WorldWideScience

Sample records for pleurotus ostreatus oyster

  1. Effect of oyster mushroom ( Pleurotus ostreatus ) mycelia on ...

    African Journals Online (AJOL)

    Effect of oyster mushroom ( Pleurotus ostreatus ) mycelia on petroleum ... of chains of hydrocarbon in a petroleum-hydrocarbon-contaminated substrate over time. ... Keywords: Mycoremediation, Mycelia, Contaminated Soil, Oyster Mushroom ...

  2. Antinociceptive effect of Pleurotus ostreatus (Oyster Mushroom ...

    African Journals Online (AJOL)

    PROF HORSFALL

    pattern by comparing it with a standard drug and a control using the hot water based flick tail test. Thirty five ... groups two, three and four were treated with 100, 200 and 400 mg/kg of Pleurotus ostreatus aqueous ... Abnormalities in the nervous system may also cause ... During this period, they were covered with wire gauze,.

  3. Antioxidant activity of the oyster mushroom, Pleurotus ostreatus, on CCl(4)-induced liver injury in rats.

    Science.gov (United States)

    Jayakumar, T; Ramesh, E; Geraldine, P

    2006-12-01

    This study was undertaken to investigate the putative antioxidant activity of the oyster mushroom Pleurotus ostreatus on CCl(4)-induced liver damage in male Wistar rats. Intraperitoneal administration of CCl(4) (2ml/kg) to rats for 4 days resulted in significantly elevated (pSALP) compared to controls. In the liver, significantly elevated levels (pSALP levels reverted to near normal, while the hepatic concentration of GSH, CAT, SOD and Gpx were significantly increased (p<0.05) and that of MDA significantly (p<0.05) lowered, when compared to CCl(4)-exposed untreated rats. Histopathological studies confirmed the hepatoprotective effect conferred by the extract of P. ostreatus. These results suggest that an extract of P. ostreatus is able to significantly alleviate the hepatotoxicity induced by CCl(4) in the rat.

  4. [The composition of volatile components of cepe (Boletus edulis) and oyster mushrooms (Pleurotus ostreatus)].

    Science.gov (United States)

    Misharina, T A; Mukhutdinova, S M; Zharikova, G G; Terenina, M B; Krikunova, N I

    2009-01-01

    The composition of aroma compounds in cooked and canned cepe (Boletus edulis) and in cooked oyster mushrooms (Pleurotus ostreatus) is studied using capillary gas chromatography and chromatography-mass spectrometry. It is found that unsaturated alcohols and ketones containing eight atoms of carbon determine the aroma of raw mushrooms and take part in the formation of the aroma of cooked mushrooms as well. The content of these compounds was the highest in canned cepes. In oyster mushrooms, the concentration of these alcohols and ketones was lower in comparison with cepes. The content of aliphatic and aromatic aldehydes was much higher in oyster mushrooms. Volatile aliphatic and heterocyclic Maillard reaction products and isomeric octenols and octenones formed the aroma of cooked and canned mushrooms.

  5. Utilization following of bioremediation attributes using oyster mushrooms - Pleurotus ostreatus

    International Nuclear Information System (INIS)

    Galanda, D.; Matel, L.

    2007-01-01

    The mushrooms are not only rich food products, but also a specific component of forest biogeocenoses playing an important role in their functioning, including radionuclide migration. The reason why fungi work as such good indicators for radioactivity and pollution in general is connected to their structure. Using absorption to obtain their nutrition, fungi lack water-conducting organs like stems and roots. They absorb moisture and nutrients from the soil background through surface cells. Dissolved or airborne materials, which include pollutants, move freely through the compartments of hyphae. What is more, radiation released during nuclear testing or accidents is absorbed, especially in areas where it rained heavily shortly after the incident. The present work is devoted to an estimation of the transfer coefficient between reared oyster mushrooms and their support die, which was injected with known activity of 241 Am and 242 Pu. After 2 months when we get the reared mushrooms of cane oyster mushrooms were dried and prepared by liquid extraction with Aliquat 336. The samples were measured by alpha-spectrometry. The results of activity 241 Am and 242 Pu in the mushrooms body and residual activity in the support was detected and calculated (authors)

  6. Maize Residue as a Viable Substrate for Farm Scale Cultivation of Oyster Mushroom (Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Abena O. Adjapong

    2015-01-01

    Full Text Available In the search for alternatives to sawdust as growing media in commercial mushroom cultivation, three organic substrates obtainable as crop residue, maize husk, maize cob, and maize stalk, with each being supplemented with rice bran, were evaluated as growth media for the oyster mushroom, Pleurotus ostreatus (Kummer. For the tested alternatives to sawdust, the harvested weight of fruiting bodies that sprouted on a kilogram maize husk media per crop (32.99 g was the highest. Sawdust media supported significantly (P<0.001 heavier fruiting bodies (42.18 than the maize residues. The peak mushroom harvests for the various substrates were obtained between the first and seventh fruiting body flushes. The biological efficiency of the substrates, which measured usable nutrients indicated that maize stalk supplemented with rice bran, was 39% compared to that of the sawdust media (60%. The maize husk media and the maize cob media had biological efficiencies of 32% and 9.5%, respectively. These results indicate that two of the tested growing media (maize stalk or husk produced mushrooms with yield characteristics that were comparable to the well-used sawdust in the cultivation of oyster mushrooms. The environmental and economic parameters involved in the use and carting of sawdust make these on-farm crop residues a viable alternative for mushroom cultivation in especially nonforest zones of Ghana.

  7. Use of Irradiation to Extend the Shelf Life of Dried White Oyster Mushroom (Pleurotus ostreatus)

    International Nuclear Information System (INIS)

    Idrus Kadir

    2010-01-01

    Irradiation is an alternative technology to extend the shelf life of food-stuffs. White oyster mushroom (Pleurotus ostreatus) which is a perishable food stuff having a short shelf life. Effects of gamma irradiation at the dose of 5 kGy on the quality of dried white oyster mushroom during storage was observed. The objective of the experiment was to improve the hygienic quality and to extend the shelf life of dried white oyster mushroom using irradiation technology. Fresh mushroom was cleaned, sorted, washed, and drained. The mushroom was then dried in two ways, namely: sun drying method and electrical oven drying method. Dried mushroom was vacuum packed in polypropylene (PP) pouch then irradiated at a of dose 5 kGy and an unirradiated control was also applied. The vacuum packed samples was stored at low temperature (18-20 o C) with a relative humidity (RH) of 65-70% and observed periodically every month up to 3 months of storage. The samples were analyzed according to the following parameters i.e, : total bacterial count, total mould and yeast count, moisture content, pH, a w , contents of protein, fat, carbohydrate, carotenoid and organoleptic properties, respectively. The results showed that irradiation at the dose of 5 kGy could eliminate significantly microbial growth 2 log cycle in the samples, while there were no changes in physico-chemical and organoleptic properties up to 3 months of storage, while control samples were still acceptable only up to 2 months of storage. (author)

  8. Evaluation of the proximate quality of the combination of Tuna (Thunnus albacares) and white oyster mushroom (Pleurotus ostreatus) nuggets

    Science.gov (United States)

    Yufidasari, H. S.; Prihanto, A. A.; Nurdiani, R.; Jaziri, A. A.

    2018-04-01

    Nugget is a processed meat product which has great market demand but need variations to increase its nutritional content. Tuna is rich in omega-3 protein, vitamins, and minerals. White oyster mushrooms have high nutritional content which are about 23-33% protein, 36-68 % carbohydrates and 12-22 % amino acids. The purpose of this research is to evaluate the chemical quality of Tuna nugget (Thunnus albacores) with combination of white oyster mushroom (Pleurotus ostreatus). Complete Randomized Design (RAL) with parameters of Tuna and white oyster mushroom formulation, TJ1 (70 % Tuna: 30 % white oyster mushroom), TJ2 (50 % Tuna: 50 % white oyster mushroom), TJ3 (30 % Tuna: 70 % white oyster mushroom), and Control or K Treatment (100 % Tuna) is used. Results of Tuna nuggets with white oyster mushroom combination showed the highest value of water content in TJ3 50.14 %, protein K 19.6 %, fat TJ3 22.98 %, ash K 3.99 % and 2.47 % crude fiber. From these results, there is a need for further research on fat, ash and coarse fiber content that is used in the manufacture of fish nuggets combined with oyster mushrooms because it failed to meet Indonesian National Standard (SNI).

  9. Cultivation of oyster mushroom Pleurotus ostreatus on date-palm leaves mixed with other agro-wastes in Saudi Arabia.

    Science.gov (United States)

    Alananbeh, Kholoud M; Bouqellah, Nahla A; Al Kaff, Nadia S

    2014-12-01

    Promoting the use of agricultural waste is one of the newly prepared water and environment friendly agriculture strategies in the Kingdom of Saudi Arabia (KSA). The objective of this research was to study the efficiency of cultivating oyster mushroom (Pleurotus ostreatus) on date palm wastes mixed with other agricultural wastes available in KSA. Four agricultural wastes were mixed with date palm leaves at different ratios, with two supplements and three spawn rates were used. Wheat straw mixed with date palm at ratio of 25 (date palm): 75 (agro-waste) showed the best results in most of the parameters measured. Corn meal was superior over wheat bran as a supplement in all treatments. Parameter values increased with the increase of the spawn rate of P. ostreatus. Treatments with date palm leave wastes contained higher carbohydrates and fibers. No significant differences were found among the fruiting bodies produced on the different agro-wastes studied for the different proximates analyzed. Analyses of metal concentration showed that potassium was the highest in all the treatments tested followed by Na, Mg, Ca, and Zn. This is the first study that reported the success of growing oyster mushroom on date palm leaf wastes mixed with other agro-wastes obtainable in KSA.

  10. Bioavailability and Digestibility of Nutrients from the Dried Oyster Culinary-Medicinal Mushroom, Pleurotus ostreatus (Agaricomycetes): In Vivo Experiments.

    Science.gov (United States)

    Regula, Julita; Suliburska, Joanna; Siwulski, Marek

    2016-01-01

    There is a limited number of publications on the bioavailability and digestibility of nutrients contained in macrofungi. The aim of this study was to assess the bioavailability and digestibility of macronutrients using in vivo experiments on laboratory animals. The experiments were conducted with the commercial oyster mushroom Pleurotus ostreatus. Semisynthetic diets were prepared based on the modified AIN-93M diet and were supplemented with 4% and 8% mushroom powder. Between days 4 and 13, apparent digestibility indexes were determined for all animals using the conventional balance method. The hematological indexes-that is, hemoglobin, hematocrit, red blood cells, white blood cells, mean corpuscular volume, mean corpuscular hemoglobin, and mean corpuscular hemoglobin concentration-were determined using a Sysmex K-1000 hematological analyzer. Feeding rats with semisynthetic diets supplemented with dried oyster mushroom had no negative effect on body weight gain or feeding efficiency, expressed in the amount of body weight gain per unit of metabolic energy uptake. Introduction of dried oyster mushroom to the diet resulted in reduced digestibility of the diet and the protein and fat it contained, as well as decreased apparent energy availability. These changes were dependent on the volume of dried mushroom added to the semisynthetic diet. The addition of dried oyster mushroom to the semisynthetic diet considerably reduced passage time through the alimentary tract of rats.

  11. Production of bio-fertilizer from microwave vacuum pyrolysis of waste palm shell for cultivation of oyster mushroom (Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Nam Wai Lun

    2017-01-01

    Full Text Available Microwave vacuum pyrolysis of waste palm shell (WPS was performed to produce biochar, which was then tested as bio-fertilizer in growing Oyster mushroom (Pleurotus ostreatus. The pyrolysis approach generated a biochar containing a highly porous structure with a high BET surface area (up to 1250 m2/g and a low moisture content (≤ 10 wt%, exhibiting desirable adsorption properties to be used as bio-fertilizer since it can act as a housing that provides many sites on which living microorganisms (mycelium or plant-growth promoting bacteria and organic nutrients can be attached or adsorbed onto. This could in turn stimulate plant growth by increasing the availability and supply of nutrients to the targeted host plant. The results from growing Oyster mushroom using the biochar record an impressive growth rate and a monthly production of up to about 550 g of mushroom. The shorter time for mycelium growth on whole baglog (30 days and the highest yield of Oyster mushroom (550 g was obtained from the cultivation medium added with 20 g of biochar. Our results demonstrate that the biochar-based bio-fertilizer produce from microwave vacuum pyrolysis of WPS show exceptional promise as an alternative growing substrate for mushroom cultivation.

  12. Production of bio-fertilizer from microwave vacuum pyrolysis of waste palm shell for cultivation of oyster mushroom (Pleurotus ostreatus)

    Science.gov (United States)

    Lun Nam, Wai; Huan Su, Man; Phang, Xue Yee; Chong, Min Yee; Keey Liew, Rock; Ma, Nyuk Ling; Lam, Su Shiung

    2017-11-01

    Microwave vacuum pyrolysis of waste palm shell (WPS) was performed to produce biochar, which was then tested as bio-fertilizer in growing Oyster mushroom (Pleurotus ostreatus). The pyrolysis approach generated a biochar containing a highly porous structure with a high BET surface area (up to 1250 m2/g) and a low moisture content (≤ 10 wt%), exhibiting desirable adsorption properties to be used as bio-fertilizer since it can act as a housing that provides many sites on which living microorganisms (mycelium or plant-growth promoting bacteria) and organic nutrients can be attached or adsorbed onto. This could in turn stimulate plant growth by increasing the availability and supply of nutrients to the targeted host plant. The results from growing Oyster mushroom using the biochar record an impressive growth rate and a monthly production of up to about 550 g of mushroom. The shorter time for mycelium growth on whole baglog (30 days) and the highest yield of Oyster mushroom (550 g) was obtained from the cultivation medium added with 20 g of biochar. Our results demonstrate that the biochar-based bio-fertilizer produce from microwave vacuum pyrolysis of WPS show exceptional promise as an alternative growing substrate for mushroom cultivation.

  13. Statistical optimization of ultraviolet irradiate conditions for vitamin D₂ synthesis in oyster mushrooms (Pleurotus ostreatus using response surface methodology.

    Directory of Open Access Journals (Sweden)

    Wei-Jie Wu

    Full Text Available Response surface methodology (RSM was used to determine the optimum vitamin D2 synthesis conditions in oyster mushrooms (Pleurotus ostreatus. Ultraviolet B (UV-B was selected as the most efficient irradiation source for the preliminary experiment, in addition to the levels of three independent variables, which included ambient temperature (25-45°C, exposure time (40-120 min, and irradiation intensity (0.6-1.2 W/m2. The statistical analysis indicated that, for the range which was studied, irradiation intensity was the most critical factor that affected vitamin D2 synthesis in oyster mushrooms. Under optimal conditions (ambient temperature of 28.16°C, UV-B intensity of 1.14 W/m2, and exposure time of 94.28 min, the experimental vitamin D2 content of 239.67 µg/g (dry weight was in very good agreement with the predicted value of 245.49 µg/g, which verified the practicability of this strategy. Compared to fresh mushrooms, the lyophilized mushroom powder can synthesize remarkably higher level of vitamin D2 (498.10 µg/g within much shorter UV-B exposure time (10 min, and thus should receive attention from the food processing industry.

  14. DNA marking of some quantitative trait loci in the cultivated edible mushroom Pleurotus ostreatus (Fr.) Kumm

    NARCIS (Netherlands)

    Sivolapova, A.B.; Shnyreva, A.V.; Sonnenberg, A.S.M.; Baars, J.J.P.

    2012-01-01

    Fungi of the genus Pleurotus, in particular, species Pleurotus ostreatus (common oyster mushroom) are among most cultivated fungi in the world. Due to intense rates of development of studies in this field, efficient breeding programs are highly required in the search for new P. ostreatus strains.

  15. Immunomodulating and Antiprotozoal Effects of Different Extracts of the Oyster Culinary-Medicinal Mushroom Pleurotus ostreatus (Higher Basidiomycetes) Against Coccidiosis in Broiler.

    Science.gov (United States)

    Ullah, Muhammad Irfan; Akhtar, Masood; Iqbal, Zafar; Shahid, Muhammad; Awais, Mian Muhammad

    2015-01-01

    The culinary-medicinal oyster mushroom Pleurotus ostreatus, procured from local sources, was processed for hot water and methanolic extraction. Extracts obtained were subjected to proximate analysis to determine the amount of crude protein, crude fiber, ash, ether, and nitrogen-free extracts. These extracts were evaluated for immunomodulating and antiprotozoal effects against coccidiosis in a broiler. Cellular immune investigation revealed significantly higher (P 0.05) findings were observed in investigations of lymphoid organs. Antiprotozoal studies revealed a significantly higher (P < 0.05) percentage of protection against coccidiosis in groups administered P. ostreatus extracts when compared with controls. Moreover, lesion scoring and oocysts per gram of droppings observed in the control group were significantly higher (P < 0.05) compared with those in groups administered hot water and methanolic extracts of P. ostreatus. Results concluded that hot water and methanolic extracts of P. ostreatus had strong immune-enhancing activities. Further, these extracts also had excellent antiprotozoal activities against coccidiosis in a broiler.

  16. Growth and yield performance of Pleurotus ostreatus (Jacq. Fr.) Kumm (oyster mushroom) on different substrates.

    Science.gov (United States)

    Girmay, Zenebe; Gorems, Weldesemayat; Birhanu, Getachew; Zewdie, Solomon

    2016-12-01

    Mushroom cultivation is reported as an economically viable bio-technology process for conversion of various lignocellulosic wastes. Given the lack of technology know-how on the cultivation of mushroom, this study was conducted in Wondo Genet College of Forestry and Natural Resource, with the aim to assess the suitability of selected substrates (agricultural and/or forest wastes) for oyster mushroom cultivation. Accordingly, four substrates (cotton seed, paper waste, wheat straw, and sawdust) were tested for their efficacy in oyster mushroom production. Pure culture of oyster mushroom was obtained from Mycology laboratory, Department of Plant Biology and Biodiversity Management, Addis Ababa University. The pure culture was inoculated on potato dextrose agar for spawn preparation. Then, the spawn containing sorghum was inoculated with the fungal culture for the formation of fruiting bodies on the agricultural wastes. The oyster mushroom cultivation was undertaken under aseptic conditions, and the growth and development of mushroom were monitored daily. Results of the study revealed that oyster mushroom can grow on cotton seed, paper waste, sawdust and wheat straw, with varying growth performances. The highest biological and economic yield, as well as the highest percentage of biological efficiency of oyster mushroom was obtained from cotton seed, while the least was from sawdust. The study recommends cotton seed, followed by paper waste as suitable substrates for the cultivation of oyster mushroom. It also suggests that there is a need for further investigation on various aspects of oyster mushroom cultivation in Ethiopia to promote the industry.

  17. Rice straw addition as sawdust substitution in oyster mushroom (Pleurotus ostreatus) planted media

    Science.gov (United States)

    Utami, Christine Pamardining; Susilawati, Puspita Ratna

    2017-08-01

    Oyster mushroom is favorite by the people because of the high nutrients. The oyster mushroom cultivation usually using sawdust. The availability of sawdust become difficult to find. It makes difficulties of mushroom cultivation. Rice straw as an agricultural waste can be used as planted media of oyster mushroom because they contain much nutrition needed to the mushroom growth. The aims of this research were to analysis the influence of rice straw addition in a baglog as planted media and to analysis the concentration of rice straw addition which can substitute sawdust in planted media of oyster mushroom. This research used 4 treatment of sawdust and rice straw ratio K = 75 % : 0 %, P1 = 60 % : 15 %, P2 = 40 % : 35 %, P3 = 15 % : 60 %. The same material composition of all baglog was bran 20%, chalk 5%, and water 70%. The parameters used in this research were wet weight, dry weight, moisture content and number of the mushroom fruit body. Data analysis was used ANOVA test with 1 factorial. The results of this research based on statistical analysis showed that there was no influence of rice straw addition in a planted media on the oyster mushroomgrowth. 15% : 60% was the concentrationof rice straw additionwhich can substitute the sawdust in planted media of oyster mushroom.

  18. Growth and yield performance of Pleurotus ostreatus (Jacq. Fr.) Kumm (oyster mushroom) on different substrates

    OpenAIRE

    Girmay, Zenebe; Gorems, Weldesemayat; Birhanu, Getachew; Zewdie, Solomon

    2016-01-01

    Mushroom cultivation is reported as an economically viable bio-technology process for conversion of various lignocellulosic wastes. Given the lack of technology know-how on the cultivation of mushroom, this study was conducted in Wondo Genet College of Forestry and Natural Resource, with the aim to assess the suitability of selected substrates (agricultural and/or forest wastes) for oyster mushroom cultivation. Accordingly, four substrates (cotton seed, paper waste, wheat straw, and sawdust) ...

  19. Risk of alpha radionuclides presence in cultivating substrate of oyster mushrooms - Pleurotus ostreatus

    International Nuclear Information System (INIS)

    Galanda, D.

    2006-01-01

    The mushrooms are not only rich food products, but also a specific component of forest biogeocenoses playing an important role in their functioning, including radionuclide migration. The reason why fungi work as such good indicators for radioactivity and pollution in general is connected to their structure. Using absorption to obtain their nutrition, fungi lack water-conducting organs like stems and roots. They absorb moisture and nutrients from the soil background through surface cells. Dissolved or airborne materials, which include pollutants, move freely through the compartments of hyphae. What is more, radiation released during nuclear testing or accidents is absorbed, especially in areas where it rained heavily shortly after the incident. The present work is devoted to an estimation of the transfer coefficient between reared oyster mushrooms and their support die, which was injected with known activity of 241 Am and 242 Pu. After 2 months when we get the reared mushrooms of cane oyster mushrooms were dried and prepared by liquid extraction with Aliquat 336. The samples were measured by ? -spectrometry. The results of activity 241 Am and 242 Pu in the mushrooms body and residual activity in the support was detected and calculated. (author)

  20. Optimization of substrate preparation for oyster mushroom (Pleurotus ostreatus) cultivation by studying different raw materials and substrate preparation conditions (composting: phases I and II).

    Science.gov (United States)

    Vieira, Fabrício Rocha; de Andrade, Meire Cristina Nogueira

    2016-11-01

    In recent years, oyster mushroom (Pleurotus ostreatus) has become one of the most cultivated mushrooms in the world, mainly in Brazil. Among many factors involved in a mushroom production, substrate preparation is the most critical step, which can be influenced by composting management techniques. Looking forward to optimizing the substrate preparation process, were tested different composting conditions (7 and 14 days of composting with or without conditioning), potential raw materials (decumbens grass, brizantha grass and sugarcane straw) and nitrogen supplementation (with or without wheat bran) on oyster mushroom yield and biological efficiency (BE). The substrate composted for 7 days with conditioning showed higher yield and biological efficiency of mushroom (24.04 and 100.54 %, respectively). Substrates without conditioning (7 and 14 days of composting) showed smaller mushroom yield and biological efficiency. Among the raw materials tested, brizantha grass showed higher mushroom yield followed by decumbens grass, sugarcane straw and wheat straw (28.5, 24.32, 23.5 and 19.27 %, respectively). Brizantha grass also showed higher biological efficiency followed by sugarcane straw, decumbens grass and wheat straw (123.95, 103.70, 96.90 and 86.44 %, respectively). Supplementation with wheat bran improved yield and biological efficiency in all substrate formulations tested; thus, oyster mushroom yield and biological efficiency were influenced by substrate formulation (raw materials), supplementation and composting conditions.

  1. DESIGN OF OYSTER (PLEUROTUS OSTREATUS PRODUCTION UNIT TAKING INTO ACCOUNT ITS AGROTECHNIC OF GROWIGN AND QUALITY AND QUANTITY OF ITS PRODUCTION

    Directory of Open Access Journals (Sweden)

    Marcel Golian

    2015-02-01

    Full Text Available According to influence of population increasing followed by agricultural soils decreasing there is noticed a necessity of individual food commodities production intensification. There is also needed to think about some new unconventional and alternative sort of food-stuff. An edible mushroom growing is one of the relatively new agricultural branches, whereby on a large scale there are grown species which belong to saprophytic group. The aim of task was the building – technological and equipment – technological proposal of oyster (Pleurotus ostreatus, Jacq. P. Kumm production unit with taking account to its specific agro technical requirements and valid legislative. In the next part of task there were evaluated and compared qualitative and quantitative parameters of sporocarps from two variants which were collected in the first growth wave and accuracy of the proposed oyster production unit. In case of variant A there were used sacks with substrates, which have been exposed to cold shock by 6°C temperature for 4 days and in variant B were used substrates without cold shock. According to reached results the cold shock had almost neither influence on production quantity. There was found out an important fact that crop height from first growth wave wasn´t identical with well-known literature sources. The low crop is connected with high CO2 content in oyster production unit room, according to our opinion. Other equipment aimed to air humidity regulation, air temperature regulation and room lights was designed correctly.

  2. Water-Soluble Polysaccharide Extracts from the Oyster Culinary-Medicinal Mushroom Pleurotus ostreatus (Agaricomycetes) with HMGCR Inhibitory Activity.

    Science.gov (United States)

    Gil-Ramirez, Alicia; Smiderle, Fhernanda R; Morales, Diego; Govers, Coen; Synytsya, Andriy; Wichers, Harry J; Iacomini, Marcello; Soler-Rivas, Cristina

    2017-01-01

    Water extracts from Pleurotus ostreatus containing no statins showed 3-hydroxy-3-methyl-glutaryl CoA reductase (HMGCR) inhibitory activity (in vitro) that might be due to specific water-soluble polysaccharides (WSPs); when isolated and deproteinized, increasing concentrations of the WSP extract induced higher inhibition. The WSP extract contained mainly β-glucans, mannogalactans, and glycogen (e.g., α-glucans), although derivatives or fragments with lower molecular weights (between 14 and 3.5 kDa) were present and were able to induce the inhibitory activity. The extract contained more β-(1→3)-glucans than β-(11→3),(11→6)-glucans, and they partially survived digestion and managed to pass through Caco2 cell monolayers to the lower compartment after in vitro digestion and transport experiments. The WSP might also modulate Caco2 membrane integrity.

  3. Mutation Induction In White Oyster Mushroom (Pleurotus Ostreatus) Using GAMMA Irradiation And Analyzing Genetic Diversity Of Induced Mutants By RAPD.PCR

    International Nuclear Information System (INIS)

    Mohammed, H.M; Soliman, S.S.A; Shawky, A.S.H; Mahgoub, E.M.I

    2013-01-01

    The present study aimed to understand the effect of gamma rays on three strains of white oyster mushroom Pleurotus ostreatus and induction of new benefit mutants. Five different doses, i.e., 0.25,0.5,0.75, and 1.00 KGy of gamma rays were used. Twelve morphological criteria were measured. The result confirmed the existence of different response of three strains to different doses of radiation. The 21 strain as a control, the first flush was misshapen, but the second flush gave normal fruit, while mutant Po 21-3 gave excellent growth performance for the shape, colour, fruit diameter and stem length, while slightly decrease in wet and dry total matter per bag and flushes numbers were found.The po 21-2 mutant considered as important mutant because slightly increased in wet and dry total matter than the control, and had short stem length. This mutant Po 21 -2 gave spores, while the control was sporeless. Control of strain 22 possessed good performance for fruit characterization but it forms fruits less than its primordial it formed (semi maturation less strain) per bag, While po 22-l and Po 22-2 appeared good performance, in addition high yielding as wet and dry total matter and faster flushing. The control of strain 66 had a good growth performance, and the four mutants for this strain is very good too they had excellent growth performance; Po 66-1 and Po 66-3 mutants had significant and highly significant values for wet matter than the control (21.04, 21.64 and 12.27) for (Po 66-1, Po 66-4, control). As well as more important criteria there were taken as short fruit stem length and fruit number/bag. These results confirmed the important of Po 66-4 followed by po 66-1 in next breeding and production programs for white oyster mushroom (Pleurotus ostreatus).the RAPD PCR results showed the oligonucleotide OPB-10, OPA-05 and OPC-02 presented the highest percentage of RAPD polymorphism (80⁒, 80⁒, 66.6⁒). The pattern obtained with OPB-10 oligonucleotide for strains

  4. DEHYDRATION OF EDIBLE MUSHROOMS (PLEUROTUS OSTREATUS)

    OpenAIRE

    Salas de la Torre, N.; Bazán, D.; Osorio, A.; Cornejo, O.; Carrero, E.

    2014-01-01

    The edible mushroom Pleurotus ostreatus have been subjected to thermal, chemical and thermal-chemical treatment. The results show that the chemical treatment produces a more effective enzymatic inactivation compared to the other two treatments. Also, the experimental study of fungi dehydration carried out at 55 ° C reveals that the critical moisture content is 10.4 kg water / kg dry solids, the equilibrium moisture is 0.22 kg water / kg of solid . Los hongos comestibles Pleurotus ostreatus...

  5. Cultivation of Pleurotus ostreatus and other edible mushrooms.

    Science.gov (United States)

    Sánchez, Carmen

    2010-02-01

    Pleurotus ostreatus is the second most cultivated edible mushroom worldwide after Agaricus bisporus. It has economic and ecological values and medicinal properties. Mushroom culture has moved toward diversification with the production of other mushrooms. Edible mushrooms are able to colonize and degrade a large variety of lignocellulosic substrates and other wastes which are produced primarily through the activities of the agricultural, forest, and food-processing industries. Particularly, P. ostreatus requires a shorter growth time in comparison to other edible mushrooms. The substrate used for their cultivation does not require sterilization, only pasteurization, which is less expensive. Growing oyster mushrooms convert a high percentage of the substrate to fruiting bodies, increasing profitability. P. ostreatus demands few environmental controls, and their fruiting bodies are not often attacked by diseases and pests, and they can be cultivated in a simple and cheap way. All this makes P. ostreatus cultivation an excellent alternative for production of mushrooms when compared to other mushrooms.

  6. Food, medicinal and environmental values of mushrooms Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    O. M. Alekseenko

    2010-07-01

    Full Text Available We present the literature review describing food, medicinal and ecological properties of the fungus Pleurotus ostreatus (oyster mushroom. It is shown that the mushroom is adequate foodstuff for human beings. It provides with proteins, carbohydrates, fats, vitamins and mineral salts. Protein of the oyster mushrooms’ mycothallus contains 18 amino acids, eight of which were essential (isoleucine, leucine, lysine, methionine, phenylalanine, tryptophan, threonine, and valine. Therapeutic value of the mushroom is characterised by a content of water-soluble (thiamine B1, riboflavin B2, niacin, B5, PP, pyridoxine B6, biotin B7, ascorbic and pantothenic acid and liposoluble (calciferol, ergosterol, tocopherol vitamins. The considerable gains from the farm wastes use for the mushrooms raising with subsequent application of the substrate in plant cultivation and animal husbandry are stated.

  7. An examination of antibacterial and antifungal properties of constituents of Shiitake (Lentinula edodes) and oyster (Pleurotus ostreatus) mushrooms.

    Science.gov (United States)

    Hearst, Rachel; Nelson, David; McCollum, Graham; Millar, B Cherie; Maeda, Yasunori; Goldsmith, Colin E; Rooney, Paul J; Loughrey, Anne; Rao, J R; Moore, John E

    2009-02-01

    Antibiotic agents have been in widespread and largely effective therapeutic use since their discovery in the 20th century. However, the emergence of multi-drug resistant pathogens now presents an increasing global challenge to both human and veterinary medicine. It is now widely acknowledged that there is a need to develop novel antimicrobial agents to minimize the threat of further antimicrobial resistance. With this in mind, a study was undertaken to examine the antimicrobial properties of aqueous extracts of 'exotic' Shiitake and Oyster mushrooms on a range of environmental and clinically important microorganisms. Several batches of Shiitake and oyster mushrooms were purchased fresh from a local supermarket and underwent aqueous extraction of potential antimicrobial components. After reconstitution, aqueous extracts were tested qualitatively against a panel of 29 bacterial and 10 fungal pathogens, for the demonstration of microbial inhibition. Our data quantitatively showed that Shiitake mushroom extract had extensive antimicrobial activity against 85% of the organisms it was tested on, including 50% of the yeast and mould species in the trial. This compared favourably with the results from both the Positive control (Ciprofloxacin) and Oyster mushroom, in terms of the number of species inhibited by the activity of the metabolite(s) inherent to the Shiitake mushroom. This small scale study shows the potential antimicrobial effects of Shitake extracts, however further work to isolate and identify the active compound(s) now requires to be undertaken. Once these have been identified, suitable pharmaceutical delivery systems should be explored to allow concentrated extracts to be prepared and delivered optimally, rather than crude ingestion of raw material, which could promote further bacterial resistance.

  8. Antimicrobial Activity of Extracts of the Oyster Culinary Medicinal Mushroom Pleurotus ostreatus (Higher Basidiomycetes) and Identification of a New Antimicrobial Compound.

    Science.gov (United States)

    Younis, Ahmed M; Wu, Fang-Sheng; El Shikh, Hussien H

    2015-01-01

    Pleurotus ostreatus is an edible mushroom that also has high medicinal values. In this study, P. ostreatus was tested for its ability to inhibit the growth of fungi and bacteria. The freeze-dried fruiting body, broth from submerged culture, and mycelial biomass of P. ostreatus were extracted using alcohols and water as solvents. The extracts were then tested for their antimicrobial activity against the growth of fungi and bacteria. It was observed that the water extract from fruiting bodies had the strongest effect in inhibiting the growth of most fungi. The most sensitive test microfungi to the inhibition were Candida albicans, Cryptococcus humicola, and Trichosporon cutaneum, and the most sensitive test bacteria were Staphylococcus aureus followed by Escherichia coli. Water extracts from culture broth or mycelial biomass were moderately inhibitive to the growth of fungi and bacteria. The alcohol-based solvents from all samples had much less antimicrobial activity against most test microorganisms. An antimicrobial compound was purified from the water extracts of fruiting bodies with Sephadex G 100 column chromatography and characterized by infrared absorption spectrum (IR), nuclear magnetic resonance (NMR), and mass spectroscopic analysis. We have identified this compound to be 3-(2-aminopheny1thio)-3-hydroxypropanoic acid. This purified compound had a minimum inhibitory concentration of 30 µg/mL and 20 µg/mL against the growth of fungi and bacteria, respectively.

  9. Degradation of Green Polyethylene by Pleurotus ostreatus.

    Directory of Open Access Journals (Sweden)

    José Maria Rodrigues da Luz

    Full Text Available We studied the biodegradation of green polyethylene (GP by Pleurotus ostreatus. The GP was developed from renewable raw materials to help to reduce the emissions of greenhouse gases. However, little information regarding the biodegradation of GP discarded in the environment is available. P. ostreatus is a lignocellulolytic fungus that has been used in bioremediation processes for agroindustrial residues, pollutants, and recalcitrant compounds. Recently, we showed the potential of this fungus to degrade oxo-biodegradable polyethylene. GP plastic bags were exposed to sunlight for up to 120 days to induce the initial photodegradation of the polymers. After this period, no cracks, pits, or new functional groups in the structure of GP were observed. Fragments of these bags were used as the substrate for the growth of P. ostreatus. After 30 d of incubation, physical and chemical alterations in the structure of GP were observed. We conclude that the exposure of GP to sunlight and its subsequent incubation in the presence of P. ostreatus can decrease the half-life of GP and facilitate the mineralization of these polymers.

  10. Degradation of Green Polyethylene by Pleurotus ostreatus.

    Science.gov (United States)

    da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Ribeiro, Karla Veloso Gonçalves; Mendes, Igor Rodrigues; Kasuya, Maria Catarina Megumi

    2015-01-01

    We studied the biodegradation of green polyethylene (GP) by Pleurotus ostreatus. The GP was developed from renewable raw materials to help to reduce the emissions of greenhouse gases. However, little information regarding the biodegradation of GP discarded in the environment is available. P. ostreatus is a lignocellulolytic fungus that has been used in bioremediation processes for agroindustrial residues, pollutants, and recalcitrant compounds. Recently, we showed the potential of this fungus to degrade oxo-biodegradable polyethylene. GP plastic bags were exposed to sunlight for up to 120 days to induce the initial photodegradation of the polymers. After this period, no cracks, pits, or new functional groups in the structure of GP were observed. Fragments of these bags were used as the substrate for the growth of P. ostreatus. After 30 d of incubation, physical and chemical alterations in the structure of GP were observed. We conclude that the exposure of GP to sunlight and its subsequent incubation in the presence of P. ostreatus can decrease the half-life of GP and facilitate the mineralization of these polymers.

  11. Improving the feeding value of straws with Pleurotus ostreatus

    NARCIS (Netherlands)

    Khan, N.A.; Hussain, S.; Ahmad, N.; Alam, S.; Bezabhi, M.; Hendriks, W.H.; Yu, P.; Cone, J.W.

    2015-01-01

    The high content of lignin in cell walls is the major limiting factor in the digestion and utilisation of cereal crop residues by ruminants. The aim of this study was to evaluate the effectiveness of the white rot fungus, Pleurotus ostreatus (P. ostreatus), to degrade lignin and to enhance the rumen

  12. Effect of β-1.3/1.6-D-glucan derived from oyster mushroom Pleurotus ostreatus on biometrical, haematological, biochemical, and immunological indices in rainbow trout (Oncorhynchus mykiss).

    Science.gov (United States)

    Dobsikova, Radka; Blahova, Jana; Franc, Ales; Jakubik, Juraj; Mikulikova, Ivana; Modra, Helena; Novotna, Kamila; Svobodova, Zdenka

    2012-01-01

    Effect of long-term oral administration of three different concentrations (0.5, 1.0, and 2.0%) of micronized β-1.3/1.6-D-glucan derived from oyster mushroom (Pleurotus ostreatus, Hiratake) on biometrical, haematological, biochemical, and immunological indices of half-year-old rainbow trout (Oncorhynchus mykiss) was assessed in the study. Rainbow trout were feed commercial feed pellets containing β-1.3/1.6-D-glucan in the concentrations of 0.5, 1.0, and 2.0% for 85 days. Biometrical indices consisted in total and standard length, body and liver weight, from which derived somatic parameters such as Fulton´s condition factor and hepatosomatic index were calculated. Haematological parameters were evaluated according to unified methods for haematological examination in fish. Plasma biochemical profile was analysed using biochemical analyser Konelab 20i and Easy Lyte Analyzer. A phagocyte cells metabolic activity (induced chemiluminescence of phagocytes) was determined as an immunological parameter by a microplate luminometric method on Immunotech LM-01T. No clinical signs of behavioral, respiratory, or neurologic distress were observed in rainbow trout. Fish showed normal feeding behavior. As for biometric parameters, no significant changes in total and standard length, body weight, liver weight, as well as in condition factor and hepatosomatic index of experimental and control fish were found. In the course of the study, weight gains in rainbow trout were similar and continuous. Shifts in PCV (pglucose, lactate, total protein, cholesterol, calcium, natrium, potassium (all p<0.05), albumins and chlorides (both p<0.01), as well as catalytic activities of ALT and AST (both p<0.05) were changed in the course of the study. A phagocyte cells metabolic activity (luminol-induced chemiluminescence) in rainbow trout was not altered by oyster mushroom β-1.3/1.6-D-glucan administration. After long-term oral administration of three concentrations of micronized β-1.3/1.6-D

  13. Economic benefit analysis of cultivating Pleurotus ostreatus with rape straw

    Science.gov (United States)

    Guan, Qinlan; Gong, Mingfu; Tang, Mei

    2018-04-01

    The cultivation of Pleurotus ostreatus with rape straw not only can save the cultivation cost of P. ostreatus, but also can reuse the resources and protect the environment. By adding different proportion of rape straw to the cultivation material of P. ostreatus, the reasonable amount of rape straw was selected and the economic benefit of P. ostreatus cultivated with the optimum amount of rape straw was analyzed. The results showed that adding 10% to 40% rape straw to the cultivation material of P. ostreatus did not affect the yield and biological conversion rate of P. ostreatus, and the ratio of production and investment of the amount of rape straw in the range of 10% to 50% was higher than of cottonseed husk alone as the main material of the formula.

  14. Crescimento micelial de Pleurotus ostreatus em resíduo de Simarouba amara Mycelial growth of Pleurotus ostreatus in Simarouba amara sawdust

    Directory of Open Access Journals (Sweden)

    Ceci Sales-Campos

    2008-11-01

    Full Text Available O objetivo deste trabalho foi avaliar o crescimento micelial do cogumelo Pleurotus ostreatus, cultivado na serragem da espécie madeireira Simarouba amara. Avaliaram-se: o efeito das temperaturas de 22, 25, 27, 30 e 35ºC sobre o crescimento micelial de P. ostreatus, nos meios malte-ágar 3% e SDA-MA (infusão da serragem de S. amara, enriquecida com farelo de soja-dextrose-ágar; e o crescimento micelial em substrato de cultivo de serragem de S. amara, com e sem suplementação de farelo de soja, a 25 e 30ºC. O melhor desenvolvimento de P. ostreatus ocorreu em meio malte-ágar 3% a 25ºC. A suplementação de farelo de soja na serragem de S. amara favorece o crescimento micelial.The objective of this work was to assess the mycelial growth of oyster mushroom (Pleurotus ostreatus cultivated in sawdust of Simarouba amara. Evaluations were made for the effect of temperatures 22, 25, 27, 30 and 35ºC on the mycelial growth of P. ostreatus in 3% malt-agar and SDA-MA (infusion of S. amara sawdust, enriched with soybean meal-dextrose-agar media; and the mycelial growth in cultivation substrate of S. amara sawdust, with and without supplementation of soybean meal, at 25 and 30ºC. The best development of P. ostreatus was in 3% malt-agar medium at 25ºC. Soybean meal supplementation on S. amara sawdust promoted mycelial growth.

  15. Cultivation of mushroom ( Pleurotus ostreatus ) using corn cobs and ...

    African Journals Online (AJOL)

    An investigation was carried out on the cultivation of mushroom (Pleurotus ostreatus) using corn cobs and saw dust as the main substrates. Lignocellulosic wastes such as corn cobs and saw dust were packaged inside heat – resistant polythene bags and pasteurized before being seeded with 7.5% w/w millet spawn of ...

  16. Evaluation of biomass of some invasive weed species as substrate for oyster mushroom (Pleurotus spp.) cultivation.

    Science.gov (United States)

    Mintesnot, Birara; Ayalew, Amare; Kebede, Ameha

    2014-01-15

    This study assessed the bioconversion of Agriculture wastes like invasive weeds species (Lantana camara, Prosopis juliflora, Parthenium hysterophorus) as a substrate for oyster mushroom (Pleurotus species) cultivation together with wheat straw as a control. The experiment was laid out in factorial combination of substrates and three edible oyster mushroom species in a Completely Randomized Design (CRD) with three replications. Pleurotus ostreatus gave significantly (p mushroom cultivation could contribute to alleviating ecological impact of invasive weed species while offering practical option to mitigating hunger and malnutrition in areas where the invasive weeds became dominant.

  17. Effect of Edible Mushroom (Pleurotus ostreatus on Type-2 Diabetics

    Directory of Open Access Journals (Sweden)

    M. Abu Sayeed

    2014-01-01

    Full Text Available The prevalence of non-communicable diseases (NCD like diabetes, hypertension, dyslipidemia and atherosclerotic cardiovascular diseases (CVD are on the increase globally and predominantly in the South East Asian Region (SEAR. The increasing NCD and its complications burdened the health cost of Bangladesh. The available literatures suggest that edible mushrooms are effective in controlling metabolic risks like hyperglycemia and hypercholesterolemia. The study addressed the metabolic effects of edible oyster mushroom (Pleurotus ostreatus in diabetic individuals and to assess the undesirable effects of mushroom. A total of 5000 newly registered diabetic women were screened for eligible participants (urban housewives, age 30 – 50y, BMI 22 – 27, FBG 8 – 12 mmol/l; free from complications or systemic illnesses and agreed to adhere to the study for 360 days. The investigations included weight and height for BMI, waist- and hip-girth for WHR, BP, FBG, 2ABF, T-chol, TG, HDL, LDL, ALT and Creatinine starting from the day 0 (baseline and each subsequent follow-up days: 60, 120, 180, 240, 300 and 360 for comparison between placebo and mushroom groups and also within group (baseline vs. follow up days, individually for placebo and mushroom. The daily intake of mushroom was 200g for the mushroom group and an equivalent calorie of vegetables for the placebo group. Overall, 73 diabetic housewives (mushroom / placebo = 43 /30 volunteered. The mean (with SEM values of BMI, WHR, BP, FBG, 2ABF, T-chol, TG, HDL, LDL, ALT and Creatinine of the placebo group were compared with the mushroom group. Compared with the placebo, the mushroom group showed significant reductions of FBG (p<0.001, 2ABF (p<0.001, T-chol (p<0.001, TG (p=0.03 and LDL (p<0.001; whereas, no difference was observed for BMI, SBP, DBP, HDL, Hb, creatinine and ALT. The comparison within groups (baseline vs. follow-up there were significant reduction of these variables in mushroom but not in the

  18. Establishment of an efficient transformation system for Pleurotus ostreatus.

    Science.gov (United States)

    Lei, Min; Wu, Xiangli; Zhang, Jinxia; Wang, Hexiang; Huang, Chenyang

    2017-11-21

    Pleurotus ostreatus is widely cultivated worldwide, but the lack of an efficient transformation system regarding its use restricts its genetic research. The present study developed an improved and efficient Agrobacterium tumefaciens-mediated transformation method in P. ostreatus. Four parameters were optimized to obtain the most efficient transformation method. The strain LBA4404 was the most suitable for the transformation of P. ostreatus. A bacteria-to-protoplast ratio of 100:1, an acetosyringone (AS) concentration of 0.1 mM, and 18 h of co-culture showed the best transformation efficiency. The hygromycin B phosphotransferase gene (HPH) was used as the selective marker, and EGFP was used as the reporter gene in this study. Southern blot analysis combined with EGFP fluorescence assay showed positive results, and mitotic stability assay showed that more than 75% transformants were stable after five generations. These results showed that our transformation method is effective and stable and may facilitate future genetic studies in P. ostreatus.

  19. Biodegradation of oxytetracycline by Pleurotus ostreatus mycelium: a mycoremediation technique

    International Nuclear Information System (INIS)

    Migliore, Luciana; Fiori, Maurizio; Spadoni, Anna; Galli, Emanuela

    2012-01-01

    Highlights: ► Oxytetracycline uptake and degradation by Pleurotus ostreatus mycelium were measured. ► The role of extracellular laccase in degradation was evaluated. ► The almost complete OTC removal was obtained. ► A possible degradation product was identified in mycelia (ADOTC). ► The system can be considered the first step of an useful mycoremediation technique. - Abstract: Oxytetracycline (OTC) is administered in high doses to livestocks and enters the environmental compartments as a consequence of animal waste disposal. As a first step in setting up a useful mycoremediation technique, an OTC lab degradation test was performed in liquid medium using the ligninolytic fungus Pleurotus ostreatus. OTC disappearance in culture medium was clearly evident as early as the third day of exposure onwards, with an almost complete removal after 14 d. The drug removal was mediated by fungal absorption in the mycelia, where the OTC molecule underwent a degradation step, as demonstrated by mass spectrometry analyses. A putative degradation product, ADOTC (2-acetyl-2-decarboxamido-oxytetracycline) is proposed. Experimental conditions excluded OTC abiotic degradation; the degradation by extracellular laccase was also experimentally discarded.

  20. Biodegradation of oxytetracycline by Pleurotus ostreatus mycelium: a mycoremediation technique

    Energy Technology Data Exchange (ETDEWEB)

    Migliore, Luciana [Dept. Biology, Tor Vergata University, Via della Ricerca Scientifica, 00133 Rome (Italy); Fiori, Maurizio [Dept. Veterinary Public Health and Food Safety, Istituto Superiore di Sanita, Viale Regina Elena 299, 00161 Rome (Italy); Spadoni, Anna [Dept. Biology, Tor Vergata University, Via della Ricerca Scientifica, 00133 Rome (Italy); Institute of Agro-Environment and Forest Biology, National Research Council, Research Area Rome 1, Via Salaria km 29.300, 00015 Monterotondo Rome (Italy); Galli, Emanuela [Institute of Agro-Environment and Forest Biology, National Research Council, Research Area Rome 1, Via Salaria km 29.300, 00015 Monterotondo Rome (Italy)

    2012-05-15

    Highlights: Black-Right-Pointing-Pointer Oxytetracycline uptake and degradation by Pleurotus ostreatus mycelium were measured. Black-Right-Pointing-Pointer The role of extracellular laccase in degradation was evaluated. Black-Right-Pointing-Pointer The almost complete OTC removal was obtained. Black-Right-Pointing-Pointer A possible degradation product was identified in mycelia (ADOTC). Black-Right-Pointing-Pointer The system can be considered the first step of an useful mycoremediation technique. - Abstract: Oxytetracycline (OTC) is administered in high doses to livestocks and enters the environmental compartments as a consequence of animal waste disposal. As a first step in setting up a useful mycoremediation technique, an OTC lab degradation test was performed in liquid medium using the ligninolytic fungus Pleurotus ostreatus. OTC disappearance in culture medium was clearly evident as early as the third day of exposure onwards, with an almost complete removal after 14 d. The drug removal was mediated by fungal absorption in the mycelia, where the OTC molecule underwent a degradation step, as demonstrated by mass spectrometry analyses. A putative degradation product, ADOTC (2-acetyl-2-decarboxamido-oxytetracycline) is proposed. Experimental conditions excluded OTC abiotic degradation; the degradation by extracellular laccase was also experimentally discarded.

  1. Decolourisation of mushroom farm wastewater by Pleurotus ostreatus.

    Science.gov (United States)

    Rodríguez Pérez, Suyén; García Oduardo, Nora; Bermúdez Savón, Rosa C; Fernández Boizán, Maikel; Augur, Christopher

    2008-07-01

    Mushroom production on coffee pulp as substrate generates an intense black residual liquid, which requires suitable treatment. In the present study, Pleurotus ostreatus growth in wastewater from mushroom farm was evaluated as a potential biological treatment process for decolourisation as well as to obtain biomass (liquid inoculum). Culture medium components affecting mycelial growth were determined, evaluating colour removal. Laccase activity was monitored during the process. P. ostreatus was able to grow in non diluted WCP. Highest biomass yield was obtained when glucose (10 g/l) was added. The addition of this carbon source was necessary for efficient decolourisation. Agitation of the culture improved biodegradation of WCP as well as fungal biomass production. Laccase and manganese-independent peroxidase activities were detected during fungal treatment of the WCP by P. ostreatus CCEBI 3024. The laccase enzyme showed good correlation with colour loss. Both wastewater colour and pollution load (as chemical oxygen demand) decreased more than 50% after 10 days of culture. Phenols were reduced by 92%.

  2. Selective adhesion of wastewater bacteria to Pleurotus ostreatus mycelium in a trickle-bed bioreactor

    Czech Academy of Sciences Publication Activity Database

    Svobodová, Kateřina; Petráčková, Denisa; Szabad, Hana; Novotný, Čeněk

    2016-01-01

    Roč. 3, č. 3 (2016), s. 395-407 ISSN 2372-0344 Institutional support: RVO:61388971 Keywords : Pleurotus ostreatus * activated sludge * fungal/bacterial co-cultur Subject RIV: EE - Microbiology, Virology

  3. Polluting macrophytes Colombian lake Fúquene used as substrate by edible fungus Pleurotus ostreatus.

    Science.gov (United States)

    Martínez-Nieto, Patricia; García-Gómez, Gustavo; Mora-Ortiz, Laura; Robles-Camargo, George

    2014-01-01

    Invasive aquatic plants from Lake Fúquene (Cundinamarca, Colombia), water hyacinth (Eichhornia crassipes C. Mart.) and Brazilian elodea (Egeria densa Planch.) have been removed mechanically from the lake and can be used for edible mushrooms production. The growth of the oyster mushroom (Pleurotus ostreatus) on these aquatic macrophytes was investigated in order to evaluate the possible use of fruiting bodies and spent biomass in food production for human and animal nutrition, respectively. Treatments included: water hyacinth, Brazilian elodea, sawdust, rice hulls and their combinations, inoculated with P. ostreatus at 3%. Water hyacinth mixed with sawdust stimulated significantly fruiting bodies production (P = 3.3 × 10(-7)) with 71% biological efficacy, followed by water hyacinth with rice husk (55%) and elodea with rice husk (48%), all of these have protein contents between 26 and 47%. Loss of lignin (0.9-21.6%), cellulose (3.7-58.3%) and hemicellulose (1.9-53.8%) and increment in vitro digestibility (16.7-139.3%) and reducing sugars (73.4-838.4%) were observed in most treatments. Treatments spent biomass presented Relative Forage Values (RFV) from 46.1 to 232.4%. The results demonstrated the fungus degrading ability and its potential use in aquatic macrophytes conversion biomass into digestible ruminant feed as added value to the fruiting bodies production for human nutrition.

  4. Degradation of oxo-biodegradable plastic by Pleurotus ostreatus.

    Science.gov (United States)

    da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Nunes, Mateus Dias; da Silva, Marliane de Cássia Soares; Kasuya, Maria Catarina Megumi

    2013-01-01

    Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV) or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W) plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate.

  5. Degradation of oxo-biodegradable plastic by Pleurotus ostreatus.

    Directory of Open Access Journals (Sweden)

    José Maria Rodrigues da Luz

    Full Text Available Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate.

  6. Lignocellulolytic enzyme production of Pleurotus ostreatus growth in agroindustrial wastes

    Directory of Open Access Journals (Sweden)

    José Maria Rodrigues da Luz

    2012-12-01

    Full Text Available The mushroom Pleurotus ostreatus has nutritional and medicinal characteristics that depend on the growth substrate. In nature, this fungus grows on dead wood, but it can be artificially cultivated on agricultural wastes (coffee husks, eucalyptus sawdust, corncobs and sugar cane bagasse. The degradation of agricultural wastes involves some enzyme complexes made up of oxidative (laccase, manganese peroxidase and lignin peroxidase and hydrolytic enzymes (cellulases, xylanases and tanases. Understanding how these enzymes work will help to improve the productivity of mushroom cultures and decrease the potential pollution that can be caused by inadequate discharge of the agroindustrial residues. The objective of this work was to assess the activity of the lignocellulolytic enzymes produced by two P. ostreatus strains (PLO 2 and PLO 6. These strains were used to inoculate samples of coffee husks, eucalyptus sawdust or eucalyptus bark add with or without 20 % rice bran. Every five days after substrate inoculation, the enzyme activity and soluble protein concentration were evaluated. The maximum activity of oxidative enzymes was observed at day 10 after inoculation, and the activity of the hydrolytic enzymes increased during the entire period of the experiment. The results show that substrate composition and colonization time influenced the activity of the lignocellulolytic enzymes.

  7. Degradation of Oxo-Biodegradable Plastic by Pleurotus ostreatus

    Science.gov (United States)

    da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Nunes, Mateus Dias; da Silva, Marliane de Cássia Soares; Kasuya, Maria Catarina Megumi

    2013-01-01

    Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV) or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W) plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate. PMID:23967057

  8. New lipases by mining of Pleurotus ostreatus genome.

    Directory of Open Access Journals (Sweden)

    Alessandra Piscitelli

    Full Text Available The analysis of Pleurotus ostreatus genome reveals the presence of automatically annotated 53 lipase and 34 carboxylesterase putative coding-genes. Since no biochemical or physiological data are available so far, a functional approach was applied to identify lipases from P. ostreatus. In the tested growth conditions, four lipases were found expressed, with different patterns depending on the used C source. Two of the four identified proteins (PleoLip241 and PleoLip369, expressed in both analysed conditions, were chosen for further studies, such as an in silico analysis and their molecular characterization. To overcome limits linked to native production, a recombinant expression approach in the yeast Pichia pastoris was applied. Different expression levels were obtained: PleoLip241 reached a maximum activity of 4000 U/L, whereas PleoLip369 reached a maximum activity of 700 U/L. Despite their sequence similarity, these enzymes exhibited different substrate specificity and diverse stability at pH, temperature, and presence of metals, detergents and organic solvents. The obtained data allowed classifying PleoLip241 as belonging to the "true lipase" family. Indeed, by phylogenetic analysis the two proteins fall in different clusters. PleoLip241 was used to remove the hydrophobic layer from wool surface in order to improve its dyeability. The encouraging results obtained with lipase treated wool led to forecast PleoLip241 applicability in this field.

  9. Investigation of Pleurotus ostreatus pretreatment on switchgrass for ethanol production

    Science.gov (United States)

    Slavens, Shelyn Gehle

    Fungal pretreatment using the white-rot fungus Pleurotus ostreatus on switchgrass for ethanol production was studied. In a small-scale storage study, small switchgrass bales were inoculated with fungal spawn and automatically watered to maintain moisture. Sampled at 25, 53, and 81 d, the switchgrass composition was determined and liquid hot water (LHW) pretreatment was conducted. Fungal pretreatment significantly decreased the xylan and lignin content; glucan was not significantly affected by fungal loading. The glucan, xylan, and lignin contents significantly decreased with increased fungal pretreatment time. The effects of the fungal pretreatment were not highly evident after the LHW pretreatment, showing only changes based on sampling time. Although other biological activity within the bales increased cellulose degradation, the fungal pretreatment successfully reduced the switchgrass lignin and hemicellulose contents. In a laboratory-scale nutrient supplementation study, copper, manganese, glucose, or water was added to switchgrass to induce production of ligninolytic enzymes by P. ostreatus. After 40 d, ligninolytic enzyme activities and biomass composition were determined and simultaneous saccharification and fermentation (SSF) was conducted to determine ethanol yield. Laccase activity was similar for all supplements and manganese peroxidase (MnP) activity was significantly less in copper-treated samples than in the other fungal-inoculated samples. The fungal pretreatment reduced glucan, xylan, and lignin content, while increasing extractable sugars content. The lowest lignin contents occurred in the water-fungal treated samples and produced the greatest ethanol yields. The greatest lignin contents occurred in the copper-fungal treated samples and produced the lowest ethanol yields. Manganese-fungal and glucose-fungal treated samples had similar, intermediate lignin contents and produced similar, intermediate ethanol yields. Ethanol yields from switchgrass

  10. Optimum Condition of Ecologic Feed Fermentation by Pleurotus ostreatus Using Soybean Curd Residue as Raw Materials

    OpenAIRE

    Shi, Min; Yang, Yingnan; Li, Yiting; Wang, Yuepeng; Zhang, Zhenya

    2011-01-01

    A novel approach by utilizing soybean curd residue, to produce polysaccharide from the edible mushroom Pleurotus ostreatus in solid-state culture, was developed. Firstly, the significant effect of fermented conditions on P. ostreatus polysaccharide production were screened out to be inoculum size, moisture content and C/N ratio by using a single factor experiment. Secondly, the three factors were optimized using central composite design in response surface methodology. As results, a quadratic...

  11. Performance of Pleurotus ostreatus mushroom grown on maize stalk residues supplemented with various levels of maize flour and wheat bran

    Directory of Open Access Journals (Sweden)

    Senzosenkosi Surprise MKHIZE

    Full Text Available Abstract Improving the performance of mushroom in terms of high production and fast growth rate is essential in mushroom cultivation. In the present study the performance of Pleurotus ostreatus was evaluated using varying levels of wheat bran (WB and maize flour (MF. The results indicated that Pleurotus ostreatus was highly influenced by different levels of supplementation, with 8% WB, 18% WB and 2% MF having higher contamination rate. The low levels of supplementation gave significantly better mycelial growth rate (MGR and shorter colonisation period as observed that the control had highest MGR whereby 20% MF had lowest MGR. The pinning time (TP was shortest at the first flush with minimum of 3 days (12% MF. The higher levels of supplementation showed maximum biological efficiency (BE such as 14% MF, 12% WB and 14% WB. The yield was also higher at high levels of supplementation such as 20% MF and 8% MF being the exception in the lower levels. Based on the results it was observed that for fast production of oyster mushroom there is no need to supplement the maize stalk substrate but for improved productivity supplements can be added up to certain limits such as 14% MF and 12 WB.

  12. Variability of Laccase Activity in the White-Rot Basidiomycete Pleurotus ostreatus

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr; Gabriel, Jiří

    2002-01-01

    Roč. 47, č. 4 (2002), s. 385-390 ISSN 0015-5632 R&D Projects: GA ČR GP204/02/P100 Institutional research plan: CEZ:AV0Z5020903 Keywords : laccase * pleurotus ostreatus Subject RIV: EE - Microbiology, Virology Impact factor: 0.979, year: 2002

  13. Decolorization of Synthetic Dyes by Pleurotus ostreatus Isolates Differing in Ligninolytic Properties

    Czech Academy of Sciences Publication Activity Database

    Eichlerová, Ivana; Homolka, Ladislav; Nerud, František

    2002-01-01

    Roč. 47, č. 6 (2002), s. 691-695 ISSN 0015-5632 R&D Projects: GA MŠk LN00B030 Institutional research plan: CEZ:AV0Z5020903 Keywords : pleurotus ostreatus * ligninolytic properties Subject RIV: EE - Microbiology, Virology Impact factor: 0.979, year: 2002

  14. The Amoebicidal Effect of Ergosterol Peroxide Isolated from Pleurotus ostreatus.

    Science.gov (United States)

    Meza-Menchaca, Thuluz; Suárez-Medellín, Jorge; Del Ángel-Piña, Christian; Trigos, Ángel

    2015-12-01

    Dysentery is an inflammation of the intestine caused by the protozoan parasite Entamoeba histolytica and is a recurrent health problem affecting millions of people worldwide. Because of the magnitude of this disease, finding novel strategies for treatment that does not affect human cells is necessary. Ergosterol peroxide is a sterol particularly known as a major cytotoxic agent with a wide spectrum of biological activities produced by edible and medicinal mushrooms. The aim of this report is to evaluate the amoebicidal activity of ergosterol peroxide (5α, 8α-epidioxy-22E-ergosta-6,22-dien-3β-ol isolated from 5α, 8α-epidioxy-22E-ergosta-6,22-dien-3β-ol) (Jacq.) P. Kumm. f. sp. Florida. Our results show that ergosterol peroxide produced a strong cytotoxic effect against amoebic growth. The inhibitory concentration IC50 of ergosterol peroxide was evaluated. The interaction between E. histolytica and ergosterol peroxide in vitro resulted in strong amoebicidal activity (IC50  = 4.23 nM) that may be due to the oxidatory effect on the parasitic membrane. We also tested selective toxicity of ergosterol peroxide using a cell line CCL-241, a human epithelial cell line isolated from normal human fetal intestinal tissue. To the best of our knowledge, this is the first report on the cytotoxicity of ergosterol peroxide against E. histolytica, which uncovers a new biological property of the lipidic compound isolated from Pleurotus ostreatus (Jacq.) P. Kumm. f. sp. Florida. Copyright © 2015 John Wiley & Sons, Ltd.

  15. Komparasi Laju Pertumbuhan Miselium Jamur Tiram Putih (Pleurotus ostreatus (Jacq. ex Fr Kummer pada Komposisi Media Bibit (F3 dan Baglog yang Berbeda

    Directory of Open Access Journals (Sweden)

    I MADE SUDARMA

    2015-09-01

    Full Text Available The growth rate comparison of white oyster mushroom (Pleurotus ostreatus (Jacq. ex FrKummer mycelium in the composition of different seed (F3 and baglog media . Cultivation ofoyster mushroom (Pleurotus ostreatus (Jacq. ex Fr Kummer has grown rapidly along with the increasein income and health awareness. Oyster mushrooms growing need for media with a particular compositionin order to grow optimally. Oyster mushroom production is determined by the quality of the seeds (F3is used, which is sourced from the media with good quality and composition. The research aimed todetermine the rate of growth of white oyster mushroom mycelium in the different composition of seedmedium (F3 (sawdust: fine bran: corn flour: CaCO3 . The experiments was conducted at nurseriesand oyster mushroom development, Jl. Siulan Gang Zella No. 7 Denpasar, from June to August 2013.Each treatment contained 50 bottles, and 10 bottles only used as a sample, in environmental conditionswith temperature and humidity ranges, 20-29oC and 59-86% respectively . T-test was used todifferentiate the growth rate of white oyster mushroom mycelium with different compositions. Theresults showed that seeds (F3 derived from the growing media composition, sawdust (1 week old:fine bran: corn flour: CaCO3 (10:4:2:0,5 significantly different and better than the composition sawdust(age 1 month : fine bran: corn flour (20:2:1:0.5, with a growth rate of mycelium in a mean 6.14±0.56cm/week and 1,81±0,82 cm/week, respectively. Spawn running in baglog with media composition10:4:2:0.5 was 2.77±1.22cm/week, but with composition media 20:2:1:0.5 mycelium could not grow.Effect of temperature and humidity on the growth rate of white oyster mushroom mycelium in seedmedia (F3 is not significantly.

  16. EFEKTIVITAS PEMBERIAN AIR LERI TERHADAP PERTUMBUHAN DAN HASIL JAMUR TIRAM PUTIH (Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Ummu Kalsum

    2011-09-01

    Full Text Available White oyster mushroom is kind of consumed mushroom that has delicious taste and efficacious drug. Mushroom need nutrition addition to increase growth and development so that better production, like nutrition from rice washing water. The contain are carbon element, nitrogen, mineral and vitamin B. This experiment aim to determine addition of rice washing water effect, optimal volume and time interval on growth and yield of white oyster mushroom (Pleurotus ostreatus. This experiment is carried out at mushroom’s house Maduraya Agro Kamal. The research design used was factorial completely randomized design with two factors. First factor is addition rice washing water volume with 4 level, that is without addition rice washing water (A0, addition rice washing water as much as 20 ml/1000 g substrat (A1, 40 ml/1000 g substrat (A2 and 60 ml/1000 g substrat (A3. Second factor is addition time interval that consists of 2 level, that is 2 days (B1 and 4 days (B2. Experiment result shows that interaction between volume treatment and addition time interval give effect on fruit body total. Addition rice washing water volume treatment give real effect on maximal pileus fruit width. While addition time interval treatment does not give significant difference on all parameters but it can increase pileus fruit width, total weight and biological efficiency. Interaction of volume treatment and addition time interval is the best combination is volume treatment 40 ml/1000 g substrat with time interval 2 days (A2B1, this matter is showed in lot fruit body total as big as 8,871 fruit. Addition rice washing water volume 40 ml/1000 g substrat is the best volume that indicated from first bud appear, first harvest time, total weight and biological efficiency.

  17. EVALUACIÓN DE LOS PARÁMETROS PRODUCTIVOS DE LA SEMILLA DE Pleurotus ostreatus PROPAGADA EN DIFERENTES MEDIOS DE CULTIVO AVALIAÇÃO DOS PARÂMETROS DE PRODUÇÃO DA SEMENTÉ DE Pleurotus ostreatus DISSEMINADAS EM DIFERENTES MEIOS DE CULTURA EVALUATION OF PARAMETERS PRODUCTION OF THE SEED Pleurotus ostreatus SPREED IN DIFFERENT CULTURE MEDIA

    Directory of Open Access Journals (Sweden)

    MARÍA DEL PILAR RÍOS

    2010-12-01

    3 inteiramente casualizado. Na terceira seção avaliada, se avaliou a colonização e frutificação do fungo em bagaço de cana utilizando parâmetros biológicos, tais como desempenho, eficiência e taxa de produção de sementes, com o inteiramente casualizado 3x3. 0 meio alternativo em pH 5,0 foi o mais adequado para o crescimento de Pleurotus ostreatus, demonstrando sua adaptabilidade a meios com alto conteúdo de carboidrato, cujos níveis de renda foram adequados para a produção competitiva e fruticultura diminuindo o tempo de incubação e colheita.Alternative media were evaluated for the propagation of Pleurotus ostreatus and its behavior was compared with that of a commercial media. The response to these media was measured through the adaptation of the fungus in barley for obtaining the commercial seed and this one in its turn in the response to a substratum based on cane bagasse for obtaining oyster mushrooms. In the first phase the fungus was obtained and planted in a solid media of potato extract at two concentrations and three pH values using a factorial design 2x3 (pH vs. concentration of potato extract. In the second phase was measured the growth of Pleurotus ostreatus inoculated in sterilized hydrated barley through a completely random design 3x3. In the third phase was evaluated the colonization and fructification of the fungus in cane bagasse using parameters as biológical efficiency performance and seed production rate, with a completely random design 3x3. The alternative media with pH 5,0 was the most adequate for the growth of Pleurotus ostreatus, displaying its adaptability to media with high carbohydrates content which performances were appropiate to obtain competitive production levels in growth and fructification, diminishing thus the incubation and harvesting time.

  18. Bioprospecting of powdered pineapple rind as an organic supplement of composted sawdust for Pleurotus ostreatus mushroom cultivation.

