WorldWideScience

Sample records for pleurotus eryngii var

  1. β-Carotene from Yeasts Enhances Laccase Production of Pleurotus eryngii var. ferulae in Co-culture.

    Science.gov (United States)

    Guo, Chaolin; Zhao, Liting; Wang, Feng; Lu, Jian; Ding, Zhongyang; Shi, Guiyang

    2017-01-01

    Laccase is widely used in several industrial applications and co-culture is a common method for enhancing laccase production in submerged fermentation. In this study, the co-culture of four yeasts with Pleurotus eryngii var. ferulae was found to enhance laccase production. An analysis of sterilization temperatures and extraction conditions revealed that the stimulatory compound in yeasts was temperature-sensitive, and that it was fat-soluble. An LC-MS analysis revealed that the possible stimulatory compound for laccase production in the four yeast extracts was β-carotene. Moreover, the addition of 4 mg β-carotene to 150 mL of P. eryngii var. ferulae culture broth improved laccase production by 2.2-fold compared with the control (i.e., a monoculture), and was similar to laccase production in co-culture. In addition, the enhanced laccase production was accompanied by an increase of lac gene transcription, which was 6.2-time higher than the control on the fifth day. Therefore, it was concluded that β-carotene from the co-cultured yeasts enhanced laccase production in P. eryngii var. ferulae , and strains that produce β-carotene could be selected to enhance fungal laccase production in a co-culture. Alternatively, β-carotene or crude extracts of β-carotene could be used to induce high laccase production in large scale.

  2. ALTERNATIVE NOURISHMENT BESIDE VEGETABLE AND FRUIT IN OUR COUNTRY SOURCE: WILD MUSHROOM (Pleurotus eryngii var. ferulae

    Directory of Open Access Journals (Sweden)

    Mehmet Akyüz

    2007-04-01

    Full Text Available P. eryngii var. ferulae which is known very well in Eastern Anatolia Region and picked up from the nature in spring months is sold by the side of the roads and in neighbour markets with the name of ‘’ çaşır, çakşır, çaşur, heliz, kırkor, göbek, göbelek and mendik’’ mushroom. As a member of Apiaceae family; Ferulae sp. that preads at the slope of the mountains, grows up naturally on the roots of its species that remained from the previous year especially at the altitude of 1000-2500 meters on high mountains. It is known that local people has benefited from the natural products special to periodic times. It is seen that it is not benefited from alternative natural nourishment resources like cultuıre vegetables and fruit with their important features and effective nutritive value. In our opinion, this article will be useful for mentioning the importance of the mushroom beside the vegetables and fruits which are vital for our life. It will be useful to expose the medical features, nourishment content and effective nutritive valu and effective nutritious features of mushroom. Furthermore, It is determined that it is necessary to describe P. eryngii and its similarities with the identification of scientific facts as species, subspecies, variety, taxa or synonym in our country.

  3. ANTIMICROBIAL PROPERTIES OF PLEUROTUS ERYNGII AND LENTINUS EDODES HYDRO-ALCOHOLIC EXTRACTS

    Directory of Open Access Journals (Sweden)

    Gabriela Popa

    2016-11-01

    Full Text Available Besides superior nutritional values mushrooms posed significant medicinal properties. Hydro-alcoholic extracts of several isolates of Pleurotus eryngii and Lentinus edodes mushroom species were investigated for their antimicrobial activities against pathogenic microorganisms with medicinal importance. Antimicrobial activities of the extracts were evaluated by the agar disk diffusion method. Results revealed that the 70% ethylic alcohol extracts have significant inhibitory activities against Bacillus subtilis var. spizizinii, Escherichia coli and Staphylococcus aureus. The results showed that the 70% ethanol extracts of Pleurotus eryngii and Lentinus edodes mushroom isolates may have biopharmaceutical potentiality.

  4. In Vitro Antioxidant and In Vivo Hypolipidemic Effects of the King Oyster Culinary-Medicinal Mushroom, Pleurotus eryngii var. ferulae DDL01 (Agaricomycetes), in Rats with High-Fat Diet-Induced Fatty Liver and Hyperlipidemia.

    Science.gov (United States)

    Choi, Jun-Hui; Kim, Dae-Won; Kim, Seung; Kim, Sung-Jun

    2017-01-01

    We investigated the effect of the culinary-medicinal mushroom Pleurotus eryngii var. ferulae DDL01 on oxidative damage in the liver and brain and a high-fat/high-cholesterol-induced hyperlipidemic model. In in vitro studies, the water extracts of the fruiting bodies showed strong scavenging activities of DPPH (139.46 ± 3.2 μg) and hydroxyl (139.46 ± 3.2 μg) radicals. Moreover, the extracts showed Fe2+ chelating and reducing abilities, as well as a large amount of polyphenols and an inhibitory effect on lipid peroxidation in the liver and brain tissues. The rats were fed a pellet diet (7.5 g/rat/day) containing P. eryngii var. ferulae DDL01 (PD) for 3 weeks. In the high-fat/high-cholesterol-induced hyperlipidemic rat model, administration of PD caused a significant decrease (P < 0.05) in the levels of serum triacylglycerols, low-density lipoprotein cholesterol, very-low-density lipoprotein cholesterol, aspartate aminotransferase, and alanine aminotransferase and a significant increase (P < 0.05) in the level of high-density lipoprotein cholesterol. PD administration significantly decreased high-fat/high-cholesterol-induced hepatic lipid accumulation. Treatment with the extracts (up to 500 μg/mL) did not significantly affect the viability of HepG2 and 3T3-L1 cells. Our findings suggest that this mushroom has potential as an antiatherogenic dietary source in the development of therapeutic agents and functional foods.

  5. DNA-fingerprinting (AFLP and RFLP) for genotypic identification in species of the Pleurotus eryngii complex.

    Science.gov (United States)

    Urbanelli, S; Della Rosa, V; Punelli, F; Porretta, D; Reverberi, M; Fabbri, A A; Fanelli, C

    2007-03-01

    Wild populations of edible species are important source of genetic variability for cultivated lines that can undergo a drastic loss of diversity resulting from man's selection. The development of tools aimed at the clear-cut and safe identification and assessment of genetic variability of the wild and cultivated strains is thus a fundamental goal of molecular genetic research. In this study, we used two polymerase chain reaction (PCR)-based fingerprinting methods-amplified fragment length polymorphism (AFLP) and restriction fragment length polymorphism (RFLP) of laccase and manganese peroxidase genes-to assess genetic differences among strains and independently evolving lineages belonging to the Pleurotus eryngii complex. Both laccase RFLP and AFLP have been proved to distinguish unambiguously the three taxa studied: Pleurotus ferulae, P. eryngii, and P. eryngii var. nebrodensis. AFLP also showed enough sensitivity to detect polymorphisms among the strains, proving to be an efficient DNA fingerprinting tool in studies of strain assignment. The divergent RFLP laccase and manganese peroxidase patterns are also discussed in relation to the role played by these genes in the interaction between these fungi and their host plants.

  6. Mycelial growth observation of Pleurotus eryngii (Higher Basidiomycota In Vitro

    Directory of Open Access Journals (Sweden)

    Mustafa Nadhim Owaid

    2016-09-01

    Full Text Available Five agro-substrates including date palm fibers (fibrillum, wheat straw, white sawdust and their combinations were investigated to grow Pleurotus eryngii. The longer mycelium complete time within bags was 20 days on sawdust (S4, in contrast, the shorter time for mycelium overgrew was completed after 15 days on date palm fiber (S5. In significant (p<0.05, S5 showed the higher growth intensity level (vigorous growth than other substrates. Thus use of date palm wastes (S5 medium may be useful for successfully cultivation king oyster mushroom in farm.International Journal of Environment Vol.5(3 2016, pp.1-10

  7. Fates of nickel and fluoranthene during the bioremediation by Pleurotus eryngii in three different soils.

    Science.gov (United States)

    Tang, Xia; Dong, Shunwen; Shi, Wenjin; Gao, Ni; Zuo, Lei; Xu, Heng

    2016-11-01

    This study focused on the bioremediation role of Pleurotus eryngii in different characteristics soils contaminated with nickel (Ni) and fluoranthene. The results of bioremediation experiments showed that fluoranthene had a positive effect on the growth of P. eryngii, whereas Ni exerted a negative influence. The concentration of fluoranthene significantly decreased in inoculated soil accounting for 86.39-91.95% of initial concentration in soils and 71.46-81.76% in non-inoculated soils, which showed that the dissipation of fluoranthene was enhanced by mushroom inoculating. The highest removal rates of fluoranthene in sandy loam, loamy clay, and sandy soils reached to 87.81, 86.39, and 91.95%, respectively, which demonstrated that P. eryngii was more suitable for the bioremediation of sandy soil contaminated with fluoranthene. In addition, the presence of Ni tended to decrease the dissipation of fluoranthene in inoculated soil. Higher ligninolytic enzymes activities were detected in inoculated soils, resulting in the enhanced dissipation of fluoranthene in inoculated soils. Furthermore, P. eryngii had the ability to uptake Ni (4.88-39.53 mg kg -1 ) in co-contamination soil. In conclusion, the inoculating of P. eryngii was effective in remediating of Ni-fluoranthene co-contaminated soils. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Decontamination of Fumonisin B1 in maize grain by Pleurotus eryngii and antioxidant enzymes

    Directory of Open Access Journals (Sweden)

    Miriam HAIDUKOWSKI

    2017-05-01

    Full Text Available Fumonisin B1 (FB1 is among the most common mycotoxins found in maize kernels and maize products worldwide. The microbiological process of detoxification and transformation of toxic organic pollutants is a promising method for foodstuffs decontamination. Some basidiomycetes, such as the Pleurotus eryngii species complex, include several important commercial edible varieties that can detoxify polycyclic organic compounds and a range of wastes and pollutants. We investigated the potential role of P. eryngii, one of the most consumed mushrooms, in the decontamination of FB1 in maize. In addition, selected antioxidant enzymes, (soluble peroxidase (POD, catalase (CAT and ascorbate peroxidase, primarily involved in control of cell hydrogen peroxide levels, and lignin degradation, were analyzed, to evaluate their contributions to the molecular mechanisms of FB1 by P. eryngii. FB1 decontamination by P. eryngii and involvement of CAT and POD enzymes in the control of toxic decontamination levels of H2O2 were demonstrated. A consistent reduction of FB1 was observed at different incubation times. The average decrease levels of FB1, with respect to the control cultures, ranged from 45 to 61% (RSD < 15%. This study is a possible eco-friendly approach to reducing this mycotoxin in the feed supply chains.

  9. Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii

    Directory of Open Access Journals (Sweden)

    Sharon Avni

    2017-07-01

    Full Text Available Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe of the fruit body contained higher glucan content then the caps (pileus. Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate.

  10. Bioremediation of aflatoxin B1-contaminated maize by king oyster mushroom (Pleurotus eryngii.

    Directory of Open Access Journals (Sweden)

    Maria Teresa Branà

    Full Text Available Aflatoxin B1 (AFB1 is the most harmful mycotoxin that occurs as natural contaminant of agricultural commodities, particularly maize. Practical solutions for detoxification of contaminated staples and reduction of agricultural wastes are scarce. We investigated the capability of the white-rot and edible fungus Plerotus eryngii (king oyster mushroom to degrade AFB1 both in vitro and in a laboratory-scale mushroom cultivation, using a substrate similar to that routinely used in mushroom farms. In malt extract broth, degradation of AFB1 (500 ng/mL by nine isolates of P. eryngii ranged from 81 to 99% after 10 days growth, and reached 100% for all isolates after 30 days. The growth of P. eryngii on solid medium (malt extract-agar, MEA was significantly reduced at concentrations of AFB1 500 ng/mL or higher. However, the addition of 5% wheat straw to the culture medium increased the tolerance of P. eryngii to AFB1 and no inhibition was observed at a AFB1 content of 500 ng/mL; degradation of AFB1 in MEA supplemented with 5% wheat straw and 2.5% (w/v maize flour was 71-94% after 30 days of growth. Further, AFB1 degradation by P. eryngii strain ITEM 13681 was tested in a laboratory-scale mushroom cultivation. The mushroom growth medium contained 25% (w/w of maize spiked with AFB1 to the final content of 128 μg/kg. Pleurotus eryngii degraded up to 86% of the AFB1 in 28 days, with no significant reduction of either biological efficiency or mushroom yield. Neither the biomass produced on the mushroom substrate nor the mature basidiocarps contained detectable levels of AFB1 or its metabolite aflatoxicol, thus ruling out the translocation of these toxins through the fungal thallus. These findings make a contribution towards the development of a novel technology for remediation of AFB1- contaminated corn through the exploitation of the degradative capability of P. eryngii and its bioconversion into high nutritional value material intended for feed production.

  11. Optimization of King Oyster Mushroom (Pleurotus eryngii Substrate Using Lignocellulosic Affordable Wastes

    Directory of Open Access Journals (Sweden)

    javad janpoor

    2018-03-01

    Full Text Available Introduction: King oyster mushroom (Pleurotus eryngii belongs to Basidiomycota division, Agaricomycetes class and Pleurotaceae family. This mushroom generally grows on wood wastes of Apiaceae family. The Pleurotus eryngii is found in pastures, meadows, gardens and seldom in grassy forest clearings and hilly areas. The Pleurotus of the Umbellifers occupy an area in the Northern hemisphere between the 30 and 50º N. These species are mainly found in the subtropical regions of the Mediterranean, Central Europe, Russia, Ukraine, Central Asia and Iran. The P. eryngii sensulato is the only taxon within the genus, which grows in association with plants. P. eryngii has distinguishable characteristics such as coherent texture, unique form, favorable taste and high durability. Mushroom cultivation represents the only current economically viable biotechnology process for the conversion of waste plant residues from forests and agriculture. The species of these genera show much diversity in their adaptation the varying agro-climatic condition which makes more cultivated species than other mushrooms. Special ability of Pleurotus family is growing in lingocellulosic plant or agricultural wastes without needing to prepared compost and casing soil. Pleurotus is an efficient lignin- degrading mushroom and can grow and yield well on different types of lignocellulolosic materials. Type of substrates for mushroom growing depends on available plant or agricultural wastes. In Europe, wheat straw is used for mushroom growing; whereas in Asian South-East countries sawdust is more popular. Different materials for cultivating of P. eryngii have been suggested in different regions of the world; but a few studies have been done on suitability of various lignocellulosic affordable wastes for P. eryngii production in Iran. Therefore, the current study aims to evaluate effects of various locally available agro wastes on the growth characteristics of King oyster mushroom (P

  12. Preliminary studies on productivity of white Pleurotus eryngii isolates in protected cultivation

    Directory of Open Access Journals (Sweden)

    Gian Luigi Rana

    2013-03-01

    Full Text Available Four isolates of Pleurotus eryngii species-complex, originating from different basidiomata growing in a mountainous area of the Basilicata region (southern Italy and characterized by white pileus cuticle (Wh A, Wh B, Wh C, and Wh D were compared, in artificial cultivation conditions, to other isolates of the same mushroom with beige (Be 3, Be 5 or brown cap (Br 1, Br 2 originating from the same area of the former or selected among the commercial ones (Com 142 and Com 164 in order to evaluate their productivity and morphological features. The experiments were carried out in a greenhouse belonging to the Faculty of Agriculture, University of Bari Aldo Moro, in autumn winter 2010-2011, using substrate bags well colonized by P. eryngii mycelium and kept at 4-6°C for 5 months. Wh A and Wh D and, less significantly, Wh C, Be 5 and Com 142, produced a fresh basidioma yield significantly higher than the five other tested isolates (Wh B, Be 3, Br 1, Br 2 and Com 164. Only Com 142 produced the basidiomata of medium and maximum size significantly heavier and with larger pileus diameter than other tested isolates. Com 142 also resulted significantly different, for the basidiomata number/substrate bag, from the white pileus cuticle isolates except for Wh B. All tested isolates concentrated almost all (90-95% of the sporophore yield in the first basidioma flush. No significant differences were found among all tested P. eryngii isolates in terms of yield earliness.

  13. Production of ligninolytic enzymes by solid-state fermentation using Pleurotus eryngii.

    Science.gov (United States)

    Akpinar, Merve; Urek, Raziye Ozturk

    2012-01-01

    Pleurotus eryngii (DC.) Gillet (MCC58) was investigated for its ability to produce various ligninolytic enzymes such as laccase (Lac), manganese peroxidase (MnP), aryl alcohol oxidase (AAO), and lignin peroxidase (LiP) by solid-state fermentation (SSF), which was carried out using a support substrate from the fruit juice industry. The chemical content of grape waste from this industry was studied. Also, the production patterns of these extracellular enzymes were researched during the growth of the organism for a period of 20 days and the protein, reducing sugar, and nitrogen levels were monitored during the stationary cultivation. The highest Lac activity was obtained as 2247.62 ± 75 U/L on day 10 in the presence of 750 µM Mn²⁺, while the highest MnP activity was attained as 2198.44 ± 65 U/L on day 15 in the presence of 500 µM Mn²⁺. Decolorization of methyl orange and reactive red 2 azo dyes was also achieved with ligninolytic enzymes, produced in SSF of P. eryngii.

  14. Cultivation of different strains of king oyster mushroom (Pleurotus eryngii) on saw dust and rice straw in Bangladesh.

    Science.gov (United States)

    Moonmoon, Mahbuba; Uddin, Md Nazim; Ahmed, Saleh; Shelly, Nasrat Jahan; Khan, Md Asaduzzaman

    2010-10-01

    Pleurotus eryngii is a popular mushroom due to its excellent consistency of cap and stem, culinary qualities and longer shelf life. In Bangladesh, where Pleurotus mushrooms are very popular, P. eryngii may take position among the consumers, but currently this mushroom is not cultivated in large scale there. In this study, 3 strains of P. eryngii such as Pe-1 (native to Bangladesh), Pe-2 (germplasm collected from China) and Pe-3 (germplasm collected from Japan) were cultivated on saw dust and rice straw and their growth and yield parameters were investigated. Pe-1 on saw dust showed the highest biological yield and efficiency (73.5%) than other strains. Also, the mycelium run rate and number of fruiting bodies were higher in Pe-1 than other two strains. The quality of mushroom strains was near about similar. On saw dust, the yield and efficiency were better than those cultivated on rice straw, however, on straw; the mushroom fruiting bodies were larger in size. This study shows the prospects of P. eryngii cultivation in Bangladesh and suggests further study in controlled environment for higher yield and production.

  15. Biodegradation of toxic chemicals by Pleurotus eryngii in submerged fermentation and solid-state fermentation.

    Science.gov (United States)

    Chang, Bea-Ven; Chang, Yi-Ming

    2016-04-01

    The toxic chemicals bisphenol A (BPA), bisphenol F (BPF), nonylphenol (NP), and tetrabromobisphenol A (TBBPA) are endocrine-disrupting chemicals that have consequently drawn much concern regarding their effect on the environment. The objectives of this study were to investigate the degradation of BPA, BPF, NP, and TBBPA by enzymes from Pleurotus eryngii in submerged fermentation (SmF) and solid-state fermentation (SSF), and also to assess the removal of toxic chemicals in spent mushroom compost (SMC). BPA and BPF were analyzed by high-performance liquid chromatography; NP and TBBPA were analyzed by gas chromatography. NP degradation was enhanced by adding CuSO4 (1 mM), MnSO4 (0.5 mM), gallic acid (1 mM), tartaric acid (20 mM), citric acid (20 mM), guaiacol (1 mM), or 2,2'-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid; 1 mM), with the last yielding a higher NP degradation rate than the other additives from SmF. The optimal conditions for enzyme activity from SSF were a sawdust/wheat bran ratio of 1:4 and a moisture content of 5 mL/g. The enzyme activities were higher with sawdust/wheat bran than with sawdust/rice bran. The optimal conditions for the extraction of enzyme from SMC required using sodium acetate buffer (pH 5.0, solid/solution ratio 1:5), and extraction over 3 hours. The removal rates of toxic chemicals by P. eryngii, in descending order of magnitude, were SSF > SmF > SMC. The removal rates were BPF > BPA > NP > TBBPA. Copyright © 2014. Published by Elsevier B.V.

  16. Effect of Pleurotus eryngii Mushroom β-Glucan on Quality Characteristics of Common Wheat Pasta.

    Science.gov (United States)

    Kim, SunHee; Lee, Jo-Won; Heo, Yena; Moon, BoKyung

    2016-04-01

    The objective of this study was to evaluate the effect of β-glucan-rich fractions (BGRFs) from Pleurotus eryngii mushroom powder on the quality, textural properties, and sensory evaluation of common wheat pasta. Pasta was prepared from semolina flour and common wheat flour by replacing common wheat flour at 2%, 4%, and 6% with BGRFs. Semolina flour showed significantly higher viscosities than common wheat flour samples. However, all viscosities, except the breakdown viscosity, were reduced with increasing percentages of BGRFs. Replacement of the common wheat flour with BGRFs resulted in a reddish brown colored pasta with a lower L* value and a higher a* value. The common wheat pastas containing up to 4% BGRFs were not significantly different from semolina pasta with regard to cooking loss. Addition of up to 2% BGRFs had no significant impact on swelling index and water absorption. The addition of BGRFs in common wheat flour had a positive effect on the quality of common wheat pasta and resulted in hardness values similar to those of semolina pasta. In a sensory evaluation, cooked pasta with 2% BGRFs had the highest overall acceptability score. In summary, the results showed that common wheat flour containing 4% BGRFs could be used to produce pasta with an improved quality and texture properties similar to semolina pasta. © 2016 Institute of Food Technologists®

  17. Effect of Pleurotus eryngii stalk residue on the oxidative status and meat quality of broiler chickens.

    Science.gov (United States)

    Lee, Tzu-Tai; Ciou, Jhih-Ying; Chiang, Ching-Jen; Chao, Yun-Peng; Yu, Bi

    2012-11-07

    Pleurotus eryngii stalk residue (PESR) is a byproduct of the edible portion of the fruiting body. The present study was conducted to evaluate the effects of PESR on the oxidative status and meat quality of broilers. Two hundred fifty 1-d-old male broilers (Arbor Acre) were evenly divided by gender and randomly allocated into control (corn-soybean meal diet) or 1.0, 5.0, 10.0, or 20.0 g/kg dried PESR groups. The results revealed that at 35 d, the dried PESR groups displayed a significantly increased water-holding capacity and decreased storage loss of breast and thigh fillets when compared to the control group. Regarding fillets color, the L* (lightness) values were lower and the a* (redness) and b* (yellowness) values were higher following dried PESR supplementation. In 5.0-20.0 g/kg PESR supplementation groups, the activities of antioxidative enzymes were significantly elevated in serum, liver, spleen, and fillet tissues when compared to control group. Additionally, malondialdehyde production was slightly decreased in the PESR supplementation groups. Lower crude fat contents were observed in fillet tissues of 5.0-20.0 g/kg PESR groups when compared with the control group. In conclusion, PESR may potentially be used as an antioxidant to decrease lipid peroxidation and improve meat quality in broilers.

  18. Preliminary study of platinum accumulation in the fruitbodies of a model fungal species: king oyster mushroom (Pleurotus eryngii)

    International Nuclear Information System (INIS)

    Urban, P.L.; Bazala, M.A.; Bystrzejewska-Piotrowska, G.; Pianka, D.; Steborowski, R.; Asztemborska, M.; Kowalska, J.; Manjon, J.L.; Kuthan, R.T.

    2005-01-01

    A model species of saprophytic fungus, king oyster mushroom (Pleurotus eryngii), was cultivated on barley substrate supplied with [Pt(NH 3 ) 4 ](NO 3 ) 2 , under well defined conditions. The samples of the collected fruiting bodies were digested and analyzed for total platinum content by means of ICP-MS. The results proved that platinum is not accumulated in the fruitbodies of Pleurotus eryngii for a wide range of Pt concentrations in the culture substrate (100-1000 ppb Pt in 50 ml of water solution added to ca. 450 g of hydrated barley seeds per container). Observable levels of Pt were only found in the fruitbodies obtained from the medium contaminated with 10000 ppb (10 ppm) platinum solution. This demonstrates significant difference in the effectiveness of platinum extraction in fungi and plants, which are capable to accumulate platinum even when supplied at lower concentration (<500 ppb). It also shows different physiological pathways of platinum and other elements which are easily accumulated in the fruitbodies of the same species. (author)

  19. Effects of Eryngii mushroom (Pleurotus eryngii) and Lactobacillus plantarum on growth performance, immunity and disease resistance of Pangasius catfish (Pangasius bocourti, Sauvage 1880).

    Science.gov (United States)

    Van Doan, Hien; Doolgindachbaporn, Sompong; Suksri, Amnuaysilpa

    2016-10-01

    This study was conducted to evaluate the effects of Eryngii mushroom, Pleurotus eryngii (PE), and Lactobacillus plantarum single or combined on growth, innate immune response and disease resistance of the Pangasius catfish, Pangasius bocourti. Two hundred forty fish were divided into four treatments, i.e., 0 g kg(-1) PE (Control, Diet 1), 3 g kg(-1) PE (Diet 2), 10(8) cfu g(-1) L. plantarum (Diet 3) and 3 g kg(-1) PE + 10(8) cfu g(-1) L. plantarum (Diet 4). Fish were culture in glass tanks with water volume approximately of 150 l, and each treatment had four replications with 15 fish per replication. Following 30, 60 and 90 days of the feeding trial, specific growth rate (SGR), feed conversion ratio (FCR), serum lysozyme, phagocytosis and respiratory burst activities were measured. SGR and FCR were significantly improved in fish fed supplemented diets after 90 days of the feeding trial. Serum lysozyme, phagocytosis and respiratory burst activity of fish were significantly stimulated by both PE and L. plantarum diets; however, the highest innate immune response was observed in fish fed synbiotic diet. At the end of the experiment, five fish were randomly selected for a challenge test against Aeromonas hydrophila. The post-challenge survival rate of the fish fed supplemented diets was significantly greater than the control treatment, and the highest post-challenge survival rate was observed in synbiotic diet. The results revealed that dietary supplementation of PE and L. plantarum stimulated growth, immunity and disease resistance of the P. bocourti.

  20. Identification and functional analysis of pheromone and receptor genes in the B3 mating locus of Pleurotus eryngii.

    Science.gov (United States)

    Kim, Kyung-Hee; Kang, Young Min; Im, Chak Han; Ali, Asjad; Kim, Sun Young; Je, Hee-Jeong; Kim, Min-Keun; Rho, Hyun Su; Lee, Hyun Sook; Kong, Won-Sik; Ryu, Jae-San

    2014-01-01

    Pleurotus eryngii has recently become a major cultivated mushroom; it uses tetrapolar heterothallism as a part of its reproductive process. Sexual development progresses only when the A and B mating types are compatible. Such mating incompatibility occasionally limits the efficiency of breeding programs in which crossing within loci-shared strains or backcrossing strategies are employed. Therefore, understanding the mating system in edible mushroom fungi will help provide a short cut in the development of new strains. We isolated and identified pheromone and receptor genes in the B3 locus of P. eryngii and performed a functional analysis of the genes in the mating process by transformation. A genomic DNA library was constructed to map the entire mating-type locus. The B3 locus was found to contain four pheromone precursor genes and four receptor genes. Remarkably, receptor PESTE3.3.1 has just 34 amino acid residues in its C-terminal cytoplasmic region; therefore, it seems likely to be a receptor-like gene. Real-time quantitative RT-PCR (real-time qRT-PCR) revealed that most pheromone and receptor genes showed significantly higher expression in monokaryotic cells than dikaryotic cells. The pheromone genes PEphb3.1 and PEphb3.3 and the receptor gene PESTE3.3.1 were transformed into P5 (A3B4). The transformants were mated with a tester strain (A4B4), and the progeny showed clamp connections and a normal fruiting body, which indicates the proposed role of these genes in mating and fruiting processes. This result also confirms that PESTE3.3.1 is a receptor gene. In this study, we identified pheromone and receptor genes in the B3 locus of P. eryngii and found that some of those genes appear to play a role in the mating and fruiting processes. These results might help elucidate the mechanism of fruiting differentiation and improve breeding efficiency.

  1. Glucans from fruit bodies of cultivated mushrooms Pleurotus ostreatus and Pleurotus eryngii: Structure and potential prebiotic activity

    Czech Academy of Sciences Publication Activity Database

    Synytsya, Andriy.; Míčková, K.; Synytsya, A.; Jablonský, I.; Spěváček, Jiří; Erban, V.; Kováříková, E.; Čopíková, J.

