ANTIMICROBIAL PROPERTIES OF PLEUROTUS ERYNGII AND LENTINUS EDODES HYDRO-ALCOHOLIC EXTRACTS
Directory of Open Access Journals (Sweden)
Gabriela Popa
2016-11-01
Full Text Available Besides superior nutritional values mushrooms posed significant medicinal properties. Hydro-alcoholic extracts of several isolates of Pleurotus eryngii and Lentinus edodes mushroom species were investigated for their antimicrobial activities against pathogenic microorganisms with medicinal importance. Antimicrobial activities of the extracts were evaluated by the agar disk diffusion method. Results revealed that the 70% ethylic alcohol extracts have significant inhibitory activities against Bacillus subtilis var. spizizinii, Escherichia coli and Staphylococcus aureus. The results showed that the 70% ethanol extracts of Pleurotus eryngii and Lentinus edodes mushroom isolates may have biopharmaceutical potentiality.
β-Carotene from Yeasts Enhances Laccase Production of Pleurotus eryngii var. ferulae in Co-culture.
Guo, Chaolin; Zhao, Liting; Wang, Feng; Lu, Jian; Ding, Zhongyang; Shi, Guiyang
2017-01-01
Laccase is widely used in several industrial applications and co-culture is a common method for enhancing laccase production in submerged fermentation. In this study, the co-culture of four yeasts with Pleurotus eryngii var. ferulae was found to enhance laccase production. An analysis of sterilization temperatures and extraction conditions revealed that the stimulatory compound in yeasts was temperature-sensitive, and that it was fat-soluble. An LC-MS analysis revealed that the possible stimulatory compound for laccase production in the four yeast extracts was β-carotene. Moreover, the addition of 4 mg β-carotene to 150 mL of P. eryngii var. ferulae culture broth improved laccase production by 2.2-fold compared with the control (i.e., a monoculture), and was similar to laccase production in co-culture. In addition, the enhanced laccase production was accompanied by an increase of lac gene transcription, which was 6.2-time higher than the control on the fifth day. Therefore, it was concluded that β-carotene from the co-cultured yeasts enhanced laccase production in P. eryngii var. ferulae , and strains that produce β-carotene could be selected to enhance fungal laccase production in a co-culture. Alternatively, β-carotene or crude extracts of β-carotene could be used to induce high laccase production in large scale.
Urbanelli, S; Della Rosa, V; Punelli, F; Porretta, D; Reverberi, M; Fabbri, A A; Fanelli, C
2007-03-01
Wild populations of edible species are important source of genetic variability for cultivated lines that can undergo a drastic loss of diversity resulting from man's selection. The development of tools aimed at the clear-cut and safe identification and assessment of genetic variability of the wild and cultivated strains is thus a fundamental goal of molecular genetic research. In this study, we used two polymerase chain reaction (PCR)-based fingerprinting methods-amplified fragment length polymorphism (AFLP) and restriction fragment length polymorphism (RFLP) of laccase and manganese peroxidase genes-to assess genetic differences among strains and independently evolving lineages belonging to the Pleurotus eryngii complex. Both laccase RFLP and AFLP have been proved to distinguish unambiguously the three taxa studied: Pleurotus ferulae, P. eryngii, and P. eryngii var. nebrodensis. AFLP also showed enough sensitivity to detect polymorphisms among the strains, proving to be an efficient DNA fingerprinting tool in studies of strain assignment. The divergent RFLP laccase and manganese peroxidase patterns are also discussed in relation to the role played by these genes in the interaction between these fungi and their host plants.
Directory of Open Access Journals (Sweden)
javad janpoor
2018-03-01
Full Text Available Introduction: King oyster mushroom (Pleurotus eryngii belongs to Basidiomycota division, Agaricomycetes class and Pleurotaceae family. This mushroom generally grows on wood wastes of Apiaceae family. The Pleurotus eryngii is found in pastures, meadows, gardens and seldom in grassy forest clearings and hilly areas. The Pleurotus of the Umbellifers occupy an area in the Northern hemisphere between the 30 and 50º N. These species are mainly found in the subtropical regions of the Mediterranean, Central Europe, Russia, Ukraine, Central Asia and Iran. The P. eryngii sensulato is the only taxon within the genus, which grows in association with plants. P. eryngii has distinguishable characteristics such as coherent texture, unique form, favorable taste and high durability. Mushroom cultivation represents the only current economically viable biotechnology process for the conversion of waste plant residues from forests and agriculture. The species of these genera show much diversity in their adaptation the varying agro-climatic condition which makes more cultivated species than other mushrooms. Special ability of Pleurotus family is growing in lingocellulosic plant or agricultural wastes without needing to prepared compost and casing soil. Pleurotus is an efficient lignin- degrading mushroom and can grow and yield well on different types of lignocellulolosic materials. Type of substrates for mushroom growing depends on available plant or agricultural wastes. In Europe, wheat straw is used for mushroom growing; whereas in Asian South-East countries sawdust is more popular. Different materials for cultivating of P. eryngii have been suggested in different regions of the world; but a few studies have been done on suitability of various lignocellulosic affordable wastes for P. eryngii production in Iran. Therefore, the current study aims to evaluate effects of various locally available agro wastes on the growth characteristics of King oyster mushroom (P
Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii
Directory of Open Access Journals (Sweden)
Sharon Avni
2017-07-01
Full Text Available Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe of the fruit body contained higher glucan content then the caps (pileus. Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate.
Moonmoon, Mahbuba; Uddin, Md Nazim; Ahmed, Saleh; Shelly, Nasrat Jahan; Khan, Md Asaduzzaman
2010-10-01
Pleurotus eryngii is a popular mushroom due to its excellent consistency of cap and stem, culinary qualities and longer shelf life. In Bangladesh, where Pleurotus mushrooms are very popular, P. eryngii may take position among the consumers, but currently this mushroom is not cultivated in large scale there. In this study, 3 strains of P. eryngii such as Pe-1 (native to Bangladesh), Pe-2 (germplasm collected from China) and Pe-3 (germplasm collected from Japan) were cultivated on saw dust and rice straw and their growth and yield parameters were investigated. Pe-1 on saw dust showed the highest biological yield and efficiency (73.5%) than other strains. Also, the mycelium run rate and number of fruiting bodies were higher in Pe-1 than other two strains. The quality of mushroom strains was near about similar. On saw dust, the yield and efficiency were better than those cultivated on rice straw, however, on straw; the mushroom fruiting bodies were larger in size. This study shows the prospects of P. eryngii cultivation in Bangladesh and suggests further study in controlled environment for higher yield and production.
Choi, Jun-Hui; Kim, Dae-Won; Kim, Seung; Kim, Sung-Jun
2017-01-01
We investigated the effect of the culinary-medicinal mushroom Pleurotus eryngii var. ferulae DDL01 on oxidative damage in the liver and brain and a high-fat/high-cholesterol-induced hyperlipidemic model. In in vitro studies, the water extracts of the fruiting bodies showed strong scavenging activities of DPPH (139.46 ± 3.2 μg) and hydroxyl (139.46 ± 3.2 μg) radicals. Moreover, the extracts showed Fe2+ chelating and reducing abilities, as well as a large amount of polyphenols and an inhibitory effect on lipid peroxidation in the liver and brain tissues. The rats were fed a pellet diet (7.5 g/rat/day) containing P. eryngii var. ferulae DDL01 (PD) for 3 weeks. In the high-fat/high-cholesterol-induced hyperlipidemic rat model, administration of PD caused a significant decrease (P < 0.05) in the levels of serum triacylglycerols, low-density lipoprotein cholesterol, very-low-density lipoprotein cholesterol, aspartate aminotransferase, and alanine aminotransferase and a significant increase (P < 0.05) in the level of high-density lipoprotein cholesterol. PD administration significantly decreased high-fat/high-cholesterol-induced hepatic lipid accumulation. Treatment with the extracts (up to 500 μg/mL) did not significantly affect the viability of HepG2 and 3T3-L1 cells. Our findings suggest that this mushroom has potential as an antiatherogenic dietary source in the development of therapeutic agents and functional foods.
Chen, Shih-Yu; Ho, Kung-Jui; Liang, Chih-Hung; Tsai, Ching-Hsuan; Huang, Ling-Yi; Mau, Jeng-Leun
2012-01-01
Pleurotus eryngii (DC. : Fr.) Ouel. was used in solid-state fermentation to develop novel mushroom products with a high amount of ergothioneine. The correlation coefficients between ergothioneine content and biomass were 0.8878 and 0.9206 for fermented adlay and buckwheat, respectively. Using optimal conditions, Pleurotus-fermented adlay and buckwheat (PFA and PFB) with the ergothioneine contents of 795.5 and 786.1 mg/ kg, respectively, were prepared. However, mycelia contained the highest ergothioneine content of 1514.6 mg/kg. As a result of SSF by P. eryngii, PFA and PFB contained more taste components than adlay and buckwheat, as evidenced by higher contents of total sugars and polyols, total free amino acids and monosodium glutamate-like components, and total and flavor 5'-nucleotides. In addition, PFB and buckwheat showed comparable equivalent umami concentration (EUC) values, whereas PFA showed a higher EUC value than adlay. Overall, Pleurotus-fermented products with a high amount of ergothioneine will be a novel functional food.
Tang, Xia; Dong, Shunwen; Shi, Wenjin; Gao, Ni; Zuo, Lei; Xu, Heng
2016-11-01
This study focused on the bioremediation role of Pleurotus eryngii in different characteristics soils contaminated with nickel (Ni) and fluoranthene. The results of bioremediation experiments showed that fluoranthene had a positive effect on the growth of P. eryngii, whereas Ni exerted a negative influence. The concentration of fluoranthene significantly decreased in inoculated soil accounting for 86.39-91.95% of initial concentration in soils and 71.46-81.76% in non-inoculated soils, which showed that the dissipation of fluoranthene was enhanced by mushroom inoculating. The highest removal rates of fluoranthene in sandy loam, loamy clay, and sandy soils reached to 87.81, 86.39, and 91.95%, respectively, which demonstrated that P. eryngii was more suitable for the bioremediation of sandy soil contaminated with fluoranthene. In addition, the presence of Ni tended to decrease the dissipation of fluoranthene in inoculated soil. Higher ligninolytic enzymes activities were detected in inoculated soils, resulting in the enhanced dissipation of fluoranthene in inoculated soils. Furthermore, P. eryngii had the ability to uptake Ni (4.88-39.53 mg kg -1 ) in co-contamination soil. In conclusion, the inoculating of P. eryngii was effective in remediating of Ni-fluoranthene co-contaminated soils. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Mycelial growth observation of Pleurotus eryngii (Higher Basidiomycota In Vitro
Directory of Open Access Journals (Sweden)
Mustafa Nadhim Owaid
2016-09-01
Full Text Available Five agro-substrates including date palm fibers (fibrillum, wheat straw, white sawdust and their combinations were investigated to grow Pleurotus eryngii. The longer mycelium complete time within bags was 20 days on sawdust (S4, in contrast, the shorter time for mycelium overgrew was completed after 15 days on date palm fiber (S5. In significant (p<0.05, S5 showed the higher growth intensity level (vigorous growth than other substrates. Thus use of date palm wastes (S5 medium may be useful for successfully cultivation king oyster mushroom in farm.International Journal of Environment Vol.5(3 2016, pp.1-10
Decontamination of Fumonisin B1 in maize grain by Pleurotus eryngii and antioxidant enzymes
Directory of Open Access Journals (Sweden)
Miriam HAIDUKOWSKI
2017-05-01
Full Text Available Fumonisin B1 (FB1 is among the most common mycotoxins found in maize kernels and maize products worldwide. The microbiological process of detoxification and transformation of toxic organic pollutants is a promising method for foodstuffs decontamination. Some basidiomycetes, such as the Pleurotus eryngii species complex, include several important commercial edible varieties that can detoxify polycyclic organic compounds and a range of wastes and pollutants. We investigated the potential role of P. eryngii, one of the most consumed mushrooms, in the decontamination of FB1 in maize. In addition, selected antioxidant enzymes, (soluble peroxidase (POD, catalase (CAT and ascorbate peroxidase, primarily involved in control of cell hydrogen peroxide levels, and lignin degradation, were analyzed, to evaluate their contributions to the molecular mechanisms of FB1 by P. eryngii. FB1 decontamination by P. eryngii and involvement of CAT and POD enzymes in the control of toxic decontamination levels of H2O2 were demonstrated. A consistent reduction of FB1 was observed at different incubation times. The average decrease levels of FB1, with respect to the control cultures, ranged from 45 to 61% (RSD < 15%. This study is a possible eco-friendly approach to reducing this mycotoxin in the feed supply chains.
Production of ligninolytic enzymes by solid-state fermentation using Pleurotus eryngii.
Akpinar, Merve; Urek, Raziye Ozturk
2012-01-01
Pleurotus eryngii (DC.) Gillet (MCC58) was investigated for its ability to produce various ligninolytic enzymes such as laccase (Lac), manganese peroxidase (MnP), aryl alcohol oxidase (AAO), and lignin peroxidase (LiP) by solid-state fermentation (SSF), which was carried out using a support substrate from the fruit juice industry. The chemical content of grape waste from this industry was studied. Also, the production patterns of these extracellular enzymes were researched during the growth of the organism for a period of 20 days and the protein, reducing sugar, and nitrogen levels were monitored during the stationary cultivation. The highest Lac activity was obtained as 2247.62 ± 75 U/L on day 10 in the presence of 750 µM Mn²⁺, while the highest MnP activity was attained as 2198.44 ± 65 U/L on day 15 in the presence of 500 µM Mn²⁺. Decolorization of methyl orange and reactive red 2 azo dyes was also achieved with ligninolytic enzymes, produced in SSF of P. eryngii.
Bioremediation of aflatoxin B1-contaminated maize by king oyster mushroom (Pleurotus eryngii.
Directory of Open Access Journals (Sweden)
Maria Teresa Branà
Full Text Available Aflatoxin B1 (AFB1 is the most harmful mycotoxin that occurs as natural contaminant of agricultural commodities, particularly maize. Practical solutions for detoxification of contaminated staples and reduction of agricultural wastes are scarce. We investigated the capability of the white-rot and edible fungus Plerotus eryngii (king oyster mushroom to degrade AFB1 both in vitro and in a laboratory-scale mushroom cultivation, using a substrate similar to that routinely used in mushroom farms. In malt extract broth, degradation of AFB1 (500 ng/mL by nine isolates of P. eryngii ranged from 81 to 99% after 10 days growth, and reached 100% for all isolates after 30 days. The growth of P. eryngii on solid medium (malt extract-agar, MEA was significantly reduced at concentrations of AFB1 500 ng/mL or higher. However, the addition of 5% wheat straw to the culture medium increased the tolerance of P. eryngii to AFB1 and no inhibition was observed at a AFB1 content of 500 ng/mL; degradation of AFB1 in MEA supplemented with 5% wheat straw and 2.5% (w/v maize flour was 71-94% after 30 days of growth. Further, AFB1 degradation by P. eryngii strain ITEM 13681 was tested in a laboratory-scale mushroom cultivation. The mushroom growth medium contained 25% (w/w of maize spiked with AFB1 to the final content of 128 μg/kg. Pleurotus eryngii degraded up to 86% of the AFB1 in 28 days, with no significant reduction of either biological efficiency or mushroom yield. Neither the biomass produced on the mushroom substrate nor the mature basidiocarps contained detectable levels of AFB1 or its metabolite aflatoxicol, thus ruling out the translocation of these toxins through the fungal thallus. These findings make a contribution towards the development of a novel technology for remediation of AFB1- contaminated corn through the exploitation of the degradative capability of P. eryngii and its bioconversion into high nutritional value material intended for feed production.
Directory of Open Access Journals (Sweden)
Mehmet Akyüz
2007-04-01
Full Text Available P. eryngii var. ferulae which is known very well in Eastern Anatolia Region and picked up from the nature in spring months is sold by the side of the roads and in neighbour markets with the name of ‘’ çaşır, çakşır, çaşur, heliz, kırkor, göbek, göbelek and mendik’’ mushroom. As a member of Apiaceae family; Ferulae sp. that preads at the slope of the mountains, grows up naturally on the roots of its species that remained from the previous year especially at the altitude of 1000-2500 meters on high mountains. It is known that local people has benefited from the natural products special to periodic times. It is seen that it is not benefited from alternative natural nourishment resources like cultuıre vegetables and fruit with their important features and effective nutritive value. In our opinion, this article will be useful for mentioning the importance of the mushroom beside the vegetables and fruits which are vital for our life. It will be useful to expose the medical features, nourishment content and effective nutritive valu and effective nutritious features of mushroom. Furthermore, It is determined that it is necessary to describe P. eryngii and its similarities with the identification of scientific facts as species, subspecies, variety, taxa or synonym in our country.
International Nuclear Information System (INIS)
Urban, P.L.; Bazala, M.A.; Bystrzejewska-Piotrowska, G.; Pianka, D.; Steborowski, R.; Asztemborska, M.; Kowalska, J.; Manjon, J.L.; Kuthan, R.T.
2005-01-01
A model species of saprophytic fungus, king oyster mushroom (Pleurotus eryngii), was cultivated on barley substrate supplied with [Pt(NH 3 ) 4 ](NO 3 ) 2 , under well defined conditions. The samples of the collected fruiting bodies were digested and analyzed for total platinum content by means of ICP-MS. The results proved that platinum is not accumulated in the fruitbodies of Pleurotus eryngii for a wide range of Pt concentrations in the culture substrate (100-1000 ppb Pt in 50 ml of water solution added to ca. 450 g of hydrated barley seeds per container). Observable levels of Pt were only found in the fruitbodies obtained from the medium contaminated with 10000 ppb (10 ppm) platinum solution. This demonstrates significant difference in the effectiveness of platinum extraction in fungi and plants, which are capable to accumulate platinum even when supplied at lower concentration (<500 ppb). It also shows different physiological pathways of platinum and other elements which are easily accumulated in the fruitbodies of the same species. (author)
Preliminary studies on productivity of white Pleurotus eryngii isolates in protected cultivation
Directory of Open Access Journals (Sweden)
Gian Luigi Rana
2013-03-01
Full Text Available Four isolates of Pleurotus eryngii species-complex, originating from different basidiomata growing in a mountainous area of the Basilicata region (southern Italy and characterized by white pileus cuticle (Wh A, Wh B, Wh C, and Wh D were compared, in artificial cultivation conditions, to other isolates of the same mushroom with beige (Be 3, Be 5 or brown cap (Br 1, Br 2 originating from the same area of the former or selected among the commercial ones (Com 142 and Com 164 in order to evaluate their productivity and morphological features. The experiments were carried out in a greenhouse belonging to the Faculty of Agriculture, University of Bari Aldo Moro, in autumn winter 2010-2011, using substrate bags well colonized by P. eryngii mycelium and kept at 4-6°C for 5 months. Wh A and Wh D and, less significantly, Wh C, Be 5 and Com 142, produced a fresh basidioma yield significantly higher than the five other tested isolates (Wh B, Be 3, Br 1, Br 2 and Com 164. Only Com 142 produced the basidiomata of medium and maximum size significantly heavier and with larger pileus diameter than other tested isolates. Com 142 also resulted significantly different, for the basidiomata number/substrate bag, from the white pileus cuticle isolates except for Wh B. All tested isolates concentrated almost all (90-95% of the sporophore yield in the first basidioma flush. No significant differences were found among all tested P. eryngii isolates in terms of yield earliness.
Directory of Open Access Journals (Sweden)
Min Keun Kim
2017-06-01
Full Text Available RcsA is a positive activator of extracellular polysaccharide (EPS synthesis in the Enterobacteriaceae. The rcsA gene of the soft rot pathogen Pantoea sp. strain PPE7 in Pleurotus eryngii was cloned by PCR amplification, and its role in EPS synthesis and virulence was investigated. The RcsA protein contains 3 highly conserved domains, and the C-terminal end of the open reading frame shared significant amino acid homology to the helix-turn-helix DNA binding motif of bacterial activator proteins. The inactivation of rcsA by insertional mutagenesis created mutants that had decreased production of EPS compared to the wild-type strain and abolished the virulence of Pantoea sp. strain PPE7 in P. eryngii. The Pantoea sp. strain PPE7 rcsA gene was shown to strongly affect the formation of the disease symptoms of a mushroom pathogen and to act as the virulence factor to cause soft rot disease in P. eryngii.
Chang, Bea-Ven; Chang, Yi-Ming
2016-04-01
The toxic chemicals bisphenol A (BPA), bisphenol F (BPF), nonylphenol (NP), and tetrabromobisphenol A (TBBPA) are endocrine-disrupting chemicals that have consequently drawn much concern regarding their effect on the environment. The objectives of this study were to investigate the degradation of BPA, BPF, NP, and TBBPA by enzymes from Pleurotus eryngii in submerged fermentation (SmF) and solid-state fermentation (SSF), and also to assess the removal of toxic chemicals in spent mushroom compost (SMC). BPA and BPF were analyzed by high-performance liquid chromatography; NP and TBBPA were analyzed by gas chromatography. NP degradation was enhanced by adding CuSO4 (1 mM), MnSO4 (0.5 mM), gallic acid (1 mM), tartaric acid (20 mM), citric acid (20 mM), guaiacol (1 mM), or 2,2'-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid; 1 mM), with the last yielding a higher NP degradation rate than the other additives from SmF. The optimal conditions for enzyme activity from SSF were a sawdust/wheat bran ratio of 1:4 and a moisture content of 5 mL/g. The enzyme activities were higher with sawdust/wheat bran than with sawdust/rice bran. The optimal conditions for the extraction of enzyme from SMC required using sodium acetate buffer (pH 5.0, solid/solution ratio 1:5), and extraction over 3 hours. The removal rates of toxic chemicals by P. eryngii, in descending order of magnitude, were SSF > SmF > SMC. The removal rates were BPF > BPA > NP > TBBPA. Copyright © 2014. Published by Elsevier B.V.
Van Doan, Hien; Doolgindachbaporn, Sompong; Suksri, Amnuaysilpa
2016-10-01
This study was conducted to evaluate the effects of Eryngii mushroom, Pleurotus eryngii (PE), and Lactobacillus plantarum single or combined on growth, innate immune response and disease resistance of the Pangasius catfish, Pangasius bocourti. Two hundred forty fish were divided into four treatments, i.e., 0 g kg(-1) PE (Control, Diet 1), 3 g kg(-1) PE (Diet 2), 10(8) cfu g(-1) L. plantarum (Diet 3) and 3 g kg(-1) PE + 10(8) cfu g(-1) L. plantarum (Diet 4). Fish were culture in glass tanks with water volume approximately of 150 l, and each treatment had four replications with 15 fish per replication. Following 30, 60 and 90 days of the feeding trial, specific growth rate (SGR), feed conversion ratio (FCR), serum lysozyme, phagocytosis and respiratory burst activities were measured. SGR and FCR were significantly improved in fish fed supplemented diets after 90 days of the feeding trial. Serum lysozyme, phagocytosis and respiratory burst activity of fish were significantly stimulated by both PE and L. plantarum diets; however, the highest innate immune response was observed in fish fed synbiotic diet. At the end of the experiment, five fish were randomly selected for a challenge test against Aeromonas hydrophila. The post-challenge survival rate of the fish fed supplemented diets was significantly greater than the control treatment, and the highest post-challenge survival rate was observed in synbiotic diet. The results revealed that dietary supplementation of PE and L. plantarum stimulated growth, immunity and disease resistance of the P. bocourti.
Kim, Kyung-Hee; Kang, Young Min; Im, Chak Han; Ali, Asjad; Kim, Sun Young; Je, Hee-Jeong; Kim, Min-Keun; Rho, Hyun Su; Lee, Hyun Sook; Kong, Won-Sik; Ryu, Jae-San
2014-01-01
Pleurotus eryngii has recently become a major cultivated mushroom; it uses tetrapolar heterothallism as a part of its reproductive process. Sexual development progresses only when the A and B mating types are compatible. Such mating incompatibility occasionally limits the efficiency of breeding programs in which crossing within loci-shared strains or backcrossing strategies are employed. Therefore, understanding the mating system in edible mushroom fungi will help provide a short cut in the development of new strains. We isolated and identified pheromone and receptor genes in the B3 locus of P. eryngii and performed a functional analysis of the genes in the mating process by transformation. A genomic DNA library was constructed to map the entire mating-type locus. The B3 locus was found to contain four pheromone precursor genes and four receptor genes. Remarkably, receptor PESTE3.3.1 has just 34 amino acid residues in its C-terminal cytoplasmic region; therefore, it seems likely to be a receptor-like gene. Real-time quantitative RT-PCR (real-time qRT-PCR) revealed that most pheromone and receptor genes showed significantly higher expression in monokaryotic cells than dikaryotic cells. The pheromone genes PEphb3.1 and PEphb3.3 and the receptor gene PESTE3.3.1 were transformed into P5 (A3B4). The transformants were mated with a tester strain (A4B4), and the progeny showed clamp connections and a normal fruiting body, which indicates the proposed role of these genes in mating and fruiting processes. This result also confirms that PESTE3.3.1 is a receptor gene. In this study, we identified pheromone and receptor genes in the B3 locus of P. eryngii and found that some of those genes appear to play a role in the mating and fruiting processes. These results might help elucidate the mechanism of fruiting differentiation and improve breeding efficiency.
Directory of Open Access Journals (Sweden)
Yueting Dai
2017-11-01
Full Text Available Identification of monokaryons and their mating types and discrimination of hybrid offspring are key steps for the crossbreeding of Pleurotus tuoliensis (Bailinggu. However, conventional crossbreeding methods are troublesome and time consuming. Using RNA-seq technology, we developed new expressed sequence tag-simple sequence repeat (EST-SSR markers for Bailinggu to easily and rapidly identify monokaryons and their mating types, genetic diversity and hybrid offspring. We identified 1110 potential EST-based SSR loci from a newly-sequenced Bailinggu transcriptome and then randomly selected 100 EST-SSRs for further validation. Results showed that 39, 43 and 34 novel EST-SSR markers successfully identified monokaryons from their parent dikaryons, differentiated two different mating types and discriminated F1 and F2 hybrid offspring, respectively. Furthermore, a total of 86 alleles were detected in 37 monokaryons using 18 highly informative EST-SSRs. The observed number of alleles per locus ranged from three to seven. Cluster analysis revealed that these monokaryons have a relatively high level of genetic diversity. Transfer rates of the EST-SSRs in the monokaryons of closely-related species Pleurotus eryngii var. ferulae and Pleurotus ostreatus were 72% and 64%, respectively. Therefore, our study provides new SSR markers and an efficient method to enhance the crossbreeding of Bailinggu and closely-related species.
Dai, Yueting; Su, Wenying; Song, Bing; Li, Yu; Fu, Yongping
2017-01-01
Identification of monokaryons and their mating types and discrimination of hybrid offspring are key steps for the crossbreeding of Pleurotus tuoliensis (Bailinggu). However, conventional crossbreeding methods are troublesome and time consuming. Using RNA-seq technology, we developed new expressed sequence tag-simple sequence repeat (EST-SSR) markers for Bailinggu to easily and rapidly identify monokaryons and their mating types, genetic diversity and hybrid offspring. We identified 1110 potential EST-based SSR loci from a newly-sequenced Bailinggu transcriptome and then randomly selected 100 EST-SSRs for further validation. Results showed that 39, 43 and 34 novel EST-SSR markers successfully identified monokaryons from their parent dikaryons, differentiated two different mating types and discriminated F1 and F2 hybrid offspring, respectively. Furthermore, a total of 86 alleles were detected in 37 monokaryons using 18 highly informative EST-SSRs. The observed number of alleles per locus ranged from three to seven. Cluster analysis revealed that these monokaryons have a relatively high level of genetic diversity. Transfer rates of the EST-SSRs in the monokaryons of closely-related species Pleurotus eryngii var. ferulae and Pleurotus ostreatus were 72% and 64%, respectively. Therefore, our study provides new SSR markers and an efficient method to enhance the crossbreeding of Bailinggu and closely-related species. PMID:29149037
Kikuchi, Takashi; Maekawa, Yukina; Tomio, Arisa; Masumoto, Yuki; Yamamoto, Taishi; In, Yasuko; Yamada, Takeshi; Tanaka, Reiko
2016-11-01
Six new ergostane-type steroids; (22E)-3β,5α,6α,11-tetrahydroxy-9(11)-seco-ergosta-7,22-dien-9-one (1), (22E)-8,14-epoxyergosta-6,22-diene-3β,5α,9α-triol (2), (22E)-4α,5α-epoxyergosta-7,22-diene-3β,6β-diol (3), (22E)-3β,4β,5α-trihydroxyergosta-7,22-dien-6-one (4), (22E)-ergosta-7,22-diene-3β,5β,6α-triol (5), and (22E)-6β-methoxyergosta-7,22-diene-3β,5α-diol 3-O-β-d-glucopyranoside (6) were isolated from the fruiting bodies of king trumpet mushroom (Pleurotus eryngii), along with fourteen known compounds (7-20). All isolated compounds were evaluated for their inhibitory effects on macrophage activation using a nitric oxide production inhibition assay. Copyright © 2016. Published by Elsevier Inc.
Assessment of Genetic Diversity among Pleurotus spp. Isolates from Jordan
Directory of Open Access Journals (Sweden)
Hanan Aref Hasan
2018-04-01
Full Text Available Pleurotus is considered an important genus that belongs to the family Pleurotaceae and includes the edible King Oyster mushroom (Pleurotus eryngii. In the present study, 19 Pleurotus isolates were collected from two locations in the north of Jordan (Tell ar-Rumman and Um-Qais. The morphological characteristics among collected isolates revealed that there was a morphological similarity among the collected isolates. Nucleotide sequence analysis of the internal transcribed spacer (ITS1–5.8S rDNA–ITS4 region and 28S nuclear large subunit (nLSU in the ribosomal DNA gene of the isolated stains showed that all of them share over 98% sequence similarity with P. eryngii. Genetic diversity among the collected strains was assessed using inter simple sequence repeat (ISSR analysis using 18 different primer pairs. Using this approach, 141 out of 196 bands obtained were considered polymorphic and the highest percentage of polymorphism was observed using primer UBC827 (92.3% with an overall Polymorphism Information Content (PIC value of 70.56%. Cluster analysis showed that the Jordanian Pleurotus isolates fall into two main clades with a coefficient of similarity values ranging from 0.59 to 0.74 with a clear clustering based on collection sites. The results of the present study reveal that molecular techniques of ISSR and rDNA sequencing can greatly aid in classification and identification of Pleurotus spp. in Jordan.
Effect of Pleurotus eryngii Mushroom β-Glucan on Quality Characteristics of Common Wheat Pasta.
Kim, SunHee; Lee, Jo-Won; Heo, Yena; Moon, BoKyung
2016-04-01
The objective of this study was to evaluate the effect of β-glucan-rich fractions (BGRFs) from Pleurotus eryngii mushroom powder on the quality, textural properties, and sensory evaluation of common wheat pasta. Pasta was prepared from semolina flour and common wheat flour by replacing common wheat flour at 2%, 4%, and 6% with BGRFs. Semolina flour showed significantly higher viscosities than common wheat flour samples. However, all viscosities, except the breakdown viscosity, were reduced with increasing percentages of BGRFs. Replacement of the common wheat flour with BGRFs resulted in a reddish brown colored pasta with a lower L* value and a higher a* value. The common wheat pastas containing up to 4% BGRFs were not significantly different from semolina pasta with regard to cooking loss. Addition of up to 2% BGRFs had no significant impact on swelling index and water absorption. The addition of BGRFs in common wheat flour had a positive effect on the quality of common wheat pasta and resulted in hardness values similar to those of semolina pasta. In a sensory evaluation, cooked pasta with 2% BGRFs had the highest overall acceptability score. In summary, the results showed that common wheat flour containing 4% BGRFs could be used to produce pasta with an improved quality and texture properties similar to semolina pasta. © 2016 Institute of Food Technologists®
Claudia Paganelli Lacerda de Azevedo
2000-01-01
Pleurotus eryngii, Lentinus sajor caju e Lentinula edodes foram produzidos, em condições controladas, com resíduos lignocelulósicos em seis composições; (1) resíduo sólido de indústria de cerveja+ bagaço de cana de açúcar + sais minerais (2) resíduo sólido de indústria de cerveja + serragem de euca/yptus + sais minerais (3) resíduo sólido de indústria de cerveja + palha de arroz + sais minerais (4) resíduo sólido de indústria de cerveja + bagaço de cana de açúcar (5) resíduo sólido de indústr...
Lee, Tzu-Tai; Ciou, Jhih-Ying; Chiang, Ching-Jen; Chao, Yun-Peng; Yu, Bi
2012-11-07
Pleurotus eryngii stalk residue (PESR) is a byproduct of the edible portion of the fruiting body. The present study was conducted to evaluate the effects of PESR on the oxidative status and meat quality of broilers. Two hundred fifty 1-d-old male broilers (Arbor Acre) were evenly divided by gender and randomly allocated into control (corn-soybean meal diet) or 1.0, 5.0, 10.0, or 20.0 g/kg dried PESR groups. The results revealed that at 35 d, the dried PESR groups displayed a significantly increased water-holding capacity and decreased storage loss of breast and thigh fillets when compared to the control group. Regarding fillets color, the L* (lightness) values were lower and the a* (redness) and b* (yellowness) values were higher following dried PESR supplementation. In 5.0-20.0 g/kg PESR supplementation groups, the activities of antioxidative enzymes were significantly elevated in serum, liver, spleen, and fillet tissues when compared to control group. Additionally, malondialdehyde production was slightly decreased in the PESR supplementation groups. Lower crude fat contents were observed in fillet tissues of 5.0-20.0 g/kg PESR groups when compared with the control group. In conclusion, PESR may potentially be used as an antioxidant to decrease lipid peroxidation and improve meat quality in broilers.
Energy Technology Data Exchange (ETDEWEB)
Bystrzejewska-Piotrowska, Grazyna [Isotope Laboratory, Faculty of Biology, Warsaw University, 02-096 Warsaw, Miecznikowa 1 (Poland)], E-mail: byst@biol.uw.edu.pl; Bazala, Michal A. [Isotope Laboratory, Faculty of Biology, Warsaw University, 02-096 Warsaw, Miecznikowa 1 (Poland)
2008-07-15
Ex vitro cultures of Pleurotus eryngii were carried out under controlled conditions using sterile medium composed of barley seeds. The influence of alkali and alkaline earth element salts (CsCl, KCl, NaCl, RbCl, and CaCl{sub 2}) and tetraethylammonium chloride on incorporation of cesium, potassium, sodium, rubidium and calcium, and their distribution within fruitbodies, was examined. The results show that incorporation of cesium into fruitbodies was not suppressed by Na{sup +} and Rb{sup +} or tetraethylammonium chloride. However, it was inhibited by Ca{sup 2+} and stimulated by high concentrations of K{sup +}. The inhibition of cesium incorporation by Ca{sup 2+}, lack of influence of tetraethylammonium chloride and stimulation by high K{sup +} concentrations suggest that there may exist two pathways of passive transport of cesium in mycelium: (i) uptake mediated by a non-specific potassium channel localised in plasmalemma (similar to voltage-insensitive cation channel, VICC) followed by diffusive transport inside hyphae and (ii) extracellular transport from the medium through inter-hyphal cavities into fruitbodies. The results highlight distinctiveness of mechanisms responsible for the uptake and incorporation of cesium in mushrooms and plants.
Liang, Chih-Hung; Huang, Ling-Yi; Ho, Kung-Jui; Lin, Shin-Yi; Mau, Jeng-Leun
2013-01-01
The culinary-medicinal king oyster mushroom, Pleurotus eryngii, was used to produce mycelia with high ergothioneine content using a one-factor-at-a-time method. The optimal culture conditions for mycelia harvested at day 14 were 25°C, 10% inoculation rate, 2% glucose, 0.5% yeast extract, and no adjustment to the initial pH value. With histidine or amino acid mix added, biomasses and the ergothioneine content of mycelia were higher than those of the control. The ergothioneine content of mycelia harvested at days 16-20 were higher than that of mycelia harvested at day 14. In addition, the ergothioneine content of mycelia from the fermentor (5.84-5.76 mg/g) was much higher than that of mycelia from the shaken flask (4.93-5.04 mg/g). Mycelia with high ergothioneine content showed a profile of proximate composition similar to that of regular mycelia but lost its characteristic umami taste. Overall, mycelia high in ergothioneine could be prepared by optimal culture conditions, the addition of precursors, prolonged harvest, and aeration in the fermentor.
Palma, C; Lloret, L; Sepúlveda, L; Contreras, E
2016-01-01
Interest in production of ligninolytic enzymes has been growing over recent years for their use in various applications such as recalcitrant pollutants bioremediation; specifically, versatile peroxidase (VP) presents a great potential due to its catalytic versatility. The proper selection of the fermentation mode and the culture medium should be an imperative to ensure a successful production by an economic and available medium that favors the process viability. VP was produced by solid-state fermentation (SSF) of Pleurotus eryngii, using the agricultural residue banana peel as growth medium; an enzymatic activity of 10,800 U L(-1) (36 U g(-1) of substrate) was detected after 18 days, whereas only 1800 U L(-1) was reached by conventional submerged fermentation (SF) with glucose-based medium. The kinetic parameters were determined by evaluating the H2O2 and Mn(2+) concentration effects on the Mn(3+)-tartrate complex formation. The results indicated that although the H2O2 inhibitory effect was observed for the enzyme produced by both media, the reaction rates for VP obtained by SSF were less impacted. This outcome suggests the presence of substances released from banana peel during the fermentation, which might exhibit a protective effect resulting in an improved kinetic behavior of the enzyme.
Gao, Yu; Zheng, Lanyan; Li, Jian-Jun; Du, Yuguang
2016-12-15
Two structural Ca 2+ (proximal and distal) is known to be important for ligninolytic peroxidases. However, few studies toward impact of residues involved in two Ca 2+ on properties of ligninolytic peroxidases have been done, especially the proximal one. In this study, mutants of nine residues involved in liganding two Ca 2+ of Pleurotus eryngii versatile peroxidase (VP) were investigated. Most mutants almost completely lost activities, except the mutants of proximal Ca 2+ - S170A and V192T. In comparison with WT (wild type), optimal pH values of S170A, S170D, and V192T shifted from pH 3.0 to pH 3.5. The order of thermal and pH stabilities of WT, V192T, S170A, and S170D is similar to that of their specific activities: WT > V192T > S170A > S170D. The CD (circular dichroism) results of WT and several mutants indicated that mutations had some effects on secondary structures. For the first time, it was observed that the thermostability of ligninolytic peroxidases is related with proximal Ca 2+ too, and the mutant containing distal Ca 2+ only was obtained. Our results clearly demonstrated that enzymatic activities, pH and thermal stabilities, Ca 2+ content, and secondary structures of VP have close relationship with the residues involved in two structural Ca 2+ . Copyright © 2016 Elsevier Inc. All rights reserved.
Czech Academy of Sciences Publication Activity Database
Synytsya, Andriy.; Míčková, K.; Synytsya, A.; Jablonský, I.; Spěváček, Jiří; Erban, V.; Kováříková, E.; Čopíková, J.
2009-01-01
Roč. 76, č. 4 (2009), s. 548-556 ISSN 0144-8617 R&D Projects: GA ČR GA525/05/0273 Institutional research plan: CEZ:AV0Z40500505 Keywords : glucans * oyster mushroom Pleurotus * isolation Subject RIV: CD - Macromolecular Chemistry Impact factor: 3.167, year: 2009
Directory of Open Access Journals (Sweden)
Cristina Ramos
2011-01-01
Full Text Available A utilização de substratos vegetais à base de palha tem vindo a assumir uma importância crescente na cultura de cogumelos sapróbios, principalmente do género Pleurotus. Estes cogumelos são considerados muito interessantes do ponto de vista comercial, não só pelas suas características organolépticas e nutricionais, mas também pela sua fácil adaptação e manutenção, crescimento rápido e relativo baixo custo de cultura. No entanto, por se tratar de alimentos perecíveis, devido sobretudo à sua composição e elevada taxa respiratória, podem apresentar reduzido valor comercial, caso a conservação não seja efectuada nas melhores condições. No sentido de minimizar estas alterações, os cogumelos frescos devem ser submetidos a um processamento mínimo com utilização combinada de embalagem em atmosfera modificada, de forma a manter a qualidade e estabilidade no período de conservação. Neste trabalho foram efectuados ensaios de produção de três espécies do género Pleurotus, cultivadas em palha de trigo, com a finalidade de determinar a espécie mais produtiva e avaliar a qualidade dos mesmos durante a conservação quando processados e embalados em atmosfera modificada. Os resultados permitem concluir que a espécie mais produtiva foi a P. ostreatus, seguida da P. sajor-caju e P. eryngii, tendo sido a P. eryngii a que mostrou maior resistência à degradação no período de conservação estabelecido.The use of substrates straw has been increasing importance in mushroom saprophytic species grown, especially of Pleurotus genus. They are considered very interesting from the commercial point of view, not only for its nutritional and organoleptic characteristics, but also for its easy adaptation, rapid growth and relatively low culture cost. Mushrooms have a short shelf life when compared to most vegetables at ambient temperatures mainly due to its composition and high respiration rate. After yield and to reduce losses and
Recycling of Date-Palm Fiber to Produce Pleurotus Cornucopiae Var. Citrinopileatus Mushroom
Directory of Open Access Journals (Sweden)
Mustafa Nadhim Owaid
2017-01-01
Full Text Available In this study, some local available organic matters, which are including wheat straw (Triticum aestivum, sawdust, and fiber of date palm (Phoenix dactylifera L., were used for growing and cultivating of bright yellow oyster mushroom Pleurotus cornucopiae var. citrinopileatus. The possibility of using date palm fiber (in mixtures with other organic residues as a substrate for the cultivation and production of fruiting bodies of P. cornucopiae var. citrinopileatus was investigated. This mushroom is capable of biorecycling and utilization of some mixtures of lignocellulosic substrates successfully, especially the mixture S3 (50% wheat straw, 30% sawdust, and 20% date palm fiber. The lower mycelia completion time was 17 days, that shown in bags of the S3 substrate. Date-palm fiber substrate exhibited best growth intensity level (moderate significantly (p<0.05. The total yield and biological efficiency percent recorded approx. 90 g and 23% on the S3 substrate respectively, as a higher percent significantly (p<0.05, while sawdust substrate alone was an unsuitable medium for cultivation and production of this mushroom. Finally, the use of date-palm fibers in mixtures is usefulness in producing a fresh edible and medicinal mushroom.INTERNATIONAL JOURNAL OF ENVIRONMENTVolume-5, Issue-4, Sep-Nov 2016, page: 56-65
Antioxidant, antifungal and anticancer activities of se-enriched Pleurotus spp. mycelium extracts
Directory of Open Access Journals (Sweden)
Milovanović Ivan
2014-01-01
Full Text Available The goal of this study was the evaluation of antifungal, antioxidant and anticancer potentials of Pleurotus eryngii, P. ostreatus and P. pulmonarius mycelial extracts, and the influence of mycelium enrichment with selenium on these activities. Both Se-amended and non-amended extracts showed the same or similar minimal inhibitory concentration for 14 studied micromycetes, while a fungicidal effect was not noted, contrary to ketoconazole, which had inhibitory and fungicidal effects at very low concentrations. Se-non-amended extracts exhibited antioxidant activity, especially at higher concentrations. Selenium enrichment influenced activity, its effects decreasing in P. eryngii and P. pulmonarius, while in P. ostreatus no effect was noted. The DPPH• radical scavenging capacity of the extracts was in direct correlation with their phenol and flavonoid contents. Cytotoxic activity against both HeLa and LS174 cell lines was very low compared with cis-DDP. These features suggest that mycelium should be an object of intensive studies. [Projekat Ministarstva nauke Republike Srbije, br. 173032
Farklı Yetiştirme Ortamlarının Pleurotus eryngii Mantarının Gelişimi ve Verimi Üzerine Etkileri
Directory of Open Access Journals (Sweden)
Beyhan Kibar
2016-05-01
Full Text Available Bu çalışma farklı yetiştirme ortamlarının Pleurotus eryngii mantarının misel gelişim süresi, ilk hasat süresi, verim ve biyolojik etkinliği üzerine etkilerini belirlemek amacıyla yapılmıştır. Çalışmada buğday sapı (BS, mısır sapı (MS, kavak talaşı (KT ve çaşır bitki artığı (ÇBA ortamları tek başlarına ve bu ortamlara %20 oranında buğday kepeği (BK ve çeltik kepeği (ÇK ilave edilerek hazırlanan toplam 12 farklı yetiştirme ortamı kullanılmıştır. Buğday sapından (%100 buğday sapı hazırlanan yetiştirme ortamı kontrol olarak ele alınmıştır. Yetiştirme ortamların özelliklerinin belirlenmesi amacıyla sterilizasyon sonrasında değişik yetiştirme ortamlarından alınan örneklerde pH, nem, kül, C, N ve C:N oranı tespit edilmiştir. Farklı yetiştirme ortamlarında misel gelişim süresi, ilk hasat süresi, verim ve biyolojik etkinlik oranı belirlenmiştir. Misel gelişim süresi (gün, ilk hasat süresi (gün, verim (g/100 g ortam ve biyolojik etkinlik (% bakımından yetiştirme ortamları arasındaki farklılık istatistiki olarak çok önemli (P<0.01 bulunmuştur. Çalışmanın sonucunda en kısa misel gelişim süresi ve ilk hasat süresi MS ortamında belirlenirken, en uzun misel gelişim süresi ve ilk hasat süresi BS+PK ortamında gözlenmiştir. En yüksek verim ve biyolojik etkinlik MS ortamından (sırasıyla 24.4 g/100 g ortam ve %81.33 elde edilmiştir. Onu istatistiksel olarak MS ortamı ile aralarında fark bulunmayan ÇBA, MS+PK, BS+BK ve ÇBA+PK ortamları izlemiştir. Buna karşılık, en düşük verim ve biyolojik etkinlik değerleri ise sırasıyla BS+PK, KT ve BS ortamlarında bulunmuştur. Doğu Anadolu Bölgesi’nde bol bulunan ve kolayca temin edilebilen çaşır bitki artıklarının tek başına ya da buğday veya çeltik kepeği ile karıştırılarak P. eryngii yetiştiriciliğinde kullanılabileceği sonucuna varılmıştır.
International Nuclear Information System (INIS)
Guillén, J.; Baeza, A.; Salas, A.
2012-01-01
In the literature, there are many data available on radionuclide contents and their transfer to different species of mushrooms. There are some variables, however, which affect the transfer but are very difficult to observe in collected wild mushrooms. An example is the effect of different concentrations of alkali and alkaline earth elements in the soil. Modification of these concentrations in the soil solution has traditionally been used as a countermeasure to deal with radioactively contaminated areas. In the present work, fruiting bodies of Pleurotus eryngii, a saprophytic mushroom, were grown under controlled laboratory conditions, varying the content of alkali (potassium and cæsium) and alkaline earth (calcium and strontium) elements. The transfer of 134 Cs, 85 Sr, and 60 Co (added to the cultures) and of natural 210 Pb was analysed by increasing the content of each stable element considered. A significant, but nonlinear, enhancement of stable cæsium and 134 Cs was observed with increasing content of stable cæsium in the substrate/mycelium. The transfer of 85 Sr decreased with the addition of each stable cation, whereas the 60 Co and 210 Pb transfers were unaffected. - Highlights: ► The addition of stable potassium did not affect the uptake of radiocaesium. ► The addition of stable caesium increased the stable caesium and 134 Cs content in the fruiting bodies of Pleurotus eryngii. ► The addition of calcium reduced the content of calcium and 85 Sr in the fruiting bodies. ► These countermeasures did not work properly in the case of 60 Co and 210 Pb, no effect was observed.
Behnamian, Mahdi; Mohammadi, Seyed A.; Sonnenberg, A.S.M.; Goltapeh, Ebrahim M.; Hendrickx, P.M.
2010-01-01
In the present study, a set of 68 P. eryngii wild strains collected from nine locations in northwest and west of Iran along with six commercial strains were studied using universal rice primers (URP). The wild strains were isolated from Ferula ovina, F. haussknechtii, Cachrys ferulacea, Kellusia
Energy Technology Data Exchange (ETDEWEB)
Guillen, J., E-mail: fguillen@unex.es [LARUEX, Dpt. Applied Physics, Faculty of Veterinary Science, University of Extremadura, Avda. Universidad, s/n, 10071 Caceres (Spain); Baeza, A.; Salas, A. [LARUEX, Dpt. Applied Physics, Faculty of Veterinary Science, University of Extremadura, Avda. Universidad, s/n, 10071 Caceres (Spain)
2012-04-15
In the literature, there are many data available on radionuclide contents and their transfer to different species of mushrooms. There are some variables, however, which affect the transfer but are very difficult to observe in collected wild mushrooms. An example is the effect of different concentrations of alkali and alkaline earth elements in the soil. Modification of these concentrations in the soil solution has traditionally been used as a countermeasure to deal with radioactively contaminated areas. In the present work, fruiting bodies of Pleurotus eryngii, a saprophytic mushroom, were grown under controlled laboratory conditions, varying the content of alkali (potassium and caesium) and alkaline earth (calcium and strontium) elements. The transfer of {sup 134}Cs, {sup 85}Sr, and {sup 60}Co (added to the cultures) and of natural {sup 210}Pb was analysed by increasing the content of each stable element considered. A significant, but nonlinear, enhancement of stable caesium and {sup 134}Cs was observed with increasing content of stable caesium in the substrate/mycelium. The transfer of {sup 85}Sr decreased with the addition of each stable cation, whereas the {sup 60}Co and {sup 210}Pb transfers were unaffected. - Highlights: Black-Right-Pointing-Pointer The addition of stable potassium did not affect the uptake of radiocaesium. Black-Right-Pointing-Pointer The addition of stable caesium increased the stable caesium and {sup 134}Cs content in the fruiting bodies of Pleurotus eryngii. Black-Right-Pointing-Pointer The addition of calcium reduced the content of calcium and {sup 85}Sr in the fruiting bodies. Black-Right-Pointing-Pointer These countermeasures did not work properly in the case of {sup 60}Co and {sup 210}Pb, no effect was observed.
Energy Technology Data Exchange (ETDEWEB)
Kamra, D.N.; Zadrazil, F.
1986-01-01
Wheat straw was fermented in the solid state with Pleurotus sajor-caju and P. eryngii at 25 degrees C under different concentrations of oxygen and carbon dioxide. Lower than 20% oxygen in the gaseous phase adversely affected the loss of organic matter, the lignin degradation and the change in straw digestibility with both species of Pleurotus. Higher concentrations (10%-30%) of carbon dioxide, with 20% oxygen in the atmospshere, slightly decreased the loss of lignin and organic matter when compared with the losses under oxygen or air. In spite of better lignin degradation by P. sajor-caju, the process efficiency with P. eryngii was higher, because of lower loss of organic matter during the fermentation. Fruit-bodies were not formed by P. eryngii during the period of experiment in any of the treatments. In P. sajor-caju, fruit-bodies were only formed either in flasks closed with cotton plugs or supplied with a continuous flow of sterile air. Carbon dioxide inhibited the process of primordia initiation and fruit-body development. A short exposure (20 minutes per day) to light was essential for primordia and fruit-body formation. The substrate changes and process efficiency with respect to increase in digestibility were much higher in darkness than in light. Light leads to intensive fruit-body production and a different pattern of substrate degradation. The indigenous microflora of wheat straw inhibited fruit-body formation and caused a higher organic matter loss, accompanied by a decrease in digestibility of the fermented wheat straw. 33 references.
Determination of Cr, Cu, Fe, Ni, Pb and Zn by ICP-OES in mushroom samples from Sakarya, Turkey
Directory of Open Access Journals (Sweden)
Esra Altıntığ
2017-06-01
Full Text Available Russula cyanoxantha, Russula delica, Lactarius salmonicolor, Lactarius deliciosus, Pleurotus eryngii, Pleurotus ostreatus, Agaricus bisporus, Suillus luteus, Pleurotus spp and Boletus edulis were collected from Sakarya-Turkey respectively. Also canned food in the form of the Pleurotus eryngii, Pleurotus ostreatus, and Lactarius salmonicolor mushrooms were used for the examination. Trace metal concentrations found in these mushrooms were determined inductively using coupled plasma optic emission spectrometry microwave processes. The results were obtained for (Cr 0.3-26.65, (Cu 17.38-132.75, (Fe 26.3-225.40, (Ni 2.57-39.28, (Pb 11.52-185.20, and (Zn 22.86-126.84 mg/kg. The accuracy of the method was checked by the standard reference material; tea leaves (INCY-TL-1 and tomato leaves (1573a.
Venturella, Giuseppe; Palazzolo, Eristanna; Saiano, Filippo; Gargano, Maria Letizia
2015-01-01
In this paper, the authors provide data on a culinary-medicinal, host-specific variety of P. eryngii species-complex that is known in Italy as "cardoncello". A species description, the techniques of isolation of a new strain (C-142-c), and the preparation of the substratum are illustrated. Data on the productivity of substratum inoculated with C-142-c strain and the nutritional value of cultivated "cardoncello" mushrooms are also provided.
Biological effects and ISSR analysis of 60Co γ-irradiation on edible mushroom mycelia
International Nuclear Information System (INIS)
Cai Weiming; Feng Weilin; Jin Qunli; Fan Lijun; Wu Yongzhi
2009-01-01
Mycelia of Agaricus bitorquis, Flammulina velutipes and Pleurotus eryngii were irradiated by 60 Co γ-rays at the dose of 0, 200, 500 and 800 Gy. The results showed that irradiation inhibited their mycelia growth positively. Of the three edible mushroom, Agaricus bitorquis was the most sensitive one to irradiation, its mycelia died at the dose of 800 Gy. Germination rate, growth rate and vigor of all mycelia irradiated with un-lethal doses increased along with the times of transfer of culture. Electrical conductivity (EC) analysis showed that irradiation increased EC of leaching solution of mycelia positively. The EC of leaching solution of mycelia of Flammulina velutipes and Pleurotus eryngii irradiated with 500 Gy, Agaricus bitorquis irradiated with 200 Gy, were significantly higher than CK. ISSR analysis revealed that 60 Co γ irradiation effect on DNA variation of Agaricus bitorquis, Flammulina velutipes and pleurotus eryngii mycelia in varying degrees. Number of polymorphic bands changed after irradiation. Flawing bands and increasing bands were observed in amplified bands of 14 selected ISSR primers. The ISSR variation rates of Agaricus bitorquis for 200 Gy and 599 Gy treatments were 33.3% and 50.5%; the ISSR variation rates of Flammulina velutipes for 200 Gy, 500 Gy and 800 Gy treatments were 2.3%, 2.3% and 3.1%, that of Pleurotus eryngii were 8.6%, 13.4% and 20.0%. It is possible to use 60 Co γ irradiation as a mutagen to screen new mushroom varieties. (authors)
Venturella, Giuseppe; Zervakis, Georgios I; Polemis, Elias; Gargano, Maria Letizia
2016-01-01
An updated overview of the outcome of studies conducted on the culinary-medicinal mushroom Pleurotus nebrodensis is presented by placing emphasis on the clarification of the taxonomic identity of P. nebrodensis and other related taxa possessing entirely white to cream basidiomes, which grow in association with different plants of the family Apiaceae. Cultivation techniques, quality of the product sold and sales price, as well as nutritional and medicinal aspects are discussed. Taking also into consideration the high economic importance of P. nebrodensis, it is essential to proceed with the verification of the commercial strains currently available in the international market under the name of "P. nebrodensis" since it is very probable that many (or most) of them do not represent the real P. nebrodensis. TO confirm this hypothesis, an in silico analysis was conducted on a large of number of ITS1-5.8S-ITS2 rRNA sequences deposited in the National Center for Biotechnology Information database under the name P. nebrodensis. Results demonstrated that all "P nebrodensis" material examined from China (plus several sequences of no reported origin) corresponded to P. eryngii subsp. tuoliensis, with only 2 exceptions, which were grouped within P. eryngii sensu stricto. The real P. nebrodensis biological material from Italy and Greece is certified and is available upon request by the authors at the University of Palermo and the Agricultural University of Athens.
Kuijk, van S.J.A.; Sonnenberg, A.S.M.; Baars, J.J.P.; Hendriks, W.H.; Cone, J.W.
2015-01-01
The aim of this study is to evaluate fungal treatments to improve in vitro rumen degradability of lignocellulosic biomass. In this study four selective lignin degrading fungi, Ganoderma lucidum, Lentinula edodes, Pleurotus eryngii and Pleurotus ostreatus, were used to pre-treat lignocellulosic
Tuyen, D.V.; Phuong, H.N.; Cone, J.W.; Baars, J.J.P.; Sonnenberg, A.S.M.; Hendriks, W.H.
2013-01-01
Maize stover, rice straw, oil palm fronds and sugarcane bagasse were treated with the white-rot fungi Ceriporiopsis subvermispora, Lentinula edodes, Pleurotus eryngii, or Pleurotus ostreatus at 24 °C for 0–6 weeks. The fungi increased total gas production from oil palm fronds by 68–132%, but none of
Güney Kore’de Mantar Yetiştiriciliği
Directory of Open Access Journals (Sweden)
Mustafa Kemal Soylu
2016-03-01
Full Text Available Güney Kore’de son yıllarda mantar üretimi çok hızlı bir şekilde artmaktadır. Güney Kore mantar üretimi 173577 ton olup, bu üretimden yıllık 800 milyon dolar gelir elde edilmektedir. Farklı mantar türlerinin üretimi yapılmakta olup, üretim miktarının %31’ni kış mantarı (Flammulina velutipes, %26’sını kulacık mantarı (Pleurotus eryngii, %26’sını kayın mantarı (Pleurotus ostreatus, %13’ünü beyaz şapkalı kültür mantar (Agaricus bisporus, kalan %4’ünü ise Lentinula edodes, Ganoderma lucidum ve Phellinus vb. mantarlar oluşturmaktadır. 764ha’lık bir alanda mantar üretimi yapılmaktadır. Üretim alanının %31’inde kayın mantarı (Pleurotus ostreatus, %14’ünde kulacık mantarı (Pleurotus eryngii, %6’sında kış mantarı (Flummulina velutipes, %16’sında beyaz şapkalı kültür mantarı (Agaricus bisporus, %3’ünde Phellinus, %3’ünde ölümsüzlük mantarı (Ganoderma lucidum, %27’sı ise diğer mantar türlerinden oluşmaktadır. Kore’de mantar sıkça tüketilen bir gıda olup, kişi başına mantar tüketimi 4.2 kg’dır. Kütüklerde (meşe mantarı, ölümsüzlük mantarı ve Phellinus yetiştiricilik, ranzalarda yetiştiricilik (Agaricus bisporus ve Pleurotus ostreatus ve şişe kültürü (Flummulina velutipes, Pleurotus ostreatus, Pleurotus eryngii yaygın olarak yapılan yetiştirme sistemleridir.
Energy Technology Data Exchange (ETDEWEB)
Bazala, Michal A.; Golda, Katarzyna [Isotope Laboratory, Faculty of Biology, University of Warsaw, Miecznikowa 1, 02-096 Warsaw (Poland); Bystrzejewska-Piotrowska, Grazyna [Isotope Laboratory, Faculty of Biology, University of Warsaw, Miecznikowa 1, 02-096 Warsaw (Poland)], E-mail: byst@biol.uw.edu.pl
2008-07-15
We present a new protocol to study fluxes of radionuclides and other xenobiotics in saprophytic fungi. This simple method has successfully been used to evaluate transport of radiocesium in hyphae of Pleurotus eryngii and its translocation to fruitbodies.
Application of SRAP in the genetic diversity of Tricholoma matsutake ...
African Journals Online (AJOL)
GREGORY
2010-09-20
Sep 20, 2010 ... intergenic spacer; PCR, polymerase chain reaction; FST, mean level of ... been developed for any of the matsutake mushrooms, ... SRAP was similar to RAPD, but it was a prefe- ..... belonging to the taxa Pleurotus eryngii (DC.
Interaction of uranium with Pleurotus sp
International Nuclear Information System (INIS)
Ohnuki, Toshihiko; Sakamoto, Fuminori; Kozaki, Naofumi; Ozaki, Takuro; Samadfam, Mohammad
2002-01-01
Uptake of uranium by higher fungi, such as mushroom is little elucidated. We have studied the interaction of uranium with Pleurotus sp. (a mushroom) in pure culture over a wide range of U concentration (50-3000 mg/L). The Pleurotus sp. was cultured in two different media. One was rice bran medium, and the other was agar (yeast extract, peptone and dextrose) medium. The uptake of uranium in Pleurotus sp. was examined by alpha ray autoradiography (A,A), X-ray fluorescence spectroscopy (XRF) and scanning microcopy (SEM) equipped with EDS. In the agar medium, the higher uranium concentration gave lower growth of mycelia, and no fruiting body was observed. In the rice bran medium, the fruiting body was grown at U concentrations up to 1000 mg/L. The AA and XRF analysis showed that uranium taken up in the fruiting body was below the detection limit. The SEM-EDS analysis indicated that U was distributed in the limited region and was not transported to the mycelia far from U containing medium. It is concluded that uranium affects the growth of Pleurotus sp., and little uranium is taken up by Pleurotus sp. during the growth of both mycelia and fruiting body. (author)
Beta-Glucan Synthase Gene Expression in Pleurotus sp
International Nuclear Information System (INIS)
Azhar Mohamad; Nie, H.J.
2016-01-01
Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)
Bio-softening of mature coconut husk for facile coir recovery.
Suganya, D S; Pradeep, S; Jayapriya, J; Subramanian, S
2007-06-01
Bio-softening of the mature coconut husk using Basidiomyceteous fungi was attempted to recover the soft and whiter fibers. The process was faster and more efficient in degrading lignin and toxic phenolics. Phanerochaete chrysosporium, Pleurotus eryngii and Ceriporiopsis subvermispora were found to degrade lignin efficiently without any appreciable loss of cellulose, yielding good quality fiber ideal for dyeing.
Laccase Enzymes in Inocula Pleurotus spp
Directory of Open Access Journals (Sweden)
Nora García-Oduardo
2017-01-01
Full Text Available The cultivation of edible and medicinal mushrooms Pleurotus has been aimed at promoting alternative management for agricultural products. This basidiomicete has been the subject of numerous studies because of its fruiting body constitutes a food, being a producer of enzymes with industrial interest and for its ability of biotransformation of lignocellulosic substrates. Pleurotus inocula in the established technology for growing edible and medicinal mushrooms in the CEBI Research- Production Plant were performed using sorghum or wheat. However, it is possible to expand the possibilities with other substrates. In this paper, the results of laccase enzymes production in inocula prepared with sorghum, corn and coffee pulp with two strains Pleurotus ostreatus CCEBI 3021 and Pleurotus ostreatus CCEBI 3024 are presented. The period of preparation of seed reaches 15-21 days, the measurements of laccase activity were performed in periods of seven days. Extraction of crude enzyme was performed in aqueous phase, the determination of the laccase enzyme activity, using guaiacol as substrate. The results obtained in this work with studies in previous work using sorghum as inocula are compared. It is found that higher yields are obtained laccase in coffee pulp. This study contributes to the theoretical knowledge and to provide alternatives for securing the production process of the plant.
DEHYDRATION OF EDIBLE MUSHROOMS (PLEUROTUS OSTREATUS)
Salas de la Torre, N.; Bazán, D.; Osorio, A.; Cornejo, O.; Carrero, E.
2014-01-01
The edible mushroom Pleurotus ostreatus have been subjected to thermal, chemical and thermal-chemical treatment. The results show that the chemical treatment produces a more effective enzymatic inactivation compared to the other two treatments. Also, the experimental study of fungi dehydration carried out at 55 ° C reveals that the critical moisture content is 10.4 kg water / kg dry solids, the equilibrium moisture is 0.22 kg water / kg of solid . Los hongos comestibles Pleurotus ostreatus...
International Nuclear Information System (INIS)
Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.
2016-01-01
Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)
African Journals Online (AJOL)
Administrator
The influence of fungus treatment on the biochemical composition and degradation patter of sawdust and cotton plant by-products (cotton burns and cotton gin trash) by Pleurotus sajor caju were evaluated. Lignin degradation increased as the incubation period progressed while the highest loss of hemicellulose, cellulose ...
Back, Chang-Gi; Lee, Chang-Yun; Seo, Geon-Sik; Jung, Hee-Young
2012-01-01
Four Cladobotryum isolates were collected from four different commercially grown mushroom types infected with cobweb disease in Cheongdo-gun and Chilgok-gun of Gyeongbuk Province, Korea in 2010. The isolates were identified as C. mycophilum from Agaricus bisporus and Pleurotus eryngii, C. varium from Flammulina velutipes and Hypsizygus marmoreus. The cultural characteristics of the four isolates were investigated using potato dextrose agar (PDA) media under nine different temperatures ranging...
Identification and characterization of Trichoderma species aggressive to Pleurotus in Italy
Institute of Scientific and Technical Information of China (English)
Woo S L; Di Benedetto P; Senatore M; Abadi K; Gigante S; Soriente I; Ferraioli S; Scala F; Lorito M
2004-01-01
@@ In the late 1980's the development of a severe epidemic of green mold caused by Trichoderma spp.was noted in the commercial production of Agaricus bisporus (champignon) in the United Kingdom,North America, Spain and Holland, which caused extensive economic losses. The parasitic fungi isolated from the edible mushroom belonged to four biotypes, Thl, Th2, Th3 and Th4 of T.harzianum. However, among these biotypes, only Th2 (since classified as T. aggressivum f.europaeum) and Th4 (T. aggressivum f. aggressivum) were identified as the fungi causing problems in Agaricus production. In general, mushroom compost hosts both aggressive and innocuous isolates of Trichoderma, which are not morphologically distinguishable. About four years ago, a problem with green mold became apparent in the production of Pleurotus ostreatus in Northern Italy,which eventually developed to a crisis situation in the South two years later and threatened to seriously compromise the Pleurotus market. This study was initiated to: isolate and identify the aggressive fungi, then morphologically, physiologically and genetically characterize the isolates, determine the source and phases of infection, and study methods of control. Samples were obtained from different phases of compost preparation at the locality of a major producer and supplier of compost to the mushroom industry in Southern Italy, and microbial counts were conducted. Although the presence of Trichoderma was detected in the initial stages of composting, this value was reduced to zero from the phase of pasteurization to seeding with Pleurotus. Trichoderma infestations were noted in the packaged Pleurotus bales at various times during the incubation phase (7-15 days after seeding) and after shipping to the mushroom greenhouses, where the pathogen infestations greatly reduced the quality and quantity of the mushroom yield, as well as the number of potential harvest cycles.Preliminary results from the morphological and genetic
International Nuclear Information System (INIS)
Rosnani Abdul Rashid; Mat Rasol Awang; Hassan Hamdani Hassan Mutaat; Meswan Maskom
2006-01-01
This paper aimed at comparing the mushroom yield of Pleurotus sajor caju and Pleurotus florida which was harvested in five flushes. The γ-irradiated empty fruit bunch (EFB) at 25kGy was used as cultivation substrate. About 1 to 2% liquid seed of P. sajor caju and P. florida was inoculated into cultivation substrate. After 30 days, the inoculated substrate was opened for fruiting. For both species, the maximum mushroom yield was obtained in first flush and the lowest yield from the fifth flush. This show the mushroom yield is affected by number of flush. From analysis, the mushroom yield of P. florida was much better compared to P. sajor caju for all flushes. (Author)
Cultivation Techniques and Medicinal Properties of Pleurotus spp.
Directory of Open Access Journals (Sweden)
Andrej Gregori
2007-01-01
Full Text Available The genus Pleurotus (oyster mushroom comprises some most popular edible mushrooms due to their favourable organoleptic and medicinal properties, vigorous growth and undemanding cultivation conditions. It can be cultivated on log and a wide variety of agroforestry (by-products, weeds and wastes for the production of food, feed, enzymes and medicinal compounds, or for waste degradation and detoxification. Many different techniques and substrates have been successfully utilized for mushroom cultivation and biomass production by means of solid-state and submerged liquid fermentation. However, in contrast to submerged liquid fermentation, solid-state fermentation is not often used in large scale due to severe engineering problems. Various Pleurotus species have been shown to possess a number of medicinal properties, such as antitumour, immunomodulatory, antigenotoxic, antioxidant, anti-inflammatory, hypocholesterolaemic, antihypertensive, antiplatelet-aggregating, antihyperglycaemic, antimicrobial and antiviral activities. These therapeutic activities are exhibited by extracts or isolated compounds from Pleurotus spp. fermentation broth, mycelia and fruiting bodies. In particular, polysaccharides appear to be potent antitumour and immuno-enhancing substances, besides possessing other beneficial activities. However, the biochemical mechanisms of these therapeutic activities still remain largely unknown. This review focuses on recent advances in the biotechnology of Pleurotus spp., with emphasis on the production of fruiting bodies, the production of mycelium and bioactive compounds by solid-state and submerged liquid fermentation. The medicinal properties of this mushroom are also outlined.
Omarini, Alejandra B; Plagemann, Ina; Schimanski, Silke; Krings, Ulrich; Berger, Ralf G
2014-11-01
Several hundred monokaryotic and new dikaryotic strains derived thereof were established from (+)-valencene tolerant Pleurotus species. When grouped according to their growth rate on agar plates and compared to the parental of Pleurotus sapidus 69, the slowly growing monokaryons converted (+)-valencene more efficiently to the grapefruit flavour compound (+)-nootkatone. The fast growing monokaryons and the slow×slow and the fast×fast dikaryotic crosses showed similar or inferior yields. Some slow×fast dikaryons, however, exceeded the biotransformation capability of the parental dikaryon significantly. The activity of the responsible enzyme, lipoxygenase, showed a weak correlation with the yields of (+)-nootkatone indicating that the determination of enzyme activity using the primary substrate linoleic acid may be misleading in predicting the biotransformation efficiency. This exploratory study indicated that a classical genetics approach resulted in altered and partly improved terpene transformation capability (plus 60%) and lipoxygenase activity of the strains. Copyright © 2014 Elsevier Ltd. All rights reserved.
Effect of oyster mushroom ( Pleurotus ostreatus ) mycelia on ...
African Journals Online (AJOL)
Effect of oyster mushroom ( Pleurotus ostreatus ) mycelia on petroleum ... of chains of hydrocarbon in a petroleum-hydrocarbon-contaminated substrate over time. ... Keywords: Mycoremediation, Mycelia, Contaminated Soil, Oyster Mushroom ...
Self-Heating Pasteurization of Substrates for Culinary-Medicinal Mushrooms Cultivation in Mexico.
Morales, Viviana; Sánchez, Jose E
2017-01-01
The aim of this study was to evaluate a self-heating pasteurization technique in preparing substrates for mushroom production. Seven species were used: Agrocybe aegerita, Auricularia fuscosuccinea, Pleurotus djamor, P. eryngii, P. ostreatus, Lentinula edodes, and Ganoderma lucidum. They were cultivated on grass, corncob, wood shavings, and a mixture thereof. The self-heating technique allowed for pasteurization of 3 of the substrates (grass, corncob, and the mixture). The preheating chamber comprised a drawer placed under the pasteurization crate. With this chamber, it was possible to increase inlet air temperatures by 4--5°C. The evaluated mushroom species responded in different ways to the pasteurization process. P. ostreatus (control) and P. djamor produced basidiomes when cultivated in all pasteurization substrates. A. aegerita and P. eryngii fruited only on corncob and the mixture, whereas A. fuscosuccinea fruited only on the pasteurized corncob. G. lucidum and L. edodes did not fructify on the pasteurized substrates.
Renata Zawirska-Wojtasiak; Marek Siwulski; Sylwia Mildner-Szkudlarz; Erwin Wąsowicz
2009-01-01
The aroma of several strains of Pleurotus ostreatus, Pleurotus citrinopileatus and Pleurotus djamor was studied by GC/MS. Three main mushrooms aroma constituents: 3-octanol, 3-octanone and 1-octen-3-ol were taken into account for quantitative measurements. The highest amount of 1-octen-3-ol was recorded in P. ostreatus, while considerably lower amounts in P. citrinopileatus. Sensory profile analysis as well as the electronic nose also varied between the three species of Pleurotus. Chiral gas ...