    Science.gov (United States)

    Narh Mensah, Deborah L; Addo, Peter; Dzomeku, Matilda; Obodai, Mary

    2018-03-01

    Pineapple rind is a by-product of the pineapple processing industry and contains nutrients and other compounds which must be utilized as a bioresource for socio-economic benefits while preventing the potential problems of improper agroindustrial biomass disposal methods. Pleurotus ostreatus is an edible oyster mushroom with medicinal properties and can be cultivated on various agroindustrial biomass, including sawdust containing supplements. Pineapple rind was powdered and used as a supplement of composted sawdust at 2%, 5%, 10%, 12%, 15%, and 20% (w/w) on dry weight basis. A control treatment consisted of composted sawdust supplemented with rice bran at 12% (the most utilized composition in Ghana). P. ostreatus strain EM-1 was cultivated on these treatments. Factors investigated included the spawn run period, yield, fruiting body weight and size, biological efficiency, and nutritional composition (proximate composition and Copper, Zinc and Lead content) of fruiting bodies harvested from selected high-yielding treatments and the control treatment. Full colonization of all treatments occurred by the 34th day of incubation. Enhanced yield, fruiting body weight and size, and biological efficiency were generally recorded with supplementation at lower concentrations (2% and 5%) compared to treatments supplemented at higher concentrations. There was also a supplement concentration-dependent alteration of the nutritional composition of the mushroom. Powdered pineapple rind can be utilized as an organic supplement at relatively low concentrations in composted sawdust for P. ostreatus strain EM-1 cultivation. The use of lower concentrations of powdered pineapple rind in composted sawdust is advantageous as relatively less input will be required to produce higher P. ostreatus strain EM-1 yields. Utilization of pineapple rind for mushroom cultivation will extend the pineapple plant value chain, intensify mushroom production in a sustainable way, and minimize agricultural

  19. Glucans from fruit bodies of cultivated mushrooms Pleurotus ostreatus and Pleurotus eryngii: Structure and potential prebiotic activity

    Czech Academy of Sciences Publication Activity Database

    Synytsya, Andriy.; Míčková, K.; Synytsya, A.; Jablonský, I.; Spěváček, Jiří; Erban, V.; Kováříková, E.; Čopíková, J.

    2009-01-01

    Roč. 76, č. 4 (2009), s. 548-556 ISSN 0144-8617 R&D Projects: GA ČR GA525/05/0273 Institutional research plan: CEZ:AV0Z40500505 Keywords : glucans * oyster mushroom Pleurotus * isolation Subject RIV: CD - Macromolecular Chemistry Impact factor: 3.167, year: 2009

  20. Influence of calcium and silicon supplementation into Pleurotus ostreatus substrates on quality of fresh and canned mushrooms.

    Science.gov (United States)

    Thongsook, T; Kongbangkerd, T

    2011-08-01

    Supplements of gypsum (calcium source), pumice (silicon source) and pumice sulfate (silicon and calcium source) into substrates for oyster mushrooms (Pleurotus ostreatus) were searched for their effects on production as well as qualities of fresh and canned mushrooms. The addition of pumice up to 30% had no effect on total yield, size distribution and cap diameters. The supplementation of gypsum at 10% decreased the total yield; and although gypsum at 5% did not affect total yield, the treatment increased the proportion of large-sized caps. High content (>10%) of pumice sulfate resulted in the lower yield. Calcium and silicon contents in the fruit bodies were not influenced by supplementations. The centrifugal drip loss values and solid content of fresh mushrooms, and the percentage of weight gained and firmness of canned mushrooms, cultivated in substrates supplemented with gypsum, pumice and pumice sulfate were significantly (p≤0.05) higher than those of the control. Scanning electron micrographs revealed the more compacted hyphae of mushroom stalks supplemented with silicon and/or calcium after heat treatment, compared to the control. Supplementation of P. ostreatus substrates with 20% pumice was the most practical treatment because it showed no effect on yield and the most cost-effective.

  1. Shake flask decolourization of direct dye solar golden yellow R by pleurotus ostreatus

    International Nuclear Information System (INIS)

    Jilani, K.; Asghar, M.; Bhatti, H.N.; Mushtaq, Z.

    2011-01-01

    Different on site treatment technologies are in practice for industrial wastewaters but bioremediation using white rot fungi is the most attractive option due to complete degradation of the pollutants to non toxic end products. Three direct dyes (Solar golden yellow R, Solar brilliant red BA and Solar orange RSN) were decolourized using white rot fungus (WRF) Pleurotus ostreatus. The best decolourized dye Solar golden yellow R was selected for subsequent optimization studies for decolourization. Under optimum conditions Pleurotus ostreatus caused 90.32 % decolourization of 0.01 % Solar golden yellow R solution within two days of shake flask incubation at pH 3.5 and 30 deg. C temperature in Kirk's basal nutrient medium with added 1 % starch and 0.01 % ammonium sulphate as carbon and nitrogen sources, respectively. Ligninolytic enzyme activities were correlated to dye decolourization and maximum laccase activity of 356.23 U/ml was also noted in the maximally decolourized medium. (author)

  2. Abiotic and Biotic Degradation of Oxo-Biodegradable Plastic Bags by Pleurotus ostreatus

    OpenAIRE

    da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Bazzolli, Denise Mara Soares; Tótola, Marcos Rogério; Demuner, Antônio Jacinto; Kasuya, Maria Catarina Megumi

    2014-01-01

    In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as su...

  3. Researches on Pleurotus ostreatus mushroom’s quality cultivated on coffee grounds

    Directory of Open Access Journals (Sweden)

    Sorina Ropciuc

    2016-10-01

    Full Text Available The objectives of this work were to evaluate the possibility of using coffee grounds for cultivating Pleurotus ostreatus mushrooms and determine the nutritional composition of Pleurotus ostreatus mushrooms produced on coffee grounds substrate. The results revealed a good fruiting of the fungus on coffee grounds and the biological effectiveness (weight of fresh mushroom reached about 97% after 30 days. We determined the total protein content in vitamin C, the total polyphenols and the activity of Polyphenol oxidases (PPOs enzyme on 32 samples of fresh Pleurotus ostreatus mushroom (top and bottom and subjected to heat treatments (blanching, boiling and freezing. The protein content was ranged between the values of 16.9 and 25.1g/ 100g and the Vitamin C content within the range of values presented 64.32-564.95 mg/100g. The polyphenol content results varied significantly in the analyzed samples varying between 1.887 – 7.667 mg GAE / 100 g vegetable product. The determination of the polyphenol oxidase enzyme responsible for enzymatically blackening of the fungus presented values in the range 0.274- 0.610mg / 100g.

  4. BIODEGRADATION OF SUGARCANE VINASSES BY THE WHITE-ROT FUNGI Pleurotus ostreatus IN A PACKED BED REACTOR

    Directory of Open Access Journals (Sweden)

    W.A. Tapie

    2016-08-01

    Full Text Available Sugarcane vinasses are considered a complex effluent because of its organic load, low pH, high temperature, and by the presence of recalcitrant substances such as melanoidins and phenolic compounds. The aim of this work was to evaluate the potential of the fungus Pleurotus ostreatus to carry out the biodegradation of sugarcane vinasses in a fixed-bed bioreactor. The experiments evidence the potential of the fungus Pleurotus ostreatus to carry out the decolorization (83%, the removal of the Chemical Oxygen Demand (COD=87% and the Biochemical Oxygen Demand (BOD5=92%, the reduction of total suspended solids (83% and volatile suspended solids (72% of vinasses. The technical simplicity of the proposed alternative as well as process performance reveals the potential of the fungus Pleurotus ostreatus for the treatment of sugarcane mill effluents.

  5. Effect of Pleurotus ostreatus fermentation on cocoa pod husk ...

    African Journals Online (AJOL)

    Cocoa pod husk (CPH) is a major agro-industrial residue in Ghana with a potential value as a low-cost unconventional feedstuff for livestock. However, its effective use is limited by poor nutrient composition, mainly due to its high lignocellulose or fibre and also low protein levels. White–rot fungi such as Pleurotus species ...

  6. Pengaruh jamur tiram putih (pleurotus ostreatus terhadap kadar glukosa darah, profil lipid dan kadar MDA pada tikus (rattus norvegicus diabetes melitus

    Directory of Open Access Journals (Sweden)

    Purbowati Purbowati

    2016-06-01

    Full Text Available Background : Diabetes mellitus is a chronic disease caused by acquired deficiency in insulin production by the pancreas, or by the ineffectiveness of using the produced insulin. Oyster mushroom (Pleurotus ostreatus can help lower blood glucose levels, improve lipid profile and reduce levels of MDA. Objective : to analyze the effect of oyster mushroom on blood glucose levels, lipid profile and MDA levels in STZ induced rats as type 1 DM model. Methods : thirty Sprague Dawley rats were randomly divided into 3 groups: one positive group (1 and two treated group which received 100 mg/kgBB (2 and 200 mg/kgBB (3 oyster mushroom extract, respectively. The interventions were carried out for 30 days. The examination of blood glucose levels, lipid profile and MDA levels was before and after the intervention. The differences inthe datapre-post interventions were analyzed by paired t-test, whereas the differences between the groups were analyzed by one-way ANOVA and kruskal wallis followed by post hoc analysis. Results : the treatment group experienced a decrease in blood glucose levels, total cholesterol, LDL cholesterol, triglycerides, MDA and an increase in HDL cholesterol levels post-intervention (p < 0,001. Oyster mushroom extract with the dose of 200 mg/kg was more effective in lowering blood glucose levels, MDA levels and improving lipid profiles (p < 0,001. Conclusion : Oyster mushrooms administration lowers blood glucose levels, total cholesterol, LDL cholesterol, triglycerides, MDA and increases HDL cholesterol levels.

  7. Effect of supplementing crop substrate with defatted pistachio meal on Agaricus bisporus and Pleurotus ostreatus production.

    Science.gov (United States)

    Pardo-Giménez, Arturo; Catalán, Luis; Carrasco, Jaime; Álvarez-Ortí, Manuel; Zied, Diego; Pardo, José

    2016-08-01

    This work assesses the agronomic performance of defatted pistachio meal, after oil extraction, as a nutritional substrate supplement when growing the mushroom species Agaricus bisporus (Lange) Imbach and Pleurotus ostreatus (Jacq.) P. Kumm. Materials were applied at different doses at spawning. Along with non-supplemented substrates, commercial nutritional supplements were used as controls. Proximate analysis of mushrooms is also considered. For the cultivation of champignon, defatted pistachio meal has provided larger mushrooms (unitary weight and cap diameter) with firmer texture and greater content in dry weight and protein, without significant alterations in quantitative parameters. For Pleurotus ostreatus, the supplement led to significant yield increase, even providing up to 34.4% of increment compared to non-supplementation with meal, reaching a biological efficiency of 129.9 kg dt(-1) , when applied to the 15 g kg(-1) compost dose. Supplementation has also been conducted to increase dry weight, protein and fibre within carpophores and to decrease the energy value. Defatted pistachio meal has similar or better results compared to the commercial supplements used as reference. Compost supplementation with defatted pistachio meal in A. bisporus concerns mainly the quantitative parameters (size, texture, dry weight and protein). Based on the results obtained, this technique has greater potential of development for P. ostreatus commercial crops, basically due to expected increases in production, with a direct impact on benefits and crop profitability. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

  8. Radiocesium concentrations in wild mushrooms and characteristics of cesium accumulation by the edible mushroom (Pleurotus ostreatus)

    International Nuclear Information System (INIS)

    Sugiyama, Hideo; Terada, Hiroshi; Shibata, Hisashi; Morita, Yohoji; Kato, Fumio

    2000-01-01

    Mushrooms collected from a sub-alpine forest of Mt. Fuji and some other locations in Japan in 1996 were analyzed for radiocesium. The 137 Cs concentrations in 37 mushrooms varied widely from 1.6 to 783 Bqkg -1 fresh wt. The characteristics of Cs accumulation were analyzed by culturing fruiting bodies of the edible mushroom Pleurotus ostreatus (Fr.) Kummer Y-1 (P. ostreatus Y-1). The 137 Cs and stable Cs accumulation expressed as the concentration ratio (CR, 137 Cs or Cs concentration in the dried fruiting body/ 137 Cs or Cs concentration in the fresh medium) were in good agreement, indicating similar migration. The CR of Cs grown on medium containing both 0.1% Cs and 0.1% K, 10.2, showed a decrease of about 30 percent as compared with that containing 0.1% Cs only. These CR values suggested that Cs accumulation by the fruiting bodies of P. ostreatus Y-1 is affected by the presence of K similarly to previous observations in the mycelia. The 133 Cs-NMR spectra from the fruiting bodies of P. ostreatus Y-1 showed two resonance signals, whereas those from the media after harvesting of fruiting bodies showed only one signal. Just before growth of the fruiting bodies, bunches consisting of many mycelia were observed by scanning electron microscopy (SEM). No significant differences in the elemental distribution (Cs, K, P and C) were detected in the mycelium surface by SEM equipped with an energy dispersive X-ray microanalyzer. (author)

  9. Abiotic and biotic degradation of oxo-biodegradable plastic bags by Pleurotus ostreatus.

    Directory of Open Access Journals (Sweden)

    José Maria Rodrigues da Luz

    Full Text Available In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as substrates for P. ostreatus. We observed that physical treatment alone was not sufficient to initiate degradation. Instead, mechanical modifications and reduced titanium oxide (TiO2 concentrations caused by sunlight exposure triggered microbial degradation. The low specificity of lignocellulolytic enzymes and presence of endomycotic nitrogen-fixing microorganisms were also contributing factors in this process.

  10. Abiotic and biotic degradation of oxo-biodegradable plastic bags by Pleurotus ostreatus.

    Science.gov (United States)

    da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Bazzolli, Denise Mara Soares; Tótola, Marcos Rogério; Demuner, Antônio Jacinto; Kasuya, Maria Catarina Megumi

    2014-01-01

    In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as substrates for P. ostreatus. We observed that physical treatment alone was not sufficient to initiate degradation. Instead, mechanical modifications and reduced titanium oxide (TiO2) concentrations caused by sunlight exposure triggered microbial degradation. The low specificity of lignocellulolytic enzymes and presence of endomycotic nitrogen-fixing microorganisms were also contributing factors in this process.

  11. Optimization of Arundo donax Saccharification by (Hemicellulolytic Enzymes from Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Rossana Liguori

    2015-01-01

    Full Text Available An enzymatic mixture of cellulases and xylanases was produced by Pleurotus ostreatus using microcrystalline cellulose as inducer, partially characterized and tested in the statistical analysis of Arundo donax bioconversion. The Plackett-Burman screening design was applied to identify the most significant parameters for the enzymatic hydrolysis of pretreated A. donax. As the most significant influence during the enzymatic hydrolysis of A. donax was exercised by the temperature (°C, pH, and time, the combined effect of these factors in the bioconversion by P. ostreatus cellulase and xylanase was analyzed by a 33 factorial experimental design. It is worth noting that the best result of 480.10 mg of sugars/gds, obtained at 45°C, pH 3.5, and 96 hours of incubation, was significant also when compared with the results previously reached by process optimization with commercial enzymes.

  12. Abiotic and Biotic Degradation of Oxo-Biodegradable Plastic Bags by Pleurotus ostreatus

    Science.gov (United States)

    da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Bazzolli, Denise Mara Soares; Tótola, Marcos Rogério; Demuner, Antônio Jacinto; Kasuya, Maria Catarina Megumi

    2014-01-01

    In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as substrates for P. ostreatus. We observed that physical treatment alone was not sufficient to initiate degradation. Instead, mechanical modifications and reduced titanium oxide (TiO2) concentrations caused by sunlight exposure triggered microbial degradation. The low specificity of lignocellulolytic enzymes and presence of endomycotic nitrogen-fixing microorganisms were also contributing factors in this process. PMID:25419675

  13. Laccase production by Pleurotus ostreatus and its application in synthesis of gold nanoparticles

    Directory of Open Access Journals (Sweden)

    Ahmed I. El-Batal

    2015-03-01

    Optimization of production conditions yielded an enzyme with activity over 32,450 IU/g of fermented substrate. Factorial design was capable of establishing the conditions that multiplied the activity of the enzyme several folds, consequently, reducing the cost of production. The enzyme was capable of decolorizing several dyes with over 80% reduction in color confirming the aromatic degrading capability of laccase. The enzyme was also used in the synthesis of gold nanoparticles, proving that laccase from Pleurotus ostreatus has a strong potential in several industrial applications.

  14. Electrical stimulation in white oyster mushroom (Pleurotus florida) production

    Science.gov (United States)

    Roshita, I.; Nurfazira, K. M. P.; Fern, C. Shi; Ain, M. S. Nur

    2017-09-01

    White oyster mushroom (Pleurotus florida) is an edible mushroom that gained popularity due to its nutritional values, low production cost and ease of cultivation. There are several research reported on the mushroom fruiting bodies which were actively developed when applying electrical shock treatment. This study was aimed to investigate the effects of different electrical voltages on the growth and yield of white oyster mushroom (Pleurotus florida). Five different electrical voltages had been applied during spawning period which were 6V, 9V, 12V, 15V and mushroom bags without any treatment served as control. Treatment at 6V showed the highest rate for mycelium growth while 15V took the shortest time for fruiting body formation. However, no significant different (P>0.05) among all the treatments was observed for the time taken for the mycelium to fill-up the bag and pinhead emergence. The total fresh weight and percentage of biological efficiency for treatment at 9V showed higher values compared to control. Treatment at 9V also showed the largest pileus diameter and the most firm in the pileus texture. Meanwhile, treatment at 6V showed the highest a* value (redness). In addition, different electrical voltage treatments applied did not show any significant effect on substrate utilization efficiency, colour L* and b* values. In conclusion, among all the electrical treatments applied, 9V could be considered as the best treatment to enhance the yield of white oyster mushroom.

  15. Production of ligninolytic enzymes by solid state fermentation using Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Seyma Ozcirak Ergun

    2017-06-01

    Full Text Available Solid state fermentation (SSF stands out in the production of lignocellulolytic and other industrially important enzymes. SSF, an alternative culture method, has several advantages over the conventional submerged ones, like higher yields of enzymes. The production of ligninolytic enzymes, such as laccase (Lac, manganese peroxidase (MnP, lignin peroxidase (LiP and aryl alcohol oxidase (AAO by Pleurotus ostreatus (Jacq. Pleurotus Kumm. (MCC16 was investigated under SSF, which was performed using a support-substrate from potato peel waste (PPW. PPW as dry and fresh was pretreated with base to neutralize organic acids and distilled water. Chemical content of PPW was investigated. Ligninolytic enzyme production patterns were investigated during the growth of the organism for a period of 23 days at 25 °C in the stationary SSF using pretreated PPW. The highest Lac and MnP activities were determined in dry PPW, pretreated with distilled water as 6708.3 ± 75 U/L and 2503.6 ± 50 U/L on day 17, respectively. In addition, amylase and protease enzyme activities were detected under same conditions. According to the results, PPW has a potential as supports for ligninolytic enzyme production by P. ostreatus under SSF.

  16. UTILIZACIÓN DE CHONTADURO (Bactris gasipaes ENRIQUECIDA CON Pleurotus ostreatus EN POLLOS

    Directory of Open Access Journals (Sweden)

    JOSE MIGUEL CAMPO GAVIRIA

    2017-12-01

    Full Text Available In commercial poultry production, 70% of the production costs are related to feeding, this is a limiting factor affecting the profitability. This study aimed to evaluate the inclusion of chontaduro peel (Bactris gasipaes, enriched with the (Pleurotus ostreatus fungus, in the feeding of broilers; using a completely randomized design, with five treatments and three repetitions per treatment, with inclusion levels of 0,10% and 20% of chontaduro fruit peel, and 10 and 20% of chontaduro fruit peel enriched with the fungus (Pleurotus ostreatus. The productive behavior of the lot was determined by the feed intake, weight gain, feed conversion, skin pigmentation and cost benefit ratio of the portions. In this regard, no statistical differences (p <0,05 between treatments for all production variables evaluated were found, except for pigmentation, which was higher with levels of 20% of inclusion; as well as the positive effect in economic terms where the addition of a 20% of chontaduro peel flour enriched with the fungus is favorable because of the better cost-benefit ratio, without significantly affectingthe productive behavior.

  17. Increase of the productivity of pleurotus ostreatus and their use in the petroleum biodegradation

    International Nuclear Information System (INIS)

    Cardona U, Fernando; Restrepo R, Dora Patricia; Nino, Pilar; Gonzalez, Raul

    2002-01-01

    This work is divided in two phases: in the first one a substrate what help to increase productivity of the white-rot fungi pleurotus ostreatus was looked, this was reached combining different kinds of substrates; in the second phase, the contribution in biodegradation of pleurotus ostreatus into the substrate obtained in the first phase and contaminated with heavy part of Cusiana oil was looked. The quantification in the augmentation of productivity was obtained taking the weight of fungi collected of each substrate and comparing it between the, until finding the best one. To quantify the biodegradation the method of determination of greases, oils, and hydrocarbons of petroleum in solids by Soxhlet method was used. The highest substrate in productivity was the mix of 70% of cotton quinine and 30% of hay with 3- 5% of seed, thiamine and vegetable oil. For the biodegradation study concentration less than 25% were used, at higher concentrations a partial inhibition was detected. When the substrate was contaminated with 10% of Cusiana oil the biodegradation was more efficient

  18. The effect of repair inhibitor on radiation damages of pleurotus ostreatus

    International Nuclear Information System (INIS)

    Yang Zongqu; Wang Bonan; Li Xuzhao

    1996-01-01

    The growth rate and enzyme activities significantly decreased when dikaryotic hypha of Pleurotus ostreatus were irradiated with γ-rays and subsequently treated with either caffeine or Na 2 -EDTA in comparison with γ-rays treatment alone. The inhibition effect of treatment with either caffeine or Na 2 -EDTA before irradiation was more obvious than that after irradiation. Treatment with either caffeine or Na 2 -EDTA could cause biological damages on hypha when the concentrations of caffeine and Na 2 -EDTA were up to 0.5 and 1.0 mg/ml respectively. It is suggested that either caffeine or Na 2 -EDTA be used to suppress the repair of radiation damage in order to increase mutation efficiency of Pleurotus ostreatus and that 0.2 mg/ml caffeine and 0.5 mg/ml Na 2 -EDTA might be the proper concentrations of treatment both before and after irradiation. The effect of caffeine is better than that of Na 2 -EDTA

  19. Biodegradation of 2,4 dichlorophenol by Pleurotus ostreatus DSM 1833

    Directory of Open Access Journals (Sweden)

    Heloisa Helena Batista da Silva

    2009-12-01

    Full Text Available This work aimed to investigate the capacity of Pleurotus ostreatus DSM 1833 to degrade 2,4-dichlorophenol, important pollutant found in the wastewaters of the paper and cellulose industry. Using a factorial design 2², the concentrations of glucose and 2,4-dichlorophenol varied between 0 and 10g.L-1 and 5 and 30mg.L-1, respectively. The best global biodegradation rate was obtained using 30 mg.L-1 of 2,4- dichlorophenol in the absence of glucose. This culture medium was used for scaling up the process, resulting in a global biodegradation rate of 0.47mg.L-1.h-1. A comparative test between an inoculated medium and an abiotic control demonstrated that 54.1% of 2,4- dichlorophenol degradation could be attributed to the presence of P. ostreatus.A indústria de papel e celulose contribui para a contaminação ambiental devido aos resíduos gerados, especialmente, no processo de branqueamento da polpa Kraft, realizada com cloro. Basideomicetos saprófitas têm a capacidade de degradar compostos organoclorados como cloroligninas e clorofenóis. Este trabalho teve como objetivo investigar a capacidade de Pleurotus ostreatus DSM 1833 em degradar 2,4-diclorofenol, importante poluente encontrado nos efluentes da indústria de papel e celulose. Utilizando um planejamento fatorial 2², as concentrações de glicose e de 2,4-diclorofenol variaram entre 0 e 10 g.L-1 e 5 e 30 mg.L-1, respectivamente. A melhor taxa global de degradação foi obtida usando-se 30 mg.L-1 de 2,4-diclorofenol na ausência de glicose. Este meio de cultura foi utilizado para a ampliação da escala do processo, resultando em uma taxa global de biodegradação de 0,47 mg.L-1.h-1. Um teste comparativo entre o meio inoculado e o controle abiótico demonstrou que 54,1% da degradação do 2,4-diclorofenol pode ser atribuída à presença de Pleurotus ostreatus.

  20. Production of exopolysaccharides in submerged cultures of gamma irradiation pleurotus ostreatus

    International Nuclear Information System (INIS)

    Khalaf, M.A.; Atia, A.I.

    2009-01-01

    Mushrooms have become attractive as a functional food and as a source for the development of drugs and nutraceuticals. Pleurotus ostreatus is considered as the best among them. The exopolysaccharides (EPS) of mushrooms demonstrated a strong antitumor and antioxidant action. However, there is little information available in the literature about the optimization of fermentation conditions for production of EPS by P. ostreatus. So, the effect of medium composition and fermentation parameters on mycelial growth and EPS production by gamma irradiated isolate of P. ostreatus were investigated in shake-flask cultures. The economical optimum fermentation parameters for the highest EPS production 5.73 g/l and mycelial growth rate 11.8 g/l were achieved at initial ph 6, cultivation temperature 28 C(degree), 20 g/l sucrose, 4 g/l yeast extract, 50 ml of medium working volume in a 250 ml flask, and 6% (v/v) of inoculum size after 10 and 12 days, respectively. EPS produced, in this study, showed strong antioxidant activity (96.3%) at concentration 10 mg/ml.

  1. Biosorption of malachite green from aqueous solutions by Pleurotus ostreatus using Taguchi method

    Science.gov (United States)

    2014-01-01

    Dyes released into the environment have been posing a serious threat to natural ecosystems and aquatic life due to presence of heat, light, chemical and other exposures stable. In this study, the Pleurotus ostreatus (a macro-fungus) was used as a new biosorbent to study the biosorption of hazardous malachite green (MG) from aqueous solutions. The effective disposal of P. ostreatus is a meaningful work for environmental protection and maximum utilization of agricultural residues. The operational parameters such as biosorbent dose, pH, and ionic strength were investigated in a series of batch studies at 25°C. Freundlich isotherm model was described well for the biosorption equilibrium data. The biosorption process followed the pseudo-second-order kinetic model. Taguchi method was used to simplify the experimental number for determining the significance of factors and the optimum levels of experimental factors for MG biosorption. Biosorbent dose and initial MG concentration had significant influences on the percent removal and biosorption capacity. The highest percent removal reached 89.58% and the largest biosorption capacity reached 32.33 mg/g. The Fourier transform infrared spectroscopy (FTIR) showed that the functional groups such as, carboxyl, hydroxyl, amino and phosphonate groups on the biosorbent surface could be the potential adsorption sites for MG biosorption. P. ostreatus can be considered as an alternative biosorbent for the removal of dyes from aqueous solutions. PMID:24620852

  2. High temperature induced disruption of the cell wall integrity and structure in Pleurotus ostreatus mycelia.

    Science.gov (United States)

    Qiu, Zhiheng; Wu, Xiangli; Gao, Wei; Zhang, Jinxia; Huang, Chenyang

    2018-05-30

    Fungal cells are surrounded by a tight cell wall to protect them from harmful environmental conditions and to resist lysis. The synthesis and assembly determine the shape, structure, and integrity of the cell wall during the process of mycelial growth and development. High temperature is an important abiotic stress, which affects the synthesis and assembly of cell walls. In the present study, the chitin and β-1,3-glucan concentrations in the cell wall of Pleurotus ostreatus mycelia were changed after high-temperature treatment. Significantly higher chitin and β-1,3-glucan concentrations were detected at 36 °C than those incubated at 28 °C. With the increased temperature, many aberrant chitin deposition patches occurred, and the distribution of chitin in the cell wall was uneven. Moreover, high temperature disrupts the cell wall integrity, and P. ostreatus mycelia became hypersensitive to cell wall-perturbing agents at 36 °C. The cell wall structure tended to shrink or distorted after high temperature. The cell walls were observed to be thicker and looser by using transmission electron microscopy. High temperature can decrease the mannose content in the cell wall and increase the relative cell wall porosity. According to infrared absorption spectrum, high temperature broke or decreased the glycosidic linkages. Finally, P. ostreatus mycelial cell wall was easily degraded by lysing enzymes after high-temperature treatment. In other words, the cell wall destruction caused by high temperature may be a breakthrough for P. ostreatus to be easily infected by Trichoderma.

  3. Lentinula edodes and Pleurotus ostreatus: functional food with antioxidant -antimicrobial activityand an important source of Vitamin D and medicinal compounds

    Directory of Open Access Journals (Sweden)

    Simone Parola

    2017-10-01

    Full Text Available Background: Mushrooms produce a large amount of medicinal compounds, and are also an optimal source of fibres, proteins, vitamins (like groups B and D, and other micronutrients including potassium, magnesium, etc. Consequently, mushrooms are commonly considered to be functional foods. Many works report the high biological potentials of medicinal mushrooms involving their antibacterial, hypoglycaemic, anticholesterolemic, radical scavenging, and anti-inflammatory effects. Context and purpose of this study: First off, this work aimed to find strains of Lentinula edodes and Pleurotus ostreatus from a bank of edible mushrooms bought from international strain banks (Table I that could possess health benefit related properties, such as a radical scavenging activity (antioxidant effect, antibacterial effects against common pathogenic bacteria, and being able to produce interesting nutrients and secondary metabolites. As the fungal bank comprises of 20 strains of L. edodes and 20 strains of P. ostreatus, a first screening was made by the selection of 13 strains for each mushroom able to grow in multiple wood types or that were particularly productive and had proved good growth reproducibility over the last 5 years. This work also studied the correlation between culture conditions and mushroom quality in terms of the previously reported properties. Comparison among the selected strains was operated by the assessment of antioxidant and antimicrobial activities after different sample treatments. Furthermore, an initial optimization of the analytic techniques was produced for the direct estimation of important secondary metabolites and nutrients by means of HPLC-MS/MS technique. Further research will encompass an evaluation of transformation processes (drying, freezing, rehydration, cooking, etc. impact on radical scavenging, antibacterial activity, and possible degradation/loss of nutraceutically important substances such as vitamin D2, ergothioneine

  4. Performance of oyster mushroom (Pleurotus ostreatus) in different ...

    African Journals Online (AJOL)

    USER

    2012-05-08

    May 8, 2012 ... These mixtures were compressed by pressing down with bottle in transparent poly bags ... The bags were then opened after two weeks and left open for mushroom ..... results of this work are within the range they reported.The.

  5. Selective adhesion of wastewater bacteria to Pleurotus ostreatus mycelium in a trickle-bed bioreactor

    Directory of Open Access Journals (Sweden)

    Čeněk Novotný

    2016-07-01

    Full Text Available The work is focused on spontaneous colonization of fungal mycelium by invading microorganisms in a trickle-bed fungal bioreactor operating under semi-sterile conditions. Pleurotus ostreatus was grown under the flow of synthetic wastewater containing activated sludge bacteria and the microbial consortium developed in the reactor was characterized. Genotype and phenotype profile of the reactor-invading, bacterial consortium was clearly distinctive from that of the original activated sludge. The bacterial consortium from the reactor contained a higher portion of bacteria capable of cellobiose utilization and a small amount of bacteria with the ability to utilize benzoic acids. The invading bacteria had no effect on the dye decolorization performance of the fungal reactor. Five bacterial strains colonizing P. ostreatus reactor cultures were isolated and identified as species of the genera Pseudomonas and Bacillus. Except for Bacillus cereus all strains displayed a potential to inhibit fungal growth on solid media (14 to 51 % inhibition which was comparable or higher than that of the reference bacterial strains. The pH- and media composition-dependence of the growth inhibition was demonstrated.

  6. Biodegradation of endocrine disruptors in urban wastewater using Pleurotus ostreatus bioreactor.

    Science.gov (United States)

    Křesinová, Zdena; Linhartová, Lucie; Filipová, Alena; Ezechiáš, Martin; Mašín, Pavel; Cajthaml, Tomáš

    2018-07-25

    The white rot fungus Pleurotus ostreatus HK 35, which is also an edible industrial mushroom commonly cultivated in farms, was tested in the degradation of typical representatives of endocrine disrupters (EDCs; bisphenol A, estrone, 17β-estradiol, estriol, 17α-ethinylestradiol, triclosan and 4-n-nonylphenol); its degradation efficiency under model laboratory conditions was greater than 90% within 12 days and better than that of another published strain P. ostreatus 3004. A spent mushroom substrate from a local farm was tested for its applicability in various batch and trickle-bed reactors in degrading EDCs in model fortified and real communal wastewater. The reactors were tested under various regimes including a pilot-scale trickle-bed reactor, which was finally tested at a wastewater treatment plant. The result revealed that the spent substrate is an efficient biodegradation agent, where the fungus was usually able to remove about 95% of EDCs together with suppression of the estrogenic activity of the sample. The results showed the fungus was able to operate in the presence of bacterial microflora in wastewater without any substantial negative effects on the degradation abilities. Finally, a pilot-scale trickle-bed reactor was installed in a wastewater treatment plant and successfully operated for 10days, where the bioreactor was able to remove more than 76% of EDCs present in the wastewater. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. High protein complementation with high fiber substrates for oyster ...

    African Journals Online (AJOL)

    Agricultural residues have been world widely accepted for oyster mushroom culture. In this study, we used wheat straw, barley straw, maize stem residue, and lawn residue as substrates coupled with wheat bran, rice bran and soybean powder as complements for the growth of Pleurotus florida and Pleurotus ostreatus as ...

  8. Tratamento do feno de braquiária pelo fungo Pleurotus ostreatus Pretreatment effects on fiber degradation of brachiaria hay by Pleurotus ostreatus fungus

    Directory of Open Access Journals (Sweden)

    Patrick Schmidt

    2003-12-01

    Full Text Available A inoculação de forragens com fungos lignocelulolíticos é uma opção para melhorar a qualidade destas sem adição de produtos químicos. O tratamento do substrato influencia a ação do fungo e a qualidade final do produto. Neste experimento, aplicaram-se quatro tratamentos (compostagem do feno inteiro, compostagem do feno picado, hidratação do feno em água fria e hidratação do feno em água quente a um feno de Brachiaria decumbens. Aos tratamentos seguiu-se inoculação com o fungo Pleurotus ostreatus e incubação por 35 dias, sob temperatura controlada. Usou-se o delineamento inteiramente casualizado, com quatro repetições e medidas repetidas. Amostras foram colhidas semanalmente para acompanhar a degradação do substrato, mediante a análise química do feno. Observou-se aumento linear, com o decorrer do tempo, no teor de proteína bruta (PB e na proporção de lignina na parede celular (LIG-FDN, e decréscimo linear nos valores de fibra em detergente neutro (FDN, celulose e hemicelulose. Não se observou efeito de tratamento no teor de FDA. Os tratamentos com compostagem apresentaram maiores valores de PB, lignina e LIG-FDN e menores de FDN e hemicelulose. Não se observou diferença entre os tratamentos com hidratação. O tratamento do feno de braquiária com o fungo propiciou degradação da fração fibrosa e aumento no teor de PB, com efeito mais intenso nos tratamentos que usaram compostagem. A ação do fungo foi mais efetiva sobre a hemicelulose que sobre os demais componentes da fibra.The innoculation of forages with lignocellulolytic fungi is an option for improving quality without adding chemical products. Substrate quality influences fungal activity and endproduct quality. The effects of four treatments (composting of whole hay, composting of chopped hay, soaking in cool water and soaking in hot water on a Brachiaria decumbens hay were evaluated. The treatments were followed by innoculation with Pleurotus ostreatus

  9. Pleurotus ostreatus

    African Journals Online (AJOL)

    badr

    2011-11-07

    Nov 7, 2011 ... Evaluation of nutritional substrate and physical stress. (gamma ... cows. Lavi et al. (2010) stated that mushroom poly- saccharides are potent substances that exhibit anti-tumor ...... A brief history of heat, chemical and radiation.

  10. Anti-Growth Factors Associated with Pleurotus ostreatus in a Submerged Liquid Fermentation

    Directory of Open Access Journals (Sweden)

    Juliet B. Akinyele

    2012-09-01

    Full Text Available Aims: Previous studies had revealed that cultivation of Pleurotus ostreatus is often met with a lot of challenges ranging from environmental to biological factors which adversely affect the successful cultivation of the mushroom. Hence, a need to determine factors against mycelia colonization of substrate during mushroom’s cultivation.Methodology and Result: Conventional streak method was employed to establish the percentage inhibition as well as intercolony distance between the test organisms obtained from the infected substrate and mycelia of the mushroom during substrate colonization. The test organisms are: a fungus, Kutilakesopsis macalpineae and a bacterium,Pseudomonas tolaasii. The effect of pH and temperature on the mycelia growth of P. ostreatus was also investigated. There was a gradual increase in the percentage inhibition from 33.3 % at 24 h to 75.0 % at 168 h for K. macalpineae and 37.5 % at 24 h to 70.0 at 168 h for P. tolaasii. The inter-colony distance between the antagonists and the mushroom mycelium gradually decreased. Optical density of the mycelium growth was at its optimum at pH 4.5 and temperature of25 °C respectively. In vitro study also showed a significant increase in the optical density from 0.855±0.03 at 24 h to 1.316±0.02 at 168 h in the absence of test antagonist as against 0.812±0.06 and 0.79±0.02 at 24 h to 1.103±0.03 and 0.902±0.03 at 168 h when K. macalpineae and P.tolaasii were used as test antagonistic respectively.Conclusion, significance and impact of study: Sterilization of substrate is essential to avoid contamination during mycelia colonization. Also, slightly acidic medium and temperature control is necessary for high yield of fruit bodies.

  11. Effect of agroforestry residues partially biodegraded by pleurotus ostreatus (pleurotaceae) on tomato seedlings development

    International Nuclear Information System (INIS)

    Luna Fontalvo, Jorge Alberto; Cordoba Lopez, Laura Sofia; Gil Pertuz, Karina Isabel; Romero Borja, Isaac Manuel

    2013-01-01

    It was evaluated the development of tomato seedlings (plant bioindicator of toxicity) in soils with sawdust and rice husk partially biodegraded by Pleurotus ostreatus in greenhouse conditions. Both organic compounds (carbon, cellulose, lignin, extractives, and organic matter), and inorganic compounds (nitrogen, phosphorus and pH) were determined, before and after fungus inoculation on sawdust and rice husk. Mixtures were held of each substrate with a nutrient poor soil in equal proportions (1:1) and the moisture content was determined. The experiment consisted of a completely randomized, with two groups of six treatments for each substrate, and 30 days later, parameters of growth and development were identified. biodegraded substrates presented low C, N and P. bsa + sf treatment (biodegraded sawdust + fertilized soil) presented the best results in the number of leaves (12.9), plant height (25.94 cm), root length (5.92 cm), dry weight (0.138 g), and fresh weight (1.012 g). bsa + sf substrate can work as favorable substrate for growing tomato seedlings, bsa + sf substrate can work as favorable substrate for growing of tomato seedlings, since it provides the nutrients necessary for a good growth. Plants in rice bran did not grow adequately for transplanting.

  12. A novel stirrer design and its application in submerged fermentation of the edible fungus Pleurotus ostreatus.

    Science.gov (United States)

    Zhu, Hu; Sun, Jiao; Tian, Baozhen; Wang, Honglin

    2015-03-01

    In this study, a straight diagonal-pitched blade stirrer was designed, built and characterized in a 5-L fermenter. Compared with the six straight blade Rushton turbine, the power consumption of the new stirrer is lower at a given speed under conditions of no ventilation. The oxygen transference is poorer at the same agitation speed in the cultivation conditions and scales investigated, which confirms that the shear stress of the new stirrer is lower and the gas dispersion is weaker. The new stirrer was installed in a 5-L bioreactor and evaluated in submerged fermentation of the edible fungus Pleurotus ostreatus. The results showed that the maximum dry weight of mycelium is increased by 47 % and reached 7.47 g/L, and the maximum laccase activity is increased by 15 % up to 2,277 U/L. Glucose consumption was also found to be relatively faster. The power consumption is 2.8 % lower than that of the Rushton turbine.

  13. Characterization and in vitro antioxidant activities of polysaccharides from Pleurotus ostreatus.

    Science.gov (United States)

    Zhang, Yunxia; Dai, Ling; Kong, Xiaowei; Chen, Liangwen

    2012-10-01

    Two polysaccharide fractions (PSPO-1a and PSPO-4a) were isolated from the fruiting bodies of Pleurotus ostreatus using ethanol precipitation, anion-exchange chromatography and gel permeation chromatography. Both fractions were heteropolysaccharide containing protein and uronic acid. PSPO-1a was composed of mannose, glucose, galactose, xylose and rhamnose with a molar ratio of 2.47:0.91:1.00:1.66:3.87. PSPO-4a was composed of only three monosaccharides: rhamnose, mannose and galactose with a molar ratio of 0.92:2.69:1.00. The average molecular weight of PSPO-1a and PSPO-4a determined by HPLC were estimated to be 1.8 × 10(4)Da and 1.1 × 10(6)Da respectively. The in vitro tests revealed that two polysaccharides were natural potential antioxidant. Both polysaccharides presented stronger DPPH radical and superoxide anion radical scavenging activity with increasing concentrations, but less effective on scavenging hydroxyl radical. Compared with PSPO-4a, PSPO-1a was the more effective free-radical scavenger. In conclusion, the two polysaccharides may be useful as a naturally potential antioxidant agent for application in food and medicinal fields. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. Optimization of King Oyster Mushroom (Pleurotus eryngii Substrate Using Lignocellulosic Affordable Wastes

    Directory of Open Access Journals (Sweden)

    javad janpoor

    2018-03-01

    Full Text Available Introduction: King oyster mushroom (Pleurotus eryngii belongs to Basidiomycota division, Agaricomycetes class and Pleurotaceae family. This mushroom generally grows on wood wastes of Apiaceae family. The Pleurotus eryngii is found in pastures, meadows, gardens and seldom in grassy forest clearings and hilly areas. The Pleurotus of the Umbellifers occupy an area in the Northern hemisphere between the 30 and 50º N. These species are mainly found in the subtropical regions of the Mediterranean, Central Europe, Russia, Ukraine, Central Asia and Iran. The P. eryngii sensulato is the only taxon within the genus, which grows in association with plants. P. eryngii has distinguishable characteristics such as coherent texture, unique form, favorable taste and high durability. Mushroom cultivation represents the only current economically viable biotechnology process for the conversion of waste plant residues from forests and agriculture. The species of these genera show much diversity in their adaptation the varying agro-climatic condition which makes more cultivated species than other mushrooms. Special ability of Pleurotus family is growing in lingocellulosic plant or agricultural wastes without needing to prepared compost and casing soil. Pleurotus is an efficient lignin- degrading mushroom and can grow and yield well on different types of lignocellulolosic materials. Type of substrates for mushroom growing depends on available plant or agricultural wastes. In Europe, wheat straw is used for mushroom growing; whereas in Asian South-East countries sawdust is more popular. Different materials for cultivating of P. eryngii have been suggested in different regions of the world; but a few studies have been done on suitability of various lignocellulosic affordable wastes for P. eryngii production in Iran. Therefore, the current study aims to evaluate effects of various locally available agro wastes on the growth characteristics of King oyster mushroom (P

  15. Biological transformation of anthracene in soil by Pleurotus ostreatus under solid-state fermentation conditions using wheat bran and compost

    International Nuclear Information System (INIS)

    Vargas, M C; Rodriguez, R; Sanchez, F; Ramirez, N

    2001-01-01

    Pleurotus ostreatus was grown in a soil mixture contaminated with anthracene, wheat bran and compost, in varying combinations. Assays with added bacteria and reinoculation of the fungus were also included. The results indicated that in many of the combinations, most of the anthracene was removed at the earliest sample time, 15 days. The most effective combination was spiked (anthracene-added) soil, fungus and compost and the addition of acclimated bacteria to this mixture inhibited anthracene removal. Analyses of extract by high-pressure liquid chromatography HPLC indicated that - anthraquinone, was the major metabolite formed. The results of this study indicate that solid-state fermentation of anthracene-contaminated soils using P. ostreatus in combination with wheat bran and compost additives can produce an accelerated rate of biological removal of anthracene from the soil

  16. Biodegradation of remazol brilliant blue R by ligninolytic enzymatic complex produced by Pleurotus ostreatus Biodegradação do azul brilhante de remazol R pelo complexo enzimático ligninolítico produzido por Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Kátia Maria Gomes Machado

    2006-12-01

    Full Text Available Pleurotus ostreatus ("shimeji" is produced in Brazil on a commercial scale using various lignocellulosic residues. Efforts have been made to reuse the culture residue to obtain products of greater aggregate value such as enzymes or in processes of bioremediation. We evaluated the Remazol brilliant blue R (RBBR degradation potential of extracts from solid substrate colonized by P. ostreatus and extracts from residue of the "shimeji" mushroom yield. Colonized substrates and residue were provided by Toyobo do Brasil Ltda. Extraction was performed with sodium acetate buffer (50 mM, pH 4.6. RBBR decolorization was monitored at 592 nm and peroxidase and laccase activities were measured by monitoring the oxidation of ABTS. Horseradish peroxidase was used as reference. The time of growth of P. ostreatus influenced RBBR degradation and peroxidase and laccase activities. Concentration of 1 mM H2O2 and pH 4.0 were the best for RBBR decolorization. Complete RBBR decolorization was obtained with the addition of only one aliquot of 50 µL of 1 mM H2O2. The stability of the extracts was higher when they were kept under refrigeration than when stored frozen. The potential application of the ligninolytic complex derived from P. ostreatus and mushroom residue for xenobiotic degradation was demonstrated.Pleurotus ostreatus ("shimeji" é produzido no Brasil em escala comercial empregando-se vários resíduos lignocelulósicos. Esforços têm sido feitos para reaproveitamento do resíduo do cultivo em produtos de maior valor agregado, como enzimas ou sua aplicação em processos de biorremediação. Foi feita avaliação do potencial de degradação do azul brilhante de remazol (RBBR por extratos obtidos de substratos sólidos colonizados por P. ostreatus e por extratos do resíduo da produção do cogumelo "shimeji". Substratos colonizados e o resíduo foram fornecidos pela Toyobo do Brasil Ltda. Extração foi feita com tampão acetato de sódio (50 mM, pH 4

  17. SYNTHESIS OF AROMA COMPOUNDS BY Pleurotus ostreatus (Jacq.:Fr. Kumm. CULTURED ON VARIOUS SUBSTRATES E. N. Vlasenko, J. V. Stepnevskaya, O. V.

    Directory of Open Access Journals (Sweden)

    E. N. Vlasenko

    2017-08-01

    Full Text Available The aim of the study was to determine the intensity of synthesis of volatile aroma compounds by Pleurotus ostreatus (oyster mushroom on sunflower husks and barley straw using sensory profile analysis and UV spectroscopy. The main cultural and morphological characteristics of the mycelial growth and development of fruiting bodies are determined: the period of mycelial development on the substrate, the time of primordial formation, the number of mushroom bunches per unit volume of substrate, the morphology of carpophores. Characteristic attributes of the aroma of dried fruiting bodies (mushroom, woody, sweet, herbaceous, fish, meat, floral, earthy, acidic, putrescent are established and their aroma profiles are built. Sensory profile analysis of flavor of dried samples showed that the mushroom flavor of fungi cultivated on the sunflower husk is more pronounced than of those grown on barley straw. The light absorption maxima are recorded in the ranges 204–210 and 250–290 nm according to UV absorption spectra. Optimal conditions for extracting aromatics from dried fungi samples are the extraction time of 20–35 min at the boiling point of the solvent. Analysis of the UV spectra of fungal alcohol and hexane extracts showed that the intensity of the synthesis of volatile compounds is higher for strains cultivated on sunflower husks than for samples obtained on barley straw.

  18. Influence of xylem ray integrity and degree of polymerization on bending strength of beech wood decayed by Pleurotus ostreatus and Trametes versicolor

    Science.gov (United States)

    Ehsan Bari; Reza Oladi; Olaf Schmidt; Carol A. Clausen; Katie Ohno; Darrel D. Nicholas; Mehrdad Ghodskhah Daryaei; Maryam Karim

    2015-01-01

    The scope of this research was to evaluate the influence of xylem ray (XR) and degree of polymerization (DP) of holocellulose in Oriental beech wood (Fagus orientalis Lipsky.) on impact bending strength against two white-rot fungi. Beech wood specimens, exposed to Pleurotus ostreatus and Trametes versicolor, were evaluated for...

  19. Effect of Agroforestry Residues Partially Biodegraded by Pleurotus Ostreatus (Pleurotaceae on Tomato Seedlings Development

    Directory of Open Access Journals (Sweden)

    Jorge Alberto Luna Fontalvo

    2013-05-01

    Se evaluó el desarrollo de plántulas de tomate (planta bioindicadora de toxicidad en suelos con aserrín y cascarilla de arroz parcialmente biodegradados por Pleurotus Ostreatus bajo condiciones de invernadero. Se determinaron los componentes orgánicos (carbono, celulosa, lignina, extraíbles y materia orgánica e inorgánicos (nitrógeno, fósforo y pH antes y después de inocular el hongo en el aserrín y la cascarilla de arroz. Se realizaron mezclas de cada sustrato con un suelo pobre en nutrientes en proporciones iguales (1:1 y se les determinó el porcentaje de humedad. El experimento estuvo constituido por un diseño completamente aleatorio, con dos grupos de seis tratamientos para cada sustrato, a los 30 días se determinaron los parámetros de crecimiento y desarrollo de las plántulas. Los sustratos biodegradados reportaron bajo contenido de C, N y P. El tratamiento aserrín biodegradado + suelo fertilizado (ASB + SF, presentó los mejores resultados en número de hojas (12,9, altura de las plantas (25,94 cm, longitud radical (5,92 cm, peso seco (0,138 g y peso fresco (1,012 g. El sustrato ASB + SF puede funcionar como sustrato favorable para el cultivo de plántulas de tomate debido a que aporta los nutrientes necesarios para el buen crecimiento de las plántulas. En la cascarilla de arroz las plantas no crecieron adecuadamente para conseguir ser trasplantadas.

  20. Growth and fruit body formation of Pleurotus ostreatus on media supplemented with inorganic selenium

    Directory of Open Access Journals (Sweden)

    Savić Milena D.

    2009-01-01

    Full Text Available Selenium is a trace mineral chemically related to sulfur and tellurium. In the body selenium combines with protein molecules to form selenoproteins and it is distributed in low concentrations and unequally in air, soil and water all over the world. Edible mushrooms are known to be selenium accumulators. Since mushrooms contain relatively high protein levels, and they can accumulate large amounts of selenium, it is reasonable to expect that selenium could be incorporated into proteins. The growth of mycelia and fruit body formation of different medicinal mushroom strains of Pleurotus ostreatus (Hk-35 and P70 over the wide range of concentrations of inorganic form of selenium were examined. Mushrooms were cultivated on agar base media and on substrates based on sawdust. Vegetative growths of mycelium were measured as colony diameter in pure cultures supplemented with inorganic form of Se supplements, prepared as Na2SeO4 and Na2SeO3 in concentrations of: 1, 10, 25, 50, 75, 100 and 150 mg/l. Inorganic form of Se supplements, showed stimulation effects (in concentration of 1-50 mg/l and toxic effects in higher concentration. On the standard industrial sawdust based substrate, supplemented with 100 mg/kg Na2SeO4 and Na2SeO3, accumulation of Se in fruit bodies was determined by the method of flameless atomic absorption spectrophotometer. The readings were performed on Varian SpectrAA-10 spectrophotometer equipped with VGA-76. Se as Na2SeO4 and Na2SeO3 was effectively taken up from substrates and accumulated in fruit bodies. Mushrooms accumulated selenium between 120 and 250 mg/kg dry weight. In mushrooms cultivated without Se supplement, Se contents were only about 1 mg/kg and in substrate about 0.1 mg/kg.

  1. VALOR NUTRICIONAL DEL HENO DE TRANSVALA INOCULADO CON EL HONGO Pleurotus ostreatus sp

    Directory of Open Access Journals (Sweden)

    Rodolfo WingChing-Jones

    2009-01-01

    Full Text Available Se analizó el valor nutricional del heno de Transvala utilizado en la producción del hongo comestible Pleurotus ostreatus. El heno fue analizado antes de inocular el hongo y después de la cosecha. Se determinó: materia seca (MS, proteína cruda (PC, extracto etéreo (EE, ceniza (Ce, digestibilidad in vitro de la MS (DIVMS, carbohidratos no fibrosos (CNF, fibra detergente neutro (FDN, fibra detergente ácido (FDA, lignina, nitrógeno ligado a la fibra detergente neutro (N-FDN y a la fibra detergente ácida (N-FDA, nutrimentos digestibles totales (NDT (1X, energía digestible (ED, energía metabolizable (EM, energía neta de lactancia (ENl, energía de mantenimiento (ENm y energía neta de ganancia (ENg. Sobresalen niveles bajos de PC, DIVMS y NDT; y valores altos de lignina, FDN y FDA. El contenido de MS, FDN, hemicelulosa (He, lignina, CNF y EE presentó diferencias significativas, debidas al crecimiento del hongo. La variación en calidad en estas variables fue de (- 48,75%, (- 24,76%, (- 80,22%, (- 27,94%, (+ 51,52% y (- 26,13%, respectivamente. La mejoría en la calidad nutricional del heno, después de la cosecha del hongo, no es tan significativa como para cambiar la perspectiva en su uso dentro de la ración total de rumiantes, por lo que el beneficio del heno se basa más en aspectos físicos que nutricionales.

  2. Assessment of Gardening Wastes as a Co-Substrate for Diapers Degradation by the Fungus Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Rosa María Espinosa-Valdemar

    2015-05-01

    Full Text Available Waste with high biomass content generated in cities in developing countries is sent to landfills or open dumps. This research aims to degrade biomass content in urban waste through cultivation, at pilot scale, of the edible mushroom Pleurotus ostreatus. First, the number of diapers used by one baby per week was measured with a survey in day care facilities. Then, cellulose content of diapers was assessed. Finally, cultivation of P. ostreatus was carried out using as substrate a mixture of diapers with gardening waste, a co-substrate readily available at urban settings. The factors assessed were strain of P. ostreatus (grey BPR-81, white BPR-5, conditioning of the substrate (diapers with and without plastic and co-substrate (wheat straw, grass, and withered leaves. Results show that diapers are a valuable source of biomass, as generation of diapers with urine is 15.3 kg/child/month and they contain 50.2% by weight of cellulose. The highest reductions in dry weight and volume (>64% of substrates was achieved with the substrate diaper without plastic and co-substrate wheat straw. Although diapers with plastic and grass and leaves showed lower degradation, they achieved efficiencies that make them suitable as a co-substrate (>40%, considering that their biomass is currently confined in landfills.

  3. Oyster mushroom (Pleurotus spp.) cultivation technique using re ...

    African Journals Online (AJOL)

    SARAH

    2014-08-31

    Aug 31, 2014 ... using re-usable substrate containers and comparison of ... oyster mushrooms in combination with other vegetables complements availability of various essential ..... higher than from oyster mushrooms produced from any.

  4. Identification of pyrG Used as an Endogenous Reference Gene in Qualitative and Real-Time Quantitative PCR Detection of Pleurotus ostreatus.

    Science.gov (United States)

    Zheng, Shi; Shan, Luying; Zhuang, Yongliang; Shang, Ying

    2018-03-01

    As a well-known edible fungus rich in nutrients, Pleurotus ostreatus has been used as an alternative to expensive wild edible fungi. Specifically, the fact that using P. ostreatus instead of other expensive wild edible fungi has damaged the rights and interests of consumers. Among the existing methods for detection of food adulteration, the amplification of endogenous reference gene is the most accurate method. However, an ideal endogenous reference gene for P. ostreatus has yet to be developed. In this study, a DNA extraction method for P. ostreatus was optimized, and pyrG was selected as a species-specific gene through sequence alignment. This gene was subsequently subjected to qualitative and quantitative Polymerase Chain Reaction (PCR) assays with 3 different P. ostreatus varieties and 7 other species. A low detection limit of 5 pg/μL was obtained by TaqMan quantitative PCR, and no pyrG amplification product was observed in the 7 other species. No allelic variation was detected in P. ostreatus varieties. These experiments confirmed that pyrG was an ideal endogenous reference gene for the qualitative and real-time quantitative PCR detection of P. ostreatus. This method was also suitable for the examination of processed P. ostreatus samples and determination of adulteration in wild mushrooms. The pyrG gene was chosen as an ideal endogenous reference gene for the qualitative and real-time quantitative PCR detection of P. ostreatus, and the detection limit was 5 pg/μL for the quantification. This method is used not only for raw materials but also for processed P. ostreatus products and other processed mushroom foods. © 2018 Institute of Food Technologists®.

  5. Evaluation of the Synergistic Effect of Mixed Cultures of White-Rot Fungus Pleurotus ostreatus and Biosurfactant-Producing Bacteria on DDT Biodegradation.

    Science.gov (United States)

    Purnomo, Adi Setyo; Ashari, Khoirul; Hermansyah, Farizha Triyogi

    2017-07-28

    DDT (1,1,1-trichloro-2,2- bis (4-chlorophenyl) ethane) is one of the organic synthetic pesticides that has many negative effects for human health and the environment. The purpose of this study was to investigate the synergistic effect of mixed cutures of white-rot fungus, Pleurotus ostreatus , and biosurfactant-producing bacteria, Pseudomonas aeruginosa and Bacillus subtilis , on DDT biodegradation. Bacteria were added into the P. ostreatus culture (mycelial wet weight on average by 8.53 g) in concentrations of 1, 3, 5, and 10 ml (1 ml ≈ 1.25 × 10 9 bacteria cells/ml culture). DDT was degraded to approximately 19% by P. ostreatus during the 7-day incubation period. The principal result of this study was that the addition of 3 ml of P. aeruginosa into P. ostreatus culture gave the highest DDT degradation rate (approximately 86%) during the 7-day incubation period. This mixed culture combination of the fungus and bacteria also gave the best ratio of optimization of 1.91. DDD (1,1-dichloro-2,2- bis (4-chlorophenyl) ethane), DDE (1,1-dichloro-2,2- bis (4-chlorophenyl) ethylene), and DDMU (1-chloro-2,2- bis (4-chlorophenyl) ethylene) were detected as metabolic products from the DDT degradation by P. ostreatus and P. aeruginosa . The results of this study indicate that P. aeruginosa has a synergistic relationship with P. ostreatus and can be used to optimize the degradation of DDT by P. ostreatus .

  6. Caracterización de la lacasa obtenida por dos métodos de producción con Pleurotus ostreatus Characterising laccase obtained by two production methods using Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Martínez César

    2003-12-01

    Full Text Available El objetivo de este trabajo fue caracterizar y evaluar diferentes métodos de purificación y separación cromatográfica de un caldo rico en enzima lacasa, producida por una variedad del basidiomycete Pleurotus ostreatus. Se llevaron a cabo dos procesos de producción, a saber: a FES (Fermentación en Estado Sólido; b fermentación en sumergido. El proceso de FES se basó en la producción de un extracto de caldo crudo rico en enzima lacasa a partir del crecimiento micelial sobre salvado con vinaza en relación 1:1 w/v duran te 20 días. Se obtuvo un caldo crudo con una actividad promedio de 20 U/ml. En el caso del proceso de fermentación en sumergido, se trabajó con el medio reportado por Hublick y Schinner (2000 con algunas modificaciones, y se obtuvo un crecimiento del hongo en forma de pellets, en un período de 15 días, con actividad promedio de 10 U/ml en el caldo crudo. Las isoenzimas aisladas en los procesos cromatográficos se caracterizaron de acuerdo a sus propiedades moleculares y cinéticas, se determinó su peso molecular por electroforesis de placa vertical (SDS-PAGE y sus parámetros cinéticos, por ejemplo estabilidad, en un rango de temperatura y pH. Palabras clave: lacasa; Pleurotus ostreatus; fermentación en estado sólido (FES; fermentación en sumergido; isoenzimas; laccase; Pleurotus ostreatus; Solid State Fermentation (SSF; Submerged Fermentation; isoenzymesThis project was designed for characterising and evaluating different methods of chromatographic separation and purification regarding a laccase enzyme-rich broth produced by Pleurotus ostreatus, a variety of basidiomycetes. SSF (Solid State Fermentation and Submerged Fermentation production processes were employed. The SSF process was based on producing a raw broth rich in laccase enzyme from mycelium grown on bran with 1:1 vinasse w/v for 20 days. A raw broth was obtained having an average 20 U/ml activity. The medium reported by Hublick and Schinner (2000

  7. Yield and nutritional composition of oyster mushroom strains newly introduced in Bangladesh

    Directory of Open Access Journals (Sweden)

    Mostak Ahmed

    2013-02-01

    Full Text Available The objective of this work was to evaluate yield and chemical composition of oyster mushroom strains newly introduced in Bangladesh. Strains of Pleurotus high‑king (strain PHK, P. ostreatus (strain PO2, and P. geesteranus (strains PG1 and PG3 were evaluated as to yield components and proximate composition. Pleurotus ostreatus was used as control. Pleurotus high‑king showed fastest growth of primordia, but moderate flush of effective fruiting bodies. Pleurotus geesteranus (PG1 showed higher economic yield and biological performance, and better chemical composition, especially in terms of protein and mineral contents. Pleurotus geesteranus (PG1 shows better performance than P. ostreatus (PO2, the most commercially cultivated edible species in Bangladesh, and, therefore, it should be recommended for commercial cultivation.

  8. In Vitro Antimicrobial and Antioxidant Activities of Ethanolic Extract of Lyophilized Mycelium of Pleurotus ostreatus PQMZ91109

    Directory of Open Access Journals (Sweden)

    Emanuel Vamanu

    2012-03-01

    Full Text Available The antioxidant and antimicrobial potential of the ethanolic extract of Pleurotus ostreatus PQMZ91109 mycelium was determined based on inorganic and organic nitrogen sources in the culture medium. The presence of ammonium sulfate resulted in a greater accumulation of bioactive compounds compared with the organic ones. This finding was also confirmed by the low values of the ascertained EC50 and minimum inhibitory concentration (MICs. Among the organic sources, peptone followed by corn extract, led to a more important radical-scavenging activity. The extracts selectively inhibited the tested strains, mainly the two of the genus Candida, at an MIC value of 1.25 mg/mL. The antioxidant potential was evaluated by the inhibition capacity of the 2,2-diphenyl-1-picrylhydrazyl (DPPH radical, β-carotene-linoleic acid, which is the reducing power. In addition, the quantity of the compounds with antioxidant effects confirmed the data obtained, they being present in the extracts.

  9. Cultivation of oyster mushroom ( Pleurotus spp.) on palm oil ...

    African Journals Online (AJOL)

    Oyster mushroom is a popular mushroom due to its nutritional, medicinal and potential commercial value. In Malaysia, the fungus is currently cultivated on sawdust and rice husk. In this study, the efficiency of cultivating oyster mushroom was assessed using palm oil mesocarp fibre as a substrate. The experiment consisted ...

  10. Valorization of spent oyster mushroom substrate and laccase recovery through successive solid state cultivation of Pleurotus, Ganoderma, and Lentinula strains.

    Science.gov (United States)

    Economou, Christina N; Diamantopoulou, Panagiota A; Philippoussis, Antonios N

    2017-06-01

    Spent mushroom substrate (SMS) of Pleurotus ostreatus was supplemented with wheat bran and soybean flour in various proportions to obtain C/N ratios of 10, 20, and 30, and their effect was evaluated in successive cultivation of Pleurotus ostreatus, Pleurotus pulmonarius, Ganoderma adspersum, Ganoderma resinaceum, and Lentinula edodes strains with respect to mycelium growth rate, biomass concentration, recovery of the enzyme laccase and crude exopolysaccharides, and also with additional fruiting body production. All fungi showed the highest growth rate on unamended SMS (C/N 30), with G. resinaceum being the fastest colonizer (Kr = 9.84 mm day -1 ), while biomass concentration maximized at C/N 10. Moreover, supplementation affected positively laccase activity, with P. pulmonarius furnishing the highest value (44,363.22 U g -1 ) at C/N 20. On the contrary, L. edodes growth, fruiting, and laccase secretion were not favored by SMS supplementation. Fruiting body formation was promoted at C/N 30 for Ganoderma and at C/N 20 for Pleurotus species. Exopolysaccharide production of further studied Pleurotus strains was favored at a C/N 20 ratio, at the initial stage of SMS colonization. The obtained results support the potential effective utilization of supplemented SMS for laccase production from Ganoderma spp. and for new fruiting body production of Pleurotus spp.

  11. Total Phenolics, Flavonoids, Tannin Contents and Antioxidant Properties of Pleurotus ostreatus Cultivated on Different Wastes and Sawdust

    Directory of Open Access Journals (Sweden)

    Ayşenur Yılmaz

    2017-01-01

    Full Text Available In this study, the usage possibilities of some agro-industrial wastes such as; peanut wastes, potatoes farm wastes, walnut and orange tree sawdust in Pleurotus ostreatus cultivation were investigated and total phenolic, flavonoid, condensed tannin content and antioxidant properties of these methanolic mushroom extracts were examined. For the determination of the total phenolic contents, the Folin-Ciocalteau procedure was used. The content of total flavonoid present in the methanolic extracts was measured using a spectrophotometric assay. Condensed tannins were determined according to the method by Julkunen-Tıtto. The antioxidant capacity was determined using ferric reducing antioxidant power (FRAP and free radical scavenging activity of DPPH. The highest total phenolic content (2.672 ± 0.003 mg GAE/g was found in mushroom cultivated on walnut sawdust. The highest condensed tannin (1.011 ± 0.088 CE mg/g and ferric reducing antioxidant power (FRAP (12.332 ± 0.017 μmol FeSO4.7H2O/g were observed in the same mushroom extract. The highest total flavonoid and free radical scavenging activity of DPPH were found in extract of mushroom cultivated on potatoes handle. Bioactive properties of P. ostreatus cultivated on walnut tree sawdust were generally exhibited remarkable results.

  12. Integration of Artificial Neural Network Modeling and Genetic Algorithm Approach for Enrichment of Laccase Production in Solid State Fermentation by Pleurotus ostreatus

    OpenAIRE

    Potu Venkata Chiranjeevi; Moses Rajasekara Pandian; Sathish Thadikamala

    2014-01-01

    Black gram husk was used as a solid substrate for laccase production by Pleurotus ostreatus, and various fermentation conditions were optimized based on an artificial intelligence method. A total of six parameters, i.e., temperature, inoculum concentration, moisture content, CuSO4, glucose, and peptone concentrations, were optimized. A total of 50 experiments were conducted, and the obtained data were modeled by a hybrid of artificial neural network (ANN) and genetic algorithm (GA) approaches...

  13. A Macrosphelide as the Unexpected Product of a Pleurotus ostreatus Strain-Mediated Biotransformation of Halolactones Containing the gem-Dimethylcyclohexane Ring. Part 1

    Directory of Open Access Journals (Sweden)

    Katarzyna Wińska

    2016-06-01

    Full Text Available The aim of the study was to obtain new compounds during biotransformation of two halocompounds, the δ-bromo and δ-iodo-γ-bicyclolactones 1 and 2. Unexpectedly Pleurotus ostreatus produced together with the hydroxylactone, 2-hydroxy-4,4-dimethyl-9-oxabicyclo[4.3.0]nonane-8-one (3, its own metabolite (3S,9S,15S-(6E,12E-3,9,15-trimethyl-4,10,16-trioxacyclohexa-deca-6,12-diene-1,5,8,11,14-pentaone (4. The method presented here, in which this macrosphelide 4 was obtained by biotransformation, has not been previously described in the literature. To the best of our knowledge, this compound has been prepared only by chemical synthesis to date. This is the first report on the possibility of the biosynthesis of this compound by the Pleurotus ostreatus strain. The conditions and factors, like temperature, salts, organic solvents, affecting the production of this macrosphelide by Pleurotus ostreatus strain were examined. The highest yield of macroshphelide production was noticed for halolactones, as well with iodide, bromide, iron and copper (2+ ions as inductors.

  14. High-Temperature Induced Changes of Extracellular Metabolites in Pleurotus ostreatus and Their Positive Effects on the Growth of Trichoderma asperellum.

    Science.gov (United States)

    Qiu, Zhiheng; Wu, Xiangli; Zhang, Jinxia; Huang, Chenyang

    2018-01-01

    Pleurotus ostreatus is a widely cultivated edible fungus in China. Green mold disease of P. ostreatus which can seriously affect yield is a common disease during cultivation. It occurs mostly after P. ostreatus mycelia have been subjected to high temperatures. However, little information is available on the relationship between high temperature and green mold disease. The aim of this study is to prove that extracellular metabolites of P. ostreatus affected by high temperature can promote the growth of Trichoderma asperellum . After P. ostreatus mycelia was subjected to high temperature, the extracellular fluid of P. ostreatus showed a higher promoting effect on mycelial growth and conidial germination of T. asperellum . The thiobarbituric acid reactive substance (TBARS) content reached the maximum after 48 h at 36°C. A comprehensive metabolite profiling strategy involving gas chromatography-mass spectrometry (GC/MS) combined with liquid chromatography-mass spectrometry (LC/MS) was used to analyze the changes of extracellular metabolites in response to high temperature. A total of 141 differential metabolites were identified, including 84.4% up-regulated and 15.6% down-regulated. Exogenous metabolites whose concentrations were increased after high temperature were randomly selected, and nearly all of them were able to promote the mycelial growth and conidial germination of T. asperellum . The combination of all selected exogenous metabolites also has the promotion effects on the mycelial growth and conidial germination of T. asperellum in a given concentration range in vitro . Overall, these results provide a first view that high temperature affects the extracellular metabolites of P. ostreatus , and the extensive change in metabolites promotes T. asperellum growth.