    2009-01-01

    Roč. 76, č. 4 (2009), s. 548-556 ISSN 0144-8617 R&D Projects: GA ČR GA525/05/0273 Institutional research plan: CEZ:AV0Z40500505 Keywords : glucans * oyster mushroom Pleurotus * isolation Subject RIV: CD - Macromolecular Chemistry Impact factor: 3.167, year: 2009

  2. Six new ergostane-type steroids from king trumpet mushroom (Pleurotus eryngii) and their inhibitory effects on nitric oxide production.

    Science.gov (United States)

    Kikuchi, Takashi; Maekawa, Yukina; Tomio, Arisa; Masumoto, Yuki; Yamamoto, Taishi; In, Yasuko; Yamada, Takeshi; Tanaka, Reiko

    2016-11-01

    Six new ergostane-type steroids; (22E)-3β,5α,6α,11-tetrahydroxy-9(11)-seco-ergosta-7,22-dien-9-one (1), (22E)-8,14-epoxyergosta-6,22-diene-3β,5α,9α-triol (2), (22E)-4α,5α-epoxyergosta-7,22-diene-3β,6β-diol (3), (22E)-3β,4β,5α-trihydroxyergosta-7,22-dien-6-one (4), (22E)-ergosta-7,22-diene-3β,5β,6α-triol (5), and (22E)-6β-methoxyergosta-7,22-diene-3β,5α-diol 3-O-β-d-glucopyranoside (6) were isolated from the fruiting bodies of king trumpet mushroom (Pleurotus eryngii), along with fourteen known compounds (7-20). All isolated compounds were evaluated for their inhibitory effects on macrophage activation using a nitric oxide production inhibition assay. Copyright © 2016. Published by Elsevier Inc.

  3. Insight into the impact of two structural calcium ions on the properties of Pleurotus eryngii versatile ligninolytic peroxidase.

    Science.gov (United States)

    Gao, Yu; Zheng, Lanyan; Li, Jian-Jun; Du, Yuguang

    2016-12-15

    Two structural Ca 2+ (proximal and distal) is known to be important for ligninolytic peroxidases. However, few studies toward impact of residues involved in two Ca 2+ on properties of ligninolytic peroxidases have been done, especially the proximal one. In this study, mutants of nine residues involved in liganding two Ca 2+ of Pleurotus eryngii versatile peroxidase (VP) were investigated. Most mutants almost completely lost activities, except the mutants of proximal Ca 2+ - S170A and V192T. In comparison with WT (wild type), optimal pH values of S170A, S170D, and V192T shifted from pH 3.0 to pH 3.5. The order of thermal and pH stabilities of WT, V192T, S170A, and S170D is similar to that of their specific activities: WT > V192T > S170A > S170D. The CD (circular dichroism) results of WT and several mutants indicated that mutations had some effects on secondary structures. For the first time, it was observed that the thermostability of ligninolytic peroxidases is related with proximal Ca 2+ too, and the mutant containing distal Ca 2+ only was obtained. Our results clearly demonstrated that enzymatic activities, pH and thermal stabilities, Ca 2+ content, and secondary structures of VP have close relationship with the residues involved in two structural Ca 2+ . Copyright © 2016 Elsevier Inc. All rights reserved.

  4. A study of mechanisms responsible for incorporation of cesium and radiocesium into fruitbodies of king oyster mushroom (Pleurotus eryngii)

    Energy Technology Data Exchange (ETDEWEB)

    Bystrzejewska-Piotrowska, Grazyna [Isotope Laboratory, Faculty of Biology, Warsaw University, 02-096 Warsaw, Miecznikowa 1 (Poland)], E-mail: byst@biol.uw.edu.pl; Bazala, Michal A. [Isotope Laboratory, Faculty of Biology, Warsaw University, 02-096 Warsaw, Miecznikowa 1 (Poland)

    2008-07-15

    Ex vitro cultures of Pleurotus eryngii were carried out under controlled conditions using sterile medium composed of barley seeds. The influence of alkali and alkaline earth element salts (CsCl, KCl, NaCl, RbCl, and CaCl{sub 2}) and tetraethylammonium chloride on incorporation of cesium, potassium, sodium, rubidium and calcium, and their distribution within fruitbodies, was examined. The results show that incorporation of cesium into fruitbodies was not suppressed by Na{sup +} and Rb{sup +} or tetraethylammonium chloride. However, it was inhibited by Ca{sup 2+} and stimulated by high concentrations of K{sup +}. The inhibition of cesium incorporation by Ca{sup 2+}, lack of influence of tetraethylammonium chloride and stimulation by high K{sup +} concentrations suggest that there may exist two pathways of passive transport of cesium in mycelium: (i) uptake mediated by a non-specific potassium channel localised in plasmalemma (similar to voltage-insensitive cation channel, VICC) followed by diffusive transport inside hyphae and (ii) extracellular transport from the medium through inter-hyphal cavities into fruitbodies. The results highlight distinctiveness of mechanisms responsible for the uptake and incorporation of cesium in mushrooms and plants.

  5. Preparation of culinary-medicinal king oyster mushroom Pleurotus eryngii-fermented products with high ergothioneine content and their taste quality.

    Science.gov (United States)

    Chen, Shih-Yu; Ho, Kung-Jui; Liang, Chih-Hung; Tsai, Ching-Hsuan; Huang, Ling-Yi; Mau, Jeng-Leun

    2012-01-01

    Pleurotus eryngii (DC. : Fr.) Ouel. was used in solid-state fermentation to develop novel mushroom products with a high amount of ergothioneine. The correlation coefficients between ergothioneine content and biomass were 0.8878 and 0.9206 for fermented adlay and buckwheat, respectively. Using optimal conditions, Pleurotus-fermented adlay and buckwheat (PFA and PFB) with the ergothioneine contents of 795.5 and 786.1 mg/ kg, respectively, were prepared. However, mycelia contained the highest ergothioneine content of 1514.6 mg/kg. As a result of SSF by P. eryngii, PFA and PFB contained more taste components than adlay and buckwheat, as evidenced by higher contents of total sugars and polyols, total free amino acids and monosodium glutamate-like components, and total and flavor 5'-nucleotides. In addition, PFB and buckwheat showed comparable equivalent umami concentration (EUC) values, whereas PFA showed a higher EUC value than adlay. Overall, Pleurotus-fermented products with a high amount of ergothioneine will be a novel functional food.

  6. Characterization of the rcsA Gene from Pantoea sp. Strain PPE7 and Its Influence on Extracellular Polysaccharide Production and Virulence on Pleurotus eryngii

    Directory of Open Access Journals (Sweden)

    Min Keun Kim

    2017-06-01

    Full Text Available RcsA is a positive activator of extracellular polysaccharide (EPS synthesis in the Enterobacteriaceae. The rcsA gene of the soft rot pathogen Pantoea sp. strain PPE7 in Pleurotus eryngii was cloned by PCR amplification, and its role in EPS synthesis and virulence was investigated. The RcsA protein contains 3 highly conserved domains, and the C-terminal end of the open reading frame shared significant amino acid homology to the helix-turn-helix DNA binding motif of bacterial activator proteins. The inactivation of rcsA by insertional mutagenesis created mutants that had decreased production of EPS compared to the wild-type strain and abolished the virulence of Pantoea sp. strain PPE7 in P. eryngii. The Pantoea sp. strain PPE7 rcsA gene was shown to strongly affect the formation of the disease symptoms of a mushroom pathogen and to act as the virulence factor to cause soft rot disease in P. eryngii.

  7. Genetic diversity and population structure of Iranian wild Pleurotus eryngii species-complex strains revealed by URP-PCR markers

    NARCIS (Netherlands)

    Behnamian, Mahdi; Mohammadi, Seyed A.; Sonnenberg, A.S.M.; Goltapeh, Ebrahim M.; Hendrickx, P.M.

    2010-01-01

    In the present study, a set of 68 P. eryngii wild strains collected from nine locations in northwest and west of Iran along with six commercial strains were studied using universal rice primers (URP). The wild strains were isolated from Ferula ovina, F. haussknechtii, Cachrys ferulacea, Kellusia

  8. Production of versatile peroxidase from Pleurotus eryngii by solid-state fermentation using agricultural residues and evaluation of its catalytic properties.

    Science.gov (United States)

    Palma, C; Lloret, L; Sepúlveda, L; Contreras, E

    2016-01-01

    Interest in production of ligninolytic enzymes has been growing over recent years for their use in various applications such as recalcitrant pollutants bioremediation; specifically, versatile peroxidase (VP) presents a great potential due to its catalytic versatility. The proper selection of the fermentation mode and the culture medium should be an imperative to ensure a successful production by an economic and available medium that favors the process viability. VP was produced by solid-state fermentation (SSF) of Pleurotus eryngii, using the agricultural residue banana peel as growth medium; an enzymatic activity of 10,800 U L(-1) (36 U g(-1) of substrate) was detected after 18 days, whereas only 1800 U L(-1) was reached by conventional submerged fermentation (SF) with glucose-based medium. The kinetic parameters were determined by evaluating the H2O2 and Mn(2+) concentration effects on the Mn(3+)-tartrate complex formation. The results indicated that although the H2O2 inhibitory effect was observed for the enzyme produced by both media, the reaction rates for VP obtained by SSF were less impacted. This outcome suggests the presence of substances released from banana peel during the fermentation, which might exhibit a protective effect resulting in an improved kinetic behavior of the enzyme.

  9. Submerged cultivation of mycelium with high ergothioneine content from the culinary-medicinal king oyster mushroom Pleurotus eryngii (higher Basidiomycetes) and its composition.

    Science.gov (United States)

    Liang, Chih-Hung; Huang, Ling-Yi; Ho, Kung-Jui; Lin, Shin-Yi; Mau, Jeng-Leun

    2013-01-01

    The culinary-medicinal king oyster mushroom, Pleurotus eryngii, was used to produce mycelia with high ergothioneine content using a one-factor-at-a-time method. The optimal culture conditions for mycelia harvested at day 14 were 25°C, 10% inoculation rate, 2% glucose, 0.5% yeast extract, and no adjustment to the initial pH value. With histidine or amino acid mix added, biomasses and the ergothioneine content of mycelia were higher than those of the control. The ergothioneine content of mycelia harvested at days 16-20 were higher than that of mycelia harvested at day 14. In addition, the ergothioneine content of mycelia from the fermentor (5.84-5.76 mg/g) was much higher than that of mycelia from the shaken flask (4.93-5.04 mg/g). Mycelia with high ergothioneine content showed a profile of proximate composition similar to that of regular mycelia but lost its characteristic umami taste. Overall, mycelia high in ergothioneine could be prepared by optimal culture conditions, the addition of precursors, prolonged harvest, and aeration in the fermentor.

  10. Avaliação de resíduos lignocelulósicos para a produção de Pleurotus eryngii, Lentinus sajor caju e Lentinula edodes

    OpenAIRE

    Claudia Paganelli Lacerda de Azevedo

    2000-01-01

    Pleurotus eryngii, Lentinus sajor caju e Lentinula edodes foram produzidos, em condições controladas, com resíduos lignocelulósicos em seis composições; (1) resíduo sólido de indústria de cerveja+ bagaço de cana de açúcar + sais minerais (2) resíduo sólido de indústria de cerveja + serragem de euca/yptus + sais minerais (3) resíduo sólido de indústria de cerveja + palha de arroz + sais minerais (4) resíduo sólido de indústria de cerveja + bagaço de cana de açúcar (5) resíduo sólido de indústr...

  11. Farklı Yetiştirme Ortamlarının Pleurotus eryngii Mantarının Gelişimi ve Verimi Üzerine Etkileri

    Directory of Open Access Journals (Sweden)

    Beyhan Kibar

    2016-05-01

    Full Text Available Bu çalışma farklı yetiştirme ortamlarının Pleurotus eryngii mantarının misel gelişim süresi, ilk hasat süresi, verim ve biyolojik etkinliği üzerine etkilerini belirlemek amacıyla yapılmıştır. Çalışmada buğday sapı (BS, mısır sapı (MS, kavak talaşı (KT ve çaşır bitki artığı (ÇBA ortamları tek başlarına ve bu ortamlara %20 oranında buğday kepeği (BK ve çeltik kepeği (ÇK ilave edilerek hazırlanan toplam 12 farklı yetiştirme ortamı kullanılmıştır. Buğday sapından (%100 buğday sapı hazırlanan yetiştirme ortamı kontrol olarak ele alınmıştır. Yetiştirme ortamların özelliklerinin belirlenmesi amacıyla sterilizasyon sonrasında değişik yetiştirme ortamlarından alınan örneklerde pH, nem, kül, C, N ve C:N oranı tespit edilmiştir. Farklı yetiştirme ortamlarında misel gelişim süresi, ilk hasat süresi, verim ve biyolojik etkinlik oranı belirlenmiştir. Misel gelişim süresi (gün, ilk hasat süresi (gün, verim (g/100 g ortam ve biyolojik etkinlik (% bakımından yetiştirme ortamları arasındaki farklılık istatistiki olarak çok önemli (P<0.01 bulunmuştur. Çalışmanın sonucunda en kısa misel gelişim süresi ve ilk hasat süresi MS ortamında belirlenirken, en uzun misel gelişim süresi ve ilk hasat süresi BS+PK ortamında gözlenmiştir. En yüksek verim ve biyolojik etkinlik MS ortamından (sırasıyla 24.4 g/100 g ortam ve %81.33 elde edilmiştir. Onu istatistiksel olarak MS ortamı ile aralarında fark bulunmayan ÇBA, MS+PK, BS+BK ve ÇBA+PK ortamları izlemiştir. Buna karşılık, en düşük verim ve biyolojik etkinlik değerleri ise sırasıyla BS+PK, KT ve BS ortamlarında bulunmuştur. Doğu Anadolu Bölgesi’nde bol bulunan ve kolayca temin edilebilen çaşır bitki artıklarının tek başına ya da buğday veya çeltik kepeği ile karıştırılarak P. eryngii yetiştiriciliğinde kullanılabileceği sonucuna varılmıştır.

  12. Recycling of Date-Palm Fiber to Produce Pleurotus Cornucopiae Var. Citrinopileatus Mushroom

    Directory of Open Access Journals (Sweden)

    Mustafa Nadhim Owaid

    2017-01-01

    Full Text Available In this study, some local available organic matters, which are including wheat straw (Triticum aestivum, sawdust, and fiber of date palm (Phoenix dactylifera L., were used for growing and cultivating of bright yellow oyster mushroom Pleurotus cornucopiae var. citrinopileatus. The possibility of using date palm fiber (in mixtures with other organic residues as a substrate for the cultivation and production of fruiting bodies of P. cornucopiae var. citrinopileatus was investigated. This mushroom is capable of biorecycling and utilization of some mixtures of lignocellulosic substrates successfully, especially the mixture S3 (50% wheat straw, 30% sawdust, and 20% date palm fiber. The lower mycelia completion time was 17 days, that shown in bags of the S3 substrate. Date-palm fiber substrate exhibited best growth intensity level (moderate significantly (p<0.05. The total yield and biological efficiency percent recorded approx. 90 g and 23% on the S3 substrate respectively, as a higher percent significantly (p<0.05, while sawdust substrate alone was an unsuitable medium for cultivation and production of this mushroom. Finally, the use of date-palm fibers in mixtures is usefulness in producing a fresh edible and medicinal mushroom.INTERNATIONAL JOURNAL OF ENVIRONMENTVolume-5, Issue-4, Sep-Nov 2016, page: 56-65

  13. Notes on a New Productive Strain of King Oyster Mushroom, Pleurotus eryngii (Higher Basidiomycetes), a Prized Italian Culinary-Medicinal Mushroom.

    Science.gov (United States)

    Venturella, Giuseppe; Palazzolo, Eristanna; Saiano, Filippo; Gargano, Maria Letizia

    2015-01-01

    In this paper, the authors provide data on a culinary-medicinal, host-specific variety of P. eryngii species-complex that is known in Italy as "cardoncello". A species description, the techniques of isolation of a new strain (C-142-c), and the preparation of the substratum are illustrated. Data on the productivity of substratum inoculated with C-142-c strain and the nutritional value of cultivated "cardoncello" mushrooms are also provided.

  14. Development of Novel Polymorphic EST-SSR Markers in Bailinggu (Pleurotus tuoliensis for Crossbreeding

    Directory of Open Access Journals (Sweden)

    Yueting Dai

    2017-11-01

    Full Text Available Identification of monokaryons and their mating types and discrimination of hybrid offspring are key steps for the crossbreeding of Pleurotus tuoliensis (Bailinggu. However, conventional crossbreeding methods are troublesome and time consuming. Using RNA-seq technology, we developed new expressed sequence tag-simple sequence repeat (EST-SSR markers for Bailinggu to easily and rapidly identify monokaryons and their mating types, genetic diversity and hybrid offspring. We identified 1110 potential EST-based SSR loci from a newly-sequenced Bailinggu transcriptome and then randomly selected 100 EST-SSRs for further validation. Results showed that 39, 43 and 34 novel EST-SSR markers successfully identified monokaryons from their parent dikaryons, differentiated two different mating types and discriminated F1 and F2 hybrid offspring, respectively. Furthermore, a total of 86 alleles were detected in 37 monokaryons using 18 highly informative EST-SSRs. The observed number of alleles per locus ranged from three to seven. Cluster analysis revealed that these monokaryons have a relatively high level of genetic diversity. Transfer rates of the EST-SSRs in the monokaryons of closely-related species Pleurotus eryngii var. ferulae and Pleurotus ostreatus were 72% and 64%, respectively. Therefore, our study provides new SSR markers and an efficient method to enhance the crossbreeding of Bailinggu and closely-related species.

  15. Development of Novel Polymorphic EST-SSR Markers in Bailinggu (Pleurotus tuoliensis) for Crossbreeding

    Science.gov (United States)

    Dai, Yueting; Su, Wenying; Song, Bing; Li, Yu; Fu, Yongping

    2017-01-01

    Identification of monokaryons and their mating types and discrimination of hybrid offspring are key steps for the crossbreeding of Pleurotus tuoliensis (Bailinggu). However, conventional crossbreeding methods are troublesome and time consuming. Using RNA-seq technology, we developed new expressed sequence tag-simple sequence repeat (EST-SSR) markers for Bailinggu to easily and rapidly identify monokaryons and their mating types, genetic diversity and hybrid offspring. We identified 1110 potential EST-based SSR loci from a newly-sequenced Bailinggu transcriptome and then randomly selected 100 EST-SSRs for further validation. Results showed that 39, 43 and 34 novel EST-SSR markers successfully identified monokaryons from their parent dikaryons, differentiated two different mating types and discriminated F1 and F2 hybrid offspring, respectively. Furthermore, a total of 86 alleles were detected in 37 monokaryons using 18 highly informative EST-SSRs. The observed number of alleles per locus ranged from three to seven. Cluster analysis revealed that these monokaryons have a relatively high level of genetic diversity. Transfer rates of the EST-SSRs in the monokaryons of closely-related species Pleurotus eryngii var. ferulae and Pleurotus ostreatus were 72% and 64%, respectively. Therefore, our study provides new SSR markers and an efficient method to enhance the crossbreeding of Bailinggu and closely-related species. PMID:29149037

  16. Assessment of Genetic Diversity among Pleurotus spp. Isolates from Jordan

    Directory of Open Access Journals (Sweden)

    Hanan Aref Hasan

    2018-04-01

    Full Text Available Pleurotus is considered an important genus that belongs to the family Pleurotaceae and includes the edible King Oyster mushroom (Pleurotus eryngii. In the present study, 19 Pleurotus isolates were collected from two locations in the north of Jordan (Tell ar-Rumman and Um-Qais. The morphological characteristics among collected isolates revealed that there was a morphological similarity among the collected isolates. Nucleotide sequence analysis of the internal transcribed spacer (ITS1–5.8S rDNA–ITS4 region and 28S nuclear large subunit (nLSU in the ribosomal DNA gene of the isolated stains showed that all of them share over 98% sequence similarity with P. eryngii. Genetic diversity among the collected strains was assessed using inter simple sequence repeat (ISSR analysis using 18 different primer pairs. Using this approach, 141 out of 196 bands obtained were considered polymorphic and the highest percentage of polymorphism was observed using primer UBC827 (92.3% with an overall Polymorphism Information Content (PIC value of 70.56%. Cluster analysis showed that the Jordanian Pleurotus isolates fall into two main clades with a coefficient of similarity values ranging from 0.59 to 0.74 with a clear clustering based on collection sites. The results of the present study reveal that molecular techniques of ISSR and rDNA sequencing can greatly aid in classification and identification of Pleurotus spp. in Jordan.

  17. Evaluation of cellulosic wastes for the cultivation of Pleurotus eryngii ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-05-16

    May 16, 2008 ... of plant residues, and they have been found to be nutritionally and ... In most countries, there is a well-established consumer accep- tance for cultivated ... temperature, dampness, CO2, cultivation methods and tecniques etc.

  18. Influence of alkali and alkaline earth elements on the uptake of radionuclides by Pleurototus eryngii fruit bodies

    Energy Technology Data Exchange (ETDEWEB)

    Guillen, J., E-mail: fguillen@unex.es [LARUEX, Dpt. Applied Physics, Faculty of Veterinary Science, University of Extremadura, Avda. Universidad, s/n, 10071 Caceres (Spain); Baeza, A.; Salas, A. [LARUEX, Dpt. Applied Physics, Faculty of Veterinary Science, University of Extremadura, Avda. Universidad, s/n, 10071 Caceres (Spain)

    2012-04-15

    In the literature, there are many data available on radionuclide contents and their transfer to different species of mushrooms. There are some variables, however, which affect the transfer but are very difficult to observe in collected wild mushrooms. An example is the effect of different concentrations of alkali and alkaline earth elements in the soil. Modification of these concentrations in the soil solution has traditionally been used as a countermeasure to deal with radioactively contaminated areas. In the present work, fruiting bodies of Pleurotus eryngii, a saprophytic mushroom, were grown under controlled laboratory conditions, varying the content of alkali (potassium and caesium) and alkaline earth (calcium and strontium) elements. The transfer of {sup 134}Cs, {sup 85}Sr, and {sup 60}Co (added to the cultures) and of natural {sup 210}Pb was analysed by increasing the content of each stable element considered. A significant, but nonlinear, enhancement of stable caesium and {sup 134}Cs was observed with increasing content of stable caesium in the substrate/mycelium. The transfer of {sup 85}Sr decreased with the addition of each stable cation, whereas the {sup 60}Co and {sup 210}Pb transfers were unaffected. - Highlights: Black-Right-Pointing-Pointer The addition of stable potassium did not affect the uptake of radiocaesium. Black-Right-Pointing-Pointer The addition of stable caesium increased the stable caesium and {sup 134}Cs content in the fruiting bodies of Pleurotus eryngii. Black-Right-Pointing-Pointer The addition of calcium reduced the content of calcium and {sup 85}Sr in the fruiting bodies. Black-Right-Pointing-Pointer These countermeasures did not work properly in the case of {sup 60}Co and {sup 210}Pb, no effect was observed.

  19. Influence of alkali and alkaline earth elements on the uptake of radionuclides by Pleurototus eryngii fruit bodies

    International Nuclear Information System (INIS)

    Guillén, J.; Baeza, A.; Salas, A.

    2012-01-01

    In the literature, there are many data available on radionuclide contents and their transfer to different species of mushrooms. There are some variables, however, which affect the transfer but are very difficult to observe in collected wild mushrooms. An example is the effect of different concentrations of alkali and alkaline earth elements in the soil. Modification of these concentrations in the soil solution has traditionally been used as a countermeasure to deal with radioactively contaminated areas. In the present work, fruiting bodies of Pleurotus eryngii, a saprophytic mushroom, were grown under controlled laboratory conditions, varying the content of alkali (potassium and cæsium) and alkaline earth (calcium and strontium) elements. The transfer of 134 Cs, 85 Sr, and 60 Co (added to the cultures) and of natural 210 Pb was analysed by increasing the content of each stable element considered. A significant, but nonlinear, enhancement of stable cæsium and 134 Cs was observed with increasing content of stable cæsium in the substrate/mycelium. The transfer of 85 Sr decreased with the addition of each stable cation, whereas the 60 Co and 210 Pb transfers were unaffected. - Highlights: ► The addition of stable potassium did not affect the uptake of radiocaesium. ► The addition of stable caesium increased the stable caesium and 134 Cs content in the fruiting bodies of Pleurotus eryngii. ► The addition of calcium reduced the content of calcium and 85 Sr in the fruiting bodies. ► These countermeasures did not work properly in the case of 60 Co and 210 Pb, no effect was observed.

  20. Pleurotus sajor caju

    African Journals Online (AJOL)

    Administrator

    The influence of fungus treatment on the biochemical composition and degradation patter of sawdust and cotton plant by-products (cotton burns and cotton gin trash) by Pleurotus sajor caju were evaluated. Lignin degradation increased as the incubation period progressed while the highest loss of hemicellulose, cellulose ...

  1. Taxonomic Identity, Geographic Distribution, and Commercial Exploitation of the Culinary-Medicinal Mushroom Pleurotus nebrodensis (Basidiomycetes).

    Science.gov (United States)

    Venturella, Giuseppe; Zervakis, Georgios I; Polemis, Elias; Gargano, Maria Letizia

    2016-01-01

    An updated overview of the outcome of studies conducted on the culinary-medicinal mushroom Pleurotus nebrodensis is presented by placing emphasis on the clarification of the taxonomic identity of P. nebrodensis and other related taxa possessing entirely white to cream basidiomes, which grow in association with different plants of the family Apiaceae. Cultivation techniques, quality of the product sold and sales price, as well as nutritional and medicinal aspects are discussed. Taking also into consideration the high economic importance of P. nebrodensis, it is essential to proceed with the verification of the commercial strains currently available in the international market under the name of "P. nebrodensis" since it is very probable that many (or most) of them do not represent the real P. nebrodensis. TO confirm this hypothesis, an in silico analysis was conducted on a large of number of ITS1-5.8S-ITS2 rRNA sequences deposited in the National Center for Biotechnology Information database under the name P. nebrodensis. Results demonstrated that all "P nebrodensis" material examined from China (plus several sequences of no reported origin) corresponded to P. eryngii subsp. tuoliensis, with only 2 exceptions, which were grouped within P. eryngii sensu stricto. The real P. nebrodensis biological material from Italy and Greece is certified and is available upon request by the authors at the University of Palermo and the Agricultural University of Athens.

  2. Antioxidant, antifungal and anticancer activities of se-enriched Pleurotus spp. mycelium extracts

    Directory of Open Access Journals (Sweden)

    Milovanović Ivan

    2014-01-01

    Full Text Available The goal of this study was the evaluation of antifungal, antioxidant and anticancer potentials of Pleurotus eryngii, P. ostreatus and P. pulmonarius mycelial extracts, and the influence of mycelium enrichment with selenium on these activities. Both Se-amended and non-amended extracts showed the same or similar minimal inhibitory concentration for 14 studied micromycetes, while a fungicidal effect was not noted, contrary to ketoconazole, which had inhibitory and fungicidal effects at very low concentrations. Se-non-amended extracts exhibited antioxidant activity, especially at higher concentrations. Selenium enrichment influenced activity, its effects decreasing in P. eryngii and P. pulmonarius, while in P. ostreatus no effect was noted. The DPPH• radical scavenging capacity of the extracts was in direct correlation with their phenol and flavonoid contents. Cytotoxic activity against both HeLa and LS174 cell lines was very low compared with cis-DDP. These features suggest that mycelium should be an object of intensive studies. [Projekat Ministarstva nauke Republike Srbije, br. 173032

  3. Influence of gaseous phase, light and substrate pretreatment on fruit-body formation, lignin degradation and in vitro digestibility of wheat straw fermented with Pleurotus spp

    Energy Technology Data Exchange (ETDEWEB)

    Kamra, D.N.; Zadrazil, F.