Directory of Open Access Journals (Sweden)
Eduardo Bernardi
2009-01-01
Full Text Available O objetivo deste trabalho foi avaliar a produtividade, eficiência biológica, massa fresca, composição centesimal dos cogumelos Pleurotus ostreatus (BF24 e Pleurotus sajor-caju (PSC96/03 e PSC01/06 produzidos no substrato capim-elefante (Pennisetum purpureum pasteurizado e a relação Carbono/Nitrogênio inicial e final do substrato. O substrato seco e particulado a 2 cm foi umedecido por 24 horas e pasteurizado a 100 ºC durante 30 minutos. Adicionaram-se 3% de inóculo de cada linhagem, sendo acondicionado em embalagens de polipropileno com 1 kg cada uma. Os substratos foram incubados a 26 ºC e na fase de frutificação a 23±3 ºC e umidade relativa de 75% a 90%. Na linhagem BF24 observou-se maior massa fresca (281,19g, eficiência biológica (112,46% e produtividade (28,11%. O substrato com relação Carbono:Nitrogênio inicial de 162:1 foi o de menor relação (68:1 após o cultivo do P. sajor-caju (PSC01/06. A linhagem PSC96/03 proporcionou maior teor de proteína em relação às demais, tendo a BF24 maior teor de lipídios. Quanto ao teor de carboidratos e cinzas, nas diferentes espécies e linhagens não houve diferenças significativas; já para a quantidade de fibras, as linhagens BF24 e PSC01/06 foram similares, porém superiores a PSC96/03. As duas espécies de Pleurotus podem ser cultivadas em capim-elefante pasteurizado, suprimindo o processo de compostagem.The objective of this work was to evaluate the productivity, biological efficiency, fresh matter, and centesimal composition of mushroom Pleurotus ostreatus (BF24 and Pleurotus sajor-caju (PSC96/03 and PSC01/06 grown in pasteurized elephant grass substrate (Pennisetum purpureum. It was also assessed the initial and final Carbon/Nitrogen ratio. The dried 2-cm-particulate substrate was moist for 24 hours and pasteurized at 100ºC during 30 minutes. Then, it was added 3% of inoculum of each strain. The substrate was placed into 1-kg polypropylene bags. The bags were incubated
Sivolapova, A.B.; Shnyreva, A.V.; Sonnenberg, A.S.M.; Baars, J.J.P.
2012-01-01
Fungi of the genus Pleurotus, in particular, species Pleurotus ostreatus (common oyster mushroom) are among most cultivated fungi in the world. Due to intense rates of development of studies in this field, efficient breeding programs are highly required in the search for new P. ostreatus strains.
Researches on Pleurotus ostreatus mushroom’s quality cultivated on coffee grounds
Directory of Open Access Journals (Sweden)
Sorina Ropciuc
2016-10-01
Full Text Available The objectives of this work were to evaluate the possibility of using coffee grounds for cultivating Pleurotus ostreatus mushrooms and determine the nutritional composition of Pleurotus ostreatus mushrooms produced on coffee grounds substrate. The results revealed a good fruiting of the fungus on coffee grounds and the biological effectiveness (weight of fresh mushroom reached about 97% after 30 days. We determined the total protein content in vitamin C, the total polyphenols and the activity of Polyphenol oxidases (PPOs enzyme on 32 samples of fresh Pleurotus ostreatus mushroom (top and bottom and subjected to heat treatments (blanching, boiling and freezing. The protein content was ranged between the values of 16.9 and 25.1g/ 100g and the Vitamin C content within the range of values presented 64.32-564.95 mg/100g. The polyphenol content results varied significantly in the analyzed samples varying between 1.887 – 7.667 mg GAE / 100 g vegetable product. The determination of the polyphenol oxidase enzyme responsible for enzymatically blackening of the fungus presented values in the range 0.274- 0.610mg / 100g.
Antinociceptive effect of Pleurotus ostreatus (Oyster Mushroom ...
African Journals Online (AJOL)
PROF HORSFALL
pattern by comparing it with a standard drug and a control using the hot water based flick tail test. Thirty five ... groups two, three and four were treated with 100, 200 and 400 mg/kg of Pleurotus ostreatus aqueous ... Abnormalities in the nervous system may also cause ... During this period, they were covered with wire gauze,.
A Low Cost 3D Acquiring System for Mushroom Robot Based on Webcam and Line Laser
Directory of Open Access Journals (Sweden)
Gang Sun
2014-03-01
Full Text Available This paper presents a low cost 3D acquiring system for mushroom robot based on webcam and line laser. The system comprises Webcam, semiconductor line laser, motion platform and data process unit. The system can get the 3D information of the Pleurotus eryngii in bottle based on structured light scanning theory. Field test shows the accuracy of the height is less than 2mm and it can be use to locate the buds in the bottle correctly. It has the potention to fulfill the requirement of the location of the mushroom for thinning bud robot.
Biocatalytic synthesis of the Green Note trans-2-hexenal in a continuous-flow microreactor.
van Schie, Morten M C H; Pedroso de Almeida, Tiago; Laudadio, Gabriele; Tieves, Florian; Fernández-Fueyo, Elena; Noël, Timothy; Arends, Isabel W C E; Hollmann, Frank
2018-01-01
The biocatalytic preparation of trans -hex-2-enal from trans -hex-2-enol using a novel aryl alcohol oxidase from Pleurotus eryngii ( Pe AAOx) is reported. As O 2 -dependent enzyme Pe AAOx-dependent reactions are generally plagued by the poor solubility of O 2 in aqueous media and mass transfer limitations resulting in poor reaction rates. These limitations were efficiently overcome by conducting the reaction in a flow-reactor setup reaching unpreceded catalytic activities for the enzyme in terms of turnover frequency (up to 38 s -1 ) and turnover numbers (more than 300000) pointing towards preparative usefulness of the proposed reaction scheme.
Directory of Open Access Journals (Sweden)
Kouki Fujioka
2013-11-01
Full Text Available Electronic noses have the benefit of obtaining smell information in a simple and objective manner, therefore, many applications have been developed for broad analysis areas such as food, drinks, cosmetics, medicine, and agriculture. However, measurement values from electronic noses have a tendency to vary under humidity or alcohol exposure conditions, since several types of sensors in the devices are affected by such variables. Consequently, we show three techniques for reducing the variation of sensor values: (1 using a trapping system to reduce the infering components; (2 performing statistical standardization (calculation of z-score; and (3 selecting suitable sensors. With these techniques, we discriminated the volatiles of four types of fresh mushrooms: golden needle (Flammulina velutipes, white mushroom (Agaricus bisporus, shiitake (Lentinus edodes, and eryngii (Pleurotus eryngii among six fresh mushrooms (hen of the woods (Grifola frondosa, shimeji (Hypsizygus marmoreus plus the above mushrooms. Additionally, we succeeded in discrimination of white mushroom, only comparing with artificial mushroom flavors, such as champignon flavor and truffle flavor. In conclusion, our techniques will expand the options to reduce variations in sensor values.
nutrient composition of pleurotus tuberregium (fr) sing's sclerotia
African Journals Online (AJOL)
DJFLEX
The amino acid and mineral profile of Pleurotus tuberregium sclerotia, was investigated. Every 100g ... sample was dried to a constant weight, defatted (by placing a ... (67%), millet, soy bean (74%), peanuts (65%), African ... sodium content to cashew nut (5-13.02mg/100g) [Nandi, .... sclerotia Flour and Protein Concentrate.
Directory of Open Access Journals (Sweden)
Maura Téllez-Téllez
2016-03-01
Full Text Available Crude extract samples of Pleurotus pulmonarius and Pycnoporus cinnabarinus were taken during growth in liquid broth in an airlift reactor. Growth was monitored indirectly by sugar consumption and pH profile. During growth Pleurotus pulmonarius consumed glucose more slowly than Pycnoporus cinnabarinus, reaching a final pH of 8.0. In contrast, Pycnoporus cinnabarinus started consuming glucose faster from the beginning to the end with a pH of 3.6, suggesting the production of different metabolites while they grow in the same culture broth. Additionally, antioxidant activity, polyphenol and flavonoid contents, as well as laccase and hydrolase activities were quantified in the culture extracts during the fermentation. Pleurotus pulmonarius showed higher antioxidant activity than Pycnoporus cinnabarinus. Both fungi have a very low polyphenol and flavonoid content. Values of amylase and pectinase activities were similar in crude extracts of both fungi; however, cellulase, xylanase, invertase, and laccase activities showed higher levels in crude extract of Pleurotus pulmonarius. Antimicrobial and insecticidal activities were also evaluated in each crude extract. In fact, Pycnoporus cinnabarinus presented a very strong bacteriostatic and bactericidal effect against Escherichia coli and Staphylococcus aureus and reliably killed Diatraea magnifactella larvae, while Pleurotus pulmonarius did not showed any negative effect on the growth of these bacteria or larvae.
Amylolytic studies of pleurotus tuber-regium | Monago | Global ...
African Journals Online (AJOL)
The alpha amylase of the sclerotium of Pleurotus tuber-regium was studied. The enzyme was purified from the fresh sclerotium through dialysis, ammonium sulphate fractionation and column chromatography of CM sephadex. The enzyme showed 70% of it's optimal activity between p.H 4.0 to 8.0. Acid and thermal stability ...
Economou, Christina N; Diamantopoulou, Panagiota A; Philippoussis, Antonios N
2017-06-01
Spent mushroom substrate (SMS) of Pleurotus ostreatus was supplemented with wheat bran and soybean flour in various proportions to obtain C/N ratios of 10, 20, and 30, and their effect was evaluated in successive cultivation of Pleurotus ostreatus, Pleurotus pulmonarius, Ganoderma adspersum, Ganoderma resinaceum, and Lentinula edodes strains with respect to mycelium growth rate, biomass concentration, recovery of the enzyme laccase and crude exopolysaccharides, and also with additional fruiting body production. All fungi showed the highest growth rate on unamended SMS (C/N 30), with G. resinaceum being the fastest colonizer (Kr = 9.84 mm day -1 ), while biomass concentration maximized at C/N 10. Moreover, supplementation affected positively laccase activity, with P. pulmonarius furnishing the highest value (44,363.22 U g -1 ) at C/N 20. On the contrary, L. edodes growth, fruiting, and laccase secretion were not favored by SMS supplementation. Fruiting body formation was promoted at C/N 30 for Ganoderma and at C/N 20 for Pleurotus species. Exopolysaccharide production of further studied Pleurotus strains was favored at a C/N 20 ratio, at the initial stage of SMS colonization. The obtained results support the potential effective utilization of supplemented SMS for laccase production from Ganoderma spp. and for new fruiting body production of Pleurotus spp.
Measurement of the CP-violation parameter Re(var-epsilon '/var-epsilon)
International Nuclear Information System (INIS)
Gibbons, L.K.; Barker, A.R.; Briere, R.A.; Makoff, G.; Papadimitriou, V.; Patterson, J.R.; Schwingenheuer, B.; Somalwar, S.V.; Wah, Y.W.; Winstein, B.; Winston, R.; Woods, M.; Yamamoto, H.; Swallow, E.C.; Bock, G.J.; Coleman, R.; Enagonio, J.; Hsiung, Y.B.; Ramberg, E.; Stanfield, K.; Tschirhart, R.; Yamanaka, T.; Gollin, G.D.; Karlsson, M.; Okamitsu, J.K.; Debu, P.; Peyaud, B.; Turlay, R.; Vallage, B.
1993-01-01
A measurement of the CP-violation parameter Re(var-epsilon '/var-epsilon) has been made using the full E731 data set. We find Re(var-epsilon '/var-epsilon)=(7.4±5.2±2.9)x10 -4 where the first error is statistical and the second systematic
Directory of Open Access Journals (Sweden)
W.A. Tapie
2016-08-01
Full Text Available Sugarcane vinasses are considered a complex effluent because of its organic load, low pH, high temperature, and by the presence of recalcitrant substances such as melanoidins and phenolic compounds. The aim of this work was to evaluate the potential of the fungus Pleurotus ostreatus to carry out the biodegradation of sugarcane vinasses in a fixed-bed bioreactor. The experiments evidence the potential of the fungus Pleurotus ostreatus to carry out the decolorization (83%, the removal of the Chemical Oxygen Demand (COD=87% and the Biochemical Oxygen Demand (BOD5=92%, the reduction of total suspended solids (83% and volatile suspended solids (72% of vinasses. The technical simplicity of the proposed alternative as well as process performance reveals the potential of the fungus Pleurotus ostreatus for the treatment of sugarcane mill effluents.
Diseases and pests noxious to Pleurotus spp. mushroom crops.
Bellettini, Marcelo B; Bellettini, Sebastião; Fiorda, Fernanda A; Pedro, Alessandra C; Bach, Fabiane; Fabela-Morón, Miriam F; Hoffmann-Ribani, Rosemary
The Pleurotus genus is one of most extensively studied white-rot fungi due to its exceptional ligninolytic properties. It is an edible mushroom that possesses biological effects, as it contains important bioactive molecules. It is a rich source of nutrients, particularly proteins, minerals as well as vitamins B, C and D. In basidiomycete fungi, intensive cultivations of edible mushrooms can often be affected by some bacterial, mold and virus diseases that rather frequently cause dramatic production loss. These infections are facilitated by the particular conditions under which mushroom cultivation is commonly carried out such as warm temperatures, humidity, carbon dioxide (CO 2 ) levels and presence of pests. There is not much bibliographic information related to pests of mushrooms and their substrates. The updated review presents a practical checklist of diseases and pests of the Pleurotus genus, providing useful information that may help different users. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.
arXiv Observation of the $\\varXi^{-}_{b}\\to J/\\psi\\varLambda K^{-}$ decay
Aaij, Roel; Adinolfi, Marco; Ajaltouni, Ziad; Akar, Simon; Albrecht, Johannes; Alessio, Federico; Alexander, Michael; Ali, Suvayu; Alkhazov, Georgy; Alvarez Cartelle, Paula; Alves Jr, Antonio Augusto; Amato, Sandra; Amerio, Silvia; Amhis, Yasmine; An, Liupan; Anderlini, Lucio; Andreassi, Guido; Andreotti, Mirco; Andrews, Jason; Appleby, Robert; Archilli, Flavio; d'Argent, Philippe; Arnau Romeu, Joan; Artamonov, Alexander; Artuso, Marina; Aslanides, Elie; Auriemma, Giulio; Baalouch, Marouen; Babuschkin, Igor; Bachmann, Sebastian; Back, John; Badalov, Alexey; Baesso, Clarissa; Baker, Sophie; Balagura, Vladislav; Baldini, Wander; Barlow, Roger; Barschel, Colin; Barsuk, Sergey; Barter, William; Baryshnikov, Fedor; Baszczyk, Mateusz; Batozskaya, Varvara; Batsukh, Baasansuren; Battista, Vincenzo; Bay, Aurelio; Beaucourt, Leo; Beddow, John; Bedeschi, Franco; Bediaga, Ignacio; Bel, Lennaert; Bellee, Violaine; Belloli, Nicoletta; Belous, Konstantin; Belyaev, Ivan; Ben-Haim, Eli; Bencivenni, Giovanni; Benson, Sean; Berezhnoy, Alexander; Bernet, Roland; Bertolin, Alessandro; Betancourt, Christopher; Betti, Federico; Bettler, Marc-Olivier; van Beuzekom, Martinus; Bezshyiko, Iaroslava; Bifani, Simone; Billoir, Pierre; Bird, Thomas; Birnkraut, Alex; Bitadze, Alexander; Bizzeti, Andrea; Blake, Thomas; Blanc, Frederic; Blouw, Johan; Blusk, Steven; Bocci, Valerio; Boettcher, Thomas; Bondar, Alexander; Bondar, Nikolay; Bonivento, Walter; Bordyuzhin, Igor; Borgheresi, Alessio; Borghi, Silvia; Borisyak, Maxim; Borsato, Martino; Bossu, Francesco; Boubdir, Meriem; Bowcock, Themistocles; Bowen, Espen Eie; Bozzi, Concezio; Braun, Svende; Britsch, Markward; Britton, Thomas; Brodzicka, Jolanta; Buchanan, Emma; Burr, Christopher; Bursche, Albert; Buytaert, Jan; Cadeddu, Sandro; Calabrese, Roberto; Calvi, Marta; Calvo Gomez, Miriam; Camboni, Alessandro; Campana, Pierluigi; Campora Perez, Daniel Hugo; Capriotti, Lorenzo; Carbone, Angelo; Carboni, Giovanni; Cardinale, Roberta; Cardini, Alessandro; Carniti, Paolo; Carson, Laurence; Carvalho Akiba, Kazuyoshi; Casse, Gianluigi; Cassina, Lorenzo; Castillo Garcia, Lucia; Cattaneo, Marco; Cavallero, Giovanni; Cenci, Riccardo; Chamont, David; Charles, Matthew; Charpentier, Philippe; Chatzikonstantinidis, Georgios; Chefdeville, Maximilien; Chen, Shanzhen; Cheung, Shu-Faye; Chobanova, Veronika; Chrzaszcz, Marcin; Cid Vidal, Xabier; Ciezarek, Gregory; Clarke, Peter; Clemencic, Marco; Cliff, Harry; Closier, Joel; Coco, Victor; Cogan, Julien; Cogneras, Eric; Cogoni, Violetta; Cojocariu, Lucian; Collazuol, Gianmaria; Collins, Paula; Comerma-Montells, Albert; Contu, Andrea; Cook, Andrew; Coombs, George; Coquereau, Samuel; Corti, Gloria; Corvo, Marco; Costa Sobral, Cayo Mar; Couturier, Benjamin; Cowan, Greig; Craik, Daniel Charles; Crocombe, Andrew; Cruz Torres, Melissa Maria; Cunliffe, Samuel; Currie, Robert; D'Ambrosio, Carmelo; Da Cunha Marinho, Franciole; Dall'Occo, Elena; Dalseno, Jeremy; David, Pieter; Davis, Adam; De Bruyn, Kristof; De Capua, Stefano; De Cian, Michel; De Miranda, Jussara; De Paula, Leandro; De Serio, Marilisa; De Simone, Patrizia; Dean, Cameron Thomas; Decamp, Daniel; Deckenhoff, Mirko; Del Buono, Luigi; Demmer, Moritz; Dendek, Adam; Derkach, Denis; Deschamps, Olivier; Dettori, Francesco; Dey, Biplab; Di Canto, Angelo; Dijkstra, Hans; Dordei, Francesca; Dorigo, Mirco; Dosil Suárez, Alvaro; Dovbnya, Anatoliy; Dreimanis, Karlis; Dufour, Laurent; Dujany, Giulio; Dungs, Kevin; Durante, Paolo; Dzhelyadin, Rustem; Dziurda, Agnieszka; Dzyuba, Alexey; Déléage, Nicolas; Easo, Sajan; Ebert, Marcus; Egede, Ulrik; Egorychev, Victor; Eidelman, Semen; Eisenhardt, Stephan; Eitschberger, Ulrich; Ekelhof, Robert; Eklund, Lars; Ely, Scott; Esen, Sevda; Evans, Hannah Mary; Evans, Timothy; Falabella, Antonio; Farley, Nathanael; Farry, Stephen; Fay, Robert; Fazzini, Davide; Ferguson, Dianne; Fernandez Prieto, Antonio; Ferrari, Fabio; Ferreira Rodrigues, Fernando; Ferro-Luzzi, Massimiliano; Filippov, Sergey; Fini, Rosa Anna; Fiore, Marco; Fiorini, Massimiliano; Firlej, Miroslaw; Fitzpatrick, Conor; Fiutowski, Tomasz; Fleuret, Frederic; Fohl, Klaus; Fontana, Marianna; Fontanelli, Flavio; Forshaw, Dean Charles; Forty, Roger; Franco Lima, Vinicius; Frank, Markus; Frei, Christoph; Fu, Jinlin; Funk, Wolfgang; Furfaro, Emiliano; Färber, Christian; Gallas Torreira, Abraham; Galli, Domenico; Gallorini, Stefano; Gambetta, Silvia; Gandelman, Miriam; Gandini, Paolo; Gao, Yuanning; Garcia Martin, Luis Miguel; García Pardiñas, Julián; Garra Tico, Jordi; Garrido, Lluis; Garsed, Philip John; Gascon, David; Gaspar, Clara; Gavardi, Laura; Gazzoni, Giulio; Gerick, David; Gersabeck, Evelina; Gersabeck, Marco; Gershon, Timothy; Ghez, Philippe; Gianì, Sebastiana; Gibson, Valerie; Girard, Olivier Göran; Giubega, Lavinia-Helena; Gizdov, Konstantin; Gligorov, Vladimir; Golubkov, Dmitry; Golutvin, Andrey; Gomes, Alvaro; Gorelov, Igor Vladimirovich; Gotti, Claudio; Graciani Diaz, Ricardo; Granado Cardoso, Luis Alberto; Graugés, Eugeni; Graverini, Elena; Graziani, Giacomo; Grecu, Alexandru; Griffith, Peter; Grillo, Lucia; Gruberg Cazon, Barak Raimond; Grünberg, Oliver; Gushchin, Evgeny; Guz, Yury; Gys, Thierry; Göbel, Carla; Hadavizadeh, Thomas; Hadjivasiliou, Christos; Haefeli, Guido; Haen, Christophe; Haines, Susan; Hamilton, Brian; Han, Xiaoxue; Hansmann-Menzemer, Stephanie; Harnew, Neville; Harnew, Samuel; Harrison, Jonathan; Hatch, Mark; He, Jibo; Head, Timothy; Heister, Arno; Hennessy, Karol; Henrard, Pierre; Henry, Louis; van Herwijnen, Eric; Heß, Miriam; Hicheur, Adlène; Hill, Donal; Hombach, Christoph; Hopchev, P H; Hulsbergen, Wouter; Humair, Thibaud; Hushchyn, Mikhail; Hutchcroft, David; Idzik, Marek; Ilten, Philip; Jacobsson, Richard; Jaeger, Andreas; Jalocha, Pawel; Jans, Eddy; Jawahery, Abolhassan; Jiang, Feng; John, Malcolm; Johnson, Daniel; Jones, Christopher; Joram, Christian; Jost, Beat; Jurik, Nathan; Kandybei, Sergii; Karacson, Matthias; Kariuki, James Mwangi; Karodia, Sarah; Kecke, Matthieu; Kelsey, Matthew; Kenzie, Matthew; Ketel, Tjeerd; Khairullin, Egor; Khanji, Basem; Khurewathanakul, Chitsanu; Kirn, Thomas; Klaver, Suzanne; Klimaszewski, Konrad; Koliiev, Serhii; Kolpin, Michael; Komarov, Ilya; Koopman, Rose; Koppenburg, Patrick; Kosmyntseva, Alena; Kozachuk, Anastasiia; Kozeiha, Mohamad; Kravchuk, Leonid; Kreplin, Katharina; Kreps, Michal; Krokovny, Pavel; Kruse, Florian; Krzemien, Wojciech; Kucewicz, Wojciech; Kucharczyk, Marcin; Kudryavtsev, Vasily; Kuonen, Axel Kevin; Kurek, Krzysztof; Kvaratskheliya, Tengiz; Lacarrere, Daniel; Lafferty, George; Lai, Adriano; Lanfranchi, Gaia; Langenbruch, Christoph; Latham, Thomas; Lazzeroni, Cristina; Le Gac, Renaud; van Leerdam, Jeroen; Leflat, Alexander; Lefrançois, Jacques; Lefèvre, Regis; Lemaitre, Florian; Lemos Cid, Edgar; Leroy, Olivier; Lesiak, Tadeusz; Leverington, Blake; Li, Tenglin; Li, Yiming; Likhomanenko, Tatiana; Lindner, Rolf; Linn, Christian; Lionetto, Federica; Liu, Xuesong; Loh, David; Longstaff, Iain; Lopes, Jose; Lucchesi, Donatella; Lucio Martinez, Miriam; Luo, Haofei; Lupato, Anna; Luppi, Eleonora; Lupton, Oliver; Lusiani, Alberto; Lyu, Xiao-Rui; Machefert, Frederic; Maciuc, Florin; Maev, Oleg; Maguire, Kevin; Malde, Sneha; Malinin, Alexander; Maltsev, Timofei; Manca, Giulia; Mancinelli, Giampiero; Manning, Peter Michael; Maratas, Jan; Marchand, Jean François; Marconi, Umberto; Marin Benito, Carla; Marinangeli, Matthieu; Marino, Pietro; Marks, Jörg; Martellotti, Giuseppe; Martin, Morgan; Martinelli, Maurizio; Martinez Santos, Diego; Martinez Vidal, Fernando; Martins Tostes, Danielle; Massacrier, Laure Marie; Massafferri, André; Matev, Rosen; Mathad, Abhijit; Mathe, Zoltan; Matteuzzi, Clara; Mauri, Andrea; Maurice, Emilie; Maurin, Brice; Mazurov, Alexander; McCann, Michael; McNab, Andrew; McNulty, Ronan; Meadows, Brian; Meier, Frank; Meissner, Marco; Melnychuk, Dmytro; Merk, Marcel; Merli, Andrea; Michielin, Emanuele; Milanes, Diego Alejandro; Minard, Marie-Noelle; Mitzel, Dominik Stefan; Mogini, Andrea; Molina Rodriguez, Josue; Monroy, Ignacio Alberto; Monteil, Stephane; Morandin, Mauro; Morawski, Piotr; Mordà, Alessandro; Morello, Michael Joseph; Morgunova, Olga; Moron, Jakub; Morris, Adam Benjamin; Mountain, Raymond; Muheim, Franz; Mulder, Mick; Mussini, Manuel; Müller, Dominik; Müller, Janine; Müller, Katharina; Müller, Vanessa; Naik, Paras; Nakada, Tatsuya; Nandakumar, Raja; Nandi, Anita; Nasteva, Irina; Needham, Matthew; Neri, Nicola; Neubert, Sebastian; Neufeld, Niko; Neuner, Max; Nguyen, Thi Dung; Nguyen-Mau, Chung; Nieswand, Simon; Niet, Ramon; Nikitin, Nikolay; Nikodem, Thomas; Nogay, Alla; Novoselov, Alexey; O'Hanlon, Daniel Patrick; Oblakowska-Mucha, Agnieszka; Obraztsov, Vladimir; Ogilvy, Stephen; Oldeman, Rudolf; Onderwater, Gerco; Otalora Goicochea, Juan Martin; Otto, Adam; Owen, Patrick; Oyanguren, Maria Aranzazu; Pais, Preema Rennee; Palano, Antimo; Palombo, Fernando; Palutan, Matteo; Papanestis, Antonios; Pappagallo, Marco; Pappalardo, Luciano; Parker, William; Parkes, Christopher; Passaleva, Giovanni; Pastore, Alessandra; Patel, Girish; Patel, Mitesh; Patrignani, Claudia; Pearce, Alex; Pellegrino, Antonio; Penso, Gianni; Pepe Altarelli, Monica; Perazzini, Stefano; Perret, Pascal; Pescatore, Luca; Petridis, Konstantinos; Petrolini, Alessandro; Petrov, Aleksandr; Petruzzo, Marco; Picatoste Olloqui, Eduardo; Pietrzyk, Boleslaw; Pikies, Malgorzata; Pinci, Davide; Pistone, Alessandro; Piucci, Alessio; Placinta, Vlad-Mihai; Playfer, Stephen; Plo Casasus, Maximo; Poikela, Tuomas; Polci, Francesco; Poluektov, Anton; Polyakov, Ivan; Polycarpo, Erica; Pomery, Gabriela Johanna; Popov, Alexander; Popov, Dmitry; Popovici, Bogdan; Poslavskii, Stanislav; Potterat, Cédric; Price, Eugenia; Price, Joseph David; Prisciandaro, Jessica; Pritchard, Adrian; Prouve, Claire; Pugatch, Valery; Puig Navarro, Albert; Punzi, Giovanni; Qian, Wenbin; Quagliani, Renato; Rachwal, Bartolomiej; Rademacker, Jonas; Rama, Matteo; Ramos Pernas, Miguel; Rangel, Murilo; Raniuk, Iurii; Ratnikov, Fedor; Raven, Gerhard; Redi, Federico; Reichert, Stefanie; dos Reis, Alberto; Remon Alepuz, Clara; Renaudin, Victor; Ricciardi, Stefania; Richards, Sophie; Rihl, Mariana; Rinnert, Kurt; Rives Molina, Vicente; Robbe, Patrick; Rodrigues, Ana Barbara; Rodrigues, Eduardo; Rodriguez Lopez, Jairo Alexis; Rodriguez Perez, Pablo; Rogozhnikov, Alexey; Roiser, Stefan; Rollings, Alexandra Paige; Romanovskiy, Vladimir; Romero Vidal, Antonio; Ronayne, John William; Rotondo, Marcello; Rudolph, Matthew Scott; Ruf, Thomas; Ruiz Valls, Pablo; Saborido Silva, Juan Jose; Sadykhov, Elnur; Sagidova, Naylya; Saitta, Biagio; Salustino Guimaraes, Valdir; Sanchez Mayordomo, Carlos; Sanmartin Sedes, Brais; Santacesaria, Roberta; Santamarina Rios, Cibran; Santimaria, Marco; Santovetti, Emanuele; Sarti, Alessio; Satriano, Celestina; Satta, Alessia; Saunders, Daniel Martin; Savrina, Darya; Schael, Stefan; Schellenberg, Margarete; Schiller, Manuel; Schindler, Heinrich; Schlupp, Maximilian; Schmelling, Michael; Schmelzer, Timon; Schmidt, Burkhard; Schneider, Olivier; Schopper, Andreas; Schubert, Konstantin; Schubiger, Maxime; Schune, Marie Helene; Schwemmer, Rainer; Sciascia, Barbara; Sciubba, Adalberto; Semennikov, Alexander; Sergi, Antonino; Serra, Nicola; Serrano, Justine; Sestini, Lorenzo; Seyfert, Paul; Shapkin, Mikhail; Shapoval, Illya; Shcheglov, Yury; Shears, Tara; Shekhtman, Lev; Shevchenko, Vladimir; Siddi, Benedetto Gianluca; Silva Coutinho, Rafael; Silva de Oliveira, Luiz Gustavo; Simi, Gabriele; Simone, Saverio; Sirendi, Marek; Skidmore, Nicola; Skwarnicki, Tomasz; Smith, Eluned; Smith, Iwan Thomas; Smith, Jackson; Smith, Mark; Snoek, Hella; Soares Lavra, Lais; Sokoloff, Michael; Soler, Paul; Souza De Paula, Bruno; Spaan, Bernhard; Spradlin, Patrick; Sridharan, Srikanth; Stagni, Federico; Stahl, Marian; Stahl, Sascha; Stefko, Pavol; Stefkova, Slavorima; Steinkamp, Olaf; Stemmle, Simon; Stenyakin, Oleg; Stevens, Holger; Stevenson, Scott; Stoica, Sabin; Stone, Sheldon; Storaci, Barbara; Stracka, Simone; Straticiuc, Mihai; Straumann, Ulrich; Sun, Liang; Sutcliffe, William; Swientek, Krzysztof; Syropoulos, Vasileios; Szczekowski, Marek; Szumlak, Tomasz; T'Jampens, Stephane; Tayduganov, Andrey; Tekampe, Tobias; Tellarini, Giulia; Teubert, Frederic; Thomas, Eric; van Tilburg, Jeroen; Tilley, Matthew James; Tisserand, Vincent; Tobin, Mark; Tolk, Siim; Tomassetti, Luca; Tonelli, Diego; Topp-Joergensen, Stig; Toriello, Francis; Tournefier, Edwige; Tourneur, Stephane; Trabelsi, Karim; Traill, Murdo; Tran, Minh Tâm; Tresch, Marco; Trisovic, Ana; Tsaregorodtsev, Andrei; Tsopelas, Panagiotis; Tully, Alison; Tuning, Niels; Ukleja, Artur; Ustyuzhanin, Andrey; Uwer, Ulrich; Vacca, Claudia; Vagnoni, Vincenzo; Valassi, Andrea; Valat, Sebastien; Valenti, Giovanni; Vazquez Gomez, Ricardo; Vazquez Regueiro, Pablo; Vecchi, Stefania; van Veghel, Maarten; Velthuis, Jaap; Veltri, Michele; Veneziano, Giovanni; Venkateswaran, Aravindhan; Vernet, Maxime; Vesterinen, Mika; Viana Barbosa, Joao Vitor; Viaud, Benoit; Vieira, Daniel; Vieites Diaz, Maria; Viemann, Harald; Vilasis-Cardona, Xavier; Vitti, Marcela; Volkov, Vladimir; Vollhardt, Achim; Voneki, Balazs; Vorobyev, Alexey; Vorobyev, Vitaly; Voß, Christian; de Vries, Jacco; Vázquez Sierra, Carlos; Waldi, Roland; Wallace, Charlotte; Wallace, Ronan; Walsh, John; Wang, Jianchun; Ward, David; Wark, Heather Mckenzie; Watson, Nigel; Websdale, David; Weiden, Andreas; Whitehead, Mark; Wicht, Jean; Wilkinson, Guy; Wilkinson, Michael; Williams, Mark Richard James; Williams, Matthew; Williams, Mike; Williams, Timothy; Wilson, Fergus; Wimberley, Jack; Wishahi, Julian; Wislicki, Wojciech; Witek, Mariusz; Wormser, Guy; Wotton, Stephen; Wraight, Kenneth; Wyllie, Kenneth; Xie, Yuehong; Xing, Zhou; Xu, Zhirui; Yang, Zhenwei; Yao, Yuezhe; Yin, Hang; Yu, Jiesheng; Yuan, Xuhao; Yushchenko, Oleg; Zarebski, Kristian Alexander; Zavertyaev, Mikhail; Zhang, Liming; Zhang, Yanxi; Zhang, Yu; Zhelezov, Alexey; Zheng, Yangheng; Zhu, Xianglei; Zhukov, Valery; Zucchelli, Stefano
2017-09-10
The observation of the decay $\\varXi_{b}^{-}\\to J/\\psi\\varLambda K^{-}$ is reported, using a data sample corresponding to an integrated luminosity of $3~\\mathrm{fb}^{-1}$, collected by the LHCb detector in $pp$ collisions at centre-of-mass energies of $7$ and $8~\\mathrm{TeV}$. The production rate of $\\varXi_{b}^{-}$ baryons detected in the decay $\\varXi_{b}^{-}\\to J/\\psi\\varLambda K^{-}$ is measured relative to that of $\\varLambda_{b}^{0}$ baryons using the decay $\\varLambda_{b}^{0}\\to J/\\psi \\varLambda$. Integrated over the $b$-baryon transverse momentum $p_{\\rm T}<25~\\mathrm{GeV/}c $ and rapidity $2.0 < y < 4.5$, the measured ratio is \\begin{equation*} \\frac{f_{\\varXi_{b}^{-}}}{f_{\\varLambda_{b}^{0}}}\\frac{\\mathcal{B}(\\varXi_{b}^{-}\\to J/\\psi\\varLambda K^{-})}{\\mathcal{B}(\\varLambda_{b}^{0}\\to J/\\psi \\varLambda)}=(4.19\\pm 0.29~(\\mathrm{stat})\\pm0.14~(\\mathrm{syst}))\\times 10^{-2}, \\end{equation*}where $f_{\\varXi_{b}^{-}}$ and $f_{\\varLambda_{b}^{0}}$ are the fragmentation fractions of $b\\to\\varXi_{...
(Pleurotus pulmonarius) grown on cotton waste and cassava peel
African Journals Online (AJOL)
This work evaluated the yield of Pleurotus pulmonarius on different mixtures of cotton waste and cassava peel. P. pulmonarius demonstrated significantly higher colonization rate on cotton waste substrate (100 g cotton waste) 3 weeks after inoculation of spawn than any other substrate mixtures. Cotton waste had the ...
Evaluation of cellulosic wastes for the cultivation of Pleurotus eryngii ...
African Journals Online (AJOL)
STORAGESEVER
2008-05-16
May 16, 2008 ... of plant residues, and they have been found to be nutritionally and ... In most countries, there is a well-established consumer accep- tance for cultivated ... temperature, dampness, CO2, cultivation methods and tecniques etc.
Improving the feeding value of straws with Pleurotus ostreatus
Khan, N.A.; Hussain, S.; Ahmad, N.; Alam, S.; Bezabhi, M.; Hendriks, W.H.; Yu, P.; Cone, J.W.
2015-01-01
The high content of lignin in cell walls is the major limiting factor in the digestion and utilisation of cereal crop residues by ruminants. The aim of this study was to evaluate the effectiveness of the white rot fungus, Pleurotus ostreatus (P. ostreatus), to degrade lignin and to enhance the rumen
Dose Response for Monokaryon mycelium of Pleurotus pulmonarius After Acute Gamma Radiation
International Nuclear Information System (INIS)
Wan Safina Wan Abdul Razak; Azhar Mohamad; Nie, H.J.
2016-01-01
Pleurotus pulmonarius is locally known as Grey oyster. The species is popular and widely cultivated throughout the world mostly in Asia Europe as their simple and low cost production technology and higher biological efficiency. Mutation induction is an alternative ways for improving available commercial strain for better quality traits. Dose response is important in evaluating effects of mutagenesis via acute gamma radiation. Monokaryon mycelium of Pleurotus pulmonarius was exposed to acute gamma radiation ranged from 0 Gy, 0.1 kGy, 0.2 kGy, 0.3 kGy, 0.4 kGy, 0.5 kGy, 0.6 kGy, 0.7 kGy, 0.8 kGy, 0.9 kGy, 1.0 kGy, 1.5 Gy, 2.0 kGy, 3.0 kGy and 4.0 kGy at dose rate 0.013 kGy/ min. growth performance was measured at 2 days interval to get the LD_5_0. Increasing of the irradiation dose found to decrease the growth performance of the monokaryon mycelium. LD_5_0 was revealed at 1.56 kGy for mono karyon mycelium. Discoveries of the works are important for the improvement of Pleurotus species via acute gamma radiation and benefiting to growers and mushroom industries. (author)
Cultivation of mushroom ( Pleurotus ostreatus ) using corn cobs and ...
African Journals Online (AJOL)
An investigation was carried out on the cultivation of mushroom (Pleurotus ostreatus) using corn cobs and saw dust as the main substrates. Lignocellulosic wastes such as corn cobs and saw dust were packaged inside heat – resistant polythene bags and pasteurized before being seeded with 7.5% w/w millet spawn of ...
Preliminary investigation into the use of Pleurotus tuber-regium ...
African Journals Online (AJOL)
The swelling capacity was three times that of maize starch BP Tablets prepared with P. tuber-regium powder disintegrated faster than those prepared with maize starch BP at concentrations below 10% w/w. At the disintegrant concentration of 10% w/w paracetamol tablets made from both Pleurotus powder and maize starch ...
Silva, Evânia Geralda; Dias, Eustáquio Souza; Siqueira, Félix Gonçalves; Schwan, Rosane Freitas
2007-01-01
Os cogumelos do gênero Pleurotus normalmente crescem bem em substratos mais pobres em nitrogênio, ao contrário dos cogumelos Agaricus que requerem substratos com relação C/N mais estreita. Por outro lado, os valores nutricionais do cogumelo dependem da composição química do substrato utilizado e das condições de cultivo. Este trabalho teve como objetivo avaliar o teor de proteína dos corpos de frutificação do cogumelo Pleurotus sajor-caju cultivado em capim coast-cross, bagaço de cana-de-açúc...
Effect of Pleurotus ostreatus fermentation on cocoa pod husk ...
African Journals Online (AJOL)
Cocoa pod husk (CPH) is a major agro-industrial residue in Ghana with a potential value as a low-cost unconventional feedstuff for livestock. However, its effective use is limited by poor nutrient composition, mainly due to its high lignocellulose or fibre and also low protein levels. White–rot fungi such as Pleurotus species ...
Effect of mushroom ( Pleurotus tuber-regium ) inoculums on crude ...
African Journals Online (AJOL)
Pollution of soils by crude oil in Niger-Delta of Nigeria has brought untold hardship to the inhabitants of the region. This study was carried out in 2010/2011 and 2011/2012 to determine the effect of Pleurotus tuber-regium (mushroom) inoculums on crude oil polluted soil on stover and grain yields and as well as cob length ...
VALOR NUTRICIONAL DE PLEUROTUS DJAMOR CULTIVADO EM PALHA DE BANANEIRA
Directory of Open Access Journals (Sweden)
Jamile Rosa RAMPINELLI
2010-11-01
Full Text Available
Cogumelos do gênero Pleurotus representam um alimento de custo baixo, com teor elevado de proteínas, aminoácidos essenciais, proporção elevada de ácidos graxos insaturados, diversas vitaminas e minerais, além de teores baixos de gorduras, ácidos nucléicos, açúcares e calorias. Assim, o objetivo deste trabalho foi avaliar o valor nutricional de basidiomas de Pleurotus djamor de 1o e 2o fluxo produtivo, cultivados em palha de bananeira, em termos de teores de carboidratos, proteínas, fi bras, gorduras, cinzas, vitaminas, fósforo e potássio. Os teores de carboidratos totais, proteína bruta, fi bra bruta e cinzas diminuíram do 1o para o 2o fl uxo produtivo de 32,7 para 27,4g/100g, de 20,5 para 19,8g/100g, de 22,4 para 12,7g/100g e de 7,4 para 6,3g/100g, respectivamente. Os valores de gordura bruta e umidade não variaram, permanecendo em torno de 1,1 e 90g/100g, respectivamente. Os teores de vitamina B1 foram superiores aos de vitamina B2, independentemente do fluxo produtivo, e foi encontrada maior quantidade de potássio do que de fósforo. Pleurotus djamor, de 1o fl uxo produtivo, pode ser considerado fonte de fósforo e potássio, além de apresentar baixo teor de açúcar e não conter gordura.
Albuquerque, Margeli Pereira de
2010-01-01
As espécies de Pleurotus, popularmente conhecidas por cogumelos ostra, são decompositoras primárias de madeira e outros resíduos vegetais biodegradáveis. Estes fungos apresentam propriedades nutricionais com elevados teores de proteínas aminoácidos essenciais, ácidos graxos insaturados, vitaminas e minerais, por isso estão tornando-se cada vez mais importantes como um recurso alimentar. A identificação de substratos que permitam o rápido desenvolvimento do micélio fúngico é uma...
Bioremediation of engine-oil polluted soil by Pleurotus tuber-regium ...
African Journals Online (AJOL)
White-rot fungi have been used in various parts of the world for bioremediation of polluted sites. Pleurotus tuber-regium was noted to have the ability to increase nutrient contents in soils polluted with 1 - 40% engine-oil concentration after six months of incubation. P. tuber-regium increased organic matter, carbon and ...
Mintesnot, Birara; Ayalew, Amare; Kebede, Ameha
2014-01-15
This study assessed the bioconversion of Agriculture wastes like invasive weeds species (Lantana camara, Prosopis juliflora, Parthenium hysterophorus) as a substrate for oyster mushroom (Pleurotus species) cultivation together with wheat straw as a control. The experiment was laid out in factorial combination of substrates and three edible oyster mushroom species in a Completely Randomized Design (CRD) with three replications. Pleurotus ostreatus gave significantly (p mushroom cultivation could contribute to alleviating ecological impact of invasive weed species while offering practical option to mitigating hunger and malnutrition in areas where the invasive weeds became dominant.
Loss, Edenes; Royer, Andrea Rafaela; Barreto-Rodrigues, Marcio; Barana, Ana Claudia
2009-07-30
This study evaluated the Pleurotus spp. mushroom production process using an effluent from the maize agroindustrial process as a carbon and nitrogen source and as a wetting agent. A complete experimental design based on factorial planning was used to optimize the biological efficiency and evaluate the effect of the concentration of effluent, pH and species of Pleurotus. The results indicated that the effluent affects the biological efficiency for the production of both species of mushrooms at all pH values studied. The maximum biological efficiency predicted by the model (81.36%) corresponded to the point defined by the effluent contents (X(1)=1), pH (X(2)=-1) and fungus species (X(3)=1), specifically 50%, 5.0 and P. floridae, respectively. The results demonstrated that the effluent is a good alternative for the production of Pleurotus mushrooms.
Directory of Open Access Journals (Sweden)
MARÍA DEL PILAR RÍOS
2010-12-01
Full Text Available Se evaluaron medios alternativos para la propagación de Pleurotus ostreatus y se comparó su comportamiento frente a un medio comercial. La respuesta a estos medios fue medida mediante la adaptación del hongo en cebada para la obtención de semilla comercial, y ésta a su vez en la respuesta a un sustrato a base de bagazo de caña para la obtención de orellanas. En la primera fase se obtuvo y sembró el hongo en un medio sólido de extracto de papa a dos concentraciones y tres valores de pH, utilizando un diseño factorial 2x3 (pH vs concentración de extracto de papa. En la segunda fase se midió el crecimiento de Pleurotus ostreatus inoculado en cebada hidratada esterilizada mediante un diseño completamente al azar 3x3. En la tercera se evaluó la colonización y fructificación del hongo en bagazo de caña usando parámetros como eficiencia biológica, rendimiento y tasa de producción semilla, con un diseño completamente al azar 3x3. El medio alternativo con pH 5,0 fue el más adecuado para el crecimiento del Pleurotus ostreatus, demostrando su adaptabilidad a medios con alto contenido de carbohidratos, cuyos rendimientos fueron apropiados para obtener niveles de producción competitivos en crecimiento y fructificación, disminuyendo así el tiempo de incubación y cosecha.Foram avaliados os meios alternativos para a propagação de fungos Pleurotus ostreatus e se comparou o seu comportamento em um ambiente comercial. A resposta a esses meios foi medida pela adaptação do fungo em cevada para a obtenção de sementes comerciais e este por sua vez, em resposta a um substrato a base de bagaço de cana para a produção de "Orellana". Na primeira fase foi obtida e plantou o fungo em meio sólido de extrato de batata a duas concentrações e três valores de pH, utilizando um design fatorial 2x3 (pH vs concentração de extrato de batata. Na segunda fase, mediu o crescimento de Pleurotus ostreatus inoculadas em cevada estéril úmida em 3x
Bioremediation of engine-oil polluted soil by Pleurotus tuber-regium ...
African Journals Online (AJOL)
SERVER
2008-01-04
Jan 4, 2008 ... White-rot fungi have been used in various parts of the world for bioremediation of polluted sites. Pleurotus tuber-regium was noted to have the ability to increase nutrient contents in soils polluted with. 1 - 40% engine-oil concentration after six months of incubation. P. tuber-regium increased organic matter ...
Variability of Laccase Activity in the White-Rot Basidiomycete Pleurotus ostreatus
Czech Academy of Sciences Publication Activity Database
Baldrian, Petr; Gabriel, Jiří
2002-01-01
Roč. 47, č. 4 (2002), s. 385-390 ISSN 0015-5632 R&D Projects: GA ČR GP204/02/P100 Institutional research plan: CEZ:AV0Z5020903 Keywords : laccase * pleurotus ostreatus Subject RIV: EE - Microbiology, Virology Impact factor: 0.979, year: 2002
The effect of repair inhibitor on radiation damages of pleurotus ostreatus
International Nuclear Information System (INIS)
Yang Zongqu; Wang Bonan; Li Xuzhao
1996-01-01
The growth rate and enzyme activities significantly decreased when dikaryotic hypha of Pleurotus ostreatus were irradiated with γ-rays and subsequently treated with either caffeine or Na 2 -EDTA in comparison with γ-rays treatment alone. The inhibition effect of treatment with either caffeine or Na 2 -EDTA before irradiation was more obvious than that after irradiation. Treatment with either caffeine or Na 2 -EDTA could cause biological damages on hypha when the concentrations of caffeine and Na 2 -EDTA were up to 0.5 and 1.0 mg/ml respectively. It is suggested that either caffeine or Na 2 -EDTA be used to suppress the repair of radiation damage in order to increase mutation efficiency of Pleurotus ostreatus and that 0.2 mg/ml caffeine and 0.5 mg/ml Na 2 -EDTA might be the proper concentrations of treatment both before and after irradiation. The effect of caffeine is better than that of Na 2 -EDTA
Weinig VVT-instellingen met VAR : onderzoek naar VAR's in Nederland
Corina de Feijter; Pieterbas Lalleman
V&VN is op zoek gegaan naar alle actieve Verpleegkundige en/of Verzorgende Adviesraden (VAR) in Nederland. Het blijkt dat in totaal 144 zorginstellingen (24%) een VAR hebben. Vooral in de VVT-sector is het aantal VAR’s laag: 13%.
Czech Academy of Sciences Publication Activity Database
Svobodová, Kateřina; Petráčková, Denisa; Szabad, Hana; Novotný, Čeněk
2016-01-01
Roč. 3, č. 3 (2016), s. 395-407 ISSN 2372-0344 Institutional support: RVO:61388971 Keywords : Pleurotus ostreatus * activated sludge * fungal/bacterial co-cultur Subject RIV: EE - Microbiology, Virology
Dara, Antoine; Drábek, Elliott F; Travassos, Mark A; Moser, Kara A; Delcher, Arthur L; Su, Qi; Hostelley, Timothy; Coulibaly, Drissa; Daou, Modibo; Dembele, Ahmadou; Diarra, Issa; Kone, Abdoulaye K; Kouriba, Bourema; Laurens, Matthew B; Niangaly, Amadou; Traore, Karim; Tolo, Youssouf; Fraser, Claire M; Thera, Mahamadou A; Djimde, Abdoulaye A; Doumbo, Ogobara K; Plowe, Christopher V; Silva, Joana C
2017-03-28
Encoded by the var gene family, highly variable Plasmodium falciparum erythrocyte membrane protein-1 (PfEMP1) proteins mediate tissue-specific cytoadherence of infected erythrocytes, resulting in immune evasion and severe malaria disease. Sequencing and assembling the 40-60 var gene complement for individual infections has been notoriously difficult, impeding molecular epidemiological studies and the assessment of particular var elements as subunit vaccine candidates. We developed and validated a novel algorithm, Exon-Targeted Hybrid Assembly (ETHA), to perform targeted assembly of var gene sequences, based on a combination of Pacific Biosciences and Illumina data. Using ETHA, we characterized the repertoire of var genes in 12 samples from uncomplicated malaria infections in children from a single Malian village and showed them to be as genetically diverse as vars from isolates from around the globe. The gene var2csa, a member of the var family associated with placental malaria pathogenesis, was present in each genome, as were vars previously associated with severe malaria. ETHA, a tool to discover novel var sequences from clinical samples, will aid the understanding of malaria pathogenesis and inform the design of malaria vaccines based on PfEMP1. ETHA is available at: https://sourceforge.net/projects/etha/ .
International Nuclear Information System (INIS)
Khan, N. A.; Awan, F. S.; Khan, A. I.; Waseem, M.
2017-01-01
The Oyster mushroom (Pleurotus) cultivation is a profitable agribusiness and having high significance due its nutritive and therapeutic value. Due to deficient knowledge on Pleurotus mushroom genetics seven strains of Oyster mushroom, two local and five exotic were studied for their genetic diversity through RAPD markers. It was clear from similarity matrix that similarity index ranges from 45 to 72%. The cluster analysis of combined data set of all the markers resulted in three major clades, while isolate P-17 remains ungrouped and shown to be the most diverse strain of the seven. During amplification of genomic DNA yielded 70 fragments that could be scored, of which 41 were polymorphic, with an average of 2.73 polymorphic fragments per primer. Number of amplified fragments with random primers ranged from three to six. Polymorphism ranged from 0% to 83.33%, with an overall 58% polymorphism. The allele frequency of RAPD primers ranged from 0.71 to 1.00 while the polymorphic information content highest for the primer GL-C-20 (0.29) followed by the primers GL A-20 and GL C-16 that is zero, indicating medium level of polymorphism among the strains of Oyster mushroom. The objective of the study was to characterize Pleurotus strains collected from different origins and to find out the variability at molecular level. (author)
Biodegradation of oxytetracycline by Pleurotus ostreatus mycelium: a mycoremediation technique
International Nuclear Information System (INIS)
Migliore, Luciana; Fiori, Maurizio; Spadoni, Anna; Galli, Emanuela
2012-01-01
Highlights: ► Oxytetracycline uptake and degradation by Pleurotus ostreatus mycelium were measured. ► The role of extracellular laccase in degradation was evaluated. ► The almost complete OTC removal was obtained. ► A possible degradation product was identified in mycelia (ADOTC). ► The system can be considered the first step of an useful mycoremediation technique. - Abstract: Oxytetracycline (OTC) is administered in high doses to livestocks and enters the environmental compartments as a consequence of animal waste disposal. As a first step in setting up a useful mycoremediation technique, an OTC lab degradation test was performed in liquid medium using the ligninolytic fungus Pleurotus ostreatus. OTC disappearance in culture medium was clearly evident as early as the third day of exposure onwards, with an almost complete removal after 14 d. The drug removal was mediated by fungal absorption in the mycelia, where the OTC molecule underwent a degradation step, as demonstrated by mass spectrometry analyses. A putative degradation product, ADOTC (2-acetyl-2-decarboxamido-oxytetracycline) is proposed. Experimental conditions excluded OTC abiotic degradation; the degradation by extracellular laccase was also experimentally discarded.
Biodegradation of oxytetracycline by Pleurotus ostreatus mycelium: a mycoremediation technique
Energy Technology Data Exchange (ETDEWEB)
Migliore, Luciana [Dept. Biology, Tor Vergata University, Via della Ricerca Scientifica, 00133 Rome (Italy); Fiori, Maurizio [Dept. Veterinary Public Health and Food Safety, Istituto Superiore di Sanita, Viale Regina Elena 299, 00161 Rome (Italy); Spadoni, Anna [Dept. Biology, Tor Vergata University, Via della Ricerca Scientifica, 00133 Rome (Italy); Institute of Agro-Environment and Forest Biology, National Research Council, Research Area Rome 1, Via Salaria km 29.300, 00015 Monterotondo Rome (Italy); Galli, Emanuela [Institute of Agro-Environment and Forest Biology, National Research Council, Research Area Rome 1, Via Salaria km 29.300, 00015 Monterotondo Rome (Italy)
2012-05-15
Highlights: Black-Right-Pointing-Pointer Oxytetracycline uptake and degradation by Pleurotus ostreatus mycelium were measured. Black-Right-Pointing-Pointer The role of extracellular laccase in degradation was evaluated. Black-Right-Pointing-Pointer The almost complete OTC removal was obtained. Black-Right-Pointing-Pointer A possible degradation product was identified in mycelia (ADOTC). Black-Right-Pointing-Pointer The system can be considered the first step of an useful mycoremediation technique. - Abstract: Oxytetracycline (OTC) is administered in high doses to livestocks and enters the environmental compartments as a consequence of animal waste disposal. As a first step in setting up a useful mycoremediation technique, an OTC lab degradation test was performed in liquid medium using the ligninolytic fungus Pleurotus ostreatus. OTC disappearance in culture medium was clearly evident as early as the third day of exposure onwards, with an almost complete removal after 14 d. The drug removal was mediated by fungal absorption in the mycelia, where the OTC molecule underwent a degradation step, as demonstrated by mass spectrometry analyses. A putative degradation product, ADOTC (2-acetyl-2-decarboxamido-oxytetracycline) is proposed. Experimental conditions excluded OTC abiotic degradation; the degradation by extracellular laccase was also experimentally discarded.
Czech Academy of Sciences Publication Activity Database
Eichlerová, Ivana; Homolka, Ladislav; Nerud, František
2002-01-01
Roč. 47, č. 6 (2002), s. 691-695 ISSN 0015-5632 R&D Projects: GA MŠk LN00B030 Institutional research plan: CEZ:AV0Z5020903 Keywords : pleurotus ostreatus * ligninolytic properties Subject RIV: EE - Microbiology, Virology Impact factor: 0.979, year: 2002
Investigation on Pleurotus ferulae potential for the sorption of Pb(II ...
African Journals Online (AJOL)
Pleurotus ferulae obtained from rotten tree was collected, washed, dried, ground and sieved to appropriate particle size. Infra-red spectrometry was used to determine functional groups on the biomass while biosorption of Pb(II) from aqueous solution was studied using the biomass in a batch system. The effect of pH (1-7.5), ...
Kaya, Zafer
1991-01-01
Delice(Olea europea var. oleaster L.) ile zeytin (Olea europea var.sativa) arasında anatomik ve palinojik ayrıcalıklar (The Anatomic And Palynological Differences Between Olea europea var. oleaster L. AND Olea europea var.sativa)
[Effect of substrate of edible mushroom on continuously cropping obstacle of Rehmannia glutinosa].
Ru, Rui-Hong; Li, Xuan-Zhen; Hunag, Xiao-Shu; Gao, Feng; Wang, Jian-Ming; Li, Ben-Yin; Zhang, Zhong-Yi
2014-08-01
The continuous cultivation of Rehmannia glutinosa causes the accumulation of phenolic acids in soil. It is supposed to be the reason of the so called "continuously cropping obstacle". In this study, phenolic acids (hydroxybenzoic acid, vanillic acid, eugenol, vanillin and ferulic acid) were degraded by the extracta of all the tested spent mushroom substrate (SMS) and the maximal degradation rate was 75.3%, contributed by extraction of SMS of Pleurotus eryngii. Pot experiment indicated that hydroxybenzoic acid and vanillin in soil were also degraded effectively by SMS of P. eryngii. The employment of SMS enhanced ecophysiology index to near the normal levels, such as crown width, leaves number, leaf length, leaf width and height. At the same time, the fresh and dry weight and total catalpol concentration of tuberous root weight of R. glutinosa was increased to 2.70, 3.66, 2.25 times by employment of SMS, respectively. The increase of bacteria, fungi and actinomycetes numbers in rhizosphere soil were observed after the employment of SMS by microbial counts. The employment of SMS also enhanced the enzyme activity in soils, such as sucrase, cellulase, phosphalase, urease and catelase. These results indicated that the employment of SMS alleviated the continuously cropping obstacle of R. glutinosa in some extent.
Soler-Rivas, C.; Garcia-Rosado, A.; Polonia, I.; Junca-Blanch, G.; Marin, F.R.; Wichers, H.J.
2006-01-01
When olive mill wastes (OMWs) and vegetation waters (VWs) obtained during the manufacture of olive oil were added as substrate supplements for the cultivation of Pleurotus pulmonarius the material modified growth of the mushroom and the endemic microbiota of the substrate, in particular the
Largeteau, M.L.; Baars, J.J.P.; Savoie, J.M.
2006-01-01
The genetic and physiological variability of Verticillium fungicola var. aleophilum responsible for Agaricus bisporus dry bubble disease in North America is well documented but little is known about the var. fungicola affecting European crops. Variability was assessed within this variety and
Shake flask decolourization of direct dye solar golden yellow R by pleurotus ostreatus
International Nuclear Information System (INIS)
Jilani, K.; Asghar, M.; Bhatti, H.N.; Mushtaq, Z.
2011-01-01
Different on site treatment technologies are in practice for industrial wastewaters but bioremediation using white rot fungi is the most attractive option due to complete degradation of the pollutants to non toxic end products. Three direct dyes (Solar golden yellow R, Solar brilliant red BA and Solar orange RSN) were decolourized using white rot fungus (WRF) Pleurotus ostreatus. The best decolourized dye Solar golden yellow R was selected for subsequent optimization studies for decolourization. Under optimum conditions Pleurotus ostreatus caused 90.32 % decolourization of 0.01 % Solar golden yellow R solution within two days of shake flask incubation at pH 3.5 and 30 deg. C temperature in Kirk's basal nutrient medium with added 1 % starch and 0.01 % ammonium sulphate as carbon and nitrogen sources, respectively. Ligninolytic enzyme activities were correlated to dye decolourization and maximum laccase activity of 356.23 U/ml was also noted in the maximally decolourized medium. (author)
UTILIZACIÓN DE CHONTADURO (Bactris gasipaes ENRIQUECIDA CON Pleurotus ostreatus EN POLLOS
Directory of Open Access Journals (Sweden)
JOSE MIGUEL CAMPO GAVIRIA
2017-12-01
Full Text Available In commercial poultry production, 70% of the production costs are related to feeding, this is a limiting factor affecting the profitability. This study aimed to evaluate the inclusion of chontaduro peel (Bactris gasipaes, enriched with the (Pleurotus ostreatus fungus, in the feeding of broilers; using a completely randomized design, with five treatments and three repetitions per treatment, with inclusion levels of 0,10% and 20% of chontaduro fruit peel, and 10 and 20% of chontaduro fruit peel enriched with the fungus (Pleurotus ostreatus. The productive behavior of the lot was determined by the feed intake, weight gain, feed conversion, skin pigmentation and cost benefit ratio of the portions. In this regard, no statistical differences (p <0,05 between treatments for all production variables evaluated were found, except for pigmentation, which was higher with levels of 20% of inclusion; as well as the positive effect in economic terms where the addition of a 20% of chontaduro peel flour enriched with the fungus is favorable because of the better cost-benefit ratio, without significantly affectingthe productive behavior.
Directory of Open Access Journals (Sweden)
Ceci Sales-Campos
2008-11-01
Full Text Available O objetivo deste trabalho foi avaliar o crescimento micelial do cogumelo Pleurotus ostreatus, cultivado na serragem da espécie madeireira Simarouba amara. Avaliaram-se: o efeito das temperaturas de 22, 25, 27, 30 e 35ºC sobre o crescimento micelial de P. ostreatus, nos meios malte-ágar 3% e SDA-MA (infusão da serragem de S. amara, enriquecida com farelo de soja-dextrose-ágar; e o crescimento micelial em substrato de cultivo de serragem de S. amara, com e sem suplementação de farelo de soja, a 25 e 30ºC. O melhor desenvolvimento de P. ostreatus ocorreu em meio malte-ágar 3% a 25ºC. A suplementação de farelo de soja na serragem de S. amara favorece o crescimento micelial.The objective of this work was to assess the mycelial growth of oyster mushroom (Pleurotus ostreatus cultivated in sawdust of Simarouba amara. Evaluations were made for the effect of temperatures 22, 25, 27, 30 and 35ºC on the mycelial growth of P. ostreatus in 3% malt-agar and SDA-MA (infusion of S. amara sawdust, enriched with soybean meal-dextrose-agar media; and the mycelial growth in cultivation substrate of S. amara sawdust, with and without supplementation of soybean meal, at 25 and 30ºC. The best development of P. ostreatus was in 3% malt-agar medium at 25ºC. Soybean meal supplementation on S. amara sawdust promoted mycelial growth.
Biodegradation of 2,4 dichlorophenol by Pleurotus ostreatus DSM 1833
Directory of Open Access Journals (Sweden)
Heloisa Helena Batista da Silva
2009-12-01
Full Text Available This work aimed to investigate the capacity of Pleurotus ostreatus DSM 1833 to degrade 2,4-dichlorophenol, important pollutant found in the wastewaters of the paper and cellulose industry. Using a factorial design 2², the concentrations of glucose and 2,4-dichlorophenol varied between 0 and 10g.L-1 and 5 and 30mg.L-1, respectively. The best global biodegradation rate was obtained using 30 mg.L-1 of 2,4- dichlorophenol in the absence of glucose. This culture medium was used for scaling up the process, resulting in a global biodegradation rate of 0.47mg.L-1.h-1. A comparative test between an inoculated medium and an abiotic control demonstrated that 54.1% of 2,4- dichlorophenol degradation could be attributed to the presence of P. ostreatus.A indústria de papel e celulose contribui para a contaminação ambiental devido aos resíduos gerados, especialmente, no processo de branqueamento da polpa Kraft, realizada com cloro. Basideomicetos saprófitas têm a capacidade de degradar compostos organoclorados como cloroligninas e clorofenóis. Este trabalho teve como objetivo investigar a capacidade de Pleurotus ostreatus DSM 1833 em degradar 2,4-diclorofenol, importante poluente encontrado nos efluentes da indústria de papel e celulose. Utilizando um planejamento fatorial 2², as concentrações de glicose e de 2,4-diclorofenol variaram entre 0 e 10 g.L-1 e 5 e 30 mg.L-1, respectivamente. A melhor taxa global de degradação foi obtida usando-se 30 mg.L-1 de 2,4-diclorofenol na ausência de glicose. Este meio de cultura foi utilizado para a ampliação da escala do processo, resultando em uma taxa global de biodegradação de 0,47 mg.L-1.h-1. Um teste comparativo entre o meio inoculado e o controle abiótico demonstrou que 54,1% da degradação do 2,4-diclorofenol pode ser atribuída à presença de Pleurotus ostreatus.
Electrical stimulation in white oyster mushroom (Pleurotus florida) production
Roshita, I.; Nurfazira, K. M. P.; Fern, C. Shi; Ain, M. S. Nur
2017-09-01
White oyster mushroom (Pleurotus florida) is an edible mushroom that gained popularity due to its nutritional values, low production cost and ease of cultivation. There are several research reported on the mushroom fruiting bodies which were actively developed when applying electrical shock treatment. This study was aimed to investigate the effects of different electrical voltages on the growth and yield of white oyster mushroom (Pleurotus florida). Five different electrical voltages had been applied during spawning period which were 6V, 9V, 12V, 15V and mushroom bags without any treatment served as control. Treatment at 6V showed the highest rate for mycelium growth while 15V took the shortest time for fruiting body formation. However, no significant different (P>0.05) among all the treatments was observed for the time taken for the mycelium to fill-up the bag and pinhead emergence. The total fresh weight and percentage of biological efficiency for treatment at 9V showed higher values compared to control. Treatment at 9V also showed the largest pileus diameter and the most firm in the pileus texture. Meanwhile, treatment at 6V showed the highest a* value (redness). In addition, different electrical voltage treatments applied did not show any significant effect on substrate utilization efficiency, colour L* and b* values. In conclusion, among all the electrical treatments applied, 9V could be considered as the best treatment to enhance the yield of white oyster mushroom.
Directory of Open Access Journals (Sweden)
Marli Camassola
2013-01-01
Full Text Available Pleurotus species secrete phenol oxidase enzymes: laccase (Lcc and manganese peroxidase (MnP. New genotypes of these species show potential to be used in processes aiming at the degradation of phenolic compounds, polycyclic aromatic hydrocarbons and dyes. Hence, a screening of some strains of Pleurotus towards Lcc and MnP production was performed in this work. Ten strains were grown through solid-state fermentation on a medium based on Pinus spp. sawdust, wheat bran and calcium carbonate. High Lcc and MnP activities were found with these strains. Highest Lcc activity, 741 ± 245 U gdm-1 of solid state-cultivation medium, was detected on strain IB11 after 32 days, while the highest MnP activity occurred with strains IB05, IB09, and IB11 (5,333 ± 357; 4,701 ± 652; 5,999 ± 1,078 U gdm-1, respectively. The results obtained here highlight the importance of further experiments with lignocellulolytic enzymes present in different strains of Pleurotus species. Such results also indicate the possibility of selecting more valuable strains for future biotechnological applications, in soil bioremediation and biological biomass pre-treatment in biofuels production, for instance, as well as obtaining value-added products from mushrooms, like phenol oxidase enzymes.
This paper highlighted the antioxidant and antibacterial activities of Lentinus tigrinus and Pleurotus djamour. Extracts of mushroom fruiting bodies were obtained using hexane and acetonitrile solvents. Acetonitrile extracts of both mushrooms exhibited higher biological activities than hexane extrac...
Directory of Open Access Journals (Sweden)
Eustáquio Souza Dias
2003-12-01
Full Text Available Diferentes resíduos agrícolas disponíveis na região sul de Minas Gerais foram testados para o cultivo do cogumelo Pleurotus sajor-caju. Foram avaliados os seguintes substratos: palha de feijão pura (PFP, palha de milho pura (PMP, casca de café pura (CCP, palha de feijão enriquecida com 2% de calcário, 2% de gesso e 10% de farelo de trigo (PFE, palha de milho enriquecida (PME e casca de café enriquecida (CCE. Todos os substratos receberam 2% de inoculante e foram incubados a 24°C. Após a colonização, os sacos foram mantidos abertos em ambiente a 24°C e umidade a 80%. PFP, PFE e PME apresentaram os melhores resultados na produção de cogumelos, com uma eficiência biológica de 85,7; 81,4 e 83,4%, respectivamente. A palha de feijão foi considerada o melhor resíduo para a produção do cogumelo P. sajor-caju, porque apresentou a melhor eficiência biológica sem necessidade de enriquecimento.Several agricultural residues available in the South of Minas Gerais were tested for cultivation of the mushroom Pleurotus sajor-caju. The following substrates were investigated: Bean (BS, Corn (CS straws and Coffee husk (CH without nutrient supplementation and straws of bean (BSS, corn (CSS and coffee husk (CHS supplemented with 2% of CaCO3, 2% of gypsum and 10% of wheat flour. All the substrates were inoculated with 2% of spawn and incubated at 24ºC. After the fungi had colonized the substrate, the plastic bags were open and maintained at room temperature with 80% of humidity. BS, BSS and CSS showed higher mushroom production than the others, showing a biological efficiency of 85.7, 81.4 and 83.6% respectively. The beans straw (BS without nutrient supplementation was considered the best residue for the growth and cultivation of the mushroom Pleurotus sajor-caju. This substrate showed higher levels of biological efficiency than the others substrates analysed.
Directory of Open Access Journals (Sweden)
Martínez César
2003-12-01
Full Text Available El objetivo de este trabajo fue caracterizar y evaluar diferentes métodos de purificación y separación cromatográfica de un caldo rico en enzima lacasa, producida por una variedad del basidiomycete Pleurotus ostreatus. Se llevaron a cabo dos procesos de producción, a saber: a FES (Fermentación en Estado Sólido; b fermentación en sumergido. El proceso de FES se basó en la producción de un extracto de caldo crudo rico en enzima lacasa a partir del crecimiento micelial sobre salvado con vinaza en relación 1:1 w/v duran te 20 días. Se obtuvo un caldo crudo con una actividad promedio de 20 U/ml. En el caso del proceso de fermentación en sumergido, se trabajó con el medio reportado por Hublick y Schinner (2000 con algunas modificaciones, y se obtuvo un crecimiento del hongo en forma de pellets, en un período de 15 días, con actividad promedio de 10 U/ml en el caldo crudo. Las isoenzimas aisladas en los procesos cromatográficos se caracterizaron de acuerdo a sus propiedades moleculares y cinéticas, se determinó su peso molecular por electroforesis de placa vertical (SDS-PAGE y sus parámetros cinéticos, por ejemplo estabilidad, en un rango de temperatura y pH. Palabras clave: lacasa; Pleurotus ostreatus; fermentación en estado sólido (FES; fermentación en sumergido; isoenzimas; laccase; Pleurotus ostreatus; Solid State Fermentation (SSF; Submerged Fermentation; isoenzymesThis project was designed for characterising and evaluating different methods of chromatographic separation and purification regarding a laccase enzyme-rich broth produced by Pleurotus ostreatus, a variety of basidiomycetes. SSF (Solid State Fermentation and Submerged Fermentation production processes were employed. The SSF process was based on producing a raw broth rich in laccase enzyme from mycelium grown on bran with 1:1 vinasse w/v for 20 days. A raw broth was obtained having an average 20 U/ml activity. The medium reported by Hublick and Schinner (2000
International Nuclear Information System (INIS)
Koyuncu, O.; Kus, G.
2014-01-01
The taxonomic status of Scorzonera pygmaea var. pygmaea and var. nutans belonging to the tribe. cichoreae (Asteraceae). S. pygmaea samples were collected from Arayit mountain. We suggest that these two subspecies should be classified as varietes because of their morphological and anatomical characteristics, ecological and geographical similarities. Moreover being together in the same localities of these under species taxa supports our opinion, i.e. S. pygmaea Sibth. and Sm. var. pygmaea stat. nov. and S. pygmaea Sibth. and Sm. var. nutans (Czeczott) O. Koyuncu and Yaylac, stat. nov. (author)
Analysis list: Su(var)205 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Su(var)205 Adult,Embryo,Larvae + dm3 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3.../target/Su(var)205.1.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/target/Su(var)205.5.tsv http://dbarc...hive.biosciencedbc.jp/kyushu-u/dm3/target/Su(var)205.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/c...olo/Su(var)205.Adult.tsv,http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/colo/Su(var)205.Embryo.tsv,http:...//dbarchive.biosciencedbc.jp/kyushu-u/dm3/colo/Su(var)205.Larvae.tsv http://dbarchive
Pelc, Joanna S.; Todling, Ricardo; Akkraoui, Amal El
2014-01-01
The Global Modeling and Assimilation Offce (GMAO) is currently using an IAU-based 3D-Var data assimilation system. GMAO has been experimenting with a 3D-Var-hybrid version of its data assimilation system (DAS) for over a year now, which will soon become operational and it will rapidly progress toward a 4D-EnVar. Concurrently, the machinery to exercise traditional 4DVar is in place and it is desirable to have a comparison of the traditional 4D approach with the other available options, and evaluate their performance in the Goddard Earth Observing System (GEOS) DAS. This work will also explore the possibility for constructing a reduced order model (ROM) to make traditional 4D-Var computationally attractive for increasing model resolutions. Part of the research on ROM will be to search for a suitably acceptable space to carry on the corresponding reduction. This poster illustrates how the IAU-based 4D-Var assimilation compares with our currently used IAU-based 3D-Var.
Production of ligninolytic enzymes by solid state fermentation using Pleurotus ostreatus
Directory of Open Access Journals (Sweden)
Seyma Ozcirak Ergun
2017-06-01
Full Text Available Solid state fermentation (SSF stands out in the production of lignocellulolytic and other industrially important enzymes. SSF, an alternative culture method, has several advantages over the conventional submerged ones, like higher yields of enzymes. The production of ligninolytic enzymes, such as laccase (Lac, manganese peroxidase (MnP, lignin peroxidase (LiP and aryl alcohol oxidase (AAO by Pleurotus ostreatus (Jacq. Pleurotus Kumm. (MCC16 was investigated under SSF, which was performed using a support-substrate from potato peel waste (PPW. PPW as dry and fresh was pretreated with base to neutralize organic acids and distilled water. Chemical content of PPW was investigated. Ligninolytic enzyme production patterns were investigated during the growth of the organism for a period of 23 days at 25 °C in the stationary SSF using pretreated PPW. The highest Lac and MnP activities were determined in dry PPW, pretreated with distilled water as 6708.3 ± 75 U/L and 2503.6 ± 50 U/L on day 17, respectively. In addition, amylase and protease enzyme activities were detected under same conditions. According to the results, PPW has a potential as supports for ligninolytic enzyme production by P. ostreatus under SSF.