  15. USO DEL BAGAZO ENRIQUECIDO CON EL HONGO Pleurotus ostreatus, EN DIETAS PARA BOVINOS ESTABULADOS EN CEBA UTILIZAÇÃO DO BAGAÇO ENRIQUECIDO COMO FUNGO Pleurotus ostreatus, EM DIETAS PARA BOVINOS ESTABULADOS EM ENGORDA Pleurotus ostreatus ENRICHED SUGAR CANEHUSKS UTILIZATION ON INDOOR CATTLEFATTENING DIETS

    Directory of Open Access Journals (Sweden)

    NATALIA LIZETTE CASTAÑO

    2012-12-01

    Full Text Available En la elaboración de la panela, entre el 40 y 54% es bagazo, el cual se caracteriza portener baja proteína y energía, altos compuestos lignocelulósicos, acompañado de una baja digestibilidad, por ello, tradicionalmente ha sido utilizado como combustiblepara las hornillas. El presente trabajo, evaluó el uso del bagazo enriquecido con el hongo Pleurotus ostreatus, como suplemento en dietas para bovinos, frente a otros tratamientos con y sin suplementación comercial. A todos los animales se les suministró una dieta balanceada que consistía en 18 Kg de pasto king grass (Saccharum sinense, 6 Kg de caña (Saccharum officinarum, 3 Kg de cogollo de caña (Saccharum officinarum, 3 Kg de gallinaza y 0,6 Kg de miel de panela, y suplemento ofrecido ad libitum a los tratamientos que lo requerían. Se analizaron las variables ganancia diaria de peso, conversión alimenticia, consumo de materiaseca y el efecto costo beneficio de la suplementación. No se presentaron diferencias significativas (PNa elaboração da rapadura, entre o 40% e 54% é bagaço, o qual se caracteriza por ter baixa proteína e energia, alto composto lignocelulósicos, acompanhado por uma baixa digestibilidade, portanto, tradicionalmente tem sido usado como combustível para os queimadores. Este trabalho avaliou o uso do bagaço enriquecido com o fungo Pleurotus ostreatus como suplemento em dietas para bovinos, comparado com outros tratamentos com e sem suplementação comercial. Aos animais todos foi subministrado uma dieta equilibrada que consistia de 18 Kg de grama king grass (Saccharum sinense, 6 Kg de cana (Saccharum officinarum, 3 Kg de broto de cana (Saccharum officinarum, 3 Kg de estrume e 0,6 Kg de mel de rapadura e suplemento oferecido ad libitum aos tratamentos que o requeiram. Analisaram-se as variáveis: ganho diário de peso, conversão alimentar e consumo de matéria seca e o efeito de custo benefício da suplementação. Não apresentaram diferen

  16. Substratum formulation for laccase and mycelial biomass production of Pleurotus ostreatusFormulação de substratos na produção de biomassa micelial e de lacase de Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Juliana Silveira do Valle

    2012-10-01

    Full Text Available Pleurotus ostreatus is a producer of biomass and laccase, an enzyme used in fermentation processes for the hydrolysis of lignocellulosic substrate, with potential use in biofuel production and animal feed. Thus, there is a need to seek more appropriate regional substrate for the production of mycelial biomass and laccase. Hence, the aim of this study was to evaluate the effect of physical and chemical characteristics of agro-industrial byproducts in a substratum formulation for the mycelial growth and laccase production by P. ostreatus. The experiment was conducted with the milled raw materials: soy fiber, wheat bran, rice bran, corn grain and corn cob that were separated according to size and analyzed for carbon/nitrogen (C/N ratio. Mycelial growth was evaluated on substratum in cylindrical tubes of borosilicate. Then laccase production was assessed using a 26-2 fractional factorial design with the variables: raw material granulometry and addition of minerals (copper, zinc, iron, cadmium and magnesium in the substrate. The production of laccase was determined by oxidation of ABTS (2,2’-bisazin-(3-ethylbenzothiazoline-6-sulfonic acid. The results indicate that the most important factor for mycelial growth is the holding capacity of oxygen in the substratum. For mycelial growth of P. ostreatus the corn cob and wheat bran are the best components for the substrate. The other raw materials reduced the mycelial growth. However the most important factor for the induction of laccase production is the reduction of particle size, increasing the contact area between the mycelium and the substratum. Pleurotus ostreatus é um produtor de biomassa e lacase, enzima utilizada em processos fermentativos para a hidrólise de substratos lignocelulósicos, com potencial de utilização na produção de biocombustíveis e na alimentação animal. Desta forma, há a necessidade de buscar substratos regionais mais apropriados para a produção de biomassa micelial

  17. PRODUKTIVITAS JAMUR TIRAM PUTIH (Pleurotus ostreatus PADA MEDIA LIMBAH SEKAM PADI DAN DAUN PISANG KERING SEBAGAI MEDIA ALTERNATIF

    Directory of Open Access Journals (Sweden)

    Suparti Suparti

    2015-08-01

    Full Text Available Jamur tiram putih (Pleurotus ostreatus merupakan jenis jamur pangan yang banyak dikonsumsi mengandung protein 27%. Kandungan protein pada jamur tiram putih dapat dipengaruhi oleh komposisi media tanam seperti selulosa, hemiselulosa, lignin dan nutrisi tambahan. Sekam padi dan daun pisang kering merupakan salah satu limbah organik yang dapat digunakan sebagai media alternatif untuk meningkatkan produktivitas jamur tiram putih.Tujuan penelitian ini adalah untuk mengetahui produktivitas jamur tiram putih yang ditumbuhkan pada media  limbah sekam padi dan daun pisang kering sebagai media alternatif. Jenis penelitian eksperimen dengan metode rancangan acak lengkap (RAL dua faktor yaitu faktor 1 penambahan sekam padi dan faktor 2 daun pisang kering (0%, 5%, 10%, 15%, masing-masing  dengan empat perlakuan dan dua kali ulangan.  Hasil analisis data menunjukkan bahwa penambahan sekam padi dan daun pisang kering  15% (S3T3 memberikan pengaruh nyata terhadap lama penyebaran miselium, jumlah badan buah dan berat segar jamur tiram putih.Perlakuan yang paling baik untuk pertumbuhan jamur pada perlakuan S3T3, dengan rata-rata lama penyebaran miselium 25,5 hari, jumlah badan buah 64,5 buah dan berat segar yang dihasilkan 402,5. Hasil data tersebut lebih tinggi dibandingkan dengan perlakuan yang lain.

  18. Bio-remediation of colored industrial wastewaters by the white-rot fungi Phanerochaete chrysosporium and Pleurotus ostreatus and their enzymes.

    Science.gov (United States)

    Faraco, V; Pezzella, C; Miele, A; Giardina, P; Sannia, G

    2009-04-01

    The effect of Phanerochaete chrysosporium and Pleurotus ostreatus whole cells and their ligninolytic enzymes on models of colored industrial wastewaters was evaluated. Models of acid, direct and reactive dye wastewaters from textile industry have been defined on the basis of discharged amounts, economic relevance and representativeness of chemical structures of the contained dyes. Phanerochaete chrysosporium provided an effective decolourization of direct dye wastewater model, reaching about 45% decolourization in only 1 day of treatment, and about 90% decolourization within 7 days, whilst P. ostreatus was able to decolorize and detoxify acid dye wastewater model providing 40% decolourization in only 1 day, and 60% in 7 days. P. ostreatus growth conditions that induce laccase production (up to 130,000 U/l) were identified, and extra-cellular enzyme mixtures, with known laccase isoenzyme composition, were produced and used in wastewater models decolourization. The mixtures decolorized and detoxified the acid dye wastewater model, suggesting laccases as the main agents of wastewater decolourization by P. ostreatus. A laccase mixture was immobilized by entrapment in Cu-alginate beads, and the immobilized enzymes were shown to be effective in batch decolourization, even after 15 stepwise additions of dye for a total exposure of about 1 month.

  19. KAJIAN MACAM LIMBAH DAN PENAMBAHAN TEPUNG TONGKOL JAGUNG TERHADAP PERTUMBUHAN DAN HASIL JAMUR TIRAM (Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Agung Setyarini

    2016-12-01

    Full Text Available One limiting for factor the production of oyster mushrooms was difficult to obtain the raw material of sengon wood sawdust, meanwhile, the production of oyster mushroom necessary need the nutrients in the form of bran or cornmeal. The purpose of this study was to study planting medium, the concentration of corn cob flour, and to find the effective interaction of these two factors on growth and yield of oyster mushroom. This study used a completely randomized design (CRD with two factors, concentration of media and corn cob flour. The media used in this study are sengon sawdust, glugu sawdust, acacia wood sawdust, rice straw and bagasse, while the concentration of corn cob flour was 0% per baglog, 1% per baglog, 2% per baglog, 3% per baglog and 4% per baglog. Data analysis was using F test level 5% and continued with Duncan test. The results of this study showed that sawdvst sengon media generally give better effect to the growth and yield of oyster mushroom, while corn cob flour treatment concentration was not known exactly in enhancing the growth and yield of oyster mushroom. Treatment of media accelerate the deployment of mycelium old, when appearing pin head, increasing the number of fruiting bodies in a single clump and increasing the mushroom fruit body weight. Extra flour treatment corncob accelerate as emerging pin head, increasing the number of fruiting bodies in a clump and increase total body weight of mushrooms.

  20. Bioconversion of apple pomace into a nutritionally enriched substrate by Candida utilis and Pleurotus ostreatus

    DEFF Research Database (Denmark)

    Villas-Bôas, Silas Granato; Esposito, E.; de Mendonca, M.M.

    2003-01-01

    , into an enriched substrate with increased digestibility for use as ruminant feed. After C. utilis fermentation, the protein level increased 100% and the mineral content 60%, accompanied by 8.2% of increase in the digestibility. The level of free sugars decreased 97% after substrate supplementation with ammonium...... the fermentation with P. ostreatus alone due to pectin and hemicellulose degradation. Considering the time required for fermentation, the C. utilis treatment was the most efficient treatment to convert apple pomace into a more nutritive substrate for ruminant feed....

  1. Pengaruh Campuran Ampas Tebu Dan Alang-Alang (Imperata Cylindrica) Sebagai Media Pertumbuhan Terhadap Kandungan Nutrisi Jamur Tiram Putih (Pleurotus Ostreatus)

    OpenAIRE

    Naila, Ishmatun; Purnomo, Adi Setyo

    2016-01-01

    Penelitian ini bertujuan untuk mengetahui pengaruh ampas tebu dan alang-alang (Imperata cylindrica) sebagai media pertumbuhan jamur tiram putih (Pleurotus ostreatus) terhadap kandungan nutrisinya. Ampas tebu dan alang-alang dipilih sebagai media pertumbuhan alternatif, karena tidak hanya mengandung lignoseluosa, tapi juga tersedia berlimpah di lingkungan. Variasi komposisi ampas tebu:alang-alang yang digunakan adalah 75:25 (A1); 50:50 (A2); 25:75 (A3); 0:100 (A4); dan 100:0 (A5). Pada penelit...

  2. Cambios en las propiedades físicas de un Inceptisol por la adición de substrato degradado con el hongo Pleurotus ostreatus Changes on physical properties of an Inceptisol influence of the degraded substrate by Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Herminio Paredes Valencia

    2010-01-01

    Full Text Available Para evaluar el efecto del substrato orgánico (aserrín de madera y 'estopa' de coco enriquecido con 40% de volúmenes iguales de hojas de plátano (Mussa sp., kudzú tropical (Pueraria phaseoloides y botón de oro (Tithonia diversifolia degradado por el hongo Pleurotus ostreatus (SDP sobre algunas propiedades físicas de un Inceptisol de Buenaventura, Valle del Cauca, Colombia, se incorporaron dosis crecientes de éste (0, 1.25, 2.5, 5, 10, 20, 40 y 80 g/kg en el suelo tamizado en malla de 2 mm. La mezcla se utilizó en materos sembrados con maíz durante 4 meses, momento en el cual se tomaron muestras para determinar los cambios en las propiedades del suelo. Se usó un diseño completamente al azar, con ocho tratamientos, cuatro repeticiones y dos profundidades de muestreo. La correlación entre la cantidad de SDP incorporado y la mayoría de propiedades físicas evaluadas fue altamente significativa. Comparadas con el control (sin SDP, las dosis de 20, 40 y 80 g/kg redujeron significativamente la densidad aparente del suelo, al tiempo que incrementaron la porosidad total, la macroporosidad, la retención de humedad a bajas tensiones y el contenido de materia orgánica. En las dosis de 40 y 80 g/kg se observó una reducción significativa de la susceptibilidad a la compactación, lo mismo que un incremento en el diámetro promedio ponderado de los agregados estables al agua. Los incrementos de la conductividad hidráulica saturada y la permeabilidad al aire no fueron significativos en relación con el control.To evaluate the effect of the degraded substrate by the mushroom Pleurotus ostreatus (DSP on some physical properties of an Inceptisol from Buenaventura, Colombia, different doses of DSP (0, 1.25, 2.5, 5, 10, 20, 40 and 80 g.kg-1 were incorporated in 2 mm-sieved soil. The mixtures were placed in pots and planted with maize during four months in a green house until the sampling time. Complete randomized design, with eight treatments, four

  3. Differential response of oyster shell powder on enzyme profile and nutritional value of oyster mushroom Pleurotus florida PF05.

    Science.gov (United States)

    Naraian, Ram; Narayan, Om Prakash; Srivastava, Jatin

    2014-01-01

    Oyster mushroom Pleurotus florida was cultivated on different combinations of wheat straw (WS) as basal substrate and oyster shell powder (OSP) supplement. The OSP supplementation considerably responded to different cultivation phases. The mycelium grew fast and showed rapid growth rate (8.91 mmd(-1)) in WS + OSP (97 + 3) combination while WS + OSP (92 + 8) showed maximum laccase (3.133 U/g) and Mn peroxidase (MnP) activities (0.091 U/g). The climax level of laccase (5.433 U/g) and MnP (0.097 U/g) was recorded during fruit body initiation in WS + OSP (97 + 3) and WS + OSP (98 + 2) combinations, respectively. The WS + OSP (97 + 3) combination represented the best condition for mushroom cultivation and produced the highest biological efficiency (147%). In addition, protein and lipid contents in fruit bodies were slightly improved in response to OSP. The carbohydrate was significantly increased by raising concentration of OSP. The highest values of protein, carbohydrate, and lipid noted were 31.3 μg/g, 0.0639 (g/g), and 0.373 (g/g) correspondingly. Conclusively it was evident that lower concentrations of OSP acted positively and relatively to higher concentrations and improved nutritional content which may suitably be used to enhance both yield and nutritional values of mushroom.

  4. Characterization of a novel single-stranded RNA mycovirus in pleurotus ostreatus

    International Nuclear Information System (INIS)

    Yu, Hyun Jae; Lim, Dongbin; Lee, Hyun-Sook

    2003-01-01

    A mycovirus, named oyster mushroom spherical virus (OMSV), was isolated from cultivated oyster mushrooms with a severe epidemic of oyster mushroom Die-back disease. OMSV was a 27-nm spherical virus encapsidating a single-stranded RNA (ssRNA) of 5.784 kb with a coat protein of approximately 28.5 kDa. The nucleotide sequence of the virus revealed that its genomic RNA was positive strand, containing 5784 bases with seven open reading frames (ORF). ORF1 had the motifs of RNA-dependent RNA polymerases (RdRp) and helicase. ORF2 encoded a coat protein. ORF3 to 7 could encode putative polypeptides of approximately 12, 12.5, 21, 14.5, and 23 kDa, respectively, but none of them showed significant similarity to any other known polypeptides. The 5' end of the viral RNA was uncapped and the 3' end was polyadenylated with 74 bases. Genomic structure and organization and the derived amino acid sequence of RdRp and helicase domain were similar to those of tymoviruses, a plant virus group

  5. USO DE HOJARASCA DE ROBLE y BAGAZO DE CAÑA EN LA PRODUCCIÓN DE Pleurotus ostreatus USO DA SERAPILHEIRA DE CARVALHO E BAGAÇO DA CANA NA PRODUÇÃO DO Pleurotus ostreatus USE OF THE OAK DEAD LEAVES AND SUGAR CANE BAGASSE IN THE Pleurotus ostreatus PRODUCTION

    Directory of Open Access Journals (Sweden)

    PILAR SUDIANY VARGAS

    2012-06-01

    Full Text Available Se evaluó hojarasca de roble en un relicto de bosque en la Vereda La Capilla de Cajibío (Cauca durante 6 meses, como sustrato para el crecimiento del hongo Pleurotus ostreatus, eligiendo árboles maduros con DAP entre 35 y 37 cm, obteniéndose un promedio de 7,41 kg de hojarasca por árbol. Se evaluó el crecimiento del hongo en hojarasca mezclada con bagazo de caña y 5 sustratos: T1: bagazo 100%, T2: roble 100%, T3: roble 75% y 25% de bagazo, T4: roble 50% y 50% bagazo y T5: roble 25% y 75% bagazo, logrando eficiencias biológicas de 221,1%, 44,35%, 52,78%, 90,30% y 109,12% respectivamente. Se observó relación inversa entre el contenido de hoja de roble y las eficiencias debido a la naturaleza coriácea y cerosa de la hoja. La mayoría de los carpóforos presentaron 5 a 12 cm de diámetro y contaminación causada por hongos competidores del género Trichoderma sp. Se detectaron cambios en la composición del sustrato agotado, principalmente incremento de minerales y proteínas y disminución de fibra en el bagazo de caña y en la hojarasca de roble, siendo apto para alimentación de animales poligástricos por el contenido de proteína micelial, presencia de celulosa y menor contenido de lignina.Avaliamos a produção de serapilheira em uma floresta na aldeia La Capilla de Cajibío, (Cauca, por 6 meses, como substrato para o crescimento do fungo Pleurotus ostreatus, escolhendo árvores maduras com DAP entre 35 e 37 cm, produzindo uma media de 7,41 kg de lixo por árvore. Avaliou-se o crescimento do fungo em folhas misturadas com bagaço de cana e 5 substratos: T1: bagaço de 100%, T2: carvalho de 100%, T3: carvalho 75% e 25% de bagaço, T4: carvalho 50% e bagaço 50% e T5: carvalho de 25% e 75% do bagaço, alcançando eficiências biológicas de 221,1%, 44,35%, 52,78%, 90,30% e 109,12%, respectivamente. Era uma associação inversa entre o conteúdo de folha de carvalho e eficiência devido à natureza de couro, folha waxy. A maioria dos

  6. Co-cultivation of mutant Penicillium oxalicum SAU(E)-3.510 and Pleurotus ostreatus for simultaneous biosynthesis of xylanase and laccase under solid-state fermentation.

    Science.gov (United States)

    Dwivedi, Pallavi; Vivekanand, V; Pareek, Nidhi; Sharma, Amit; Singh, Rajesh P

    2011-10-01

    Co-cultivation of mutant Penicillium oxalicum SAU(E)-3.510 and Pleurotus ostreatus MTCC 1804 was evaluated for the production of xylanase-laccase mixture under solid-state fermentation (SSF) condition. Growth compatibility between mutant P. oxalicum SAU(E)-3.510 and white rot fungi (P. ostreatus MTCC 1804, Trametes hirsuta MTCC 136 and Pycnoporus sp. MTCC 137) was analyzed by growing them on potato dextrose agar plate. Extracellular enzyme activities were determined spectrophotometrically. Under derived conditions, paired culturing of mutant P. oxalicum SAU(E)-3.510 and P. ostreatus MTCC 1804 resulted in 58% and 33% higher levels of xylanase and laccase production, respectively. A combination of sugarcane bagasse and black gram husk in a ratio of 3:1 was found to be the most ideal solid substrate and support for fungal colonization and enzyme production during co-cultivation. Maximum levels of xylanase (8205.31 ± 168.31 IU g(-1)) and laccase (375.53 ± 34.17 IU g(-1)) during SSF were obtained by using 4 g of solid support with 80% of moisture content. Furthermore, expressions of both xylanase and laccase were characterized during mixed culture by zymogram analysis. Improved levels of xylanase and laccase biosynthesis were achieved by co-culturing the mutant P. oxalicum SAU(E)-3.510 and P. ostreatus MTCC 1804. This may be because of efficient substrate utilization as compared to their respective monocultures in the presence of lignin degradation compounds because of synergistic action of xylanase and laccase. Understanding and developing the process of co-cultivation appears productive for the development of mixed enzyme preparation with tremendous potential for biobleaching. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. Use of medicinal plants in different composts for yield improvement of various strains of oyster mushroom

    International Nuclear Information System (INIS)

    Inam-ul-Haq, M.; Khan, M.N.; Khan, M.A.; Khan, M.A.; Javed, N.; Binyamin, R.; Irshad, G.

    2010-01-01

    Different of concentration of four medicinal plants viz., Eucalyptus camaldulensis, Azadirachta indica, Citrus lemon, Cymbopogon marginatus were investigated for the effect of certain active components in their parts, capable of increasing mushroom yield and controlling mushrooms pathogenic microbes which cause great loss in mushroom yield. Four strains of Oyster mushroom were selected on the basis of their well mycelial growth on MEA. For selection of best compost simple composts were also prepared without any medicinal plant products i.e., cotton, wheat, paddy straw. Corn stover composts and cotton compost gave the maximum yield. The dried leaves of the Citrus lemons, lemon grass and Neem cake (dried) were crushed, and the sawdust of the logs of Eucalyptus were incorporated with different doses of 2%, 3%, 4%, 5% w/w of substrates with cotton substrate before compost fermentation. Each of the compost bag having specific medicinal plant product with specific concentration were spawned with selected four strains of Oyster mushroom i.e., two local strain Pleurotus florida (P-17), Pleurotus ostreatus (P- 19) and two exotic strains Pleurotus (florida) ostreatus (WC536), Pleurotus ostreatus (WC-522). Spawn running and mushroom fruitification were allowed to develop under optimum environmental condition. The mushroom yield data of compost bags with different concentration of medicinal plant products plants were calculated. The results showed that presence of Neem cake and Citrus lemon in the substrate increased the yield of Oyster mushroom strains i.e. Pleurotus florida) ostreatus (WC-536) followed by P. ostreatus (WC-522) strain. Neem cake and Citrus lemon were more promising in improving yield of mushroom. These results led to the conclusion that addition of specific medicinal plants concentration to compost increases the yield of Oyster mushroom by reducing the incidence of microbes and is more preferable than chemicals due to their lethal effects during human

  8. Pleurotus ostreatus and Pleurotus pulmonarius

    African Journals Online (AJOL)

    STORAGESEVER

    2010-03-15

    Mar 15, 2010 ... was maintained on plate of potato dextrose agar (PDA). Degradation of ... 40% concentrate feed (40% corn, 10% wheat offal, 10% palm kernel cake, 20% ... meal) and 60% Pannicum maximum at 5% body weight. The rumen.

  9. Yield and nutritional composition of oyster mushroom strains newly introduced in Bangladesh Produtividade e composição nutricional de linhagens de cogumelo‑ostra recentemente lançadas em Bangladesh

    Directory of Open Access Journals (Sweden)

    Mostak Ahmed

    2013-02-01

    Full Text Available The objective of this work was to evaluate yield and chemical composition of oyster mushroom strains newly introduced in Bangladesh. Strains of Pleurotus high‑king (strain PHK, P. ostreatus (strain PO2, and P. geesteranus (strains PG1 and PG3 were evaluated as to yield components and proximate composition. Pleurotus ostreatus was used as control. Pleurotus high‑king showed fastest growth of primordia, but moderate flush of effective fruiting bodies. Pleurotus geesteranus (PG1 showed higher economic yield and biological performance, and better chemical composition, especially in terms of protein and mineral contents. Pleurotus geesteranus (PG1 shows better performance than P. ostreatus (PO2, the most commercially cultivated edible species in Bangladesh, and, therefore, it should be recommended for commercial cultivation.O objetivo deste trabalho foi avaliar a produtividade e a composição química de linhagens de cogumelo‑ostra introduzidas recentemente em Bangladesh. Linhagens de Pleurotus high‑king (linhagem PHK, P. ostreatus (linhagem PO2 e P. geesteranus (linhagens PG1 e PG3 foram avaliadas quanto aos componentes da produção e à composição proximal. Pleurotus ostreatus foi utilizado como controle. Pleurotus high‑king apresentou rápido crescimento de primórdios, mas fluxo moderado de corpos de frutificação efetivos. Pleurotus geesteranus (PG1 apresentou maior produtividade econômica e desempenho biológico, além de melhor composição química, especialmente em termos de conteúdos de proteína e minerais. Pleurotus geesteranus (PG1 apresenta melhor desempenho que P. ostreatus (linhagem PO2, a espécie comestível mais cultivada comercialmente em Bangladesh, e, portanto, deve ser recomendado para plantio comercial.

  10. Antiproliferative and apoptotic effect of Pleurotus ostreatus on human mammary carcinoma cell line (michigan cancer foundation-7

    Directory of Open Access Journals (Sweden)

    Krishnamoorthy Deepalakshmi

    2016-01-01

    Conclusion: The study demonstrates a potent anticancer property of P. ostreatus against human mammary carcinoma cells which might be of value in nutraceutical industry. Further investigations are essential to establish it as a treatment against breast cancer.

  11. Rare earth elements concentration in mushroom cultivation substrates affects the production process and fruit-bodies content of Pleurotus ostreatus and Cyclocybe cylindracea.

    Science.gov (United States)

    Koutrotsios, Georgios; Danezis, Georgios P; Georgiou, Constantinos A; Zervakis, Georgios I

    2018-04-20

    Concentrations of 16 rare earth elements (REEs) and two actinides were determined for the first time both in cultivated mushrooms and in their production substrates by inductively coupled plasma mass spectroscopy. Moreover, the effect of REEs on cultivation parameters and composition of the final product was assessed, together with their potential use for authentication purposes. The concentrations of REEs varied greatly among seven cultivation substrates and correlated with measurements in Cyclocybe cylindracea mushrooms; no such correlation was established in Pleurotus ostreatus. Reduction of hemicellulose, cellulose, and lignin in substrates during P. ostreatus cultivation was positively correlated with REE concentrations, which also affected the production performance depending on the species examined. In all cases, a negative correlation was established between bioconcentration factors (BCF) in mushrooms and REE content in substrates, while the effect of substrate composition on BCF values varied according to the element studied. The estimated daily intake values of REEs through mushroom consumption was at much lower levels than those reported as potentially harmful for human health. The content of REEs in cultivation substrates and in mushrooms revealed that the bioaccumulation of elements differed in each fungus. The nature/origin of substrates seemed to affect the concentration of REEs in mushrooms to a considerable extent. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

  12. Crystallization and preliminary X-ray crystallographic analysis of the small subunit of the heterodimeric laccase POXA3b from Pleurotus ostreatus

    Science.gov (United States)

    Ferraroni, Marta; Scozzafava, Andrea; Ullah, Sana; Tron, Thierry; Piscitelli, Alessandra; Sannia, Giovanni

    2014-01-01

    Laccases are multicopper oxidases of great biotechnological potential. While laccases are generally monomeric glycoproteins, the white-rot fungus Pleurotus ostreatus produces two closely related heterodimeric isoenzymes composed of a large subunit, homologous to the other fungal laccases, and a small subunit. The sequence of the small subunit does not show significant homology to any other protein or domain of known function and consequently its function is unknown. The highest similarity to proteins of known structure is to a putative enoyl-CoA hydratase/isomerase from Acinetobacter baumannii, which shows an identity of 27.8%. Diffraction-quality crystals of the small subunit of the heterodimeric laccase POXA3b (sPOXA3b) from P. ostreatus were obtained using the sitting-drop vapour-diffusion method at 294 K from a solution consisting of 1.8 M sodium formate, 0.1 M Tris–HCl pH 8.5. The crystals belonged to the tetragonal space group P41212 or P43212, with unit-cell parameters a = 126.6, c = 53.9 Å. The asymmetric unit contains two molecules related by a noncrystallographic twofold axis. A complete data set extending to a maximum resolution of 2.5 Å was collected at 100 K using a wavelength of 1.140 Å. PMID:24419623

  13. Radiosensitivity study and radiation effects on morphology characterization of grey oyster mushroom Pleurotus sajor-caju

    Energy Technology Data Exchange (ETDEWEB)

    Rashid, Rosnani Abdul; Awang, Mat Rasol; Mohamad, Azhar; Mutaat, Hassan Hamdani; Maskom, Mohd Meswan [Bioprocess Group, Agrotechnology and Biosciences Division, Malaysian Nuclear Agency, Bangi 43600, Selangor (Malaysia); Daud, Fauzi; Senafi, Sahidan [School of Bioscience and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, Bangi 43600, Selangor (Malaysia)

    2014-09-03

    Radiosensitive dosage and morphology characterization of irradiated grey oyster mushroom Pleurotus sajor-caju by gamma rays was investigated due to effects of irradiation. In order to establish the effect, mycelium of P. sajor-caju was irradiated by gamma rays at dose 0.1 to 8.0 kGy with dose rate 0.227 Gy sec{sup −1}. The irradiation of mycelia was carried out at the radiation facility in Malaysian Nuclear Agency. The radiosensitivity study was performed by evaluating the percentage of survival irradiated mycelia. The lethal dose of the mycelium P. sajor-caju was determined at 4.0 kGy and LD{sub 50} to be equal at 2.2 kGy. The radiation effects on morphology were evaluated based on growth rate of irradiated mycelia, mycelia types, colonization period on substrate, morphology of fruit bodies and yields. The results shown growth rate of irradiated mycelium was slightly lower than the control and decreased as the dose increased. Irradiation was found can induced the primordia formation on PDA and the BE of irradiated seed is higher than to control. The irradiation is proven to be useful for generating new varieties of mushroom with commercial value to the industry.

  14. PROSES PENGELOLAHAN MENINGKATKAN AKTIVITAS HIPOLIPIDEMIK JAMUR TIRAM (PLEUROTUS OSTREATUS PADA TIKUS (RATTUS NORVEGICUS SPRGUE-DAWLEY HIPERKOLESTEROL

    Directory of Open Access Journals (Sweden)

    Eni Harmayani, Deera Army Pramana, Sri Anggrahini dan Sutikarini

    2012-12-01

    Full Text Available Oyster mushroom is considered to have hypocholesterolemic and hypolipidemic activities. Therefore, it is classifiedas functional food. Prior to serving and consumption, oyster mushroom can be processed in various ways. Thisresearch studied the effect of three kinds of processing commonly used in cooking oyster mushroom; boiling,frying, and roasting. Thirty Sprague-Dawley male rats, 8 weeks old, were acclimated to laboratory condition,and then induced with high lipid diet. The rats were divided into five experiment groups; high-lipid diet (K,high-lipid diet + raw oyster mushroom (M, high-lipid diet + fried oyster mushroom (G, high-lipid diet + roastedoyster mushroom (P, and high-lipid diet + boiled oyster mushroom (R. Blood samples were obtained from orbitalplexus after acclimation, hypercholesterolemic induction, and 21 days of feeding. The blood serum was examinedfor total cholesterol (TC, triglyceride (TG, low-density lipoprotein cholesterol (LDL-c, dan high-densitylipoprotein cholesterol (HDL-c. The result showed that cooked oyster mushroom had better hypocholesterolemicand hypolipidemic activity than raw oyster mushroom. Among the three, the roasted oyster mushroom reduced thetotal cholesterol the most, while boiled oyster mushroom reduced triglyceride the most.

  15. Physicochemical and sensorial characteristics of noodle enriched with oyster mushroom (Pleorotus ostreatus) powder

    Science.gov (United States)

    Wahyono, A.; Novianti; Bakri, A.; Kasutjianingati

    2018-01-01

    Oyster Mushroom is a mushroom that can be used for food and medicine. It contains highly nutritious and functional substances such as statins and beta-glucan. A comprehensive evaluation of noodle-enriched with Oyster Mushroom powder has not been performed so far. In this study, we performed a comprehensive evaluation of noodle-enriched with Oyster Mushroom powder. The aim of this study was to assess the effects of enrichment of Oyster Mushroom Powder (OMP) on the quality of noodle. The quality of noodle was evaluated based on physical, chemical and sensorial characteristics. This study was done by substituting wheat flour with OMP at the level of 0 (control); 5; 7.5; 10; 12.5; and 15%. The results showed that OMP significantly affected (Pvalues of noodle.

  16. Bioconversion of lignocellulosic residues by Agrocybe cylindracea and Pleurotus ostreatus mushroom fungi--assessment of their effect on the final product and spent substrate properties.

    Science.gov (United States)

    Koutrotsios, Georgios; Mountzouris, Konstantinos C; Chatzipavlidis, Iordanis; Zervakis, Georgios I

    2014-10-15

    Nine agro-industrial and forestry by-products were subjected to solid-state fermentation by Agrocybe cylindracea and Pleurotus ostreatus, and the process and end-products were comparatively evaluated. Grape marc waste plus cotton gin trash was the best performing medium for both fungi, while substrate composition had a marked effect on most cultivation parameters. Biological efficiency was positively correlated with nitrogen, lignin and ash, and negatively with hemicelluloses and carbohydrate content of substrates. Spent substrates demonstrated high reductions in hemicelluloses and cellulose in contrast to lignin; fibre fractions were correlated with nitrogen, fat and ash content of initial materials, while residual mycelial biomass was affected by mushroom productivity. Mushroom proximate analysis revealed significant variations of constituents depending on the substrate. Crude protein and fat were correlated with substrates nitrogen for both species. Alternative cultivation substrates of high potential are proposed, while spent material could be exploited as animal feed due to its upgraded properties. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Extraction and Application of Laccases from Shimeji Mushrooms (Pleurotus ostreatus Residues in Decolourisation of Reactive Dyes and a Comparative Study Using Commercial Laccase from Aspergillus oryzae

    Directory of Open Access Journals (Sweden)

    Ricardo Sposina S. Teixeira

    2010-01-01

    Full Text Available Oxidases are able to degrade organic pollutants; however, high costs associated with biocatalysts production still hinder their use in environmental biocatalysis. Our study compared the action of a commercial laccase from Aspergillus oryzae and a rich extract from Pleurotus ostreatus cultivation residues in decolourisation of reactive dyes: Drimaren Blue X-3LR (DMBLR, Drimaren Blue X-BLN (DMBBLN, Drimaren Rubinol X-3LR (DMR, and Drimaren Blue C-R (RBBR. The colour removal was evaluated by considering dye concentration, reaction time, absence or presence of the mediator ABTS (2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid, and the source of laccase. The presence of ABTS was essential for decolourisation of DMR (80–90%, 1 h and RBBR (80–90%, 24 h with both laccases. The use of ABTS was not necessary in reactions containing DMBLR (85–97%, 1 h and DMBBLN (63–84%, 24 h. The decolourisation of DMBBLN by commercial laccase showed levels near 60% while the crude extract presented 80% in 24 h.

  18. Biotransformation of 1,8-cineole by solid-state fermentation of Eucalyptus waste from the essential oil industry using Pleurotus ostreatus and Favolus tenuiculus.

    Science.gov (United States)

    Omarini, Alejandra; Dambolena, José Sebastián; Lucini, Enrique; Jaramillo Mejía, Santiago; Albertó, Edgardo; Zygadlo, Julio A

    2016-03-01

    Biotechnological conversion of low-cost agro-industrial by-products, such as industrial waste or terpenes from the distillation of essential oils from plants into more valuable oxygenated derivatives, can be achieved by using microbial cells or enzymes. In Argentina, the essential oil industry produces several tons of waste each year that could be used as raw materials in the production of industrially relevant and value-added compounds. In this study, 1,8-cineole, one of the components remaining in the spent leaves of the Eucalyptus cinerea waste, was transformed by solid-state fermentation (SSF) using the two edible mushrooms Pleurotus ostreatus and Favolus tenuiculus. As a result, two new oxygenated derivatives of 1,8-cineole were identified: 1,3,3-trimethyl-2-oxabicyclo [2.2.2]octan-6-ol and 1,3,3-trimethyl-2-oxabicyclo [2.2.2]octan-6-one. Additionally, changes in the relative percentages of other aroma compounds present in the substrate were observed during SSF. Both fungal strains have the ability to produce aroma compounds with potential applications in the food and pharmaceutical industries.

  19. Electrochemistry Combined with LC-HRMS: Elucidating Transformation Products of the Recalcitrant Pharmaceutical Compound Carbamazepine Generated by the White-Rot Fungus Pleurotus ostreatus.

    Science.gov (United States)

    Seiwert, Bettina; Golan-Rozen, Naama; Weidauer, Cindy; Riemenschneider, Christina; Chefetz, Benny; Hadar, Yitzhak; Reemtsma, Thorsten

    2015-10-20

    Transformation products (TPs) of environmental pollutants must be identified to understand biodegradation processes and reaction mechanisms and to assess the efficiency of treatment processes. The combination of oxidation by an electrochemical cell (EC) with analysis by liquid chromatography-high-resolution mass spectrometry (LC-HRMS) is a rapid approach for the determination and identification of TPs generated by natural microbial processes. Electrochemically generated TPs of the recalcitrant pharmaceutical carbamazepine (CBZ) were used for a target screening for TPs formed by the white-rot fungus Pleurotus ostreatus. EC with LC-HRMS facilitates detection and identification of TPs because the product spectrum is not superimposed with biogenic metabolites and elevated substrate concentrations can be used. A group of 10 TPs formed in the microbial process were detected by target screening for molecular ions, and another 4 were detected by screening on the basis of characteristic fragment ions. Three of these TPs have never been reported before. For CBZ, EC with LC-HRMS was found to be more effective than software tools in defining targets for the screening and faster than nontarget screening alone in TP identification. EC with LC-HRMS may be used to feed MS databases with spectra of possible TPs of larger numbers of environmental contaminants for an efficient target screening.

  20. Diversity Profile and Dynamics of Peptaibols Produced by Green Mould Trichoderma Species in Interactions with Their Hosts Agaricus bisporus and Pleurotus ostreatus.

    Science.gov (United States)

    Marik, Tamás; Urbán, Péter; Tyagi, Chetna; Szekeres, András; Leitgeb, Balázs; Vágvölgyi, Máté; Manczinger, László; Druzhinina, Irina S; Vágvölgyi, Csaba; Kredics, László

    2017-06-01

    Certain Trichoderma species are causing serious losses in mushroom production worldwide. Trichoderma aggressivum and Trichoderma pleuroti are among the major causal agents of the green mould diseases affecting Agaricus bisporus and Pleurotus ostreatus, respectively. The genus Trichoderma is well-known for the production of bioactive secondary metabolites, including peptaibols, which are short, linear peptides containing unusual amino acid residues and being synthesised via non-ribosomal peptide synthetases (NRPSs). The aim of this study was to get more insight into the peptaibol production of T. aggressivum and T. pleuroti. HPLC/MS-based methods revealed the production of peptaibols closely related to hypomurocins B by T. aggressivum, while tripleurins representing a new group of 18-residue peptaibols were identified in T. pleuroti. Putative NRPS genes enabling the biosynthesis of the detected peptaibols could be found in the genomes of both Trichoderma species. In vitro experiments revealed that peptaibols are potential growth inhibitors of mushroom mycelia, and that the host mushrooms may have an influence on the peptaibol profiles of green mould agents. © 2017 Wiley-VHCA AG, Zurich, Switzerland.

  1. Bioremediation of aflatoxin B1-contaminated maize by king oyster mushroom (Pleurotus eryngii.

    Directory of Open Access Journals (Sweden)

    Maria Teresa Branà

    Full Text Available Aflatoxin B1 (AFB1 is the most harmful mycotoxin that occurs as natural contaminant of agricultural commodities, particularly maize. Practical solutions for detoxification of contaminated staples and reduction of agricultural wastes are scarce. We investigated the capability of the white-rot and edible fungus Plerotus eryngii (king oyster mushroom to degrade AFB1 both in vitro and in a laboratory-scale mushroom cultivation, using a substrate similar to that routinely used in mushroom farms. In malt extract broth, degradation of AFB1 (500 ng/mL by nine isolates of P. eryngii ranged from 81 to 99% after 10 days growth, and reached 100% for all isolates after 30 days. The growth of P. eryngii on solid medium (malt extract-agar, MEA was significantly reduced at concentrations of AFB1 500 ng/mL or higher. However, the addition of 5% wheat straw to the culture medium increased the tolerance of P. eryngii to AFB1 and no inhibition was observed at a AFB1 content of 500 ng/mL; degradation of AFB1 in MEA supplemented with 5% wheat straw and 2.5% (w/v maize flour was 71-94% after 30 days of growth. Further, AFB1 degradation by P. eryngii strain ITEM 13681 was tested in a laboratory-scale mushroom cultivation. The mushroom growth medium contained 25% (w/w of maize spiked with AFB1 to the final content of 128 μg/kg. Pleurotus eryngii degraded up to 86% of the AFB1 in 28 days, with no significant reduction of either biological efficiency or mushroom yield. Neither the biomass produced on the mushroom substrate nor the mature basidiocarps contained detectable levels of AFB1 or its metabolite aflatoxicol, thus ruling out the translocation of these toxins through the fungal thallus. These findings make a contribution towards the development of a novel technology for remediation of AFB1- contaminated corn through the exploitation of the degradative capability of P. eryngii and its bioconversion into high nutritional value material intended for feed production.

  2. Analisis Faktor-Faktor yang Mempengaruhi Pendapatan Usahatani Jamur Tiram (Pleurotus ostreatus) di Kota Medan dan Kabupaten Deli Serdang

    OpenAIRE

    Ginting, Nina Maksimiliana

    2015-01-01

    Oyster mushroom is a horticultural crop which is very good for health and has high economic value. Therefore, how big the economic value that can be gained is needs to be studied. The purpose of this study was to analyze the factors influencing the income of oyster mushroom farming in the City of Medan and Deli Serdang District. The data used in this study conducted in 2012 were primary and secondary data. The data obtained were analyzed through multiple linear regression tests using SPSS ...

  3. Preliminary study of platinum accumulation in the fruitbodies of a model fungal species: king oyster mushroom (Pleurotus eryngii)

    International Nuclear Information System (INIS)

    Urban, P.L.; Bazala, M.A.; Bystrzejewska-Piotrowska, G.; Pianka, D.; Steborowski, R.; Asztemborska, M.; Kowalska, J.; Manjon, J.L.; Kuthan, R.T.

    2005-01-01

    A model species of saprophytic fungus, king oyster mushroom (Pleurotus eryngii), was cultivated on barley substrate supplied with [Pt(NH 3 ) 4 ](NO 3 ) 2 , under well defined conditions. The samples of the collected fruiting bodies were digested and analyzed for total platinum content by means of ICP-MS. The results proved that platinum is not accumulated in the fruitbodies of Pleurotus eryngii for a wide range of Pt concentrations in the culture substrate (100-1000 ppb Pt in 50 ml of water solution added to ca. 450 g of hydrated barley seeds per container). Observable levels of Pt were only found in the fruitbodies obtained from the medium contaminated with 10000 ppb (10 ppm) platinum solution. This demonstrates significant difference in the effectiveness of platinum extraction in fungi and plants, which are capable to accumulate platinum even when supplied at lower concentration (<500 ppb). It also shows different physiological pathways of platinum and other elements which are easily accumulated in the fruitbodies of the same species. (author)

  4. Cambios en las propiedades físicas de un Inceptisol por la adición de substrato degradado con el hongo Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Gómez Carabalí Arnulfo

    2010-03-01

    Full Text Available Para evaluar el efecto del substrato orgánico (aserrín de madera y ‘estopa’ de coco enriquecido con 40% de volúmenes iguales de hojas de plátano (Mussa sp., kudzú tropical (Pueraria phaseoloides y botón de oro (Tithonia diversifolia degradado por el hongo Pleurotus ostreatus (SDP sobre algunas propiedades físicas de un Inceptisol de Buenaventura, Valle del Cauca, Colombia, se incorporaron dosis crecientes de éste (0, 1.25, 2.5, 5, 10, 20, 40 y 80 g/kg en el suelo tamizado en malla de 2 mm. La mezcla se utilizó en materos sembrados con maíz durante 4 meses, momento en el cual se tomaron muestras para determinar los cambios en las propiedades del suelo. Se usó un diseño completamente al azar, con ocho tratamientos, cuatro repeticiones y dos profundidades de muestreo. La correlación entre la cantidad de SDP incorporado y la mayoría de propiedades físicas evaluadas fue altamente significativa. Comparadas con el control (sin SDP, las dosis de 20, 40 y 80 g/kg redujeron significativamente la densidad aparente del suelo, al tiempo que incrementaron la porosidad total, la macroporosidad, la retención de humedad a bajas tensiones y el contenido de materia orgánica. En las dosis de 40 y 80 g/kg se observó una reducción significativa de la susceptibilidad a la compactación, lo mismo que un incremento en el diámetro promedio ponderado de los agregados estables al agua. Los incrementos de la conductividad hidráulica saturada y la permeabilidad al aire no fueron significativos en relación con el control.

  5. Cambios en las propiedades físicas de un Inceptisol por la adición de substrato degradado con el hongo Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Herminio Paredes Valencia

    2010-01-01

    Full Text Available Para evaluar el efecto del substrato orgánico (aserrín de madera y 'estopa' de coco enriquecido con 40% de volúmenes iguales de hojas de plátano (Mussa sp., kudzú tropical (Pueraria phaseoloides y botón de oro (Tithonia diversifolia degradado por el hongo Pleurotus ostreatus (SDP sobre algunas propiedades físicas de un Inceptisol de Buenaventura, Valle del Cauca, Colombia, se incorporaron dosis crecientes de éste (0, 1.25, 2.5, 5, 10, 20, 40 y 80 g/kg en el suelo tamizado en malla de 2 mm. La mezcla se utilizó en materos sembrados con maíz durante 4 meses, momento en el cual se tomaron muestras para determinar los cambios en las propiedades del suelo. Se usó un diseño completamente al azar, con ocho tratamientos, cuatro repeticiones y dos profundidades de muestreo. La correlación entre la cantidad de SDP incorporado y la mayoría de propiedades físicas evaluadas fue altamente significativa. Comparadas con el control (sin SDP, las dosis de 20, 40 y 80 g/kg redujeron significativamente la densidad aparente del suelo, al tiempo que incrementaron la porosidad total, la macroporosidad, la retención de humedad a bajas tensiones y el contenido de materia orgánica. En las dosis de 40 y 80 g/kg se observó una reducción significativa de la susceptibilidad a la compactación, lo mismo que un incremento en el diámetro promedio ponderado de los agregados estables al agua. Los incrementos de la conductividad hidráulica saturada y la permeabilidad al aire no fueron significativos en relación con el control.

  6. Composição mineral de uma linhagem de Pleurotus ostreatus cultivada em resíduos madeireiros e agroindustriais da região amazônica Mineral composition of Pleurotus ostreatus strain grown in wood and agroindustrial residues from the Amazon region

    Directory of Open Access Journals (Sweden)

    Ceci Sales-Campos

    2009-12-01

    Full Text Available Os cogumelos do gênero Pleurotus são cultivados em diversos substratos lignocelulósicos, dada a atividade decompositora desses organismos proveniente de seu metabolismo enzimático. O presente estudo teve como objetivo analisar a composição mineral de Pleurotus ostreatus e dos substratos de cultivo preparados à base de resíduos madeireiros e agroindustriais da região amazônica. Foram analisados macro (P, K, Ca e Mg e micronutrientes (Fe, Zn, Cu, Mn e Na dos cogumelos e dos substratos. Os substratos foram formulados a partir da serragem de Simarouba amara Aubl. (marupá, Ochroma piramidale Cav. ex. Lam. (pau de balsa e de bagaços de Bactris gasipaes Kunth (pupunheira e de Saccharum officinarum (cana-de-açúcar. As amostras foram solubilizadas mediante digestão ácida (nítrico-peridrol. Os elementos Ca, Mg, Fe, Cu, Zn e Mn foram determinados por espectrometria de absorção atômica; o Na e K, por emissão atômica e o P, por colorimetria. A composição mineral do cogumelo variou com o substrato de cultivo. Os diferentes substratos possibilitaram a produção de um cogumelo rico em K, P, Mg e Fe, essenciais à nutrição e à saúde humana. O potássio foi o mineral de maior teor no cogumelo em todos os substratos testados (36,83-42,18 g.kg-1, seguido de fósforo (6,95-10,60 g.kg-1 e do magnésio (1,57-2,50 g.kg-1.Mushrooms belonging to the Pleurotus gender are grown in several lignocellulosic substrates due to the decomposing activity of these organisms that result from their enzymatic metabolism. The objective of the present study was to analyze the mineral composition of Pleurotus ostreatus and the cultivation substrates prepared with wood and agroindustrial residues from the Amazon region. Macro (P, K, Ca and Mg and micronutrients (Fe, Zn, Cu, Mn and Na of mushroom and substrates were analyzed. Substrates were formulated from Simarouba amara Aubl. and Ochroma piramidale Cav. ex. Lam. sawdust and crushed Bactris gasipaes Kunth

  7. An environmentally friendly and cost effective technique for the commercial cultivation of oyster mushroom [Pleurotus florida (Mont.) Singer].

    Science.gov (United States)

    Panjikkaran, Seeja Thomachan; Mathew, Deepu

    2013-03-15

    The existing protocol for the cultivation of oyster mushroom (Pleurotus florida) in polyethylene bags leads to environmental pollution amounting to 18 g of polyethylene per 450 g of mushroom, which is the average biological efficiency achieved from a bag. Thus the projected annual global pollution amounts to 2 million tones, corresponding to the production of 48 million tones. Experiments were conducted at Kerala Agricultural University, India, to formulate an oyster mushroom cultivation strategy that reduces this pollution level. Pooled results of experiments at the institute's and farmers' units have shown that reusable plastic buckets having perforations of 1.5 cm × 1.0 cm throughout the side walls could be used to substitute polyethylene bags, while following the standard cultivation protocols. Cultivation in perforated buckets has recorded a biological efficiency of 435.69 ± 56.75 g in 47.07 ± 5.22 days against 459.11 ± 53.52 g in 38.05 ± 4.54 days in polyethylene bags. The rate of contamination in buckets was significantly lower than that in bags: 9.28 ± 2.12 and 12.60 ± 3.73% respectively. Reusable plastic buckets with perforations on the side walls could be used to substitute the conventional polyethylene bags in oyster mushroom cultivation, with no significant difference in yield. Losses due to slight increase in crop duration in buckets will be compensated with a lower rate of contamination. For a unit having a daily output of 100 kg, it was estimated that during 10 years of permanent cultivation following this technique, the cost of cultivation could be reduced to one-tenth and the environmental pollution reduced by at least 730 000 non-degradable polyethylene bags. © 2012 Society of Chemical Industry.

  8. SUPPLEMENTATION OF COFFEE HUSK FERMENTED WITH Pleurotus ostreatus: EFFECT ON PERFORMANCE AND BLOOD PROFILE OF GASTROINTESTINAL NEMATODES INFECTED GOAT

    Directory of Open Access Journals (Sweden)

    I. Badarina

    2016-03-01

    Full Text Available The aim of this study was to investigate the potency of coffee husk fermented with P.ostreatus as a natural anthelmintic supplement by measuring the performance and blood profile of goat suffered gastrointestinal nematodes infection. Eighteen local male goats of Kacang goat with body weight of 9.23 ± 1.71 kg and aged at ± 10 months were arranged into three treatments in completely randomized design. The treatments were T0 (group without chemical anthelmintic treatment and no supplementation of fermented coffee husk, T1 (without chemical anthelmintic treatment, but supplied with fermented coffee husk and T2 (group with chemical anthelmintic and no supplementation of fermented coffee husk. All goats were offered a basal diet in the ratio of 60% natural grasses along with 40% concentrate. Fermented coffee husk was added in the diet as much as 6% from the dry matter need. The result showed that there were no significant effect to dry matter intake, daily weight gain, PCV value and eosinophil counts (P>0.05. The supplementation of fermented coffee husk (T1 enhanced Hb and red blood cell (RBC value (P<0.05 while no significant difference to T2. There were no nematodes infection in T1 and T2 with the eggs count were zero while the animals in T0 were still infected. This result indicated that fermented coffee husk can be used as a promising natural anthelmintic supplement with the improvement of Hb value, RBC, egg counts and daily weight gain.

  9. Nutrient Digestibility, Ruminal Fermentation Activities, Serum Parameters and Milk Production and Composition of Lactating Goats Fed Diets Containing Rice Straw Treated with Pleurotus ostreatus.

    Science.gov (United States)

    Kholif, A E; Khattab, H M; El-Shewy, A A; Salem, A Z M; Kholif, A M; El-Sayed, M M; Gado, H M; Mariezcurrena, M D

    2014-03-01

    The study evaluated replacement of Egyptian berseem clover (BC, Trifolium alexandrinum) with spent rice straw (SRS) of Pleurotus ostreatus basidiomycete in diets of lactating Baladi goats. Nine lactating homo-parity Baladi goats (average BW 23.8±0.4 kg) at 7 d postpartum were used in a triplicate 3×3 Latin square design with 30 d experimental periods. Goats were fed a basal diet containing 0 (Control), 0.25 (SRS25) and 0.45 (SRS45) (w/w, DM basis) of SRS. The Control diet was berseem clover and concentrate mixture (1:1 DM basis). The SRS45 had lowered total feed intake and forages intake compared to Control. The SRS25 and SRS45 rations had the highest digestibilities of DM (p = 0.0241) and hemicellulose (p = 0.0021) compared to Control which had higher (p<0.01) digestibilities of OM (p = 0.0002) and CP (p = 0.0005) than SRS25 and SRS45. Ruminal pH and microbial protein synthesis were higher (p<0.0001) for SRS25 and SRS45 than Control, which also had the highest (p<0.0001) concentration of TVFA, total proteins, non-protein N, and ammonia-N. All values of serum constituents were within normal ranges. The Control ration had higher serum globulin (p = 0.0148), creatinine (p = 0.0150), glucose (p = 0.0002) and cholesterol (p = 0.0016). Both Control and SRS25 groups had the highest (p<0.05) milk (p = 0.0330) and energy corrected milk (p = 0.0290) yields. Fat content was higher (p = 0.0373) with SRS45 and SRS25 groups compared with Control. Replacement of BC with SRS in goat rations increased milk levels of conjugated linoleic acid and unsaturated fatty acids compared with Control. It was concluded that replacing 50% of Egyptian berseem clover with SRS in goat rations improved their productive performance without marked effects on metabolic indicators health.

  10. Nutrient Digestibility, Ruminal Fermentation Activities, Serum Parameters and Milk Production and Composition of Lactating Goats Fed Diets Containing Rice Straw Treated with Pleurotus ostreatus

    Science.gov (United States)

    Kholif, A. E.; Khattab, H. M.; El-Shewy, A. A.; Salem, A. Z. M.; Kholif, A. M.; El-Sayed, M. M.; Gado, H. M.; Mariezcurrena, M. D.

    2014-01-01

    The study evaluated replacement of Egyptian berseem clover (BC, Trifolium alexandrinum) with spent rice straw (SRS) of Pleurotus ostreatus basidiomycete in diets of lactating Baladi goats. Nine lactating homo-parity Baladi goats (average BW 23.8±0.4 kg) at 7 d postpartum were used in a triplicate 3×3 Latin square design with 30 d experimental periods. Goats were fed a basal diet containing 0 (Control), 0.25 (SRS25) and 0.45 (SRS45) (w/w, DM basis) of SRS. The Control diet was berseem clover and concentrate mixture (1:1 DM basis). The SRS45 had lowered total feed intake and forages intake compared to Control. The SRS25 and SRS45 rations had the highest digestibilities of DM (p = 0.0241) and hemicellulose (p = 0.0021) compared to Control which had higher (p<0.01) digestibilities of OM (p = 0.0002) and CP (p = 0.0005) than SRS25 and SRS45. Ruminal pH and microbial protein synthesis were higher (p<0.0001) for SRS25 and SRS45 than Control, which also had the highest (p<0.0001) concentration of TVFA, total proteins, non-protein N, and ammonia-N. All values of serum constituents were within normal ranges. The Control ration had higher serum globulin (p = 0.0148), creatinine (p = 0.0150), glucose (p = 0.0002) and cholesterol (p = 0.0016). Both Control and SRS25 groups had the highest (p<0.05) milk (p = 0.0330) and energy corrected milk (p = 0.0290) yields. Fat content was higher (p = 0.0373) with SRS45 and SRS25 groups compared with Control. Replacement of BC with SRS in goat rations increased milk levels of conjugated linoleic acid and unsaturated fatty acids compared with Control. It was concluded that replacing 50% of Egyptian berseem clover with SRS in goat rations improved their productive performance without marked effects on metabolic indicators health. PMID:25049962

  11. Submerged Cultivation of Mycelium with High Ergothioneine Content from the Culinary-Medicinal Golden Oyster Mushroom, Pleurotus citrinopileatus (Higher Basidiomycetes).

    Science.gov (United States)

    Lin, Shin-Yi; Chien, Shih-Chang; Wang, Sheng-Yang; Mau, Jeng-Leun

    2015-01-01

    The optimization of submerged culture of the culinary-medicinal golden oyster mushroom, Pleurotus citrinopileatus, was studied using a one-factor-at-a-time, two-stage stimulation and central composite rotatable design to produce mycelia with high ergothioneine content. The optimal culture conditions for mycelia harvested at day 22 were a temperature of 25°C, an inoculation ratio of 5%, 2% glucose, 0.5% yeast extract, and adjustment of the initial pH value to 10. The biomass and ergothioneine content were 8.28 g/L and 10.65 mg/g dry weight (dw), respectively. The addition of an amino acid precursor increased the ergothioneine content of mycelia; cysteine was the most effective. In addition, the results obtained from central composite rotatable design showed that the recommended combination for cysteine, histidine, and methionine was 8, 4, and 0.5 mmol/L, respectively. The predicted ergothioneine content was 13.90 mg/g dw, whereas the experimental maximal ergothioneine content was 14.57 mg/g dw. With the addition of complex precursors and under optimal culture conditions, mycelia harvested at days 16-20 had higher ergothioneine content. Accordingly, the information obtained could be used to produce mycelia with high ergothioneine content.

  12. Effect of light and atmosphere on the cultivation of the golden oyster culinary-medicinal mushroom, Pleurotus citrinopileatus (higher Basidiomycetes).

    Science.gov (United States)

    Hu, Shu-Hui; Wu, Chiu-Yeh; Chen, Yu-Kuei; Wang, Jinn-Chyi; Chang, Sue-Joan

    2013-01-01

    With an aim to explore the productivity and quality of the fruiting body of culinary-medicinal golden oyster mushroom Pleurotus citrinopileatus, the carbon dioxide (CO₂) concentration of the ambient atmosphere was adjusted and a light-emitting diode panel was used to illuminate the colonized mycelium at different wavelengths. Biological efficiency and yield were higher at CO₂ levels of 0.05 and 0.1% than other tested CO₂ levels, and the mature fruiting body showed the highest yellow value at a CO₂ level of 0.1% (of all tested CO₂ levels). The highest biological efficiency and yield was obtained at the 720-nm wavelength. The ergosterol content of the pileus of the fruiting body was higher than that of the stipe in any flush time at a 720-nm wavelength of light and a CO₂ concentration of 0.1%. The decreased percentages of cellulose and lignin at the appearance of primordia were larger than those of mycelial growth duration. The fruiting quality of P. citrinopileatus might thus be enhanced by 720-nm illumination and an atmosphere with a CO₂ concentration of 0.1 to 0.15%.

  13. The Management of Humidifying Treatment for Low Contamination Risks During Indoor Cultivation of Grey Oyster Mushroom (Pleurotus pulmonarius

    Directory of Open Access Journals (Sweden)

    Islam Md. Tariqul

    2017-01-01

    Full Text Available In this study, grey oyster mushroom (Pleurotus pulmonarius was cultivated in indoor controlled environment to seeking out the possible risks of contamination and ways of treatment to avoid the contamination. For this, mushroom was cultivated in providing artificial humidifying and ventilation system to ensure optimum humidity (80-90% and fresh air recirculation in different ways of treatment. The ways of treatment were included as in position of humidifier, frequency of humidifying, plastic cork of bags opening part and cleaning of humidifier water container. Maximum percentages of bag contamination (2.5-25.30%, cap contamination (5.6-30.75%, stalk contamination (4.75-23.25% and root contamination (2.6-18.45% were found in front to front humidifier position, long humidifying with long interval frequency, without plastic cork, without cleaning and bi-monthly cleaning of humidifier water container treatment but no diseases and pest infection was found. Whereas, very low percentages of contamination (0.1-0.5% were found in surrounding humidifying position, short humidifying duration with short interval frequency, with plastic cork and weekly cleaning of humidifier water container treatment.

  14. Extension of the shelf-life of fresh oyster mushrooms ( Pleurotus ...

    African Journals Online (AJOL)

    The objective of this study was to improve the preservation of fresh oyster mushrooms by modified atmosphere packaging (MAP) and chemical treatments. The MAP effects and treatments on organoleptic quality, weight loss, cell permeability, texture changes and polyphenol oxidase (PPO) activity were studied. In addition ...

  15. The Removal of Turbidity and TSS of the Domestic Wastewater by Coagulation-Flocculation Process Involving Oyster Mushroom as Biocoagulant

    Science.gov (United States)

    Pardede, Astrid; Budihardjo, Mochamad Arief; Purwono

    2018-02-01

    Oyster mushroom (Pleurotus ostreatus) can be utilized as biocoagulant since it has chitin cell wall. Chitin has characteristics of bioactivity, biodegradability, absorption and could bind the metal ions. In this study, Oyster Mushroom is micronized and mixed with wastewater to treat turbidity and Total Suspended Solid (TSS) using coagulation-flocculation process employed jartest method. Various doses of Oyster mushroom, 600 mg/l, 1000 mg/l, and 2000 mg/l were tested in several rapid mixing rates which were 100 rpm, 125 rpm, and 150 rpm for 3 minutes followed by 12 minutes of slow mixing at 45 rpm. The mixture then was settled for 60 minutes with pH level maintained at 6-8. The result showed that the Oyster mushroom biocoagulant was able to remove 84% of turbidity and 90% of TSS. These reductions were achieved with biocoagulant dose of 600 mg/ L at 150 rpm mixing rate.

  16. Evaluación de la capacidad productiva de Pleurotus ostreatus utilizando hoja de plátano deshidratada (Musa paradisiaca L., en relación con otros sustratos agrícolas

    Directory of Open Access Journals (Sweden)

    Omar Romero

    2010-01-01

    Full Text Available El objetivo de este estudio fue evaluar la producción de la cepa CP-50 de P. ostreatus en residuos de hoja de plátano deshidratada en contraste con otros sustratos agrícolas de desecho del Municipio de Tetela de Ocampo-Puebla. Las hojas de plátano (M. paradisiaca fueron colectadas en la zona de Martínez de la Torre, Veracruz- México y los demás sustratos agrícolas como paja de trigo (T. aestivum, paja de cebada (H. vulgare, pajilla de frijol (P. vulgaris y rastrojo de maíz (Z. mays se adquirieron en la región de Tetela de Ocampo, Puebla, México, para la obtención de fructificaciones en condiciones rurales. La cepa CP-50 demostró un adecuado crecimiento de aéreas miceliales sobre la hoja de plátano deshidratada con una tasa de producción de 1,5±0,1%. La mayor eficiencia biológica (EB se obtuvo en el sustrato paja de trigo, con 129,34±9,1%, la hoja de plátano deshidratada con 123,30±0,7%, y la pajilla de frijol obtuvo la EB más baja de 82,91±0,4%. Los resultados demostraron la factibilidad de cultivar la cepa CP-50 de Pleurotus ostreatus bajo condiciones rústicas en la sierra norte del estado de Puebla, al aprovechar los residuos de la cosecha de plátano de las regiones aledañas del municipio.

  17. Oyster mycelium on the liquid medium

    Directory of Open Access Journals (Sweden)

    Mariusz Gapiński

    2013-12-01

    Full Text Available The research presents the results of oyster mycelium growth on the liquid medium. The growth of 4-mycelium genius: Pleurotus citrinopileatus Singer, Pleurotus djamor Fries, Boedjin, Pleurotus erynii Fr. Kumm. and Pleurotus precoce Fr. Quel was tested. The quality and quantity of mycelium was assumed.

  18. Studies on the aroma of different species and strains of Pleurotus measured by GC/MS, sensory analysis and electronic nose

    OpenAIRE

    Renata Zawirska-Wojtasiak; Marek Siwulski; Sylwia Mildner-Szkudlarz; Erwin Wąsowicz

    2009-01-01

    The aroma of several strains of Pleurotus ostreatus, Pleurotus citrinopileatus and Pleurotus djamor was studied by GC/MS. Three main mushrooms aroma constituents: 3-octanol, 3-octanone and 1-octen-3-ol were taken into account for quantitative measurements. The highest amount of 1-octen-3-ol was recorded in P. ostreatus, while considerably lower amounts in P. citrinopileatus. Sensory profile analysis as well as the electronic nose also varied between the three species of Pleurotus. Chiral gas ...

  19. Computational analysis and low-scale constitutive expression of laccases synthetic genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris.

    Directory of Open Access Journals (Sweden)

    Claudia M Rivera-Hoyos

    Full Text Available Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range

  20. Malachite Green and Crystal Violet Decolorization by Ganoderma lucidum and Pleurotus ostreatus Supernatant and by rGlLCC1 and rPOXA 1B Concentrates: Molecular Docking Analysis.

    Science.gov (United States)

    Morales-Álvarez, Edwin D; Rivera-Hoyos, Claudia M; Poveda-Cuevas, Sergio A; Reyes-Guzmán, Edwin A; Pedroza-Rodríguez, Aura M; Reyes-Montaño, Edgar A; Poutou-Piñales, Raúl A

    2018-03-01

    Laccases catalyze the oxidation of various aromatic organic compounds concomitantly with molecular oxygen reduction to water. Triphenylmethane dyes are synthetic compounds widely used in diverse industries. Their removal from effluents is difficult, due to their high degree of structural complexity; hence, their high concentration in effluents cause a negative impact on the environment. In the present work, molecular docking was used to evaluate interactions between rGlLCC1 or rPOXA 1B enzymes with Crystal Violet (CV) or Malachite Green (MG) dyes. In addition, removal tests of the two dyes were performed. Van der Waals interactions were obtained for only the CV dye for both GlLCC1 and POXA 1B enzymes. Nevertheless, in the GlLCC1 model, two π-π interactions were observed. For the MG dye only, Van der Waals interactions were obtained. Moreover, amino acid composition interacting in each model with each dye was similar. It is important to highlight that by molecular docking, none of the estimated ligand configurations generated hydrogen bonds. Thus, explaining the difficulty to degrade CV and MG. Regarding CV, maximum decolorization percentage was 23.6 ± 1.0% using Ganoderma lucidum supernatant and 5.0 ± 0.5% with Pleurotus ostreatus supernatant. When using recombinant laccase enzyme concentrates, decolorization percentages were 9.9 ± 0.1 and 7.5 ± 1.0% for rGlLCC1 and rPOXA 1B, respectively. On the other hand, for the MG dye, maximum decolorization percentages were 52.1 ± 5.1 and 2.3 ± 0.2% using G. lucidum and P. ostreatus concentrates, respectively. Whereas with recombinant laccase enzymatic concentrates, values of 9.4 ± 0.8% were obtained, with rGlLCC1, and 2.1 ± 0.1% when using rPOXA 1B. These findings represent an important step in bioremediation processes improvement and efficiency of industry-generated products, using environmentally friendly alternatives.

  1. Evaluation of the Efficacy of Fermented By-product of Mushroom, Pleurotus ostreatus, as a Fish Meal Replacer in Juvenile Amur Catfish, Silurus asotus: Effects on Growth, Serological Characteristics and Immune Responses

    Science.gov (United States)

    Katya, Kumar; Yun, Yong-hyun; Park, Gunhyun; Lee, Jeong-Yeol; Yoo, Gwangyeol; Bai, Sungchul C.

    2014-01-01

    The present experiment was conducted to evaluate the efficacy of dietary fermented by-product of mushroom, Pleurotus ostreatus, (FBPM) as a fish meal (FM) replacer in juvenile Amur catfish, Silurus asotus. A total number of 225 fish averaging 5.7±0.1 g (mean±standard deviation) were fed one of the five experimental diets formulated to replace FM with FBPM at 0%, 5%, 10%, 20%, and 30% (FBPM0, FBPM5, FBPM10, FBPM20, and FBPM30, respectively). At the end of eight weeks of the experiment, average weight gain (WG) of fish fed FBPM0 or FBPM5 were significantly higher than those of fish fed FBPM20 or FBPM30 diets (p<0.05). However, there was no significant differences in WG among the fish fed FBPM0, FBPM5 or FBPM10, and between fish fed FBPM10 or FBPM20, and also between those fed FBPM20 or FBPM30 diets. Lysozyme activity of fish fed FBPM0 or FBPM5 were significantly higher than those of fish fed FBPM10, FBPM20 or FBPM30 diets (p<0.05). The chemiluminescent response of fish fed FBPM5 was significantly higher than those of fish fed FBPM0, FBPM20 or FBPM30 diets (p<0.05). Broken line regression analysis of WG suggested that the maximal dietary inclusion level for FBPM as a FM replacer could be 6.3% without any adverse effects on whole body composition and on serological characteristics. Therefore, these results may indicate that the maximal dietary inclusion level of FBPM as a FM replacer could be 6.3% in juvenile Amur catfish. PMID:25178300

  2. Cultivation of the culinary-medicinal Lung Oyster mushroom, Pleurotus pulmonarius (Fr.) Quél. (Agaricomycetideae) on grass plants in Taiwan.

    Science.gov (United States)

    Liang, Zeng-Chin; Wu, Kuan-Jzen; Wang, Jinn-Chyi; Lin, Chorng-Horng; Wu, Chiu-Yeh

    2011-01-01

    Cultivation of the culinary-medicinal Lung Oyster mushroom, Pleurotus pulmonarius, on the stalks of three grass plants, i.e., Panicum repens, Pennisetum purpureum, and Zea mays were investigated. The effects of various combinatorial substrates on mushroom mycelial growth and yield calculated as biological efficiency (BE) were determined. Among 9 experimental substrates, the most suitable substrate for mycelial growth was 45ZMS:45S, followed by 45PRS:45S; their mycelial growth rates were obviously quicker than that of the control substrate. The BEs of all the experimental substrates respectively containing P. repens stalk, P. purpureum stalk and Z. mays stalk were higher than that of the control (39.55%) during the 2.5 months of cultivation period. The best substrate in terms of BE was 60ZMS:30S (58.33%), followed by 45PRS:45S (57.16%), 45ZMS:45S (49.86%), and 30ZMS:60S (47.20%). Based on the BE of the tested substrates, Z mays stalk appeared to be the best alternative material for the production of P. pulmonarius.