    1986-01-01

    Wheat straw was fermented in the solid state with Pleurotus sajor-caju and P. eryngii at 25 degrees C under different concentrations of oxygen and carbon dioxide. Lower than 20% oxygen in the gaseous phase adversely affected the loss of organic matter, the lignin degradation and the change in straw digestibility with both species of Pleurotus. Higher concentrations (10%-30%) of carbon dioxide, with 20% oxygen in the atmospshere, slightly decreased the loss of lignin and organic matter when compared with the losses under oxygen or air. In spite of better lignin degradation by P. sajor-caju, the process efficiency with P. eryngii was higher, because of lower loss of organic matter during the fermentation. Fruit-bodies were not formed by P. eryngii during the period of experiment in any of the treatments. In P. sajor-caju, fruit-bodies were only formed either in flasks closed with cotton plugs or supplied with a continuous flow of sterile air. Carbon dioxide inhibited the process of primordia initiation and fruit-body development. A short exposure (20 minutes per day) to light was essential for primordia and fruit-body formation. The substrate changes and process efficiency with respect to increase in digestibility were much higher in darkness than in light. Light leads to intensive fruit-body production and a different pattern of substrate degradation. The indigenous microflora of wheat straw inhibited fruit-body formation and caused a higher organic matter loss, accompanied by a decrease in digestibility of the fermented wheat straw. 33 references.

  4. Produção de três espécies de cogumelos Pleurotus e avaliação da qualidade em atmosfera modificada Production of three species of Pleurotus mushrooms and quality evaluation in modified atmosphere

    Directory of Open Access Journals (Sweden)

    Cristina Ramos

    2011-01-01

    Full Text Available A utilização de substratos vegetais à base de palha tem vindo a assumir uma importância crescente na cultura de cogumelos sapróbios, principalmente do género Pleurotus. Estes cogumelos são considerados muito interessantes do ponto de vista comercial, não só pelas suas características organolépticas e nutricionais, mas também pela sua fácil adaptação e manutenção, crescimento rápido e relativo baixo custo de cultura. No entanto, por se tratar de alimentos perecíveis, devido sobretudo à sua composição e elevada taxa respiratória, podem apresentar reduzido valor comercial, caso a conservação não seja efectuada nas melhores condições. No sentido de minimizar estas alterações, os cogumelos frescos devem ser submetidos a um processamento mínimo com utilização combinada de embalagem em atmosfera modificada, de forma a manter a qualidade e estabilidade no período de conservação. Neste trabalho foram efectuados ensaios de produção de três espécies do género Pleurotus, cultivadas em palha de trigo, com a finalidade de determinar a espécie mais produtiva e avaliar a qualidade dos mesmos durante a conservação quando processados e embalados em atmosfera modificada. Os resultados permitem concluir que a espécie mais produtiva foi a P. ostreatus, seguida da P. sajor-caju e P. eryngii, tendo sido a P. eryngii a que mostrou maior resistência à degradação no período de conservação estabelecido.The use of substrates straw has been increasing importance in mushroom saprophytic species grown, especially of Pleurotus genus. They are considered very interesting from the commercial point of view, not only for its nutritional and organoleptic characteristics, but also for its easy adaptation, rapid growth and relatively low culture cost. Mushrooms have a short shelf life when compared to most vegetables at ambient temperatures mainly due to its composition and high respiration rate. After yield and to reduce losses and

  5. Two oxidation sites for low redox potential substrates: a directed mutagenesis, kinetic, and crystallographic study on Pleurotus eryngii versatile peroxidase.

    Science.gov (United States)

    Morales, María; Mate, María J; Romero, Antonio; Martínez, María Jesús; Martínez, Ángel T; Ruiz-Dueñas, Francisco J

    2012-11-30

    Versatile peroxidase shares with manganese peroxidase and lignin peroxidase the ability to oxidize Mn(2+) and high redox potential aromatic compounds, respectively. Moreover, it is also able to oxidize phenols (and low redox potential dyes) at two catalytic sites, as shown by biphasic kinetics. A high efficiency site (with 2,6-dimethoxyphenol and p-hydroquinone catalytic efficiencies of ∼70 and ∼700 s(-1) mM(-1), respectively) was localized at the same exposed Trp-164 responsible for high redox potential substrate oxidation (as shown by activity loss in the W164S variant). The second site, characterized by low catalytic efficiency (∼3 and ∼50 s(-1) mM(-1) for 2,6-dimethoxyphenol and p-hydroquinone, respectively) was localized at the main heme access channel. Steady-state and transient-state kinetics for oxidation of phenols and dyes at the latter site were improved when side chains of residues forming the heme channel edge were removed in single and multiple variants. Among them, the E140G/K176G, E140G/P141G/K176G, and E140G/W164S/K176G variants attained catalytic efficiencies for oxidation of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) at the heme channel similar to those of the exposed tryptophan site. The heme channel enlargement shown by x-ray diffraction of the E140G, P141G, K176G, and E140G/K176G variants would allow a better substrate accommodation near the heme, as revealed by the up to 26-fold lower K(m) values (compared with native VP). The resulting interactions were shown by the x-ray structure of the E140G-guaiacol complex, which includes two H-bonds of the substrate with Arg-43 and Pro-139 in the distal heme pocket (at the end of the heme channel) and several hydrophobic interactions with other residues and the heme cofactor.

  6. DEHYDRATION OF EDIBLE MUSHROOMS (PLEUROTUS OSTREATUS)

    OpenAIRE

    Salas de la Torre, N.; Bazán, D.; Osorio, A.; Cornejo, O.; Carrero, E.

    2014-01-01

    The edible mushroom Pleurotus ostreatus have been subjected to thermal, chemical and thermal-chemical treatment. The results show that the chemical treatment produces a more effective enzymatic inactivation compared to the other two treatments. Also, the experimental study of fungi dehydration carried out at 55 ° C reveals that the critical moisture content is 10.4 kg water / kg dry solids, the equilibrium moisture is 0.22 kg water / kg of solid . Los hongos comestibles Pleurotus ostreatus...

  7. Interaction of uranium with Pleurotus sp

    International Nuclear Information System (INIS)

    Ohnuki, Toshihiko; Sakamoto, Fuminori; Kozaki, Naofumi; Ozaki, Takuro; Samadfam, Mohammad

    2002-01-01

    Uptake of uranium by higher fungi, such as mushroom is little elucidated. We have studied the interaction of uranium with Pleurotus sp. (a mushroom) in pure culture over a wide range of U concentration (50-3000 mg/L). The Pleurotus sp. was cultured in two different media. One was rice bran medium, and the other was agar (yeast extract, peptone and dextrose) medium. The uptake of uranium in Pleurotus sp. was examined by alpha ray autoradiography (A,A), X-ray fluorescence spectroscopy (XRF) and scanning microcopy (SEM) equipped with EDS. In the agar medium, the higher uranium concentration gave lower growth of mycelia, and no fruiting body was observed. In the rice bran medium, the fruiting body was grown at U concentrations up to 1000 mg/L. The AA and XRF analysis showed that uranium taken up in the fruiting body was below the detection limit. The SEM-EDS analysis indicated that U was distributed in the limited region and was not transported to the mycelia far from U containing medium. It is concluded that uranium affects the growth of Pleurotus sp., and little uranium is taken up by Pleurotus sp. during the growth of both mycelia and fruiting body. (author)

  8. Antinociceptive effect of Pleurotus ostreatus (Oyster Mushroom ...

    African Journals Online (AJOL)

    PROF HORSFALL

    pattern by comparing it with a standard drug and a control using the hot water based flick tail test. Thirty five ... groups two, three and four were treated with 100, 200 and 400 mg/kg of Pleurotus ostreatus aqueous ... Abnormalities in the nervous system may also cause ... During this period, they were covered with wire gauze,.

  9. Laccase Enzymes in Inocula Pleurotus spp

    Directory of Open Access Journals (Sweden)

    Nora García-Oduardo

    2017-01-01

    Full Text Available The cultivation of edible and medicinal mushrooms Pleurotus has been aimed at promoting alternative management for agricultural products. This basidiomicete has been the subject of numerous studies because of its fruiting body constitutes a food, being a producer of enzymes with industrial interest and for its ability of biotransformation of lignocellulosic substrates. Pleurotus inocula in the established technology for growing edible and medicinal mushrooms in the CEBI Research- Production Plant were performed using sorghum or wheat. However, it is possible to expand the possibilities with other substrates. In this paper, the results of laccase enzymes production in inocula prepared with sorghum, corn and coffee pulp with two strains Pleurotus ostreatus CCEBI 3021 and Pleurotus ostreatus CCEBI 3024 are presented. The period of preparation of seed reaches 15-21 days, the measurements of laccase activity were performed in periods of seven days. Extraction of crude enzyme was performed in aqueous phase, the determination of the laccase enzyme activity, using guaiacol as substrate. The results obtained in this work with studies in previous work using sorghum as inocula are compared. It is found that higher yields are obtained laccase in coffee pulp. This study contributes to the theoretical knowledge and to provide alternatives for securing the production process of the plant.

  10. Effect of oyster mushroom ( Pleurotus ostreatus ) mycelia on ...

    African Journals Online (AJOL)

    Effect of oyster mushroom ( Pleurotus ostreatus ) mycelia on petroleum ... of chains of hydrocarbon in a petroleum-hydrocarbon-contaminated substrate over time. ... Keywords: Mycoremediation, Mycelia, Contaminated Soil, Oyster Mushroom ...

  11. Comparison of mushroom yield for Pleurotus Sajor Caju and Pleurotus Florida in different number of flushes

    International Nuclear Information System (INIS)

    Rosnani Abdul Rashid; Mat Rasol Awang; Hassan Hamdani Hassan Mutaat; Meswan Maskom

    2006-01-01

    This paper aimed at comparing the mushroom yield of Pleurotus sajor caju and Pleurotus florida which was harvested in five flushes. The γ-irradiated empty fruit bunch (EFB) at 25kGy was used as cultivation substrate. About 1 to 2% liquid seed of P. sajor caju and P. florida was inoculated into cultivation substrate. After 30 days, the inoculated substrate was opened for fruiting. For both species, the maximum mushroom yield was obtained in first flush and the lowest yield from the fifth flush. This show the mushroom yield is affected by number of flush. From analysis, the mushroom yield of P. florida was much better compared to P. sajor caju for all flushes. (Author)

  12. Beta-Glucan Synthase Gene Expression in Pleurotus sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

  13. Molecular Identification and Phylogenetic Relationships of Pleurotus spp. Diversity in Malaysia by ITS Marker

    International Nuclear Information System (INIS)

    Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)

  14. dbVar

    Data.gov (United States)

    U.S. Department of Health & Human Services — dbVar is a database of genomic structural variation. It accepts data from all species and includes clinical data. It can accept diverse types of events, including...

  15. Degradation of Green Polyethylene by Pleurotus ostreatus.

    Directory of Open Access Journals (Sweden)

    José Maria Rodrigues da Luz

    Full Text Available We studied the biodegradation of green polyethylene (GP by Pleurotus ostreatus. The GP was developed from renewable raw materials to help to reduce the emissions of greenhouse gases. However, little information regarding the biodegradation of GP discarded in the environment is available. P. ostreatus is a lignocellulolytic fungus that has been used in bioremediation processes for agroindustrial residues, pollutants, and recalcitrant compounds. Recently, we showed the potential of this fungus to degrade oxo-biodegradable polyethylene. GP plastic bags were exposed to sunlight for up to 120 days to induce the initial photodegradation of the polymers. After this period, no cracks, pits, or new functional groups in the structure of GP were observed. Fragments of these bags were used as the substrate for the growth of P. ostreatus. After 30 d of incubation, physical and chemical alterations in the structure of GP were observed. We conclude that the exposure of GP to sunlight and its subsequent incubation in the presence of P. ostreatus can decrease the half-life of GP and facilitate the mineralization of these polymers.

  16. Degradation of Green Polyethylene by Pleurotus ostreatus.

    Science.gov (United States)

    da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Ribeiro, Karla Veloso Gonçalves; Mendes, Igor Rodrigues; Kasuya, Maria Catarina Megumi

    2015-01-01

    We studied the biodegradation of green polyethylene (GP) by Pleurotus ostreatus. The GP was developed from renewable raw materials to help to reduce the emissions of greenhouse gases. However, little information regarding the biodegradation of GP discarded in the environment is available. P. ostreatus is a lignocellulolytic fungus that has been used in bioremediation processes for agroindustrial residues, pollutants, and recalcitrant compounds. Recently, we showed the potential of this fungus to degrade oxo-biodegradable polyethylene. GP plastic bags were exposed to sunlight for up to 120 days to induce the initial photodegradation of the polymers. After this period, no cracks, pits, or new functional groups in the structure of GP were observed. Fragments of these bags were used as the substrate for the growth of P. ostreatus. After 30 d of incubation, physical and chemical alterations in the structure of GP were observed. We conclude that the exposure of GP to sunlight and its subsequent incubation in the presence of P. ostreatus can decrease the half-life of GP and facilitate the mineralization of these polymers.

  17. Cultivation Techniques and Medicinal Properties of Pleurotus spp.

    Directory of Open Access Journals (Sweden)

    Andrej Gregori

    2007-01-01

    Full Text Available The genus Pleurotus (oyster mushroom comprises some most popular edible mushrooms due to their favourable organoleptic and medicinal properties, vigorous growth and undemanding cultivation conditions. It can be cultivated on log and a wide variety of agroforestry (by-products, weeds and wastes for the production of food, feed, enzymes and medicinal compounds, or for waste degradation and detoxification. Many different techniques and substrates have been successfully utilized for mushroom cultivation and biomass production by means of solid-state and submerged liquid fermentation. However, in contrast to submerged liquid fermentation, solid-state fermentation is not often used in large scale due to severe engineering problems. Various Pleurotus species have been shown to possess a number of medicinal properties, such as antitumour, immunomodulatory, antigenotoxic, antioxidant, anti-inflammatory, hypocholesterolaemic, antihypertensive, antiplatelet-aggregating, antihyperglycaemic, antimicrobial and antiviral activities. These therapeutic activities are exhibited by extracts or isolated compounds from Pleurotus spp. fermentation broth, mycelia and fruiting bodies. In particular, polysaccharides appear to be potent antitumour and immuno-enhancing substances, besides possessing other beneficial activities. However, the biochemical mechanisms of these therapeutic activities still remain largely unknown. This review focuses on recent advances in the biotechnology of Pleurotus spp., with emphasis on the production of fruiting bodies, the production of mycelium and bioactive compounds by solid-state and submerged liquid fermentation. The medicinal properties of this mushroom are also outlined.

  18. Amylolytic studies of pleurotus tuber-regium | Monago | Global ...

    African Journals Online (AJOL)

    The alpha amylase of the sclerotium of Pleurotus tuber-regium was studied. The enzyme was purified from the fresh sclerotium through dialysis, ammonium sulphate fractionation and column chromatography of CM sephadex. The enzyme showed 70% of it's optimal activity between p.H 4.0 to 8.0. Acid and thermal stability ...

  19. nutrient composition of pleurotus tuberregium (fr) sing's sclerotia

    African Journals Online (AJOL)

    DJFLEX

    The amino acid and mineral profile of Pleurotus tuberregium sclerotia, was investigated. Every 100g ... sample was dried to a constant weight, defatted (by placing a ... (67%), millet, soy bean (74%), peanuts (65%), African ... sodium content to cashew nut (5-13.02mg/100g) [Nandi, .... sclerotia Flour and Protein Concentrate.

  20. Improving the feeding value of straws with Pleurotus ostreatus

    NARCIS (Netherlands)

    Khan, N.A.; Hussain, S.; Ahmad, N.; Alam, S.; Bezabhi, M.; Hendriks, W.H.; Yu, P.; Cone, J.W.

    2015-01-01

    The high content of lignin in cell walls is the major limiting factor in the digestion and utilisation of cereal crop residues by ruminants. The aim of this study was to evaluate the effectiveness of the white rot fungus, Pleurotus ostreatus (P. ostreatus), to degrade lignin and to enhance the rumen

  1. Effect of Pleurotus ostreatus fermentation on cocoa pod husk ...

    African Journals Online (AJOL)

    Cocoa pod husk (CPH) is a major agro-industrial residue in Ghana with a potential value as a low-cost unconventional feedstuff for livestock. However, its effective use is limited by poor nutrient composition, mainly due to its high lignocellulose or fibre and also low protein levels. White–rot fungi such as Pleurotus species ...

  2. Cultivation of mushroom ( Pleurotus ostreatus ) using corn cobs and ...

    African Journals Online (AJOL)

    An investigation was carried out on the cultivation of mushroom (Pleurotus ostreatus) using corn cobs and saw dust as the main substrates. Lignocellulosic wastes such as corn cobs and saw dust were packaged inside heat – resistant polythene bags and pasteurized before being seeded with 7.5% w/w millet spawn of ...

  3. Effect of mushroom ( Pleurotus tuber-regium ) inoculums on crude ...

    African Journals Online (AJOL)

    Pollution of soils by crude oil in Niger-Delta of Nigeria has brought untold hardship to the inhabitants of the region. This study was carried out in 2010/2011 and 2011/2012 to determine the effect of Pleurotus tuber-regium (mushroom) inoculums on crude oil polluted soil on stover and grain yields and as well as cob length ...

  4. Preliminary investigation into the use of Pleurotus tuber-regium ...

    African Journals Online (AJOL)

    The swelling capacity was three times that of maize starch BP Tablets prepared with P. tuber-regium powder disintegrated faster than those prepared with maize starch BP at concentrations below 10% w/w. At the disintegrant concentration of 10% w/w paracetamol tablets made from both Pleurotus powder and maize starch ...

  5. (Pleurotus pulmonarius) grown on cotton waste and cassava peel

    African Journals Online (AJOL)

    This work evaluated the yield of Pleurotus pulmonarius on different mixtures of cotton waste and cassava peel. P. pulmonarius demonstrated significantly higher colonization rate on cotton waste substrate (100 g cotton waste) 3 weeks after inoculation of spawn than any other substrate mixtures. Cotton waste had the ...

  6. Hvem var morderen?

    DEFF Research Database (Denmark)

    Andersen, Lene Vinther

    2014-01-01

    Folkemindesamleren og forfatteren Helene Strange (1874-1943) skrev flere gange om et giftmord på en præst på Nordfalster i 1755. Hun satte spørgsmålstegn ved højesteretsdommen og hævdede, at en uskyldig pige blev dømt, mens den virkelige morder slap fri. Det var folkets uskrevne dom, som i over...... hundrede år var blevet fortalt mundtligt videre på egnen, og hun forsøgte – med forskellige midler – at få bragt denne version af historien frem i offentligheden....

  7. Paulus var kristendommens Lenin

    DEFF Research Database (Denmark)

    Thyssen, Ole

    2017-01-01

    En af Luthers inspirationskilder var Paulus, hvis løsning på lokale problemer fik globale konsekvenser. Han trak en skarp grænse mellem det snavsede kød og den rene sjæl og mellem vantro og tro.......En af Luthers inspirationskilder var Paulus, hvis løsning på lokale problemer fik globale konsekvenser. Han trak en skarp grænse mellem det snavsede kød og den rene sjæl og mellem vantro og tro....

  8. DNA marking of some quantitative trait loci in the cultivated edible mushroom Pleurotus ostreatus (Fr.) Kumm

    NARCIS (Netherlands)

    Sivolapova, A.B.; Shnyreva, A.V.; Sonnenberg, A.S.M.; Baars, J.J.P.

    2012-01-01

    Fungi of the genus Pleurotus, in particular, species Pleurotus ostreatus (common oyster mushroom) are among most cultivated fungi in the world. Due to intense rates of development of studies in this field, efficient breeding programs are highly required in the search for new P. ostreatus strains.

  9. Crosses between monokaryons of Pleurotus sapidus or Pleurotus florida show an improved biotransformation of (+)-valencene to (+)-nootkatone.

    Science.gov (United States)

    Omarini, Alejandra B; Plagemann, Ina; Schimanski, Silke; Krings, Ulrich; Berger, Ralf G

    2014-11-01

    Several hundred monokaryotic and new dikaryotic strains derived thereof were established from (+)-valencene tolerant Pleurotus species. When grouped according to their growth rate on agar plates and compared to the parental of Pleurotus sapidus 69, the slowly growing monokaryons converted (+)-valencene more efficiently to the grapefruit flavour compound (+)-nootkatone. The fast growing monokaryons and the slow×slow and the fast×fast dikaryotic crosses showed similar or inferior yields. Some slow×fast dikaryons, however, exceeded the biotransformation capability of the parental dikaryon significantly. The activity of the responsible enzyme, lipoxygenase, showed a weak correlation with the yields of (+)-nootkatone indicating that the determination of enzyme activity using the primary substrate linoleic acid may be misleading in predicting the biotransformation efficiency. This exploratory study indicated that a classical genetics approach resulted in altered and partly improved terpene transformation capability (plus 60%) and lipoxygenase activity of the strains. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. VALOR NUTRICIONAL DE PLEUROTUS DJAMOR CULTIVADO EM PALHA DE BANANEIRA

    Directory of Open Access Journals (Sweden)

    Jamile Rosa RAMPINELLI

    2010-11-01

    Full Text Available

    Cogumelos do gênero Pleurotus representam um alimento de custo baixo, com teor elevado de proteínas, aminoácidos essenciais, proporção elevada de ácidos graxos insaturados, diversas vitaminas e minerais, além de teores baixos de gorduras, ácidos nucléicos, açúcares e calorias. Assim, o objetivo deste trabalho foi avaliar o valor nutricional de basidiomas de Pleurotus djamor de 1o e 2o fluxo produtivo, cultivados em palha de bananeira, em termos de teores de carboidratos, proteínas, fi bras, gorduras, cinzas, vitaminas, fósforo e potássio. Os teores de carboidratos totais, proteína bruta, fi bra bruta e cinzas diminuíram do 1o para o 2o fl uxo produtivo de 32,7 para 27,4g/100g, de 20,5 para 19,8g/100g, de 22,4 para 12,7g/100g e de 7,4 para 6,3g/100g, respectivamente. Os valores de gordura bruta e umidade não variaram, permanecendo em torno de 1,1 e 90g/100g, respectivamente. Os teores de vitamina B1 foram superiores aos de vitamina B2, independentemente do fluxo produtivo, e foi encontrada maior quantidade de potássio do que de fósforo. Pleurotus djamor, de 1o fl uxo produtivo, pode ser considerado fonte de fósforo e potássio, além de apresentar baixo teor de açúcar e não conter gordura.

  11. Cultivo de Lentinus sajor-caju (Fr.) Fr. [= Pleurotus sajor-caju (Fr.) Singer] e Pleurotus spp. em diferentes substratos

    OpenAIRE

    Albuquerque, Margeli Pereira de

    2010-01-01

    As espécies de Pleurotus, popularmente conhecidas por cogumelos ostra, são decompositoras primárias de madeira e outros resíduos vegetais biodegradáveis. Estes fungos apresentam propriedades nutricionais com elevados teores de proteínas aminoácidos essenciais, ácidos graxos insaturados, vitaminas e minerais, por isso estão tornando-se cada vez mais importantes como um recurso alimentar. A identificação de substratos que permitam o rápido desenvolvimento do micélio fúngico é uma...

  12. Electrical stimulation in white oyster mushroom (Pleurotus florida) production

    Science.gov (United States)

    Roshita, I.; Nurfazira, K. M. P.; Fern, C. Shi; Ain, M. S. Nur

    2017-09-01

    White oyster mushroom (Pleurotus florida) is an edible mushroom that gained popularity due to its nutritional values, low production cost and ease of cultivation. There are several research reported on the mushroom fruiting bodies which were actively developed when applying electrical shock treatment. This study was aimed to investigate the effects of different electrical voltages on the growth and yield of white oyster mushroom (Pleurotus florida). Five different electrical voltages had been applied during spawning period which were 6V, 9V, 12V, 15V and mushroom bags without any treatment served as control. Treatment at 6V showed the highest rate for mycelium growth while 15V took the shortest time for fruiting body formation. However, no significant different (P>0.05) among all the treatments was observed for the time taken for the mycelium to fill-up the bag and pinhead emergence. The total fresh weight and percentage of biological efficiency for treatment at 9V showed higher values compared to control. Treatment at 9V also showed the largest pileus diameter and the most firm in the pileus texture. Meanwhile, treatment at 6V showed the highest a* value (redness). In addition, different electrical voltage treatments applied did not show any significant effect on substrate utilization efficiency, colour L* and b* values. In conclusion, among all the electrical treatments applied, 9V could be considered as the best treatment to enhance the yield of white oyster mushroom.

  13. Diseases and pests noxious to Pleurotus spp. mushroom crops.

    Science.gov (United States)

    Bellettini, Marcelo B; Bellettini, Sebastião; Fiorda, Fernanda A; Pedro, Alessandra C; Bach, Fabiane; Fabela-Morón, Miriam F; Hoffmann-Ribani, Rosemary

    The Pleurotus genus is one of most extensively studied white-rot fungi due to its exceptional ligninolytic properties. It is an edible mushroom that possesses biological effects, as it contains important bioactive molecules. It is a rich source of nutrients, particularly proteins, minerals as well as vitamins B, C and D. In basidiomycete fungi, intensive cultivations of edible mushrooms can often be affected by some bacterial, mold and virus diseases that rather frequently cause dramatic production loss. These infections are facilitated by the particular conditions under which mushroom cultivation is commonly carried out such as warm temperatures, humidity, carbon dioxide (CO 2 ) levels and presence of pests. There is not much bibliographic information related to pests of mushrooms and their substrates. The updated review presents a practical checklist of diseases and pests of the Pleurotus genus, providing useful information that may help different users. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  14. Biodegradation of oxytetracycline by Pleurotus ostreatus mycelium: a mycoremediation technique

    International Nuclear Information System (INIS)

    Migliore, Luciana; Fiori, Maurizio; Spadoni, Anna; Galli, Emanuela

    2012-01-01

    Highlights: ► Oxytetracycline uptake and degradation by Pleurotus ostreatus mycelium were measured. ► The role of extracellular laccase in degradation was evaluated. ► The almost complete OTC removal was obtained. ► A possible degradation product was identified in mycelia (ADOTC). ► The system can be considered the first step of an useful mycoremediation technique. - Abstract: Oxytetracycline (OTC) is administered in high doses to livestocks and enters the environmental compartments as a consequence of animal waste disposal. As a first step in setting up a useful mycoremediation technique, an OTC lab degradation test was performed in liquid medium using the ligninolytic fungus Pleurotus ostreatus. OTC disappearance in culture medium was clearly evident as early as the third day of exposure onwards, with an almost complete removal after 14 d. The drug removal was mediated by fungal absorption in the mycelia, where the OTC molecule underwent a degradation step, as demonstrated by mass spectrometry analyses. A putative degradation product, ADOTC (2-acetyl-2-decarboxamido-oxytetracycline) is proposed. Experimental conditions excluded OTC abiotic degradation; the degradation by extracellular laccase was also experimentally discarded.

  15. Biodegradation of oxytetracycline by Pleurotus ostreatus mycelium: a mycoremediation technique

    Energy Technology Data Exchange (ETDEWEB)

    Migliore, Luciana [Dept. Biology, Tor Vergata University, Via della Ricerca Scientifica, 00133 Rome (Italy); Fiori, Maurizio [Dept. Veterinary Public Health and Food Safety, Istituto Superiore di Sanita, Viale Regina Elena 299, 00161 Rome (Italy); Spadoni, Anna [Dept. Biology, Tor Vergata University, Via della Ricerca Scientifica, 00133 Rome (Italy); Institute of Agro-Environment and Forest Biology, National Research Council, Research Area Rome 1, Via Salaria km 29.300, 00015 Monterotondo Rome (Italy); Galli, Emanuela [Institute of Agro-Environment and Forest Biology, National Research Council, Research Area Rome 1, Via Salaria km 29.300, 00015 Monterotondo Rome (Italy)

    2012-05-15

    Highlights: Black-Right-Pointing-Pointer Oxytetracycline uptake and degradation by Pleurotus ostreatus mycelium were measured. Black-Right-Pointing-Pointer The role of extracellular laccase in degradation was evaluated. Black-Right-Pointing-Pointer The almost complete OTC removal was obtained. Black-Right-Pointing-Pointer A possible degradation product was identified in mycelia (ADOTC). Black-Right-Pointing-Pointer The system can be considered the first step of an useful mycoremediation technique. - Abstract: Oxytetracycline (OTC) is administered in high doses to livestocks and enters the environmental compartments as a consequence of animal waste disposal. As a first step in setting up a useful mycoremediation technique, an OTC lab degradation test was performed in liquid medium using the ligninolytic fungus Pleurotus ostreatus. OTC disappearance in culture medium was clearly evident as early as the third day of exposure onwards, with an almost complete removal after 14 d. The drug removal was mediated by fungal absorption in the mycelia, where the OTC molecule underwent a degradation step, as demonstrated by mass spectrometry analyses. A putative degradation product, ADOTC (2-acetyl-2-decarboxamido-oxytetracycline) is proposed. Experimental conditions excluded OTC abiotic degradation; the degradation by extracellular laccase was also experimentally discarded.

