. brasiliana, the prevalences were 70.5% and 35.7%, respectively. The higher prevalence of P. beihaiensis in C. rhizophorae was probably influenced by salinity, with which was positively correlated (r> 0.8. In both oysters, P. beihaiensis was located mainly in the gastric epithelium. The infection was generally mild or moderate, without apparent harm to the hosts, but in cases of severe infection, there was hemocytical reaction and tissue disorganization. The generally high prevalence in the region suggests that oysters should be monitored with respect to this pathogen, especially in growing areas.

Inhibition of 4NQO-Induced Oral Carcinogenesis by Dietary Oyster Shell Calcium.

Science.gov (United States)

Chen, Ying; Jiang, Yi; Liao, Liyan; Zhu, Xiaoxin; Tang, Shengan; Yang, Qing; Sun, Lihua; Li, Yujie; Gao, Shuangrong; Xie, Zhongjian

2016-03-01

Oyster has gained much attention recently for its anticancer activity but it is unclear whether calcium, the major antitumor ingredient in oyster shell, is responsible for the anticarcinogenic role of the oyster. To address this issue, C57BL/6 mice were fed with the carcinogen 4-nitroquinoline-1-oxide (4NQO, 50 µg/mL) and normal diet or a diet containing oyster powder, oyster calcium, or calcium depleted oyster powder. The tongue tissue specimens isolated from these mice were histologically evaluated for hyperplasia, dysplasia, and papillary lesions, and then analyzed for proliferation and differentiation markers by immunohistochemistry. The results showed that mice on the diet containing oyster calcium significantly reduced rates of tumors in the tongue and proliferation and enhanced differentiation in the oral epithelium compared with the diet containing calcium depleted oyster powder. These results suggest that calcium in oyster plays a critical role in suppressing formation of oral squamous cell carcinoma and proliferation and promoting differentiation of the oral epithelium. © The Author(s) 2015.

Preliminary investigation into the use of Pleurotus tuber-regium ...

African Journals Online (AJOL)

The swelling capacity was three times that of maize starch BP Tablets prepared with P. tuber-regium powder disintegrated faster than those prepared with maize starch BP at concentrations below 10% w/w. At the disintegrant concentration of 10% w/w paracetamol tablets made from both Pleurotus powder and maize starch ...

INFLUENCE OF ALTERED FRESHWATER FLOWS ON EASTERN OYSTERS

Science.gov (United States)

Abstract for National Shellfisheries AssociationEastern oysters Crassostrea virginica are prominent in Gulf of Mexico estuaries. Valued both commercially and ecologically, oyster populations are threatened by human activity, including dredging, harvesting, and upstream al...

Water quality parameters and total aerobic bacterial and vibrionaceae loads in eastern oysters (Crassostrea virginica) from oyster gardening sites

Science.gov (United States)

Oyster gardening is a practice designed to restore habitat for marine life and to improve water quality. This study determined physical and chemical water quality parameters at two oyster gardening sites in the Delaware Inland Bays and compared them with total aerobic bacteria and Vibrionaceae conc...

Bacteriological quality of fresh and smoke-dried oysters sold in ...

African Journals Online (AJOL)

Bacterial isolates found in fresh oyster were Klebsiella sp. Escherichia sp., Proteus mirabilis, Citrobacter sp., Micrococcus sp., Bacillus sp., Staphylococccus sp. and Serratia sp. while E. coli, Streptococcus sp., Staphylococcus sp. and B. cereus predominated in dried oysters. The oyster meats did not meet the standards of ...

Detection of hepatitis A virus and bacterial contamination in raw oysters in Thailand.

Science.gov (United States)

Kittigul, Leera; Pombubpa, Kannika; Sukonthalux, Suntharee; Rattanatham, Tippawan; Utrarachkij, Fuangfa; Diraphat, Pornphan

2010-01-01

This study was conducted to determine the presence of hepatitis A virus (HAV) in raw oysters (Crassostrea belcheri) using a virus concentration method and reverse transcription-nested polymerase chain reaction (RT-nested PCR). A total of 220 oyster samples were collected from oyster farms and local markets in Thailand. HAV was found in three oyster samples. Nested PCR products of HAV detected in oysters were characterized further by DNA sequencing of the VP1/2A region and subjected to phylogenetic analysis. All HAV sequences (168 basepairs) were associated with human HAV subgenotype IB (GIB). Fecal coliforms and Escherichia coli were determined using the multiple tube fermentation method, to assess the microbiological quality of collected oysters. Among oyster samples tested, 65% had fecal coliforms higher than the standard level for raw shellfish [oyster samples (85%) were contaminated with E. coli in the range of 3.0-4.6 x 10(4) MPN/g. One oyster sample with an acceptable level of fecal coliforms contained HAV GIB. E. coli was found in all HAV-positive oyster samples. The results suggest a significant presence of HAV and bacterial indicators of fecal contamination in raw oysters, which are a health risk for consumers and a source of gastrointestinal illness. Enteric viruses should also be tested to assess the microbiological quality of oysters.

Drought Increases Consumer Pressure on Oyster Reefs in Florida, USA.

Directory of Open Access Journals (Sweden)

Hanna G Garland

Full Text Available Coastal economies and ecosystems have historically depended on oyster reefs, but this habitat has declined globally by 85% because of anthropogenic activities. In a Florida estuary, we investigated the cause of newly reported losses of oysters. We found that the oyster reefs have deteriorated from north to south and that this deterioration was positively correlated with the abundance of carnivorous conchs and water salinity. In experiments across these gradients, oysters survived regardless of salinity if conchs were excluded. After determining that conchs were the proximal cause of oyster loss, we tested whether elevated water salinity was linked to conch abundance either by increasing conch growth and survivorship or by decreasing the abundance of a predator of conchs. In field experiments across a salinity gradient, we failed to detect spatial variation in predation on conchs or in conch growth and survivorship. A laboratory experiment, however, demonstrated the role of salinity by showing that conch larvae failed to survive at low salinities. Because this estuary's salinity increased in 2006 in response to reduced inputs of freshwater, we concluded that the ultimate cause of oyster decline was an increase in salinity. According to records from 2002 to 2012, oyster harvests have remained steady in the northernmost estuaries of this ecoregion (characterized by high reef biomass, low salinity, and low conch abundance but have declined in the southernmost estuaries (characterized by lower reef biomass, increases in salinity, and increases in conch abundance. Oyster conservation in this ecoregion, which is probably one of the few that still support viable oyster populations, may be undermined by drought-induced increases in salinity causing an increased abundance of carnivorous conchs.

Drought Increases Consumer Pressure on Oyster Reefs in Florida, USA.

Science.gov (United States)

Garland, Hanna G; Kimbro, David L

2015-01-01

Coastal economies and ecosystems have historically depended on oyster reefs, but this habitat has declined globally by 85% because of anthropogenic activities. In a Florida estuary, we investigated the cause of newly reported losses of oysters. We found that the oyster reefs have deteriorated from north to south and that this deterioration was positively correlated with the abundance of carnivorous conchs and water salinity. In experiments across these gradients, oysters survived regardless of salinity if conchs were excluded. After determining that conchs were the proximal cause of oyster loss, we tested whether elevated water salinity was linked to conch abundance either by increasing conch growth and survivorship or by decreasing the abundance of a predator of conchs. In field experiments across a salinity gradient, we failed to detect spatial variation in predation on conchs or in conch growth and survivorship. A laboratory experiment, however, demonstrated the role of salinity by showing that conch larvae failed to survive at low salinities. Because this estuary's salinity increased in 2006 in response to reduced inputs of freshwater, we concluded that the ultimate cause of oyster decline was an increase in salinity. According to records from 2002 to 2012, oyster harvests have remained steady in the northernmost estuaries of this ecoregion (characterized by high reef biomass, low salinity, and low conch abundance) but have declined in the southernmost estuaries (characterized by lower reef biomass, increases in salinity, and increases in conch abundance). Oyster conservation in this ecoregion, which is probably one of the few that still support viable oyster populations, may be undermined by drought-induced increases in salinity causing an increased abundance of carnivorous conchs.

Chemical analysis of fructification bodies of Pleurotus sajor-caju cultivated in several nitrogen concentrations

OpenAIRE

Silva, Evânia Geralda; Dias, Eustáquio Souza; Siqueira, Félix Gonçalves; Schwan, Rosane Freitas

2007-01-01

Os cogumelos do gênero Pleurotus normalmente crescem bem em substratos mais pobres em nitrogênio, ao contrário dos cogumelos Agaricus que requerem substratos com relação C/N mais estreita. Por outro lado, os valores nutricionais do cogumelo dependem da composição química do substrato utilizado e das condições de cultivo. Este trabalho teve como objetivo avaliar o teor de proteína dos corpos de frutificação do cogumelo Pleurotus sajor-caju cultivado em capim coast-cross, bagaço de cana-de-açúc...

Neuropeptides encoded by the genomes of the Akoya pearl oyster Pinctata fucata and Pacific oyster Crassostrea gigas: a bioinformatic and peptidomic survey.

Science.gov (United States)

Stewart, Michael J; Favrel, Pascal; Rotgans, Bronwyn A; Wang, Tianfang; Zhao, Min; Sohail, Manzar; O'Connor, Wayne A; Elizur, Abigail; Henry, Joel; Cummins, Scott F

2014-10-02

Oysters impart significant socio-ecological benefits from primary production of food supply, to estuarine ecosystems via reduction of water column nutrients, plankton and seston biomass. Little though is known at the molecular level of what genes are responsible for how oysters reproduce, filter nutrients, survive stressful physiological events and form reef communities. Neuropeptides represent a diverse class of chemical messengers, instrumental in orchestrating these complex physiological events in other species. By a combination of in silico data mining and peptide analysis of ganglia, 74 putative neuropeptide genes were identified from genome and transcriptome databases of the Akoya pearl oyster, Pinctata fucata and the Pacific oyster, Crassostrea gigas, encoding precursors for over 300 predicted bioactive peptide products, including three newly identified neuropeptide precursors PFGx8amide, RxIamide and Wx3Yamide. Our findings also include a gene for the gonadotropin-releasing hormone (GnRH) and two egg-laying hormones (ELH) which were identified from both oysters. Multiple sequence alignments and phylogenetic analysis supports similar global organization of these mature peptides. Computer-based peptide modeling of the molecular tertiary structures of ELH highlights the structural homologies within ELH family, which may facilitate ELH activity leading to the release of gametes. Our analysis demonstrates that oysters possess conserved molluscan neuropeptide domains and overall precursor organization whilst highlighting many previously unrecognized bivalve idiosyncrasies. This genomic analysis provides a solid foundation from which further studies aimed at the functional characterization of these molluscan neuropeptides can be conducted to further stimulate advances in understanding the ecology and cultivation of oysters.

Radiocesium uptake mechanisms in wild and culture mushrooms

International Nuclear Information System (INIS)

Sugiyama, Hideo; Terada, Hiroshi; Isomura, Kimio; Tsukada, Hirofumi; Shibata, Hisashi.

1993-01-01

Concentrations of 137 Cs and stable Cs in wild mushrooms, cultivated mushrooms and those substrates were measured by gamma-ray spectrometry and neutron activation analysis. The average concentration of 137 Cs in 80 wild mushrooms in Japan was 87.5 Bq/kg (wet wt.), and concentration of 137 Cs in mycorrhizal mushrooms was higher than that of saprophytic mushrooms. High concentrations of 137 Cs were found in Pleurotus ostreatus (Fr.) Kummer Y-1, saprophytic mushrooms, cultivated in culture substrates containing high 137 Cs. Clear correlations with 5% level of significance were found between wild mushroom-to-substrate ratios (wet/dry) of 137 Cs concentration and those of stable Cs. Cultivated P. ostreatus-to-culture substrate ratios (wet/wet) of 137 Cs concentration were stable in the order of 10 0 when the culture substrate was containing 10 000 Bq/kg (wet wt.) of 137 Cs or 1 000 mg/kg (wet wt.) of stable Cs. The ratios of 137 Cs concentration in cultivated mushrooms were about equal to those in wild mushrooms. Higher concentration of 137 Cs in culture substrate after sampling P. ostreatus was observed at the upper layer where mycelium density was high. (author)

Virus, protozoa and organic compounds decay in depurated oysters.

Science.gov (United States)

Souza, Doris Sobral Marques; Piazza, Rômi Sharon; Pilotto, Mariana Rangel; do Nascimento, Mariana de Almeida; Moresco, Vanessa; Taniguchi, Satie; Leal, Diego Averaldo Guiguet; Schmidt, Éder der Carlos; Cargin-Ferreira, Eduardo; Bícego, Márcia Caruso; Sasaki, Silvio Tarou; Montone, Rosalinda Carmela; de Araujo, Rafael Alves; Franco, Regina Maura Bueno; Bouzon, Zenilda Laurita; Bainy, Afonso Celso Dias; Barardi, Célia Regina Monte

2013-11-01

(1) Evaluate the dynamic of the depuration process of Crassostrea gigas oysters using different ultraviolet doses with different amounts of contaminants (virus, protozoa and organic contaminants) and (2) investigate the morphological changes in the oysters' tissues produced by the depuration procedures. The oysters were allocated in sites with different degrees of contamination and analyzed after 14 days. Some animals were used as positive controls by artificial bioaccumulation with HAdV2 and MNV1 and subjected to depuration assays using UV lamps (18 or 36 W) for 168 h. The following pollutants were researched in the naturally contaminated oysters, oysters after 14 days in sites and oysters during the depuration processes: virus (HAdV, HAV, HuNoV GI/GII and JCPyV), by (RT) qPCR; protozoa (Cryptosporidium and Giardia species), by immunomagnetic separation and immunofluorescence; and organic compounds (AHs, PAHs, LABs, PCBs and organochlorine pesticides-OCs), by chromatography. Changes in the oysters' tissues produced by the depuration processes were also evaluated using histochemical analysis by light microscopy. In the artificially bioaccumulated oysters, only HAdV2 and MNV1 were investigated by (RT) qPCR before the depuration procedures and after 96 and 168 h of these procedures. At 14 days post-allocation, HAdV was found in all the sites (6.2 × 105 to 4.4 × 107 GC g(-1)), and Giardia species in only one site. Levels of PCBs and OCs in the oyster's tissues were below the detection limit for all samples. AHs (3.5 to 4.4 μg g(-1)), PAHs (11 to 191 ng g(-1)) and LABs (57 to 751 ng g(-1)) were detected in the samples from 3 sites. During the depuration assays, we found HAdV, Giardia and Cryptosporidium species until 168 h, independent of UV treatment. AHs, PAHs and LABs were found also after 168 h of depuration (36 W and without UV lamp). The depuration procedures did not produce changes in the oysters' tissues. In the artificially contaminated and depurated

Characterization of adhesive from oysters: A structural and compositional study

Science.gov (United States)

Alberts, Erik

The inability for man-made adhesives to set in wet or humid environments is an ongoing challenging the design of biomedical and marine adhesive materials. However, we see that nature has already overcome this challenge. Mussels, barnacles, oysters and sandcastle worms all have unique mechanisms by which they attach themselves to surfaces. By understanding what evolution has already spent millions of years perfecting, we can design novel adhesive materials inspired by nature's elegant designs. The well-studied mussel is currently the standard for design of marine inspired biomimetic polymers. In the work presented here, we aim to provide new insights into the adhesive produced by the eastern oyster, Crassostrea virginica. Unlike the mussel, which produces thread-like plaques comprised of DOPA containing-protein, the oyster secretes an organic-inorganic hybrid adhesive as it settles and grows onto a surface. This form of adhesion renders the oyster to be permanently fixed in place. Over time, hundreds of thousands of oyster grow and agglomerate to form extensive reef structures. These reefs are not only essential to survival of the oyster, but are also vital to intertidal ecosystems. While the shell of the oyster has been extensively studied, curiously, only a few conflicting insights have been made into the nature of the adhesive and contact zone between shell and substrate, and even lesfs information has been ascertained on organic and inorganic composition. In this work, we provide microscopy and histochemical studies to characterize the structure and composition of the adhesive, using oyster in the adult and juvenile stages of life. Preliminary work on extracting and characterizing organic components through collaborative help with solid-state NMR (SSNMR) and proteomics are also detailed here. We aim to provide a full, comprehensive characterization of oyster adhesive so that in the future, we may apply what we learn to the design of new materials.

Effect of mushroom ( Pleurotus tuber-regium ) inoculums on crude ...

African Journals Online (AJOL)

Pollution of soils by crude oil in Niger-Delta of Nigeria has brought untold hardship to the inhabitants of the region. This study was carried out in 2010/2011 and 2011/2012 to determine the effect of Pleurotus tuber-regium (mushroom) inoculums on crude oil polluted soil on stover and grain yields and as well as cob length ...

CAN OYSTERS PLAY A ROLE IN ENVIRONMENTAL MANAGEMENT?

Science.gov (United States)

The culinary and commercial value of oysters is widely recognized but, until recently, their ecological importance has been largely overlooked. Field and laboratory studies have begun to explore how filter-feeding and reef building by oysters can influence nutrient cycling, biodi...

Oyster reproduction is affected by exposure to polystyrene microplastics.

Science.gov (United States)

Sussarellu, Rossana; Suquet, Marc; Thomas, Yoann; Lambert, Christophe; Fabioux, Caroline; Pernet, Marie Eve Julie; Le Goïc, Nelly; Quillien, Virgile; Mingant, Christian; Epelboin, Yanouk; Corporeau, Charlotte; Guyomarch, Julien; Robbens, Johan; Paul-Pont, Ika; Soudant, Philippe; Huvet, Arnaud

2016-03-01

Plastics are persistent synthetic polymers that accumulate as waste in the marine environment. Microplastic (MP) particles are derived from the breakdown of larger debris or can enter the environment as microscopic fragments. Because filter-feeder organisms ingest MP while feeding, they are likely to be impacted by MP pollution. To assess the impact of polystyrene microspheres (micro-PS) on the physiology of the Pacific oyster, adult oysters were experimentally exposed to virgin micro-PS (2 and 6 µm in diameter; 0.023 mg·L(-1)) for 2 mo during a reproductive cycle. Effects were investigated on ecophysiological parameters; cellular, transcriptomic, and proteomic responses; fecundity; and offspring development. Oysters preferentially ingested the 6-µm micro-PS over the 2-µm-diameter particles. Consumption of microalgae and absorption efficiency were significantly higher in exposed oysters, suggesting compensatory and physical effects on both digestive parameters. After 2 mo, exposed oysters had significant decreases in oocyte number (-38%), diameter (-5%), and sperm velocity (-23%). The D-larval yield and larval development of offspring derived from exposed parents decreased by 41% and 18%, respectively, compared with control offspring. Dynamic energy budget modeling, supported by transcriptomic profiles, suggested a significant shift of energy allocation from reproduction to structural growth, and elevated maintenance costs in exposed oysters, which is thought to be caused by interference with energy uptake. Molecular signatures of endocrine disruption were also revealed, but no endocrine disruptors were found in the biological samples. This study provides evidence that micro-PS cause feeding modifications and reproductive disruption in oysters, with significant impacts on offspring.

VALOR NUTRICIONAL DE PLEUROTUS DJAMOR CULTIVADO EM PALHA DE BANANEIRA

Directory of Open Access Journals (Sweden)

Jamile Rosa RAMPINELLI

2010-11-01

Full Text Available

Cogumelos do gênero Pleurotus representam um alimento de custo baixo, com teor elevado de proteínas, aminoácidos essenciais, proporção elevada de ácidos graxos insaturados, diversas vitaminas e minerais, além de teores baixos de gorduras, ácidos nucléicos, açúcares e calorias. Assim, o objetivo deste trabalho foi avaliar o valor nutricional de basidiomas de Pleurotus djamor de 1o e 2o fluxo produtivo, cultivados em palha de bananeira, em termos de teores de carboidratos, proteínas, fi bras, gorduras, cinzas, vitaminas, fósforo e potássio. Os teores de carboidratos totais, proteína bruta, fi bra bruta e cinzas diminuíram do 1o para o 2o fl uxo produtivo de 32,7 para 27,4g/100g, de 20,5 para 19,8g/100g, de 22,4 para 12,7g/100g e de 7,4 para 6,3g/100g, respectivamente. Os valores de gordura bruta e umidade não variaram, permanecendo em torno de 1,1 e 90g/100g, respectivamente. Os teores de vitamina B1 foram superiores aos de vitamina B2, independentemente do fluxo produtivo, e foi encontrada maior quantidade de potássio do que de fósforo. Pleurotus djamor, de 1o fl uxo produtivo, pode ser considerado fonte de fósforo e potássio, além de apresentar baixo teor de açúcar e não conter gordura.

Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii

Directory of Open Access Journals (Sweden)

Sharon Avni

2017-07-01

Full Text Available Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe of the fruit body contained higher glucan content then the caps (pileus. Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate.

Utilization of detrital complexes by the oyster, Crassostrea virginica (Gmelin)

International Nuclear Information System (INIS)

Crosby, M.P.