  3. Submerged cultivation of mycelium with high ergothioneine content from the culinary-medicinal king oyster mushroom Pleurotus eryngii (higher Basidiomycetes) and its composition.

    Science.gov (United States)

    Liang, Chih-Hung; Huang, Ling-Yi; Ho, Kung-Jui; Lin, Shin-Yi; Mau, Jeng-Leun

    2013-01-01

    The culinary-medicinal king oyster mushroom, Pleurotus eryngii, was used to produce mycelia with high ergothioneine content using a one-factor-at-a-time method. The optimal culture conditions for mycelia harvested at day 14 were 25°C, 10% inoculation rate, 2% glucose, 0.5% yeast extract, and no adjustment to the initial pH value. With histidine or amino acid mix added, biomasses and the ergothioneine content of mycelia were higher than those of the control. The ergothioneine content of mycelia harvested at days 16-20 were higher than that of mycelia harvested at day 14. In addition, the ergothioneine content of mycelia from the fermentor (5.84-5.76 mg/g) was much higher than that of mycelia from the shaken flask (4.93-5.04 mg/g). Mycelia with high ergothioneine content showed a profile of proximate composition similar to that of regular mycelia but lost its characteristic umami taste. Overall, mycelia high in ergothioneine could be prepared by optimal culture conditions, the addition of precursors, prolonged harvest, and aeration in the fermentor.

  4. PCB in the environment: bio-based processes for soil decontamination and management of waste from the industrial production of Pleurotus ostreatus.

    Science.gov (United States)

    Siracusa, Giovanna; Becarelli, Simone; Lorenzi, Roberto; Gentini, Alessandro; Di Gregorio, Simona

    2017-10-25

    Polychlorinated biphenyls (PCBs) are hazardous soil contaminants for which a bio-based technology for their recovery is essential. The objective of this study was to validate the exploitation of spent mushroom substrate (SMS), a low or null cost organic waste derived from the industrial production of P. ostreatus, as bulking agent in a dynamic biopile pilot plant. The SMS shows potential oxidative capacity towards recalcitrant compounds. The aim was consistent with the design of a process of oxidation of highly chlorinated PCBs, which is independent from their reductive dehalogenation. Feasibility was verified at a mesocosm scale and validated at pilot scale in a dynamic biopile pilot plant treating ten tons of a historically contaminated soil (9.28±0.08mg PCB/kg soil dry weight). Mixing of the SMS with the soil was required for the depletion of the contaminants. At the pilot scale, after eight months of incubation, 94.1% depletion was recorded. A positive correlation between Actinobacteria and Firmicutes active metabolism, soil laccase activity and PCB removal was observed. The SMS was found to be exploitable as a versatile low cost organic substrate capable of activating processes for the oxidation of highly chlorinated PCBs. Moreover, its exploitation as bulking agent in biopiles is a valuable management strategy for the re-utilisation of an organic waste deriving from the industrial cultivation of edible mushrooms. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Cultivation of different strains of king oyster mushroom (Pleurotus eryngii) on saw dust and rice straw in Bangladesh.

    Science.gov (United States)

    Moonmoon, Mahbuba; Uddin, Md Nazim; Ahmed, Saleh; Shelly, Nasrat Jahan; Khan, Md Asaduzzaman

    2010-10-01

    Pleurotus eryngii is a popular mushroom due to its excellent consistency of cap and stem, culinary qualities and longer shelf life. In Bangladesh, where Pleurotus mushrooms are very popular, P. eryngii may take position among the consumers, but currently this mushroom is not cultivated in large scale there. In this study, 3 strains of P. eryngii such as Pe-1 (native to Bangladesh), Pe-2 (germplasm collected from China) and Pe-3 (germplasm collected from Japan) were cultivated on saw dust and rice straw and their growth and yield parameters were investigated. Pe-1 on saw dust showed the highest biological yield and efficiency (73.5%) than other strains. Also, the mycelium run rate and number of fruiting bodies were higher in Pe-1 than other two strains. The quality of mushroom strains was near about similar. On saw dust, the yield and efficiency were better than those cultivated on rice straw, however, on straw; the mushroom fruiting bodies were larger in size. This study shows the prospects of P. eryngii cultivation in Bangladesh and suggests further study in controlled environment for higher yield and production.

  6. Pleurotus ostreatus Yetiştiriciliğinde Katkı Maddesi Olarak Mısır Silajının Kullanımı

    Directory of Open Access Journals (Sweden)

    Beyhan Kibar

    2016-05-01

    Full Text Available Bu çalışma Pleurotus ostreatus mantarı yetiştiriciliğinde mısır silajının katkı maddesi olarak kullanım durumunu belirlemek amacıyla yapılmıştır. Çalışmada buğday samanına farklı oranlarda (%5, 10, 15 ve 20 mısır silajı ilave edilerek hazırlanan yetiştirme ortamları, verim ve morfolojik özellikler bakımından kontrol ile (%95 buğday samanı+%5 buğday kepeği karşılaştırılmıştır. Yetiştirme ortamlarının hazırlanmasında kullanılan materyallerin her birinin başlangıçtaki ve hazırlanan yetiştirme ortamlarının sterilizasyondan sonraki pH, karbon (C ve azot (N miktarı, C:N oranı ve mineral madde (K, P, Mg, Zn, Fe ve Mn içerikleri tespit edilmiştir. Verim bakımından kontrol ve farklı oranlarda mısır silajı ilave edilerek hazırlanan yetiştirme ortamları arasındaki farklılık istatistiki olarak önemli (P<0.05, morfolojik özellikler (şapka uzunluğu, sap uzunluğu ve sap kalınlığı bakımından ise önemsiz bulunmuştur. En yüksek verim (220.13 g kg-1 ortam buğday samanına %10 oranında mısır silajının ilave edilmesiyle hazırlanan yetiştirme ortamından, en düşük verim (153.75 g kg-1 ortam ise kontrol ortamından elde edilmiştir. Mısır silajının P. ostreatus yetiştiriciliğinde buğday kepeğine alternatif iyi ve ucuz bir katkı maddesi olarak kullanılabileceği sonucuna varılmıştır.

  7. A study of mechanisms responsible for incorporation of cesium and radiocesium into fruitbodies of king oyster mushroom (Pleurotus eryngii)

    Energy Technology Data Exchange (ETDEWEB)

    Bystrzejewska-Piotrowska, Grazyna [Isotope Laboratory, Faculty of Biology, Warsaw University, 02-096 Warsaw, Miecznikowa 1 (Poland)], E-mail: byst@biol.uw.edu.pl; Bazala, Michal A. [Isotope Laboratory, Faculty of Biology, Warsaw University, 02-096 Warsaw, Miecznikowa 1 (Poland)

    2008-07-15

    Ex vitro cultures of Pleurotus eryngii were carried out under controlled conditions using sterile medium composed of barley seeds. The influence of alkali and alkaline earth element salts (CsCl, KCl, NaCl, RbCl, and CaCl{sub 2}) and tetraethylammonium chloride on incorporation of cesium, potassium, sodium, rubidium and calcium, and their distribution within fruitbodies, was examined. The results show that incorporation of cesium into fruitbodies was not suppressed by Na{sup +} and Rb{sup +} or tetraethylammonium chloride. However, it was inhibited by Ca{sup 2+} and stimulated by high concentrations of K{sup +}. The inhibition of cesium incorporation by Ca{sup 2+}, lack of influence of tetraethylammonium chloride and stimulation by high K{sup +} concentrations suggest that there may exist two pathways of passive transport of cesium in mycelium: (i) uptake mediated by a non-specific potassium channel localised in plasmalemma (similar to voltage-insensitive cation channel, VICC) followed by diffusive transport inside hyphae and (ii) extracellular transport from the medium through inter-hyphal cavities into fruitbodies. The results highlight distinctiveness of mechanisms responsible for the uptake and incorporation of cesium in mushrooms and plants.

  8. Screening of antagonistic bacteria against the green mold disease (Trichoderma harzianum Rifai of Grey Oyster Mushroom (Pleurotus pulmonarius (Fr. Quel.

    Directory of Open Access Journals (Sweden)

    Nualsri, C.

    2005-01-01

    Full Text Available A total of 174 strains of bacteria antagonistic against the green mold (Trichoderma harzianum, isolated from cultivating bags and fruiting bodies of the mushrooms, were screened for effects on mushroom mycelia and ability to control the green mold disease. Twenty-eight of them promoted the primodia formation of the Pleurotus pulmonarius mycelia on agar plates. Twenty-two isolates were selected and further tested in a mushroom house. Cell suspension of each isolate was prepared and sprayed onto the spawn surface of P. pulmonarius. Fifteen isolates shortened the times required from watering to 2nd and 3rd flushing and increased yield of the basidiocarps by 1.1-34.3% over 30 days. Six isolates of bacteria which showed an inhibitory effect against T. harzianum, enhanced primordia formation and increased yield of P. pulmonarius were selected and used for control testing in a cultivation house. The suspension of each isolate was sprayed onto the spawn surface immediately after exposure to the air in the mushroom house, followed by spore suspension of T. harzianum two days later. The number of infected bags was counted at 30 days after inoculation and the cumulative yield was compared after 60 days. The results showed that bacteria isolate B012-022 was highly effective in suppressing the green mold disease.Only 6.7% of the cultivating bags were found to be infected by T. harzianum when bacteria isolate B012-022 was applied. Cumulative yield obtained from 900 g of 94% sawdust + 5% rice bran + 1% Ca(OH2 was 300.0 g/bag after 60 days, 71.1% higher than the bags infected by the green mold and without bacterial spraying. Identification of the six bacterial isolates showed all to be Bacillus spp.

  9. Obtención in vitro de micelio de hongos comestibles, shiitake (Lentinula edodes) y orellanas (Pleurotus ostreatus y Pleurotus pulmonarius) a partir de aislamientos de cuerpos fructíferos, para la producción de semilla / In vitro micelia isolation of edible mushrooms, shiitake (Lentinula edodes) and oyster mushrooms (Pleurotus ostreatus and Pleurotus pulmonarius) from fruiting bodies, for spawn production

    OpenAIRE

    Suárez Arango, Carolina

    2010-01-01

    Los macromicetos han sido parte de la cultura humana desde hace miles de años y han sido reportados como alimento humano en las más importantes civilizaciones de la historia. Se han descrito muchísimas propiedades nutricéuticas de los macromicetos, como lo son sus propiedades anticancerígenas y antitumorales, hipocolesterolémicas, antivirales, antibacterianas, inmunomoduladoras, entre otras. Igualmente, han sido descritas sus propiedades nutricionales, tienen un elevado contenido de proteína,...

  10. EVALUATION OF GIN WASTE AS A GROWING SUBSTRATE, ENRICHED WITH DIFFERENT VOLUME PERCENTAGE OF THE WHEAT BRAN FOR CULTIVATION OF OYSTER MUSHROOM (PLEUROTUS OSTREATUS

    Directory of Open Access Journals (Sweden)

    M. M. Akhtar

    2016-08-01

    Full Text Available Pleurotusostreatus mushroom was cultivated on cotton gin waste amended with wheat bran in order to judge its growth potential. Two substrates (cotton gin waste and wheat bran were employed alone and with different combinations. Experiment consisted of four treatments T0 (100 % cotton gin waste, T1(97% cotton gin waste + 3% wheat bran, T2(94% cotton gin waste + 6% wheat bran and T3(91% cotton gin waste + 9% wheat bran. Data about time needed for commencement of spawn run, time needed for completion of mycelial growth, time needed for initiation of pinheads, time needed for harvesting of 1st, 2nd and 3rd flush, fresh weight of 1st, 2nd and 3rd flush harvested, total yield, pH of mushroom, total soluble solids of mushroom, acidity and ascorbic acid contents, reducing sugars, non-reducing sugars and total sugars of mushroom, total nitrogen, phosphorus and potassium contents of mushroom was recorded. T0 (100 % cotton gin waste performed better as compared to other treatments.

  11. Use of Edible and Medicinal Oyster Mushroom (Pleurotus ostreatus(Jacq.: Fr.) Kumm.) Spent Compost in Remediation of Chemically Polluted Soils

    Czech Academy of Sciences Publication Activity Database

    Eggen, T.; Šašek, Václav

    2002-01-01

    Roč. 4, č. 3 (2002), s. 255-261 ISSN 1521-9437 Grant - others:GA of the Center for Molecular and Gene Biotechnology(XC) LN00B030; Norwegian Research Founding grant(NO) 113788/720 Program:LN Institutional research plan: CEZ:AV0Z5020903 Keywords : biodegradation * bioremediation * contaminated soil Subject RIV: EE - Microbiology, Virology

  12. Investigation of antioxidative, antityrosinase and cytotoxic effects of extract of irradiated oyster mushroom

    Directory of Open Access Journals (Sweden)

    Nutsuda Banlangsawan

    2016-02-01

    Full Text Available Oyster mushroom (Pleurotus ostreatus Fries. is rich in nutrition and has many medicinal properties such as antioxidant and anticancer activities. It also contains a high amount of ergosterol which can be converted to vitamin D2 when exposing to UV light. Oyster mushroom powder was irradiated with UV-B for 180 min and extracted with 95% ethanol. Mushroom extract was determined for vitamin D2 concentration, total phenolic compound, antioxidative activity, tyrosinase inhibitory property and cytotoxicity effect on human keratinocytes (HaCaT and murine melanoma cells (B16F10 by MTT assay. The results demonstrated that the concentration of vitamin D2 of irradiated oyster mushroom extract was 153.96 µg/g, which is 13 times higher than that of non-irradiated mushroom extract. Total phenolic content, antioxidative and tyrosinase inhibitory activities of the two mushroom extracts were not significantly different. Neither oyster mushroom extract had a cytotoxic effect on keratinocytes, but on the other hand both inhibited the growth of murine melanoma cells.

  13. and extracellular laccase isoenzymes from Pleurotus ostreatus

    African Journals Online (AJOL)

    ZMG

    Colonia Vicentina, Delegación Iztapalapa, 09340 México D.F., México. 3Centro de .... mechanic homogenization of the mycelium in physiological solution, with the help of an electric ..... pubescens and regulation of its synthesis by metal ions.

  14. Comparative effect of steam and gamma irradiation sterilization of sawdust compost on the yield, nutrient and shelf-life of Pleurotus ostreatus (Jacq. Ex.Fr) Kummer stored in two different packaging materials

    International Nuclear Information System (INIS)

    Kortei, J. N. K.

    2015-06-01

    influence of radiation on drying rate of oyster mushrooms were determined by five non- linear regression models (Lewis, Page, Henderson and Pabis, Diffussion and Wang and Singh by the estimation of R 2 , X 2 and RMSE). The total phenolic contents, flavonoids and free radical scavenging activity DPPH (2, 2' - diphenyl- 1- picrylhydrazyl) as sources of natural antioxidant of stored mushroom in polypropylene and polythene packs were determined using aqueous, ethanol and methanol extracts by Folin- Ciocalteau method. Finally, the influence of gamma irradiation on the colour characteristics were determined by the Hunter L * a* b* and Browning Index (BI) method while textural characteristics were determined mechanically by measuring Texture Hardness (kgf), Fracturability (N), Cohesiveness, Chewiness (N), Springiness (mm), Gumminess, Adhesiveness (kgf.s) and Resilience of fresh, dry and rehydrated mushrooms. The mechanical estimation to textural characters obtained were compared mean scores on 9-point Hedonic scale of sensory acceptability attributes (appearance, colour, aroma, taste, mouthfeel and overall acceptability of coded samples in two packaging containers. The survey demonstrated the popularity of drum (moist heat) technique of sterilization in Ghana. Majority (64%) of the respondents were dissatisfied with the method of sterilization of compost and spawn substrate with 36% indicated the method was alright by them. Majority (82%) of the respondents have never heard of sterilization of food or mushroom by gamma irradiation technique. Because of the high contamination rate of the steam sterilized compost and spawn substrate, the farmers indicated the need to achieve better sterilization for these starting material for mushroom cultivation. Drying was selected as the most popular preservation method as the fresh fruiting bodies have short shelf-life and P. ostreatus was found to be the most preferred mushroom followed by the termite mushroom (Termitomyces sp.). The

  15. Laccase Enzymes in Inocula Pleurotus spp

    Directory of Open Access Journals (Sweden)

    Nora García-Oduardo

    2017-01-01

    Full Text Available The cultivation of edible and medicinal mushrooms Pleurotus has been aimed at promoting alternative management for agricultural products. This basidiomicete has been the subject of numerous studies because of its fruiting body constitutes a food, being a producer of enzymes with industrial interest and for its ability of biotransformation of lignocellulosic substrates. Pleurotus inocula in the established technology for growing edible and medicinal mushrooms in the CEBI Research- Production Plant were performed using sorghum or wheat. However, it is possible to expand the possibilities with other substrates. In this paper, the results of laccase enzymes production in inocula prepared with sorghum, corn and coffee pulp with two strains Pleurotus ostreatus CCEBI 3021 and Pleurotus ostreatus CCEBI 3024 are presented. The period of preparation of seed reaches 15-21 days, the measurements of laccase activity were performed in periods of seven days. Extraction of crude enzyme was performed in aqueous phase, the determination of the laccase enzyme activity, using guaiacol as substrate. The results obtained in this work with studies in previous work using sorghum as inocula are compared. It is found that higher yields are obtained laccase in coffee pulp. This study contributes to the theoretical knowledge and to provide alternatives for securing the production process of the plant.

  16. Preparation of culinary-medicinal king oyster mushroom Pleurotus eryngii-fermented products with high ergothioneine content and their taste quality.

    Science.gov (United States)

    Chen, Shih-Yu; Ho, Kung-Jui; Liang, Chih-Hung; Tsai, Ching-Hsuan; Huang, Ling-Yi; Mau, Jeng-Leun

    2012-01-01

    Pleurotus eryngii (DC. : Fr.) Ouel. was used in solid-state fermentation to develop novel mushroom products with a high amount of ergothioneine. The correlation coefficients between ergothioneine content and biomass were 0.8878 and 0.9206 for fermented adlay and buckwheat, respectively. Using optimal conditions, Pleurotus-fermented adlay and buckwheat (PFA and PFB) with the ergothioneine contents of 795.5 and 786.1 mg/ kg, respectively, were prepared. However, mycelia contained the highest ergothioneine content of 1514.6 mg/kg. As a result of SSF by P. eryngii, PFA and PFB contained more taste components than adlay and buckwheat, as evidenced by higher contents of total sugars and polyols, total free amino acids and monosodium glutamate-like components, and total and flavor 5'-nucleotides. In addition, PFB and buckwheat showed comparable equivalent umami concentration (EUC) values, whereas PFA showed a higher EUC value than adlay. Overall, Pleurotus-fermented products with a high amount of ergothioneine will be a novel functional food.

  17. Molecular and Antibacterial Profile of Edible Oyster Mushrooms ...

    African Journals Online (AJOL)

    2012r

    2014-09-24

    Sep 24, 2014 ... Phenol/Chloroform DNA extraction protocol and the DNA was ... DNA from oyster mushroom fermentation broth, mycelia or fruiting bodies. .... Sample preparation: The different strains of Pleurotus were obtained in test- tubes.

  18. Molecular Identification and Phylogenetic Relationships of Pleurotus spp. Diversity in Malaysia by ITS Marker

    International Nuclear Information System (INIS)

    Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)

  19. Anti-Fungal activity of essential oil from Baeckea frutescens L against Pleuratus ostreatus

    Science.gov (United States)

    Jemi, Renhart; Barus, Ade Irma; Nuwa, Sarinah, Luhan, Gimson

    2017-11-01

    Ujung Atap is an herb that have distinctive odor on its leaves. The plant's essential oil contains bioactive compounds but has not been investigated its anti-fungal activity against Pleurotus ostreatus. Essential oil from Ujung Atap leaves is one environmentally friendly natural preservative. This study consisted of distillation Ujung Atap leaves with boiled method, determining the number of acid, essential oil ester, and anti-fungal activity against Pleurotus ostreatus. Analysis of the data to calculate anti-fungal activity used probit analysis method to determine the IC50. Results for the distillation of leaves Ujung Atap produce essential oil yield of 0.071% and the average yield of the acid number and the ester of essential oils Ujung Atap leaves are 5.24 and 12.15. Anti-fungal activity Pleurotus ostreatus at a concentration of 1000 µg/mL, 100 µg/mL, 75 µg/mL, 50 µg/mL and 100 µg/mL BA defunct or fungi was declared dead, while at a concentration of 25 µg/mL, 10 µg/mL and 5 µg/mL still occur inhibitory processes. Results obtained probit analysis method IC50 of 35.48 mg/mL; means the essential oil of Ujung Atap leaf can inhibit fungal growth by 50 percent to 35.48 µg/mL concentration.

  20. Anti-inflammatory activity of edible oyster mushroom is mediated through the inhibition of NF-κB and AP-1 signaling

    Directory of Open Access Journals (Sweden)

    Simon James

    2011-05-01

    Full Text Available Abstract Background Mushrooms are well recognized for their culinary properties as well as for their potency to enhance immune response. In the present study, we evaluated anti-inflammatory properties of an edible oyster mushroom (Pleurotus ostreatus in vitro and in vivo. Methods RAW264.7 murine macrophage cell line and murine splenocytes were incubated with the oyster mushroom concentrate (OMC, 0-100 μg/ml in the absence or presence of lipopolysacharide (LPS or concanavalin A (ConA, respectively. Cell proliferation was determined by MTT assay. Expression of cytokines and proteins was measured by ELISA assay and Western blot analysis, respectively. DNA-binding activity was assayed by the gel-shift analysis. Inflammation in mice was induced by intraperitoneal injection of LPS. Results OMC suppressed LPS-induced secretion of tumor necrosis factor-α (TNF-α, interleukin-6 (IL-6, and IL-12p40 from RAW264.7 macrophages. OMC inhibited LPS-induced production of prostaglandin E2 (PGE2 and nitric oxide (NO through the down-regulation of expression of COX-2 and iNOS, respectively. OMC also inhibited LPS-dependent DNA-binding activity of AP-1 and NF-κB in RAW264.7 cells. Oral administration of OMC markedly suppressed secretion of TNF-α and IL-6 in mice challenged with LPS in vivo. Anti-inflammatory activity of OMC was confirmed by the inhibition of proliferation and secretion of interferon-γ (IFN-γ, IL-2, and IL-6 from concanavalin A (ConA-stimulated mouse splenocytes. Conclusions Our study suggests that oyster mushroom possesses anti-inflammatory activities and could be considered a dietary agent against inflammation. The health benefits of the oyster mushroom warrant further clinical studies.

  1. Yield and size of oyster mushroom grown on rice/wheat straw basal substrate supplemented with cotton seed hull.

    Science.gov (United States)

    Yang, Wenjie; Guo, Fengling; Wan, Zhengjie

    2013-10-01

    Oyster mushroom (Pleurotus ostreatus) was cultivated on rice straw basal substrate, wheat straw basal substrate, cotton seed hull basal substrate, and wheat straw or rice straw supplemented with different proportions (15%, 30%, and 45% in rice straw substrate, 20%, 30%, and 40% in wheat straw substrate) of cotton seed hull to find a cost effective substrate. The effect of autoclaved sterilized and non-sterilized substrate on growth and yield of oyster mushroom was also examined. Results indicated that for both sterilized substrate and non-sterilized substrate, oyster mushroom on rice straw and wheat basal substrate have faster mycelial growth rate, comparatively poor surface mycelial density, shorter total colonization period and days from bag opening to primordia formation, lower yield and biological efficiency, lower mushroom weight, longer stipe length and smaller cap diameter than that on cotton seed hull basal substrate. The addition of cotton seed hull to rice straw and wheat straw substrate slowed spawn running, primordial development and fruit body formation. However, increasing the amount of cotton seed hull can increase the uniformity and white of mycelium, yield and biological efficiency, and increase mushroom weight, enlarge cap diameter and shorten stipe length. Compared to the sterilized substrate, the non-sterilized substrate had comparatively higher mycelial growth rate, shorter total colonization period and days from bag opening to primordia formation. However, the non-sterilized substrate did not gave significantly higher mushroom yield and biological efficiency than the sterilized substrate, but some undesirable characteristics, i.e. smaller mushroom cap diameter and relatively long stipe length.

  2. Effect of Pleurotus ostreatus fermentation on cocoa pod husk ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-05-04

    May 4, 2009 ... 1Department of Biochemistry and Biotechnology, Kwame Nkrumah University of Science and ... composition, mainly due to its high lignocellulose or fibre and also low protein levels. White–rot ... as biocatalyst to improve the nutritional status of CPH. ... L.) is an important commodity in Ghana because of the.

  3. Lignocellulose degradation by Pleurotus ostreatus in the presence of cadmium

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr; Gabriel, Jiří

    2003-01-01

    Roč. 220, - (2003), s. 235-240 ISSN 0378-1097 R&D Projects: GA ČR GP204/02/P100 Institutional research plan: CEZ:AV0Z5020903 Keywords : cadmium * cellulose * hemicellulose Subject RIV: EE - Microbiology, Virology Impact factor: 1.932, year: 2003

  4. Effect of bacteria on the degradation ability of Pleurotus ostreatus

    Czech Academy of Sciences Publication Activity Database

    Válková, H.; Novotný, Čeněk; Malachová, K.; Šlosarčíková, P.; Fojtík, J.

    2017-01-01

    Roč. 584, APR 15 (2017), s. 1114-1120 ISSN 0048-9697 Institutional support: RVO:61388971 Keywords : Fungal biofilms * Biodegradation * Anthraquinone dye Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 4.900, year: 2016

  5. screening of pleurotus ostreatus and gleophylum sepiarium strains ...

    African Journals Online (AJOL)

    USER

    sawdust dump-site were screened for protease enzyme production. High yields of protease ... glass spreader, sterilized by dipping in 95% ethanol and flaming. .... because higher temperatures led to a sharp decrease in activity. The result is ...

  6. Improving biological efficiency of Oyster mushroom, Pleurotus ...

    African Journals Online (AJOL)

    International Journal of Biological and Chemical Sciences ... Yield improvement were observed in both pigeon pea and sunflower seed cake supplemented treatments with the highest mycelium vigor (91.65%) and biological ... Keywords: biological efficiency, compost, mycelium vigor, pigeon pea, sunflower seed cake

  7. Assessment of Genetic Diversity among Pleurotus spp. Isolates from Jordan

    Directory of Open Access Journals (Sweden)

    Hanan Aref Hasan

    2018-04-01

    Full Text Available Pleurotus is considered an important genus that belongs to the family Pleurotaceae and includes the edible King Oyster mushroom (Pleurotus eryngii. In the present study, 19 Pleurotus isolates were collected from two locations in the north of Jordan (Tell ar-Rumman and Um-Qais. The morphological characteristics among collected isolates revealed that there was a morphological similarity among the collected isolates. Nucleotide sequence analysis of the internal transcribed spacer (ITS1–5.8S rDNA–ITS4 region and 28S nuclear large subunit (nLSU in the ribosomal DNA gene of the isolated stains showed that all of them share over 98% sequence similarity with P. eryngii. Genetic diversity among the collected strains was assessed using inter simple sequence repeat (ISSR analysis using 18 different primer pairs. Using this approach, 141 out of 196 bands obtained were considered polymorphic and the highest percentage of polymorphism was observed using primer UBC827 (92.3% with an overall Polymorphism Information Content (PIC value of 70.56%. Cluster analysis showed that the Jordanian Pleurotus isolates fall into two main clades with a coefficient of similarity values ranging from 0.59 to 0.74 with a clear clustering based on collection sites. The results of the present study reveal that molecular techniques of ISSR and rDNA sequencing can greatly aid in classification and identification of Pleurotus spp. in Jordan.

  8. Cultivation Techniques and Medicinal Properties of Pleurotus spp.

    Directory of Open Access Journals (Sweden)

    Andrej Gregori

    2007-01-01

    Full Text Available The genus Pleurotus (oyster mushroom comprises some most popular edible mushrooms due to their favourable organoleptic and medicinal properties, vigorous growth and undemanding cultivation conditions. It can be cultivated on log and a wide variety of agroforestry (by-products, weeds and wastes for the production of food, feed, enzymes and medicinal compounds, or for waste degradation and detoxification. Many different techniques and substrates have been successfully utilized for mushroom cultivation and biomass production by means of solid-state and submerged liquid fermentation. However, in contrast to submerged liquid fermentation, solid-state fermentation is not often used in large scale due to severe engineering problems. Various Pleurotus species have been shown to possess a number of medicinal properties, such as antitumour, immunomodulatory, antigenotoxic, antioxidant, anti-inflammatory, hypocholesterolaemic, antihypertensive, antiplatelet-aggregating, antihyperglycaemic, antimicrobial and antiviral activities. These therapeutic activities are exhibited by extracts or isolated compounds from Pleurotus spp. fermentation broth, mycelia and fruiting bodies. In particular, polysaccharides appear to be potent antitumour and immuno-enhancing substances, besides possessing other beneficial activities. However, the biochemical mechanisms of these therapeutic activities still remain largely unknown. This review focuses on recent advances in the biotechnology of Pleurotus spp., with emphasis on the production of fruiting bodies, the production of mycelium and bioactive compounds by solid-state and submerged liquid fermentation. The medicinal properties of this mushroom are also outlined.

  9. Ligninolytic peroxidase genes in the oyster mushroom genome: heterologous expression, molecular structure, catalytic and stability properties, and lignin-degrading ability

    Science.gov (United States)

    Elena Fernández-Fueyo; Francisco J Ruiz-Dueñas; María Jesús Martinez; Antonio Romero; Kenneth E Hammel; Francisco Javier Medrano; Angel T. Martínez

    2014-01-01

    Background: The genome of Pleurotus ostreatus, an important edible mushroom and a model ligninolytic organism of interest in lignocellulose biorefineries due to its ability to delignify agricultural wastes, was sequenced with the purpose of identifying and characterizing the enzymes responsible for lignin degradation. ...

  10. Pleurotus sajor caju

    African Journals Online (AJOL)

    Administrator

    The influence of fungus treatment on the biochemical composition and degradation patter of sawdust and cotton plant by-products (cotton burns and cotton gin trash) by Pleurotus sajor caju were evaluated. Lignin degradation increased as the incubation period progressed while the highest loss of hemicellulose, cellulose ...

  11. In Vitro Antioxidant and In Vivo Hypolipidemic Effects of the King Oyster Culinary-Medicinal Mushroom, Pleurotus eryngii var. ferulae DDL01 (Agaricomycetes), in Rats with High-Fat Diet-Induced Fatty Liver and Hyperlipidemia.

    Science.gov (United States)

    Choi, Jun-Hui; Kim, Dae-Won; Kim, Seung; Kim, Sung-Jun

    2017-01-01

    We investigated the effect of the culinary-medicinal mushroom Pleurotus eryngii var. ferulae DDL01 on oxidative damage in the liver and brain and a high-fat/high-cholesterol-induced hyperlipidemic model. In in vitro studies, the water extracts of the fruiting bodies showed strong scavenging activities of DPPH (139.46 ± 3.2 μg) and hydroxyl (139.46 ± 3.2 μg) radicals. Moreover, the extracts showed Fe2+ chelating and reducing abilities, as well as a large amount of polyphenols and an inhibitory effect on lipid peroxidation in the liver and brain tissues. The rats were fed a pellet diet (7.5 g/rat/day) containing P. eryngii var. ferulae DDL01 (PD) for 3 weeks. In the high-fat/high-cholesterol-induced hyperlipidemic rat model, administration of PD caused a significant decrease (P < 0.05) in the levels of serum triacylglycerols, low-density lipoprotein cholesterol, very-low-density lipoprotein cholesterol, aspartate aminotransferase, and alanine aminotransferase and a significant increase (P < 0.05) in the level of high-density lipoprotein cholesterol. PD administration significantly decreased high-fat/high-cholesterol-induced hepatic lipid accumulation. Treatment with the extracts (up to 500 μg/mL) did not significantly affect the viability of HepG2 and 3T3-L1 cells. Our findings suggest that this mushroom has potential as an antiatherogenic dietary source in the development of therapeutic agents and functional foods.

  12. Effect of substrate on the growth, nutritional and bioactive ...

    African Journals Online (AJOL)

    rosemary

    2016-07-06

    Jul 6, 2016 ... growth, determining nutritional and bioactive components of two oyster mushroom, Pleurotus ostreatus and. Pleurotus ... and the method of cultivation are of major importance ..... rendered alkaline with a few drops of ammonia solution. 5 ..... production and non-enzymatic antioxidant activity of Pleurotus.

  13. Mycelial growth observation of Pleurotus eryngii (Higher Basidiomycota In Vitro

    Directory of Open Access Journals (Sweden)

    Mustafa Nadhim Owaid

    2016-09-01

    Full Text Available Five agro-substrates including date palm fibers (fibrillum, wheat straw, white sawdust and their combinations were investigated to grow Pleurotus eryngii. The longer mycelium complete time within bags was 20 days on sawdust (S4, in contrast, the shorter time for mycelium overgrew was completed after 15 days on date palm fiber (S5. In significant (p<0.05, S5 showed the higher growth intensity level (vigorous growth than other substrates. Thus use of date palm wastes (S5 medium may be useful for successfully cultivation king oyster mushroom in farm.International Journal of Environment Vol.5(3 2016, pp.1-10

  14. Isolation and characterization of differentially expressed genes in ...

    African Journals Online (AJOL)

    USER

    Through reverse transcriptase-polymerase chain reaction analysis, priA homologue and AP-1 like transcription factor ... The oyster mushroom, Pleurotus ostreatus, and white button mushroom ..... differential display of RAPD. FEMS Microbiol.

  15. Pleurotus giganteus (Berk. Karun & Hyde), the giant oyster mushroom inhibits NO production in LPS/H2O2 stimulated RAW 264.7 cells via STAT 3 and COX-2 pathways.

    Science.gov (United States)

    Baskaran, Asweni; Chua, Kek Heng; Sabaratnam, Vikineswary; Ravishankar Ram, Mani; Kuppusamy, Umah Rani

    2017-01-13

    Pleurotus giganteus (Berk. Karunarathna and K.D. Hyde), has been used as a culinary mushroom and is known to have medicinal properties but its potential as an anti-inflammatory agent to mitigate inflammation triggered diseases is untapped. In this study, the molecular mechanism underlying the protective effect of ethanol extract of P. giganteus (EPG) against lipopolysaccharide (LPS) and combination of LPS and hydrogen peroxide (H 2 O 2 )-induced inflammation on RAW 264.7 macrophages was investigated. The effect of EPG on nitric oxide (NO) production as an indicator of inflammation in RAW 264.7 macrophages was estimated based on Griess reaction that measures nitrite level. The expressions of inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), NF-kB activating protein (NKAP), signal transducer and activator of transcription 3 protein (STAT 3) and glutathione peroxidase (GPx) genes were assessed using real time reverse transcription polymerase chain reaction (RT-PCR) approach. EPG (10 μg/ml) showed the highest reduction in the LPS-induced NO production in RAW 264.7 macrophages and significantly suppressed (p < 0.05) the expression iNOS, STAT 3 and COX-2. There was a significant increase (p < 0.05) in combination of LPS and H 2 O 2 - induced iNOS production when compared to the LPS-induced iNOS production in RAW 264.7 macrophages and this concurred with the NO production which was attenuated by EPG at 10 μg/ml. A significant (p < 0.05) down regulation was observed in the combination of LPS and H 2 O 2 -induced iNOS and GPx expression by EPG. Our data suggest that the anti-inflammatory activity of EPG is mediated via the suppression of the STAT 3 and COX-2 pathways and can serve as potential endogenous antioxidant stimulant.

  16. Genetic diversity of edible mushroom pleurotus spp. revealed by randomly amplified polymorphic dna fingerprinting

    International Nuclear Information System (INIS)

    Khan, N. A.; Awan, F. S.; Khan, A. I.; Waseem, M.

    2017-01-01

    The Oyster mushroom (Pleurotus) cultivation is a profitable agribusiness and having high significance due its nutritive and therapeutic value. Due to deficient knowledge on Pleurotus mushroom genetics seven strains of Oyster mushroom, two local and five exotic were studied for their genetic diversity through RAPD markers. It was clear from similarity matrix that similarity index ranges from 45 to 72%. The cluster analysis of combined data set of all the markers resulted in three major clades, while isolate P-17 remains ungrouped and shown to be the most diverse strain of the seven. During amplification of genomic DNA yielded 70 fragments that could be scored, of which 41 were polymorphic, with an average of 2.73 polymorphic fragments per primer. Number of amplified fragments with random primers ranged from three to six. Polymorphism ranged from 0% to 83.33%, with an overall 58% polymorphism. The allele frequency of RAPD primers ranged from 0.71 to 1.00 while the polymorphic information content highest for the primer GL-C-20 (0.29) followed by the primers GL A-20 and GL C-16 that is zero, indicating medium level of polymorphism among the strains of Oyster mushroom. The objective of the study was to characterize Pleurotus strains collected from different origins and to find out the variability at molecular level. (author)

  17. Disease control by chemical and biological fungicides in cultivated mushrooms: Button mushroom, oyster mushroom and shiitake

    OpenAIRE

    Potočnik, Ivana; Stepanović, Miloš; Rekanović, Emil; Todorović, Biljana; Milijašević-Marčić, Svetlana

    2015-01-01

    The most commonly cultivated basidiomycetes worldwide and in Serbia are button mushroom (Agaricus bisporus), oyster mushroom (Pleurotus sp.) and shiitake (Lentinus edodes). Production of their fruiting bodies is severely afflicted by fungal, bacterial, and viral pathogens that are able to cause diseases which affect yield and quality. Major A. bisporus fungal pathogens include Mycogone perniciosa, Lecanicillium fungicola, and Cladobotryum spp., the causal a...

  18. Molecular identification and artificial cultivation of a wild isolate of oyster mushroom in Albania

    Directory of Open Access Journals (Sweden)

    Jordan Merkuri

    2016-03-01

    Full Text Available Basidiomata of a wild mushroom macroscopically recognised as Pleurotus ostreatus were observed on an oak trunk in a mixed wood of northern Albania. Pure cultures of the fungus were then obtained on potato-dextrose-agar medium. Molecular analyses of genomic DNA of the fungus confirmed its identification. The rDNA ITS region nucleotide sequence of the studied Pleurotacea matched at 99% those of two P. ostreatus strains already present in NCBI GenBank database. The rDNA ITS nucelotide sequences of two pure cultures of the Albanian P. ostreatus were deposited in EMBL database under the accession numbers LN849458 and LN849459. One of the fungus isolates was subsequently cultivated under protected and semi-natural conditions. Productivity and biological efficiency of the Albanian P. ostreatus ranged from about 10% to 16% and from 33 to 53.33%, respectively. This seems to be the first report on the artificial cultivation of P. ostreatus in Albania and could have, in the next future, a high economic impact on development and diffusion of this important edible mushroom over the country.

  19. Identification and characterization of Trichoderma species aggressive to Pleurotus in Italy

    Institute of Scientific and Technical Information of China (English)

    Woo S L; Di Benedetto P; Senatore M; Abadi K; Gigante S; Soriente I; Ferraioli S; Scala F; Lorito M

    2004-01-01

    @@ In the late 1980's the development of a severe epidemic of green mold caused by Trichoderma spp.was noted in the commercial production of Agaricus bisporus (champignon) in the United Kingdom,North America, Spain and Holland, which caused extensive economic losses. The parasitic fungi isolated from the edible mushroom belonged to four biotypes, Thl, Th2, Th3 and Th4 of T.harzianum. However, among these biotypes, only Th2 (since classified as T. aggressivum f.europaeum) and Th4 (T. aggressivum f. aggressivum) were identified as the fungi causing problems in Agaricus production. In general, mushroom compost hosts both aggressive and innocuous isolates of Trichoderma, which are not morphologically distinguishable. About four years ago, a problem with green mold became apparent in the production of Pleurotus ostreatus in Northern Italy,which eventually developed to a crisis situation in the South two years later and threatened to seriously compromise the Pleurotus market. This study was initiated to: isolate and identify the aggressive fungi, then morphologically, physiologically and genetically characterize the isolates, determine the source and phases of infection, and study methods of control. Samples were obtained from different phases of compost preparation at the locality of a major producer and supplier of compost to the mushroom industry in Southern Italy, and microbial counts were conducted. Although the presence of Trichoderma was detected in the initial stages of composting, this value was reduced to zero from the phase of pasteurization to seeding with Pleurotus. Trichoderma infestations were noted in the packaged Pleurotus bales at various times during the incubation phase (7-15 days after seeding) and after shipping to the mushroom greenhouses, where the pathogen infestations greatly reduced the quality and quantity of the mushroom yield, as well as the number of potential harvest cycles.Preliminary results from the morphological and genetic

  20. Development of Novel Polymorphic EST-SSR Markers in Bailinggu (Pleurotus tuoliensis for Crossbreeding

    Directory of Open Access Journals (Sweden)

    Yueting Dai

    2017-11-01

    Full Text Available Identification of monokaryons and their mating types and discrimination of hybrid offspring are key steps for the crossbreeding of Pleurotus tuoliensis (Bailinggu. However, conventional crossbreeding methods are troublesome and time consuming. Using RNA-seq technology, we developed new expressed sequence tag-simple sequence repeat (EST-SSR markers for Bailinggu to easily and rapidly identify monokaryons and their mating types, genetic diversity and hybrid offspring. We identified 1110 potential EST-based SSR loci from a newly-sequenced Bailinggu transcriptome and then randomly selected 100 EST-SSRs for further validation. Results showed that 39, 43 and 34 novel EST-SSR markers successfully identified monokaryons from their parent dikaryons, differentiated two different mating types and discriminated F1 and F2 hybrid offspring, respectively. Furthermore, a total of 86 alleles were detected in 37 monokaryons using 18 highly informative EST-SSRs. The observed number of alleles per locus ranged from three to seven. Cluster analysis revealed that these monokaryons have a relatively high level of genetic diversity. Transfer rates of the EST-SSRs in the monokaryons of closely-related species Pleurotus eryngii var. ferulae and Pleurotus ostreatus were 72% and 64%, respectively. Therefore, our study provides new SSR markers and an efficient method to enhance the crossbreeding of Bailinggu and closely-related species.

  1. Development of Novel Polymorphic EST-SSR Markers in Bailinggu (Pleurotus tuoliensis) for Crossbreeding

    Science.gov (United States)

    Dai, Yueting; Su, Wenying; Song, Bing; Li, Yu; Fu, Yongping

    2017-01-01

    Identification of monokaryons and their mating types and discrimination of hybrid offspring are key steps for the crossbreeding of Pleurotus tuoliensis (Bailinggu). However, conventional crossbreeding methods are troublesome and time consuming. Using RNA-seq technology, we developed new expressed sequence tag-simple sequence repeat (EST-SSR) markers for Bailinggu to easily and rapidly identify monokaryons and their mating types, genetic diversity and hybrid offspring. We identified 1110 potential EST-based SSR loci from a newly-sequenced Bailinggu transcriptome and then randomly selected 100 EST-SSRs for further validation. Results showed that 39, 43 and 34 novel EST-SSR markers successfully identified monokaryons from their parent dikaryons, differentiated two different mating types and discriminated F1 and F2 hybrid offspring, respectively. Furthermore, a total of 86 alleles were detected in 37 monokaryons using 18 highly informative EST-SSRs. The observed number of alleles per locus ranged from three to seven. Cluster analysis revealed that these monokaryons have a relatively high level of genetic diversity. Transfer rates of the EST-SSRs in the monokaryons of closely-related species Pleurotus eryngii var. ferulae and Pleurotus ostreatus were 72% and 64%, respectively. Therefore, our study provides new SSR markers and an efficient method to enhance the crossbreeding of Bailinggu and closely-related species. PMID:29149037

  2. Oysters and Oyster Reef Communities in Florida.

    Science.gov (United States)

    Knight, Jean; Bly, Joe

    1989-01-01

    The habitat, life history, feeding, classification, anatomy and pearl production of the American oyster (Crassostrea virginica) are presented. A list of other oyster reef inhabitants and predators is provided. Harvest and habitat loss are discussed. (CW)

  3. Oyster mushrooms (Pleurotus) are useful for utilizing lignocellulosic ...

    African Journals Online (AJOL)

    DR. ADEBAYO

    2015-01-07

    Jan 7, 2015 ... Agro-residues contain three major structural polymers, cellulose ... aggregated together in the form of micro-fibrils order that ... Rice straw. 29.2-34.7 ... Oat straw. 31-35 ...... production of banana shell and cassava starch. Dyna ...

  4. Oyster mushrooms ( Pleurotus ) are useful for utilizing lignocellulosic ...

    African Journals Online (AJOL)

    The biodegradation and bioconversion of agro wastes (lignin, cellulose and hemicellulose) could have vital implication in cleaning our environment. The bioprocessing of lignin depends on the potent lignocellulolytic enzymes such as phenol oxidases (laccase) or heme peroxidases (lignin peroxidase (LiP), manganese ...

  5. Cultivo e características nutricionais de Pleurotus em substrato pasteurizado Cultivation and nutritional characteristics of Pleurotus grown in pasteurized substrate

    Directory of Open Access Journals (Sweden)

    Eduardo Bernardi

    2009-01-01

    Full Text Available O objetivo deste trabalho foi avaliar a produtividade, eficiência biológica, massa fresca, composição centesimal dos cogumelos Pleurotus ostreatus (BF24 e Pleurotus sajor-caju (PSC96/03 e PSC01/06 produzidos no substrato capim-elefante (Pennisetum purpureum pasteurizado e a relação Carbono/Nitrogênio inicial e final do substrato. O substrato seco e particulado a 2 cm foi umedecido por 24 horas e pasteurizado a 100 ºC durante 30 minutos. Adicionaram-se 3% de inóculo de cada linhagem, sendo acondicionado em embalagens de polipropileno com 1 kg cada uma. Os substratos foram incubados a 26 ºC e na fase de frutificação a 23±3 ºC e umidade relativa de 75% a 90%. Na linhagem BF24 observou-se maior massa fresca (281,19g, eficiência biológica (112,46% e produtividade (28,11%. O substrato com relação Carbono:Nitrogênio inicial de 162:1 foi o de menor relação (68:1 após o cultivo do P. sajor-caju (PSC01/06. A linhagem PSC96/03 proporcionou maior teor de proteína em relação às demais, tendo a BF24 maior teor de lipídios. Quanto ao teor de carboidratos e cinzas, nas diferentes espécies e linhagens não houve diferenças significativas; já para a quantidade de fibras, as linhagens BF24 e PSC01/06 foram similares, porém superiores a PSC96/03. As duas espécies de Pleurotus podem ser cultivadas em capim-elefante pasteurizado, suprimindo o processo de compostagem.The objective of this work was to evaluate the productivity, biological efficiency, fresh matter, and centesimal composition of mushroom Pleurotus ostreatus (BF24 and Pleurotus sajor-caju (PSC96/03 and PSC01/06 grown in pasteurized elephant grass substrate (Pennisetum purpureum. It was also assessed the initial and final Carbon/Nitrogen ratio. The dried 2-cm-particulate substrate was moist for 24 hours and pasteurized at 100ºC during 30 minutes. Then, it was added 3% of inoculum of each strain. The substrate was placed into 1-kg polypropylene bags. The bags were incubated

  6. The potential of Pleurotus-treated olive mill solid waste as cattle feed.

    Science.gov (United States)

    Shabtay, Ariel; Hadar, Yitzhak; Eitam, Harel; Brosh, Arieh; Orlov, Alla; Tadmor, Yaakov; Izhaki, Ido; Kerem, Zohar

    2009-12-01

    The aims of the current study were to follow: (1) the capability of the edible mushroom Pleurotus ostreatus to degrade cell wall components and soluble phenols of the olive mill solid waste (OMSW), and improve it for ruminant nutrition (2) the fate of oil and the lipid-soluble compounds tocopherols, squalene and beta-sitosterol in the fermented OMSW. A significant decrease in oil and lipid-soluble compounds with a concomitant shift in the fatty acid profile and degradation of soluble phenols took place already after 14 d. The utilization of lipids by the fungus shifted the degradation of the structural carbohydrates to a later stage, and significantly reduced the metabolizable energy of the OMSW. We propose that edible fungi with reduced lipase activity would preserve the energy and health promoting ingredients of the oil, and force the fungus to degrade structural carbohydrates, thus improving its digestibility.

  7. Oysters and Vibriosis

    Science.gov (United States)

    ... this? Submit What's this? Submit Button Past Emails Oysters and Vibriosis Language: English (US) Español (Spanish) Recommend ... is to cook them properly. Tips for Cooking Oysters & Other Shellfish Before cooking, throw out any shellfish ...

  8. Antioxidant, antifungal and anticancer activities of se-enriched Pleurotus spp. mycelium extracts

    Directory of Open Access Journals (Sweden)

    Milovanović Ivan

    2014-01-01

    Full Text Available The goal of this study was the evaluation of antifungal, antioxidant and anticancer potentials of Pleurotus eryngii, P. ostreatus and P. pulmonarius mycelial extracts, and the influence of mycelium enrichment with selenium on these activities. Both Se-amended and non-amended extracts showed the same or similar minimal inhibitory concentration for 14 studied micromycetes, while a fungicidal effect was not noted, contrary to ketoconazole, which had inhibitory and fungicidal effects at very low concentrations. Se-non-amended extracts exhibited antioxidant activity, especially at higher concentrations. Selenium enrichment influenced activity, its effects decreasing in P. eryngii and P. pulmonarius, while in P. ostreatus no effect was noted. The DPPH• radical scavenging capacity of the extracts was in direct correlation with their phenol and flavonoid contents. Cytotoxic activity against both HeLa and LS174 cell lines was very low compared with cis-DDP. These features suggest that mycelium should be an object of intensive studies. [Projekat Ministarstva nauke Republike Srbije, br. 173032

  9. Potential applications of the white rot fungus Pleurotus in bioregenerative life support systems

    Science.gov (United States)

    Manukovsky, N. S.; Kovalev, V. S.; Yu, Ch.; Gurevich, Yu. L.; Liu, H.

    Earlier we demonstrated the possibility of using soil-like substrate SLS for plant cultivation in bioregenerative life support systems BLSS We suggest dividing the process of SLS bioregeneration at BLSS conditions into two stages At the first stage plant residues should be used for growing of white rot fungus Pleurotus ostreatus Pleurotus florida etc The fruit bodies could be used as food Spent mushroom compost is carried in SLS and treated by microorganisms and worms at the second stage The possibility of extension of human food ration is only one of the reasons for realization of the suggested two-stage SLS regeneration scheme people s daily consumption of mushrooms is limited to 200 -250 g of wet weight or 20 -25 g of dry weight Multiple tests showed what is more important is that inclusion of mushrooms into the system cycle scheme contributes through various mechanisms to the more stable functioning of vegetative cenosis in general Taking into account the given experimental data we determined the scheme of mushroom module material balance The technological peculiarities of mushroom cultivation at BLSS conditions are being discussed

  10. Activity of the fungus Pleurotus ostreatus and of its proteases on ...

    African Journals Online (AJOL)

    Avell G1511

    more studies from biological models under laboratory conditions. Extracellular proteases produced by nematophagous fungi are directly involved in the stages of the infection. They act in the digestion of nematode's protection barrier, rich in protein (Braga et al., 2010). However, there is a lack of studies aimed at elucidating ...

  11. A two-dimensional protein map of Pleurotus ostreatus microsomes-proteome dynamics

    Czech Academy of Sciences Publication Activity Database

    Petráčková, Denisa; Halada, Petr; Bezoušková, Silvia; Křesinová, Zdena; Svobodová, Kateřina

    2016-01-01

    Roč. 61, č. 1 (2016), s. 63-71 ISSN 0015-5632 R&D Projects: GA ČR(CZ) GA15-02328S Institutional support: RVO:61388971 Keywords : FUNGUS * EXPRESSION * BIODEGRADATION Subject RIV: DK - Soil Contamination ; De-contamination incl. Pesticides Impact factor: 1.521, year: 2016

  12. Iron bioavailability from cereal products enriched with Pleurotus ostreatus mushrooms in rats with induced anaemia

    Directory of Open Access Journals (Sweden)

    Julita Reguła

    2016-06-01

    Product may be a valuable source of iron in the nutrition of individuals with a deficiency of this element, first of all patients with absorption and metabolism disorders, but also may add variety to the traditional daily diet.

  13. Mutual interactions of Pleurotus ostreatus with bacteria of activated sludge in solid-bed bioreactors

    Czech Academy of Sciences Publication Activity Database

    Svobodová, Kateřina; Petráčková, Denisa; Kozická, Barbora; Halada, Petr; Novotný, Čeněk

    2016-01-01

    Roč. 32, č. 6 (2016), s. 94 ISSN 0959-3993 R&D Projects: GA ČR(CZ) GA15-02328S; GA MŠk LO1509 Institutional support: RVO:61388971 Keywords : TRAMETES-VERSICOLOR * WASTE-WATER * BIOFILM FORMATION Subject RIV: EI - Biotechnology ; Bionics Impact factor: 1.658, year: 2016

  14. Decolorization and detoxification of reactive industrial dyes by immobilized fungi Trametes pubescens and Pleurotus ostreatus

    Czech Academy of Sciences Publication Activity Database

    Caiseri, L.; Varese, G.C.; Anastasi, A.; Prigione, V.; Svobodová, Kateřina; Marchisio, V.F.; Novotný, Čeněk

    2008-01-01

    Roč. 53, č. 1 (2008), s. 44-52 ISSN 0015-5632 R&D Projects: GA AV ČR IAA6020411 Institutional research plan: CEZ:AV0Z50200510 Keywords : decolorization * detoxification * trametes pubescens Subject RIV: EE - Microbiology, Virology Impact factor: 1.172, year: 2008

  15. Dose Response for Monokaryon mycelium of Pleurotus pulmonarius After Acute Gamma Radiation

    International Nuclear Information System (INIS)

    Wan Safina Wan Abdul Razak; Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus pulmonarius is locally known as Grey oyster. The species is popular and widely cultivated throughout the world mostly in Asia Europe as their simple and low cost production technology and higher biological efficiency. Mutation induction is an alternative ways for improving available commercial strain for better quality traits. Dose response is important in evaluating effects of mutagenesis via acute gamma radiation. Monokaryon mycelium of Pleurotus pulmonarius was exposed to acute gamma radiation ranged from 0 Gy, 0.1 kGy, 0.2 kGy, 0.3 kGy, 0.4 kGy, 0.5 kGy, 0.6 kGy, 0.7 kGy, 0.8 kGy, 0.9 kGy, 1.0 kGy, 1.5 Gy, 2.0 kGy, 3.0 kGy and 4.0 kGy at dose rate 0.013 kGy/ min. growth performance was measured at 2 days interval to get the LD_5_0. Increasing of the irradiation dose found to decrease the growth performance of the monokaryon mycelium. LD_5_0 was revealed at 1.56 kGy for mono karyon mycelium. Discoveries of the works are important for the improvement of Pleurotus species via acute gamma radiation and benefiting to growers and mushroom industries. (author)

  16. Morphological and molecular identification of four Brazilian commercial isolates of Pleurotus spp. and cultivation on corncob

    Directory of Open Access Journals (Sweden)

    Nelson Menolli Junior

    2010-04-01

    Full Text Available The species of Pleurotus have great commercial importance and adaptability for growth and fructification within a wide variety of agro-industrial lignocellulosic wastes. In this study, two substrates prepared from ground corncobs supplemented with rice bran and charcoal were tested for mycelium growth kinetics in test tubes and for the cultivation of four Pleurotus commercial isolates in polypropylene bags. The identification of the isolates was based on the morphology of the basidiomata obtained and on sequencing of the LSU rDNA gene. Three isolates were identified as P. ostreatus, and one was identified as P. djamor. All isolates had better in-depth mycelium development in the charcoal-supplemented substrate. In the cultivation experiment, the isolates reacted differently to the two substrates. One isolate showed particularly high growth on the substrate containing charcoal.Espécies de Pleurotus têm grande importância comercial e adaptabilidade para crescimento e frutificação em uma ampla variedade de resíduos agro-industriais lignocelulósicos. Neste trabalho foram testados dois substratos à base de sabugo de milho triturado, suplementados com farelo de arroz e carvão vegetal, para avaliação da cinética de crescimento micelial em tubos de ensaio e produção em sacos de polipropileno, utilizando quatro isolados comerciais. O estudo taxonômico foi realizado com a análise da morfologia dos basidiomas obtidos em cultivo e pelo seqüenciamento do gene nLSU do DNAr, para certificar a identificação taxonômica. Os isolados tiveram melhor desenvolvimento micelial em profundidade no substrato suplementado com carvão vegetal. Em relação à produção, os isolados reagiram de formas distintas em função dos substratos, sendo significativamente melhor o substrato contendo carvão. Três isolados foram identificados como P. ostreatus e o outro foi identificado como P. djamor.

  17. Evaluación del crecimiento y producción de biomasa de dos cepas del género Pleurotus spp., cultivadas en un medio agar con diferentes sustratos

    Directory of Open Access Journals (Sweden)

    Carol Daniela Coello-Loor

    2017-12-01

    Full Text Available La velocidad de crecimiento radial (VCR (mm.h-1 y la producción de biomasa (PB (g.g-1 de sustrato seco son técnicas que puedan establecer el grado de adaptación y desarrollo de los hongos del género Pleurotus spp., a distintos sustratos que podrían emplearse en una fermentación en medio sólido. Las especies fueron Pleurotus sapidus (Ps y Pleurotus ostreatus IE8 (Po. El medio de cultivo sintético empleado fue el papa dextrosa agar (PDA, con un pH que va de 5.6 a 5.9, ideal para el crecimiento de hongos, tiene todos los componentes nutritivos, y ligera acidez que logran la inhibición del desarrollo de bacterias; diluido en 4 diferentes soluciones preparadas con los materiales residuales (solución cascarilla de arroz CaPDA, solución cáscara de maracuyá CmPDA, solución mezcla 50% Cascarilla de arroz+50% Cáscara de maracuyá CaCmPDA y agua destilada+PDA con el propósito de observar el crecimiento radial cada 24 horas y la producción de biomasa fúngica de estos hongos lignocelulósicos por su periodo de incubación y la adaptación a nivel in vitro. Los tratamientos que presentaron mejor comportamiento VCR fueron el PoCaPDA (0.569 y el PoCaCmPDA (0.549; la cepa que reporto valores más altos en VCR y PB fue el Pleurotus ostreatus y el mejor medio de cultivo fue el CaPDA, en ambas variables; mientras, la mayor producción de biomasa fue en Pleurotus sapidus en CaPDA (0.1727 y el Pleurotus ostreatus IE8 en CmPDA (0.1722, CaPDA (0.1706 y PDA (0.1694.

  18. 78 FR 62293 - Safety Zone, Oyster Festival 30th Anniversary Fireworks Display, Oyster Bay; Oyster Bay, NY

    Science.gov (United States)

    2013-10-15

    ... Safety Zone, Oyster Festival 30th Anniversary Fireworks Display, Oyster Bay; Oyster Bay, NY AGENCY: Coast... zone on the navigable waters of Oyster Bay near Oyster Bay, NY for the Oyster Festival 30th Anniversary... Oyster Festival 30th Anniversary Fireworks Display is scheduled for October 19, 2013 and is one of...

  19. 21 CFR 161.136 - Olympia oysters.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Olympia oysters. 161.136 Section 161.136 Food and... oysters. Olympia oysters, raw Olympia oysters, shucked Olympia oysters, are of the species Ostrea lurida and conform to the definition and standard of identity prescribed for oysters in § 161.130. ...

  20. Content of Chemical Elements in Wood-Destroying Fungi

    Directory of Open Access Journals (Sweden)

    Strapáč I.

    2016-12-01

    Full Text Available The aim of this study was to examine the content of chemical elements in the dried fruiting bodies of edible wood decaying fungi such as Honey mushrooms (Armillaria mellea, Shiitakes (Lentinus edodes and Oyster mushrooms (Pleurotus ostreatus. Powdered samples of fungi were mineralized in a microwave digestion. Twenty-one (21 chemical elements were detected in the plasma of the device ICP-MS AGILENT 7500c by accredited methods with the aid of calibration curves. The content of individual elements varied within a considerable range. The highest contents of K, Mn, Cu and Cd were found in the fruiting bodies of Honey mushrooms (Armillaria mellea. Shiitakes (Lentinus edodes had the highest content of B and Mo. Significant differences were found in the content of elements in the Oyster mushrooms (Pleurotus ostreatus from Slovakia, Hungary and China. The highest content of Al was found in the Oyster mushrooms (Pleurotus ostreatus from Hungary. The Chinese oysters had a maximum contents of Ca, Mg, Co, Pb, As and U. The Oyster mushrooms (Pleurotus ostreatus from Lemešany (Slovakia had the highest contents of Na, Zn, Fe, Se, Ag, Hg and Cr. The difference of chemical element content could be influenced by the genotype of the fungus and by the composition of substrate on which mushroom grow up.

  1. Interaction of uranium with Pleurotus sp

    International Nuclear Information System (INIS)

    Ohnuki, Toshihiko; Sakamoto, Fuminori; Kozaki, Naofumi; Ozaki, Takuro; Samadfam, Mohammad

    2002-01-01

    Uptake of uranium by higher fungi, such as mushroom is little elucidated. We have studied the interaction of uranium with Pleurotus sp. (a mushroom) in pure culture over a wide range of U concentration (50-3000 mg/L). The Pleurotus sp. was cultured in two different media. One was rice bran medium, and the other was agar (yeast extract, peptone and dextrose) medium. The uptake of uranium in Pleurotus sp. was examined by alpha ray autoradiography (A,A), X-ray fluorescence spectroscopy (XRF) and scanning microcopy (SEM) equipped with EDS. In the agar medium, the higher uranium concentration gave lower growth of mycelia, and no fruiting body was observed. In the rice bran medium, the fruiting body was grown at U concentrations up to 1000 mg/L. The AA and XRF analysis showed that uranium taken up in the fruiting body was below the detection limit. The SEM-EDS analysis indicated that U was distributed in the limited region and was not transported to the mycelia far from U containing medium. It is concluded that uranium affects the growth of Pleurotus sp., and little uranium is taken up by Pleurotus sp. during the growth of both mycelia and fruiting body. (author)

  2. Oyster radiation sensitivity

    International Nuclear Information System (INIS)

    Marchese, Sandra R.M.; Mastro, Nelida L. del

    1996-01-01

    Various food products like oysters, crabs and shrimps have been described as possible Vibrio spp. transmitting agents. Seafood irradiation is been presented as an alternative among the different public health intervention measures to control food borne diseases. The objective of this work was to establish, firstly, the radioresistance of Crassostrea brasiliana oysters. The oysters were irradiated with Co-60 radiation with doses of 0, 1.5,3 and 6 kGy. Survival curves a function of time showed that 100% of samples irradiated with 3 kGy survived at least 6 days; among those irradiated with 6 kGy, 100% survived 3 days. These results are encouraging since a dose of 2 kGy is already effective in diminishing oyster bioburden. (author)

  3. Enzyme-assisted extraction enhancing the umami taste amino acids recovery from several cultivated mushrooms

    DEFF Research Database (Denmark)

    Poojary, Mahesha Manjunatha; Orlien, Vibeke; Passamonti, Paolo

    2017-01-01

    In this study, enzyme-assisted extraction was performed to extract umami taste and total free amino acids (FAAs) from the six different mushrooms including shiitake (Lentinus edodes), oyster (Pleurotus ostreatus), tea tree (Agrocybe aegerita) and, white, brown and portobello champignons (Agaricus...

  4. Heavy metal and proximate composition associated with the ...

    African Journals Online (AJOL)

    Changes in the heavy metal content and proximate composition during the 28 day composting of cassava peels used in the cultivation of the oyster mushrooms Pleurotus ostreatus strain EM-1 was studied. Significant dry weight variations of cellulose, hemicellulose and fat contents were observed from day 0 to 12.

  5. Author Details - African Journals Online

    African Journals Online (AJOL)

    Shan, L. Vol 6, No 23 (2007) - Articles Seasonal and spatial root biomass and water use efficiency of four forage legumes in semiarid northwest China Abstract PDF · Vol 10, No 46 (2011) - Articles Extension of the shelf-life of fresh oyster mushrooms (Pleurotus ostreatus) by modified atmosphere packaging with chemical ...

  6. Evaluation on the effects of P. ostreatus spent mushroom compost ...

    African Journals Online (AJOL)

    Realization in minimizing production cost for in vitro culture had brought to a study on application of P. ostreatus spent mushroom compost (SMC). Sterile nodal explants was inoculated on different treatments with 15 replicates each. Treatments were MS medium supplemented with different concentrations of SMC (1 and 2 ...

  7. The American Oyster.

    Science.gov (United States)

    Thompson, Nancy E.

    The Maryland Marine Science Education Project has produced a series of mini-units in marine science education for the junior high/middle school classroom. This unit focuses on the American oyster. Although the unit specifically treats the Chesapeake Bay, it may be adapted for use with similar estuarine systems. In addition, the unit may be…

  8. Putting oysters under pressure

    Science.gov (United States)

    High pressure processing (HPP) is the most commercially important food processing technology in use now and is anticipated to remain of equal or greater importance during the next five to 10 years. This month’s column reviews the theory and current applications of HPP for oysters to improve their sa...

  9. Oyster Fauna of Thailand

    DEFF Research Database (Denmark)

    Bussarawit, Somchai; Cedhagen, Tomas

    2012-01-01

    Here, we describe 16 species of true oysters from Thai waters. They are widely distributed on various intertidal and subtidal substrates in the Gulf of Thailand and in the Andaman Sea. The different species were identified on the basis of their shell morphology, and their characteristic features...

  10. Dangerous Raw Oysters

    Centers for Disease Control (CDC) Podcasts

    2013-08-05

    Dr. Duc Vugia, chief of the Infectious Diseases Branch at the California Department of Public Health, discusses the dangers of eating raw oysters.  Created: 8/5/2013 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 8/7/2013.

  11. Produção de três espécies de cogumelos Pleurotus e avaliação da qualidade em atmosfera modificada Production of three species of Pleurotus mushrooms and quality evaluation in modified atmosphere

    Directory of Open Access Journals (Sweden)

    Cristina Ramos

    2011-01-01

    Full Text Available A utilização de substratos vegetais à base de palha tem vindo a assumir uma importância crescente na cultura de cogumelos sapróbios, principalmente do género Pleurotus. Estes cogumelos são considerados muito interessantes do ponto de vista comercial, não só pelas suas características organolépticas e nutricionais, mas também pela sua fácil adaptação e manutenção, crescimento rápido e relativo baixo custo de cultura. No entanto, por se tratar de alimentos perecíveis, devido sobretudo à sua composição e elevada taxa respiratória, podem apresentar reduzido valor comercial, caso a conservação não seja efectuada nas melhores condições. No sentido de minimizar estas alterações, os cogumelos frescos devem ser submetidos a um processamento mínimo com utilização combinada de embalagem em atmosfera modificada, de forma a manter a qualidade e estabilidade no período de conservação. Neste trabalho foram efectuados ensaios de produção de três espécies do género Pleurotus, cultivadas em palha de trigo, com a finalidade de determinar a espécie mais produtiva e avaliar a qualidade dos mesmos durante a conservação quando processados e embalados em atmosfera modificada. Os resultados permitem concluir que a espécie mais produtiva foi a P. ostreatus, seguida da P. sajor-caju e P. eryngii, tendo sido a P. eryngii a que mostrou maior resistência à degradação no período de conservação estabelecido.The use of substrates straw has been increasing importance in mushroom saprophytic species grown, especially of Pleurotus genus. They are considered very interesting from the commercial point of view, not only for its nutritional and organoleptic characteristics, but also for its easy adaptation, rapid growth and relatively low culture cost. Mushrooms have a short shelf life when compared to most vegetables at ambient temperatures mainly due to its composition and high respiration rate. After yield and to reduce losses and

  12. Long term storage of Pleurotus ostreatus and Trametes versicolor isolates using different cryopreservation techniques and its impact on laccase activity

    Czech Academy of Sciences Publication Activity Database

    Eichlerová, Ivana; Homolka, Ladislav; Tomšovský, M.; Lisá, Ludmila

    2015-01-01

    Roč. 119, č. 12 (2015), s. 1345-1353 ISSN 1878-6146 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Basidiomycetes * Cryopreservant * Liquid nitrogen Subject RIV: EE - Microbiology, Virology Impact factor: 2.244, year: 2015

  13. Mechanistic Study of 17 alpha-Ethinylestradiol Biodegradation by Pleurotus ostreatus: Tracking of Extracelullar and Intracelullar Degradation Mechanisms

    Czech Academy of Sciences Publication Activity Database

    Křesinová, Zdena; Moeder, M.; Ezechiáš, Martin; Svobodová, Kateřina; Cajthaml, Tomáš

    2012-01-01

    Roč. 46, č. 24 (2012), s. 13377-13385 ISSN 0013-936X R&D Projects: GA TA ČR TA01020804; GA ČR GAP503/10/0408 Institutional support: RVO:61388971 Keywords : WHITE-ROT FUNGI * ENDOCRINE-DISRUPTING CHEMICALS * PERSONAL CARE PRODUCTS Subject RIV: EE - Microbiology, Virology Impact factor: 5.257, year: 2012

  14. Comparison of mushroom yield for Pleurotus Sajor Caju and Pleurotus Florida in different number of flushes

    International Nuclear Information System (INIS)

    Rosnani Abdul Rashid; Mat Rasol Awang; Hassan Hamdani Hassan Mutaat; Meswan Maskom

    2006-01-01

    This paper aimed at comparing the mushroom yield of Pleurotus sajor caju and Pleurotus florida which was harvested in five flushes. The γ-irradiated empty fruit bunch (EFB) at 25kGy was used as cultivation substrate. About 1 to 2% liquid seed of P. sajor caju and P. florida was inoculated into cultivation substrate. After 30 days, the inoculated substrate was opened for fruiting. For both species, the maximum mushroom yield was obtained in first flush and the lowest yield from the fifth flush. This show the mushroom yield is affected by number of flush. From analysis, the mushroom yield of P. florida was much better compared to P. sajor caju for all flushes. (Author)

  15. Effect of inclusion of oyster mushroom substrate on the in vitro fermentation kinetics of Brachiaria brizantha hay

    Directory of Open Access Journals (Sweden)

    Ricardo da Silva Oliveira

    2015-07-01

    Full Text Available The objective of this study was to evaluate the effect of inclusion of exhausted substrate of Pleurotus ostreatus on the in vitro fermentation of Brachiaria brizantha hay-based diets. The experiment was conducted using the semi-automated gas production technique. The ruminal inoculum was collected from three fistulated cattle kept on Brachiaria brizantha pasture. Brachiaria brizantha hay and exhausted substrate of Pleurotus production were used for composition of the diets: ES (100% exhausted substrate, BH (100% Brachiaria brizantha hay, ES5 (5% ES + 95% BH, ES20 (20% ES + 80% BH, and ES30 (30% ES + 70% BH. The experimental design was a 5x3 factorial scheme consisting of five treatments and three ruminal inocula. The degradation kinetics of dry matter (DM was determined after 96 hours of fermentation [D (96h]. No significant differences in the cumulative volume of gas (A were observed between BH (262.6 mL/g DM, ES5 (284.3 mL/g MS, ES20 (256.6 mL/g MS and ES30 (261.7 mL/g MS, indicating that inclusion of the substrate did not affect hay fermentation. A lower gas volume (165.9 mL and lower degradability (52% were observed for the ES diet, showing a lower nutritional value of this substrate compared to Brachiaria brizantha hay, probably due to the action of enzymes that degrade structural carbohydrates found in the mycelia of Pleurotus. The ES diet exhibited a shorter colonization time (L=2.6 h; P<0.05, a finding that may be attributed to the interaction between the mycelium and substrate, facilitating initial colonization. The inclusion of exhausted substrate did not increase microbial growth or degradation compared to the BH diet, but seems to have favored initial colonization of this substrate. The use of ES does not negatively affect colonization and may be used as an ingredient of ruminant diets.