  16. Selective adhesion of wastewater bacteria to Pleurotus ostreatus mycelium in a trickle-bed bioreactor

    Czech Academy of Sciences Publication Activity Database

    Svobodová, Kateřina; Petráčková, Denisa; Szabad, Hana; Novotný, Čeněk

    2016-01-01

    Roč. 3, č. 3 (2016), s. 395-407 ISSN 2372-0344 Institutional support: RVO:61388971 Keywords : Pleurotus ostreatus * activated sludge * fungal/bacterial co-cultur Subject RIV: EE - Microbiology, Virology

  17. Antioxidant and antibacterial activities of acetonitrile and hexane extracts of Lentinus tigrinus and Pleurotus djamour

    Science.gov (United States)

    This paper highlighted the antioxidant and antibacterial activities of Lentinus tigrinus and Pleurotus djamour. Extracts of mushroom fruiting bodies were obtained using hexane and acetonitrile solvents. Acetonitrile extracts of both mushrooms exhibited higher biological activities than hexane extrac...

  18. Da Danmark var en slavenation

    DEFF Research Database (Denmark)

    Peters, Rikke Louise Alberg; Brunbech, Peter Johan Yding; Poulsen, Jens Aage

    I mere end 250 år var Danmark en stor kolonimagt. Skt. Jan, Skt. Thomas og Skt. Croix, eller U.S. Virgin Islands, som de kaldes i dag, var danske kolonier, hvor der bl.a. blev dyrket sukkerrør og bomuld. Det hårde arbejde blev udført af slaver, som man fra slutningen af 1600-tallet begyndte at tr...

  19. Studies on the aroma of different species and strains of Pleurotus measured by GC/MS, sensory analysis and electronic nose

    OpenAIRE

    Renata Zawirska-Wojtasiak; Marek Siwulski; Sylwia Mildner-Szkudlarz; Erwin Wąsowicz

    2009-01-01

    The aroma of several strains of Pleurotus ostreatus, Pleurotus citrinopileatus and Pleurotus djamor was studied by GC/MS. Three main mushrooms aroma constituents: 3-octanol, 3-octanone and 1-octen-3-ol were taken into account for quantitative measurements. The highest amount of 1-octen-3-ol was recorded in P. ostreatus, while considerably lower amounts in P. citrinopileatus. Sensory profile analysis as well as the electronic nose also varied between the three species of Pleurotus. Chiral gas ...

  20. var. puiggarianum (Batrachospermales, Rhodophyta

    Directory of Open Access Journals (Sweden)

    María Cecilia Gauna

    2005-01-01

    Full Text Available Se coleccionó Batrachospermum atrum var. puiggarianum por primera vez en la provincia de Buenos Aires. La identificación de las muestras se basó en el análisis de la morfología microscópica y en el número cromosómico de cada una de las generaciones de su ciclo de vida bajo cultivo. Los talos se estudiaron con microscopio óptico, y la cariología, por medio de la técnica de carmín acético. El ciclo de vida presentó tres generaciones: una gametofítica haploide, una carposporófitica diploide que originó la última fase Chantransia diploide. Los talos gametófitos estuvieron formados por verticilos separados por zonas internodales, cada uno de ellos constituidos por ramas primarias densamente comprimidas. Entre éstas se observaron ramas portadoras de espermatangios y de carpogonios. Las zonas internodales estuvieron constituidas por células corticales y axiales. Los carposporófitos ovoideos estuvieron formados por filamentos gonimoblásticos portadores de carposporangios terminales. El estado Chantransia se caracterizó por presentar filamentos cortos con pocas células. El material estudiado presentó un número haploide n = 4 y diploide 2n = 8.

  1. Cultivation of Pleurotus ostreatus and other edible mushrooms.

    Science.gov (United States)

    Sánchez, Carmen

    2010-02-01

    Pleurotus ostreatus is the second most cultivated edible mushroom worldwide after Agaricus bisporus. It has economic and ecological values and medicinal properties. Mushroom culture has moved toward diversification with the production of other mushrooms. Edible mushrooms are able to colonize and degrade a large variety of lignocellulosic substrates and other wastes which are produced primarily through the activities of the agricultural, forest, and food-processing industries. Particularly, P. ostreatus requires a shorter growth time in comparison to other edible mushrooms. The substrate used for their cultivation does not require sterilization, only pasteurization, which is less expensive. Growing oyster mushrooms convert a high percentage of the substrate to fruiting bodies, increasing profitability. P. ostreatus demands few environmental controls, and their fruiting bodies are not often attacked by diseases and pests, and they can be cultivated in a simple and cheap way. All this makes P. ostreatus cultivation an excellent alternative for production of mushrooms when compared to other mushrooms.

  2. Food, medicinal and environmental values of mushrooms Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    O. M. Alekseenko

    2010-07-01

    Full Text Available We present the literature review describing food, medicinal and ecological properties of the fungus Pleurotus ostreatus (oyster mushroom. It is shown that the mushroom is adequate foodstuff for human beings. It provides with proteins, carbohydrates, fats, vitamins and mineral salts. Protein of the oyster mushrooms’ mycothallus contains 18 amino acids, eight of which were essential (isoleucine, leucine, lysine, methionine, phenylalanine, tryptophan, threonine, and valine. Therapeutic value of the mushroom is characterised by a content of water-soluble (thiamine B1, riboflavin B2, niacin, B5, PP, pyridoxine B6, biotin B7, ascorbic and pantothenic acid and liposoluble (calciferol, ergosterol, tocopherol vitamins. The considerable gains from the farm wastes use for the mushrooms raising with subsequent application of the substrate in plant cultivation and animal husbandry are stated.

  3. Economic benefit analysis of cultivating Pleurotus ostreatus with rape straw

    Science.gov (United States)

    Guan, Qinlan; Gong, Mingfu; Tang, Mei

    2018-04-01

    The cultivation of Pleurotus ostreatus with rape straw not only can save the cultivation cost of P. ostreatus, but also can reuse the resources and protect the environment. By adding different proportion of rape straw to the cultivation material of P. ostreatus, the reasonable amount of rape straw was selected and the economic benefit of P. ostreatus cultivated with the optimum amount of rape straw was analyzed. The results showed that adding 10% to 40% rape straw to the cultivation material of P. ostreatus did not affect the yield and biological conversion rate of P. ostreatus, and the ratio of production and investment of the amount of rape straw in the range of 10% to 50% was higher than of cottonseed husk alone as the main material of the formula.

  4. Measurement of the CP-violation parameter Re(var-epsilon '/var-epsilon)

    International Nuclear Information System (INIS)

    Gibbons, L.K.; Barker, A.R.; Briere, R.A.; Makoff, G.; Papadimitriou, V.; Patterson, J.R.; Schwingenheuer, B.; Somalwar, S.V.; Wah, Y.W.; Winstein, B.; Winston, R.; Woods, M.; Yamamoto, H.; Swallow, E.C.; Bock, G.J.; Coleman, R.; Enagonio, J.; Hsiung, Y.B.; Ramberg, E.; Stanfield, K.; Tschirhart, R.; Yamanaka, T.; Gollin, G.D.; Karlsson, M.; Okamitsu, J.K.; Debu, P.; Peyaud, B.; Turlay, R.; Vallage, B.

    1993-01-01

    A measurement of the CP-violation parameter Re(var-epsilon '/var-epsilon) has been made using the full E731 data set. We find Re(var-epsilon '/var-epsilon)=(7.4±5.2±2.9)x10 -4 where the first error is statistical and the second systematic

  5. Identification and characterization of Trichoderma species aggressive to Pleurotus in Italy

    Institute of Scientific and Technical Information of China (English)

    Woo S L; Di Benedetto P; Senatore M; Abadi K; Gigante S; Soriente I; Ferraioli S; Scala F; Lorito M

    2004-01-01

    @@ In the late 1980's the development of a severe epidemic of green mold caused by Trichoderma spp.was noted in the commercial production of Agaricus bisporus (champignon) in the United Kingdom,North America, Spain and Holland, which caused extensive economic losses. The parasitic fungi isolated from the edible mushroom belonged to four biotypes, Thl, Th2, Th3 and Th4 of T.harzianum. However, among these biotypes, only Th2 (since classified as T. aggressivum f.europaeum) and Th4 (T. aggressivum f. aggressivum) were identified as the fungi causing problems in Agaricus production. In general, mushroom compost hosts both aggressive and innocuous isolates of Trichoderma, which are not morphologically distinguishable. About four years ago, a problem with green mold became apparent in the production of Pleurotus ostreatus in Northern Italy,which eventually developed to a crisis situation in the South two years later and threatened to seriously compromise the Pleurotus market. This study was initiated to: isolate and identify the aggressive fungi, then morphologically, physiologically and genetically characterize the isolates, determine the source and phases of infection, and study methods of control. Samples were obtained from different phases of compost preparation at the locality of a major producer and supplier of compost to the mushroom industry in Southern Italy, and microbial counts were conducted. Although the presence of Trichoderma was detected in the initial stages of composting, this value was reduced to zero from the phase of pasteurization to seeding with Pleurotus. Trichoderma infestations were noted in the packaged Pleurotus bales at various times during the incubation phase (7-15 days after seeding) and after shipping to the mushroom greenhouses, where the pathogen infestations greatly reduced the quality and quantity of the mushroom yield, as well as the number of potential harvest cycles.Preliminary results from the morphological and genetic

  6. Evaluation of biomass of some invasive weed species as substrate for oyster mushroom (Pleurotus spp.) cultivation.

    Science.gov (United States)

    Mintesnot, Birara; Ayalew, Amare; Kebede, Ameha

    2014-01-15

    This study assessed the bioconversion of Agriculture wastes like invasive weeds species (Lantana camara, Prosopis juliflora, Parthenium hysterophorus) as a substrate for oyster mushroom (Pleurotus species) cultivation together with wheat straw as a control. The experiment was laid out in factorial combination of substrates and three edible oyster mushroom species in a Completely Randomized Design (CRD) with three replications. Pleurotus ostreatus gave significantly (p mushroom cultivation could contribute to alleviating ecological impact of invasive weed species while offering practical option to mitigating hunger and malnutrition in areas where the invasive weeds became dominant.

  7. Degradation of oxo-biodegradable plastic by Pleurotus ostreatus.

    Science.gov (United States)

    da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Nunes, Mateus Dias; da Silva, Marliane de Cássia Soares; Kasuya, Maria Catarina Megumi

    2013-01-01

    Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV) or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W) plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate.

  8. Degradation of oxo-biodegradable plastic by Pleurotus ostreatus.

    Directory of Open Access Journals (Sweden)

    José Maria Rodrigues da Luz

    Full Text Available Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate.

  9. Decolourisation of mushroom farm wastewater by Pleurotus ostreatus.

    Science.gov (United States)

    Rodríguez Pérez, Suyén; García Oduardo, Nora; Bermúdez Savón, Rosa C; Fernández Boizán, Maikel; Augur, Christopher

    2008-07-01

    Mushroom production on coffee pulp as substrate generates an intense black residual liquid, which requires suitable treatment. In the present study, Pleurotus ostreatus growth in wastewater from mushroom farm was evaluated as a potential biological treatment process for decolourisation as well as to obtain biomass (liquid inoculum). Culture medium components affecting mycelial growth were determined, evaluating colour removal. Laccase activity was monitored during the process. P. ostreatus was able to grow in non diluted WCP. Highest biomass yield was obtained when glucose (10 g/l) was added. The addition of this carbon source was necessary for efficient decolourisation. Agitation of the culture improved biodegradation of WCP as well as fungal biomass production. Laccase and manganese-independent peroxidase activities were detected during fungal treatment of the WCP by P. ostreatus CCEBI 3024. The laccase enzyme showed good correlation with colour loss. Both wastewater colour and pollution load (as chemical oxygen demand) decreased more than 50% after 10 days of culture. Phenols were reduced by 92%.

  10. Exopolysaccharides from Pleurotus pulmonarius: Fermentation Optimization, Characterization and Antioxidant Activity

    Directory of Open Access Journals (Sweden)

    Jin-Wen Shen

    2013-01-01

    Full Text Available Culture conditions for exopolysaccharide (EPS production by Pleurotus pulmonarius in submerged culture are optimized. The suggested medium composition was as follows: 60 g/L of xylose, 6 g/L of soy extract, 5 mM of KH2PO4 and 5 mM of MgSO4. Under the optimized culture conditions in a 5-litre stirred tank fermentor, the maximum concentration of EPS was 6.36 g/L. Furthermore, the morphological parameters (i.e. average diameter, circularity, roughness and compactness of the pellets and the broth viscosity are characterized. It has been proven that mycelial morphology and broth viscosity may be the critical parameters affecting the EPS yield. After deproteinization using Sevag method, a group of EPS (designated as fraction was obtained from the culture filtrates by gel filtration chromatography. FT-IR analysis of the purified EPS revealed prominent characteristic groups corresponding to polyhydric alcohols. GC analysis showed that the purified EPS were mainly composed of galactose and glucose. Furthermore, thermogravimetric analysis indicated that the degradation temperature of the purified EPS was 217 °C. Finally, the antioxidant activity of the EPS fraction was investigated and the relationship with molecular properties was discussed as well.

  11. Lignocellulolytic enzyme production of Pleurotus ostreatus growth in agroindustrial wastes

    Directory of Open Access Journals (Sweden)

    José Maria Rodrigues da Luz

    2012-12-01

    Full Text Available The mushroom Pleurotus ostreatus has nutritional and medicinal characteristics that depend on the growth substrate. In nature, this fungus grows on dead wood, but it can be artificially cultivated on agricultural wastes (coffee husks, eucalyptus sawdust, corncobs and sugar cane bagasse. The degradation of agricultural wastes involves some enzyme complexes made up of oxidative (laccase, manganese peroxidase and lignin peroxidase and hydrolytic enzymes (cellulases, xylanases and tanases. Understanding how these enzymes work will help to improve the productivity of mushroom cultures and decrease the potential pollution that can be caused by inadequate discharge of the agroindustrial residues. The objective of this work was to assess the activity of the lignocellulolytic enzymes produced by two P. ostreatus strains (PLO 2 and PLO 6. These strains were used to inoculate samples of coffee husks, eucalyptus sawdust or eucalyptus bark add with or without 20 % rice bran. Every five days after substrate inoculation, the enzyme activity and soluble protein concentration were evaluated. The maximum activity of oxidative enzymes was observed at day 10 after inoculation, and the activity of the hydrolytic enzymes increased during the entire period of the experiment. The results show that substrate composition and colonization time influenced the activity of the lignocellulolytic enzymes.

  12. Nutriceutical potential of Pleurotus tuber-regium sclerotium

    Directory of Open Access Journals (Sweden)

    R. C. Ohiri

    2018-04-01

    Full Text Available The aim of the study was to determine the composition of the sclerotium of Pleurotus tuber-regium and to analyze its nutritional potential. Major minerals and micronutrients content of the P. tuber-regium sclerotium were determined. The study has shown fairly high concentrations of potassium and magnesium as major minerals with values of 60.66 ± 4.13 and 41.79 ± 3.14 mg/kg, while manganese and zinc were micronutrients with the highest values of 1.20 ± 0.10 and 0.95 ± 0.07 mg/kg. Glutamic acid and aspartic acid were also observed in high concentrations with values of 11.51 ± 1.01 and 5.52 ± 0.86 mg/kg. The mushroom powder of P. tuber-regium was a source for production of oil, which was analyzed by GC-MS method. Benzenedicarboxylic acid mono-(2-ethylhexyl ester and benzenedicarboxylic acid butyl-cyclohexyl ester were volatile constituents predominating with percentage total of 78.7 and 5.2, respectively. It is concluded that the presence of mineral elements, amino acids and volatile components observed in this fungus indicated the presence of the nutritional potential in the sclerotia of P. tuber-regium.

  13. Establishment of an efficient transformation system for Pleurotus ostreatus.

    Science.gov (United States)

    Lei, Min; Wu, Xiangli; Zhang, Jinxia; Wang, Hexiang; Huang, Chenyang

    2017-11-21

    Pleurotus ostreatus is widely cultivated worldwide, but the lack of an efficient transformation system regarding its use restricts its genetic research. The present study developed an improved and efficient Agrobacterium tumefaciens-mediated transformation method in P. ostreatus. Four parameters were optimized to obtain the most efficient transformation method. The strain LBA4404 was the most suitable for the transformation of P. ostreatus. A bacteria-to-protoplast ratio of 100:1, an acetosyringone (AS) concentration of 0.1 mM, and 18 h of co-culture showed the best transformation efficiency. The hygromycin B phosphotransferase gene (HPH) was used as the selective marker, and EGFP was used as the reporter gene in this study. Southern blot analysis combined with EGFP fluorescence assay showed positive results, and mitotic stability assay showed that more than 75% transformants were stable after five generations. These results showed that our transformation method is effective and stable and may facilitate future genetic studies in P. ostreatus.

  14. Degradation of Oxo-Biodegradable Plastic by Pleurotus ostreatus

    Science.gov (United States)

    da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Nunes, Mateus Dias; da Silva, Marliane de Cássia Soares; Kasuya, Maria Catarina Megumi

    2013-01-01

    Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV) or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W) plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate. PMID:23967057

  15. Isolation, Purification, and Characterization of Fungal Laccase from Pleurotus sp.

    Directory of Open Access Journals (Sweden)

    Sunil S. More

    2011-01-01

    Full Text Available Laccases are blue copper oxidases (E.C. 1.10.3.2 benzenediol: oxygen oxidoreductase that catalyze the one-electron oxidation of phenolics, aromatic amines, and other electron-rich substrates with the concomitant reduction of O2 to H2O. They are currently seen as highly interesting industrial enzymes because of their broad substrate specificity. A positive strain was isolated and characterized as nonspore forming Basidiomycetes Pleurotus sp. Laccase activity was determined using ABTS as substrate. Laccase was purified by ionexchange and gel filtration chromatography. The purified laccase was a monomer showed a molecular mass of 40±1 kDa as estimated by SDS-PAGE and a 72-fold purification with a 22% yield. The optimal pH and temperature were 4.5 and 65°C, respectively. The Km and Vmax⁡ values are 250 (mM and 0.33 (μmol/min, respectively, for ABTS as substrate. Metal ions like CuSO4, BaCl2, MgCl2, FeCl2, ZnCl2 have no effect on purified laccase whereas HgCl2 and MnCl2 moderately decrease enzyme activity. SDS and sodium azide inhibited enzyme activity, whereas Urea, PCMB, DTT, and mercaptoethanol have no effect on enzyme activity. The isolated laccase can be used in development of biosensor for detecting the phenolic compounds from the effluents of paper industries.

  16. New lipases by mining of Pleurotus ostreatus genome.

    Directory of Open Access Journals (Sweden)

    Alessandra Piscitelli

    Full Text Available The analysis of Pleurotus ostreatus genome reveals the presence of automatically annotated 53 lipase and 34 carboxylesterase putative coding-genes. Since no biochemical or physiological data are available so far, a functional approach was applied to identify lipases from P. ostreatus. In the tested growth conditions, four lipases were found expressed, with different patterns depending on the used C source. Two of the four identified proteins (PleoLip241 and PleoLip369, expressed in both analysed conditions, were chosen for further studies, such as an in silico analysis and their molecular characterization. To overcome limits linked to native production, a recombinant expression approach in the yeast Pichia pastoris was applied. Different expression levels were obtained: PleoLip241 reached a maximum activity of 4000 U/L, whereas PleoLip369 reached a maximum activity of 700 U/L. Despite their sequence similarity, these enzymes exhibited different substrate specificity and diverse stability at pH, temperature, and presence of metals, detergents and organic solvents. The obtained data allowed classifying PleoLip241 as belonging to the "true lipase" family. Indeed, by phylogenetic analysis the two proteins fall in different clusters. PleoLip241 was used to remove the hydrophobic layer from wool surface in order to improve its dyeability. The encouraging results obtained with lipase treated wool led to forecast PleoLip241 applicability in this field.

  17. Microbiological effects of olive mill waste addition to substrates for Pleurotus pulmonarius cultivation

    NARCIS (Netherlands)

    Soler-Rivas, C.; Garcia-Rosado, A.; Polonia, I.; Junca-Blanch, G.; Marin, F.R.; Wichers, H.J.

    2006-01-01

    When olive mill wastes (OMWs) and vegetation waters (VWs) obtained during the manufacture of olive oil were added as substrate supplements for the cultivation of Pleurotus pulmonarius the material modified growth of the mushroom and the endemic microbiota of the substrate, in particular the

  18. Bioremediation of engine-oil polluted soil by Pleurotus tuber-regium ...

    African Journals Online (AJOL)

    White-rot fungi have been used in various parts of the world for bioremediation of polluted sites. Pleurotus tuber-regium was noted to have the ability to increase nutrient contents in soils polluted with 1 - 40% engine-oil concentration after six months of incubation. P. tuber-regium increased organic matter, carbon and ...

  19. Variability of Laccase Activity in the White-Rot Basidiomycete Pleurotus ostreatus

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr; Gabriel, Jiří

    2002-01-01

    Roč. 47, č. 4 (2002), s. 385-390 ISSN 0015-5632 R&D Projects: GA ČR GP204/02/P100 Institutional research plan: CEZ:AV0Z5020903 Keywords : laccase * pleurotus ostreatus Subject RIV: EE - Microbiology, Virology Impact factor: 0.979, year: 2002

  20. Decolorization of Synthetic Dyes by Pleurotus ostreatus Isolates Differing in Ligninolytic Properties

    Czech Academy of Sciences Publication Activity Database

    Eichlerová, Ivana; Homolka, Ladislav; Nerud, František

    2002-01-01

    Roč. 47, č. 6 (2002), s. 691-695 ISSN 0015-5632 R&D Projects: GA MŠk LN00B030 Institutional research plan: CEZ:AV0Z5020903 Keywords : pleurotus ostreatus * ligninolytic properties Subject RIV: EE - Microbiology, Virology Impact factor: 0.979, year: 2002

  1. Investigation on Pleurotus ferulae potential for the sorption of Pb(II ...

    African Journals Online (AJOL)

    Pleurotus ferulae obtained from rotten tree was collected, washed, dried, ground and sieved to appropriate particle size. Infra-red spectrometry was used to determine functional groups on the biomass while biosorption of Pb(II) from aqueous solution was studied using the biomass in a batch system. The effect of pH (1-7.5), ...

  2. Bioremediation of engine-oil polluted soil by Pleurotus tuber-regium ...

    African Journals Online (AJOL)

    SERVER

    2008-01-04

    Jan 4, 2008 ... White-rot fungi have been used in various parts of the world for bioremediation of polluted sites. Pleurotus tuber-regium was noted to have the ability to increase nutrient contents in soils polluted with. 1 - 40% engine-oil concentration after six months of incubation. P. tuber-regium increased organic matter ...

  3. The Amoebicidal Effect of Ergosterol Peroxide Isolated from Pleurotus ostreatus.

    Science.gov (United States)

    Meza-Menchaca, Thuluz; Suárez-Medellín, Jorge; Del Ángel-Piña, Christian; Trigos, Ángel

    2015-12-01

    Dysentery is an inflammation of the intestine caused by the protozoan parasite Entamoeba histolytica and is a recurrent health problem affecting millions of people worldwide. Because of the magnitude of this disease, finding novel strategies for treatment that does not affect human cells is necessary. Ergosterol peroxide is a sterol particularly known as a major cytotoxic agent with a wide spectrum of biological activities produced by edible and medicinal mushrooms. The aim of this report is to evaluate the amoebicidal activity of ergosterol peroxide (5α, 8α-epidioxy-22E-ergosta-6,22-dien-3β-ol isolated from 5α, 8α-epidioxy-22E-ergosta-6,22-dien-3β-ol) (Jacq.) P. Kumm. f. sp. Florida. Our results show that ergosterol peroxide produced a strong cytotoxic effect against amoebic growth. The inhibitory concentration IC50 of ergosterol peroxide was evaluated. The interaction between E. histolytica and ergosterol peroxide in vitro resulted in strong amoebicidal activity (IC50  = 4.23 nM) that may be due to the oxidatory effect on the parasitic membrane. We also tested selective toxicity of ergosterol peroxide using a cell line CCL-241, a human epithelial cell line isolated from normal human fetal intestinal tissue. To the best of our knowledge, this is the first report on the cytotoxicity of ergosterol peroxide against E. histolytica, which uncovers a new biological property of the lipidic compound isolated from Pleurotus ostreatus (Jacq.) P. Kumm. f. sp. Florida. Copyright © 2015 John Wiley & Sons, Ltd.

  4. Investigation of Pleurotus ostreatus pretreatment on switchgrass for ethanol production

    Science.gov (United States)

    Slavens, Shelyn Gehle

    Fungal pretreatment using the white-rot fungus Pleurotus ostreatus on switchgrass for ethanol production was studied. In a small-scale storage study, small switchgrass bales were inoculated with fungal spawn and automatically watered to maintain moisture. Sampled at 25, 53, and 81 d, the switchgrass composition was determined and liquid hot water (LHW) pretreatment was conducted. Fungal pretreatment significantly decreased the xylan and lignin content; glucan was not significantly affected by fungal loading. The glucan, xylan, and lignin contents significantly decreased with increased fungal pretreatment time. The effects of the fungal pretreatment were not highly evident after the LHW pretreatment, showing only changes based on sampling time. Although other biological activity within the bales increased cellulose degradation, the fungal pretreatment successfully reduced the switchgrass lignin and hemicellulose contents. In a laboratory-scale nutrient supplementation study, copper, manganese, glucose, or water was added to switchgrass to induce production of ligninolytic enzymes by P. ostreatus. After 40 d, ligninolytic enzyme activities and biomass composition were determined and simultaneous saccharification and fermentation (SSF) was conducted to determine ethanol yield. Laccase activity was similar for all supplements and manganese peroxidase (MnP) activity was significantly less in copper-treated samples than in the other fungal-inoculated samples. The fungal pretreatment reduced glucan, xylan, and lignin content, while increasing extractable sugars content. The lowest lignin contents occurred in the water-fungal treated samples and produced the greatest ethanol yields. The greatest lignin contents occurred in the copper-fungal treated samples and produced the lowest ethanol yields. Manganese-fungal and glucose-fungal treated samples had similar, intermediate lignin contents and produced similar, intermediate ethanol yields. Ethanol yields from switchgrass

  5. Valorization of spent oyster mushroom substrate and laccase recovery through successive solid state cultivation of Pleurotus, Ganoderma, and Lentinula strains.

    Science.gov (United States)

    Economou, Christina N; Diamantopoulou, Panagiota A; Philippoussis, Antonios N

    2017-06-01

    Spent mushroom substrate (SMS) of Pleurotus ostreatus was supplemented with wheat bran and soybean flour in various proportions to obtain C/N ratios of 10, 20, and 30, and their effect was evaluated in successive cultivation of Pleurotus ostreatus, Pleurotus pulmonarius, Ganoderma adspersum, Ganoderma resinaceum, and Lentinula edodes strains with respect to mycelium growth rate, biomass concentration, recovery of the enzyme laccase and crude exopolysaccharides, and also with additional fruiting body production. All fungi showed the highest growth rate on unamended SMS (C/N 30), with G. resinaceum being the fastest colonizer (Kr = 9.84 mm day -1 ), while biomass concentration maximized at C/N 10. Moreover, supplementation affected positively laccase activity, with P. pulmonarius furnishing the highest value (44,363.22 U g -1 ) at C/N 20. On the contrary, L. edodes growth, fruiting, and laccase secretion were not favored by SMS supplementation. Fruiting body formation was promoted at C/N 30 for Ganoderma and at C/N 20 for Pleurotus species. Exopolysaccharide production of further studied Pleurotus strains was favored at a C/N 20 ratio, at the initial stage of SMS colonization. The obtained results support the potential effective utilization of supplemented SMS for laccase production from Ganoderma spp. and for new fruiting body production of Pleurotus spp.