1987-01-01

The contribution of bacteria and nonliving particulate organic matter of detrital complexes to the nutrition of the American oyster, Crassostrea virginica, was investigated in the laboratory under normal feeding conditions. Results indicate the oysters were capable of assimilating crude fiber extracted from 14 C-Spartina alterniflora with an efficiency of approximately 3% and that enteric bacteria did not enhance this process. Less than 1% of an oyster's energetic demands could be met by direct utilization of this substrate, in the Choptank River subestuary of the Chesapeake Bay. The potential contribution of refractory organics to oysters in large salt marshes having crude fiber concentration greater than in the Choptank system, are discussed. The ability of the oyster to utilize 14 C and 15 N from cellulolytic marine bacteria, isolated from a S. alterniflora dominated salt marsh, was also studied

Guidelines for evaluating performance of oyster habitat restoration

Science.gov (United States)

Baggett, Lesley P.; Powers, Sean P.; Brumbaugh, Robert D.; Coen, Loren D.; DeAngelis, Bryan M.; Greene, Jennifer K.; Hancock, Boze T.; Morlock, Summer M.; Allen, Brian L.; Breitburg, Denise L.; Bushek, David; Grabowski, Jonathan H.; Grizzle, Raymond E.; Grosholz, Edwin D.; LaPeyre, Megan K.; Luckenbach, Mark W.; McGraw, Kay A.; Piehler, Michael F.; Westby, Stephanie R.; zu Ermgassen, Philine S. E.

2015-01-01

Restoration of degraded ecosystems is an important societal goal, yet inadequate monitoring and the absence of clear performance metrics are common criticisms of many habitat restoration projects. Funding limitations can prevent adequate monitoring, but we suggest that the lack of accepted metrics to address the diversity of restoration objectives also presents a serious challenge to the monitoring of restoration projects. A working group with experience in designing and monitoring oyster reef projects was used to develop standardized monitoring metrics, units, and performance criteria that would allow for comparison among restoration sites and projects of various construction types. A set of four universal metrics (reef areal dimensions, reef height, oyster density, and oyster size–frequency distribution) and a set of three universal environmental variables (water temperature, salinity, and dissolved oxygen) are recommended to be monitored for all oyster habitat restoration projects regardless of their goal(s). In addition, restoration goal-based metrics specific to four commonly cited ecosystem service-based restoration goals are recommended, along with an optional set of seven supplemental ancillary metrics that could provide information useful to the interpretation of prerestoration and postrestoration monitoring data. Widespread adoption of a common set of metrics with standardized techniques and units to assess well-defined goals not only allows practitioners to gauge the performance of their own projects but also allows for comparison among projects, which is both essential to the advancement of the field of oyster restoration and can provide new knowledge about the structure and ecological function of oyster reef ecosystems.

Sediment quality guidelines for copper and zinc for filter-feeding estuarine oysters?

Energy Technology Data Exchange (ETDEWEB)

Birch, G.F., E-mail: gavin.birch@sydney.edu.a [Environmental Geology Group, School of Geosciences, Sydney University, NSW (Australia); Hogg, T.D. [Environmental Geology Group, School of Geosciences, Sydney University, NSW (Australia)

2011-01-15

Sediment quality guidelines (SQGs) assess the ability of bottom sediment to sustain healthy infauna and water quality guidelines (WQGs) provide protection for a designated percentage of aquatic species. Filter-feeding marine species, e.g. oysters and mussels, acquire food from particles in the water column and protection of these animals is not provided by SQGs or WQGs. The current work investigated the relationship between metal (Cu, Zn) concentrations in total and fine-fraction (<62.5 {mu}m) surficial sediment digested in a range of acids and chelating agents and oyster tissue metal concentrations. A strong correlation between oyster tissue Cu and Zn concentrations and fine-fraction surficial sediment digested in 1 M HCl provided a sedimentary guideline which predicted tissue metal concentrations in oysters and established a level (<45 {mu}g g{sup -1} and <1000 {mu}g g{sup -1}, respectively) for protecting oysters from exceeding human consumption levels (70 {mu}g g{sup -1} and 1000 {mu}g g{sup -1}, respectively). - A strong correlation between oyster tissue Cu and Zn concentrations and fine-fraction surficial sediment digested in 1 M HCl provided a sedimentary guideline which predicted tissue metal concentrations in oysters and established a level for protecting oysters from exceeding human consumption levels for these metals. The guidelines for fine surficial sediment developed in the present work accurately predicted oyster tissue concentrations in the field.

National survey of foodborne viruses in Australian oysters at production.

Science.gov (United States)

Torok, Valeria; Hodgson, Kate; McLeod, Catherine; Tan, Jessica; Malhi, Navreet; Turnbull, Alison

2018-02-01

Internationally human enteric viruses, such as norovirus (NoV) and hepatitis A virus (HAV), are frequently associated with shellfish related foodborne disease outbreaks, and it has been suggested that acceptable NoV limits based on end-point testing be established for this high risk food group. Currently, shellfish safety is generally managed through the use of indicators of faecal contamination. Between July 2014 and August 2015, a national prevalence survey for NoV and HAV was done in Australian oysters suitable for harvest. Two sampling rounds were undertaken to determine baseline levels of these viruses. Commercial Australian growing areas, represented by 33 oyster production regions in New South Wales, South Australia, Tasmania and Queensland, were included in the survey. A total of 149 and 148 samples were collected during round one and two of sampling, respectively, and tested for NoV and HAV by quantitative RT-PCR. NoV and HAV were not detected in oysters collected in either sampling round, indicating an estimated prevalence for these viruses in Australian oysters of oysters was consistent with epidemiological evidence, with no oyster-related foodborne viral illness reported during the survey period. Copyright © 2017 Elsevier Ltd. All rights reserved.

Copper and zinc contamination in oysters: subcellular distribution and detoxification.

Science.gov (United States)

Wang, Wen-Xiong; Yang, Yubo; Guo, Xiaoyu; He, Mei; Guo, Feng; Ke, Caihuan

2011-08-01

Metal pollution levels in estuarine and coastal environments have been widely reported, but few documented reports exist of severe contamination in specific environments. Here, we report on a metal-contaminated estuary in Fujian Province, China, in which blue oysters (Crassostrea hongkongensis) and green oysters (Crassostrea angulata) were discovered to be contaminated with Cu and other metals. Extraordinarily high metal concentrations were found in the oysters collected from the estuary. Comparison with historical data suggests that the estuary has recently been contaminated with Cr, Cu, Ni, and Zn. Metal concentrations in blue oysters were as high as 1.4 and 2.4% of whole-body tissue dry wt for Cu and Zn, respectively. Cellular debris was the main subcellular fraction binding the metals, but metal-rich granules were important for Cr, Ni, and Pb. With increasing Cu accumulation, its partitioning into the cytosolic proteins decreased. In contrast, metallothionein-like proteins increased their importance in binding with Zn as tissue concentrations of Zn increased. In the most severely contaminated oysters, only a negligible fraction of their Cu and Zn was bound with the metal-sensitive fraction, which may explain the survival of oysters in such contaminated environments. Copyright © 2011 SETAC.

Oyster reproduction is affected by exposure to polystyrene microplastics

Science.gov (United States)

Sussarellu, Rossana; Suquet, Marc; Thomas, Yoann; Lambert, Christophe; Fabioux, Caroline; Pernet, Marie Eve Julie; Le Goïc, Nelly; Quillien, Virgile; Mingant, Christian; Epelboin, Yanouk; Corporeau, Charlotte; Guyomarch, Julien; Robbens, Johan; Paul-Pont, Ika; Soudant, Philippe; Huvet, Arnaud

2016-01-01

Plastics are persistent synthetic polymers that accumulate as waste in the marine environment. Microplastic (MP) particles are derived from the breakdown of larger debris or can enter the environment as microscopic fragments. Because filter-feeder organisms ingest MP while feeding, they are likely to be impacted by MP pollution. To assess the impact of polystyrene microspheres (micro-PS) on the physiology of the Pacific oyster, adult oysters were experimentally exposed to virgin micro-PS (2 and 6 µm in diameter; 0.023 mg·L−1) for 2 mo during a reproductive cycle. Effects were investigated on ecophysiological parameters; cellular, transcriptomic, and proteomic responses; fecundity; and offspring development. Oysters preferentially ingested the 6-µm micro-PS over the 2-µm-diameter particles. Consumption of microalgae and absorption efficiency were significantly higher in exposed oysters, suggesting compensatory and physical effects on both digestive parameters. After 2 mo, exposed oysters had significant decreases in oocyte number (−38%), diameter (−5%), and sperm velocity (−23%). The D-larval yield and larval development of offspring derived from exposed parents decreased by 41% and 18%, respectively, compared with control offspring. Dynamic energy budget modeling, supported by transcriptomic profiles, suggested a significant shift of energy allocation from reproduction to structural growth, and elevated maintenance costs in exposed oysters, which is thought to be caused by interference with energy uptake. Molecular signatures of endocrine disruption were also revealed, but no endocrine disruptors were found in the biological samples. This study provides evidence that micro-PS cause feeding modifications and reproductive disruption in oysters, with significant impacts on offspring. PMID:26831072

Cultivo de Lentinus sajor-caju (Fr.) Fr. [= Pleurotus sajor-caju (Fr.) Singer] e Pleurotus spp. em diferentes substratos

OpenAIRE

Albuquerque, Margeli Pereira de

2010-01-01

As espécies de Pleurotus, popularmente conhecidas por cogumelos ostra, são decompositoras primárias de madeira e outros resíduos vegetais biodegradáveis. Estes fungos apresentam propriedades nutricionais com elevados teores de proteínas aminoácidos essenciais, ácidos graxos insaturados, vitaminas e minerais, por isso estão tornando-se cada vez mais importantes como um recurso alimentar. A identificação de substratos que permitam o rápido desenvolvimento do micélio fúngico é uma...

Macrofauna Settlement on Pearl Oyster Collectors in Kenya ...

African Journals Online (AJOL)

Key words: Pearl oysters, seed collection, macrofauna, bivalves, settlement, monsoon seasons,. Kenya .... have shown that pearl oyster settlement is higher within calm ...... collectors in the Timor Sea, Northern Australia. J. Shellfish ... systems. Aquaculture, 189: 375-388. Urban, H.J. (2000b): Culture potential of the pearl.

Nutrient bioassimilation capacity of aquacultured oysters: quantification of an ecosystem service.

Science.gov (United States)

Higgins, Colleen B; Stephenson, Kurt; Brown, Bonnie L

2011-01-01

Like many coastal zones and estuaries, the Chesapeake Bay has been severely degraded by cultural eutrophication. Rising implementation costs and difficulty achieving nutrient reduction goals associated with point and nonpoint sources suggests that approaches supplemental to source reductions may prove useful in the future. Enhanced oyster aquaculture has been suggested as one potential policy initiative to help rid the Bay waters of excess nutrients via harvest of bioassimilated nutrients. To assess this potential, total nitrogen (TN), total phosphorous (TP), and total carbon (TC) content were measured in oyster tissue and shell at two floating-raft cultivation sites in the Chesapeake Bay. Models were developed based on the common market measurement of total length (TL) for aquacultured oysters, which was strongly correlated to the TN (R2 = 0.76), TP (R2 = 0.78), and TC (R2 = 0.76) content per oyster tissue and shell. These models provide resource managers with a tool to quantify net nutrient removal. Based on model estimates, 10(6) harvest-sized oysters (76 mm TL) remove 132 kg TN, 19 kg TP, and 3823 kg TC. In terms of nutrients removed per unit area, oyster harvest is an effective means of nutrient removal compared with other nonpoint source reduction strategies. At a density of 286 oysters m(-2), assuming no mortality, harvest size nutrient removal rates can be as high as 378 kg TN ha(-1), 54 kg TP ha(-1), and 10,934 kg TC ha(-1) for 76-mm oysters. Removing 1 t N from the Bay would require harvesting 7.7 million 76-mm TL cultivated oysters.

Bioremediation of engine-oil polluted soil by Pleurotus tuber-regium ...

African Journals Online (AJOL)

White-rot fungi have been used in various parts of the world for bioremediation of polluted sites. Pleurotus tuber-regium was noted to have the ability to increase nutrient contents in soils polluted with 1 - 40% engine-oil concentration after six months of incubation. P. tuber-regium increased organic matter, carbon and ...

Quantitative validation of a habitat suitability index for oyster restoration

Directory of Open Access Journals (Sweden)

Seth eTheuerkauf

2016-05-01

Full Text Available Habitat suitability index (HSI models provide spatially explicit information on the capacity of a given habitat to support a species of interest, and their prevalence has increased dramatically in recent years. Despite caution that the reliability of HSIs must be validated using independent, quantitative data, most HSIs intended to inform terrestrial and marine species management remain unvalidated. Furthermore, of the eight HSI models developed for eastern oyster (Crassostrea virginica restoration and fishery production, none has been validated. Consequently, we developed, calibrated, and validated an HSI for the eastern oyster to identify optimal habitat for restoration in a tributary of Chesapeake Bay, the Great Wicomico River (GWR. The GWR harbors a high density, restored oyster population, and therefore serves as an excellent model system for assessing the validity of the HSI. The HSI was derived from GIS layers of bottom type, salinity, and water depth (surrogate for dissolved oxygen, and was tested using live adult oyster density data from a survey of high vertical relief reefs (HRR and low vertical relief reefs (LRR in the sanctuary network. Live adult oyster density was a statistically-significant sigmoid function of the HSI, which validates the HSI as a robust predictor of suitable oyster reef habitat for rehabilitation or restoration. In addition, HRR had on average 103-116 more adults m^−2 than LRR at a given level of the HSI. For HRR, HSI values ≥0.3 exceeded the accepted restoration target of 50 live adult oysters m^−2. For LRR, the HSI was generally able to predict live adult oyster densities that meet or exceed the target at HSI values ≥0.3. The HSI indicated that there remain large areas of suitable habitat for restoration in the GWR. This study provides a robust framework for HSI model development and validation, which can be refined and applied to other systems and previously developed HSIs to improve the efficacy of

Use of maize wastewater for the cultivation of the Pleurotus spp. mushroom and optimization of its biological efficiency.

Science.gov (United States)

Loss, Edenes; Royer, Andrea Rafaela; Barreto-Rodrigues, Marcio; Barana, Ana Claudia

2009-07-30

This study evaluated the Pleurotus spp. mushroom production process using an effluent from the maize agroindustrial process as a carbon and nitrogen source and as a wetting agent. A complete experimental design based on factorial planning was used to optimize the biological efficiency and evaluate the effect of the concentration of effluent, pH and species of Pleurotus. The results indicated that the effluent affects the biological efficiency for the production of both species of mushrooms at all pH values studied. The maximum biological efficiency predicted by the model (81.36%) corresponded to the point defined by the effluent contents (X(1)=1), pH (X(2)=-1) and fungus species (X(3)=1), specifically 50%, 5.0 and P. floridae, respectively. The results demonstrated that the effluent is a good alternative for the production of Pleurotus mushrooms.

Shell Games. VORTEX: Virginia's Oyster Reef Teaching EXperience.

Science.gov (United States)

Harding, Juliana M.; Mann, Roger; Clark, Vicki P.

This document introduces Virginia's Oyster Reef Teaching EXperience (VORTEX), which is an interdisciplinary program focusing on the importance of oyster reef communities in the Chesapeake Bay ecosystem. The VORTEX program uses field and laboratory experiences supported by multimedia instruction. This document presents an overview on the biology of…

Effects of a thermal effluent on the reproduction of the American oyster

International Nuclear Information System (INIS)

Tinsman, J.C.; Tinsman, S.G.; Maurer, D.

1976-01-01

Oysters were sampled from September 1970 to September 1972 from two stations in Indian River Bay, Delaware, for histological examination. Station 1 (control) was located near the intake of the Delmarva Power and Light Company's fossil-fuel plant in Millsboro, Del. Station 2 (effluent) was 2.5 km east of the plant at the mouth of Island Creek. A combination of classical and quantitative methods was used to document changes in the developmental cycle of oysters resulting from the influence of a thermal effluent. Oysters in the effluent showed precocious gonadal development during the spring, but the time of maximum ripeness and spawning activity was the same at both stations. An extension of the spawning season for several weeks in September was noted for oysters in the effluent. During 1972, oysters in the thermal effluent showed a significantly lower level of gonadal development than did controls. Since this season of decreased reproductive amplitude corresponds with a period of high mortalities among effluent oysters, it seems likely that these oysters were thermally stressed, requiring more energy for maintenance and leaving less available for reproduction

Role of bacteria in bioaccumulation of mercury in the oyster Crassostrea virginica

International Nuclear Information System (INIS)

Sayler, G.S.; Nelson, J.D. Jr.; Colwell, R.R.

1975-01-01

An investigation of mercury-resistant bacteria was undertaken to determine their role in the accumulation of mercury in a simplified food chain. Oysters (Crassostrea virginica) were maintained in a closed system, sealed aquarium with stirred, aerated water containing 10 μg of 203 HgCl 2 per liter. Uptake of 203 Hg by oysters held under control conditions was compared with that of 203 Hg uptake by oysters under similar conditions except that mercury-accumulating and mercury-metabolizing species of Pseudomonsa, isolated from Chesapeake Bay, were added to the experimental oysters. After incubation for 4 days, the major portion of the 203 Hg in the water column was found to be associated with the microparticulate fraction, corresponding to a rise in total viable count. Mercury accumulation in the oysters was significantly higher in the gill and fisceral tissue than other tissues. Mercury concentrations were 200 times greater in tissue fractions of oysters dosed with mercury-metabolizing bacteria compared with the oysters held under control conditions without mercury-metabolizing bacteria. (U.S.)

Angiotensin I-Converting Enzyme Inhibitor Derived from Cross-Linked Oyster Protein

Directory of Open Access Journals (Sweden)

Cheng-Liang Xie

2014-01-01

Full Text Available Following cross-linking by microbial transglutaminase, modified oyster proteins were hydrolyzed to improve inhibitory activity against angiotensin-converting enzyme (ACE inhibitory activity with the use of a single protease, or a combination of six proteases. The oyster hydrolysate with the lowest 50% ACE inhibitory concentration (IC50 of 0.40 mg/mL was obtained by two-step hydrolysis of the cross-linked oyster protein using Protamex and Neutrase. Five ACE inhibitory peptides were purified from the oyster hydrolysate using a multistep chromatographic procedure comprised of ion-exchange, size exclusion, and reversed-phase liquid chromatography. Their sequences were identified as TAY, VK, KY, FYN, and YA, using automated Edman degradation and mass spectrometry. These peptides were synthesized, and their IC50 values were measured to be 16.7, 29.0, 51.5, 68.2, and 93.9 μM, respectively. Toxicity of the peptides on the HepG2 cell line was not detected. The oyster hydrolysate also significantly decreased the systolic blood pressure of spontaneously hypertensive rats (SHR. The antihypertensive effect of the oyster hydrolysate on SHR was rapid and long-lasting, compared to commercially obtained sardine hydrolysate. These results suggest that the oyster hydrolysate could be a source of effective nutraceuticals against hypertension.

[Comparison of two nucleic acid extraction methods for norovirus in oysters].

Science.gov (United States)

Yuan, Qiao; Li, Hui; Deng, Xiaoling; Mo, Yanling; Fang, Ling; Ke, Changwen

2013-04-01

To explore a convenient and effective method for norovirus nucleic acid extraction from oysters suitable for long-term viral surveillance. Two methods, namely method A (glycine washing and polyethylene glycol precipitation of the virus followed by silica gel centrifugal column) and method B (protease K digestion followed by application of paramagnetic silicon) were compared for their performance in norovirus nucleic acid extraction from oysters. Real-time RT-PCR was used to detect norovirus in naturally infected oysters and in oysters with induced infection. The two methods yielded comparable positive detection rates for the samples, but the recovery rate of the virus was higher with method B than with method A. Method B is a more convenient and rapid method for norovirus nucleic acid extraction from oysters and suitable for long-term surveillance of norovirus.

Bioremediation of engine-oil polluted soil by Pleurotus tuber-regium ...

African Journals Online (AJOL)

SERVER

2008-01-04

Jan 4, 2008 ... White-rot fungi have been used in various parts of the world for bioremediation of polluted sites. Pleurotus tuber-regium was noted to have the ability to increase nutrient contents in soils polluted with. 1 - 40% engine-oil concentration after six months of incubation. P. tuber-regium increased organic matter ...

Decontamination of Cuban oysters using irradiation

Energy Technology Data Exchange (ETDEWEB)

Cisneros Despaigne, E; Leyva Castillo, V; Martinez, L L; Lara Ortiz, C [Instituto de Nutricion e Higiene de los Alimentos (Cuba); Castillo Rodriguez, E [Centro Nacional de Salud Animal (Cuba)

2001-04-01

Oysters (Crassostrea virginica) collected on the Cuban coast near Havana were examined for contamination with Vibrio cholerae and other potentially pathogenic Vibrio species. The strains thus isolated were characterized and identified to species following standard methods, and their radiation resistance (D{sub 10}) was determined in pure culture. The Vibrio species most often isolated were V. cholerae, V. parahaemolyticus and V. Alginolyticus. Representative cultures from each species were later used to inoculate shucked oysters to determine the optimal radiation dose that would ensure elimination of 10{sup 8} colony forming units (CFU)/g. The highest proportion of isolates were identified as Vibrio parahaemolyticus and V. algynoliticus. Non-O1 strains of Vibrio cholerae were isolated from 50% of samples, but no V. cholerae O1 was identified. D{sub 10} values calculated for the various strains were low in relation to those in the literature. The radiation dose for decontaminating heavily inoculated (10{sup 8} CFU/g) oysters was 1.2 kGy. (author)

Decontamination of Cuban oysters using irradiation

International Nuclear Information System (INIS)

Cisneros Despaigne, E.; Leyva Castillo, V.; Martinez, L.L.; Lara Ortiz, C.; Castillo Rodriguez, E.