  16. Distribution of Georgia Oyster Reefs

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The feature class in this ESRI Geodatabase contains polygons representing oyster reefs along the Georgia coastal waterways from Chatham County south to Glynn County....

  17. Recycling of Date-Palm Fiber to Produce Pleurotus Cornucopiae Var. Citrinopileatus Mushroom

    Directory of Open Access Journals (Sweden)

    Mustafa Nadhim Owaid

    2017-01-01

    Full Text Available In this study, some local available organic matters, which are including wheat straw (Triticum aestivum, sawdust, and fiber of date palm (Phoenix dactylifera L., were used for growing and cultivating of bright yellow oyster mushroom Pleurotus cornucopiae var. citrinopileatus. The possibility of using date palm fiber (in mixtures with other organic residues as a substrate for the cultivation and production of fruiting bodies of P. cornucopiae var. citrinopileatus was investigated. This mushroom is capable of biorecycling and utilization of some mixtures of lignocellulosic substrates successfully, especially the mixture S3 (50% wheat straw, 30% sawdust, and 20% date palm fiber. The lower mycelia completion time was 17 days, that shown in bags of the S3 substrate. Date-palm fiber substrate exhibited best growth intensity level (moderate significantly (p<0.05. The total yield and biological efficiency percent recorded approx. 90 g and 23% on the S3 substrate respectively, as a higher percent significantly (p<0.05, while sawdust substrate alone was an unsuitable medium for cultivation and production of this mushroom. Finally, the use of date-palm fibers in mixtures is usefulness in producing a fresh edible and medicinal mushroom.INTERNATIONAL JOURNAL OF ENVIRONMENTVolume-5, Issue-4, Sep-Nov 2016, page: 56-65

  18. Oyster mushroom cultivation with rice and wheat straw.

    Science.gov (United States)

    Zhang, Ruihong; Li, Xiujin; Fadel, J G

    2002-05-01

    Cultivation of the oyster mushroom, Pleurotus sajor-caju, on rice and wheat straw without nutrient supplementation was investigated. The effects of straw size reduction method and particle size, spawn inoculation level, and type of substrate (rice straw versus wheat straw) on mushroom yield, biological efficiency, bioconversion efficiency, and substrate degradation were determined. Two size reduction methods, grinding and chopping, were compared. The ground straw yielded higher mushroom growth rate and yield than the chopped straw. The growth cycles of mushrooms with the ground substrate were five days shorter than with the chopped straw for a similar particle size. However, it was found that when the straw was ground into particles that were too small, the mushroom yield decreased. With the three spawn levels tested (12%, 16% and 18%), the 12% level resulted in significantly lower mushroom yield than the other two levels. Comparing rice straw with wheat straw, rice straw yielded about 10% more mushrooms than wheat straw under the same cultivation conditions. The dry matter loss of the substrate after mushroom growth varied from 30.1% to 44.3%. The straw fiber remaining after fungal utilization was not as degradable as the original straw fiber, indicating that the fungal fermentation did not improve the feed value of the straw.

  19. 7 CFR 701.54 - Oysters.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Oysters. 701.54 Section 701.54 Agriculture Regulations... ADMINISTERED UNDER THIS PART § 701.54 Oysters. (a) Notwithstanding § 701.5(b), but otherwise subject to the... be made available under this section for the eligible cost of refurbishing public or private oyster...

  20. Beta-Glucan Synthase Gene Expression in Pleurotus sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

  1. Effect of branding Gulf oysters on consumers willingness to pay

    OpenAIRE

    Acquah, Sarah; Petrolia, Daniel

    2014-01-01

    Using a choice experiment this study found that raw oyster consumers are more likely to buy oysters harvested from their region over those harvested outside the region. Consumers are more likely to buy wild-caught oysters over cultivated oysters. Non-Gulf consumers are more likely to buy medium or large size oysters over small size.

  2. Persistence of Caliciviruses in Artificially Contaminated Oysters during Depuration▿

    OpenAIRE

    Ueki, You; Shoji, Mika; Suto, Atsushi; Tanabe, Toru; Okimura, Yoko; Kikuchi, Yoshihiko; Saito, Noriyuki; Sano, Daisuke; Omura, Tatsuo

    2007-01-01

    The fate of calicivirus in oysters in a 10-day depuration was assessed. The norovirus gene was persistently detected from artificially contaminated oysters during the depuration, whereas feline calicivirus in oysters was promptly eliminated. The prolonged observation of norovirus in oysters implies the existence of a selective retention mechanism for norovirus within oysters.

  3. Hyperspectral remote sensing of wild oyster reefs

    Science.gov (United States)

    Le Bris, Anthony; Rosa, Philippe; Lerouxel, Astrid; Cognie, Bruno; Gernez, Pierre; Launeau, Patrick; Robin, Marc; Barillé, Laurent

    2016-04-01

    The invasion of the wild oyster Crassostrea gigas along the western European Atlantic coast has generated changes in the structure and functioning of intertidal ecosystems. Considered as an invasive species and a trophic competitor of the cultivated conspecific oyster, it is now seen as a resource by oyster farmers following recurrent mass summer mortalities of oyster spat since 2008. Spatial distribution maps of wild oyster reefs are required by local authorities to help define management strategies. In this work, visible-near infrared (VNIR) hyperspectral and multispectral remote sensing was investigated to map two contrasted intertidal reef structures: clusters of vertical oysters building three-dimensional dense reefs in muddy areas and oysters growing horizontally creating large flat reefs in rocky areas. A spectral library, collected in situ for various conditions with an ASD spectroradiometer, was used to run Spectral Angle Mapper classifications on airborne data obtained with an HySpex sensor (160 spectral bands) and SPOT satellite HRG multispectral data (3 spectral bands). With HySpex spectral/spatial resolution, horizontal oysters in the rocky area were correctly classified but the detection was less efficient for vertical oysters in muddy areas. Poor results were obtained with the multispectral image and from spatially or spectrally degraded HySpex data, it was clear that the spectral resolution was more important than the spatial resolution. In fact, there was a systematic mud deposition on shells of vertical oyster reefs explaining the misclassification of 30% of pixels recognized as mud or microphytobenthos. Spatial distribution maps of oyster reefs were coupled with in situ biomass measurements to illustrate the interest of a remote sensing product to provide stock estimations of wild oyster reefs to be exploited by oyster producers. This work highlights the interest of developing remote sensing techniques for aquaculture applications in coastal

  4. Japanese oysters in Dutch waters

    NARCIS (Netherlands)

    Berg, van den J.B.; Kozyreff, G.; Lin, H.X.; McDarby, J.; Peletier, M.A.; Planqué, R.; Wilson, P.L.

    2005-01-01

    Since the introduction of the Japanese oyster in the Eastern Scheldt it has spread into the Wadden Sea. This growth has a negative impact on the life of various other species in the sea. Seen from a mathematical viewpoint, the biological problem of how to restore the disturbed natural equilibrium

  5. Japanese oysters in Dutch waters

    NARCIS (Netherlands)

    Berg, van den J.B.; Kozyreff, G.; Lin, H.X.; McDarby, J.; Peletier, M.A.; Planqué, R.; Wilson, P.L.; Pik, D.; Rottschäfer, V.

    2004-01-01

    We study a number of aspects of the colonisation of the Eastern Scheldt by the Japanese Oyster. We formulate and analyse some simple models of the spatial spreading, and determine a rough dependence of the spreading behaviour on parameters. We examine the suggestion of reducing salinity by opening

  6. The effect of oyster mushroom β-1.3/1.6-D-glucan and oxytetracycline antibiotic on biometrical, haematological, biochemical, and immunological indices, and histopathological changes in common carp (Cyprinus carpio L.).

    Science.gov (United States)

    Dobšíková, Radka; Blahová, Jana; Mikulíková, Ivana; Modrá, Helena; Prášková, Eva; Svobodová, Zdeňka; Skorič, Mišo; Jarkovský, Jiří; Siwicki, Andrzej-Krzysztof

    2013-12-01

    The aim of the study was to evaluate the effect of micronized β-1.3/1.6-D-glucan (BG) derived from the oyster mushroom Pleurotus ostreatus Hiratake and tetracycline antibiotic oxytetracycline (OTC) on biometrical, haematological, biochemical, and immunological indices, and histopathological changes in tissues of one- to two-year-old common carp (Cyprinus carpio L.). The fish tested were divided into five experimental groups and one control. Carp in the control group were fed commercial carp feed pellets. Fish in the five experimental groups were fed the same pellets supplemented with either OTC, a combination of OTC and BG, or BG as follows: 75 mg oxytetracycline kg(-1) bw (OTC group), 75 mg oxytetracycline kg(-1) bw and 0.5% β-glucan (OTC + 0.5% BG group), 75 mg oxytetracycline kg(-1) bw and 2.0% β-glucan (OTC + 2.0% BG group), 0.5% β-glucan (0.5% BG group), and 2.0% β-glucan (2.0% BG group). OTC- and BG-supplemented diets and the control diet were administered to experimental and control carp for 50 days (i.e. samplings 1-3, the exposure period); for the following 14 days, fish were fed only control feed pellets with no OTC or BG supplementation (i.e. sampling 4, the recovery period). Blood and tissue samples were collected both during, and at the end of the study. No significant changes in biometrical indices (i.e. total length, standard length, total weight, hepatosomatic and spleen somatic index, and Fulton's condition factor) were found in experimental carp compared to control in any sampling. In haematological indices, significant changes were found only in sampling 2, in which shifts in PCV (P < 0.01), Hb (P < 0.01), and WBC (P < 0.01), and in the counts of lymphocytes (P < 0.01), monocytes (P < 0.01), and neutrophil granulocytes-segments (P < 0.05) were revealed. As for biochemical profiling, plasma concentrations of glucose, albumins, cholesterol, natrium, and chlorides (all P < 0.01), and total proteins, lactate, phosphorus, and potassium (all P < 0

  7. Calculation of Oyster Benefits with a Bioenergetics Model of the Virginia Oyster

    Science.gov (United States)

    2014-11-01

    soft tissue, and reproduction. Inorganic carbon incorporated into shell CaCO3 is considered separately. The organic carbon sequestered in biomass ...oyster biomass (dry tissue weight); • oyster age vs. shell length; • standing stock (population and biomass ); • shell accretion rates; • age...that found use in model parameterization and validation included: • individual oyster biomass (dry tissue weight); • oyster age vs. shell length

  8. Amylolytic studies of pleurotus tuber-regium | Monago | Global ...

    African Journals Online (AJOL)

    The alpha amylase of the sclerotium of Pleurotus tuber-regium was studied. The enzyme was purified from the fresh sclerotium through dialysis, ammonium sulphate fractionation and column chromatography of CM sephadex. The enzyme showed 70% of it's optimal activity between p.H 4.0 to 8.0. Acid and thermal stability ...

  9. nutrient composition of pleurotus tuberregium (fr) sing's sclerotia

    African Journals Online (AJOL)

    DJFLEX

    The amino acid and mineral profile of Pleurotus tuberregium sclerotia, was investigated. Every 100g ... sample was dried to a constant weight, defatted (by placing a ... (67%), millet, soy bean (74%), peanuts (65%), African ... sodium content to cashew nut (5-13.02mg/100g) [Nandi, .... sclerotia Flour and Protein Concentrate.

  10. Effect of mushroom ( Pleurotus tuber-regium ) inoculums on crude ...

    African Journals Online (AJOL)

    Pollution of soils by crude oil in Niger-Delta of Nigeria has brought untold hardship to the inhabitants of the region. This study was carried out in 2010/2011 and 2011/2012 to determine the effect of Pleurotus tuber-regium (mushroom) inoculums on crude oil polluted soil on stover and grain yields and as well as cob length ...

  11. Preliminary investigation into the use of Pleurotus tuber-regium ...

    African Journals Online (AJOL)

    The swelling capacity was three times that of maize starch BP Tablets prepared with P. tuber-regium powder disintegrated faster than those prepared with maize starch BP at concentrations below 10% w/w. At the disintegrant concentration of 10% w/w paracetamol tablets made from both Pleurotus powder and maize starch ...

  12. (Pleurotus pulmonarius) grown on cotton waste and cassava peel

    African Journals Online (AJOL)

    This work evaluated the yield of Pleurotus pulmonarius on different mixtures of cotton waste and cassava peel. P. pulmonarius demonstrated significantly higher colonization rate on cotton waste substrate (100 g cotton waste) 3 weeks after inoculation of spawn than any other substrate mixtures. Cotton waste had the ...

  13. High pressure inactivation of HAV within oysters: comparison of shucked oysters with whole in shell meats

    Science.gov (United States)

    High pressure inactivation of hepatitis A virus (HAV) within oysters bioaccumulated under simulated natural conditions to levels >106 PFU/oyster has been evaluated. Five min treatments at 20C were administered at 350, 375, and 400 MegaPascals (MPa). Shucked and whole-in-shell oysters were directly...

  14. Composted oyster shell as lime fertilizer is more effective than fresh oyster shell.

    Science.gov (United States)

    Lee, Young Han; Islam, Shah Md Asraful; Hong, Sun Joo; Cho, Kye Man; Math, Renukaradhya K; Heo, Jae Young; Kim, Hoon; Yun, Han Dae

    2010-01-01

    Physio-chemical changes in oyster shell were examined, and fresh and composted oyster shell meals were compared as lime fertilizers in soybean cultivation. Structural changes in oyster shell were observed by AFM and FE-SEM. We found that grains of the oyster shell surface became smoother and smaller over time. FT-IR analysis indicated the degradation of a chitin-like compound of oyster shell. In chemical analysis, pH (12.3+/-0.24), electrical conductivity (4.1+/-0.24 dS m(-1)), and alkaline powder (53.3+/-1.12%) were highest in commercial lime. Besides, pH was higher in composted oyster shell meal (9.9+/-0.53) than in fresh oyster shell meal (8.4+/-0.32). The highest organic matter (1.1+/-0.08%), NaCl (0.54+/-0.03%), and moisture (15.1+/-1.95%) contents were found in fresh oyster shell meal. A significant higher yield of soybean (1.33 t ha(-1)) was obtained by applying composted oyster shell meal (a 21% higher yield than with fresh oyster shell meal). Thus composting of oyster shell increases the utility of oyster shell as a liming material for crop cultivation.

  15. Noroviruses in oysters from local markets and oyster farms in southern Thailand.

    Science.gov (United States)

    Kittigul, Leera; Pombubpa, Kannika; Sukonthalux, Suntharee; Rattanatham, Tippawan; Utrarachkij, Fuangfa

    2011-01-01

    One hundred and eighteen oyster samples collected from local markets and oyster farms in southern Thailand were examined for noroviruses (NoVs) and bacterial indicators of fecal contamination (fecal coliforms and Escherichia coli). Using a virus concentration procedure followed by RT-nested PCR, NoVs were detected in 38% of the samples. Oysters collected from oyster farms were found with NoVs at a higher detection rate (25/53 samples) than oysters from local markets (20/65 samples). Of the 45 NoV-positive oyster samples, 67% belonged to NoV genogroup I (GI), 15% to GII, and 18% to both GI and GII. DNA sequencing showed that 2 NoVs belonged to NoV GI-2 genotype. Fecal coliforms in NoV-positive oyster samples were in the range of oyster samples contained fecal coliforms within the standard acceptable level of raw shellfish (oyster samples were within acceptable levels of E. coli contamination (oysters obtained from both markets and oyster farms might pose a potential risk of acute gastroenteritis associated with raw oyster consumption. Examination for both fecal bacterial indicators and enteric viruses should be conducted for microbiological food safety of shellfish.

  16. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  17. Pacific oyster culture in British Columbia

    National Research Council Canada - National Science Library

    Quayle, D. B; Quayle, Daniel Branch

    1988-01-01

    .... Harvesting, processing, and storage methods are described. The problems of Pacific oyster culture include industrial and sewage pollution, paralytic shellfish poisoning along with predators and disease...

  18. The hot oyster: levels of virulent Vibrio parahaemolyticus strains in individual oysters.

    Science.gov (United States)

    Klein, Savannah L; Lovell, Charles R

    2017-02-01

    Vibrio parahaemolyticus is the leading cause of seafood-associated gastroenteritis and is most commonly transmitted by raw oysters. Consequently, detection of virulent strains of this organism in oysters is a primary concern for seafood safety. Vibrio parahaemolyticus levels were determined in 110 individual oysters harvested from two sampling sites in SC, USA. The majority of oysters (98%) contained low levels of presumptive V. parahaemolyticus However, two healthy oysters contained presumptive V. parahaemolyticus numbers that were unusually high. These two 'hot' oysters contained levels of presumptive V. parahaemolyticus within the gills that were ∼100-fold higher than the average for other oysters collected at the same date and location. Current V. parahaemolyticus detection practices require homogenizing a dozen oysters pooled together to determine V. parahaemolyticus numbers, a procedure that would dilute out V. parahaemolyticus in these 'hot' oysters. This study demonstrates the variability of V. parahaemolyticus densities taken from healthy, neighboring individual oysters in the environment. Additionally, environmental V parahaemolyticus isolates were screened for the virulence-related genes, tdh and trh, using improved polymerase chain reaction primers and protocols. We detected these genes, previously thought to be rare in environmental isolates, in approximately half of the oyster isolates. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  19. Pengaruh mutasi dengan radiasi sinar gamma (CO₆₀ terhadap produktivitas jamur tiram abu-abu (Pleurotus sajur-caju

    Directory of Open Access Journals (Sweden)

    Ira Djajanegara

    2012-02-01

    Full Text Available Irradiation aplied to living organisms may have positive or negative effects on physiological and morphological properties of the organisms. One way to gain genetic variation with better properties than the parental strain is by Gamma (Co 60 radiation application. During this experiment, Gama (Co 60 rays was applied to the grey oyster (Pleurotus sajur-caju mushroom mycellia during exponential phase. Radiation was applied at 0.75 KGray with dose velocity of 1.149 KGray. Analysis of mushroom productivity performances indicate that diameter of mycellia, fresh weight, dry weight, diameter of fruit body and the amount of fruit body of the mutant and control were not significantly different. However, the isozyme pattern showed a different pattern between the mutant and the control which indicates that mutation process has already occured. These data show that mutation did not affect the productivity of the mushroom. Therefore, mutation may affect the nutritional quality of the mushroom instead. Further experiment to verify this possibility is suggested.

  20. Mapping Oyster Reef Habitats in Mobile Bay

    Science.gov (United States)

    Bolte, Danielle

    2011-01-01

    Oyster reefs around the world are declining rapidly, and although they haven t received as much attention as coral reefs, they are just as important to their local ecosystems and economies. Oyster reefs provide habitats for many species of fish, invertebrates, and crustaceans, as well as the next generations of oysters. Oysters are also harvested from many of these reefs and are an important segment of many local economies, including that of Mobile Bay, where oysters rank in the top five commercial marine species both by landed weight and by dollar value. Although the remaining Mobile Bay oyster reefs are some of the least degraded in the world, projected climate change could have dramatic effects on the health of these important ecosystems. The viability of oyster reefs depends on water depth and temperature, appropriate pH and salinity levels, and the amount of dissolved oxygen in the water. Projected increases in sea level, changes in precipitation and runoff patterns, and changes in pH resulting from increases in the amount of carbon dioxide dissolved in the oceans could all affect the viability of oyster reefs in the future. Human activities such as dredging and unsustainable harvesting practices are also adversely impacting the oyster reefs. Fortunately, several projects are already under way to help rebuild or support existing or previously existing oyster reefs. The success of these projects will depend on the local effects of climate change on the current and potential habitats and man s ability to recognize and halt unsustainable harvesting practices. As the extent and health of the reefs changes, it will have impacts on the Mobile Bay ecosystem and economy, changing the resources available to the people who live there and to the rest of the country, since Mobile Bay is an important national source of seafood. This project identified potential climate change impacts on the oyster reefs of Mobile Bay, including the possible addition of newly viable

  1. 21 CFR 161.130 - Oysters.

    Science.gov (United States)

    2010-04-01

    ... water. Before packing into the containers for shipment or other delivery for consumption the oysters are... FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION FISH AND SHELLFISH Requirements for Specific Standardized Fish and Shellfish § 161.130 Oysters. (a...

  2. Sensitivity of oysters (Crassostrea Brasiliana) to radiation

    International Nuclear Information System (INIS)

    Mattiolo Marchese, S.R.; Mastro, N.L. del

    1997-01-01

    Various foods including oysters, crabs and shrimps have been shown to be possible transmitters of Vibrio ssp. Irradiation of sea-foods is being considered an alternative to intervention measures in Public Health against food borne diseases. The aim of this work was to establish, the radiation resistance of the oysters Crassostrea brasiliana. The oysters were irradiated with Co-60 radiation with doses of 0, 1.5, 3 and 6 kGy. Survival curves as a function of time showed that 100% of the oysters irradiated with doses of 3 kGy survived at least 6 days. 100% those irradiated with 6 kGy survived 3 days. The obtained results are auspicious considering that a dose of 2 kGy is already effective in the diminishing of the microbial load on oysters. (author)

  3. Sensory and Chemical Characteristics of Eastern Oysters(Crassostrea virginica)

    OpenAIRE

    Chen, Luman

    2011-01-01

    Eastern Oysters, or Crassostrea virginica, are an important dietary component in the Chesapeake region and have supported a major fishery in the Chesapeake for more than 100 years. Virginia oysters do not always receive attention in up-scale markets. It is possible that the lack of information on sensory characteristics of Chesapeake oysters may contribute to this problem. In order to differentiate Chesapeake oysters from other oysters, a descriptive sensory test (n=8) was conducted and chemi...

  4. Uptake of cadmium from Pacific oysters (Crassostrea gigas) in British Columbia oyster growers

    International Nuclear Information System (INIS)

    Copes, Ray; Clark, Nina Annika; Rideout, Karen; Palaty, Jan; Teschke, Kay

    2008-01-01

    Background: Pacific oysters along the North American coast from Washington to Alaska contain concentrations of cadmium (Cd) that are high by comparison with Atlantic oysters, frequently exceeding 2 μg/g wet weight, but it is unclear whether this Cd is absorbed by consumers. Objectives: To determine the effect of oyster consumption on Cd in blood and urine among a group with high oyster consumption. Methods: Sixty-one non-smoking oyster growers and family members with a mean age of 47.3±7.6 years (range 33-64) were interviewed by telephone to assess their oyster consumption and other sources of Cd exposure at present and 5 years prior to the start of oyster farming. Their blood and urine Cd concentrations were measured. Results: The geometric mean Cd concentration in blood was 0.83 μg/L and in urine was 0.76 μg/g creatinine. Thirty-six percent of participants had urinary Cd levels above 1 μg/g creatinine and 5% were above 2 μg/g creatinine. Recent (last 12 months) and long-term oyster consumptions were positive predictors of blood Cd but did not directly predict urinary Cd. The optimal model for predicting the variance in blood Cd included recent intake of oyster-derived Cd, serum iron concentration and recent ketchup consumption (R 2 =0.34, p=0.00004), with the latter two variables showing a protective effect. The factors found to predict urinary Cd were blood Cd concentration and duration of oyster farming. A rise in blood Cd was observed after 12 years of farming oysters, likely caused by higher consumption of oysters during this period. Conclusions: Oyster-derived Cd is bioavailable and affects body stores of the metal

  5. Crosses between monokaryons of Pleurotus sapidus or Pleurotus florida show an improved biotransformation of (+)-valencene to (+)-nootkatone.

    Science.gov (United States)

    Omarini, Alejandra B; Plagemann, Ina; Schimanski, Silke; Krings, Ulrich; Berger, Ralf G

    2014-11-01

    Several hundred monokaryotic and new dikaryotic strains derived thereof were established from (+)-valencene tolerant Pleurotus species. When grouped according to their growth rate on agar plates and compared to the parental of Pleurotus sapidus 69, the slowly growing monokaryons converted (+)-valencene more efficiently to the grapefruit flavour compound (+)-nootkatone. The fast growing monokaryons and the slow×slow and the fast×fast dikaryotic crosses showed similar or inferior yields. Some slow×fast dikaryons, however, exceeded the biotransformation capability of the parental dikaryon significantly. The activity of the responsible enzyme, lipoxygenase, showed a weak correlation with the yields of (+)-nootkatone indicating that the determination of enzyme activity using the primary substrate linoleic acid may be misleading in predicting the biotransformation efficiency. This exploratory study indicated that a classical genetics approach resulted in altered and partly improved terpene transformation capability (plus 60%) and lipoxygenase activity of the strains. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Feeding traits of the European flat oyster, Ostrea edulis, and the invasive Pacific oyster, Crassostrea gigas

    DEFF Research Database (Denmark)

    Nielsen, Mette; Hansen, Benni Winding; Vismann, Bent

    2017-01-01

    Two oysters, the native flat oyster, Ostrea edulis, and the non-indigenous Pacific oyster, Crassostrea gigas, have partially overlapping distributions in European waters. Relatively little is known about particle selection by O. edulis, and the goal of the present study was to establish baselines...... for particle selection by both oyster species under controlled conditions in the laboratory. The study was carried out with adult oysters of similar shell size collected in the Limfjord estuary, Denmark (56°47′N, 08°51′E), in November 2011. The feeding traits of both species [clearance rate (CR), retention...... efficiency (RE) and lower threshold for clearance (LTC)] were compared using five algal species with different cell sizes (5−32 µm ESD) (Isochrysis galbana, Rhodomonas salina, Thalassiosira weissflogii, Prorocentrum micans and Akashiwo sanguinea). Oysters were acclimated to an experimental temperature of 22...

  7. Estimation of Bound and Free Fractions of Lignocellulose-Degrading Enzymes of Wood-Rotting Fungi Pleurotus ostreatus, Trametes versicolor and Piptoporus betulinus

    Czech Academy of Sciences Publication Activity Database

    Valášková, Vendula; Baldrian, Petr

    2006-01-01

    Roč. 157, - (2006), s. 119-124 ISSN 0923-2508 R&D Projects: GA AV ČR KJB600200516 Institutional research plan: CEZ:AV0Z50200510 Keywords : cellulase * freeeze-drying * hemicellulase Subject RIV: EE - Microbiology, Virology Impact factor: 2.504, year: 2006

  8. Disease control by chemical and biological fungicides in cultivated mushrooms: button mushroom, oyster mushroom and shiitake

    Directory of Open Access Journals (Sweden)

    Ivana Potočnik

    2015-12-01

    Full Text Available The most commonly cultivated basidiomycetes worldwide and in Serbia are button mushroom (Agaricus bisporus, oyster mushroom (Pleurotus sp. and shiitake (Lentinus edodes. Production of their fruiting bodies is severely afflicted by fungal, bacterial, and viral pathogens that are able to cause diseases which affect yield and quality. Major A. bisporus fungal pathogens include Mycogone perniciosa, Lecanicillium fungicola, and Cladobotryum spp., the causal agents of dry bubble, wet bubble, and cobweb disease, respectively. Various Trichoderma species, the causal agents of green mould, also affect all three kinds of edible mushrooms. Over the past two decades, green mould caused by T. aggressivum has been the most serious disease of button mushroom. Oyster mushroom is susceptible to T. pleurotum and shiitake to T. harzianum. The bacterial brawn blotch disease, caused by Pseudomonas tolaasii, is distributed globally. Disease control on mushroom farms worldwide is commonly based on the use of fungicides. However, evolution of pathogen resistance to fungicides after frequent application, and host sensitivity to fungicides are serious problems. Only a few fungicides are officially recommended in mushroom production: chlorothalonil and thiabendazol in North America and prochloraz in the EU and some other countries. Even though decreased sensitivity levels of L. fungicola and Cladobotryum mycophilum to prochloraz have been detected, disease control is still mainly provided by that chemical fungicide. Considering such resistance evolution, harmful impact to the environment and human health, special attention should be focused on biofungicides, both microbiological products based on Bacillus species and various natural substances of biological origin, together with good programs of hygiene. Introduction of biofungicides has created new possibilities for crop protection with reduced application of chemicals.

  9. Oyster Reef Projects 1997-2001

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — We used a quantitative sampling device to compare nekton use among high-relief live oyster reef, vegetated marsh edge Spartina alterniflora, and nonvegetated bottom...

  10. Norwalk virus gastroenteritis following raw oyster consumption.

    Science.gov (United States)

    Gunn, R A; Janowski, H T; Lieb, S; Prather, E C; Greenberg, H B

    1982-03-01

    In January, 1980, six out of 13 persons (46%) attending a party in a small northwest Florida town near the Gulf of Mexico became ill with Norwalk virus gastroenteritis after eating raw oysters. Symptoms experienced by the ill persons were principally nausea (100%), vomiting (83%) and diarrhea (50%) and were of brief duration. The symptom complex and epidemiology of Norwalk virus infection closely resemble the gastrointestinal illness commonly referred to as the 24-hour intestinal flu or "stomach flu." Norwalk virus infection was identified in this outbreak by application of a recently developed sensitive and specific serologic radioimmunoassay. Oysters from the incriminated batch had fecal coliform levels above recommended standards; however, recent studies of oyster-harvesting waters have shown only a weak correlation between fecal coliforms and the presence of enteric viruses. Further studies are needed to determine whether modifications of monitoring modalities for oyster-harvesting waters are needed.

  11. Survival of Salmonella Newport in oysters.

    Science.gov (United States)

    Morrison, Christopher M; Armstrong, Alexandra E; Evans, Sanford; Mild, Rita M; Langdon, Christopher J; Joens, Lynn A

    2011-08-02

    Salmonella enterica is the leading cause of laboratory-confirmed foodborne illness in the United States and raw shellfish consumption is a commonly implicated source of gastrointestinal pathogens. A 2005 epidemiological study done in our laboratory by Brands et al., showed that oysters in the United States are contaminated with Salmonella, and in particular, a specific strain of the Newport serovar. This work sought to further investigate the host-microbe interactions between Salmonella Newport and oysters. A procedure was developed to reliably and repeatedly expose oysters to enteric bacteria and quantify the subsequent levels of bacterial survival. The results show that 10 days after an exposure to Salmonella Newport, an average concentration of 3.7 × 10(3)CFU/g remains within the oyster meat, and even after 60 days there still can be more than 10(2)CFU/g remaining. However, the strain of Newport that predominated in the market survey done by Brands et al. does not survive within oysters or the estuarine environment better than any other strains of Salmonella we tested. Using this same methodology, we compared Salmonella Newport's ability to survive within oysters to a non-pathogenic strain of E. coli and found that after 10 days the concentration of Salmonella was 200-times greater than that of E. coli. We also compared those same strains of Salmonella and E. coli in a depuration process to determine if a constant 120 L/h flux of clean seawater could significantly reduce the concentration of bacteria within oysters and found that after 3 days the oysters retained over 10(4)CFU/g of Salmonella while the oysters exposed to the non-pathogenic strain of E. coli contained 100-times less bacteria. Overall, the results of this study demonstrate that any of the clinically relevant serovars of Salmonella can survive within oysters for significant periods of time after just one exposure event. Based on the drastic differences in survivability between Salmonella and a non

  12. VALOR NUTRICIONAL DE PLEUROTUS DJAMOR CULTIVADO EM PALHA DE BANANEIRA

    Directory of Open Access Journals (Sweden)

    Jamile Rosa RAMPINELLI

    2010-11-01

    Full Text Available

    Cogumelos do gênero Pleurotus representam um alimento de custo baixo, com teor elevado de proteínas, aminoácidos essenciais, proporção elevada de ácidos graxos insaturados, diversas vitaminas e minerais, além de teores baixos de gorduras, ácidos nucléicos, açúcares e calorias. Assim, o objetivo deste trabalho foi avaliar o valor nutricional de basidiomas de Pleurotus djamor de 1o e 2o fluxo produtivo, cultivados em palha de bananeira, em termos de teores de carboidratos, proteínas, fi bras, gorduras, cinzas, vitaminas, fósforo e potássio. Os teores de carboidratos totais, proteína bruta, fi bra bruta e cinzas diminuíram do 1o para o 2o fl uxo produtivo de 32,7 para 27,4g/100g, de 20,5 para 19,8g/100g, de 22,4 para 12,7g/100g e de 7,4 para 6,3g/100g, respectivamente. Os valores de gordura bruta e umidade não variaram, permanecendo em torno de 1,1 e 90g/100g, respectivamente. Os teores de vitamina B1 foram superiores aos de vitamina B2, independentemente do fluxo produtivo, e foi encontrada maior quantidade de potássio do que de fósforo. Pleurotus djamor, de 1o fl uxo produtivo, pode ser considerado fonte de fósforo e potássio, além de apresentar baixo teor de açúcar e não conter gordura.

  13. Immunochromatographic assay of cadmium levels in oysters.

    Science.gov (United States)

    Nishi, Kosuke; Kim, In-Hae; Itai, Takaaki; Sugahara, Takuya; Takeyama, Haruko; Ohkawa, Hideo

    2012-08-15

    Oysters are one of foodstuffs containing a relatively high amount of cadmium. Here we report on establishment of an immunochromatographic assay (ICA) method of cadmium levels in oysters. Cadmium was extracted with 0.l mol L(-1) HCl from oysters and cleaned up from other metals by the use of an anion-exchange column. The behavior of five metals Mn, Fe, Cu, Zn, and Cd was monitored at each step of extraction and clean-up procedure for the ICA method in an inductively coupled plasma-mass spectrometry (ICP-MS) analysis. The results revealed that a simple extraction method with the HCl solution was efficient enough to extract almost all of cadmium from oysters. Clean-up with an anion-exchange column presented almost no loss of cadmium adsorbed on the column and an efficient removal of metals other than cadmium. When a spiked recovery test was performed in the ICA method, the recovery ranged from 98% to 112% with relative standard deviations between 5.9% and 9.2%. The measured values of cadmium in various oyster samples in the ICA method were favorably correlated with those in ICP-MS analysis (r(2)=0.97). Overall results indicate that the ICA method established in the present study is an adequate and reliable detection method for cadmium levels in oysters. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. Thermoluminescence analysis of irradiated oyster shells

    International Nuclear Information System (INIS)

    Cruz-Zaragoza, E.; Marcazzó, J.; Della Monaca, S.; Boniglia, C.; Gargiulo, R.; Bortolin, E.

    2012-01-01

    This paper reports the thermoluminescence (TL) analysis performed on the oyster shells powder. TL response of 60 Co gamma-rays irradiated samples were studied in the range from 80 Gy to 8 kGy doses. TL signal of irradiated shell powder was higher as compared to the unirradiated control samples, which allowed to identify the irradiated oysters. Results show that the oyster shells have good TL properties and can be useful for the identification of irradiated seafood as well as for the evaluation of the treatment dose. - Highlights: ► TL properties of irradiated oyster shell powder were studied. ► The SEM analysis shows that several elements are present in oyster shell powder. ► Calcite is the main component in the samples and β-calcite is also present. ► Following the European Standard EN 1788, the irradiated oyster can be identified. ► Determination of absorbed dose is possible by performing a preheat treatment.

  15. Oyster Reef Communities in the Chesapeake Bay: A Brief Primer. VORTEX: Virginia's Oyster Reef Teaching EXperience.

    Science.gov (United States)

    Harding, Juliana M.; Mann, Roger; Clark, Vicki P.

    This document introduces Virginia's Oyster Reef Teaching EXperience (VORTEX), which is an interdisciplinary program focusing on the importance of oyster reef communities in the Chesapeake Bay ecosystem. The VORTEX program uses field and laboratory experience supported by multimedia instruction. This document presents an overview on the biology of…

  16. INFLUENCE OF ALTERED FRESHWATER FLOWS ON EASTERN OYSTERS

    Science.gov (United States)

    Abstract for National Shellfisheries AssociationEastern oysters Crassostrea virginica are prominent in Gulf of Mexico estuaries. Valued both commercially and ecologically, oyster populations are threatened by human activity, including dredging, harvesting, and upstream al...

  17. Cultivo de Lentinus sajor-caju (Fr.) Fr. [= Pleurotus sajor-caju (Fr.) Singer] e Pleurotus spp. em diferentes substratos

    OpenAIRE

    Albuquerque, Margeli Pereira de

    2010-01-01

    As espécies de Pleurotus, popularmente conhecidas por cogumelos ostra, são decompositoras primárias de madeira e outros resíduos vegetais biodegradáveis. Estes fungos apresentam propriedades nutricionais com elevados teores de proteínas aminoácidos essenciais, ácidos graxos insaturados, vitaminas e minerais, por isso estão tornando-se cada vez mais importantes como um recurso alimentar. A identificação de substratos que permitam o rápido desenvolvimento do micélio fúngico é uma...

  18. Flat oysters in the Eierlandse Gat, Wadden Sea

    NARCIS (Netherlands)

    Have, van der T.M.; Kamermans, P.; Zee, van der E.M.

    2018-01-01

    This report presents the results of a short survey of flat oysters (Ostrea edulis) in the Western Wadden Sea. Ten sites were visited and flat oysters were found on nine locations in the Eijerlandse gat. Empty cockleshells and live and dead Pacific oysters provided the main settlement substrate. The

  19. Diseases and pests noxious to Pleurotus spp. mushroom crops.

    Science.gov (United States)

    Bellettini, Marcelo B; Bellettini, Sebastião; Fiorda, Fernanda A; Pedro, Alessandra C; Bach, Fabiane; Fabela-Morón, Miriam F; Hoffmann-Ribani, Rosemary

    The Pleurotus genus is one of most extensively studied white-rot fungi due to its exceptional ligninolytic properties. It is an edible mushroom that possesses biological effects, as it contains important bioactive molecules. It is a rich source of nutrients, particularly proteins, minerals as well as vitamins B, C and D. In basidiomycete fungi, intensive cultivations of edible mushrooms can often be affected by some bacterial, mold and virus diseases that rather frequently cause dramatic production loss. These infections are facilitated by the particular conditions under which mushroom cultivation is commonly carried out such as warm temperatures, humidity, carbon dioxide (CO 2 ) levels and presence of pests. There is not much bibliographic information related to pests of mushrooms and their substrates. The updated review presents a practical checklist of diseases and pests of the Pleurotus genus, providing useful information that may help different users. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  20. Antioxidant and antibacterial activities of acetonitrile and hexane extracts of Lentinus tigrinus and Pleurotus djamour

    Science.gov (United States)

    This paper highlighted the antioxidant and antibacterial activities of Lentinus tigrinus and Pleurotus djamour. Extracts of mushroom fruiting bodies were obtained using hexane and acetonitrile solvents. Acetonitrile extracts of both mushrooms exhibited higher biological activities than hexane extrac...

  1. Pyrosequencing Analysis of Norovirus Genogroup II Distribution in Sewage and Oysters: First Detection of GII.17 Kawasaki 2014 in Oysters.

    Science.gov (United States)

    Pu, Jian; Kazama, Shinobu; Miura, Takayuki; Azraini, Nabila Dhyan; Konta, Yoshimitsu; Ito, Hiroaki; Ueki, You; Cahyaningrum, Ermaya Eka; Omura, Tatsuo; Watanabe, Toru

    2016-12-01

    Norovirus GII.3, GII.4, and GII.17 were detected using pyrosequencing in sewage and oysters in January and February 2015, in Japan. The strains in sewage and oyster samples were genetically identical or similar, predominant strains belonging to GII.17 Kawasaki 2014 lineage. This is the first report of GII.17 Kawasaki 2014 in oysters.

  2. Influence of 50 Hz magnetic field on growth of mushroom species: Shitake (Lentinus edodes) and Oyster (Pleurotus astreatus)

    Energy Technology Data Exchange (ETDEWEB)

    Bambang Anggoro; Pakpahan, P.M.; Fajar Dwi Kusnoaji; Sirait, K.T. [Bandung Institute of Technology (Indonesia). Faculty of Industrial Technology

    1999-07-01

    Investigation on effects of electromagnetic fields on different aspects of biological systems has been done by much research. Our present study, which has been carried out under the joint research between the laboratory of High voltage and High current Engineering and the Laboratory of Microbiology of Institut Teknologi Bandung, investigates the influence of 50 Hz magnetic field on the growth of several species of mushroom. In this study, we observed growth of mushroom, from spora up to fully ripped stages, under magnetic field exposure of different intensity from 0,1 mT to 1,7 mT. During exposure the room condition was held constant at a temperature of 20{sup o}C and 95% humidity. We noted that some parameters such as: mushroom growth velocity, shape, dimension, quantity, color and period of mushroom ovary are significantly influenced by magnetic energy absorbed. (author)

  3. Prevalence of Salmonella spp. in Oysters in the United States

    OpenAIRE

    Brands, Danielle A.; Inman, Allison E.; Gerba, Charles P.; Maré, C. John; Billington, Stephen J.; Saif, Linda A.; Levine, Jay F.; Joens, Lynn A.

    2005-01-01

    Food-borne diseases such as salmonellosis can be attributed, in part, to the consumption of raw oysters. To determine the prevalence of Salmonella spp. in oysters, oysters harvested from 36 U.S. bays (12 each from the West, East, and Gulf coasts in the summer of 2002, and 12 bays, four per coast, in the winter of 2002-2003) were tested. Salmonella was isolated from oysters from each coast of the United States, and 7.4% of all oysters tested contained Salmonella. Isolation tended to be bay spe...

  4. Oyster leases in Louisiana, Geographic NAD83, LOSCO (1997) [oyster_leases_USACE_1997

    Data.gov (United States)

    Louisiana Geographic Information Center — This data set indicates the locations of oyster leases in Louisiana. The lease areas should be polygons, however, the source data has very poor topology including...

  5. Drywell corrosion stopped at Oyster Creek

    International Nuclear Information System (INIS)

    Lipford, B.L.; Flynn, J.C.

    1993-01-01

    This article describes the detection of corrosion on the drywell containment vessel of Oyster Creek Nuclear Plant and the application of a protective coating to repair the drywell. The topics of the article include drywell design features, identification of the problem, initial action, drywell corrosion, failure of cathodic protection, long-term repair, and repair results

  6. INORGANIC ELEMENTS AND DISTRIBUTION OF EASTERN OYSTERS.

    Science.gov (United States)

    Fisher, William S. In press. Inorganic Elements and Distribution of Eastern Oysters (Abstract). To be presented at the 96th Annual Meeting (Aquaculture 2004) of the National Shellfisheries Association, 1-5 March 2004, Honolulu, HI. 1 p. (ERL,GB R962). For over a century w...

  7. A microbial spoilage profile of half shell Pacific oysters (Crassostrea gigas) and Sydney rock oysters (Saccostrea glomerata).

    Science.gov (United States)

    Madigan, Thomas L; Bott, Nathan J; Torok, Valeria A; Percy, Nigel J; Carragher, John F; de Barros Lopes, Miguel A; Kiermeier, Andreas

    2014-04-01

    This study aimed to assess bacterial spoilage of half shell Pacific and Sydney rock oysters during storage using microbial culture and 16S rRNA pyrosequencing. Odour and pH of oyster meats were also investigated. Estimation of microbiological counts by microbial culture highlighted growth of psychrotrophic bacteria. During storage, odour scores (a score describing deterioration of fresh odours where a score of 1 is fresh and 4 is completely spoiled) increased from 1.0 to 3.0 for Pacific oysters and from 1.3 to 3.4 for Sydney rock oysters. pH results obtained for both species fluctuated during storage (range 6.28-6.73) with an overall increase at end of storage. Pyrosequencing revealed that the majority of bacteria at Day 0 represented taxa from amongst the Proteobacteria, Tenericutes and Spirochaetes that have not been cultured and systematically described. During storage, Proteobacteria became abundant with Pseudoalteromonas and Vibrio found to be dominant in both oyster species at Day 7. Analysis of the pyrosequencing data showed significant differences in bacterial profiles between oyster species and storage time (both P = 0.001). As oysters spoiled, bacterial profiles between oyster species became more similar indicating a common spoilage profile. Data presented here provides detailed insight into the changing bacterial profile of shucked oysters during storage and has identified two genera, Pseudoalteromonas and Vibrio, as being important in spoilage of shucked oysters. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. OYSTER POPULATUION ESTIMATION IN SUPPORT OF THE TEN-YEAR GOAL FOR OYSTER RESOTRATION IN THE CHESAPEAKE BAY: DEVELOPING STRATEGIES FOR RESTORING AND MANAGING THE EASTERN OYSTER

    Science.gov (United States)

    Mann, Roger, Steve Jordan, Gary Smith, Kennedy Paynter, James Wesson, Mary Christman, Jessica Vanisko, Juliana Harding, Kelly Greenhawk and Melissa Southworth. 2003. Oyster Population Estimation in Support of the Ten-Year Goal for Oyster Restoration in the Chesapeake Bay: Develop...

  9. Using of gamma rays in stimulation and improvement of mushroom spawns plerotus ostreatus

    International Nuclear Information System (INIS)

    Hussein, O.S.; Atia, A.I.

    2009-01-01

    The objective of this work was activation and stimulation of plerotus ostreatus growth and increasing their yields by using of gamma rays, in addition to improvement of mushroom quality and shelf life.Exposing plerotus ostreatus to different doses of gamma rays 2.5, 5, 10 and 15 Gy to determine some of the basic composition of mushroom fruits achieved significant increase in yields and basic composition of resulted mushrooms. Also, increase in carbohydrates content, most of amino acids content and fatty acids content, mainly unsaturated fatty acid i.e., (C 16:1) and (C 18:1,2), which are essential for human nutrition as antioxidant. Whereas, there was a significant decrease in the total phenols content of the resulted fruits, which affected the quality and shelf life of mushroom fruits. All gamma rays doses used increased mushroom yield in fresh and dry wt basis. The recommended dose for spawn irradiation was 10 Gy to increase mushroom yields and its chemical components

  10. Immune and stress responses in oysters with insights on adaptation.

    Science.gov (United States)

    Guo, Ximing; He, Yan; Zhang, Linlin; Lelong, Christophe; Jouaux, Aude

    2015-09-01

    Oysters are representative bivalve molluscs that are widely distributed in world oceans. As successful colonizers of estuaries and intertidal zones, oysters are remarkably resilient against harsh environmental conditions including wide fluctuations in temperature and salinity as well as prolonged air exposure. Oysters have no adaptive immunity but can thrive in microbe-rich estuaries as filter-feeders. These unique adaptations make oysters interesting models to study the evolution of host-defense systems. Recent advances in genomic studies including sequencing of the oyster genome have provided insights into oyster's immune and stress responses underlying their amazing resilience. Studies show that the oyster genomes are highly polymorphic and complex, which may be key to their resilience. The oyster genome has a large gene repertoire that is enriched for immune and stress response genes. Thousands of genes are involved in oyster's immune and stress responses, through complex interactions, with many gene families expanded showing high sequence, structural and functional diversity. The high diversity of immune receptors and effectors may provide oysters with enhanced specificity in immune recognition and response to cope with diverse pathogens in the absence of adaptive immunity. Some members of expanded immune gene families have diverged to function at different temperatures and salinities or assumed new roles in abiotic stress response. Most canonical innate immunity pathways are conserved in oysters and supported by a large number of diverse and often novel genes. The great diversity in immune and stress response genes exhibited by expanded gene families as well as high sequence and structural polymorphisms may be central to oyster's adaptation to highly stressful and widely changing environments. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Exploring Proteomic Variation in Pacific Oysters (Crassostrea gigas)

    OpenAIRE

    Venkataraman, Yaamini

    2017-01-01

    150 sibling Pacific oysters (Crassostrea gigas) were outplanted at five different sites around Puget Sound. Oysters were placed in exclusion cages either inside or outside of eelgrass beds. After a month of environmental exposure, gill tissue samples were collected for proteomic analyses. Initial DIA mass spectrometry methods on a subset of oysters (one per site and eelgrass condition, 10 total) provide data for upwards of 6,000 proteins. A subset of stress-related proteins reveal site-specif...

  12. Prevalence of Salmonella spp. in oysters in the United States.

    Science.gov (United States)

    Brands, Danielle A; Inman, Allison E; Gerba, Charles P; Maré, C John; Billington, Stephen J; Saif, Linda A; Levine, Jay F; Joens, Lynn A

    2005-02-01

    Food-borne diseases such as salmonellosis can be attributed, in part, to the consumption of raw oysters. To determine the prevalence of Salmonella spp. in oysters, oysters harvested from 36 U.S. bays (12 each from the West, East, and Gulf coasts in the summer of 2002, and 12 bays, four per coast, in the winter of 2002-2003) were tested. Salmonella was isolated from oysters from each coast of the United States, and 7.4% of all oysters tested contained Salmonella. Isolation tended to be bay specific, with some bays having a high prevalence of Salmonella, while other bays had none. Differences in the percentage of oysters from which Salmonella was isolated were observed between the summer and winter months, with winter numbers much lower probably due to a variety of weather-related events. The vast majority (78/101) of Salmonella isolates from oysters were Salmonella enterica serovar Newport, a major human pathogen, confirming the human health hazard of raw oyster consumption. Contrary to previous findings, no relationship was found between the isolation of fecal coliforms and Salmonella from oysters, indicating a necessity for specific monitoring for Salmonella and other pathogens rather than the current reliance on fecal coliform testing.

  13. Temperature-dependent stress response in oysters, Crassostrea virginica: Pollution reduces temperature tolerance in oysters

    International Nuclear Information System (INIS)

    Lannig, Gisela; Flores, Jason F.; Sokolova, Inna M.

    2006-01-01

    Combined effects of temperature and a toxic metal, cadmium (Cd), on energy metabolism were studied in a model marine bivalve, the eastern oyster Crassostrea virginica, acclimated at 20, 24 and 28 deg. C and exposed to 50 μg l -1 of Cd. Both increasing temperature and Cd exposure led to a rise in standard metabolic rates, and combined stressors appeared to override the capability for aerobic energy production resulting in impaired stress tolerance. Oysters exposed to elevated temperature but not Cd showed no significant change in condition, survival rate and lipid peroxidation, whereas those exposed to both Cd and temperature stress suffered high mortality accompanied by low condition index and elevated lipid peroxidation. Furthermore, RNA/DNA ratios indicative of protein synthesis rate, and levels of glutathione, which is involved in metal detoxification, increased in Cd-exposed oysters at 20 deg. C but not at 28 deg. C. Implications of the synergism between elevated temperatures and cadmium stress on energy metabolism of oysters are discussed in the light of the potential effects of climate change on oyster populations in polluted areas

  14. ANTIMICROBIAL PROPERTIES OF PLEUROTUS ERYNGII AND LENTINUS EDODES HYDRO-ALCOHOLIC EXTRACTS

    Directory of Open Access Journals (Sweden)

    Gabriela Popa

    2016-11-01

    Full Text Available Besides superior nutritional values mushrooms posed significant medicinal properties. Hydro-alcoholic extracts of several isolates of Pleurotus eryngii and Lentinus edodes mushroom species were investigated for their antimicrobial activities against pathogenic microorganisms with medicinal importance. Antimicrobial activities of the extracts were evaluated by the agar disk diffusion method. Results revealed that the 70% ethylic alcohol extracts have significant inhibitory activities against Bacillus subtilis var. spizizinii, Escherichia coli and Staphylococcus aureus. The results showed that the 70% ethanol extracts of Pleurotus eryngii and Lentinus edodes mushroom isolates may have biopharmaceutical potentiality.

  15. Calcium, strontium and fluorine patterns in shells of Pacific Oyster and Rock Oyster

    International Nuclear Information System (INIS)

    Coote, G.E.

    1996-01-01

    The IGNS proton microprobe has been applied in a study of the distribution of Calcium, Strontium and Fluorine in the calcite shells of Pacific Oyster (Crassostrea gigas) and the native Rock oyster (Crassostrea glomerata). The ultimate aim is to derive information which could have application in such fields as archaeology, biology, palaeontology, aquaculture and environmental studies. Calcium and strontium were determined from their emissions of K X-rays under proton bombardment, and fluorine from the 19 F (p,alpha gamma) 16 O nuclear reaction. The three elements were determined simultaneously at points no more than 20 micrometres apart. A total of 14 one and 17 two-dimensional scans were performed on sections of the shells embedded in epoxy resin. We studied shells from nine Pacific oysters (five transferred from the Marlborough Sounds to Wellington Harbour and four from the Bay of Islands). (author). 11 refs.; 5 figs

  16. Exopolysaccharides from Pleurotus pulmonarius: Fermentation Optimization, Characterization and Antioxidant Activity

    Directory of Open Access Journals (Sweden)

    Jin-Wen Shen

    2013-01-01

    Full Text Available Culture conditions for exopolysaccharide (EPS production by Pleurotus pulmonarius in submerged culture are optimized. The suggested medium composition was as follows: 60 g/L of xylose, 6 g/L of soy extract, 5 mM of KH2PO4 and 5 mM of MgSO4. Under the optimized culture conditions in a 5-litre stirred tank fermentor, the maximum concentration of EPS was 6.36 g/L. Furthermore, the morphological parameters (i.e. average diameter, circularity, roughness and compactness of the pellets and the broth viscosity are characterized. It has been proven that mycelial morphology and broth viscosity may be the critical parameters affecting the EPS yield. After deproteinization using Sevag method, a group of EPS (designated as fraction was obtained from the culture filtrates by gel filtration chromatography. FT-IR analysis of the purified EPS revealed prominent characteristic groups corresponding to polyhydric alcohols. GC analysis showed that the purified EPS were mainly composed of galactose and glucose. Furthermore, thermogravimetric analysis indicated that the degradation temperature of the purified EPS was 217 °C. Finally, the antioxidant activity of the EPS fraction was investigated and the relationship with molecular properties was discussed as well.

  17. Nutriceutical potential of Pleurotus tuber-regium sclerotium

    Directory of Open Access Journals (Sweden)

    R. C. Ohiri

    2018-04-01

    Full Text Available The aim of the study was to determine the composition of the sclerotium of Pleurotus tuber-regium and to analyze its nutritional potential. Major minerals and micronutrients content of the P. tuber-regium sclerotium were determined. The study has shown fairly high concentrations of potassium and magnesium as major minerals with values of 60.66 ± 4.13 and 41.79 ± 3.14 mg/kg, while manganese and zinc were micronutrients with the highest values of 1.20 ± 0.10 and 0.95 ± 0.07 mg/kg. Glutamic acid and aspartic acid were also observed in high concentrations with values of 11.51 ± 1.01 and 5.52 ± 0.86 mg/kg. The mushroom powder of P. tuber-regium was a source for production of oil, which was analyzed by GC-MS method. Benzenedicarboxylic acid mono-(2-ethylhexyl ester and benzenedicarboxylic acid butyl-cyclohexyl ester were volatile constituents predominating with percentage total of 78.7 and 5.2, respectively. It is concluded that the presence of mineral elements, amino acids and volatile components observed in this fungus indicated the presence of the nutritional potential in the sclerotia of P. tuber-regium.

  18. Isolation, Purification, and Characterization of Fungal Laccase from Pleurotus sp.

    Directory of Open Access Journals (Sweden)

    Sunil S. More

    2011-01-01

    Full Text Available Laccases are blue copper oxidases (E.C. 1.10.3.2 benzenediol: oxygen oxidoreductase that catalyze the one-electron oxidation of phenolics, aromatic amines, and other electron-rich substrates with the concomitant reduction of O2 to H2O. They are currently seen as highly interesting industrial enzymes because of their broad substrate specificity. A positive strain was isolated and characterized as nonspore forming Basidiomycetes Pleurotus sp. Laccase activity was determined using ABTS as substrate. Laccase was purified by ionexchange and gel filtration chromatography. The purified laccase was a monomer showed a molecular mass of 40±1 kDa as estimated by SDS-PAGE and a 72-fold purification with a 22% yield. The optimal pH and temperature were 4.5 and 65°C, respectively. The Km and Vmax⁡ values are 250 (mM and 0.33 (μmol/min, respectively, for ABTS as substrate. Metal ions like CuSO4, BaCl2, MgCl2, FeCl2, ZnCl2 have no effect on purified laccase whereas HgCl2 and MnCl2 moderately decrease enzyme activity. SDS and sodium azide inhibited enzyme activity, whereas Urea, PCMB, DTT, and mercaptoethanol have no effect on enzyme activity. The isolated laccase can be used in development of biosensor for detecting the phenolic compounds from the effluents of paper industries.

  19. Eating oysters without risk of vibriosis: application of a bacteriophage against Vibrio parahaemolyticus in oysters.

    Science.gov (United States)

    Jun, Jin Woo; Kim, Hyoun Joong; Yun, Sae Kil; Chai, Ji Young; Park, Se Chang

    2014-10-01

    Vibrio parahaemolyticus is a major cause of foodborne illness and related with the consumption of raw contaminated seafood, especially oysters. To evaluate the effectiveness of various applications of a bacteriophage (phage), pVp-1, against a multiple-antibiotic-resistant V. parahaemolyticus pandemic strain (CRS 09-17), we designed artificial contamination models that are most likely to be encountered during oyster processing. When live oysters were treated with bath immersion with pVp-1 after CRS 09-17 challenge, the growth of bacterial strain was significantly reduced. After 72h of phage application with bath immersion, bacterial growth reduction was observed to be 8.9×10(6)CFU/ml (control group) to 1.4×10CFU/ml (treatment group). When pVp-1 was surface-applied on the flesh of oysters after CRS 09-17 inoculation, bacterial growth was properly inhibited. After 12h of phage application on the surface of oysters, bacterial growth inhibition was revealed to be 1.44×10(6)CFU/ml (control group) to 1.94CFU/ml (treatment group). This is the first report, to the best of our knowledge, of oyster surface-application of a phage against a multiple-antibiotic-resistant V. parahaemolyticus pandemic strain, and our successful phage application to various situations emphasizes the potential use of the phage to avoid V. parahaemolyticus infection from aquaculture to consumption. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Decontamination of Cuban oysters using irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Cisneros Despaigne, E; Leyva Castillo, V; Martinez, L L; Lara Ortiz, C [Instituto de Nutricion e Higiene de los Alimentos (Cuba); Castillo Rodriguez, E [Centro Nacional de Salud Animal (Cuba)

    2001-04-01

    Oysters (Crassostrea virginica) collected on the Cuban coast near Havana were examined for contamination with Vibrio cholerae and other potentially pathogenic Vibrio species. The strains thus isolated were characterized and identified to species following standard methods, and their radiation resistance (D{sub 10}) was determined in pure culture. The Vibrio species most often isolated were V. cholerae, V. parahaemolyticus and V. Alginolyticus. Representative cultures from each species were later used to inoculate shucked oysters to determine the optimal radiation dose that would ensure elimination of 10{sup 8} colony forming units (CFU)/g. The highest proportion of isolates were identified as Vibrio parahaemolyticus and V. algynoliticus. Non-O1 strains of Vibrio cholerae were isolated from 50% of samples, but no V. cholerae O1 was identified. D{sub 10} values calculated for the various strains were low in relation to those in the literature. The radiation dose for decontaminating heavily inoculated (10{sup 8} CFU/g) oysters was 1.2 kGy. (author)

  1. Decontamination of Cuban oysters using irradiation

    International Nuclear Information System (INIS)

    Cisneros Despaigne, E.; Leyva Castillo, V.; Martinez, L.L.; Lara Ortiz, C.; Castillo Rodriguez, E.

    2001-01-01

    Oysters (Crassostrea virginica) collected on the Cuban coast near Havana were examined for contamination with Vibrio cholerae and other potentially pathogenic Vibrio species. The strains thus isolated were characterized and identified to species following standard methods, and their radiation resistance (D 10 ) was determined in pure culture. The Vibrio species most often isolated were V. cholerae, V. parahaemolyticus and V. Alginolyticus. Representative cultures from each species were later used to inoculate shucked oysters to determine the optimal radiation dose that would ensure elimination of 10 8 colony forming units (CFU)/g. The highest proportion of isolates were identified as Vibrio parahaemolyticus and V. algynoliticus. Non-O1 strains of Vibrio cholerae were isolated from 50% of samples, but no V. cholerae O1 was identified. D 10 values calculated for the various strains were low in relation to those in the literature. The radiation dose for decontaminating heavily inoculated (10 8 CFU/g) oysters was 1.2 kGy. (author)

  2. The potential of aerial photography for estimating surface areas of intertidal Pacific oyster beds (Crassostrea gigas)

    NARCIS (Netherlands)

    Kater, B.J.; Baars, J.M.D.D.

    2004-01-01

    Pacific oysters were introduced into the Eastern Scheldt in 1964 for breeding purposes. The first spatfall of wild Pacific oysters was recorded in 1976, and a second larval outburst in 1982 definitely settled wild Pacific oysters in the Eastern Scheldt waters. Oyster beds on intertidal and subtidal

  3. Markers associated with disease resistance in Eastern oysters, Crassostrea virginica

    Science.gov (United States)

    Eastern oyster, Crassostrea viginica, is an economically important aquaculture species in the USA, but production has been impacted by diseases such as dermo and MSX. Efforts have been put into the development of disease-resistant oyster lines using selective breeding techniques. However, these met...

  4. CAN OYSTERS PLAY A ROLE IN ENVIRONMENTAL MANAGEMENT?

    Science.gov (United States)

    The culinary and commercial value of oysters is widely recognized but, until recently, their ecological importance has been largely overlooked. Field and laboratory studies have begun to explore how filter-feeding and reef building by oysters can influence nutrient cycling, biodi...

  5. Bioimmuring late Cretaceous and Recent oysters : 'A view from within'

    NARCIS (Netherlands)

    Jagt, John W M; Neumann, Christian; Schulp, Anne S.

    2007-01-01

    Being obligate cementers, oysters (Ostreoidea), both fossil and Recent, often yield valuable information on their substrates, whether biotic/ abiotic, perishable or inert. By a process called bioimmuration, oyster shells may preserve lightly or non-calcified sessile organisms already present on the

  6. Shell Games. VORTEX: Virginia's Oyster Reef Teaching EXperience.

    Science.gov (United States)

    Harding, Juliana M.; Mann, Roger; Clark, Vicki P.

    This document introduces Virginia's Oyster Reef Teaching EXperience (VORTEX), which is an interdisciplinary program focusing on the importance of oyster reef communities in the Chesapeake Bay ecosystem. The VORTEX program uses field and laboratory experiences supported by multimedia instruction. This document presents an overview on the biology of…

  7. Resource potential and status of pearl oyster fishery in India

    Digital Repository Service at National Institute of Oceanography (India)

    Ingole, B.S.; Parulekar, A.H.

    Many cultivable species of pearl oysters are known to occur in the Indo-Australian Archipelago which is an important region in the world distribution of pearl oysters. An account of the development of Indian pearl fisheries that took place over...

  8. Seasonal dynamics and diversity of bacteria in retail oyster tissues.

    Science.gov (United States)

    Wang, Dapeng; Zhang, Qian; Cui, Yan; Shi, Xianming

    2014-03-03

    Oysters are one of the important vehicles for the transfer of foodborne pathogens. It was reported that bacteria could be bio-accumulated mainly in the gills and digestive glands. In artificially treated oysters, bacterial communities have been investigated by culture-independent methods after harvest. However, little information is available on the seasonal dynamics of bacterial accumulation in retail oyster tissues. In this study, retail oysters were collected from local market in different seasons. The seasonal dynamics and diversity of bacteria in oyster tissues, including the gills, digestive glands and residual tissues, were analyzed by denaturing gradient gel electrophoresis (DGGE). It was interesting that the highest bacterial diversity appeared in the Fall season, not in summer. Our results indicated that Proteobacteria was the predominant member (23/46) in oyster tissues. Our results also suggested that bacterial diversity in gills was higher than that in digestive glands and other tissues. In addition, not all the bacteria collected from surrounding water by gills were transferred to digestive glands. On the other hand, few bacteria were found in oyster tissues except in the gills. Therefore, the gills could be the best candidate target tissue for monitoring of pathogenic bacteria either to human or to oyster. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Macrofauna Settlement on Pearl Oyster Collectors in Kenya ...

    African Journals Online (AJOL)

    Key words: Pearl oysters, seed collection, macrofauna, bivalves, settlement, monsoon seasons,. Kenya .... have shown that pearl oyster settlement is higher within calm ...... collectors in the Timor Sea, Northern Australia. J. Shellfish ... systems. Aquaculture, 189: 375-388. Urban, H.J. (2000b): Culture potential of the pearl.

  10. Microcontroller based automatic temperature control for oyster mushroom plants

    Science.gov (United States)

    Sihombing, P.; Astuti, T. P.; Herriyance; Sitompul, D.

    2018-03-01

    In the cultivation of Oyster Mushrooms need special treatment because oyster mushrooms are susceptible to disease. Mushroom growth will be inhibited if the temperature and humidity are not well controlled because temperature and inertia can affect mold growth. Oyster mushroom growth usually will be optimal at temperatures around 22-28°C and humidity around 70-90%. This problem is often encountered in the cultivation of oyster mushrooms. Therefore it is very important to control the temperature and humidity of the room of oyster mushroom cultivation. In this paper, we developed an automatic temperature monitoring tool in the cultivation of oyster mushroom-based Arduino Uno microcontroller. We have designed a tool that will control the temperature and humidity automatically by Android Smartphone. If the temperature increased more than 28°C in the room of mushroom plants, then this tool will turn on the pump automatically to run water in order to lower the room temperature. And if the room temperature of mushroom plants below of 22°C, then the light will be turned on in order to heat the room. Thus the temperature in the room oyster mushrooms will remain stable so that the growth of oyster mushrooms can grow with good quality.

  11. EPR investigation of some desiccated Ascomycota and Basidiomycota gamma-irradiated mushrooms

    Energy Technology Data Exchange (ETDEWEB)

    Bercu, V., E-mail: vbercu@gmail.co [University of Bucharest, Department of Atomic and Nuclear Physics, P.O. Box MG-11, 077125 Magurele (Ilfov) (Romania); Negut, C.D., E-mail: dnegut@nipne.r [University of Bucharest, Department of Atomic and Nuclear Physics, P.O. Box MG-11, 077125 Magurele (Ilfov) (Romania); Horia Hulubei National Institute for Physics and Nuclear Engineering, P.O. Box MG-6, 077125 Magurele (Ilfov) (Romania); Duliu, O.G., E-mail: duliu@b.astral.r [University of Bucharest, Department of Atomic and Nuclear Physics, P.O. Box MG-11, 077125 Magurele (Ilfov) (Romania)

    2010-12-15

    The suitability of the EPR spectroscopy for detection of {gamma}-irradiation in five species of dried mushroom, currently used in gastronomy: yellow morel-Morchella esculenta, (L.) Pers. (Phylum Ascomycota), button mushroom-Agaricus bisporus (J.E.Lange), Agaricus haemorrhoidarius Fr., golden chantarelle-Cantharellus cibarius Fr., as well as oyster mushroom-Pleurotus ostreatus (Jacq. ex Fr.) (Phylum Basidiomycota) is presented and discussed. Although after irradiation at doses up to 11 kGy, all specimens presented well defined EPR spectra, only A. bisporus EPR signal was enough stable to make detection possible after 18 months.