  6. Effect of Edible Mushroom (Pleurotus ostreatus on Type-2 Diabetics

    Directory of Open Access Journals (Sweden)

    M. Abu Sayeed

    2014-01-01

    Full Text Available The prevalence of non-communicable diseases (NCD like diabetes, hypertension, dyslipidemia and atherosclerotic cardiovascular diseases (CVD are on the increase globally and predominantly in the South East Asian Region (SEAR. The increasing NCD and its complications burdened the health cost of Bangladesh. The available literatures suggest that edible mushrooms are effective in controlling metabolic risks like hyperglycemia and hypercholesterolemia. The study addressed the metabolic effects of edible oyster mushroom (Pleurotus ostreatus in diabetic individuals and to assess the undesirable effects of mushroom. A total of 5000 newly registered diabetic women were screened for eligible participants (urban housewives, age 30 – 50y, BMI 22 – 27, FBG 8 – 12 mmol/l; free from complications or systemic illnesses and agreed to adhere to the study for 360 days. The investigations included weight and height for BMI, waist- and hip-girth for WHR, BP, FBG, 2ABF, T-chol, TG, HDL, LDL, ALT and Creatinine starting from the day 0 (baseline and each subsequent follow-up days: 60, 120, 180, 240, 300 and 360 for comparison between placebo and mushroom groups and also within group (baseline vs. follow up days, individually for placebo and mushroom. The daily intake of mushroom was 200g for the mushroom group and an equivalent calorie of vegetables for the placebo group. Overall, 73 diabetic housewives (mushroom / placebo = 43 /30 volunteered. The mean (with SEM values of BMI, WHR, BP, FBG, 2ABF, T-chol, TG, HDL, LDL, ALT and Creatinine of the placebo group were compared with the mushroom group. Compared with the placebo, the mushroom group showed significant reductions of FBG (p<0.001, 2ABF (p<0.001, T-chol (p<0.001, TG (p=0.03 and LDL (p<0.001; whereas, no difference was observed for BMI, SBP, DBP, HDL, Hb, creatinine and ALT. The comparison within groups (baseline vs. follow-up there were significant reduction of these variables in mushroom but not in the

  7. Cultivo e características nutricionais de Pleurotus em substrato pasteurizado Cultivation and nutritional characteristics of Pleurotus grown in pasteurized substrate

    Directory of Open Access Journals (Sweden)

    Eduardo Bernardi

    2009-01-01

    Full Text Available O objetivo deste trabalho foi avaliar a produtividade, eficiência biológica, massa fresca, composição centesimal dos cogumelos Pleurotus ostreatus (BF24 e Pleurotus sajor-caju (PSC96/03 e PSC01/06 produzidos no substrato capim-elefante (Pennisetum purpureum pasteurizado e a relação Carbono/Nitrogênio inicial e final do substrato. O substrato seco e particulado a 2 cm foi umedecido por 24 horas e pasteurizado a 100 ºC durante 30 minutos. Adicionaram-se 3% de inóculo de cada linhagem, sendo acondicionado em embalagens de polipropileno com 1 kg cada uma. Os substratos foram incubados a 26 ºC e na fase de frutificação a 23±3 ºC e umidade relativa de 75% a 90%. Na linhagem BF24 observou-se maior massa fresca (281,19g, eficiência biológica (112,46% e produtividade (28,11%. O substrato com relação Carbono:Nitrogênio inicial de 162:1 foi o de menor relação (68:1 após o cultivo do P. sajor-caju (PSC01/06. A linhagem PSC96/03 proporcionou maior teor de proteína em relação às demais, tendo a BF24 maior teor de lipídios. Quanto ao teor de carboidratos e cinzas, nas diferentes espécies e linhagens não houve diferenças significativas; já para a quantidade de fibras, as linhagens BF24 e PSC01/06 foram similares, porém superiores a PSC96/03. As duas espécies de Pleurotus podem ser cultivadas em capim-elefante pasteurizado, suprimindo o processo de compostagem.The objective of this work was to evaluate the productivity, biological efficiency, fresh matter, and centesimal composition of mushroom Pleurotus ostreatus (BF24 and Pleurotus sajor-caju (PSC96/03 and PSC01/06 grown in pasteurized elephant grass substrate (Pennisetum purpureum. It was also assessed the initial and final Carbon/Nitrogen ratio. The dried 2-cm-particulate substrate was moist for 24 hours and pasteurized at 100ºC during 30 minutes. Then, it was added 3% of inoculum of each strain. The substrate was placed into 1-kg polypropylene bags. The bags were incubated

  8. New var reconstruction algorithm exposes high var sequence diversity in a single geographic location in Mali.

    Science.gov (United States)

    Dara, Antoine; Drábek, Elliott F; Travassos, Mark A; Moser, Kara A; Delcher, Arthur L; Su, Qi; Hostelley, Timothy; Coulibaly, Drissa; Daou, Modibo; Dembele, Ahmadou; Diarra, Issa; Kone, Abdoulaye K; Kouriba, Bourema; Laurens, Matthew B; Niangaly, Amadou; Traore, Karim; Tolo, Youssouf; Fraser, Claire M; Thera, Mahamadou A; Djimde, Abdoulaye A; Doumbo, Ogobara K; Plowe, Christopher V; Silva, Joana C

    2017-03-28

    Encoded by the var gene family, highly variable Plasmodium falciparum erythrocyte membrane protein-1 (PfEMP1) proteins mediate tissue-specific cytoadherence of infected erythrocytes, resulting in immune evasion and severe malaria disease. Sequencing and assembling the 40-60 var gene complement for individual infections has been notoriously difficult, impeding molecular epidemiological studies and the assessment of particular var elements as subunit vaccine candidates. We developed and validated a novel algorithm, Exon-Targeted Hybrid Assembly (ETHA), to perform targeted assembly of var gene sequences, based on a combination of Pacific Biosciences and Illumina data. Using ETHA, we characterized the repertoire of var genes in 12 samples from uncomplicated malaria infections in children from a single Malian village and showed them to be as genetically diverse as vars from isolates from around the globe. The gene var2csa, a member of the var family associated with placental malaria pathogenesis, was present in each genome, as were vars previously associated with severe malaria. ETHA, a tool to discover novel var sequences from clinical samples, will aid the understanding of malaria pathogenesis and inform the design of malaria vaccines based on PfEMP1. ETHA is available at: https://sourceforge.net/projects/etha/ .

  9. arXiv Observation of the $\\varXi^{-}_{b}\\to J/\\psi\\varLambda K^{-}$ decay

    CERN Document Server

    Aaij, Roel; Adinolfi, Marco; Ajaltouni, Ziad; Akar, Simon; Albrecht, Johannes; Alessio, Federico; Alexander, Michael; Ali, Suvayu; Alkhazov, Georgy; Alvarez Cartelle, Paula; Alves Jr, Antonio Augusto; Amato, Sandra; Amerio, Silvia; Amhis, Yasmine; An, Liupan; Anderlini, Lucio; Andreassi, Guido; Andreotti, Mirco; Andrews, Jason; Appleby, Robert; Archilli, Flavio; d'Argent, Philippe; Arnau Romeu, Joan; Artamonov, Alexander; Artuso, Marina; Aslanides, Elie; Auriemma, Giulio; Baalouch, Marouen; Babuschkin, Igor; Bachmann, Sebastian; Back, John; Badalov, Alexey; Baesso, Clarissa; Baker, Sophie; Balagura, Vladislav; Baldini, Wander; Barlow, Roger; Barschel, Colin; Barsuk, Sergey; Barter, William; Baryshnikov, Fedor; Baszczyk, Mateusz; Batozskaya, Varvara; Batsukh, Baasansuren; Battista, Vincenzo; Bay, Aurelio; Beaucourt, Leo; Beddow, John; Bedeschi, Franco; Bediaga, Ignacio; Bel, Lennaert; Bellee, Violaine; Belloli, Nicoletta; Belous, Konstantin; Belyaev, Ivan; Ben-Haim, Eli; Bencivenni, Giovanni; Benson, Sean; Berezhnoy, Alexander; Bernet, Roland; Bertolin, Alessandro; Betancourt, Christopher; Betti, Federico; Bettler, Marc-Olivier; van Beuzekom, Martinus; Bezshyiko, Iaroslava; Bifani, Simone; Billoir, Pierre; Bird, Thomas; Birnkraut, Alex; Bitadze, Alexander; Bizzeti, Andrea; Blake, Thomas; Blanc, Frederic; Blouw, Johan; Blusk, Steven; Bocci, Valerio; Boettcher, Thomas; Bondar, Alexander; Bondar, Nikolay; Bonivento, Walter; Bordyuzhin, Igor; Borgheresi, Alessio; Borghi, Silvia; Borisyak, Maxim; Borsato, Martino; Bossu, Francesco; Boubdir, Meriem; Bowcock, Themistocles; Bowen, Espen Eie; Bozzi, Concezio; Braun, Svende; Britsch, Markward; Britton, Thomas; Brodzicka, Jolanta; Buchanan, Emma; Burr, Christopher; Bursche, Albert; Buytaert, Jan; Cadeddu, Sandro; Calabrese, Roberto; Calvi, Marta; Calvo Gomez, Miriam; Camboni, Alessandro; Campana, Pierluigi; Campora Perez, Daniel Hugo; Capriotti, Lorenzo; Carbone, Angelo; Carboni, Giovanni; Cardinale, Roberta; Cardini, Alessandro; Carniti, Paolo; Carson, Laurence; Carvalho Akiba, Kazuyoshi; Casse, Gianluigi; Cassina, Lorenzo; Castillo Garcia, Lucia; Cattaneo, Marco; Cavallero, Giovanni; Cenci, Riccardo; Chamont, David; Charles, Matthew; Charpentier, Philippe; Chatzikonstantinidis, Georgios; Chefdeville, Maximilien; Chen, Shanzhen; Cheung, Shu-Faye; Chobanova, Veronika; Chrzaszcz, Marcin; Cid Vidal, Xabier; Ciezarek, Gregory; Clarke, Peter; Clemencic, Marco; Cliff, Harry; Closier, Joel; Coco, Victor; Cogan, Julien; Cogneras, Eric; Cogoni, Violetta; Cojocariu, Lucian; Collazuol, Gianmaria; Collins, Paula; Comerma-Montells, Albert; Contu, Andrea; Cook, Andrew; Coombs, George; Coquereau, Samuel; Corti, Gloria; Corvo, Marco; Costa Sobral, Cayo Mar; Couturier, Benjamin; Cowan, Greig; Craik, Daniel Charles; Crocombe, Andrew; Cruz Torres, Melissa Maria; Cunliffe, Samuel; Currie, Robert; D'Ambrosio, Carmelo; Da Cunha Marinho, Franciole; Dall'Occo, Elena; Dalseno, Jeremy; David, Pieter; Davis, Adam; De Bruyn, Kristof; De Capua, Stefano; De Cian, Michel; De Miranda, Jussara; De Paula, Leandro; De Serio, Marilisa; De Simone, Patrizia; Dean, Cameron Thomas; Decamp, Daniel; Deckenhoff, Mirko; Del Buono, Luigi; Demmer, Moritz; Dendek, Adam; Derkach, Denis; Deschamps, Olivier; Dettori, Francesco; Dey, Biplab; Di Canto, Angelo; Dijkstra, Hans; Dordei, Francesca; Dorigo, Mirco; Dosil Suárez, Alvaro; Dovbnya, Anatoliy; Dreimanis, Karlis; Dufour, Laurent; Dujany, Giulio; Dungs, Kevin; Durante, Paolo; Dzhelyadin, Rustem; Dziurda, Agnieszka; Dzyuba, Alexey; Déléage, Nicolas; Easo, Sajan; Ebert, Marcus; Egede, Ulrik; Egorychev, Victor; Eidelman, Semen; Eisenhardt, Stephan; Eitschberger, Ulrich; Ekelhof, Robert; Eklund, Lars; Ely, Scott; Esen, Sevda; Evans, Hannah Mary; Evans, Timothy; Falabella, Antonio; Farley, Nathanael; Farry, Stephen; Fay, Robert; Fazzini, Davide; Ferguson, Dianne; Fernandez Prieto, Antonio; Ferrari, Fabio; Ferreira Rodrigues, Fernando; Ferro-Luzzi, Massimiliano; Filippov, Sergey; Fini, Rosa Anna; Fiore, Marco; Fiorini, Massimiliano; Firlej, Miroslaw; Fitzpatrick, Conor; Fiutowski, Tomasz; Fleuret, Frederic; Fohl, Klaus; Fontana, Marianna; Fontanelli, Flavio; Forshaw, Dean Charles; Forty, Roger; Franco Lima, Vinicius; Frank, Markus; Frei, Christoph; Fu, Jinlin; Funk, Wolfgang; Furfaro, Emiliano; Färber, Christian; Gallas Torreira, Abraham; Galli, Domenico; Gallorini, Stefano; Gambetta, Silvia; Gandelman, Miriam; Gandini, Paolo; Gao, Yuanning; Garcia Martin, Luis Miguel; García Pardiñas, Julián; Garra Tico, Jordi; Garrido, Lluis; Garsed, Philip John; Gascon, David; Gaspar, Clara; Gavardi, Laura; Gazzoni, Giulio; Gerick, David; Gersabeck, Evelina; Gersabeck, Marco; Gershon, Timothy; Ghez, Philippe; Gianì, Sebastiana; Gibson, Valerie; Girard, Olivier Göran; Giubega, Lavinia-Helena; Gizdov, Konstantin; Gligorov, Vladimir; Golubkov, Dmitry; Golutvin, Andrey; Gomes, Alvaro; Gorelov, Igor Vladimirovich; Gotti, Claudio; Graciani Diaz, Ricardo; Granado Cardoso, Luis Alberto; Graugés, Eugeni; Graverini, Elena; Graziani, Giacomo; Grecu, Alexandru; Griffith, Peter; Grillo, Lucia; Gruberg Cazon, Barak Raimond; Grünberg, Oliver; Gushchin, Evgeny; Guz, Yury; Gys, Thierry; Göbel, Carla; Hadavizadeh, Thomas; Hadjivasiliou, Christos; Haefeli, Guido; Haen, Christophe; Haines, Susan; Hamilton, Brian; Han, Xiaoxue; Hansmann-Menzemer, Stephanie; Harnew, Neville; Harnew, Samuel; Harrison, Jonathan; Hatch, Mark; He, Jibo; Head, Timothy; Heister, Arno; Hennessy, Karol; Henrard, Pierre; Henry, Louis; van Herwijnen, Eric; Heß, Miriam; Hicheur, Adlène; Hill, Donal; Hombach, Christoph; Hopchev, P H; Hulsbergen, Wouter; Humair, Thibaud; Hushchyn, Mikhail; Hutchcroft, David; Idzik, Marek; Ilten, Philip; Jacobsson, Richard; Jaeger, Andreas; Jalocha, Pawel; Jans, Eddy; Jawahery, Abolhassan; Jiang, Feng; John, Malcolm; Johnson, Daniel; Jones, Christopher; Joram, Christian; Jost, Beat; Jurik, Nathan; Kandybei, Sergii; Karacson, Matthias; Kariuki, James Mwangi; Karodia, Sarah; Kecke, Matthieu; Kelsey, Matthew; Kenzie, Matthew; Ketel, Tjeerd; Khairullin, Egor; Khanji, Basem; Khurewathanakul, Chitsanu; Kirn, Thomas; Klaver, Suzanne; Klimaszewski, Konrad; Koliiev, Serhii; Kolpin, Michael; Komarov, Ilya; Koopman, Rose; Koppenburg, Patrick; Kosmyntseva, Alena; Kozachuk, Anastasiia; Kozeiha, Mohamad; Kravchuk, Leonid; Kreplin, Katharina; Kreps, Michal; Krokovny, Pavel; Kruse, Florian; Krzemien, Wojciech; Kucewicz, Wojciech; Kucharczyk, Marcin; Kudryavtsev, Vasily; Kuonen, Axel Kevin; Kurek, Krzysztof; Kvaratskheliya, Tengiz; Lacarrere, Daniel; Lafferty, George; Lai, Adriano; Lanfranchi, Gaia; Langenbruch, Christoph; Latham, Thomas; Lazzeroni, Cristina; Le Gac, Renaud; van Leerdam, Jeroen; Leflat, Alexander; Lefrançois, Jacques; Lefèvre, Regis; Lemaitre, Florian; Lemos Cid, Edgar; Leroy, Olivier; Lesiak, Tadeusz; Leverington, Blake; Li, Tenglin; Li, Yiming; Likhomanenko, Tatiana; Lindner, Rolf; Linn, Christian; Lionetto, Federica; Liu, Xuesong; Loh, David; Longstaff, Iain; Lopes, Jose; Lucchesi, Donatella; Lucio Martinez, Miriam; Luo, Haofei; Lupato, Anna; Luppi, Eleonora; Lupton, Oliver; Lusiani, Alberto; Lyu, Xiao-Rui; Machefert, Frederic; Maciuc, Florin; Maev, Oleg; Maguire, Kevin; Malde, Sneha; Malinin, Alexander; Maltsev, Timofei; Manca, Giulia; Mancinelli, Giampiero; Manning, Peter Michael; Maratas, Jan; Marchand, Jean François; Marconi, Umberto; Marin Benito, Carla; Marinangeli, Matthieu; Marino, Pietro; Marks, Jörg; Martellotti, Giuseppe; Martin, Morgan; Martinelli, Maurizio; Martinez Santos, Diego; Martinez Vidal, Fernando; Martins Tostes, Danielle; Massacrier, Laure Marie; Massafferri, André; Matev, Rosen; Mathad, Abhijit; Mathe, Zoltan; Matteuzzi, Clara; Mauri, Andrea; Maurice, Emilie; Maurin, Brice; Mazurov, Alexander; McCann, Michael; McNab, Andrew; McNulty, Ronan; Meadows, Brian; Meier, Frank; Meissner, Marco; Melnychuk, Dmytro; Merk, Marcel; Merli, Andrea; Michielin, Emanuele; Milanes, Diego Alejandro; Minard, Marie-Noelle; Mitzel, Dominik Stefan; Mogini, Andrea; Molina Rodriguez, Josue; Monroy, Ignacio Alberto; Monteil, Stephane; Morandin, Mauro; Morawski, Piotr; Mordà, Alessandro; Morello, Michael Joseph; Morgunova, Olga; Moron, Jakub; Morris, Adam Benjamin; Mountain, Raymond; Muheim, Franz; Mulder, Mick; Mussini, Manuel; Müller, Dominik; Müller, Janine; Müller, Katharina; Müller, Vanessa; Naik, Paras; Nakada, Tatsuya; Nandakumar, Raja; Nandi, Anita; Nasteva, Irina; Needham, Matthew; Neri, Nicola; Neubert, Sebastian; Neufeld, Niko; Neuner, Max; Nguyen, Thi Dung; Nguyen-Mau, Chung; Nieswand, Simon; Niet, Ramon; Nikitin, Nikolay; Nikodem, Thomas; Nogay, Alla; Novoselov, Alexey; O'Hanlon, Daniel Patrick; Oblakowska-Mucha, Agnieszka; Obraztsov, Vladimir; Ogilvy, Stephen; Oldeman, Rudolf; Onderwater, Gerco; Otalora Goicochea, Juan Martin; Otto, Adam; Owen, Patrick; Oyanguren, Maria Aranzazu; Pais, Preema Rennee; Palano, Antimo; Palombo, Fernando; Palutan, Matteo; Papanestis, Antonios; Pappagallo, Marco; Pappalardo, Luciano; Parker, William; Parkes, Christopher; Passaleva, Giovanni; Pastore, Alessandra; Patel, Girish; Patel, Mitesh; Patrignani, Claudia; Pearce, Alex; Pellegrino, Antonio; Penso, Gianni; Pepe Altarelli, Monica; Perazzini, Stefano; Perret, Pascal; Pescatore, Luca; Petridis, Konstantinos; Petrolini, Alessandro; Petrov, Aleksandr; Petruzzo, Marco; Picatoste Olloqui, Eduardo; Pietrzyk, Boleslaw; Pikies, Malgorzata; Pinci, Davide; Pistone, Alessandro; Piucci, Alessio; Placinta, Vlad-Mihai; Playfer, Stephen; Plo Casasus, Maximo; Poikela, Tuomas; Polci, Francesco; Poluektov, Anton; Polyakov, Ivan; Polycarpo, Erica; Pomery, Gabriela Johanna; Popov, Alexander; Popov, Dmitry; Popovici, Bogdan; Poslavskii, Stanislav; Potterat, Cédric; Price, Eugenia; Price, Joseph David; Prisciandaro, Jessica; Pritchard, Adrian; Prouve, Claire; Pugatch, Valery; Puig Navarro, Albert; Punzi, Giovanni; Qian, Wenbin; Quagliani, Renato; Rachwal, Bartolomiej; Rademacker, Jonas; Rama, Matteo; Ramos Pernas, Miguel; Rangel, Murilo; Raniuk, Iurii; Ratnikov, Fedor; Raven, Gerhard; Redi, Federico; Reichert, Stefanie; dos Reis, Alberto; Remon Alepuz, Clara; Renaudin, Victor; Ricciardi, Stefania; Richards, Sophie; Rihl, Mariana; Rinnert, Kurt; Rives Molina, Vicente; Robbe, Patrick; Rodrigues, Ana Barbara; Rodrigues, Eduardo; Rodriguez Lopez, Jairo Alexis; Rodriguez Perez, Pablo; Rogozhnikov, Alexey; Roiser, Stefan; Rollings, Alexandra Paige; Romanovskiy, Vladimir; Romero Vidal, Antonio; Ronayne, John William; Rotondo, Marcello; Rudolph, Matthew Scott; Ruf, Thomas; Ruiz Valls, Pablo; Saborido Silva, Juan Jose; Sadykhov, Elnur; Sagidova, Naylya; Saitta, Biagio; Salustino Guimaraes, Valdir; Sanchez Mayordomo, Carlos; Sanmartin Sedes, Brais; Santacesaria, Roberta; Santamarina Rios, Cibran; Santimaria, Marco; Santovetti, Emanuele; Sarti, Alessio; Satriano, Celestina; Satta, Alessia; Saunders, Daniel Martin; Savrina, Darya; Schael, Stefan; Schellenberg, Margarete; Schiller, Manuel; Schindler, Heinrich; Schlupp, Maximilian; Schmelling, Michael; Schmelzer, Timon; Schmidt, Burkhard; Schneider, Olivier; Schopper, Andreas; Schubert, Konstantin; Schubiger, Maxime; Schune, Marie Helene; Schwemmer, Rainer; Sciascia, Barbara; Sciubba, Adalberto; Semennikov, Alexander; Sergi, Antonino; Serra, Nicola; Serrano, Justine; Sestini, Lorenzo; Seyfert, Paul; Shapkin, Mikhail; Shapoval, Illya; Shcheglov, Yury; Shears, Tara; Shekhtman, Lev; Shevchenko, Vladimir; Siddi, Benedetto Gianluca; Silva Coutinho, Rafael; Silva de Oliveira, Luiz Gustavo; Simi, Gabriele; Simone, Saverio; Sirendi, Marek; Skidmore, Nicola; Skwarnicki, Tomasz; Smith, Eluned; Smith, Iwan Thomas; Smith, Jackson; Smith, Mark; Snoek, Hella; Soares Lavra, Lais; Sokoloff, Michael; Soler, Paul; Souza De Paula, Bruno; Spaan, Bernhard; Spradlin, Patrick; Sridharan, Srikanth; Stagni, Federico; Stahl, Marian; Stahl, Sascha; Stefko, Pavol; Stefkova, Slavorima; Steinkamp, Olaf; Stemmle, Simon; Stenyakin, Oleg; Stevens, Holger; Stevenson, Scott; Stoica, Sabin; Stone, Sheldon; Storaci, Barbara; Stracka, Simone; Straticiuc, Mihai; Straumann, Ulrich; Sun, Liang; Sutcliffe, William; Swientek, Krzysztof; Syropoulos, Vasileios; Szczekowski, Marek; Szumlak, Tomasz; T'Jampens, Stephane; Tayduganov, Andrey; Tekampe, Tobias; Tellarini, Giulia; Teubert, Frederic; Thomas, Eric; van Tilburg, Jeroen; Tilley, Matthew James; Tisserand, Vincent; Tobin, Mark; Tolk, Siim; Tomassetti, Luca; Tonelli, Diego; Topp-Joergensen, Stig; Toriello, Francis; Tournefier, Edwige; Tourneur, Stephane; Trabelsi, Karim; Traill, Murdo; Tran, Minh Tâm; Tresch, Marco; Trisovic, Ana; Tsaregorodtsev, Andrei; Tsopelas, Panagiotis; Tully, Alison; Tuning, Niels; Ukleja, Artur; Ustyuzhanin, Andrey; Uwer, Ulrich; Vacca, Claudia; Vagnoni, Vincenzo; Valassi, Andrea; Valat, Sebastien; Valenti, Giovanni; Vazquez Gomez, Ricardo; Vazquez Regueiro, Pablo; Vecchi, Stefania; van Veghel, Maarten; Velthuis, Jaap; Veltri, Michele; Veneziano, Giovanni; Venkateswaran, Aravindhan; Vernet, Maxime; Vesterinen, Mika; Viana Barbosa, Joao Vitor; Viaud, Benoit; Vieira, Daniel; Vieites Diaz, Maria; Viemann, Harald; Vilasis-Cardona, Xavier; Vitti, Marcela; Volkov, Vladimir; Vollhardt, Achim; Voneki, Balazs; Vorobyev, Alexey; Vorobyev, Vitaly; Voß, Christian; de Vries, Jacco; Vázquez Sierra, Carlos; Waldi, Roland; Wallace, Charlotte; Wallace, Ronan; Walsh, John; Wang, Jianchun; Ward, David; Wark, Heather Mckenzie; Watson, Nigel; Websdale, David; Weiden, Andreas; Whitehead, Mark; Wicht, Jean; Wilkinson, Guy; Wilkinson, Michael; Williams, Mark Richard James; Williams, Matthew; Williams, Mike; Williams, Timothy; Wilson, Fergus; Wimberley, Jack; Wishahi, Julian; Wislicki, Wojciech; Witek, Mariusz; Wormser, Guy; Wotton, Stephen; Wraight, Kenneth; Wyllie, Kenneth; Xie, Yuehong; Xing, Zhou; Xu, Zhirui; Yang, Zhenwei; Yao, Yuezhe; Yin, Hang; Yu, Jiesheng; Yuan, Xuhao; Yushchenko, Oleg; Zarebski, Kristian Alexander; Zavertyaev, Mikhail; Zhang, Liming; Zhang, Yanxi; Zhang, Yu; Zhelezov, Alexey; Zheng, Yangheng; Zhu, Xianglei; Zhukov, Valery; Zucchelli, Stefano

    2017-09-10

    The observation of the decay $\\varXi_{b}^{-}\\to J/\\psi\\varLambda K^{-}$ is reported, using a data sample corresponding to an integrated luminosity of $3~\\mathrm{fb}^{-1}$, collected by the LHCb detector in $pp$ collisions at centre-of-mass energies of $7$ and $8~\\mathrm{TeV}$. The production rate of $\\varXi_{b}^{-}$ baryons detected in the decay $\\varXi_{b}^{-}\\to J/\\psi\\varLambda K^{-}$ is measured relative to that of $\\varLambda_{b}^{0}$ baryons using the decay $\\varLambda_{b}^{0}\\to J/\\psi \\varLambda$. Integrated over the $b$-baryon transverse momentum $p_{\\rm T}<25~\\mathrm{GeV/}c $ and rapidity $2.0 < y < 4.5$, the measured ratio is \\begin{equation*} \\frac{f_{\\varXi_{b}^{-}}}{f_{\\varLambda_{b}^{0}}}\\frac{\\mathcal{B}(\\varXi_{b}^{-}\\to J/\\psi\\varLambda K^{-})}{\\mathcal{B}(\\varLambda_{b}^{0}\\to J/\\psi \\varLambda)}=(4.19\\pm 0.29~(\\mathrm{stat})\\pm0.14~(\\mathrm{syst}))\\times 10^{-2}, \\end{equation*}where $f_{\\varXi_{b}^{-}}$ and $f_{\\varLambda_{b}^{0}}$ are the fragmentation fractions of $b\\to\\varXi_{...