2001-01-01

Oysters (Crassostrea virginica) collected on the Cuban coast near Havana were examined for contamination with Vibrio cholerae and other potentially pathogenic Vibrio species. The strains thus isolated were characterized and identified to species following standard methods, and their radiation resistance (D 10 ) was determined in pure culture. The Vibrio species most often isolated were V. cholerae, V. parahaemolyticus and V. Alginolyticus. Representative cultures from each species were later used to inoculate shucked oysters to determine the optimal radiation dose that would ensure elimination of 10 8 colony forming units (CFU)/g. The highest proportion of isolates were identified as Vibrio parahaemolyticus and V. algynoliticus. Non-O1 strains of Vibrio cholerae were isolated from 50% of samples, but no V. cholerae O1 was identified. D 10 values calculated for the various strains were low in relation to those in the literature. The radiation dose for decontaminating heavily inoculated (10 8 CFU/g) oysters was 1.2 kGy. (author)

Using natural and synthetic growth regulators of plants in industrial mycology and malting

Directory of Open Access Journals (Sweden)

O. V. Kuznetcova

2010-07-01

Full Text Available Data on the expansion of the use the plants growth regulators in different areas are presented. The positive impact of the growth stimulators on the development of the Pleurotus ostreatus mycelium’s on agar nutrient media during surface cultivation is shown. The results for growth regulators stimulating effect on the fungus biosynthetic activity in submerged cultures are obtained. The possibility of using fumar and heteroauxin for malting is considered. The decline of malting time and increase of amylolytic activity of the malt are recorded.

Produção enzimática de biodiesel a partir de resíduos agro-industriais usando a lipase imobilizada de origem microbiana

OpenAIRE

Almeida, Marta Neves Rebelo de

2016-01-01

Trabalho Final de Mestrado para obtenção do grau de Mestre em Engenharia Química e Biológica O presente trabalho teve como objectivo a optimização do cultivo de várias estirpes mutantes bacterianas Pseudomonas aeruginosa da estirpe AI3(P. aeruginosa AI3), estirpe Ph3B (P. aeruginosa Ph3B) e estirpe L10 (P. aeruginosa L10) e fúngicas (Phlebia rufa (PM), Ganoderma lucidum violeta(GV), Pleurotus ostreatus (PO) e Ganoderma carnosum (G)), para a produ...

Cadmium uptake in oyster isognomon alatus under laboratory condition

International Nuclear Information System (INIS)

Katayon Saed; Ahmad Ismail; Missri Kusnan; Hishamuddin Omar

1999-01-01

The uptake of cadmium in Flat tree oyster Isognomon alatus was investigated under controlled laboratory conditions for two weeks. Oysters were exposed to 100 μg 1'-1 cadmium and the accumulation of cadmium in the tissues was measured for every two days. Soft tissues of oyster were digested in concentrated acid and cadmium concentrations were determined by using Atomic Absorption Spectrophotometer. The accumulation of cadmium in the soft tissues of oysters was increased during the first six days from 0.73 μg g- 1 to 10.77 μg g'-1, and remaining constant for four days at average level of 10.96 μg g'-1. The Cl concentrations was increased to 32.70 μg g'-1 until the end of experiment. There was no sign of cadmium accumulation approaching saturation for the period of exposure. (author)

Oyster leases in Louisiana, Geographic NAD83, LOSCO (1997) [oyster_leases_USACE_1997

Data.gov (United States)

Louisiana Geographic Information Center — This data set indicates the locations of oyster leases in Louisiana. The lease areas should be polygons, however, the source data has very poor topology including...

Dangerous Raw Oysters

Centers for Disease Control (CDC) Podcasts

2013-08-05

Dr. Duc Vugia, chief of the Infectious Diseases Branch at the California Department of Public Health, discusses the dangers of eating raw oysters.  Created: 8/5/2013 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 8/7/2013.

First isolation of Nocardia crassostreae from Pacific oysters (Crassostrea gigas) in Europe

NARCIS (Netherlands)

Engelsma, M.Y.; Roozenburg, I.; Joly, J.P.

2008-01-01

In summer 2006 an extensive mortality of Pacific oysters Crassostrea gigas occurred in Lake Grevelingen, the Netherlands. A sample of Pacific oysters was investigated for the presence of shellfish pathogens as potential causes of the mortality. Yellow-green lesions were observed in several oysters

Incorporation of metabolites into glycogen and lipids of the oyster, crassostrea virginica

International Nuclear Information System (INIS)

Swift, M.L.; Humphrey, C.L.

1987-01-01

Groups of oysters, either fed or unfed, were exposed to U- 14 C labelled D-glucose, L-asp, L-leu, L-ala or acetate for 6 hrs. Except for the glucose trials, the disappearance of radioactivity from the saline of the unfed oysters was greater (83%) than for the fed animals (65%). With glucose, 88% of the radioactivity disappeared in each trial. The specific radioactivity of glycogen isolated from oysters exposed to labelled glucose, asp and ala was 1283, 468 and 8.22 dpm/mg glycogen respectively. Radioactivity was found primarily in the triacylglycerols and phospholipids (PL) in fed oysters and in PL only in unfed oysters. Phosphatidyl choline, phosphatidyl ethanolamine, and a fraction containing phosphatidyl serine and phosphatidyl inositol, had 32%, 25% and 35-40% of the radioactivity respectively. Incorporation of total radioactivity into PL was 70% lower in unfed vs. fed trials, but the distribution of counts among the phospholipids classes was unchanged. Glycogenesis does not appear to be a significant pathway in the oyster. Apparently well-fed oysters are able to store excess dietary calories as lipid. During periods of starvation exogenous small metabolites along with glucose from glycogen are catabolized

Annual dose of Taiwanese from the ingestion of 210Po in oysters.

Science.gov (United States)

Lee, Hsiu-wei; Wang, Jeng-Jong

2013-03-01

Oysters around the coast of Taiwan were collected, dried, spiked with a (209)Po tracer for yield, digested with concentrated HNO(3) and H(2)O(2), and finally dissolved in 0.5 N HCl. The polonium was then spontaneously deposited onto a silver disc, and the activity of (210)Po was measured using an alpha spectrum analyzer equipped with a silicon barrier detector. Meanwhile, the internal effective dose of (210)Po coming from the intake of oysters by Taiwanese was evaluated. The results of the present study indicate that (210)Po average activity concentrations ranged from 23.4 ± 0.4 to 126 ± 94 Bq kg(-1) of fresh oysters. The oysters coming from Penghu island and Kinmen island regions contain higher concentrations of (210)Po in comparison with oysters from other regions of Taiwan. The value of (210)Po weighted average activity concentrations for all oyster samples studied is 25.9 Bq kg(-1). The annual effective dose of Taiwanese due to the ingestion of (210)Po in oysters was estimated to be 4.1 × 10(-2) mSv y(-1). Copyright © 2013. Published by Elsevier Ltd.

Exploring spatial and temporal variations of cadmium concentrations in pacific oysters from british columbia.

Science.gov (United States)

Feng, Cindy Xin; Cao, Jiguo; Bendell, Leah

2011-09-01

Oysters from the Pacific Northwest coast of British Columbia, Canada, contain high levels of cadmium, in some cases exceeding some international food safety guidelines. A primary goal of this article is the investigation of the spatial and temporal variation in cadmium concentrations for oysters sampled from coastal British Columbia. Such information is important so that recommendations can be made as to where and when oysters can be cultured such that accumulation of cadmium within these oysters is minimized. Some modern statistical methods are applied to achieve this goal, including monotone spline smoothing, functional principal component analysis, and semi-parametric additive modeling. Oyster growth rates are estimated as the first derivatives of the monotone smoothing growth curves. Some important patterns in cadmium accumulation by oysters are observed. For example, most inland regions tend to have a higher level of cadmium concentration than most coastal regions, so more caution needs to be taken for shellfish aquaculture practices occurring in the inland regions. The semi-parametric additive modeling shows that oyster cadmium concentration decreases with oyster length, and oysters sampled at 7 m have higher average cadmium concentration than those sampled at 1 m. © 2010, The International Biometric Society.

Sediment quality guidelines for copper and zinc for filter-feeding estuarine oysters?

International Nuclear Information System (INIS)

Birch, G.F.; Hogg, T.D.

2011-01-01

Sediment quality guidelines (SQGs) assess the ability of bottom sediment to sustain healthy infauna and water quality guidelines (WQGs) provide protection for a designated percentage of aquatic species. Filter-feeding marine species, e.g. oysters and mussels, acquire food from particles in the water column and protection of these animals is not provided by SQGs or WQGs. The current work investigated the relationship between metal (Cu, Zn) concentrations in total and fine-fraction ( -1 and -1 , respectively) for protecting oysters from exceeding human consumption levels (70 μg g -1 and 1000 μg g -1 , respectively). - A strong correlation between oyster tissue Cu and Zn concentrations and fine-fraction surficial sediment digested in 1 M HCl provided a sedimentary guideline which predicted tissue metal concentrations in oysters and established a level for protecting oysters from exceeding human consumption levels for these metals. The guidelines for fine surficial sediment developed in the present work accurately predicted oyster tissue concentrations in the field.

Self-Heating Pasteurization of Substrates for Culinary-Medicinal Mushrooms Cultivation in Mexico.

Science.gov (United States)

Morales, Viviana; Sánchez, Jose E

2017-01-01

The aim of this study was to evaluate a self-heating pasteurization technique in preparing substrates for mushroom production. Seven species were used: Agrocybe aegerita, Auricularia fuscosuccinea, Pleurotus djamor, P. eryngii, P. ostreatus, Lentinula edodes, and Ganoderma lucidum. They were cultivated on grass, corncob, wood shavings, and a mixture thereof. The self-heating technique allowed for pasteurization of 3 of the substrates (grass, corncob, and the mixture). The preheating chamber comprised a drawer placed under the pasteurization crate. With this chamber, it was possible to increase inlet air temperatures by 4--5°C. The evaluated mushroom species responded in different ways to the pasteurization process. P. ostreatus (control) and P. djamor produced basidiomes when cultivated in all pasteurization substrates. A. aegerita and P. eryngii fruited only on corncob and the mixture, whereas A. fuscosuccinea fruited only on the pasteurized corncob. G. lucidum and L. edodes did not fructify on the pasteurized substrates.

QUANTIFICATION AND BIOREMEDIATION OF ENVIRONMENTAL SAMPLES BY DEVELOPING A NOVEL AND EFFICIENT METHOD

Directory of Open Access Journals (Sweden)

Mohammad Osama

2014-06-01

Full Text Available Pleurotus ostreatus, a white rot fungus, is capable of bioremediating a wide range of organic contaminants including Polycyclic Aromatic Hydrocarbons (PAHs. Ergosterol is produced by living fungal biomass and used as a measure of fungal biomass. The first part of this work deals with the extraction and quantification of PAHs from contaminated sediments by Lipid Extraction Method (LEM. The second part consists of the development of a novel extraction method (Ergosterol Extraction Method (EEM, quantification and bioremediation. The novelty of this method is the simultaneously extraction and quantification of two different types of compounds, sterol (ergosterol and PAHs and is more efficient than LEM. EEM has been successful in extracting ergosterol from the fungus grown on barley in the concentrations of 17.5-39.94 µg g-1 ergosterol and the PAHs are much more quantified in numbers and amounts as compared to LEM. In addition, cholesterol usually found in animals, has also been detected in the fungus, P. ostreatus at easily detectable levels.

Effect of Pleurotus ostreatus fermentation on cocoa pod husk ...

African Journals Online (AJOL)

STORAGESEVER

2009-05-04

May 4, 2009 ... 1Department of Biochemistry and Biotechnology, Kwame Nkrumah University of Science and ... composition, mainly due to its high lignocellulose or fibre and also low protein levels. White–rot ... as biocatalyst to improve the nutritional status of CPH. ... L.) is an important commodity in Ghana because of the.

Experimental infection of Pacific oyster Crassostrea gigas spat by ostreid herpesvirus 1: demonstration of oyster spat susceptibility

Directory of Open Access Journals (Sweden)

Schikorski David

2011-02-01

Full Text Available Abstract In 2008 and 2009, acute mortalities occurred in France among Pacific cupped oyster, Crassostrea gigas, spat. Different hypothesis including the implication of environmental factors, toxic algae and/or pathogens have been explored. Diagnostic tests indicated that OsHV-1 including a particular genotype, termed OsHV-1 μVar, was detected in most of samples and especially in moribund oysters with the highlighting of virus particles looking like herpes viruses by TEM examination. In this study, an experimental protocol to reproduce OsHV-1 infection in laboratory conditions was developed. This protocol was based on the intramuscular injection of filtered (0.22 μm tissue homogenates prepared from naturally OsHV-1 infected spat collected on French coasts during mortality outbreaks in 2008. Results of the experimental trials showed that mortalities were induced after injection. Moreover, filtered tissue homogenates induced mortalities whereas the same tissue homogenates exposed to an ultraviolet (UV treatment did not induce any mortality suggesting that oyster spat mortalities require the presence of a UV sensitive agent. Furthermore, analysis of injected oyster spat revealed the detection of high amounts of OsHV-1 DNA by real-time quantitative PCR. Finally, TEM analysis demonstrated the presence of herpes virus particles. The developed protocol allowed to maintain sources of infective virus which can be useful for the development of further studies concerning the transmission and the development of OsHV-1 infection.

Comparison of methods for detection of norovirus in oysters

DEFF Research Database (Denmark)

Schultz, Anna Charlotte; Saadbye, Peter; Hoorfar, Jeffrey

2007-01-01

a successful detection it is of great importance to remove the tissue inhibitors during the viral RNA extraction. To select the most efficient extraction procedure of oysters we have compared four protocols. A pool of digestive gland material from oyster samples was divided into 1.5 g portions and spiked...... with I 0-fold dilutions of human faecal samples containing norovirus genogroup II. The samples were tested on three different occasions using four different sample treatment protocols. The protocols were assessed with regard to their ability to recover viral RNA and detect norovirus in spiked oysters...

Genotoxicity of diuron and glyphosate in oyster spermatozoa and embryos.

Science.gov (United States)

Akcha, F; Spagnol, C; Rouxel, J

2012-01-15

We investigated the effects of genotoxicant exposure in gametes and embryos to find a possible link between genotoxicity and reproduction/developmental impairment, and explore the impact of chemical genotoxicity on population dynamics. Our study focused on the genotoxic effects of two herbicides on oyster gametes and embryos: glyphosate (both as an active substance and in the Roundup formulation) and diuron. France is Europe's leading consumer of agrochemical substances and as such, contamination of France's coastal waters by pesticides is a major concern. Glyphosate and diuron are among the most frequently detected herbicides in oyster production areas; as oyster is a specie with external reproduction, its gametes and embryos are in direct contact with the surrounding waters and are hence particularly exposed to these potentially dangerous substances. In the course of this study, differences in genotoxic and embryotoxic responses were observed in the various experiments, possibly due to differences in pollutant sensitivity between the tested genitor lots. Glyphosate and Roundup had no effect on oyster development at the concentrations tested, whereas diuron significantly affected embryo-larval development from the lowest tested concentration of 0.05 μg L⁻¹, i.e. an environmentally realistic concentration. Diuron may therefore have a significant impact on oyster recruitment rates in the natural environment. Our spermiotoxicity study revealed none of the tested herbicides to be cytotoxic for oyster spermatozoa. However, the alkaline comet assay showed diuron to have a significant genotoxic effect on oyster spermatozoa at concentrations of 0.05 μg L⁻¹ upwards. Conversely, no effects due to diuron exposure were observed on sperm mitochondrial function or acrosomal membrane integrity. Although our initial results showed no negative effect on sperm function, the possible impact on fertilization rate and the consequences of the transmission of damaged DNA for

Vitamin D2 Stability During the Refrigerated Storage of Ultraviolet B-Treated Cultivated Culinary-Medicinal Mushrooms.

Science.gov (United States)

Slawinska, Aneta; Fornal, Emilia; Radzki, Wojciech; Jablonska-Rys, Ewa; Parfieniuk, Ewa

2017-01-01

The effects of ultraviolet B (UVB) irradiation on the synthesis of vitamin D2 and its stability during refrigerated storage was determined in fresh cultivated culinary-medicinal mushrooms (Agaricus bisporus, Pleurotus ostreatus, and Lentinus edodes) after harvest. The irradiated mushrooms were stored at 4°C for up to 10 days. The concentrations of vitamin D2 and ergosterol were determined using ultrahigh-performance liquid chromatography/tandem mass spectrometry. The cultivated mushrooms not treated with UVB were devoid of vitamin D2. After UVB irradiation, we obtained mushrooms with a large amount of ergocalciferol. A. bisporus showed the lowest vitamin D2 content (3.55 ± 0.11 μg D2/g dry weight); P. ostreatus contained 58.96 ± 1.15 μg D2/g dry weight, and L. edodes contained 29.46 ± 2.21 μg/g dry weight. During storage at 4°C, the amount of vitamin D2 was gradually decreased in P. ostreatus and L. edodes, whereas in A. bisporus vitamin D2 gradually increased until the sixth day, then decreased. Mushrooms exposed to UVB radiation contain a significant amount of vitamin D2 and are therefore an excellent food source of vitamin D.

Influence of eutrophication on metal bioaccumulation and oral bioavailability in oysters, Crassostrea angulata.

Science.gov (United States)

Li, Shun-Xing; Chen, Li-Hui; Zheng, Feng-Ying; Huang, Xu-Guang

2014-07-23

Oysters (Crassostrea angulata) are often exposed to eutrophication. However, how these exposures influence metal bioaccumulation and oral bioavailability (OBA) in oysters is unknown. After a four month field experimental cultivation, bioaccumulation factors (BAF) of metals (Fe, Cu, As, Cd, and Pb) from seawater to oysters and metal oral bioavailability in oysters by bionic gastrointestinal tract were determined. A positive effect of macronutrient (nitrate N and total P) concentration in seawater on BAF of Cd in oysters was observed, but such an effect was not significant for Fe, Cu, Pb, and As. Only OBA of As was significantly positively correlated to N and P contents. For Fe, OBA was negatively correlated with N. The regular variation of the OBA of Fe and As may be due to the effect of eutrophication on the synthesis of metal granules and heat-stable protein in oysters, respectively.

Comparative effect of steam and gamma irradiation sterilization of sawdust compost on the yield, nutrient and shelf-life of Pleurotus ostreatus (Jacq. Ex.Fr) Kummer stored in two different packaging materials

International Nuclear Information System (INIS)

Kortei, J. N. K.

2015-06-01

influence of radiation on drying rate of oyster mushrooms were determined by five non- linear regression models (Lewis, Page, Henderson and Pabis, Diffussion and Wang and Singh by the estimation of R 2 , X 2 and RMSE). The total phenolic contents, flavonoids and free radical scavenging activity DPPH (2, 2' - diphenyl- 1- picrylhydrazyl) as sources of natural antioxidant of stored mushroom in polypropylene and polythene packs were determined using aqueous, ethanol and methanol extracts by Folin- Ciocalteau method. Finally, the influence of gamma irradiation on the colour characteristics were determined by the Hunter L * a* b* and Browning Index (BI) method while textural characteristics were determined mechanically by measuring Texture Hardness (kgf), Fracturability (N), Cohesiveness, Chewiness (N), Springiness (mm), Gumminess, Adhesiveness (kgf.s) and Resilience of fresh, dry and rehydrated mushrooms. The mechanical estimation to textural characters obtained were compared mean scores on 9-point Hedonic scale of sensory acceptability attributes (appearance, colour, aroma, taste, mouthfeel and overall acceptability of coded samples in two packaging containers. The survey demonstrated the popularity of drum (moist heat) technique of sterilization in Ghana. Majority (64%) of the respondents were dissatisfied with the method of sterilization of compost and spawn substrate with 36% indicated the method was alright by them. Majority (82%) of the respondents have never heard of sterilization of food or mushroom by gamma irradiation technique. Because of the high contamination rate of the steam sterilized compost and spawn substrate, the farmers indicated the need to achieve better sterilization for these starting material for mushroom cultivation. Drying was selected as the most popular preservation method as the fresh fruiting bodies have short shelf-life and P. ostreatus was found to be the most preferred mushroom followed by the termite mushroom (Termitomyces sp.). The

Parasites infecting the cultured oyster Crassostrea gasar (Adanson, 1757) in Northeast Brazil.