Effect of 60Co γ-irradiation on postharvest quality of pleurotus nebrodensis stored at 4 degree C
International Nuclear Information System (INIS)
Xiong Qiaoling; Huazhong Agriculture Univ., Wuhan; Xing Zengtao; Feng Zhiyong; Buswell, J.; Bian Yinbing
2007-01-01
The effect of γ-rays irradiation on the fresh-keeping of Pleurotus nebrodensis fruit bodies was reported in this paper. Fresh harvested fruit bodies of Pleurotus nebrodensis were irradiate at different doses levels (0.8-2.0 kGy) and stored for 22 days at 4 degree C. The fruit bodies treated with 1.2 kGy irradiation retained the highest soluble protein contents, and exhibited less postharvest softening throughout the storage period. Regression analysis plots of fruit body hardness versus soluble protein content were linear (t>0.05). Increases in mushroom cell permeability observed throughout the storage period were directly related to irradiation dose. Too higher dose(≥2.0 kGy) of irradiation will accelerate the nutrition degradation and rotting of the fruit bodies. (authors)
International Nuclear Information System (INIS)
Wu, Yue-Liang
2001-01-01
The low-energy dynamics of QCD is investigated with special attention paid to the matching between QCD and chiral perturbation theory (ChPT), and also to some useful algebraic chiral operator relations which survive even when we include chiral loop corrections. It then allows us to evaluate the hadronic matrix elements below the energy scale Λ χ ≅1GeV. Based on the new analyses, we present a consistent prediction for both the direct CP-violating parameter var-epsilonprime/var-epsilon and the ΔI=1/2 rule in kaon decays. In the leading 1/N c approximation, the isospin amplitudes A 0 and A 2 are found to agree well with the data, and the direct CP-violating parameter var-epsilonprime/var-epsilon is predicted to be large, which also confirms our earlier conclusion. Its numerical value is var-epsilonprime/var-epsilon=23.6 -7.8 +12.4 x10 -4 (Imλ t /= 1.2x10 -4 ) which is no longer sensitive to the strange quark mass due to the matching conditions. Taking into account a simultaneous consistent analysis on the isospin amplitudes A 0 and A 2 , the ratio var-epsilonprime/var-epsilon is in favor of the values var-epsilonprime/var-epsilon=(20±9)x10 -4
International Nuclear Information System (INIS)
Manjon, J.L.; Urban, P.L.; Bystrzejewska-Piotrowska, G.
2004-01-01
A simple model of Pleurotus eryngii mushroom culture, grown under stringent laboratory conditions, was developed to watch ecophysiological pathways of xenobiotics in saprophytic fungi. The investigated substances may be added in different stages of biological cycle of the fungus. It is emphasized that to obtain the fruitbodies, all the physiological needs of the species have to be fulfilled, i.e.: nutritional requirements, optimal temperature (according to the biological cycle), humidity, aeration (oxygen and CO 2 ), absence or presence of the light in each reproduction phase, as well as the control of infections and plaques through all the production stages. The described model serves for investigation of radionuclide and heavy metal uptake and transfer in fungi. Double and some multiple fructification from the same substrate is possible giving a possibility to investigate bioremediation by mycoextraction. (author)
Survival and infectivity of Sarcoptes scabiei var. canis and var. hominis.
Arlian, L G; Runyan, R A; Achar, S; Estes, S A
1984-08-01
Sarcoptes scabiei var. canis served as a suitable model for the study of S. scabiei var. hominis survival. S. scabiei var. canis and var. hominis mites were found to survive off the host for 24 to 36 hours at room conditions (21 degrees C and 40% to 80% relative humidity [RH]), and the canine variety survived 19 days at 10 degrees C and 97% RH. Female mites survived decidedly longer than male mites at comparable conditions. Generally, higher RH values and lower temperatures favored survival, whereas higher temperature and lower RH led to early death. Most canine scabies mites that were held off the host for 36 hours at 75% RH and 22 degrees to 24 degrees C remained infective and penetrated when returned to the host. Live mites of the human variety that were recovered from bed linen slept on by infested patients would also penetrate a host after being held off a host for 96 hours in alternating 12-hour periods of room conditions and refrigeration. Penetration required less than 30 minutes for all life stages of both varieties, and it was accomplished by a mite secretion that dissolved the host tissue. Dislodged mites, particularly those in close proximity to the source, can be a likely source of infestation.
Li, Xia; Zhang, Dan; Sheng, Fei; Qing, Hui
2018-01-01
This study investigated the adsorption characteristics of Copper (Ⅱ), Zinc (Ⅱ) and Mercury (Ⅱ) by immobilized Flammulina velutipes, Auricularia polytricha, Pleurotus eryngii and Pleurotus ostreatus residues. Lagergren model, elovich and intraparticle diffusion model were used to present the adsorption kinetics, and it was proved that Langmuir isotherm model and pseudo-second order kinetics are the best suitable model with high correlation coefficient to characterize the adsorption process of Copper (Ⅱ), Zinc (Ⅱ) and Mercury (Ⅱ). The results showed that adsorption process finished in 120min at pH 6.0. The adsorption rate of Cu 2+ , Zn 2+ and Hg 2+ were reached to 53.8-84.1% of total in the initial 60min, and finished in 120min. Ion exchange and complexation of F. velutipes were the main mechanisms for adsorption of metal ions by characterizations of Scanning electron microscopy (SEM) and Fourier transform infrared (FTIR). In addition the functional group of cell walls such as hydroxyl, amide, carbonyl, phosphoric played a critical role in ions adsorption of edible mushroom residues. Cu 2+ , Zn 2+ and Hg 2+ in wastewater could be efficiently removed by F. velutipes residue with removal ratio of 73.11%, 66.67% and 69.35%, respectively. Copyright © 2017 Elsevier Inc. All rights reserved.
Teucrium pruinosum var. aksarayense var. nov. (Lamiaceae from Central Anatolia, Turkey
Directory of Open Access Journals (Sweden)
Muhittin Dinç
2016-06-01
Full Text Available Teucrium pruinosum var. aksarayense M. Dinç & S. Doğu (Lamiaceae, a new variety from Aksaray in Central Anatolia, is described and illustrated. The new variety is similar to the typical one in its calyx teeth uncinate at tip and subequal to the tube with conspicious midvein. It is readily distinguished from var. pruinosum by its general appearance, indumentum, and floral organ pigmentation. The map showing the distributions of the varieties was given.
Increase of the productivity of pleurotus ostreatus and their use in the petroleum biodegradation
International Nuclear Information System (INIS)
Cardona U, Fernando; Restrepo R, Dora Patricia; Nino, Pilar; Gonzalez, Raul
2002-01-01
This work is divided in two phases: in the first one a substrate what help to increase productivity of the white-rot fungi pleurotus ostreatus was looked, this was reached combining different kinds of substrates; in the second phase, the contribution in biodegradation of pleurotus ostreatus into the substrate obtained in the first phase and contaminated with heavy part of Cusiana oil was looked. The quantification in the augmentation of productivity was obtained taking the weight of fungi collected of each substrate and comparing it between the, until finding the best one. To quantify the biodegradation the method of determination of greases, oils, and hydrocarbons of petroleum in solids by Soxhlet method was used. The highest substrate in productivity was the mix of 70% of cotton quinine and 30% of hay with 3- 5% of seed, thiamine and vegetable oil. For the biodegradation study concentration less than 25% were used, at higher concentrations a partial inhibition was detected. When the substrate was contaminated with 10% of Cusiana oil the biodegradation was more efficient
Potential applications of the white rot fungus Pleurotus in bioregenerative life support systems
Manukovsky, N. S.; Kovalev, V. S.; Yu, Ch.; Gurevich, Yu. L.; Liu, H.
Earlier we demonstrated the possibility of using soil-like substrate SLS for plant cultivation in bioregenerative life support systems BLSS We suggest dividing the process of SLS bioregeneration at BLSS conditions into two stages At the first stage plant residues should be used for growing of white rot fungus Pleurotus ostreatus Pleurotus florida etc The fruit bodies could be used as food Spent mushroom compost is carried in SLS and treated by microorganisms and worms at the second stage The possibility of extension of human food ration is only one of the reasons for realization of the suggested two-stage SLS regeneration scheme people s daily consumption of mushrooms is limited to 200 -250 g of wet weight or 20 -25 g of dry weight Multiple tests showed what is more important is that inclusion of mushrooms into the system cycle scheme contributes through various mechanisms to the more stable functioning of vegetative cenosis in general Taking into account the given experimental data we determined the scheme of mushroom module material balance The technological peculiarities of mushroom cultivation at BLSS conditions are being discussed
Directory of Open Access Journals (Sweden)
Katarzyna Wińska
2016-06-01
Full Text Available The aim of the study was to obtain new compounds during biotransformation of two halocompounds, the δ-bromo and δ-iodo-γ-bicyclolactones 1 and 2. Unexpectedly Pleurotus ostreatus produced together with the hydroxylactone, 2-hydroxy-4,4-dimethyl-9-oxabicyclo[4.3.0]nonane-8-one (3, its own metabolite (3S,9S,15S-(6E,12E-3,9,15-trimethyl-4,10,16-trioxacyclohexa-deca-6,12-diene-1,5,8,11,14-pentaone (4. The method presented here, in which this macrosphelide 4 was obtained by biotransformation, has not been previously described in the literature. To the best of our knowledge, this compound has been prepared only by chemical synthesis to date. This is the first report on the possibility of the biosynthesis of this compound by the Pleurotus ostreatus strain. The conditions and factors, like temperature, salts, organic solvents, affecting the production of this macrosphelide by Pleurotus ostreatus strain were examined. The highest yield of macroshphelide production was noticed for halolactones, as well with iodide, bromide, iron and copper (2+ ions as inductors.
DEFF Research Database (Denmark)
Andersen, Lene Vinther
2014-01-01
Folkemindesamleren og forfatteren Helene Strange (1874-1943) skrev flere gange om et giftmord på en præst på Nordfalster i 1755. Hun satte spørgsmålstegn ved højesteretsdommen og hævdede, at en uskyldig pige blev dømt, mens den virkelige morder slap fri. Det var folkets uskrevne dom, som i over...... hundrede år var blevet fortalt mundtligt videre på egnen, og hun forsøgte – med forskellige midler – at få bragt denne version af historien frem i offentligheden....
Directory of Open Access Journals (Sweden)
Hong-Ting Victor Lin
Full Text Available The genome sequence of V. cholerae O1 Biovar Eltor strain N16961 has revealed a putative antibiotic resistance (var regulon that is predicted to encode a transcriptional activator (VarR, which is divergently transcribed relative to the putative resistance genes for both a metallo-β-lactamase (VarG and an antibiotic efflux-pump (VarABCDEF. We sought to test whether these genes could confer antibiotic resistance and are organised as a regulon under the control of VarR. VarG was overexpressed and purified and shown to have β-lactamase activity against penicillins, cephalosporins and carbapenems, having the highest activity against meropenem. The expression of VarABCDEF in the Escherichia coli (ΔacrAB strain KAM3 conferred resistance to a range of drugs, but most significant resistance was to the macrolide spiramycin. A gel-shift analysis was used to determine if VarR bound to the promoter regions of the resistance genes. Consistent with the regulation of these resistance genes, VarR binds to three distinct intergenic regions, varRG, varGA and varBC located upstream and adjacent to varG, varA and varC, respectively. VarR can act as a repressor at the varRG promoter region; whilst this repression was relieved upon addition of β-lactams, these did not dissociate the VarR/varRG-DNA complex, indicating that the de-repression of varR by β-lactams is indirect. Considering that the genomic arrangement of VarR-VarG is strikingly similar to that of AmpR-AmpC system, it is possible that V. cholerae has evolved a system for resistance to the newer β-lactams that would prove more beneficial to the bacterium in light of current selective pressures.
Abiotic and Biotic Degradation of Oxo-Biodegradable Plastic Bags by Pleurotus ostreatus
da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Bazzolli, Denise Mara Soares; Tótola, Marcos Rogério; Demuner, Antônio Jacinto; Kasuya, Maria Catarina Megumi
2014-01-01
In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as su...
VaR Methodology Application for Banking Currency Portfolios
Directory of Open Access Journals (Sweden)
Daniel Armeanu
2007-02-01
Full Text Available VaR has become the standard measure that financial analysts use to quantify market risk. VaR measures can have many applications, such as in risk management, to evaluate the performance of risk takers and for regulatory requirements, and hence it is very important to develop methodologies that provide accurate estimates. In particular, the Basel Committee on Banking Supervision at the Bank for International Settlements imposes to financial institutions such as banks and investment firms to meet capital requirements based on VaR estimates. In this paper we determine VaR for a banking currency portfolio and respect rules of National Bank of Romania regarding VaR report.
Directory of Open Access Journals (Sweden)
Carol Daniela Coello-Loor
2017-12-01
Full Text Available La velocidad de crecimiento radial (VCR (mm.h-1 y la producción de biomasa (PB (g.g-1 de sustrato seco son técnicas que puedan establecer el grado de adaptación y desarrollo de los hongos del género Pleurotus spp., a distintos sustratos que podrían emplearse en una fermentación en medio sólido. Las especies fueron Pleurotus sapidus (Ps y Pleurotus ostreatus IE8 (Po. El medio de cultivo sintético empleado fue el papa dextrosa agar (PDA, con un pH que va de 5.6 a 5.9, ideal para el crecimiento de hongos, tiene todos los componentes nutritivos, y ligera acidez que logran la inhibición del desarrollo de bacterias; diluido en 4 diferentes soluciones preparadas con los materiales residuales (solución cascarilla de arroz CaPDA, solución cáscara de maracuyá CmPDA, solución mezcla 50% Cascarilla de arroz+50% Cáscara de maracuyá CaCmPDA y agua destilada+PDA con el propósito de observar el crecimiento radial cada 24 horas y la producción de biomasa fúngica de estos hongos lignocelulósicos por su periodo de incubación y la adaptación a nivel in vitro. Los tratamientos que presentaron mejor comportamiento VCR fueron el PoCaPDA (0.569 y el PoCaCmPDA (0.549; la cepa que reporto valores más altos en VCR y PB fue el Pleurotus ostreatus y el mejor medio de cultivo fue el CaPDA, en ambas variables; mientras, la mayor producción de biomasa fue en Pleurotus sapidus en CaPDA (0.1727 y el Pleurotus ostreatus IE8 en CmPDA (0.1722, CaPDA (0.1706 y PDA (0.1694.
International Nuclear Information System (INIS)
Chen Henglei; Wan Honggui; Lv Changwu; Zeng Xianxian
2010-01-01
Pleurotus polysaccharide high-yield strains were selected through a method of auxotrophic primary screening and Shake-flask fermentation re-screening after low-energy heavy ions (the fluence of 1.2 x 10 16 N + /cm 2 at the energy of 15 keV) stepwise implantation. Two Pleurotus polysaccharide high-yield strains, PFPH-1 and PFPH-2, were selected with stable mycelium polysaccharide yield. The mycelium polysaccharide yield of PFPH-1 and PFPH-2 increased by 46.55% and 75.14%, respectively, compared to the original strain. The accumulation of mycelium biomass and intracellular polysaccharides were monitored in the submerged fermentation of Pleurotus ferulae by supplementation of various carbon and nitrogen sources as well as inorganic salts and pH alteration. The optima1 submerged fermentation medium favoring the accumulation of mycelium biomass and intracellular polysaccharides of PFPH-2 consisted of 1.0% wheat flour, 2.0% sucrose, 2.0% soybean flour, 1.5% bran extract, 0.2% K 2 HPO 4 , and 0.15% MgSO 4 ·7H 2 O, with a fittest pH value of 5.64. The orthogonal combination of the optimal carbon and nitrogen sources with inorganic salts indicates a synergistic effect on the accumulation of mycelium biomass and intracellular polysaccharides in the submerged fermentation of PFPH-2. The yield of mycelium polysaccharides of PFPH-2 increased to 903.73 ± 1.23 mg·L -1 by the end of fermentation. (authors)
Meng, Peng; Li, Yu-Ling; Zhang, Bai-xi
2013-02-01
For the popularization of Pinus densiflora var. zhangwuensis, a new afforestation tree species on the desertified and salinized-alkalized lands in Northern China, and to evaluate the salinity-alkalinity tolerance of the tree species and to better understand the tolerance mechanisms, a pot experiment with 4-year old P. densiflora var. zhangwuensis and P. sylvestris var. mongolica was conducted to study their seedlings growth and physiological and biochemical indices under the effects of three types salt (NaCl, Na2CO3, and NaHCO3 ) stresses and of alkali (NaOH) stress. Under the salt-alkali stresses, the injury level of P. densiflora var. zhangwuensis was lower, and the root tolerance index was higher. The leaf catalase (CAT) activity increased significantly by 22. 6 times at the most, as compared with the control; the leaf malondialdehyde (MDA) content had no significant increase; the leaf chlorophyll (Chl) content had a smaller decrement; and the leaf water content (LWC) increased slightly. P. sylvestris var. mongolica responded differently to the salt-alkali stresses. Its leaf CAT activity had less change, MDA content increased significantly, Chl content had significant decrease, and LWC decreased slightly. It was suggested that P. densi-flora var. zhangwuensis had a greater salinity-alkalinity tolerance than P. sylvestris var. mongolica. The higher iron concentration in P. densiflora var. zhangwuensis needles enhanced the CAT activity and Chl content, whereas the higher concentrations of zinc and copper were associated with the stronger salinity-alkalinity tolerance.
U.S. Department of Health & Human Services — dbVar is a database of genomic structural variation. It accepts data from all species and includes clinical data. It can accept diverse types of events, including...
Directory of Open Access Journals (Sweden)
Evânia Geralda Silva
2007-03-01
Full Text Available Os cogumelos do gênero Pleurotus normalmente crescem bem em substratos mais pobres em nitrogênio, ao contrário dos cogumelos Agaricus que requerem substratos com relação C/N mais estreita. Por outro lado, os valores nutricionais do cogumelo dependem da composição química do substrato utilizado e das condições de cultivo. Este trabalho teve como objetivo avaliar o teor de proteína dos corpos de frutificação do cogumelo Pleurotus sajor-caju cultivado em capim coast-cross, bagaço de cana-de-açúcar, farelo de trigo e diferentes teores de nitrogênio. Apenas os substratos com teores de nitrogênio de 0,65 a 1,30% foram colonizados, enquanto que nos substratos com 1,75 e 2,20% de nitrogênio não houve colonização. Não houve diferença significativa na produção de cogumelos, porém o teor de proteína dos cogumelos produzidos no substrato com 1,30% de N foi significativamente superior em relação aos substratos com menor teor de N.Mushrooms of Pleurotus genus usually grow well in substrates containing low amounts of nitrogen, whereas Agaricus mushrooms require substrates with a high content of nitrogen. On the other hand, the nutritional values of mushrooms depend on the chemical composition of the substrate in use and the conditions of cultivation. The aim of this work is to measure the protein content of the fructification bodies of Pleurotus sajor-caju cultivated in coast-cross grass, sugar cane bagasse, whole wheat meal and various nitrogen concentrations. Only the substrates with nitrogen content ranging from 0.65 to 1.30% were colonized, while in the substrates with 1.75 and 2.20% of nitrogen, colonization did not occur. There was no significant difference in the production of mushrooms, however the protein content of the mushrooms produced on the substrate with 1.30% of N was considerably higher in relation to those mushrooms grown in substrates with a reduced nitrogen content.
Paulus var kristendommens Lenin
DEFF Research Database (Denmark)
Thyssen, Ole
2017-01-01
En af Luthers inspirationskilder var Paulus, hvis løsning på lokale problemer fik globale konsekvenser. Han trak en skarp grænse mellem det snavsede kød og den rene sjæl og mellem vantro og tro.......En af Luthers inspirationskilder var Paulus, hvis løsning på lokale problemer fik globale konsekvenser. Han trak en skarp grænse mellem det snavsede kød og den rene sjæl og mellem vantro og tro....
B. oleracea var. capitata monosomic and disomic alien
Indian Academy of Sciences (India)
Five monosomic alien addition lines (MAALs) of Brassica rapa ssp. pekinensis – B. oleracea var. capitata were obtained by hybridization and backcrossing between B. rapa ssp. pekinensis (female parent) and B. oleracea var. capitata. The alien linkage groups were identified using 42 B. oleracea var. capitata linkage ...
DEFF Research Database (Denmark)
Peters, Rikke Louise Alberg; Brunbech, Peter Johan Yding; Poulsen, Jens Aage
I mere end 250 år var Danmark en stor kolonimagt. Skt. Jan, Skt. Thomas og Skt. Croix, eller U.S. Virgin Islands, som de kaldes i dag, var danske kolonier, hvor der bl.a. blev dyrket sukkerrør og bomuld. Det hårde arbejde blev udført af slaver, som man fra slutningen af 1600-tallet begyndte at tr...
Akpinar, Merve; Ozturk Urek, Raziye
2017-06-01
Lignocellulosic wastes are generally produced in huge amounts worldwide. Peach waste of these obtained from fruit juice industry was utilized as the substrate for laccase production by Pleurotus eryngii under solid state bioprocessing (SSB). Its chemical composition was determined and this bioprocess was carried out under stationary conditions at 28 °C. The effects of different compounds; copper, iron, Tween 80, ammonium nitrate and manganese, and their variable concentrations on laccase production were investigated in detail. The optimum production of laccase (43,761.33 ± 3845 U L -1 ) was achieved on the day of 20 by employing peach waste of 5.0 g and 70 µM Cu 2+ , 18 µM Fe 2+ , 0.025% (v/v) Tween 80, 4.0 g L -1 ammonium nitrate, 750 µM Mn 2+ as the inducers. The dye decolorization also researched to determine the degrading capability of laccase produced from peach culture under the above-mentioned conditions. Within this scope of the study, methyl orange, tartrazine, reactive red 2 and reactive black dyes were treated with this enzyme. The highest decolorization was performed with methyl orange as 43 ± 2.8% after 5 min of treatment when compared to other dyes. Up to now, this is the first report on the induction of laccase production by P. eryngii under SSB using peach waste as the substrate.
Distribution of radionuclides in different parts of a mushroom: Influence of the degree of maturity
Energy Technology Data Exchange (ETDEWEB)
Baeza, Antonio [Department of Physics, Veterinary Faculty, University of Extremadura, Avda de la Universidad s/n, 10071 Caceres (Spain)]. E-mail: ymiralle@unex.es; Guillen, Fco. Javier [Department of Physics, Veterinary Faculty, University of Extremadura, Avda de la Universidad s/n, 10071 Caceres (Spain); Salas, Alejandro [Department of Physics, Veterinary Faculty, University of Extremadura, Avda de la Universidad s/n, 10071 Caceres (Spain); Manjon, Jose Luis [Department of Plant Biology, Faculty of Sciences, University of Alcala, 28871 Alcala de Henares, Madrid (Spain)
2006-04-15
Mushrooms are known to be bioaccumulators of radionuclides, but little is known about their distribution within the fruiting bodies or the influence of the degree of maturity on uptake. We carried out a series of cultures of the species Pleurotus eryngii under controlled laboratory conditions to analyze these variables. The maximal uptake of {sup 134}Cs and {sup 85}Sr was found to occur in mature fruiting bodies, and with the growth of the mushroom the distribution of radionuclides within the fruiting bodies became inhomogeneous. In particular, there was an exponential increase in the percentage of the total activity of {sup 134}Cs, {sup 85}Sr, and {sup 6}Co in the cap + gills as the fruiting bodies matured, accompanied by a complementary decrease in the stem. Radiocaesium, potassium, calcium, {sup 239+24}Pu, {sup 234,238}U, {sup 228,230,232}Th, and {sup 226}Ra were assayed in the cap, gills, and stem of fruiting bodies of Tricholoma equestre collected in a natural ecosystem and cultured P. eryngii. Potassium and radiocaesium were mainly located in the cap + gills, and {sup 226}Ra in the gills. There was a disequilibrium between {sup 230,232}Th and {sup 228}Th in the different parts of the fungi, probably due to uptake of {sup 228}Ra and subsequent decay to {sup 228}Th. Finally, the distribution pattern of{sup 239+24}Pu, {sup 234,238}U, and {sup 230,232}Th seemed to be species dependent.
ESTIMASI NILAI VaR PORTOFOLIO MENGGUNAKAN FUNGSI ARCHIMEDEAN COPULA
Directory of Open Access Journals (Sweden)
AULIA ATIKA PRAWIBTA SUHARTO
2017-01-01
Full Text Available Value at Risk explains the magnitude of the worst losses occurred in financial products investments with a certain level of confidence and time interval. The purpose of this study is to estimate the VaR of portfolio using Archimedean Copula family. The methods for calculating the VaR are as follows: (1 calculating the stock return; (2 calculating descriptive statistics of return; (3 checking for the nature of autocorrelation and heteroscedasticity effects on stock return data; (4 checking for the presence of extreme value by using Pareto tail; (5 estimating the parameters of Achimedean Copula family; (6 conducting simulations of Archimedean Copula; (7 estimating the value of the stock portfolio VaR. This study uses the closing price of TLKM and GGRM. At 90% the VaR obtained using Clayton, Gumbel, Frank copulas are 0.9562%, 1.0189%, 0.9827% respectively. At 95% the VaR obtained using Clayton, Gumbel, Frank copulas are 1.2930%, 1.2522%, 1.3152% respectively. At 99% the VaR obtained using Clayton, Gumbel, Frank copulas are 2.0327%, 1.9164%, is 1.8678% respectively. In conclusion estimation of VaR using Clayton copula yields the highest VaR.
Ballintijn, Koos (J.) F.
1997-01-01
On the basis of recent observations and study of herbarium material it might tentatively be concluded that var. anomala (with erecto-patent barb hairs on achenes as well as on the bristles) is becoming more common since 1954 and might be locally replacing the hitherto more common var. fallax (with
Biomass production of pleurotus sajor-caju by submerged culture fermentation
International Nuclear Information System (INIS)
Kausar, T.; Nasreen, Z.; Nadeem, M.; Baig, S.
2006-01-01
The effect of different carbon sources, namely, sawdust and powder of agro wastes (as such, or water soluble extracts), and inorganic/natural nitrogen sources on the biomass production of Pleurotus sajor-caju by submerged culture fermentation was studied. Supplementation of the fermentation medium with 2% molasses, 2% wheat spike powder, extract of 2% wheat spike powder, and com gluten meal resulted in 12.85, 10.85, 12.35 and 13.92 g/sub l/ biomass production of P. sajor-caju, respectively. The fungal hyphae biomass contained 8.28% moisture, 21.18% crude protein, 1.55% fat, 3.59% ash, 2.32% crude fibre, and 63.48% nitrogen-free extract. (author)
Hybrid VAR compensator with improved efficiency
Directory of Open Access Journals (Sweden)
V. V. Burlaka
2015-03-01
Full Text Available In modern electrical networks thyristor-switched capacitors (TSC are most used devices for VAR compensation. These devices don’t contain rotating parts and mechanical contacts, provide a stepwise control of reactive power and no generation of harmonics to the network. However, with the help of TSC it’s not possible to ensure smooth control of reactive power and capacitor banks (CB are exposed to the negative impact of higher harmonic components of the network voltage. Hybrid VAR compensator don’t have such drawbacks. It consists of active filter (AF and capacitor bank with discrete regulation. The main drawback of such systems is the necessity of accessing all six terminals of CB, while most of them are manufactured with three terminals, internally delta-connected. In the article, the topology and control system of hybrid VAR compensator free from beforementioned drawback, is proposed. The control system provides operating modes of overcompensation or undercompensation reactive power. VAR distribution regulator performs redistribution of reactive power between active filter and capacitor banks with the condition to minimize active filter’s power. Scheme of the hybrid VAR compensator, which includes a three-phase three-terminal delta-connected capacitor banks, is shown. Proposed approach allows to provide smooth control of reactive power, isolate the capacitor bank from harmonic currents and use a more effective low-voltage power components
Antioxidant capacity and mineral contents of edible wild Australian mushrooms.
Zeng, X; Suwandi, J; Fuller, J; Doronila, A; Ng, K
2012-08-01
Five selected edible wild Australian mushrooms, Morchella elata, Suillus luteus, Pleurotus eryngii, Cyttaria gunnii, and Flammulina velutipes, were evaluated for their antioxidant capacity and mineral contents. The antioxidant capacities of the methanolic extracts of the dried caps of the mushrooms were determined using a number of different chemical reactions in evaluating multi-mechanistic antioxidant activities. These included the Trolox equivalent antioxidant capacity, ferric ion reducing antioxidant power, and ferrous ion chelating activity. Mineral contents of the dried caps of the mushrooms were also determined by inductively coupled plasma-optical emission spectroscopy. The results indicated that these edible wild mushrooms have a high antioxidant capacity and all, except C. gunnii, have a high level of several essential micro-nutrients such as copper, magnesium, and zinc. It can be concluded that these edible wild mushrooms are good sources of nutritional antioxidants and a number of mineral elements.
International Nuclear Information System (INIS)
Nozaki, Hirofumi; Itonori, Saki; Sugita, Mutsumi; Nakamura, Kimihide; Ohba, Kiyoshi; Suzuki, Akemi; Kushi, Yasunori
2008-01-01
Interferon (IFN)-γ and interleukin (IL)-4 regulate many types of immune responses. Here we report that acidic glycosphingolipids (AGLs) of Hypsizigus marmoreus and Pleurotus eryngii induced secretion of IFN- γ and IL-4 from T cells in a CD11c-positive cell-dependent manner similar to that of α-galactosylceramide (α-GalCer) and isoglobotriaosylceramide (iGb3), although activated T cells by AGLs showed less secretion of cytokine than those activated by α-GalCer. In addition, stimulation of these mushroom AGLs induced proliferation of NK1.1 α/β TCR-double positive cells in splenocytes. Administration of a mixture of α-GalCer and AGLs affected the stimulation of α-GalCer and generally induced a subtle Th1 bias for splenocytes but induced an extreme Th2 bias for thymocytes. These results suggested that edible mushroom AGLs contribute to immunomodulation
Directory of Open Access Journals (Sweden)
Hamid Akbarirad
2013-06-01
Full Text Available Mushrooms are consider as a nutritional and health beneficial product. Three most cultivated mushrooms worldwide are Agaricus bisporus, Lentinus edodes and Pleurotus spp. Mushrooms are highly perishable. They tend to lose quality after harvest, mainly because of their high respiration rate and the fact that they have no barrier to protect them from water loss. Mushrooms’ shelf-life is limited to a few days under normal refrigeration conditions, which is a constraint on the distribution and marketing of fresh product, making extension of mushroom’s shelf life a constant quest. Modified atmosphere packaging provides an affordable packaging system that partly avoids enzymatic browning, fermentation and other biochemical processes by maintaining a controlled gas atmosphere. However, modified atmosphere packaging conditions should be carefully designed. Inappropriate modified atmosphere conditions may be ineffective or even shorten the shelf life of the product due to damage of tissues. Preservation techniques and specially use of MAP, specifically for Agaricus, Lentinus edodes and Pleurotus, is reviewed.
DEFF Research Database (Denmark)
Gimpel, Denise; Nielsen, Bent
2006-01-01
Hvorfor faldt Kina bagud i kapløbet med Vesten?« spørger David Favrholdt i sidste nummer af Weekendavisen. Var der overhovedet noget kapløb? Forudsætter et kapløb ikke, at man har et fælles mål? Spørgsmålet implicerer, at Vesten har vundet og indplacerer samtidig klodens øvrige kulturer i forhold....... Som en af 1900-tallets største sinologer A. C. Graham skriver i sin bog Disputers of the Tao (La Salle, Ill., 1989) var den videnskabelige revolution »en unik og kompleks begivenhed, som var afhængig af en mangfoldighed af sociale og andre betingelser, herunder et sammenfald af opdagelser (græske......, indiske, kinesiske, arabiske, næsten ingen romerske) koncentreret om kombinationen af indiske tal og aritmetik og græsk logik og geometri« (s. 317). En unik begivenhed, som er forekommet én gang i verdenshistorien. Det giver derfor ingen mening at spørge, hvorfor det ikke skete andre steder. Hvis det var...
Laccase production by Pleurotus ostreatus and its application in synthesis of gold nanoparticles
Directory of Open Access Journals (Sweden)
Ahmed I. El-Batal
2015-03-01
Optimization of production conditions yielded an enzyme with activity over 32,450 IU/g of fermented substrate. Factorial design was capable of establishing the conditions that multiplied the activity of the enzyme several folds, consequently, reducing the cost of production. The enzyme was capable of decolorizing several dyes with over 80% reduction in color confirming the aromatic degrading capability of laccase. The enzyme was also used in the synthesis of gold nanoparticles, proving that laccase from Pleurotus ostreatus has a strong potential in several industrial applications.
Woon, Shiau Mei; Seng, Yew Wei; Ling, Anna Pick Kiong; Chye, Soi Moi; Koh, Rhun Yian
2014-03-01
This study examined the anti-adipogenic effects of extracts of Ficus deltoidea var. deltoidia and var. angustifolia, a natural slimming aid, on 3T3-L1 adipocytes. Methanol and water extracts of leaves of the F. deltoidea varieties were analyzed to determine their total flavonoid content (TFC) and total phenolic content (TPC), respectively. The study was initiated by determining the maximum non-toxic dose (MNTD) of the methanol and water extracts for 3T3-L1 preadipocytes. Possible anti-adipogenic effects were then examined by treating 2-d post confluent 3T3-L1 preadipocytes with either methanol extract or water extract at MNTD and half MNTD (½MNTD), after which the preadipocytces were induced to form mature adipocytes. Visualisation and quantification of lipid content in mature adipocytes were carried out through oil red O staining and measurement of optical density (OD) at 520 nm, respectively. The TFCs of the methanol extracts were 1.36 and 1.97 g quercetin equivalents (QE)/100 g dry weight (DW), while the TPCs of the water extracts were 5.61 and 2.73 g gallic acid equivalents (GAE)/100 g DW for var. deltoidea and var. angustilofia, respectively. The MNTDs determined for methanol and water extracts were (300.0 ± 28.3) and (225.0 ± 21.2) µg/ml, respectively, for var. deltoidea, while much lower MNTDs [(60.0 ± 2.0) µg/ml for methanol extracts and (8.0 ± 1.0) µg/ml for water extracts] were recorded for var. angustifolia. Studies revealed that the methanol extracts of both varieties and the water extracts of var. angustifolia at either MNTD or ½MNTD significantly inhibited the maturation of preadipocytes. The inhibition of the formation of mature adipocytes indicated that leaf extracts of F. deltoidea could have potential anti-obesity effects.
Directory of Open Access Journals (Sweden)
Nelson Menolli Junior
2010-04-01
Full Text Available The species of Pleurotus have great commercial importance and adaptability for growth and fructification within a wide variety of agro-industrial lignocellulosic wastes. In this study, two substrates prepared from ground corncobs supplemented with rice bran and charcoal were tested for mycelium growth kinetics in test tubes and for the cultivation of four Pleurotus commercial isolates in polypropylene bags. The identification of the isolates was based on the morphology of the basidiomata obtained and on sequencing of the LSU rDNA gene. Three isolates were identified as P. ostreatus, and one was identified as P. djamor. All isolates had better in-depth mycelium development in the charcoal-supplemented substrate. In the cultivation experiment, the isolates reacted differently to the two substrates. One isolate showed particularly high growth on the substrate containing charcoal.Espécies de Pleurotus têm grande importância comercial e adaptabilidade para crescimento e frutificação em uma ampla variedade de resíduos agro-industriais lignocelulósicos. Neste trabalho foram testados dois substratos à base de sabugo de milho triturado, suplementados com farelo de arroz e carvão vegetal, para avaliação da cinética de crescimento micelial em tubos de ensaio e produção em sacos de polipropileno, utilizando quatro isolados comerciais. O estudo taxonômico foi realizado com a análise da morfologia dos basidiomas obtidos em cultivo e pelo seqüenciamento do gene nLSU do DNAr, para certificar a identificação taxonômica. Os isolados tiveram melhor desenvolvimento micelial em profundidade no substrato suplementado com carvão vegetal. Em relação à produção, os isolados reagiram de formas distintas em função dos substratos, sendo significativamente melhor o substrato contendo carvão. Três isolados foram identificados como P. ostreatus e o outro foi identificado como P. djamor.
Degradation of Green Polyethylene by Pleurotus ostreatus.
Directory of Open Access Journals (Sweden)
José Maria Rodrigues da Luz
Full Text Available We studied the biodegradation of green polyethylene (GP by Pleurotus ostreatus. The GP was developed from renewable raw materials to help to reduce the emissions of greenhouse gases. However, little information regarding the biodegradation of GP discarded in the environment is available. P. ostreatus is a lignocellulolytic fungus that has been used in bioremediation processes for agroindustrial residues, pollutants, and recalcitrant compounds. Recently, we showed the potential of this fungus to degrade oxo-biodegradable polyethylene. GP plastic bags were exposed to sunlight for up to 120 days to induce the initial photodegradation of the polymers. After this period, no cracks, pits, or new functional groups in the structure of GP were observed. Fragments of these bags were used as the substrate for the growth of P. ostreatus. After 30 d of incubation, physical and chemical alterations in the structure of GP were observed. We conclude that the exposure of GP to sunlight and its subsequent incubation in the presence of P. ostreatus can decrease the half-life of GP and facilitate the mineralization of these polymers.
Degradation of Green Polyethylene by Pleurotus ostreatus.
da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Ribeiro, Karla Veloso Gonçalves; Mendes, Igor Rodrigues; Kasuya, Maria Catarina Megumi
2015-01-01
We studied the biodegradation of green polyethylene (GP) by Pleurotus ostreatus. The GP was developed from renewable raw materials to help to reduce the emissions of greenhouse gases. However, little information regarding the biodegradation of GP discarded in the environment is available. P. ostreatus is a lignocellulolytic fungus that has been used in bioremediation processes for agroindustrial residues, pollutants, and recalcitrant compounds. Recently, we showed the potential of this fungus to degrade oxo-biodegradable polyethylene. GP plastic bags were exposed to sunlight for up to 120 days to induce the initial photodegradation of the polymers. After this period, no cracks, pits, or new functional groups in the structure of GP were observed. Fragments of these bags were used as the substrate for the growth of P. ostreatus. After 30 d of incubation, physical and chemical alterations in the structure of GP were observed. We conclude that the exposure of GP to sunlight and its subsequent incubation in the presence of P. ostreatus can decrease the half-life of GP and facilitate the mineralization of these polymers.
Mazzarella, Vincenzo; Maiello, Ida; Capozzi, Vincenzo; Budillon, Giorgio; Ferretti, Rossella
2017-08-01
This work aims to provide a comparison between three dimensional and four dimensional variational data assimilation methods (3D-Var and 4D-Var) for a heavy rainfall case in central Italy. To evaluate the impact of the assimilation of reflectivity and radial velocity acquired from Monte Midia Doppler radar into the Weather Research Forecasting (WRF) model, the quantitative precipitation forecast (QPF) is used.The two methods are compared for a heavy rainfall event that occurred in central Italy on 14 September 2012 during the first Special Observation Period (SOP1) of the HyMeX (HYdrological cycle in Mediterranean EXperiment) campaign. This event, characterized by a deep low pressure system over the Tyrrhenian Sea, produced flash floods over the Marche and Abruzzo regions, where rainfall maxima reached more than 150 mm 24 h-1.To identify the best QPF, nine experiments are performed using 3D-Var and 4D-Var data assimilation techniques. All simulations are compared in terms of rainfall forecast and precipitation measured by the gauges through three statistical indicators: probability of detection (POD), critical success index (CSI) and false alarm ratio (FAR). The assimilation of conventional observations with 4D-Var method improves the QPF compared to 3D-Var. In addition, the use of radar measurements in 4D-Var simulations enhances the performances of statistical scores for higher rainfall thresholds.
VAR Methodology Used for Exchange Risk Measurement and Prevention
Directory of Open Access Journals (Sweden)
Florentina Balu
2006-05-01
Full Text Available In this article we discuss one of the modern risk measuring techniques Value-at-Risk (VaR. Currently central banks in major money centers, under the auspices of the BIS Basle Committee, adopt the VaR system to evaluate the market risk of their supervised banks. Banks regulators ask all commercial banks to report VaRs with their internal models. Value at risk (VaR is a powerful tool for assessing market risk, but it also imposes a challenge. Its power is its generality. Unlike market risk metrics such as the Greeks, duration and convexity, or beta, which are applicable to only certain asset categories or certain sources of market risk, VaR is general. It is based on the probability distribution for a portfolio’s market value. Value at Risk (VAR calculates the maximum loss expected (or worst case scenario on an investment, over a given time period and given a specified degree of confidence. There are three methods by which VaR can be calculated: the historical simulation, the variance-covariance method and the Monte Carlo simulation. The variance-covariance method is easiest because you need to estimate only two factors: average return and standard deviation. However, it assumes returns are well-behaved according to the symmetrical normal curve and that historical patterns will repeat into the future. The historical simulation improves on the accuracy of the VAR calculation, but requires more computational data; it also assumes that “past is prologue”. The Monte Carlo simulation is complex, but has the advantage of allowing users to tailor ideas about future patterns that depart from historical patterns.
VAR Methodology Used for Exchange Risk Measurement and Prevention
Directory of Open Access Journals (Sweden)
Ion Stancu
2006-03-01
Full Text Available In this article we discuss one of the modern risk measuring techniques Value-at-Risk (VaR. Currently central banks in major money centers, under the auspices of the BIS Basle Committee, adopt the VaR system to evaluate the market risk of their supervised banks. Banks regulators ask all commercial banks to report VaRs with their internal models. Value at risk (VaR is a powerful tool for assessing market risk, but it also imposes a challenge. Its power is its generality. Unlike market risk metrics such as the Greeks, duration and convexity, or beta, which are applicable to only certain asset categories or certain sources of market risk, VaR is general. It is based on the probability distribution for a portfolio’s market value. Value at Risk (VAR calculates the maximum loss expected (or worst case scenario on an investment, over a given time period and given a specified degree of confidence. There are three methods by which VaR can be calculated: the historical simulation, the variance-covariance method and the Monte Carlo simulation. The variance-covariance method is easiest because you need to estimate only two factors: average return and standard deviation. However, it assumes returns are well-behaved according to the symmetrical normal curve and that historical patterns will repeat into the future. The historical simulation improves on the accuracy of the VAR calculation, but requires more computational data; it also assumes that “past is prologue”. The Monte Carlo simulation is complex, but has the advantage of allowing users to tailor ideas about future patterns that depart from historical patterns.
Decolourisation of mushroom farm wastewater by Pleurotus ostreatus.
Rodríguez Pérez, Suyén; García Oduardo, Nora; Bermúdez Savón, Rosa C; Fernández Boizán, Maikel; Augur, Christopher
2008-07-01
Mushroom production on coffee pulp as substrate generates an intense black residual liquid, which requires suitable treatment. In the present study, Pleurotus ostreatus growth in wastewater from mushroom farm was evaluated as a potential biological treatment process for decolourisation as well as to obtain biomass (liquid inoculum). Culture medium components affecting mycelial growth were determined, evaluating colour removal. Laccase activity was monitored during the process. P. ostreatus was able to grow in non diluted WCP. Highest biomass yield was obtained when glucose (10 g/l) was added. The addition of this carbon source was necessary for efficient decolourisation. Agitation of the culture improved biodegradation of WCP as well as fungal biomass production. Laccase and manganese-independent peroxidase activities were detected during fungal treatment of the WCP by P. ostreatus CCEBI 3024. The laccase enzyme showed good correlation with colour loss. Both wastewater colour and pollution load (as chemical oxygen demand) decreased more than 50% after 10 days of culture. Phenols were reduced by 92%.
Cultivation of Pleurotus ostreatus and other edible mushrooms.
Sánchez, Carmen
2010-02-01
Pleurotus ostreatus is the second most cultivated edible mushroom worldwide after Agaricus bisporus. It has economic and ecological values and medicinal properties. Mushroom culture has moved toward diversification with the production of other mushrooms. Edible mushrooms are able to colonize and degrade a large variety of lignocellulosic substrates and other wastes which are produced primarily through the activities of the agricultural, forest, and food-processing industries. Particularly, P. ostreatus requires a shorter growth time in comparison to other edible mushrooms. The substrate used for their cultivation does not require sterilization, only pasteurization, which is less expensive. Growing oyster mushrooms convert a high percentage of the substrate to fruiting bodies, increasing profitability. P. ostreatus demands few environmental controls, and their fruiting bodies are not often attacked by diseases and pests, and they can be cultivated in a simple and cheap way. All this makes P. ostreatus cultivation an excellent alternative for production of mushrooms when compared to other mushrooms.
Food, medicinal and environmental values of mushrooms Pleurotus ostreatus
Directory of Open Access Journals (Sweden)
O. M. Alekseenko
2010-07-01
Full Text Available We present the literature review describing food, medicinal and ecological properties of the fungus Pleurotus ostreatus (oyster mushroom. It is shown that the mushroom is adequate foodstuff for human beings. It provides with proteins, carbohydrates, fats, vitamins and mineral salts. Protein of the oyster mushrooms’ mycothallus contains 18 amino acids, eight of which were essential (isoleucine, leucine, lysine, methionine, phenylalanine, tryptophan, threonine, and valine. Therapeutic value of the mushroom is characterised by a content of water-soluble (thiamine B1, riboflavin B2, niacin, B5, PP, pyridoxine B6, biotin B7, ascorbic and pantothenic acid and liposoluble (calciferol, ergosterol, tocopherol vitamins. The considerable gains from the farm wastes use for the mushrooms raising with subsequent application of the substrate in plant cultivation and animal husbandry are stated.
EFFECT OF USING VARIOUS SUBSTRATES ON CULTIVATION OF PLEUROTUS SAJOR-CAJU
Directory of Open Access Journals (Sweden)
S. N. FASEHAH
2017-04-01
Full Text Available The unmanageable agricultural waste comprises of structural polymers, cellulose, hemicellulose and lignin can be led to pollutions, thus it can be used as a mushroom substrate. Lignocellulosic materials are most favorable feedstock as renewable and natural resource. Forestry and agricultural practices generated a large amount of ligncelluosic waste and promoted to serious problematic environmental pollution. It can be easily broken down by lignocellulotic enzymes. In this study, an attempt was made to evaluate the effect of various substrates on cultivation of Pleurotus sajor-caju. The substrates used in this study were tissue paper, rice husk ash and rubber sawdust. All of the substrates were added with rice bran and calcium carbonate (CaCO3. Then, the mixtures were transferred into plastic sized 8 cm × 4.5 cm and were pasteurized in the steamer for 1 hour at60 °C - 100 °C. After that they were cooled overnight at 25 °C - 30 °C. The spawn were inoculated into the bag and incubated in incubation room. The media bags were incubated until mycelium fully colonized and watering was done twice a day. The parameters studies were included spawn running, number of fruit body, total of stipe length, weight of fruit body and biological efficiency. Results showed that the fastest spawn running and highest number of fruits body, total of stipe length, weight of fruit body and biological efficiency are found using tissue paper substrates. In contrast the rubber sawdust showed the lowest values of spawn running, total of stipe length, weight of fruit body and biological efficiency. It can be concluded that the tissue paper is one of promising substrate which can be used in growing of Pleurotus sajor-caju due to lower cost and easy to purchase as compared to other substrates.
Kitamura, Masashi; Ando, Hirokazu; Sasaki, Yohei
2018-03-01
Coptis japonica is widely distributed in Japan, and its dried rhizome is a source of the domestic herbal medicine Coptidis Rhizoma ( Oren). There are three varieties of C. japonica, two of which, namely, C. japonica var. anemonifolia and C. japonica var. major, are important as sources of traditional medicines. Coptis japonica var. anemonifolia and C. japonica var. major are distinguishable on the basis of their ternate or biternate compound leaves, respectively. In the Hokuriku area, where both C. japonica var. anemonifolia and C. japonica var. major grow naturally, some individual plants cannot be identified unambiguously on the basis of leaf morphology because changes in leaf morphology may occur due to intra-variety variation or crossbreeding between the two varieties. In addition, genetic differences between the two varieties have remained unclear. In this study, we employed new genetic and morphological classification approaches to discriminate between the two varieties. Based on the single nucleotide polymorphisms of the tetrahydroberberine oxidase gene, we found four conserved SNPs between the two varieties and were able to classify C. japonica into two varieties and crossbreeds. Furthermore, we introduced a new leaf type index based on the overall degree of leaflet dissection calculated by surface area of a leaflet and length of leaflet margin and petiolule. Using our new index we were able to discriminate between the two varieties and their crossbreeds more accurately than is possible with the conventional discrimination method. Our genetic and morphological classification methods may be used as novel benchmarks to discriminate between the two varieties and their crossbreeds.
Some tests for parameter constancy in cointegrated VAR-models
DEFF Research Database (Denmark)
Hansen, Henrik; Johansen, Søren
1999-01-01
Some methods for the evaluation of parameter constancy in vector autoregressive (VAR) models are discussed. Two different ways of re-estimating the VAR model are proposed; one in which all parameters are estimated recursively based upon the likelihood function for the first observations, and anot...... be applied to test the constancy of the long-run parameters in the cointegrated VAR-model. All results are illustrated using a model for the term structure of interest rates on US Treasury securities. ......Some methods for the evaluation of parameter constancy in vector autoregressive (VAR) models are discussed. Two different ways of re-estimating the VAR model are proposed; one in which all parameters are estimated recursively based upon the likelihood function for the first observations......, and another in which the cointegrating relations are estimated recursively from a likelihood function, where the short-run parameters have been concentrated out. We suggest graphical procedures based on recursively estimated eigenvalues to evaluate the constancy of the long-run parameters in the model...
Foliar flavonoids from Tanacetum vulgare var. boreale and their geographical variation.
Uehara, Ayumi; Akiyama, Shinobu; Iwashina, Tsukasa
2015-03-01
Foliar flavonoids of Tanacetum vulgare var. boreale were isolated. Eight flavonoid glycosides, 7-O-glucosides of apigenin, luteolin, scutellarein and 6- hydroxyluteolin, and 7-O-glucuronides of apigenin, luteolin, chrysoeriol and eriodictyol were identified. Moreover, eight flavonoid aglycones, apigenin, luteolin, hispidulin, nepetin, eupatilin, jaceosidin, pectolinarigenin and axillarin were also isolated and identified. The flavonoid composition of two varieties of T. vulgare, i.e. var. boreale and var. vulgare, were compared. All samples of var. boreale and one sample of var. vulgare had the same flavonoid pattern, and could be distinguished from almost all the samples of var. vulgare. Thus, the occurrence of chemotypes, which are characterized by either the presence or absence of scutellarein 7-O-glucoside, eriodictyol 7-O-glucuronide and pectolinarigenin was shown in T. vulgare sensu lato.
Duffy, Michael F; Tang, Jingyi; Sumardy, Fransisca; Nguyen, Hanh H T; Selvarajah, Shamista A; Josling, Gabrielle A; Day, Karen P; Petter, Michaela; Brown, Graham V
2017-01-01
The Plasmodium falciparum var multigene family encodes the cytoadhesive, variant antigen PfEMP1. P. falciparum antigenic variation and cytoadhesion specificity are controlled by epigenetic switching between the single, or few, simultaneously expressed var genes. Most var genes are maintained in perinuclear clusters of heterochromatic telomeres. The active var gene(s) occupy a single, perinuclear var expression site. It is unresolved whether the var expression site forms in situ at a telomeric cluster or whether it is an extant compartment to which single chromosomes travel, thus controlling var switching. Here we show that transcription of a var gene did not require decreased colocalisation with clusters of telomeres, supporting var expression site formation in situ. However following recombination within adjacent subtelomeric sequences, the same var gene was persistently activated and did colocalise less with telomeric clusters. Thus, participation in stable, heterochromatic, telomere clusters and var switching are independent but are both affected by subtelomeric sequences. The var expression site colocalised with the euchromatic mark H3K27ac to a greater extent than it did with heterochromatic H3K9me3. H3K27ac was enriched within the active var gene promoter even when the var gene was transiently repressed in mature parasites and thus H3K27ac may contribute to var gene epigenetic memory. © 2016 Federation of European Biochemical Societies.
Rediscovery of Impatiens laevigata var. grandifolia (Balsaminaceae from NE India
Directory of Open Access Journals (Sweden)
R. Gogoi
2013-12-01
Full Text Available Impatiens laevigata var. grandifolia Hook.f. rediscovered after a lapse of 139 years from Lohit district of Arunachal Pradesh. Earlier it was known only – from its type locality in Manipur. Detailed morphological description of I. laevigata var. laevigata and var. grandifolia have been provided based on fresh plant collections.
Spini, Vanessa B.M.G.; Kerr, Warwick Estevam
2000-01-01
The cauliflower (Brassica oleracea var. botrytis) is an annual vegetable cultivated in Southern and Southwestern Brazil with limited production in the Northeast and Centralwest. A variety of Chinese kale, "kaai laan" or "gaillon" (Brassica oleracea var. alboglabra), produces seeds at high temperatures and therefore can do so in North and Northeastern Brazil. Gaillon and cauliflower were crossed 55 times using 10 gaillon plants as mothers and 4 cauliflower plants as pollen donors. From these c...
Larvicidal Activity of Isodon japonicus var. glaucocalyx (Maxim ...
African Journals Online (AJOL)
HP
Purpose: To determine the larvicidal activity of the essential oil derived from Isodon japonicus var. ... Methods: The essential oil of I. japonicus var. glaucocalyx aerial parts was obtained by ..... µg/mL; G. silvatica leaves, LC50 = 117.9 µg/mL.
Economic benefit analysis of cultivating Pleurotus ostreatus with rape straw
Guan, Qinlan; Gong, Mingfu; Tang, Mei
2018-04-01
The cultivation of Pleurotus ostreatus with rape straw not only can save the cultivation cost of P. ostreatus, but also can reuse the resources and protect the environment. By adding different proportion of rape straw to the cultivation material of P. ostreatus, the reasonable amount of rape straw was selected and the economic benefit of P. ostreatus cultivated with the optimum amount of rape straw was analyzed. The results showed that adding 10% to 40% rape straw to the cultivation material of P. ostreatus did not affect the yield and biological conversion rate of P. ostreatus, and the ratio of production and investment of the amount of rape straw in the range of 10% to 50% was higher than of cottonseed husk alone as the main material of the formula.
ClinVar data parsing [version 1; referees: 2 approved
Directory of Open Access Journals (Sweden)
Xiaolei Zhang
2017-05-01
Full Text Available This software repository provides a pipeline for converting raw ClinVar data files into analysis-friendly tab-delimited tables, and also provides these tables for the most recent ClinVar release. Separate tables are generated for genome builds GRCh37 and GRCh38 as well as for mono-allelic variants and complex multi-allelic variants. Additionally, the tables are augmented with allele frequencies from the ExAC and gnomAD datasets as these are often consulted when analyzing ClinVar variants. Overall, this work provides ClinVar data in a format that is easier to work with and can be directly loaded into a variety of popular analysis tools such as R, python pandas, and SQL databases.
Pitfalls in VAR based return decompositions: A clarification
DEFF Research Database (Denmark)
Engsted, Tom; Pedersen, Thomas Quistgaard; Tanggaard, Carsten
in their analysis is not "cashflow news" but "inter- est rate news" which should not be zero. Consequently, in contrast to what Chen and Zhao claim, their decomposition does not serve as a valid caution against VAR based decompositions. Second, we point out that in order for VAR based decompositions to be valid......Based on Chen and Zhao's (2009) criticism of VAR based return de- compositions, we explain in detail the various limitations and pitfalls involved in such decompositions. First, we show that Chen and Zhao's interpretation of their excess bond return decomposition is wrong: the residual component...
Shi, Min; Yang, Yingnan; Li, Yiting; Wang, Yuepeng; Zhang, Zhenya
2011-01-01
A novel approach by utilizing soybean curd residue, to produce polysaccharide from the edible mushroom Pleurotus ostreatus in solid-state culture, was developed. Firstly, the significant effect of fermented conditions on P. ostreatus polysaccharide production were screened out to be inoculum size, moisture content and C/N ratio by using a single factor experiment. Secondly, the three factors were optimized using central composite design in response surface methodology. As results, a quadratic...
Directory of Open Access Journals (Sweden)
Alfonso Soto-Sánchez
2015-09-01
Full Text Available Barley (Hordeum vulgare L., and its derivatives, ranks fourth in cereal production worldwide, and the Pleurotus species are among the most efficient types of lignocellulolytic white-rot fungi. The objective of this research study was to evaluate the degradation of barley straw and barley rootless with an inoculum of Pleurotus to improve their nutritional availability as a food source for ruminants. Two experiments were conducted; the first was to determine the effects of inoculation of Pleurotus sapidus (Schulzer Sacc. (PS in barley straw (BS, barley rootless (BR, and a 75% BS and 25% BR mixture (M. The second experiment was to evaluate the same substrates in vitro ruminal fermentation. Barley rootless had better organic matter (OM degradability than BS after 24 h incubation with PS. The protein content in BR was higher than in BS (P < 0.01. Enzyme activities had the highest concentration from the start of fermentation, and in vitro dry matter (DM degradability in BS and BR increased after 8 and 24 d fermentation, respectively (P < 0.05. Propionic acid concentration was enhanced after 16 d fermentation in BR (P < 0.5. The use of BS combined with BR exhibited better fermentation; this result provides relevant information for integrating BR with other substrates and improving the use of straw, which can be more nutritionally available for feeding ruminants.
What is Orobanche haenseleri var. deludens Beck?
Directory of Open Access Journals (Sweden)
Pujadas Salvà, Antonio J.
2004-12-01
Full Text Available Orobanche haenseleri var. deludens Beck (Orobanchaceae, a problematic taxon described from Algeciras (Cádiz, S Spain is here identified after studying the original material of Wolley-Dod (BM 4476. It is considered to be the same as O. austrohispanica M.J.Y. Foley and better included, as a variety, under O. gracilis Sm. The new combination O. gracilis var. deludens (Beck A. Pujadas is consequently proposed. It mainly parasites Ulex (Fabaceae in the western Mediterranean Region (Iberian Peninsula and NW Africa.Se identifica Orobanche haenseleri var. deludens Beck (Orobanchaceae, un taxon conflictivo descrito de Algeciras (Cádiz, sur de España, a partir del análisis del material original de Wolley-Dod (BM 4476. Se considera que es lo mismo que O. austrohispanica M.J.Y. Foley, y se incluye en O. gracilis Sm. con rango varietal. Se propone la nueva combinación O. gracilis var. deludens (Beck A. Pujadas. Parasita principalmente a especies del género Ulex (Fabaceae en la Región Mediterránea Occidental (Península Ibérica y noroeste de África.
Nutriceutical potential of Pleurotus tuber-regium sclerotium
Directory of Open Access Journals (Sweden)
R. C. Ohiri
2018-04-01
Full Text Available The aim of the study was to determine the composition of the sclerotium of Pleurotus tuber-regium and to analyze its nutritional potential. Major minerals and micronutrients content of the P. tuber-regium sclerotium were determined. The study has shown fairly high concentrations of potassium and magnesium as major minerals with values of 60.66 ± 4.13 and 41.79 ± 3.14 mg/kg, while manganese and zinc were micronutrients with the highest values of 1.20 ± 0.10 and 0.95 ± 0.07 mg/kg. Glutamic acid and aspartic acid were also observed in high concentrations with values of 11.51 ± 1.01 and 5.52 ± 0.86 mg/kg. The mushroom powder of P. tuber-regium was a source for production of oil, which was analyzed by GC-MS method. Benzenedicarboxylic acid mono-(2-ethylhexyl ester and benzenedicarboxylic acid butyl-cyclohexyl ester were volatile constituents predominating with percentage total of 78.7 and 5.2, respectively. It is concluded that the presence of mineral elements, amino acids and volatile components observed in this fungus indicated the presence of the nutritional potential in the sclerotia of P. tuber-regium.
Growth and provenance variation of Pinus caribaea var ...
African Journals Online (AJOL)
CAMCORE has visited 33 populations of Pinus caribaea var. hondurensis in Belize, Guatemala, Honduras, El Salvador, Nicaragua, and Quintana Roo, Mexico. Seed collections have been made in 29 provenances from 1, 325 mother trees. A total of 21 provenances and sources of Pinus caribaea var. hondurensis were ...
Empirical analysis on future-cash arbitrage risk with portfolio VaR
Chen, Rongda; Li, Cong; Wang, Weijin; Wang, Ze
2014-03-01
This paper constructs the positive arbitrage position by alternating the spot index with Chinese Exchange Traded Fund (ETF) portfolio and estimating the arbitrage-free interval of futures with the latest trade data. Then, an improved Delta-normal method was used, which replaces the simple linear correlation coefficient with tail dependence correlation coefficient, to measure VaR (Value-at-risk) of the arbitrage position. Analysis of VaR implies that the risk of future-cash arbitrage is less than that of investing completely in either futures or spot market. Then according to the compositional VaR and the marginal VaR, we should increase the futures position and decrease the spot position appropriately to minimize the VaR, which can minimize risk subject to certain revenues.
Quercetin - A Flavonoid Compound from Sarcopyramis bodinieri var ...
African Journals Online (AJOL)
DAPI staining and PARP SDS-PAGE tests showed 60 μM quercetin could induce potential apoptotic activity in HepG2 liver cancer cells. Conclusion: Quercetin was the major cytotoxicity constituent in S. bodinieri var. delicate. Keywords: Apoptotic activity, Quercetin, Sarcopyramis bodinieri var. delicate, HepG2 liver cancer ...
Wang, Ai-Hua; Sun, Ye; Schneider, Harald; Zhai, Jun-Wen; Liu, Dong-Ming; Zhou, Jin-Song; Xing, Fu-Wu; Chen, Hong-Feng; Wang, Fa-Guo
2015-02-05
There are different opinions about the relationship of two disjunctively distributed varieties Adiantum reniforme L. var. sinense Y.X.Lin and Adiantum reniforme L. Adiantum reniforme var. sinense is an endangered fern only distributed in a narrowed region of Chongqing city in China, while Adiantum reniforme var. reniforme just distributed in Canary Islands and Madeira off the north-western African coast. To verify the relationship of these two taxa, relative phylogenetic analyses, karyotype analyses, microscopic spore observations and morphological studies were performed in this study. Besides, divergence time between A. reniforme var. sinense and A. reniforme var. reniforme was estimated using GTR model according to a phylogeny tree constructed with the three cpDNA markers atpA, atpB, and rbcL. Phylogenetic results and divergence time analyses--all individuals of A. reniforme var. sinense from 4 different populations (representing all biogeographic distributions) were clustered into one clade and all individuals of A. reniforme var. reniforme from 7 different populations (all biogeographic distributions are included) were clustered into another clade. The divergence between A. reniforme var. reniforme and A. reniforme var. sinense was estimated to be 4.94 (2.26-8.66) Myr. Based on karyotype analyses, A. reniforme var. reniforme was deduced to be hexaploidy with 2n = 180, X = 30, while A. reniforme var. sinense was known as tetraploidy. Microscopic spore observations suggested that surface ornamentation of A. reniforme var. reniforme is psilate, but that of A. reniforme var. sinense is rugate. Leaf blades of A. reniforme var. sinense are membranous and reniform and with several obvious concentric rings, and leaves of A. reniforme var. reniforme are pachyphyllous and coriaceous and are much rounder and similar to palm. Adiantum reniforme var. sinense is an independent species rather than the variety of Adiantum reniforme var. reniforme. As a result, we
Establishment of an efficient transformation system for Pleurotus ostreatus.
Lei, Min; Wu, Xiangli; Zhang, Jinxia; Wang, Hexiang; Huang, Chenyang
2017-11-21
Pleurotus ostreatus is widely cultivated worldwide, but the lack of an efficient transformation system regarding its use restricts its genetic research. The present study developed an improved and efficient Agrobacterium tumefaciens-mediated transformation method in P. ostreatus. Four parameters were optimized to obtain the most efficient transformation method. The strain LBA4404 was the most suitable for the transformation of P. ostreatus. A bacteria-to-protoplast ratio of 100:1, an acetosyringone (AS) concentration of 0.1 mM, and 18 h of co-culture showed the best transformation efficiency. The hygromycin B phosphotransferase gene (HPH) was used as the selective marker, and EGFP was used as the reporter gene in this study. Southern blot analysis combined with EGFP fluorescence assay showed positive results, and mitotic stability assay showed that more than 75% transformants were stable after five generations. These results showed that our transformation method is effective and stable and may facilitate future genetic studies in P. ostreatus.
Foco de leishmaniasis en El Hobo, municipio de El Carmen de Bolívar, Bolívar, Colombia
Directory of Open Access Journals (Sweden)
Luis Alberto Cortés
2006-10-01
Full Text Available Introducción. Se describen las características epidemiológica e importancia de la especies de Lutzomyia presentes en un foco de leishmaniasis en la vereda El Hobo Carmen de Bolívar, departamento de Bolívar. Objetivos. Obtener un conocimiento preliminar de la transmisión de leishmaniasis en la vereda El Hobo Carmen de Bolívar. Materiales y métodos. Se analizaron datos epidemiológicos y se realizaron capturas de flebótomos con trampas CDC y cebo humano en la vereda El Hobo. Para establecer la sero prevalencia de leishmaniasis visceral canina se hizo un estudio en perros mediante la técnica de inmunofluorescencia indirecta. Resultados. Se capturaron nueve especies de Lutzomyia: L. trinidadensis, L. evansi, L .cayennensis, L. venezuelensis, L. gomezi,L. dubitans, L. ylephiletor, L. yuilli, y L. walkeri. Las especie de mayor importancia por sus implicaciones en la transmisión de leishmaniasis cutánea y visceral fueron L. gomezi, y L. evansi respectivamente. Se reporta por primera vez para Bolívar especimenes de L. venezuelensis, L. dubitans, L. ylephiletor, L. yuilli, y L. walkeri. Se determinó una prevalencia de leishmaniasis visceral del 36% en los caninos estudiados. Según los reportes epidemiológicos, en el 2002 en el municipio de Carmen de Bolívar la leishmaniasis cutánea mostró un aumento del 40% y la leishmaniasis visceral canina del 80% de los casos con respecto al 2001, debido al brote presentado en la vereda El Hobo Conclusiones. Los resultados determinan a la vereda El Hobo como una zona de riesgo potencial de transmisión de leishmaniasis cutánea y visceral.
Phosphorylation of SU(VAR3-9 by the chromosomal kinase JIL-1.
Directory of Open Access Journals (Sweden)
Joern Boeke
2010-04-01
Full Text Available The histone methyltransferase SU(VAR3-9 plays an important role in the formation of heterochromatin within the eukaryotic nucleus. Several studies have shown that the formation of condensed chromatin is highly regulated during development, suggesting that SU(VAR3-9's activity is regulated as well. However, no mechanism by which this may be achieved has been reported so far. As we and others had shown previously that the N-terminus of SU(VAR3-9 plays an important role for its activity, we purified interaction partners from Drosophila embryo nuclear extract using as bait a GST fusion protein containing the SU(VAR3-9 N-terminus. Among several other proteins known to bind Su(VAR3-9 we isolated the chromosomal kinase JIL-1 as a strong interactor. We show that SU(VAR3-9 is a substrate for JIL-1 in vitro as well as in vivo and map the site of phosphorylation. These findings may provide a molecular explanation for the observed genetic interaction between SU(VAR3-9 and JIL-1.
21 CFR 173.145 - Alpha-Galactosidase derived from Mortierella vinaceae var. raffinoseutilizer.
2010-04-01
... vinaceae var. raffinoseutilizer. 173.145 Section 173.145 Food and Drugs FOOD AND DRUG ADMINISTRATION... Alpha-Galactosidase derived from Mortierella vinaceae var. raffinoseutilizer. The food additive alpha-galactosidase and parent mycelial microorganism Mortierella vinaceae var. raffinoseutilizer may be safely used...
Neufeld, Howard S; Johnson, Jennifer; Kohut, Robert
2018-01-01
Cutleaf coneflower (Rudbeckia laciniata L. var. digitata) is native to Great Smoky Mountains National Park (GRSM) and an ozone bioindicator species. Variety ampla, whose ozone sensitivity is less well known, is native to Rocky Mountain National Park (ROMO). In the early 2000s, researchers found putative ozone symptoms on var. ampla and rhizomes were sent to Appalachian State University to verify that the symptoms were the result of ozone exposure. In 2011, potted plants were exposed to ambient ozone from May to August. These same plants were grown in open-top chambers (OTCs) in 2012 and 2013, and exposed to charcoal-filtered (CF), non-filtered (NF), elevated ozone (EO), NF+50ppb in 2012 for 47days and NF+30/NF+50ppb ozone in 2013 for 36 and 36days, respectively. Ozone symptoms similar to those found in ROMO (blue-black adaxial stippling) were reproduced both in ambient air and in the OTCs. Both varieties exhibited foliar injury in the OTCs in an exposure-dependent manner, verifying that symptoms resulted from ozone exposure. In two of the three study years, var. digitata appeared more sensitive than var. ampla. Exposure to EO caused reductions in ambient photosynthetic rate (A) and stomatal conductance (g s ) for both varieties. Light response curves indicated that ozone reduced A, g s , and the apparent quantum yield while it increased the light compensation point. In CF air, var. ampla had higher light saturated A (18.2±1.04 vs 11.6±0.37μmolm -2 s -1 ), higher light saturation (1833±166.7 vs 1108±141.7μmolm -2 s -1 ), and lower Ci/Ca ratio (0.67±0.01 vs 0.77±0.01) than var. digitata. Coneflowers in both Parks are adversely affected by exposure to ambient ozone and if ozone concentrations increase in the Rocky Mountains, greater amounts of injury on var. ampla can be expected. Copyright © 2017 Elsevier B.V. All rights reserved.
VAr reserve concept applied to a wind power plant
DEFF Research Database (Denmark)
Martinez, Jorge; Kjær, Philip C.; Rodriguez, Pedro
2011-01-01
to wind power plants. This paper proposes two different VAr reserve control strategies for a wind power plant. The amount of dynamic VAr available most of the operation time, makes the wind power plant (WPP) a good candidate to include a VAr reserve management system. Two different ways of implementing...... a VAr management system are proposed and analyzed. Such a reactive power reserve may be provided by the wind power plant since the amount of reactive power installed for most active power working points exceeds the demand required by the grid operator. Basically, this overrated reactive power capacity...... is a consequence of sizing wind turbine facilities for maximum active power level. The reactive power losses, due to active power transportation inside the plant (normally two transformers), and P-Q wind turbine characteristics define the P-Q reserve chart. By utilizing the intrinsic overrated reactive power...
A comprehensive market-based scheme for VAR management and pricing in the electricity markets
Energy Technology Data Exchange (ETDEWEB)
El-Araby, E.E. [Qassim Univ., Alqassim, Meldia (Saudi Arabia). Dept. of Electrical Engineering
2009-07-01
In order to enable a power system to operate within an acceptable degree of reliability and security, the provision of VAR ancillary services from the VAR sources in electricity markets is the most effective method. The procurement of VAR services is particularly problematic for transmission operators as it relates to pricing mechanism and various technical issues during system operation. This paper proposed an integrated market-based approach for pricing VAR service in the electricity market. The paper was an extension of the authors' proposal for the provision of the VAR service from dynamic VAR sources in a competitive market-based environment. The formulation was modified to include VAR utilization payment and possible power system transition states multiple base cases and contingencies with their associated occurrence probabilities. The paper discussed the basic terms of the proposed approach including the VAR market objective and generator VAR output and its compensation. The mathematical formulation that considered VAR capacity payment, utilization payment and operating costs under the previous transition states in a unified single problem were introduced. The overall problem formulation and solution algorithm were also presented as a large-scale mixed integer nonlinear optimization problem. It was concluded that the proposed method was suited for the simulation and analysis of the existing VAR market. 8 refs., 3 tabs., 5 figs., 2 appendices.
METODE VECTOR AUTOREGRESSIVE (VAR DALAM PERAMALAN JUMLAH WISATAWAN MANCANEGARA KE BALI
Directory of Open Access Journals (Sweden)
TJOK GDE SAHITYAHUTTI RANANGGA
2018-05-01
Full Text Available The purposes of this research were to model and to forecast the number of foreign tourists (Australia, China, and Japan arrival to Bali using vector autoregressive (VAR method. The estimated of VAR model obtained to forecast the number of foreign tourists to Bali is the sixth order VAR (VAR(6.We used multivariate least square method to estimate the VAR(6’s parameters.The mean absolute percentage error (MAPE in this model were as follows 6.8% in predicting the number of Australian tourists, 15.9% in predicting the number of Chinese tourists, and 9% in predicting the number of Japanese tourists. The prediction of Australian, Chinese, and Japanese tourists arrival to Bali for July 2017 to December 2017 tended to experience up and downs that were not too high compared to the previous months.