  10. Chemical analysis of fructification bodies of Pleurotus sajor-caju cultivated in several nitrogen concentrations

    OpenAIRE

    Silva, Evânia Geralda; Dias, Eustáquio Souza; Siqueira, Félix Gonçalves; Schwan, Rosane Freitas

    2007-01-01

    Os cogumelos do gênero Pleurotus normalmente crescem bem em substratos mais pobres em nitrogênio, ao contrário dos cogumelos Agaricus que requerem substratos com relação C/N mais estreita. Por outro lado, os valores nutricionais do cogumelo dependem da composição química do substrato utilizado e das condições de cultivo. Este trabalho teve como objetivo avaliar o teor de proteína dos corpos de frutificação do cogumelo Pleurotus sajor-caju cultivado em capim coast-cross, bagaço de cana-de-açúc...

  11. Shake flask decolourization of direct dye solar golden yellow R by pleurotus ostreatus

    International Nuclear Information System (INIS)

    Jilani, K.; Asghar, M.; Bhatti, H.N.; Mushtaq, Z.

    2011-01-01

    Different on site treatment technologies are in practice for industrial wastewaters but bioremediation using white rot fungi is the most attractive option due to complete degradation of the pollutants to non toxic end products. Three direct dyes (Solar golden yellow R, Solar brilliant red BA and Solar orange RSN) were decolourized using white rot fungus (WRF) Pleurotus ostreatus. The best decolourized dye Solar golden yellow R was selected for subsequent optimization studies for decolourization. Under optimum conditions Pleurotus ostreatus caused 90.32 % decolourization of 0.01 % Solar golden yellow R solution within two days of shake flask incubation at pH 3.5 and 30 deg. C temperature in Kirk's basal nutrient medium with added 1 % starch and 0.01 % ammonium sulphate as carbon and nitrogen sources, respectively. Ligninolytic enzyme activities were correlated to dye decolourization and maximum laccase activity of 356.23 U/ml was also noted in the maximally decolourized medium. (author)

  12. Abiotic and Biotic Degradation of Oxo-Biodegradable Plastic Bags by Pleurotus ostreatus

    OpenAIRE

    da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Bazzolli, Denise Mara Soares; Tótola, Marcos Rogério; Demuner, Antônio Jacinto; Kasuya, Maria Catarina Megumi

    2014-01-01

    In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as su...

  13. Optimum Condition of Ecologic Feed Fermentation by Pleurotus ostreatus Using Soybean Curd Residue as Raw Materials

    OpenAIRE

    Shi, Min; Yang, Yingnan; Li, Yiting; Wang, Yuepeng; Zhang, Zhenya

    2011-01-01

    A novel approach by utilizing soybean curd residue, to produce polysaccharide from the edible mushroom Pleurotus ostreatus in solid-state culture, was developed. Firstly, the significant effect of fermented conditions on P. ostreatus polysaccharide production were screened out to be inoculum size, moisture content and C/N ratio by using a single factor experiment. Secondly, the three factors were optimized using central composite design in response surface methodology. As results, a quadratic...

  14. Dose Response for Monokaryon mycelium of Pleurotus pulmonarius After Acute Gamma Radiation

    International Nuclear Information System (INIS)

    Wan Safina Wan Abdul Razak; Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus pulmonarius is locally known as Grey oyster. The species is popular and widely cultivated throughout the world mostly in Asia Europe as their simple and low cost production technology and higher biological efficiency. Mutation induction is an alternative ways for improving available commercial strain for better quality traits. Dose response is important in evaluating effects of mutagenesis via acute gamma radiation. Monokaryon mycelium of Pleurotus pulmonarius was exposed to acute gamma radiation ranged from 0 Gy, 0.1 kGy, 0.2 kGy, 0.3 kGy, 0.4 kGy, 0.5 kGy, 0.6 kGy, 0.7 kGy, 0.8 kGy, 0.9 kGy, 1.0 kGy, 1.5 Gy, 2.0 kGy, 3.0 kGy and 4.0 kGy at dose rate 0.013 kGy/ min. growth performance was measured at 2 days interval to get the LD_5_0. Increasing of the irradiation dose found to decrease the growth performance of the monokaryon mycelium. LD_5_0 was revealed at 1.56 kGy for mono karyon mycelium. Discoveries of the works are important for the improvement of Pleurotus species via acute gamma radiation and benefiting to growers and mushroom industries. (author)

  15. Genetic diversity of edible mushroom pleurotus spp. revealed by randomly amplified polymorphic dna fingerprinting

    International Nuclear Information System (INIS)

    Khan, N. A.; Awan, F. S.; Khan, A. I.; Waseem, M.

    2017-01-01

    The Oyster mushroom (Pleurotus) cultivation is a profitable agribusiness and having high significance due its nutritive and therapeutic value. Due to deficient knowledge on Pleurotus mushroom genetics seven strains of Oyster mushroom, two local and five exotic were studied for their genetic diversity through RAPD markers. It was clear from similarity matrix that similarity index ranges from 45 to 72%. The cluster analysis of combined data set of all the markers resulted in three major clades, while isolate P-17 remains ungrouped and shown to be the most diverse strain of the seven. During amplification of genomic DNA yielded 70 fragments that could be scored, of which 41 were polymorphic, with an average of 2.73 polymorphic fragments per primer. Number of amplified fragments with random primers ranged from three to six. Polymorphism ranged from 0% to 83.33%, with an overall 58% polymorphism. The allele frequency of RAPD primers ranged from 0.71 to 1.00 while the polymorphic information content highest for the primer GL-C-20 (0.29) followed by the primers GL A-20 and GL C-16 that is zero, indicating medium level of polymorphism among the strains of Oyster mushroom. The objective of the study was to characterize Pleurotus strains collected from different origins and to find out the variability at molecular level. (author)

  16. Researches on Pleurotus ostreatus mushroom’s quality cultivated on coffee grounds

    Directory of Open Access Journals (Sweden)

    Sorina Ropciuc

    2016-10-01

    Full Text Available The objectives of this work were to evaluate the possibility of using coffee grounds for cultivating Pleurotus ostreatus mushrooms and determine the nutritional composition of Pleurotus ostreatus mushrooms produced on coffee grounds substrate. The results revealed a good fruiting of the fungus on coffee grounds and the biological effectiveness (weight of fresh mushroom reached about 97% after 30 days. We determined the total protein content in vitamin C, the total polyphenols and the activity of Polyphenol oxidases (PPOs enzyme on 32 samples of fresh Pleurotus ostreatus mushroom (top and bottom and subjected to heat treatments (blanching, boiling and freezing. The protein content was ranged between the values of 16.9 and 25.1g/ 100g and the Vitamin C content within the range of values presented 64.32-564.95 mg/100g. The polyphenol content results varied significantly in the analyzed samples varying between 1.887 – 7.667 mg GAE / 100 g vegetable product. The determination of the polyphenol oxidase enzyme responsible for enzymatically blackening of the fungus presented values in the range 0.274- 0.610mg / 100g.

  17. Taxonomical studies on endemic scorzonera pygmaea var. pygmaea and var. nutans stat. nov. (asteraceae) from turkey

    International Nuclear Information System (INIS)

    Koyuncu, O.; Kus, G.

    2014-01-01

    The taxonomic status of Scorzonera pygmaea var. pygmaea and var. nutans belonging to the tribe. cichoreae (Asteraceae). S. pygmaea samples were collected from Arayit mountain. We suggest that these two subspecies should be classified as varietes because of their morphological and anatomical characteristics, ecological and geographical similarities. Moreover being together in the same localities of these under species taxa supports our opinion, i.e. S. pygmaea Sibth. and Sm. var. pygmaea stat. nov. and S. pygmaea Sibth. and Sm. var. nutans (Czeczott) O. Koyuncu and Yaylac, stat. nov. (author)

  18. Enzymatic, Antioxidant, Antimicrobial, and Insecticidal Activities of Pleurotus pulmonarius and Pycnoporus cinnabarinus Grown Separately in an Airlift Reactor

    Directory of Open Access Journals (Sweden)

    Maura Téllez-Téllez

    2016-03-01

    Full Text Available Crude extract samples of Pleurotus pulmonarius and Pycnoporus cinnabarinus were taken during growth in liquid broth in an airlift reactor. Growth was monitored indirectly by sugar consumption and pH profile. During growth Pleurotus pulmonarius consumed glucose more slowly than Pycnoporus cinnabarinus, reaching a final pH of 8.0. In contrast, Pycnoporus cinnabarinus started consuming glucose faster from the beginning to the end with a pH of 3.6, suggesting the production of different metabolites while they grow in the same culture broth. Additionally, antioxidant activity, polyphenol and flavonoid contents, as well as laccase and hydrolase activities were quantified in the culture extracts during the fermentation. Pleurotus pulmonarius showed higher antioxidant activity than Pycnoporus cinnabarinus. Both fungi have a very low polyphenol and flavonoid content. Values of amylase and pectinase activities were similar in crude extracts of both fungi; however, cellulase, xylanase, invertase, and laccase activities showed higher levels in crude extract of Pleurotus pulmonarius. Antimicrobial and insecticidal activities were also evaluated in each crude extract. In fact, Pycnoporus cinnabarinus presented a very strong bacteriostatic and bactericidal effect against Escherichia coli and Staphylococcus aureus and reliably killed Diatraea magnifactella larvae, while Pleurotus pulmonarius did not showed any negative effect on the growth of these bacteria or larvae.

  19. "Var Teatre"--A Pioneer Turns 40.

    Science.gov (United States)

    Jones, Pamela L.

    1984-01-01

    Describes the Stockholm Municipal Youth and Children's theatre ("Var Teatre"), an institution of 14 theatres and attendant professional staff devoted exclusively to drama activities for children and teenagers. (PD)

  20. 4D-Var Developement at GMAO

    Science.gov (United States)

    Pelc, Joanna S.; Todling, Ricardo; Akkraoui, Amal El

    2014-01-01

    The Global Modeling and Assimilation Offce (GMAO) is currently using an IAU-based 3D-Var data assimilation system. GMAO has been experimenting with a 3D-Var-hybrid version of its data assimilation system (DAS) for over a year now, which will soon become operational and it will rapidly progress toward a 4D-EnVar. Concurrently, the machinery to exercise traditional 4DVar is in place and it is desirable to have a comparison of the traditional 4D approach with the other available options, and evaluate their performance in the Goddard Earth Observing System (GEOS) DAS. This work will also explore the possibility for constructing a reduced order model (ROM) to make traditional 4D-Var computationally attractive for increasing model resolutions. Part of the research on ROM will be to search for a suitably acceptable space to carry on the corresponding reduction. This poster illustrates how the IAU-based 4D-Var assimilation compares with our currently used IAU-based 3D-Var.

  1. Use of maize wastewater for the cultivation of the Pleurotus spp. mushroom and optimization of its biological efficiency.

    Science.gov (United States)

    Loss, Edenes; Royer, Andrea Rafaela; Barreto-Rodrigues, Marcio; Barana, Ana Claudia

    2009-07-30

    This study evaluated the Pleurotus spp. mushroom production process using an effluent from the maize agroindustrial process as a carbon and nitrogen source and as a wetting agent. A complete experimental design based on factorial planning was used to optimize the biological efficiency and evaluate the effect of the concentration of effluent, pH and species of Pleurotus. The results indicated that the effluent affects the biological efficiency for the production of both species of mushrooms at all pH values studied. The maximum biological efficiency predicted by the model (81.36%) corresponded to the point defined by the effluent contents (X(1)=1), pH (X(2)=-1) and fungus species (X(3)=1), specifically 50%, 5.0 and P. floridae, respectively. The results demonstrated that the effluent is a good alternative for the production of Pleurotus mushrooms.

  2. BIODEGRADATION OF SUGARCANE VINASSES BY THE WHITE-ROT FUNGI Pleurotus ostreatus IN A PACKED BED REACTOR

    Directory of Open Access Journals (Sweden)

    W.A. Tapie

    2016-08-01

    Full Text Available Sugarcane vinasses are considered a complex effluent because of its organic load, low pH, high temperature, and by the presence of recalcitrant substances such as melanoidins and phenolic compounds. The aim of this work was to evaluate the potential of the fungus Pleurotus ostreatus to carry out the biodegradation of sugarcane vinasses in a fixed-bed bioreactor. The experiments evidence the potential of the fungus Pleurotus ostreatus to carry out the decolorization (83%, the removal of the Chemical Oxygen Demand (COD=87% and the Biochemical Oxygen Demand (BOD5=92%, the reduction of total suspended solids (83% and volatile suspended solids (72% of vinasses. The technical simplicity of the proposed alternative as well as process performance reveals the potential of the fungus Pleurotus ostreatus for the treatment of sugarcane mill effluents.

  3. Weinig VVT-instellingen met VAR : onderzoek naar VAR's in Nederland

    NARCIS (Netherlands)

    Corina de Feijter; Pieterbas Lalleman

    V&VN is op zoek gegaan naar alle actieve Verpleegkundige en/of Verzorgende Adviesraden (VAR) in Nederland. Het blijkt dat in totaal 144 zorginstellingen (24%) een VAR hebben. Vooral in de VVT-sector is het aantal VAR’s laag: 13%.

  4. Molecular and physiological diversity among Verticillium fungicola var. fungicola and var. aleophilum

    NARCIS (Netherlands)

    Largeteau, M.L.; Baars, J.J.P.; Savoie, J.M.

    2006-01-01

    The genetic and physiological variability of Verticillium fungicola var. aleophilum responsible for Agaricus bisporus dry bubble disease in North America is well documented but little is known about the var. fungicola affecting European crops. Variability was assessed within this variety and

  5. Over de verspreiding binnen Nederland van Bidens connata var. fallax (Warnst.) Sherf en var. anomala Farw

    NARCIS (Netherlands)

    Ballintijn, Koos (J.) F.

    1997-01-01

    On the basis of recent observations and study of herbarium material it might tentatively be concluded that var. anomala (with erecto-patent barb hairs on achenes as well as on the bristles) is becoming more common since 1954 and might be locally replacing the hitherto more common var. fallax (with

  6. Application of SRAP in the genetic diversity of Tricholoma matsutake ...

    African Journals Online (AJOL)

    GREGORY

    2010-09-20

    Sep 20, 2010 ... intergenic spacer; PCR, polymerase chain reaction; FST, mean level of ... been developed for any of the matsutake mushrooms, ... SRAP was similar to RAPD, but it was a prefe- ..... belonging to the taxa Pleurotus eryngii (DC.

  7. Transport of radiocesium in mycelium and its translocation to fruitbodies of a saprophytic macromycete

    Energy Technology Data Exchange (ETDEWEB)

    Bazala, Michal A.; Golda, Katarzyna [Isotope Laboratory, Faculty of Biology, University of Warsaw, Miecznikowa 1, 02-096 Warsaw (Poland); Bystrzejewska-Piotrowska, Grazyna [Isotope Laboratory, Faculty of Biology, University of Warsaw, Miecznikowa 1, 02-096 Warsaw (Poland)], E-mail: byst@biol.uw.edu.pl

    2008-07-15

    We present a new protocol to study fluxes of radionuclides and other xenobiotics in saprophytic fungi. This simple method has successfully been used to evaluate transport of radiocesium in hyphae of Pleurotus eryngii and its translocation to fruitbodies.

  8. Hybrid VAR compensator with improved efficiency

    Directory of Open Access Journals (Sweden)

    V. V. Burlaka

    2015-03-01

    Full Text Available In modern electrical networks thyristor-switched capacitors (TSC are most used devices for VAR compensation. These devices don’t contain rotating parts and mechanical contacts, provide a stepwise control of reactive power and no generation of harmonics to the network. However, with the help of TSC it’s not possible to ensure smooth control of reactive power and capacitor banks (CB are exposed to the negative impact of higher harmonic components of the network voltage. Hybrid VAR compensator don’t have such drawbacks. It consists of active filter (AF and capacitor bank with discrete regulation. The main drawback of such systems is the necessity of accessing all six terminals of CB, while most of them are manufactured with three terminals, internally delta-connected. In the article, the topology and control system of hybrid VAR compensator free from beforementioned drawback, is proposed. The control system provides operating modes of overcompensation or undercompensation reactive power. VAR distribution regulator performs redistribution of reactive power between active filter and capacitor banks with the condition to minimize active filter’s power. Scheme of the hybrid VAR compensator, which includes a three-phase three-terminal delta-connected capacitor banks, is shown. Proposed approach allows to provide smooth control of reactive power, isolate the capacitor bank from harmonic currents and use a more effective low-voltage power components

  9. Crescimento micelial de Pleurotus ostreatus em resíduo de Simarouba amara Mycelial growth of Pleurotus ostreatus in Simarouba amara sawdust

    Directory of Open Access Journals (Sweden)

    Ceci Sales-Campos

    2008-11-01

    Full Text Available O objetivo deste trabalho foi avaliar o crescimento micelial do cogumelo Pleurotus ostreatus, cultivado na serragem da espécie madeireira Simarouba amara. Avaliaram-se: o efeito das temperaturas de 22, 25, 27, 30 e 35ºC sobre o crescimento micelial de P. ostreatus, nos meios malte-ágar 3% e SDA-MA (infusão da serragem de S. amara, enriquecida com farelo de soja-dextrose-ágar; e o crescimento micelial em substrato de cultivo de serragem de S. amara, com e sem suplementação de farelo de soja, a 25 e 30ºC. O melhor desenvolvimento de P. ostreatus ocorreu em meio malte-ágar 3% a 25ºC. A suplementação de farelo de soja na serragem de S. amara favorece o crescimento micelial.The objective of this work was to assess the mycelial growth of oyster mushroom (Pleurotus ostreatus cultivated in sawdust of Simarouba amara. Evaluations were made for the effect of temperatures 22, 25, 27, 30 and 35ºC on the mycelial growth of P. ostreatus in 3% malt-agar and SDA-MA (infusion of S. amara sawdust, enriched with soybean meal-dextrose-agar media; and the mycelial growth in cultivation substrate of S. amara sawdust, with and without supplementation of soybean meal, at 25 and 30ºC. The best development of P. ostreatus was in 3% malt-agar medium at 25ºC. Soybean meal supplementation on S. amara sawdust promoted mycelial growth.

  10. Laccase production by Pleurotus ostreatus and its application in synthesis of gold nanoparticles

    Directory of Open Access Journals (Sweden)

    Ahmed I. El-Batal

    2015-03-01

    Optimization of production conditions yielded an enzyme with activity over 32,450 IU/g of fermented substrate. Factorial design was capable of establishing the conditions that multiplied the activity of the enzyme several folds, consequently, reducing the cost of production. The enzyme was capable of decolorizing several dyes with over 80% reduction in color confirming the aromatic degrading capability of laccase. The enzyme was also used in the synthesis of gold nanoparticles, proving that laccase from Pleurotus ostreatus has a strong potential in several industrial applications.

  11. Haavelmo's Probability Approach and the Cointegrated VAR

    DEFF Research Database (Denmark)

    Juselius, Katarina

    Some key econometric concepts and problems addressed by Trygve Haavelmo and Ragnar Frisch are discussed within the general frame- work of a cointegrated VAR. The focus is on problems typical of time- series data such as multicollinearity, spurious correlation and regres- sion results, time......) the plausibility of the multivari- ate normality assumption underlying the VAR, (3) cointegration as a solution to the problem of spurious correlation and multicollinearity when data contain deterministic and stochastic trends, (4) the exis- tence of a universe, (5) the association between Frisch’s con...

  12. Rediscovery of Impatiens laevigata var. grandifolia (Balsaminaceae from NE India

    Directory of Open Access Journals (Sweden)

    R. Gogoi

    2013-12-01

    Full Text Available Impatiens laevigata var. grandifolia Hook.f. rediscovered after a lapse of 139 years from Lohit district of Arunachal Pradesh. Earlier it was known only – from its type locality in Manipur. Detailed morphological description of I. laevigata var. laevigata and var. grandifolia have been provided based on fresh plant collections.

  13. B. oleracea var. capitata monosomic and disomic alien

    Indian Academy of Sciences (India)

    Five monosomic alien addition lines (MAALs) of Brassica rapa ssp. pekinensis – B. oleracea var. capitata were obtained by hybridization and backcrossing between B. rapa ssp. pekinensis (female parent) and B. oleracea var. capitata. The alien linkage groups were identified using 42 B. oleracea var. capitata linkage ...

  14. Production of ligninolytic enzymes by solid state fermentation using Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Seyma Ozcirak Ergun

    2017-06-01

    Full Text Available Solid state fermentation (SSF stands out in the production of lignocellulolytic and other industrially important enzymes. SSF, an alternative culture method, has several advantages over the conventional submerged ones, like higher yields of enzymes. The production of ligninolytic enzymes, such as laccase (Lac, manganese peroxidase (MnP, lignin peroxidase (LiP and aryl alcohol oxidase (AAO by Pleurotus ostreatus (Jacq. Pleurotus Kumm. (MCC16 was investigated under SSF, which was performed using a support-substrate from potato peel waste (PPW. PPW as dry and fresh was pretreated with base to neutralize organic acids and distilled water. Chemical content of PPW was investigated. Ligninolytic enzyme production patterns were investigated during the growth of the organism for a period of 23 days at 25 °C in the stationary SSF using pretreated PPW. The highest Lac and MnP activities were determined in dry PPW, pretreated with distilled water as 6708.3 ± 75 U/L and 2503.6 ± 50 U/L on day 17, respectively. In addition, amylase and protease enzyme activities were detected under same conditions. According to the results, PPW has a potential as supports for ligninolytic enzyme production by P. ostreatus under SSF.

  15. Potential applications of the white rot fungus Pleurotus in bioregenerative life support systems

    Science.gov (United States)

    Manukovsky, N. S.; Kovalev, V. S.; Yu, Ch.; Gurevich, Yu. L.; Liu, H.

    Earlier we demonstrated the possibility of using soil-like substrate SLS for plant cultivation in bioregenerative life support systems BLSS We suggest dividing the process of SLS bioregeneration at BLSS conditions into two stages At the first stage plant residues should be used for growing of white rot fungus Pleurotus ostreatus Pleurotus florida etc The fruit bodies could be used as food Spent mushroom compost is carried in SLS and treated by microorganisms and worms at the second stage The possibility of extension of human food ration is only one of the reasons for realization of the suggested two-stage SLS regeneration scheme people s daily consumption of mushrooms is limited to 200 -250 g of wet weight or 20 -25 g of dry weight Multiple tests showed what is more important is that inclusion of mushrooms into the system cycle scheme contributes through various mechanisms to the more stable functioning of vegetative cenosis in general Taking into account the given experimental data we determined the scheme of mushroom module material balance The technological peculiarities of mushroom cultivation at BLSS conditions are being discussed

  16. UTILIZACIÓN DE CHONTADURO (Bactris gasipaes ENRIQUECIDA CON Pleurotus ostreatus EN POLLOS

    Directory of Open Access Journals (Sweden)

    JOSE MIGUEL CAMPO GAVIRIA

    2017-12-01

    Full Text Available In commercial poultry production, 70% of the production costs are related to feeding, this is a limiting factor affecting the profitability. This study aimed to evaluate the inclusion of chontaduro peel (Bactris gasipaes, enriched with the (Pleurotus ostreatus fungus, in the feeding of broilers; using a completely randomized design, with five treatments and three repetitions per treatment, with inclusion levels of 0,10% and 20% of chontaduro fruit peel, and 10 and 20% of chontaduro fruit peel enriched with the fungus (Pleurotus ostreatus. The productive behavior of the lot was determined by the feed intake, weight gain, feed conversion, skin pigmentation and cost benefit ratio of the portions. In this regard, no statistical differences (p <0,05 between treatments for all production variables evaluated were found, except for pigmentation, which was higher with levels of 20% of inclusion; as well as the positive effect in economic terms where the addition of a 20% of chontaduro peel flour enriched with the fungus is favorable because of the better cost-benefit ratio, without significantly affectingthe productive behavior.

  17. Effect of supplementing crop substrate with defatted pistachio meal on Agaricus bisporus and Pleurotus ostreatus production.

    Science.gov (United States)

    Pardo-Giménez, Arturo; Catalán, Luis; Carrasco, Jaime; Álvarez-Ortí, Manuel; Zied, Diego; Pardo, José

    2016-08-01

    This work assesses the agronomic performance of defatted pistachio meal, after oil extraction, as a nutritional substrate supplement when growing the mushroom species Agaricus bisporus (Lange) Imbach and Pleurotus ostreatus (Jacq.) P. Kumm. Materials were applied at different doses at spawning. Along with non-supplemented substrates, commercial nutritional supplements were used as controls. Proximate analysis of mushrooms is also considered. For the cultivation of champignon, defatted pistachio meal has provided larger mushrooms (unitary weight and cap diameter) with firmer texture and greater content in dry weight and protein, without significant alterations in quantitative parameters. For Pleurotus ostreatus, the supplement led to significant yield increase, even providing up to 34.4% of increment compared to non-supplementation with meal, reaching a biological efficiency of 129.9 kg dt(-1) , when applied to the 15 g kg(-1) compost dose. Supplementation has also been conducted to increase dry weight, protein and fibre within carpophores and to decrease the energy value. Defatted pistachio meal has similar or better results compared to the commercial supplements used as reference. Compost supplementation with defatted pistachio meal in A. bisporus concerns mainly the quantitative parameters (size, texture, dry weight and protein). Based on the results obtained, this technique has greater potential of development for P. ostreatus commercial crops, basically due to expected increases in production, with a direct impact on benefits and crop profitability. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

  18. Increase of the productivity of pleurotus ostreatus and their use in the petroleum biodegradation

    International Nuclear Information System (INIS)

    Cardona U, Fernando; Restrepo R, Dora Patricia; Nino, Pilar; Gonzalez, Raul

    2002-01-01

    This work is divided in two phases: in the first one a substrate what help to increase productivity of the white-rot fungi pleurotus ostreatus was looked, this was reached combining different kinds of substrates; in the second phase, the contribution in biodegradation of pleurotus ostreatus into the substrate obtained in the first phase and contaminated with heavy part of Cusiana oil was looked. The quantification in the augmentation of productivity was obtained taking the weight of fungi collected of each substrate and comparing it between the, until finding the best one. To quantify the biodegradation the method of determination of greases, oils, and hydrocarbons of petroleum in solids by Soxhlet method was used. The highest substrate in productivity was the mix of 70% of cotton quinine and 30% of hay with 3- 5% of seed, thiamine and vegetable oil. For the biodegradation study concentration less than 25% were used, at higher concentrations a partial inhibition was detected. When the substrate was contaminated with 10% of Cusiana oil the biodegradation was more efficient

  19. The effect of repair inhibitor on radiation damages of pleurotus ostreatus

    International Nuclear Information System (INIS)

    Yang Zongqu; Wang Bonan; Li Xuzhao

    1996-01-01

    The growth rate and enzyme activities significantly decreased when dikaryotic hypha of Pleurotus ostreatus were irradiated with γ-rays and subsequently treated with either caffeine or Na 2 -EDTA in comparison with γ-rays treatment alone. The inhibition effect of treatment with either caffeine or Na 2 -EDTA before irradiation was more obvious than that after irradiation. Treatment with either caffeine or Na 2 -EDTA could cause biological damages on hypha when the concentrations of caffeine and Na 2 -EDTA were up to 0.5 and 1.0 mg/ml respectively. It is suggested that either caffeine or Na 2 -EDTA be used to suppress the repair of radiation damage in order to increase mutation efficiency of Pleurotus ostreatus and that 0.2 mg/ml caffeine and 0.5 mg/ml Na 2 -EDTA might be the proper concentrations of treatment both before and after irradiation. The effect of caffeine is better than that of Na 2 -EDTA

  20. Teucrium pruinosum var. aksarayense var. nov. (Lamiaceae from Central Anatolia, Turkey

    Directory of Open Access Journals (Sweden)

    Muhittin Dinç

    2016-06-01

    Full Text Available Teucrium pruinosum var. aksarayense M. Dinç & S. Doğu (Lamiaceae, a new variety from Aksaray in Central Anatolia, is described and illustrated. The new variety is similar to the typical one in its calyx teeth uncinate at tip and subequal to the tube with conspicious midvein. It is readily distinguished from var. pruinosum by its general appearance, indumentum, and floral organ pigmentation. The map showing the distributions of the varieties was given.