Science.gov (United States)

Queiroga, Fernando Ramos; Vianna, Rogério Tubino; Vieira, Cairé Barreto; Farias, Natanael Dantas; Da Silva, Patricia Mirella

2015-05-01

The oyster Crassostrea gasar is a species widely used as food and a source of income for the local population of the estuaries of Northeast Brazil. Perkinsus marinus and Perkinsus olseni are deleterious parasites for oyster farming and were recently detected in Brazil. In this study, a histopathologic survey of the oyster C. gasar cultured in the estuary of the River Mamanguape (Paraíba State) was performed. Adult oysters were collected in December 2011 and March, May, August and October 2012 and processed for histology and Perkinsus sp. identification by molecular analyses. Histopathological analysis revealed the presence of parasitic organisms including viral gametocytic hypertrophy, prokaryote-like colonies, protozoans (Perkinsus sp. and Nematopsis sp.) and metazoans (Tylocephalum sp. and cestodes). Other commensal organisms were also detected (the protozoan Ancistrocoma sp. and the turbellarian Urastoma sp.). The protozoan parasite Perkinsus sp. had the highest overall prevalence among the symbiotic organisms studied (48.9%), followed by Nematopsis sp. (36.3%). The other organisms were only sporadically observed. Only the protozoan Perkinsus sp. caused alterations in the oysters' infected organs. Molecular analyses confirmed the presence of P. marinus, P. olseni and Perkinsus beihaiensis infecting the oyster C. gasar. This is the first report of P. beihaiensis in this oyster species.

Behavior of pathogenic bacteria in the oyster, Crassostrea commercialis, during depuration, re-laying, and storage.

OpenAIRE

Son, N T; Fleet, G H

1980-01-01

Oysters (Crassostrea commercials) harvested from major cultivation areas within the state of New South Wales, Australia, were commonly contaminated with low levels of the food-poisoning organisms Bacillus cereus, Clostridium perfringens, and Vibrio parahaemolyticus. Salmonella was found in oysters on only one occasion. These bacteria were cleansed from oysters during oyster purification by re-laying in a non-polluted waterway. Oysters were laboratory contaminated to levels in excess 1,000 cel...

Temporal variation in development of ecosystem services from oyster reef restoration

Science.gov (United States)

LaPeyre, Megan K.; Humphries, Austin T.; Casas, Sandra M.; La Peyre, Jerome F.

2014-01-01

Restoration ecology relies heavily on ecosystem development theories that generally assume development of fully functioning natural systems over time, but often fail to identify the time-frame required for provision of desired functions, or acknowledge different pathways of functional development. In estuaries, a decline of overall habitat quality and functioning has led to significant efforts to restore critical ecosystem services, recently through the creation and restoration of oyster reefs. Oyster reef restoration generally occurs with goals of (1) increasing water quality via filtration through sustainable oyster recruitment, (2) stabilizing shorelines, and (3) creating and enhancing critical estuarine habitat for fish and invertebrates. We restored over 260 m2 of oyster reef habitat in coastal Louisiana and followed the development and provision of these ecosystem services from 2009 through 2012. Oysters recruited to reefs immediately, with densities of oysters greater than 75 mm exceeding 80 ind m−2 after 3 years, and provision of filtration rates of 1002 ± 187 L h−1 m−2; shoreline stabilization effects of the created reefs were minimal over the three years of monitoring, with some evidence of positive shoreline stabilization during higher wind/energy events only; increased nekton abundance of resident, but not larger transient fish was immediately measurable at the reefs, however, this failed to increase through time. Our results provide critical insights into the development trajectories of ecosystem services provided by restored oyster reefs, as well as the mechanisms mediating these changes. This is critical both ecologically to understand how and where a reef thrives, and for policy and management to guide decision-making related to oyster reef restoration and the crediting and accounting of ecosystem services.

Optimization and application of spray-drying process on oyster cooking soup byproduct

Directory of Open Access Journals (Sweden)

Huibin CHEN

Full Text Available Abstract Oyster drying processes have produced a large amount of cooking soup byproducts. In this study, oyster cooking soup byproduct was concentrated and spray-dried after enzymatic hydrolysis to produce seasoning powder. Response surface methodology (RSM was performed on the basis of single-factor studies to optimize the feeding temperature, hot air temperature, atomization pressure, and total solid content of oyster drying. Results revealed the following optimized parameters of this process: feeding temperature of 60 °C, total solid content of 30%, hot air temperature of 197 °C, and atomization pressure of 92 MPa. Under these conditions, the oyster powder yield was 63.7% ± 0.7% and the moisture content was 4.1% ± 0.1%. Our pilot trial also obtained 63.1% yield and 4.0% moisture content. The enzyme hydrolysis of cooking soup byproduct further enhanced the antioxidant activity of the produced oyster seasoning powder to some extent. Spray drying process optimized by RSM can provide a reference for high-valued applications of oyster cooking soup byproducts.

Pesticides and Ostreid Herpesvirus 1 Infection in the Pacific Oyster, Crassostrea gigas.

Science.gov (United States)

Moreau, Pierrick; Faury, Nicole; Burgeot, Thierry; Renault, Tristan

2015-01-01

Since 2008, mass mortality outbreaks have been reported in all French regions producing Pacific oysters, and in several Member States of the European Union. These mass mortality events of Pacific oysters are related to OsHV-1 infection. They occur during spring and summer periods leaving suspect the quality of the marine environment and the role of seasonal use of pesticides associated with the arrival of freshwater in oyster rearing areas. Pesticides have been also detected in French coastal waters, especially in areas of oyster production. Using PMA real-time PCR we showed that a mixture of 14 pesticides has no effect on the integrity of virus capsids from viral suspension in the conditions tested. A contact of oysters with this pesticide mixture was related to higher mortality rates among experimentally infected animals in comparison with control ones (no previous pesticide exposure before experimental infection). We therefore suggest that pesticides at realistic concentration can exert adverse effects on Pacific oysters and causes an increased susceptibility to the viral infection in experimental conditions.

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

Science.gov (United States)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Intertidal oysters reach their physiological limit in a future high-CO2 world.

Science.gov (United States)

Scanes, Elliot; Parker, Laura M; O'Connor, Wayne A; Stapp, Laura S; Ross, Pauline M

2017-03-01

Sessile marine molluscs living in the intertidal zone experience periods of internal acidosis when exposed to air (emersion) during low tide. Relative to other marine organisms, molluscs have been identified as vulnerable to future ocean acidification; however, paradoxically it has also been shown that molluscs exposed to high CO 2 environments are more resilient compared with those molluscs naive to CO 2 exposure. Two competing hypotheses were tested using a novel experimental design incorporating tidal simulations to predict the future intertidal limit of oysters in a high-CO 2 world; either high-shore oysters will be more tolerant of elevated P CO 2 because of their regular acidosis, or elevated P CO 2  will cause high-shore oysters to reach their limit. Sydney rock oysters, Saccostrea glomerata , were collected from the high-intertidal and subtidal areas of the shore and exposed in an orthogonal design to either an intertidal or a subtidal treatment at ambient or elevated P CO 2 , and physiological variables were measured. The combined treatment of tidal emersion and elevated P CO 2  interacted synergistically to reduce the haemolymph pH (pH e ) of oysters, and increase the P CO 2  in the haemolymph ( P e,CO 2 ) and standard metabolic rate. Oysters in the intertidal treatment also had lower condition and growth. Oysters showed a high degree of plasticity, and little evidence was found that intertidal oysters were more resilient than subtidal oysters. It is concluded that in a high-CO 2 world the upper vertical limit of oyster distribution on the shore may be reduced. These results suggest that previous studies on intertidal organisms that lacked tidal simulations may have underestimated the effects of elevated P CO 2 . © 2017. Published by The Company of Biologists Ltd.

Oyster larvae settle in response to habitat-associated underwater sounds.

Science.gov (United States)

Lillis, Ashlee; Eggleston, David B; Bohnenstiehl, DelWayne R

2013-01-01

Following a planktonic dispersal period of days to months, the larvae of benthic marine organisms must locate suitable seafloor habitat in which to settle and metamorphose. For animals that are sessile or sedentary as adults, settlement onto substrates that are adequate for survival and reproduction is particularly critical, yet represents a challenge since patchily distributed settlement sites may be difficult to find along a coast or within an estuary. Recent studies have demonstrated that the underwater soundscape, the distinct sounds that emanate from habitats and contain information about their biological and physical characteristics, may serve as broad-scale environmental cue for marine larvae to find satisfactory settlement sites. Here, we contrast the acoustic characteristics of oyster reef and off-reef soft bottoms, and investigate the effect of habitat-associated estuarine sound on the settlement patterns of an economically and ecologically important reef-building bivalve, the Eastern oyster (Crassostrea virginica). Subtidal oyster reefs in coastal North Carolina, USA show distinct acoustic signatures compared to adjacent off-reef soft bottom habitats, characterized by consistently higher levels of sound in the 1.5-20 kHz range. Manipulative laboratory playback experiments found increased settlement in larval oyster cultures exposed to oyster reef sound compared to unstructured soft bottom sound or no sound treatments. In field experiments, ambient reef sound produced higher levels of oyster settlement in larval cultures than did off-reef sound treatments. The results suggest that oyster larvae have the ability to respond to sounds indicative of optimal settlement sites, and this is the first evidence that habitat-related differences in estuarine sounds influence the settlement of a mollusk. Habitat-specific sound characteristics may represent an important settlement and habitat selection cue for estuarine invertebrates and could play a role in driving

Oyster larvae settle in response to habitat-associated underwater sounds.

Directory of Open Access Journals (Sweden)

Ashlee Lillis

Full Text Available Following a planktonic dispersal period of days to months, the larvae of benthic marine organisms must locate suitable seafloor habitat in which to settle and metamorphose. For animals that are sessile or sedentary as adults, settlement onto substrates that are adequate for survival and reproduction is particularly critical, yet represents a challenge since patchily distributed settlement sites may be difficult to find along a coast or within an estuary. Recent studies have demonstrated that the underwater soundscape, the distinct sounds that emanate from habitats and contain information about their biological and physical characteristics, may serve as broad-scale environmental cue for marine larvae to find satisfactory settlement sites. Here, we contrast the acoustic characteristics of oyster reef and off-reef soft bottoms, and investigate the effect of habitat-associated estuarine sound on the settlement patterns of an economically and ecologically important reef-building bivalve, the Eastern oyster (Crassostrea virginica. Subtidal oyster reefs in coastal North Carolina, USA show distinct acoustic signatures compared to adjacent off-reef soft bottom habitats, characterized by consistently higher levels of sound in the 1.5-20 kHz range. Manipulative laboratory playback experiments found increased settlement in larval oyster cultures exposed to oyster reef sound compared to unstructured soft bottom sound or no sound treatments. In field experiments, ambient reef sound produced higher levels of oyster settlement in larval cultures than did off-reef sound treatments. The results suggest that oyster larvae have the ability to respond to sounds indicative of optimal settlement sites, and this is the first evidence that habitat-related differences in estuarine sounds influence the settlement of a mollusk. Habitat-specific sound characteristics may represent an important settlement and habitat selection cue for estuarine invertebrates and could play a

A survey of Australian oysters for the presence of human noroviruses.

Science.gov (United States)

Brake, Felicity; Ross, Tom; Holds, Geoffrey; Kiermeier, Andreas; McLeod, Catherine

2014-12-01

Impending international policies for norovirus in oysters and the lack of Australian data suggested there was a need to undertake a national survey of norovirus in oysters. Two geographically distinct oyster-growing areas from each of three Australian states were sampled on 4 occasions during 2010 and 2011. The sites selected were considered by state shellfish authorities to be the most compromised with respect to the potential for human faecal contamination as identified by shoreline surveys. The oysters were tested for norovirus GI, GII and Escherichia coli. Norovirus GII was detected in two of 120 (1.7%) samples and norovirus GI was not detected. One of the norovirus positive samples was cloned and sequenced as GII.3. Five of 120 (4.2%) samples were found to have more than the guidance concentration of 230 E. coli per 100 g of shellfish but these samples did not contain detectable concentrations of norovirus. The apparently low prevalence of norovirus in oysters from Australian growing areas supports epidemiological data that suggests norovirus contamination of Australian oysters is rare. The results from this study emphasise the need for future norovirus control measures for shellfish to be commensurate with the risk associated with the growing area. Copyright © 2014 Elsevier Ltd. All rights reserved.

Investigation on Pleurotus ferulae potential for the sorption of Pb(II ...

African Journals Online (AJOL)

Pleurotus ferulae obtained from rotten tree was collected, washed, dried, ground and sieved to appropriate particle size. Infra-red spectrometry was used to determine functional groups on the biomass while biosorption of Pb(II) from aqueous solution was studied using the biomass in a batch system. The effect of pH (1-7.5), ...

Detection, quantification and genotyping of noroviruses in oysters implicated in disease outbreaks

DEFF Research Database (Denmark)

Haefeli, Deborah; Gantenbein-Demarchi, Corinne; Böttiger, Blenda

2012-01-01

. While GI and GII have often been verified as causative agents of oyster-transmitted illness, GIV is rarely detected and has so far not been confirmed in outbreaks related to oysters. The aim of this study was to determine whether NoVs from oysters implicated in a disease outbreak were linked to the GI......Noroviruses (NoVs) are a major cause of foodborne outbreaks of acute gastroenteritis in humans. Transmission of NoV is commonly linked to the consumption of oysters as they accumulate viruses through filter feeding in faecal-contaminated water. The NoV genogroups (G)I, GII and GIV infect humans...

Investigations of Salmonella enterica serovar newport infections of oysters by using immunohistochemistry and knockout mutagenesis.

Science.gov (United States)

Morrison, Christopher M; Dial, Sharon M; Day, William A; Joens, Lynn A

2012-04-01

The consumption of raw oysters is an important risk factor in the acquisition of food-borne disease, with Salmonella being one of a number of pathogens that have been found in market oysters. Previous work by our lab found that Salmonella was capable of surviving in oysters for over 2 months under laboratory conditions, and this study sought to further investigate Salmonella's tissue affinity and mechanism of persistence within the oysters. Immunohistochemistry was used to show that Salmonella was capable of breaching the epithelial barriers, infecting the deeper connective tissues of the oysters, and evading destruction by the oysters' phagocytic hemocytes. To further investigate the mechanism of these infections, genes vital to the function of Salmonella's two main type III secretion systems were disrupted and the survivability of these knockout mutants within oysters was assayed. When the Salmonella pathogenicity island 1 and 2 mutant strains were exposed to oysters, there were no detectable deficiencies in their abilities to survive, suggesting that Salmonella's long-term infection of oysters does not rely upon these two important pathogenicity islands and must be due to some other, currently unknown, mechanism.

Biotechnological modification of lignin

Energy Technology Data Exchange (ETDEWEB)

1989-01-01

A literature search of organisms capable of degrading lignin was conducted. Four fungi were selected for study and these were Phanerochaete chrysosporium, Chrysosporium pruinosum, Phlebia tremellosus and Trametes versicolor. Other organisms, Pleurotus ostreatus, Pleurotus florida and Lentinus edodes were also tested in preliminary experiments. All cultures were screened for their ability to degrade the lignin component of aspen sawdust and also lignin extracted from steam-exploded wood. This type of screen was followed by analysis of culture filtrates for the presence of ligninase, the marker enzyme for lignin degradation. Phanerochaete chrysosporium and consequently chosen for further studies in fermentors. Considerable efforts were directed to production of ligninase in fermentors. Only when Chrysosporium pruinosum was pre-cultured in a shake flask for 4 days and then transferred to a fermentor could ligninase activity be detected. The enzyme from shake flasks has been concentrated ready for use in bench-scale studies on cell-free depolymerization of lignin. 13 refs., 8 tabs.

The American Oyster.

Science.gov (United States)

Thompson, Nancy E.

The Maryland Marine Science Education Project has produced a series of mini-units in marine science education for the junior high/middle school classroom. This unit focuses on the American oyster. Although the unit specifically treats the Chesapeake Bay, it may be adapted for use with similar estuarine systems. In addition, the unit may be…

The biofilteration ability of oysters (Crassostrea gigas) to reduce Aeromonas salmonicida in salmon culture.

Science.gov (United States)

Ma, Xiaona; Li, Xian; Sun, Guoxiang; Sharawy, Zaki Zaki; Qiu, Tianlong; Du, Yishuai; Liu, Ying

2017-07-01

Pathogen contamination in the environment is inevitable with the rapid development of intensive aquaculture. Therefore, alternative ecofriendly biological strategies to control pathogenic bacteria are required. However, our aim was to investigate the ability of oysters (Crassostrea gigas) to filter the important opportunistic pathogen, Aeromonas salmonicida (strain C4), using a green fluorescent protein tag (GFP) in the Atlantic salmon (Salmo salar) farming wastewater. Hence, A. salmonicida removal efficiency and ingestion rate were detected in two different oyster stages (larvae and adults). To evaluate the practical performance of oysters as A. salmonicida biofilter, adult oysters were applied to an integrated constructed wetlands system (ICWS) and their long-term C4-GFP removal efficiency was recorded for 60 days. Overall, our results clearly indicated that oysters had substantial A. salmonicida removal ability via their ingestion process when observed under a fluorescent microscope. Approximately 88-95% of C4-GFP was removed by oyster larvae at an ingestion rate of 6.4 × 10 3 -6.2 × 10 5  CFU/h·ind, while 79-92% of C4-GFP was removed by adult oysters at an ingestion rate of 2.1 × 10 4 -3.1 × 10 6  CFU/h·ind. Furthermore, 57.9 ± 17.2% of C4-GFP removal efficiency was achieved when oysters were applied to ICWS. We, therefore, concluded that using oysters as a biofilter represents an effective alternative for removing A. salmonicida from aquaculture wastewater. However, the fate of oysters after ingesting the pathogenic bacteria, acting as a potential reservoir or vector for pathogens, is still debatable. This research provides the basis for the application of oysters as a biofilter to remove pathogens from aquaculture wastewater in industrialized production.

Bioimmuring late Cretaceous and Recent oysters : 'A view from within'

NARCIS (Netherlands)

Jagt, John W M; Neumann, Christian; Schulp, Anne S.

2007-01-01

Being obligate cementers, oysters (Ostreoidea), both fossil and Recent, often yield valuable information on their substrates, whether biotic/ abiotic, perishable or inert. By a process called bioimmuration, oyster shells may preserve lightly or non-calcified sessile organisms already present on the

Resource potential and status of pearl oyster fishery in India

Digital Repository Service at National Institute of Oceanography (India)

Ingole, B.S.; Parulekar, A.H.

Many cultivable species of pearl oysters are known to occur in the Indo-Australian Archipelago which is an important region in the world distribution of pearl oysters. An account of the development of Indian pearl fisheries that took place over...

Role of dissolved and particulate cadmium in the accumulation of cadmium in cultured oysters (Crassostrea gigas)

Energy Technology Data Exchange (ETDEWEB)

Lekhi, Priyanka [Department of Chemistry, University of British Columbia, Vancouver, BC V6T 1Z4 (Canada)], E-mail: anka.lekhi@ubc.ca; Cassis, D. [Department of Earth and Ocean Sciences, University of British Columbia, Vancouver, BC V6T 1Z4 (Canada); Pearce, C.M. [Pacific Biological Station, Fisheries and Oceans Canada, Nanaimo, BC V9T 6N7 (Canada); Ebell, N. [Odyssey Shellfish Ltd., Nanoose Bay, BC V0R 9G0 (Canada); Maldonado, M.T. [Department of Earth and Ocean Sciences, University of British Columbia, Vancouver, BC V6T 1Z4 (Canada); Orians, K.J. [Department of Chemistry, University of British Columbia, Vancouver, BC V6T 1Z4 (Canada); Department of Earth and Ocean Sciences, University of British Columbia, Vancouver, BC V6T 1Z4 (Canada)

2008-04-15

Pacific oysters (Crassostrea gigas) collected on the coast of British Columbia, Canada have occasionally shown cadmium (Cd) concentrations at or above 2 {mu}g g{sup -1} (wet weight), which has resulted in the loss of some international markets. This study investigated the source and transfer of Cd to oysters by focusing on the role of dissolved and particulate Cd in seawater. Parameters monitored for 1 year at two oyster farm sites on Vancouver Island included: oyster tissue mass and shell length, Cd in oysters, dissolved Cd, particulate Cd, temperature and salinity. Results show that dissolved Cd was the main source of Cd to the oysters and that Cd was mainly concentrated in the gut tissues. A seasonal trend was observed in Cd in oysters, in which levels were lowest during periods of higher temperatures. Results also indicate that the local oceanographic inputs and sediment diagenesis directly affect dissolved Cd and thereby influence the Cd levels in oysters. Particulate matter was not found to be a source of Cd in oysters, and was actually negatively correlated. This was likely due to the uptake of dissolved Cd by phytoplankton and the effect of phytoplankton on oyster tissue mass.

Role of dissolved and particulate cadmium in the accumulation of cadmium in cultured oysters (Crassostrea gigas)

International Nuclear Information System (INIS)

Lekhi, Priyanka; Cassis, D.; Pearce, C.M.; Ebell, N.; Maldonado, M.T.; Orians, K.J.