To the issue of increasing efficiency of VAR compensation
Directory of Open Access Journals (Sweden)
Світлана Костянтинівна Поднебенна
2015-11-01
Full Text Available This article describes the features of VAR compensation of variable loads. One of the most common non-symmetric non-linear power consumers are welding power sources. Time and duration of the work of these sources vary randomly. To compensate the consumption of reactive power on the basis of consumption data from the three-phase electricity meters is inefficient. Compensation devices power should be calculated taking into account the asymmetrical consumption/generation of reactive power per phase and changing consumption patterns. Thyristor-controlled reactor, thyristor-switched capacitors, hybrid VAR compensators, active compensators (STATCOMs, «dynamic capacitors» can be used as the VAR compensation devices. Thyristor-controlled reactors can provide smooth regulation of reactive power, but they have high weight and size parameters and are additional sources of higher harmonics. Thyristor-switched capacitors provide stepwise adjustment of reactive power and are subject to the current higher harmonics. Hybrid VAR compensators make it possible to isolate capacitors from the higher harmonics and ensure smooth regulation, which is achieved by active filter introduction to the reactive power compensation devices based on thyristor-switched capacitors. However, this increases the cost of a compensator and complicates its control system. STATCOMs provide smooth regulation of reactive power, but they are too expensive.Perspective direction in the development of effective VAR compensation devices is «dynamic capacitor». As a result of a feasibility study the prospects for further research of electrical grids power efficiency through the development of effective devices for VAR compensation have been established
How can the origin of the decay var-phi →3π be determined?
International Nuclear Information System (INIS)
Achasov, N.N.; Kozhevnikov, A.A.
1992-01-01
It is shown that the interference pattern in the region √s = 1.05 GeV in the reaction e + e - →ω, var-phi →3π can be used to determine unambiguously whether the decay var-phi →3π occurs because of var-phi ω mixing, var-phi →ω→3π, or because of the direct transition var-phi →3π. 8 refs., 3 figs., 1 tab
Directory of Open Access Journals (Sweden)
Evelise Moncaio Moda
2005-04-01
Full Text Available Traditionally, the cultivation of Pleurotus sajor-caju is performed on different composted and pasteurized agricultural residues. The objective of this study was to investigate whether traditional composting and pasteurization processes could be replaced by washed and supplemented (mineral or organic sugarcane bagasse. In one experiment, fresh sugarcane bagasse was immersed in hot water at 80°C for two hours (control or washed in fresh water for one hour using an adapted machine for residue treatment. In another experiment, fresh sugarcane bagasse was washed in fresh water (control, and supplemented with corn grits (organic supplementation, or supplemented with nutrient solution (mineral supplementation. In the first experiment, the washed bagasse presented a average biological efficiency (ABE of 19.16% with 44% contamination, and the pasteurized bagasse presented a ABE of 13.86% with 70% contamination. In the second experiment, corn grits presented the poorest performance, with a ABE of 15.66% and 60% contamination, while supplementation with the nutrient solution presented a ABE of 30.03%, whereas the control of 26.62%. Washing fresh sugarcane bagasse could suppress the pasteurized substrate in Pleurotus sajor-caju production, compensating a reduced ABE with a faster process.Tradicionalmente, o cultivo do Pleurotus sajor-caju é realizado utilizando-se diversos resíduos agrícolas, precedido dos processos de compostagem e pasteurização. O presente trabalho teve por objetivo comparar o processo de pasteurização com a lavagem do bagaço de cana-de-açúcar e avaliar formas de suplementação do bagaço, visando aumento na produtividade. No primeiro experimento, os colmos da cana-de-açúcar passaram por moenda para a extração do caldo, sendo em seguida desfibrados. No tratamento controle, o bagaço fresco foi pasteurizado em água a 80°C durante 2 horas e o outro tratamento consistiu na lavagem do bagaço fresco em centrífuga com
VAR, stress-testing and supplementary methodologies: uses and constraints in energy risk management
International Nuclear Information System (INIS)
Senior, Brian
1999-01-01
This chapter lists some of the special risks associated with a range of energy markets, and questions what is risk. Market risk, the use of value-at-risk (VAR) for measuring and managing market risk, use of VAR in the banking sector, back-testing of VAR, the corporate sector, making investment decisions, and the need for additional methods of risk analysis are discussed. Scenario analysis and stress testing, liquidity, and combining VAR and stress-testing are described. Credit risk and the quantitative analysis of credit risk are addressed, and operational risk, and organisational challenges are considered. Panels present examples of a simple VAR calculation and give descriptions of VAR in corporate decisions, the measurement of liquidity, and the use of the Greeks in decisions on day to day trading and risk management
Computing level-impulse responses of log-specified VAR systems
Wieringa, J.E.; Horvath, C.
2005-01-01
Impulse response functions (IRFs) are often used to analyze the dynamic behavior of a vector autoregressive (VAR) system. In many applications of VAR modelling, the variables are log-transformed before the model is estimated. If this is the case, the results of the IRFs do not have a direct
Directory of Open Access Journals (Sweden)
Álison Bruno da Silva Santos
2009-01-01
Full Text Available Plague control is based almost exclusively on application of chemical substances, however these products are toxic to men and animals and cause odd effects on environment quality. In Plague Integrated Management (PIM, the use of selected insecticides and entomopathogenic fungi should be considered as one viable strategy for plague control in agriculture. This work aimed to evaluate, in laboratory, the compatibility of the entomopathogenic fungi Metarhizium anisopliae var. acridum and Metarhizium anisopliae var. anisopliae with the oil of Nim. The addition of the product was made to the potato-dextrose-agar medium still liquid (±45°C, in a way that the final concentration obeyed 50% of the producer's recommendation. After fungi inoculation, the dishes were incubated in a cimatized room at 28°C, photophase of 12 hours and relative humidity of 75±5% for 12 day period. The number of conidia per colonie was counted with a Neubauer chamber. Statistic delineament was entirely in random, with two treatments (PDA with insecticide, and a control group (PDA without insecticide, and 9 repetitions for each treatment. The results showed that the insecticide inhibited conidial production in Metarhizium anisopliae var. anisopliae strains when compared to the control group. The diameter of Metarhizium anisopliae var. acridum colonies suffered significative reduction in its size, compared to control. The tested insecticide, in the concentration and formulation used, presented compatibility with the tested strains.
Protoplast preparation from monokaryotic mycelium of Pleurotus sajor-caju using lysing enzyme
International Nuclear Information System (INIS)
Hassan Hamdani Mutaat; Mat Rasol Awang
2004-01-01
The objective of this study was to determine the optimum parameters of the factors influencing protoplast isolation from monokaryotic mycelium of Pleurotus sajor-caju using lysing enzyme from Trichoderma harzianurm. The study was conducted by manipulating the variables of the factors affecting protoplast isolation, such as age of mycelium culture, period for lysing of mycelium, concentration of lysing enzyme and concentration of osmotic stabilizer. The highest protoplast yield of 8.3 x 104 protoplast/ml was achieved when a 3-day P. sajor-caju mycelium, cultured statically, was incubated for 3 hours in a lytic mixture containing 7.5 mg/ml lysing enzyme and 1.2 M ammonium sulfate as osmotic stabilizer. This protoplast yield, however, is insufficient for regeneration and protoplast fusion works. (Author)
Saccharomyces cerevisiae var. boulardii fungemia following probiotic treatment
Appel-da-Silva, Marcelo C.; Narvaez, Gabriel A.; Perez, Leandro R.R.; Drehmer, Laura; Lewgoy, Jairo
2017-01-01
Probiotics are commonly prescribed as an adjuvant in the treatment of antibiotic-associated diarrhea caused by Clostridium difficile. We report the case of an immunocompromised 73-year-old patient on chemotherapy who developed Saccharomyces cerevisiae var. boulardii fungemia in a central venous catheter during treatment of antibiotic-associated pseudomembranous colitis with the probiotic Saccharomyces cerevisiae var. boulardii. Fungemia was resolved after interruption of probiotic administrat...
Ehsan Bari; Reza Oladi; Olaf Schmidt; Carol A. Clausen; Katie Ohno; Darrel D. Nicholas; Mehrdad Ghodskhah Daryaei; Maryam Karim
2015-01-01
The scope of this research was to evaluate the influence of xylem ray (XR) and degree of polymerization (DP) of holocellulose in Oriental beech wood (Fagus orientalis Lipsky.) on impact bending strength against two white-rot fungi. Beech wood specimens, exposed to Pleurotus ostreatus and Trametes versicolor, were evaluated for...
Mofiz, Ehtesham; Holt, Deborah C; Seemann, Torsten; Currie, Bart J; Fischer, Katja; Papenfuss, Anthony T
2016-06-02
The scabies mite, Sarcoptes scabiei, is a parasitic arachnid and cause of the infectious skin disease scabies in humans and mange in other animal species. Scabies infections are a major health problem, particularly in remote Indigenous communities in Australia, where secondary group A streptococcal and Staphylococcus aureus infections of scabies sores are thought to drive the high rate of rheumatic heart disease and chronic kidney disease. We sequenced the genome of two samples of Sarcoptes scabiei var. hominis obtained from unrelated patients with crusted scabies located in different parts of northern Australia using the Illumina HiSeq. We also sequenced samples of Sarcoptes scabiei var. suis from a pig model. Because of the small size of the scabies mite, these data are derived from pools of thousands of mites and are metagenomic, including host and microbiome DNA. We performed cleaning and de novo assembly and present Sarcoptes scabiei var. hominis and var. suis draft reference genomes. We have constructed a preliminary annotation of this reference comprising 13,226 putative coding sequences based on sequence similarity to known proteins. We have developed extensive genomic resources for the scabies mite, including reference genomes and a preliminary annotation.
Zhang, Xin-Hui; Lang, Duo-Yong; Chen, Jing; Zhao, Yun-Sheng; Wu, Xiu-Li; Fu, Xue-Yan
2014-02-01
To exploring the relationship between continuous cropping obstacle and autotoxicity of Astragalus membranaceus var. mongholicus, autotoxic effect of plant aqueous extract were determined. Distilled water (CK), aqueous extract of plant, including root, stem and leaf (12.5, 25, 50 and 100 mg/mL respectively)were applied to testing their effect on early growth of Astragalus membranaceus var. mongholicus. Specifically, seed germination rate, germination index, emergence rate, elongation of radical and embryo, and seedling vigor index were determined. The aqueous extract of root, stem, and leaf at 25 mg/mL significantly inhibited the seed germination and seedling growth of Astragalus membranaceus var. mongholicus, and this inhibitory effect generally increased with the increase of the concentration of aqueous extracts. To the comprehensive allelopathic effect, the extracts from Astragalus membranaceus var. mongholicus stem were more inhibitory than those from leaf and root. The germination index and seedling vigor index were more sensitive to extract than other determined parameters. Aqueous extracts from Astragalus membranaceus var. mongholicus plant gave inhibitory effects on Astragalus. membranaceus var. mongholicus germination and seedling growth, and this inhibitory effect generally increased with the increases of aqueous extract concentration at a certain ranges. In conclusion, there is an autotoxicity in continuous cropping of Astragalus membranaceus var. mongholicus.
Wei, Zheng-xin; Guo, Dong-qin; Li, Hai-feng; Ding, Bo; Zhang, Jie; Zhou, Nong; Yu, Jie
2015-10-01
Through potted inoculation test at room temperature and indoor analysis, the photosynthetic parameters and physiological and biochemical indexes of Paris polyphylla var. yunnanensis were observed after 28 arbuscular mycorrhizal (AM) fungi were injected into the P. polyphylla var. yunnanensis growing in a sterile soil environment. The results showed that AM fungi established a good symbiosis with P. polyphylla var. yunnanensis. The AM fungi influenced the photosynthetic parameters and physiological and biochemical indexes of P. polyphylla var. yunnanensis. And the influences were varied depending on different AM fungi. The application of AM fungi improved photosynthesis intensity of P. polyphylla var. yunnanensis mesophyll cells, the contents of soluble protein and soluble sugar, protective enzyme activity of P. polyphylla var. yunnanensis leaf, which was beneficial to resist the adverse environment and promote the growth of P. polyphylla var. yunnanensis. Otherwise, there was a certain mutual selectivity between P. polyphylla var. yunnanensis and AM fungi. From the comprehensive effect of inoculation, Racocetra coralloidea, Scutellospora calospora, Claroideoglomus claroideum, S. pellucida and Rhizophagus clarus were the most suitable AM fungi to P. polyphylla var. yunnanensis when P. polyphylla var. yunnanensis was planted in the field.
Directory of Open Access Journals (Sweden)
Georgios I. Zervakis
2013-01-01
Full Text Available Two-phase olive mill waste (TPOMW, “alperujo” is a highly biotoxic sludge-like effluent of the olive-oil milling process with a huge seasonal production. One of the treatment approaches that has so far received little attention is the use of TPOMW as substrate for the cultivation of edible mushrooms. Fifteen fungal strains belonging to five species (Basidiomycota, that is, Agrocybe cylindracea, Pleurotus cystidiosus, P. eryngii, P. ostreatus, and P. pulmonarius, were evaluated for their efficacy to colonize media composed of TPOMW, which was used either raw or composted in mixtures with wheat straw in various ratios. Qualified strains exhibited high values of biological efficiency (e.g., 120–135% for Pleurotus spp. and 125% for A. cylindracea and productivity in subsequent cultivation experiments on substrates supplemented with 20–40% composted TPOMW or 20% raw TPOMW. Only when supplementation exceeded 60% for raw TPOMW, a negative impact was noted on mushroom yields which could be attributed to the effluent's toxicity (otherwise alleviated in the respective composted TPOMW medium. Earliness and mushroom size as well as quality parameters such as total phenolic content and antioxidant activity did not demonstrate significant differences versus the control wheat-straw substrate. The substrates hemicellulose content was negatively correlated with mycelium growth rates and yields and positively with earliness; in addition, cellulose: lignin ratio presented a positive correlation with mycelium growth and mushroom weight for A. cylindracea and with earliness for all species examined. TPOMW-based media revealed a great potential for the substitution of traditional cultivation substrates by valorizing environmentally hazardous agricultural waste.
Zervakis, Georgios I; Koutrotsios, Georgios; Katsaris, Panagiotis
2013-01-01
Two-phase olive mill waste (TPOMW, "alperujo") is a highly biotoxic sludge-like effluent of the olive-oil milling process with a huge seasonal production. One of the treatment approaches that has so far received little attention is the use of TPOMW as substrate for the cultivation of edible mushrooms. Fifteen fungal strains belonging to five species (Basidiomycota), that is, Agrocybe cylindracea, Pleurotus cystidiosus, P. eryngii, P. ostreatus, and P. pulmonarius, were evaluated for their efficacy to colonize media composed of TPOMW, which was used either raw or composted in mixtures with wheat straw in various ratios. Qualified strains exhibited high values of biological efficiency (e.g., 120-135% for Pleurotus spp. and 125% for A. cylindracea) and productivity in subsequent cultivation experiments on substrates supplemented with 20-40% composted TPOMW or 20% raw TPOMW. Only when supplementation exceeded 60% for raw TPOMW, a negative impact was noted on mushroom yields which could be attributed to the effluent's toxicity (otherwise alleviated in the respective composted TPOMW medium). Earliness and mushroom size as well as quality parameters such as total phenolic content and antioxidant activity did not demonstrate significant differences versus the control wheat-straw substrate. The substrates hemicellulose content was negatively correlated with mycelium growth rates and yields and positively with earliness; in addition, cellulose: lignin ratio presented a positive correlation with mycelium growth and mushroom weight for A. cylindracea and with earliness for all species examined. TPOMW-based media revealed a great potential for the substitution of traditional cultivation substrates by valorizing environmentally hazardous agricultural waste.
Morphology and mycelial growth rate of Pleurotus spp. strains from the Mexican mixtec region
Guadarrama-Mendoza, P.C.; del Toro, G. Valencia; Ramírez-Carrillo, R.; Robles-Martínez, F.; Yáñez-Fernández, J.; Garín-Aguilar, M.E.; Hernández, C.G.; Bravo-Villa, G.
2014-01-01
Two native Pleurotus spp. strains (white LB-050 and pale pink LB-051) were isolated from rotten tree trunks of cazahuate (Ipomoea murucoides) from the Mexican Mixtec Region. Both strains were chemically dedikaryotized to obtain their symmetrical monokaryotic components (neohaplonts). This was achieved employing homogenization time periods from 60 to 65 s, and 3 day incubation at 28 °C in a peptone-glucose solution (PGS). Pairing of compatible neohaplonts resulted in 56 hybrid strains which were classified into the four following hybrid types: (R1-nxB1-n, R1-nxB2-1, R2-nxB1-n and R2-nxB2-1). The mycelial growth of Pleurotus spp. monokaryotic and dikaryotic strains showed differences in texture (cottony or floccose), growth (scarce, regular or abundant), density (high, regular or low), and pigmentation (off-white, white or pale pink). To determine the rate and the amount of mycelium growth in malt extract agar at 28 °C, the diameter of the colony was measured every 24 h until the Petri dish was completely colonized. A linear model had the best fit to the mycelial growth kinetics. A direct relationship between mycelial morphology and growth rate was observed. Cottony mycelium presented significantly higher growth rates (p < 0.01) in comparison with floccose mycelium. Thus, mycelial morphology can be used as criterion to select which pairs must be used for optimizing compatible-mating studies. Hybrids resulting from cottony neohaplonts maintained the characteristically high growth rates of their parental strains with the hybrid R1-nxB1-n being faster than the latter. PMID:25477920
Pardo-Giménez, Arturo; Catalán, Luis; Carrasco, Jaime; Álvarez-Ortí, Manuel; Zied, Diego; Pardo, José
2016-08-01
This work assesses the agronomic performance of defatted pistachio meal, after oil extraction, as a nutritional substrate supplement when growing the mushroom species Agaricus bisporus (Lange) Imbach and Pleurotus ostreatus (Jacq.) P. Kumm. Materials were applied at different doses at spawning. Along with non-supplemented substrates, commercial nutritional supplements were used as controls. Proximate analysis of mushrooms is also considered. For the cultivation of champignon, defatted pistachio meal has provided larger mushrooms (unitary weight and cap diameter) with firmer texture and greater content in dry weight and protein, without significant alterations in quantitative parameters. For Pleurotus ostreatus, the supplement led to significant yield increase, even providing up to 34.4% of increment compared to non-supplementation with meal, reaching a biological efficiency of 129.9 kg dt(-1) , when applied to the 15 g kg(-1) compost dose. Supplementation has also been conducted to increase dry weight, protein and fibre within carpophores and to decrease the energy value. Defatted pistachio meal has similar or better results compared to the commercial supplements used as reference. Compost supplementation with defatted pistachio meal in A. bisporus concerns mainly the quantitative parameters (size, texture, dry weight and protein). Based on the results obtained, this technique has greater potential of development for P. ostreatus commercial crops, basically due to expected increases in production, with a direct impact on benefits and crop profitability. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.
International Nuclear Information System (INIS)
Wang Lianfeng; Chen Henglei; Zhang Jun; Zeng Xianxian
2009-01-01
In order to screen pleurotus mycelium polysaccharide high-yield strains, the comparative study was made by use of ion beam implantation and composite mutagenesis before screening. The treating mycelium pellet of pleurotus ferulae tentatively with ion beam implantation was performed at the first. Two polysaccharide high-yield strains, PFPH-1and PFPH-2, were selected using fermentation quantitative screening after auxotrophy qualitative primary screening. It has been found that the polysaccharide yield of the mutants is 551.80mg/L and 659.46mg/L respectively,which increases by 46.55% and 75.14% respectively compared to that of initial strain. Then PFPH-1and PFPH-2, as the original strain, is exposed to ultraviolet light and is suffered by additive of LiCl respectively. The results indicate that the polysaccharide yield of strains 1,9 and 10 decreases by 27%, 38% and 37% respectively compared to that of PFPH-1 meanwhile the polysaccharide yield of strain 17 decreases by 28% compared to that of PFPH-2 after high-flux qualitative primary screening. In this study, composite mutagenesis with exposure of ultra-violet and additive of lithium chloride shows some negative effects. (authors)
International Nuclear Information System (INIS)
Mohammed, H.M; Soliman, S.S.A; Shawky, A.S.H; Mahgoub, E.M.I
2013-01-01
The present study aimed to understand the effect of gamma rays on three strains of white oyster mushroom Pleurotus ostreatus and induction of new benefit mutants. Five different doses, i.e., 0.25,0.5,0.75, and 1.00 KGy of gamma rays were used. Twelve morphological criteria were measured. The result confirmed the existence of different response of three strains to different doses of radiation. The 21 strain as a control, the first flush was misshapen, but the second flush gave normal fruit, while mutant Po 21-3 gave excellent growth performance for the shape, colour, fruit diameter and stem length, while slightly decrease in wet and dry total matter per bag and flushes numbers were found.The po 21-2 mutant considered as important mutant because slightly increased in wet and dry total matter than the control, and had short stem length. This mutant Po 21 -2 gave spores, while the control was sporeless. Control of strain 22 possessed good performance for fruit characterization but it forms fruits less than its primordial it formed (semi maturation less strain) per bag, While po 22-l and Po 22-2 appeared good performance, in addition high yielding as wet and dry total matter and faster flushing. The control of strain 66 had a good growth performance, and the four mutants for this strain is very good too they had excellent growth performance; Po 66-1 and Po 66-3 mutants had significant and highly significant values for wet matter than the control (21.04, 21.64 and 12.27) for (Po 66-1, Po 66-4, control). As well as more important criteria there were taken as short fruit stem length and fruit number/bag. These results confirmed the important of Po 66-4 followed by po 66-1 in next breeding and production programs for white oyster mushroom (Pleurotus ostreatus).the RAPD PCR results showed the oligonucleotide OPB-10, OPA-05 and OPC-02 presented the highest percentage of RAPD polymorphism (80⁒, 80⁒, 66.6⁒). The pattern obtained with OPB-10 oligonucleotide for strains
Haavelmo's Probability Approach and the Cointegrated VAR
DEFF Research Database (Denmark)
Juselius, Katarina
Some key econometric concepts and problems addressed by Trygve Haavelmo and Ragnar Frisch are discussed within the general frame- work of a cointegrated VAR. The focus is on problems typical of time- series data such as multicollinearity, spurious correlation and regres- sion results, time......) the plausibility of the multivari- ate normality assumption underlying the VAR, (3) cointegration as a solution to the problem of spurious correlation and multicollinearity when data contain deterministic and stochastic trends, (4) the exis- tence of a universe, (5) the association between Frisch’s con...
Comparison of historically simulated VaR: Evidence from oil prices
International Nuclear Information System (INIS)
Costello, Alexandra; Asem, Ebenezer; Gardner, Eldon
2008-01-01
Cabedo and Moya [Cabedo, J.D., Moya, I., 2003. Estimating oil price 'Value at Risk' using the historical simulation approach. Energy Economics 25, 239-253] find that ARMA with historical simulation delivers VaR forecasts that are superior to those from GARCH. We compare the ARMA with historical simulation to the semi-parametric GARCH model proposed by Barone-Adesi et al. [Barone-Adesi, G., Giannopoulos, K., Vosper, L., 1999. VaR without correlations for portfolios of derivative securities. Journal of Futures Markets 19 (5), 583-602]. The results suggest that the semi-parametric GARCH model generates VaR forecasts that are superior to the VaR forecasts from the ARMA with historical simulation. This is due to the fact that GARCH captures volatility clustering. Our findings suggest that Cabedo and Moya's conclusion is mainly driven by the normal distributional assumption imposed on the future risk structure in the GARCH model. (author)
Amit-Avraham, Inbar; Pozner, Guy; Eshar, Shiri; Fastman, Yair; Kolevzon, Netanel; Yavin, Eylon; Dzikowski, Ron
2015-03-03
The virulence of Plasmodium falciparum, the causative agent of the deadliest form of human malaria, is attributed to its ability to evade human immunity through antigenic variation. These parasites alternate between expression of variable antigens, encoded by members of a multicopy gene family named var. Immune evasion through antigenic variation depends on tight regulation of var gene expression, ensuring that only a single var gene is expressed at a time while the rest of the family is maintained transcriptionally silent. Understanding how a single gene is chosen for activation is critical for understanding mutually exclusive expression but remains a mystery. Here, we show that antisense long noncoding RNAs (lncRNAs) initiating from var introns are associated with the single active var gene at the time in the cell cycle when the single var upstream promoter is active. We demonstrate that these antisense transcripts are incorporated into chromatin, and that expression of these antisense lncRNAs in trans triggers activation of a silent var gene in a sequence- and dose-dependent manner. On the other hand, interference with these lncRNAs using complement peptide nucleic acid molecules down-regulated the active var gene, erased the epigenetic memory, and induced expression switching. Altogether, our data provide evidence that these antisense lncRNAs play a key role in regulating var gene activation and mutually exclusive expression.
Bachmann, Anna; Petter, Michaela; Krumkamp, Ralf; Esen, Meral; Held, Jana; Scholz, Judith A M; Li, Tao; Sim, B Kim Lee; Hoffman, Stephen L; Kremsner, Peter G; Mordmüller, Benjamin; Duffy, Michael F; Tannich, Egbert
2016-04-01
Virulence of the most deadly malaria parasite Plasmodium falciparum is linked to the variant surface antigen PfEMP1, which is encoded by about 60 var genes per parasite genome. Although the expression of particular variants has been associated with different clinical outcomes, little is known about var gene expression at the onset of infection. By analyzing controlled human malaria infections via quantitative real-time PCR, we show that parasite populations from 18 volunteers expressed virtually identical transcript patterns that were dominated by the subtelomeric var gene group B and, to a lesser extent, group A. Furthermore, major changes in composition and frequency of var gene transcripts were detected between the parental parasite culture that was used to infect mosquitoes and Plasmodia recovered from infected volunteers, suggesting that P. falciparum resets its var gene expression during mosquito passage and starts with the broad expression of a specific subset of var genes when entering the human blood phase.
Genome-wide analysis of SU(VAR)3-9 distribution in chromosomes of Drosophila melanogaster.
Maksimov, Daniil A; Laktionov, Petr P; Posukh, Olga V; Belyakin, Stepan N; Koryakov, Dmitry E
2018-03-01
Histone modifications represent one of the key factors contributing to proper genome regulation. One of histone modifications involved in gene silencing is methylation of H3K9 residue. Present in the chromosomes across different eukaryotes, this epigenetic mark is controlled by SU(VAR)3-9 and its orthologs. Despite SU(VAR)3-9 was discovered over two decades ago, little is known about the details of its chromosomal distribution pattern. To fill in this gap, we used DamID-seq approach and obtained high-resolution genome-wide profiles for SU(VAR)3-9 in two somatic (salivary glands and brain ganglia) and two germline (ovarian nurse cells and testes) tissues of Drosophila melanogaster. Analysis of tissue and developmental expression of SU(VAR)3-9-bound genes indicates that in the somatic tissues tested, as well as in the ovarian nurse cells, SU(VAR)3-9 tends to associate with transcriptionally silent genes. In contrast, in the testes, SU(VAR)3-9 shows preferential association with testis-specific genes, and its binding appears dynamic during spermatogenesis. In somatic cells, the mere presence/absence of SU(VAR)3-9 binding correlates with lower/higher expression. No such correlation is found in the male germline. Interestingly, transcription units in piRNA clusters (particularly flanks thereof) are frequently targeted by SU(VAR)3-9, and Su(var)3-9 mutation affects the expression of select piRNA species. Our analyses suggest a context-dependent role of SU(VAR)3-9. In euchromatin, SU(VAR)3-9 may serve to fine-tune the expression of individual genes, whereas in heterochromatin, chromosome 4, and piRNA clusters, it may act more broadly over large chromatin domains.
Narita, Ayu; Izuno, Ayako; Komaki, Yoshiteru; Tanaka, Takefumi; Murata, Jin; Isagi, Yuji
2016-09-01
Microsatellite markers were identified for Melastoma tetramerum var. tetramerum (Melastomataceae), a critically endangered shrub endemic to the Bonin Islands, to reveal genetic characteristics in wild and restored populations. Using next-generation sequencing, 27 microsatellite markers were identified. Twenty of these markers were polymorphic in M. tetramerum var. tetramerum, with two to nine alleles per locus and expected heterozygosity ranging from 0.10 to 0.71. Among the 20 polymorphic markers, 15 were applicable to other closely related taxa, namely M. tetramerum var. pentapetalum, M. candidum var. candidum, and M. candidum var. alessandrense. These markers can be potentially useful to investigate the genetic diversity, population genetic structure, and reproductive ecology of M. tetramerum var. tetramerum as well as of the three related taxa to provide appropriate genetic information for conservation.
Abiotic and biotic degradation of oxo-biodegradable plastic bags by Pleurotus ostreatus.
Directory of Open Access Journals (Sweden)
José Maria Rodrigues da Luz
Full Text Available In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as substrates for P. ostreatus. We observed that physical treatment alone was not sufficient to initiate degradation. Instead, mechanical modifications and reduced titanium oxide (TiO2 concentrations caused by sunlight exposure triggered microbial degradation. The low specificity of lignocellulolytic enzymes and presence of endomycotic nitrogen-fixing microorganisms were also contributing factors in this process.
Abiotic and biotic degradation of oxo-biodegradable plastic bags by Pleurotus ostreatus.
da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Bazzolli, Denise Mara Soares; Tótola, Marcos Rogério; Demuner, Antônio Jacinto; Kasuya, Maria Catarina Megumi
2014-01-01
In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as substrates for P. ostreatus. We observed that physical treatment alone was not sufficient to initiate degradation. Instead, mechanical modifications and reduced titanium oxide (TiO2) concentrations caused by sunlight exposure triggered microbial degradation. The low specificity of lignocellulolytic enzymes and presence of endomycotic nitrogen-fixing microorganisms were also contributing factors in this process.
Abiotic and Biotic Degradation of Oxo-Biodegradable Plastic Bags by Pleurotus ostreatus
da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Bazzolli, Denise Mara Soares; Tótola, Marcos Rogério; Demuner, Antônio Jacinto; Kasuya, Maria Catarina Megumi
2014-01-01
In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as substrates for P. ostreatus. We observed that physical treatment alone was not sufficient to initiate degradation. Instead, mechanical modifications and reduced titanium oxide (TiO2) concentrations caused by sunlight exposure triggered microbial degradation. The low specificity of lignocellulolytic enzymes and presence of endomycotic nitrogen-fixing microorganisms were also contributing factors in this process. PMID:25419675
Semi-nonparametric VaR forecasts for hedge funds during the recent crisis
Del Brio, Esther B.; Mora-Valencia, Andrés; Perote, Javier
2014-05-01
The need to provide accurate value-at-risk (VaR) forecasting measures has triggered an important literature in econophysics. Although these accurate VaR models and methodologies are particularly demanded for hedge fund managers, there exist few articles specifically devoted to implement new techniques in hedge fund returns VaR forecasting. This article advances in these issues by comparing the performance of risk measures based on parametric distributions (the normal, Student’s t and skewed-t), semi-nonparametric (SNP) methodologies based on Gram-Charlier (GC) series and the extreme value theory (EVT) approach. Our results show that normal-, Student’s t- and Skewed t- based methodologies fail to forecast hedge fund VaR, whilst SNP and EVT approaches accurately success on it. We extend these results to the multivariate framework by providing an explicit formula for the GC copula and its density that encompasses the Gaussian copula and accounts for non-linear dependences. We show that the VaR obtained by the meta GC accurately captures portfolio risk and outperforms regulatory VaR estimates obtained through the meta Gaussian and Student’s t distributions.
Machado, Nelson Santana de Oliveira; Pereira, Flaviane Gomes; Santos, Paulo Roberto Dias dos; Costa, Cecília Gonçalves; Guimarães, Elsie Franklin
2015-01-01
This study showed anatomical differences related to Piper lepturumvar. lepturum and P. lepturum var. angustifolium species, sometimes considered varieties and in other cases synonyms. For histological analysis, fully expanded leaves were collected and for analysis by scanning electron microscope (SEM), fragments from the midrib were fixed on both leaf surfaces. The two species revealed differences in plant anatomy and it was observed that the stem of P. lepturum var. lepturum showed persisten...
Thies, Judy A; Ariss, Jennifer J; Kousik, Chandrasekar S; Hassell, Richard L; Levi, Amnon
2016-03-01
Southern root-knot nematode (RKN, Meloidogyne incognita) is a serious pest of cultivated watermelon (Citrullus lanatus var. lanatus) in southern regions of the United States and no resistance is known to exist in commercial watermelon cultivars. Wild watermelon relatives (Citrullus lanatus var. citroides) have been shown in greenhouse studies to possess varying degrees of resistance to RKN species. Experiments were conducted over 2 yr to assess resistance of southern RKN in C. lanatus var. citroides accessions from the U.S. Watermelon Plant Introduction Collection in an artificially infested field site at the U.S. Vegetable Laboratory in Charleston, SC. In the first study (2006), 19 accessions of C. lanatus var. citroides were compared with reference entries of Citrullus colocynthis and C. lanatus var. lanatus. Of the wild watermelon accessions, two entries exhibited significantly less galling than all other entries. Five of the best performing C. lanatus var. citroides accessions were evaluated with and without nematicide at the same field site in 2007. Citrullus lanatus var. citroides accessions performed better than C. lanatus var. lanatus and C. colocynthis. Overall, most entries of C. lanatus var. citroides performed similarly with and without nematicide treatment in regard to root galling, visible egg masses, vine vigor, and root mass. In both years of field evaluations, most C. lanatus var. citroides accessions showed lesser degrees of nematode reproduction and higher vigor and root mass than C. colocynthis and C. lanatus var. lanatus. The results of these two field evaluations suggest that wild watermelon populations may be useful sources of resistance to southern RKN.
ESTIMATING RISK ON THE CAPITAL MARKET WITH VaR METHOD
Directory of Open Access Journals (Sweden)
Sinisa Bogdan
2015-06-01
Full Text Available The two basic questions that every investor tries to answer before investment are questions about predicting return and risk. Risk and return are generally considered two positively correlated sizes, during the growth of risk it is expected increase of return to compensate the higher risk. The quantification of risk in the capital market represents the current topic since occurrence of securities. Together with estimated future returns it represents starting point of any investment. In this study it is described the history of the emergence of VaR methods, usefulness in assessing the risks of financial assets. Three main Value at Risk (VaR methodologies are decribed and explained in detail: historical method, parametric method and Monte Carlo method. After the theoretical review of VaR methods it is estimated risk of liquid stocks and portfolio from the Croatian capital market with historical and parametric VaR method, after which the results were compared and explained.
Comparison of historically simulated VaR: Evidence from oil prices
Energy Technology Data Exchange (ETDEWEB)
Costello, Alexandra [Seminole Canada Energy, Calgary, AB (Canada); Asem, Ebenezer; Gardner, Eldon [Faculty of Management, University of Lethbridge, Lethbridge, AB (Canada)
2008-09-15
Cabedo and Moya [Cabedo, J.D., Moya, I., 2003. Estimating oil price 'Value at Risk' using the historical simulation approach. Energy Economics 25, 239-253] find that ARMA with historical simulation delivers VaR forecasts that are superior to those from GARCH. We compare the ARMA with historical simulation to the semi-parametric GARCH model proposed by Barone-Adesi et al. [Barone-Adesi, G., Giannopoulos, K., Vosper, L., 1999. VaR without correlations for portfolios of derivative securities. Journal of Futures Markets 19 (5), 583-602]. The results suggest that the semi-parametric GARCH model generates VaR forecasts that are superior to the VaR forecasts from the ARMA with historical simulation. This is due to the fact that GARCH captures volatility clustering. Our findings suggest that Cabedo and Moya's conclusion is mainly driven by the normal distributional assumption imposed on the future risk structure in the GARCH model. (author)
Directory of Open Access Journals (Sweden)
Rodolfo Devera
2015-11-01
Full Text Available Between may and july 2010 a study was performed in order to determine the prevalence of Strongyloides stercoralis and other intestinal parasites in alcoholic homeless who attend two Alcoholics Anonymous Centers in Ciudad Bolívar, Bolívar State, Venezuela. Eighty stool samples were collected, which were analyzed using the techniques of direct examination, Kato, micro-Baermann, Rugai and agar plate culture. An estimate of 61.3% of the evaluated population was parasitized. The intestinal parasite most prevalent was the chromist Blastocystis (33.8%. Among the protozoan, the most common was Endolimax nana (21.3% and among the helminths it was Strongyloides stercoralis (12.5%.
EFFECTS OF MONETARY POLICY IN ROMANIA - A VAR APPROACH
Directory of Open Access Journals (Sweden)
Iulian Popescu
2012-10-01
Full Text Available Understanding how monetary policy decisions affect inflation and other economic variables is particularly important. In this paper we consider the implications of monetary policy under the inflation targeting regime in Romania, based on an autoregressive vector method including recursive VAR and structural VAR (SVAR. Therefore, we focus on assessing the extent and persistence of monetary policy effects on gross domestic product (GDP, price level, extended monetary aggregate (M3 and exchange rate. The main results of VAR analysis reflect a negative response of consumer price index (CPI, GDP and M3 and positive nominal exchange rate behaviour to a monetary policy shock, and also a limited impact of a short-term interest rate shock in explaining the consumer prices, production and exchange rate fluctuations.
Directory of Open Access Journals (Sweden)
Ceci Sales-Campos
2009-12-01
Full Text Available Os cogumelos do gênero Pleurotus são cultivados em diversos substratos lignocelulósicos, dada a atividade decompositora desses organismos proveniente de seu metabolismo enzimático. O presente estudo teve como objetivo analisar a composição mineral de Pleurotus ostreatus e dos substratos de cultivo preparados à base de resíduos madeireiros e agroindustriais da região amazônica. Foram analisados macro (P, K, Ca e Mg e micronutrientes (Fe, Zn, Cu, Mn e Na dos cogumelos e dos substratos. Os substratos foram formulados a partir da serragem de Simarouba amara Aubl. (marupá, Ochroma piramidale Cav. ex. Lam. (pau de balsa e de bagaços de Bactris gasipaes Kunth (pupunheira e de Saccharum officinarum (cana-de-açúcar. As amostras foram solubilizadas mediante digestão ácida (nítrico-peridrol. Os elementos Ca, Mg, Fe, Cu, Zn e Mn foram determinados por espectrometria de absorção atômica; o Na e K, por emissão atômica e o P, por colorimetria. A composição mineral do cogumelo variou com o substrato de cultivo. Os diferentes substratos possibilitaram a produção de um cogumelo rico em K, P, Mg e Fe, essenciais à nutrição e à saúde humana. O potássio foi o mineral de maior teor no cogumelo em todos os substratos testados (36,83-42,18 g.kg-1, seguido de fósforo (6,95-10,60 g.kg-1 e do magnésio (1,57-2,50 g.kg-1.Mushrooms belonging to the Pleurotus gender are grown in several lignocellulosic substrates due to the decomposing activity of these organisms that result from their enzymatic metabolism. The objective of the present study was to analyze the mineral composition of Pleurotus ostreatus and the cultivation substrates prepared with wood and agroindustrial residues from the Amazon region. Macro (P, K, Ca and Mg and micronutrients (Fe, Zn, Cu, Mn and Na of mushroom and substrates were analyzed. Substrates were formulated from Simarouba amara Aubl. and Ochroma piramidale Cav. ex. Lam. sawdust and crushed Bactris gasipaes Kunth
Da abort ikke var en sag for kvinden
DEFF Research Database (Denmark)
Schultz, Annette Østergaard
2013-01-01
Case fra tiden før 1973, hvor der ikke var fri abort i Danmark. Sagen er fundet i Mødrehjælpens arkiv og giver som andre sager indblik i kvindens situation. Led i serien: Nyt i arkivet.......Case fra tiden før 1973, hvor der ikke var fri abort i Danmark. Sagen er fundet i Mødrehjælpens arkiv og giver som andre sager indblik i kvindens situation. Led i serien: Nyt i arkivet....
Optimizing expression of the pregnancy malaria vaccine candidate, VAR2CSA in Pichia pastoris.
Avril, Marion; Hathaway, Marianne J; Cartwright, Megan M; Gose, Severin O; Narum, David L; Smith, Joseph D
2009-06-29
VAR2CSA is the main candidate for a vaccine against pregnancy-associated malaria, but vaccine development is complicated by the large size and complex disulfide bonding pattern of the protein. Recent X-ray crystallographic information suggests that domain boundaries of VAR2CSA Duffy binding-like (DBL) domains may be larger than previously predicted and include two additional cysteine residues. This study investigated whether longer constructs would improve VAR2CSA recombinant protein secretion from Pichia pastoris and if domain boundaries were applicable across different VAR2CSA alleles. VAR2CSA sequences were bioinformatically analysed to identify the predicted C11 and C12 cysteine residues at the C-termini of DBL domains and revised N- and C-termimal domain boundaries were predicted in VAR2CSA. Multiple construct boundaries were systematically evaluated for protein secretion in P. pastoris and secreted proteins were tested as immunogens. From a total of 42 different VAR2CSA constructs, 15 proteins (36%) were secreted. Longer construct boundaries, including the predicted C11 and C12 cysteine residues, generally improved expression of poorly or non-secreted domains and permitted expression of all six VAR2CSA DBL domains. However, protein secretion was still highly empiric and affected by subtle differences in domain boundaries and allelic variation between VAR2CSA sequences. Eleven of the secreted proteins were used to immunize rabbits. Antibodies reacted with CSA-binding infected erythrocytes, indicating that P. pastoris recombinant proteins possessed native protein epitopes. These findings strengthen emerging data for a revision of DBL domain boundaries in var-encoded proteins and may facilitate pregnancy malaria vaccine development.
Optimizing expression of the pregnancy malaria vaccine candidate, VAR2CSA in Pichia pastoris
Directory of Open Access Journals (Sweden)
Narum David L
2009-06-01
Full Text Available Abstract Background VAR2CSA is the main candidate for a vaccine against pregnancy-associated malaria, but vaccine development is complicated by the large size and complex disulfide bonding pattern of the protein. Recent X-ray crystallographic information suggests that domain boundaries of VAR2CSA Duffy binding-like (DBL domains may be larger than previously predicted and include two additional cysteine residues. This study investigated whether longer constructs would improve VAR2CSA recombinant protein secretion from Pichia pastoris and if domain boundaries were applicable across different VAR2CSA alleles. Methods VAR2CSA sequences were bioinformatically analysed to identify the predicted C11 and C12 cysteine residues at the C-termini of DBL domains and revised N- and C-termimal domain boundaries were predicted in VAR2CSA. Multiple construct boundaries were systematically evaluated for protein secretion in P. pastoris and secreted proteins were tested as immunogens. Results From a total of 42 different VAR2CSA constructs, 15 proteins (36% were secreted. Longer construct boundaries, including the predicted C11 and C12 cysteine residues, generally improved expression of poorly or non-secreted domains and permitted expression of all six VAR2CSA DBL domains. However, protein secretion was still highly empiric and affected by subtle differences in domain boundaries and allelic variation between VAR2CSA sequences. Eleven of the secreted proteins were used to immunize rabbits. Antibodies reacted with CSA-binding infected erythrocytes, indicating that P. pastoris recombinant proteins possessed native protein epitopes. Conclusion These findings strengthen emerging data for a revision of DBL domain boundaries in var-encoded proteins and may facilitate pregnancy malaria vaccine development.
Waarnemingen aan Equisetum arvense L. var. serotinum F.W. Meyer
Hoek, van L.
1978-01-01
Observations during six successive years in a cultivated clone of Equisetum arvense L. var. serotinum F. W. Meyer made it possible to study various types of fertile, sterile, and homophyadic stems developing in this clone. As E. arvense var. varium Milde, E. arvense f. sanguineum Luerss., and E.
Een nieuwe naam voor Arenaria serpyllifolia L. var. macrocarpa Lloyd
Gutermann, W.; Mennema, J.
1983-01-01
The name Arenaria serpyllifoiia L. var. macrocarpa Lloyd is illegitimate, because of the existence of the earlier non-synonymous A. serpyllifolia0 macrocarpa Godron. As on the level of variety no other name is available, we call the taxon A renaria serpylli/olia L. var. Iloydn (Jord.) Gutermann et
Optimization of Arundo donax Saccharification by (Hemicellulolytic Enzymes from Pleurotus ostreatus
Directory of Open Access Journals (Sweden)
Rossana Liguori
2015-01-01
Full Text Available An enzymatic mixture of cellulases and xylanases was produced by Pleurotus ostreatus using microcrystalline cellulose as inducer, partially characterized and tested in the statistical analysis of Arundo donax bioconversion. The Plackett-Burman screening design was applied to identify the most significant parameters for the enzymatic hydrolysis of pretreated A. donax. As the most significant influence during the enzymatic hydrolysis of A. donax was exercised by the temperature (°C, pH, and time, the combined effect of these factors in the bioconversion by P. ostreatus cellulase and xylanase was analyzed by a 33 factorial experimental design. It is worth noting that the best result of 480.10 mg of sugars/gds, obtained at 45°C, pH 3.5, and 96 hours of incubation, was significant also when compared with the results previously reached by process optimization with commercial enzymes.
International Nuclear Information System (INIS)
Darewych, J.W.
1997-01-01
The complex scalar (Klein-Gordon) quantum field theory (QFT) with a λ(var-phi * var-phi) 2 interaction is considered in the Feshbach-Villars formulation. It is shown that exact few-particle eigenstates of the QFT Hamiltonian can be obtained. The resulting relativistic few-body equations correspond to Klein-Gordon particles interacting via delta-function, or open-quotes contact,close quotes potentials. Momentum-space solutions of the two-body equation yield a open-quotes trivialclose quotes unity S matrix. copyright 1997 The American Physical Society
Phyllactinia mali and Podosphaera tridactyla var. tridactyla – new hosts of Ampelomyces quisqualis
Directory of Open Access Journals (Sweden)
Beata Czerniawska
2014-08-01
Full Text Available In 2002, the occurrence of fungi of the order Erysiphales on plants of the Słowiański Park located in Goorzów Wielkopolski was investigated. Plant samples were collected once a month, from August to November. The samples examined were above ground plant parts colonized by powdery mildew fungi. A total of 78 samples were collected. Apart from 14 species of the order Erysiphales, Ampelomyces quisqualis parasitizing on Erysiphe cichoracearum var. cichoracearum, Phyllactinia mali and Podosphaera tridactyl var. tridactyla was found. Ampelomyces quisqualis affected hyphae, oidia, and young cleistothecia of P. mali. In contrast, in E. cichoracearum var. cichoracearum, Po. tridactyle var. tridactyla, this hyperparasite colonized only hyphae and oidia. This paper for the first trime informs of A. quisqualis parasitizing on P. mali and Po. tridactyla var. tridactyla.
"Var Teatre"--A Pioneer Turns 40.
Jones, Pamela L.
1984-01-01
Describes the Stockholm Municipal Youth and Children's theatre ("Var Teatre"), an institution of 14 theatres and attendant professional staff devoted exclusively to drama activities for children and teenagers. (PD)
Directory of Open Access Journals (Sweden)
Paula Fernanda Bomfim Oliveira Cogorni
2014-06-01
Full Text Available The aim of this study was to evaluate of Pleurotus sajor-caju production in peach palm leaves and the addition of different fractions of mushroom powder to wheat flour to increase its nutritional value without changing its characteristics. The best yield (48.4%, biologic efficiency (4.5%, and Pr (0.36 g/day values were obtained using 20% inoculum fraction and 10% rice bran fraction. The Pleurotus sajor-caju fruiting body cultivated under these conditions had the following composition in 100 g: 29.91 g (carbohydrates, 42.92 g (proteins, 1.24 g (lipids, 15.93 g (fibers, 7.42 g (ashes, 1.6 g (phosphorus, 2.7 g (potassium, 8.73 mg (iron, 23.75 mg (sodium, 0.34 mg (thiamine, and 0.57 mg (riboflavin. The wheat flour with mushroom powder had reduced sugar content, but it did not have increased fat content. The fiber, protein, phosphorus, potassium, iron, and riboflavin contents were increased mainly when 10% mushroom powder was added to the wheat flour. Furthermore, this flour does not undergo drastic alterations in its physicochemical characteristics such as in moisture, wet gluten, color, and falling number.
Somatic Embryogenesis in Olive (Olea europaea L. subsp. europaea var. sativa and var. sylvestris).
Rugini, Eddo; Silvestri, Cristian
2016-01-01
Protocols for olive somatic embryogenesis from zygotic embryos and mature tissues have been described for both Olea europaea sub. europaea var. sativa and var. sylvestris. Immature zygotic embryos (no more than 75 days old), used after fruit collection or stored at 12-14 °C for 2-3 months, are the best responsive explants and very slightly genotype dependent, and one single protocol can be effective for a wide range of genotypes. On the contrary, protocols for mature zygotic embryos and for mature tissue of cultivars are often genotype specific, so that they may require many adjustments according to genotypes. The use of thidiazuron and cefotaxime seems to be an important trigger for induction phase particularly for tissues derived from cultivars. Up to now, however, the application of this technique for large-scale propagation is hampered also by the low rate of embryo germination; it proves nonetheless very useful for genetic improvement.
VAR Portfolio Optimal: Perbandingan Antara Metode Markowitz dan Mean Absolute Deviation
Directory of Open Access Journals (Sweden)
R. Agus Sartono
2009-05-01
Full Text Available Portfolio selection method which have been introduced by Harry Markowitz (1952 used variance or deviation standard as a measure of risk. Kanno and Yamazaki (1991 introduced another method and used mean absolute deviation as a measure of risk instead of variance. The Value-at Risk (VaR is a relatively new method to capitalized risk that been used by financial institutions. The aim of this research is compare between mean variance and mean absolute deviation of two portfolios. Next, we attempt to assess the VaR of two portfolios using delta normal method and historical simulation. We use the secondary data from the Jakarta Stock Exchange – LQ45 during 2003. We find that there is a weak-positive correlation between deviation standard and return in both portfolios. The VaR nolmal delta based on mean absolute deviation method eventually is higher than the VaR normal delta based on mean variance method. However, based on the historical simulation the VaR of two methods is statistically insignificant. Thus, the deviation standard is sufficient measures of portfolio risk.Keywords: optimalisasi portofolio, mean-variance, mean-absolute deviation, value-at-risk, metode delta normal, metode simulasi historis
Directory of Open Access Journals (Sweden)
NATALIA LIZETTE CASTAÑO
2012-12-01
Full Text Available En la elaboración de la panela, entre el 40 y 54% es bagazo, el cual se caracteriza portener baja proteína y energía, altos compuestos lignocelulósicos, acompañado de una baja digestibilidad, por ello, tradicionalmente ha sido utilizado como combustiblepara las hornillas. El presente trabajo, evaluó el uso del bagazo enriquecido con el hongo Pleurotus ostreatus, como suplemento en dietas para bovinos, frente a otros tratamientos con y sin suplementación comercial. A todos los animales se les suministró una dieta balanceada que consistía en 18 Kg de pasto king grass (Saccharum sinense, 6 Kg de caña (Saccharum officinarum, 3 Kg de cogollo de caña (Saccharum officinarum, 3 Kg de gallinaza y 0,6 Kg de miel de panela, y suplemento ofrecido ad libitum a los tratamientos que lo requerían. Se analizaron las variables ganancia diaria de peso, conversión alimenticia, consumo de materiaseca y el efecto costo beneficio de la suplementación. No se presentaron diferencias significativas (PNa elaboração da rapadura, entre o 40% e 54% é bagaço, o qual se caracteriza por ter baixa proteína e energia, alto composto lignocelulósicos, acompanhado por uma baixa digestibilidade, portanto, tradicionalmente tem sido usado como combustível para os queimadores. Este trabalho avaliou o uso do bagaço enriquecido com o fungo Pleurotus ostreatus como suplemento em dietas para bovinos, comparado com outros tratamentos com e sem suplementação comercial. Aos animais todos foi subministrado uma dieta equilibrada que consistia de 18 Kg de grama king grass (Saccharum sinense, 6 Kg de cana (Saccharum officinarum, 3 Kg de broto de cana (Saccharum officinarum, 3 Kg de estrume e 0,6 Kg de mel de rapadura e suplemento oferecido ad libitum aos tratamentos que o requeiram. Analisaram-se as variáveis: ganho diário de peso, conversão alimentar e consumo de matéria seca e o efeito de custo benefício da suplementação. Não apresentaram diferen
[Use of ITS and ISSR markers in the molecular characterisation of Pleurotus djamor hybrid strains].
Aguilar Doroteo, Leticia; Zárate Segura, Paola Berenice; Villanueva Arce, Ramón; Yáñez Fernández, Jorge; Garín Aguilar, María Eugenia; Guadarrama Mendoza, Paula Cecilia; Valencia Del Toro, Gustavo
Molecular characterisation of wild type Pleurotus species is important for germplasm conservation and its further use for genetic improvement. No molecular studies have been performed with monokaryons used for producing hybrid strains, either with the reconstituted strains obtained by pairing those monokaryons. The molecular characterisation of parental dikaryons, hybrid, and reconstituted strains as well as monokaryotic strains, is therefore of utmost importance. To carry out the molecular identification of Pleurotus djamor strains, i.e. dikaryotic wild type strains, hybrid strains, and the monokaryotic strains used for the hybrid formation. Five wild type strains of P. djamor from different states in Mexico were collected and molecularly identified by sequencing the ITS1-5.8-ITS2 region using ITS1 and ITS4 universal oligonucleotides. Four hybrid strains were obtained by pairing neohaplonts of two wild type strains selected. Six ISSR markers were used for the molecular characterisation of monokaryotic and dikaryotic strains. Using the ITS markers, an amplified product of 700bp was obtained in five wild type strains, with a 99-100% similarity with P. djamor. A total of 95 fragments were obtained using the ISSR markers, with 99% of polymorphism. Wild type strains were identified as P. djamor, and were clearly grouped with Mexican strains from other states of Mexico. ISSR markers allowed the generation of polymorphic bands in monokaryotic and dikaryotic strains, splitting both types of strains. The high degree of polymorphism indicates the genetic diversity of P. djamor, an advantage in mushroom production and in the improving of the species. Copyright © 2017 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.
Efficient transformation and expression of gfp gene in Valsa mali var. mali.
Chen, Liang; Sun, Gengwu; Wu, Shujing; Liu, Huixiang; Wang, Hongkai
2015-01-01
Valsa mali var. mali, the causal agent of valsa canker of apple, causes great loss of apple production in apple producing regions. The pathogenic mechanism of the pathogen has not been studied extensively, thus a suitable gene marker for pathogenic invasion analysis and a random insertion of T-DNA for mutants are desirable. In this paper, we reported the construction of a binary vector pKO1-HPH containing a positive selective gene hygromycin phosphotransferase (hph), a reporter gene gfp conferring green fluorescent protein, and an efficient protocol for V. mali var. mali transformation mediated by Agrobacterium tumefaciens. A transformation efficiency up to about 75 transformants per 10(5) conidia was achieved when co-cultivation of V. mali var. mali and A. tumefaciens for 48 h in A. tumefaciens inductive medium agar plates. The insertions of hph gene and gfp gene into V. mali var. mali genome verified by polymerase chain reaction and southern blot analysis showed that 10 randomly-selected transformants exhibited a single, unique hybridization pattern. This is the first report of A. tumefaciens-mediated transformation of V. mali var mali carrying a 'reporter' gfp gene that stably and efficiently expressed in the transformed V. mali var. mali species.
Dynamics of anti-VAR2CSA immunoglobulin G response in a cohort of senegalese pregnant women
DEFF Research Database (Denmark)
Tuikue Ndam, N G; Salanti, A; Le-Hesran, J-Y
2006-01-01
demonstrated that a single P. falciparum infection was able to trigger a VAR2CSA-specific antibody response. Among women with infected placentas, women with high anti-VAR2CSA IgG levels at enrollment were more likely to present with a past infection than with an acute/chronic infection. CONCLUSIONS: Anti-VAR2...... (VSAPAM). Several studies have shown that 1 var gene, var2csa, is transcribed at high levels and expressed in CSA-binding Plasmodium falciparum parasites. METHODS: Plasma levels of anti-VAR2CSA immunoglobulin G (IgG) in Senegalese women were measured during pregnancy by enzyme-linked immunosorbent assay......, using 3 recombinant proteins representing 3 domains of the var2csa gene product. RESULTS: The 3 recombinant proteins were specifically recognized by plasma from pregnant women but not by control plasma. A parity-dependent recognition pattern was observed with 2 of the 3 VAR2CSA antigens. A kinetic study...
Dechavanne, Sebastien; Sousa, Patrícia M.; Barateiro, André; Cunha, Sónia F.; Nunes-Silva, Sofia; Lima, Flávia A.; Murillo, Oscar; Marinho, Claudio R. F.; Gangnard, Stephane; Srivastava, Anand; Braks, Joanna A.; Janse, Chris J.; Gamain, Benoit; Penha-Gonçalves, Carlos
2016-01-01
Plasmodium falciparum infection during pregnancy leads to abortions, stillbirth, low birth weight, and maternal mortality. Infected erythrocytes (IEs) accumulate in the placenta by adhering to chondroitin sulfate A (CSA) via var2CSA protein exposed on the P. falciparum IE membrane. Plasmodium berghei IE infection in pregnant BALB/c mice is a model for severe placental malaria (PM). Here, we describe a transgenic P. berghei parasite expressing the full-length var2CSA extracellular region (domains DBL1X to DBL6ε) fused to a P. berghei exported protein (EMAP1) and characterize a var2CSA-based mouse model of PM. BALB/c mice were infected at midgestation with different doses of P. berghei-var2CSA (P. berghei-VAR) or P. berghei wild-type IEs. Infection with 104 P. berghei-VAR IEs induced a higher incidence of stillbirth and lower fetal weight than P. berghei. At doses of 105 and 106 IEs, P. berghei-VAR-infected mice showed increased maternal mortality during pregnancy and fetal loss, respectively. Parasite loads in infected placentas were similar between parasite lines despite differences in maternal outcomes. Fetal weight loss normalized for parasitemia was higher in P. berghei-VAR-infected mice than in P. berghei-infected mice. In vitro assays showed that higher numbers of P. berghei-VAR IEs than P. berghei IEs adhered to placental tissue. Immunization of mice with P. berghei-VAR elicited IgG antibodies reactive to DBL1-6 recombinant protein, indicating that the topology of immunogenic epitopes is maintained between DBL1-6–EMAP1 on P. berghei-VAR and recombinant DBL1-6 (recDBL1-6). Our data suggested that impairments in pregnancy caused by P. berghei-VAR infection were attributable to var2CSA expression. This model provides a tool for preclinical evaluation of protection against PM induced by approaches that target var2CSA. PMID:27045035
Fast Responding Voltage Regulator and Dynamic VAR Compensator
Energy Technology Data Exchange (ETDEWEB)
Divan, Deepak [Varentec, Incorporated, San Jose, CA (United States); Moghe, Rohit [Varentec, Incorporated, San Jose, CA (United States); Tholomier, Damien [Varentec, Incorporated, San Jose, CA (United States)
2014-12-31
The objectives of this project were to develop a dynamic VAR compensator (DVC) for voltage regulation through VAR support to demonstrate the ability to achieve greater levels of voltage control on electricity distribution networks, and faster response compared to existing grid technology. The goal of the project was to develop a prototype Fast Dynamic VAR Compensator (Fast DVC) hardware device, and this was achieved. In addition to developing the dynamic VAR compensator device, Varentec in partnership with researchers at North Carolina State University (NCSU) successfully met the objectives to model the potential positive impact of such DVCs on representative power networks. This modeling activity validated the ability of distributed dynamic VAR compensators to provide fast voltage regulation and reactive power control required to respond to grid disturbances under high penetration of fluctuating and intermittent distributed energy resources (DERs) through extensive simulation studies. Specifically the following tasks were set to be accomplished: 1) Development of dynamic VAR compensator to support dynamic voltage variations on the grid through VAR control 2) Extensive testing of the DVC in the lab environment 3) Present the operational DVC device to the DOE at Varentec’s lab 4) Formulation of a detailed specification sheet, unit assembly document, test setup document, unit bring-up plan, and test plan 5) Extensive simulations of the DVC in a system with high PV penetration. Understanding the operation with many DVC on a single distribution system 6) Creation and submittal of quarterly and final reports conveying the design documents, unit performance data, modeling simulation charts and diagrams, and summary explanations of the satisfaction of program goals. This report details the various efforts that led to the development of the Fast DVC as well as the modeling & simulation results. The report begins with the introduction in Section II which outlines the
Saccharomyces cerevisiae var. boulardii fungemia following probiotic treatment
Directory of Open Access Journals (Sweden)
Marcelo C. Appel-da-Silva
2017-12-01
Full Text Available Probiotics are commonly prescribed as an adjuvant in the treatment of antibiotic-associated diarrhea caused by Clostridium difficile. We report the case of an immunocompromised 73-year-old patient on chemotherapy who developed Saccharomyces cerevisiae var. boulardii fungemia in a central venous catheter during treatment of antibiotic-associated pseudomembranous colitis with the probiotic Saccharomyces cerevisiae var. boulardii. Fungemia was resolved after interruption of probiotic administration without the need to replace the central venous line. Keywords: Saccharomyces, Probiotics, Fungemia, Critical illness, Clostridium difficile
Lignin depolymerization by fungal secretomes and a microbial sink
Energy Technology Data Exchange (ETDEWEB)
Salvachúa, Davinia; Katahira, Rui; Cleveland, Nicholas S.; Khanna, Payal; Resch, Michael G.; Black, Brenna A.; Purvine, Samuel O.; Zink, Erika M.; Prieto, Alicia; Martínez, María J.; Martínez, Angel T.; Simmons, Blake A.; Gladden, John M.; Beckham, Gregg T.
2016-08-25
In Nature, powerful oxidative enzymes secreted by white rot fungi and some bacteria catalyze lignin depolymerization and some microbes are able to catabolize the resulting aromatic compounds as carbon and energy sources. Taken together, these two processes offer a potential route for microbial valorization of lignin. However, many challenges remain in realizing this concept, including that oxidative enzymes responsible for lignin depolymerization also catalyze polymerization of low molecular weight (LMW) lignin. Here, multiple basidiomycete secretomes were screened for ligninolytic enzyme activities in the presence of a residual lignin solid stream from a corn stover biorefinery, dubbed DMR-EH (Deacetylation, Mechanical Refining, and Enzymatic Hydrolysis) lignin. Two selected fungal secretomes, with high levels of laccases and peroxidases, were utilized for DMR-EH lignin depolymerization assays. The secretome from Pleurotus eryngii, which exhibited the highest laccase activity, reduced the lignin average molecular weight by 63% and 75% at pH 7 compared to the Mw of the control treated at the same conditions and the initial DMR-EH lignin, respectively, and was applied in further depolymerization assays as a function of time. As repolymerization was observed after 3 days of incubation, an aromatic-catabolic microbe (Pseudomonas putida KT2440) was incubated with the fungal secretome and DMR-EH lignin. These experiments demonstrated that the presence of the bacterium enhances lignin depolymerization, likely due to bacterial catabolism of LMW lignin, which may partially prevent repolymerization. In addition, proteomics was also applied to the P. eryngii secretome to identify the enzymes present in the fungal cocktail utilized for the depolymerization assays, which highlighted a significant number of glucose/ methanol/choline (GMC) oxidoreductases and laccases. Overall, this study demonstrates that ligninolytic enzymes can be used to partially depolymerize a solid, high
Directory of Open Access Journals (Sweden)
Senzosenkosi Surprise MKHIZE
2017-10-01
Full Text Available Abstract The use of supplemented agricultural waste in mushroom cultivation can be one of the environmentally friendly strategies for poverty alleviation. The study evaluated the performance of Pleurotus pulmonarius mushroom grown on maize stalk supplemented with varying levels of wheat bran (WB and maize flour (MF. A completely random design was used for the experiments. It was observed that Pleurotus pulmonarius was significantly affected by varying levels of supplementation, as 20% WB supplementation encountered higher contamination. The lower supplementation levels gave significantly shorter colonisation period with better mycelial growth rate (MGR. The 2% MF, 2% WB and 4% WB gave significantly higher MGR and faster colonisation. The shortest pinning time (TP was observed at the first flush with the minimum of 2 days. Higher supplementation levels gave maximum yield and biological efficiency (BE. With further increase of supplementation above a 12% WB and 14% MF, the BE and yield declined. Lower supplementation levels resulted in quicker colonisation period and improved growth rate, whereas high supplementation gave better production in terms of yield and BE. Therefore, for the purpose of maximum production, 12% WB and 14% MF may be recommended while for fast production time, 2% MF and 2% WB are recommended.
Directory of Open Access Journals (Sweden)
Senzosenkosi Surprise MKHIZE
Full Text Available Abstract Improving the performance of mushroom in terms of high production and fast growth rate is essential in mushroom cultivation. In the present study the performance of Pleurotus ostreatus was evaluated using varying levels of wheat bran (WB and maize flour (MF. The results indicated that Pleurotus ostreatus was highly influenced by different levels of supplementation, with 8% WB, 18% WB and 2% MF having higher contamination rate. The low levels of supplementation gave significantly better mycelial growth rate (MGR and shorter colonisation period as observed that the control had highest MGR whereby 20% MF had lowest MGR. The pinning time (TP was shortest at the first flush with minimum of 3 days (12% MF. The higher levels of supplementation showed maximum biological efficiency (BE such as 14% MF, 12% WB and 14% WB. The yield was also higher at high levels of supplementation such as 20% MF and 8% MF being the exception in the lower levels. Based on the results it was observed that for fast production of oyster mushroom there is no need to supplement the maize stalk substrate but for improved productivity supplements can be added up to certain limits such as 14% MF and 12 WB.
Directory of Open Access Journals (Sweden)
Beatriz Vaz de Melo Mendes
2005-12-01
Full Text Available It is now widespread the use of Value-at-Risk (VaR as a canonical measure at risk. Most accurate VaR measures make use of some volatility model such as GARCH-type models. However, the pattern of volatility dynamic of a portfolio follows from the (univariate behavior of the risk assets, as well as from the type and strength of the associations among them. Moreover, the dependence structure among the components may change conditionally t past observations. Some papers have attempted to model this characteristic by assuming a multivariate GARCH model, or by considering the conditional correlation coefficient, or by incorporating some possibility for switches in regimes. In this paper we address this problem using time-varying copulas. Our modeling strategy allows for the margins to follow some FIGARCH type model while the copula dependence structure changes over time.
MODEL NON LINIER GARCH (NGARCH UNTUK MENGESTIMASI NILAI VALUE at RISK (VaR PADA IHSG
Directory of Open Access Journals (Sweden)
I KOMANG TRY BAYU MAHENDRA
2015-06-01
Full Text Available In investment, risk measurement is important. One of risk measure is Value at Risk (VaR. There are many methods that can be used to estimate risk based on VaR framework. One of them Non Linier GARCH (NGARCH model. In this research, determination of VaR used NGARCH model. NGARCH model allowed for asymetric behaviour in the volatility such that “good news” or positive return and “bad news” or negative return. Based on calculations of VaR, the higher of the confidence level and the longer the investment period, the risk was greater. Determination of VaR using NGARCH model was less than GARCH model.
Yu, Xiao-Dan; Jiang, Chao; Huang, Lu-Qi; Qin, Shuang-Shuang; Zeng, Xiang-Mei; Chen, Ping; Yuan, Yuan
2013-08-01
To clone SABATH methyltransferase (rLjSABATHMT) gene in Lonicera japonica var. chinensis, and compare the gene expression and intron sequence of SABATH methyltransferase orthologous in L. japonica with L. japonica var. chinensis. It provide a basis for gene regulate the formation of L. japonica floral scents. The cDNA and genome sequences of LjSABATHMT from L. japonica var. chinensis were cloned according to the gene fragments in cDNA library. The LjSABATHMT protein was characterized by bioinformatics analysis. SABATH family phylogenetic tree were built by MEGA 5.0. The transcripted level of SABATHMT orthologous were analyzed in different organs and different flower periods of L. japonica and L. japonica var. chinensis using RT-PCR analysis. Intron sequences of SABATHMT orthologous were also analyzied. The cDNA of LjSABATHMT was 1 251 bp, had a complete coding frame with 365 amino acids. The protein had the conservative SABATHMT domain, and phylogenetic tree showed that it may be a salicylic acid/benzoic acid methyltransferase. Higher expression of SABATH methyltransferase orthologous was found in flower. The intron sequence of L. japonica and L. japonica var. chinensis had rich polymorphism, and two SNP are unique genotype of L. japonica var. chinensis. The motif elements in two orthologous genes were significant differences. The intron difference of SABATH methyltransferase orthologous could be inducing to difference of gene expression between L. japonica and L. japonica var. chinensis. These results will provide important base on regulating active compounds of L. japonica.
A hybrid PSO technique for procuring VAR ancillary service in the deregulated electricity markets
Energy Technology Data Exchange (ETDEWEB)
El-Araby, E.E. [Department of Electrical Engineering, Suez Canal University (Egypt); Yorino, Naoto [Department of Artificial Complex Systems Engineering, Hiroshima University (Japan)
2010-07-15
This paper develops a new market-based technique for acquiring VAR ancillary service in the electricity market. The main objective of the developed market is to enable transmission operator ''TO'' to procure VAR service in a long term contract from the critical VAR providers that satisfy minimum VAR service payment while maintaining system security. Reactive power control problem for voltage stability is introduced into the VAR market problem in an explicit manner for normal and emergency states. An integration of particle swarm optimization ''PSO'' is presented with successive linear programming ''SLP'' for dealing with the VAR ancillary service problem. The problem is formulated as a large-scale nonlinear constrained optimization problem with a non-differentiable objective function representing VAR payment and operational costs. This type of problem is hard to be treated straightforwardly by the classical optimization methods. Therefore, we propose here a two-layer hybrid PSO/SLP approach, which is suited for carrying out the difficulties associated with non-differentiable and discontinuous objective functions. The proposed method has been examined on the standard IEEE 57 bus-system and compared with GA/SLP method to demonstrate its capability. (author)
Directory of Open Access Journals (Sweden)
Clenderson Corradi de Mattos Gonçalves
2010-02-01
Full Text Available O resíduo proveniente do beneficiamento do algodão em lixadeiras na indústria têxtil é um material rico em lignocelulose, tem baixa digestibilidade e é pobre em proteínas e minerais, o que dificulta seu uso 'in natura' na alimentação de ruminantes. Neste tarbalho, objetivou-se avaliar a produtividade e eficiência biológica deste resíduo de algodão na produção do cogumelo comestível Pleurotus sajor-caju e avaliar as alterações promovidas no resíduo para alimentação de ruminantes. Foram realizados 5 tratamentos: T1- 80% de serragem de eucalipto + 20% de farelo de trigo (testemunha; T2- 50% de resíduo de algodão + 50% de serragem; T3- 45% de resíduo + 45% serragem + 10% de farelo; T4- 40% de resíduo + 40% serragem + 20% de farelo e T5- 80% de resíduo + 20% de farelo. O T5 apresentou os melhores resultados para produtividade (22,46% e eficiência biológica (71,48% do Pleurotus sajor-caju. O fungo alterou a constituição dos substratos nos estágios de produção do cogumelo, principalmente os constituintes da fibra e agregou N ao substrato. Dessa forma, o uso do resíduo de lixadeira de algodão no cultivo de Pleurotus sajor-caju pode se tornar uma alternativa viável para produção de cogumelo e melhorar a qualidade deste resíduo para alimentação animal.The waste coming from cotton processing in mills in the textile industry is a lignocellulose-rich material, but has low digestibility, and is poor in proteins and minerals, making it inappropriate for ruminant feeding. This study was intended to evaluate the productivity and biologic efficiency of cotton textile mill waste in the production of the edible mushroom Pleurotus sajor-caju, and to evaluate the alterations brought about in the waste for use in ruminant feeding. Five treatments were undertaken in the following manner: T1- 80% eucalyptus sawdust + 20% wheat bran (control; T2- 50% waste + 50% sawdust; T3- 45% waste + 45% sawdust + 10% wheat bran; T4- 40% waste
Yorifuji, Eri; Ishikawa, Naoko; Okada, Hiroshi; Tsukaya, Hirokazu
2015-03-01
Morphological and molecular variation between Arundina graminifolia var. graminifolia and the dwarf variety, A. graminifolia var. revoluta, was examined to assess the validity of their taxonomic characteristics and genetic background for identification. Morphological analysis in combination with field observations indicated that A. graminifolia var. revoluta is a rheophyte form of A. graminifolia characterized by narrow leaves, whereas the other morphological characteristics described for A. graminifolia var. revoluta, such as smaller flowers and short stems, were not always accompanied by the narrower leaf phenotype. Molecular analysis based on matK sequences indicated that only partial differentiation has occurred between A. graminifolia var. graminifolia and A. graminifolia var. revoluta. Therefore, we should consider the rheophyte form an ecotype rather than a variety. Anatomical observations of the leaves revealed that the rheophyte form of A. graminifolia possessed characteristics of the rheophytes of both ferns and angiosperms, such as narrower palisade tissue cells and thinner spongy tissue cells, as well as fewer cells in the leaf-width direction and fewer mesophyll cell layers.
Misharina, T A; Mukhutdinova, S M; Zharikova, G G; Terenina, M B; Krikunova, N I
2009-01-01
The composition of aroma compounds in cooked and canned cepe (Boletus edulis) and in cooked oyster mushrooms (Pleurotus ostreatus) is studied using capillary gas chromatography and chromatography-mass spectrometry. It is found that unsaturated alcohols and ketones containing eight atoms of carbon determine the aroma of raw mushrooms and take part in the formation of the aroma of cooked mushrooms as well. The content of these compounds was the highest in canned cepes. In oyster mushrooms, the concentration of these alcohols and ketones was lower in comparison with cepes. The content of aliphatic and aromatic aldehydes was much higher in oyster mushrooms. Volatile aliphatic and heterocyclic Maillard reaction products and isomeric octenols and octenones formed the aroma of cooked and canned mushrooms.