  1. What is Orobanche haenseleri var. deludens Beck?

    Directory of Open Access Journals (Sweden)

    Pujadas Salvà, Antonio J.

    2004-12-01

    Full Text Available Orobanche haenseleri var. deludens Beck (Orobanchaceae, a problematic taxon described from Algeciras (Cádiz, S Spain is here identified after studying the original material of Wolley-Dod (BM 4476. It is considered to be the same as O. austrohispanica M.J.Y. Foley and better included, as a variety, under O. gracilis Sm. The new combination O. gracilis var. deludens (Beck A. Pujadas is consequently proposed. It mainly parasites Ulex (Fabaceae in the western Mediterranean Region (Iberian Peninsula and NW Africa.Se identifica Orobanche haenseleri var. deludens Beck (Orobanchaceae, un taxon conflictivo descrito de Algeciras (Cádiz, sur de España, a partir del análisis del material original de Wolley-Dod (BM 4476. Se considera que es lo mismo que O. austrohispanica M.J.Y. Foley, y se incluye en O. gracilis Sm. con rango varietal. Se propone la nueva combinación O. gracilis var. deludens (Beck A. Pujadas. Parasita principalmente a especies del género Ulex (Fabaceae en la Región Mediterránea Occidental (Península Ibérica y noroeste de África.

  2. Is Solanum ferox var. ferox (Solanaceae) extinct?

    NARCIS (Netherlands)

    Heiser, C.B.

    2001-01-01

    In 1995 I wrote letters to over 50 people (botanists, agricultural scientists, and former students of Indiana University) in south-eastern Asia trying to obtain a few seeds of Solanumferox L. var. ferox (S. involucratum Blume). I had over 25 replies, five of which included seeds, but none of the

  3. Anogeissus sericea var. nummalaria King ex Duthie

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 8; Issue 4. Anogeissus sericea var. nummalaria King ex Duthie. Flowering Trees Volume 8 Issue 4 April 2003 pp 89-89. Fulltext. Click here to view fulltext PDF. Permanent link: https://www.ias.ac.in/article/fulltext/reso/008/04/0089-0089. Resonance ...

  4. Var der noget kapløb?

    DEFF Research Database (Denmark)

    Gimpel, Denise; Nielsen, Bent

    2006-01-01

    Hvorfor faldt Kina bagud i kapløbet med Vesten?« spørger David Favrholdt i sidste nummer af Weekendavisen. Var der overhovedet noget kapløb? Forudsætter et kapløb ikke, at man har et fælles mål? Spørgsmålet implicerer, at Vesten har vundet og indplacerer samtidig klodens øvrige kulturer i forhold....... Som en af 1900-tallets største sinologer A. C. Graham skriver i sin bog Disputers of the Tao (La Salle, Ill., 1989) var den videnskabelige revolution »en unik og kompleks begivenhed, som var afhængig af en mangfoldighed af sociale og andre betingelser, herunder et sammenfald af opdagelser (græske......, indiske, kinesiske, arabiske, næsten ingen romerske) koncentreret om kombinationen af indiske tal og aritmetik og græsk logik og geometri« (s. 317). En unik begivenhed, som er forekommet én gang i verdenshistorien. Det giver derfor ingen mening at spørge, hvorfor det ikke skete andre steder. Hvis det var...

  5. Analysis list: Su(var)205 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Su(var)205 Adult,Embryo,Larvae + dm3 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3.../target/Su(var)205.1.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/target/Su(var)205.5.tsv http://dbarc...hive.biosciencedbc.jp/kyushu-u/dm3/target/Su(var)205.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/c...olo/Su(var)205.Adult.tsv,http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/colo/Su(var)205.Embryo.tsv,http:...//dbarchive.biosciencedbc.jp/kyushu-u/dm3/colo/Su(var)205.Larvae.tsv http://dbarchive

  6. Morphological and molecular identification of four Brazilian commercial isolates of Pleurotus spp. and cultivation on corncob

    Directory of Open Access Journals (Sweden)

    Nelson Menolli Junior

    2010-04-01

    Full Text Available The species of Pleurotus have great commercial importance and adaptability for growth and fructification within a wide variety of agro-industrial lignocellulosic wastes. In this study, two substrates prepared from ground corncobs supplemented with rice bran and charcoal were tested for mycelium growth kinetics in test tubes and for the cultivation of four Pleurotus commercial isolates in polypropylene bags. The identification of the isolates was based on the morphology of the basidiomata obtained and on sequencing of the LSU rDNA gene. Three isolates were identified as P. ostreatus, and one was identified as P. djamor. All isolates had better in-depth mycelium development in the charcoal-supplemented substrate. In the cultivation experiment, the isolates reacted differently to the two substrates. One isolate showed particularly high growth on the substrate containing charcoal.Espécies de Pleurotus têm grande importância comercial e adaptabilidade para crescimento e frutificação em uma ampla variedade de resíduos agro-industriais lignocelulósicos. Neste trabalho foram testados dois substratos à base de sabugo de milho triturado, suplementados com farelo de arroz e carvão vegetal, para avaliação da cinética de crescimento micelial em tubos de ensaio e produção em sacos de polipropileno, utilizando quatro isolados comerciais. O estudo taxonômico foi realizado com a análise da morfologia dos basidiomas obtidos em cultivo e pelo seqüenciamento do gene nLSU do DNAr, para certificar a identificação taxonômica. Os isolados tiveram melhor desenvolvimento micelial em profundidade no substrato suplementado com carvão vegetal. Em relação à produção, os isolados reagiram de formas distintas em função dos substratos, sendo significativamente melhor o substrato contendo carvão. Três isolados foram identificados como P. ostreatus e o outro foi identificado como P. djamor.

  7. Biodegradation of 2,4 dichlorophenol by Pleurotus ostreatus DSM 1833

    Directory of Open Access Journals (Sweden)

    Heloisa Helena Batista da Silva

    2009-12-01

    Full Text Available This work aimed to investigate the capacity of Pleurotus ostreatus DSM 1833 to degrade 2,4-dichlorophenol, important pollutant found in the wastewaters of the paper and cellulose industry. Using a factorial design 2², the concentrations of glucose and 2,4-dichlorophenol varied between 0 and 10g.L-1 and 5 and 30mg.L-1, respectively. The best global biodegradation rate was obtained using 30 mg.L-1 of 2,4- dichlorophenol in the absence of glucose. This culture medium was used for scaling up the process, resulting in a global biodegradation rate of 0.47mg.L-1.h-1. A comparative test between an inoculated medium and an abiotic control demonstrated that 54.1% of 2,4- dichlorophenol degradation could be attributed to the presence of P. ostreatus.A indústria de papel e celulose contribui para a contaminação ambiental devido aos resíduos gerados, especialmente, no processo de branqueamento da polpa Kraft, realizada com cloro. Basideomicetos saprófitas têm a capacidade de degradar compostos organoclorados como cloroligninas e clorofenóis. Este trabalho teve como objetivo investigar a capacidade de Pleurotus ostreatus DSM 1833 em degradar 2,4-diclorofenol, importante poluente encontrado nos efluentes da indústria de papel e celulose. Utilizando um planejamento fatorial 2², as concentrações de glicose e de 2,4-diclorofenol variaram entre 0 e 10 g.L-1 e 5 e 30 mg.L-1, respectivamente. A melhor taxa global de degradação foi obtida usando-se 30 mg.L-1 de 2,4-diclorofenol na ausência de glicose. Este meio de cultura foi utilizado para a ampliação da escala do processo, resultando em uma taxa global de biodegradação de 0,47 mg.L-1.h-1. Um teste comparativo entre o meio inoculado e o controle abiótico demonstrou que 54,1% da degradação do 2,4-diclorofenol pode ser atribuída à presença de Pleurotus ostreatus.

  8. Combined remediation of Cd-phenanthrene co-contaminated soil by Pleurotus cornucopiae and Bacillus thuringiensis FQ1 and the antioxidant responses in Pleurotus cornucopiae.

    Science.gov (United States)

    Jiang, Juan; Liu, Hongying; Li, Qiao; Gao, Ni; Yao, Yuan; Xu, Heng

    2015-10-01

    Remediation of soil co-contaminated with heavy metals and PAHs by mushroom and bacteria is a novel technique. In this study, the combined remediation effect of mushroom (Pleurotus cornucopiae) and bacteria (FQ1, Bacillus thuringiensis) on Cd and phenanthrene co-contaminated soil was investigated. The effect of bacteria (B. thuringiensis) on mushroom growth, Cd accumulation, phenanthrene degradation by P. cornucopiae and antioxidative responses of P. cornucopiae were studied. P. cornucopiae could adapt easily and grow well in Cd-phenanthrene co-contaminated soil. It was found that inoculation of FQ1 enhanced mushroom growth (biomass) and Cd accumulation with the increment of 26.68-43.58% and 14.29-97.67% respectively. Up to 100% and 95.07% of phenanthrene were removed in the bacteria-mushroom (B+M) treatment respectively spiked with 200mg/kg and 500mg/kg phenanthrene. In addition, bacterial inoculation alleviated oxidative stress caused by co-contamination with relative decreases in lipid peroxidation and enzyme activity, including malondialdehyde (MDA), superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD). This study demonstrated that the integrated remediation strategy of bacteria and mushroom is an effective and promising method for Cd-phenanthrene co-contaminated soil bioremediation. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Abiotic and biotic degradation of oxo-biodegradable plastic bags by Pleurotus ostreatus.

    Directory of Open Access Journals (Sweden)

    José Maria Rodrigues da Luz

    Full Text Available In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as substrates for P. ostreatus. We observed that physical treatment alone was not sufficient to initiate degradation. Instead, mechanical modifications and reduced titanium oxide (TiO2 concentrations caused by sunlight exposure triggered microbial degradation. The low specificity of lignocellulolytic enzymes and presence of endomycotic nitrogen-fixing microorganisms were also contributing factors in this process.

  10. Abiotic and biotic degradation of oxo-biodegradable plastic bags by Pleurotus ostreatus.

    Science.gov (United States)

    da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Bazzolli, Denise Mara Soares; Tótola, Marcos Rogério; Demuner, Antônio Jacinto; Kasuya, Maria Catarina Megumi

    2014-01-01

    In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as substrates for P. ostreatus. We observed that physical treatment alone was not sufficient to initiate degradation. Instead, mechanical modifications and reduced titanium oxide (TiO2) concentrations caused by sunlight exposure triggered microbial degradation. The low specificity of lignocellulolytic enzymes and presence of endomycotic nitrogen-fixing microorganisms were also contributing factors in this process.

  11. Effect of some heavy metals on the growth and development of Pleurotus tuber-regium.

    Directory of Open Access Journals (Sweden)

    Akpaja EO

    2012-02-01

    Full Text Available The effects of five heavy metals (cadmium, copper, mercury, lead and zinc on the growth and fruit body production in Pleurotus tuber-regium was investigated. Lead sulphate, zinc sulphate, copper sulphate, cadmium nitrate and mercury chloride were added to garden soil at concentrations of 0, 0.125, 0.25, 0.5, 1.0, and 2.0 mmol per 3 kg of soil. Sclerotia of the test mushroom were used to inoculate the artificially contaminated soil. Mercury prevented growth and fruit body production in P. tuber-regium. Fungal morphometry was greatly affected by lead. The heavy metal content in the fungal biomass complex increased with increase of heavy metal concentration in the soil. The highest concentration (183.06 mg/kg was found in zinc at 2 mmol/L.

  12. [The composition of volatile components of cepe (Boletus edulis) and oyster mushrooms (Pleurotus ostreatus)].

    Science.gov (United States)

    Misharina, T A; Mukhutdinova, S M; Zharikova, G G; Terenina, M B; Krikunova, N I

    2009-01-01

    The composition of aroma compounds in cooked and canned cepe (Boletus edulis) and in cooked oyster mushrooms (Pleurotus ostreatus) is studied using capillary gas chromatography and chromatography-mass spectrometry. It is found that unsaturated alcohols and ketones containing eight atoms of carbon determine the aroma of raw mushrooms and take part in the formation of the aroma of cooked mushrooms as well. The content of these compounds was the highest in canned cepes. In oyster mushrooms, the concentration of these alcohols and ketones was lower in comparison with cepes. The content of aliphatic and aromatic aldehydes was much higher in oyster mushrooms. Volatile aliphatic and heterocyclic Maillard reaction products and isomeric octenols and octenones formed the aroma of cooked and canned mushrooms.

  13. The potential of Pleurotus-treated olive mill solid waste as cattle feed.

    Science.gov (United States)

    Shabtay, Ariel; Hadar, Yitzhak; Eitam, Harel; Brosh, Arieh; Orlov, Alla; Tadmor, Yaakov; Izhaki, Ido; Kerem, Zohar

    2009-12-01

    The aims of the current study were to follow: (1) the capability of the edible mushroom Pleurotus ostreatus to degrade cell wall components and soluble phenols of the olive mill solid waste (OMSW), and improve it for ruminant nutrition (2) the fate of oil and the lipid-soluble compounds tocopherols, squalene and beta-sitosterol in the fermented OMSW. A significant decrease in oil and lipid-soluble compounds with a concomitant shift in the fatty acid profile and degradation of soluble phenols took place already after 14 d. The utilization of lipids by the fungus shifted the degradation of the structural carbohydrates to a later stage, and significantly reduced the metabolizable energy of the OMSW. We propose that edible fungi with reduced lipase activity would preserve the energy and health promoting ingredients of the oil, and force the fungus to degrade structural carbohydrates, thus improving its digestibility.

  14. Protoplast preparation from monokaryotic mycelium of Pleurotus sajor-caju using lysing enzyme

    International Nuclear Information System (INIS)

    Hassan Hamdani Mutaat; Mat Rasol Awang

    2004-01-01

    The objective of this study was to determine the optimum parameters of the factors influencing protoplast isolation from monokaryotic mycelium of Pleurotus sajor-caju using lysing enzyme from Trichoderma harzianurm. The study was conducted by manipulating the variables of the factors affecting protoplast isolation, such as age of mycelium culture, period for lysing of mycelium, concentration of lysing enzyme and concentration of osmotic stabilizer. The highest protoplast yield of 8.3 x 104 protoplast/ml was achieved when a 3-day P. sajor-caju mycelium, cultured statically, was incubated for 3 hours in a lytic mixture containing 7.5 mg/ml lysing enzyme and 1.2 M ammonium sulfate as osmotic stabilizer. This protoplast yield, however, is insufficient for regeneration and protoplast fusion works. (Author)

  15. Optimization of Arundo donax Saccharification by (Hemicellulolytic Enzymes from Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Rossana Liguori

    2015-01-01

    Full Text Available An enzymatic mixture of cellulases and xylanases was produced by Pleurotus ostreatus using microcrystalline cellulose as inducer, partially characterized and tested in the statistical analysis of Arundo donax bioconversion. The Plackett-Burman screening design was applied to identify the most significant parameters for the enzymatic hydrolysis of pretreated A. donax. As the most significant influence during the enzymatic hydrolysis of A. donax was exercised by the temperature (°C, pH, and time, the combined effect of these factors in the bioconversion by P. ostreatus cellulase and xylanase was analyzed by a 33 factorial experimental design. It is worth noting that the best result of 480.10 mg of sugars/gds, obtained at 45°C, pH 3.5, and 96 hours of incubation, was significant also when compared with the results previously reached by process optimization with commercial enzymes.

  16. Abiotic and Biotic Degradation of Oxo-Biodegradable Plastic Bags by Pleurotus ostreatus

    Science.gov (United States)

    da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Bazzolli, Denise Mara Soares; Tótola, Marcos Rogério; Demuner, Antônio Jacinto; Kasuya, Maria Catarina Megumi

    2014-01-01

    In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as substrates for P. ostreatus. We observed that physical treatment alone was not sufficient to initiate degradation. Instead, mechanical modifications and reduced titanium oxide (TiO2) concentrations caused by sunlight exposure triggered microbial degradation. The low specificity of lignocellulolytic enzymes and presence of endomycotic nitrogen-fixing microorganisms were also contributing factors in this process. PMID:25419675

  17. Antioxidant activity of the oyster mushroom, Pleurotus ostreatus, on CCl(4)-induced liver injury in rats.

    Science.gov (United States)

    Jayakumar, T; Ramesh, E; Geraldine, P

    2006-12-01

    This study was undertaken to investigate the putative antioxidant activity of the oyster mushroom Pleurotus ostreatus on CCl(4)-induced liver damage in male Wistar rats. Intraperitoneal administration of CCl(4) (2ml/kg) to rats for 4 days resulted in significantly elevated (pSALP) compared to controls. In the liver, significantly elevated levels (pSALP levels reverted to near normal, while the hepatic concentration of GSH, CAT, SOD and Gpx were significantly increased (p<0.05) and that of MDA significantly (p<0.05) lowered, when compared to CCl(4)-exposed untreated rats. Histopathological studies confirmed the hepatoprotective effect conferred by the extract of P. ostreatus. These results suggest that an extract of P. ostreatus is able to significantly alleviate the hepatotoxicity induced by CCl(4) in the rat.

  18. Biomass production of pleurotus sajor-caju by submerged culture fermentation

    International Nuclear Information System (INIS)

    Kausar, T.; Nasreen, Z.; Nadeem, M.; Baig, S.

    2006-01-01

    The effect of different carbon sources, namely, sawdust and powder of agro wastes (as such, or water soluble extracts), and inorganic/natural nitrogen sources on the biomass production of Pleurotus sajor-caju by submerged culture fermentation was studied. Supplementation of the fermentation medium with 2% molasses, 2% wheat spike powder, extract of 2% wheat spike powder, and com gluten meal resulted in 12.85, 10.85, 12.35 and 13.92 g/sub l/ biomass production of P. sajor-caju, respectively. The fungal hyphae biomass contained 8.28% moisture, 21.18% crude protein, 1.55% fat, 3.59% ash, 2.32% crude fibre, and 63.48% nitrogen-free extract. (author)

  19. Isolation and characterization of wild-type lipoxygenase LOX(Psa)1 from Pleurotus sapidus.

    Science.gov (United States)

    Plagemann, Ina; Krings, Ulrich; Berger, Ralf G

    2014-01-01

    The lipoxygenase LOX(Psa) 1 of Pleurotus sapidus, originally investigated because of its ability to oxidize (+)-valencene to the valuable grapefruit aroma (+)-nootkatone, was isolated from the peptidase-rich lyophilisate using a three-step purification scheme including preparative isoelectric focusing and chromatographic techniques. Nano-liquid chromatography electrospray ionization tandem mass spectrometry (nLC-ESI-MS/MS) of the purified enzyme and peptide mass fingerprint analysis gave 38 peptides of the lipoxygenase from P. sapidus. Nearly 50% of the 643 amino acids long sequence encoded by the cDNA was covered. Both terminal peptides of the native LOX(Psa) 1 were identified by de novo sequencing, and the postulated molecular mass of 72.5 kDa was confirmed. With linoleic acid as the substrate, the LOX(Psa)1 showed a specific activity of 113 U mg(-1) and maximal activity at pH 7.0 and 30 degrees C, respectively.

  20. A Structured VAR under Changing Monetary Policy

    DEFF Research Database (Denmark)

    Juselius, Katarina

    The empirical analysis is mainly concerned with the aggregate demand for money relation as part of a small macroeconomic system. Using the theory of cointegrated VAR models for I(2) data the long-run relationships in the data are first investigated, and the ML-estimates of the corresponding coint...... the effects of capital liberalization on the determination of money, income, prices, and interest rates in a small open economy...

  1. Morphology and mycelial growth rate of Pleurotus spp. strains from the Mexican mixtec region

    Science.gov (United States)

    Guadarrama-Mendoza, P.C.; del Toro, G. Valencia; Ramírez-Carrillo, R.; Robles-Martínez, F.; Yáñez-Fernández, J.; Garín-Aguilar, M.E.; Hernández, C.G.; Bravo-Villa, G.

    2014-01-01

    Two native Pleurotus spp. strains (white LB-050 and pale pink LB-051) were isolated from rotten tree trunks of cazahuate (Ipomoea murucoides) from the Mexican Mixtec Region. Both strains were chemically dedikaryotized to obtain their symmetrical monokaryotic components (neohaplonts). This was achieved employing homogenization time periods from 60 to 65 s, and 3 day incubation at 28 °C in a peptone-glucose solution (PGS). Pairing of compatible neohaplonts resulted in 56 hybrid strains which were classified into the four following hybrid types: (R1-nxB1-n, R1-nxB2-1, R2-nxB1-n and R2-nxB2-1). The mycelial growth of Pleurotus spp. monokaryotic and dikaryotic strains showed differences in texture (cottony or floccose), growth (scarce, regular or abundant), density (high, regular or low), and pigmentation (off-white, white or pale pink). To determine the rate and the amount of mycelium growth in malt extract agar at 28 °C, the diameter of the colony was measured every 24 h until the Petri dish was completely colonized. A linear model had the best fit to the mycelial growth kinetics. A direct relationship between mycelial morphology and growth rate was observed. Cottony mycelium presented significantly higher growth rates (p < 0.01) in comparison with floccose mycelium. Thus, mycelial morphology can be used as criterion to select which pairs must be used for optimizing compatible-mating studies. Hybrids resulting from cottony neohaplonts maintained the characteristically high growth rates of their parental strains with the hybrid R1-nxB1-n being faster than the latter. PMID:25477920

  2. EFFECT OF USING VARIOUS SUBSTRATES ON CULTIVATION OF PLEUROTUS SAJOR-CAJU

    Directory of Open Access Journals (Sweden)

    S. N. FASEHAH

    2017-04-01

    Full Text Available The unmanageable agricultural waste comprises of structural polymers, cellulose, hemicellulose and lignin can be led to pollutions, thus it can be used as a mushroom substrate. Lignocellulosic materials are most favorable feedstock as renewable and natural resource. Forestry and agricultural practices generated a large amount of ligncelluosic waste and promoted to serious problematic environmental pollution. It can be easily broken down by lignocellulotic enzymes. In this study, an attempt was made to evaluate the effect of various substrates on cultivation of Pleurotus sajor-caju. The substrates used in this study were tissue paper, rice husk ash and rubber sawdust. All of the substrates were added with rice bran and calcium carbonate (CaCO3. Then, the mixtures were transferred into plastic sized 8 cm × 4.5 cm and were pasteurized in the steamer for 1 hour at60 °C - 100 °C. After that they were cooled overnight at 25 °C - 30 °C. The spawn were inoculated into the bag and incubated in incubation room. The media bags were incubated until mycelium fully colonized and watering was done twice a day. The parameters studies were included spawn running, number of fruit body, total of stipe length, weight of fruit body and biological efficiency. Results showed that the fastest spawn running and highest number of fruits body, total of stipe length, weight of fruit body and biological efficiency are found using tissue paper substrates. In contrast the rubber sawdust showed the lowest values of spawn running, total of stipe length, weight of fruit body and biological efficiency. It can be concluded that the tissue paper is one of promising substrate which can be used in growing of Pleurotus sajor-caju due to lower cost and easy to purchase as compared to other substrates.

  3. [Use of ITS and ISSR markers in the molecular characterisation of Pleurotus djamor hybrid strains].

    Science.gov (United States)

    Aguilar Doroteo, Leticia; Zárate Segura, Paola Berenice; Villanueva Arce, Ramón; Yáñez Fernández, Jorge; Garín Aguilar, María Eugenia; Guadarrama Mendoza, Paula Cecilia; Valencia Del Toro, Gustavo

    Molecular characterisation of wild type Pleurotus species is important for germplasm conservation and its further use for genetic improvement. No molecular studies have been performed with monokaryons used for producing hybrid strains, either with the reconstituted strains obtained by pairing those monokaryons. The molecular characterisation of parental dikaryons, hybrid, and reconstituted strains as well as monokaryotic strains, is therefore of utmost importance. To carry out the molecular identification of Pleurotus djamor strains, i.e. dikaryotic wild type strains, hybrid strains, and the monokaryotic strains used for the hybrid formation. Five wild type strains of P. djamor from different states in Mexico were collected and molecularly identified by sequencing the ITS1-5.8-ITS2 region using ITS1 and ITS4 universal oligonucleotides. Four hybrid strains were obtained by pairing neohaplonts of two wild type strains selected. Six ISSR markers were used for the molecular characterisation of monokaryotic and dikaryotic strains. Using the ITS markers, an amplified product of 700bp was obtained in five wild type strains, with a 99-100% similarity with P. djamor. A total of 95 fragments were obtained using the ISSR markers, with 99% of polymorphism. Wild type strains were identified as P. djamor, and were clearly grouped with Mexican strains from other states of Mexico. ISSR markers allowed the generation of polymorphic bands in monokaryotic and dikaryotic strains, splitting both types of strains. The high degree of polymorphism indicates the genetic diversity of P. djamor, an advantage in mushroom production and in the improving of the species. Copyright © 2017 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.

  4. Effect of 60Co γ-irradiation on postharvest quality of pleurotus nebrodensis stored at 4 degree C

    International Nuclear Information System (INIS)

    Xiong Qiaoling; Huazhong Agriculture Univ., Wuhan; Xing Zengtao; Feng Zhiyong; Buswell, J.; Bian Yinbing

    2007-01-01

    The effect of γ-rays irradiation on the fresh-keeping of Pleurotus nebrodensis fruit bodies was reported in this paper. Fresh harvested fruit bodies of Pleurotus nebrodensis were irradiate at different doses levels (0.8-2.0 kGy) and stored for 22 days at 4 degree C. The fruit bodies treated with 1.2 kGy irradiation retained the highest soluble protein contents, and exhibited less postharvest softening throughout the storage period. Regression analysis plots of fruit body hardness versus soluble protein content were linear (t>0.05). Increases in mushroom cell permeability observed throughout the storage period were directly related to irradiation dose. Too higher dose(≥2.0 kGy) of irradiation will accelerate the nutrition degradation and rotting of the fruit bodies. (authors)

  5. Fungal treatment of lignocellulosic biomass: Importance of fungal species, colonization and time on chemical composition and in vitro rumen degradability

    NARCIS (Netherlands)

    Kuijk, van S.J.A.; Sonnenberg, A.S.M.; Baars, J.J.P.; Hendriks, W.H.; Cone, J.W.

    2015-01-01

    The aim of this study is to evaluate fungal treatments to improve in vitro rumen degradability of lignocellulosic biomass. In this study four selective lignin degrading fungi, Ganoderma lucidum, Lentinula edodes, Pleurotus eryngii and Pleurotus ostreatus, were used to pre-treat lignocellulosic

  6. Effect of fungal treatments of fibrous agricultural by-products on chemical composition and in vitro rumen fermentation and methane production

    NARCIS (Netherlands)

    Tuyen, D.V.; Phuong, H.N.; Cone, J.W.; Baars, J.J.P.; Sonnenberg, A.S.M.; Hendriks, W.H.

    2013-01-01

    Maize stover, rice straw, oil palm fronds and sugarcane bagasse were treated with the white-rot fungi Ceriporiopsis subvermispora, Lentinula edodes, Pleurotus eryngii, or Pleurotus ostreatus at 24 °C for 0–6 weeks. The fungi increased total gas production from oil palm fronds by 68–132%, but none of

  7. Secretion of laccase and manganese peroxidase by Pleurotus strains cultivate in solid-state using Pinus spp. sawdust

    Directory of Open Access Journals (Sweden)

    Marli Camassola

    2013-01-01

    Full Text Available Pleurotus species secrete phenol oxidase enzymes: laccase (Lcc and manganese peroxidase (MnP. New genotypes of these species show potential to be used in processes aiming at the degradation of phenolic compounds, polycyclic aromatic hydrocarbons and dyes. Hence, a screening of some strains of Pleurotus towards Lcc and MnP production was performed in this work. Ten strains were grown through solid-state fermentation on a medium based on Pinus spp. sawdust, wheat bran and calcium carbonate. High Lcc and MnP activities were found with these strains. Highest Lcc activity, 741 ± 245 U gdm-1 of solid state-cultivation medium, was detected on strain IB11 after 32 days, while the highest MnP activity occurred with strains IB05, IB09, and IB11 (5,333 ± 357; 4,701 ± 652; 5,999 ± 1,078 U gdm-1, respectively. The results obtained here highlight the importance of further experiments with lignocellulolytic enzymes present in different strains of Pleurotus species. Such results also indicate the possibility of selecting more valuable strains for future biotechnological applications, in soil bioremediation and biological biomass pre-treatment in biofuels production, for instance, as well as obtaining value-added products from mushrooms, like phenol oxidase enzymes.