2008-01-01

Pacific oysters (Crassostrea gigas) collected on the coast of British Columbia, Canada have occasionally shown cadmium (Cd) concentrations at or above 2 μg g -1 (wet weight), which has resulted in the loss of some international markets. This study investigated the source and transfer of Cd to oysters by focusing on the role of dissolved and particulate Cd in seawater. Parameters monitored for 1 year at two oyster farm sites on Vancouver Island included: oyster tissue mass and shell length, Cd in oysters, dissolved Cd, particulate Cd, temperature and salinity. Results show that dissolved Cd was the main source of Cd to the oysters and that Cd was mainly concentrated in the gut tissues. A seasonal trend was observed in Cd in oysters, in which levels were lowest during periods of higher temperatures. Results also indicate that the local oceanographic inputs and sediment diagenesis directly affect dissolved Cd and thereby influence the Cd levels in oysters. Particulate matter was not found to be a source of Cd in oysters, and was actually negatively correlated. This was likely due to the uptake of dissolved Cd by phytoplankton and the effect of phytoplankton on oyster tissue mass

Ocean acidification increases the vulnerability of native oysters to predation by invasive snails.

Science.gov (United States)

Sanford, Eric; Gaylord, Brian; Hettinger, Annaliese; Lenz, Elizabeth A; Meyer, Kirstin; Hill, Tessa M

2014-03-07

There is growing concern that global environmental change might exacerbate the ecological impacts of invasive species by increasing their per capita effects on native species. However, the mechanisms underlying such shifts in interaction strength are poorly understood. Here, we test whether ocean acidification, driven by elevated seawater pCO₂, increases the susceptibility of native Olympia oysters to predation by invasive snails. Oysters raised under elevated pCO₂ experienced a 20% increase in drilling predation. When presented alongside control oysters in a choice experiment, 48% more high-CO₂ oysters were consumed. The invasive snails were tolerant of elevated CO₂ with no change in feeding behaviour. Oysters raised under acidified conditions did not have thinner shells, but were 29-40% smaller than control oysters, and these smaller individuals were consumed at disproportionately greater rates. Reduction in prey size is a common response to environmental stress that may drive increasing per capita effects of stress-tolerant invasive predators.

Studies on Possible Activation of Microbial Laccase Production Using Gamma Irradiation

International Nuclear Information System (INIS)

ElKenawy, N.M.A.

2013-01-01

Enzyme production is an essential discipline in biotechnology. Laccase enzyme is an oxidoreductase that catalyzes the oxidation of various aromatic compounds, with the simultaneous reduction of oxygen into water. Although the enzyme is present in plants, insects and bacteria, the most important source is fungi and particularly the Basidiomycetes. In fungi, the enzyme plays a role in the removal of potentially toxic phenols arising during fungal morphogenesis, sporulation, phytopathogensis and virulence. In this work, the production of fungal laccase was optimized from a local isolate of Pleurotus ostreatus using solid state fermentation. Factorial design was used to study the effect of several nutrients and inducer on enzyme activity. Purification, characterization of the enzyme, the effect of temperature and ph were studied. The effect of gamma radiation on fungal growth and enzyme production was investigated. The optimization of the production conditions yielded an enzyme with activity over 32,054 IU/gram of fermented substrate. Factorial design was capable of establishing the conditions that multiplied the activity of the enzyme several folds and consequently, reducing the cost of production. The enzyme was capable of decolorizing several dyes with over 80 % reduction in color in case of methyl orange and trypan blue. The decolorisation of dyes is a simple method to assess the aromatic degrading capability of laccase. The enzyme was also used in the synthesis of gold nanoparticles, proving that laccase from Pleurotus ostreatus has a strong potential in several industrial applications, which opens a door towards using of fungal laccase in further biotechnological processes.

Microplastics in oysters Saccostrea cucullata along the Pearl River Estuary, China.

Science.gov (United States)

Li, Heng-Xiang; Ma, Li-Sha; Lin, Lang; Ni, Zhi-Xin; Xu, Xiang-Rong; Shi, Hua-Hong; Yan, Yan; Zheng, Guang-Ming; Rittschof, Daniel

2018-05-01

As a transitional zone between riverine and marine environments, an estuary plays an important role for the sources, accumulation and transport of microplastics. Although estuarine environments are hotspots of microplastic pollution, the correlation between microplastic pollution and aquatic organisms is less known. Here we investigated microplastic pollution in wild oysters Saccostrea cucullata from 11 sampling sites along the Pearl River Estuary in South China. The microplastic abundances in oysters ranged from 1.4 to 7.0 items per individual or from 1.5 to 7.2 items per gram tissue wet weight, which were positively related to those in surrounding waters. The oysters near urban areas contained significantly more microplastics than those near rural areas. Fibers accounted for 69.4% of the total microplastics in oysters. Microplastic sizes varied from 20 to 5000 μm and 83.9% of which were less than 100 μm. Light color microplastics were significantly more common than dark color ones. Based on the results, oysters are recommended as a biomonitor for the microplastic pollution in estuaries. Copyright © 2018 Elsevier Ltd. All rights reserved.

Structural and compositional characterization of the adhesive produced by reef building oysters.

Science.gov (United States)

Alberts, Erik M; Taylor, Stephen D; Edwards, Stephanie L; Sherman, Debra M; Huang, Chia-Ping; Kenny, Paul; Wilker, Jonathan J

2015-04-29

Oysters have an impressive ability to overcome difficulties of life within the stressful intertidal zone. These shellfish produce an adhesive for attaching to each other and building protective reef communities. With their reefs often exceeding kilometers in length, oysters play a major role in balancing the health of coastal marine ecosystems. Few details are available to describe oyster adhesive composition or structure. Here several characterization methods were applied to describe the nature of this material. Microscopy studies indicated that the glue is comprised of organic fiber-like and sheet-like structures surrounded by an inorganic matrix. Phospholipids, cross-linking chemistry, and conjugated organics were found to differentiate this adhesive from the shell. Symbiosis in material synthesis could also be present, with oysters incorporating bacterial polysaccharides into their adhesive. Oyster glue shows that an organic-inorganic composite material can provide adhesion, a property especially important when constructing a marine ecosystem.

Rapid detection of toxic metals in non-crushed oyster shells by portable X-ray fluorescence spectrometry

Energy Technology Data Exchange (ETDEWEB)

Chou Ju, E-mail: Ju.Chou@selu.ed [Department of Chemistry and Physics, Southeastern Louisiana University, Hammond, LA 70402 (United States); Clement, Garret; Bursavich, Bradley; Elbers, Don [Department of Chemistry and Physics, Southeastern Louisiana University, Hammond, LA 70402 (United States); Cao Baobao; Zhou Weilie [Advanced Material Research Institute, University of New Orleans, New Orleans, LA 70148 (United States)

2010-06-15

The aim of this study was the multi-elemental detection of toxic metals such as lead (Pb) in non-crushed oyster shells by using a portable X-ray fluorescence (XRF) spectrometer. A rapid, simultaneous multi-element analytical methodology for non-crushed oyster shells has been developed using a portable XRF which provides a quick, quantitative, non-destructive, and cost-effective mean for assessment of oyster shell contamination from Pb. Pb contamination in oyster shells was further confirmed by scanning electron microscopy with energy dispersive spectroscopy (SEM-EDS). The results indicated that Pb is distributed in-homogeneously in contaminated shells. Oyster shells have a lamellar structure that could contribute to the high accumulation of Pb on oyster shells. - A rapid, simultaneous multi-element analytical methodology for non-crushed oyster shells has been developed using XRF and contamination of lead on oyster shells was confirmed by XRF and SEM-EDS.

Rapid detection of toxic metals in non-crushed oyster shells by portable X-ray fluorescence spectrometry

International Nuclear Information System (INIS)

Chou Ju; Clement, Garret; Bursavich, Bradley; Elbers, Don; Cao Baobao; Zhou Weilie

2010-01-01

The aim of this study was the multi-elemental detection of toxic metals such as lead (Pb) in non-crushed oyster shells by using a portable X-ray fluorescence (XRF) spectrometer. A rapid, simultaneous multi-element analytical methodology for non-crushed oyster shells has been developed using a portable XRF which provides a quick, quantitative, non-destructive, and cost-effective mean for assessment of oyster shell contamination from Pb. Pb contamination in oyster shells was further confirmed by scanning electron microscopy with energy dispersive spectroscopy (SEM-EDS). The results indicated that Pb is distributed in-homogeneously in contaminated shells. Oyster shells have a lamellar structure that could contribute to the high accumulation of Pb on oyster shells. - A rapid, simultaneous multi-element analytical methodology for non-crushed oyster shells has been developed using XRF and contamination of lead on oyster shells was confirmed by XRF and SEM-EDS.

Increases in the amounts of Vibrio spp. in oysters upon addition of exogenous bacteria.

Science.gov (United States)

Froelich, Brett; Oliver, James

2013-09-01

The bacterial pathogen Vibrio vulnificus is found naturally in brackish coastal waters but can be greatly concentrated by filter-feeding organisms such as shellfish. Numerous experiments in which exogenous V. vulnificus cells are added to oysters in an attempt to measure uptake and depuration have been performed. In nearly all cases, results have shown that laboratory-grown bacteria are rapidly taken up by the oysters but ultimately eliminated, while naturally present Vibrio populations in oysters are resistant to depuration. In this study, oysters harvested during winter months, with low culturable Vibrio concentrations, were incubated in aquaria supplemented with strains of V. vulnificus that were either genotypically or phenotypically distinct from the background bacteria. These exogenous cells were eliminated from the oysters, as previously seen, but other vibrios already inhabiting the oysters responded to the V. vulnificus inoculum by rapidly increasing in number and maintaining a large stable population. The presence of such an oyster-adapted Vibrio population would be expected to prevent colonization by exogenous V. vulnificus cells, thus explaining the rapid depuration of these added bacteria.

Effect of storage on the quality of purified live Pacific and Sydney rock oysters

OpenAIRE

Bird, P; Arnold, G; Holliday, J; Boronovshy, A

1992-01-01

In December, 1990, the N.S.W. Minister for Agriculture and Rural Affairs removed the Pacific oyster (Crassostrea gigas) from the noxious fish list for the Port Stephens area, permitting it's cultivation. As Port Stephens Pacific oysters are grown intertidally, similar to Sydney rock oysters (Saccostrea commercialis) there was a belief that they may have different storage requirements to overseas Pacific oysters which are cultivated in deep water exclusively. Consequently, the keeping quality ...

Temperature-dependent persistence of human norovirus within oysters (Crassotrea virginica)

Science.gov (United States)

This study characterizes the persistence of human norovirus in Eastern oysters (Crassostrea virginica) held at different seawater temperatures. Oysters were contaminated with human norovirus GI.1 (Norwalk strain 8fIIa) by exposing them to virus contaminated water at 15 degrees C, and subsequently ho...

Markers associated with disease resistance in Eastern oysters, Crassostrea virginica

Science.gov (United States)

Eastern oyster, Crassostrea viginica, is an economically important aquaculture species in the USA, but production has been impacted by diseases such as dermo and MSX. Efforts have been put into the development of disease-resistant oyster lines using selective breeding techniques. However, these met...

Effects of High Hydrostatic Pressure on the Physical, Microbial, and Chemical Attributes of Oysters (Crassostrea virginica).

Science.gov (United States)

Lingham, Talaysha; Ye, Mu; Chen, Haiqiang; Chintapenta, Lathadevi Karuna; Handy, Eunice; Zhao, Jing; Wu, Changqing; Ozbay, Gulnihal

2016-05-01

The change in the quality attributes (physical, microbial, and chemical) of oysters (Crassostrea virginica) after high hydrostatic pressure (HHP) treatment at 300 MPa at room temperature (RT, 25 °C) 300, 450, and 500 MPa at 0 °C for 2 min and control oysters without treatment were evaluated over 3 wk. The texture and tissue yield percentages of oysters HHP treated at 300 MPa, RT increased significantly (P oysters reached the spoilage point of 7 log CFU/g after 15 d. Coliform counts (log MPN/g) were low during storage with total and fecal coliforms less than 3.5 and 1.0. High pressure treated oysters at 500 MPa at 0 °C were significantly higher (P oysters HHP treated at 300 MPa at 0 °C in lipid oxidation values. The highest pressure (500 MPa) treatment in this study, significantly (P oysters at 3 wk was significantly higher (P oysters [300 MPa, (RT); 450 MPa (0 °C); and 500 MPa (0 °C)]. HHP treatments of oysters were not significantly different in pH, percent salt extractable protein (SEP), and total lipid values compared to control. Based on our results, HHP prolongs the physical, microbial, and chemical quality of oysters. © 2016 Institute of Food Technologists®

Isolation of Vibrio cholerae serotype O1 from the eastern oyster, Crassostrea virginica.

Science.gov (United States)

Hood, M A; Ness, G E; Rodrick, G E

1981-01-01

Two strains of Vibrio cholerae serotype O1 Inaba were isolated from eastern oysters, Crassostrea virginica, collected from estuarine waters in Florida during April 1980. The oyster meats and waters from which the oysters were collected had low fecal coliform counts, and the area had no prior evidence of sewage contamination. PMID:7235700

Removal of Arsenic with Oyster Shell: Experimental Measurements

Directory of Open Access Journals (Sweden)

Md. Atiqur Rahman, , and

2008-12-01

Full Text Available Oyster shell has tremendous potential as a remediation material for the removal of arsenic from groundwater. A single arsenic removal system was developed with oyster shell for tube well water containing arsenic. The system removes arsenic from water by adsorption through fine oyster shell. Various conditions that affect the adsorption/desorption of arsenic were investigated. Adsorption column methods showed the removal of As(III under the following conditions: initial As concentration, 100 µg /L; oyster shell amount, 6 g; particle size, <355µm ; treatment flow rate, 1.7 mL/min; and pH 6.5. Arsenic concentration of the treated water were below the Bangladesh drinking water standard of 50 µg/L for As. The desorption efficiencies with 2M of KOH after the treatment of groundwater were in the range of 80-83%. A combination of techniques was used to measure the pH, conductivity, cations and anions. The average concentrations of other inorganic constituents of health concern (Na, K, Ca, Mg and Fe in treated water were below their respective WHO guideline for drinking. The present study might provide new avenues to achieve the arsenic concentrations required for drinking water recommended by Bangladesh and the World Health Organization (WHO.

The potential of aerial photography for estimating surface areas of intertidal Pacific oyster beds (Crassostrea gigas)

NARCIS (Netherlands)

Kater, B.J.; Baars, J.M.D.D.

2004-01-01

Pacific oysters were introduced into the Eastern Scheldt in 1964 for breeding purposes. The first spatfall of wild Pacific oysters was recorded in 1976, and a second larval outburst in 1982 definitely settled wild Pacific oysters in the Eastern Scheldt waters. Oyster beds on intertidal and subtidal

Oyster Reef Projects 1997-2001

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — We used a quantitative sampling device to compare nekton use among high-relief live oyster reef, vegetated marsh edge Spartina alterniflora, and nonvegetated bottom...

Distribution of Georgia Oyster Reefs

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — The feature class in this ESRI Geodatabase contains polygons representing oyster reefs along the Georgia coastal waterways from Chatham County south to Glynn County....

Microbiological effects of olive mill waste addition to substrates for Pleurotus pulmonarius cultivation

NARCIS (Netherlands)

Soler-Rivas, C.; Garcia-Rosado, A.; Polonia, I.; Junca-Blanch, G.; Marin, F.R.; Wichers, H.J.

2006-01-01

When olive mill wastes (OMWs) and vegetation waters (VWs) obtained during the manufacture of olive oil were added as substrate supplements for the cultivation of Pleurotus pulmonarius the material modified growth of the mushroom and the endemic microbiota of the substrate, in particular the

Controlling Vibrio vulnificus and spoilage bacteria in fresh shucked oysters using natural antimicrobials.

Science.gov (United States)

Mahmoud, B S M

2014-01-01

This study evaluated the efficacy of grape seed extract (GE), citric acid (CA) and lactic acid (LA) on the inactivation of Vibrio vulnificus and inherent microflora in fresh shucked oysters. The minimum inhibitory concentration (MIC) of GE, CA or LA against V. vulnificus was determined. Furthermore, the shucked oysters were artificially inoculated with V. vulnificus. The inoculated shucked oysters (25 g) were then dipped in 250 ml GE, CA or LA solutions for 10 min. The population of V. vulnificus in shucked oysters was determined. The effects of the treatments with GE, CA or LA solutions on the inherent microbiota in fresh shucked oysters during storage at 5°C for 20 days were also studied. The MICs of GE, CA or LA against V. vulnificus were 10.0, 5.0 or 1.0 mg ml(-1), respectively. The concentrations of 500, 300 or 150 mg ml(-1) GE, CA or LA solutions were needed to reduce the population of V. vulnificus to below the detection level (1.0 log g(-1)). Treatment with 500, 300, 150 mg ml(-1) GE, CA or LA significantly reduced the initial inherent microbiota in fresh shucked oysters, and inherent levels were significantly (P Oysters filter large volume of seawater during their feeding activities that concentrate bacteria such as Vibrio vulnificus in their body. The presence of V. vulnificus in oysters has a serious impact on public health and international trade. There is increasing concern over the use of chemical preservatives. Furthermore, the food industry is looking for new natural preservation methods. This study indicated that lactic acid and citric acid wash solutions could offer an inexpensive, natural and strong approach to control V. vulnificus and spoilage bacteria in fresh shucked for the oyster industry. © 2013 The Society for Applied Microbiology.

PARASITIC AND SYMBIOTIC FAUNA INHABITING OYSTERS (CRASSOSTREA VIRGINICA) SAMPLED FROM THE CALOOSAHATCHEE ESTUARY, FL

Science.gov (United States)

Oysters, Crassostrea virginica, inhabiting 5 sites in the Caloosahatchee River estuary were studied over a 13 month period to determine the suitability of oyster habitat in relation to their health and condition. Histological examination of 650 oysters (10 animals per station per...

Behavior of pathogenic bacteria in the oyster, Crassostrea commercialis, during depuration, re-laying, and storage.

Science.gov (United States)

Son, N T; Fleet, G H

1980-12-01

Oysters (Crassostrea commercials) harvested from major cultivation areas within the state of New South Wales, Australia, were commonly contaminated with low levels of the food-poisoning organisms Bacillus cereus, Clostridium perfringens, and Vibrio parahaemolyticus. Salmonella was found in oysters on only one occasion. These bacteria were cleansed from oysters during oyster purification by re-laying in a non-polluted waterway. Oysters were laboratory contaminated to levels in excess 1,000 cells per g with either B. cereus, C. perfringens, V. parahaemolyticus, Salmonella typhimurium, or S. senftenberg. These species were cleansed from such oysters during purification in a laboratory depuration unit that used ultraviolet light for sterilizing the depuration water. Escherichia coli was also cleansed from oysters under the same re-laying or depuration conditions so that its measurement alone could be used to indicate the cleansing of the above pathogenic species. The levels of these bacteria were also measured during the storage of oysters under conditions that occur during marketing. While B. cereus counts remained relatively stable during storage, the Salmonella spp. gradually decreased in numbers and C. perfringens rapidly died off. V. parahaemolyticus counts increased slightly during the first 4 days of storage, after which decreases occurred.

Oyster Fauna of Thailand

DEFF Research Database (Denmark)

Bussarawit, Somchai; Cedhagen, Tomas

2012-01-01

Here, we describe 16 species of true oysters from Thai waters. They are widely distributed on various intertidal and subtidal substrates in the Gulf of Thailand and in the Andaman Sea. The different species were identified on the basis of their shell morphology, and their characteristic features...

[Cellulose acetate membrane electrophoresis CAE and Raman spectroscopy as a method identification of beta-glucans, used as biologically and therapeutically active biomaterials].

Science.gov (United States)

Pielesz, Anna; Biniaś, Włodzimierz; Paluch, Jadwiga

2012-01-01

The formation of AGEs progressively increases with normal aging, even in the absence of disease (the pathogenesis of diabetes associated vascular disorders and neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease). However, they are formed at accelerated rates in age-related diseases. The polysaccharides might play a role in wound healing, both internally and externally, and also that they could play a role against inflammation and may lead to the production of better medicines to be used as supplements in cancer treatment. The acid hydrolysis was studied with H2SO4 at 80% concentration to determine the most effective procedure for total hydrolysis of beta-glucan. The standard of beta-glucans acid hydrolysate were compared for commercial oat and oatmeal, mushrooms: Pleurotus ostreatus, Fungus and yeast Saccharomyces cerevisiae. The following materials and reagents were used in the examination: reference beta-(1 --> 3)-(1 --> 6)-glucan, oat and oatmeal, mushrooms: Pleurotus ostreatus, Fungus and yeast Saccharomyces cerevisiae. The Raman spectra of the sample solutions (beta-glucan acid hydrolysates) were recorded on a MAGNA-IR 860 with FT-Raman accessory. Sample was irradiated with a 1064 nm line of the T10-8S Nd spectra-physics model: YAG laser and scattered radiation were collected at 180 degrees, using 4 cm(-1) resolution. The polysaccharide was hydrolyzed into component monosaccharides with 80% H2SO4 at 0 degrees C for 30 minutes and monosaccharide derivatives were subjected to electrophoresis, as in a ealier authors study, on a strip of cellulose acetate membrane (CA-SYS-MINI Cellulose Acetate Systems) in 0.2 M Ca(OAc)2 (pH 7.5) at 10 mA, max. 240 V for 1.5 h. The strips were stained with 0.5% toluidine blue in 3% HOAc solution and then rinsed in distilled water and air-dried. A part of the hexoses (for example glucose) are converted, to products such as 5-hydroxymethylfurfural. Various coloured substances, through the Maillard

Are oysters being bored to death? Influence of Cliona celata on Crassostrea virginica condition, growth and survival.