An orientin derivative isolated from Passiflora tripartita var. mollissima
Ramos, Freddy A.; Castellanos, Leonardo; López, César; Palacios, Lizeth; Duque, Carmenza; Pacheco, Ricardo; Guzmán, Antonio
2010-01-01
Passiflora tripartita var. mollisima (banana passion fruit) is an edible fruit widespread in the Andean highlands of Colombia and Ecuador. The fruit is used for juices as well as for the sedative properties of the leaves. As a contribution to the chemical characterization of this species, a new compound, 4'- methoxyluteolin-8-C-6”acetylglucopyranoside, was isolated from the ethanolic extract of Passiflora tripartita var. mollisima leaves and identified by spectroscopical data (NMR, MS, UV).
Swamy, Lakshmi; Amulic, Borko; Deitsch, Kirk W.
2011-01-01
Antigenic variation in the human malaria parasite Plasmodium falciparum depends on the transcriptional regulation of the var gene family. In each individual parasite, mRNA is expressed exclusively from 1 var gene out of ∼60, while the rest of the genes are transcriptionally silenced. Both modifications to chromatin structure and DNA regulatory elements associated with each var gene have been implicated in the organization and maintenance of the silent state. Whether silencing is established at the level of entire chromosomal regions via heterochromatin spreading or at the level of individual var promoters through the action of a silencing element within each var intron has been debated. Here, we consider both possibilities, using clonal parasite lines carrying chromosomally integrated transgenes. We confirm a previous finding that the loss of an adjacent var intron results in var promoter activation and further show that transcriptional activation of a var promoter within a cluster does not affect the transcriptional activity of neighboring var promoters. Our results provide more evidence for the hypothesis that var genes are primarily silenced at the level of an individual gene, rather than by heterochromatin spreading. We also tested the intrinsic directionality of an intron's silencing effect on upstream or downstream var promoters. We found that an intron is capable of silencing in either direction and that, once established, a var promoter-intron pair is stably maintained through many generations, suggesting a possible role in epigenetic memory. This study provides insights into the regulation of endogenous var gene clusters. PMID:21317310
The potential of Pleurotus-treated olive mill solid waste as cattle feed.
Shabtay, Ariel; Hadar, Yitzhak; Eitam, Harel; Brosh, Arieh; Orlov, Alla; Tadmor, Yaakov; Izhaki, Ido; Kerem, Zohar
2009-12-01
The aims of the current study were to follow: (1) the capability of the edible mushroom Pleurotus ostreatus to degrade cell wall components and soluble phenols of the olive mill solid waste (OMSW), and improve it for ruminant nutrition (2) the fate of oil and the lipid-soluble compounds tocopherols, squalene and beta-sitosterol in the fermented OMSW. A significant decrease in oil and lipid-soluble compounds with a concomitant shift in the fatty acid profile and degradation of soluble phenols took place already after 14 d. The utilization of lipids by the fungus shifted the degradation of the structural carbohydrates to a later stage, and significantly reduced the metabolizable energy of the OMSW. We propose that edible fungi with reduced lipase activity would preserve the energy and health promoting ingredients of the oil, and force the fungus to degrade structural carbohydrates, thus improving its digestibility.
Can reported VaR be used as an indicator of the volatility of share prices? Evidence from UK banks.
Ou, Shian Kao
2006-01-01
Value at Risk (VaR) is used as an indicator to measure the risks contained in a firm. With the uprising development of VaR theory and computational techniques, the VaR is nowadays adopted by banks and reported in annual reports. Since the method to calculate VaR is questioned, and the reported VaR can not be thoroughly audited, this paper attempts to find the relationship between the reported VaR and the volatility of share price for UK listed banks. This paper reviews literature about VaR an...
Naila, Ishmatun; Purnomo, Adi Setyo
2016-01-01
Penelitian ini bertujuan untuk mengetahui pengaruh ampas tebu dan alang-alang (Imperata cylindrica) sebagai media pertumbuhan jamur tiram putih (Pleurotus ostreatus) terhadap kandungan nutrisinya. Ampas tebu dan alang-alang dipilih sebagai media pertumbuhan alternatif, karena tidak hanya mengandung lignoseluosa, tapi juga tersedia berlimpah di lingkungan. Variasi komposisi ampas tebu:alang-alang yang digunakan adalah 75:25 (A1); 50:50 (A2); 25:75 (A3); 0:100 (A4); dan 100:0 (A5). Pada penelit...
A novel virus-like particle based vaccine platform displaying the placental malaria antigen VAR2CSA
DEFF Research Database (Denmark)
Thrane, Susan; Janitzek, Christoph M; Agerbæk, Mette Ø
2015-01-01
, this difference was not statistically significant after 3rd immunization. Importantly, the VLP-VAR2CSA induced antibodies were functional in inhibiting the binding of parasites to CSA. This study demonstrates that the described Avi-L1 VLP-platform may serve as a versatile system for facilitating optimal VLP......SA-VAR2CSA vaccines induced higher antibody titers than the soluble naked VAR2CSA vaccine after three immunizations. The VAR2CSA Avi-L1 VLP vaccine induced statistically significantly higher endpoint titres compared to the soluble mSA-VAR2CSA vaccine, after 1st and 2nd immunization; however...
Liu, Siwei; Molenaar, Peter C M
2014-12-01
This article introduces iVAR, an R program for imputing missing data in multivariate time series on the basis of vector autoregressive (VAR) models. We conducted a simulation study to compare iVAR with three methods for handling missing data: listwise deletion, imputation with sample means and variances, and multiple imputation ignoring time dependency. The results showed that iVAR produces better estimates for the cross-lagged coefficients than do the other three methods. We demonstrate the use of iVAR with an empirical example of time series electrodermal activity data and discuss the advantages and limitations of the program.
Population genomics of the immune evasion (var genes of Plasmodium falciparum.
Directory of Open Access Journals (Sweden)
Alyssa E Barry
2007-03-01
Full Text Available Var genes encode the major surface antigen (PfEMP1 of the blood stages of the human malaria parasite Plasmodium falciparum. Differential expression of up to 60 diverse var genes in each parasite genome underlies immune evasion. We compared the diversity of the DBLalpha domain of var genes sampled from 30 parasite isolates from a malaria endemic area of Papua New Guinea (PNG and 59 from widespread geographic origins (global. Overall, we obtained over 8,000 quality-controlled DBLalpha sequences. Within our sampling frame, the global population had a total of 895 distinct DBLalpha "types" and negligible overlap among repertoires. This indicated that var gene diversity on a global scale is so immense that many genomes would need to be sequenced to capture its true extent. In contrast, we found a much lower diversity in PNG of 185 DBLalpha types, with an average of approximately 7% overlap among repertoires. While we identify marked geographic structuring, nearly 40% of types identified in PNG were also found in samples from different countries showing a cosmopolitan distribution for much of the diversity. We also present evidence to suggest that recombination plays a key role in maintaining the unprecedented levels of polymorphism found in these immune evasion genes. This population genomic framework provides a cost effective molecular epidemiological tool to rapidly explore the geographic diversity of var genes.
Degradation of oxo-biodegradable plastic by Pleurotus ostreatus.
da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Nunes, Mateus Dias; da Silva, Marliane de Cássia Soares; Kasuya, Maria Catarina Megumi
2013-01-01
Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV) or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W) plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate.
Degradation of oxo-biodegradable plastic by Pleurotus ostreatus.
Directory of Open Access Journals (Sweden)
José Maria Rodrigues da Luz
Full Text Available Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate.
Degradation of Oxo-Biodegradable Plastic by Pleurotus ostreatus
da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Nunes, Mateus Dias; da Silva, Marliane de Cássia Soares; Kasuya, Maria Catarina Megumi
2013-01-01
Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV) or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W) plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate. PMID:23967057
New lipases by mining of Pleurotus ostreatus genome.
Directory of Open Access Journals (Sweden)
Alessandra Piscitelli
Full Text Available The analysis of Pleurotus ostreatus genome reveals the presence of automatically annotated 53 lipase and 34 carboxylesterase putative coding-genes. Since no biochemical or physiological data are available so far, a functional approach was applied to identify lipases from P. ostreatus. In the tested growth conditions, four lipases were found expressed, with different patterns depending on the used C source. Two of the four identified proteins (PleoLip241 and PleoLip369, expressed in both analysed conditions, were chosen for further studies, such as an in silico analysis and their molecular characterization. To overcome limits linked to native production, a recombinant expression approach in the yeast Pichia pastoris was applied. Different expression levels were obtained: PleoLip241 reached a maximum activity of 4000 U/L, whereas PleoLip369 reached a maximum activity of 700 U/L. Despite their sequence similarity, these enzymes exhibited different substrate specificity and diverse stability at pH, temperature, and presence of metals, detergents and organic solvents. The obtained data allowed classifying PleoLip241 as belonging to the "true lipase" family. Indeed, by phylogenetic analysis the two proteins fall in different clusters. PleoLip241 was used to remove the hydrophobic layer from wool surface in order to improve its dyeability. The encouraging results obtained with lipase treated wool led to forecast PleoLip241 applicability in this field.
Dimonte, Sandra; Bruske, Ellen I; Hass, Johanna; Supan, Christian; Salazar, Carmen L; Held, Jana; Tschan, Serena; Esen, Meral; Flötenmeyer, Matthias; Koch, Iris; Berger, Jürgen; Bachmann, Anna; Sim, Betty K L; Hoffman, Stephen L; Kremsner, Peter G; Mordmüller, Benjamin; Frank, Matthias
2016-09-15
Antigenic variation in Plasmodium falciparum is mediated by the multicopy var gene family. Each parasite possesses about 60 var genes, and switching between active var loci results in antigenic variation. In the current study, the effect of mosquito and host passage on in vitro var gene transcription was investigated. Thirty malaria-naive individuals were inoculated by intradermal or intravenous injection with cryopreserved, isogenic NF54 P. falciparum sporozoites (PfSPZ) generated from 1 premosquito culture. Microscopic parasitemia developed in 22 individuals, and 21 in vitro cultures were established. The var gene transcript levels were determined in early and late postpatient cultures and in the premosquito culture. At the early time point, all cultures preferentially transcribed 8 subtelomeric var genes. Intradermal infections had higher var gene transcript levels than intravenous infections and a significantly longer intrahost replication time (P = .03). At the late time point, 9 subtelomeric and 8 central var genes were transcribed at the same levels in almost all cultures. Premosquito and late postpatient cultures transcribed the same subtelomeric and central var genes, except for var2csa The duration of intrahost replication influences in vitro var gene transcript patterns. Differences between premosquito and postpatient cultures decrease with prolonged in vitro growth. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.
Disruption of var2csa gene impairs placental malaria associated adhesion phenotype.
Directory of Open Access Journals (Sweden)
Nicola K Viebig
Full Text Available Infection with Plasmodium falciparum during pregnancy is one of the major causes of malaria related morbidity and mortality in newborn and mothers. The complications of pregnancy-associated malaria result mainly from massive adhesion of Plasmodium falciparum-infected erythrocytes (IE to chondroitin sulfate A (CSA present in the placental intervillous blood spaces. Var2CSA, a member of the P. falciparum erythrocyte membrane protein 1 (PfEMP1 family is the predominant parasite ligand mediating CSA binding. However, experimental evidence suggests that other host receptors, such as hyaluronic acid (HA and the neonatal Fc receptor, may also support placental binding. Here we used parasites in which var2csa was genetically disrupted to evaluate the contribution of these receptors to placental sequestration and to identify additional adhesion receptors that may be involved in pregnancy-associated malaria. By comparison to the wild-type parasites, the FCR3delta var2csa mutants could not be selected for HA adhesion, indicating that var2csa is not only essential for IE cytoadhesion to the placental receptor CSA, but also to HA. However, further studies using different pure sources of HA revealed that the previously observed binding results from CSA contamination in the bovine vitreous humor HA preparation. To identify CSA-independent placental interactions, FCR3delta var2csa mutant parasites were selected for adhesion to the human placental trophoblastic BeWo cell line. BeWo selected parasites revealed a multi-phenotypic adhesion population expressing multiple var genes. However, these parasites did not cytoadhere specifically to the syncytiotrophoblast lining of placental cryosections and were not recognized by sera from malaria-exposed women in a parity dependent manner, indicating that the surface molecules present on the surface of the BeWo selected population are not specifically expressed during the course of pregnancy-associated malaria. Taken
Yu, Fei; Wang, Dexiang; Yi, Xianfeng; Shi, Xiaoxiao; Huang, Yakun; Zhang, Hongwu; Zhang, XinPing
2014-01-01
The Pinus armandii and Quercus aliena var. acuteserrata mixed forest is one of the major forest types in the Qinling Mountains, China. P. armandii is considered to be a pioneer species during succession and it is usually invaded by late successional Q. aliena var. acuteserrata. However, the mechanism that underlies its invasion remains unclear. In the present study, we tracked seed dispersal of P. armandii and Q. aliena var. acuteserrata using coded plastic tags in the western, middle and eastern Qinling Mountains to elucidate the invasion process in the mixed forests. Our results indicated that the seeds of both P. armandii and Q. aliena var. acuteserrata were removed rapidly in the Qinling Mountains, and there were no differences in the seed removal rates between the two species. There were significant differences in rodent seed-eating and caching strategies between the two tree species. For P. armandii, seeds were more likely to be eaten in situ than those of Q. aliena var. acuteserrata in all plots. By contrast, the acorns of Q. aliena var. acuteserrata were less frequently eaten in situ, but more likely to be removed and cached. Q. aliena var. acuteserrata acorns had significantly longer dispersal distances than P. armandii seeds in all plots. Although P. armandii seeds were less likely to be dispersed into the Q. aliena var. acuteserrata stands, over 30% of the released acorns were transported into the P. armandii stands where they established five seedlings. Based on the coupled recruitment patterns of P. armandii and Q. aliena var. acuteserrata, we suggest that the animal-mediated seed dispersal contributes to the formation of Pinus armandii-Quercus aliena var. acuteserrata forests.
Kalman Filter or VAR Models to Predict Unemployment Rate in Romania?
Directory of Open Access Journals (Sweden)
Simionescu Mihaela
2015-06-01
Full Text Available This paper brings to light an economic problem that frequently appears in practice: For the same variable, more alternative forecasts are proposed, yet the decision-making process requires the use of a single prediction. Therefore, a forecast assessment is necessary to select the best prediction. The aim of this research is to propose some strategies for improving the unemployment rate forecast in Romania by conducting a comparative accuracy analysis of unemployment rate forecasts based on two quantitative methods: Kalman filter and vector-auto-regressive (VAR models. The first method considers the evolution of unemployment components, while the VAR model takes into account the interdependencies between the unemployment rate and the inflation rate. According to the Granger causality test, the inflation rate in the first difference is a cause of the unemployment rate in the first difference, these data sets being stationary. For the unemployment rate forecasts for 2010-2012 in Romania, the VAR models (in all variants of VAR simulations determined more accurate predictions than Kalman filter based on two state space models for all accuracy measures. According to mean absolute scaled error, the dynamic-stochastic simulations used in predicting unemployment based on the VAR model are the most accurate. Another strategy for improving the initial forecasts based on the Kalman filter used the adjusted unemployment data transformed by the application of the Hodrick-Prescott filter. However, the use of VAR models rather than different variants of the Kalman filter methods remains the best strategy in improving the quality of the unemployment rate forecast in Romania. The explanation of these results is related to the fact that the interaction of unemployment with inflation provides useful information for predictions of the evolution of unemployment related to its components (i.e., natural unemployment and cyclical component.
PERHITUNGAN VaR PORTOFOLIO SAHAM MENGGUNAKAN DATA HISTORIS DAN DATA SIMULASI MONTE CARLO
Directory of Open Access Journals (Sweden)
WAYAN ARTHINI
2012-09-01
Full Text Available Value at Risk (VaR is the maximum potential loss on a portfolio based on the probability at a certain time. In this research, portfolio VaR values calculated from historical data and Monte Carlo simulation data. Historical data is processed so as to obtain stock returns, variance, correlation coefficient, and variance-covariance matrix, then the method of Markowitz sought proportion of each stock fund, and portfolio risk and return portfolio. The data was then simulated by Monte Carlo simulation, Exact Monte Carlo Simulation and Expected Monte Carlo Simulation. Exact Monte Carlo simulation have same returns and standard deviation with historical data, while the Expected Monte Carlo Simulation satistic calculation similar to historical data. The results of this research is the portfolio VaR with time horizon T=1, T=10, T=22 and the confidence level of 95 %, values obtained VaR between historical data and Monte Carlo simulation data with the method exact and expected. Value of VaR from both Monte Carlo simulation is greater than VaR historical data.
Claessens, Antoine; Hamilton, William L; Kekre, Mihir; Otto, Thomas D; Faizullabhoy, Adnan; Rayner, Julian C; Kwiatkowski, Dominic
2014-12-01
The most polymorphic gene family in P. falciparum is the ∼60 var genes distributed across parasite chromosomes, both in the subtelomeres and in internal regions. They encode hypervariable surface proteins known as P. falciparum erythrocyte membrane protein 1 (PfEMP1) that are critical for pathogenesis and immune evasion in Plasmodium falciparum. How var gene sequence diversity is generated is not currently completely understood. To address this, we constructed large clone trees and performed whole genome sequence analysis to study the generation of novel var gene sequences in asexually replicating parasites. While single nucleotide polymorphisms (SNPs) were scattered across the genome, structural variants (deletions, duplications, translocations) were focused in and around var genes, with considerable variation in frequency between strains. Analysis of more than 100 recombination events involving var exon 1 revealed that the average nucleotide sequence identity of two recombining exons was only 63% (range: 52.7-72.4%) yet the crossovers were error-free and occurred in such a way that the resulting sequence was in frame and domain architecture was preserved. Var exon 1, which encodes the immunologically exposed part of the protein, recombined in up to 0.2% of infected erythrocytes in vitro per life cycle. The high rate of var exon 1 recombination indicates that millions of new antigenic structures could potentially be generated each day in a single infected individual. We propose a model whereby var gene sequence polymorphism is mainly generated during the asexual part of the life cycle.
Zhou, Nong; Qi, Wen-hua; Xiao, Guo-sheng; Ding, Bo; Zhang, Hua; Guo, Dong-qin; Shen, Wei
2015-03-01
In this paper, the varying pattern of the amount of rhizospheric microorganisms, including bacteria, actinomycetes and fungus, was observed during the cultivation of Paris polyphylla var. yunnanensis. And the correlations between number of rhizospheric microorganisms and the quality of P. polyphylla var. yunnanensis were also studied. The results showed that the rhizospheric microorganism source of P. polyphylla var. yunnanensis was rich. The distribution of rhizospheric microorganisms (soil bacteria, fungus, actinomycetes, potassium-solubilizing bacteria, inorganic phosphorus-solubilizing bacteria, organic phosphorus-solubilizing bacteria) collected from different origin places existed significant difference (P the amount of actinomycetes > the amount of fungus. The medicinal quality of P. polyphylla var. yunnanensis was influenced by their habits, and the increase of cultivation years caused the obvious decrease of the quality of P. polyphylla var. yunnanensis. Therefore, the increase of cultivation years will cause the variation of the soil micro-ecology flora, and decrease the nutrient absorption and the utilization of P. polyphylla var. yunnanensis, which will make the decrease of the medical quality of P. polyphylla var. yunnanensis.
Directory of Open Access Journals (Sweden)
Donald S Chen
2011-02-01
Full Text Available The reservoir of Plasmodium infection in humans has traditionally been defined by blood slide positivity. This study was designed to characterize the local reservoir of infection in relation to the diverse var genes that encode the major surface antigen of Plasmodium falciparum blood stages and underlie the parasite's ability to establish chronic infection and transmit from human to mosquito.We investigated the molecular epidemiology of the var multigene family at local sites in Gabon, Senegal and Kenya which differ in parasite prevalence and transmission intensity. 1839 distinct var gene types were defined by sequencing DBLα domains in the three sites. Only 76 (4.1% var types were found in more than one population indicating spatial heterogeneity in var types across the African continent. The majority of var types appeared only once in the population sample. Non-parametric statistical estimators predict in each population at minimum five to seven thousand distinct var types. Similar diversity of var types was seen in sites with different parasite prevalences.Var population genomics provides new insights into the epidemiology of P. falciparum in Africa where malaria has never been conquered. In particular, we have described the extensive reservoir of infection in local African sites and discovered a unique var population structure that can facilitate superinfection through minimal overlap in var repertoires among parasite genomes. Our findings show that var typing as a molecular surveillance system defines the extent of genetic complexity in the reservoir of infection to complement measures of malaria prevalence. The observed small scale spatial diversity of var genes suggests that var genetics could greatly inform current malaria mapping approaches and predict complex malaria population dynamics due to the import of var types to areas where no widespread pre-existing immunity in the population exists.
Leliwa-Sytek, Aleksandra; Smith, Terry-Ann; Peterson, Ingrid; Brown, Stuart M.; Migot-Nabias, Florence; Deloron, Philippe; Kortok, Moses M.; Marsh, Kevin; Daily, Johanna P.; Ndiaye, Daouda; Sarr, Ousmane; Mboup, Souleymane; Day, Karen P.
2011-01-01
Background The reservoir of Plasmodium infection in humans has traditionally been defined by blood slide positivity. This study was designed to characterize the local reservoir of infection in relation to the diverse var genes that encode the major surface antigen of Plasmodium falciparum blood stages and underlie the parasite's ability to establish chronic infection and transmit from human to mosquito. Methodology/Principal Findings We investigated the molecular epidemiology of the var multigene family at local sites in Gabon, Senegal and Kenya which differ in parasite prevalence and transmission intensity. 1839 distinct var gene types were defined by sequencing DBLα domains in the three sites. Only 76 (4.1%) var types were found in more than one population indicating spatial heterogeneity in var types across the African continent. The majority of var types appeared only once in the population sample. Non-parametric statistical estimators predict in each population at minimum five to seven thousand distinct var types. Similar diversity of var types was seen in sites with different parasite prevalences. Conclusions/Significance Var population genomics provides new insights into the epidemiology of P. falciparum in Africa where malaria has never been conquered. In particular, we have described the extensive reservoir of infection in local African sites and discovered a unique var population structure that can facilitate superinfection through minimal overlap in var repertoires among parasite genomes. Our findings show that var typing as a molecular surveillance system defines the extent of genetic complexity in the reservoir of infection to complement measures of malaria prevalence. The observed small scale spatial diversity of var genes suggests that var genetics could greatly inform current malaria mapping approaches and predict complex malaria population dynamics due to the import of var types to areas where no widespread pre-existing immunity in the population
Momoh, James A.; Salkuti, Surender Reddy
2016-06-01
This paper proposes a stochastic optimization technique for solving the Voltage/VAr control problem including the load demand and Renewable Energy Resources (RERs) variation. The RERs often take along some inputs like stochastic behavior. One of the important challenges i. e., Voltage/VAr control is a prime source for handling power system complexity and reliability, hence it is the fundamental requirement for all the utility companies. There is a need for the robust and efficient Voltage/VAr optimization technique to meet the peak demand and reduction of system losses. The voltages beyond the limit may damage costly sub-station devices and equipments at consumer end as well. Especially, the RERs introduces more disturbances and some of the RERs are not even capable enough to meet the VAr demand. Therefore, there is a strong need for the Voltage/VAr control in RERs environment. This paper aims at the development of optimal scheme for Voltage/VAr control involving RERs. In this paper, Latin Hypercube Sampling (LHS) method is used to cover full range of variables by maximally satisfying the marginal distribution. Here, backward scenario reduction technique is used to reduce the number of scenarios effectively and maximally retain the fitting accuracy of samples. The developed optimization scheme is tested on IEEE 24 bus Reliability Test System (RTS) considering the load demand and RERs variation.
The Burr X Pareto Distribution: Properties, Applications and VaR Estimation
Directory of Open Access Journals (Sweden)
Mustafa Ç. Korkmaz
2017-12-01
Full Text Available In this paper, a new three-parameter Pareto distribution is introduced and studied. We discuss various mathematical and statistical properties of the new model. Some estimation methods of the model parameters are performed. Moreover, the peaks-over-threshold method is used to estimate Value-at-Risk (VaR by means of the proposed distribution. We compare the distribution with a few other models to show its versatility in modelling data with heavy tails. VaR estimation with the Burr X Pareto distribution is presented using time series data, and the new model could be considered as an alternative VaR model against the generalized Pareto model for financial institutions.
Testing popular VaR models in EU new member and candidate states
Directory of Open Access Journals (Sweden)
Saša Žiković
2007-12-01
Full Text Available The impact of allowing banks to calculate their capital requirement based on their internal VaR models, and the impact of regulation changes on banks in transitional countries has not been well studied. This paper examines whether VaR models that are created and suited for developed markets apply to the volatile stock markets of EU new member and candidate states (Bulgaria, Romania, Croatia and Turkey. Nine popular VaR models are tested on five stock indexes from EU new member and candidate states. Backtesting results show that VaR models commonly used in developed stock markets are not well suited for measuring market risk in these markets. Presented findings bear very important implications that have to be addressed by regulators and risk practitioners operating in EU new member andcandidate states. Risk managers have to start thinking outside the frames set by their parent companies or else investors present in these markets may find themselves in serious trouble, dealing with losses that they have not been expecting. National regulators have to take into consideration that simplistic VaR models that are widely used in some developed countries are not well suited for these illiquid and developing stock markets.
DEFF Research Database (Denmark)
Babakhanyan, Anna; Fang, Rui; Wey, Andrew
2015-01-01
BACKGROUND: Antibodies (Ab) to VAR2CSA prevent Plasmodium falciparum-infected erythrocytes from sequestrating in the placenta, i.e., prevent placental malaria (PM). The specificity of Ab to VAR2CSA associated with absence of PM is unknown. Accordingly, differences in the specificity of Ab to VAR2......CSA were compared between multigravidae with and without PM who had Ab to VAR2CSA. METHODS: In a retrospective case-control study, plasma collected from Cameroonian multigravidae with (n = 96) and without (n = 324) PM were screened in 21 assays that measured antibody levels to full length VAR2CSA (FV2......), individual VAR2CSA DBL domains, VAR2CSA domains from different genetic backgrounds (variants), as well as proportion of high avidity Ab to FV2. RESULTS: Multigravidae with and without PM had similar levels of Ab to FV2, the six VAR2CSA DBL domains and different variants, while the proportion of high avidity...
Schmid, Christoph D.; Bühlmann, Tobias; Louis, Edward J.; Beck, Hans-Peter
2011-01-01
One of the major virulence factors of the malaria causing parasite is the Plasmodium falciparum encoded erythrocyte membrane protein 1 (PfEMP1). It is translocated to It the membrane of infected erythrocytes and expressed from approximately 60 var genes in a mutually exclusive manner. Switching of var genes allows the parasite to alter functional and antigenic properties of infected erythrocytes, to escape the immune defense and to establish chronic infections. We have developed an efficient method for isolating VAR genes from telomeric and other genome locations by adapting transformation-associated recombination (TAR) cloning, which can then be analyzed and sequenced. For this purpose, three plasmids each containing a homologous sequence representing the upstream regions of the group A, B, and C var genes and a sequence homologous to the conserved acidic terminal segment (ATS) of var genes were generated. Co-transfection with P. falciparum strain ITG2F6 genomic DNA in yeast cells yielded 200 TAR clones. The relative frequencies of clones from each group were not biased. Clones were screened by PCR, as well as Southern blotting, which revealed clones missed by PCR due to sequence mismatches with the primers. Selected clones were transformed into E. coli and further analyzed by RFLP and end sequencing. Physical analysis of 36 clones revealed 27 distinct types potentially representing 50% of the var gene repertoire. Three clones were selected for sequencing and assembled into single var gene containing contigs. This study demonstrates that it is possible to rapidly obtain the repertoire of var genes from P. falciparum within a single set of cloning experiments. This technique can be applied to individual isolates which will provide a detailed picture of the diversity of var genes in the field. This is a powerful tool to overcome the obstacles with cloning and assembly of multi-gene families by simultaneously cloning each member. PMID:21408186
Hu, Guang-Fu; Liu, Xiang-Jiang; Li, Zhong; Liang, Hong-Wei; Hu, Shao-Na; Zou, Gui-Wei
2016-01-01
The complete mitochondrial genomes of Xingguo red carp (Cyprinus carpio var. singuonensis) and purse red carp (Cyprinus carpio var. wuyuanensis) were sequenced. Comparison of these two mitochondrial genomes revealed that the mtDNAs of these two common carp varieties were remarkably similar in genome length, gene order and content, and AT content. However, size variation between these two mitochondrial genomes presented here showed 39 site differences in overall length. About 2 site differences were located in rRNAs, 3 in tRNAs, 3 in the control region, 31 in protein-coding genes. Thirty-one variable bases in the protein-coding regions between the two varieties mitochondrial sequences led to three variable amino acids, which were mainly located in the protein ND5 and ND4.
Effect of some heavy metals on the growth and development of Pleurotus tuber-regium.
Directory of Open Access Journals (Sweden)
Akpaja EO
2012-02-01
Full Text Available The effects of five heavy metals (cadmium, copper, mercury, lead and zinc on the growth and fruit body production in Pleurotus tuber-regium was investigated. Lead sulphate, zinc sulphate, copper sulphate, cadmium nitrate and mercury chloride were added to garden soil at concentrations of 0, 0.125, 0.25, 0.5, 1.0, and 2.0 mmol per 3 kg of soil. Sclerotia of the test mushroom were used to inoculate the artificially contaminated soil. Mercury prevented growth and fruit body production in P. tuber-regium. Fungal morphometry was greatly affected by lead. The heavy metal content in the fungal biomass complex increased with increase of heavy metal concentration in the soil. The highest concentration (183.06 mg/kg was found in zinc at 2 mmol/L.
Guizetti, Julien; Barcons-Simon, Anna; Scherf, Artur
2016-11-16
Monoallelic expression of the var multigene family enables immune evasion of the malaria parasite Plasmodium falciparum in its human host. At a given time only a single member of the 60-member var gene family is expressed at a discrete perinuclear region called the 'var expression site'. However, the mechanism of var gene counting remains ill-defined. We hypothesize that activation factors associating specifically with the expression site play a key role in this process. Here, we investigate the role of a GC-rich non-coding RNA (ncRNA) gene family composed of 15 highly homologous members. GC-rich genes are positioned adjacent to var genes in chromosome-central gene clusters but are absent near subtelomeric var genes. Fluorescence in situ hybridization demonstrates that GC-rich ncRNA localizes to the perinuclear expression site of central and subtelomeric var genes in trans. Importantly, overexpression of distinct GC-rich ncRNA members disrupts the gene counting process at the single cell level and results in activation of a specific subset of var genes in distinct clones. We identify the first trans-acting factor targeted to the elusive perinuclear var expression site and open up new avenues to investigate ncRNA function in antigenic variation of malaria and other protozoan pathogens. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Orientation of the Fiscal Policy in Tunisia: Structural VAR Analysis
Directory of Open Access Journals (Sweden)
Wissem Khanfir
2017-06-01
Full Text Available The objective of this paper is to indicate the orientation of fiscal policy in Tunisia, using the structural budget balance, during the period 1972-2014. For this purpose, we estimate a structural VAR model consisting of the fiscal deficit to current GDP ratio and the volume of economic activity represented by the real GDP. We estimate bivariate structural VAR in order to decompose fiscal deficit fluctuations into different disturbances.
Functional expression of a valencene dioxygenase from Pleurotus sapidus in E. coli.
Zelena, Kateryna; Krings, Ulrich; Berger, Ralf G
2012-03-01
Valencene dioxygenase (ValOx) from the edible basidiomycete Pleurotus sapidus converted the sesquiterpene (+)-valencene to the valuable grapefruit flavour (+)-nootkatone and to nootkatols through intermediate hydroperoxides. Expression of the enzyme was carried out in the cytosol and periplasm of Escherichia coli. The heterologous production led to high yields of inclusion bodies. The poor yield of soluble recombinant protein was improved by various strategies including cold shock expression, chaperone co-expression, and employment of mutant E. coli strains. Up to 60 mg of the biologically active, soluble ValOx was produced by cold shock under control of the cspA promoter at 8 °C in the BL21(DE3)Star strain and co-expression of the E. coli trigger factor. The recombinant enzyme, purified using the N-terminal His tag, showed the catalytic properties of the wild-type enzyme, as was confirmed by the LC-MS analysis of hydroperoxide intermediates and GC-MS analysis of the volatile products. Copyright © 2011 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Antoine Claessens
2014-12-01
Full Text Available The most polymorphic gene family in P. falciparum is the ∼60 var genes distributed across parasite chromosomes, both in the subtelomeres and in internal regions. They encode hypervariable surface proteins known as P. falciparum erythrocyte membrane protein 1 (PfEMP1 that are critical for pathogenesis and immune evasion in Plasmodium falciparum. How var gene sequence diversity is generated is not currently completely understood. To address this, we constructed large clone trees and performed whole genome sequence analysis to study the generation of novel var gene sequences in asexually replicating parasites. While single nucleotide polymorphisms (SNPs were scattered across the genome, structural variants (deletions, duplications, translocations were focused in and around var genes, with considerable variation in frequency between strains. Analysis of more than 100 recombination events involving var exon 1 revealed that the average nucleotide sequence identity of two recombining exons was only 63% (range: 52.7-72.4% yet the crossovers were error-free and occurred in such a way that the resulting sequence was in frame and domain architecture was preserved. Var exon 1, which encodes the immunologically exposed part of the protein, recombined in up to 0.2% of infected erythrocytes in vitro per life cycle. The high rate of var exon 1 recombination indicates that millions of new antigenic structures could potentially be generated each day in a single infected individual. We propose a model whereby var gene sequence polymorphism is mainly generated during the asexual part of the life cycle.
Reversal of cisplatin resistance in non-small cell lung cancer stem cells by Taxus chinensis var.
Jiang, Y Q; Xu, X P; Guo, Q M; Xu, X C; Liu, Q Y; An, S H; Xu, J L; Su, F; Tai, J B
2016-09-02
Drug resistance in cells is a major impedance to successful treatment of lung cancer. Taxus chinensis var. inhibits the growth of tumor cells and promotes the synthesis of interleukins 1 and 2 and tumor necrosis factor, enhancing immune function. In this study, T. chinensis var.-induced cell death was analyzed in lung cancer cells (H460) enriched for stem cell growth in a defined serum-free medium. Taxus-treated stem cells were also analyzed for Rhodamine 123 (Rh-123) expression by flow cytometry, and used as a standard functional indicator of MDR. The molecular basis of T. chinensis var.-mediated drug resistance was established by real-time PCR analysis of ABCC1, ABCB1, and lung resistance-related protein (LRP) mRNA, and western blot analysis of MRP1, MDR1, and LRP. Our results revealed that stem cells treated with higher doses of T. chinensis var. showed significantly lower growth inhibition rates than did H460 cells (P var. and cisplatin was also significantly inhibited (P var. (P var.-treated stem cells showed significant downregulation of the ABCC1, ABCB1, and LRP mRNA and MRP1, MDR1, and LRP (P var.-mediated downregulation of MRP1, MDR1, and LRP might contribute to the reversal of drug resistance in non-small cell lung cancer stem cells.
International Nuclear Information System (INIS)
Jahangir, M.; Farid, I.B.A.
2014-01-01
Brassica rapa (var. raapstelen) and Raphanus sativus (red radish) are being used as food and fodder while also known as model in recent plant research due to the diversity of metabolites as well as genetic resemblance to Arabidopsis. This study explains the change in metabolites (amino acids, organic acids, chlorophyll, carotenoids, tocopherols, ascorbic acid, sucrose, phenylpropanoids and glucosinolates) during plant development. In present study the metabolomic variation in relation to plant growth has been evaluated, for Brassica rapa (var. raapstelen) and red radish (Raphanus sativus) at three different developmental stages. A non-targeted and targeted metabolomic approach by NMR and HPLC in combination with Principal component analysis (PCA) of the data was used to identify phytochemicals being influenced by plant growth. The results lead to the better understanding of metabolic changes during plant development and show the importance of plant age with respect to the metabolomic profile of vegetables. (author)
Jiang, Juan; Liu, Hongying; Li, Qiao; Gao, Ni; Yao, Yuan; Xu, Heng
2015-10-01
Remediation of soil co-contaminated with heavy metals and PAHs by mushroom and bacteria is a novel technique. In this study, the combined remediation effect of mushroom (Pleurotus cornucopiae) and bacteria (FQ1, Bacillus thuringiensis) on Cd and phenanthrene co-contaminated soil was investigated. The effect of bacteria (B. thuringiensis) on mushroom growth, Cd accumulation, phenanthrene degradation by P. cornucopiae and antioxidative responses of P. cornucopiae were studied. P. cornucopiae could adapt easily and grow well in Cd-phenanthrene co-contaminated soil. It was found that inoculation of FQ1 enhanced mushroom growth (biomass) and Cd accumulation with the increment of 26.68-43.58% and 14.29-97.67% respectively. Up to 100% and 95.07% of phenanthrene were removed in the bacteria-mushroom (B+M) treatment respectively spiked with 200mg/kg and 500mg/kg phenanthrene. In addition, bacterial inoculation alleviated oxidative stress caused by co-contamination with relative decreases in lipid peroxidation and enzyme activity, including malondialdehyde (MDA), superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD). This study demonstrated that the integrated remediation strategy of bacteria and mushroom is an effective and promising method for Cd-phenanthrene co-contaminated soil bioremediation. Copyright © 2015 Elsevier Inc. All rights reserved.
Clinical development of a VAR2CSA-based placental malaria vaccine PAMVAC
DEFF Research Database (Denmark)
Gbédandé, Komi; Fievet, Nadine; Viwami, Firmine
2017-01-01
Background The antigen VAR2CSA plays a pivotal role in the pathophysiology of pregnancy-associated malaria (PAM) caused by Plasmodium falciparum. A VAR2CSA-based vaccine candidate, PAMVAC, is under development by an EU-funded multi-country consortium (PlacMalVac project). As part of PAMVAC...
Hwang, Yu-Jin; Lee, Eun-Ju; Kim, Haeng-Ran; Hwang, Kyung-A
2013-11-09
Recently, considerable attention has been focused on exploring the potential antioxidant properties of plant extracts or isolated products of plant origin. Prunella vulgaris var. lilacina is widely distributed in Korea, Japan, China, and Europe, and it continues to be used to treat inflammation, eye pain, headache, and dizziness. However, reports on the antioxidant activities of P. vulgaris var. lilacina are limited, particularly concerning the relationship between its phenolic content and antioxidant capacity. In this study, we investigated the antioxidant and anticancer activities of an ethanol extract from P. vulgaris var. lilacina and its fractions. Dried powder of P. vulgaris var. lilacina was extracted with ethanol, and the extract was fractionated to produce the hexane fraction, butanol fraction, chloroform fraction and residual water fraction. The phenolic content was assayed using the Folin-Ciocalteu colorimetric method. Subsequently, the antioxidant activities of the ethanol extract and its fractions were analyzed employing various antioxidant assay methods including DPPH, FRAP, ABTS, SOD activity and production of reactive oxygen species. Additionally, the extract and fractions were assayed for their ability to exert cytotoxic activities on various cancer cells using the MTT assay. We also investigated the expression of genes associated with apoptotic cell death by RT-PCR. The total phenolic contents of the ethanol extract and water fraction of P. vulgaris var. lilacina were 303.66 and 322.80 mg GAE/g dry weight (or fractions), respectively. The results showed that the ethanol extract and the water fraction of P. vulgaris var. lilacina had higher antioxidant content than other solvent fractions, similar to their total phenolic content. Anticancer activity was also tested using the HepG2, HT29, A549, MKN45 and HeLa cancer cell lines. The results clearly demonstrated that the P. vulgaris var. lilacina ethanol extract induced significant cytotoxic effects
Production of exopolysaccharides in submerged cultures of gamma irradiation pleurotus ostreatus
International Nuclear Information System (INIS)
Khalaf, M.A.; Atia, A.I.
2009-01-01
Mushrooms have become attractive as a functional food and as a source for the development of drugs and nutraceuticals. Pleurotus ostreatus is considered as the best among them. The exopolysaccharides (EPS) of mushrooms demonstrated a strong antitumor and antioxidant action. However, there is little information available in the literature about the optimization of fermentation conditions for production of EPS by P. ostreatus. So, the effect of medium composition and fermentation parameters on mycelial growth and EPS production by gamma irradiated isolate of P. ostreatus were investigated in shake-flask cultures. The economical optimum fermentation parameters for the highest EPS production 5.73 g/l and mycelial growth rate 11.8 g/l were achieved at initial ph 6, cultivation temperature 28 C(degree), 20 g/l sucrose, 4 g/l yeast extract, 50 ml of medium working volume in a 250 ml flask, and 6% (v/v) of inoculum size after 10 and 12 days, respectively. EPS produced, in this study, showed strong antioxidant activity (96.3%) at concentration 10 mg/ml.
Subcellular distribution and chemical forms of thorium in Brassica juncea var. foliosa
International Nuclear Information System (INIS)
Zhou, Sai; Kai, Hailu; Zha, Zhongyong; Fang, Zhendong; Wang, Dingna; Du, Liang; Zhang, Dong; Feng, Xiaojie; Jin, Yongdong; Xia, Chuanqin
2016-01-01
Brassica juncea var. foliosa (B. juncea var. foliosa) is a promising species for thorium (Th) phytoextraction due to its large biomass, fast growth rate and high tolerance toward Th. To further understand the mechanisms of Th tolerance, the present study investigated the subcellular distribution and chemical forms of Th found in B. juncea var. foliosa Our results indicated that in both roots and leaves, Th contents in different parts of the cells follow the order of cell wall > membranes and soluble fraction > organelles. In particular, Transmission Electron Microscope (TEM) analysis showed that Th was abundantly located in cell walls of the roots. Additionally, when plants were exposed to different concentrations of Th, we have found that Th existed in B. juncea var. foliosa with different chemical forms. Much of the Th extracted by 2% acetic acid (HAc), 1 M NaCl and HCl in roots with the percentage distribution varied from 47.2% to 62.5%, while in leaves, most of the Th was in the form of residue and the subdominant amount of Th was extracted by HCl, followed by 2% HAc. This suggested that Th compartmentation in cytosol and integration with phosphate or proteins in cell wall might be responsible for the tolerance of B. juncea var. foliosa to the stress of Th. - Highlights: • Brassica juncea var. foliosa can adapt to the stress of Th(<200 μM) under hydroponic condition. • Th was selectively distributed on cell wall, membranes and soluble fraction. • Th mainly existed in low-toxicity forms which were benefit for Th tolerance.
Potu Venkata Chiranjeevi; Moses Rajasekara Pandian; Sathish Thadikamala
2014-01-01
Black gram husk was used as a solid substrate for laccase production by Pleurotus ostreatus, and various fermentation conditions were optimized based on an artificial intelligence method. A total of six parameters, i.e., temperature, inoculum concentration, moisture content, CuSO4, glucose, and peptone concentrations, were optimized. A total of 50 experiments were conducted, and the obtained data were modeled by a hybrid of artificial neural network (ANN) and genetic algorithm (GA) approaches...
Silence, Metaperformance, and Communication in Pedro Almodóvar's "Hable con ella"
Fellie, Maria C.
2016-01-01
Many scenes in Pedro Almodóvar's "Hable con ella" (2002) include shots of metaperformances such as silent films, dances, television shows, concerts, and bullfights. Spectators often observe passive characters who are in turn observing. By presenting these performances within cinematic performance, Almodóvar highlights our role as viewers…
Chemopreventive and Anticancer Activities of Allium victorialis var. platyphyllum Extracts.
Kim, Hyun-Jeong; Park, Min Jeong; Park, Hee-Juhn; Chung, Won-Yoon; Kim, Ki-Rim; Park, Kwang-Kyun
2014-09-01
Allium victorialis var. platyphyllum is an edible perennial herb and has been used as a vegetable or as a Korean traditional medicine. Allium species have received much attention owing to their diverse pharmacological properties, including antioxidative, anti-inflammatory, and anticancer activities. However, A. victorialis var. platyphyllum needs more study. The chemopreventive potential of A. victorialis var. platyphyllum methanol extracts was examined by measuring 12-O-tetra-decanoylphorbol 13-acetate (TPA)-induced superoxide anion production in the differentiated HL-60 cells, TPA-induced mouse ear edema, and Ames/Salmonella mutagenicity. The apoptosis-inducing capabilities of the extracts were evaluated by the 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide assay, 4',6-diamidino-2-phenylindole staining, and the DNA fragmentation assay in human colon cancer HT-29 cells. Antimetastatic activities of the extracts were also investigated in an experimental mouse lung metastasis model. The methanol extracts of A. victorialis var. platyphyllum rhizome (AVP-R) and A. victorialis var. platyphyllum stem (AVP-S) dose-dependently inhibited the TPA-induced generation of superoxide anion in HL-60 cells and TPA-induced ear edema in mice, as well as 7,12-dimethylbenz[a]anthracene (DMBA) and tert-butyl hydroperoxide (t-BOOH) -induced bacterial mutagenesis. AVP-R and AVP-S reduced cell viability in a dose-related manner and induced apoptotic morphological changes and internucleosomal DNA fragmentation in HT-29 cells. In the experimental mouse lung metastasis model, the formation of tumor nodules in lung tissue was significantly inhibited by the treatment of the extracts. AVP-R and AVP-S possess antioxidative, anti-inflammatory, antimutagenic, proapoptotic, and antimetastatic activities. Therefore, these extracts can serve as a beneficial supplement for the prevention and treatment of cancer.
Amanitin and phallotoxin concentration in Amanita phalloides var. alba mushroom.
Kaya, Ertugrul; Yilmaz, Ismail; Sinirlioglu, Zeynep Aydin; Karahan, Selim; Bayram, Recep; Yaykasli, Kursat Oguz; Colakoglu, Serdar; Saritas, Ayhan; Severoglu, Zeki
2013-12-15
Although rarely seen, Amanita phalloides var. alba, a variety of A. phalloides type mushrooms, causes mushroom poisoning resulting in death. Since it is frequently confused with some edible mushrooms due to its white colored cap and macroscopic appearance, it becomes important in toxicological terms. Knowledge of the toxin amount contained in this mushroom type is invaluable in the treatment of cases involving poisoning. In this study, we examined the toxin levels of various parts of the A. phalloides var. alba mushroom growing Duzce region of Turkey. Toxin analyses were carried out for A. phalloides var. alba, which were collected from the forests Duzce region of Turkey in 2011, as a whole and also separately in its spore, pileus, gills, stipe and volva parts. The alpha amanitin, beta amanitin, gamma amanitin, phalloidin and phallacidine analyses of the mushrooms were carried out using the RP-HPLC method. A genetic analysis of the mushroom showed that it had similar genetic characteristics as A. phalloides and was a variety of it. The lowest toxins quantity was detected in spores, volva and stipe among all parts of the mushroom. The maximum amount of amatoxins was measured in the gills. The pileus also contained a high amount of amatoxins. Generally, amatoxins and phallotoxin concentrations were lower as compared to A. phalloides, but interestingly all toxins other than gamma toxin were higher in the spores of A. phalloides var. alba. The amount of toxin in all of its parts had sufficient concentrations to cause death. With this study, the amatoxin and phallotoxin concentrations in A. phalloides var. alba mushroom and in its parts have been revealed in detail for the first time. Copyright © 2013 Elsevier Ltd. All rights reserved.
Subcellular distribution and chemical forms of thorium in Brassica juncea var. foliosa.
Zhou, Sai; Kai, Hailu; Zha, Zhongyong; Fang, Zhendong; Wang, Dingna; Du, Liang; Zhang, Dong; Feng, Xiaojie; Jin, Yongdong; Xia, Chuanqin
2016-06-01
Brassica juncea var. foliosa (B. juncea var. foliosa) is a promising species for thorium (Th) phytoextraction due to its large biomass, fast growth rate and high tolerance toward Th. To further understand the mechanisms of Th tolerance, the present study investigated the subcellular distribution and chemical forms of Th found in B. juncea var. foliosa Our results indicated that in both roots and leaves, Th contents in different parts of the cells follow the order of cell wall > membranes and soluble fraction > organelles. In particular, Transmission Electron Microscope (TEM) analysis showed that Th was abundantly located in cell walls of the roots. Additionally, when plants were exposed to different concentrations of Th, we have found that Th existed in B. juncea var. foliosa with different chemical forms. Much of the Th extracted by 2% acetic acid (HAc), 1 M NaCl and HCl in roots with the percentage distribution varied from 47.2% to 62.5%, while in leaves, most of the Th was in the form of residue and the subdominant amount of Th was extracted by HCl, followed by 2% HAc. This suggested that Th compartmentation in cytosol and integration with phosphate or proteins in cell wall might be responsible for the tolerance of B. juncea var. foliosa to the stress of Th. Copyright © 2016 Elsevier Ltd. All rights reserved.
Takano, Atsuko
2017-01-01
Both Salvia akiensis and S. lutescens (Lamiaceae) are endemic to Japan. Salvia akiensis was recently described in 2014 in the Chugoku (= SW Honshu) region, and each four varieties of S. lutescens distributed allopatrically. Among varieties in S. lutescens , var. intermedia show a disjunctive distribution in the Kanto (=E Honshu) and Kinki (= W Honshu) regions. Recent field studies of S. lutescens var. intermedia revealed several morphological differences between the Kanto and Kinki populations. Here, I evaluated these differences among Salvia lutescens var. intermedia and its allies with morphological analysis and molecular phylogenetic analyses of nuclear ribosomal DNA (internal and external transcribed spacer regions) and plastid DNA ( ycf1-rps15 spacer, rbcL , and trnL-F ) sequences. Both morphological analysis and molecular phylogenetic analyses showed that S. lutescens var. intermedia from the Kinki region and var. lutescens were closely related to each other. However, var. intermedia from the Kanto region exhibited an association with S. lutescens var. crenata and var. stolonifera, which also grew in eastern Japan, rather than var. intermedia in the Kinki region. These results indicated that S. lutescens var. intermedia is not a taxon with a disjunctive distribution, but a combination of two or more allopatric taxa. Present study also suggested that S. akiensis was most closely related to S. omerocalyx .
Isolation and characterization of wild-type lipoxygenase LOX(Psa)1 from Pleurotus sapidus.
Plagemann, Ina; Krings, Ulrich; Berger, Ralf G
2014-01-01
The lipoxygenase LOX(Psa) 1 of Pleurotus sapidus, originally investigated because of its ability to oxidize (+)-valencene to the valuable grapefruit aroma (+)-nootkatone, was isolated from the peptidase-rich lyophilisate using a three-step purification scheme including preparative isoelectric focusing and chromatographic techniques. Nano-liquid chromatography electrospray ionization tandem mass spectrometry (nLC-ESI-MS/MS) of the purified enzyme and peptide mass fingerprint analysis gave 38 peptides of the lipoxygenase from P. sapidus. Nearly 50% of the 643 amino acids long sequence encoded by the cDNA was covered. Both terminal peptides of the native LOX(Psa) 1 were identified by de novo sequencing, and the postulated molecular mass of 72.5 kDa was confirmed. With linoleic acid as the substrate, the LOX(Psa)1 showed a specific activity of 113 U mg(-1) and maximal activity at pH 7.0 and 30 degrees C, respectively.
Jahangir, M.; Abdel-Farid, I.B.; Vos, de C.H.R.; Jonker, H.H.; Choi, Y.H.; Verpoorte, R.
2014-01-01
Brassica rapa (var. raapstelen) and Raphanus sativus (red radish) are being used as food and fodder while also known as model in recent plant research due to the diversity of metabolites as well as genetic resemblance to Arabidopsis. This study explains the change in metabolites (amino acids,
A Novel Virus-Like Particle Based Vaccine Platform Displaying the Placental Malaria Antigen VAR2CSA.
Directory of Open Access Journals (Sweden)
Susan Thrane
Full Text Available Placental malaria caused by Plasmodium falciparum is a major cause of mortality and severe morbidity. Clinical testing of a soluble protein-based vaccine containing the parasite ligand, VAR2CSA, has been initiated. VAR2CSA binds to the human receptor chondroitin sulphate A (CSA and is responsible for sequestration of Plasmodium falciparum infected erythrocytes in the placenta. It is imperative that a vaccine against malaria in pregnancy, if administered to women before they become pregnant, can induce a strong and long lasting immune response. While most soluble protein-based vaccines have failed during clinical testing, virus-like particle (VLP based vaccines (e.g., the licensed human papillomavirus vaccines have demonstrated high efficacy, suggesting that the spatial assembly of the vaccine antigen is a critical parameter for inducing an optimal long-lasting protective immune response. We have developed a VLP vaccine display platform by identifying regions of the HPV16 L1 coat protein where a biotin acceptor site (AviTagTM can be inserted without compromising VLP-assembly. Subsequent biotinylation of Avi-L1 VLPs allow us to anchor monovalent streptavidin (mSA-fused proteins to the biotin, thereby obtaining a dense and repetitive VLP-display of the vaccine antigen. The mSA-VAR2CSA antigen was delivered on the Avi-L1 VLP platform and tested in C57BL/6 mice in comparison to two soluble protein-based vaccines consisting of naked VAR2CSA and mSA-VAR2CSA. The mSA-VAR2CSA Avi-L1 VLP and soluble mSA-VAR2CSA vaccines induced higher antibody titers than the soluble naked VAR2CSA vaccine after three immunizations. The VAR2CSA Avi-L1 VLP vaccine induced statistically significantly higher endpoint titres compared to the soluble mSA-VAR2CSA vaccine, after 1st and 2nd immunization; however, this difference was not statistically significant after 3rd immunization. Importantly, the VLP-VAR2CSA induced antibodies were functional in inhibiting the binding of
Directory of Open Access Journals (Sweden)
Ixora Requena
2017-11-01
Full Text Available A descriptive study was performed to determine the prevalence of intestinal parasites in a sample of apparently healthy individuals who sold food in streets in Los Proceres of Ciudad Bolívar, Bolívar State. Fecal samples were collected from 85 individuals, which were analyzed by means of direct examination, qualitative Kato, spontaneous sedimentation and Kinyoun staining. Each individual was filled a clinical epidemiological record and underwent anamnesis and oriented clinical examination. The assessed group comprised 50 women and 35 men with ages 14 to 57 years (mean 15.25 ± 4.21 years. From this group, 50 persons (58.82% were parasitized mainly by Blastocystis spp. (42.22%, Endolimax nana (11.11%, Entamoeba coli (6.67%, Giardia intestinalis (11.11%, Cryptosporidium spp. (11.11% and Cystoisospora belli (4.44%. There was no preference for gender or age (p > 0.05, and persons aged 20 to 25 years were the most affected group. Monoparasitism was observed in 56% (n = 28 cases and 44% (n = 22 of cases had other associated parasites, being the most frequent association between Blastocystis spp with Entamoeba coli and Endolimax nana. It is concluded that there is a high prevalence of intestinal parasitosis among street food handlers.
DEFF Research Database (Denmark)
Wang, Christian W; Lavstsen, Thomas; Bengtsson, Dominique C
2012-01-01
ABSTRACT: BACKGROUND: Members of the Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) adhesion antigen family are major contributors to the pathogenesis of P. falciparum malaria infections. The PfEMP1-encoding var genes are among the most diverse sequences in nature, but three genes......, var1, var2csa and var3 are found conserved in most parasite genomes. The most severe forms of malaria disease are caused by parasites expressing a subset of antigenically conserved PfEMP1 variants. Thus the ubiquitous and conserved VAR3 PfEMP1 is of particular interest to the research field. Evidence...... of VAR3 expression on the infected erythrocyte surface has never been presented, and var3 genes have been proposed to be transcribed and expressed differently from the rest of the var gene family members. METHODS: In this study, parasites expressing VAR3 PfEMP1 were generated using anti-VAR3 antibodies...
Warhurst, David C; Craig, John C; Raheem, K Saki
2016-01-01
Antimalarial chloroquine (CQ) prevents haematin detoxication when CQ-base concentrates in the acidic digestive vacuole through protonation of its p-aminopyridine (pAP) basic aromatic nitrogen and sidechain diethyl-N. CQ export through the variant vacuolar membrane export channel, PFCRT, causes CQ-resistance in Plasmodium falciparum but 3-methyl CQ (sontochin SC), des-ethyl amodiaquine (DAQ) and bis 4-aminoquinoline piperaquine (PQ) are still active. This is determined by changes in drug accumulation ratios in parasite lipid (LAR) and in vacuolar water (VAR). Higher LAR may facilitate drug binding to and blocking PFCRT and also aid haematin in lipid to bind drug. LAR for CQ is only 8.3; VAR is 143,482. More hydrophobic SC has LAR 143; VAR remains 68,523. Similarly DAQ with a phenol substituent has LAR of 40.8, with VAR 89,366. In PQ, basicity of each pAP is reduced by distal piperazine N, allowing very high LAR of 973,492, retaining VAR of 104,378. In another bis quinoline, dichlorquinazine (DCQ), also active but clinically unsatisfactory, each pAP retains basicity, being insulated by a 2-carbon chain from a proximal nitrogen of the single linking piperazine. While LAR of 15,488 is still high, the lowest estimate of VAR approaches 4.9 million. DCQ may be expected to be very highly lysosomotropic and therefore potentially hepatotoxic. In 11 pAP antimalarials a quadratic relationship between logLAR and logResistance Index (RI) was confirmed, while log (LAR/VAR) vs logRI for 12 was linear. Both might be used to predict the utility of structural modifications.
BRINE SHRIMP LETHALITY BIOASSAY OF GLAUCIUM GRANDIFLORUM VAR. GRANDIFLORUM
A. SARI, Ç. ÜNSAL, İ. SARIOĞLU, A. SARI, Ç. ÜNSAL, İ. SARIOĞLU
2013-01-01
Türkiye'nin 3 farklı bölgesinden toplanan Glaucium grandiflorum Boiss. et Huet var. grandiflorum örneklerinin toprak üstü kısımlarından elde edilen alkaloit ekstreleri ve bu ekstrelerden elde edilen majör alkaloitler allokriptopin, protopİn, (+)-izokoridin, (+)-korİdin üzerinde brİne shrimp lethality testi yapılarak sitotoksisiteleri İncelenmiştir. Glaucium grandiflorum var. grandiflorum türünün 3 örneği de önemli oranda sitotoksik aktİvite göstermiştir. Allokriptopin, protopin, (+)-izok...
A three-enzyme-system to degrade curcumin to natural vanillin.
Esparan, Vida; Krings, Ulrich; Struch, Marlene; Berger, Ralf G
2015-04-14
The symmetrical structure of curcumin includes two 4-hydroxy-3-methoxyphenyl substructures. Laccase catalyzed formation of a phenol radical, radical migration and oxygen insertion at the benzylic positions can result in the formation of vanillin. As vanillin itself is a preferred phenolic substrate of laccases, the formation of vanillin oligomers and polymers is inevitable, once vanillin becomes liberated. To decelerate the oligomerization, one of the phenolic hydroxyl groups was protected via acetylation. Monoacetyl curcumin with an approximate molar yield of 49% was the major acetylation product, when a lipase from Candida antarctica (CAL) was used. In the second step, monoacetyl curcumin was incubated with purified laccases of various basidiomycete fungi in a biphasic system (diethyl ether/aqueous buffer). A laccase from Funalia trogii (LccFtr) resulted in a high conversion (46% molar yield of curcumin monoacetate) to vanillin acetate. The non-protected vanillin moiety reacted to a mixture of higher molecular products. In the third step, the protecting group was removed from vanillin acetate using a feruloyl esterase from Pleurotus eryngii (PeFaeA) (68% molar yield). Alignment of the amino acid sequences indicated that high potential laccases performed better in this mediator and cofactor-free reaction.
Back, Chang-Gi; Lee, Chang-Yun; Seo, Geon-Sik; Jung, Hee-Young
2012-09-01
Four Cladobotryum isolates were collected from four different commercially grown mushroom types infected with cobweb disease in Cheongdo-gun and Chilgok-gun of Gyeongbuk Province, Korea in 2010. The isolates were identified as C. mycophilum from Agaricus bisporus and Pleurotus eryngii, C. varium from Flammulina velutipes and Hypsizygus marmoreus. The cultural characteristics of the four isolates were investigated using potato dextrose agar (PDA) media under nine different temperatures ranging from 5~32℃. Rapid growth of the isolates to colony diameters of 47~82 mm was observed at conditions of 18~22℃. No growth was observed at 32℃. C. mycophilum produced a yellowish red pigment while C. varium produced a cream colored pigment after cultivation for 25 days on PDA. Phylogenetic analysis of the internal transcribed spacer region and partial 28S rDNA from the four isolates confirmed they were C. mycophilum and C. varium. Cross pathogenicity tests revealed that the two isolates of C. mycophilum were highly pathogenic toward three mushroom types, but not toward H. marmoreus. The two isolates of C. varium were less pathogenic than those of C. mycophilum, but were pathogenic toward all mushroom types evaluated.
Czech Academy of Sciences Publication Activity Database
Šamec, D.; Piljac-Žegarac, J.; Bogovic, M.; Habjanic, K.; Grúz, Jiří
2011-01-01
Roč. 128, č. 2 (2011), s. 78-83 ISSN 0304-4238 R&D Projects: GA AV ČR KAN200380801; GA ČR GA301/08/1649 Institutional research plan: CEZ:AV0Z50380511 Keywords : Antimicrobial activity * Antioxidant capacity * Brassica oleracea L. var. capitata * rapa L. var. pekinensis Lour * Cabbage Subject RIV: EF - Botanics Impact factor: 1.527, year: 2011
Influence of beetroot (Beta vulgaris var. cruenta) on mice leukocytes increase
Amaro, Jony
2014-01-01
Background: Beetroot is a flavonoid-containing Mediterranean plant used for food and medicinal purposes. Objectives: To determine the influence of Beta vulgaris var. cruenta extract consumption in increasing albino mice leukocytes. Design: Experimental study. Setting: School N° 1182 bioterium. Biologic material: Twenty male Balb/c albino mice weighing 24 g average. Interventions: Two groups of ten mice each were formed; the experimental group received Beta vulgaris var. cruenta extract at 250...
Yu, Shao-Shuai; Sun, Qi-Wu; Zhang, Xiao-Ping; Tian, Sheng-Ni; Bo, Pei-Lei
2012-10-01
Taxus chinensis var. mairei is an endemic and endangered plant species in China. The resources of T. chinensis var. mairei have been excessively exploited due to its anti-cancer potential, accordingly, the extant T. chinensis var. mairei population is decreasing. In this paper, ultrasonic extraction and HPLC were adopted to determine the contents of active components paclitaxel, 7-xylosyltaxol and cephalomannine in cultivated and wild T. chinensis var. mairei plants, with the content distribution of these components in different parts of the plants having grown for different years and at different slope aspects investigated. There existed obvious differences in the contents of these active components between cultivated and wild T. chinensis var. mairei plants. The paclitaxel content in the wild plants was about 0.78 times more than that in the cultivated plants, whereas the 7-xylosyltaxol and cephalomannine contents were slishtly higher in the cultivated plants. The differences in the three active components contents between different parts and tree canopies of the plants were notable, being higher in barks and upper tree canopies. Four-year old plants had comparatively higher contents of paclitaxel, 7-xylosyltaxol and cephalomannine (0.08, 0.91 and 0.32 mg x g(-1), respectively), and the plants growing at sunny slope had higher contents of the three active components, with significant differences in the paclitaxel and 7-xylosyltaxol contents and unapparent difference in the cephalomannine content of the plants at shady slope. It was suggested that the accumulation of the three active components in T. chinensis var. mairei plants were closely related to the sunshine conditions. To appropriately increase the sunshine during the artificial cultivation of T. chinensis var. mairei would be beneficial to the accumulation of the three active components in T. chinensis var. mairei plants.
Scleria neesii Kunth var. gadchiroliensis (Cyperaceae, a New Variety from Central India
Directory of Open Access Journals (Sweden)
Milind M. Sardesai
2015-12-01
Full Text Available A new variety of Scleria P. J. Bergius (Cyperaceae S. neesii Kunth var. gadchiroliensis from Central India is described here with description, line-drawing, photographic illustration and notes. It resembles with S. neesii Kunth var. neesii in overall morphology but differs in having milky white nuts covered with ribbon like hairs on distinct stalk.
Utilizing nanobody technology to target non-immunodominant domains of VAR2CSA.
Directory of Open Access Journals (Sweden)
Sisse B Ditlev
Full Text Available Placental malaria is a major health problem for both pregnant women and their fetuses in malaria endemic regions. It is triggered by the accumulation of Plasmodium falciparum-infected erythrocytes (IE in the intervillous spaces of the placenta and is associated with foetal growth restriction and maternal anemia. IE accumulation is supported by the binding of the parasite-expressed protein VAR2CSA to placental chondroitin sulfate A (CSA. Defining specific CSA-binding epitopes of VAR2CSA, against which to target the immune response, is essential for the development of a vaccine aimed at blocking IE adhesion. However, the development of a VAR2CSA adhesion-blocking vaccine remains challenging due to (i the large size of VAR2CSA and (ii the extensive immune selection for polymorphisms and thereby non-neutralizing B-cell epitopes. Camelid heavy-chain-only antibodies (HcAbs are known to target epitopes that are less immunogenic to classical IgG and, due to their small size and protruding antigen-binding loop, able to reach and recognize cryptic, conformational epitopes which are inaccessible to conventional antibodies. The variable heavy chain (VHH domain is the antigen-binding site of camelid HcAbs, the so called Nanobody, which represents the smallest known (15 kDa intact, native antigen-binding fragment. In this study, we have used the Nanobody technology, an approach new to malaria research, to generate small and functional antibody fragments recognizing unique epitopes broadly distributed on VAR2CSA.
Controlling Kuka Industrial Robots : Flexible Communication Interface JOpenShowVar.
Sanfilippo, Filippo; Hatledal, Lars Ivar; Zhang, Houxiang; Fago, Massimiliano; Pettersen, Kristin Ytterstad
2015-01-01
JOpenShowVar is a Java open-source cross-platform communication interface to Kuka industrial robots. This novel interface allows for read-write use of the controlled manipulator variables and data structures. JOpenShowVar, which is compatible with all the Kuka industrial robots that use KUKA Robot Controller version 4 (KR C4) and KUKA Robot Controller version 2 (KR C2), runs as a client on a remote computer connected with the Kuka controller via TCP/IP. Even though only soft real-time applica...
Miragall, Marta; Baños, Rosa M; Cebolla, Ausiàs; Botella, Cristina
2015-01-01
This study examines the psychometric properties of the Working Alliance Inventory-Short (WAI-S) adaptation to Virtual Reality (VR) and Augmented Reality (AR) therapies (WAI-VAR). The relationship between the therapeutic alliance (TA) with VR and AR and clinically significant change (CSC) is also explored. Seventy-five patients took part in this study (74.7% women, M age = 34.41). Fear of flying and adjustment disorder patients received VR therapy, and cockroach phobia patients received AR therapy. Psychometric properties, CSC, one-way ANOVA, Spearman's Correlations and Multiple Regression were calculated. The WAI-VAR showed a unidimensional structure, high internal consistency and adequate convergent validity. "Not changed" patients scored lower on the WAI-VAR than "improved" and "recovered" patients. Correlation between the WAI-VAR and CSC was moderate. The best fitting model for predicting CSC was a linear combination of the TA with therapist (WAI-S) and the TA with VR and AR (WAI-VAR), due to the latter variable slightly increased the percentage of variability accounted for in CSC. The WAI-VAR is the first validated instrument to measure the TA with VR and AR in research and clinical practice. This study reveals the importance of the quality of the TA with technologies in achieving positive outcomes in the therapy.
On Setting Day-Ahead Equity Trading Risk Limits: VaR Prediction at Market Close or Open?
Directory of Open Access Journals (Sweden)
Ana-Maria Fuertes
2016-09-01
Full Text Available This paper investigates the information content of the ex post overnight return for one-day-ahead equity Value-at-Risk (VaR forecasting. To do so, we deploy a univariate VaR modeling approach that constructs the forecast at market open and, accordingly, exploits the available overnight close-to-open price variation. The benchmark is the bivariate VaR modeling approach proposed by Ahoniemi et al. that constructs the forecast at the market close instead and, accordingly, it models separately the daytime and overnight return processes and their covariance. For a small cap portfolio, the bivariate VaR approach affords superior predictive ability than the ex post overnight VaR approach whereas for a large cap portfolio the results are reversed. The contrast indicates that price discovery at the market open is less efficient for small capitalization, thinly traded stocks.
Voolaid, Piret, 1971-
2007-01-01
Autor käsitleb artiklis Ahvenamaa Põhjamaade Instituudi (Nordens Institut på Åland) eestvedamisel korraldatud lastepärimuse projekti, mille käigus koguti koolipärimust Soomest Ahvenamaalt ja Rootsist Gotlandilt ning Eestist endistelt rannarootsi aladelt. Kogutu põhjal ilmus rootsikeelne antoloogiline naljakogumik Det var en ko och det var poängen. Artiklis keskendutakse välitööde kogumismetoodikale ja tulemustele Eestis. Välitööd toimusid Noarootsi Koolis ja Vormsi Põhikoolis
Faske, T R
2013-03-01
Cucumis melo var. texanus, a wild melon commonly found in the southern United States and two accessions, Burleson Co. and MX 1230, expressed resistance to Meloidogyne incognita in preliminary experiments. To characterize the mechanism of resistance, we evaluated root penetration, post-penetration development, reproduction, and emigration of M. incognita on these two accessions of C. melo var. texanus. Additionally, we evaluated 22 accessions of C. melo var. texanus for their reaction against M. incognita in a greenhouse experiment. Fewer (P ≤ 0.05) J2 penetrated the root system of C. melo var. texanus accessions (Burleson Co. and MX 1230) and C. metuliferus (PI 482452) (resistant control), 7 days after inoculation (DAI) than in C. melo 'Hales Best Jumbo' (susceptible control). A delayed (P ≤ 0.05) rate of nematode development was observed at 7, 14, and 21 DAI that contributed to lower (P ≤ 0.05) egg production on both accessions and C. metuliferus compared with C. melo. Though J2 emigration was observed on all Cucumis genotypes a higher (P ≤ 0.05) rate of J2 emigration was observed from 3 to 6 DAI on accession Burleson Co. and C. metuliferus than on C. melo. The 22 accessions of C. melo var. texanus varied relative to their reaction to M. incognita with eight supporting similar levels of nematode reproduction to that of C. metuliferus. Cucumis melo var. texanus may be a useful source of resistance against root-knot nematode in melon.
Tao, Qiao-Qiao; Ma, Ke; Bao, Li; Wang, Kai; Han, Jun-Jie; Zhang, Jin-Xia; Huang, Chen-Yang; Liu, Hong-Wei
2016-06-01
Nine new sesquiterpenoids, clitocybulol derivatives, clitocybulols G-O (1-9) and three known sesquiterpenoids, clitocybulols C-E (10-12), were isolated from the solid culture of the edible fungus Pleurotus cystidiosus. The structures of compounds 1-12 were determined by spectroscopic methods. The absolute configurations of compounds 1-9 were assigned via the circular dichroism (CD) data analysis. Compounds 1, 6 and 10 showed moderate inhibitory activity against protein tyrosine phosphatase-1B (PTP1B) with IC50 values of 49.5, 38.1 and 36.0μM, respectively. Copyright © 2016. Published by Elsevier B.V.
Chegwin Angarita, Carolina
2014-01-01
El cultivo biotecnológico empleando fermentaciones en estado líquido de hongos del género Pleurotus, usando salvado de trigo y harinas de cereales y leguminosas como fuentes de carbono no convencionales, en busca de evaluar el efecto del cambio de algunas condiciones del proceso sobre la composición tanto de los micelios como de los caldos agotados y por ende del potencial como nutriceútico del mismo, para posteriormente evaluar la aplicabilidad de dicho producto en la obtención de fructifica...
Directory of Open Access Journals (Sweden)
B. T. Santos
2016-11-01
Full Text Available This study aimed to evaluate the potential of essential oils of rosemary (Rosmarinus officinalis, baccharis (Baccharis trimera, lemon grass (Cymbopogon citratus, basil (Ocimum basilicum and eucalyptus (Corymbia citriodora in inducing resistance in cotton plants against C. gossypii var. cephalosporioides. The inductive effect of the essential oils was evaluated in plants growing in pots in the environment, which were treated with 1% essential oil at 47 days of age. 24 hours after elicitor treatment the plants were inoculated with a suspension of 1.5 x 105 conidia mL-1 of C. gossypii var. cephalosporioides. Five evaluations were performed disease and calculated the area under the disease progress curve. All essential oils showed potential for inducing resistance against cotton C. gossypii var. cephalosporioides.
Application of superconducting coils to VAR control in electric power systems: a proposal
International Nuclear Information System (INIS)
Boenig, H.J.; Hassenzahl, W.V.
1979-11-01
During the last eight years, static VAR-control systems with thyristor-controlled, room-temperature reactors have been used in electrical systems for voltage control and system stabilization. In this proposal, we describe a new static VAR-control system that uses an asymmetrically controlled Graetz bridge and a superconducting dc coil. Preliminary studies indicate that the proposed system will have lower overall losses and that its capital cost and electrical characteristics are comparable to those of a conventional system. Three- and four-year programs for developing the electronic circuitry and superconducting coils for VAR control, culminating in the installation and testing of an approx. 40-MVAR system, are proposed
Ji, X.