  12. EPR investigation of some desiccated Ascomycota and Basidiomycota gamma-irradiated mushrooms

    Science.gov (United States)

    Bercu, V.; Negut, C. D.; Duliu, O. G.

    2010-12-01

    The suitability of the EPR spectroscopy for detection of γ-irradiation in five species of dried mushroom, currently used in gastronomy: yellow morel— Morchella esculenta, (L.) Pers. (Phylum Ascomycota), button mushroom— Agaricus bisporus (J.E.Lange), Agaricus haemorrhoidarius Fr., golden chantarelle— Cantharellus cibarius Fr., as well as oyster mushroom— Pleurotus ostreatus (Jacq. ex Fr.) (Phylum Basidiomycota) is presented and discussed. Although after irradiation at doses up to 11 kGy, all specimens presented well defined EPR spectra, only A. bisporus EPR signal was enough stable to make detection possible after 18 months.

  13. EPR investigation of some desiccated Ascomycota and Basidiomycota gamma-irradiated mushrooms

    International Nuclear Information System (INIS)

    Bercu, V.; Negut, C.D.; Duliu, O.G.

    2010-01-01

    The suitability of the EPR spectroscopy for detection of γ-irradiation in five species of dried mushroom, currently used in gastronomy: yellow morel-Morchella esculenta, (L.) Pers. (Phylum Ascomycota), button mushroom-Agaricus bisporus (J.E.Lange), Agaricus haemorrhoidarius Fr., golden chantarelle-Cantharellus cibarius Fr., as well as oyster mushroom-Pleurotus ostreatus (Jacq. ex Fr.) (Phylum Basidiomycota) is presented and discussed. Although after irradiation at doses up to 11 kGy, all specimens presented well defined EPR spectra, only A. bisporus EPR signal was enough stable to make detection possible after 18 months.

  14. Utilization of detrital complexes by the oyster, Crassostrea virginica (Gmelin)

    International Nuclear Information System (INIS)

    Crosby, M.P.

    1987-01-01

    The contribution of bacteria and nonliving particulate organic matter of detrital complexes to the nutrition of the American oyster, Crassostrea virginica, was investigated in the laboratory under normal feeding conditions. Results indicate the oysters were capable of assimilating crude fiber extracted from 14 C-Spartina alterniflora with an efficiency of approximately 3% and that enteric bacteria did not enhance this process. Less than 1% of an oyster's energetic demands could be met by direct utilization of this substrate, in the Choptank River subestuary of the Chesapeake Bay. The potential contribution of refractory organics to oysters in large salt marshes having crude fiber concentration greater than in the Choptank system, are discussed. The ability of the oyster to utilize 14 C and 15 N from cellulolytic marine bacteria, isolated from a S. alterniflora dominated salt marsh, was also studied

  15. Behavior of pathogenic bacteria in the oyster, Crassostrea commercialis, during depuration, re-laying, and storage.

    OpenAIRE

    Son, N T; Fleet, G H

    1980-01-01

    Oysters (Crassostrea commercials) harvested from major cultivation areas within the state of New South Wales, Australia, were commonly contaminated with low levels of the food-poisoning organisms Bacillus cereus, Clostridium perfringens, and Vibrio parahaemolyticus. Salmonella was found in oysters on only one occasion. These bacteria were cleansed from oysters during oyster purification by re-laying in a non-polluted waterway. Oysters were laboratory contaminated to levels in excess 1,000 cel...

  16. Water quality parameters and total aerobic bacterial and vibrionaceae loads in eastern oysters (Crassostrea virginica) from oyster gardening sites

    Science.gov (United States)

    Oyster gardening is a practice designed to restore habitat for marine life and to improve water quality. This study determined physical and chemical water quality parameters at two oyster gardening sites in the Delaware Inland Bays and compared them with total aerobic bacteria and Vibrionaceae conc...

  17. Microbiological effects of olive mill waste addition to substrates for Pleurotus pulmonarius cultivation

    NARCIS (Netherlands)

    Soler-Rivas, C.; Garcia-Rosado, A.; Polonia, I.; Junca-Blanch, G.; Marin, F.R.; Wichers, H.J.

    2006-01-01

    When olive mill wastes (OMWs) and vegetation waters (VWs) obtained during the manufacture of olive oil were added as substrate supplements for the cultivation of Pleurotus pulmonarius the material modified growth of the mushroom and the endemic microbiota of the substrate, in particular the

  18. Bioremediation of engine-oil polluted soil by Pleurotus tuber-regium ...

    African Journals Online (AJOL)

    White-rot fungi have been used in various parts of the world for bioremediation of polluted sites. Pleurotus tuber-regium was noted to have the ability to increase nutrient contents in soils polluted with 1 - 40% engine-oil concentration after six months of incubation. P. tuber-regium increased organic matter, carbon and ...

  19. Investigation on Pleurotus ferulae potential for the sorption of Pb(II ...

    African Journals Online (AJOL)

    Pleurotus ferulae obtained from rotten tree was collected, washed, dried, ground and sieved to appropriate particle size. Infra-red spectrometry was used to determine functional groups on the biomass while biosorption of Pb(II) from aqueous solution was studied using the biomass in a batch system. The effect of pH (1-7.5), ...

  20. Bioremediation of engine-oil polluted soil by Pleurotus tuber-regium ...

    African Journals Online (AJOL)

    SERVER

    2008-01-04

    Jan 4, 2008 ... White-rot fungi have been used in various parts of the world for bioremediation of polluted sites. Pleurotus tuber-regium was noted to have the ability to increase nutrient contents in soils polluted with. 1 - 40% engine-oil concentration after six months of incubation. P. tuber-regium increased organic matter ...

  1. Interactions between the introduced Pacific oyster Crassostrea gigas and the indigenous blue mussel Mytilus edulis. Local-scale food competition

    NARCIS (Netherlands)

    Hans, I.W.

    2004-01-01

    The aim of this study was to determine if food competition between mussels and oysters occurs, and how mussel and oyster growth is affected by this interaction. This was done by relating mussel growth to oyster density relating oyster growth to oyster biomass and perform a field control, by

  2. Prevalence and characterization of Salmonella serovars isolated from oysters served raw in restaurants.

    Science.gov (United States)

    Brillhart, Crystal D; Joens, Lynn A

    2011-06-01

    To determine if Salmonella-contaminated oysters are reaching consumer tables, a survey of raw oysters served in eight Tucson restaurants was performed from October 2007 to September 2008. Salmonella spp. were isolated during 7 of the 8 months surveyed and were present in 1.2% of 2,281 oysters tested. This observed prevalence is lower than that seen in a previous study in which U.S. market oysters were purchased from producers at bays where oysters are harvested. To test whether the process of refrigerating oysters in restaurants for several days reduces Salmonella levels, oysters were artificially infected with Salmonella and kept at 4°C for up to 13 days. Direct plate counts of oyster homogenate showed that Salmonella levels within oysters did not decrease during refrigeration. Six different serovars of Salmonella enterica were found in the restaurant oysters, indicating multiple incidences of Salmonella contamination of U.S. oyster stocks. Of the 28 contaminated oysters, 12 (43%) contained a strain of S. enterica serovar Newport that matched by pulsed-field gel electrophoresis a serovar Newport strain seen predominantly in the study of bay oysters performed in 2002. The repeated occurrence of this strain in oyster surveys is concerning, since the strain was resistant to seven antimicrobials tested and thus presents a possible health risk to consumers of raw oysters.

  3. Photosynthetic epibionts and endobionts of Pacific oyster shells from oyster reefs in rocky versus mudflat shores.

    Directory of Open Access Journals (Sweden)

    Laurent Barillé

    Full Text Available The Pacific oyster, Crassostrea gigas (Thunberg, is the main bivalve species cultivated in the world. With global warming enabling its reproduction and larval survival at higher latitudes, this species is now recognized as invasive and creates wild oyster reefs globally. In this study, the spatial distribution of photosynthetic assemblages colonizing the shells of wild C. gigas was investigated on both a large scale (two contrasting types of reefs found in mudflats and rocky areas and a small scale (within individual shells using a hyperspectral imager. The microspatial distribution of all phototrophs was obtained by mapping the Normalized Difference Vegetation Index (NDVI. Second derivative (δδ analyses of hyperspectral images at 462, 524, 571 and 647 nm were subsequently applied to map diatoms, cyanobacteria, rhodophytes and chlorophytes, respectively. A concomitant pigment analysis was carried out by high performance liquid chromatography and completed by taxonomic observations. This study showed that there was high microalgal diversity associated with wild oyster shells and that there were differences in the structure of the phototropic assemblages depending on the type of reef. Namely, vertically-growing oysters in mudflat areas had a higher biomass of epizoic diatoms (hyperspectral proxy at δδ462 nm and were mainly colonized by species of the genera Navicula, Nitzschia and Hippodonta, which are epipelic or motile epipsammic. The assemblages on the horizontal oysters contained more tychoplanktonic diatoms (e.g. Thalassiosira pseudonana, T. proschkinae and Plagiogrammopsis vanheurckii. Three species of boring cyanobacteria were observed for both types of reef: Mastigocoleus testarum, Leptolyngbya terrebrans, and Hyella caespistosa, but the second derivative analysis at 524 nm showed a significantly higher biomass for the horizontally-growing oysters. There was no biomass difference for the boring chlorophyte assemblages (δδ647 nm, with

  4. Perkinsus beihaiensis (Perkinsozoa in oysters of Bahia State, Brazil

    Directory of Open Access Journals (Sweden)

    M. S. A. Luz

    2017-08-01

    Full Text Available Abstract This study reports the pathogen Perkinsus beihaiensis in oysters of the genus Crassostrea on the coast of the State of Bahia (Brazil, its prevalence, infection intensity and correlation with salinity. Oysters (n = 240 were collected between October and December 2014 at eight sampling stations between latitudes 13°55'S and 15°42'S. The laboratory procedures included macroscopic analysis, histology, culture in Ray's fluid thioglycollate medium (RFTM, Polymerase Chain Reaction (PCR and DNA sequencing. PCR and sequencing have been used for the genetic identification of oysters as well. Two species of oysters have been identified: Crassostrea rhizophorae and C. brasiliana. In both oyster species P. beihaiensis was the only Perkinsus species detected. In C. rhizophorae, the average prevalence was 82.8% by histology and 65.2% by RFTM. In C. brasiliana, the prevalences were 70.5% and 35.7%, respectively. The higher prevalence of P. beihaiensis in C. rhizophorae was probably influenced by salinity, with which was positively correlated (r> 0.8. In both oysters, P. beihaiensis was located mainly in the gastric epithelium. The infection was generally mild or moderate, without apparent harm to the hosts, but in cases of severe infection, there was hemocytical reaction and tissue disorganization. The generally high prevalence in the region suggests that oysters should be monitored with respect to this pathogen, especially in growing areas.

  5. Drought Increases Consumer Pressure on Oyster Reefs in Florida, USA.

    Directory of Open Access Journals (Sweden)

    Hanna G Garland

    Full Text Available Coastal economies and ecosystems have historically depended on oyster reefs, but this habitat has declined globally by 85% because of anthropogenic activities. In a Florida estuary, we investigated the cause of newly reported losses of oysters. We found that the oyster reefs have deteriorated from north to south and that this deterioration was positively correlated with the abundance of carnivorous conchs and water salinity. In experiments across these gradients, oysters survived regardless of salinity if conchs were excluded. After determining that conchs were the proximal cause of oyster loss, we tested whether elevated water salinity was linked to conch abundance either by increasing conch growth and survivorship or by decreasing the abundance of a predator of conchs. In field experiments across a salinity gradient, we failed to detect spatial variation in predation on conchs or in conch growth and survivorship. A laboratory experiment, however, demonstrated the role of salinity by showing that conch larvae failed to survive at low salinities. Because this estuary's salinity increased in 2006 in response to reduced inputs of freshwater, we concluded that the ultimate cause of oyster decline was an increase in salinity. According to records from 2002 to 2012, oyster harvests have remained steady in the northernmost estuaries of this ecoregion (characterized by high reef biomass, low salinity, and low conch abundance but have declined in the southernmost estuaries (characterized by lower reef biomass, increases in salinity, and increases in conch abundance. Oyster conservation in this ecoregion, which is probably one of the few that still support viable oyster populations, may be undermined by drought-induced increases in salinity causing an increased abundance of carnivorous conchs.

  6. Characterization of adhesive from oysters: A structural and compositional study

    Science.gov (United States)

    Alberts, Erik

    The inability for man-made adhesives to set in wet or humid environments is an ongoing challenging the design of biomedical and marine adhesive materials. However, we see that nature has already overcome this challenge. Mussels, barnacles, oysters and sandcastle worms all have unique mechanisms by which they attach themselves to surfaces. By understanding what evolution has already spent millions of years perfecting, we can design novel adhesive materials inspired by nature's elegant designs. The well-studied mussel is currently the standard for design of marine inspired biomimetic polymers. In the work presented here, we aim to provide new insights into the adhesive produced by the eastern oyster, Crassostrea virginica. Unlike the mussel, which produces thread-like plaques comprised of DOPA containing-protein, the oyster secretes an organic-inorganic hybrid adhesive as it settles and grows onto a surface. This form of adhesion renders the oyster to be permanently fixed in place. Over time, hundreds of thousands of oyster grow and agglomerate to form extensive reef structures. These reefs are not only essential to survival of the oyster, but are also vital to intertidal ecosystems. While the shell of the oyster has been extensively studied, curiously, only a few conflicting insights have been made into the nature of the adhesive and contact zone between shell and substrate, and even lesfs information has been ascertained on organic and inorganic composition. In this work, we provide microscopy and histochemical studies to characterize the structure and composition of the adhesive, using oyster in the adult and juvenile stages of life. Preliminary work on extracting and characterizing organic components through collaborative help with solid-state NMR (SSNMR) and proteomics are also detailed here. We aim to provide a full, comprehensive characterization of oyster adhesive so that in the future, we may apply what we learn to the design of new materials.

  7. Human enteroviruses in oysters and their overlying waters.

    Science.gov (United States)

    Goyal, S M; Gerba, C P; Melnick, J L

    1979-03-01

    The presence of enteroviruses in oysters and oyster-harvesting waters of the Texas Gulf coast was monitored over a period of 10 months. Viruses were detected in water and oyster samples obtained from areas both open and closed to shellfish harvesting. Viruses were detected periodically in waters that met current bacteriological standards for shellfish harvesting. No significant statistical relationship was demonstrated between virus concentration in oysters and the bacteriological and physiochemical quality of water and shellfish. Viruses in water were, however, moderately correlated with total coliforms in water and oysters and with fecal coliforms in oysters. Total coliforms in water were realted to total coliforms in sediment were related only to total coliforms in sediment. Among the physiochemical characteristics of water, turbidity was related statistically to the organic matter content of water and to fecal coliforms in water. There was a marked effect of rainfall on the bacteriological quality of water. Of a total of 44 water samples, 26 yielded virus in concentrations from 4 to 167 plaque-forming units per 100-gallon (ca. 378.5-liter) sample. Of a total of 40 pools of 10 to 12 oysters each, virus was found in 14 pools at a concentration of 6 to 224 plaque-forming units per 100 g of oyster meat. On five occasions, virus was found in water samples when no virus could be detected in oysters harvested from the same sites. This study indicates that current bacteriological standards for determining the safety of shellfish and shellfish-growing waters do no reflect the occurrence of enteroviruses.

  8. Drought Increases Consumer Pressure on Oyster Reefs in Florida, USA.

    Science.gov (United States)

    Garland, Hanna G; Kimbro, David L

    2015-01-01

    Coastal economies and ecosystems have historically depended on oyster reefs, but this habitat has declined globally by 85% because of anthropogenic activities. In a Florida estuary, we investigated the cause of newly reported losses of oysters. We found that the oyster reefs have deteriorated from north to south and that this deterioration was positively correlated with the abundance of carnivorous conchs and water salinity. In experiments across these gradients, oysters survived regardless of salinity if conchs were excluded. After determining that conchs were the proximal cause of oyster loss, we tested whether elevated water salinity was linked to conch abundance either by increasing conch growth and survivorship or by decreasing the abundance of a predator of conchs. In field experiments across a salinity gradient, we failed to detect spatial variation in predation on conchs or in conch growth and survivorship. A laboratory experiment, however, demonstrated the role of salinity by showing that conch larvae failed to survive at low salinities. Because this estuary's salinity increased in 2006 in response to reduced inputs of freshwater, we concluded that the ultimate cause of oyster decline was an increase in salinity. According to records from 2002 to 2012, oyster harvests have remained steady in the northernmost estuaries of this ecoregion (characterized by high reef biomass, low salinity, and low conch abundance) but have declined in the southernmost estuaries (characterized by lower reef biomass, increases in salinity, and increases in conch abundance). Oyster conservation in this ecoregion, which is probably one of the few that still support viable oyster populations, may be undermined by drought-induced increases in salinity causing an increased abundance of carnivorous conchs.

  9. Quantitative validation of a habitat suitability index for oyster restoration

    Directory of Open Access Journals (Sweden)

    Seth eTheuerkauf

    2016-05-01

    Full Text Available Habitat suitability index (HSI models provide spatially explicit information on the capacity of a given habitat to support a species of interest, and their prevalence has increased dramatically in recent years. Despite caution that the reliability of HSIs must be validated using independent, quantitative data, most HSIs intended to inform terrestrial and marine species management remain unvalidated. Furthermore, of the eight HSI models developed for eastern oyster (Crassostrea virginica restoration and fishery production, none has been validated. Consequently, we developed, calibrated, and validated an HSI for the eastern oyster to identify optimal habitat for restoration in a tributary of Chesapeake Bay, the Great Wicomico River (GWR. The GWR harbors a high density, restored oyster population, and therefore serves as an excellent model system for assessing the validity of the HSI. The HSI was derived from GIS layers of bottom type, salinity, and water depth (surrogate for dissolved oxygen, and was tested using live adult oyster density data from a survey of high vertical relief reefs (HRR and low vertical relief reefs (LRR in the sanctuary network. Live adult oyster density was a statistically-significant sigmoid function of the HSI, which validates the HSI as a robust predictor of suitable oyster reef habitat for rehabilitation or restoration. In addition, HRR had on average 103-116 more adults m^−2 than LRR at a given level of the HSI. For HRR, HSI values ≥0.3 exceeded the accepted restoration target of 50 live adult oysters m^−2. For LRR, the HSI was generally able to predict live adult oyster densities that meet or exceed the target at HSI values ≥0.3. The HSI indicated that there remain large areas of suitable habitat for restoration in the GWR. This study provides a robust framework for HSI model development and validation, which can be refined and applied to other systems and previously developed HSIs to improve the efficacy of

  10. Development of Genetic Markers for Triploid Verification of the Pacific Oyster,

    Directory of Open Access Journals (Sweden)

    Jung-Ha Kang

    2013-07-01

    Full Text Available The triploid Pacific oyster, which is produced by mating tetraploid and diploid oysters, is favored by the aquaculture industry because of its better flavor and firmer texture, particularly during the summer. However, tetraploid oyster production is not feasible in all oysters; the development of tetraploid oysters is ongoing in some oyster species. Thus, a method for ploidy verification is necessary for this endeavor, in addition to ploidy verification in aquaculture farms and in the natural environment. In this study, a method for ploidy verification of triploid and diploid oysters was developed using multiplex polymerase chain reaction (PCR panels containing primers for molecular microsatellite markers. Two microsatellite multiplex PCR panels consisting of three markers each were developed using previously developed microsatellite markers that were optimized for performance. Both panels were able to verify the ploidy levels of 30 triploid oysters with 100% accuracy, illustrating the utility of microsatellite markers as a tool for verifying the ploidy of individual oysters.

  11. Comparison of methods for detection of norovirus in oysters

    DEFF Research Database (Denmark)

    Schultz, Anna Charlotte; Saadbye, Peter; Hoorfar, Jeffrey

    2007-01-01

    a successful detection it is of great importance to remove the tissue inhibitors during the viral RNA extraction. To select the most efficient extraction procedure of oysters we have compared four protocols. A pool of digestive gland material from oyster samples was divided into 1.5 g portions and spiked...... with I 0-fold dilutions of human faecal samples containing norovirus genogroup II. The samples were tested on three different occasions using four different sample treatment protocols. The protocols were assessed with regard to their ability to recover viral RNA and detect norovirus in spiked oysters...

  12. Episodic recruitment of the rock oyster Saccostrea cucullata (Born ...

    African Journals Online (AJOL)

    Episodic recruitment of the rock oyster Saccostrea cucullata (Born, 1778) on the Transkei coast. ... This single recruitment, which is 6 to 31 times the annual mean recorded over the last 6 to 7 years, represents 5 ... AJOL African Journals Online.

  13. The Edibility and Cultivation of the Oyster Mushroom.

    Science.gov (United States)

    Brenneman, James; Guttman, Mark C.

    1994-01-01

    Describes an enjoyable and fascinating experience that involves the cultivation of oyster mushrooms. By allowing students to participate in this process, the students are able to better understand the biology and utility of fungi. (ZWH)

  14. Phylogeny and Species Diversity of Gulf of California Oysters

    Data.gov (United States)

    U.S. Environmental Protection Agency — Dataset of DNA sequence data from two mitochondrial loci (COI and 16S) used to infer the phylogeny of oysters in the genus Ostrea along the Pacific coast of North...

  15. Oyster radiation sensitivity; Sensibilidade de ostras a radiacao

    Energy Technology Data Exchange (ETDEWEB)

    Marchese, Sandra R.M. [Centro Tecnologico da Marinha em Sao Paulo (CTMSP), SP (Brazil); Mastro, Nelida L. del [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil)

    1996-07-01

    Various food products like oysters, crabs and shrimps have been described as possible Vibrio spp. transmitting agents. Seafood irradiation is been presented as an alternative among the different public health intervention measures to control food borne diseases. The objective of this work was to establish, firstly, the radioresistance of Crassostrea brasiliana oysters. The oysters were irradiated with Co-60 radiation with doses of 0, 1.5,3 and 6 kGy. Survival curves a function of time showed that 100% of samples irradiated with 3 kGy survived at least 6 days; among those irradiated with 6 kGy, 100% survived 3 days. These results are encouraging since a dose of 2 kGy is already effective in diminishing oyster bioburden. (author)

  16. Cadmium uptake in oyster isognomon alatus under laboratory condition

    International Nuclear Information System (INIS)

    Katayon Saed; Ahmad Ismail; Missri Kusnan; Hishamuddin Omar

    1999-01-01

    The uptake of cadmium in Flat tree oyster Isognomon alatus was investigated under controlled laboratory conditions for two weeks. Oysters were exposed to 100 μg 1'-1 cadmium and the accumulation of cadmium in the tissues was measured for every two days. Soft tissues of oyster were digested in concentrated acid and cadmium concentrations were determined by using Atomic Absorption Spectrophotometer. The accumulation of cadmium in the soft tissues of oysters was increased during the first six days from 0.73 μg g- 1 to 10.77 μg g'-1, and remaining constant for four days at average level of 10.96 μg g'-1. The Cl concentrations was increased to 32.70 μg g'-1 until the end of experiment. There was no sign of cadmium accumulation approaching saturation for the period of exposure. (author)

  17. Carbon And Nitrogen Requirements For The Cultivation Of Oyster ...

    African Journals Online (AJOL)

    Carbon And Nitrogen Requirements For The Cultivation Of Oyster Mushroom ... It was found that under these experimental conditions, the carbon compounds supported growth except ribose, starch and dextrin. ... HOW TO USE AJOL.

  18. Length-weight relationship of Giant Oyster, Crassostrea gyphoides (Schlotheim)

    Digital Repository Service at National Institute of Oceanography (India)

    Chatterji, A.; Ansari, Z.A.; Ingole, B.S.; Parulekar, A.H.

    Relationship between shell length and total weight, shell weight and meat weight of giant oyster, Crassostrea gryphoides revealed that the growth of these parameters is very fast and significant. It indicates the suitability of the species concerned...

  19. IS COPPER REQUIRED FOR EASTERN OYSTER SETTING AND METAMORPHOSIS?

    Science.gov (United States)

    Recent field research with eastern oysters demonstrated higher defense activities, including hemocyte numbers, locomotion and bactericidal ability, associated with locations exhibiting relatively high contamination. Copper and zinc, found in high concentrations in tissues of oyst...

  20. Virus, protozoa and organic compounds decay in depurated oysters.

    Science.gov (United States)

    Souza, Doris Sobral Marques; Piazza, Rômi Sharon; Pilotto, Mariana Rangel; do Nascimento, Mariana de Almeida; Moresco, Vanessa; Taniguchi, Satie; Leal, Diego Averaldo Guiguet; Schmidt, Éder der Carlos; Cargin-Ferreira, Eduardo; Bícego, Márcia Caruso; Sasaki, Silvio Tarou; Montone, Rosalinda Carmela; de Araujo, Rafael Alves; Franco, Regina Maura Bueno; Bouzon, Zenilda Laurita; Bainy, Afonso Celso Dias; Barardi, Célia Regina Monte

    2013-11-01

    (1) Evaluate the dynamic of the depuration process of Crassostrea gigas oysters using different ultraviolet doses with different amounts of contaminants (virus, protozoa and organic contaminants) and (2) investigate the morphological changes in the oysters' tissues produced by the depuration procedures. The oysters were allocated in sites with different degrees of contamination and analyzed after 14 days. Some animals were used as positive controls by artificial bioaccumulation with HAdV2 and MNV1 and subjected to depuration assays using UV lamps (18 or 36 W) for 168 h. The following pollutants were researched in the naturally contaminated oysters, oysters after 14 days in sites and oysters during the depuration processes: virus (HAdV, HAV, HuNoV GI/GII and JCPyV), by (RT) qPCR; protozoa (Cryptosporidium and Giardia species), by immunomagnetic separation and immunofluorescence; and organic compounds (AHs, PAHs, LABs, PCBs and organochlorine pesticides-OCs), by chromatography. Changes in the oysters' tissues produced by the depuration processes were also evaluated using histochemical analysis by light microscopy. In the artificially bioaccumulated oysters, only HAdV2 and MNV1 were investigated by (RT) qPCR before the depuration procedures and after 96 and 168 h of these procedures. At 14 days post-allocation, HAdV was found in all the sites (6.2 × 105 to 4.4 × 107 GC g(-1)), and Giardia species in only one site. Levels of PCBs and OCs in the oyster's tissues were below the detection limit for all samples. AHs (3.5 to 4.4 μg g(-1)), PAHs (11 to 191 ng g(-1)) and LABs (57 to 751 ng g(-1)) were detected in the samples from 3 sites. During the depuration assays, we found HAdV, Giardia and Cryptosporidium species until 168 h, independent of UV treatment. AHs, PAHs and LABs were found also after 168 h of depuration (36 W and without UV lamp). The depuration procedures did not produce changes in the oysters' tissues. In the artificially contaminated and depurated

  1. Chemical analysis of fructification bodies of Pleurotus sajor-caju cultivated in several nitrogen concentrations

    OpenAIRE

    Silva, Evânia Geralda; Dias, Eustáquio Souza; Siqueira, Félix Gonçalves; Schwan, Rosane Freitas

    2007-01-01

    Os cogumelos do gênero Pleurotus normalmente crescem bem em substratos mais pobres em nitrogênio, ao contrário dos cogumelos Agaricus que requerem substratos com relação C/N mais estreita. Por outro lado, os valores nutricionais do cogumelo dependem da composição química do substrato utilizado e das condições de cultivo. Este trabalho teve como objetivo avaliar o teor de proteína dos corpos de frutificação do cogumelo Pleurotus sajor-caju cultivado em capim coast-cross, bagaço de cana-de-açúc...

  2. High-pressure treatment for shelf-life extension and quality improvement of oysters cooked in a traditional Taiwanese oyster omelet.

    Science.gov (United States)

    Lai, Kung-Ming; Chi, Hsin-Yi; Hsu, Kuo-Chiang

    2010-01-01

    Whole oysters were processed using high-pressure (HP) treatment at 250 and 300 MPa for 0 to 10 min and stored at 4 degrees Celsius for up to 28 days. HP-treated oysters and untreated oysters were evaluated for lipid oxidation, growth of microorganisms, and sensory characteristics after cooking at 160 degrees Celsius for 90 s. Microbial counts after HP treatment revealed that the bacterial load was initially reduced at all pressures. HP-treated oysters had significantly higher pH and moisture (P oysters during storage. HP treatment increased lipid oxidation with unpleasant odor during storage compared with the control. HP treatment decreased redness but did not significantly affect the brightness and yellowness of cooked oysters. From tests of mechanical properties, 300 MPa-treated oysters after cooking had significantly increased toughness as measured by cutting force. HP-treated oysters after cooking received higher quality scores than did the control during the storage trial. Results indicated that 300 MPa for 2 min is the optimum HP treatment that results in oysters most acceptable for oyster omelets during storage at 4 degrees Celsius, and this treatment may extend the shelf life of these oysters to 21 days.

  3. National survey of foodborne viruses in Australian oysters at production.

    Science.gov (United States)

    Torok, Valeria; Hodgson, Kate; McLeod, Catherine; Tan, Jessica; Malhi, Navreet; Turnbull, Alison

    2018-02-01

    Internationally human enteric viruses, such as norovirus (NoV) and hepatitis A virus (HAV), are frequently associated with shellfish related foodborne disease outbreaks, and it has been suggested that acceptable NoV limits based on end-point testing be established for this high risk food group. Currently, shellfish safety is generally managed through the use of indicators of faecal contamination. Between July 2014 and August 2015, a national prevalence survey for NoV and HAV was done in Australian oysters suitable for harvest. Two sampling rounds were undertaken to determine baseline levels of these viruses. Commercial Australian growing areas, represented by 33 oyster production regions in New South Wales, South Australia, Tasmania and Queensland, were included in the survey. A total of 149 and 148 samples were collected during round one and two of sampling, respectively, and tested for NoV and HAV by quantitative RT-PCR. NoV and HAV were not detected in oysters collected in either sampling round, indicating an estimated prevalence for these viruses in Australian oysters of oysters was consistent with epidemiological evidence, with no oyster-related foodborne viral illness reported during the survey period. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Copper and zinc contamination in oysters: subcellular distribution and detoxification.

    Science.gov (United States)

    Wang, Wen-Xiong; Yang, Yubo; Guo, Xiaoyu; He, Mei; Guo, Feng; Ke, Caihuan

    2011-08-01

    Metal pollution levels in estuarine and coastal environments have been widely reported, but few documented reports exist of severe contamination in specific environments. Here, we report on a metal-contaminated estuary in Fujian Province, China, in which blue oysters (Crassostrea hongkongensis) and green oysters (Crassostrea angulata) were discovered to be contaminated with Cu and other metals. Extraordinarily high metal concentrations were found in the oysters collected from the estuary. Comparison with historical data suggests that the estuary has recently been contaminated with Cr, Cu, Ni, and Zn. Metal concentrations in blue oysters were as high as 1.4 and 2.4% of whole-body tissue dry wt for Cu and Zn, respectively. Cellular debris was the main subcellular fraction binding the metals, but metal-rich granules were important for Cr, Ni, and Pb. With increasing Cu accumulation, its partitioning into the cytosolic proteins decreased. In contrast, metallothionein-like proteins increased their importance in binding with Zn as tissue concentrations of Zn increased. In the most severely contaminated oysters, only a negligible fraction of their Cu and Zn was bound with the metal-sensitive fraction, which may explain the survival of oysters in such contaminated environments. Copyright © 2011 SETAC.

  5. Raw oysters can be a risk for infections

    Directory of Open Access Journals (Sweden)

    Regine Helena Silva dos Fernandes Vieira

    Full Text Available The aims of this study were to count and identify sucrose positive and negative vibrios isolated from cultivated Crassostrea rhizophorae oysters during their growing cycle. Every month for 12 months, 10 to 18 oysters were collected for study. Collections occurred at the Center for Studies of Coastal Aquaculture (CSCA, which is associated with the Institute of Marine Science, Labomar, located in Euzebio, Ceará, Brazil. Approximately 150 oysters and their intervalvular liquor were studied. Vibrio Standard Plates Counts (SPC from oyster meat and their intervalvular liquor varied from 25 to 59,000,000 CFU/g. For most of the 12 months of the oysters' life, it was possible to identify Vibrio parahaemolyticus. Vibrio carchariae was identified in four collections. Among other isolated species, the most important, considering public health risks, was V. vulnificus, although only one strain was confirmed. We concluded that retail purchased oysters should never be eaten raw or undercooked because many species of the genus Vibrio are known to be pathogenic to humans and live naturally on and in shellfish throughout their life cycle.

  6. Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii

    Directory of Open Access Journals (Sweden)

    Sharon Avni

    2017-07-01

    Full Text Available Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe of the fruit body contained higher glucan content then the caps (pileus. Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate.

  7. Economic Values Associated With Construction of Oyster Reefs by the Corps of Engineers

    National Research Council Canada - National Science Library

    Henderson, Jim

    2003-01-01

    .... That template includes a community model for the American oyster (Crassostrea virginica) which can be used to quantify the ecological benefits of an oyster reef in an ecosystem restoration project...

  8. DIFFERENTIAL EFFECTS OF OYSTER (CRASSOSTREA VIRGINICA) DEFENSES ON CLINICAL AND ENVIRONMENTAL ISOLATES OF VIBRIO PARAHEMOLYTICUS

    Science.gov (United States)

    Three clinical (2030, 2062, and 2107) and three environmental (1094, 1163, and ATCC 17802) isolates of Vibrio parahaemolyticus were exposed to hemocytes and plasma collected from oysters (Crassostrea virginica) to determine their susceptibility to putative oyster defenses. Clinic...

  9. Predicting the effects of proposed Mississippi River diversions on oyster habitat quality; application of an oyster habitat suitability index model

    Science.gov (United States)

    Soniat, Thomas M.; Conzelmann, Craig P.; Byrd, Jason D.; Roszell, Dustin P.; Bridevaux, Joshua L.; Suir, Kevin J.; Colley, Susan B.

    2013-01-01

    In an attempt to decelerate the rate of coastal erosion and wetland loss, and protect human communities, the state of Louisiana developed its Comprehensive Master Plan for a Sustainable Coast. The master plan proposes a combination of restoration efforts including shoreline protection, marsh creation, sediment diversions, and ridge, barrier island, and hydrological restoration. Coastal restoration projects, particularly the large-scale diversions of fresh water from the Mississippi River, needed to supply sediment to an eroding coast potentially impact oyster populations and oyster habitat. An oyster habitat suitability index model is presented that evaluates the effects of a proposed sediment and freshwater diversion into Lower Breton Sound. Voluminous freshwater, needed to suspend and broadly distribute river sediment, will push optimal salinities for oysters seaward and beyond many of the existing reefs. Implementation and operation of the Lower Breton Sound diversion structure as proposed would render about 6,173 ha of hard bottom immediately east of the Mississippi River unsuitable for the sustained cultivation of oysters. If historical harvests are to be maintained in this region, a massive and unprecedented effort to relocate private leases and restore oyster bottoms would be required. Habitat suitability index model results indicate that the appropriate location for such efforts are to the east and north of the Mississippi River Gulf Outlet.

  10. Species Profiles: Life Histories and Environmental Requirements of Coastal Fishes and Invertebrates (Pacific Northwest), Pacific Oyster

    Science.gov (United States)

    1988-09-01

    are provided by Galtsoff (1964). Pho- The germinal vesicle is eccentricall, tographs of C. ia larval develop- located within the nucleolus . ment at vari... composition to cultures, and together with high tem- which oysters are exposed (Grave 1916; peratures may cause oyster mortality Morse 1944). (Lipovsky...setting in oyster. Bull. Jap. Soc. Sci. Fish. European and American oysters: 43(9): 1069-1076. response to surface chemistry versus waterborne

  11. Effect of storage on the quality of purified live Pacific and Sydney rock oysters

    OpenAIRE

    Bird, P; Arnold, G; Holliday, J; Boronovshy, A

    1992-01-01

    In December, 1990, the N.S.W. Minister for Agriculture and Rural Affairs removed the Pacific oyster (Crassostrea gigas) from the noxious fish list for the Port Stephens area, permitting it's cultivation. As Port Stephens Pacific oysters are grown intertidally, similar to Sydney rock oysters (Saccostrea commercialis) there was a belief that they may have different storage requirements to overseas Pacific oysters which are cultivated in deep water exclusively. Consequently, the keeping quality ...

  12. Enzymatic, Antioxidant, Antimicrobial, and Insecticidal Activities of Pleurotus pulmonarius and Pycnoporus cinnabarinus Grown Separately in an Airlift Reactor

    Directory of Open Access Journals (Sweden)

    Maura Téllez-Téllez

    2016-03-01

    Full Text Available Crude extract samples of Pleurotus pulmonarius and Pycnoporus cinnabarinus were taken during growth in liquid broth in an airlift reactor. Growth was monitored indirectly by sugar consumption and pH profile. During growth Pleurotus pulmonarius consumed glucose more slowly than Pycnoporus cinnabarinus, reaching a final pH of 8.0. In contrast, Pycnoporus cinnabarinus started consuming glucose faster from the beginning to the end with a pH of 3.6, suggesting the production of different metabolites while they grow in the same culture broth. Additionally, antioxidant activity, polyphenol and flavonoid contents, as well as laccase and hydrolase activities were quantified in the culture extracts during the fermentation. Pleurotus pulmonarius showed higher antioxidant activity than Pycnoporus cinnabarinus. Both fungi have a very low polyphenol and flavonoid content. Values of amylase and pectinase activities were similar in crude extracts of both fungi; however, cellulase, xylanase, invertase, and laccase activities showed higher levels in crude extract of Pleurotus pulmonarius. Antimicrobial and insecticidal activities were also evaluated in each crude extract. In fact, Pycnoporus cinnabarinus presented a very strong bacteriostatic and bactericidal effect against Escherichia coli and Staphylococcus aureus and reliably killed Diatraea magnifactella larvae, while Pleurotus pulmonarius did not showed any negative effect on the growth of these bacteria or larvae.

  13. First isolation of Nocardia crassostreae from Pacific oysters (Crassostrea gigas) in Europe

    NARCIS (Netherlands)

    Engelsma, M.Y.; Roozenburg, I.; Joly, J.P.

    2008-01-01

    In summer 2006 an extensive mortality of Pacific oysters Crassostrea gigas occurred in Lake Grevelingen, the Netherlands. A sample of Pacific oysters was investigated for the presence of shellfish pathogens as potential causes of the mortality. Yellow-green lesions were observed in several oysters

  14. 21 CFR 161.30 - Declaration of quantity of contents on labels for canned oysters.

    Science.gov (United States)

    2010-04-01

    ... canned oysters. 161.30 Section 161.30 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH....30 Declaration of quantity of contents on labels for canned oysters. (a) For many years packers of canned oysters in the Gulf area of the United States have labeled their output with a declaration of the...

  15. Isolation of Vibrio cholerae serotype O1 from the eastern oyster, Crassostrea virginica.

    Science.gov (United States)

    Hood, M A; Ness, G E; Rodrick, G E

    1981-01-01

    Two strains of Vibrio cholerae serotype O1 Inaba were isolated from eastern oysters, Crassostrea virginica, collected from estuarine waters in Florida during April 1980. The oyster meats and waters from which the oysters were collected had low fecal coliform counts, and the area had no prior evidence of sewage contamination. PMID:7235700

  16. Detection of hepatitis A virus and bacterial contamination in raw oysters in Thailand.

    Science.gov (United States)

    Kittigul, Leera; Pombubpa, Kannika; Sukonthalux, Suntharee; Rattanatham, Tippawan; Utrarachkij, Fuangfa; Diraphat, Pornphan

    2010-01-01

    This study was conducted to determine the presence of hepatitis A virus (HAV) in raw oysters (Crassostrea belcheri) using a virus concentration method and reverse transcription-nested polymerase chain reaction (RT-nested PCR). A total of 220 oyster samples were collected from oyster farms and local markets in Thailand. HAV was found in three oyster samples. Nested PCR products of HAV detected in oysters were characterized further by DNA sequencing of the VP1/2A region and subjected to phylogenetic analysis. All HAV sequences (168 basepairs) were associated with human HAV subgenotype IB (GIB). Fecal coliforms and Escherichia coli were determined using the multiple tube fermentation method, to assess the microbiological quality of collected oysters. Among oyster samples tested, 65% had fecal coliforms higher than the standard level for raw shellfish [oyster samples (85%) were contaminated with E. coli in the range of 3.0-4.6 x 10(4) MPN/g. One oyster sample with an acceptable level of fecal coliforms contained HAV GIB. E. coli was found in all HAV-positive oyster samples. The results suggest a significant presence of HAV and bacterial indicators of fecal contamination in raw oysters, which are a health risk for consumers and a source of gastrointestinal illness. Enteric viruses should also be tested to assess the microbiological quality of oysters.

  17. PARASITIC AND SYMBIOTIC FAUNA INHABITING OYSTERS (CRASSOSTREA VIRGINICA) SAMPLED FROM THE CALOOSAHATCHEE ESTUARY, FL

    Science.gov (United States)

    Oysters, Crassostrea virginica, inhabiting 5 sites in the Caloosahatchee River estuary were studied over a 13 month period to determine the suitability of oyster habitat in relation to their health and condition. Histological examination of 650 oysters (10 animals per station per...

  18. Bacteriological quality of fresh and smoke-dried oysters sold in ...

    African Journals Online (AJOL)

    Bacterial isolates found in fresh oyster were Klebsiella sp. Escherichia sp., Proteus mirabilis, Citrobacter sp., Micrococcus sp., Bacillus sp., Staphylococccus sp. and Serratia sp. while E. coli, Streptococcus sp., Staphylococcus sp. and B. cereus predominated in dried oysters. The oyster meats did not meet the standards of ...

  19. Oyster reproduction is affected by exposure to polystyrene microplastics

    Science.gov (United States)

    Sussarellu, Rossana; Suquet, Marc; Thomas, Yoann; Lambert, Christophe; Fabioux, Caroline; Pernet, Marie Eve Julie; Le Goïc, Nelly; Quillien, Virgile; Mingant, Christian; Epelboin, Yanouk; Corporeau, Charlotte; Guyomarch, Julien; Robbens, Johan; Paul-Pont, Ika; Soudant, Philippe; Huvet, Arnaud

    2016-01-01

    Plastics are persistent synthetic polymers that accumulate as waste in the marine environment. Microplastic (MP) particles are derived from the breakdown of larger debris or can enter the environment as microscopic fragments. Because filter-feeder organisms ingest MP while feeding, they are likely to be impacted by MP pollution. To assess the impact of polystyrene microspheres (micro-PS) on the physiology of the Pacific oyster, adult oysters were experimentally exposed to virgin micro-PS (2 and 6 µm in diameter; 0.023 mg·L−1) for 2 mo during a reproductive cycle. Effects were investigated on ecophysiological parameters; cellular, transcriptomic, and proteomic responses; fecundity; and offspring development. Oysters preferentially ingested the 6-µm micro-PS over the 2-µm-diameter particles. Consumption of microalgae and absorption efficiency were significantly higher in exposed oysters, suggesting compensatory and physical effects on both digestive parameters. After 2 mo, exposed oysters had significant decreases in oocyte number (−38%), diameter (−5%), and sperm velocity (−23%). The D-larval yield and larval development of offspring derived from exposed parents decreased by 41% and 18%, respectively, compared with control offspring. Dynamic energy budget modeling, supported by transcriptomic profiles, suggested a significant shift of energy allocation from reproduction to structural growth, and elevated maintenance costs in exposed oysters, which is thought to be caused by interference with energy uptake. Molecular signatures of endocrine disruption were also revealed, but no endocrine disruptors were found in the biological samples. This study provides evidence that micro-PS cause feeding modifications and reproductive disruption in oysters, with significant impacts on offspring. PMID:26831072

  20. Oyster reproduction is affected by exposure to polystyrene microplastics.

    Science.gov (United States)

    Sussarellu, Rossana; Suquet, Marc; Thomas, Yoann; Lambert, Christophe; Fabioux, Caroline; Pernet, Marie Eve Julie; Le Goïc, Nelly; Quillien, Virgile; Mingant, Christian; Epelboin, Yanouk; Corporeau, Charlotte; Guyomarch, Julien; Robbens, Johan; Paul-Pont, Ika; Soudant, Philippe; Huvet, Arnaud

    2016-03-01

    Plastics are persistent synthetic polymers that accumulate as waste in the marine environment. Microplastic (MP) particles are derived from the breakdown of larger debris or can enter the environment as microscopic fragments. Because filter-feeder organisms ingest MP while feeding, they are likely to be impacted by MP pollution. To assess the impact of polystyrene microspheres (micro-PS) on the physiology of the Pacific oyster, adult oysters were experimentally exposed to virgin micro-PS (2 and 6 µm in diameter; 0.023 mg·L(-1)) for 2 mo during a reproductive cycle. Effects were investigated on ecophysiological parameters; cellular, transcriptomic, and proteomic responses; fecundity; and offspring development. Oysters preferentially ingested the 6-µm micro-PS over the 2-µm-diameter particles. Consumption of microalgae and absorption efficiency were significantly higher in exposed oysters, suggesting compensatory and physical effects on both digestive parameters. After 2 mo, exposed oysters had significant decreases in oocyte number (-38%), diameter (-5%), and sperm velocity (-23%). The D-larval yield and larval development of offspring derived from exposed parents decreased by 41% and 18%, respectively, compared with control offspring. Dynamic energy budget modeling, supported by transcriptomic profiles, suggested a significant shift of energy allocation from reproduction to structural growth, and elevated maintenance costs in exposed oysters, which is thought to be caused by interference with energy uptake. Molecular signatures of endocrine disruption were also revealed, but no endocrine disruptors were found in the biological samples. This study provides evidence that micro-PS cause feeding modifications and reproductive disruption in oysters, with significant impacts on offspring.

  1. Use of maize wastewater for the cultivation of the Pleurotus spp. mushroom and optimization of its biological efficiency.

    Science.gov (United States)

    Loss, Edenes; Royer, Andrea Rafaela; Barreto-Rodrigues, Marcio; Barana, Ana Claudia

    2009-07-30

    This study evaluated the Pleurotus spp. mushroom production process using an effluent from the maize agroindustrial process as a carbon and nitrogen source and as a wetting agent. A complete experimental design based on factorial planning was used to optimize the biological efficiency and evaluate the effect of the concentration of effluent, pH and species of Pleurotus. The results indicated that the effluent affects the biological efficiency for the production of both species of mushrooms at all pH values studied. The maximum biological efficiency predicted by the model (81.36%) corresponded to the point defined by the effluent contents (X(1)=1), pH (X(2)=-1) and fungus species (X(3)=1), specifically 50%, 5.0 and P. floridae, respectively. The results demonstrated that the effluent is a good alternative for the production of Pleurotus mushrooms.

  2. Project ash cultch: A report on optimal oyster cultch based on a prepared fly ash substratum

    International Nuclear Information System (INIS)

    Price, K.S.; Hansen, K.M.; Schlekat, C.E.

    1991-01-01

    Based on a three year study involving setting, growth, mortality, oyster condition, and metals accumulation, the evidence is extensive and convincing that stabilized coal ash is an acceptable oyster growing cultch (substratum). Oyster larvae are attracted to set on coal ash cultch at commercial fishery densities, tend to grow as well as on natural substrata (oyster shell), and are moderately more exposed to predators on the puck shaped ash materials as produced for this study. Oysters grown for one to two years on coal ash do not accumulate heavy metals and generally are in good health as measured by several biological condition indexes

  3. Decolourization and degradation of azo Dye, Synozol Red HF6BN ...

    African Journals Online (AJOL)

    Decolourization and degradation of azo Dye, Synozol Red HF6BN, by Pleurotus ostreatus. Sidra Ilyas, Skinder Sultan Sultan, Abdul Rehman. Abstract. The present paper focuses on the use of fungus, Pleurotus ostreatus, to decolorize and degrade azo dye, Synazol Red HF6BN. Decolorization study showed that P.

  4. Suspension of oysters reduces the populations of Vibrio parahaemolyticus and Vibrio vulnificus.

    Science.gov (United States)

    Cole, K M; Supan, J; Ramirez, A; Johnson, C N

    2015-09-01

    Vibrio parahaemolyticus (Vp) and Vibrio vulnificus (Vv) are associated with the consumption of raw oysters and cause illnesses ranging from simple gastroenteritis to life-threatening septicaemia. These halophilic bacteria are frequently found in marine and estuarine systems, accumulating within the tissues of a number of aquatic organisms and passing on to humans after consumption, through contaminated water, or via open wounds. As benthic organisms capable of filtering 40 gallons of water per hour, sediment is an important source of potentially pathogenic vibrios in oysters destined for raw consumption. This research used off-bottom oyster culture to reduce vibrio concentrations in oysters. Colony hybridization was used to enumerate Vp and Vv in bottom and suspended oysters. Vv and Vp concentrations were generally lower in oysters suspended off-bottom, and suspension decreased vibrio loads in oysters by an average of 13%. Suspension of oysters reduced vibrio concentrations. This study found that oyster suspension significantly reduced some populations of potentially pathogenic vibrios. These results indicate that oyster suspension could be a viable approach for preharvest treatment to reduce illness in consumers of raw oysters. © 2015 The Society for Applied Microbiology.

  5. Vibrio bacteria in raw oysters: managing risks to human health.

    Science.gov (United States)

    Froelich, Brett A; Noble, Rachel T

    2016-03-05

    The human-pathogenic marine bacteria Vibrio vulnificus and V. parahaemolyticus are strongly correlated with water temperature, with concentrations increasing as waters warm seasonally. Both of these bacteria can be concentrated in filter-feeding shellfish, especially oysters. Because oysters are often consumed raw, this exposes people to large doses of potentially harmful bacteria. Various models are used to predict the abundance of these bacteria in oysters, which guide shellfish harvest policy meant to reduce human health risk. Vibrio abundance and behaviour varies from site to site, suggesting that location-specific studies are needed to establish targeted risk reduction strategies. Moreover, virulence potential, rather than simple abundance, should be also be included in future modeling efforts. © 2016 The Author(s).

  6. Cholera after the consumption of raw oysters. A case report.

    Science.gov (United States)

    Klontz, K C; Tauxe, R V; Cook, W L; Riley, W H; Wachsmuth, I K

    1987-12-01

    In August 1986, a 76-year-old woman in Miami, Florida, developed profuse watery diarrhea and abdominal cramps. Two and four days before the onset of her illness, she had eaten six raw oysters at each of two restaurants in Miami. A stool specimen yielded toxigenic Vibrio cholerae O1 biotype El Tor, serotype Inaba. The results of toxin gene probing of the organism recovered from the patient differed significantly from those of other V. cholerae O1 isolates from the Gulf Coast and elsewhere in the world. A program of active surveillance identified no other cases of cholera in Miami. The source of the raw oysters eaten by the patient was traced to Louisiana. Her case represents the first reported case of cholera associated with eating raw oysters.

  7. Guidelines for evaluating performance of oyster habitat restoration

    Science.gov (United States)

    Baggett, Lesley P.; Powers, Sean P.; Brumbaugh, Robert D.; Coen, Loren D.; DeAngelis, Bryan M.; Greene, Jennifer K.; Hancock, Boze T.; Morlock, Summer M.; Allen, Brian L.; Breitburg, Denise L.; Bushek, David; Grabowski, Jonathan H.; Grizzle, Raymond E.; Grosholz, Edwin D.; LaPeyre, Megan K.; Luckenbach, Mark W.; McGraw, Kay A.; Piehler, Michael F.; Westby, Stephanie R.; zu Ermgassen, Philine S. E.

    2015-01-01

    Restoration of degraded ecosystems is an important societal goal, yet inadequate monitoring and the absence of clear performance metrics are common criticisms of many habitat restoration projects. Funding limitations can prevent adequate monitoring, but we suggest that the lack of accepted metrics to address the diversity of restoration objectives also presents a serious challenge to the monitoring of restoration projects. A working group with experience in designing and monitoring oyster reef projects was used to develop standardized monitoring metrics, units, and performance criteria that would allow for comparison among restoration sites and projects of various construction types. A set of four universal metrics (reef areal dimensions, reef height, oyster density, and oyster size–frequency distribution) and a set of three universal environmental variables (water temperature, salinity, and dissolved oxygen) are recommended to be monitored for all oyster habitat restoration projects regardless of their goal(s). In addition, restoration goal-based metrics specific to four commonly cited ecosystem service-based restoration goals are recommended, along with an optional set of seven supplemental ancillary metrics that could provide information useful to the interpretation of prerestoration and postrestoration monitoring data. Widespread adoption of a common set of metrics with standardized techniques and units to assess well-defined goals not only allows practitioners to gauge the performance of their own projects but also allows for comparison among projects, which is both essential to the advancement of the field of oyster restoration and can provide new knowledge about the structure and ecological function of oyster reef ecosystems.

  8. Defining optimal freshwater flow for oyster production: effects of freshet rate and magnitude of change and duration on eastern oysters and Perkinsus marinus infection

    Science.gov (United States)

    LaPeyre, Megan K.; Gossman, B.; La Peyre, Jerome F.

    2009-01-01

    In coastal Louisiana, the development of large-scale freshwater diversion projects has led to controversy over their effects on oyster resources. Using controlled laboratory experiments in combination with a field study, we examined the effects of pulsed freshwater events (freshet) of different magnitude, duration, and rate of change on oyster resources. Laboratory and field evidence indicate that low salinity events (oyster growth was positively correlated with salinity. To maximize oyster production, data indicate that both low and high salinity events will be necessary.

  9. Gulf-Wide Information System, Environmental Sensitivity Index Oyster Leases, Geographic NAD83, LDWF (2001) [esi_oyster_lease_LDWF_2001

    Data.gov (United States)

    Louisiana Geographic Information Center — This data set contains Environmental Sensitivity Index (ESI) oyster leases data of coastal Louisiana. The ESI is a classification and ranking system, which...

  10. Genotoxicity of diuron and glyphosate in oyster spermatozoa and embryos.

    Science.gov (United States)

    Akcha, F; Spagnol, C; Rouxel, J

    2012-01-15

    We investigated the effects of genotoxicant exposure in gametes and embryos to find a possible link between genotoxicity and reproduction/developmental impairment, and explore the impact of chemical genotoxicity on population dynamics. Our study focused on the genotoxic effects of two herbicides on oyster gametes and embryos: glyphosate (both as an active substance and in the Roundup formulation) and diuron. France is Europe's leading consumer of agrochemical substances and as such, contamination of France's coastal waters by pesticides is a major concern. Glyphosate and diuron are among the most frequently detected herbicides in oyster production areas; as oyster is a specie with external reproduction, its gametes and embryos are in direct contact with the surrounding waters and are hence particularly exposed to these potentially dangerous substances. In the course of this study, differences in genotoxic and embryotoxic responses were observed in the various experiments, possibly due to differences in pollutant sensitivity between the tested genitor lots. Glyphosate and Roundup had no effect on oyster development at the concentrations tested, whereas diuron significantly affected embryo-larval development from the lowest tested concentration of 0.05 μg L⁻¹, i.e. an environmentally realistic concentration. Diuron may therefore have a significant impact on oyster recruitment rates in the natural environment. Our spermiotoxicity study revealed none of the tested herbicides to be cytotoxic for oyster spermatozoa. However, the alkaline comet assay showed diuron to have a significant genotoxic effect on oyster spermatozoa at concentrations of 0.05 μg L⁻¹ upwards. Conversely, no effects due to diuron exposure were observed on sperm mitochondrial function or acrosomal membrane integrity. Although our initial results showed no negative effect on sperm function, the possible impact on fertilization rate and the consequences of the transmission of damaged DNA for

  11. Oyster Shell Recycling and Bone Waste Treatment Using Plasma Pyrolysis

    International Nuclear Information System (INIS)

    Chae, Jae Ou; Knak, S P; Knak, A N; Koo, H J; Ravi, V

    2006-01-01

    Investigations on the recycling of oyster shells and bone waste treatment using the plasma pyrolysis technique are presented in this paper. A arc based plasma torch operated at 25 kW was employed for the experiments. Fresh oyster shells were recycled using the plasma torch to convert them to a useful product such as CaO. Bone waste was treated to remove the infectious organic part and to vitrify the inorganic part. The time required for treatment in both cases was significantly short. Significant reduction in the weight of the samples was observed in both cases

  12. Oyster Shell Recycling and Bone Waste Treatment Using Plasma Pyrolysis

    Science.gov (United States)

    Jae, Ou Chae; Knak, S. P.; Knak, A. N.; Koo, H. J.; Ravi, V.

    2006-11-01

    Investigations on the recycling of oyster shells and bone waste treatment using the plasma pyrolysis technique are presented in this paper. A arc based plasma torch operated at 25 kW was employed for the experiments. Fresh oyster shells were recycled using the plasma torch to convert them to a useful product such as CaO. Bone waste was treated to remove the infectious organic part and to vitrify the inorganic part. The time required for treatment in both cases was significantly short. Significant reduction in the weight of the samples was observed in both cases.

  13. Fungal bioremediation of the creosote-contaminated soil: Influence of Pleurotus ostreatus and Irpex lacteus on polycyclic aromatic hydrocarbons removal and soil microbial community composition in the laboratory-scale study

    Czech Academy of Sciences Publication Activity Database

    Byss, Marius; Elhottová, Dana; Tříska, Jan; Baldrian, Petr

    2008-01-01

    Roč. 2008, č. 73 (2008), s. 1518-1523 ISSN 0045-6535 R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z60870520; CEZ:AV0Z60660521; CEZ:AV0Z50200510 Keywords : Wood-rotting basidiomycetes * Soil microbial community * PLFA, PAH Subject RIV: EH - Ecology, Behaviour Impact factor: 3.054, year: 2008

  14. Perbedaan Efek Infusa Bubuk Kedelai (Glycine max, Jamur Tiram (Pleurotus ostreatus, dan Campuran Keduanya terhadap Kadar Kolesterol LDL, Ekspresi Gen Reseptor LDL Hati, dan Berat Omentum Majus Mencit Model Hiperlipidemia

    Directory of Open Access Journals (Sweden)

    Rizky Suganda Prawiradilaga

    2016-07-01

    Full Text Available Abstrak Angka kejadian dislipidemia di Indonesia semakin meningkat. Dislipidemia dan obesitas abdominal merupakan faktor risiko penyakit kardiovaskular. Diperlukan solusi yang efektif dengan bahan alami seperti kedelai dan jamur tiram. Tujuan penelitian ini melihat efektivitas infusa bubuk kedelai, jamur tiram, dan campuran keduanya terhadap kadar kolesterol LDL, ekspresi gen LDLR hati, dan berat omentum majus mencit percobaan. Penelitian eksperimental di Laboratorium Farmakologi RSUP Dr. Hasan Sadikin Bandung tahun 2010 memakai rancangan postes kelompok kontrol. Mencit jantan sebanyak 20 ekor dibagi 5 kelompok perlakuan, yaitu A pakan standar, B induksi kolesterol, C infusa kedelai dengan induksi kolesterol, D infusa jamur tiram dengan induksi kolesterol, dan E infusa campuran dengan induksi kolesterol. Pada akhir penelitian mencit dikorbankan lalu dibedah untuk diambil darah jantung, juga sedikit bagian hati dan omentum majus. Kolesterol LDL darah kelompok E (12±5,48 mg/dL sama dengan kelompok D (12±6,06 mg/dL, tetapi lebih rendah daripada kelompok C (15±5,35 mg/dL dan kelompok B (13,5±5,45 mg/dL, namun tidak signifikan. Didapatkan ekspresi gen LDLR yang sedang pada kelompok A dan C, ekspresi gen LDLR yang lemah pada kelompok B, dan tidak terekspresi pada kelompok D dan E. Berat basah omentum majus kelompok E (0,40±0,07 g lebih rendah bermakna dibanding kelompok A (0,55±0,07 g, B (0,8±0,49 g, C (1,28±0,28 g, D (0,74±0,11 g (p<0,05. Berat kering omentum majus kelompok E (0,16±0,03 g lebih rendah bermakna daripada kelompok B (0,27±0,25 g, C (0,39±0,06 g, dan D (0,31±0,07 g (p=0,025. Simpulan, infusa kedelai 100 mg/hari meningkatkan kadar kolesterol LDL darah dan berat omentum majus, tetapi jamur tiram 75 mg/hari sebaliknya, menurunkan kadar kolesterol LDL darah dan berat omentum majus mencit.

  15. Notes on a New Productive Strain of King Oyster Mushroom, Pleurotus eryngii (Higher Basidiomycetes), a Prized Italian Culinary-Medicinal Mushroom.

    Science.gov (United States)

    Venturella, Giuseppe; Palazzolo, Eristanna; Saiano, Filippo; Gargano, Maria Letizia

    2015-01-01

    In this paper, the authors provide data on a culinary-medicinal, host-specific variety of P. eryngii species-complex that is known in Italy as "cardoncello". A species description, the techniques of isolation of a new strain (C-142-c), and the preparation of the substratum are illustrated. Data on the productivity of substratum inoculated with C-142-c strain and the nutritional value of cultivated "cardoncello" mushrooms are also provided.

  16. In vivo effects of metaldehyde on Pacific oyster, Crassostrea gigas: comparing hemocyte parameters in two oyster families.

    Science.gov (United States)

    Moreau, Pierrick; Burgeot, Thierry; Renault, Tristan

    2015-06-01

    Pollutants via run-off into the ocean represent a potential threat to marine organisms, especially bivalves such as oysters living in coastal environments. These organisms filter large volumes of seawater and may accumulate contaminants within their tissues. Pesticide contamination in water could have a direct or indirect toxic action on tissues or cells and could induce alteration of immune system. Bivalve immunity is mainly supported by hemocytes and participates directly by phagocytosis to eliminate pathogens. Some studies have shown that pesticides can reduce immune defences and/or modify genomes in vertebrates and invertebrates. Metaldehyde is used to kill slugs, snails and other terrestrial gastropods. Although metaldehyde has been detected in surface waters, its effects on marine bivalves including the Pacific oyster, Crassostrea gigas, have never been studied. Given the mode of action of this molecule and its targets (molluscs), it could be potentially more toxic to oysters than other pesticides (herbicides, fungicides, insecticides, etc.). Effects of metaldehyde on oyster hemocyte parameters were thus monitored through in vivo experiments based on a short-term exposure. In this work, metaldehyde at 0.1 μg/L, which corresponds to an average concentration detected in the environment, modulated hemocyte activities of Pacific oysters after an in vivo short-term contact. Individuals belonging to two families showed different behaviours for some hemocyte activities after contamination by metaldehyde. These results suggested that effects of pollutants on oysters may differ from an individual to another in relation to genetic diversity. Finally, it appears essential to take an interest in the effects of metaldehyde on a wide variety of aquatic invertebrates including those that have a significant economic impact.

  17. Flow-sediment-oyster interaction around degraded, restored, and reference oyster reefs in Florida's Indian River Lagoon

    Science.gov (United States)

    Kitsikoudis, V.; Kibler, K. M.; Spiering, D. W.

    2017-12-01

    This study analyzes flow patterns and sediment distributions around three oyster reefs in a bar-built estuarine lagoon. We studied a degraded reef, a recently restored reef, and a reference condition reef with a healthy live oyster community. The restored reef had been regraded and restored with oyster shell mats to aid in recruitment of oyster spat, with the goal of reestablishing a healthy oyster community. Despite the fact that flow-biota-sediment interaction constitutes a blossoming research field, actual field data are sparse and current knowledge emanates from flume studies and numerical modeling. Moreover, the hydraulic effect of restored oyster reefs has not been thoroughly investigated and it is not clear if the flow field and sediment erosion/deposition are similar or diverge from natural reefs. Instantaneous three-dimensional flow velocities were collected on reefs using a Nortek Vectrino Profiler and an acoustic Doppler current profiler (Nortek Aquadopp). The former measured a 2 - 3 cm velocity profile above the oyster bed, while the latter quantified incoming velocities across the flow profile approximately 10 m from the edge of the reef. Flow measurements were conducted during rising tides and are coupled with simultaneous wind speed and direction data. In addition, 20 cm deep sediment cores were retrieved on and off the investigated reefs. Sediment grain size distributions were determined after individual cores were processed for loss on ignition. Incoming flow velocities were as high as 10 cm/s, relatively higher than those recorded close to reefs. Mean and turbulent flow velocities close to the reefs, varied among the investigated sites, despite the similar wind flow conditions offshore. For instance, the measurements at the degraded reef showed decreased wave attenuation and augmented flow velocities compared to the other sites. Boat wakes exhibited a very distinct signal in the flow velocity time-series and significantly increased the approaching

  18. Millennial-scale sustainability of the Chesapeake Bay Native American oyster fishery.

    Science.gov (United States)

    Rick, Torben C; Reeder-Myers, Leslie A; Hofman, Courtney A; Breitburg, Denise; Lockwood, Rowan; Henkes, Gregory; Kellogg, Lisa; Lowery, Darrin; Luckenbach, Mark W; Mann, Roger; Ogburn, Matthew B; Southworth, Melissa; Wah, John; Wesson, James; Hines, Anson H

    2016-06-07

    Estuaries around the world are in a state of decline following decades or more of overfishing, pollution, and climate change. Oysters (Ostreidae), ecosystem engineers in many estuaries, influence water quality, construct habitat, and provide food for humans and wildlife. In North America's Chesapeake Bay, once-thriving eastern oyster (Crassostrea virginica) populations have declined dramatically, making their restoration and conservation extremely challenging. Here we present data on oyster size and human harvest from Chesapeake Bay archaeological sites spanning ∼3,500 y of Native American, colonial, and historical occupation. We compare oysters from archaeological sites with Pleistocene oyster reefs that existed before human harvest, modern oyster reefs, and other records of human oyster harvest from around the world. Native American fisheries were focused on nearshore oysters and were likely harvested at a rate that was sustainable over centuries to millennia, despite changing Holocene climatic conditions and sea-level rise. These data document resilience in oyster populations under long-term Native American harvest, sea-level rise, and climate change; provide context for managing modern oyster fisheries in the Chesapeake Bay and elsewhere around the world; and demonstrate an interdisciplinary approach that can be applied broadly to other fisheries.

  19. Role of dissolved and particulate cadmium in the accumulation of cadmium in cultured oysters (Crassostrea gigas)

    Energy Technology Data Exchange (ETDEWEB)

    Lekhi, Priyanka [Department of Chemistry, University of British Columbia, Vancouver, BC V6T 1Z4 (Canada)], E-mail: anka.lekhi@ubc.ca; Cassis, D. [Department of Earth and Ocean Sciences, University of British Columbia, Vancouver, BC V6T 1Z4 (Canada); Pearce, C.M. [Pacific Biological Station, Fisheries and Oceans Canada, Nanaimo, BC V9T 6N7 (Canada); Ebell, N. [Odyssey Shellfish Ltd., Nanoose Bay, BC V0R 9G0 (Canada); Maldonado, M.T. [Department of Earth and Ocean Sciences, University of British Columbia, Vancouver, BC V6T 1Z4 (Canada); Orians, K.J. [Department of Chemistry, University of British Columbia, Vancouver, BC V6T 1Z4 (Canada); Department of Earth and Ocean Sciences, University of British Columbia, Vancouver, BC V6T 1Z4 (Canada)

    2008-04-15

    Pacific oysters (Crassostrea gigas) collected on the coast of British Columbia, Canada have occasionally shown cadmium (Cd) concentrations at or above 2 {mu}g g{sup -1} (wet weight), which has resulted in the loss of some international markets. This study investigated the source and transfer of Cd to oysters by focusing on the role of dissolved and particulate Cd in seawater. Parameters monitored for 1 year at two oyster farm sites on Vancouver Island included: oyster tissue mass and shell length, Cd in oysters, dissolved Cd, particulate Cd, temperature and salinity. Results show that dissolved Cd was the main source of Cd to the oysters and that Cd was mainly concentrated in the gut tissues. A seasonal trend was observed in Cd in oysters, in which levels were lowest during periods of higher temperatures. Results also indicate that the local oceanographic inputs and sediment diagenesis directly affect dissolved Cd and thereby influence the Cd levels in oysters. Particulate matter was not found to be a source of Cd in oysters, and was actually negatively correlated. This was likely due to the uptake of dissolved Cd by phytoplankton and the effect of phytoplankton on oyster tissue mass.

  20. Effects of High Hydrostatic Pressure on the Physical, Microbial, and Chemical Attributes of Oysters (Crassostrea virginica).

    Science.gov (United States)

    Lingham, Talaysha; Ye, Mu; Chen, Haiqiang; Chintapenta, Lathadevi Karuna; Handy, Eunice; Zhao, Jing; Wu, Changqing; Ozbay, Gulnihal

    2016-05-01

    The change in the quality attributes (physical, microbial, and chemical) of oysters (Crassostrea virginica) after high hydrostatic pressure (HHP) treatment at 300 MPa at room temperature (RT, 25 °C) 300, 450, and 500 MPa at 0 °C for 2 min and control oysters without treatment were evaluated over 3 wk. The texture and tissue yield percentages of oysters HHP treated at 300 MPa, RT increased significantly (P oysters reached the spoilage point of 7 log CFU/g after 15 d. Coliform counts (log MPN/g) were low during storage with total and fecal coliforms less than 3.5 and 1.0. High pressure treated oysters at 500 MPa at 0 °C were significantly higher (P oysters HHP treated at 300 MPa at 0 °C in lipid oxidation values. The highest pressure (500 MPa) treatment in this study, significantly (P oysters at 3 wk was significantly higher (P oysters [300 MPa, (RT); 450 MPa (0 °C); and 500 MPa (0 °C)]. HHP treatments of oysters were not significantly different in pH, percent salt extractable protein (SEP), and total lipid values compared to control. Based on our results, HHP prolongs the physical, microbial, and chemical quality of oysters. © 2016 Institute of Food Technologists®

  1. Role of dissolved and particulate cadmium in the accumulation of cadmium in cultured oysters (Crassostrea gigas)

    International Nuclear Information System (INIS)

    Lekhi, Priyanka; Cassis, D.; Pearce, C.M.; Ebell, N.; Maldonado, M.T.; Orians, K.J.