Science.gov (United States)

Carroll, John M; O'Shaughnessy, Kathryn A; Diedrich, Grant A; Finelli, Christopher M

2015-11-17

The boring sponge Cliona celata is a nuisance species that can have deleterious effects on eastern oyster Crassostrea virginica growth, condition, and survival. Surprisingly, however, these effects have not been well documented and when examined, results have been equi-vocal. In this study, we provide a direct comparison of growth, condition, and survival of sponge-colonized and uncolonized oysters in southeast North Carolina in 2 separate experiments. In the first experiment, sponge-colonized oysters exhibited significantly slower growth rates, reduced condition, and lower survival relative to uncolonized oysters, although results may have been confounded by oyster source. In the second experiment, using smaller oysters from the same source population, growth rate was again significantly reduced in colonized oysters relative to uncolonized oysters, however neither condition nor survival differed. In field surveys of the same population, colonized individuals across a range of sizes demonstrated significantly reduced condition. Further, condition index was negatively correlated with sponge biomass, which was positively correlated with oyster size, suggesting that the impact of the sponge changes with ontogeny. By investigating clearance rates, tissue isotopic and nutrient content, as well as caloric value, this study provides further evidence that sponge presence causes the oysters to divert energy into costly shell maintenance and repair at the expense of shell and somatic growth. Thus, although variable, our results demonstrate negative impacts of sponge infestation on oyster demographics, particularly as oysters grow larger.

Rapid transcriptional acclimation following transgenerational exposure of oysters to ocean acidification.

Science.gov (United States)

Goncalves, Priscila; Anderson, Kelli; Thompson, Emma L; Melwani, Aroon; Parker, Laura M; Ross, Pauline M; Raftos, David A

2016-10-01

Marine organisms need to adapt in order to cope with the adverse effects of ocean acidification and warming. Transgenerational exposure to CO2 stress has been shown to enhance resilience to ocean acidification in offspring from a number of species. However, the molecular basis underlying such adaptive responses is currently unknown. Here, we compared the transcriptional profiles of two genetically distinct oyster breeding lines following transgenerational exposure to elevated CO2 in order to explore the molecular basis of acclimation or adaptation to ocean acidification in these organisms. The expression of key target genes associated with antioxidant defence, metabolism and the cytoskeleton was assessed in oysters exposed to elevated CO2 over three consecutive generations. This set of target genes was chosen specifically to test whether altered responsiveness of intracellular stress mechanisms contributes to the differential acclimation of oyster populations to climate stressors. Transgenerational exposure to elevated CO2 resulted in changes to both basal and inducible expression of those key target genes (e.g. ecSOD, catalase and peroxiredoxin 6), particularly in oysters derived from the disease-resistant, fast-growing B2 line. Exposure to CO2 stress over consecutive generations produced opposite and less evident effects on transcription in a second population that was derived from wild-type (nonselected) oysters. The analysis of key target genes revealed that the acute responses of oysters to CO2 stress appear to be affected by population-specific genetic and/or phenotypic traits and by the CO2 conditions to which their parents had been exposed. This supports the contention that the capacity for heritable change in response to ocean acidification varies between oyster breeding lines and is mediated by parental conditioning. © 2016 John Wiley & Sons Ltd.

Oysters and eelgrass: potential partners in a high pCO2 ocean.

Science.gov (United States)

Groner, Maya L; Burge, Colleen A; Cox, Ruth; Rivlin, Natalie; Turner, Mo; Van Alstyne, Kathryn L; Wyllie-Echeverria, Sandy; Bucci, John; Staudigel, Philip; Friedman, Carolyn S

2018-05-25

Climate change is affecting the health and physiology of marine organisms and altering species interactions. Ocean acidification (OA) threatens calcifying organisms such as the Pacific oyster, Crassostrea gigas. In contrast, seagrasses, such as the eelgrass Zostera marina, can benefit from the increase in available carbon for photosynthesis found at a lower seawater pH. Seagrasses can remove dissolved inorganic carbon from OA environments, creating local daytime pH refugia. Pacific oysters may improve the health of eelgrass by filtering out pathogens such as Labyrinthula zosterae (LZ), which causes eelgrass wasting disease (EWD). We examined how co-culture of eelgrass ramets and juvenile oysters affected the health and growth of eelgrass and the mass of oysters under different pCO 2 exposures. In Phase I, each species was cultured alone or in co-culture at 12°C across ambient, medium, and high pCO 2 conditions, (656, 1158 and1606 μatm pCO 2 , respectively). Under high pCO 2 , eelgrass grew faster and had less severe EWD (contracted in the field prior to the experiment). Co-culture with oysters also reduced the severity of EWD. While the presence of eelgrass decreased daytime pCO 2 , this reduction was not substantial enough to ameliorate the negative impact of high pCO 2 on oyster mass. In Phase II, eelgrass alone or oysters and eelgrass in co-culture were held at 15°C under ambient and high pCO 2 conditions, (488 and 2013 μatm pCO 2 , respectively). Half of the replicates were challenged with cultured LZ. Concentrations of defensive compounds in eelgrass (total phenolics and tannins), were altered by LZ exposure and pCO 2 treatments. Greater pathogen loads and increased EWD severity were detected in LZ exposed eelgrass ramets; EWD severity was reduced at high relative to low pCO 2 . Oyster presence did not influence pathogen load or EWD severity; high LZ concentrations in experimental treatments may have masked the effect of this treatment. Collectively, these

Occurrence of Proteus mirabilis associated with two species of venezuelan oysters.

Science.gov (United States)

Fernández-Delgado, Milagro; Contreras, Monica; García-Amado, María Alexandra; Gueneau, Pulchérie; Suárez, Paula

2007-01-01

The fecal contamination of raw seafood by indicators and opportunistic pathogenic microorganisms represents a public health concern. The objective of this study was to investigate the presence of enteric bacteria colonizing oysters collected from a Venezuelan touristic area. Oyster samples were collected at the northwestern coast of Venezuela and local salinity, pH, temperature, and dissolved oxygen of seawater were recorded. Total and fecal coliforms were measured for the assessment of the microbiological quality of water and oysters, using the Multiple Tube Fermentation technique. Analyses were made using cultures and 16S rRNA gene sequencing. Diverse enrichment and selective culture methods were used to isolate enteric bacteria. We obtained pure cultures of Gram-negative straight rods with fimbriae from Isognomon alatus and Crassostrea rhizophorae. Our results show that P. mirabilis was predominant under our culture conditions. We confirmed the identity of the cultures by biochemical tests, 16S rRNA gene sequencing, and data analysis. Other enterobacteria such as Escherichia coli, Morganella morganii and Klebsiella pneumoniae were also isolated from seawater and oysters. The presence of pathogenic bacteria in oysters could have serious epidemiological implications and a potential human health risk associated with consumption of raw seafood.

Transcriptome of American oysters, Crassostrea virginica, in response to bacterial challenge: insights into potential mechanisms of disease resistance.

Science.gov (United States)

McDowell, Ian C; Nikapitiya, Chamilani; Aguiar, Derek; Lane, Christopher E; Istrail, Sorin; Gomez-Chiarri, Marta

2014-01-01

The American oyster Crassostrea virginica, an ecologically and economically important estuarine organism, can suffer high mortalities in areas in the Northeast United States due to Roseovarius Oyster Disease (ROD), caused by the gram-negative bacterial pathogen Roseovarius crassostreae. The goals of this research were to provide insights into: 1) the responses of American oysters to R. crassostreae, and 2) potential mechanisms of resistance or susceptibility to ROD. The responses of oysters to bacterial challenge were characterized by exposing oysters from ROD-resistant and susceptible families to R. crassostreae, followed by high-throughput sequencing of cDNA samples from various timepoints after disease challenge. Sequence data was assembled into a reference transcriptome and analyzed through differential gene expression and functional enrichment to uncover genes and processes potentially involved in responses to ROD in the American oyster. While susceptible oysters experienced constant levels of mortality when challenged with R. crassostreae, resistant oysters showed levels of mortality similar to non-challenged oysters. Oysters exposed to R. crassostreae showed differential expression of transcripts involved in immune recognition, signaling, protease inhibition, detoxification, and apoptosis. Transcripts involved in metabolism were enriched in susceptible oysters, suggesting that bacterial infection places a large metabolic demand on these oysters. Transcripts differentially expressed in resistant oysters in response to infection included the immune modulators IL-17 and arginase, as well as several genes involved in extracellular matrix remodeling. The identification of potential genes and processes responsible for defense against R. crassostreae in the American oyster provides insights into potential mechanisms of disease resistance.

A comparative proteomic study on the effects of metal pollution in oysters Crassostrea hongkongensis.

Science.gov (United States)

Xu, Lanlan; Ji, Chenglong; Wu, Huifeng; Tan, Qiaoguo; Wang, Wen-Xiong

2016-11-15

The metal pollution has posed great risk on the coastal organisms along the Jiulongjiang Estuary in South China. In this work, two-dimensional electrophoresis-based proteomics was applied to the oysters Crassostrea hongkongensis from metal pollution sites to characterize the proteomic responses to metal pollution. Metal accumulation and proteomic responses indicated that the oysters from BJ site were more severely contaminated than those from FG site. Compared with those oyster samples from the clean site (JZ), metal pollution induced cellular injuries, oxidative and immune stresses in oyster heapatopancreas from both BJ and FG sites via differential metabolic pathways. In addition, metal pollution in BJ site induced disturbance in energy and lipid metabolisms in oysters. Results indicated that cathepsin L and ferritin GF1 might be the biomarkers of As and Fe in oyster C. hongkongensis, respectively. This study demonstrates that proteomics is a useful tool for investigating biological effects induced by metal pollution. Copyright © 2016 Elsevier Ltd. All rights reserved.

The role of tissue-specific microbiota in initial establishment success of Pacific oysters.

Science.gov (United States)

Lokmer, Ana; Kuenzel, Sven; Baines, John F; Wegner, Karl Mathias

2016-03-01

Microbiota can have positive and negative effects on hosts depending on the environmental conditions. Therefore, it is important to decipher host-microbiota-environment interactions, especially under natural conditions exerting (a)biotic stress. Here, we assess the relative importance of microbiota in different tissues of Pacific oyster for its successful establishment in a new environment. We transplanted oysters from the Southern to the Northern Wadden Sea and controlled for the effects of resident microbiota by administering antibiotics to half of the oysters. We then followed survival and composition of haemolymph, mantle, gill and gut microbiota in local and translocated oysters over 5 days. High mortality was recorded only in non-antibiotic-treated translocated oysters, where high titres of active Vibrio sp. in solid tissues indicated systemic infections. Network analyses revealed the highest connectivity and a link to seawater communities in the haemolymph microbiota. Since antibiotics decreased modularity and increased connectivity of the haemolymph-based networks, we propose that community destabilization in non-treated translocated oysters could be attributed to interactions between resident and external microbiota, which in turn facilitated passage of vibrios into solid tissues and invoked disease. These interactions of haemolymph microbiota with the external and internal environment may thus represent an important component of oyster fitness. © 2015 Society for Applied Microbiology and John Wiley & Sons Ltd.

Detection and forecasting of oyster norovirus outbreaks: recent advances and future perspectives.

Science.gov (United States)

Wang, Jiao; Deng, Zhiqiang

2012-09-01

Norovirus is a highly infectious pathogen that is commonly found in oysters growing in fecally contaminated waters. Norovirus outbreaks can cause the closure of oyster harvesting waters and acute gastroenteritis in humans associated with consumption of contaminated raw oysters. Extensive efforts and progresses have been made in detection and forecasting of oyster norovirus outbreaks over the past decades. The main objective of this paper is to provide a literature review of methods and techniques for detecting and forecasting oyster norovirus outbreaks and thereby to identify the future directions for improving the detection and forecasting of norovirus outbreaks. It is found that (1) norovirus outbreaks display strong seasonality with the outbreak peak occurring commonly in December-March in the U.S. and April-May in the Europe; (2) norovirus outbreaks are affected by multiple environmental factors, including but not limited to precipitation, temperature, solar radiation, wind, and salinity; (3) various modeling approaches may be employed to forecast norovirus outbreaks, including Bayesian models, regression models, Artificial Neural Networks, and process-based models; and (4) diverse techniques are available for near real-time detection of norovirus outbreaks, including multiplex PCR, seminested PCR, real-time PCR, quantitative PCR, and satellite remote sensing. The findings are important to the management of oyster growing waters and to future investigations into norovirus outbreaks. It is recommended that a combined approach of sensor-assisted real time monitoring and modeling-based forecasting should be utilized for an efficient and effective detection and forecasting of norovirus outbreaks caused by consumption of contaminated oysters. Copyright © 2012 Elsevier Ltd. All rights reserved.

Pacific oyster culture in British Columbia

National Research Council Canada - National Science Library

Quayle, D. B; Quayle, Daniel Branch

1988-01-01

.... Harvesting, processing, and storage methods are described. The problems of Pacific oyster culture include industrial and sewage pollution, paralytic shellfish poisoning along with predators and disease...

ANTIMICROBIAL ACTIVITY OF COPPER AND ZINC ACCUMULATED BY EASTERN OYSTER AMEBOCYTES

Science.gov (United States)

Fisher, William S. Submitted. Antimicrobial Activity of Copper and Zinc Accumulated by Eastern Oyster Amebocytes. J. Shellfish Res. 54 p. (ERL,GB 1196). The distribution of eastern oysters Crassostrea virginica near terrestrial watersheds has led to a general impression t...

Calcium flouride (CaF2) from oyster shell as a raw material for thermoluminescence dosimeter

International Nuclear Information System (INIS)

Coloma, Lyra C.; Fanuga, Lyn N.; Ocreto, Cherries Ann; Rodriguez, Richita

2006-03-01

This study aims to develop a thermoluminescence dosimeter raw material made of calcium fluoride from locally available seashells that is suitable for personal radiation monitoring. Oyster shells were collected and grounded as powder samples and analyzed for calcium fluoride (CaF 2 ) content using XRF and XRD testing. Samples include pure CaF 2 , pure oyster shell, and oyster shells treated with acid. Based from the XRF results, natural oyster shell (w/ and w/o HNO 3 ) had high percentage of calcium about 49.64% and 47.45%, next to the pure calcium fluoride of 51.08%. X-ray diffractrogram shows that oyster sample had the nearest desired structure of CaF 2 compared with two seashells relative to the pure CaF 2 as standard materials. Results show that all of the natural oyster samples displayed TL emission glow curves at the temperature range 200-300 o C. It was also found that pure oyster sample has better TL response as compared to the treated ones. The researchers concluded that the calcium fluoride from oyster shells (without acid and heated) is a potentially good low-cost TLD raw material and may be used as an alternative for the much more expensive LiF dosimeters. (Authors)

Trade-off between increased survival and reduced growth for blue mussels living on Pacific oyster reefs

DEFF Research Database (Denmark)

Eschweiler, Nina; Christensen, Helle Torp

2011-01-01

Pacific oysters Crassostrea gigas (Thunberg 1793) have been introduced into the Wadden Sea (North Sea, Germany) in the mid of the 1980s and have invaded native blue mussel Mytilus edulis (L.) beds. The latter turned into oyster reefs where mussels seem to be relegated to the bottom in between...... the much larger oysters. By combining field and laboratory experiments, we reveal how mussels react to cohabitation with the invasive oysters. Mussels subjected to direct contact with crabs Carcinus maenas migrate from top to bottom positions between oysters in both field and laboratory experiments within...... 22days. Shell growth was significantly reduced for mussels placed on the bottom compared to mussels at the top of an oyster reef. Condition index was lower for mussels on the bottom of the reef irrespective of whether placed between dead or living oysters. We conclude that mussels experience a trade...

Detection and distribution of ostreid herpesvirus 1 in experimentally infected Pacific oyster spat.

Science.gov (United States)

Segarra, Amélie; Baillon, Laury; Faury, Nicole; Tourbiez, Delphine; Renault, Tristan

2016-01-01

High mortality rates are reported in spat and larvae of Pacific oyster Crassostrea gigas and associated with ostreid herpesvirus 1 (OsHV-1) detection in France. Although the viral infection has been experimentally reproduced in oyster larvae and spat, little knowledge is currently available concerning the viral entry and its distribution in organs and tissues. This study compares OsHV-1 DNA and RNA detection and localization in experimentally infected oysters using two virus doses: a low dose that did not induce any mortality and a high dose inducing high mortality. Real time PCR demonstrated significant differences in terms of viral DNA amounts between the two virus doses. RNA transcripts were detected in oysters receiving the highest dose of viral suspension whereas no transcript was observed in oysters injected with the low dose. This study also allowed observing kinetics of viral DNA and RNA detection in different tissues of oyster spat. Finally, viral detection was significantly different in function of tissues (p<0.005), time (p<0.005) with an interaction between tissues and time (p<0.005) for each probe. Copyright © 2015 Elsevier Inc. All rights reserved.

Putting oysters under pressure

Science.gov (United States)

High pressure processing (HPP) is the most commercially important food processing technology in use now and is anticipated to remain of equal or greater importance during the next five to 10 years. This month’s column reviews the theory and current applications of HPP for oysters to improve their sa...

Microbiological, physicochemical, and sensory characteristics of gamma-irradiated fresh oysters during storage

Energy Technology Data Exchange (ETDEWEB)

Park, Jae Sek; Pak, Jae Nam; Park, Jin Gyu; Han, In Jun; Jung, Pil Mun; Song, Beaom Seok; Choi, Jong Il; Kim, Jae Hun; Byun, Myung Woo; Lee, Ju Woon [Team for Radiation Food Science and Biotechnology, Advanced Radiation Technology Institute, Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of); Han, Sang Bae [Food and Risk Standardization Team, KFDA, Seoul (Korea, Republic of)

2008-05-15

The microbiological, physicochemical and sensory characteristics of gamma irradiated fresh oysters were evaluated regarding its shelf-life during refrigeration. Non-irradiated fresh oysters began to be putrefied after 14 days, while fresh oysters irradiated with 2 kGy showed 5.54 log CFU∙g-1 even after 28 days. Volatile basic nitrogen (VBN) value increased more rapidly in the non-irradiated sample than the irradiated samples during storage. Especially the VBN value of the non-irradiated sample was eight fold higher then that of the the sample irradiated with 2 kGy. The pH of the non-irradiated fresh oysters significantly decreased during storage while the samples irradiated with doses higher than 2 kGy showed no significant change. Thiobarbituric acid (TBA) value increased in all samples during a storage period, and gamma irradiation accelerated the increase of lipid oxidation. Sensory characteristics of fresh oysters were deteriorated as irradiation doses increased, and sensory scores of the samples irradiated with doses higher than 2 kGy were significantly decreased.

Microbiological, physicochemical, and sensory characteristics of gamma-irradiated fresh oysters during storage

International Nuclear Information System (INIS)

Park, Jae Sek; Pak, Jae Nam; Park, Jin Gyu; Han, In Jun; Jung, Pil Mun; Song, Beaom Seok; Choi, Jong Il; Kim, Jae Hun; Byun, Myung Woo; Lee, Ju Woon; Han, Sang Bae

2008-01-01

The microbiological, physicochemical and sensory characteristics of gamma irradiated fresh oysters were evaluated regarding its shelf-life during refrigeration. Non-irradiated fresh oysters began to be putrefied after 14 days, while fresh oysters irradiated with 2 kGy showed 5.54 log CFU∙g-1 even after 28 days. Volatile basic nitrogen (VBN) value increased more rapidly in the non-irradiated sample than the irradiated samples during storage. Especially the VBN value of the non-irradiated sample was eight fold higher then that of the the sample irradiated with 2 kGy. The pH of the non-irradiated fresh oysters significantly decreased during storage while the samples irradiated with doses higher than 2 kGy showed no significant change. Thiobarbituric acid (TBA) value increased in all samples during a storage period, and gamma irradiation accelerated the increase of lipid oxidation. Sensory characteristics of fresh oysters were deteriorated as irradiation doses increased, and sensory scores of the samples irradiated with doses higher than 2 kGy were significantly decreased

Rapid determination of silver in cultivated Japanese and South Korean oysters and Japanese rock oysters using the 24.6-s neutron activation product 110Ag and estimation of its average daily intake

International Nuclear Information System (INIS)

Fukushima, M.; Chatt, A.