2014-01-01
Numerical and structural chromosome aberrations in cauliflower (Brassica oleracea var. botrytis) and Arabidopsis thaliana.
I studied numerical and structural chromosome aberrations in cauliflower (Brassica oleracea var. botrytis) and
Lignocellulolytic enzyme production of Pleurotus ostreatus growth in agroindustrial wastes
Directory of Open Access Journals (Sweden)
José Maria Rodrigues da Luz
2012-12-01
Full Text Available The mushroom Pleurotus ostreatus has nutritional and medicinal characteristics that depend on the growth substrate. In nature, this fungus grows on dead wood, but it can be artificially cultivated on agricultural wastes (coffee husks, eucalyptus sawdust, corncobs and sugar cane bagasse. The degradation of agricultural wastes involves some enzyme complexes made up of oxidative (laccase, manganese peroxidase and lignin peroxidase and hydrolytic enzymes (cellulases, xylanases and tanases. Understanding how these enzymes work will help to improve the productivity of mushroom cultures and decrease the potential pollution that can be caused by inadequate discharge of the agroindustrial residues. The objective of this work was to assess the activity of the lignocellulolytic enzymes produced by two P. ostreatus strains (PLO 2 and PLO 6. These strains were used to inoculate samples of coffee husks, eucalyptus sawdust or eucalyptus bark add with or without 20 % rice bran. Every five days after substrate inoculation, the enzyme activity and soluble protein concentration were evaluated. The maximum activity of oxidative enzymes was observed at day 10 after inoculation, and the activity of the hydrolytic enzymes increased during the entire period of the experiment. The results show that substrate composition and colonization time influenced the activity of the lignocellulolytic enzymes.
Directory of Open Access Journals (Sweden)
Jin-Wen Shen
2013-01-01
Full Text Available Culture conditions for exopolysaccharide (EPS production by Pleurotus pulmonarius in submerged culture are optimized. The suggested medium composition was as follows: 60 g/L of xylose, 6 g/L of soy extract, 5 mM of KH2PO4 and 5 mM of MgSO4. Under the optimized culture conditions in a 5-litre stirred tank fermentor, the maximum concentration of EPS was 6.36 g/L. Furthermore, the morphological parameters (i.e. average diameter, circularity, roughness and compactness of the pellets and the broth viscosity are characterized. It has been proven that mycelial morphology and broth viscosity may be the critical parameters affecting the EPS yield. After deproteinization using Sevag method, a group of EPS (designated as fraction was obtained from the culture filtrates by gel filtration chromatography. FT-IR analysis of the purified EPS revealed prominent characteristic groups corresponding to polyhydric alcohols. GC analysis showed that the purified EPS were mainly composed of galactose and glucose. Furthermore, thermogravimetric analysis indicated that the degradation temperature of the purified EPS was 217 °C. Finally, the antioxidant activity of the EPS fraction was investigated and the relationship with molecular properties was discussed as well.
[Diversity and community structure of endophytic fungi from Taxus chinensis var. mairei].
2014-07-01
A total of 628 endophytic fungi were isolated from 480 tissue segments of needles and branches of Taxus chinensis var. mairei. According to morphological characteristics and ITS sequences, they represented 43 taxa in 28 genera, of which 10 Hyphomycetes, 20 Coelomycetes, 12 Ascomycetes and 1 unknown fungus. Phomopsis mali was confirmed as the dominant species. In accordance with relative frequency, Alternaria alternata, Aureobasidium pullulans, Colletotrichum boninense, C. gloeosporioides, Epicoccum nigrum , Fungal sp., Fusarium lateritium, Glomerella cingulata, Magnaporthales sp. , Nigrospora oryzae, Pestalotiopsis maculiformans, P. microspora, Peyronellaea glomerata and Xylaria sp. 1 were more common in T. chinensis var. mairei. T. chinensis var. mairei were severely infected by endophytic fungi. Endophytic fungi were found in 81 percent of plant tissues with a high diversity. Distribution ranges of endophytic fungi were influenced by tissue properties. The colonization rate, richness, diversity of endophytic fungi in needles were obviously lower than in branches, and kinds of endophytic fungi between branches were more similar than those in needles, thus endophytic fungi had tissue preference. In addition, tissue age influenced the community structure of endophytic fungi. The elder branch tissues were, the higher colonization rate, richness, diversity of endophytic fungi were. Systematic studying the diversity and community structure of endophytic fungi in T. chinensis var. mairei and clarifying their distribution regularity in plant tissues would offer basic data and scientific basis for their development and utilization. Discussing the presence of fungal pathogens in healthy plant tissues would be of positive significance for source protection of T. chinensis var. mairei.
DEFF Research Database (Denmark)
Tabor, Morten Nyboe
2014-01-01
conrm the original intuition behind the attempt to combine IKE and the econometric approach based on the cointegrated VAR model, that the parameter-instability of IKE models could potentially be an important source of the persistence found empirically in estimated cointegrated VAR models...
Xie, Zhong-de; Jia, Han; Fu, Shao-Zhi; Gao, Wen-Yuan; Zhang, Zhi-Wei; Sun, Wei
2017-11-01
The study aims at investigating the ecological environment Adiantum reniforme var. sinense of in Three Gorges Reservoir region, and providing a reference basis for the protection of resources and artificial cultivation of A. reniforme var. sinense. By using the method of investigation, field survey and experimental analysis, the vegetation, natural geographical environment, climate, soil nutrients of A. reniforme var. sinense were studied and analyzed. The survey found that A. reniforme var. sinense distribution area reduced fast in Three Gorges region, a lot of distribution has diminished and vanished due to excessive digging, currently only in 3 towns of Wanzhou there exist 4 wild distribution areas. The growth of A. reniforme var. sinense needs an environment with low altitude, steep slope and thin soil, northeast slope, canopy height and warm and humid climate characteristics, and the soil in distribution has the characteristics of high organic matter, available nitrogen, available potassium, and low available phosphorus content. Copyright© by the Chinese Pharmaceutical Association.
Potential for wind extraction from 4D-Var assimilation of aerosols and moisture
Zaplotnik, Žiga; Žagar, Nedjeljka
2017-04-01
We discuss the potential of the four-dimensional variational data assimilation (4D-Var) to retrieve the unobserved wind field from observations of atmospheric tracers and the mass field through internal model dynamics and the multivariate relationships in the background-error term for 4D-Var. The presence of non-linear moist dynamics makes the wind retrieval from tracers very difficult. On the other hand, it has been shown that moisture observations strongly influence both tropical and mid-latitude wind field in 4D-Var. We present an intermediate complexity model that describes nonlinear interactions between the wind, temperature, aerosols and moisture including their sinks and sources in the framework of the so-called first baroclinic mode atmosphere envisaged by A. Gill. Aerosol physical processes, which are included in the model, are the non-linear advection, diffusion and sources and sinks that exist as dry and wet deposition and diffusion. Precipitation is parametrized according to the Betts-Miller scheme. The control vector for 4D-Var includes aerosols, moisture and the three dynamical variables. The former is analysed univariately whereas wind field and mass field are analysed in a multivariate fashion taking into account quasi-geostrophic and unbalanced dynamics. The OSSE type of studies are performed for the tropical region to assess the ability of 4D-Var to extract wind-field information from the time series of observations of tracers as a function of the flow nonlinearity, the observations density and the length of the assimilation window (12 hours and 24 hours), in dry and moist environment. Results show that the 4D-Var assimilation of aerosols and temperature data is beneficial for the wind analysis with analysis errors strongly dependent on the moist processes and reliable background-error covariances.
Zhang, He-ting; Wang, Jian; Cheng, Ming-en; Duan, Hai-yan; Peng, Hua-sheng
2015-12-01
To investigate the main cultivation areas of Astragalus membranaceus var. mongholicus, and to clarify its present cultivation status and commercial specification grades. Astragalus membranaceus var. mongholicus cultivated in Hunyuan and Ying County of Shanxi, Longxi, Weiyuan and Min County of Gansu and Wuchuan, Guyang and Chifeng of Inner Mongolia were investigated, including their ecological environment, cultivation history and present situation, harvesting and processing as well as commercial specification grades. The cultivation methods of Astragalus membranaceus var. mongholicus changed greatly in the main cultivation areas. In Gansu and Inner Mongolia, the current major cultivation method was 2 - 3 years of seedling transplantation method, while the 3 - 5 years of seed-directly-sowed method in Inner Mongolia had been almost abandoned, and the 6 - 8 years of mountain direct seeding method was still in application in Hunyuan county of Shanxi province. On the other hand, the harvest method of Astragalus membranaceus var. mongholicus had been gradually changed from manual harvesting in ancient times to the current mechanical harvesting although the latter method did more damage to environment of cultivation areas and the resource of Astragalus membranaceus var. mongholicus in regions Hunyuan county of Shanxi. Through investigating the processing methods of Astragalus membranaceus var. mongholicus in different cultivation areas, it was found that processing method varied from area to area, and no unified specifications had been formulated on processing methods in market. In addition, the current processing method was too complicated in processing the slices of prepared Astragali Radix and most were self processing by farmers themselves, creating market disorders. Moreover, the Astragali Radix products were basically without grading classification but sold as bulk cargo. It is urgent to unify the specifications and grades of Astragali Radix product, and standardize
Anatomical element localization by EDXS in Grevillea exul var. exul under nickel stress
International Nuclear Information System (INIS)
Rabier, J.; Laffont-Schwob, I.; Notonier, R.; Fogliani, B.; Bouraima-Madjebi, S.
2008-01-01
Grevillea exul var. exul, an endemic serpentinic Proteaceae of New Caledonia, was chosen to study the spatial distribution of Ni because this species supports strong content of metals, which can allow important absorptions thus detectable by microanalysis. Fine transversal sections of axenic G. exul var. exul plants grown during 15 days on nickel sulphate medium were examined by EDXS microanalysis. It showed that in Ni treated plants, Ni was concentrated mostly in the phloem compared to the xylem and the epidermis, either in roots or in the basal part of the stems and was mostly in the epidermis in the upper part of the stems and not detectable in the leaves. This metal took the place of P and K in the treated plants whereas the localization of these macroelements was quite uniform in control sections. We assume that a mechanism of phloem loading is implicated to restrict Ni accumulation in G. exul var. exul. - Ni resistance mechanism in Grevillea exul var. exul plants depends on a basipetal export mechanism
Anatomical element localization by EDXS in Grevillea exul var. exul under nickel stress
Energy Technology Data Exchange (ETDEWEB)
Rabier, J. [Equipe Biomarqueurs et Bioindicateurs Environnementaux, Institut Mediterraneen d' Ecologie et de Paleoecologie, UMR CNRS 6116, Universite de Provence, Case 17, 3 Place Victor Hugo, 13331 Marseille Cedex 3 (France)], E-mail: Jacques.Rabier@univ-provence.fr; Laffont-Schwob, I. [Equipe Biomarqueurs et Bioindicateurs Environnementaux, Institut Mediterraneen d' Ecologie et de Paleoecologie, UMR CNRS 6116, Universite de Provence, Case 17, 3 Place Victor Hugo, 13331 Marseille Cedex 3 (France)], E-mail: Isabelle.Schwob@univ-provence.fr; Notonier, R. [Service commun de microscopie electronique, Universite de Provence, Case 76, 3 Place Victor Hugo, 13331 Marseille Cedex 3 (France)], E-mail: Roger.Notonier@univ-provence.fr; Fogliani, B. [MABioM, Universite de la Nouvelle-Caledonie, BP R4, 98847 Noumea, New Caledonia (France)], E-mail: bfoglian@univ-nc.nc; Bouraima-Madjebi, S. [MABioM, Universite de la Nouvelle-Caledonie, BP R4, 98847 Noumea, New Caledonia (France)], E-mail: bouraima@univ-nc.nc
2008-12-15
Grevillea exul var. exul, an endemic serpentinic Proteaceae of New Caledonia, was chosen to study the spatial distribution of Ni because this species supports strong content of metals, which can allow important absorptions thus detectable by microanalysis. Fine transversal sections of axenic G. exul var. exul plants grown during 15 days on nickel sulphate medium were examined by EDXS microanalysis. It showed that in Ni treated plants, Ni was concentrated mostly in the phloem compared to the xylem and the epidermis, either in roots or in the basal part of the stems and was mostly in the epidermis in the upper part of the stems and not detectable in the leaves. This metal took the place of P and K in the treated plants whereas the localization of these macroelements was quite uniform in control sections. We assume that a mechanism of phloem loading is implicated to restrict Ni accumulation in G. exul var. exul. - Ni resistance mechanism in Grevillea exul var. exul plants depends on a basipetal export mechanism.
Forecasting VaR and ES of stock index portfolio: A Vine copula method
Zhang, Bangzheng; Wei, Yu; Yu, Jiang; Lai, Xiaodong; Peng, Zhenfeng
2014-12-01
Risk measurement has both theoretical and practical significance in risk management. Using daily sample of 10 international stock indices, firstly this paper models the internal structures among different stock markets with C-Vine, D-Vine and R-Vine copula models. Secondly, the Value-at-Risk (VaR) and Expected Shortfall (ES) of the international stock markets portfolio are forecasted using Monte Carlo method based on the estimated dependence of different Vine copulas. Finally, the accuracy of VaR and ES measurements obtained from different statistical models are evaluated by UC, IND, CC and Posterior analysis. The empirical results show that the VaR forecasts at the quantile levels of 0.9, 0.95, 0.975 and 0.99 with three kinds of Vine copula models are sufficiently accurate. Several traditional methods, such as historical simulation, mean-variance and DCC-GARCH models, fail to pass the CC backtesting. The Vine copula methods can accurately forecast the ES of the portfolio on the base of VaR measurement, and D-Vine copula model is superior to other Vine copulas.
Directory of Open Access Journals (Sweden)
Patrick Schmidt
2003-12-01
Full Text Available A inoculação de forragens com fungos lignocelulolíticos é uma opção para melhorar a qualidade destas sem adição de produtos químicos. O tratamento do substrato influencia a ação do fungo e a qualidade final do produto. Neste experimento, aplicaram-se quatro tratamentos (compostagem do feno inteiro, compostagem do feno picado, hidratação do feno em água fria e hidratação do feno em água quente a um feno de Brachiaria decumbens. Aos tratamentos seguiu-se inoculação com o fungo Pleurotus ostreatus e incubação por 35 dias, sob temperatura controlada. Usou-se o delineamento inteiramente casualizado, com quatro repetições e medidas repetidas. Amostras foram colhidas semanalmente para acompanhar a degradação do substrato, mediante a análise química do feno. Observou-se aumento linear, com o decorrer do tempo, no teor de proteína bruta (PB e na proporção de lignina na parede celular (LIG-FDN, e decréscimo linear nos valores de fibra em detergente neutro (FDN, celulose e hemicelulose. Não se observou efeito de tratamento no teor de FDA. Os tratamentos com compostagem apresentaram maiores valores de PB, lignina e LIG-FDN e menores de FDN e hemicelulose. Não se observou diferença entre os tratamentos com hidratação. O tratamento do feno de braquiária com o fungo propiciou degradação da fração fibrosa e aumento no teor de PB, com efeito mais intenso nos tratamentos que usaram compostagem. A ação do fungo foi mais efetiva sobre a hemicelulose que sobre os demais componentes da fibra.The innoculation of forages with lignocellulolytic fungi is an option for improving quality without adding chemical products. Substrate quality influences fungal activity and endproduct quality. The effects of four treatments (composting of whole hay, composting of chopped hay, soaking in cool water and soaking in hot water on a Brachiaria decumbens hay were evaluated. The treatments were followed by innoculation with Pleurotus ostreatus
Directory of Open Access Journals (Sweden)
Kátia Maria Gomes Machado
2006-12-01
Full Text Available Pleurotus ostreatus ("shimeji" is produced in Brazil on a commercial scale using various lignocellulosic residues. Efforts have been made to reuse the culture residue to obtain products of greater aggregate value such as enzymes or in processes of bioremediation. We evaluated the Remazol brilliant blue R (RBBR degradation potential of extracts from solid substrate colonized by P. ostreatus and extracts from residue of the "shimeji" mushroom yield. Colonized substrates and residue were provided by Toyobo do Brasil Ltda. Extraction was performed with sodium acetate buffer (50 mM, pH 4.6. RBBR decolorization was monitored at 592 nm and peroxidase and laccase activities were measured by monitoring the oxidation of ABTS. Horseradish peroxidase was used as reference. The time of growth of P. ostreatus influenced RBBR degradation and peroxidase and laccase activities. Concentration of 1 mM H2O2 and pH 4.0 were the best for RBBR decolorization. Complete RBBR decolorization was obtained with the addition of only one aliquot of 50 µL of 1 mM H2O2. The stability of the extracts was higher when they were kept under refrigeration than when stored frozen. The potential application of the ligninolytic complex derived from P. ostreatus and mushroom residue for xenobiotic degradation was demonstrated.Pleurotus ostreatus ("shimeji" é produzido no Brasil em escala comercial empregando-se vários resíduos lignocelulósicos. Esforços têm sido feitos para reaproveitamento do resíduo do cultivo em produtos de maior valor agregado, como enzimas ou sua aplicação em processos de biorremediação. Foi feita avaliação do potencial de degradação do azul brilhante de remazol (RBBR por extratos obtidos de substratos sólidos colonizados por P. ostreatus e por extratos do resíduo da produção do cogumelo "shimeji". Substratos colonizados e o resíduo foram fornecidos pela Toyobo do Brasil Ltda. Extração foi feita com tampão acetato de sódio (50 mM, pH 4
Directory of Open Access Journals (Sweden)
Szu-I Hsieh
2013-06-01
Full Text Available Abelmoschus manihot var. pungens (Roxburgh Hochreutiner is naturalized in abandoned land of central Taiwan. The distinguished characteristics of A. manihot var. pungens include the ovate-lanceolate epicalyx lobes, distinct prickly hairs all over the plant, and even over the margins of its epicalyx lobes. Descriptions, line drawings and photos of this species are provided.
[Study on quality standard of Mucuna pruriens var. utilis].
Wu, Shi-Hong; Jiang, Wei-Zhe; Lv, Li; Wu, Ling-Ling; Lv, Cong; Shi, Xiao-Xia; Su, Gui-Liang
2009-03-01
To provide scientific basis for the utilization and development of Mucuna pruriens var. utilis by establishing its quality control standard. The bioactive constituents were analyzed by TLC and HPLC. Moisture, ash and the extracts of Mucuna pruriens var. utilis were all determined. The TLC spots of levodopa had similar color with the control group at the same position. The results of HPLC quantitative analysis showed that the linear range of levodopa was 26.45 to approximately 132.25 microg/mL, r = 0.9992, and the average recovery rate was 103.8%, RSD = 1.85%. This method is convenient, accurate, reliable with good reproducibility, so it can be used to establish quality standard for the medicinal material.
A Stochastic Dominance Approach to the Basel III Dilemma: Expected Shortfall or VaR?
C-L. Chang (Chia-Lin); J.A. Jiménez-Martín (Juan-Ángel); E. Maasoumi (Esfandiar); M.J. McAleer (Michael); T. Pérez-Amaral (Teodosio)
2015-01-01
markdownabstract__Abstract__ The Basel Committee on Banking Supervision (BCBS) (2013) recently proposed shifting the quantitative risk metrics system from Value-at-Risk (VaR) to Expected Shortfall (ES). The BCBS (2013) noted that “a number of weaknesses have been identified with using VaR for
Directory of Open Access Journals (Sweden)
Vanessa B.M.G. Spini
2000-03-01
Full Text Available The cauliflower (Brassica oleracea var. botrytis is an annual vegetable cultivated in Southern and Southwestern Brazil with limited production in the Northeast and Centralwest. A variety of Chinese kale, "kaai laan" or "gaillon" (Brassica oleracea var. alboglabra, produces seeds at high temperatures and therefore can do so in North and Northeastern Brazil. Gaillon and cauliflower were crossed 55 times using 10 gaillon plants as mothers and 4 cauliflower plants as pollen donors. From these crosses, in the F2 generation, 612 plants with inflorescence like gaillon and 48 plants with inflorescence like cauliflower were obtained, in a proportion similar to 15:1, implying that 2 pairs of genes entered into formation of the cauliflower inflorescence type. In order to study flower color, 339 plants were analyzed: 274 presented white flowers and 65, yellow flowers, denoting that this caracter is determined by 1 pair of genes, white being dominant over yellow; white flowers had a slighly higher adaptive value in our population. The characteristic waxy leaf showed a proportion of 3 waxy plants for 1 not waxy, indicating the action of one pair of genes.A couve-flor (Brassica oleracea var. botrytis é um vegetal anual e tem seu cultivo no Brasil limitado às regiões Sul e Sudeste, com pequena produção no Nordeste e Centro-Oeste. Uma variedade de couve da China, "kaai laan" ou "gaillon" (Brassica oleracea var. alboglabra, produz sementes em altas temperaturas e, portanto, é apta a produzir sementes no Norte e Nordeste do Brasil. Gaillon e couve-flor foram cruzados. Foram feitos 55 cruzamentos usando 10 plantas de gaillon como mãe e 4 plantas de couve-flor como doadores de pólen. Desses cruzamentos, na geração F2, 612 plantas com inflorescência tipo gaillon e 48 plantas com inflorescência tipo couve-flor foram obtidas, em proporção similar a 15:1, demonstrando que 2 pares de genes estão envolvidos na formação da inflorescência em couve
DE Lara, Ana Paula DE Souza Stori; Lorenzon, Lucas Bigolin; Vianna, Ana Muñoz; Santos, Francisco Denis Souza; Pinto, Luciano Silva; Aires Berne, Maria Elisabeth; Leite, Fábio Pereira Leivas
2016-10-01
Effective control of gastrointestinal parasites is necessary in sheep production. The development of anthelmintics resistance is causing the available chemically based anthelmintics to become less effective. Biological control strategies present an alternative to this problem. In the current study, we tested the larvicidal effects of Bacillus thuringiensis var. israelensis Cry11Aa toxin against Haemonchus contortus larvae. Bacterial suspensions [2 × 108 colony-forming units (CFU) g-1 of the feces] of B. thuringiensis var. israelensis and recombinant Escherichia coli expressing Cry11Aa toxin were added to naturally H. contortus egg-contaminated feces. The larvae were quantified, and significant reductions of 62 and 81% (P var. israelensis and recombinant E. coli expressing Cry11Aa toxin were then orally administered to lambs naturally infected with H. contortus. Twelve hours after administration, feces were collected and submitted to coprocultures. Significant larvae reductions (P var. israelensis is a promising new class of biological anthelmintics for treating sheep against H. contortus.
Cai, Jian-Piao; Liu, Ling-Li; To, Kelvin K W; Lau, Candy C Y; Woo, Patrick C Y; Lau, Susanna K P; Guo, Yong-Hui; Ngan, Antonio H Y; Che, Xiao-Yan; Yuen, Kwok-Yung
2015-01-01
Cryptococcus neoformans var. neoformans is an important fungal pathogen. The capsule is a well established virulence factor and a target site for diagnostic tests. The CPL1 gene is required for capsular formation and virulence. The protein product Cpl1 has been proposed to be a secreted protein, but the characteristics of this protein have not been reported. Here we sought to characterize Cpl1. Phylogenetic analysis showed that the Cpl1 of C. neoformans var. neoformans and the Cpl1 orthologs identified in C. neoformans var. grubii and C. gattii formed a distinct cluster among related fungi; while the putative ortholog found in Trichosporon asahii was distantly related to the Cryptococcus cluster. We expressed Cpl1 abundantly as a secreted His-tagged protein in Pichia pastoris. The protein was used to immunize guinea pigs and rabbits for high titer mono-specific polyclonal antibody that was shown to be highly specific against the cell wall of C. neoformans var. neoformans and did not cross react with C. gattii, T. asahii, Aspergillus spp., Candida spp. and Penicillium spp. Using the anti-Cpl1 antibody, we detected Cpl1 protein in the fresh culture supernatant of C. neoformans var. neoformans and we showed by immunostaining that the Cpl1 protein was located on the surface. The Cpl1 protein is a specific surface protein of C. neoformans var. neoformans. © 2015 by The Mycological Society of America.
Energy Technology Data Exchange (ETDEWEB)
Betts, C.; Ruf, R.H. Jr.
1966-01-01
Cantaloupe (Cucumis melo L. var. reticulatus) and lettuce (Lactuca sativa L. var. crispa) were grown in the greenhouse in redwood boxes with bare and plastic mulched soil. Soil temperature in the bare boxes was equated to the plastic mulch with buried temperature coils. Bottled CO/sub 2/ was used to bring the concentration around the plants in bare soil up to the concentration around mulched plants. Carbon dioxide was sampled in leaf canopy. The temperature treatment increased the yields of the bare soil so that they were comparable to those of the plastic mulched soil. Yields from the soil with the auxiliary CO/sub 2/ were lower than those of the mulched treatment.
Eom, Hee Jeong; Kang, Hee Rae; Kim, Ho Kyong; Jung, Eun Bee; Park, Hyun Bong; Kang, Ki Sung; Kim, Ki Hyun
2016-06-01
The bark of Betula platyphylla var. japonica (Betulaceae) has been used to treat pneumonia, choloplania, nephritis, and chronic bronchitis. This study aimed to investigate the bioactive chemical constituents of the bark of B. platyphylla var. japonica. A bioassay-guided fractionation and chemical investigation of the bark of B. platyphylla var. japonica resulted in the isolation and identification of a new lupane-type triterpene, 27-hydroxybetunolic acid (1), along with 18 known triterpenoids (2-19). The structure of the new compound (1) was elucidated on the basis of 1D and 2D NMR spectroscopic data analysis as well as HR-ESIMS. Among the known compounds, chilianthin B (17), chilianthin C (18), and chilianthin A (19) were triterpene-lignan esters, which are rarely found in nature. Compounds 4, 6, 7, 17, 18, and 19 showed significant antioxidant activities with IC50 values in the range 4.48-43.02μM in a DPPH radical-scavenging assay. However, no compound showed significant inhibition of acetylcholine esterase (AChE). Unfortunately, the new compound (1) exhibited no significance in both biological activities. This study strongly suggests that B. platyphylla var. japonica bark is a potential source of natural antioxidants for use in pharmaceuticals and functional foods. Copyright © 2016 Elsevier Inc. All rights reserved.
Jayakumar, T; Ramesh, E; Geraldine, P
2006-12-01
This study was undertaken to investigate the putative antioxidant activity of the oyster mushroom Pleurotus ostreatus on CCl(4)-induced liver damage in male Wistar rats. Intraperitoneal administration of CCl(4) (2ml/kg) to rats for 4 days resulted in significantly elevated (pSALP) compared to controls. In the liver, significantly elevated levels (pSALP levels reverted to near normal, while the hepatic concentration of GSH, CAT, SOD and Gpx were significantly increased (p<0.05) and that of MDA significantly (p<0.05) lowered, when compared to CCl(4)-exposed untreated rats. Histopathological studies confirmed the hepatoprotective effect conferred by the extract of P. ostreatus. These results suggest that an extract of P. ostreatus is able to significantly alleviate the hepatotoxicity induced by CCl(4) in the rat.
Lang, Duo-yong; Fu, Xue-yan; Rong, Jia-wang; Zhang, Xin-hui
2015-01-01
To explore the relationship between continuous cropping obstacle and autotoxicity of Astragalus membranaceus var. mongholicus. Distilled water(CK), water extracts of rhizosphere soil(50, 100, 200 and 400 mg/mL) were applied to test their effect on early growth and physiological characteristics of Astragalus membranaceus var. mongholicus. The water extracts from rhizospher soil of cultivated Astragalus membranaceus var. mongholicus significantly increased seedling emergence rate, root length and vigor index of Astragalus membranaceus var. mongholicus seedling when at the concentration of 100 mg/mL or below, however,there was no significant effect at 200 mg/mL or higher. The water extracts from rhizosphere soil of cultivated Astragalus membranaceus var. mongholicus significantly reduced the SOD activity in Astragalus membranaceus var. mongholicus seedling at 400 mg/mL and POD activity at 200 mg/mL and 400 mg/mL,while significantly increased the MDA content. Water extracts from Astragalus membranaceus var. mongholicus rhizosphere soil significantly affected Astragalus membranaceus var. mongholicus germination and seedling growth in a concentration-dependent manner, generally, low concentrations increased the SOD and POD activity which improved seed germination and seedling growth, while high concentrations caused cell membrane damage of the seedling.
Krockenberger, M B; Canfield, P J; Malik, R
2002-06-01
This study is the one in a series looking at the relationship among Cryptococcus neoformans var. gattii, koalas and the environment. The koala was used as a natural biological sampler in an attempt to understand the dynamics of C. neoformans var. gattii in Australian environments. Evidence of asymptomatic nasal and skin colonization for extended periods by large numbers of C. n. var. gattii was obtained and geographical factors assessed. The key finding was the ability of koalas to amplify numbers of C. n. var. gattii in certain environments. Koalas were not found to be obligatory for the survival of the organism in all environments. Geographical factors alone could not explain differing rates of nasal and skin colonization in koalas in different environments. A strong association between healthy koalas and C. n. var. gattii was confirmed and C n. var. gattii was isolated from novel sources, including the turpentine gum tree (Syncarpia glomulifera), tallowwood (Eucalyptus microcorys) and flooded gum (E. grandis). It seems likely that as yet undiscovered environmental sources of C. n. var. gattii exist in eastern Australia. Further investigation of host, environmental and organism factors integral to the hostpathogen relationship will assist an understanding of the progression from colonization to tissue invasion and cryptococcosis in all species.
Occurrence of pathotypes of Phoma medicaginis var. pinodella (Jones Boerema in the Olsztyn district
Directory of Open Access Journals (Sweden)
Helena Furgał-Węgrzycka
2013-12-01
Full Text Available The causal agents of leaves and pods spot-pot of peas and field peas in the Olsztyn district was the fungus Phoma medicaginis var. pinodella. Investigated isolates of P. medicaginis var. pinodella differed by macroscopic and microscopic features. From diseases leaves and pods of peas and field peas obtained also saprophytic fungi among which Alternaria alternata, Botrytis cinerea, Cladosporium cladosporioides, Epicoccum purpurascens, Stemphylium botryosum, Sordaria fimicola and mycelia sterilia were dominated. In the study on the identification and distribution of pathotypes of P. medicaginis var. pinodella six pathotypes were identified among which pathotype 3 were dominated. The identified pathotypes differed by macroscopic and microscopic features.
Is Solanum ferox var. ferox (Solanaceae) extinct?
Heiser, C.B.
2001-01-01
In 1995 I wrote letters to over 50 people (botanists, agricultural scientists, and former students of Indiana University) in south-eastern Asia trying to obtain a few seeds of Solanumferox L. var. ferox (S. involucratum Blume). I had over 25 replies, five of which included seeds, but none of the
Fastman, Yair; Noble, Robert; Recker, Mario; Dzikowski, Ron
2012-01-01
Antigenic variation in Plasmodium falciparum is regulated by transcriptional switches among members of the var gene family, each expressed in a mutually exclusive manner and encoding a different variant of the surface antigens collectively named PfEMP1. Antigenic switching starts when the first merozoites egress from the liver and begin their asexual proliferation within red blood cells. By erasing the epigenetic memory we created parasites with no var background, similar to merozoites that egress from the liver where no var gene is expressed. Creating a null-var background enabled us to investigate the onset of antigenic switches at the early phase of infection. At the onset of switching, var transcription pattern is heterogeneous with numerous genes transcribed at low levels including upsA vars, a subtype that was implicated in severe malaria, which are rarely activated in growing cultures. Analysis of subsequent in vitro switches shows that the probability of a gene to turn on or off is not associated with its chromosomal position or promoter type per se but on intrinsic properties of each gene. We concluded that var switching is determined by gene specific associated switch rates rather than general promoter type or locus associated switch rates. In addition, we show that fine tuned reduction in var transcription increases their switch rate, indicating that transcriptional perturbation can alter antigenic switching. PMID:22461905
Zheng, Shun-lin; Tian, Meng-liang; Liu, Jin-liang; Zhao, Ting-ting; Zhang, Zhong
2014-09-01
To decide on the optimum artificial domestication cultivation light environment for Paris polyphylla var. chinensis through investigating the effect of light intensity on leaf's gas exchange parameters, photosynthetic parameters, light saturation point and compensation point of Paris polyphylla var. chinensis. Different low-light stress gradients' effect on the growth of Paris polyphylla var. chinensis was compared with no low-light stress treatment through calculating leaf's gas exchange parameters, photosynthetic parameters, light saturation point and compensation point, and then all these parameters were statistically analyzed. Light intensity had significant influence on the photosynthetic characteristics of Paris polyphylla var. chinensis. With the strengthening of the low-light stress, chlorophyll content, gas exchange parameters, photosynthetic parameters P., AQY and light saturation point all gradually increased at first, and then decreased. However, both photosynthetic parameters Rd and light compensation point firstly decreased and then rose again. These results showed that too strong or too weak light intensity affected the optimization of photosynthetic parameters of Paris polyphylla var. chinensis. The optimal illuminance for each parameter was not completely same, but they could all reach a relative ideal state when the shading ranges between 40% and 60%. However, photosynthetic parameters deteriorated rapidly when the shading surpass 80%. For artificially cultivating Paris polyphylla var. chinensis in Baoxing,Sichuan or the similar ecological region, shading 40%-60% is the optimal light environment, which can enhance the photosynthesis of Paris polyphylla var. chinensis and promote the accumulation of photosynthetic products.
Park, Soo-Hyun; Sim, Yun-Beom; Han, Pyung-Lim; Lee, Jin-Koo; Suh, Hong-Won
2010-06-01
Opuntia ficus-indica var. saboten. is widely cultivated in Jeju Island (South Korea) for use in manufacture of health foods. This study described antidepressant effect of two flavonoids (kaempferol and quercitrin) isolated from the Opuntia ficus-indica var. saboten. The expression of the hypothalamic POMC mRNA or plasma β-endorphin levels were increased by extract of Opuntia ficus-indica var. saboten or its flavoniods administered orally. In addition, antidepressant activity was studied using tail suspension test (TST), forced swimming test (FST) and rota-rod test in chronically restraint immobilization stress group in mice. After restraint stress (2 hrs/day for 14 days), animals were kept in cage for 14 days without any further stress, bet with drugs. Mice were fed with a diet supplemented for 14 days and during the behavioral test period with kaempferol or quercitrin (30 mg/kg/day). POMC mRNA or plasma β-endorphin level was increased by extract of Opuntia ficus-indica var. saboten and its flavoniods. In addition, immobility time in TST and FST was significantly reduced by kaempferol or quercitrin. In rota-rod test, the time of permanence was maintained to the semblance of control group in turning at 15 rpm. Our results suggest that two flavonoids (kaempferol and quercitrin) isolated from the Opuntia ficus-indica var. saboten. show a potent antidepressant effect.
Park, Soo-Hyun; Sim, Yun-Beom; Han, Pyung-Lim; Lee, Jin-Koo
2010-01-01
Opuntia ficus-indica var. saboten. is widely cultivated in Jeju Island (South Korea) for use in manufacture of health foods. This study described antidepressant effect of two flavonoids (kaempferol and quercitrin) isolated from the Opuntia ficus-indica var. saboten. The expression of the hypothalamic POMC mRNA or plasma β-endorphin levels were increased by extract of Opuntia ficus-indica var. saboten or its flavoniods administered orally. In addition, antidepressant activity was studied using tail suspension test (TST), forced swimming test (FST) and rota-rod test in chronically restraint immobilization stress group in mice. After restraint stress (2 hrs/day for 14 days), animals were kept in cage for 14 days without any further stress, bet with drugs. Mice were fed with a diet supplemented for 14 days and during the behavioral test period with kaempferol or quercitrin (30 mg/kg/day). POMC mRNA or plasma β-endorphin level was increased by extract of Opuntia ficus-indica var. saboten and its flavoniods. In addition, immobility time in TST and FST was significantly reduced by kaempferol or quercitrin. In rota-rod test, the time of permanence was maintained to the semblance of control group in turning at 15 rpm. Our results suggest that two flavonoids (kaempferol and quercitrin) isolated from the Opuntia ficus-indica var. saboten. show a potent antidepressant effect. PMID:22110339
Directory of Open Access Journals (Sweden)
Hino Takafumi
2015-07-01
Full Text Available Macrophytes are a critical component of freshwater ecosystems and are often eaten by cervids. However, the impact of cervids on macrophytes is not well known. In this study, we investigated the effect of sika deer (Cervus nippon yesoensis on the endangered macrophyte Ranunculus nipponicus var. submersus in a spring stream in southwestern Hokkaido, Japan. We monitored the frequency of stream habitat use by deer by using sensor cameras in photography mode for four seasons. We also monitored deer feeding behavior on R. nipponicus var. submersus using sensor cameras in movie mode. To quantitatively evaluate the impact of deer on R. nipponicus var. submersus, we conducted a field experiment in which deer were excluded from part of the stream. We selected 10 pairs of adjacent patches of R. nipponicus var. submersus and set up exclosures covering one patch in each pair. We assessed the frequency of deer feeding and trampling on the control patches using the sensor cameras in photography mode and measured the mean macrophyte stem length in the exclosure and control patches every month for four seasons. To compare abiotic conditions between the exclosure and control patches, we investigated canopy openness, water depth, water temperature, electrical conductivity, pH, current velocity, and water quality at each patch during the growing season. The frequency of deer in the stream habitat was higher from spring to summer than in other seasons. Direct evidence of deer feeding behavior on R. nipponicus var. submersus was recorded using the sensor cameras. Deer often fed on and trampled on the control patches, particularly from spring to summer. The R. nipponicus var. submersus stem length was longer in the exclosure patches than in control patches (P 0.189. Stem growth of R. nipponicus var. submersus differed among seasons (P <0.001, and was low from winter to spring. In addition, exclosure and seasonality significantly affected stem length (P <0.001, and the
Probiotic Activity of Saccharomyces cerevisiae var. boulardii Against Human Pathogens
Directory of Open Access Journals (Sweden)
Katarzyna Rajkowska
2012-01-01
Full Text Available Infectious diarrhoea is associated with a modification of the intestinal microflora and colonization of pathogenic bacteria. Tests were performed for seven probiotic yeast strains of Saccharomyces cerevisiae var. boulardii, designated for the prevention and treatment of diarrhoea. To check their possible effectiveness against diarrhoea of different etiologies, the activity against a variety of human pathogenic or opportunistic bacteria was investigated in vitro. In mixed cultures with S. cerevisiae var. boulardii, a statistically significant reduction was observed in the number of cells of Listeria monocytogenes, Pseudomonas aeruginosa and Staphylococcus aureus, by even 55.9 % in the case of L. monocytogenes compared with bacterial monocultures. The influence of yeasts was mostly associated with the shortening of the bacterial lag phase duration, more rapid achievement of the maximum growth rates, and a decrease by 4.4–57.1 % (L. monocytogenes, P. aeruginosa, or an increase by 1.4–70.6 % (Escherichia coli, Enterococcus faecalis, Salmonella Typhimurium in the exponential growth rates. Another issue included in the research was the ability of S. cerevisiae var. boulardii to bind pathogenic bacteria to its cell surface. Yeasts have shown binding capacity of E. coli, S. Typhimurium and additionally of S. aureus, Campylobacter jejuni and E. faecalis. However, no adhesion of L. monocytogenes and P. aeruginosa to the yeast cell wall was noted. The probiotic activity of S. cerevisiae var. boulardii against human pathogens is related to a decrease in the number of viable and active cells of bacteria and the binding capacity of yeasts. These processes may limit bacterial invasiveness and prevent bacterial adherence and translocation in the human intestines.
The complete chloroplast genome sequence of Dianthus superbus var. longicalycinus.
Gurusamy, Raman; Lee, Do-Hyung; Park, SeonJoo
2016-05-01
The complete chloroplast genome (cpDNA) sequence of Dianthus superbus var. longicalycinus is an economically important traditional Chinese medicine was reported and characterized. The cpDNA of Dianthus superbus var. longicalycinus is 149,539 bp, with 36.3% GC content. A pair of inverted repeats (IRs) of 24,803 bp is separated by a large single-copy region (LSC, 82,805 bp) and a small single-copy region (SSC, 17,128 bp). It encodes 85 protein-coding genes, 36 tRNA genes and 8 rRNA genes. Of 129 individual genes, 13 genes encoded one intron and three genes have two introns.
Anogeissus sericea var. nummalaria King ex Duthie
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 8; Issue 4. Anogeissus sericea var. nummalaria King ex Duthie. Flowering Trees Volume 8 Issue 4 April 2003 pp 89-89. Fulltext. Click here to view fulltext PDF. Permanent link: https://www.ias.ac.in/article/fulltext/reso/008/04/0089-0089. Resonance ...
Isolation, Purification, and Characterization of Fungal Laccase from Pleurotus sp.
Directory of Open Access Journals (Sweden)
Sunil S. More
2011-01-01
Full Text Available Laccases are blue copper oxidases (E.C. 1.10.3.2 benzenediol: oxygen oxidoreductase that catalyze the one-electron oxidation of phenolics, aromatic amines, and other electron-rich substrates with the concomitant reduction of O2 to H2O. They are currently seen as highly interesting industrial enzymes because of their broad substrate specificity. A positive strain was isolated and characterized as nonspore forming Basidiomycetes Pleurotus sp. Laccase activity was determined using ABTS as substrate. Laccase was purified by ionexchange and gel filtration chromatography. The purified laccase was a monomer showed a molecular mass of 40±1 kDa as estimated by SDS-PAGE and a 72-fold purification with a 22% yield. The optimal pH and temperature were 4.5 and 65°C, respectively. The Km and Vmax values are 250 (mM and 0.33 (μmol/min, respectively, for ABTS as substrate. Metal ions like CuSO4, BaCl2, MgCl2, FeCl2, ZnCl2 have no effect on purified laccase whereas HgCl2 and MnCl2 moderately decrease enzyme activity. SDS and sodium azide inhibited enzyme activity, whereas Urea, PCMB, DTT, and mercaptoethanol have no effect on enzyme activity. The isolated laccase can be used in development of biosensor for detecting the phenolic compounds from the effluents of paper industries.
Cai, Nian-Hui; Xu, Yu-Lan; Wang, Da-Wei; Chen, Shi; Li, Gen-Qian
2017-02-01
Microsatellite primers were developed in Pinus kesiya var. langbianensis (Pinaceae), a species native to southwestern China, to investigate its genetic diversity and population structure in order to provide information for the conservation and management of this species. Using next-generation sequencing, a total of 2349 putative simple sequence repeat primer pairs were designed. Eighteen polymorphic markers in 60 individuals belonging to four populations of P. kesiya var. langbianensis were identified and characterized with two to 11 alleles per locus. The observed and expected heterozygosity ranged from 0.000 to 0.800 and 0.000 to 0.840, respectively. Each of these loci cross-amplified in the closely related species P. massoniana , P. densata , P. tabuliformis , and P. yunnanensis , with one to seven alleles per locus. The new markers are promising tools to study the population genetics of P. kesiya var. langbianensis and related species.
DEFF Research Database (Denmark)
Sander, Adam F; Salanti, Ali; Lavstsen, Thomas
2011-01-01
multiple genes coding for different VAR2CSA proteins, and parasites with >1 var2csa gene appear to be more common in pregnant women with placental malaria than in nonpregnant individuals. We present evidence that, in pregnant women, parasites containing multiple var2csa-type genes possess a selective...... advantage over parasites with a single var2csa gene. Accumulation of parasites with multiple copies of the var2csa gene during the course of pregnancy was also correlated with the development of antibodies involved in blocking VAR2CSA adhesion. The data suggest that multiplicity of var2csa-type genes...
VaR: Exchange Rate Risk and Jump Risk
Directory of Open Access Journals (Sweden)
Fen-Ying Chen
2010-01-01
Full Text Available Incorporating the Poisson jumps and exchange rate risk, this paper provides an analytical VaR to manage market risk of international portfolios over the subprime mortgage crisis. There are some properties in the model. First, different from past studies in portfolios valued only in one currency, this model considers portfolios not only with jumps but also with exchange rate risk, that is vital for investors in highly integrated global financial markets. Second, in general, the analytical VaR solution is more accurate than historical simulations in terms of backtesting and Christoffersen's independence test (1998 for small portfolios and large portfolios. In other words, the proposed model is reliable not only for a portfolio on specific stocks but also for a large portfolio. Third, the model can be regarded as the extension of that of Kupiec (1999 and Chen and Liao (2009.
Characterization and in vitro antioxidant activities of polysaccharides from Pleurotus ostreatus.
Zhang, Yunxia; Dai, Ling; Kong, Xiaowei; Chen, Liangwen
2012-10-01
Two polysaccharide fractions (PSPO-1a and PSPO-4a) were isolated from the fruiting bodies of Pleurotus ostreatus using ethanol precipitation, anion-exchange chromatography and gel permeation chromatography. Both fractions were heteropolysaccharide containing protein and uronic acid. PSPO-1a was composed of mannose, glucose, galactose, xylose and rhamnose with a molar ratio of 2.47:0.91:1.00:1.66:3.87. PSPO-4a was composed of only three monosaccharides: rhamnose, mannose and galactose with a molar ratio of 0.92:2.69:1.00. The average molecular weight of PSPO-1a and PSPO-4a determined by HPLC were estimated to be 1.8 × 10(4)Da and 1.1 × 10(6)Da respectively. The in vitro tests revealed that two polysaccharides were natural potential antioxidant. Both polysaccharides presented stronger DPPH radical and superoxide anion radical scavenging activity with increasing concentrations, but less effective on scavenging hydroxyl radical. Compared with PSPO-4a, PSPO-1a was the more effective free-radical scavenger. In conclusion, the two polysaccharides may be useful as a naturally potential antioxidant agent for application in food and medicinal fields. Copyright © 2012 Elsevier B.V. All rights reserved.
Zhou Nong; Ding, Bo; Feng, Yuan; Qi, Wen-hua; Zhang, Hua; Guo, Dong-qin; Xiang, Jun
2015-08-01
After 28 foreign species of AM fungi were inoculated in sterilized soil, the effects of the AM mycorrhizal colonization and the medicine quality of Paris polyphylla var. yunnanensis were observed by combination of inoculation test in pot at room temperature and instrumental analysis. The results showed that, compared with control group (CK), the inoculation of foreign AM fungi in the soil influenced the spore density, mycorrhizal infection rate, and colonization intensity of AM fungi in root system of P. polyphylla var. yunnanensis. The inoculation of foreign AM fungi enhanced the mycorrhiza viability of P. polyphylla var. yunnanensis by increasing the activity of succinic dehydrogenase (SDH) and alkaline phosphatase (ALP) in intraradical hyphae. The content of single steroid saponin in rhizome of P. polyphylla var. yunnanensis showed variation after P. polyphylla var. yunnanensis was inoculated by different foreign species of AM fungi, which was beneficial for increasing the medicine quality; however, the kinds of steroid saponin showed no difference. In a degree, there was a selectivity of symbiosis between P. polyphylla var. yunnanensis and foreign AM fungi. And we found that the Claroideoglomus claroideum and Racocetra coralloidea were best foreign AM fungi species for cultivating P. polyphylla var. yunnanensis under field condition.
Gavanji, Shahin; Larki, Behrouz; Bakhtari, Azizollah
2014-06-01
Herbal drugs are considered alternative agents and have been used for several years around the world. Recurrent aphthous stomatitis (RAS) is one of the most common problems recognized by dentists and skin specialists. This problem is characterized by recurring, painful, small oral mucosal ulcers with a round or oval aspect that mostly appear in keratinized mucosa, cheeks, and on the surface of the mouth under the tongue. In our experiment, the alcoholic and water extracts of Punica granatum var. pleniflora, P. granatum var. Sweet Alak, and P. granatum var. Saveh Black were tested on minor RAS. The study was carried out using the double-blind method. The study population consisted of 210 participants, of whom 69 were females (32%) and 141 were males (68%). In addition to checking several factors, the pain and the degree of the participant's satisfaction had been determined based on visual analog scale. Data analysis was done in the form of a nonparametric method using Kruskal-Wallis test and SPSS version 20 software. The results show that the alcoholic and water extracts of P. granatum var. pleniflora have a meaningful therapeutic effect on minor RAS. Results from the antioxidant activity and its relation to total phenolics show that P. granatum var. pleniflora and P. granatum var. Sweet Alak are rich in phenols. The water and alcoholic extracts of P. granatum varpleniflora decreased the entire time of complete treatment, and the treatment was meaningfully satisfactory for patients who participated in this experiment.
LitVar: a semantic search engine for linking genomic variant data in PubMed and PMC.
Allot, Alexis; Peng, Yifan; Wei, Chih-Hsuan; Lee, Kyubum; Phan, Lon; Lu, Zhiyong
2018-05-14
The identification and interpretation of genomic variants play a key role in the diagnosis of genetic diseases and related research. These tasks increasingly rely on accessing relevant manually curated information from domain databases (e.g. SwissProt or ClinVar). However, due to the sheer volume of medical literature and high cost of expert curation, curated variant information in existing databases are often incomplete and out-of-date. In addition, the same genetic variant can be mentioned in publications with various names (e.g. 'A146T' versus 'c.436G>A' versus 'rs121913527'). A search in PubMed using only one name usually cannot retrieve all relevant articles for the variant of interest. Hence, to help scientists, healthcare professionals, and database curators find the most up-to-date published variant research, we have developed LitVar for the search and retrieval of standardized variant information. In addition, LitVar uses advanced text mining techniques to compute and extract relationships between variants and other associated entities such as diseases and chemicals/drugs. LitVar is publicly available at https://www.ncbi.nlm.nih.gov/CBBresearch/Lu/Demo/LitVar.
Energy Technology Data Exchange (ETDEWEB)
Awafo, V [Quebec Univ., Montreal, PQ (Canada)
1994-12-31
Lignocellulosic biomass like corn stalk is an abundant and renewable resource from which food, feed and chemicals may be derived. Enzymatic hydrolysis of native lignocellulosic material is prohibitively slow due to their compositional heterogeneity and structural complexity. In this work, ground corn stalks (20 mesh) were subjected to gamma irradiation (10-170 Mrads) as pretreatments to make them more susceptible for bioconversion into protein-rich mycelial biomass of Pleurotus sajor-caju NRRL 18757. The irradiation was carried out in air in a {sup 60}Co Underwater Calibrator (UC-15, Nordion International) at a dose rate of 2.5 Mrads/h as measured by Fricke dosimetry. No apparent structural differences were observed under the light microscope. However, the protein synthesis and the proportion of mycelial biomass increased with the increase in both the dose of irradiation and time of fermentation during the bioconversion of 1% corn stalk into mycelial biomass of Pleurotus sajor-caju. Gamma irradiation at the dose of 50 Mrads or lower did not produce any appreciable increase in the amount of protein synthesised. At 170 Mrads, the final product contained 28% protein representing a 2-fold increase from non-irradiated corn stalk and an efficiency of 36% conversion of total utilizable polysaccharides of corn stalks into mycelial biomass. The lag phase during mycelial biomass production was much more prolonged at very high doses indicating possible production of some toxic substances during irradiation. (author). 2 tabs., 6 figs.
Marc A. Baker
2007-01-01
Individuals of E. sneedii var. sneedii were found to occur in greater abundance within the Guadalupe Mountains than was previously recorded. No additional populations morphologically intermediate between E. guadalupensis and E. sneedii were found. Taxonomic affiliation and geographic...
Efficient gene replacements in ku70 disruption strain of Aspergillus chevalieri var. intermedius
Directory of Open Access Journals (Sweden)
Qingqing Huang
2017-01-01
Full Text Available Aspergillus chevalieri var. intermedius is a dominant filamentous fungal species in Fuzhuan tea and is associated with the quality and health benefits of this tea. The sexual or asexual reproduction of this fungus depends on the osmotic pressure of the tea. Efforts to enhance the beneficial effects of A. chevalieri var. intermedius are hampered by difficulties in disrupting its genes. To address this issue, we identified the A. chevalieri var. intermedius homolog (Acku70 of human Ku70 and generated an Acku70 disruption strain (ΔAcku70, aiming to improve the gene replacement efficiency. ΔAcku70 grew at a slightly lower rate in vitro than the wild-type strain; however, the two strains exhibited similar sensitivity to temperature, osmotic pressure and the effects of ethyl methane sulphonate and H2O2. The replacement efficiency of veA and flbA dramatically increased in ΔAcku70 compared to that in the wild type. The efficiency of flbA replacement increased from 2.6% to 80%, whereas the frequency of veA disruption increased from 15.2% to 83.9% and from 30.8% to 86.8%. Thus, ΔAcku70 is suitable for use as a type strain for large-scale functional genomic analysis of A. chevalieri var. intermedius.
RBF neural network prediction on weak electrical signals in Aloe vera var. chinensis
Wang, Lanzhou; Zhao, Jiayin; Wang, Miao
2008-10-01
A Gaussian radial base function (RBF) neural network forecast on signals in the Aloe vera var. chinensis by the wavelet soft-threshold denoised as the time series and using the delayed input window chosen at 50, is set up to forecast backward. There was the maximum amplitude at 310.45μV, minimum -75.15μV, average value -2.69μV and Aloe vera var. chinensis respectively. The electrical signal in Aloe vera var. chinensis is a sort of weak, unstable and low frequency signals. A result showed that it is feasible to forecast plant electrical signals for the timing by the RBF. The forecast data can be used as the preferences for the intelligent autocontrol system based on the adaptive characteristic of plants to achieve the energy saving on the agricultural production in the plastic lookum or greenhouse.
Mutations in the Arabidopsis AtMRS2-11/AtMGT10/VAR5 Gene Cause Leaf Reticulation
Directory of Open Access Journals (Sweden)
Shuang Liang
2017-11-01
Full Text Available In higher plants, the development of functional chloroplasts is essential for photosynthesis and many other physiological processes. With a long-term goal of elucidating the genetic regulation of chloroplast development, we identified two allelic leaf variegation mutants, variegated5-1 (var5-1 and var5-2. Both mutants showed a distinct leaf reticulation phenotype of yellow paraveinal regions and green interveinal regions, and the leaf reticulation phenotype correlated with photosynthetic defects. Through the identification of mutation sites in the two mutant alleles and the molecular complementation, we confirmed that VAR5 encodes a CorA family of Mg2+ transporters also known as AtMRS2-11/AtMGT10. Using protoplast transient expression and biochemical fractionation assays, we demonstrated that AtMRS2-11/AtMGT10/VAR5 likely localizes to the chloroplast envelope. Moreover, we established that AtMRS2-11/AtMGT10/VAR5 forms large molecular weight complexes in the chloroplast and the sizes of these complexes clearly exceed those of their bacterial counterparts, suggesting the compositions of CorA Mg2+ transporter complex is different between the chloroplast and bacteria. Our findings indicate that AtMRS2-11/AtMGT10/VAR5 plays an important role in the tissue specific regulation of chloroplast development.
RİSK ÖLÇÜMÜNDE ALTERNATİF YAKLAŞIMLAR: RİSKE MARUZ DEĞER (VaR ve BEKLENEN KAYIP (ES UYGULAMALARI
Directory of Open Access Journals (Sweden)
SEZER BOZKUŞ
2013-06-01
Full Text Available This article shows that Value-at-Risk (VaR, the most popular risk measure in practice, has a considerable positive bias when used for a portfolio with fat-tail distribution. Numerical examples, i.e. USD/Euro daily prices and ISE-100 Index monthly returns, are given to demonstrate the use of our method. In the search for a suitable alternative to VaR, Expected Shortfall (ES or conditional VaR has been characterized as the coherent risk measure to dominate VaR. We discuss properties of VaR and ES and compare them in terms of consistency with elimination of tail risk, strengths and weaknesses. We conclude that ES is more applicable than VaR since ES is free of tail risk and consistent under more lenient conditions than VaR is.
Micropropagation of Caralluma stalagmifera var. longipetala : A rare ...
African Journals Online (AJOL)
An efficient in vitro protocol has been developed for the multiplication of shoots and conservation of a rare succulent medicinal plant Caralluma stalagmifera var. longipetala growing wildly in Karnataka State. Proliferation of multiple shoots was achieved on Murashige and Skoog's (MS) medium supplemented with various ...
Aaij, Roel; LHCb Collaboration; Adinolfi, Marco; Ajaltouni, Ziad; Akar, Simon; Albrecht, Johannes; Alessio, Federico; Alexander, Michael; Alfonso Albero, Alejandro; Ali, Suvayu; Alkhazov, Georgy; Alvarez Cartelle, Paula; Alves Jr, Antonio Augusto; Amato, Sandra; Amerio, Silvia; Amhis, Yasmine; An, Liupan; Anderlini, Lucio; Andreassi, Guido; Andreotti, Mirco; Andrews, Jason; Appleby, Robert; Archilli, Flavio; d'Argent, Philippe; Arnau Romeu, Joan; Artamonov, Alexander; Artuso, Marina; Aslanides, Elie; Atzeni, Michele; Auriemma, Giulio; Baalouch, Marouen; Babuschkin, Igor; Bachmann, Sebastian; Back, John; Badalov, Alexey; Baesso, Clarissa; Baker, Sophie; Balagura, Vladislav; Baldini, Wander; Baranov, Alexander; Barlow, Roger; Barschel, Colin; Barsuk, Sergey; Barter, William; Baryshnikov, Fedor; Batozskaya, Varvara; Battista, Vincenzo; Bay, Aurelio; Beaucourt, Leo; Beddow, John; Bedeschi, Franco; Bediaga, Ignacio; Beiter, Andrew; Bel, Lennaert; Beliy, Nikita; Bellee, Violaine; Belloli, Nicoletta; Belous, Konstantin; Belyaev, Ivan; Ben-Haim, Eli; Bencivenni, Giovanni; Benson, Sean; Beranek, Sarah; Berezhnoy, Alexander; Bernet, Roland; Berninghoff, Daniel; Bertholet, Emilie; Bertolin, Alessandro; Betancourt, Christopher; Betti, Federico; Bettler, Marc-Olivier; van Beuzekom, Martinus; Bezshyiko, Iaroslava; Bifani, Simone; Billoir, Pierre; Birnkraut, Alex; Bizzeti, Andrea; Bjørn, Mikkel; Blake, Thomas; Blanc, Frederic; Blusk, Steven; Bocci, Valerio; Boettcher, Thomas; Bondar, Alexander; Bondar, Nikolay; Bordyuzhin, Igor; Borghi, Silvia; Borisyak, Maxim; Borsato, Martino; Bossu, Francesco; Boubdir, Meriem; Bowcock, Themistocles; Bowen, Espen Eie; Bozzi, Concezio; Braun, Svende; Brodzicka, Jolanta; Brundu, Davide; Buchanan, Emma; Burr, Christopher; Bursche, Albert; Buytaert, Jan; Byczynski, Wiktor; Cadeddu, Sandro; Cai, Hao; Calabrese, Roberto; Calladine, Ryan; Calvi, Marta; Calvo Gomez, Miriam; Camboni, Alessandro; Campana, Pierluigi; Campora Perez, Daniel Hugo; Capriotti, Lorenzo; Carbone, Angelo; Carboni, Giovanni; Cardinale, Roberta; Cardini, Alessandro; Carniti, Paolo; Carson, Laurence; Carvalho Akiba, Kazuyoshi; Casse, Gianluigi; Cassina, Lorenzo; Cattaneo, Marco; Cavallero, Giovanni; Cenci, Riccardo; Chamont, David; Chapman, Matthew George; Charles, Matthew; Charpentier, Philippe; Chatzikonstantinidis, Georgios; Chefdeville, Maximilien; Chen, Shanzhen; Cheung, Shu Faye; Chitic, Stefan-Gabriel; Chobanova, Veronika; Chrzaszcz, Marcin; Chubykin, Alexsei; Ciambrone, Paolo; Cid Vidal, Xabier; Ciezarek, Gregory; Clarke, Peter; Clemencic, Marco; Cliff, Harry; Closier, Joel; Coco, Victor; Cogan, Julien; Cogneras, Eric; Cogoni, Violetta; Cojocariu, Lucian; Collins, Paula; Colombo, Tommaso; Comerma-Montells, Albert; Contu, Andrea; Coombs, George; Coquereau, Samuel; Corti, Gloria; Corvo, Marco; Costa Sobral, Cayo Mar; Couturier, Benjamin; Cowan, Greig; Craik, Daniel Charles; Crocombe, Andrew; Cruz Torres, Melissa Maria; Currie, Robert; D'Ambrosio, Carmelo; Da Cunha Marinho, Franciole; Da Silva, Cesar Luiz; Dall'Occo, Elena; Dalseno, Jeremy; Davis, Adam; De Aguiar Francisco, Oscar; De Bruyn, Kristof; De Capua, Stefano; De Cian, Michel; De Miranda, Jussara; De Paula, Leandro; De Serio, Marilisa; De Simone, Patrizia; Dean, Cameron Thomas; Decamp, Daniel; Del Buono, Luigi; Dembinski, Hans Peter; Demmer, Moritz; Dendek, Adam; Derkach, Denis; Deschamps, Olivier; Dettori, Francesco; Dey, Biplab; Di Canto, Angelo; Di Nezza, Pasquale; Dijkstra, Hans; Dordei, Francesca; Dorigo, Mirco; Dosil Suárez, Alvaro; Douglas, Lauren; Dovbnya, Anatoliy; Dreimanis, Karlis; Dufour, Laurent; Dujany, Giulio; Durante, Paolo; Durham, John Matthew; Dutta, Deepanwita; Dzhelyadin, Rustem; Dziewiecki, Michal; Dziurda, Agnieszka; Dzyuba, Alexey; Easo, Sajan; Ebert, Marcus; Egede, Ulrik; Egorychev, Victor; Eidelman, Semen; Eisenhardt, Stephan; Eitschberger, Ulrich; Ekelhof, Robert; Eklund, Lars; Ely, Scott; Esen, Sevda; Evans, Hannah Mary; Evans, Timothy; Falabella, Antonio; Farley, Nathanael; Farry, Stephen; Fazzini, Davide; Federici, Luca; Ferguson, Dianne; Fernandez, Gerard; Fernandez Declara, Placido; Fernandez Prieto, Antonio; Ferrari, Fabio; Ferreira Lopes, Lino; Ferreira Rodrigues, Fernando; Ferro-Luzzi, Massimiliano; Filippov, Sergey; Fini, Rosa Anna; Fiorini, Massimiliano; Firlej, Miroslaw; Fitzpatrick, Conor; Fiutowski, Tomasz; Fleuret, Frederic; Fontana, Marianna; Fontanelli, Flavio; Forty, Roger; Franco Lima, Vinicius; Frank, Markus; Frei, Christoph; Fu, Jinlin; Funk, Wolfgang; Furfaro, Emiliano; Färber, Christian; Gabriel, Emmy; Gallas Torreira, Abraham; Galli, Domenico; Gallorini, Stefano; Gambetta, Silvia; Gandelman, Miriam; Gandini, Paolo; Gao, Yuanning; Garcia Martin, Luis Miguel; García Pardiñas, Julián; Garra Tico, Jordi; Garrido, Lluis; Gascon, David; Gaspar, Clara; Gavardi, Laura; Gazzoni, Giulio; Gerick, David; Gersabeck, Evelina; Gersabeck, Marco; Gershon, Timothy; Ghez, Philippe; Gianì, Sebastiana; Gibson, Valerie; Girard, Olivier Göran; Giubega, Lavinia-Helena; Gizdov, Konstantin; Gligorov, Vladimir; Golubkov, Dmitry; Golutvin, Andrey; Gomes, Alvaro; Gorelov, Igor Vladimirovich; Gotti, Claudio; Govorkova, Ekaterina; Grabowski, Jascha Peter; Graciani Diaz, Ricardo; Granado Cardoso, Luis Alberto; Graugés, Eugeni; Graverini, Elena; Graziani, Giacomo; Grecu, Alexandru; Greim, Roman; Griffith, Peter; Grillo, Lucia; Gruber, Lukas; Gruberg Cazon, Barak Raimond; Grünberg, Oliver; Gushchin, Evgeny; Guz, Yury; Gys, Thierry; Göbel, Carla; Hadavizadeh, Thomas; Hadjivasiliou, Christos; Haefeli, Guido; Haen, Christophe; Haines, Susan; Hamilton, Brian; Han, Xiaoxue; Hancock, Thomas Henry; Hansmann-Menzemer, Stephanie; Harnew, Neville; Harnew, Samuel; Hasse, Christoph; Hatch, Mark; He, Jibo; Hecker, Malte; Heinicke, Kevin; Heister, Arno; Hennessy, Karol; Henrard, Pierre; Henry, Louis; van Herwijnen, Eric; Heß, Miriam; Hicheur, Adlène; Hill, Donal; Hopchev, Plamen Hristov; Hu, Wenhua; Huang, Wenqian; Huard, Zachary; Hulsbergen, Wouter; Humair, Thibaud; Hushchyn, Mikhail; Hutchcroft, David; Ibis, Philipp; Idzik, Marek; Ilten, Philip; Jacobsson, Richard; Jalocha, Pawel; Jans, Eddy; Jawahery, Abolhassan; Jiang, Feng; John, Malcolm; Johnson, Daniel; Jones, Christopher; Joram, Christian; Jost, Beat; Jurik, Nathan; Kandybei, Sergii; Karacson, Matthias; Kariuki, James Mwangi; Karodia, Sarah; Kazeev, Nikita; Kecke, Matthieu; Keizer, Floris; Kelsey, Matthew; Kenzie, Matthew; Ketel, Tjeerd; Khairullin, Egor; Khanji, Basem; Khurewathanakul, Chitsanu; Kirn, Thomas; Klaver, Suzanne; Klimaszewski, Konrad; Klimkovich, Tatsiana; Koliiev, Serhii; Kolpin, Michael; Kopecna, Renata; Koppenburg, Patrick; Kosmyntseva, Alena; Kotriakhova, Sofia; Kozeiha, Mohamad; Kravchuk, Leonid; Kreps, Michal; Kress, Felix Johannes; Krokovny, Pavel; Krzemien, Wojciech; Kucewicz, Wojciech; Kucharczyk, Marcin; Kudryavtsev, Vasily; Kuonen, Axel Kevin; Kvaratskheliya, Tengiz; Lacarrere, Daniel; Lafferty, George; Lai, Adriano; Lanfranchi, Gaia; Langenbruch, Christoph; Latham, Thomas; Lazzeroni, Cristina; Le Gac, Renaud; Leflat, Alexander; Lefrançois, Jacques; Lefèvre, Regis; Lemaitre, Florian; Lemos Cid, Edgar; Leroy, Olivier; Lesiak, Tadeusz; Leverington, Blake; Li, Pei-Rong; Li, Tenglin; Li, Yiming; Li, Zhuoming; Liang, Xixin; Likhomanenko, Tatiana; Lindner, Rolf; Lionetto, Federica; Lisovskyi, Vitalii; Liu, Xuesong; Loh, David; Loi, Angelo; Longstaff, Iain; Lopes, Jose; Lucchesi, Donatella; Lucio Martinez, Miriam; Luo, Haofei; Lupato, Anna; Luppi, Eleonora; Lupton, Oliver; Lusiani, Alberto; Lyu, Xiao-Rui; Machefert, Frederic; Maciuc, Florin; Macko, Vladimir; Mackowiak, Patrick; Maddrell-Mander, Samuel; Maev, Oleg; Maguire, Kevin; Maisuzenko, Dmitrii; Majewski, Maciej Witold; Malde, Sneha; Malecki, Bartosz; Malinin, Alexander; Maltsev, Timofei; Manca, Giulia; Mancinelli, Giampiero; Marangotto, Daniele; Maratas, Jan; Marchand, Jean François; Marconi, Umberto; Marin Benito, Carla; Marinangeli, Matthieu; Marino, Pietro; Marks, Jörg; Martellotti, Giuseppe; Martin, Morgan; Martinelli, Maurizio; Martinez Santos, Diego; Martinez Vidal, Fernando; Massafferri, André; Matev, Rosen; Mathad, Abhijit; Mathe, Zoltan; Matteuzzi, Clara; Mauri, Andrea; Maurice, Emilie; Maurin, Brice; Mazurov, Alexander; McCann, Michael; McNab, Andrew; McNulty, Ronan; Mead, James Vincent; Meadows, Brian; Meaux, Cedric; Meier, Frank; Meinert, Nis; Melnychuk, Dmytro; Merk, Marcel; Merli, Andrea; Michielin, Emanuele; Milanes, Diego Alejandro; Millard, Edward James; Minard, Marie-Noelle; Minzoni, Luca; Mitzel, Dominik Stefan; Mogini, Andrea; Molina Rodriguez, Josue; Mombächer, Titus; Monroy, Igancio Alberto; Monteil, Stephane; Morandin, Mauro; Morello, Michael Joseph; Morgunova, Olga; Moron, Jakub; Morris, Adam Benjamin; Mountain, Raymond; Muheim, Franz; Mulder, Mick; Müller, Dominik; Müller, Janine; Müller, Katharina; Müller, Vanessa; Naik, Paras; Nakada, Tatsuya; Nandakumar, Raja; Nandi, Anita; Nasteva, Irina; Needham, Matthew; Neri, Nicola; Neubert, Sebastian; Neufeld, Niko; Neuner, Max; Nguyen, Thi Dung; Nguyen-Mau, Chung; Nieswand, Simon; Niet, Ramon; Nikitin, Nikolay; Nikodem, Thomas; Nogay, Alla; O'Hanlon, Daniel Patrick; Oblakowska-Mucha, Agnieszka; Obraztsov, Vladimir; Ogilvy, Stephen; Oldeman, Rudolf; Onderwater, Gerco; Ossowska, Anna; Otalora Goicochea, Juan Martin; Owen, Patrick; Oyanguren, Maria Aranzazu; Pais, Preema Rennee; Palano, Antimo; Palutan, Matteo; Papanestis, Antonios; Pappagallo, Marco; Pappalardo, Luciano; Parker, William; Parkes, Christopher; Passaleva, Giovanni; Pastore, Alessandra; Patel, Mitesh; Patrignani, Claudia; Pearce, Alex; Pellegrino, Antonio; Penso, Gianni; Pepe Altarelli, Monica; Perazzini, Stefano; Pereima, Dmitrii; Perret, Pascal; Pescatore, Luca; Petridis, Konstantinos; Petrolini, Alessandro; Petrov, Aleksandr; Petruzzo, Marco; Picatoste Olloqui, Eduardo; Pietrzyk, Boleslaw; Pietrzyk, Guillaume; Pikies, Malgorzata; Pinci, Davide; Pisani, Flavio; Pistone, Alessandro; Piucci, Alessio; Placinta, Vlad-Mihai; Playfer, Stephen; Plo Casasus, Maximo; Polci, Francesco; Poli Lener, Marco; Poluektov, Anton; Polyakov, Ivan; Polycarpo, Erica; Pomery, Gabriela Johanna; Ponce, Sebastien; Popov, Alexander; Popov, Dmitry; Poslavskii, Stanislav; Potterat, Cédric; Price, Eugenia; Prisciandaro, Jessica; Prouve, Claire; Pugatch, Valery; Puig Navarro, Albert; Pullen, Hannah Louise; Punzi, Giovanni; Qian, Wenbin; Qin, Jia-Jia; Quagliani, Renato; Quintana, Boris; Rachwal, Bartlomiej; Rademacker, Jonas; Rama, Matteo; Ramos Pernas, Miguel; Rangel, Murilo; Raniuk, Iurii; Ratnikov, Fedor; Raven, Gerhard; Ravonel Salzgeber, Melody; Reboud, Meril; Redi, Federico; Reichert, Stefanie; dos Reis, Alberto; Remon Alepuz, Clara; Renaudin, Victor; Ricciardi, Stefania; Richards, Sophie; Rihl, Mariana; Rinnert, Kurt; Robbe, Patrick; Robert, Arnaud; Rodrigues, Ana Barbara; Rodrigues, Eduardo; Rodriguez Lopez, Jairo Alexis; Rogozhnikov, Alexey; Roiser, Stefan; Rollings, Alexandra Paige; Romanovskiy, Vladimir; Romero Vidal, Antonio; Rotondo, Marcello; Rudolph, Matthew Scott; Ruf, Thomas; Ruiz Valls, Pablo; Ruiz Vidal, Joan; Saborido Silva, Juan Jose; Sadykhov, Elnur; Sagidova, Naylya; Saitta, Biagio; Salustino Guimaraes, Valdir; Sanchez Mayordomo, Carlos; Sanmartin Sedes, Brais; Santacesaria, Roberta; Santamarina Rios, Cibran; Santimaria, Marco; Santovetti, Emanuele; Sarpis, Gediminas; Sarti, Alessio; Satriano, Celestina; Satta, Alessia; Saunders, Daniel Martin; Savrina, Darya; Schael, Stefan; Schellenberg, Margarete; Schiller, Manuel; Schindler, Heinrich; Schmelling, Michael; Schmelzer, Timon; Schmidt, Burkhard; Schneider, Olivier; Schopper, Andreas; Schreiner, HF; Schubiger, Maxime; Schune, Marie Helene; Schwemmer, Rainer; Sciascia, Barbara; Sciubba, Adalberto; Semennikov, Alexander; Sepulveda, Eduardo Enrique; Sergi, Antonino; Serra, Nicola; Serrano, Justine; Sestini, Lorenzo; Seyfert, Paul; Shapkin, Mikhail; Shapoval, Illya; Shcheglov, Yury; Shears, Tara; Shekhtman, Lev; Shevchenko, Vladimir; Siddi, Benedetto Gianluca; Silva Coutinho, Rafael; Silva de Oliveira, Luiz Gustavo; Simi, Gabriele; Simone, Saverio; Sirendi, Marek; Skidmore, Nicola; Skwarnicki, Tomasz; Smith, Iwan Thomas; Smith, Jackson; Smith, Mark; Soares Lavra, Lais; Sokoloff, Michael; Soler, Paul; Souza De Paula, Bruno; Spaan, Bernhard; Spradlin, Patrick; Sridharan, Srikanth; Stagni, Federico; Stahl, Marian; Stahl, Sascha; Stefko, Pavol; Stefkova, Slavomira; Steinkamp, Olaf; Stemmle, Simon; Stenyakin, Oleg; Stepanova, Margarita; Stevens, Holger; Stone, Sheldon; Storaci, Barbara; Stracka, Simone; Stramaglia, Maria Elena; Straticiuc, Mihai; Straumann, Ulrich; Sun, Jiayin; Sun, Liang; Swientek, Krzysztof; Syropoulos, Vasileios; Szumlak, Tomasz; Szymanski, Maciej Pawel; T'Jampens, Stephane; Tayduganov, Andrey; Tekampe, Tobias; Tellarini, Giulia; Teubert, Frederic; Thomas, Eric; van Tilburg, Jeroen; Tilley, Matthew James; Tisserand, Vincent; Tobin, Mark; Tolk, Siim; Tomassetti, Luca; Tonelli, Diego; Tourinho Jadallah Aoude, Rafael; Tournefier, Edwige; Traill, Murdo; Tran, Minh Tâm; Tresch, Marco; Trisovic, Ana; Tsaregorodtsev, Andrei; Tsopelas, Panagiotis; Tully, Alison; Tuning, Niels; Ukleja, Artur; Usachov, Andrii; Ustyuzhanin, Andrey; Uwer, Ulrich; Vacca, Claudia; Vagner, Alexander; Vagnoni, Vincenzo; Valassi, Andrea; Valat, Sebastien; Valenti, Giovanni; Vazquez Gomez, Ricardo; Vazquez Regueiro, Pablo; Vecchi, Stefania; van Veghel, Maarten; Velthuis, Jaap; Veltri, Michele; Veneziano, Giovanni; Venkateswaran, Aravindhan; Verlage, Tobias Anton; Vernet, Maxime; Vesterinen, Mika; Viana Barbosa, Joao Vitor; Vieira, Daniel; Vieites Diaz, Maria; Viemann, Harald; Vilasis-Cardona, Xavier; Vitti, Marcela; Volkov, Vladimir; Vollhardt, Achim; Voneki, Balazs; Vorobyev, Alexey; Vorobyev, Vitaly; Voß, Christian; de Vries, Jacco; Vázquez Sierra, Carlos; Waldi, Roland; Walsh, John; Wang, Jianchun; Wang, Yilong; Ward, David; Wark, Heather Mckenzie; Watson, Nigel; Websdale, David; Weiden, Andreas; Weisser, Constantin; Whitehead, Mark; Wicht, Jean; Wilkinson, Guy; Wilkinson, Michael; Williams, Mark Richard James; Williams, Mike; Williams, Timothy; Wilson, Fergus; Wimberley, Jack; Winn, Michael Andreas; Wishahi, Julian; Wislicki, Wojciech; Witek, Mariusz; Wormser, Guy; Wotton, Stephen; Wyllie, Kenneth; Xie, Yuehong; Xu, Menglin; Xu, Qingnian; Xu, Zehua; Xu, Zhirui; Yang, Zhenwei; Yang, Zishuo; Yao, Yuezhe; Yin, Hang; Yu, Jiesheng; Yuan, Xuhao; Yushchenko, Oleg; Zarebski, Kristian Alexander; Zavertyaev, Mikhail; Zhang, Liming; Zhang, Yanxi; Zhelezov, Alexey; Zheng, Yangheng; Zhu, Xianglei; Zhukov, Valery; Zonneveld, Jennifer Brigitta; Zucchelli, Stefano
2017-01-01
The difference between the $C\\!P$ asymmetries in the decays $\\varLambda_{c}^{+} \\to pK^{-}K^{+}$ and $\\varLambda_{c}^{+} \\to p\\pi^{-}\\pi^{+}$ is presented. Proton-proton collision data taken at centre-of-mass energies of $7$ and $8\\,\\mathrm{TeV}$ collected by the LHCb detector in 2011 and 2012 are used, corresponding to an integrated luminosity of $3\\,\\mathrm{fb}^{-1}$. The $\\varLambda_{c}^{+}$ candidates are reconstructed as part of the $\\varLambda_{b}^{0} \\to \\varLambda_{c}^{+}\\mu^{-}X$ decay chain. In order to maximize the cancellation of production and detection asymmetries in the difference, the final-state kinematic distributions of the two samples are aligned by applying phase-space-dependent weights to the \\mbox{$\\varLambda_{c}^{+} \\to p\\pi^{-}\\pi^{+}$} sample. This alters the definition of the integrated $C\\!P$ asymmetry to $A_{C\\!P}^{\\text{wgt}}(p\\pi^{-}\\pi^{+})$. Both samples are corrected for reconstruction and selection efficiencies across the five-dimensional $\\varLambda_{c}^{+}$ decay phase s...