    2008-01-01

    Pacific oysters (Crassostrea gigas) collected on the coast of British Columbia, Canada have occasionally shown cadmium (Cd) concentrations at or above 2 μg g -1 (wet weight), which has resulted in the loss of some international markets. This study investigated the source and transfer of Cd to oysters by focusing on the role of dissolved and particulate Cd in seawater. Parameters monitored for 1 year at two oyster farm sites on Vancouver Island included: oyster tissue mass and shell length, Cd in oysters, dissolved Cd, particulate Cd, temperature and salinity. Results show that dissolved Cd was the main source of Cd to the oysters and that Cd was mainly concentrated in the gut tissues. A seasonal trend was observed in Cd in oysters, in which levels were lowest during periods of higher temperatures. Results also indicate that the local oceanographic inputs and sediment diagenesis directly affect dissolved Cd and thereby influence the Cd levels in oysters. Particulate matter was not found to be a source of Cd in oysters, and was actually negatively correlated. This was likely due to the uptake of dissolved Cd by phytoplankton and the effect of phytoplankton on oyster tissue mass

  2. DNA-fingerprinting (AFLP and RFLP) for genotypic identification in species of the Pleurotus eryngii complex.

    Science.gov (United States)

    Urbanelli, S; Della Rosa, V; Punelli, F; Porretta, D; Reverberi, M; Fabbri, A A; Fanelli, C

    2007-03-01

    Wild populations of edible species are important source of genetic variability for cultivated lines that can undergo a drastic loss of diversity resulting from man's selection. The development of tools aimed at the clear-cut and safe identification and assessment of genetic variability of the wild and cultivated strains is thus a fundamental goal of molecular genetic research. In this study, we used two polymerase chain reaction (PCR)-based fingerprinting methods-amplified fragment length polymorphism (AFLP) and restriction fragment length polymorphism (RFLP) of laccase and manganese peroxidase genes-to assess genetic differences among strains and independently evolving lineages belonging to the Pleurotus eryngii complex. Both laccase RFLP and AFLP have been proved to distinguish unambiguously the three taxa studied: Pleurotus ferulae, P. eryngii, and P. eryngii var. nebrodensis. AFLP also showed enough sensitivity to detect polymorphisms among the strains, proving to be an efficient DNA fingerprinting tool in studies of strain assignment. The divergent RFLP laccase and manganese peroxidase patterns are also discussed in relation to the role played by these genes in the interaction between these fungi and their host plants.

  3. Performance of selected eastern oyster lines across northeastern US estuaries

    Science.gov (United States)

    Eastern oyster production derived from aquaculture has expanded, but growth potential is constrained by losses to disease. Breeding programs supporting industry in the Northeast have targeted resistance to three diseases: MSX, Dermo, and ROD. Selected lines should possess some level of resistance a...

  4. High pressure processing inactivates human norovirus within oysters

    Science.gov (United States)

    Consumption of raw bivalve mollusks can result in norovirus infection. One potential intervention for virus-contaminated shellfish is high pressure processing (HPP). Currently HPP is known to inactivate Vibrio bacteria, hepatitis A virus, and murine norovirus within oysters. To evaluate the potentia...

  5. Genetic variation in anti-parasite behavior in oysters

    Science.gov (United States)

    Behavioral avoidance of disease-causing parasites provides a first line of defense against the threat of infection, particularly when hosts are exposed to free-living parasite stages in the external environment. We report that suspension-feeding oysters (Crassostrea virginica) respond to the presenc...

  6. Growth and reproductive investment of introduced Pacific oysters

    NARCIS (Netherlands)

    Cardoso, J.F.M.F.; Peralta, N.R.E.; Machado, J.P.; van der Veer, H.W.

    2013-01-01

    Growth and reproductive investment of cultured Pacific oysters Crassostrea gigas were studied in two south-western European estuaries: the Ria de Ribadeo in Spain and the Ria Formosa in Portugal. Developing gonads were found in individuals >23.5 mm shell length in the Ria Formosa and >27.5 mm shell

  7. Length-Weight relationships of mangrove oyster, Crassostrea gasar ...

    African Journals Online (AJOL)

    The length-weight relationships (LWRs) of mangrove oyster, Crassostrea gasar, cultured under continuous and periodic submergence in tidal ponds, for a period of seven months, February to August 2010 were determined. A total of 375 individuals each of pond A (continuous submergence) and B (periodic submergence) ...

  8. Effect of Depuration on Microbial Content of Mangrove Oyster ...

    African Journals Online (AJOL)

    Mangrove oysters and water samples collected from Benya lagoon, located at Elmina in the Central Region of Ghana were investigated for microbial contamination. A total of nine fungal isolates were identified. These were Aspergilus niger, A. sulphurus, species of Penicillium, Rhizopus, Trichoderma, Fusarium, ...

  9. THE USE OF THE MANGROVE OYSTER ( CROSSOSTREA GASAR ...

    African Journals Online (AJOL)

    DR NWAGBOJE

    mangrove oyster (Crossostrea gasar) and water from Golubo creek in the Niger ... did not exceed the Federal Environmental Protection Agency (FEPA) maximum ... the area include farming, local gin production, lumbering and palm wine production. ..... Risk Assessment of Heavy Metals in Ogba River, Benin City, Nigeria.

  10. Removal of Arsenic with Oyster Shell: Experimental Measurements

    Directory of Open Access Journals (Sweden)

    Md. Atiqur Rahman, , and

    2008-12-01

    Full Text Available Oyster shell has tremendous potential as a remediation material for the removal of arsenic from groundwater. A single arsenic removal system was developed with oyster shell for tube well water containing arsenic. The system removes arsenic from water by adsorption through fine oyster shell. Various conditions that affect the adsorption/desorption of arsenic were investigated. Adsorption column methods showed the removal of As(III under the following conditions: initial As concentration, 100 µg /L; oyster shell amount, 6 g; particle size, <355µm ; treatment flow rate, 1.7 mL/min; and pH 6.5. Arsenic concentration of the treated water were below the Bangladesh drinking water standard of 50 µg/L for As. The desorption efficiencies with 2M of KOH after the treatment of groundwater were in the range of 80-83%. A combination of techniques was used to measure the pH, conductivity, cations and anions. The average concentrations of other inorganic constituents of health concern (Na, K, Ca, Mg and Fe in treated water were below their respective WHO guideline for drinking. The present study might provide new avenues to achieve the arsenic concentrations required for drinking water recommended by Bangladesh and the World Health Organization (WHO.

  11. Accumulation of diarrhetic shellfish poisoning toxins in the oyster ...

    African Journals Online (AJOL)

    Diarrhetic shellfish poisoning (DSP) poses a significant threat to the safe consumption of shellfish in the southern Benguela ecosystem. The accumulation of DSP toxins was investigated in two cultivated bivalve species, the Pacific oyster Crassostrea gigas and the mussel Choromytilus meridionalis, suspended from a ...

  12. Biochemical and volatile organic compound profile of European flat oyster (Ostrea edulis) and Pacific cupped oyster (Crassostrea gigas) cultivated in the Eastern Scheldt and Lake Grevelingen, the Netherlands

    NARCIS (Netherlands)

    Houcke, van Jasper; Medina, Isabel; Linssen, Jozef; Luten, Joop

    2016-01-01

    The aim of this study was to evaluate the effect of two important different geographical cultivation areas in the Netherlands (Eastern Scheldt and Lake Grevelingen) on the volatile organic compound (VOC) profile of European flat oyster (Ostrea edulis) and Pacific cupped oyster (Crassostrea

  13. Oysters as biomonitors of the apex barge oil spill

    International Nuclear Information System (INIS)

    Wade, T.L.; Jackson, T.J.; McDonald, T.J.; Wilkinson, D.L.; Brooks, J.M.

    1993-01-01

    The collision of the Greek tanker ship Shinoussa resulted in a spill of an estimated 692,000 gallons of catalytic feed stock oil into Galveston Bay on July 28, 1990. Oysters were collected from Galveston Bay Todds Dump (GBTD) 235 days previous to the spill and 6, 37, 132, and 495 days after the spill. Oysters were also collected from Galveston Bay Redfish Island (GBRI), a site known to be impacted by the spill, 37 and 110 days after the spill. The concentration of the 24 polynuclear aromatic hydrocarbons (PAH) measured for the National Oceanic and Atmospheric Administration's national status and trends program (NS ampersand T) site showed a sharp increase from about 100 ng/g to over 600 ng/g one week after the spill compared to concentrations 235 days previous to the spill. The concentration of the 24 NS ampersand T PAH in oysters from GBRI ranges from 400 to over 1000 ng/g. Soon after the spill the concentration of the 24 NS ampersand T PAH at Todds Dump decreased to levels not statistically different from prespill samples. However, analyses of alkylated and sulfur containing aromatic compounds indicate the oysters were still contaminated with Apex barge oil at least 37 and 110 days after the spill at GBTD and GBRI, respectively. Data from NS ampersand T sampling at GBTD more than a year after the spill (495 days) indicates the presence of alkylated aromatic hydrocarbons that may be from Apex barge oil still in the area. It appears that a sink of Apex barge oil (i.e., in sediments) may periodically be released by storms or other events into the ecosystem near GBTD. Therefore, bioavailable Apex barge oil is still present and may adversely affect oysters 495 days after the spill

  14. Biochemical profile of oyster Crassostrea madrasensis and its nutritional attributes

    Directory of Open Access Journals (Sweden)

    K.K. Asha

    2014-01-01

    Full Text Available Oysters are highly esteemed sea food and considered a delicacy throughout the world. Yet this resource is not optimally utilised in several parts of the world. The aim of this study is to highlight its nutritional importance. Biochemical composition and nutritional attributes of oyster meat are discussed. Proximate composition, fatty acid and amino acid profiles and mineral content were determined in oysters (Crassostrea madrasensis. Moisture, protein, fat, carbohydrate and ash contents in the oyster were 82.64%, 9.41%, 3.25% 3.2% and 1.01%, respectively and it was rich in macro-minerals and trace elements especially selenium. Polyunsaturated fatty acids (PUFA were highest of the total lipids among which eicosapentaenoic acid, docosahexaenoic acid and linoleic acid were the prominent fatty acids. The n-3/n-6 index was high indicating a predominance of n-3 fatty acids in the species. Total amino acid content was 99.33 g/100 g crude protein, of which, essential amino acid lysine was the most abundant. Valine had the lowest essential amino acid score (EAAS (0.17 while threonine had the highest EAAS of 3.62. Chemical score was 17% and the lowest limiting amino acid was valine. Protein efficiency ratio, essential amino acid index and biological value of oyster were 3.92, 120.2 and 174.0, respectively which indicates that the protein is of superior quality. Data on biochemical composition, nutritional attributes and quality indices of C. madrasensis protein may prove important for future policies regarding exploitation of this species and for inducing favourable changes in consumer preferences.

  15. Latitudinal gradients in ecosystem engineering by oysters vary across habitats.

    Science.gov (United States)

    McAfee, Dominic; Cole, Victoria J; Bishop, Melanie J

    2016-04-01

    Ecological theory predicts that positive interactions among organisms will increase across gradients of increasing abiotic stress or consumer pressure. This theory has been supported by empirical studies examining the magnitude of ecosystem engineering across environmental gradients and between habitat settings at local scale. Predictions that habitat setting, by modifying both biotic and abiotic factors, will determine large-scale gradients in ecosystem engineering have not been tested, however. A combination of manipulative experiments and field surveys assessed whether along the east Australian coastline: (1) facilitation of invertebrates by the oyster Saccostrea glomerata increased across a latitudinal gradient in temperature; and (2) the magnitude of this effect varied between intertidal rocky shores and mangrove forests. It was expected that on rocky shores, where oysters are the primary ecosystem engineer, they would play a greater role in ameliorating latitudinal gradients in temperature than in mangroves, where they are a secondary ecosystem engineer living under the mangrove canopy. On rocky shores, the enhancement of invertebrate abundance in oysters as compared to bare microhabitat decreased with latitude, as the maximum temperatures experienced by intertidal organisms diminished. By contrast, in mangrove forests, where the mangrove canopy resulted in maximum temperatures that were cooler and of greater humidity than on rocky shores, we found no evidence of latitudinal gradients of oyster effects on invertebrate abundance. Contrary to predictions, the magnitude by which oysters enhanced biodiversity was in many instances similar between mangroves and rocky shores. Whether habitat-context modifies patterns of spatial variation in the effects of ecosystem engineers on community structure will depend, in part, on the extent to which the environmental amelioration provided by an ecosystem engineer replicates that of other co-occurring ecosystem engineers.

  16. Experimental infection of Pacific oyster Crassostrea gigas spat by ostreid herpesvirus 1: demonstration of oyster spat susceptibility

    Directory of Open Access Journals (Sweden)

    Schikorski David

    2011-02-01

    Full Text Available Abstract In 2008 and 2009, acute mortalities occurred in France among Pacific cupped oyster, Crassostrea gigas, spat. Different hypothesis including the implication of environmental factors, toxic algae and/or pathogens have been explored. Diagnostic tests indicated that OsHV-1 including a particular genotype, termed OsHV-1 μVar, was detected in most of samples and especially in moribund oysters with the highlighting of virus particles looking like herpes viruses by TEM examination. In this study, an experimental protocol to reproduce OsHV-1 infection in laboratory conditions was developed. This protocol was based on the intramuscular injection of filtered (0.22 μm tissue homogenates prepared from naturally OsHV-1 infected spat collected on French coasts during mortality outbreaks in 2008. Results of the experimental trials showed that mortalities were induced after injection. Moreover, filtered tissue homogenates induced mortalities whereas the same tissue homogenates exposed to an ultraviolet (UV treatment did not induce any mortality suggesting that oyster spat mortalities require the presence of a UV sensitive agent. Furthermore, analysis of injected oyster spat revealed the detection of high amounts of OsHV-1 DNA by real-time quantitative PCR. Finally, TEM analysis demonstrated the presence of herpes virus particles. The developed protocol allowed to maintain sources of infective virus which can be useful for the development of further studies concerning the transmission and the development of OsHV-1 infection.

  17. Oil palm empty fruit bunch as media for mushroom cultivation

    International Nuclear Information System (INIS)

    Mat Rasol Awang; Wan Badrin Wan Husin; Tajuddin Osman; Tamikazu Kume; Shinpei Matsuhashi

    1998-01-01

    The mushroom strains Pleurotus sajor caju(grey oyster mushroom), Pleurotus flavellatus((pink oyster mushroom), Pleurotus cystidiosus(abalone mushroom) and Auricularia polytricha (black jelly mushroom) grow satisfactorily on the EFB media treated with lime. Based on their Biological Efficiency (BE) or yield, the strain Pleurotus sajor caju was selected for further investigation. The BE of the Pleurotus sajor caju was 73.8 %. The lime treatment, aeration and four weeks incubation period was necessary for fruiting

  18. Ocean acidification increases the vulnerability of native oysters to predation by invasive snails.

    Science.gov (United States)

    Sanford, Eric; Gaylord, Brian; Hettinger, Annaliese; Lenz, Elizabeth A; Meyer, Kirstin; Hill, Tessa M

    2014-03-07

    There is growing concern that global environmental change might exacerbate the ecological impacts of invasive species by increasing their per capita effects on native species. However, the mechanisms underlying such shifts in interaction strength are poorly understood. Here, we test whether ocean acidification, driven by elevated seawater pCO₂, increases the susceptibility of native Olympia oysters to predation by invasive snails. Oysters raised under elevated pCO₂ experienced a 20% increase in drilling predation. When presented alongside control oysters in a choice experiment, 48% more high-CO₂ oysters were consumed. The invasive snails were tolerant of elevated CO₂ with no change in feeding behaviour. Oysters raised under acidified conditions did not have thinner shells, but were 29-40% smaller than control oysters, and these smaller individuals were consumed at disproportionately greater rates. Reduction in prey size is a common response to environmental stress that may drive increasing per capita effects of stress-tolerant invasive predators.

  19. Influence of eutrophication on metal bioaccumulation and oral bioavailability in oysters, Crassostrea angulata.

    Science.gov (United States)

    Li, Shun-Xing; Chen, Li-Hui; Zheng, Feng-Ying; Huang, Xu-Guang

    2014-07-23

    Oysters (Crassostrea angulata) are often exposed to eutrophication. However, how these exposures influence metal bioaccumulation and oral bioavailability (OBA) in oysters is unknown. After a four month field experimental cultivation, bioaccumulation factors (BAF) of metals (Fe, Cu, As, Cd, and Pb) from seawater to oysters and metal oral bioavailability in oysters by bionic gastrointestinal tract were determined. A positive effect of macronutrient (nitrate N and total P) concentration in seawater on BAF of Cd in oysters was observed, but such an effect was not significant for Fe, Cu, Pb, and As. Only OBA of As was significantly positively correlated to N and P contents. For Fe, OBA was negatively correlated with N. The regular variation of the OBA of Fe and As may be due to the effect of eutrophication on the synthesis of metal granules and heat-stable protein in oysters, respectively.

  20. A comparative proteomic study on the effects of metal pollution in oysters Crassostrea hongkongensis.

    Science.gov (United States)

    Xu, Lanlan; Ji, Chenglong; Wu, Huifeng; Tan, Qiaoguo; Wang, Wen-Xiong

    2016-11-15

    The metal pollution has posed great risk on the coastal organisms along the Jiulongjiang Estuary in South China. In this work, two-dimensional electrophoresis-based proteomics was applied to the oysters Crassostrea hongkongensis from metal pollution sites to characterize the proteomic responses to metal pollution. Metal accumulation and proteomic responses indicated that the oysters from BJ site were more severely contaminated than those from FG site. Compared with those oyster samples from the clean site (JZ), metal pollution induced cellular injuries, oxidative and immune stresses in oyster heapatopancreas from both BJ and FG sites via differential metabolic pathways. In addition, metal pollution in BJ site induced disturbance in energy and lipid metabolisms in oysters. Results indicated that cathepsin L and ferritin GF1 might be the biomarkers of As and Fe in oyster C. hongkongensis, respectively. This study demonstrates that proteomics is a useful tool for investigating biological effects induced by metal pollution. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Detection, quantification and genotyping of noroviruses in oysters implicated in disease outbreaks

    DEFF Research Database (Denmark)

    Haefeli, Deborah; Gantenbein-Demarchi, Corinne; Böttiger, Blenda

    2012-01-01

    . While GI and GII have often been verified as causative agents of oyster-transmitted illness, GIV is rarely detected and has so far not been confirmed in outbreaks related to oysters. The aim of this study was to determine whether NoVs from oysters implicated in a disease outbreak were linked to the GI......Noroviruses (NoVs) are a major cause of foodborne outbreaks of acute gastroenteritis in humans. Transmission of NoV is commonly linked to the consumption of oysters as they accumulate viruses through filter feeding in faecal-contaminated water. The NoV genogroups (G)I, GII and GIV infect humans...

  2. Exploring spatial and temporal variations of cadmium concentrations in pacific oysters from british columbia.

    Science.gov (United States)

    Feng, Cindy Xin; Cao, Jiguo; Bendell, Leah

    2011-09-01

    Oysters from the Pacific Northwest coast of British Columbia, Canada, contain high levels of cadmium, in some cases exceeding some international food safety guidelines. A primary goal of this article is the investigation of the spatial and temporal variation in cadmium concentrations for oysters sampled from coastal British Columbia. Such information is important so that recommendations can be made as to where and when oysters can be cultured such that accumulation of cadmium within these oysters is minimized. Some modern statistical methods are applied to achieve this goal, including monotone spline smoothing, functional principal component analysis, and semi-parametric additive modeling. Oyster growth rates are estimated as the first derivatives of the monotone smoothing growth curves. Some important patterns in cadmium accumulation by oysters are observed. For example, most inland regions tend to have a higher level of cadmium concentration than most coastal regions, so more caution needs to be taken for shellfish aquaculture practices occurring in the inland regions. The semi-parametric additive modeling shows that oyster cadmium concentration decreases with oyster length, and oysters sampled at 7 m have higher average cadmium concentration than those sampled at 1 m. © 2010, The International Biometric Society.

  3. Investigations of Salmonella enterica serovar newport infections of oysters by using immunohistochemistry and knockout mutagenesis.

    Science.gov (United States)

    Morrison, Christopher M; Dial, Sharon M; Day, William A; Joens, Lynn A

    2012-04-01

    The consumption of raw oysters is an important risk factor in the acquisition of food-borne disease, with Salmonella being one of a number of pathogens that have been found in market oysters. Previous work by our lab found that Salmonella was capable of surviving in oysters for over 2 months under laboratory conditions, and this study sought to further investigate Salmonella's tissue affinity and mechanism of persistence within the oysters. Immunohistochemistry was used to show that Salmonella was capable of breaching the epithelial barriers, infecting the deeper connective tissues of the oysters, and evading destruction by the oysters' phagocytic hemocytes. To further investigate the mechanism of these infections, genes vital to the function of Salmonella's two main type III secretion systems were disrupted and the survivability of these knockout mutants within oysters was assayed. When the Salmonella pathogenicity island 1 and 2 mutant strains were exposed to oysters, there were no detectable deficiencies in their abilities to survive, suggesting that Salmonella's long-term infection of oysters does not rely upon these two important pathogenicity islands and must be due to some other, currently unknown, mechanism.

  4. Sediment quality guidelines for copper and zinc for filter-feeding estuarine oysters?

    Energy Technology Data Exchange (ETDEWEB)

    Birch, G.F., E-mail: gavin.birch@sydney.edu.a [Environmental Geology Group, School of Geosciences, Sydney University, NSW (Australia); Hogg, T.D. [Environmental Geology Group, School of Geosciences, Sydney University, NSW (Australia)

    2011-01-15

    Sediment quality guidelines (SQGs) assess the ability of bottom sediment to sustain healthy infauna and water quality guidelines (WQGs) provide protection for a designated percentage of aquatic species. Filter-feeding marine species, e.g. oysters and mussels, acquire food from particles in the water column and protection of these animals is not provided by SQGs or WQGs. The current work investigated the relationship between metal (Cu, Zn) concentrations in total and fine-fraction (<62.5 {mu}m) surficial sediment digested in a range of acids and chelating agents and oyster tissue metal concentrations. A strong correlation between oyster tissue Cu and Zn concentrations and fine-fraction surficial sediment digested in 1 M HCl provided a sedimentary guideline which predicted tissue metal concentrations in oysters and established a level (<45 {mu}g g{sup -1} and <1000 {mu}g g{sup -1}, respectively) for protecting oysters from exceeding human consumption levels (70 {mu}g g{sup -1} and 1000 {mu}g g{sup -1}, respectively). - A strong correlation between oyster tissue Cu and Zn concentrations and fine-fraction surficial sediment digested in 1 M HCl provided a sedimentary guideline which predicted tissue metal concentrations in oysters and established a level for protecting oysters from exceeding human consumption levels for these metals. The guidelines for fine surficial sediment developed in the present work accurately predicted oyster tissue concentrations in the field.

  5. Inhibition of 4NQO-Induced Oral Carcinogenesis by Dietary Oyster Shell Calcium.

    Science.gov (United States)

    Chen, Ying; Jiang, Yi; Liao, Liyan; Zhu, Xiaoxin; Tang, Shengan; Yang, Qing; Sun, Lihua; Li, Yujie; Gao, Shuangrong; Xie, Zhongjian

    2016-03-01

    Oyster has gained much attention recently for its anticancer activity but it is unclear whether calcium, the major antitumor ingredient in oyster shell, is responsible for the anticarcinogenic role of the oyster. To address this issue, C57BL/6 mice were fed with the carcinogen 4-nitroquinoline-1-oxide (4NQO, 50 µg/mL) and normal diet or a diet containing oyster powder, oyster calcium, or calcium depleted oyster powder. The tongue tissue specimens isolated from these mice were histologically evaluated for hyperplasia, dysplasia, and papillary lesions, and then analyzed for proliferation and differentiation markers by immunohistochemistry. The results showed that mice on the diet containing oyster calcium significantly reduced rates of tumors in the tongue and proliferation and enhanced differentiation in the oral epithelium compared with the diet containing calcium depleted oyster powder. These results suggest that calcium in oyster plays a critical role in suppressing formation of oral squamous cell carcinoma and proliferation and promoting differentiation of the oral epithelium. © The Author(s) 2015.

  6. Rapid detection of toxic metals in non-crushed oyster shells by portable X-ray fluorescence spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Chou Ju, E-mail: Ju.Chou@selu.ed [Department of Chemistry and Physics, Southeastern Louisiana University, Hammond, LA 70402 (United States); Clement, Garret; Bursavich, Bradley; Elbers, Don [Department of Chemistry and Physics, Southeastern Louisiana University, Hammond, LA 70402 (United States); Cao Baobao; Zhou Weilie [Advanced Material Research Institute, University of New Orleans, New Orleans, LA 70148 (United States)

    2010-06-15

    The aim of this study was the multi-elemental detection of toxic metals such as lead (Pb) in non-crushed oyster shells by using a portable X-ray fluorescence (XRF) spectrometer. A rapid, simultaneous multi-element analytical methodology for non-crushed oyster shells has been developed using a portable XRF which provides a quick, quantitative, non-destructive, and cost-effective mean for assessment of oyster shell contamination from Pb. Pb contamination in oyster shells was further confirmed by scanning electron microscopy with energy dispersive spectroscopy (SEM-EDS). The results indicated that Pb is distributed in-homogeneously in contaminated shells. Oyster shells have a lamellar structure that could contribute to the high accumulation of Pb on oyster shells. - A rapid, simultaneous multi-element analytical methodology for non-crushed oyster shells has been developed using XRF and contamination of lead on oyster shells was confirmed by XRF and SEM-EDS.

  7. Rapid detection of toxic metals in non-crushed oyster shells by portable X-ray fluorescence spectrometry

    International Nuclear Information System (INIS)

    Chou Ju; Clement, Garret; Bursavich, Bradley; Elbers, Don; Cao Baobao; Zhou Weilie

    2010-01-01

    The aim of this study was the multi-elemental detection of toxic metals such as lead (Pb) in non-crushed oyster shells by using a portable X-ray fluorescence (XRF) spectrometer. A rapid, simultaneous multi-element analytical methodology for non-crushed oyster shells has been developed using a portable XRF which provides a quick, quantitative, non-destructive, and cost-effective mean for assessment of oyster shell contamination from Pb. Pb contamination in oyster shells was further confirmed by scanning electron microscopy with energy dispersive spectroscopy (SEM-EDS). The results indicated that Pb is distributed in-homogeneously in contaminated shells. Oyster shells have a lamellar structure that could contribute to the high accumulation of Pb on oyster shells. - A rapid, simultaneous multi-element analytical methodology for non-crushed oyster shells has been developed using XRF and contamination of lead on oyster shells was confirmed by XRF and SEM-EDS.

  8. COMPARISON OF CARBON AND NITROGEN FLUXES IN TIDEFLAT FOOD WEBS DOMINATED BY BURROWING SHRIMP OR BY CULTURED OYSTERS

    Science.gov (United States)

    Two species of indigenous, thalassinid burrowing shrimps are pests to the benthic culture of Pacific oysters (Crassostrea gigas) because deposition of sediment excavated by the shrimps buries or smothers the oysters. Carbaryl pesticide is used to reduce burrowing shrimp densitie...

  9. Combined remediation of Cd-phenanthrene co-contaminated soil by Pleurotus cornucopiae and Bacillus thuringiensis FQ1 and the antioxidant responses in Pleurotus cornucopiae.

    Science.gov (United States)

    Jiang, Juan; Liu, Hongying; Li, Qiao; Gao, Ni; Yao, Yuan; Xu, Heng

    2015-10-01

    Remediation of soil co-contaminated with heavy metals and PAHs by mushroom and bacteria is a novel technique. In this study, the combined remediation effect of mushroom (Pleurotus cornucopiae) and bacteria (FQ1, Bacillus thuringiensis) on Cd and phenanthrene co-contaminated soil was investigated. The effect of bacteria (B. thuringiensis) on mushroom growth, Cd accumulation, phenanthrene degradation by P. cornucopiae and antioxidative responses of P. cornucopiae were studied. P. cornucopiae could adapt easily and grow well in Cd-phenanthrene co-contaminated soil. It was found that inoculation of FQ1 enhanced mushroom growth (biomass) and Cd accumulation with the increment of 26.68-43.58% and 14.29-97.67% respectively. Up to 100% and 95.07% of phenanthrene were removed in the bacteria-mushroom (B+M) treatment respectively spiked with 200mg/kg and 500mg/kg phenanthrene. In addition, bacterial inoculation alleviated oxidative stress caused by co-contamination with relative decreases in lipid peroxidation and enzyme activity, including malondialdehyde (MDA), superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD). This study demonstrated that the integrated remediation strategy of bacteria and mushroom is an effective and promising method for Cd-phenanthrene co-contaminated soil bioremediation. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Effect of some heavy metals on the growth and development of Pleurotus tuber-regium.

    Directory of Open Access Journals (Sweden)

    Akpaja EO

    2012-02-01

    Full Text Available The effects of five heavy metals (cadmium, copper, mercury, lead and zinc on the growth and fruit body production in Pleurotus tuber-regium was investigated. Lead sulphate, zinc sulphate, copper sulphate, cadmium nitrate and mercury chloride were added to garden soil at concentrations of 0, 0.125, 0.25, 0.5, 1.0, and 2.0 mmol per 3 kg of soil. Sclerotia of the test mushroom were used to inoculate the artificially contaminated soil. Mercury prevented growth and fruit body production in P. tuber-regium. Fungal morphometry was greatly affected by lead. The heavy metal content in the fungal biomass complex increased with increase of heavy metal concentration in the soil. The highest concentration (183.06 mg/kg was found in zinc at 2 mmol/L.

  11. Protoplast preparation from monokaryotic mycelium of Pleurotus sajor-caju using lysing enzyme

    International Nuclear Information System (INIS)

    Hassan Hamdani Mutaat; Mat Rasol Awang

    2004-01-01

    The objective of this study was to determine the optimum parameters of the factors influencing protoplast isolation from monokaryotic mycelium of Pleurotus sajor-caju using lysing enzyme from Trichoderma harzianurm. The study was conducted by manipulating the variables of the factors affecting protoplast isolation, such as age of mycelium culture, period for lysing of mycelium, concentration of lysing enzyme and concentration of osmotic stabilizer. The highest protoplast yield of 8.3 x 104 protoplast/ml was achieved when a 3-day P. sajor-caju mycelium, cultured statically, was incubated for 3 hours in a lytic mixture containing 7.5 mg/ml lysing enzyme and 1.2 M ammonium sulfate as osmotic stabilizer. This protoplast yield, however, is insufficient for regeneration and protoplast fusion works. (Author)

  12. Biomass production of pleurotus sajor-caju by submerged culture fermentation

    International Nuclear Information System (INIS)

    Kausar, T.; Nasreen, Z.; Nadeem, M.; Baig, S.

    2006-01-01

    The effect of different carbon sources, namely, sawdust and powder of agro wastes (as such, or water soluble extracts), and inorganic/natural nitrogen sources on the biomass production of Pleurotus sajor-caju by submerged culture fermentation was studied. Supplementation of the fermentation medium with 2% molasses, 2% wheat spike powder, extract of 2% wheat spike powder, and com gluten meal resulted in 12.85, 10.85, 12.35 and 13.92 g/sub l/ biomass production of P. sajor-caju, respectively. The fungal hyphae biomass contained 8.28% moisture, 21.18% crude protein, 1.55% fat, 3.59% ash, 2.32% crude fibre, and 63.48% nitrogen-free extract. (author)

  13. Isolation and characterization of wild-type lipoxygenase LOX(Psa)1 from Pleurotus sapidus.

    Science.gov (United States)

    Plagemann, Ina; Krings, Ulrich; Berger, Ralf G

    2014-01-01

    The lipoxygenase LOX(Psa) 1 of Pleurotus sapidus, originally investigated because of its ability to oxidize (+)-valencene to the valuable grapefruit aroma (+)-nootkatone, was isolated from the peptidase-rich lyophilisate using a three-step purification scheme including preparative isoelectric focusing and chromatographic techniques. Nano-liquid chromatography electrospray ionization tandem mass spectrometry (nLC-ESI-MS/MS) of the purified enzyme and peptide mass fingerprint analysis gave 38 peptides of the lipoxygenase from P. sapidus. Nearly 50% of the 643 amino acids long sequence encoded by the cDNA was covered. Both terminal peptides of the native LOX(Psa) 1 were identified by de novo sequencing, and the postulated molecular mass of 72.5 kDa was confirmed. With linoleic acid as the substrate, the LOX(Psa)1 showed a specific activity of 113 U mg(-1) and maximal activity at pH 7.0 and 30 degrees C, respectively.

  14. Morphology and mycelial growth rate of Pleurotus spp. strains from the Mexican mixtec region

    Science.gov (United States)

    Guadarrama-Mendoza, P.C.; del Toro, G. Valencia; Ramírez-Carrillo, R.; Robles-Martínez, F.; Yáñez-Fernández, J.; Garín-Aguilar, M.E.; Hernández, C.G.; Bravo-Villa, G.

    2014-01-01

    Two native Pleurotus spp. strains (white LB-050 and pale pink LB-051) were isolated from rotten tree trunks of cazahuate (Ipomoea murucoides) from the Mexican Mixtec Region. Both strains were chemically dedikaryotized to obtain their symmetrical monokaryotic components (neohaplonts). This was achieved employing homogenization time periods from 60 to 65 s, and 3 day incubation at 28 °C in a peptone-glucose solution (PGS). Pairing of compatible neohaplonts resulted in 56 hybrid strains which were classified into the four following hybrid types: (R1-nxB1-n, R1-nxB2-1, R2-nxB1-n and R2-nxB2-1). The mycelial growth of Pleurotus spp. monokaryotic and dikaryotic strains showed differences in texture (cottony or floccose), growth (scarce, regular or abundant), density (high, regular or low), and pigmentation (off-white, white or pale pink). To determine the rate and the amount of mycelium growth in malt extract agar at 28 °C, the diameter of the colony was measured every 24 h until the Petri dish was completely colonized. A linear model had the best fit to the mycelial growth kinetics. A direct relationship between mycelial morphology and growth rate was observed. Cottony mycelium presented significantly higher growth rates (p < 0.01) in comparison with floccose mycelium. Thus, mycelial morphology can be used as criterion to select which pairs must be used for optimizing compatible-mating studies. Hybrids resulting from cottony neohaplonts maintained the characteristically high growth rates of their parental strains with the hybrid R1-nxB1-n being faster than the latter. PMID:25477920

  15. EFFECT OF USING VARIOUS SUBSTRATES ON CULTIVATION OF PLEUROTUS SAJOR-CAJU

    Directory of Open Access Journals (Sweden)

    S. N. FASEHAH

    2017-04-01

    Full Text Available The unmanageable agricultural waste comprises of structural polymers, cellulose, hemicellulose and lignin can be led to pollutions, thus it can be used as a mushroom substrate. Lignocellulosic materials are most favorable feedstock as renewable and natural resource. Forestry and agricultural practices generated a large amount of ligncelluosic waste and promoted to serious problematic environmental pollution. It can be easily broken down by lignocellulotic enzymes. In this study, an attempt was made to evaluate the effect of various substrates on cultivation of Pleurotus sajor-caju. The substrates used in this study were tissue paper, rice husk ash and rubber sawdust. All of the substrates were added with rice bran and calcium carbonate (CaCO3. Then, the mixtures were transferred into plastic sized 8 cm × 4.5 cm and were pasteurized in the steamer for 1 hour at60 °C - 100 °C. After that they were cooled overnight at 25 °C - 30 °C. The spawn were inoculated into the bag and incubated in incubation room. The media bags were incubated until mycelium fully colonized and watering was done twice a day. The parameters studies were included spawn running, number of fruit body, total of stipe length, weight of fruit body and biological efficiency. Results showed that the fastest spawn running and highest number of fruits body, total of stipe length, weight of fruit body and biological efficiency are found using tissue paper substrates. In contrast the rubber sawdust showed the lowest values of spawn running, total of stipe length, weight of fruit body and biological efficiency. It can be concluded that the tissue paper is one of promising substrate which can be used in growing of Pleurotus sajor-caju due to lower cost and easy to purchase as compared to other substrates.

  16. [Use of ITS and ISSR markers in the molecular characterisation of Pleurotus djamor hybrid strains].

    Science.gov (United States)

    Aguilar Doroteo, Leticia; Zárate Segura, Paola Berenice; Villanueva Arce, Ramón; Yáñez Fernández, Jorge; Garín Aguilar, María Eugenia; Guadarrama Mendoza, Paula Cecilia; Valencia Del Toro, Gustavo

    Molecular characterisation of wild type Pleurotus species is important for germplasm conservation and its further use for genetic improvement. No molecular studies have been performed with monokaryons used for producing hybrid strains, either with the reconstituted strains obtained by pairing those monokaryons. The molecular characterisation of parental dikaryons, hybrid, and reconstituted strains as well as monokaryotic strains, is therefore of utmost importance. To carry out the molecular identification of Pleurotus djamor strains, i.e. dikaryotic wild type strains, hybrid strains, and the monokaryotic strains used for the hybrid formation. Five wild type strains of P. djamor from different states in Mexico were collected and molecularly identified by sequencing the ITS1-5.8-ITS2 region using ITS1 and ITS4 universal oligonucleotides. Four hybrid strains were obtained by pairing neohaplonts of two wild type strains selected. Six ISSR markers were used for the molecular characterisation of monokaryotic and dikaryotic strains. Using the ITS markers, an amplified product of 700bp was obtained in five wild type strains, with a 99-100% similarity with P. djamor. A total of 95 fragments were obtained using the ISSR markers, with 99% of polymorphism. Wild type strains were identified as P. djamor, and were clearly grouped with Mexican strains from other states of Mexico. ISSR markers allowed the generation of polymorphic bands in monokaryotic and dikaryotic strains, splitting both types of strains. The high degree of polymorphism indicates the genetic diversity of P. djamor, an advantage in mushroom production and in the improving of the species. Copyright © 2017 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.

  17. Multibiomarker assessment of three Brazilian estuaries using oysters as bioindicators

    International Nuclear Information System (INIS)

    Valdez Domingos, F.X.; Azevedo, M.; Silva, M.D.; Randi, M.A.F.; Freire, C.A.; Silva de Assis, H.C.; Oliveira Ribeiro, C.A.

    2007-01-01

    Oysters have been largely employed as bioindicators of environmental quality in biomonitoring studies. Crassostrea rhizophorae was selected to evaluate the health status of three estuarine areas impacted by anthropogenic activities along the Brazilian coast, in three estuarine complexes, ranging in latitude from 7 to 25 deg. S. In each estuary three sites were sampled in Winter and in Summer: a site considered as reference, and two sites next to contamination sources. Condition index was similar at all sites and estuaries, with the highest values found for Itamaraca oysters in Summer. Necrosis, hyperplasia, mucocyte hypertrophy and fusion of ordinary filaments were the main histopathological lesions observed. Muscle cholinesterase activity was overall similar, but with a strong seasonal effect. Inhibition or activation of branchial total ATPase and Na,K-ATPase activities at the contaminated sites was observed. The health status of these estuarine areas is quite similar, and the combined use of biomarkers is recommended

  18. Plesiomonas shigelloides Periprosthetic Knee Infection After Consumption of Raw Oysters.

    Science.gov (United States)

    Hustedt, Joshua W; Ahmed, Sarim

    Periprosthetic infections are a leading cause of morbidity after total joint arthroplasty. Common pathogens include Staphylococcus aureus, streptococcus, enterococcus, Escherichia coli, and Pseudomonas aeruginosa. However, there are many cases in which rare bacteria are isolated. This case report describes a periprosthetic knee infection caused by Plesiomonas shigelloides. In the United States, P shigelloides and 2 other Vibrionaceae family members, Vibrio vulnificus and Vibrio parahaemolyticus, are most often contracted from eating raw oysters and shellfish. P shigelloides usually causes a self-limiting watery diarrhea, but in immunosuppressed people it can cause septicemia. In this case report, a chemically and biologically immunosuppressed man consumed raw oysters and developed P shigelloides septicemia and acute periprosthetic knee infection that required surgical intervention.

  19. Retran simulation of Oyster Creek generator trip startup test

    International Nuclear Information System (INIS)

    Alammar, M.A.

    1987-01-01

    RETRAN simulation of Oyster Creek generator trip startup test was carried out as part of Oyster Creek RETRAN model qualification program for reload licensing applications. The objective of the simulation was to qualify the turbine model and its interface with the control valve and bypass systems under severe transients. The test was carried out by opening the main breakers at rated power. The turbine speed governor closed the control valves and the pressure regulator opened the bypass valves within 0.5 sec. The stop valves closed by a no-load turbine trip, before the 10 percent overspeed trip was reached and the reactor scrammed on high APRM neutron flux. The simulation resulted in qualifying a normalized hydraulic torque for the turbine model and a 0.3 sec, delay block for the bypass model to account for the different delays in the hydraulic linkages present in the system. One-dimensional kinetics was used in this simulation

  20. Multiple enzymatic profiles of Vibrio parahaemolyticus strains isolated from oysters

    Directory of Open Access Journals (Sweden)

    Renata Albuquerque Costa

    Full Text Available The enzymatic characterization of vibrios has been used as a virulence indicator of sanitary interest. The objective of this study was to determine the enzymatic profile of Vibrio parahaemolyticus strains (n = 70 isolated from Crassostrea rhizophorae oysters. The strains were examined for the presence of gelatinase (GEL, caseinase (CAS, elastase (ELAS, phospholipase (PHOS, lipase (LIP, amilase (AML and DNase. All enzymes, except elastase, were detected in more than 60% of the strains. The most recurrent enzymatic profiles were AML + DNase + PHOS + GEL + LIP (n = 16; 22.9% and AML + CAS + DNase + PHOS + GEL + LIP (n = 21; 30%. Considering the fact that exoenzyme production by vibrios is closely related to virulence, one must be aware of the bacteriological risk posed to human health by the consumption of raw or undercooked oysters.

  1. Factors affecting the uptake and retention of Vibrio vulnificus in oysters.

    Science.gov (United States)

    Froelich, Brett A; Noble, Rachel T

    2014-12-01

    Vibrio vulnificus, a bacterium ubiquitous in oysters and coastal water, is capable of causing ailments ranging from gastroenteritis to grievous wound infections or septicemia. The uptake of these bacteria into oysters is often examined in vitro by placing oysters in seawater amended with V. vulnificus. Multiple teams have obtained similar results in studies where laboratory-grown bacteria were observed to be rapidly taken up by oysters but quickly eliminated. This technique, along with suggested modifications, is reviewed here. In contrast, the natural microflora within oysters is notoriously difficult to eliminate via depuration. The reason for the transiency of exogenous bacteria is that those bacteria are competitively excluded by the oyster's preexisting microflora. Evidence of this phenomenon is shown using in vitro oyster studies and a multiyear in situ case study. Depuration of the endogenous oyster bacteria occurs naturally and can also be artificially induced, but both of these events require extreme conditions, natural or otherwise, as explained here. Finally, the "viable but nonculturable" (VBNC) state of Vibrio is discussed. This bacterial torpor can easily be confused with a reduction in bacterial abundance, as bacteria in this state fail to grow on culture media. Thus, oysters collected from colder months may appear to be relatively free of Vibrio but in reality harbor VBNC cells that respond to exogenous bacteria and prevent colonization of oyster matrices. Bacterial-uptake experiments combined with studies involving cell-free spent media are detailed that demonstrate this occurrence, which could explain why the microbial community in oysters does not always mirror that of the surrounding water. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  2. The biofilteration ability of oysters (Crassostrea gigas) to reduce Aeromonas salmonicida in salmon culture.

    Science.gov (United States)

    Ma, Xiaona; Li, Xian; Sun, Guoxiang; Sharawy, Zaki Zaki; Qiu, Tianlong; Du, Yishuai; Liu, Ying

    2017-07-01

    Pathogen contamination in the environment is inevitable with the rapid development of intensive aquaculture. Therefore, alternative ecofriendly biological strategies to control pathogenic bacteria are required. However, our aim was to investigate the ability of oysters (Crassostrea gigas) to filter the important opportunistic pathogen, Aeromonas salmonicida (strain C4), using a green fluorescent protein tag (GFP) in the Atlantic salmon (Salmo salar) farming wastewater. Hence, A. salmonicida removal efficiency and ingestion rate were detected in two different oyster stages (larvae and adults). To evaluate the practical performance of oysters as A. salmonicida biofilter, adult oysters were applied to an integrated constructed wetlands system (ICWS) and their long-term C4-GFP removal efficiency was recorded for 60 days. Overall, our results clearly indicated that oysters had substantial A. salmonicida removal ability via their ingestion process when observed under a fluorescent microscope. Approximately 88-95% of C4-GFP was removed by oyster larvae at an ingestion rate of 6.4 × 10 3 -6.2 × 10 5  CFU/h·ind, while 79-92% of C4-GFP was removed by adult oysters at an ingestion rate of 2.1 × 10 4 -3.1 × 10 6  CFU/h·ind. Furthermore, 57.9 ± 17.2% of C4-GFP removal efficiency was achieved when oysters were applied to ICWS. We, therefore, concluded that using oysters as a biofilter represents an effective alternative for removing A. salmonicida from aquaculture wastewater. However, the fate of oysters after ingesting the pathogenic bacteria, acting as a potential reservoir or vector for pathogens, is still debatable. This research provides the basis for the application of oysters as a biofilter to remove pathogens from aquaculture wastewater in industrialized production.

  3. Are oysters being bored to death? Influence of Cliona celata on Crassostrea virginica condition, growth and survival.

    Science.gov (United States)

    Carroll, John M; O'Shaughnessy, Kathryn A; Diedrich, Grant A; Finelli, Christopher M

    2015-11-17

    The boring sponge Cliona celata is a nuisance species that can have deleterious effects on eastern oyster Crassostrea virginica growth, condition, and survival. Surprisingly, however, these effects have not been well documented and when examined, results have been equi-vocal. In this study, we provide a direct comparison of growth, condition, and survival of sponge-colonized and uncolonized oysters in southeast North Carolina in 2 separate experiments. In the first experiment, sponge-colonized oysters exhibited significantly slower growth rates, reduced condition, and lower survival relative to uncolonized oysters, although results may have been confounded by oyster source. In the second experiment, using smaller oysters from the same source population, growth rate was again significantly reduced in colonized oysters relative to uncolonized oysters, however neither condition nor survival differed. In field surveys of the same population, colonized individuals across a range of sizes demonstrated significantly reduced condition. Further, condition index was negatively correlated with sponge biomass, which was positively correlated with oyster size, suggesting that the impact of the sponge changes with ontogeny. By investigating clearance rates, tissue isotopic and nutrient content, as well as caloric value, this study provides further evidence that sponge presence causes the oysters to divert energy into costly shell maintenance and repair at the expense of shell and somatic growth. Thus, although variable, our results demonstrate negative impacts of sponge infestation on oyster demographics, particularly as oysters grow larger.

  4. 46 CFR 2.01-50 - Persons other than crew on towing, oyster, or fishing steam vessels.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 1 2010-10-01 2010-10-01 false Persons other than crew on towing, oyster, or fishing steam vessels. 2.01-50 Section 2.01-50 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY PROCEDURES... than crew on towing, oyster, or fishing steam vessels. (a) A steam vessel engaged in towing, oyster...

  5. The reproductive cycle of the oyster Crassostrea gasar

    Directory of Open Access Journals (Sweden)

    CHAM Gomes

    Full Text Available The purpose of this study was to analyze the reproductive cycle of the oyster Crassostrea gasar (= C. brasiliana in the field and the laboratory. The reproductive cycle of the animals was evaluated in the field at Sambaqui Beach, Florianópolis, SC (27° 29′18″ S and 48° 32′12″ W from May 2008 through November 2009. In July, the animals were in the resting stage. The early growth stage began in August and was followed by the late growth stage in October. In November and December, the oysters began to enter the mature stage. Females in spawning condition were predominant during these months. The stages of the reproductive cycle were positively associated with temperature (r=0.77, P<0.01 and negatively associated with salinity (r=−0.56, P=0.042. These findings demonstrated that increased temperature and reduced salinity influence the reproductive development of Crassostrea gasar. The condition index (CI of the animals was also associated with the seawater temperature. The highest values of the condition index were observed during the months when the temperature of the seawater was gradually increasing. A laboratory experiment was performed to test the effect of salinity on the reproductive cycle of the oysters. The experiment was conducted in standardized tanks. The animals were conditioned using two salinities (24‰ and 34‰. The salinity regime influenced the development of the gonadal tissue of the oysters. A salinity of 24‰ produced greater reproductive development.

  6. Effect of 60Co γ-irradiation on postharvest quality of pleurotus nebrodensis stored at 4 degree C

    International Nuclear Information System (INIS)

    Xiong Qiaoling; Huazhong Agriculture Univ., Wuhan; Xing Zengtao; Feng Zhiyong; Buswell, J.; Bian Yinbing

    2007-01-01

    The effect of γ-rays irradiation on the fresh-keeping of Pleurotus nebrodensis fruit bodies was reported in this paper. Fresh harvested fruit bodies of Pleurotus nebrodensis were irradiate at different doses levels (0.8-2.0 kGy) and stored for 22 days at 4 degree C. The fruit bodies treated with 1.2 kGy irradiation retained the highest soluble protein contents, and exhibited less postharvest softening throughout the storage period. Regression analysis plots of fruit body hardness versus soluble protein content were linear (t>0.05). Increases in mushroom cell permeability observed throughout the storage period were directly related to irradiation dose. Too higher dose(≥2.0 kGy) of irradiation will accelerate the nutrition degradation and rotting of the fruit bodies. (authors)

  7. Identification of irradiated oysters by EPR measurements on shells

    Energy Technology Data Exchange (ETDEWEB)

    Della Monaca, S., E-mail: sara.dellamonaca@iss.it [Istituto Superiore di Sanita, viale Regina Elena, 299 Rome (Italy); Fattibene, P.; Boniglia, C.; Gargiulo, R.; Bortolin, E. [Istituto Superiore di Sanita, viale Regina Elena, 299 Rome (Italy)

    2011-09-15

    In this paper the EPR spectra of the radicals induced in oyster shells after irradiation to (0.5-2) kGy ionizing radiation doses are analyzed. EPR spectra of irradiated shells showed the complex radical composition of biocarbonates, characterized by the presence of SO{sub 2}{sup -}, SO{sub 3}{sup -} and CO{sub 2}{sup -} radicals with different symmetries. In particular, the radiation-induced line at g = 2.0038, due to the g{sub x} component of the orthorhombic SO{sub 3}{sup -}, was well distinguishable from the rest of the spectrum. The g{sub x} component of the orthorhombic SO{sub 3}{sup -} was found to be intense and stable enough to allow the identification at least for the whole shelf life of the oyster. Furthermore, it is still well visible at low microwave powers for which the other signals are weak or non-visible and has a linear dose response in the (0.5-2) kGy range. A possible procedure protocol for the identification of irradiated oysters, can be based on acquisitions of the spectrum at low microwave power values (tenths of milliWatt) and low modulation amplitude values (0.03-0.05 mT) and on the identification of the g = 2.0038 signal as a proof of the ionizing radiation treatment performed on the sample.

  8. Detection of Toxoplasma gondii DNA in Brazilian oysters (Crassostrea rhizophorae).

    Science.gov (United States)

    Ribeiro, L A; Santos, L K N S S; Brito, P A; Maciel, B M; Da Silva, A V; Albuquerque, G R

    2015-05-04

    The aim of this study was to detect evidence of Toxoplasma gondii using polymerase chain reaction (PCR)-based techniques in oysters (Crassostrea rhizophorae) obtained from the southern coastal region of Bahia, Brazil. A total of 624 oysters were collected, and the gills and digestive glands were dissected. Each tissue sample was separated into pools containing tissues (of the same type) from three animals, leading to a total of 416 experimental samples for analysis (208 samples each from the gills and digestive glands). Molecular analysis using PCR-based detection of the T. gondii AF 146527 repetitive fragment yielded negative results for all samples. However, when nested-PCR was used for detection of the T. gondii SAG-1 gene, 17 samples were positive, with the gills being the tissue with maximal detection of the parasite. These positive results were confirmed by sample sequencing. It is therefore suggested that C. rhizophorae oysters are capable of filtering and retaining T. gondii oocysts in their tissue. This represents a risk to public health because they are traditionally ingested in natura.

  9. Identification of irradiated oysters by EPR measurements on shells

    International Nuclear Information System (INIS)

    Della Monaca, S.; Fattibene, P.; Boniglia, C.; Gargiulo, R.; Bortolin, E.

    2011-01-01

    In this paper the EPR spectra of the radicals induced in oyster shells after irradiation to (0.5-2) kGy ionizing radiation doses are analyzed. EPR spectra of irradiated shells showed the complex radical composition of biocarbonates, characterized by the presence of SO 2 - , SO 3 - and CO 2 - radicals with different symmetries. In particular, the radiation-induced line at g = 2.0038, due to the g x component of the orthorhombic SO 3 - , was well distinguishable from the rest of the spectrum. The g x component of the orthorhombic SO 3 - was found to be intense and stable enough to allow the identification at least for the whole shelf life of the oyster. Furthermore, it is still well visible at low microwave powers for which the other signals are weak or non-visible and has a linear dose response in the (0.5-2) kGy range. A possible procedure protocol for the identification of irradiated oysters, can be based on acquisitions of the spectrum at low microwave power values (tenths of milliWatt) and low modulation amplitude values (0.03-0.05 mT) and on the identification of the g = 2.0038 signal as a proof of the ionizing radiation treatment performed on the sample.

  10. A conserved tad pilus promotes Vibrio vulnificus oyster colonization.

    Science.gov (United States)

    Pu, Meng; Duriez, Patrick; Arazi, Mattan; Rowe-Magnus, Dean A

    2018-02-01

    Vibrio vulnificus has the highest death rate (>35%) and per-case economic burden ($3.3 million) of any foodborne pathogen in the United States. Infections occur via open wounds or following ingestion of contaminated seafood, most infamously oysters. We isolated a 1000th generation descendant, designated NT that exhibited increased biofilm and aggregate formation relative to its parent. We identified two significant causal changes underlying these phenotypes. First, the entire 24-kb capsular polysaccharide biosynthesis locus, which is essential for virulence but inhibits biofilm formation, had been purged from the genome. However, NT formed more extensive biofilms and aggregates than a defined cps mutant, suggesting that additional factor(s) contributed to its phenotypes. Second, the expression of a tight adherence (tad) pilus locus was elevated in NT. Deletion of the associated pilin (flp) decreased NT biofilm and aggregate formation. Furthermore, NTΔflp strains were deficient relative to NT in an oyster colonization model, demonstrating a positive correlation between the biofilm and aggregation phenotypes associated with Tad pilus production and efficient bacterial retention by feeding oysters. Despite being widely distributed in the Vibrionaceae, this is the first demonstration of a bona fide physiological role for a Tad pilus in this bacterial family. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  11. The effect of algae diets (Skeletonema costatum and Rhodomonas baltica) on the biochemical composition and sensory characteristics of Pacific cupped oysters (Crassostrea gigas) during land-based refinement

    NARCIS (Netherlands)

    Houcke, van Jasper; Medina, Isabel; Maehre, Hanne K.; Cornet, Josiane; Cardinal, Mireille; Linssen, Jozef; Luten, Joop

    2017-01-01

    Oyster refinement, a common practice in France, is aimed at increasing the weight of oyster tissue and influencing the taste properties of the refined oysters. Refinement usually takes place in land-based systems where the oysters are fed with relatively high concentrations of microalgae. In this

  12. Oysters as vectors of marine aliens, with notes on four introduced ...

    African Journals Online (AJOL)

    Surveys of oyster farms in South Africa revealed four newly-recorded alien species: the black sea urchin, Tetrapygus niger, from Chile; the European flat oyster, Ostrea edulis (thought to be extinct since its intentional introduction in 1946); Montagu's crab, Xantho incisus, from the North Eastern Atlantic seas of Europe, and ...

  13. The eastern oyster genome: A resource for comparative genomics in shellfish aquaculture species

    Science.gov (United States)

    Oyster aquaculture is an important sector of world food production. As such, it is imperative to develop a high quality reference genome for the eastern oyster, Crassostrea virginica, to assist in the elucidation of the genomic basis of commercially important traits. All genetic, gene expression and...

  14. The oyster genome reveals stress adaptation and complexity of shell formation

    DEFF Research Database (Denmark)

    Zhang, Guofan; Fang, Xiaodong; Guo, Ximing

    2012-01-01

    The Pacific oyster Crassostrea gigas belongs to one of the most species-rich but genomically poorly explored phyla, the Mollusca. Here we report the sequencing and assembly of the oyster genome using short reads and a fosmid-pooling strategy, along with transcriptomes of development and stress re...

  15. A habitat suitability model for Pacific oysters (Crassostrea gigas) in the Oosterschelde

    NARCIS (Netherlands)

    Schellekens, T.; Wijsman, J.W.M.; Brink, van den A.M.

    2012-01-01

    The modelled habitat suitability maps show a reasonable estimation of the suitability for oysters throughout the Delta and can be used to broadly indicate the consequences of the effect of climate change and infrastructural changes on the habitat suitability for oysters. The largest effect on the

  16. Thermal inactivation of enteric viruses and bioaccumulation of enteric foodborne viruses in live oysters (Crassostrea virginica)

    Science.gov (United States)

    Human enteric viruses are one of the main causative agents of shellfish associated outbreaks. In this study, the kinetics of viral bioaccumulation in live oysters and the heat stability of the most predominant enteric viruses were determined in both tissue culture and in oyster tissues. A human nor...

  17. Growth, morphometrics and nutrient content of farmed eastern oysters, Crassostrea virginica (Gmelin), in New Hampshire, USA

    Science.gov (United States)

    When harvested, oysters represent a removal from the ecosystem of nutrients such as nitrogen (N)and carbon (C). A number of factors potentially affect nutrient content, but a quantitative understanding across the geographical range of the eastern oysters is lacking. This study wa...

  18. Temperature-dependent persistence of human norovirus within oysters (Crassotrea virginica)

    Science.gov (United States)

    This study characterizes the persistence of human norovirus in Eastern oysters (Crassostrea virginica) held at different seawater temperatures. Oysters were contaminated with human norovirus GI.1 (Norwalk strain 8fIIa) by exposing them to virus contaminated water at 15 degrees C, and subsequently ho...

  19. Behavior of pathogenic bacteria in the oyster, Crassostrea commercialis, during depuration, re-laying, and storage.

    Science.gov (United States)

    Son, N T; Fleet, G H

    1980-12-01

    Oysters (Crassostrea commercials) harvested from major cultivation areas within the state of New South Wales, Australia, were commonly contaminated with low levels of the food-poisoning organisms Bacillus cereus, Clostridium perfringens, and Vibrio parahaemolyticus. Salmonella was found in oysters on only one occasion. These bacteria were cleansed from oysters during oyster purification by re-laying in a non-polluted waterway. Oysters were laboratory contaminated to levels in excess 1,000 cells per g with either B. cereus, C. perfringens, V. parahaemolyticus, Salmonella typhimurium, or S. senftenberg. These species were cleansed from such oysters during purification in a laboratory depuration unit that used ultraviolet light for sterilizing the depuration water. Escherichia coli was also cleansed from oysters under the same re-laying or depuration conditions so that its measurement alone could be used to indicate the cleansing of the above pathogenic species. The levels of these bacteria were also measured during the storage of oysters under conditions that occur during marketing. While B. cereus counts remained relatively stable during storage, the Salmonella spp. gradually decreased in numbers and C. perfringens rapidly died off. V. parahaemolyticus counts increased slightly during the first 4 days of storage, after which decreases occurred.

  20. Impact of an icy winter on the Pacific oyster (Crassostrea gigas Thunberg, 1793) populations in Scandinavia

    DEFF Research Database (Denmark)

    Strand, Åsa; Blanda, Elisa; Bodvin, Torjan

    2012-01-01

    The Pacific oyster (Crassostrea gigas) is an invasive species that has dispersed into Scandinavia during the last few decades. The objective of this study was to evaluate the effects of extreme winter conditions on the mortality of the Pacific oyster in Scandinavia. The study was done by compilin...

  1. ANTIMICROBIAL ACTIVITY OF COPPER AND ZINC ACCUMULATED BY EASTERN OYSTER AMEBOCYTES

    Science.gov (United States)

    Fisher, William S. Submitted. Antimicrobial Activity of Copper and Zinc Accumulated by Eastern Oyster Amebocytes. J. Shellfish Res. 54 p. (ERL,GB 1196). The distribution of eastern oysters Crassostrea virginica near terrestrial watersheds has led to a general impression t...

  2. Calcium flouride (CaF2) from oyster shell as a raw material for thermoluminescence dosimeter

    International Nuclear Information System (INIS)

    Coloma, Lyra C.; Fanuga, Lyn N.; Ocreto, Cherries Ann; Rodriguez, Richita

    2006-03-01

    This study aims to develop a thermoluminescence dosimeter raw material made of calcium fluoride from locally available seashells that is suitable for personal radiation monitoring. Oyster shells were collected and grounded as powder samples and analyzed for calcium fluoride (CaF 2 ) content using XRF and XRD testing. Samples include pure CaF 2 , pure oyster shell, and oyster shells treated with acid. Based from the XRF results, natural oyster shell (w/ and w/o HNO 3 ) had high percentage of calcium about 49.64% and 47.45%, next to the pure calcium fluoride of 51.08%. X-ray diffractrogram shows that oyster sample had the nearest desired structure of CaF 2 compared with two seashells relative to the pure CaF 2 as standard materials. Results show that all of the natural oyster samples displayed TL emission glow curves at the temperature range 200-300 o C. It was also found that pure oyster sample has better TL response as compared to the treated ones. The researchers concluded that the calcium fluoride from oyster shells (without acid and heated) is a potentially good low-cost TLD raw material and may be used as an alternative for the much more expensive LiF dosimeters. (Authors)

  3. ANTIOXIDANT ENZYMES, POTENTIAL VIRULENT FACTORS, IN DIFFERENT STRAINS OF THE OYSTER PROTOZOAN PARASITE, PERKINSUS MARINUS

    Science.gov (United States)

    The oyster protozoan parasite, Perkinsus marinus, is one of the two important parasites causing severe mortality in the eastern oysters (Crassostrea virginica) on the US east coast. Our recent study suggests that P. marinus cells and its extracellular products (ECP) could scaveng...

  4. High pressure processing with hot sauce flavoring enhances sensory quality for raw oysters (Crassostrea virginica)

    Science.gov (United States)

    This study evaluated the feasibility of flavoring raw oysters by placing them under pressure in the presence of selected flavorings. Hand-shucked raw oysters were processed at high pressure (600 MPa), in the presence or absence of (Sriracha®) flavoring, and evaluated by a trained sensory panel 3 an...

  5. Desirability of oysters treated by high pressure processing at different temperatures and elevated pressures

    Science.gov (United States)

    Organoleptic changes in sterile triploid oysters (Crassostrea virginica) induced by high pressure processing (HPP) were investigated using a volunteer panel. Using a 1-7 hedonic scale, where seven is “like very much”, and one is “dislike very much”, oysters were evaluated organoleptically for flavo...

  6. Secretion of laccase and manganese peroxidase by Pleurotus strains cultivate in solid-state using Pinus spp. sawdust

    Directory of Open Access Journals (Sweden)

    Marli Camassola

    2013-01-01

    Full Text Available Pleurotus species secrete phenol oxidase enzymes: laccase (Lcc and manganese peroxidase (MnP. New genotypes of these species show potential to be used in processes aiming at the degradation of phenolic compounds, polycyclic aromatic hydrocarbons and dyes. Hence, a screening of some strains of Pleurotus towards Lcc and MnP production was performed in this work. Ten strains were grown through solid-state fermentation on a medium based on Pinus spp. sawdust, wheat bran and calcium carbonate. High Lcc and MnP activities were found with these strains. Highest Lcc activity, 741 ± 245 U gdm-1 of solid state-cultivation medium, was detected on strain IB11 after 32 days, while the highest MnP activity occurred with strains IB05, IB09, and IB11 (5,333 ± 357; 4,701 ± 652; 5,999 ± 1,078 U gdm-1, respectively. The results obtained here highlight the importance of further experiments with lignocellulolytic enzymes present in different strains of Pleurotus species. Such results also indicate the possibility of selecting more valuable strains for future biotechnological applications, in soil bioremediation and biological biomass pre-treatment in biofuels production, for instance, as well as obtaining value-added products from mushrooms, like phenol oxidase enzymes.

  7. [Comparison of two nucleic acid extraction methods for norovirus in oysters].

    Science.gov (United States)

    Yuan, Qiao; Li, Hui; Deng, Xiaoling; Mo, Yanling; Fang, Ling; Ke, Changwen

    2013-04-01

    To explore a convenient and effective method for norovirus nucleic acid extraction from oysters suitable for long-term viral surveillance. Two methods, namely method A (glycine washing and polyethylene glycol precipitation of the virus followed by silica gel centrifugal column) and method B (protease K digestion followed by application of paramagnetic silicon) were compared for their performance in norovirus nucleic acid extraction from oysters. Real-time RT-PCR was used to detect norovirus in naturally infected oysters and in oysters with induced infection. The two methods yielded comparable positive detection rates for the samples, but the recovery rate of the virus was higher with method B than with method A. Method B is a more convenient and rapid method for norovirus nucleic acid extraction from oysters and suitable for long-term surveillance of norovirus.

  8. Structural and compositional characterization of the adhesive produced by reef building oysters.

    Science.gov (United States)

    Alberts, Erik M; Taylor, Stephen D; Edwards, Stephanie L; Sherman, Debra M; Huang, Chia-Ping; Kenny, Paul; Wilker, Jonathan J

    2015-04-29

    Oysters have an impressive ability to overcome difficulties of life within the stressful intertidal zone. These shellfish produce an adhesive for attaching to each other and building protective reef communities. With their reefs often exceeding kilometers in length, oysters play a major role in balancing the health of coastal marine ecosystems. Few details are available to describe oyster adhesive composition or structure. Here several characterization methods were applied to describe the nature of this material. Microscopy studies indicated that the glue is comprised of organic fiber-like and sheet-like structures surrounded by an inorganic matrix. Phospholipids, cross-linking chemistry, and conjugated organics were found to differentiate this adhesive from the shell. Symbiosis in material synthesis could also be present, with oysters incorporating bacterial polysaccharides into their adhesive. Oyster glue shows that an organic-inorganic composite material can provide adhesion, a property especially important when constructing a marine ecosystem.

  9. Eastern oyster (Crassostrea virginica) δ15N as a bioindicator of nitrogen sources: Observations and modeling

    International Nuclear Information System (INIS)

    Fertig, B.; Carruthers, T.J.B.; Dennison, W.C.; Fertig, E.J.; Altabet, M.A.

    2010-01-01

    Stable nitrogen isotopes (δ 15 N) in bioindicators are increasingly employed to identify nitrogen sources in many ecosystems and biological characteristics of the eastern oyster (Crassostrea virginica) make it an appropriate species for this purpose. To assess nitrogen isotopic fractionation associated with assimilation and baseline variations in oyster mantle, gill, and muscle tissue δ 15 N, manipulative fieldwork in Chesapeake Bay and corresponding modeling exercises were conducted. This study (1) determined that five individuals represented an optimal sample size; (2) verified that δ 15 N in oysters from two locations converged after shared deployment to a new location reflecting a change in nitrogen sources; (3) identified required exposure time and temporal integration (four months for muscle, two to three months for gill and mantle); and (4) demonstrated seasonal δ 15 N increases in seston (summer) and oysters (winter). As bioindicators, oysters can be deployed for spatial interpolation of nitrogen sources, even in areas lacking extant populations.

  10. Surveying a fossil oyster reef using terrestrial laser scanning

    Science.gov (United States)

    Haring, A.; Exner, U.; Harzhauser, M.