2013-01-01

Soft tissues of cultivated Japanese (Miyagi Prefecture) and South Korean (Koje-do and Kosong) oysters and Japanese rock oysters (Honshu Island) were analyzed to measure silver levels. The soft tissues, namely hepatopancreas, gill, muscle, and mantle were separated, freeze-dried, pulverized, and analyzed by an instrumental neutron activation analysis method in conjunction with Compton suppression spectrometry (INAA-CSS). The method consisted of the irradiation of samples in a neutron flux of 5 x 10 11 cm -2 s -1 using the rapid transfer system in an inner pneumatic irradiation site of the Dalhousie University SLOWPOKE-2 reactor (DUSR) facility for 12-15 s, decay for 20 s, and counting for 60 s. The 657.8-keV gamma-ray of the 24.6-s nuclide 110 Ag was used for assaying silver. The method was validated using NIST, NRC and NIES certified reference materials. An absolute detection limit of 0.05 μg silver using NIST SRM 1566b Oyster Tissue was achieved. About 10-50 times higher levels of silver were found in cultivated Japanese oysters compared to the South Korean ones. The silver concentrations in cultivated oysters in Miyagi Prefecture showed the following trend: gill > mantle > hepatopancreas > muscle as well as on the age. Rock oysters generally had higher silver content compared to cultivated oysters. A very preliminary value of about 0.466 μg silver average intake per person per day was estimated from the consumption of oysters by the people living in the Sendai city of Miyagi Prefecture. (author)

21 CFR 161.30 - Declaration of quantity of contents on labels for canned oysters.

Science.gov (United States)

2010-04-01

... canned oysters. 161.30 Section 161.30 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH....30 Declaration of quantity of contents on labels for canned oysters. (a) For many years packers of canned oysters in the Gulf area of the United States have labeled their output with a declaration of the...

Preliminary Evaluation of Microbial Communities Isolated from the Calcifying Fluid of Oysters

Science.gov (United States)

Banker, R.

2016-02-01

The process of biomineralization is defined as the selective uptake of elements that are incorporated into a defined mineral structure under strict biological control. For bivalve molluscs, such as clams, oysters, and mussels, the mantle is the primary organ in control of shell deposition. Alternatively, remote calcification takes place when carbonate-precipitating microbes (e.g. sulfate reducers) colonize a shell-secreting organism and enhance the ability of the host to build shell material. The oyster syndrome is a term that describes bivalves that possess an unusual shell morphology characterized by exceptionally thick valves containing numerous chambers filled with chalky calcite. Although remote calcification via microbial metabolism has been proposed as a mechanism of chalky deposit formation in oysters, this hypothesis has not yet been rigorously investigated. Here I present data on the microbial communities found in the calcifying fluid of two oyster species; Crassostrea gigas and Ostrea lurida are examples of oysters that do and do not exhibit the oyster syndrome, respectively. Comparison of the microbiomes of these two morphological end members may provide insight into the role of microbes in the formation of chalky deposits. Results indicate that the microbial community in the surrounding water is the dominant source for bacterial taxa found in the calcifying fluid of both oyster species. Also, it appears as though C. gigas maintains a microbial community that is more similar to its ambient environment than O. lurida. These results demonstrate that the ambient aquatic environment has a guiding influence on the microbiome found in the calcifying fluid of bivalve molluscs. However, the magnitude of this effect varies among organisms, even those that are closely related.

Antioxidant properties of mushroom mycelia obtained by batch cultivation and tocopherol content affected by extraction procedures.

Science.gov (United States)

Vamanu, Emanuel

2014-01-01

The determination of the antioxidant potential of lyophilized mushroom mycelia from 5 strains of the species Pleurotus ostreatus and Coprinus comatus (obtained by submerged cultivation in batch system) was analyzed as ethanolic extracts by evaluating ABTS and the hydroxyl scavenging activity, FRAP method, the chelating capacity, the inhibition of human erythrocyte hemolysis, and the inhibition of xanthine oxidase activity. The main compounds present in all extracts were determined by HPLC chromatography. Overall, results demonstrated that the biologically active substances content is modulated by the extraction method used. The most beneficial extract, characterized by determining the EC50 value, was that of C. comatus M8102, followed by P. ostreatus PQMZ91109. Significant amount of α-tocopherol (179.51 ± 1.51 mg/100 g extract) was determined as well as flavones such as rutin and apigenin. In the P. ostreatus PQMZ91109 extract, 4.8 ± 0.05 mg/100 g extract of tocopherol acetate known to play a significant role as an antioxidant in skin protection against oxidative stress generated by UV rays was determined. The various correlations (r (2) = 0.7665-0.9426 for tocopherol content) assessed and the composition of extracts in fluidized bed from the mycelia of the tested species depicted a significant pharmacological potential as well as the possibility of usage in the development of new functional products.

Vibrio bacteria in raw oysters: managing risks to human health.

Science.gov (United States)

Froelich, Brett A; Noble, Rachel T

2016-03-05

The human-pathogenic marine bacteria Vibrio vulnificus and V. parahaemolyticus are strongly correlated with water temperature, with concentrations increasing as waters warm seasonally. Both of these bacteria can be concentrated in filter-feeding shellfish, especially oysters. Because oysters are often consumed raw, this exposes people to large doses of potentially harmful bacteria. Various models are used to predict the abundance of these bacteria in oysters, which guide shellfish harvest policy meant to reduce human health risk. Vibrio abundance and behaviour varies from site to site, suggesting that location-specific studies are needed to establish targeted risk reduction strategies. Moreover, virulence potential, rather than simple abundance, should be also be included in future modeling efforts. © 2016 The Author(s).

Interactions between the introduced Pacific oyster Crassostrea gigas and the indigenous blue mussel Mytilus edulis. Local-scale food competition

NARCIS (Netherlands)

Hans, I.W.

2004-01-01

The aim of this study was to determine if food competition between mussels and oysters occurs, and how mussel and oyster growth is affected by this interaction. This was done by relating mussel growth to oyster density relating oyster growth to oyster biomass and perform a field control, by

Shellfish Aquaculture from Space: Potential of Sentinel2 to Monitor Tide-Driven Changes in Turbidity, Chlorophyll Concentration and Oyster Physiological Response at the Scale of an Oyster Farm

Directory of Open Access Journals (Sweden)

Pierre Gernez

2017-05-01

Full Text Available The algorithms of Novoa et al. (2017 and Gons et al. (2005 were recalibrated and applied to Sentinel2 data to retrieve suspended particulate matter (SPM and chlorophyll a (chl a concentration in the environmentally and economically important intertidal zones. Sentinel2-derived chl a and SPM concentration distributions were analyzed at the scale of an oyster farm over a variety of tidal conditions. Sentinel2 imagery was then coupled with ecophysiological modeling to analyze the influence of tide-driven chl a and SPM dynamics on oyster clearance and chl consumption rates. Within the studied oyster farming site (Bourgneuf Bay along the French Atlantic coast, chl consumption rate mirrored the changes in chl a concentration during neap tides, whereas oyster clearance and chl consumption rates were both negatively impacted by high SPM concentration during spring tides.

Secretion of laccase and manganese peroxidase by Pleurotus strains cultivate in solid-state using Pinus spp. sawdust

Directory of Open Access Journals (Sweden)

Marli Camassola

2013-01-01

Full Text Available Pleurotus species secrete phenol oxidase enzymes: laccase (Lcc and manganese peroxidase (MnP. New genotypes of these species show potential to be used in processes aiming at the degradation of phenolic compounds, polycyclic aromatic hydrocarbons and dyes. Hence, a screening of some strains of Pleurotus towards Lcc and MnP production was performed in this work. Ten strains were grown through solid-state fermentation on a medium based on Pinus spp. sawdust, wheat bran and calcium carbonate. High Lcc and MnP activities were found with these strains. Highest Lcc activity, 741 ± 245 U gdm-1 of solid state-cultivation medium, was detected on strain IB11 after 32 days, while the highest MnP activity occurred with strains IB05, IB09, and IB11 (5,333 ± 357; 4,701 ± 652; 5,999 ± 1,078 U gdm-1, respectively. The results obtained here highlight the importance of further experiments with lignocellulolytic enzymes present in different strains of Pleurotus species. Such results also indicate the possibility of selecting more valuable strains for future biotechnological applications, in soil bioremediation and biological biomass pre-treatment in biofuels production, for instance, as well as obtaining value-added products from mushrooms, like phenol oxidase enzymes.

Gear and survey efficiency of patent tongs for oyster populations on restoration reefs.

Science.gov (United States)

Schulte, David M; Lipcius, Romuald N; Burke, Russell P

2018-01-01

Surveys of restored oyster reefs need to produce accurate population estimates to assess the efficacy of restoration. Due to the complex structure of subtidal oyster reefs, one effective and efficient means to sample is by patent tongs, rather than SCUBA, dredges, or bottom cores. Restored reefs vary in relief and oyster density, either of which could affect survey efficiency. This study is the first to evaluate gear (the first full grab) and survey (which includes selecting a specific half portion of the first grab for further processing) efficiencies of hand-operated patent tongs as a function of reef height and oyster density on subtidal restoration reefs. In the Great Wicomico River, a tributary of lower Chesapeake Bay, restored reefs of high- and low-relief (25-45 cm, and 8-12 cm, respectively) were constructed throughout the river as the first large-scale oyster sanctuary reef restoration effort (sanctuary acreage > 20 ha at one site) in Chesapeake Bay. We designed a metal frame to guide a non-hydraulic mechanical patent tong repeatedly into the same plot on a restored reef until all oysters within the grab area were captured. Full capture was verified by an underwater remotely-operated vehicle. Samples (n = 19) were taken on nine different reefs, including five low- (n = 8) and four high-relief reefs (n = 11), over a two-year period. The gear efficiency of the patent tong was estimated to be 76% (± 5% standard error), whereas survey efficiency increased to 81% (± 10%) due to processing. Neither efficiency differed significantly between young-of-the-year oysters (spat) and adults, high- and low-relief reefs, or years. As this type of patent tong is a common and cost-effective tool to evaluate oyster restoration projects as well as population density on fished habitat, knowing the gear and survey efficiencies allows for accurate and precise population estimates.

Hemolymph chemistry and histopathological changes in Pacific oysters (Crassostrea gigas) in response to low salinity stress.

Science.gov (United States)

Knowles, Graeme; Handlinger, Judith; Jones, Brian; Moltschaniwskyj, Natalie

2014-09-01

This study described seasonal differences in the histopathological and hemolymph chemistry changes in different family lines of Pacific oysters, Crassostrea gigas, in response to the stress of an abrupt change to low salinity, and mechanical grading. The most significant changes in pallial cavity salinity, hemolymph chemistry and histopathological findings occurred in summer at low salinity. In summer (water temperature 18°C) at low salinity, 9 (25.7% of full salinity), the mean pallial cavity salinity in oysters at day 3 was 19.8±1.6 (SE) and day 10 was 22.8±1.6 (SE) lower than oysters at salinity 35. Associated with this fall in pallial cavity salinity, mean hemolymph sodium for oysters at salinity 9 on day 3 and 10 were 297.2mmol/L±20(SE) and 350.4mmol/L±21.3(SE) lower than oysters at salinity 35. Similarly mean hemolymph potassium in oysters held at salinity 9 at day 3 and 10 were 5.6mmol/L±0.6(SE) and 7.9mmol/L±0.6 (SE) lower than oysters at salinity 35. These oysters at low salinity had expanded intercellular spaces and significant intracytoplasmic vacuolation distending the cytoplasm of epithelial cells in the alimentary tract and kidney and hemocyte infiltrate (diapedesis) within the alimentary tract wall. In contrast, in winter (water temperature 8°C) oyster mean pallial cavity salinity only fell at day 10 and this was by 6.0±0.6 (SE) compared to that of oysters at salinity 35. There were limited histopathological changes (expanded intercellular spaces and moderate intracytoplasmic vacuolation of renal epithelial cells) in these oysters at day 10 in low salinity. Mechanical grading and family line did not influence the oyster response to sudden low salinity. These findings provide additional information for interpretation of non-lethal, histopathological changes associated with temperature and salinity variation. Copyright © 2014 Elsevier Inc. All rights reserved.

Antioxidant and antibacterial activities of acetonitrile and hexane extracts of Lentinus tigrinus and Pleurotus djamour

Science.gov (United States)

This paper highlighted the antioxidant and antibacterial activities of Lentinus tigrinus and Pleurotus djamour. Extracts of mushroom fruiting bodies were obtained using hexane and acetonitrile solvents. Acetonitrile extracts of both mushrooms exhibited higher biological activities than hexane extrac...

Project ash cultch: A report on optimal oyster cultch based on a prepared fly ash substratum

International Nuclear Information System (INIS)

Price, K.S.; Hansen, K.M.; Schlekat, C.E.

1991-01-01

Based on a three year study involving setting, growth, mortality, oyster condition, and metals accumulation, the evidence is extensive and convincing that stabilized coal ash is an acceptable oyster growing cultch (substratum). Oyster larvae are attracted to set on coal ash cultch at commercial fishery densities, tend to grow as well as on natural substrata (oyster shell), and are moderately more exposed to predators on the puck shaped ash materials as produced for this study. Oysters grown for one to two years on coal ash do not accumulate heavy metals and generally are in good health as measured by several biological condition indexes

Cultivo do cogumelo Pleurotus sajor-caju em diferentes resíduos agrícolas Cultivation of the mushroom Pleurotus sajor-caju in different agricultural residues

Directory of Open Access Journals (Sweden)

Eustáquio Souza Dias

2003-12-01

Full Text Available Diferentes resíduos agrícolas disponíveis na região sul de Minas Gerais foram testados para o cultivo do cogumelo Pleurotus sajor-caju. Foram avaliados os seguintes substratos: palha de feijão pura (PFP, palha de milho pura (PMP, casca de café pura (CCP, palha de feijão enriquecida com 2% de calcário, 2% de gesso e 10% de farelo de trigo (PFE, palha de milho enriquecida (PME e casca de café enriquecida (CCE. Todos os substratos receberam 2% de inoculante e foram incubados a 24°C. Após a colonização, os sacos foram mantidos abertos em ambiente a 24°C e umidade a 80%. PFP, PFE e PME apresentaram os melhores resultados na produção de cogumelos, com uma eficiência biológica de 85,7; 81,4 e 83,4%, respectivamente. A palha de feijão foi considerada o melhor resíduo para a produção do cogumelo P. sajor-caju, porque apresentou a melhor eficiência biológica sem necessidade de enriquecimento.Several agricultural residues available in the South of Minas Gerais were tested for cultivation of the mushroom Pleurotus sajor-caju. The following substrates were investigated: Bean (BS, Corn (CS straws and Coffee husk (CH without nutrient supplementation and straws of bean (BSS, corn (CSS and coffee husk (CHS supplemented with 2% of CaCO3, 2% of gypsum and 10% of wheat flour. All the substrates were inoculated with 2% of spawn and incubated at 24ºC. After the fungi had colonized the substrate, the plastic bags were open and maintained at room temperature with 80% of humidity. BS, BSS and CSS showed higher mushroom production than the others, showing a biological efficiency of 85.7, 81.4 and 83.6% respectively. The beans straw (BS without nutrient supplementation was considered the best residue for the growth and cultivation of the mushroom Pleurotus sajor-caju. This substrate showed higher levels of biological efficiency than the others substrates analysed.

The oyster genome reveals stress adaptation and complexity of shell formation

DEFF Research Database (Denmark)

Zhang, Guofan; Fang, Xiaodong; Guo, Ximing

2012-01-01

The Pacific oyster Crassostrea gigas belongs to one of the most species-rich but genomically poorly explored phyla, the Mollusca. Here we report the sequencing and assembly of the oyster genome using short reads and a fosmid-pooling strategy, along with transcriptomes of development and stress re...

Screening of antagonistic bacteria against the green mold disease (Trichoderma harzianum Rifai of Grey Oyster Mushroom (Pleurotus pulmonarius (Fr. Quel.

Directory of Open Access Journals (Sweden)

Nualsri, C.

2005-01-01

Full Text Available A total of 174 strains of bacteria antagonistic against the green mold (Trichoderma harzianum, isolated from cultivating bags and fruiting bodies of the mushrooms, were screened for effects on mushroom mycelia and ability to control the green mold disease. Twenty-eight of them promoted the primodia formation of the Pleurotus pulmonarius mycelia on agar plates. Twenty-two isolates were selected and further tested in a mushroom house. Cell suspension of each isolate was prepared and sprayed onto the spawn surface of P. pulmonarius. Fifteen isolates shortened the times required from watering to 2nd and 3rd flushing and increased yield of the basidiocarps by 1.1-34.3% over 30 days. Six isolates of bacteria which showed an inhibitory effect against T. harzianum, enhanced primordia formation and increased yield of P. pulmonarius were selected and used for control testing in a cultivation house. The suspension of each isolate was sprayed onto the spawn surface immediately after exposure to the air in the mushroom house, followed by spore suspension of T. harzianum two days later. The number of infected bags was counted at 30 days after inoculation and the cumulative yield was compared after 60 days. The results showed that bacteria isolate B012-022 was highly effective in suppressing the green mold disease.Only 6.7% of the cultivating bags were found to be infected by T. harzianum when bacteria isolate B012-022 was applied. Cumulative yield obtained from 900 g of 94% sawdust + 5% rice bran + 1% Ca(OH2 was 300.0 g/bag after 60 days, 71.1% higher than the bags infected by the green mold and without bacterial spraying. Identification of the six bacterial isolates showed all to be Bacillus spp.

Interactions between Xylotrophic Mushrooms and Mycoparasitic Fungi in Dual-Culture Experiments

Directory of Open Access Journals (Sweden)

S.M. Badalyan

2004-04-01

Full Text Available Seventeen wood-decaying mushroom species (Coriolus versicolor, Flammulina velutipes, Ganoderma sp., Hypholoma fasciculare, H. sublateritium, Kühneromyces mutabilis, Lentinula edodes, Lentinus tigrinus, Pholiota alnicola, Ph. aurivella, Ph. destruens, Pleurotus cornucopiae, Pl. ostreatus, Polyporus subarcularius, Po. squamosus, Po. varius and Schizophyllum commune were paired with three Trichoderma species (T. harzianum, T. pseudokoningii, and T. viride and Clonostachys rosea in dual-culture experiments on an agar-based medium. Xylotrophic mushrooms and mycoparasitic fungi in general showed similar competitive ability; deadlock, or mutual inhibition after mycelial contact, was observed in 45.6% of pairings, while stable inhibition at a distance occurred in 4.4% of pairings. Replacement, or overgrowth of xylotrophic mushroom by a mycoparasitic fungus was observed in 29.4% of pairings; the opposite, overgrowth of the xylotrophic mushroom on the mycoparasitic fungus in 20.6%. of pairings. Of the xylotrophic mushrooms, Pl. ostreatus, Ganoderma sp., F. velutipes and H. fasciculare, showed the highest competitive ability against mycoparasitic fungi. Of the mycoparasitic fungi, T. harzianum showed the strongest competitive activity against xylotrophic mushrooms.

Species Profiles: Life Histories and Environmental Requirements of Coastal Fishes and Invertebrates (Pacific Northwest), Pacific Oyster

Science.gov (United States)

1988-09-01

are provided by Galtsoff (1964). Pho- The germinal vesicle is eccentricall, tographs of C. ia larval develop- located within the nucleolus . ment at vari... composition to cultures, and together with high tem- which oysters are exposed (Grave 1916; peratures may cause oyster mortality Morse 1944). (Lipovsky...setting in oyster. Bull. Jap. Soc. Sci. Fish. European and American oysters: 43(9): 1069-1076. response to surface chemistry versus waterborne

Growth, mortality and susceptibility of oyster Crassostrea spp. to Perkinsus spp. infection during on growing in northeast Brazil

Directory of Open Access Journals (Sweden)

Marcos Paiva Scardua

2017-11-01

Full Text Available Abstract Crassostrea rhizophorae and C. gasar oysters are cultivated in the northeast region. Perkinsus parasites infect bivalves, and their effects on oysters from tropical regions are poorly understood. This study evaluated the impact of Perkinsus infection on the productive traits of native oysters. Oysters were sampled bimonthly during 7 months, from July 2010 to February 2011, to evaluate growth rate, mortality and shell color patterns (white and dark-gray (n = 500, and to determine the prevalence and intensity of Perkinsus (n = 152. Perkinsus and Crassostrea species were determined using molecular tools. Results showed that most dark-gray (90%, n = 20 and white (67%, n = 18 oysters were C. gasar and C. rhizophorae, respectively. Oysters showed a high growth rate and moderate cumulative mortality (44%. C. gasar oysters grew better and showed lower mortality and lower incidence of Perkinsus compared to C. rhizophorae. The mean prevalence of Perkinsus was moderate (48%, but the infection intensity was light (2.2. Perkinsosis affected very small oysters (19.4 mm. In conclusion, native oysters, especially C. gasar, have a great potential for culture, mortality is not associated with perkinsosis, and the shell color of oysters can be used to improve selection for spats with better performance.

Post-mortem ecosystem engineering by oysters creates habitat for a rare marsh plant.