VarR controls colonization and virulence in the marine macroalgal pathogen Nautella italica R11
Directory of Open Access Journals (Sweden)
Melissa eGardiner
2015-10-01
Full Text Available There is increasing evidence to suggest that macroalgae (seaweeds are susceptible to infectious disease. However, to date, little is known about the mechanisms that facilitate the colonization and virulence of microbial seaweed pathogens. One well-described example of a seaweed disease is the bleaching of the red alga Delisea pulchra, which can be caused by the bacterium Nautella italica R11, a member of the Roseobacter clade. This pathogen contains a unique luxR-type gene, varR, which we hypothesize controls its colonization and virulence. We show here that a varR knock-out strain is deficient in its ability to cause disease in D. pulchra and is defective in biofilm formation and attachment to a common algal polysaccharide. Moreover complementation of the varR gene in trans can restore these functions to the wild type levels. Proteomic analysis of bacterial cells in planktonic and biofilm growth highlight the potential importance of nitrogen scavenging, mobilization of energy reserves, and stress resistance in the biofilm lifestyle of N. italica R11. Moreover, we show that VarR regulates the expression of a specific subset of biofilm-associated proteins. Taken together these data suggest that VarR controls colonization and persistence of N. italica R11 on the surface of a macroalgal host and that it is an important regulator of virulence.
Directory of Open Access Journals (Sweden)
Juan P. Pérez Monsalve
2014-12-01
Full Text Available This work analyzed the relationship of the two main Price indicators in the Colombian economy, the IPP and the IPC. For this purpose, we identified the theory comprising both indexes to then develop a vector autoregressive model, which shows the reaction to shocks both in itself as in the other variable, whose impact continues propagating in the long term. Additionally, the work presents a simulation of the VAR model through the Monte Carlo method, verifying the coincidence in distributions of probability and volatility levels, as well as the existence correlation over time
DEFF Research Database (Denmark)
Nielsen, Morten A; Pinto, Vera V; Resende, Mafalda
2009-01-01
between a parasite protein expressed on erythrocytes named variant surface antigen 2-chondroitin sulfate A (VAR2CSA) and CSA on syncytiotrophoblasts. VAR2CSA is a large polymorphic protein consisting of six Duffy binding-like (DBL), domains and with current constraints on recombinant protein production...... which induce antibodies that inhibit CSA binding of different parasite strains. In this study, we produced a large panel of VAR2CSA proteins and raised antibodies against these antigens. We show that antibodies against the DBL4 domain effectively inhibit parasite binding. As the inhibition...... was not limited to homologous parasite strains, it seems feasible to base a protective malaria vaccine on a single VAR2CSA DBL domain....
[Leishmaniasis transmission focus in El Hobo, Carmen de Bolívar, Bolívar, Colombia].
Cortés, Luis Alberto
2006-10-01
The epidemiological characteristics and the importance of the Lutzomyia species present in a leishmaniasis focus in the village El Hobo, Carmen de Bolívar, Department of Bolivar, Colombia, are described. To obtain a preliminary assessment of leishmaniasis transmission in the village of El Hobo, Carmen de Bolívar. Epidemiological data were analyzed and sandflies were collected with CDC traps and on protected human volunteers in the village of El Hobo. Sero prevalence of canine visceral leishmaniasis in dogs was evaluated using indirect inmunofluorescence (IFAT). Nine Lutzomyia species were collected: L. trinidadensis, L. evansi, L. cayennensis, L. venezuelensis, L. gomezi, L. dubitans, L. ylephiletor, L. yuilli, and L. walkeri. The species of greater importance based on their implication in the transmission of cutaneous and visceral leishmaniasis were L. gomezi, and L. evansi respectively. Specimens of L. venezuelensis, L. dubitans, L. ylephiletor, L. yuilli, and L. walkeri are reported for the first time for the Department of Bolivar. The sero prevalence of visceral leishmaniasis in dogs was 36%. According to the epidemiological records, in 2002 the municipality of Carmen de Bolivar presented a 40% increase in cases of cutaneous leishmaniasis and an 80% increase in canine visceral leishmaniasis as compared to 2001, due to the outbreak in the village of El Hobo. The results indicate that the village of El Hobo is an area of potential risk for transmission of both cutaneous and visceral leishmaniasis.
Expression of P. falciparum var Genes Involves Exchange of the Histone Variant H2A.Z at the Promoter
Petter, Michaela; Lee, Chin Chin; Byrne, Timothy J.; Boysen, Katja E.; Volz, Jennifer; Ralph, Stuart A.; Cowman, Alan F.; Brown, Graham V.; Duffy, Michael F.
2011-01-01
Plasmodium falciparum employs antigenic variation to evade the human immune response by switching the expression of different variant surface antigens encoded by the var gene family. Epigenetic mechanisms including histone modifications and sub-nuclear compartmentalization contribute to transcriptional regulation in the malaria parasite, in particular to control antigenic variation. Another mechanism of epigenetic control is the exchange of canonical histones with alternative variants to generate functionally specialized chromatin domains. Here we demonstrate that the alternative histone PfH2A.Z is associated with the epigenetic regulation of var genes. In many eukaryotic organisms the histone variant H2A.Z mediates an open chromatin structure at promoters and facilitates diverse levels of regulation, including transcriptional activation. Throughout the asexual, intraerythrocytic lifecycle of P. falciparum we found that the P. falciparum ortholog of H2A.Z (PfH2A.Z) colocalizes with histone modifications that are characteristic of transcriptionally-permissive euchromatin, but not with markers of heterochromatin. Consistent with this finding, antibodies to PfH2A.Z co-precipitate the permissive modification H3K4me3. By chromatin-immunoprecipitation we show that PfH2A.Z is enriched in nucleosomes around the transcription start site (TSS) in both transcriptionally active and silent stage-specific genes. In var genes, however, PfH2A.Z is enriched at the TSS only during active transcription in ring stage parasites. Thus, in contrast to other genes, temporal var gene regulation involves histone variant exchange at promoter nucleosomes. Sir2 histone deacetylases are important for var gene silencing and their yeast ortholog antagonises H2A.Z function in subtelomeric yeast genes. In immature P. falciparum parasites lacking Sir2A or Sir2B high var transcription levels correlate with enrichment of PfH2A.Z at the TSS. As Sir2A knock out parasites mature the var genes are
Impacts of Bacillus thuringiensis var. israelensis and Bacillus ...
African Journals Online (AJOL)
The study assessed the impact of bio-larvicides- Bacillus thuringiensis var. israelensis (Bti) and B. sphaericus (Bs) on anopheline mosquito larval densities in four selected areas of Lusaka urban district. Larval densities were determined using a standard WHO protocol at each study area prior to and after larviciding.
Scalable and Flexible Multiview MAX-VAR Canonical Correlation Analysis
Fu, Xiao; Huang, Kejun; Hong, Mingyi; Sidiropoulos, Nicholas D.; So, Anthony Man-Cho
2017-08-01
Generalized canonical correlation analysis (GCCA) aims at finding latent low-dimensional common structure from multiple views (feature vectors in different domains) of the same entities. Unlike principal component analysis (PCA) that handles a single view, (G)CCA is able to integrate information from different feature spaces. Here we focus on MAX-VAR GCCA, a popular formulation which has recently gained renewed interest in multilingual processing and speech modeling. The classic MAX-VAR GCCA problem can be solved optimally via eigen-decomposition of a matrix that compounds the (whitened) correlation matrices of the views; but this solution has serious scalability issues, and is not directly amenable to incorporating pertinent structural constraints such as non-negativity and sparsity on the canonical components. We posit regularized MAX-VAR GCCA as a non-convex optimization problem and propose an alternating optimization (AO)-based algorithm to handle it. Our algorithm alternates between {\\em inexact} solutions of a regularized least squares subproblem and a manifold-constrained non-convex subproblem, thereby achieving substantial memory and computational savings. An important benefit of our design is that it can easily handle structure-promoting regularization. We show that the algorithm globally converges to a critical point at a sublinear rate, and approaches a global optimal solution at a linear rate when no regularization is considered. Judiciously designed simulations and large-scale word embedding tasks are employed to showcase the effectiveness of the proposed algorithm.
Molt disruption and mortality of Locusta migratoria var. manilensis ...
African Journals Online (AJOL)
IGRs) on the oriental migratory locust Locusta migratoria var. manilensis were assessed. Under laboratory conditions, at the highest tested dose rate of 300 ppm, the percent mortality and molt inhibition after two weeks for the five tested ...
Immunogenic Properties of Ricinus Communis Var Minor Seed on ...
African Journals Online (AJOL)
Prof. Ogunji
1College of Health Technology, Zawan, Plateau State.2Department of ... Ricinus communis var minor seed included in their feed (5g/100g body weight). ... White Blood cell Count (WBC) count and lymphocytosis in the differential count.
A Three-Enzyme-System to Degrade Curcumin to Natural Vanillin
Directory of Open Access Journals (Sweden)
Vida Esparan
2015-04-01
Full Text Available The symmetrical structure of curcumin includes two 4-hydroxy-3-methoxyphenyl substructures. Laccase catalyzed formation of a phenol radical, radical migration and oxygen insertion at the benzylic positions can result in the formation of vanillin. As vanillin itself is a preferred phenolic substrate of laccases, the formation of vanillin oligomers and polymers is inevitable, once vanillin becomes liberated. To decelerate the oligomerization, one of the phenolic hydroxyl groups was protected via acetylation. Monoacetyl curcumin with an approximate molar yield of 49% was the major acetylation product, when a lipase from Candida antarctica (CAL was used. In the second step, monoacetyl curcumin was incubated with purified laccases of various basidiomycete fungi in a biphasic system (diethyl ether/aqueous buffer. A laccase from Funalia trogii (LccFtr resulted in a high conversion (46% molar yield of curcumin monoacetate to vanillin acetate. The non-protected vanillin moiety reacted to a mixture of higher molecular products. In the third step, the protecting group was removed from vanillin acetate using a feruloyl esterase from Pleurotus eryngii (PeFaeA (68% molar yield. Alignment of the amino acid sequences indicated that high potential laccases performed better in this mediator and cofactor-free reaction.
Muhle, Rebecca A; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J; Muhle, Michael E; Fidock, David A
2009-11-01
Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitised erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilising the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var subtelomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronised parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may result from the integrated UpsA promoter being largely silenced by the neighbouring cg6 promoter. Our analyses also revealed that the DownsA 3' untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA-promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyse promoter activity of Group A var genes, which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of var
Assimilation of Atmospheric InfraRed Sounder (AIRS) Profiles using WRF-Var
Zavodsky, Brad; Jedlovec, Gary J.; Lapenta, William
2008-01-01
The Weather Research and Forecasting (WRF) model contains a three-dimensional variational (3DVAR) assimilation system (WRF-Var), which allows a user to join data from multiple sources into one coherent analysis. WRF-Var combines observations with a background field traditionally generated using a previous model forecast through minimization of a cost function. In data sparse regions, remotely-sensed observations may be able to improve analyses and produce improved forecasts. One such source comes from the Atmospheric Infrared Sounder (AIRS), which together with the Advanced Microwave Sounding Unit (AMSU), represents one of the most advanced space-based atmospheric sounding systems. The combined AIRS/AMSU system provides radiance measurements used as input to a sophisticated retrieval scheme which has been shown to produce temperature profiles with an accuracy of 1 K over 1 km layers and humidity profiles with accuracy of 15% in 2 km layers in both clear and partly cloudy conditions. The retrieval algorithm also provides estimates of the accuracy of the retrieved values at each pressure level, allowing the user to select profiles based on the required error tolerances of the application. The purpose of this paper is to describe a procedure to optimally assimilate high-resolution AIRS profile data into a regional configuration of the Advanced Research WRF (ARW) version 2.2 using WRF-Var. The paper focuses on development of background error covariances for the regional domain and background field type using gen_be and an optimal methodology for ingesting AIRS temperature and moisture profiles as separate overland and overwater retrievals with different error characteristics in the WRF-Var. The AIRS thermodynamic profiles are obtained from the version 5.0 Earth Observing System (EOS) science team retrieval algorithm and contain information about the quality of each temperature layer. The quality indicators are used to select the highest quality temperature and moisture
Several domains from VAR2CSA can induce Plasmodium falciparum adhesion-blocking antibodies
DEFF Research Database (Denmark)
Salanti, Ali; Resende, Mafalda; Ditlev, Sisse B
2010-01-01
. In this study, it is demonstrated that other domains of VAR2CSA also can induce antibodies with inhibitory activity. METHODS: All VAR2CSA domains from the 3D7 and HB3 parasites were produced in Baculovirus-transfected insect cells. Groups of three rats per protein were immunized and anti-sera were tested...
Ye, Run; Zhang, Dongmei; Chen, Biaobang; Zhu, Yongqiang; Zhang, Yilong; Wang, Shengyue; Pan, Weiqing
2015-02-07
Antigenic variation in Plasmodium falciparum involves switching among multicopy var gene family and is responsible for immune evasion and the maintenance of chronic infections. Current understanding of var gene expression and switching patterns comes from experiments conducted on long laboratory-adapted strains, with little known about their wild counterparts. Genome sequencing was used to obtain 50 var genes from a parasite isolated from the China-Myanmar border. Four clones with different dominant var genes were cultured in vitro in replicates for 50 generations. Transcription of the individual var gene was detected by real-time PCR and then the switching process was analysed. The expression of multicopy var genes is mutually exclusive in clones of a wild P. falciparum isolate. The activation of distinct primary dominant var genes leads to different and favoured switching patterns in the four clones. The on/off rates of individual var genes are variable and the choice of subsequent dominant var genes are random, which results in the different switching patterns among replicates of each clonal wild P. falciparum isolate with near identical initial transcription profiles. This study suggests that the switching patterns of var genes are abundant, which consist of both conserved and random parts.
Directory of Open Access Journals (Sweden)
Gisele Martini Borges
2013-12-01
Full Text Available Polysaccharides with medicinal properties can be obtained from fruiting bodies, mycelium and culture broth of several fungus species. This work was carried out in batch culture using a stirred tank reactor with two different initial glucose concentrations (40-50 g/L and pH values (3.0-4.0 to enhance extracellular polysaccharides production by Pleurotus djamor UNIVILLE 001 and evaluate antitumor effect of intraperitonial administration of Pleurotus djamor extract on sarcoma 180 animal model. According to factorial design, the low pH value (pH 3.0 led to a gain of 1.6 g/L on the extracellular polysaccharide concentration, while glucose concentration in the tested range had no significant effect on the concentration of polysaccharide. With 40 g/L initial glucose concentration and pH 3.0, it was observed that yield factor of extracellular polysaccharide on substrate (Y P/S = 0.072 and maximum extracellular polysaccharide productivity (Q Pmax = 11.26 mg/L.h were about 188% and 321% respectively higher than those obtained in the experiment performed at pH 4.0. Under these conditions, the highest values of the yield factor of biomass on substrate (Y X/S = 0.24 and maximal biomass productivity (Q Xmax = 32.2 mg/L.h were also reached. In tumor response study, mean tumor volume on the 21th day was 35.3 cm³ in untreated group and 1.6 cm³ in treated group (p = 0.05 with a tumor inhibition rate of 94%. These impressive results suggests an inhibitory effect of P.djamor extract on cancer cells.
Githinji, George; Bull, Peter C
2017-01-01
PfEMP1 are variant parasite antigens that are inserted on the surface of Plasmodium falciparum infected erythrocytes (IE). Through interactions with various host molecules, PfEMP1 mediate IE sequestration in tissues and play a key role in the pathology of severe malaria. PfEMP1 is encoded by a diverse multi-gene family called var . Previous studies have shown that that expression of specific subsets of var genes are associated with low levels of host immunity and severe malaria. However, in most clinical studies to date, full-length var gene sequences were unavailable and various approaches have been used to make comparisons between var gene expression profiles in different parasite isolates using limited information. Several studies have relied on the classification of a 300 - 500 base-pair "DBLα tag" region in the DBLα domain located at the 5' end of most var genes. We assessed the relationship between various DBLα tag classification methods, and sequence features that are only fully assessable through full-length var gene sequences. We compared these different sequence features in full-length var gene from six fully sequenced laboratory isolates. These comparisons show that despite a long history of recombination, DBLα sequence tag classification can provide functional information on important features of full-length var genes. Notably, a specific subset of DBLα tags previously defined as "group A-like" is associated with CIDRα1 domains proposed to bind to endothelial protein C receptor. This analysis helps to bring together different sources of data that have been used to assess var gene expression in clinical parasite isolates.
Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes
Directory of Open Access Journals (Sweden)
Rowe J
2009-08-01
Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.
Transient Stability Enhancement in Power System Using Static VAR Compensator (SVC
Directory of Open Access Journals (Sweden)
Youssef MOULOUDI
2012-12-01
Full Text Available In this paper, an indirect adaptive fuzzy excitation and static VAR (unit of reactive power, volt-ampere reactive compensator (SVC controller is proposed to enhance transient stability for the power system, which based on input-output linearization technique. A three-bus system, which contains a generator and static VAR compensator (SVC, is considered in this paper, the SVC is located at the midpoint of the transmission lines. Simulation results show that the proposed controller compared with a controller based on tradition linearization technique can enhance the transient stability of the power system under a large sudden fault, which may occur nearly at the generator bus terminal.
MANAGEMENT OF Amburana cearensis var. acreana IN ACRE STATE, BRAZIL
Directory of Open Access Journals (Sweden)
Evaldo Muñoz Braz
2014-06-01
Full Text Available http://dx.doi.org/10.5902/1980509814586This work has as its objectives: a to assess the geographical distribution and population structure of Amburana cearensis var. acreana; b to calculate sustainable cutting rates, according to stipulated cutting cycles, and c to simulate the projected recovery potential in volume based on the calculated cutting rate. It was used data from sustainable forest management plans, and the results will contribute for future decisions about its endangered condition. The results did not corroborate the information that Amburana cearensis var. acreana is endangered in Acre state. However the management sustainability will only be feasible if considered the ideal remaining population structure and the estimative of the optimal cutting rate according to the cutting cycle.
Directory of Open Access Journals (Sweden)
PILAR SUDIANY VARGAS
2012-06-01
Full Text Available Se evaluó hojarasca de roble en un relicto de bosque en la Vereda La Capilla de Cajibío (Cauca durante 6 meses, como sustrato para el crecimiento del hongo Pleurotus ostreatus, eligiendo árboles maduros con DAP entre 35 y 37 cm, obteniéndose un promedio de 7,41 kg de hojarasca por árbol. Se evaluó el crecimiento del hongo en hojarasca mezclada con bagazo de caña y 5 sustratos: T1: bagazo 100%, T2: roble 100%, T3: roble 75% y 25% de bagazo, T4: roble 50% y 50% bagazo y T5: roble 25% y 75% bagazo, logrando eficiencias biológicas de 221,1%, 44,35%, 52,78%, 90,30% y 109,12% respectivamente. Se observó relación inversa entre el contenido de hoja de roble y las eficiencias debido a la naturaleza coriácea y cerosa de la hoja. La mayoría de los carpóforos presentaron 5 a 12 cm de diámetro y contaminación causada por hongos competidores del género Trichoderma sp. Se detectaron cambios en la composición del sustrato agotado, principalmente incremento de minerales y proteínas y disminución de fibra en el bagazo de caña y en la hojarasca de roble, siendo apto para alimentación de animales poligástricos por el contenido de proteína micelial, presencia de celulosa y menor contenido de lignina.Avaliamos a produção de serapilheira em uma floresta na aldeia La Capilla de Cajibío, (Cauca, por 6 meses, como substrato para o crescimento do fungo Pleurotus ostreatus, escolhendo árvores maduras com DAP entre 35 e 37 cm, produzindo uma media de 7,41 kg de lixo por árvore. Avaliou-se o crescimento do fungo em folhas misturadas com bagaço de cana e 5 substratos: T1: bagaço de 100%, T2: carvalho de 100%, T3: carvalho 75% e 25% de bagaço, T4: carvalho 50% e bagaço 50% e T5: carvalho de 25% e 75% do bagaço, alcançando eficiências biológicas de 221,1%, 44,35%, 52,78%, 90,30% e 109,12%, respectivamente. Era uma associação inversa entre o conteúdo de folha de carvalho e eficiência devido à natureza de couro, folha waxy. A maioria dos
Anogeissus sericea var. nummalaria King ex Duthie (Combretaceae ...
Indian Academy of Sciences (India)
Anogeissus sericea var. nummalaria King ex Duthie (Combretaceae) is moderate sized multipurpose hard wood tree of dry deciduous forests with drooping branches and yellow to brownish-yellow flowers. it is endemic to Rajasthan and is considered to be a threatened tree of the region due to over exploitation for timber ...
Directory of Open Access Journals (Sweden)
EN. Gari
Full Text Available Spatial and temporal variations of Cocconeis placentula var. euglypta in drift and periphyton were studied in mountain streams of the Córdoba Province (Argentina. The sampling program was conducted in study sites located on a confluence between different order streams during an annual cycle. Samples were also taken every two hours during the daylight period in high and low water conditions. The relationship between drift and cellular reproduction was evaluated by valve length biometrics analysis. C. placentula var. euglypta drift was continuous; its density was not always dependent on periphyton density in each locality. C. placentula var. euglypta drift could be related to abiotic factors such as temperature and flow during the annual cycle. There were significant differences between periphyton and drift valve lengths. Moreover, drift can be associated with cellular reproduction because density was higher when valve lengths were shorter at different hours of the day. C. placentula var. euglypta epiphytims on Cladophora glomerata also influenced drift density and size distribution, modifying the relationship between periphyton and drift during the late spring when C. placentula var. euglypta was detached from senescent mats.
Harrison, Steven M; Dolinsky, Jill S; Knight Johnson, Amy E; Pesaran, Tina; Azzariti, Danielle R; Bale, Sherri; Chao, Elizabeth C; Das, Soma; Vincent, Lisa; Rehm, Heidi L
2017-10-01
Data sharing through ClinVar offers a unique opportunity to identify interpretation differences between laboratories. As part of a ClinGen initiative, four clinical laboratories (Ambry, GeneDx, Partners Healthcare Laboratory for Molecular Medicine, and University of Chicago Genetic Services Laboratory) collaborated to identify the basis of interpretation differences and to investigate if data sharing and reassessment resolve interpretation differences by analyzing a subset of variants. ClinVar variants with submissions from at least two of the four participating laboratories were compared. For a subset of identified differences, laboratories documented the basis for discordance, shared internal data, independently reassessed with the American College of Medical Genetics and Genomics-Association for Molecular Pathology (ACMG-AMP) guidelines, and then compared interpretations. At least two of the participating laboratories interpreted 6,169 variants in ClinVar, of which 88.3% were initially concordant. Laboratories reassessed 242/724 initially discordant variants, of which 87.2% (211) were resolved by reassessment with current criteria and/or internal data sharing; 12.8% (31) of reassessed variants remained discordant owing to differences in the application of the ACMG-AMP guidelines. Participating laboratories increased their overall concordance from 88.3 to 91.7%, indicating that sharing variant interpretations in ClinVar-thereby allowing identification of differences and motivation to resolve those differences-is critical to moving toward more consistent variant interpretations.Genet Med advance online publication 09 March 2017.
Value at risk (VaR in uncertainty: Analysis with parametric method and black & scholes simulations
Directory of Open Access Journals (Sweden)
Humberto Banda Ortiz
2014-07-01
Full Text Available VaR is the most accepted risk measure worldwide and the leading reference in any risk management assessment. However, its methodology has important limitations which makes it unreliable in contexts of crisis or high uncertainty. For this reason, the aim of this work is to test the VaR accuracy when is employed in contexts of volatility, for which we compare the VaR outcomes in scenarios of both stability and uncertainty, using the parametric method and a historical simulation based on data generated with the Black & Scholes model. VaR main objective is the prediction of the highest expected loss for any given portfolio, but even when it is considered a useful tool for risk management under conditions of markets stability, we found that it is substantially inaccurate in contexts of crisis or high uncertainty. In addition, we found that the Black & Scholes simulations lead to underestimate the expected losses, in comparison with the parametric method and we also found that those disparities increase substantially in times of crisis. In the first section of this work we present a brief context of risk management in finance. In section II we present the existent literature relative to the VaR concept, its methods and applications. In section III we describe the methodology and assumptions used in this work. Section IV is dedicated to expose the findings. And finally, in Section V we present our conclusions.
DEFF Research Database (Denmark)
Lavstsen, Thomas; Salanti, Ali; Jensen, Anja T R
2003-01-01
and organization of the 3D7 PfEMP1 repertoire was investigated on the basis of the complete genome sequence. METHODS: Using two tree-building methods we analysed the coding and non-coding sequences of 3D7 var and rif genes as well as var genes of other parasite strains. RESULTS: var genes can be sub...
Deng, Huai; Cai, Weili; Wang, Chao; Lerach, Stephanie; Delattre, Marion; Girton, Jack; Johansen, Jørgen; Johansen, Kristen M.
2010-01-01
The essential JIL-1 histone H3S10 kinase is a key regulator of chromatin structure that functions to maintain euchromatic domains while counteracting heterochromatization and gene silencing. In the absence of the JIL-1 kinase, two of the major heterochromatin markers H3K9me2 and HP1a spread in tandem to ectopic locations on the chromosome arms. Here we address the role of the third major heterochromatin component, the zinc-finger protein Su(var)3-7. We show that the lethality but not the chromosome morphology defects associated with the null JIL-1 phenotype to a large degree can be rescued by reducing the dose of the Su(var)3-7 gene and that Su(var)3-7 and JIL-1 loss-of-function mutations have an antagonistic and counterbalancing effect on position-effect variegation (PEV). Furthermore, we show that in the absence of JIL-1 kinase activity, Su(var)3-7 gets redistributed and upregulated on the chromosome arms. Reducing the dose of the Su(var)3-7 gene dramatically decreases this redistribution; however, the spreading of H3K9me2 to the chromosome arms was unaffected, strongly indicating that ectopic Su(var)3-9 activity is not a direct cause of lethality. These observations suggest a model where Su(var)3-7 functions as an effector downstream of Su(var)3-9 and H3K9 dimethylation in heterochromatic spreading and gene silencing that is normally counteracted by JIL-1 kinase activity. PMID:20457875
DEFF Research Database (Denmark)
Sander, Adam F; Salanti, Ali; Lavstsen, Thomas
2009-01-01
in the VAR2CSA protein, sequence variation in the DBL2X region of var2csa genes in 54 P.falciparum samples was analyzed. Chromosome mapping of var2csa loci was carried out and a quantitative PCR assay was developed to estimate the number of var2csa genes in P.falciparum isolates from the placenta of pregnant....... falciparum isolates. One gene is on chromosome 12 but additional var2csa-type genes are on different chromosomes in different isolates. Multiplicity of var2csa genes appears more common in infected placentae than in samples from non-pregnant donors indicating a possible advantage of this genotype...
Directory of Open Access Journals (Sweden)
Čeněk Novotný
2016-07-01
Full Text Available The work is focused on spontaneous colonization of fungal mycelium by invading microorganisms in a trickle-bed fungal bioreactor operating under semi-sterile conditions. Pleurotus ostreatus was grown under the flow of synthetic wastewater containing activated sludge bacteria and the microbial consortium developed in the reactor was characterized. Genotype and phenotype profile of the reactor-invading, bacterial consortium was clearly distinctive from that of the original activated sludge. The bacterial consortium from the reactor contained a higher portion of bacteria capable of cellobiose utilization and a small amount of bacteria with the ability to utilize benzoic acids. The invading bacteria had no effect on the dye decolorization performance of the fungal reactor. Five bacterial strains colonizing P. ostreatus reactor cultures were isolated and identified as species of the genera Pseudomonas and Bacillus. Except for Bacillus cereus all strains displayed a potential to inhibit fungal growth on solid media (14 to 51 % inhibition which was comparable or higher than that of the reference bacterial strains. The pH- and media composition-dependence of the growth inhibition was demonstrated.
Gil-Ramirez, Alicia; Smiderle, Fhernanda R; Morales, Diego; Govers, Coen; Synytsya, Andriy; Wichers, Harry J; Iacomini, Marcello; Soler-Rivas, Cristina
2017-01-01
Water extracts from Pleurotus ostreatus containing no statins showed 3-hydroxy-3-methyl-glutaryl CoA reductase (HMGCR) inhibitory activity (in vitro) that might be due to specific water-soluble polysaccharides (WSPs); when isolated and deproteinized, increasing concentrations of the WSP extract induced higher inhibition. The WSP extract contained mainly β-glucans, mannogalactans, and glycogen (e.g., α-glucans), although derivatives or fragments with lower molecular weights (between 14 and 3.5 kDa) were present and were able to induce the inhibitory activity. The extract contained more β-(1→3)-glucans than β-(11→3),(11→6)-glucans, and they partially survived digestion and managed to pass through Caco2 cell monolayers to the lower compartment after in vitro digestion and transport experiments. The WSP might also modulate Caco2 membrane integrity.
Biodegradation of endocrine disruptors in urban wastewater using Pleurotus ostreatus bioreactor.
Křesinová, Zdena; Linhartová, Lucie; Filipová, Alena; Ezechiáš, Martin; Mašín, Pavel; Cajthaml, Tomáš
2018-07-25
The white rot fungus Pleurotus ostreatus HK 35, which is also an edible industrial mushroom commonly cultivated in farms, was tested in the degradation of typical representatives of endocrine disrupters (EDCs; bisphenol A, estrone, 17β-estradiol, estriol, 17α-ethinylestradiol, triclosan and 4-n-nonylphenol); its degradation efficiency under model laboratory conditions was greater than 90% within 12 days and better than that of another published strain P. ostreatus 3004. A spent mushroom substrate from a local farm was tested for its applicability in various batch and trickle-bed reactors in degrading EDCs in model fortified and real communal wastewater. The reactors were tested under various regimes including a pilot-scale trickle-bed reactor, which was finally tested at a wastewater treatment plant. The result revealed that the spent substrate is an efficient biodegradation agent, where the fungus was usually able to remove about 95% of EDCs together with suppression of the estrogenic activity of the sample. The results showed the fungus was able to operate in the presence of bacterial microflora in wastewater without any substantial negative effects on the degradation abilities. Finally, a pilot-scale trickle-bed reactor was installed in a wastewater treatment plant and successfully operated for 10days, where the bioreactor was able to remove more than 76% of EDCs present in the wastewater. Copyright © 2017 Elsevier B.V. All rights reserved.
Li, Wei; Feng, Yanxia; Sun, Haiyan; Deng, Yuanyu; Yu, Hanshou; Chen, Huaigu
2014-11-01
Understanding the genetic structure of Gaeumannomyces graminis var. tritici is essential for the establishment of efficient disease control strategies. It is becoming clear that microsatellites, or simple sequence repeats (SSRs), play an important role in genome organization and phenotypic diversity, and are a large source of genetic markers for population genetics and meiotic maps. In this study, we examined the G. graminis var. tritici genome (1) to analyze its pattern of SSRs, (2) to compare it with other plant pathogenic filamentous fungi, such as Magnaporthe oryzae and M. poae, and (3) to identify new polymorphic SSR markers for genetic diversity. The G. graminis var. tritici genome was rich in SSRs; a total 13,650 SSRs have been identified with mononucleotides being the most common motifs. In coding regions, the densities of tri- and hexanucleotides were significantly higher than in noncoding regions. The di-, tri-, tetra, penta, and hexanucleotide repeats in the G. graminis var. tritici genome were more abundant than the same repeats in M. oryzae and M. poae. From 115 devised primers, 39 SSRs are polymorphic with G. graminis var. tritici isolates, and 8 primers were randomly selected to analyze 116 isolates from China. The number of alleles varied from 2 to 7 and the expected heterozygosity (He) from 0.499 to 0.837. In conclusion, SSRs developed in this study were highly polymorphic, and our analysis indicated that G. graminis var. tritici is a species with high genetic diversity. The results provide a pioneering report for several applications, such as the assessment of population structure and genetic diversity of G. graminis var. tritici.
Fiscal developments and financial stress: a threshold VAR analysis
Czech Academy of Sciences Publication Activity Database
Afonso, A.; Baxa, Jaromír; Slavík, M.
2011-01-01
Roč. 2011, č. 1319 (2011), s. 1-60 ISSN 1725-2806 Institutional research plan: CEZ:AV0Z10750506 Keywords : fiscal policy * financial markets * threshold VAR Subject RIV: AH - Economics http://library.utia.cas.cz/separaty/2011/E/baxa-0364091.pdf
Directory of Open Access Journals (Sweden)
A. F. Zobaa
2006-09-01
Full Text Available Many of today utility interconnected wind farms use induction generator (IG to convert the captured wind mechanical power into electricity. Induction generator has some advantages over the synchronous generator (SG. The main advantages are its robustness and its capability to be synchronized directly to the grid. The main disadvantage, however, is its dependency on the grid for supplying its own reactive power ‘VAr’. Whether fixed or adjustable VAr systems are connected across its terminal, IG must operate at unity power factor at the rated loading while the wind power varies. With supervised control and appropriate coordination, VAr can be used to the benefits of both the wind farm developer and the hosting utility. The incorporation of today adjustable reactive power compensators such as the Static VAr Compensation (SVC and Static Synchronous Compensator (STATCOM with IG are vital ingredient toward a successful penetration of wind energy in today distribution grid to ensure voltage stability during the steady state and transient periods.
Datta, Suprama; Timson, David J; Annapure, Uday S
2017-07-01
Saccharomyces cerevisiae var. boulardii is the only yeast species with probiotic properties. It is considered to have therapeutic significance in gastrointestinal disorders. In the present study, a comparative physiological study between this yeast and Saccharomyces cerevisiae (BY4742) was performed by evaluating two prominent traits of probiotic species, responses to different stress conditions and antioxidant capacity. A global metabolite profile was also developed aiming to identify which therapeutically important secondary metabolites are produced. Saccharomyces cerevisiae var. boulardii showed no significant difference in growth patterns but greater stress tolerance compared to S. cerevisiae. It also demonstrated a six- to 10-fold greater antioxidant potential (judged by the 1,1-diphenyl-2-picrylhydrazyl assay), with a 70-fold higher total phenolic content and a 20-fold higher total flavonoid content in the extracellular fraction. These features were clearly differentiated by principal component analysis and further indicated by metabolite profiling. The extracellular fraction of the S. cerevisiae var. boulardii cultures was found to be rich in polyphenolic metabolites: vanillic acid, cinnamic acid, phenyl ethyl alcohol (rose oil), erythromycin, amphetamine and vitamin B 6 , which results in the antioxidant capacity of this strain. The present study presents a new perspective for differentiating the two genetically related strains of yeast, S. cerevisiae and S. cerevisiae var. boulardii by assessing their metabolome fingerprints. In addition to the correlation of the phenotypic properties with the secretory metabolites of these two yeasts, the present study also emphasizes the potential to exploit S. cerevisiae var. boulardii in the industrial production of these metabolites. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Zhang, Guang-Hui; Ma, Chun-Hua; Zhang, Jia-Jin; Chen, Jun-Wen; Tang, Qing-Yan; He, Mu-Han; Xu, Xiang-Zeng; Jiang, Ni-Hao; Yang, Sheng-Chao
2015-03-08
P. vietnamensis var. fuscidiscus, called "Yesanqi" in Chinese, is a new variety of P. vietnamensis, which was first found in Jinping County, the southern part of Yunnan Province, China. Compared with other Panax plants, this species contains higher content of ocotillol-type saponin, majonoside R2. Despite the pharmacological importance of ocotillol-type saponins, little is known about their biosynthesis in plants. Hence, P. vietnamensis var. fuscidiscus is a suitable medicinal herbal plant species to study biosynthesis of ocotillol-type saponins. In addition, the available genomic information of this important herbal plant is lacking. To investigate the P. vietnamensis var. fuscidiscus transcriptome, Illumina HiSeq™ 2000 sequencing platform was employed. We produced 114,703,210 clean reads, assembled into 126,758 unigenes, with an average length of 1,304 bp and N50 of 2,108 bp. Among these 126,758 unigenes, 85,214 unigenes (67.23%) were annotated based on the information available from the public databases. The transcripts encoding the known enzymes involved in triterpenoid saponins biosynthesis were identified in our Illumina dataset. A full-length cDNA of three Squalene epoxidase (SE) genes were obtained using reverse transcription PCR (RT-PCR) and the expression patterns of ten unigenes were analyzed by reverse transcription quantitative real-time PCR (RT-qPCR). Furthermore, 15 candidate cytochrome P450 genes and 17 candidate UDP-glycosyltransferase genes most likely to involve in triterpenoid saponins biosynthesis pathway were discovered from transcriptome sequencing of P. vietnamensis var. fuscidiscus. We further analyzed the data and found 21,320 simple sequence repeats (SSRs), 30 primer pairs for SSRs were randomly selected for validation of the amplification and polymorphism in 13 P. vietnamensis var. fuscidiscus accessions. Meanwhile, five major triterpene saponins in roots of P. vietnamensis var. fuscidicus were determined using high performance
Heterologous production of the stain solving peptidase PPP1 from Pleurotus pulmonarius.
Leonhardt, Robin-Hagen; Krings, Ulrich; Berger, Ralf G; Linke, Diana
2016-05-01
A novel stain solving subtilisin-like peptidase (PPP1) was identified from the culture supernatant of the agaricomycete Pleurotus pulmonarius. It was purified to homogeneity using a sequence of preparative isoelectric focusing, anion exchange and size exclusion chromatography. Peptides were identified by ab initio sequencing (nLC-ESI-QTOF-MS/MS), characterizing the enzyme as a member of the subtilase family (EC 3.4.21.X). An expression system was established featuring the pPIC9K vector, an alternative Kozak sequence, the codon optimized gene ppp1 gene without the native signal sequence with C-terminal hexa-histidine tag, and Pichia pastoris GS115 as expression host. Intracellular active enzyme was obtained from cultivations in shake flasks and in a five liter bioreactor. With reaction optima of 40 °C and a pH > 8.5, considerable bleaching of pre-stained fabrics (blood, milk and India ink), and the possibility of larger-scale production, the heterologous enzyme is well suitable for detergent applications, especially at lower temperatures as part of a more energy- and cost-efficient washing process. Showing little sequence similarity to other subtilases, this unique peptidase is the first subtilisin-like peptidase from Basidiomycota, which has been functionally produced in Pichia pastoris.
Directory of Open Access Journals (Sweden)
Antônio Gilberto Bertechini
2009-08-01
Full Text Available Avaliou-se a adição dietética de um composto exaurido da produção do cogumelo Pleurotus sajor caju sobre o desempenho de frangos de corte nos períodos de um a 21, 22 a 38 e um a 38 dias de idade. Foram utilizados 500 pintos de um dia Ross-308, machos, em delineamento inteiramente casualizado, com cinco tratamentos, obtidos pelos níveis do composto na ração (0; 0,5; 1,0; 1,5 e 2,0% com quatro repetições de 20 aves cada. Foram avaliados ganho de peso, consumo de ração, conversão alimentar, rendimento de carcaça, gordura abdominal e altura das microvilosidades do intestino. A adição do composto não influenciou no consumo da ração e na conversão alimentar. Para o ganho de peso houve efeito positivo somente na fase inicial (um a 21 dias, sendo o valor máximo obtido com a adição de 0,67% do composto. A adição do composto não alterou o rendimento de carcaça e gordura abdominal, porém, alterou a altura das microvilosidades do intestino. A adição de composto exaurido da produção do fungo Pleurotus sajor caju, na concentração de 0,67%, melhora o ganho de peso dos frangos nos primeiros 21 dias de idadeThis research evaluated the effect of the addition of a spent mushroom substrate (SMS Pleurotus sajor caju at different levels on the performance of broiler chicks from 1 to 21, 22 to 38 and 1 to 38 days of age. Five hundred one-day-old Ross-308 chicks were utilized, allocated in a completely randomized design, with five treatments obtained by increased levels of compost on ration (0; 0.5; 1.0; 1.5 and 2.0%, with four replicates of 20 birds per experimental unit. The intake, weight gain, feed conversion, carcass yield, abdominal fat and villus height were evaluated. No effect was observed on intake and feed conversion when the compost was included in the feeding. A positive effect was observed for weight gain from 1 to 21 days of age, with maximum value of 0.67% of SMS, but its addition did not modify the carcass yield and
Utilizing nanobody technology to target non-immunodominant domains of VAR2CSA
DEFF Research Database (Denmark)
Ditlev, Sisse B; Florea, Raluca; Nielsen, Morten A
2014-01-01
adhesion. However, the development of a VAR2CSA adhesion-blocking vaccine remains challenging due to (i) the large size of VAR2CSA and (ii) the extensive immune selection for polymorphisms and thereby non-neutralizing B-cell epitopes. Camelid heavy-chain-only antibodies (HcAbs) are known to target epitopes...... that are less immunogenic to classical IgG and, due to their small size and protruding antigen-binding loop, able to reach and recognize cryptic, conformational epitopes which are inaccessible to conventional antibodies. The variable heavy chain (VHH) domain is the antigen-binding site of camelid HcAbs, the so...
Travassos, Mark A; Coulibaly, Drissa; Bailey, Jason A; Niangaly, Amadou; Adams, Matthew; Nyunt, Myaing M; Ouattara, Amed; Lyke, Kirsten E; Laurens, Matthew B; Pablo, Jozelyn; Jasinskas, Algis; Nakajima, Rie; Berry, Andrea A; Takala-Harrison, Shannon; Kone, Abdoulaye K; Kouriba, Bourema; Rowe, J Alexandra; Doumbo, Ogobara K; Thera, Mahamadou A; Laufer, Miriam K; Felgner, Philip L; Plowe, Christopher V
2015-06-01
The Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family mediates parasite sequestration in small capillaries through tissue-specific cytoadherence. The best characterized of these proteins is VAR2CSA, which is expressed on the surface of infected erythrocytes that bind to chondroitin sulfate in the placental matrix. Antibodies to VAR2CSA prevent placental cytoadherence and protect against placental malaria. The size and complexity of the VAR2CSA protein pose challenges for vaccine development, but smaller constitutive domains may be suitable for subunit vaccine development. A protein microarray was printed to include five overlapping fragments of the 3D7 VAR2CSA extracellular region. Malian women with a history of at least one pregnancy had antibody recognition of four of these fragments and had stronger reactivity against the two distal fragments than did nulliparous women, children, and men from Mali, suggesting that the C-terminal extracellular VAR2CSA domains are a potential focus of protective immunity. With carefully chosen sera from longitudinal studies of pregnant women, this approach has the potential to identify seroreactive VAR2CSA domains associated with protective immunity against pregnancy-associated malaria. © The American Society of Tropical Medicine and Hygiene.
Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.
2009-01-01
Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of
Characterization of flavonoids in Millettia nitida var. hirsutissima by HPLC/DAD/ESI-MS n
Ye, Min; Yang, Wen-Zhi; Liu, Ke-Di; Qiao, Xue; Li, Bei-Jia; Cheng, Jun; Feng, Jie; Guo, De-An; Zhao, Yu-Ying
2011-01-01
Millettia nitida var. hirsutissima is a Chinese herbal medicine used for the treatment of gynecological diseases. An HPLC/DAD/ESI-MSn method was established for the rapid separation and characterization of bioactive flavonoids in M. nitida var. hirsutissima. A total of 32 flavonoids were detected, of which 14 compounds were unambiguously characterized by comparing their retention time, UV, and MS spectra with those of the reference standards, and the others were tentatively identified based o...
Description of rainfall variability in Br hat -samhita of Varâha-mihira
Iyengar, RN
2004-01-01
Br hat -samhita of Varâha-mihira (5–6th century AD) provides valuable information on the approach in ancient India towards monsoon rainfall, including its measurement and forecasting. In this context, we come across a description of the expected amount of total seasonal rainfall depending on the first rains under the 27 naks atras of Indian astronomy. This provides a rough statistical picture of what might have been the rainfall and its variability in the region around Ujjain, where Varâha-mi...
Bolívar, primer diplomático de la libertad americana
Directory of Open Access Journals (Sweden)
Rafael Gómez Hoyos
1969-03-01
Full Text Available Don Miguel Luis Amunátegui, primer biógrafo de don Andrés Bello, recopilador y comentarista meritorio de sus obras, nos dejó una falsa visión de Bolívar como diplomático de la libertad. Basado en los recuerdos del anciano humanista, cuando ya le flaqueaba la memoria, o gracias a un error suyo de apreciación, al comentar los incidentes de la misión encomendada ante el gobierno británico por la Junta Suprema de Caracas, nos relata increíble falta de tacto y descuido imperdonable en Simón Bolívar, Jefe de la Misión.
Directory of Open Access Journals (Sweden)
Anastasia P Litvintseva
2011-05-01
Full Text Available Most of the species of fungi that cause disease in mammals, including Cryptococcus neoformans var. grubii (serotype A, are exogenous and non-contagious. Cryptococcus neoformans var. grubii is associated worldwide with avian and arboreal habitats. This airborne, opportunistic pathogen is profoundly neurotropic and the leading cause of fungal meningitis. Patients with HIV/AIDS have been ravaged by cryptococcosis--an estimated one million new cases occur each year, and mortality approaches 50%. Using phylogenetic and population genetic analyses, we present evidence that C. neoformans var. grubii may have evolved from a diverse population in southern Africa. Our ecological studies support the hypothesis that a few of these strains acquired a new environmental reservoir, the excreta of feral pigeons (Columba livia, and were globally dispersed by the migration of birds and humans. This investigation also discovered a novel arboreal reservoir for highly diverse strains of C. neoformans var. grubii that are restricted to southern Africa, the mopane tree (Colophospermum mopane. This finding may have significant public health implications because these primal strains have optimal potential for evolution and because mopane trees contribute to the local economy as a source of timber, folkloric remedies and the edible mopane worm.
Testing for Granger causality in large mixed-frequency VARs
Götz, T.B.; Hecq, A.W.
2014-01-01
In this paper we analyze Granger causality testing in a mixed-frequency VAR, originally proposed by Ghysels (2012), where the difference in sampling frequencies of the variables is large. In particular, we investigate whether past information on a low-frequency variable help in forecasting a
2010-07-01
... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Bacillus subtilis var... EXEMPTIONS FOR PESTICIDE CHEMICAL RESIDUES IN FOOD Exemptions From Tolerances § 180.1243 Bacillus subtilis... the requirement of a tolerance for residues of the Bacillus subtilis var. amyloliquefaciens strain...
DEFF Research Database (Denmark)
Jepsen, Helene Friborg; Jensen, B.
2004-01-01
The disaccharide trehalose, known to be an effective protectant against various kinds of stress, was observed to accumulate in the cytosol of Chaetomium thermophilum var. coprophilum during heat stress. Trehalose was apparently neither involved in the defence of C. thermophilum var. coprophilum...... against high concentrations of sodium chloride nor directly linked to thermophily. In C. thermophilum var. coprophilum three different trehalose hydrolyzing activities were eluted from a mono Q anion exchange column by sodium chloride concentrations of 0.10, 0.15 and 0.24 M, respectively....
Modeling and Analysis of a Three-Phase Solid-State Var ...
African Journals Online (AJOL)
Modeling and Analysis of a Three-Phase Solid-State Var Compensator (SSVC) ... Nigerian Journal of Technology. Journal Home ... The problems associated with the flow of reactive power in transmission and distribution lines are well known.
Directory of Open Access Journals (Sweden)
Vera Lúcia Gomes Klein
1989-01-01
Full Text Available São mencionados os diversos usos como alimento dos frutos de Cyclanthera pedata (L. Schrad. var. edulis (Naud. Cogn., além de sua descrição morfológica e de seus nomes vulgares, objetivando um melhor conhecimento e ou divulgação dessa nova opção entre as fontes já bastantes conhecidas de alimentos.On mention here the food uses of the fruits of "Cyclanthera pedata (L. var. edulis (Naud. Cogn. besides the its morphology description and common families having in view the knowing or else the divulgation of new options among the sourrées already wellknown.
DEFF Research Database (Denmark)
Dahlbäck, Madeleine; Lavstsen, Thomas; Salanti, Ali
2007-01-01
, consistent with previous studies of other PfEMP1. Transcription of the pseudogene var1csa could not be detected in NF54VAR2CSA cells. CONCLUSION: The optimal sampling point for analysis of var transcripts using quantitative real-time PCR is the ring-stage, which is encouraging for the analysis of fresh...
A Structured VAR under Changing Monetary Policy
DEFF Research Database (Denmark)
Juselius, Katarina
The empirical analysis is mainly concerned with the aggregate demand for money relation as part of a small macroeconomic system. Using the theory of cointegrated VAR models for I(2) data the long-run relationships in the data are first investigated, and the ML-estimates of the corresponding coint...... the effects of capital liberalization on the determination of money, income, prices, and interest rates in a small open economy...
Sugiura, Nobuo; Clausen, Thomas Mandel; Shioiri, Tatsumasa; Gustavsson, Tobias; Watanabe, Hideto; Salanti, Ali
2016-12-01
Placental malaria, a serious infection caused by the parasite Plasmodium falciparum, is characterized by the selective accumulation of infected erythrocytes (IEs) in the placentas of the pregnant women. Placental adherence is mediated by the malarial VAR2CSA protein, which interacts with chondroitin sulfate (CS) proteoglycans present in the placental tissue. CS is a linear acidic polysaccharide composed of repeating disaccharide units of D-glucuronic acid and N-acetyl-D-galactosamine that are modified by sulfate groups at different positions. Previous reports have shown that placental-adhering IEs were associated with an unusually low sulfated form of chondroitin sulfate A (CSA) and that a partially sulfated dodecasaccharide is the minimal motif for the interaction. However, the fine molecular structure of this CS chain remains unclear. In this study, we have characterized the CS chain that interacts with a recombinant minimal CS-binding region of VAR2CSA (rVAR2) using a CS library of various defined lengths and sulfate compositions. The CS library was chemo-enzymatically synthesized with bacterial chondroitin polymerase and recombinant CS sulfotransferases. We found that C-4 sulfation of the N-acetyl-D-galactosamine residue is critical for supporting rVAR2 binding, whereas no other sulfate modifications showed effects. Interaction of rVAR2 with CS is highly correlated with the degree of C-4 sulfation and CS chain length. We confirmed that the minimum structure binding to rVAR2 is a tri-sulfated CSA dodecasaccharide, and found that a highly sulfated CSA eicosasaccharide is a more potent inhibitor of rVAR2 binding than the dodecasaccharides. These results suggest that CSA derivatives may potentially serve as targets in therapeutic strategies against placental malaria.
Fried, Michal; Kurtis, Jonathan D; Swihart, Bruce; Morrison, Robert; Pond-Tor, Sunthorn; Barry, Amadou; Sidibe, Youssoufa; Keita, Sekouba; Mahamar, Almahamoudou; Andemel, Naissem; Attaher, Oumar; Dembele, Adama B; Cisse, Kadidia B; Diarra, Bacary S; Kanoute, Moussa B; Narum, David L; Dicko, Alassane; Duffy, Patrick E
2018-03-09
Maternal malaria is a tropical scourge associated with poor pregnancy outcomes. Women become resistant to Plasmodium falciparum pregnancy malaria as they acquire antibodies to the variant surface antigen VAR2CSA, a leading vaccine candidate. Because malaria infection may increase VAR2CSA antibody levels and thereby confound analyses of immune protection, gravidity-dependent changes in antibody levels during and after infection, and the effect of VAR2CSA antibodies on pregnancy outcomes were evaluated. Pregnant women enrolled in a longitudinal cohort study of mother-infant pairs in Ouelessebougou, Mali provided plasma samples at enrollment, gestational week 30-32, and delivery. Antibody levels to VAR2CSA domains were measured using a multiplex bead-based assay. Antibody levels to VAR2CSA were higher in multigravidae than primigravidae. Malaria infection was associated with increased antibody levels to VAR2CSA domains. In primigravidae but not in secundigravidae or multigravidae, antibodies levels sharply declined after an infection. A relationship between any VAR2CSA antibody specificity and protection from adverse pregnancy outcomes was not detected. During malaria infection, primigravidae acquire short-lived antibodies. The lack of an association between VAR2CSA domain antibody reactivity and improved pregnancy outcomes suggests that the recombinant proteins may not present native epitopes targeted by protective antibodies.
McBee, Kerry D.
The emphasis on creating a more efficient distribution system has led many utility companies to employ dynamic voltage and VAr compensation (Volt/VAr) applications that reduce energy demand, generation, and losses associated with the transmission and distribution of energy. To achieve these benefits, Volt/VAr applications rely upon algorithms to control voltage support equipment, such as transformer load tap changers, voltage regulators, and capacitor banks. The majority of these algorithms utilize metaheuristic programming methods to determine the Volt/VAr scheme that produces the most energy efficient operating conditions. It has been well documented that the interaction between capacitor bank reactance and the inductive reactance of a distribution system can produce parallel harmonic resonance that can damage utility and customer equipment. The Volt/VAr controlling algorithms that account for harmonics do so in an indirect manner that can mask harmonic resonance conditions. Unlike previous research endeavors, the primary focus of the method described within this dissertation is to identify Volt/VAr schemes that prevent harmonic resonance due to capacitor bank operation. Instead of a metaheuristic approach, the harmonic resonance identification algorithm relies upon constrained mixed integer nonlinear programming (MINLP), which is more suited for analyzing impedance characteristics created by the energized states of a system of capacitor banks. Utilizing a numerical approach improves the accuracy of identifying harmonic resonance conditions, while also reducing the complexity of the process by exclusively relying upon the system's admittance characteristics. The novel harmonic resonance identification method is applicable to distribution systems that are dynamically reconfigured, which can result in a number of unknown harmonic resonance producing conditions, a feature unavailable with existing controlling algorithms. The ability to identify all harmonic
Deng, Qi; Zhang, Hanrui; He, Yipeng; Wang, Ting; Su, Yingjuan
2017-03-01
Pseudotaxus chienii (Taxaceae) is an old rare species endemic to China that has adapted well to ecological heterogeneity with high genetic diversity in its nuclear genome. However, the genetic variation in its chloroplast genome is unknown. Eighteen chloroplast microsatellite markers (cpSSRs) were developed from the whole chloroplast genome of Taxus chinensis var. mairei and successfully amplified in four P. chienii populations and one T. chinensis var. mairei population. Of these loci, 10 were polymorphic in P. chienii , whereas six were polymorphic in T. chinensis var. mairei . The unbiased haploid diversity per locus ranged from 0.000 to 0.641 and 0.000 to 0.545 for P. chienii and T. chinensis var. mairei , respectively. The 18 cpSSRs will be used to further investigate the chloroplast genetic structure and adaptive evolution in P. chienii populations.
Zhu, Hu; Sun, Jiao; Tian, Baozhen; Wang, Honglin
2015-03-01
In this study, a straight diagonal-pitched blade stirrer was designed, built and characterized in a 5-L fermenter. Compared with the six straight blade Rushton turbine, the power consumption of the new stirrer is lower at a given speed under conditions of no ventilation. The oxygen transference is poorer at the same agitation speed in the cultivation conditions and scales investigated, which confirms that the shear stress of the new stirrer is lower and the gas dispersion is weaker. The new stirrer was installed in a 5-L bioreactor and evaluated in submerged fermentation of the edible fungus Pleurotus ostreatus. The results showed that the maximum dry weight of mycelium is increased by 47 % and reached 7.47 g/L, and the maximum laccase activity is increased by 15 % up to 2,277 U/L. Glucose consumption was also found to be relatively faster. The power consumption is 2.8 % lower than that of the Rushton turbine.
Development of the WRF-CO2 4D-Var assimilation system v1.0
Zheng, Tao; French, Nancy H. F.; Baxter, Martin
2018-05-01
Regional atmospheric CO2 inversions commonly use Lagrangian particle trajectory model simulations to calculate the required influence function, which quantifies the sensitivity of a receptor to flux sources. In this paper, an adjoint-based four-dimensional variational (4D-Var) assimilation system, WRF-CO2 4D-Var, is developed to provide an alternative approach. This system is developed based on the Weather Research and Forecasting (WRF) modeling system, including the system coupled to chemistry (WRF-Chem), with tangent linear and adjoint codes (WRFPLUS), and with data assimilation (WRFDA), all in version 3.6. In WRF-CO2 4D-Var, CO2 is modeled as a tracer and its feedback to meteorology is ignored. This configuration allows most WRF physical parameterizations to be used in the assimilation system without incurring a large amount of code development. WRF-CO2 4D-Var solves for the optimized CO2 flux scaling factors in a Bayesian framework. Two variational optimization schemes are implemented for the system: the first uses the limited memory Broyden-Fletcher-Goldfarb-Shanno (BFGS) minimization algorithm (L-BFGS-B) and the second uses the Lanczos conjugate gradient (CG) in an incremental approach. WRFPLUS forward, tangent linear, and adjoint models are modified to include the physical and dynamical processes involved in the atmospheric transport of CO2. The system is tested by simulations over a domain covering the continental United States at 48 km × 48 km grid spacing. The accuracy of the tangent linear and adjoint models is assessed by comparing against finite difference sensitivity. The system's effectiveness for CO2 inverse modeling is tested using pseudo-observation data. The results of the sensitivity and inverse modeling tests demonstrate the potential usefulness of WRF-CO2 4D-Var for regional CO2 inversions.
Development of the WRF-CO2 4D-Var assimilation system v1.0
Directory of Open Access Journals (Sweden)
T. Zheng
2018-05-01
Full Text Available Regional atmospheric CO2 inversions commonly use Lagrangian particle trajectory model simulations to calculate the required influence function, which quantifies the sensitivity of a receptor to flux sources. In this paper, an adjoint-based four-dimensional variational (4D-Var assimilation system, WRF-CO2 4D-Var, is developed to provide an alternative approach. This system is developed based on the Weather Research and Forecasting (WRF modeling system, including the system coupled to chemistry (WRF-Chem, with tangent linear and adjoint codes (WRFPLUS, and with data assimilation (WRFDA, all in version 3.6. In WRF-CO2 4D-Var, CO2 is modeled as a tracer and its feedback to meteorology is ignored. This configuration allows most WRF physical parameterizations to be used in the assimilation system without incurring a large amount of code development. WRF-CO2 4D-Var solves for the optimized CO2 flux scaling factors in a Bayesian framework. Two variational optimization schemes are implemented for the system: the first uses the limited memory Broyden–Fletcher–Goldfarb–Shanno (BFGS minimization algorithm (L-BFGS-B and the second uses the Lanczos conjugate gradient (CG in an incremental approach. WRFPLUS forward, tangent linear, and adjoint models are modified to include the physical and dynamical processes involved in the atmospheric transport of CO2. The system is tested by simulations over a domain covering the continental United States at 48 km × 48 km grid spacing. The accuracy of the tangent linear and adjoint models is assessed by comparing against finite difference sensitivity. The system's effectiveness for CO2 inverse modeling is tested using pseudo-observation data. The results of the sensitivity and inverse modeling tests demonstrate the potential usefulness of WRF-CO2 4D-Var for regional CO2 inversions.
Rabbani, Aulia Husna; -, Alimuddin; Saleh, Chairul
2015-01-01
The research of desalination the sea water by utilization of the strach bump a “Pisang Ambon (Musa paradisiaca var sapientum)” modification has been done. Modification of starch bump “Pisang Ambon (Musa paradisiaca var sapientum)” had be a ability better than starch bump “Pisang Ambon (Musa paradisiaca var sapientum)” in the levels of chloride. The variation upon which to do to absorb chloride of sea water which are starch, starch been activated NaOH and starch acetate bump of a “Pisang Ambon...
Salanti, Ali; Lavstsen, Thomas; Nielsen, Morten A.; Theander, Thor G.; Leke, Rose G. F.; Lo, Yeung Y.; Bobbili, Naveen; Arnot, David E.; Taylor, Diane W.
2011-01-01
Placental malaria infections are caused by Plasmodium falciparum–infected red blood cells sequestering in the placenta by binding to chondroitin sulfate A, mediated by VAR2CSA, a variant of the PfEMP1 family of adhesion antigens. Recent studies have shown that many P. falciparum genomes have multiple genes coding for different VAR2CSA proteins, and parasites with >1 var2csa gene appear to be more common in pregnant women with placental malaria than in nonpregnant individuals. We present evidence that, in pregnant women, parasites containing multiple var2csa-type genes possess a selective advantage over parasites with a single var2csa gene. Accumulation of parasites with multiple copies of the var2csa gene during the course of pregnancy was also correlated with the development of antibodies involved in blocking VAR2CSA adhesion. The data suggest that multiplicity of var2csa-type genes enables P. falciparum parasites to persist for a longer period of time during placental infections, probably because of their greater capacity for antigenic variation and evasion of variant-specific immune responses. PMID:21592998
The Amoebicidal Effect of Ergosterol Peroxide Isolated from Pleurotus ostreatus.
Meza-Menchaca, Thuluz; Suárez-Medellín, Jorge; Del Ángel-Piña, Christian; Trigos, Ángel
2015-12-01
Dysentery is an inflammation of the intestine caused by the protozoan parasite Entamoeba histolytica and is a recurrent health problem affecting millions of people worldwide. Because of the magnitude of this disease, finding novel strategies for treatment that does not affect human cells is necessary. Ergosterol peroxide is a sterol particularly known as a major cytotoxic agent with a wide spectrum of biological activities produced by edible and medicinal mushrooms. The aim of this report is to evaluate the amoebicidal activity of ergosterol peroxide (5α, 8α-epidioxy-22E-ergosta-6,22-dien-3β-ol isolated from 5α, 8α-epidioxy-22E-ergosta-6,22-dien-3β-ol) (Jacq.) P. Kumm. f. sp. Florida. Our results show that ergosterol peroxide produced a strong cytotoxic effect against amoebic growth. The inhibitory concentration IC50 of ergosterol peroxide was evaluated. The interaction between E. histolytica and ergosterol peroxide in vitro resulted in strong amoebicidal activity (IC50 = 4.23 nM) that may be due to the oxidatory effect on the parasitic membrane. We also tested selective toxicity of ergosterol peroxide using a cell line CCL-241, a human epithelial cell line isolated from normal human fetal intestinal tissue. To the best of our knowledge, this is the first report on the cytotoxicity of ergosterol peroxide against E. histolytica, which uncovers a new biological property of the lipidic compound isolated from Pleurotus ostreatus (Jacq.) P. Kumm. f. sp. Florida. Copyright © 2015 John Wiley & Sons, Ltd.
Menéndez Díaz, Zulema; Rodríguez Rodríguez, Jinnay; Gato Armas, René; Companioni Ibañez, Ariamys; Díaz Pérez, Manuel; Bruzón Aguila, Rosa Yirian
2012-01-01
the integration of chemical and biological methods is one of the strategies for the vector control, due to the existing environmental problems and the concerns of the community as a result of the synthetic organic insecticide actions. The bacterium called Bacillus thuringiensis var. israelensis in liquid formulation has been widely used in the vector control programs in several countries and has shown high efficacy at lab in Cuba. to determine the susceptibility of Aedes aegypti collected in the municipalities of La Habana province to Bacillus thuringiensis var. israelensis. fifteen Aedes aegypti strains, one from each municipality, were used including larvae and pupas collected in 2010 and one reference strain known as Rockefeller. The aqueous formulation of Bacillus thuringiensis var. israelensis (Bactivec, Labiofam, Cuba) was used. The bioassays complied with the World Health Organization guidelines for use of bacterial larvicides in the public health sector. The larval mortality was read after 24 hours and the results were processed by the statistical system SPSS (11.0) through Probit analysis. the evaluated mosquito strains showed high susceptibility to biolarvicide, there were no significant differences in LC50 values of Ae. aegypti strains, neither in the comparison of these values with those of the reference strain. the presented results indicate that the use of Bacillus thuringiensis var. israelensis continues to be a choice for the control of Aedes aegypti larval populations in La Habana province.
Cogliati, Massimo; Zani, Alberto; Rickerts, Volker; McCormick, Ilka; Desnos-Ollivier, Marie; Velegraki, Aristea; Escandon, Patricia; Ichikawa, Tomoe; Ikeda, Reiko; Bienvenu, Anne-Lise; Tintelnot, Kathrin; Tore, Okan; Akcaglar, Sevim; Lockhart, Shawn; Tortorano, Anna Maria; Varma, Ashok
2016-02-01
Cryptococcus neoformans var. neoformans (serotype D) represents about 30% of the clinical isolates in Europe and is present less frequently in the other continents. It is the prevalent etiological agent in primary cutaneous cryptococcosis as well as in cryptococcal skin lesions of disseminated cryptococcosis. Very little is known about the genotypic diversity of this Cryptococcus subtype. The aim of this study was to investigate the genotypic diversity among a set of clinical and environmental C. neoformans var. neoformans isolates and to evaluate the relationship between genotypes, geographical origin and clinical manifestations. A total of 83 globally collected C. neoformans var. neoformans isolates from Italy, Germany, France, Belgium, Denmark, Greece, Turkey, Thailand, Japan, Colombia, and the USA, recovered from different sources (primary and secondary cutaneous cryptococcosis, disseminated cryptococcosis, the environment, and animals), were included in the study. All isolates were confirmed to belong to genotype VNIV by molecular typing and they were further investigated by MLST analysis. Maximum likelihood phylogenetic as well as network analysis strongly suggested the existence of a recombinant rather than a clonal population structure. Geographical origin and source of isolation were not correlated with a specific MLST genotype. The comparison with a set of outgroup C. neoformans var. grubii isolates provided clear evidence that the two varieties have different population structures. Copyright © 2016 Elsevier Inc. All rights reserved.
Zhang, Xuemei; Yang, Xiaoyan; Wang, Hongbin; Li, Qinchun; Wang, Haijuan; Li, Yanyan
2017-04-01
A pot experiment was conducted to compare the content of endogenous trans-zeatin (Z), plant arsenic (As) uptake and physiological indices in the fronds of As-hyperaccumulator (Pteris cretica var. nervosa) and non-hyperaccumulator (Pteris ensiformis). Furthermore, a stepwise regression method was used to study the relationship among determined indices, and the time-course effect of main indices was also investigated under 100mg/kg As stress with time extension. In the 100-200mg/kg As treatments, plant height showed no significant difference and endogenous Z content significantly increased in P. cretica var. nervosa compared to the control, but a significant decrease of height and endogenous Z was observed in P. ensiformis. The concentrations of As (III) and As (V) increased significantly in the fronds of two plants, but this increase was much higher in P. cretica var. nervosa. Compared to the control, the contents of chlorophyll and soluble protein were significantly increased in P. cretica var. nervosa but decreased in P. ensiformis in the 200mg/kg As treatment, respectively. A significant positive correlation was found between the contents of endogenous Z and total As in P. cretica var. nervosa, but such a correlation was not found in P. ensiformis. Additionally, in the time-course effect experiment, a peak value of each index was appeared in the 43rd day in two plants, except for chlorophyll in P. ensiformis, but this value was significantly higher in P. cretica var. nervosa than that in P. ensiformis. In conclusion, a higher endogenous Z content contributed to As accumulation of P. cretica var. nervosa under As stress. Copyright © 2016 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Silva, Fabio de Oliveira; Oliveira, Irvila Ricarte de; Silva, Maria Goretti de Vasconcelos, E-mail: mgvsilva@ufc.b [Universidade Federal do Ceara (UFC), Fortaleza, CE (Brazil). Dept. de Quimica Organica e Inorganica; Braz Filho, Raimundo [Universidade Estadual do Norte Fluminense (UENF), Campos dos Goytacazes, RJ (Brazil)
2010-07-01
From leaves of Senna spectabilis var. excelsa were isolated caffeine, the triterpenes lupeol, {alpha}-amyrin, {beta}-amyrin, cycloeucalenol, friedelin and ursolic, oleanolic and betulinic acids, besides the steroids sitosterol and stigmasterol and their respective glucosides. The structures of these compounds were established by spectroscopic analysis including two-dimensional NMR methods and comparison with published spectral data. This paper deals with the first report of these compounds in S. spectabilis var. excelsa. (author)
Chemical composition of essential oil of Psidium cattleianum var ...