    2009-04-01

    The Korneuburg Basin, situated north-west of Vienna, is well known to contain a rich variety of fossils from the Early Miocene (16.5 ma) and therefore has been investigated extensively by scientists in the past decades. An exceptional discovery was made in 2005: a large fossil oyster reef has been excavated and documented carefully during the last years. Aside from the giant-sized oyster (Crassostrea gryphoides), the excavation site contains numerous species of molluscs along with teeth of sharks and rays and even isolated bones of sea cows. The oysters, having lengths of up to 80 cm, are protruding from the ground surface, which is more or less a tilted plane (25˚ ) with a size of about 300 m2. The entire site is crosscut by a network of geological faults, often also offsetting individual oyster shells. Displacements along the normal faults do not exceed ~ 15 cm. The faulted fossils offer a unique opportunity to measure displacement distribution along the faults in great detail and provide insight in deformation mechanisms in porous, barely lithified sediments. In order to get a precise 3D model of the oyster reef, the terrestrial laser scanner system Leica HDS 6000 is used. It is a phase-based laser scanner, i.e. the distance measurement is performed using the phase-shift principle. Compared to the time-of-flight principle, this method is generally more appropriate to projects like this one, where the distances to be measured are relatively small (< 35 m) and where a high point density (point spacing of about 1 cm) and precision (some mm) is required for capturing the oysters adequately. However, due to fact that they occlude each other, one single scan is not sufficient to get all sides of their surface. Therefore, scans from different positions had to be acquired. These scans have to be merged, which involves the problem of sensor orientation as well as sampling of the entire 3D point cloud. Furthermore, a representation of the surface data is required that

  11. Satellite remote sensing reveals a positive impact of living oyster reefs on microalgal biofilm development

    Directory of Open Access Journals (Sweden)

    C. Echappé

    2018-02-01

    Full Text Available Satellite remote sensing (RS is routinely used for the large-scale monitoring of microphytobenthos (MPB biomass in intertidal mudflats and has greatly improved our knowledge of MPB spatio-temporal variability and its potential drivers. Processes operating on smaller scales however, such as the impact of benthic macrofauna on MPB development, to date remain underinvestigated. In this study, we analysed the influence of wild Crassostrea gigas oyster reefs on MPB biofilm development using multispectral RS. A 30-year time series (1985–2015 combining high-resolution (30 m Landsat and SPOT data was built in order to explore the relationship between C. gigas reefs and MPB spatial distribution and seasonal dynamics, using the normalized difference vegetation index (NDVI. Emphasis was placed on the analysis of a before–after control-impact (BACI experiment designed to assess the effect of oyster killing on the surrounding MPB biofilms. Our RS data reveal that the presence of oyster reefs positively affects MPB biofilm development. Analysis of the historical time series first showed the presence of persistent, highly concentrated MPB patches around oyster reefs. This observation was supported by the BACI experiment which showed that killing the oysters (while leaving the physical reef structure, i.e. oyster shells, intact negatively affected both MPB biofilm biomass and spatial stability around the reef. As such, our results are consistent with the hypothesis of nutrient input as an explanation for the MPB growth-promoting effect of oysters, whereby organic and inorganic matter released through oyster excretion and biodeposition stimulates MPB biomass accumulation. MPB also showed marked seasonal variations in biomass and patch shape, size and degree of aggregation around the oyster reefs. Seasonal variations in biomass, with higher NDVI during spring and autumn, were consistent with those observed on broader scales in other European mudflats. Our

  12. Satellite remote sensing reveals a positive impact of living oyster reefs on microalgal biofilm development

    Science.gov (United States)

    Echappé, Caroline; Gernez, Pierre; Méléder, Vona; Jesus, Bruno; Cognie, Bruno; Decottignies, Priscilla; Sabbe, Koen; Barillé, Laurent

    2018-02-01

    Satellite remote sensing (RS) is routinely used for the large-scale monitoring of microphytobenthos (MPB) biomass in intertidal mudflats and has greatly improved our knowledge of MPB spatio-temporal variability and its potential drivers. Processes operating on smaller scales however, such as the impact of benthic macrofauna on MPB development, to date remain underinvestigated. In this study, we analysed the influence of wild Crassostrea gigas oyster reefs on MPB biofilm development using multispectral RS. A 30-year time series (1985-2015) combining high-resolution (30 m) Landsat and SPOT data was built in order to explore the relationship between C. gigas reefs and MPB spatial distribution and seasonal dynamics, using the normalized difference vegetation index (NDVI). Emphasis was placed on the analysis of a before-after control-impact (BACI) experiment designed to assess the effect of oyster killing on the surrounding MPB biofilms. Our RS data reveal that the presence of oyster reefs positively affects MPB biofilm development. Analysis of the historical time series first showed the presence of persistent, highly concentrated MPB patches around oyster reefs. This observation was supported by the BACI experiment which showed that killing the oysters (while leaving the physical reef structure, i.e. oyster shells, intact) negatively affected both MPB biofilm biomass and spatial stability around the reef. As such, our results are consistent with the hypothesis of nutrient input as an explanation for the MPB growth-promoting effect of oysters, whereby organic and inorganic matter released through oyster excretion and biodeposition stimulates MPB biomass accumulation. MPB also showed marked seasonal variations in biomass and patch shape, size and degree of aggregation around the oyster reefs. Seasonal variations in biomass, with higher NDVI during spring and autumn, were consistent with those observed on broader scales in other European mudflats. Our study provides the

  13. Intertidal oysters reach their physiological limit in a future high-CO2 world.

    Science.gov (United States)

    Scanes, Elliot; Parker, Laura M; O'Connor, Wayne A; Stapp, Laura S; Ross, Pauline M

    2017-03-01

    Sessile marine molluscs living in the intertidal zone experience periods of internal acidosis when exposed to air (emersion) during low tide. Relative to other marine organisms, molluscs have been identified as vulnerable to future ocean acidification; however, paradoxically it has also been shown that molluscs exposed to high CO 2 environments are more resilient compared with those molluscs naive to CO 2 exposure. Two competing hypotheses were tested using a novel experimental design incorporating tidal simulations to predict the future intertidal limit of oysters in a high-CO 2 world; either high-shore oysters will be more tolerant of elevated P CO 2 because of their regular acidosis, or elevated P CO 2  will cause high-shore oysters to reach their limit. Sydney rock oysters, Saccostrea glomerata , were collected from the high-intertidal and subtidal areas of the shore and exposed in an orthogonal design to either an intertidal or a subtidal treatment at ambient or elevated P CO 2 , and physiological variables were measured. The combined treatment of tidal emersion and elevated P CO 2  interacted synergistically to reduce the haemolymph pH (pH e ) of oysters, and increase the P CO 2  in the haemolymph ( P e,CO 2 ) and standard metabolic rate. Oysters in the intertidal treatment also had lower condition and growth. Oysters showed a high degree of plasticity, and little evidence was found that intertidal oysters were more resilient than subtidal oysters. It is concluded that in a high-CO 2 world the upper vertical limit of oyster distribution on the shore may be reduced. These results suggest that previous studies on intertidal organisms that lacked tidal simulations may have underestimated the effects of elevated P CO 2 . © 2017. Published by The Company of Biologists Ltd.

  14. Trade-off between increased survival and reduced growth for blue mussels living on Pacific oyster reefs

    DEFF Research Database (Denmark)

    Eschweiler, Nina; Christensen, Helle Torp

    2011-01-01

    Pacific oysters Crassostrea gigas (Thunberg 1793) have been introduced into the Wadden Sea (North Sea, Germany) in the mid of the 1980s and have invaded native blue mussel Mytilus edulis (L.) beds. The latter turned into oyster reefs where mussels seem to be relegated to the bottom in between...... the much larger oysters. By combining field and laboratory experiments, we reveal how mussels react to cohabitation with the invasive oysters. Mussels subjected to direct contact with crabs Carcinus maenas migrate from top to bottom positions between oysters in both field and laboratory experiments within...... 22days. Shell growth was significantly reduced for mussels placed on the bottom compared to mussels at the top of an oyster reef. Condition index was lower for mussels on the bottom of the reef irrespective of whether placed between dead or living oysters. We conclude that mussels experience a trade...

  15. Evaluation of Ice Slurries as a Control for Postharvest Growth of Vibrio spp. in Oysters and Potential for Filth Contamination.

    Science.gov (United States)

    Lydon, Keri Ann; Farrell-Evans, Melissa; Jones, Jessica L

    2015-07-01

    Raw oyster consumption is the most common route of exposure for Vibrio spp. infections in humans. Vibriosis has been increasing steadily in the United States despite efforts to reduce the incidence of the disease. Research has demonstrated that ice is effective in reducing postharvest Vibrio spp. growth in oysters but has raised concerns of possible contamination of oyster meat by filth (as indicated by the presence of fecal coliform bacteria or Clostridium perfringens). This study examined the use of ice slurries (oysters, from 23.9°C (75°F) to 10°C (50°F) within 12 min. The initial bacterial loads in the ice slurry waters were near the limits of detection. Following repeated dipping of oysters into ice slurries, water samples exhibited significant (P oyster meat, however, was unchanged after 15 min of submergence, with no significant differences (P oysters to minimize Vibrio growth.

  16. Transcriptome of American oysters, Crassostrea virginica, in response to bacterial challenge: insights into potential mechanisms of disease resistance.

    Science.gov (United States)

    McDowell, Ian C; Nikapitiya, Chamilani; Aguiar, Derek; Lane, Christopher E; Istrail, Sorin; Gomez-Chiarri, Marta

    2014-01-01

    The American oyster Crassostrea virginica, an ecologically and economically important estuarine organism, can suffer high mortalities in areas in the Northeast United States due to Roseovarius Oyster Disease (ROD), caused by the gram-negative bacterial pathogen Roseovarius crassostreae. The goals of this research were to provide insights into: 1) the responses of American oysters to R. crassostreae, and 2) potential mechanisms of resistance or susceptibility to ROD. The responses of oysters to bacterial challenge were characterized by exposing oysters from ROD-resistant and susceptible families to R. crassostreae, followed by high-throughput sequencing of cDNA samples from various timepoints after disease challenge. Sequence data was assembled into a reference transcriptome and analyzed through differential gene expression and functional enrichment to uncover genes and processes potentially involved in responses to ROD in the American oyster. While susceptible oysters experienced constant levels of mortality when challenged with R. crassostreae, resistant oysters showed levels of mortality similar to non-challenged oysters. Oysters exposed to R. crassostreae showed differential expression of transcripts involved in immune recognition, signaling, protease inhibition, detoxification, and apoptosis. Transcripts involved in metabolism were enriched in susceptible oysters, suggesting that bacterial infection places a large metabolic demand on these oysters. Transcripts differentially expressed in resistant oysters in response to infection included the immune modulators IL-17 and arginase, as well as several genes involved in extracellular matrix remodeling. The identification of potential genes and processes responsible for defense against R. crassostreae in the American oyster provides insights into potential mechanisms of disease resistance.

  17. Metal leaching from experimental coal fly-ash oyster cultch

    Energy Technology Data Exchange (ETDEWEB)

    Homziak, J.; Bennett, L.; Simon, P.; Herring, R. (Mississippi State University, MS (USA). Coastal Research and Extension Center)

    1993-08-01

    Because oysters accumulate metals far in excess of ambient concentrations potential leaching and bioaccumulation of metals may be important public health concerns where ash-cement aggregates are being considered for oyster cultivation. This study examined the potential for metal release from an ash-cement aggregate proposed for use in oyster reef construction in Mississippi coastal waters. Seven acid-washed aquaria were each filled with 77L of artificial seawater. Five randomly selected aquaria each received 8.6 L of aggregate pellets. Samples were taken from each aquarium one hour after the start of the experiment and at 10 day intervals on six subsequent sampling dates. The samples were analysed for arsenic, cadmium, chromium, copper, iron, lead, manganese, mercury, nickel, selenium and zinc. Cadmium, iron and mercury were essentially not detected in the treatment aquaria. Except for chromium, the mean concentrations of metals in the treatment samples were generally less than 10 ppb. An overall comparison of the concentrations of 8 metals among all aquaria and sampling dates detected significant differences in the concentration of chromium (p[lt]0.001), manganese (p[lt]0.05) and selenium (p[lt]0.001). Treatment aquaria had significantly greater concentrations of chromium and selenium than did either control (nonparametric multiple comparison, p[lt]0.05). Most of the chromium found in the treatment aquaria was the hexavalent form (means range from 0.052 to 1.328 ppm). Treatment hexavalent chromium concentrations increased over time. 14 refs., 1 fig., 2 tabs.

  18. 3D CENTRAL LINE EXTRACTION OF FOSSIL OYSTER SHELLS

    Directory of Open Access Journals (Sweden)

    A. Djuricic

    2016-06-01

    Full Text Available Photogrammetry provides a powerful tool to digitally document protected, inaccessible, and rare fossils. This saves manpower in relation to current documentation practice and makes the fragile specimens more available for paleontological analysis and public education. In this study, high resolution orthophoto (0.5 mm and digital surface models (1 mm are used to define fossil boundaries that are then used as an input to automatically extract fossil length information via central lines. In general, central lines are widely used in geosciences as they ease observation, monitoring and evaluation of object dimensions. Here, the 3D central lines are used in a novel paleontological context to study fossilized oyster shells with photogrammetric and LiDAR-obtained 3D point cloud data. 3D central lines of 1121 Crassostrea gryphoides oysters of various shapes and sizes were computed in the study. Central line calculation included: i Delaunay triangulation between the fossil shell boundary points and formation of the Voronoi diagram; ii extraction of Voronoi vertices and construction of a connected graph tree from them; iii reduction of the graph to the longest possible central line via Dijkstra’s algorithm; iv extension of longest central line to the shell boundary and smoothing by an adjustment of cubic spline curve; and v integration of the central line into the corresponding 3D point cloud. The resulting longest path estimate for the 3D central line is a size parameter that can be applied in oyster shell age determination both in paleontological and biological applications. Our investigation evaluates ability and performance of the central line method to measure shell sizes accurately by comparing automatically extracted central lines with manually collected reference data used in paleontological analysis. Our results show that the automatically obtained central line length overestimated the manually collected reference by 1.5% in the test set, which

  19. D Central Line Extraction of Fossil Oyster Shells

    Science.gov (United States)

    Djuricic, A.; Puttonen, E.; Harzhauser, M.; Mandic, O.; Székely, B.; Pfeifer, N.

    2016-06-01

    Photogrammetry provides a powerful tool to digitally document protected, inaccessible, and rare fossils. This saves manpower in relation to current documentation practice and makes the fragile specimens more available for paleontological analysis and public education. In this study, high resolution orthophoto (0.5 mm) and digital surface models (1 mm) are used to define fossil boundaries that are then used as an input to automatically extract fossil length information via central lines. In general, central lines are widely used in geosciences as they ease observation, monitoring and evaluation of object dimensions. Here, the 3D central lines are used in a novel paleontological context to study fossilized oyster shells with photogrammetric and LiDAR-obtained 3D point cloud data. 3D central lines of 1121 Crassostrea gryphoides oysters of various shapes and sizes were computed in the study. Central line calculation included: i) Delaunay triangulation between the fossil shell boundary points and formation of the Voronoi diagram; ii) extraction of Voronoi vertices and construction of a connected graph tree from them; iii) reduction of the graph to the longest possible central line via Dijkstra's algorithm; iv) extension of longest central line to the shell boundary and smoothing by an adjustment of cubic spline curve; and v) integration of the central line into the corresponding 3D point cloud. The resulting longest path estimate for the 3D central line is a size parameter that can be applied in oyster shell age determination both in paleontological and biological applications. Our investigation evaluates ability and performance of the central line method to measure shell sizes accurately by comparing automatically extracted central lines with manually collected reference data used in paleontological analysis. Our results show that the automatically obtained central line length overestimated the manually collected reference by 1.5% in the test set, which is deemed

  20. Increases in the amounts of Vibrio spp. in oysters upon addition of exogenous bacteria.

    Science.gov (United States)

    Froelich, Brett; Oliver, James

    2013-09-01

    The bacterial pathogen Vibrio vulnificus is found naturally in brackish coastal waters but can be greatly concentrated by filter-feeding organisms such as shellfish. Numerous experiments in which exogenous V. vulnificus cells are added to oysters in an attempt to measure uptake and depuration have been performed. In nearly all cases, results have shown that laboratory-grown bacteria are rapidly taken up by the oysters but ultimately eliminated, while naturally present Vibrio populations in oysters are resistant to depuration. In this study, oysters harvested during winter months, with low culturable Vibrio concentrations, were incubated in aquaria supplemented with strains of V. vulnificus that were either genotypically or phenotypically distinct from the background bacteria. These exogenous cells were eliminated from the oysters, as previously seen, but other vibrios already inhabiting the oysters responded to the V. vulnificus inoculum by rapidly increasing in number and maintaining a large stable population. The presence of such an oyster-adapted Vibrio population would be expected to prevent colonization by exogenous V. vulnificus cells, thus explaining the rapid depuration of these added bacteria.

  1. Proteomic analysis of Sydney Rock oysters (Saccostrea glomerata) exposed to metal contamination in the field

    International Nuclear Information System (INIS)

    Thompson, Emma L.; Taylor, Daisy A.; Nair, Sham V.; Birch, Gavin; Hose, Grant C.; Raftos, David A.

    2012-01-01

    This study used proteomics to assess the impacts of metal contamination in the field on Sydney Rock oysters. Oysters were transplanted into Lake Macquarie, NSW, for two weeks in both 2009 and 2010. Two-dimensional electrophoresis identified changes in protein expression profiles of oyster haemolymph between control and metal contaminated sites. There were unique protein expression profiles for each field trial. Principal components analysis attributed these differences in oyster proteomes to the different combinations and concentrations of metals and other environmental variables present during the three field trials. Identification of differentially expressed proteins showed that proteins associated with cytoskeletal activity and stress responses were the most commonly affected biological functions in the Sydney Rock oyster. Overall, the data show that proteomics combined with multivariate analysis has the potential to link the effects of contaminants with biological consequences. - Highlights: ► Sydney Rock oyster haemolymph was analysed by proteomics after metal exposure in 3 field trials. ► 2-DE analysis was used to compare protein profiles between control and contaminated sites. ► Different protein expression profiles were revealed per field trial. ► Principal components analysis attributed profiles to different suites of metals and environmental variables per trial. ► The study highlights the need to do multiple field trials and to combine proteomic and enviro. data. - This study used proteomics to analyse impacts of metal contamination on Sydney Rock oyster (Saccostrea glomerata) haemolymph in multiple field trials.

  2. Annual dose of Taiwanese from the ingestion of 210Po in oysters.

    Science.gov (United States)

    Lee, Hsiu-wei; Wang, Jeng-Jong

    2013-03-01

    Oysters around the coast of Taiwan were collected, dried, spiked with a (209)Po tracer for yield, digested with concentrated HNO(3) and H(2)O(2), and finally dissolved in 0.5 N HCl. The polonium was then spontaneously deposited onto a silver disc, and the activity of (210)Po was measured using an alpha spectrum analyzer equipped with a silicon barrier detector. Meanwhile, the internal effective dose of (210)Po coming from the intake of oysters by Taiwanese was evaluated. The results of the present study indicate that (210)Po average activity concentrations ranged from 23.4 ± 0.4 to 126 ± 94 Bq kg(-1) of fresh oysters. The oysters coming from Penghu island and Kinmen island regions contain higher concentrations of (210)Po in comparison with oysters from other regions of Taiwan. The value of (210)Po weighted average activity concentrations for all oyster samples studied is 25.9 Bq kg(-1). The annual effective dose of Taiwanese due to the ingestion of (210)Po in oysters was estimated to be 4.1 × 10(-2) mSv y(-1). Copyright © 2013. Published by Elsevier Ltd.

  3. The role of tissue-specific microbiota in initial establishment success of Pacific oysters.

    Science.gov (United States)

    Lokmer, Ana; Kuenzel, Sven; Baines, John F; Wegner, Karl Mathias

    2016-03-01

    Microbiota can have positive and negative effects on hosts depending on the environmental conditions. Therefore, it is important to decipher host-microbiota-environment interactions, especially under natural conditions exerting (a)biotic stress. Here, we assess the relative importance of microbiota in different tissues of Pacific oyster for its successful establishment in a new environment. We transplanted oysters from the Southern to the Northern Wadden Sea and controlled for the effects of resident microbiota by administering antibiotics to half of the oysters. We then followed survival and composition of haemolymph, mantle, gill and gut microbiota in local and translocated oysters over 5 days. High mortality was recorded only in non-antibiotic-treated translocated oysters, where high titres of active Vibrio sp. in solid tissues indicated systemic infections. Network analyses revealed the highest connectivity and a link to seawater communities in the haemolymph microbiota. Since antibiotics decreased modularity and increased connectivity of the haemolymph-based networks, we propose that community destabilization in non-treated translocated oysters could be attributed to interactions between resident and external microbiota, which in turn facilitated passage of vibrios into solid tissues and invoked disease. These interactions of haemolymph microbiota with the external and internal environment may thus represent an important component of oyster fitness. © 2015 Society for Applied Microbiology and John Wiley & Sons Ltd.

  4. Epizootiology of Perkinsus sp. inCrassostrea gasar oysters in polyculture with shrimps in northeastern Brazil

    Directory of Open Access Journals (Sweden)

    Patricia Mirella da Silva

    2016-03-01

    Full Text Available Abstract Bivalve culture is of considerable economic and social interest in northeastern (NE Brazil. The polyculture is an alternative approach to traditional monoculture for reducing the environmental impact of shrimp farming and improving oyster culture. Perkinsus marinus andPerkinsus olseni were found infecting oysters in NE Brazil and can threaten oyster production. This study evaluatedPerkinsus spp. occurrence in Crassostrea gasar during all production stages. Oyster spats were produced in a hatchery and grown in shrimp ponds in Rio Grande do Norte state.Perkinsus spp. were surveyed by Ray’s fluid thioglycollate medium and confirmed by polymerase chain reaction. Prevalence and intensity of infection were determined in oysters until they reached 7 cm. Results showed that the broodstock was already infected by Perkinsus (60%, but the derived spats were Perkinsus-free. Oyster spats acquired Perkinsus infection when transferred to ponds. The prevalence gradually increased in the seven months following placement in ponds (73%, and then decreased to 17% by the tenth month. The infections were initially mild, but intensity increased at the final growth stage. In conclusion, it is possible to produce Perkinsus-free C. gasar oyster spats from infected broodstock, and their culture in shrimp ponds is feasible.

  5. Effects of a thermal effluent on the reproduction of the American oyster

    International Nuclear Information System (INIS)

    Tinsman, J.C.; Tinsman, S.G.; Maurer, D.

    1976-01-01

    Oysters were sampled from September 1970 to September 1972 from two stations in Indian River Bay, Delaware, for histological examination. Station 1 (control) was located near the intake of the Delmarva Power and Light Company's fossil-fuel plant in Millsboro, Del. Station 2 (effluent) was 2.5 km east of the plant at the mouth of Island Creek. A combination of classical and quantitative methods was used to document changes in the developmental cycle of oysters resulting from the influence of a thermal effluent. Oysters in the effluent showed precocious gonadal development during the spring, but the time of maximum ripeness and spawning activity was the same at both stations. An extension of the spawning season for several weeks in September was noted for oysters in the effluent. During 1972, oysters in the thermal effluent showed a significantly lower level of gonadal development than did controls. Since this season of decreased reproductive amplitude corresponds with a period of high mortalities among effluent oysters, it seems likely that these oysters were thermally stressed, requiring more energy for maintenance and leaving less available for reproduction

  6. Incorporation of metabolites into glycogen and lipids of the oyster, crassostrea virginica

    International Nuclear Information System (INIS)

    Swift, M.L.; Humphrey, C.L.

    1987-01-01

    Groups of oysters, either fed or unfed, were exposed to U- 14 C labelled D-glucose, L-asp, L-leu, L-ala or acetate for 6 hrs. Except for the glucose trials, the disappearance of radioactivity from the saline of the unfed oysters was greater (83%) than for the fed animals (65%). With glucose, 88% of the radioactivity disappeared in each trial. The specific radioactivity of glycogen isolated from oysters exposed to labelled glucose, asp and ala was 1283, 468 and 8.22 dpm/mg glycogen respectively. Radioactivity was found primarily in the triacylglycerols and phospholipids (PL) in fed oysters and in PL only in unfed oysters. Phosphatidyl choline, phosphatidyl ethanolamine, and a fraction containing phosphatidyl serine and phosphatidyl inositol, had 32%, 25% and 35-40% of the radioactivity respectively. Incorporation of total radioactivity into PL was 70% lower in unfed vs. fed trials, but the distribution of counts among the phospholipids classes was unchanged. Glycogenesis does not appear to be a significant pathway in the oyster. Apparently well-fed oysters are able to store excess dietary calories as lipid. During periods of starvation exogenous small metabolites along with glucose from glycogen are catabolized

  7. Role of bacteria in bioaccumulation of mercury in the oyster Crassostrea virginica

    International Nuclear Information System (INIS)

    Sayler, G.S.; Nelson, J.D. Jr.; Colwell, R.R.

    1975-01-01

    An investigation of mercury-resistant bacteria was undertaken to determine their role in the accumulation of mercury in a simplified food chain. Oysters (Crassostrea virginica) were maintained in a closed system, sealed aquarium with stirred, aerated water containing 10 μg of 203 HgCl 2 per liter. Uptake of 203 Hg by oysters held under control conditions was compared with that of 203 Hg uptake by oysters under similar conditions except that mercury-accumulating and mercury-metabolizing species of Pseudomonsa, isolated from Chesapeake Bay, were added to the experimental oysters. After incubation for 4 days, the major portion of the 203 Hg in the water column was found to be associated with the microparticulate fraction, corresponding to a rise in total viable count. Mercury accumulation in the oysters was significantly higher in the gill and fisceral tissue than other tissues. Mercury concentrations were 200 times greater in tissue fractions of oysters dosed with mercury-metabolizing bacteria compared with the oysters held under control conditions without mercury-metabolizing bacteria. (U.S.)

  8. Parasites infecting the cultured oyster Crassostrea gasar (Adanson, 1757) in Northeast Brazil.

    Science.gov (United States)

    Queiroga, Fernando Ramos; Vianna, Rogério Tubino; Vieira, Cairé Barreto; Farias, Natanael Dantas; Da Silva, Patricia Mirella

    2015-05-01

    The oyster Crassostrea gasar is a species widely used as food and a source of income for the local population of the estuaries of Northeast Brazil. Perkinsus marinus and Perkinsus olseni are deleterious parasites for oyster farming and were recently detected in Brazil. In this study, a histopathologic survey of the oyster C. gasar cultured in the estuary of the River Mamanguape (Paraíba State) was performed. Adult oysters were collected in December 2011 and March, May, August and October 2012 and processed for histology and Perkinsus sp. identification by molecular analyses. Histopathological analysis revealed the presence of parasitic organisms including viral gametocytic hypertrophy, prokaryote-like colonies, protozoans (Perkinsus sp. and Nematopsis sp.) and metazoans (Tylocephalum sp. and cestodes). Other commensal organisms were also detected (the protozoan Ancistrocoma sp. and the turbellarian Urastoma sp.). The protozoan parasite Perkinsus sp. had the highest overall prevalence among the symbiotic organisms studied (48.9%), followed by Nematopsis sp. (36.3%). The other organisms were only sporadically observed. Only the protozoan Perkinsus sp. caused alterations in the oysters' infected organs. Molecular analyses confirmed the presence of P. marinus, P. olseni and Perkinsus beihaiensis infecting the oyster C. gasar. This is the first report of P. beihaiensis in this oyster species.

  9. Biofiltration, growth and body composition of oyster Crassostrea rhizophorae in effluents from shrimp Litopenaeus vannamei1

    Directory of Open Access Journals (Sweden)

    Rafael Vieira de Azevedo

    Full Text Available The objective of this study was to use oyster as biofilter to improve the quality of effluent from shrimp farming and to assess its growth performance and body composition. It was distributed 1,080 oysters into lanterns in fiberglass tanks (170 L in a completely randomized design with three treatments (0, 60 and 120 oysters and six replicates. It was used the effluent from the sedimentation tank. It was measured weekly: temperature, salinity, dissolved oxygen and pH, and it was analyzed ammonia-N, nitrite-N, nitrate-N, orthophosphate-P, suspended solids and chlorophyll-α of the input effluent. The control tanks (without oysters were more efficient at removing ammonia-N, nitrite-N, nitrate-N and orthophosphate-P. The tanks containing oysters were more efficient at removing suspended solids and chlorophyll-α. Stocking density influenced the height growth of oysters, but not width. Wet and daily weight, condition and yield index were not affected by stocking density, and a significant increase in comparison to the initials values was observed. Body composition was not affected by stocking density, and a significant difference (p0.05. Under the conditions evaluated, the oyster Crassostrea rhizophorae improves water quality and presents growth rates and body composition similar to those obtained in traditional crops.

  10. Angiotensin I-Converting Enzyme Inhibitor Derived from Cross-Linked Oyster Protein

    Directory of Open Access Journals (Sweden)

    Cheng-Liang Xie

    2014-01-01

    Full Text Available Following cross-linking by microbial transglutaminase, modified oyster proteins were hydrolyzed to improve inhibitory activity against angiotensin-converting enzyme (ACE inhibitory activity with the use of a single protease, or a combination of six proteases. The oyster hydrolysate with the lowest 50% ACE inhibitory concentration (IC50 of 0.40 mg/mL was obtained by two-step hydrolysis of the cross-linked oyster protein using Protamex and Neutrase. Five ACE inhibitory peptides were purified from the oyster hydrolysate using a multistep chromatographic procedure comprised of ion-exchange, size exclusion, and reversed-phase liquid chromatography. Their sequences were identified as TAY, VK, KY, FYN, and YA, using automated Edman degradation and mass spectrometry. These peptides were synthesized, and their IC50 values were measured to be 16.7, 29.0, 51.5, 68.2, and 93.9 μM, respectively. Toxicity of the peptides on the HepG2 cell line was not detected. The oyster hydrolysate also significantly decreased the systolic blood pressure of spontaneously hypertensive rats (SHR. The antihypertensive effect of the oyster hydrolysate on SHR was rapid and long-lasting, compared to commercially obtained sardine hydrolysate. These results suggest that the oyster hydrolysate could be a source of effective nutraceuticals against hypertension.

  11. The invasive Pacific oyster, Crassostrea gigas, in Scandinavia coastal waters

    DEFF Research Database (Denmark)

    Dolmer, Per; Holm, Mark Wejlemann; Strand, Åsa

    visualized the need for a continued collaboration between scientists in the Scandinavian countries, as the bio-invasion is a cross-border issue and management actions then have to be synchronized, and based on a “state of the art” knowledge of the Scandinavian bio-invasion of the species. The risk assessment......A massive invasion of the Pacific oyster, Crassostrea gigas , has occurred in Scandinavia during the last decade. The introduction and dispersal was described through collaboration between scientists from Sweden, Denmark and Norway. This work has been followed up by national activities that clearly...

  12. Bioaccumulation factor of tritium in oyster and tilapia

    International Nuclear Information System (INIS)

    Garcia, T.Y.; Juan, N.B.

    1984-01-01

    This paper reports on the bioaccumulation factor as well as the residence time of tritium in marine organisms such as tilapia fish (Tilapia mossambica) and oyster (Crassostrea iredalei) reared under laboratory conditions. The organisms were submerged in aquarium water containing tritium with specific activity of 1.0 nCi/ml. The samples were analyzed for tissue-free water tritium (TFWT) by freeze drying and for tissue-bound tritium (TBT) by combustion methods. Tritiated water collected was assayed using the liquid scintillation counting technique. (author)

  13. Perbandingan Pertumbuhan Jamur Tiram Putih di Kumbung Ciseeng dan Universitas Al-Azhar Indonesia

    Directory of Open Access Journals (Sweden)

    Putri Kenanga

    2016-03-01

    Full Text Available White oyster mushroom (Pleurotus ostreatus is one of wood fungi which easy to grow at rotting wood and organic waste. White oyster mushroom is rich in protein, carbohydrates, minerals, and vitamins. Environmental factors affecting the growth of white oyster mushrooms is temperature and humidity. The study aims to compare the growth and production of white oyster mushroom in different location, Ciseeng and University of Al-Azhar Indonesia (UAI. Cultivation in UAI done in a controlled situation using autoclave sterilization, inoculation using enkas and the treatment is watering on gunny sack in the mushroom house regularly. Whereas, cultivation in Ciseeng less controlled by traditional cultivation using steam sterilization and inoculation process at open space. Wet weight, dry weight, and biological efficiency results is higher in UAI than Ciseeng at 7.95%, 14.5%, and 7.34% higher, respectively. Morphological parameter such as number of fruiting body, mushroom cap diameters, and stem lenght also show better in UAI than Ciseeng at 23.67%, 8.75%, 54.96% higher, respectively. Better result of mushroom cultivation at UAI supported by 28.3oC average temperature and 93.95% humidity, meanwhile in Ciseeng average temperature and humidity was 29.25oC and 82.15%.

  14. Overcoming restoration paradigms: value of the historical record and metapopulation dynamics in native oyster restoration

    Directory of Open Access Journals (Sweden)

    Romuald N. Lipcius

    2015-09-01

    Full Text Available Restoration strategies for native oyster populations rely on multiple sources of information, which often conflict due to time- and space-varying patterns in abundance and distribution. For instance, strategies based on population connectivity and disease resistance can differ, and extant and historical records of abundance and distribution are often at odds, such that the optimal strategy is unclear and valuable restoration sites may be excluded from consideration. This was the case for the Lynnhaven River subestuary of lower Chesapeake Bay, which was deemed unsuitable for Eastern Oyster restoration based on physical conditions, disease challenge, and extant oyster abundance. Consequently, we (i evaluated previously unknown historical data from the 1800s, (ii quantified extant oyster recruitment and abundance, physical conditions, and disease presence on constructed restoration reefs and alternative substrates, and (iii assessed simulations from biophysical models to identify potential restoration sites in the metapopulation. The collective data distinguished numerous restoration sites (i in the polyhaline zone (salinity 18.4-22.2 where disease resistance is evolving, (ii where oysters were abundant in the late 1800s-early 1900s, (iii of recent high recruitment, abundance and survival, despite consistent and elevated disease challenge, and (iv interconnected as a metapopulation via larval dispersal. Moreover, a network of constructed restoration reefs met size structure, abundance and biomass standards of restoration success. These findings demonstrate that assumptions about the suitability of sites for oyster restoration based on individual processes can be severely flawed, and that in-depth examination of multiple processes and sources of information are required for oyster reef restoration plans to maximize success. We use these findings and previous information to recommend a strategy for successful restoration of subtidal oyster reefs

  15. Contrasting impacts of ocean acidification and warming on the molecular responses of CO2-resilient oysters.

    Science.gov (United States)

    Goncalves, Priscila; Thompson, Emma L; Raftos, David A

    2017-06-02

    This study characterises the molecular processes altered by both elevated CO 2 and increasing temperature in oysters. Differences in resilience of marine organisms against the environmental stressors associated with climate change will have significant implications for the sustainability of coastal ecosystems worldwide. Some evidence suggests that climate change resilience can differ between populations within a species. B2 oysters represent a unique genetic resource because of their capacity to better withstand the impacts of elevated CO 2 at the physiological level, compared to non-selected oysters from the same species (Saccostrea glomerata). Here, we used proteomic and transcriptomic analysis of gill tissue to evaluate whether the differential response of B2 oysters to elevated CO 2 also extends to increased temperature. Substantial and distinctive effects on protein concentrations and gene expression were evident among B2 oysters responding to elevated CO 2 or elevated temperature. The combination of both stressors also altered oyster gill proteomes and gene expression. However, the impacts of elevated CO 2 and temperature were not additive or synergistic, and may be antagonistic. The data suggest that the simultaneous exposure of CO 2 -resilient oysters to near-future projected ocean pH and temperature results in complex changes in molecular processes in order to prevent stress-induced cellular damage. The differential response of B2 oysters to the combined stressors also indicates that the addition of thermal stress may impair the resilience of these oysters to decreased pH. Overall, this study reveals the intracellular mechanisms that might enable marine calcifiers to endure the emergent, adverse seawater conditions resulting from climate change.

  16. Controlling Vibrio vulnificus and spoilage bacteria in fresh shucked oysters using natural antimicrobials.

    Science.gov (United States)

    Mahmoud, B S M

    2014-01-01

    This study evaluated the efficacy of grape seed extract (GE), citric acid (CA) and lactic acid (LA) on the inactivation of Vibrio vulnificus and inherent microflora in fresh shucked oysters. The minimum inhibitory concentration (MIC) of GE, CA or LA against V. vulnificus was determined. Furthermore, the shucked oysters were artificially inoculated with V. vulnificus. The inoculated shucked oysters (25 g) were then dipped in 250 ml GE, CA or LA solutions for 10 min. The population of V. vulnificus in shucked oysters was determined. The effects of the treatments with GE, CA or LA solutions on the inherent microbiota in fresh shucked oysters during storage at 5°C for 20 days were also studied. The MICs of GE, CA or LA against V. vulnificus were 10.0, 5.0 or 1.0 mg ml(-1), respectively. The concentrations of 500, 300 or 150 mg ml(-1) GE, CA or LA solutions were needed to reduce the population of V. vulnificus to below the detection level (1.0 log g(-1)). Treatment with 500, 300, 150 mg ml(-1) GE, CA or LA significantly reduced the initial inherent microbiota in fresh shucked oysters, and inherent levels were significantly (P Oysters filter large volume of seawater during their feeding activities that concentrate bacteria such as Vibrio vulnificus in their body. The presence of V. vulnificus in oysters has a serious impact on public health and international trade. There is increasing concern over the use of chemical preservatives. Furthermore, the food industry is looking for new natural preservation methods. This study indicated that lactic acid and citric acid wash solutions could offer an inexpensive, natural and strong approach to control V. vulnificus and spoilage bacteria in fresh shucked for the oyster industry. © 2013 The Society for Applied Microbiology.

  17. Nutrient bioassimilation capacity of aquacultured oysters: quantification of an ecosystem service.

    Science.gov (United States)

    Higgins, Colleen B; Stephenson, Kurt; Brown, Bonnie L

    2011-01-01

    Like many coastal zones and estuaries, the Chesapeake Bay has been severely degraded by cultural eutrophication. Rising implementation costs and difficulty achieving nutrient reduction goals associated with point and nonpoint sources suggests that approaches supplemental to source reductions may prove useful in the future. Enhanced oyster aquaculture has been suggested as one potential policy initiative to help rid the Bay waters of excess nutrients via harvest of bioassimilated nutrients. To assess this potential, total nitrogen (TN), total phosphorous (TP), and total carbon (TC) content were measured in oyster tissue and shell at two floating-raft cultivation sites in the Chesapeake Bay. Models were developed based on the common market measurement of total length (TL) for aquacultured oysters, which was strongly correlated to the TN (R2 = 0.76), TP (R2 = 0.78), and TC (R2 = 0.76) content per oyster tissue and shell. These models provide resource managers with a tool to quantify net nutrient removal. Based on model estimates, 10(6) harvest-sized oysters (76 mm TL) remove 132 kg TN, 19 kg TP, and 3823 kg TC. In terms of nutrients removed per unit area, oyster harvest is an effective means of nutrient removal compared with other nonpoint source reduction strategies. At a density of 286 oysters m(-2), assuming no mortality, harvest size nutrient removal rates can be as high as 378 kg TN ha(-1), 54 kg TP ha(-1), and 10,934 kg TC ha(-1) for 76-mm oysters. Removing 1 t N from the Bay would require harvesting 7.7 million 76-mm TL cultivated oysters.

  18. Mortalities of Eastern and Pacific oyster Larvae caused by the pathogens Vibrio coralliilyticus and Vibrio tubiashii.

    Science.gov (United States)

    Richards, Gary P; Watson, Michael A; Needleman, David S; Church, Karlee M; Häse, Claudia C

    2015-01-01

    Vibrio tubiashii is reported to be a bacterial pathogen of larval Eastern oysters (Crassostrea virginica) and Pacific oysters (Crassostrea gigas) and has been associated with major hatchery crashes, causing shortages in seed oysters for commercial shellfish producers. Another bacterium, Vibrio coralliilyticus, a well-known coral pathogen, has recently been shown to elicit mortality in fish and shellfish. Several strains of V. coralliilyticus, such as ATCC 19105 and Pacific isolates RE22 and RE98, were misidentified as V. tubiashii until recently. We compared the mortalities caused by two V. tubiashii and four V. coralliilyticus strains in Eastern and Pacific oyster larvae. The 50% lethal dose (LD50) of V. coralliilyticus in Eastern oysters (defined here as the dose required to kill 50% of the population in 6 days) ranged from 1.1 × 10(4) to 3.0 × 10(4) CFU/ml seawater; strains RE98 and RE22 were the most virulent. This study shows that V. coralliilyticus causes mortality in Eastern oyster larvae. Results for Pacific oysters were similar, with LD50s between 1.2 × 10(4) and 4.0 × 10(4) CFU/ml. Vibrio tubiashii ATCC 19106 and ATCC 19109 were highly infectious toward Eastern oyster larvae but were essentially nonpathogenic toward healthy Pacific oyster larvae at dosages of ≥1.1 × 10(4) CFU/ml. These data, coupled with the fact that several isolates originally thought to be V. tubiashii are actually V. coralliilyticus, suggest that V. coralliilyticus has been a more significant pathogen for larval bivalve shellfish than V. tubiashii, particularly on the U.S. West Coast, contributing to substantial hatchery-associated morbidity and mortality in recent years. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  19. Hemolymph chemistry and histopathological changes in Pacific oysters (Crassostrea gigas) in response to low salinity stress.

    Science.gov (United States)

    Knowles, Graeme; Handlinger, Judith; Jones, Brian; Moltschaniwskyj, Natalie

    2014-09-01

    This study described seasonal differences in the histopathological and hemolymph chemistry changes in different family lines of Pacific oysters, Crassostrea gigas, in response to the stress of an abrupt change to low salinity, and mechanical grading. The most significant changes in pallial cavity salinity, hemolymph chemistry and histopathological findings occurred in summer at low salinity. In summer (water temperature 18°C) at low salinity, 9 (25.7% of full salinity), the mean pallial cavity salinity in oysters at day 3 was 19.8±1.6 (SE) and day 10 was 22.8±1.6 (SE) lower than oysters at salinity 35. Associated with this fall in pallial cavity salinity, mean hemolymph sodium for oysters at salinity 9 on day 3 and 10 were 297.2mmol/L±20(SE) and 350.4mmol/L±21.3(SE) lower than oysters at salinity 35. Similarly mean hemolymph potassium in oysters held at salinity 9 at day 3 and 10 were 5.6mmol/L±0.6(SE) and 7.9mmol/L±0.6 (SE) lower than oysters at salinity 35. These oysters at low salinity had expanded intercellular spaces and significant intracytoplasmic vacuolation distending the cytoplasm of epithelial cells in the alimentary tract and kidney and hemocyte infiltrate (diapedesis) within the alimentary tract wall. In contrast, in winter (water temperature 8°C) oyster mean pallial cavity salinity only fell at day 10 and this was by 6.0±0.6 (SE) compared to that of oysters at salinity 35. There were limited histopathological changes (expanded intercellular spaces and moderate intracytoplasmic vacuolation of renal epithelial cells) in these oysters at day 10 in low salinity. Mechanical grading and family line did not influence the oyster response to sudden low salinity. These findings provide additional information for interpretation of non-lethal, histopathological changes associated with temperature and salinity variation. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. [History of oyster as drug from the origin to the 21st century].

    Science.gov (United States)

    Bonnemain, Bruno

    2015-06-01

    Since Antiquity, oyster is a subject of interest and medical use, as indicated by Oribiase and Galien. From the 17th century, this unique drug was proposed by physicians for various diseases, and more often for (la rage). One could think that that drug disappeared at the 20th and 21st centuries. But we can observe that it was still recommended by several authors as drug. Still today, companies offer oyster under various forms for allopathic and homeopathic treatments, as well as for food supplement. Research are ongoing to discover active substances within oyster and their potential medical interests.

  1. Growth, mortality and susceptibility of oyster Crassostrea spp. to Perkinsus spp. infection during on growing in northeast Brazil

    Directory of Open Access Journals (Sweden)

    Marcos Paiva Scardua

    2017-11-01

    Full Text Available Abstract Crassostrea rhizophorae and C. gasar oysters are cultivated in the northeast region. Perkinsus parasites infect bivalves, and their effects on oysters from tropical regions are poorly understood. This study evaluated the impact of Perkinsus infection on the productive traits of native oysters. Oysters were sampled bimonthly during 7 months, from July 2010 to February 2011, to evaluate growth rate, mortality and shell color patterns (white and dark-gray (n = 500, and to determine the prevalence and intensity of Perkinsus (n = 152. Perkinsus and Crassostrea species were determined using molecular tools. Results showed that most dark-gray (90%, n = 20 and white (67%, n = 18 oysters were C. gasar and C. rhizophorae, respectively. Oysters showed a high growth rate and moderate cumulative mortality (44%. C. gasar oysters grew better and showed lower mortality and lower incidence of Perkinsus compared to C. rhizophorae. The mean prevalence of Perkinsus was moderate (48%, but the infection intensity was light (2.2. Perkinsosis affected very small oysters (19.4 mm. In conclusion, native oysters, especially C. gasar, have a great potential for culture, mortality is not associated with perkinsosis, and the shell color of oysters can be used to improve selection for spats with better performance.

  2. Effect of linear alkylbenzene mixtures and sanitary sewage in biochemical and molecular responses in pacific oyster Crassostrea gigas.

    Science.gov (United States)

    Flores-Nunes, Fabrício; Mattos, Jacó J; Zacchi, Flávia L; Serrano, Miguel A S; Piazza, Clei E; Sasaki, Silvio T; Taniguchi, Satie; Bicego, Márcia C; Melo, Cláudio M R; Bainy, Afonso C D

    2015-11-01

    Urban effluents are rich in nutrients, organic matter, pharmaceuticals and personal care products (PPCPs), pesticides, hydrocarbons, surfactants, and others. Previous studies have shown that oysters Crassostrea gigas accumulate significant levels of linear alkylbenzenes (LABs) in sanitary sewage contaminated sites, but there is little information about its toxicological effects in marine bivalves. The aim of this study was to analyze the transcription of genes in two tissues of C. gigas exposed for 12, 24, and 36 h to LABs or sanitary sewage. Likewise, the activity of antioxidant and biotransformation enzymes was measured in oysters exposed for 36 h in all groups. Oysters exposed to LABs and oysters exposed to sanitary sewage showed different patterns of transcriptional responses. LAB-exposed oysters showed lower level of biological responses than the oysters exposed to sanitary sewage. Despite the ability of the oyster C. gigas to accumulate LABs (28-fold), the data indicate that these contaminants are not the cause for the transcriptional responses observed in oysters exposed to sanitary sewage. Possibly, the biological changes observed in the sanitary sewage-exposed oysters are associated with the presence of other contaminants, which might have caused synergistic, additive, or antagonistic effects. The results show that FABP-like and GST-ω-like messenger RNAs (mRNAs) have a rapid response in tissues of oyster C. gigas exposed to sanitary sewage, suggesting a possible protective response and a role in maintaining homeostasis of these organisms.

  3. Taxonomic Identity, Geographic Distribution, and Commercial Exploitation of the Culinary-Medicinal Mushroom Pleurotus nebrodensis (Basidiomycetes).

    Science.gov (United States)

    Venturella, Giuseppe; Zervakis, Georgios I; Polemis, Elias; Gargano, Maria Letizia

    2016-01-01

    An updated overview of the outcome of studies conducted on the culinary-medicinal mushroom Pleurotus nebrodensis is presented by placing emphasis on the clarification of the taxonomic identity of P. nebrodensis and other related taxa possessing entirely white to cream basidiomes, which grow in association with different plants of the family Apiaceae. Cultivation techniques, quality of the product sold and sales price, as well as nutritional and medicinal aspects are discussed. Taking also into consideration the high economic importance of P. nebrodensis, it is essential to proceed with the verification of the commercial strains currently available in the international market under the name of "P. nebrodensis" since it is very probable that many (or most) of them do not represent the real P. nebrodensis. TO confirm this hypothesis, an in silico analysis was conducted on a large of number of ITS1-5.8S-ITS2 rRNA sequences deposited in the National Center for Biotechnology Information database under the name P. nebrodensis. Results demonstrated that all "P nebrodensis" material examined from China (plus several sequences of no reported origin) corresponded to P. eryngii subsp. tuoliensis, with only 2 exceptions, which were grouped within P. eryngii sensu stricto. The real P. nebrodensis biological material from Italy and Greece is certified and is available upon request by the authors at the University of Palermo and the Agricultural University of Athens.

  4. Evaluation of Antioxidant, Anti-cholinesterase, and Anti-inflammatory Effects of Culinary Mushroom Pleurotus pulmonarius.

    Science.gov (United States)

    Nguyen, Trung Kien; Im, Kyung Hoan; Choi, Jaehyuk; Shin, Pyung Gyun; Lee, Tae Soo

    2016-12-01

    Culinary mushroom Pleurotus pulmonarius has been popular in Asian countries. In this study, the anti-oxidant, cholinesterase, and inflammation inhibitory activities of methanol extract (ME) of fruiting bodies of P. pulmonarius were evaluted. The 1,1-diphenyl-2-picryl-hydrazy free radical scavenging activity of ME at 2.0 mg/mL was comparable to that of butylated hydroxytoluene, the standard reference. The ME exhibited significantly higher hydroxyl radical scavenging activity than butylated hydroxytoluene. ME showed slightly lower but moderate inhibitory activity against acetylcholinesterase (AChE) and butyrylcholinesterase than galantamine, a standard AChE inhibitor. It also exhibited protective effect against cytotoxicity to PC-12 cells induced by glutamate (10~100 µg/mL), inhibitory effect on nitric oxide (NO) production and inducible nitric oxide synthase protein expression in lipopolysaccharide-stimulated RAW 264.7 macrophages, and carrageenan-induced paw edema in a rat model. High-performance liquid chromatography analysis revealed the ME of P. pulmonarius contained at least 10 phenolic compounds and some of them were identified by the comparison with known standard phenolics. Taken together, our results demonstrate that fruiting bodies of P. pulmonarius possess antioxidant, anti-cholinesterase, and inflammation inhibitory activities.

  5. Sesquiterpenoids with PTP1B Inhibitory Activity and Cytotoxicity from the Edible Mushroom Pleurotus citrinopileatus.

    Science.gov (United States)

    Tao, Qiao-Qiao; Ma, Ke; Bao, Li; Wang, Kai; Han, Jun-Jie; Wang, Wen-Zhao; Zhang, Jin-Xia; Huang, Chen-Yang; Liu, Hong-Wei

    2016-05-01

    One new perhydrobenzannulated 5,5-spiroketal sesquiterpene, pleurospiroketal F (1), as well as six new modified bisabolene sesquiterpenes pleurotins A-F (2-7) were isolated from solid-state fermentation of Pleurotus citrinopileatus. The structures of compounds 1-7 were determined by NMR and MS spectroscopic analysis. The absolute configuration of 1 was determined by X-ray diffraction analysis, while the absolute configurations of 3-7 were assigned using the in situ dimolybdenum circular dichroism method and circular dichroism data comparison. Protein tyrosine phosphatase 1B plays a crucial role as a negative regulator of the insulin-dependent signal cascades. Therefore, the protein tyrosine phosphatase 1B inhibitor can be used for treating type 2 diabetes mellitus and obesity. Compounds 2 and 6 showed moderate inhibitory effects on protein tyrosine phosphatase 1B with IC50 s of 32.1 µM and 30.5 µM, respectively. The kinetic study confirmed compound 2 to be a noncompetitive inhibitor. Compounds 1-7 did not show cytotoxic activity against cancer cell lines (IC50 > 50 µM). Georg Thieme Verlag KG Stuttgart · New York.

  6. Biochemical Characteristics of Three Laccase Isoforms from the Basidiomycete Pleurotus nebrodensis

    Directory of Open Access Journals (Sweden)

    Xianghe Yuan

    2016-02-01

    Full Text Available The characterization of three laccase isoforms from Pleurotus nebrodensis is described. Isoenzymes Lac1, Lac2 and Lac3 were purified to homogeneity using ion exchange chromatography on DEAE-cellulose, CM-cellulose and Q-Sepharose and a gel filtration step on Superdex 75. The molecular weights of the purified laccases were estimated to be 68, 64 and 51 kDa, respectively. The isoenzymes demonstrated the same optimum pH at 3.0 but slightly different temperature optima: 50–60 °C for Lac1 and Lac3 and 60 °C for Lac2. Lac2 was always more stable than the other two isoforms and exposure to 50 °C for 120 min caused 30% loss in activity. Lac2 was relatively less stable than the other two isoforms when exposed to the pH range of 3.0–8.0 for 24 h, but inactivation only occurred initially, with around 70% residual activity being maintained during the whole process. Oxidative ability towards aromatic compounds varied substantially among the isoforms and each of them displayed preference toward some substrates. Kinetic constants (Km, Kcat were determined by using a 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid diammonium salt (ABTS assay, with Lac3 showing the best affinity and Lac2 displaying the highest catalytic efficiency. Amino acid sequences from peptides derived from digestion of isoenzymes showed great consistency with laccases in the databases.

  7. Effect of Pleurotus eryngii Mushroom β-Glucan on Quality Characteristics of Common Wheat Pasta.

    Science.gov (United States)

    Kim, SunHee; Lee, Jo-Won; Heo, Yena; Moon, BoKyung

    2016-04-01

    The objective of this study was to evaluate the effect of β-glucan-rich fractions (BGRFs) from Pleurotus eryngii mushroom powder on the quality, textural properties, and sensory evaluation of common wheat pasta. Pasta was prepared from semolina flour and common wheat flour by replacing common wheat flour at 2%, 4%, and 6% with BGRFs. Semolina flour showed significantly higher viscosities than common wheat flour samples. However, all viscosities, except the breakdown viscosity, were reduced with increasing percentages of BGRFs. Replacement of the common wheat flour with BGRFs resulted in a reddish brown colored pasta with a lower L* value and a higher a* value. The common wheat pastas containing up to 4% BGRFs were not significantly different from semolina pasta with regard to cooking loss. Addition of up to 2% BGRFs had no significant impact on swelling index and water absorption. The addition of BGRFs in common wheat flour had a positive effect on the quality of common wheat pasta and resulted in hardness values similar to those of semolina pasta. In a sensory evaluation, cooked pasta with 2% BGRFs had the highest overall acceptability score. In summary, the results showed that common wheat flour containing 4% BGRFs could be used to produce pasta with an improved quality and texture properties similar to semolina pasta. © 2016 Institute of Food Technologists®

  8. Effect of Pleurotus eryngii stalk residue on the oxidative status and meat quality of broiler chickens.

    Science.gov (United States)

    Lee, Tzu-Tai; Ciou, Jhih-Ying; Chiang, Ching-Jen; Chao, Yun-Peng; Yu, Bi

    2012-11-07

    Pleurotus eryngii stalk residue (PESR) is a byproduct of the edible portion of the fruiting body. The present study was conducted to evaluate the effects of PESR on the oxidative status and meat quality of broilers. Two hundred fifty 1-d-old male broilers (Arbor Acre) were evenly divided by gender and randomly allocated into control (corn-soybean meal diet) or 1.0, 5.0, 10.0, or 20.0 g/kg dried PESR groups. The results revealed that at 35 d, the dried PESR groups displayed a significantly increased water-holding capacity and decreased storage loss of breast and thigh fillets when compared to the control group. Regarding fillets color, the L* (lightness) values were lower and the a* (redness) and b* (yellowness) values were higher following dried PESR supplementation. In 5.0-20.0 g/kg PESR supplementation groups, the activities of antioxidative enzymes were significantly elevated in serum, liver, spleen, and fillet tissues when compared to control group. Additionally, malondialdehyde production was slightly decreased in the PESR supplementation groups. Lower crude fat contents were observed in fillet tissues of 5.0-20.0 g/kg PESR groups when compared with the control group. In conclusion, PESR may potentially be used as an antioxidant to decrease lipid peroxidation and improve meat quality in broilers.

  9. Production of ligninolytic enzymes by solid-state fermentation using Pleurotus eryngii.

    Science.gov (United States)

    Akpinar, Merve; Urek, Raziye Ozturk

    2012-01-01

    Pleurotus eryngii (DC.) Gillet (MCC58) was investigated for its ability to produce various ligninolytic enzymes such as laccase (Lac), manganese peroxidase (MnP), aryl alcohol oxidase (AAO), and lignin peroxidase (LiP) by solid-state fermentation (SSF), which was carried out using a support substrate from the fruit juice industry. The chemical content of grape waste from this industry was studied. Also, the production patterns of these extracellular enzymes were researched during the growth of the organism for a period of 20 days and the protein, reducing sugar, and nitrogen levels were monitored during the stationary cultivation. The highest Lac activity was obtained as 2247.62 ± 75 U/L on day 10 in the presence of 750 µM Mn²⁺, while the highest MnP activity was attained as 2198.44 ± 65 U/L on day 15 in the presence of 500 µM Mn²⁺. Decolorization of methyl orange and reactive red 2 azo dyes was also achieved with ligninolytic enzymes, produced in SSF of P. eryngii.

  10. Decontamination of Fumonisin B1 in maize grain by Pleurotus eryngii and antioxidant enzymes

    Directory of Open Access Journals (Sweden)

    Miriam HAIDUKOWSKI

    2017-05-01

    Full Text Available Fumonisin B1 (FB1 is among the most common mycotoxins found in maize kernels and maize products worldwide. The microbiological process of detoxification and transformation of toxic organic pollutants is a promising method for foodstuffs decontamination. Some basidiomycetes, such as the Pleurotus eryngii species complex, include several important commercial edible varieties that can detoxify polycyclic organic compounds and a range of wastes and pollutants. We investigated the potential role of P. eryngii, one of the most consumed mushrooms, in the decontamination of FB1 in maize. In addition, selected antioxidant enzymes, (soluble peroxidase (POD, catalase (CAT and ascorbate peroxidase, primarily involved in control of cell hydrogen peroxide levels, and lignin degradation, were analyzed, to evaluate their contributions to the molecular mechanisms of FB1 by P. eryngii. FB1 decontamination by P. eryngii and involvement of CAT and POD enzymes in the control of toxic decontamination levels of H2O2 were demonstrated. A consistent reduction of FB1 was observed at different incubation times. The average decrease levels of FB1, with respect to the control cultures, ranged from 45 to 61% (RSD < 15%. This study is a possible eco-friendly approach to reducing this mycotoxin in the feed supply chains.

  11. Heterologous production of the stain solving peptidase PPP1 from Pleurotus pulmonarius.

    Science.gov (United States)

    Leonhardt, Robin-Hagen; Krings, Ulrich; Berger, Ralf G; Linke, Diana

    2016-05-01

    A novel stain solving subtilisin-like peptidase (PPP1) was identified from the culture supernatant of the agaricomycete Pleurotus pulmonarius. It was purified to homogeneity using a sequence of preparative isoelectric focusing, anion exchange and size exclusion chromatography. Peptides were identified by ab initio sequencing (nLC-ESI-QTOF-MS/MS), characterizing the enzyme as a member of the subtilase family (EC 3.4.21.X). An expression system was established featuring the pPIC9K vector, an alternative Kozak sequence, the codon optimized gene ppp1 gene without the native signal sequence with C-terminal hexa-histidine tag, and Pichia pastoris GS115 as expression host. Intracellular active enzyme was obtained from cultivations in shake flasks and in a five liter bioreactor. With reaction optima of 40 °C and a pH > 8.5, considerable bleaching of pre-stained fabrics (blood, milk and India ink), and the possibility of larger-scale production, the heterologous enzyme is well suitable for detergent applications, especially at lower temperatures as part of a more energy- and cost-efficient washing process. Showing little sequence similarity to other subtilases, this unique peptidase is the first subtilisin-like peptidase from Basidiomycota, which has been functionally produced in Pichia pastoris.

  12. Chemical composition of Pleurotus pulmonarius (Fr. Quél., substrates and residue after cultivation

    Directory of Open Access Journals (Sweden)

    Silva Sueli Oliveira

    2002-01-01

    Full Text Available The cultivation of Pleurotus pulmonarius was carried out on different substrate: cotton waste (A leaves of Cymbopogon citratus (B and leaves of Panicum maximum Jacq. (C. The mushroom had a varied chemical composition; nevertheless they contained a good composition for to be used as a good source of protein for human kind. The results showed the higher protein content (29.19% and fibre (9.0% for the mushroom that were cultivated on cotton peel. The substrate composition and the residue composition after the mushroom harvest were: Protein for the substrate "A" (10.63% and 9.35%, "B" (7.87% and 4.24% and "C" (7.55% and 5.90 %; Lipids "A" (4.17% and 2.03%, "B"(2.77% and 3.20% and "C" (0.91% and 2.05%; Fibres "A" (49.02% and 37.02%, "B" (28.40% and 23.26% and "C" (37.50% and 26.66% respectively. The substrate "A" showed 0.048% of iron and "C" 0.14% of magnesium, 0.31% of potassium and 0.26% of calcium. In the substrate "B" the quantity of the minerals were very low in comparison to the other substrates. The residues after the harvest of mushroom could be used as fertiliser or as complement in the composition for animal feed.

  13. Fates of nickel and fluoranthene during the bioremediation by Pleurotus eryngii in three different soils.

    Science.gov (United States)

    Tang, Xia; Dong, Shunwen; Shi, Wenjin; Gao, Ni; Zuo, Lei; Xu, Heng

    2016-11-01

    This study focused on the bioremediation role of Pleurotus eryngii in different characteristics soils contaminated with nickel (Ni) and fluoranthene. The results of bioremediation experiments showed that fluoranthene had a positive effect on the growth of P. eryngii, whereas Ni exerted a negative influence. The concentration of fluoranthene significantly decreased in inoculated soil accounting for 86.39-91.95% of initial concentration in soils and 71.46-81.76% in non-inoculated soils, which showed that the dissipation of fluoranthene was enhanced by mushroom inoculating. The highest removal rates of fluoranthene in sandy loam, loamy clay, and sandy soils reached to 87.81, 86.39, and 91.95%, respectively, which demonstrated that P. eryngii was more suitable for the bioremediation of sandy soil contaminated with fluoranthene. In addition, the presence of Ni tended to decrease the dissipation of fluoranthene in inoculated soil. Higher ligninolytic enzymes activities were detected in inoculated soils, resulting in the enhanced dissipation of fluoranthene in inoculated soils. Furthermore, P. eryngii had the ability to uptake Ni (4.88-39.53 mg kg -1 ) in co-contamination soil. In conclusion, the inoculating of P. eryngii was effective in remediating of Ni-fluoranthene co-contaminated soils. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Functional expression of a valencene dioxygenase from Pleurotus sapidus in E. coli.

    Science.gov (United States)

    Zelena, Kateryna; Krings, Ulrich; Berger, Ralf G

    2012-03-01

    Valencene dioxygenase (ValOx) from the edible basidiomycete Pleurotus sapidus converted the sesquiterpene (+)-valencene to the valuable grapefruit flavour (+)-nootkatone and to nootkatols through intermediate hydroperoxides. Expression of the enzyme was carried out in the cytosol and periplasm of Escherichia coli. The heterologous production led to high yields of inclusion bodies. The poor yield of soluble recombinant protein was improved by various strategies including cold shock expression, chaperone co-expression, and employment of mutant E. coli strains. Up to 60 mg of the biologically active, soluble ValOx was produced by cold shock under control of the cspA promoter at 8 °C in the BL21(DE3)Star strain and co-expression of the E. coli trigger factor. The recombinant enzyme, purified using the N-terminal His tag, showed the catalytic properties of the wild-type enzyme, as was confirmed by the LC-MS analysis of hydroperoxide intermediates and GC-MS analysis of the volatile products. Copyright © 2011 Elsevier Ltd. All rights reserved.

  15. Neuropeptides encoded by the genomes of the Akoya pearl oyster Pinctata fucata and Pacific oyster Crassostrea gigas: a bioinformatic and peptidomic survey.

    Science.gov (United States)

    Stewart, Michael J; Favrel, Pascal; Rotgans, Bronwyn A; Wang, Tianfang; Zhao, Min; Sohail, Manzar; O'Connor, Wayne A; Elizur, Abigail; Henry, Joel; Cummins, Scott F

    2014-10-02

    Oysters impart significant socio-ecological benefits from primary production of food supply, to estuarine ecosystems via reduction of water column nutrients, plankton and seston biomass. Little though is known at the molecular level of what genes are responsible for how oysters reproduce, filter nutrients, survive stressful physiological events and form reef communities. Neuropeptides represent a diverse class of chemical messengers, instrumental in orchestrating these complex physiological events in other species. By a combination of in silico data mining and peptide analysis of ganglia, 74 putative neuropeptide genes were identified from genome and transcriptome databases of the Akoya pearl oyster, Pinctata fucata and the Pacific oyster, Crassostrea gigas, encoding precursors for over 300 predicted bioactive peptide products, including three newly identified neuropeptide precursors PFGx8amide, RxIamide and Wx3Yamide. Our findings also include a gene for the gonadotropin-releasing hormone (GnRH) and two egg-laying hormones (ELH) which were identified from both oysters. Multiple sequence alignments and phylogenetic analysis supports similar global organization of these mature peptides. Computer-based peptide modeling of the molecular tertiary structures of ELH highlights the structural homologies within ELH family, which may facilitate ELH activity leading to the release of gametes. Our analysis demonstrates that oysters possess conserved molluscan neuropeptide domains and overall precursor organization whilst highlighting many previously unrecognized bivalve idiosyncrasies. This genomic analysis provides a solid foundation from which further studies aimed at the functional characterization of these molluscan neuropeptides can be conducted to further stimulate advances in understanding the ecology and cultivation of oysters.

  16. Characteristic crystal orientation of folia in oyster shell, Crassostrea gigas

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Seung Woo [Department of Chemical and Biomolecular Engineering, Sogang University, Seoul (Korea, Republic of); Kim, Gyeung Ho [Nano-Materials Reserch Center, Korea Institute of Science and Technology, Seoul (Korea, Republic of); Choi, Cheong Song [Department of Chemical and Biomolecular Engineering, Sogang University, Seoul (Korea, Republic of)], E-mail: cschoi@sogang.ac.kr

    2008-03-10

    The thin sheets of calcite, termed folia, that make up much of the shell of an oyster are composed of foliated lath. Folia of the giant Pacific oyster (Crassostrea gigas) were examined using TEM (transmission electron microscopy) and tested using microindentation and nanoindentation techniques. Analysis of the Kikuchi patterns obtained from the folia showed that there are two types (type I and type II) of preferred orientation, with an angle of around 70{sup o} between them. Nanoindentation tests showed that the folia exhibit a hardness of about 3 GPa and elastic modulus of about 73 GPa. Microcracks were generated using a microindenter in order to study the fracture mechanisms of the folia. Following on from these investigations, fracture mechanisms are discussed in conjunction with the correlation between preferred orientation and structural characteristics during cracking of the folia. Comparing the morphology and the polymorphism with nacre (also known as mother of pearl), the advantages of the relatively fast crystal growth and less amount of organic matrix in folia may have interesting implications for the development of sophisticated synthetic materials.

  17. Mutation breeding and submerged fermentation of a Pleurotus polysaccharide high-yield strain with low-energy heavy ions implantation

    International Nuclear Information System (INIS)

    Chen Henglei; Wan Honggui; Lv Changwu; Zeng Xianxian

    2010-01-01

    Pleurotus polysaccharide high-yield strains were selected through a method of auxotrophic primary screening and Shake-flask fermentation re-screening after low-energy heavy ions (the fluence of 1.2 x 10 16 N + /cm 2 at the energy of 15 keV) stepwise implantation. Two Pleurotus polysaccharide high-yield strains, PFPH-1 and PFPH-2, were selected with stable mycelium polysaccharide yield. The mycelium polysaccharide yield of PFPH-1 and PFPH-2 increased by 46.55% and 75.14%, respectively, compared to the original strain. The accumulation of mycelium biomass and intracellular polysaccharides were monitored in the submerged fermentation of Pleurotus ferulae by supplementation of various carbon and nitrogen sources as well as inorganic salts and pH alteration. The optima1 submerged fermentation medium favoring the accumulation of mycelium biomass and intracellular polysaccharides of PFPH-2 consisted of 1.0% wheat flour, 2.0% sucrose, 2.0% soybean flour, 1.5% bran extract, 0.2% K 2 HPO 4 , and 0.15% MgSO 4 ·7H 2 O, with a fittest pH value of 5.64. The orthogonal combination of the optimal carbon and nitrogen sources with inorganic salts indicates a synergistic effect on the accumulation of mycelium biomass and intracellular polysaccharides in the submerged fermentation of PFPH-2. The yield of mycelium polysaccharides of PFPH-2 increased to 903.73 ± 1.23 mg·L -1 by the end of fermentation. (authors)

  18. New sesquiterpenoids from the edible mushroom Pleurotus cystidiosus and their inhibitory activity against α-glucosidase and PTP1B.

    Science.gov (United States)

    Tao, Qiao-Qiao; Ma, Ke; Bao, Li; Wang, Kai; Han, Jun-Jie; Zhang, Jin-Xia; Huang, Chen-Yang; Liu, Hong-Wei

    2016-06-01

    Nine new sesquiterpenoids, clitocybulol derivatives, clitocybulols G-O (1-9) and three known sesquiterpenoids, clitocybulols C-E (10-12), were isolated from the solid culture of the edible fungus Pleurotus cystidiosus. The structures of compounds 1-12 were determined by spectroscopic methods. The absolute configurations of compounds 1-9 were assigned via the circular dichroism (CD) data analysis. Compounds 1, 6 and 10 showed moderate inhibitory activity against protein tyrosine phosphatase-1B (PTP1B) with IC50 values of 49.5, 38.1 and 36.0μM, respectively. Copyright © 2016. Published by Elsevier B.V.

  19. Year-round screening of noncommercial and commercial oysters for the presence of human pathogenic viruses

    NARCIS (Netherlands)

    Lodder-Verschoor, F.; Husman, A.M.R.; Berg, van den H.H.J.L.; Stein, A.; Pelt-Heerschap, van H.M.L.; Poel, van der W.H.M.

    2005-01-01

    Consumption of virus-contaminated shellfish has caused numerous outbreaks of gastroenteritis and hepatitis worldwide. In The Netherlands, oysters are cultured and imported both for consumption and export; therefore, the presence of noroviruses, rotaviruses, astroviruses, hepatitis A viruses, and

  20. Evaluation of waste concrete road materials for use in oyster aquaculture.

    Science.gov (United States)

    2013-02-01

    The primary objective of this study was to determine the suitability of recycled concrete : aggregate (RCA) from road projects as bottom conditioning material for on-bottom oyster : aquaculture in the Chesapeake Bay. The testing was designed to (1) e...