Science.gov (United States)

Guo, Hongyu; Pennings, Steven C

2012-11-01

Oysters are ecosystem engineers in marine ecosystems, but the functions of oyster shell deposits in intertidal salt marshes are not well understood. The annual plant Suaeda linearis is associated with oyster shell deposits in Georgia salt marshes. We hypothesized that oyster shell deposits promoted the distribution of Suaeda linearis by engineering soil conditions unfavorable to dominant salt marsh plants of the region (the shrub Borrichia frutescens, the rush Juncus roemerianus, and the grass Spartina alterniflora). We tested this hypothesis using common garden pot experiments and field transplant experiments. Suaeda linearis thrived in Borrichia frutescens stands in the absence of neighbors, but was suppressed by Borrichia frutescens in the with-neighbor treatment, suggesting that Suaeda linearis was excluded from Borrichia frutescens stands by interspecific competition. Suaeda linearis plants all died in Juncus roemerianus and Spartina alterniflora stands, regardless of neighbor treatments, indicating that Suaeda linearis is excluded from these habitats by physical stress (likely water-logging). In contrast, Borrichia frutescens, Juncus roemerianus, and Spartina alterniflora all performed poorly in Suaeda linearis stands regardless of neighbor treatments, probably due to physical stresses such as low soil water content and low organic matter content. Thus, oyster shell deposits play an important ecosystem engineering role in influencing salt marsh plant communities by providing a unique niche for Suaeda linearis, which otherwise would be rare or absent in salt marshes in the southeastern US. Since the success of Suaeda linearis is linked to the success of oysters, efforts to protect and restore oyster reefs may also benefit salt marsh plant communities.

Lignocellulose degradation by Pleurotus ostreatus in the presence of cadmium

Czech Academy of Sciences Publication Activity Database

Baldrian, Petr; Gabriel, Jiří

2003-01-01

Roč. 220, - (2003), s. 235-240 ISSN 0378-1097 R&D Projects: GA ČR GP204/02/P100 Institutional research plan: CEZ:AV0Z5020903 Keywords : cadmium * cellulose * hemicellulose Subject RIV: EE - Microbiology, Virology Impact factor: 1.932, year: 2003

Effect of bacteria on the degradation ability of Pleurotus ostreatus

Czech Academy of Sciences Publication Activity Database

Válková, H.; Novotný, Čeněk; Malachová, K.; Šlosarčíková, P.; Fojtík, J.

2017-01-01

Roč. 584, APR 15 (2017), s. 1114-1120 ISSN 0048-9697 Institutional support: RVO:61388971 Keywords : Fungal biofilms * Biodegradation * Anthraquinone dye Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 4.900, year: 2016

Improving biological efficiency of Oyster mushroom, Pleurotus ...

African Journals Online (AJOL)

International Journal of Biological and Chemical Sciences ... Yield improvement were observed in both pigeon pea and sunflower seed cake supplemented treatments with the highest mycelium vigor (91.65%) and biological ... Keywords: biological efficiency, compost, mycelium vigor, pigeon pea, sunflower seed cake

Economic Values Associated With Construction of Oyster Reefs by the Corps of Engineers

National Research Council Canada - National Science Library

Henderson, Jim

2003-01-01

.... That template includes a community model for the American oyster (Crassostrea virginica) which can be used to quantify the ecological benefits of an oyster reef in an ecosystem restoration project...

Oysters as vectors of marine aliens, with notes on four introduced ...

African Journals Online (AJOL)

Surveys of oyster farms in South Africa revealed four newly-recorded alien species: the black sea urchin, Tetrapygus niger, from Chile; the European flat oyster, Ostrea edulis (thought to be extinct since its intentional introduction in 1946); Montagu's crab, Xantho incisus, from the North Eastern Atlantic seas of Europe, and ...

Biochemical and volatile organic compound profile of European flat oyster (Ostrea edulis) and Pacific cupped oyster (Crassostrea gigas) cultivated in the Eastern Scheldt and Lake Grevelingen, the Netherlands

NARCIS (Netherlands)

Houcke, van Jasper; Medina, Isabel; Linssen, Jozef; Luten, Joop

2016-01-01

The aim of this study was to evaluate the effect of two important different geographical cultivation areas in the Netherlands (Eastern Scheldt and Lake Grevelingen) on the volatile organic compound (VOC) profile of European flat oyster (Ostrea edulis) and Pacific cupped oyster (Crassostrea

Effect of 60Co γ-irradiation on postharvest quality of pleurotus nebrodensis stored at 4 degree C

International Nuclear Information System (INIS)

Xiong Qiaoling; Huazhong Agriculture Univ., Wuhan; Xing Zengtao; Feng Zhiyong; Buswell, J.; Bian Yinbing

2007-01-01

The effect of γ-rays irradiation on the fresh-keeping of Pleurotus nebrodensis fruit bodies was reported in this paper. Fresh harvested fruit bodies of Pleurotus nebrodensis were irradiate at different doses levels (0.8-2.0 kGy) and stored for 22 days at 4 degree C. The fruit bodies treated with 1.2 kGy irradiation retained the highest soluble protein contents, and exhibited less postharvest softening throughout the storage period. Regression analysis plots of fruit body hardness versus soluble protein content were linear (t>0.05). Increases in mushroom cell permeability observed throughout the storage period were directly related to irradiation dose. Too higher dose(≥2.0 kGy) of irradiation will accelerate the nutrition degradation and rotting of the fruit bodies. (authors)

Ostreid herpesvirus in wild oysters from the Huelva coast (SW Spain).

Science.gov (United States)

López-Sanmartín, M; López-Fernández, J R; Cunha, M E; De la Herrán, R; Navas, J I

2016-08-09

This is the first report of ostreid herpesvirus 1 microvariant (OsHV-1 µVar) infecting natural oyster beds located in Huelva (SW Spain). The virus was detected in 3 oyster species present in the intertidal zone: Crassostrea gigas (Thunberg, 1793), C. angulata (Lamarck, 1819) and, for the first time, in Ostrea stentina Payraudeau, 1826. Oysters were identified by a specific polymerase chain reaction (PCR) and posterior restriction fragment length polymorphism (RFLP) analysis based on cytochrome oxidase I (COI) mitochondrial DNA. Results confirmed that C. angulata still remains the dominant oyster population in SW Spain despite the introduction of C. gigas for cultivation in the late 1970s, and its subsequent naturalization. C. angulata shows a higher haplotype diversity than C. gigas. OsHV-1 virus was detected by PCR with C2/C6 pair primers. Posterior RFLP analyses with the restriction enzyme MfeI were done in order to reveal the OsHV-1 µVar. Detections were confirmed by DNA sequencing, and infections were evidenced by in situ hybridization in C. gigas, C. angulata and O. stentina samples. The prevalence was similar among the 3 oyster species but varied between sampling locations, being higher in areas with greater harvesting activities. OsHV-1 µVar accounted for 93% of all OsHV-1 detected.

Epizootiology of Perkinsus sp. inCrassostrea gasar oysters in polyculture with shrimps in northeastern Brazil

Directory of Open Access Journals (Sweden)

Patricia Mirella da Silva

2016-03-01

Full Text Available Abstract Bivalve culture is of considerable economic and social interest in northeastern (NE Brazil. The polyculture is an alternative approach to traditional monoculture for reducing the environmental impact of shrimp farming and improving oyster culture. Perkinsus marinus andPerkinsus olseni were found infecting oysters in NE Brazil and can threaten oyster production. This study evaluatedPerkinsus spp. occurrence in Crassostrea gasar during all production stages. Oyster spats were produced in a hatchery and grown in shrimp ponds in Rio Grande do Norte state.Perkinsus spp. were surveyed by Ray’s fluid thioglycollate medium and confirmed by polymerase chain reaction. Prevalence and intensity of infection were determined in oysters until they reached 7 cm. Results showed that the broodstock was already infected by Perkinsus (60%, but the derived spats were Perkinsus-free. Oyster spats acquired Perkinsus infection when transferred to ponds. The prevalence gradually increased in the seven months following placement in ponds (73%, and then decreased to 17% by the tenth month. The infections were initially mild, but intensity increased at the final growth stage. In conclusion, it is possible to produce Perkinsus-free C. gasar oyster spats from infected broodstock, and their culture in shrimp ponds is feasible.

Satellite remote sensing reveals a positive impact of living oyster reefs on microalgal biofilm development

Directory of Open Access Journals (Sweden)

C. Echappé

2018-02-01

Full Text Available Satellite remote sensing (RS is routinely used for the large-scale monitoring of microphytobenthos (MPB biomass in intertidal mudflats and has greatly improved our knowledge of MPB spatio-temporal variability and its potential drivers. Processes operating on smaller scales however, such as the impact of benthic macrofauna on MPB development, to date remain underinvestigated. In this study, we analysed the influence of wild Crassostrea gigas oyster reefs on MPB biofilm development using multispectral RS. A 30-year time series (1985–2015 combining high-resolution (30 m Landsat and SPOT data was built in order to explore the relationship between C. gigas reefs and MPB spatial distribution and seasonal dynamics, using the normalized difference vegetation index (NDVI. Emphasis was placed on the analysis of a before–after control-impact (BACI experiment designed to assess the effect of oyster killing on the surrounding MPB biofilms. Our RS data reveal that the presence of oyster reefs positively affects MPB biofilm development. Analysis of the historical time series first showed the presence of persistent, highly concentrated MPB patches around oyster reefs. This observation was supported by the BACI experiment which showed that killing the oysters (while leaving the physical reef structure, i.e. oyster shells, intact negatively affected both MPB biofilm biomass and spatial stability around the reef. As such, our results are consistent with the hypothesis of nutrient input as an explanation for the MPB growth-promoting effect of oysters, whereby organic and inorganic matter released through oyster excretion and biodeposition stimulates MPB biomass accumulation. MPB also showed marked seasonal variations in biomass and patch shape, size and degree of aggregation around the oyster reefs. Seasonal variations in biomass, with higher NDVI during spring and autumn, were consistent with those observed on broader scales in other European mudflats. Our

Satellite remote sensing reveals a positive impact of living oyster reefs on microalgal biofilm development

Science.gov (United States)

Echappé, Caroline; Gernez, Pierre; Méléder, Vona; Jesus, Bruno; Cognie, Bruno; Decottignies, Priscilla; Sabbe, Koen; Barillé, Laurent

2018-02-01

Satellite remote sensing (RS) is routinely used for the large-scale monitoring of microphytobenthos (MPB) biomass in intertidal mudflats and has greatly improved our knowledge of MPB spatio-temporal variability and its potential drivers. Processes operating on smaller scales however, such as the impact of benthic macrofauna on MPB development, to date remain underinvestigated. In this study, we analysed the influence of wild Crassostrea gigas oyster reefs on MPB biofilm development using multispectral RS. A 30-year time series (1985-2015) combining high-resolution (30 m) Landsat and SPOT data was built in order to explore the relationship between C. gigas reefs and MPB spatial distribution and seasonal dynamics, using the normalized difference vegetation index (NDVI). Emphasis was placed on the analysis of a before-after control-impact (BACI) experiment designed to assess the effect of oyster killing on the surrounding MPB biofilms. Our RS data reveal that the presence of oyster reefs positively affects MPB biofilm development. Analysis of the historical time series first showed the presence of persistent, highly concentrated MPB patches around oyster reefs. This observation was supported by the BACI experiment which showed that killing the oysters (while leaving the physical reef structure, i.e. oyster shells, intact) negatively affected both MPB biofilm biomass and spatial stability around the reef. As such, our results are consistent with the hypothesis of nutrient input as an explanation for the MPB growth-promoting effect of oysters, whereby organic and inorganic matter released through oyster excretion and biodeposition stimulates MPB biomass accumulation. MPB also showed marked seasonal variations in biomass and patch shape, size and degree of aggregation around the oyster reefs. Seasonal variations in biomass, with higher NDVI during spring and autumn, were consistent with those observed on broader scales in other European mudflats. Our study provides the

Oysters as biomonitors of the apex barge oil spill

International Nuclear Information System (INIS)

Wade, T.L.; Jackson, T.J.; McDonald, T.J.; Wilkinson, D.L.; Brooks, J.M.

1993-01-01

The collision of the Greek tanker ship Shinoussa resulted in a spill of an estimated 692,000 gallons of catalytic feed stock oil into Galveston Bay on July 28, 1990. Oysters were collected from Galveston Bay Todds Dump (GBTD) 235 days previous to the spill and 6, 37, 132, and 495 days after the spill. Oysters were also collected from Galveston Bay Redfish Island (GBRI), a site known to be impacted by the spill, 37 and 110 days after the spill. The concentration of the 24 polynuclear aromatic hydrocarbons (PAH) measured for the National Oceanic and Atmospheric Administration's national status and trends program (NS ampersand T) site showed a sharp increase from about 100 ng/g to over 600 ng/g one week after the spill compared to concentrations 235 days previous to the spill. The concentration of the 24 NS ampersand T PAH in oysters from GBRI ranges from 400 to over 1000 ng/g. Soon after the spill the concentration of the 24 NS ampersand T PAH at Todds Dump decreased to levels not statistically different from prespill samples. However, analyses of alkylated and sulfur containing aromatic compounds indicate the oysters were still contaminated with Apex barge oil at least 37 and 110 days after the spill at GBTD and GBRI, respectively. Data from NS ampersand T sampling at GBTD more than a year after the spill (495 days) indicates the presence of alkylated aromatic hydrocarbons that may be from Apex barge oil still in the area. It appears that a sink of Apex barge oil (i.e., in sediments) may periodically be released by storms or other events into the ecosystem near GBTD. Therefore, bioavailable Apex barge oil is still present and may adversely affect oysters 495 days after the spill

Effects of High-Hydrostatic Pressure on Inactivation of Human Norovirus and Physical and Sensory Characteristics of Oysters.

Science.gov (United States)

Ye, Mu; Lingham, Talaysha; Huang, Yaoxin; Ozbay, Gulnihal; Ji, Lin; Karwe, Mukund; Chen, Haiqiang

2015-06-01

The purpose of the study was to determine the effect of high-hydrostatic pressure (HHP) on inactivation of human norovirus (HuNoV) in oysters and to evaluate organoleptic characteristics of oysters treated at pressure levels required for HuNoV inactivation. Genogroup I.1 (GI.1) or Genogroup II.4 (GII.4) HuNoV was inoculated into oysters and treated at 300 to 600 MPa at 25 and 0 °C for 2 min. After HHP, viral particles were extracted by porcine gastric mucin-conjugated magnetic beads (PGM-MBs) and viral RNA was quantified by real-time RT-PCR. Lower initial temperature (0 °C) significantly enhanced HHP inactivation of HuNoV compared to ambient temperature (25 °C; P oysters, respectively. HHP treatments did not significantly change color or texture of oyster tissue. A 1- to 5-scale hedonic sensory evaluation on appearance, aroma, color, and overall acceptability showed that pressure-treated oysters received significantly higher quality scores than the untreated control (P oysters. Oysters treated at 0 °C had slightly lower acceptability than the group treated at room temperature on day 1 (P 0.05). © 2015 Institute of Food Technologists®

Biochemical profile of oyster Crassostrea madrasensis and its nutritional attributes

Directory of Open Access Journals (Sweden)

K.K. Asha

2014-01-01

Full Text Available Oysters are highly esteemed sea food and considered a delicacy throughout the world. Yet this resource is not optimally utilised in several parts of the world. The aim of this study is to highlight its nutritional importance. Biochemical composition and nutritional attributes of oyster meat are discussed. Proximate composition, fatty acid and amino acid profiles and mineral content were determined in oysters (Crassostrea madrasensis. Moisture, protein, fat, carbohydrate and ash contents in the oyster were 82.64%, 9.41%, 3.25% 3.2% and 1.01%, respectively and it was rich in macro-minerals and trace elements especially selenium. Polyunsaturated fatty acids (PUFA were highest of the total lipids among which eicosapentaenoic acid, docosahexaenoic acid and linoleic acid were the prominent fatty acids. The n-3/n-6 index was high indicating a predominance of n-3 fatty acids in the species. Total amino acid content was 99.33 g/100 g crude protein, of which, essential amino acid lysine was the most abundant. Valine had the lowest essential amino acid score (EAAS (0.17 while threonine had the highest EAAS of 3.62. Chemical score was 17% and the lowest limiting amino acid was valine. Protein efficiency ratio, essential amino acid index and biological value of oyster were 3.92, 120.2 and 174.0, respectively which indicates that the protein is of superior quality. Data on biochemical composition, nutritional attributes and quality indices of C. madrasensis protein may prove important for future policies regarding exploitation of this species and for inducing favourable changes in consumer preferences.

Populations, not clones, are the unit of vibrio pathogenesis in naturally infected oysters.

Science.gov (United States)

Lemire, Astrid; Goudenège, David; Versigny, Typhaine; Petton, Bruno; Calteau, Alexandra; Labreuche, Yannick; Le Roux, Frédérique

2015-07-01

Disease in oysters has been steadily rising over the past decade, threatening the long-term survival of commercial and natural stocks. Our understanding and management of such diseases are of critical importance as aquaculture is an important aspect of dealing with the approaching worldwide food shortage. Although some bacteria of the Vibrio genus isolated from diseased oysters have been demonstrated to be pathogenic by experimental infection, direct causality has not been established. Little is known about the dynamics of how the bacterial population hosted by oysters changes during disease progression. Combining experimental ecology, a high-throughput infection assay and genome sequencing, we show that the onset of disease in oysters is associated with progressive replacement of diverse benign colonizers by members of a phylogenetically coherent virulent population. Although the virulent population is genetically diverse, all members of that population can cause disease. Comparative genomics across virulent and nonvirulent populations identified candidate virulence factors that were clustered in population-specific genomic regions. Genetic analyses revealed that one gene for a candidate virulent factor, a putative outer membrane protein, is necessary for infection of oysters. Finally, analyses of oyster mortality following experimental infection suggest that disease onset can be facilitated by the presence of nonvirulent strains. This is a new form of polymicrobial disease, in which nonpathogenic strains contribute to increase mortality.

Overcoming restoration paradigms: value of the historical record and metapopulation dynamics in native oyster restoration

Directory of Open Access Journals (Sweden)

Romuald N. Lipcius

2015-09-01

Full Text Available Restoration strategies for native oyster populations rely on multiple sources of information, which often conflict due to time- and space-varying patterns in abundance and distribution. For instance, strategies based on population connectivity and disease resistance can differ, and extant and historical records of abundance and distribution are often at odds, such that the optimal strategy is unclear and valuable restoration sites may be excluded from consideration. This was the case for the Lynnhaven River subestuary of lower Chesapeake Bay, which was deemed unsuitable for Eastern Oyster restoration based on physical conditions, disease challenge, and extant oyster abundance. Consequently, we (i evaluated previously unknown historical data from the 1800s, (ii quantified extant oyster recruitment and abundance, physical conditions, and disease presence on constructed restoration reefs and alternative substrates, and (iii assessed simulations from biophysical models to identify potential restoration sites in the metapopulation. The collective data distinguished numerous restoration sites (i in the polyhaline zone (salinity 18.4-22.2 where disease resistance is evolving, (ii where oysters were abundant in the late 1800s-early 1900s, (iii of recent high recruitment, abundance and survival, despite consistent and elevated disease challenge, and (iv interconnected as a metapopulation via larval dispersal. Moreover, a network of constructed restoration reefs met size structure, abundance and biomass standards of restoration success. These findings demonstrate that assumptions about the suitability of sites for oyster restoration based on individual processes can be severely flawed, and that in-depth examination of multiple processes and sources of information are required for oyster reef restoration plans to maximize success. We use these findings and previous information to recommend a strategy for successful restoration of subtidal oyster reefs

Gear and survey efficiency of patent tongs for oyster populations on restoration reefs.

Directory of Open Access Journals (Sweden)

David M Schulte

Full Text Available Surveys of restored oyster reefs need to produce accurate population estimates to assess the efficacy of restoration. Due to the complex structure of subtidal oyster reefs, one effective and efficient means to sample is by patent tongs, rather than SCUBA, dredges, or bottom cores. Restored reefs vary in relief and oyster density, either of which could affect survey efficiency. This study is the first to evaluate gear (the first full grab and survey (which includes selecting a specific half portion of the first grab for further processing efficiencies of hand-operated patent tongs as a function of reef height and oyster density on subtidal restoration reefs. In the Great Wicomico River, a tributary of lower Chesapeake Bay, restored reefs of high- and low-relief (25-45 cm, and 8-12 cm, respectively were constructed throughout the river as the first large-scale oyster sanctuary reef restoration effort (sanctuary acreage > 20 ha at one site in Chesapeake Bay. We designed a metal frame to guide a non-hydraulic mechanical patent tong repeatedly into the same plot on a restored reef until all oysters within the grab area were captured. Full capture was verified by an underwater remotely-operated vehicle. Samples (n = 19 were taken on nine different reefs, including five low- (n = 8 and four high-relief reefs (n = 11, over a two-year period. The gear efficiency of the patent tong was estimated to be 76% (± 5% standard error, whereas survey efficiency increased to 81% (± 10% due to processing. Neither efficiency differed significantly between young-of-the-year oysters (spat and adults, high- and low-relief reefs, or years. As this type of patent tong is a common and cost-effective tool to evaluate oyster restoration projects as well as population density on fished habitat, knowing the gear and survey efficiencies allows for accurate and precise population estimates.