African Journals Online (AJOL)
The aim of this study was to investigate the essential oil composition of Psidium cattleianum var. lucidum from South Africa. The essential oils were extracted by hydrodistillation and the components were identified by gas chromatography coupled to mass spectrometry (GC-MS) to determine the chemical composition of the ...
The identity of zostera marina var. angustifolia Hornemann (Potamogetonaceae)
Hartog, den C.
1972-01-01
Since Hornemann (Fl. Dan. 9, 1816, p. 3, pl. 1501) published the name Zostera marina var. angustifolia together with a very poor drawing and the extremely short diagnosis ‘foliis subenerviis’ several interpretations of the identity of this taxon have been given. Some authors regarded it as a
Song, Yun; Xu, Jin; Chen, NaiZhong; Li, MingFu
2017-03-01
Paris polyphylla var. yunnanensis is a perennial medical plant widely used in traditional Chinese medicine. Here, we report the complete chloroplast genome of P. polyphylla var. yunnanensis. The genome is 157 675 bp in length including a small single-copy region (SSC, 18 319 bp) and a large single-copy region (LSC, 84 108 bp) separated by a pair of inverted repeats (IRs, 27 624 bp). The genome contained 115 genes, including 81 protein-coding genes, 4 ribosomal RNA genes, and 30 tRNA genes. Among these genes, 13 harbored a single intron and 2 contained a couple of introns. The overall G + C content of the cpDNA is 37.4%, while the corresponding values of the LSC, SSC, and IR regions are 35.71%, 31.43%, and 41.87%, respectively. A Maximum-likelihood phylogenetic analysis suggested that genus Trillium, Paris, Fritillaria, and Lilium were strongly supported as monophyletic and the P. polyphylla var. yunnanensis is closely related to Trillium.
International Nuclear Information System (INIS)
Vargas, M C; Rodriguez, R; Sanchez, F; Ramirez, N
2001-01-01
Pleurotus ostreatus was grown in a soil mixture contaminated with anthracene, wheat bran and compost, in varying combinations. Assays with added bacteria and reinoculation of the fungus were also included. The results indicated that in many of the combinations, most of the anthracene was removed at the earliest sample time, 15 days. The most effective combination was spiked (anthracene-added) soil, fungus and compost and the addition of acclimated bacteria to this mixture inhibited anthracene removal. Analyses of extract by high-pressure liquid chromatography HPLC indicated that - anthraquinone, was the major metabolite formed. The results of this study indicate that solid-state fermentation of anthracene-contaminated soils using P. ostreatus in combination with wheat bran and compost additives can produce an accelerated rate of biological removal of anthracene from the soil
Guizetti, Julien; Martins, Rafael Miyazawa; Guadagnini, Stéphanie; Claes, Aurélie; Scherf, Artur
2013-05-01
The human malaria parasite Plasmodium falciparum modifies the erythrocyte it infects by exporting variant proteins to the host cell surface. The var gene family that codes for a large, variant adhesive surface protein called P. falciparum erythrocyte membrane protein 1 (PfEMP1) plays a particular role in this process, which is linked to pathogenesis and immune evasion. A single member of this gene family is highly transcribed while the other 59 members remain silenced. Importantly, var gene transcription occurs at a spatially restricted, but yet undefined, perinuclear site that is distinct from repressed var gene clusters. To advance our understanding of monoallelic expression, we investigated whether nuclear pores associate with the var gene expression site. To this end, we studied the nuclear pore organization during the asexual blood stage using a specific antibody directed against a subunit of the nuclear pore, P. falciparum Nup116 (PfNup116). Ring and schizont stage parasites showed highly polarized nuclear pore foci, whereas in trophozoite stage nuclear pores redistributed over the entire nuclear surface. Colocalization studies of var transcripts and anti-PfNup116 antibodies showed clear dissociation between nuclear pores and the var gene expression site in ring stage. Similar results were obtained for another differentially transcribed perinuclear gene family, the ribosomal DNA units. Furthermore, we show that in the poised state, the var gene locus is not physically linked to nuclear pores. Our results indicate that P. falciparum does form compartments of high transcriptional activity at the nuclear periphery which are, unlike the case in yeast, devoid of nuclear pores.
Directory of Open Access Journals (Sweden)
Eugenia A. Sar
2006-12-01
Full Text Available En el marco de un proyecto de monitoreo de especies de diatomeas nocivas llevado a cabo en el área norte del Golfo San Matías (Provincia de Río Negro, Argentina hemos encontrado a Pseudo-nitzschia pungens (Grunow ex. P.T. Cleve Hasle var. pungens y establecido cultivos monoclonales de esta variedad. Las cepas aisladas a partir de muestras tomadas con red, provenientes de Las Grutas y Piedras Coloradas (Golfo San Matías, fueron cultivadas en medio F/2 con adición de silicatos, y mantenidas a 20 ºC con luz continua, blanca, fría. Los cultivos fueron analizados mediante Cromatografía Líquida de Alta Resolución (HPLC para determinar si la variedad aislada era productora de ácido domoico (DA en el área bajo estudio. Material procedente de campo y de cultivo fue estudiado con microscopios óptico y electrónico de barrido. Una comparación con los taxa más allegados, P . pungens var. cingulata Villac y P . multiseries (Hasle Hasle, y datos sobre la morfología fina del material procedente de los cultivos, son presentados y discutidos. A pesar de que P . pungens var. pungens ha sido reportada como productora de ácido domoico, los resultados del análisis para detección de las toxinas fueron negativos para las cultivos chequeados.In the framework of a project of monitoring of harmful diatom species carried out in the Northern area of the Golfo San Matías (Provincia de Río Negro, Argentina we found and established cultures of Pseudo-nitzschia pungens (Grunow ex. P.T. Cleve Hasle var. pungens . The strains isolated from net phytoplankton samples obtained in Las Grutas and Piedras Coloradas, (Golfo San Matías were cultured in F/2 medium, with silica added, and maintained at 20 ºC, under continuous light supplied by cool-white fluorescent tubes. Cultures were essayed for domoic acid (DA by High Performance Liquid Chromatography (HPLC. Materials from field and cultures were studied with light and scanning electron microscopy. Comparison
Potential utilization of Citrullus lanatus var. Colocynthoides waste as a novel source of pectin.
Korish, Mohamed
2015-04-01
The Citrullus lanatus var. Colocynthoides is an ancestor type of watermelon. It was investigated as a new source of pectin. It was cultivated in Egypt for seeds only, while the remaining fruits are discarded as waste. Effect of different extraction conditions such as pH, solid: liquid ratio, temperature and extraction time on pectin yield of Citrullus lanatus var. Colocynthoides waste was investigated in the present study. The highest yield (19.75 % w/w) was achieved at pH 2, solid: liquid ratio1:15 and 85 °C, for 60 min. Methylation degree and galacturonic acid content of extracted pectin were 55.25 %, w/w and 76.84 %, w/w. The main neutral sugars were galactose followed by arabinose and rhamnose. In addition, glucose, xylose and mannose existed as constituents in the pectin hydrolysate. The results indicated that Citrullus lanatus var. Colocynthoide waste is a potential new source of pectin.
High avidity antibodies to full-length VAR2CSA correlate with absence of placental malaria
DEFF Research Database (Denmark)
Tutterrow, Yeung Lo; Salanti, Ali; Avril, Marion
2012-01-01
VAR2CSA mediates sequestration of Plasmodium falciparum-infected erythrocytes in the placenta, increasing the risk of poor pregnancy outcomes. Naturally acquired antibodies (Ab) to placental parasites at delivery have been associated with improved pregnancy outcomes, but Ab levels and how early...... in pregnancy Ab must be present in order to eliminate placental parasites before delivery remains unknown. Antibodies to individual Duffy-binding like domains of VAR2CSA have been studied, but the domains lack many of the conformational epitopes present in full-length VAR2CSA (FV2). Thus, the purpose...... of this study was to describe the acquisition of Ab to FV2 in women residing in high and low transmission areas and determine how Ab levels during pregnancy correlate with clearance of placental parasites. Plasma samples collected monthly throughout pregnancy from pregnant women living in high and low...
International Nuclear Information System (INIS)
Soltani, J.; Fath Abadi, A.M.
2003-01-01
This paper describes the application of static var compensators, on an electrical distribution network containing two large synchronous motors, one of which is excited via a three-phase thyristor bridge rectifier. The second machine is excited via a diode bridge rectifier. Based on linear optimization control, the measurable feedback signals are applied to the control system loops of static var compensators and the excitation control loop of the first synchronous motor. The phase equations method was used to develop a computer program to model the distribution network. Computer results were obtained to demonstrate the system performance for some abnormal modes of operation. These results show that employing static var compensators based on the linear optimization control design for electrical distribution networks containing large synchronous motors is beneficial and may be considered a first stage of the system design
Lifescience Database Archive (English)
Full Text Available MeCab user dictionary for science technology term Brassica rapa var. peruviridis 名詞... 一般 * * * * コマツナ コマツナ コマツナ Thesaurus2015 200906099324987960 C LS06/LS72 UNKNOWN_2 Brassica rapa var . peruviridis
Biochemical Characteristics of Three Laccase Isoforms from the Basidiomycete Pleurotus nebrodensis
Directory of Open Access Journals (Sweden)
Xianghe Yuan
2016-02-01
Full Text Available The characterization of three laccase isoforms from Pleurotus nebrodensis is described. Isoenzymes Lac1, Lac2 and Lac3 were purified to homogeneity using ion exchange chromatography on DEAE-cellulose, CM-cellulose and Q-Sepharose and a gel filtration step on Superdex 75. The molecular weights of the purified laccases were estimated to be 68, 64 and 51 kDa, respectively. The isoenzymes demonstrated the same optimum pH at 3.0 but slightly different temperature optima: 50–60 °C for Lac1 and Lac3 and 60 °C for Lac2. Lac2 was always more stable than the other two isoforms and exposure to 50 °C for 120 min caused 30% loss in activity. Lac2 was relatively less stable than the other two isoforms when exposed to the pH range of 3.0–8.0 for 24 h, but inactivation only occurred initially, with around 70% residual activity being maintained during the whole process. Oxidative ability towards aromatic compounds varied substantially among the isoforms and each of them displayed preference toward some substrates. Kinetic constants (Km, Kcat were determined by using a 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid diammonium salt (ABTS assay, with Lac3 showing the best affinity and Lac2 displaying the highest catalytic efficiency. Amino acid sequences from peptides derived from digestion of isoenzymes showed great consistency with laccases in the databases.
DGA-based VAR rescheduling for transmission loss reduction
Energy Technology Data Exchange (ETDEWEB)
Mishra, S. [Indian Inst. of Technology, Delhi (India); Taylor, G.A. [Brunel Univ., London (United Kingdom). Brunel Inst. of Power Systems; Reddy, J.B.V. [Government of India, New Delhi (India). Dept. of Science and Technology; Naeem, M.H. [Multimedia Univ. (Malaysia). Faculty of Engineering
2009-07-01
Power losses in power transmission lines can be minimized by adjusting transformer taps and switchable VAR sources. Optimal power flow (OPF) is a static, nonlinear, multi-objective optimization challenge in which the optimal settings of control variables must be determined for minimizing the cost of generation, emissions, transmission losses and voltage and power flow deviations. OPF is important in power system operation because a small savings per hour can mean a large annual savings. This paper presented a method to reduce transmission power losses using a Differential Genetic Algorithm (DGA) for VAR rescheduling. The New England 39-bus power system was used as a test case. Power losses were minimized by changing the tap settings of various transformers and by varying the injected reactive power. The paper showed that certain buses in the system can improve the voltage profile and reduce transmission losses through reactive power injections from capacitor banks. In this study, minimum reactive power output of generators was maintained at zero to ensure that the generators did not draw reactive power. The DGA was shown to produce better results than the Conventional Genetic Algorithm in terms of power loss minimization. 12 refs., 1 tab., 2 figs.
Tessema, Sofonias K; Monk, Stephanie L; Schultz, Mark B; Tavul, Livingstone; Reeder, John C; Siba, Peter M; Mueller, Ivo; Barry, Alyssa E
2015-01-01
Plasmodium falciparum malaria is a major global health problem that is being targeted for progressive elimination. Knowledge of local disease transmission patterns in endemic countries is critical to these elimination efforts. To investigate fine-scale patterns of malaria transmission, we have compared repertoires of rapidly evolving var genes in a highly endemic area. A total of 3680 high-quality DBLα-sequences were obtained from 68 P. falciparum isolates from ten villages spread over two distinct catchment areas on the north coast of Papua New Guinea (PNG). Modelling of the extent of var gene diversity in the two parasite populations predicts more than twice as many var gene alleles circulating within each catchment (Mugil = 906; Wosera = 1094) than previously recognized in PNG (Amele = 369). In addition, there were limited levels of var gene sharing between populations, consistent with local parasite population structure. Phylogeographic analyses demonstrate that while neutrally evolving microsatellite markers identified population structure only at the catchment level, var gene repertoires reveal further fine-scale geospatial clustering of parasite isolates. The clustering of parasite isolates by village in Mugil, but not in Wosera was consistent with the physical and cultural isolation of the human populations in the two catchments. The study highlights the microheterogeneity of P. falciparum transmission in highly endemic areas and demonstrates the potential of var genes as markers of local patterns of parasite population structure. © 2014 John Wiley & Sons Ltd.
Pollination ecology of Swartzia apetala Raddi var. apetala (leguminosae-papilionoideae
Directory of Open Access Journals (Sweden)
Maria Cecília de Chiara Moço
1999-01-01
Full Text Available The pollination ecology of Swartzia apetala Raddi var. apetala was studied in the restinga of Maricá, State of Rio de Janeiro, Brazil. S. apetala var. apetala is a shrub with asynchronic annual blooming, between the months of November and April (hot-rainy season. Each plant can exhibit more than one blooming episode in this period. Their flowers are hermaphrodites, apetalous, heterantherous, odoriferous, and the pollen represents the only reward offered to visitors. It is pollinized by species of Centris and Xylocopa, solitary and polyletic bees, which collect the pollen by means of vibratory movements. Other bees such as Apis mellifera, Pseudaugochloropsis graminea and Trigona spinipes are only pollen-thieves. In this variety of Swartzia vibrating is an efficient method to collect pollen from the anthers despite non-poricidal dehiscence.. The flowering phenology and the behavior of visitors influence the rate of outcrossing.A ecologia da polinização de Swartzia apetala Raddi var. apetala foi estudada na restinga de Maricá, Estado do Rio de Janeiro, Brasil. S. apetala var. apetala é um arbusto com floração do tipo anual assincrônica, entre os meses de novembro e abril (estação quente- chuvosa. Cada planta pode apresentar mais de um episódio de floração neste período. As flores são hermafroditas, apétalas, heterândricas, odoríferas e o polem constitui a única recompensa oferecida aos visitantes. É polinizada por espécies de Centris e Xylocopa, abelhas solitárias e poliléticas, que coletam o polem através do método de vibração. Nesta variedade de Swartzia a vibração é um método eficiente de coleta de polem apesar das anteras apresentarem deiscência rimosa. Outras abelhas, como Apis mellifera, Pseudaugochloropsis graminea e Trigona spinipes, são pilhadoras de pólen. A fenologia da floração e o comportamento dos visitantes florais influenciam a taxa de fertilização cruzada.
1D-Var temperature retrievals from microwave radiometer and convective scale model
Directory of Open Access Journals (Sweden)
Pauline Martinet
2015-12-01
Full Text Available This paper studies the potential of ground-based microwave radiometers (MWR for providing accurate temperature retrievals by combining convective scale numerical models and brightness temperatures (BTs. A one-dimensional variational (1D-Var retrieval technique has been tested to optimally combine MWR and 3-h forecasts from the French convective scale model AROME. A microwave profiler HATPRO (Humidity and Temperature PROfiler was operated during 6 months at the meteorological station of Bordeaux (Météo France. MWR BTs were monitored against simulations from the Atmospheric Radiative Transfer Simulator 2 radiative transfer model. An overall good agreement was found between observations and simulations for opaque V-band channels but large errors were observed for channels the most affected by liquid water and water vapour emissions (51.26 and 52.28 GHz. 1D-Var temperature retrievals are performed in clear-sky and cloudy conditions using a screening procedure based on cloud base height retrieval from ceilometer observations, infrared radiometer temperature and liquid water path derived from the MWR observations. The 1D-Var retrievals were found to improve the AROME forecasts up to 2 km with a maximum gain of approximately 50 % in root-mean-square-errors (RMSE below 500 m. They were also found to outperform neural network retrievals. A static bias correction was proposed to account for systematic instrumental errors. This correction was found to have a negligible impact on the 1D-Var retrievals. The use of low elevation angles improves the retrievals up to 12 % in RMSE in cloudy-sky in the first layers. The present implementation achieved a RMSE with respect to radiosondes within 1 K in clear-sky and 1.3 K in cloudy-sky conditions for temperature.
International Nuclear Information System (INIS)
Luna Fontalvo, Jorge Alberto; Cordoba Lopez, Laura Sofia; Gil Pertuz, Karina Isabel; Romero Borja, Isaac Manuel
2013-01-01
It was evaluated the development of tomato seedlings (plant bioindicator of toxicity) in soils with sawdust and rice husk partially biodegraded by Pleurotus ostreatus in greenhouse conditions. Both organic compounds (carbon, cellulose, lignin, extractives, and organic matter), and inorganic compounds (nitrogen, phosphorus and pH) were determined, before and after fungus inoculation on sawdust and rice husk. Mixtures were held of each substrate with a nutrient poor soil in equal proportions (1:1) and the moisture content was determined. The experiment consisted of a completely randomized, with two groups of six treatments for each substrate, and 30 days later, parameters of growth and development were identified. biodegraded substrates presented low C, N and P. bsa + sf treatment (biodegraded sawdust + fertilized soil) presented the best results in the number of leaves (12.9), plant height (25.94 cm), root length (5.92 cm), dry weight (0.138 g), and fresh weight (1.012 g). bsa + sf substrate can work as favorable substrate for growing tomato seedlings, bsa + sf substrate can work as favorable substrate for growing of tomato seedlings, since it provides the nutrients necessary for a good growth. Plants in rice bran did not grow adequately for transplanting.
Nguyen, Trung Kien; Im, Kyung Hoan; Choi, Jaehyuk; Shin, Pyung Gyun; Lee, Tae Soo
2016-12-01
Culinary mushroom Pleurotus pulmonarius has been popular in Asian countries. In this study, the anti-oxidant, cholinesterase, and inflammation inhibitory activities of methanol extract (ME) of fruiting bodies of P. pulmonarius were evaluted. The 1,1-diphenyl-2-picryl-hydrazy free radical scavenging activity of ME at 2.0 mg/mL was comparable to that of butylated hydroxytoluene, the standard reference. The ME exhibited significantly higher hydroxyl radical scavenging activity than butylated hydroxytoluene. ME showed slightly lower but moderate inhibitory activity against acetylcholinesterase (AChE) and butyrylcholinesterase than galantamine, a standard AChE inhibitor. It also exhibited protective effect against cytotoxicity to PC-12 cells induced by glutamate (10~100 µg/mL), inhibitory effect on nitric oxide (NO) production and inducible nitric oxide synthase protein expression in lipopolysaccharide-stimulated RAW 264.7 macrophages, and carrageenan-induced paw edema in a rat model. High-performance liquid chromatography analysis revealed the ME of P. pulmonarius contained at least 10 phenolic compounds and some of them were identified by the comparison with known standard phenolics. Taken together, our results demonstrate that fruiting bodies of P. pulmonarius possess antioxidant, anti-cholinesterase, and inflammation inhibitory activities.
Day, Karen P; Artzy-Randrup, Yael; Tiedje, Kathryn E; Rougeron, Virginie; Chen, Donald S; Rask, Thomas S; Rorick, Mary M; Migot-Nabias, Florence; Deloron, Philippe; Luty, Adrian J F; Pascual, Mercedes
2017-05-16
Existing theory on competition for hosts between pathogen strains has proposed that immune selection can lead to the maintenance of strain structure consisting of discrete, weakly overlapping antigenic repertoires. This prediction of strain theory has conceptual overlap with fundamental ideas in ecology on niche partitioning and limiting similarity between coexisting species in an ecosystem, which oppose the hypothesis of neutral coexistence. For Plasmodium falciparum , strain theory has been specifically proposed in relation to the major surface antigen of the blood stage, known as Pf EMP1 and encoded by the multicopy multigene family known as the var genes. Deep sampling of the DBLα domain of var genes in the local population of Bakoumba, West Africa, was completed to define whether patterns of repertoire overlap support a role of immune selection under the opposing force of high outcrossing, a characteristic of areas of intense malaria transmission. Using a 454 high-throughput sequencing protocol, we report extremely high diversity of the DBLα domain and a large parasite population with DBLα repertoires structured into nonrandom patterns of overlap. Such population structure, significant for the high diversity of var genes that compose it at a local level, supports the existence of "strains" characterized by distinct var gene repertoires. Nonneutral, frequency-dependent competition would be at play and could underlie these patterns. With a computational experiment that simulates an intervention similar to mass drug administration, we argue that the observed repertoire structure matters for the antigenic var diversity of the parasite population remaining after intervention.
A Bootstrap Cointegration Rank Test for Panels of VAR Models
DEFF Research Database (Denmark)
Callot, Laurent
functions of the individual Cointegrated VARs (CVAR) models. A bootstrap based procedure is used to compute empirical distributions of the trace test statistics for these individual models. From these empirical distributions two panel trace test statistics are constructed. The satisfying small sample...
Local cabbage ( Brassica oleracea var. capitata L.) populations from ...
African Journals Online (AJOL)
In previous experiments, we were able to augment cabbages (Brassica oleracea L. var. capitata L.) with two new local open pollinated (OP) populations and one cultivar. The type of use indicated that these are cabbages with thinner and juicier leaves, which predisposes their heads for fine grating and also makes their ...
Ma, Jun; Kanakala, S; He, Yehua; Zhang, Junli; Zhong, Xiaolan
2015-01-01
Ananas comosus var. bracteatus (Red Pineapple) is an important ornamental plant for its colorful leaves and decorative red fruits. Because of its complex genome, it is difficult to understand the molecular mechanisms involved in the growth and development. Thus high-throughput transcriptome sequencing of Ananas comosus var. bracteatus is necessary to generate large quantities of transcript sequences for the purpose of gene discovery and functional genomic studies. The Ananas comosus var. bracteatus transcriptome was sequenced by the Illumina paired-end sequencing technology. We obtained a total of 23.5 million high quality sequencing reads, 1,555,808 contigs and 41,052 unigenes. In total 41,052 unigenes of Ananas comosus var. bracteatus, 23,275 unigenes were annotated in the NCBI non-redundant protein database and 23,134 unigenes were annotated in the Swiss-Port database. Out of these, 17,748 and 8,505 unigenes were assigned to gene ontology categories and clusters of orthologous groups, respectively. Functional annotation against Kyoto Encyclopedia of Genes and Genomes Pathway database identified 5,825 unigenes which were mapped to 117 pathways. The assembly predicted many unigenes that were previously unknown. The annotated unigenes were compared against pineapple, rice, maize, Arabidopsis, and sorghum. Unigenes that did not match any of those five sequence datasets are considered to be Ananas comosus var. bracteatus unique. We predicted unigenes encoding enzymes involved in terpenoid and phenylpropanoid biosynthesis. The sequence data provide the most comprehensive transcriptomic resource currently available for Ananas comosus var. bracteatus. To our knowledge; this is the first report on the de novo transcriptome sequencing of the Ananas comosus var. bracteatus. Unigenes obtained in this study, may help improve future gene expression, genetic and genomics studies in Ananas comosus var. bracteatus.
Directory of Open Access Journals (Sweden)
Jun Ma
Full Text Available Ananas comosus var. bracteatus (Red Pineapple is an important ornamental plant for its colorful leaves and decorative red fruits. Because of its complex genome, it is difficult to understand the molecular mechanisms involved in the growth and development. Thus high-throughput transcriptome sequencing of Ananas comosus var. bracteatus is necessary to generate large quantities of transcript sequences for the purpose of gene discovery and functional genomic studies.The Ananas comosus var. bracteatus transcriptome was sequenced by the Illumina paired-end sequencing technology. We obtained a total of 23.5 million high quality sequencing reads, 1,555,808 contigs and 41,052 unigenes. In total 41,052 unigenes of Ananas comosus var. bracteatus, 23,275 unigenes were annotated in the NCBI non-redundant protein database and 23,134 unigenes were annotated in the Swiss-Port database. Out of these, 17,748 and 8,505 unigenes were assigned to gene ontology categories and clusters of orthologous groups, respectively. Functional annotation against Kyoto Encyclopedia of Genes and Genomes Pathway database identified 5,825 unigenes which were mapped to 117 pathways. The assembly predicted many unigenes that were previously unknown. The annotated unigenes were compared against pineapple, rice, maize, Arabidopsis, and sorghum. Unigenes that did not match any of those five sequence datasets are considered to be Ananas comosus var. bracteatus unique. We predicted unigenes encoding enzymes involved in terpenoid and phenylpropanoid biosynthesis.The sequence data provide the most comprehensive transcriptomic resource currently available for Ananas comosus var. bracteatus. To our knowledge; this is the first report on the de novo transcriptome sequencing of the Ananas comosus var. bracteatus. Unigenes obtained in this study, may help improve future gene expression, genetic and genomics studies in Ananas comosus var. bracteatus.
Bootstrap Determination of the Co-Integration Rank in Heteroskedastic VAR Models
DEFF Research Database (Denmark)
Cavaliere, G.; Rahbek, Anders; Taylor, A.M.R.
2014-01-01
In a recent paper Cavaliere et al. (2012) develop bootstrap implementations of the (pseudo-) likelihood ratio (PLR) co-integration rank test and associated sequential rank determination procedure of Johansen (1996). The bootstrap samples are constructed using the restricted parameter estimates...... of the underlying vector autoregressive (VAR) model which obtain under the reduced rank null hypothesis. They propose methods based on an independent and individual distributed (i.i.d.) bootstrap resampling scheme and establish the validity of their proposed bootstrap procedures in the context of a co......-integrated VAR model with i.i.d. innovations. In this paper we investigate the properties of their bootstrap procedures, together with analogous procedures based on a wild bootstrap resampling scheme, when time-varying behavior is present in either the conditional or unconditional variance of the innovations. We...
Effect of the irradiation on Salmonella enteretidis var. typhimurium with gamma rays from 60Co
International Nuclear Information System (INIS)
Maliska, C.; Norberg, A.N.; Norberg, J.B.M.; Santos Souza, R.C. dos; Silva Tavares, P.R. da
1988-01-01
The use of ionizinf radiation to the destruction of microrganisms responsible for food deterioration, and productive of feeding toxinfections constitute their usefulness for actually peaceful goals of nuclear energy. The feeding toxinfections are, among us, produced in their most part by Salmonella enteritidis var. typhimurim. One hundred nineteen samples of milk containing about 150.000 bacteria per ml, by means doses ranging from 100 to 1.100 gy, two samples of surviving bacteria were again irradiated by doses up to 2.5000 Gy. The bacteria not previously irradiated were throughly killed by means of doses of 1.100 Gy. Salmonella enteritidis var. typhimurium was inactivated by means of 1.200 and 1.900 Gy doses. It was concluded that 60-Cobalt gamma radiation minimal lethal dose to Salmonella enteritidis var. typhimurium is 1.200 Gy; the re-irradiation to the survivors prompts the forthcoming of more resistant germs. (author) [pt
Directory of Open Access Journals (Sweden)
Ira Djajanegara
2012-02-01
Full Text Available Irradiation aplied to living organisms may have positive or negative effects on physiological and morphological properties of the organisms. One way to gain genetic variation with better properties than the parental strain is by Gamma (Co 60 radiation application. During this experiment, Gama (Co 60 rays was applied to the grey oyster (Pleurotus sajur-caju mushroom mycellia during exponential phase. Radiation was applied at 0.75 KGray with dose velocity of 1.149 KGray. Analysis of mushroom productivity performances indicate that diameter of mycellia, fresh weight, dry weight, diameter of fruit body and the amount of fruit body of the mutant and control were not significantly different. However, the isozyme pattern showed a different pattern between the mutant and the control which indicates that mutation process has already occured. These data show that mutation did not affect the productivity of the mushroom. Therefore, mutation may affect the nutritional quality of the mushroom instead. Further experiment to verify this possibility is suggested.
Directory of Open Access Journals (Sweden)
Emanuel Vamanu
2012-03-01
Full Text Available The antioxidant and antimicrobial potential of the ethanolic extract of Pleurotus ostreatus PQMZ91109 mycelium was determined based on inorganic and organic nitrogen sources in the culture medium. The presence of ammonium sulfate resulted in a greater accumulation of bioactive compounds compared with the organic ones. This finding was also confirmed by the low values of the ascertained EC50 and minimum inhibitory concentration (MICs. Among the organic sources, peptone followed by corn extract, led to a more important radical-scavenging activity. The extracts selectively inhibited the tested strains, mainly the two of the genus Candida, at an MIC value of 1.25 mg/mL. The antioxidant potential was evaluated by the inhibition capacity of the 2,2-diphenyl-1-picrylhydrazyl (DPPH radical, β-carotene-linoleic acid, which is the reducing power. In addition, the quantity of the compounds with antioxidant effects confirmed the data obtained, they being present in the extracts.
International Nuclear Information System (INIS)
Chen Henglei; Wan Honggui; Zhang Jun; Zeng Xianxian
2008-01-01
In order to obtain Pleurotus ferulae with high temperature tolerance, mycelium mono-cells of wild type strain ACK was treated by nitrogen ion (5-30 keV, 1.5x10 15 -1.5x10 16 cm -2 ) implantation, and mutant CGMCC1762 was selected through auxotrophy screening method, which was Lys, VB6 auxotrophy stress with high temperature. We found that during riper period the surface layer mycelium of the mutant was not aging neither grew tegument even above 30 degree C. The mycelium endurable temperature of the mutant was increased 7 degree C compared with that of the wild type strain. The fruiting bodies growth temperature of the mutant was 16-20 degree C in daytime and was 6-12 degree C at night. The highest growth temperature of fruiting bodies of the mutant was increased by 5 degree C than that of original strain. Through three generation investigation, we found that the mutant CGMCC1762 was stable with high temperature tolerance. (authors)
Huang, Yufu; Xue, Xiangyang; Yan, He; Sun, Xiaodong; Wang, Jian; McCutchan, Thomas F.; Pan, Weiqing
2011-01-01
Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1), encoded by the var gene family, plays a crucial role in disease virulence through its involvement in binding to various host cellular receptors during infection. Growing evidence suggests that differential expression of the various var subgroups may be involved in parasite virulence. To further explore this issue, we have collected isolates from symptomatic patients in south China-Myanmar border, and characterized their sequence diversity and transcription profiles over time of var gene family, and cytoadherence properties from the time of their initial collection and extending through a two month period of adaptation to culture. Initially, we established a highly diverse, DBLα (4 cysteines) subtype-enriched, but unique local repertoire of var-DBL1α sequences by cDNA cloning and sequencing. Next we observed a rapid transcriptional decline of upsA- and upsB-subtype var genes at ring stage through qRT-PCR assays, and a switching event from initial ICAM-I binding to the CD36-binding activity during the first week of adaptive cultivation in vitro. Moreover, predominant transcription of upsA var genes was observed to be correlated with those isolates that showed a higher parasitemia at the time of collection and the ICAM-1-binding phenotype in culture. Taken together, these data indicate that the initial stage of adaptive process in vitro significantly influences the transcription of virulence-related var subtypes and expression of PfEMP1 variants. Further, the specific upregulation of the upsA var genes is likely linked to the rapid propagation of the parasite during natural infection due to the A-type PfEMP1 variant-mediated growth advantages. PMID:21674009
Directory of Open Access Journals (Sweden)
Helenires Queiroz de Souza
2004-01-01
Full Text Available Foi realizado um estudo dos representantes da Ordem Agaricales Clements (Hymenomycetes, Basidiomycotina, ocorrentes na Reserva Biológica Walter Egler, situada na Estrada AM-010, Manaus-Itacoatiara, Km 64, Latitude 02° 43' S e Longitude 59° 47' W, Rio Preto da Eva, Amazonas. A área abrange 709 ha de floresta de terra firme primária. As coletas foram realizadas no período de dezembro de 2000 a junho de 2001 e seguiu-se a metodologia usual para identificação de Agaricales. Foram estudadas um total de 39 espécies, distribuídas em 13 gêneros e seis famílias: Polyporaceae: Pleurotus sp.; Hygrophoraceae: Hygrocybe cf. megistospora, Hygrocybe aff. miniceps, Hygrocybe occidentalis var. scarletina, e mais oito espécies de Hygrocybe indeterminadas; Tricholomataceae: Clitocybe sp., Hydropus sp.1 e Hydropus sp.2, Macrocystidia sp., Marasmiellus sp., Marasmius bellus, Marasmius haedinus var. haedinus,Marasmius cf. leoninus, Marasmius cf. mazatecus, Marasmius cf. ruber,Marasmius cf. setulosifolius, Marasmius tageticolor, Marasmius cf. variabiliceps var. variabiliceps, Marasmius sp.1, Marasmius sp.2, Marasmius sp.3 e Marasmius sp.4, Tricholoma sp.; Agaricaceae: Agaricus sp.1 e Agaricus sp.2, Lepiota sp., Cystoderma sp.; Entolomataceae: Entoloma cf. azureoviride, Entoloma cf. cystidiophorum, Entoloma strigosissima, Entoloma sp.; Russulaceae: Lactarius panuoides. Destas, Entoloma azureoviride, Hygrocybe miniceps, Lactarius panuoides, Marasmius cf. mazatecus, Marasmius cf. setulosifolius e Marasmius variabiliceps var. variabiliceps, provavelmente, estão sendo aqui citadas pela primeira vez, para o Brasil. Com exceção de Marasmius tageticolor, as demais espécies são citadas pela primeira vez, para a Reserva Egler. São fornecidas tabelas com a ocorrência das espécies de acordo com o gradiente topográfico (baixio, vertente, platô e seus respectivos habitats.A study of the order Agaricales Clements (Hymenomycetes, Basidiomycotina, occurring in
Investigation of Pleurotus ostreatus pretreatment on switchgrass for ethanol production
Slavens, Shelyn Gehle
Fungal pretreatment using the white-rot fungus Pleurotus ostreatus on switchgrass for ethanol production was studied. In a small-scale storage study, small switchgrass bales were inoculated with fungal spawn and automatically watered to maintain moisture. Sampled at 25, 53, and 81 d, the switchgrass composition was determined and liquid hot water (LHW) pretreatment was conducted. Fungal pretreatment significantly decreased the xylan and lignin content; glucan was not significantly affected by fungal loading. The glucan, xylan, and lignin contents significantly decreased with increased fungal pretreatment time. The effects of the fungal pretreatment were not highly evident after the LHW pretreatment, showing only changes based on sampling time. Although other biological activity within the bales increased cellulose degradation, the fungal pretreatment successfully reduced the switchgrass lignin and hemicellulose contents. In a laboratory-scale nutrient supplementation study, copper, manganese, glucose, or water was added to switchgrass to induce production of ligninolytic enzymes by P. ostreatus. After 40 d, ligninolytic enzyme activities and biomass composition were determined and simultaneous saccharification and fermentation (SSF) was conducted to determine ethanol yield. Laccase activity was similar for all supplements and manganese peroxidase (MnP) activity was significantly less in copper-treated samples than in the other fungal-inoculated samples. The fungal pretreatment reduced glucan, xylan, and lignin content, while increasing extractable sugars content. The lowest lignin contents occurred in the water-fungal treated samples and produced the greatest ethanol yields. The greatest lignin contents occurred in the copper-fungal treated samples and produced the lowest ethanol yields. Manganese-fungal and glucose-fungal treated samples had similar, intermediate lignin contents and produced similar, intermediate ethanol yields. Ethanol yields from switchgrass
Testo, Weston L; Watkins, James E
2013-11-01
Understanding the ecology of rare species can inform aspects of conservation strategies; however, the mechanisms of rarity remain elusive for most pteridophytes, which possess independent and ecologically distinct gametophyte and sporophyte generations. To elucidate factors contributing to recent declines of the rare fern Asplenium scolopendrium var. americanum, we studied the ecology and ecophysiology of its gametophyte generation, focusing on responses to competition, temperature, and water stress. Gametophytes of A. scolopendrium var. americanum, its widespread European relative A. scolopendrium var. scolopendrium, and five co-occurring fern species were grown from spores. Gametophytes were grown at 20°C and 25°C, and germination rates, intra- and interspecific competition, desiccation tolerance, and sporophyte production were determined for all species. Gametophytes of A. scolopendrium var. americanum had the lowest rates of germination and sporophyte production among all species studied and exhibited the greatest sensitivity to interspecific competition, temperature increases, and desiccation. Mature gametophytes of A. scolopendrium var. americanum grown at 25°C were 84.6% smaller than those grown at 20°C, and only 1.5% produced sporophytes after 200 d in culture. Similar responses were not observed in other species studied. The recent declines and current status of populations of A. scolopendrium var. americanum are linked to its gametophyte's limited capacity to tolerate competition and physiological stress linked to climate change. This is the first study to develop a mechanistic understanding of rarity and decline in a fern and demonstrates the importance of considering the ecology of the gametophyte in plants with independent sporophyte and gametophyte generations.
Najid, Najihah Mohd; Zain, Che Radziah Che Mohd; Zainal, Zamri
2016-11-01
Ficus deltoidea (moraceae) is a herbal plant with medicinal values. Previous studies reported that the F. deltoidea contains a high level of bioactive compounds such as flavonoids. A cDNA encodes for chalcone isomerase was identified from F. deltoidea, designated as FdCHI, which involved in the isomerization of naringenin chalcone to naringenin. Naringenin is a key branch point for the synthesis of rutin, which is believed involved in defense mechanism in the plant. Therefore, we hypothesized that there might be a direct relationship between FdCHI expression level and rutin production in leaves of F. deltoidea var. deltoidea (FDD) and F. deltoidea var. angustifolia (FDA). Our result showed that expression level of FdCHI in leaves FDD was greater than FDA. Analysis of High Performance Liquid Chromatography (HPLC) revealed that rutin was only detected in FDA leaves. Based on the results between FdCHI expression and rutin production, this study concluded that there is no relationship between FdCHI expression and rutin production in leaves of FDA and FDD.
DEFF Research Database (Denmark)
Doritchamou, Justin; Sabbagh, Audrey; Jespersen, Jakob S
2015-01-01
The VAR2CSA protein of Plasmodium falciparum is transported to and expressed on the infected erythrocyte surface where it plays a key role in placental malaria (PM). It is the current leading candidate for a vaccine to prevent PM. However, the antigenic polymorphism integral to VAR2CSA poses...... a challenge for vaccine development. Based on detailed analysis of polymorphisms in the sequence of its ligand-binding N-terminal region, currently the main focus for vaccine development, we assessed var2csa from parasite isolates infecting pregnant women. The results reveal for the first time the presence...
Inflows and their Macroeconomic Impact in India a VAR Analysis
Directory of Open Access Journals (Sweden)
Narayan Sethi
2012-12-01
Full Text Available The present study attempts to examine the effects of private foreign capital inflows (FINV on macroeconomic variables in India. The study also examines the trends and composition of capital inflows into India. Using the Vector Autoregression (VAR method, this paper specifically examines effects of private foreign capital inflows (FINV on macroeconomic variables in India. This study is based on the monthly data from 1995:04 to 2011:07 and incorporating the macroeconomic variables such as exchange rate (EXR, inflation, money supply (M3, export (EXPO, import (IMP, foreign exchange reserve (FOREX and economic growth (IIP as proxy of GDP. The important observations emerge from the VAR analysis which shows there is dynamic short and long equilibrium relationship between few macroeconomic variables like exchange rate (EXR, foreign exchange reserve (FOREX, index of industrial production (IIP and money supply (M3 with private foreign capital inflows (FINV during the study period from 1995:04 to 2011:07
Niazi, Nabeel Khan; Singh, Balwant; Van Zwieten, Lukas; Kachenko, Anthony George
2011-10-01
This study examined the phytoextraction potential of two arsenic (As) hyperaccumulators, Pteris vittata L. and Pityrogramma calomelanos var. austroamericana at a historical As-contaminated cattle dip site in northern New South Wales (NSW), Australia. Total As concentration in the surface soil (0-20 cm) showed a better spatial structure than phosphate-extractable As in the surface and sub-surface soil at this site. P. calomelanos var. austroamericana produced greater frond dry biomass (mean = 130 g plant(-1)) than P. vittata (mean = 81 g plant(-1)) after 10 months of growth. Arsenic concentration and uptake in fronds were also significantly higher in P. calomelanos var. austroamericana (means = 887 mg kg(-1) and 124 mg plant(-1)) than in P. vittata (means = 674 mg kg(-1) and 57 mg plant(-1)). Our results showed that under the field conditions and highly variable soil As at the site, P. calomelanos var. austroamericana performed better than P. vittata. We predict that P. calomelanos var. austroamericana would take approximately 100 years to reduce the total As to below 20 mg kg(-1) at the site compared to > or =200 years estimated for P. vittata. However, long-term data are required to confirm these observations under field conditions.
Screening of some biological activities of Alyssum fulvescens var. fulvescens known as ege madwort.
Ozay, Cennet; Mammadov, Ramazan
2017-09-01
In this research, the phenolic composition, antioxidant, antibacterial and cytotoxic activities of the methanolic extracts obtained from Alyssum fulvescens var. fulvescens aerial parts known as Ege kuduzotu in western Turkey, were firstly investigated. The antioxidant activity of the extract was determined by DPPH, metal chelating, phosphomolybdenum, β-carotene/linoleic acid and ferric reducing power assays. Moreover, total phenolic and flavonoid contents in the extract were investigated. The brine shrimp (Artemia salina L.) lethality test was used to investigate for the possible cytotoxic activity of the extract. Microdilution broth method was used to study antibacterial potency of extract against Gram-positive and Gram-negative bacteria. The extract exhibited good biological activities. Total phenolic and flavonoid contents in the extract were significantly correlated with antioxidant potentials. HPLC analysis showed that chlorogenic acid was the major phenolic in extract tested. The results indicated that the extract of A. fulvescens var. fulvescens may be considered as a potential source of biological agents and in vivo investigations are needed to test the biological effects of A. fulvescens var. fulvescens.
AFLP analysis of Cynodon dactylon (L.) Pers. var. dactylon genetic variation.
Wu, Y Q; Taliaferro, C M; Bai, G H; Anderson, M P
2004-08-01
Cynodon dactylon (L.) Pers. var. dactylon (common bermudagrass) is geographically widely distributed between about lat 45 degrees N and lat 45 degrees S, penetrating to about lat 53 degrees N in Europe. The extensive variation of morphological and adaptive characteristics of the taxon is substantially documented, but information is lacking on DNA molecular variation in geographically disparate forms. Accordingly, this study was conducted to assess molecular genetic variation and genetic relatedness among 28 C. dactylon var. dactylon accessions originating from 11 countries on 4 continents (Africa, Asia, Australia, and Europe). A fluorescence-labeled amplified fragment length polymorphism (AFLP) DNA profiling method was used to detect the genetic diversity and relatedness. On the basis of 443 polymorphic AFLP fragments from 8 primer combinations, the accessions were grouped into clusters and subclusters associating with their geographic origins. Genetic similarity coefficients (SC) for the 28 accessions ranged from 0.53 to 0.98. Accessions originating from Africa, Australia, Asia, and Europe formed major groupings as indicated by cluster and principal coordinate analysis. Accessions from Australia and Asia, though separately clustered, were relatively closely related and most distantly related to accessions of European origin. African accessions formed two distant clusters and had the greatest variation in genetic relatedness relative to accessions from other geographic regions. Sampling the full extent of genetic variation in C. dactylon var. dactylon would require extensive germplasm collection in the major geographic regions of its distributional range.
Hidrocefalia conseqüente à varíola incidindo no período fetal
Directory of Open Access Journals (Sweden)
Gilberto Machado de Almeida
1964-09-01
Full Text Available A partir de 1941, muito tem sido escrito a respeito da possibilidade de que uma infecção, incidindo em gestante, determine malformação. O papel da rubéola como causa de embriopatias está comprovado; entretanto, não há, até agora, demonstração cabal de que outras viroses também as determinem. No que diz respeito à possibilidade de existir embriopatia causada por varíola, encontramos apenas o caso de Jellife, para o qual esta etiologia foi sugerida. Com relação às malformações causadas por fetopatias, a toxoplasmose e a citomegalia constituem as únicas bem estudadas e caracterizadas. Morquio, em 1903, registrou três pacientes hidrocefálicos para os quais a etiologia variólica é sugerida; êste trabalho não foi citado na literatura ulterior. A possibilidade de a varíola atingir o feto, determinando hidrocefalia, não foi mais referida, se bem que seja relativamente numerosa a bibliografia a respeito das conseqüências desta virose quando incide durante a gravidez. Dentre 450 pacientes hidrocefálicas que tivemos a oportunidade de examinar, encontramos 15 nos quais pôde ser demonstrado que a varíola, incidindo após o quarto mês de gestação, atingiu o feto determinando fetopatia cujo elemento mais característico foi a hidrocefalia. O quadro clínico e anátomo-patológico apresentado por êstes doentes tem algumas características semelhantes às encontradas em casos de citomegalia e toxoplasmose. O estudo dêstes pacientes e da literatura correlata permitiu chegar às seguintes conclusões: 1. A varíola incidindo em gestante, nos dois últimos trimestres da gravidez, pode atingir o feto determinando lesões encefálicas graves e hidrocefalia. 2. Nos casos de crianças que apresentam sinais de hidrocefalia deve ser indagada a ocorrência de doença eruptiva materna, varíola em particular, durante a gestação. Mesmo quando se trate de mães imunes à varíola por vacinação ou por moléstia anterior e que n
Directory of Open Access Journals (Sweden)
Keita Masuko
2018-01-01
Full Text Available Summary: Drosophila imaginal disc cells exhibit a remarkable ability to convert cell fates in response to various perturbations, a phenomenon called transdetermination (TD. We previously identified winged eye (wge as a factor that induces eye-to-wing TD upon overexpression in eye imaginal discs, but the molecular mechanisms underlying TD have remained largely unclear. Here, we found that wge induces various histone modifications and enhances the methylation of Lys9 on histone H3 (H3K9, a feature of heterochromatin. A histone methyltransferase, Su(var3-9, is required for wge-mediated H3K9 methylation and eye-to-wing TD. Su(var3-9 is also required for classical wound-induced TD but not for normal development, suggesting its involvement in several types of imaginal disc TDs. Transcriptome analysis revealed that wge represses eye identity genes independently of Su(var3-9 and activates TD-related genes by acting together with Su(var3-9. These findings provide new insights into diverse types of chromatin regulation at progressive steps of cell-fate conversions. : Drosophila imaginal discs switch disc identity by a process known as transdetermination. Masuko et al. demonstrate that expression of the winged eye gene induces transdetermination through histone modifications such as H3K9-methylation. winged eye regulates expression of transdetermination-related genes via a histone methyltransferase, Su(var3-9. Keywords: Drosophila, imaginal disc, transdetermination, heterochromatin, cell fate, winged eye, reprogramming, Su(var3-9
Bootstrap Determination of the Co-integration Rank in Heteroskedastic VAR Models
DEFF Research Database (Denmark)
Cavaliere, Giuseppe; Rahbek, Anders; Taylor, A.M.Robert
In a recent paper Cavaliere et al. (2012) develop bootstrap implementations of the (pseudo-) likelihood ratio [PLR] co-integration rank test and associated sequential rank determination procedure of Johansen (1996). The bootstrap samples are constructed using the restricted parameter estimates...... of the underlying VAR model which obtain under the reduced rank null hypothesis. They propose methods based on an i.i.d. bootstrap re-sampling scheme and establish the validity of their proposed bootstrap procedures in the context of a co-integrated VAR model with i.i.d. innovations. In this paper we investigate...... the properties of their bootstrap procedures, together with analogous procedures based on a wild bootstrap re-sampling scheme, when time-varying behaviour is present in either the conditional or unconditional variance of the innovations. We show that the bootstrap PLR tests are asymptotically correctly sized and...
Bootstrap Determination of the Co-Integration Rank in Heteroskedastic VAR Models
DEFF Research Database (Denmark)
Cavaliere, Giuseppe; Rahbek, Anders; Taylor, A. M. Robert
In a recent paper Cavaliere et al. (2012) develop bootstrap implementations of the (pseudo-) likelihood ratio [PLR] co-integration rank test and associated sequential rank determination procedure of Johansen (1996). The bootstrap samples are constructed using the restricted parameter estimates...... of the underlying VAR model which obtain under the reduced rank null hypothesis. They propose methods based on an i.i.d. bootstrap re-sampling scheme and establish the validity of their proposed bootstrap procedures in the context of a co-integrated VAR model with i.i.d. innovations. In this paper we investigate...... the properties of their bootstrap procedures, together with analogous procedures based on a wild bootstrap re-sampling scheme, when time-varying behaviour is present in either the conditional or unconditional variance of the innovations. We show that the bootstrap PLR tests are asymptotically correctly sized and...
Yunis-Varón syndrome caused by biallelic VAC14 mutations
Lines, Matthew A.; Ito, Yoko; Kernohan, Kristin D.; Mears, Wendy; Hurteau-Miller, Julie; Venkateswaran, Sunita; Ward, Leanne; Khatchadourian, Karine; McClintock, Jeff; Bhola, Priya; Campeau, Philippe M.; Boycott, Kym M.; Michaud, Jean; van Kuilenburg, André Bp; Ferdinandusse, Sacha; Dyment, David A.
2017-01-01
Yunis-Varón syndrome (YVS) is an autosomal recessive disorder comprising skeletal anomalies, dysmorphism, global developmental delay and intracytoplasmic vacuolation in brain and other tissues. All hitherto-reported pathogenic variants affect FIG4, a lipid phosphatase involved in
Zhang, Xiaohui; Liu, Tongjin; Li, Xixiang; Duan, Mengmeng; Wang, Jinglei; Qiu, Yang; Wang, Haiping; Song, Jiangping; Shen, Di
2016-01-04
Brassica oleracea and B. rapa are two important vegetable crops. Both are composed of dozens of subspecies encompassing hundreds of varieties and cultivars. Synthetic B. napus with these two plants has been used extensively as a research model for the investigation of allopolyploid evolution. However, the mechanism underlying the explosive evolution of hundreds of varieties of B. oleracea and B. rapa within a short period is poorly understood. In the present study, interspecific hybridization between B. oleracea var. alboglabra and B. rapa var. purpurea was performed. The backcross progeny displayed extensive morphological variation, including some individuals that phenocopied subspecies other than their progenitors. Numerous interesting novel phenotypes and mutants were identified among the backcross progeny. The chromosomal recombination between the A and C genomes and the chromosomal asymmetric segregation were revealed using Simple Sequence Repeats (SSR) markers. These findings provide direct evidence in support of the hypothesis that interspecific hybridization and backcrossing have played roles in the evolution of the vast variety of vegetables among these species and suggest that combination of interspecific hybridization and backcrossing may facilitate the development of new mutants and novel phenotypes for both basic research and the breeding of new vegetable crops.
Directory of Open Access Journals (Sweden)
I MADE SUDARMA
2015-09-01
Full Text Available The growth rate comparison of white oyster mushroom (Pleurotus ostreatus (Jacq. ex FrKummer mycelium in the composition of different seed (F3 and baglog media . Cultivation ofoyster mushroom (Pleurotus ostreatus (Jacq. ex Fr Kummer has grown rapidly along with the increasein income and health awareness. Oyster mushrooms growing need for media with a particular compositionin order to grow optimally. Oyster mushroom production is determined by the quality of the seeds (F3is used, which is sourced from the media with good quality and composition. The research aimed todetermine the rate of growth of white oyster mushroom mycelium in the different composition of seedmedium (F3 (sawdust: fine bran: corn flour: CaCO3 . The experiments was conducted at nurseriesand oyster mushroom development, Jl. Siulan Gang Zella No. 7 Denpasar, from June to August 2013.Each treatment contained 50 bottles, and 10 bottles only used as a sample, in environmental conditionswith temperature and humidity ranges, 20-29oC and 59-86% respectively . T-test was used todifferentiate the growth rate of white oyster mushroom mycelium with different compositions. Theresults showed that seeds (F3 derived from the growing media composition, sawdust (1 week old:fine bran: corn flour: CaCO3 (10:4:2:0,5 significantly different and better than the composition sawdust(age 1 month : fine bran: corn flour (20:2:1:0.5, with a growth rate of mycelium in a mean 6.14±0.56cm/week and 1,81±0,82 cm/week, respectively. Spawn running in baglog with media composition10:4:2:0.5 was 2.77±1.22cm/week, but with composition media 20:2:1:0.5 mycelium could not grow.Effect of temperature and humidity on the growth rate of white oyster mushroom mycelium in seedmedia (F3 is not significantly.
The Advantages of Hybrid 4DEnVar in the Context of the Forecast Sensitivity to Initial Conditions
Song, Hyo-Jong; Shin, Seoleun; Ha, Ji-Hyun; Lim, Sujeong
2017-11-01
Hybrid four-dimensional ensemble variational data assimilation (hybrid 4DEnVar) is a prospective successor to three-dimensional variational data assimilation (3DVar) in operational weather prediction centers currently developing a new weather prediction model and those that do not operate adjoint models. In experiments using real observations, hybrid 4DEnVar improved Northern Hemisphere (NH; 20°N-90°N) 500 hPa geopotential height forecasts up to 5 days in a NH summer month compared to 3DVar, with statistical significance. This result is verified against ERA-Interim through a Monte Carlo test. By a regression analysis, the sensitivity of 5 day forecast is associated with the quality of the initial condition. The increased analysis skill for midtropospheric midlatitude temperature and subtropical moisture has the most apparent effect on forecast skill in the NH including a typhoon prediction case. Through attributing the analysis improvements by hybrid 4DEnVar separately to the ensemble background error covariance (BEC), its four-dimensional (4-D) extension, and climatological BEC, it is revealed that the ensemble BEC contributes to the subtropical moisture analysis, whereas the 4-D extension does to the midtropospheric midlatitude temperature. This result implies that hourly wind-mass correlation in 6 h analysis window is required to extract the potential of hybrid 4DEnVar for the midlatitude temperature analysis to the maximum. However, the temporal ensemble correlation, in hourly time scale, between moisture and another variable is invalid so that it could not work for improving the hybrid 4DEnVar analysis.
Basquin, Denis; Spierer, Anne; Begeot, Flora; Koryakov, Dmitry E; Todeschini, Anne-Laure; Ronsseray, Stéphane; Vieira, Cristina; Spierer, Pierre; Delattre, Marion
2014-01-01
Heterochromatin is made of repetitive sequences, mainly transposable elements (TEs), the regulation of which is critical for genome stability. We have analyzed the role of the heterochromatin-associated Su(var)3-7 protein in Drosophila ovaries. We present evidences that Su(var)3-7 is required for correct oogenesis and female fertility. It accumulates in heterochromatic domains of ovarian germline and somatic cells nuclei, where it co-localizes with HP1. Homozygous mutant females display ovaries with frequent degenerating egg-chambers. Absence of Su(var)3-7 in embryos leads to defects in meiosis and first mitotic divisions due to chromatin fragmentation or chromosome loss, showing that Su(var)3-7 is required for genome integrity. Females homozygous for Su(var)3-7 mutations strongly impair repression of P-transposable element induced gonadal dysgenesis but have minor effects on other TEs. Su(var)3-7 mutations reduce piRNA cluster transcription and slightly impact ovarian piRNA production. However, this modest piRNA reduction does not correlate with transposon de-silencing, suggesting that the moderate effect of Su(var)3-7 on some TE repression is not linked to piRNA production. Strikingly, Su(var)3-7 genetically interacts with the piwi and aubergine genes, key components of the piRNA pathway, by strongly impacting female fertility without impairing transposon silencing. These results lead us to propose that the interaction between Su(var)3-7 and piwi or aubergine controls important developmental processes independently of transposon silencing.
Directory of Open Access Journals (Sweden)
Mitun Chakraborty
Full Text Available The alcohol oxidase (AOx cDNA from Aspergillus terreus MTCC6324 with an open reading frame (ORF of 2001 bp was constructed from n-hexadecane induced cells and expressed in Escherichia coli with a yield of ∼4.2 mg protein g-1 wet cell. The deduced amino acid sequences of recombinant rAOx showed maximum structural homology with the chain B of aryl AOx from Pleurotus eryngii. A functionally active AOx was achieved by incubating the apo-AOx with flavin adenine dinucleotide (FAD for ∼80 h at 16°C and pH 9.0. The isoelectric point and mass of the apo-AOx were found to be 6.5±0.1 and ∼74 kDa, respectively. Circular dichroism data of the rAOx confirmed its ordered structure. Docking studies with an ab-initio protein model demonstrated the presence of a conserved FAD binding domain with an active substrate binding site. The rAOx was specific for aryl alcohols and the order of its substrate preference was 4-methoxybenzyl alcohol >3-methoxybenzyl alcohol>3, 4-dimethoxybenzyl alcohol > benzyl alcohol. A significantly high aggregation to ∼1000 nm (diameter and catalytic efficiency (kcat/Km of 7829.5 min-1 mM-1 for 4-methoxybenzyl alcohol was also demonstrated for rAOx. The results infer the novelty of the AOx and its potential biocatalytic application.
Phenyl ethers from cultured lichen mycobionts of Graphis scripta var. serpentina and G. rikuzensis.
Takenaka, Yukiko; Tanahashi, Takao; Nagakura, Naotaka; Hamada, Nobuo
2003-07-01
Spore-derived mycobionts of the lichen Graphis scripta var. serpentina and G. rikuzensis were cultivated on a malt-yeast extract medium supplemented with 10% sucrose and their metabolites were investigated. 3,3'-Dihydroxy-5,5'-dimethyldiphenyl ether was isolated from the cultures of the mycobionts of G. scripta var. serpentina, while a new phenyl ether, rikuzenol, along with two known diphenyl ethers, violaceol-I and violaceol-II, were isolated from those of G. rikuzensis. The structure of the new compound was determined by spectroscopic methods. Violaceol-I was chemically synthesized and interconversion between violaceol-I and violaceol-II was proven.
Anti-U-like as an alloantibody in S-s-U- and S-s-U+(var) black people.
Peyrard, Thierry; Lam, Yin; Saison, Carole; Arnaud, Lionel; Babinet, Jérôme; Rouger, Philippe; Bierling, Philippe; Janvier, Daniel
2012-03-01
S, s, and U antigens belong to the MNS system. They are carried by glycophorin B (GPB), encoded by GYPB. Black people with the low-prevalence S-s- phenotype, either U- or U+(var), can make a clinically significant anti-U. Anti-U-like, a cold immunoglobulin G autoantibody quite commonly observed in S-s+U+ black persons, was previously described to be nonreactive with ficin-, α-chymotrypsin-, and pronase-treated red blood cells (RBCs); nonreactive or weakly reactive with papain-treated RBCs; and reactive with trypsin-treated RBCs. Here we describe, in S-s- people from different molecular backgrounds, an alloantibody to a high-prevalence GPB antigen, which presents the same pattern of reactivity with proteases as autoanti-U-like. Four S-s- patients with an alloantibody to a high-prevalence GPB antigen were investigated by serologic and molecular methods. An alloantibody was observed in two S-s-U-/Del GYPB, one S-s-U+(var)/GYPB(P2), and one S-s-U+(var)/GYPB(NY) patients. As this alloantibody showed the same pattern of reactivity with proteases as autoanti-U-like, we decided to name it "anti-U-like." Anti-U-like made by the two S-s-U- patients was reactive with the S-s-U+(var) RBCs of the two other patients. S-s-U-/Del GYPB, S-s-U+(var)/GYPB(P2), and S-s-U+(var)/GYPB(NY) patients can make an alloanti-U-like. Anti-U-like made by S-s-U- people appears reactive with GYPB(P2) and GYPB(NY) RBCs, which both express a weak and partial U-like reactivity. We recommend transfusing S-s-U- RBCs in S-s-U- patients showing alloanti-U-like. Our study contributes to a better understanding of alloimmunization to GPB in black people and confirms importance of genotyping in S-s- patients, especially those with sickle cell disease to be frequently transfused. © 2011 American Association of Blood Banks.
Equisetum hyemale L. var. affine (Engelm.) A.A. Eaton in Schoorl
Swolfs, Aart G.
1996-01-01
A giant form of the Northamerican Equisetum hyemale var. affine has been planted a decade ago near the coast, where it has naturalized since. It is suggested that other Northamerican introductions of this extremely variable taxon may have remained unnoticed.
Rorick, Mary M; Rask, Thomas S; Baskerville, Edward B; Day, Karen P; Pascual, Mercedes
2013-11-06
The primary target of the human immune response to the malaria parasite Plasmodium falciparum, P. falciparum erythrocyte membrane protein 1 (PfEMP1), is encoded by the members of the hyper-diverse var gene family. The parasite exhibits antigenic variation via mutually exclusive expression (switching) of the ~60 var genes within its genome. It is thought that different variants exhibit different host endothelial binding preferences that in turn result in different manifestations of disease. Var sequences comprise ancient sequence fragments, termed homology blocks (HBs), that recombine at exceedingly high rates. We use HBs to define distinct var types within a local population. We then reanalyze a dataset that contains clinical and var expression data to investigate whether the HBs allow for a description of sequence diversity corresponding to biological function, such that it improves our ability to predict disease phenotype from parasite genetics. We find that even a generic set of HBs, which are defined for a small number of non-local parasites: capture the majority of local sequence diversity; improve our ability to predict disease severity from parasite genetics; and reveal a previously hypothesized yet previously unobserved parasite genetic basis for two forms of severe disease. We find that the expression rates of some HBs correlate more strongly with severe disease phenotypes than the expression rates of classic var DBLα tag types, and principal components of HB expression rate profiles further improve genotype-phenotype models. More specifically, within the large Kenyan dataset that is the focus of this study, we observe that HB expression differs significantly for severe versus mild disease, and for rosetting versus impaired consciousness associated severe disease. The analysis of a second much smaller dataset from Mali suggests that these HB-phenotype associations are consistent across geographically distant populations, since we find evidence suggesting
Fiscal developments and financial stress: a threshold VAR analysis
Czech Academy of Sciences Publication Activity Database
Afonso, A.; Baxa, Jaromír; Slavík, M.
2018-01-01
Roč. 54, č. 2 (2018), s. 395-423 ISSN 0377-7332 R&D Projects: GA ČR(CZ) GBP402/12/G097 Institutional support: RVO:67985556 Keywords : Fiscal policy * Financial markets * Threshold VAR Subject RIV: AH - Economic s OBOR OECD: Applied Economic s, Econometrics Impact factor: 0.645, year: 2016 http://library.utia.cas.cz/separaty/2018/E/baxa-0488303.pdf
Ibrahim, Doaa S
2017-02-01
The central nervous system is one of the most vulnerable organs affected by the oxidative stress associated with diabetes mellitus. Healthy food provides an important source for antioxidants. Therefore, the protective effect of Cucumis melo var. flexuosus (C. melo var. flexuosus) leaf extract on the brains of diabetic rats was investigated. Adult male albino rats divided into 5 groups of 6 rats each were assigned into a normal control group and four diabetic groups. Diabetes was induced in rats by a single intraperitoneal injection of streptozotocin (STZ; 60 mg/kg bw). One of the four diabetic groups was left untreated and was considered as a diabetic control group while the three other groups were treated with C. melo var. flexuosus leaf extract at the doses of 30, 60 and 120 mg/kg bw for a period of 30 days. After completion of experimental duration plasma and brains were used for evaluating biochemical changes. The obtained data showed that C. melo var. flexuosus leaf extract treatment lowered blood glucose, glycated hemoglobin, brain tumor necrosis factor-alpha, interleukin levels, brain malondialdehyde content and caspase-3 activity. Furthermore, the treatment resulted in a marked increase in plasma dopamine, melatonin, brain vascular endothelial growth factor-A levels, brain catalase and superoxide dismutase activities. From the present study, it can be concluded that the C. melo var. flexuosus leaf extract exerts a neuroprotective effect against oxidative damage associated with diabetes.
Jia, Peilin; Zhao, Zhongming
2014-02-01
A major challenge in interpreting the large volume of mutation data identified by next-generation sequencing (NGS) is to distinguish driver mutations from neutral passenger mutations to facilitate the identification of targetable genes and new drugs. Current approaches are primarily based on mutation frequencies of single-genes, which lack the power to detect infrequently mutated driver genes and ignore functional interconnection and regulation among cancer genes. We propose a novel mutation network method, VarWalker, to prioritize driver genes in large scale cancer mutation data. VarWalker fits generalized additive models for each sample based on sample-specific mutation profiles and builds on the joint frequency of both mutation genes and their close interactors. These interactors are selected and optimized using the Random Walk with Restart algorithm in a protein-protein interaction network. We applied the method in >300 tumor genomes in two large-scale NGS benchmark datasets: 183 lung adenocarcinoma samples and 121 melanoma samples. In each cancer, we derived a consensus mutation subnetwork containing significantly enriched consensus cancer genes and cancer-related functional pathways. These cancer-specific mutation networks were then validated using independent datasets for each cancer. Importantly, VarWalker prioritizes well-known, infrequently mutated genes, which are shown to interact with highly recurrently mutated genes yet have been ignored by conventional single-gene-based approaches. Utilizing VarWalker, we demonstrated that network-assisted approaches can be effectively adapted to facilitate the detection of cancer driver genes in NGS data.
DEFF Research Database (Denmark)
Gbédandé, Komi; Cottrell, Gilles; Vianou, Bertin
2016-01-01
BACKGROUND: Current knowledge of human immunological responses to pregnancy-associated malaria-specific Plasmodium falciparum protein VAR2CSA concerns almost exclusively B cell-driven antibody-mediated activity. Knowledge of VAR2CSA-specific T cell-mediated activity is minimal by comparison, with...
Controlling liquid pool depth in VAR of a 21.6 cm diameter ingot of Alloy 718
Lopez, Felipe; Beaman, Joseph; Williamson, Rodney; Taleff, Eric; Watt, Trevor
It is believed that the final microstructure in vacuum arc remelted (VAR) ingots is strongly influenced by the molten metal pool profile. Thus, if the pool profile was properly controlled during the melt then defect-free microstructures would be obtained. The recent development of a reduced-order model of VAR solidification allowed the design of a pool depth controller to accomplish this task. The controller used a linear quadratic regulator and a Kalman filter to stabilize the melt pool solidification front under the effect of uncertain process dynamics and noisy measurements. Basic Axisymmetric Remelting (BAR), a high-fidelity VAR ingot model, was used in real time to provide pool depth measurements that were incorporated in the control loop. The controller was tested at Los Alamos National Laboratory in a 21.6 diameter Alloy 718 ingot. Details of the controller design will be presented, along with comparisons to experimentally-measured pool depths.
Tao, Qiao-Qiao; Ma, Ke; Bao, Li; Wang, Kai; Han, Jun-Jie; Wang, Wen-Zhao; Zhang, Jin-Xia; Huang, Chen-Yang; Liu, Hong-Wei
2016-05-01
One new perhydrobenzannulated 5,5-spiroketal sesquiterpene, pleurospiroketal F (1), as well as six new modified bisabolene sesquiterpenes pleurotins A-F (2-7) were isolated from solid-state fermentation of Pleurotus citrinopileatus. The structures of compounds 1-7 were determined by NMR and MS spectroscopic analysis. The absolute configuration of 1 was determined by X-ray diffraction analysis, while the absolute configurations of 3-7 were assigned using the in situ dimolybdenum circular dichroism method and circular dichroism data comparison. Protein tyrosine phosphatase 1B plays a crucial role as a negative regulator of the insulin-dependent signal cascades. Therefore, the protein tyrosine phosphatase 1B inhibitor can be used for treating type 2 diabetes mellitus and obesity. Compounds 2 and 6 showed moderate inhibitory effects on protein tyrosine phosphatase 1B with IC50 s of 32.1 µM and 30.5 µM, respectively. The kinetic study confirmed compound 2 to be a noncompetitive inhibitor. Compounds 1-7 did not show cytotoxic activity against cancer cell lines (IC50 > 50 µM). Georg Thieme Verlag KG Stuttgart · New York.
Kipling var racist og sexist. Men værd at læse
DEFF Research Database (Denmark)
Møller, Michael
2017-01-01
For over 100 år siden fik Rudyard Kipling Nobelprisen i Litteratur. Han var særdeles alsidig. Han skrev både digte, noveller og bøger, og han skrev både for børn, teenagere og voksne. Han skrev krigsdigte, han skrev digte, der hyldede erhvervslivet, han skrev digte for at fremme bedre pensioner t...... gamle soldater, og han skrev digte til børn. Også hans bøger var meget varierede. I dag er det vel hovedsagelig ' Junglebogen', som unge mennesker kender Kipling for, og det udelukkende på grund af Disney-filmen. Kiplings ry faldt umådeligt efter hans død...
The design and performance of Static Var Compensators for particle accelerators
Kahle, Karsten; Genton, Charles-Mathieu
2015-01-01
Particle accelerators, and in particular synchrotrons, represent large cycling non-linear loads connected to the electrical distribution network. This paper discusses the typical design and performance of Static Var Compensators (SVCs) to obtain the excellent power quality levels required for particle accelerator operation.
Li, Binbin; Li, Sisi; Yin, Juan; Zhong, Jiang
2013-01-01
Histone H3-lysine(9) (H3K9) trimethyltransferase gene Su(var) 3-9 was cloned and identified in three Spodoptera insects, Spodopterafrugiperda (S. frugiperda), S. exigua and S. litura. Sequence analysis showed that Spodoptera Su(var) 3-9 is highly conserved evolutionarily. Su(var) 3-9 protein was found to be localized in the nucleus in Sf9 cells, and interact with histone H3, and the heterochromatin protein 1a (HP1a) and HP1b. A dose-dependent enzymatic activity was found at both 27 °C and 37 °C in vitro, with higher activity at 27 °C. Addition of specific inhibitor chaetocin resulted in decreased histone methylation level and host chromatin relaxation. In contrast, overexpression of Su(var) 3-9 caused increased histone methylation level and cellular genome compaction. In AcMNV-infected Sf9 cells, the transcription of Su(var) 3-9 increased at late time of infection, although the mRNA levels of most cellular genes decreased. Pre-treatment of Sf9 cells with chaetocin speeded up viral DNA replication, and increased the transcription level of a variety of virus genes, whereas in Sf9 cells pre-transformed with Su(var) 3-9 expression vector, viral DNA replication slow down slightly. These findings suggest that Su(var) 3-9 might participate in the viral genes expression an genome replication repression during AcMNPV infection. It provided a new insight for the understanding virus-host interaction mechanism.
Chemical composition of Pleurotus pulmonarius (Fr. Quél., substrates and residue after cultivation
Directory of Open Access Journals (Sweden)
Silva Sueli Oliveira
2002-01-01
Full Text Available The cultivation of Pleurotus pulmonarius was carried out on different substrate: cotton waste (A leaves of Cymbopogon citratus (B and leaves of Panicum maximum Jacq. (C. The mushroom had a varied chemical composition; nevertheless they contained a good composition for to be used as a good source of protein for human kind. The results showed the higher protein content (29.19% and fibre (9.0% for the mushroom that were cultivated on cotton peel. The substrate composition and the residue composition after the mushroom harvest were: Protein for the substrate "A" (10.63% and 9.35%, "B" (7.87% and 4.24% and "C" (7.55% and 5.90 %; Lipids "A" (4.17% and 2.03%, "B"(2.77% and 3.20% and "C" (0.91% and 2.05%; Fibres "A" (49.02% and 37.02%, "B" (28.40% and 23.26% and "C" (37.50% and 26.66% respectively. The substrate "A" showed 0.048% of iron and "C" 0.14% of magnesium, 0.31% of potassium and 0.26% of calcium. In the substrate "B" the quantity of the minerals were very low in comparison to the other substrates. The residues after the harvest of mushroom could be used as fertiliser or as complement in the composition for animal feed.
Biosorption of malachite green from aqueous solutions by Pleurotus ostreatus using Taguchi method
2014-01-01
Dyes released into the environment have been posing a serious threat to natural ecosystems and aquatic life due to presence of heat, light, chemical and other exposures stable. In this study, the Pleurotus ostreatus (a macro-fungus) was used as a new biosorbent to study the biosorption of hazardous malachite green (MG) from aqueous solutions. The effective disposal of P. ostreatus is a meaningful work for environmental protection and maximum utilization of agricultural residues. The operational parameters such as biosorbent dose, pH, and ionic strength were investigated in a series of batch studies at 25°C. Freundlich isotherm model was described well for the biosorption equilibrium data. The biosorption process followed the pseudo-second-order kinetic model. Taguchi method was used to simplify the experimental number for determining the significance of factors and the optimum levels of experimental factors for MG biosorption. Biosorbent dose and initial MG concentration had significant influences on the percent removal and biosorption capacity. The highest percent removal reached 89.58% and the largest biosorption capacity reached 32.33 mg/g. The Fourier transform infrared spectroscopy (FTIR) showed that the functional groups such as, carboxyl, hydroxyl, amino and phosphonate groups on the biosorbent surface could be the potential adsorption sites for MG biosorption. P. ostreatus can be considered as an alternative biosorbent for the removal of dyes from aqueous solutions. PMID:24620852