  8. Tratamento do feno de braquiária pelo fungo Pleurotus ostreatus Pretreatment effects on fiber degradation of brachiaria hay by Pleurotus ostreatus fungus

    Directory of Open Access Journals (Sweden)

    Patrick Schmidt

    2003-12-01

    Full Text Available A inoculação de forragens com fungos lignocelulolíticos é uma opção para melhorar a qualidade destas sem adição de produtos químicos. O tratamento do substrato influencia a ação do fungo e a qualidade final do produto. Neste experimento, aplicaram-se quatro tratamentos (compostagem do feno inteiro, compostagem do feno picado, hidratação do feno em água fria e hidratação do feno em água quente a um feno de Brachiaria decumbens. Aos tratamentos seguiu-se inoculação com o fungo Pleurotus ostreatus e incubação por 35 dias, sob temperatura controlada. Usou-se o delineamento inteiramente casualizado, com quatro repetições e medidas repetidas. Amostras foram colhidas semanalmente para acompanhar a degradação do substrato, mediante a análise química do feno. Observou-se aumento linear, com o decorrer do tempo, no teor de proteína bruta (PB e na proporção de lignina na parede celular (LIG-FDN, e decréscimo linear nos valores de fibra em detergente neutro (FDN, celulose e hemicelulose. Não se observou efeito de tratamento no teor de FDA. Os tratamentos com compostagem apresentaram maiores valores de PB, lignina e LIG-FDN e menores de FDN e hemicelulose. Não se observou diferença entre os tratamentos com hidratação. O tratamento do feno de braquiária com o fungo propiciou degradação da fração fibrosa e aumento no teor de PB, com efeito mais intenso nos tratamentos que usaram compostagem. A ação do fungo foi mais efetiva sobre a hemicelulose que sobre os demais componentes da fibra.The innoculation of forages with lignocellulolytic fungi is an option for improving quality without adding chemical products. Substrate quality influences fungal activity and endproduct quality. The effects of four treatments (composting of whole hay, composting of chopped hay, soaking in cool water and soaking in hot water on a Brachiaria decumbens hay were evaluated. The treatments were followed by innoculation with Pleurotus ostreatus

  9. Survival and infectivity of Sarcoptes scabiei var. canis and var. hominis.

    Science.gov (United States)

    Arlian, L G; Runyan, R A; Achar, S; Estes, S A

    1984-08-01

    Sarcoptes scabiei var. canis served as a suitable model for the study of S. scabiei var. hominis survival. S. scabiei var. canis and var. hominis mites were found to survive off the host for 24 to 36 hours at room conditions (21 degrees C and 40% to 80% relative humidity [RH]), and the canine variety survived 19 days at 10 degrees C and 97% RH. Female mites survived decidedly longer than male mites at comparable conditions. Generally, higher RH values and lower temperatures favored survival, whereas higher temperature and lower RH led to early death. Most canine scabies mites that were held off the host for 36 hours at 75% RH and 22 degrees to 24 degrees C remained infective and penetrated when returned to the host. Live mites of the human variety that were recovered from bed linen slept on by infested patients would also penetrate a host after being held off a host for 96 hours in alternating 12-hour periods of room conditions and refrigeration. Penetration required less than 30 minutes for all life stages of both varieties, and it was accomplished by a mite secretion that dissolved the host tissue. Dislodged mites, particularly those in close proximity to the source, can be a likely source of infestation.

  10. Pleurotus ostreatus

    African Journals Online (AJOL)

    badr

    2011-11-07

    Nov 7, 2011 ... Evaluation of nutritional substrate and physical stress. (gamma ... cows. Lavi et al. (2010) stated that mushroom poly- saccharides are potent substances that exhibit anti-tumor ...... A brief history of heat, chemical and radiation.

  11. Cardenolide glycosides from Elaeodendron australe var. integrifolium.

    Science.gov (United States)

    Butler, Mark S; Towerzey, Leanne; Pham, Ngoc B; Hyde, Edward; Wadi, Sao Khemar; Guymer, Gordon P; Quinn, Ronald J

    2014-02-01

    Extracts from dried leaf and stems of Elaeodendron australe var. integrifolium (Celastraceae) collected in South East Queensland, Australia, were active in an assay that measured Ca(2+) driven expression of IL-2/luciferase designed to identify inhibitors of the ICRAC channel. Bioassay-guided isolation using C18 and polyamide column chromatography, HPLC (Phenyl and C18) and centrifugal partition chromatography (CPC) led to the isolation of digitoxigenin (1) and three cardenolide glycosides, glucoside 2, quinovoside 3 and the new natural product xyloside 4, as the active components with low nM activity in the reporter assay. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. VAR IPP-IPC Model Simulation

    Directory of Open Access Journals (Sweden)

    Juan P. Pérez Monsalve

    2014-12-01

    Full Text Available This work analyzed the relationship of the two main Price indicators in the Colombian economy, the IPP and the IPC. For this purpose, we identified the theory comprising both indexes to then develop a vector autoregressive model, which shows the reaction to shocks both in itself as in the other variable, whose impact continues propagating in the long term. Additionally, the work presents a simulation of the VAR model through the Monte Carlo method, verifying the coincidence in distributions of probability and volatility levels, as well as the existence correlation over time

  13. Quercetin - A Flavonoid Compound from Sarcopyramis bodinieri var ...

    African Journals Online (AJOL)

    DAPI staining and PARP SDS-PAGE tests showed 60 μM quercetin could induce potential apoptotic activity in HepG2 liver cancer cells. Conclusion: Quercetin was the major cytotoxicity constituent in S. bodinieri var. delicate. Keywords: Apoptotic activity, Quercetin, Sarcopyramis bodinieri var. delicate, HepG2 liver cancer ...

  14. Growth and provenance variation of Pinus caribaea var ...

    African Journals Online (AJOL)

    CAMCORE has visited 33 populations of Pinus caribaea var. hondurensis in Belize, Guatemala, Honduras, El Salvador, Nicaragua, and Quintana Roo, Mexico. Seed collections have been made in 29 provenances from 1, 325 mother trees. A total of 21 provenances and sources of Pinus caribaea var. hondurensis were ...

  15. Larvicidal Activity of Isodon japonicus var. glaucocalyx (Maxim ...

    African Journals Online (AJOL)

    HP

    Purpose: To determine the larvicidal activity of the essential oil derived from Isodon japonicus var. ... Methods: The essential oil of I. japonicus var. glaucocalyx aerial parts was obtained by ..... µg/mL; G. silvatica leaves, LC50 = 117.9 µg/mL.

  16. ESTIMASI NILAI VaR PORTOFOLIO MENGGUNAKAN FUNGSI ARCHIMEDEAN COPULA

    Directory of Open Access Journals (Sweden)

    AULIA ATIKA PRAWIBTA SUHARTO

    2017-01-01

    Full Text Available Value at Risk explains the magnitude of the worst losses occurred in financial products investments with a certain level of confidence and time interval. The purpose of this study is to estimate the VaR of portfolio using Archimedean Copula family. The methods for calculating the VaR are as follows: (1 calculating the stock return; (2 calculating descriptive statistics of return; (3 checking for the nature of autocorrelation and heteroscedasticity effects on stock return data; (4 checking for the presence of extreme value by using Pareto tail; (5 estimating the parameters of Achimedean Copula family; (6 conducting simulations of Archimedean Copula; (7 estimating the value of the stock portfolio VaR. This study uses the closing price of TLKM and GGRM. At 90% the VaR obtained using Clayton, Gumbel, Frank copulas are 0.9562%, 1.0189%, 0.9827% respectively. At 95% the VaR obtained using Clayton, Gumbel, Frank copulas are 1.2930%, 1.2522%, 1.3152% respectively. At 99% the VaR obtained using Clayton, Gumbel, Frank copulas are 2.0327%, 1.9164%, is 1.8678% respectively. In conclusion estimation of VaR using Clayton copula yields the highest VaR.

  17. Een nieuwe naam voor Arenaria serpyllifolia L. var. macrocarpa Lloyd

    NARCIS (Netherlands)

    Gutermann, W.; Mennema, J.

    1983-01-01

    The name Arenaria serpyllifoiia L. var. macrocarpa Lloyd is illegitimate, because of the existence of the earlier non-synonymous A. serpyllifolia0 macrocarpa Godron. As on the level of variety no other name is available, we call the taxon A renaria serpylli/olia L. var. Iloydn (Jord.) Gutermann et

  18. VaR Methodology Application for Banking Currency Portfolios

    Directory of Open Access Journals (Sweden)

    Daniel Armeanu

    2007-02-01

    Full Text Available VaR has become the standard measure that financial analysts use to quantify market risk. VaR measures can have many applications, such as in risk management, to evaluate the performance of risk takers and for regulatory requirements, and hence it is very important to develop methodologies that provide accurate estimates. In particular, the Basel Committee on Banking Supervision at the Bank for International Settlements imposes to financial institutions such as banks and investment firms to meet capital requirements based on VaR estimates. In this paper we determine VaR for a banking currency portfolio and respect rules of National Bank of Romania regarding VaR report.

  19. Pleurotus ostreatus and Pleurotus pulmonarius

    African Journals Online (AJOL)

    STORAGESEVER

    2010-03-15

    Mar 15, 2010 ... was maintained on plate of potato dextrose agar (PDA). Degradation of ... 40% concentrate feed (40% corn, 10% wheat offal, 10% palm kernel cake, 20% ... meal) and 60% Pannicum maximum at 5% body weight. The rumen.

  20. Production of exopolysaccharides in submerged cultures of gamma irradiation pleurotus ostreatus

    International Nuclear Information System (INIS)

    Khalaf, M.A.; Atia, A.I.

    2009-01-01

    Mushrooms have become attractive as a functional food and as a source for the development of drugs and nutraceuticals. Pleurotus ostreatus is considered as the best among them. The exopolysaccharides (EPS) of mushrooms demonstrated a strong antitumor and antioxidant action. However, there is little information available in the literature about the optimization of fermentation conditions for production of EPS by P. ostreatus. So, the effect of medium composition and fermentation parameters on mycelial growth and EPS production by gamma irradiated isolate of P. ostreatus were investigated in shake-flask cultures. The economical optimum fermentation parameters for the highest EPS production 5.73 g/l and mycelial growth rate 11.8 g/l were achieved at initial ph 6, cultivation temperature 28 C(degree), 20 g/l sucrose, 4 g/l yeast extract, 50 ml of medium working volume in a 250 ml flask, and 6% (v/v) of inoculum size after 10 and 12 days, respectively. EPS produced, in this study, showed strong antioxidant activity (96.3%) at concentration 10 mg/ml.

  1. Evaluation of Antioxidant, Anti-cholinesterase, and Anti-inflammatory Effects of Culinary Mushroom Pleurotus pulmonarius.

    Science.gov (United States)

    Nguyen, Trung Kien; Im, Kyung Hoan; Choi, Jaehyuk; Shin, Pyung Gyun; Lee, Tae Soo

    2016-12-01

    Culinary mushroom Pleurotus pulmonarius has been popular in Asian countries. In this study, the anti-oxidant, cholinesterase, and inflammation inhibitory activities of methanol extract (ME) of fruiting bodies of P. pulmonarius were evaluted. The 1,1-diphenyl-2-picryl-hydrazy free radical scavenging activity of ME at 2.0 mg/mL was comparable to that of butylated hydroxytoluene, the standard reference. The ME exhibited significantly higher hydroxyl radical scavenging activity than butylated hydroxytoluene. ME showed slightly lower but moderate inhibitory activity against acetylcholinesterase (AChE) and butyrylcholinesterase than galantamine, a standard AChE inhibitor. It also exhibited protective effect against cytotoxicity to PC-12 cells induced by glutamate (10~100 µg/mL), inhibitory effect on nitric oxide (NO) production and inducible nitric oxide synthase protein expression in lipopolysaccharide-stimulated RAW 264.7 macrophages, and carrageenan-induced paw edema in a rat model. High-performance liquid chromatography analysis revealed the ME of P. pulmonarius contained at least 10 phenolic compounds and some of them were identified by the comparison with known standard phenolics. Taken together, our results demonstrate that fruiting bodies of P. pulmonarius possess antioxidant, anti-cholinesterase, and inflammation inhibitory activities.

  2. Maize Residue as a Viable Substrate for Farm Scale Cultivation of Oyster Mushroom (Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Abena O. Adjapong

    2015-01-01

    Full Text Available In the search for alternatives to sawdust as growing media in commercial mushroom cultivation, three organic substrates obtainable as crop residue, maize husk, maize cob, and maize stalk, with each being supplemented with rice bran, were evaluated as growth media for the oyster mushroom, Pleurotus ostreatus (Kummer. For the tested alternatives to sawdust, the harvested weight of fruiting bodies that sprouted on a kilogram maize husk media per crop (32.99 g was the highest. Sawdust media supported significantly (P<0.001 heavier fruiting bodies (42.18 than the maize residues. The peak mushroom harvests for the various substrates were obtained between the first and seventh fruiting body flushes. The biological efficiency of the substrates, which measured usable nutrients indicated that maize stalk supplemented with rice bran, was 39% compared to that of the sawdust media (60%. The maize husk media and the maize cob media had biological efficiencies of 32% and 9.5%, respectively. These results indicate that two of the tested growing media (maize stalk or husk produced mushrooms with yield characteristics that were comparable to the well-used sawdust in the cultivation of oyster mushrooms. The environmental and economic parameters involved in the use and carting of sawdust make these on-farm crop residues a viable alternative for mushroom cultivation in especially nonforest zones of Ghana.

  3. Sesquiterpenoids with PTP1B Inhibitory Activity and Cytotoxicity from the Edible Mushroom Pleurotus citrinopileatus.

    Science.gov (United States)

    Tao, Qiao-Qiao; Ma, Ke; Bao, Li; Wang, Kai; Han, Jun-Jie; Wang, Wen-Zhao; Zhang, Jin-Xia; Huang, Chen-Yang; Liu, Hong-Wei

    2016-05-01

    One new perhydrobenzannulated 5,5-spiroketal sesquiterpene, pleurospiroketal F (1), as well as six new modified bisabolene sesquiterpenes pleurotins A-F (2-7) were isolated from solid-state fermentation of Pleurotus citrinopileatus. The structures of compounds 1-7 were determined by NMR and MS spectroscopic analysis. The absolute configuration of 1 was determined by X-ray diffraction analysis, while the absolute configurations of 3-7 were assigned using the in situ dimolybdenum circular dichroism method and circular dichroism data comparison. Protein tyrosine phosphatase 1B plays a crucial role as a negative regulator of the insulin-dependent signal cascades. Therefore, the protein tyrosine phosphatase 1B inhibitor can be used for treating type 2 diabetes mellitus and obesity. Compounds 2 and 6 showed moderate inhibitory effects on protein tyrosine phosphatase 1B with IC50 s of 32.1 µM and 30.5 µM, respectively. The kinetic study confirmed compound 2 to be a noncompetitive inhibitor. Compounds 1-7 did not show cytotoxic activity against cancer cell lines (IC50 > 50 µM). Georg Thieme Verlag KG Stuttgart · New York.

  4. Biochemical Characteristics of Three Laccase Isoforms from the Basidiomycete Pleurotus nebrodensis

    Directory of Open Access Journals (Sweden)

    Xianghe Yuan

    2016-02-01

    Full Text Available The characterization of three laccase isoforms from Pleurotus nebrodensis is described. Isoenzymes Lac1, Lac2 and Lac3 were purified to homogeneity using ion exchange chromatography on DEAE-cellulose, CM-cellulose and Q-Sepharose and a gel filtration step on Superdex 75. The molecular weights of the purified laccases were estimated to be 68, 64 and 51 kDa, respectively. The isoenzymes demonstrated the same optimum pH at 3.0 but slightly different temperature optima: 50–60 °C for Lac1 and Lac3 and 60 °C for Lac2. Lac2 was always more stable than the other two isoforms and exposure to 50 °C for 120 min caused 30% loss in activity. Lac2 was relatively less stable than the other two isoforms when exposed to the pH range of 3.0–8.0 for 24 h, but inactivation only occurred initially, with around 70% residual activity being maintained during the whole process. Oxidative ability towards aromatic compounds varied substantially among the isoforms and each of them displayed preference toward some substrates. Kinetic constants (Km, Kcat were determined by using a 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid diammonium salt (ABTS assay, with Lac3 showing the best affinity and Lac2 displaying the highest catalytic efficiency. Amino acid sequences from peptides derived from digestion of isoenzymes showed great consistency with laccases in the databases.

  5. Effect of agroforestry residues partially biodegraded by pleurotus ostreatus (pleurotaceae) on tomato seedlings development

    International Nuclear Information System (INIS)

    Luna Fontalvo, Jorge Alberto; Cordoba Lopez, Laura Sofia; Gil Pertuz, Karina Isabel; Romero Borja, Isaac Manuel

    2013-01-01

    It was evaluated the development of tomato seedlings (plant bioindicator of toxicity) in soils with sawdust and rice husk partially biodegraded by Pleurotus ostreatus in greenhouse conditions. Both organic compounds (carbon, cellulose, lignin, extractives, and organic matter), and inorganic compounds (nitrogen, phosphorus and pH) were determined, before and after fungus inoculation on sawdust and rice husk. Mixtures were held of each substrate with a nutrient poor soil in equal proportions (1:1) and the moisture content was determined. The experiment consisted of a completely randomized, with two groups of six treatments for each substrate, and 30 days later, parameters of growth and development were identified. biodegraded substrates presented low C, N and P. bsa + sf treatment (biodegraded sawdust + fertilized soil) presented the best results in the number of leaves (12.9), plant height (25.94 cm), root length (5.92 cm), dry weight (0.138 g), and fresh weight (1.012 g). bsa + sf substrate can work as favorable substrate for growing tomato seedlings, bsa + sf substrate can work as favorable substrate for growing of tomato seedlings, since it provides the nutrients necessary for a good growth. Plants in rice bran did not grow adequately for transplanting.

  6. Selective adhesion of wastewater bacteria to Pleurotus ostreatus mycelium in a trickle-bed bioreactor

    Directory of Open Access Journals (Sweden)

    Čeněk Novotný

    2016-07-01

    Full Text Available The work is focused on spontaneous colonization of fungal mycelium by invading microorganisms in a trickle-bed fungal bioreactor operating under semi-sterile conditions. Pleurotus ostreatus was grown under the flow of synthetic wastewater containing activated sludge bacteria and the microbial consortium developed in the reactor was characterized. Genotype and phenotype profile of the reactor-invading, bacterial consortium was clearly distinctive from that of the original activated sludge. The bacterial consortium from the reactor contained a higher portion of bacteria capable of cellobiose utilization and a small amount of bacteria with the ability to utilize benzoic acids. The invading bacteria had no effect on the dye decolorization performance of the fungal reactor. Five bacterial strains colonizing P. ostreatus reactor cultures were isolated and identified as species of the genera Pseudomonas and Bacillus. Except for Bacillus cereus all strains displayed a potential to inhibit fungal growth on solid media (14 to 51 % inhibition which was comparable or higher than that of the reference bacterial strains. The pH- and media composition-dependence of the growth inhibition was demonstrated.

  7. Biodegradation of endocrine disruptors in urban wastewater using Pleurotus ostreatus bioreactor.

    Science.gov (United States)

    Křesinová, Zdena; Linhartová, Lucie; Filipová, Alena; Ezechiáš, Martin; Mašín, Pavel; Cajthaml, Tomáš

    2018-07-25

    The white rot fungus Pleurotus ostreatus HK 35, which is also an edible industrial mushroom commonly cultivated in farms, was tested in the degradation of typical representatives of endocrine disrupters (EDCs; bisphenol A, estrone, 17β-estradiol, estriol, 17α-ethinylestradiol, triclosan and 4-n-nonylphenol); its degradation efficiency under model laboratory conditions was greater than 90% within 12 days and better than that of another published strain P. ostreatus 3004. A spent mushroom substrate from a local farm was tested for its applicability in various batch and trickle-bed reactors in degrading EDCs in model fortified and real communal wastewater. The reactors were tested under various regimes including a pilot-scale trickle-bed reactor, which was finally tested at a wastewater treatment plant. The result revealed that the spent substrate is an efficient biodegradation agent, where the fungus was usually able to remove about 95% of EDCs together with suppression of the estrogenic activity of the sample. The results showed the fungus was able to operate in the presence of bacterial microflora in wastewater without any substantial negative effects on the degradation abilities. Finally, a pilot-scale trickle-bed reactor was installed in a wastewater treatment plant and successfully operated for 10days, where the bioreactor was able to remove more than 76% of EDCs present in the wastewater. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. A novel stirrer design and its application in submerged fermentation of the edible fungus Pleurotus ostreatus.

    Science.gov (United States)

    Zhu, Hu; Sun, Jiao; Tian, Baozhen; Wang, Honglin

    2015-03-01

    In this study, a straight diagonal-pitched blade stirrer was designed, built and characterized in a 5-L fermenter. Compared with the six straight blade Rushton turbine, the power consumption of the new stirrer is lower at a given speed under conditions of no ventilation. The oxygen transference is poorer at the same agitation speed in the cultivation conditions and scales investigated, which confirms that the shear stress of the new stirrer is lower and the gas dispersion is weaker. The new stirrer was installed in a 5-L bioreactor and evaluated in submerged fermentation of the edible fungus Pleurotus ostreatus. The results showed that the maximum dry weight of mycelium is increased by 47 % and reached 7.47 g/L, and the maximum laccase activity is increased by 15 % up to 2,277 U/L. Glucose consumption was also found to be relatively faster. The power consumption is 2.8 % lower than that of the Rushton turbine.

  9. Polluting macrophytes Colombian lake Fúquene used as substrate by edible fungus Pleurotus ostreatus.

    Science.gov (United States)

    Martínez-Nieto, Patricia; García-Gómez, Gustavo; Mora-Ortiz, Laura; Robles-Camargo, George

    2014-01-01

    Invasive aquatic plants from Lake Fúquene (Cundinamarca, Colombia), water hyacinth (Eichhornia crassipes C. Mart.) and Brazilian elodea (Egeria densa Planch.) have been removed mechanically from the lake and can be used for edible mushrooms production. The growth of the oyster mushroom (Pleurotus ostreatus) on these aquatic macrophytes was investigated in order to evaluate the possible use of fruiting bodies and spent biomass in food production for human and animal nutrition, respectively. Treatments included: water hyacinth, Brazilian elodea, sawdust, rice hulls and their combinations, inoculated with P. ostreatus at 3%. Water hyacinth mixed with sawdust stimulated significantly fruiting bodies production (P = 3.3 × 10(-7)) with 71% biological efficacy, followed by water hyacinth with rice husk (55%) and elodea with rice husk (48%), all of these have protein contents between 26 and 47%. Loss of lignin (0.9-21.6%), cellulose (3.7-58.3%) and hemicellulose (1.9-53.8%) and increment in vitro digestibility (16.7-139.3%) and reducing sugars (73.4-838.4%) were observed in most treatments. Treatments spent biomass presented Relative Forage Values (RFV) from 46.1 to 232.4%. The results demonstrated the fungus degrading ability and its potential use in aquatic macrophytes conversion biomass into digestible ruminant feed as added value to the fruiting bodies production for human nutrition.

  10. Biosorption of malachite green from aqueous solutions by Pleurotus ostreatus using Taguchi method

    Science.gov (United States)

    2014-01-01

    Dyes released into the environment have been posing a serious threat to natural ecosystems and aquatic life due to presence of heat, light, chemical and other exposures stable. In this study, the Pleurotus ostreatus (a macro-fungus) was used as a new biosorbent to study the biosorption of hazardous malachite green (MG) from aqueous solutions. The effective disposal of P. ostreatus is a meaningful work for environmental protection and maximum utilization of agricultural residues. The operational parameters such as biosorbent dose, pH, and ionic strength were investigated in a series of batch studies at 25°C. Freundlich isotherm model was described well for the biosorption equilibrium data. The biosorption process followed the pseudo-second-order kinetic model. Taguchi method was used to simplify the experimental number for determining the significance of factors and the optimum levels of experimental factors for MG biosorption. Biosorbent dose and initial MG concentration had significant influences on the percent removal and biosorption capacity. The highest percent removal reached 89.58% and the largest biosorption capacity reached 32.33 mg/g. The Fourier transform infrared spectroscopy (FTIR) showed that the functional groups such as, carboxyl, hydroxyl, amino and phosphonate groups on the biosorbent surface could be the potential adsorption sites for MG biosorption. P. ostreatus can be considered as an alternative biosorbent for the removal of dyes from aqueous solutions. PMID:24620852

  11. Characterization and in vitro antioxidant activities of polysaccharides from Pleurotus ostreatus.

    Science.gov (United States)

    Zhang, Yunxia; Dai, Ling; Kong, Xiaowei; Chen, Liangwen

    2012-10-01

    Two polysaccharide fractions (PSPO-1a and PSPO-4a) were isolated from the fruiting bodies of Pleurotus ostreatus using ethanol precipitation, anion-exchange chromatography and gel permeation chromatography. Both fractions were heteropolysaccharide containing protein and uronic acid. PSPO-1a was composed of mannose, glucose, galactose, xylose and rhamnose with a molar ratio of 2.47:0.91:1.00:1.66:3.87. PSPO-4a was composed of only three monosaccharides: rhamnose, mannose and galactose with a molar ratio of 0.92:2.69:1.00. The average molecular weight of PSPO-1a and PSPO-4a determined by HPLC were estimated to be 1.8 × 10(4)Da and 1.1 × 10(6)Da respectively. The in vitro tests revealed that two polysaccharides were natural potential antioxidant. Both polysaccharides presented stronger DPPH radical and superoxide anion radical scavenging activity with increasing concentrations, but less effective on scavenging hydroxyl radical. Compared with PSPO-4a, PSPO-1a was the more effective free-radical scavenger. In conclusion, the two polysaccharides may be useful as a naturally potential antioxidant agent for application in food and medicinal fields. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Heterologous production of the stain solving peptidase PPP1 from Pleurotus pulmonarius.

    Science.gov (United States)

    Leonhardt, Robin-Hagen; Krings, Ulrich; Berger, Ralf G; Linke, Diana

    2016-05-01

    A novel stain solving subtilisin-like peptidase (PPP1) was identified from the culture supernatant of the agaricomycete Pleurotus pulmonarius. It was purified to homogeneity using a sequence of preparative isoelectric focusing, anion exchange and size exclusion chromatography. Peptides were identified by ab initio sequencing (nLC-ESI-QTOF-MS/MS), characterizing the enzyme as a member of the subtilase family (EC 3.4.21.X). An expression system was established featuring the pPIC9K vector, an alternative Kozak sequence, the codon optimized gene ppp1 gene without the native signal sequence with C-terminal hexa-histidine tag, and Pichia pastoris GS115 as expression host. Intracellular active enzyme was obtained from cultivations in shake flasks and in a five liter bioreactor. With reaction optima of 40 °C and a pH > 8.5, considerable bleaching of pre-stained fabrics (blood, milk and India ink), and the possibility of larger-scale production, the heterologous enzyme is well suitable for detergent applications, especially at lower temperatures as part of a more energy- and cost-efficient washing process. Showing little sequence similarity to other subtilases, this unique peptidase is the first subtilisin-like peptidase from Basidiomycota, which has been functionally produced in Pichia pastoris.

  13. Chemical composition of Pleurotus pulmonarius (Fr. Quél., substrates and residue after cultivation

    Directory of Open Access Journals (Sweden)

    Silva Sueli Oliveira

    2002-01-01

    Full Text Available The cultivation of Pleurotus pulmonarius was carried out on different substrate: cotton waste (A leaves of Cymbopogon citratus (B and leaves of Panicum maximum Jacq. (C. The mushroom had a varied chemical composition; nevertheless they contained a good composition for to be used as a good source of protein for human kind. The results showed the higher protein content (29.19% and fibre (9.0% for the mushroom that were cultivated on cotton peel. The substrate composition and the residue composition after the mushroom harvest were: Protein for the substrate "A" (10.63% and 9.35%, "B" (7.87% and 4.24% and "C" (7.55% and 5.90 %; Lipids "A" (4.17% and 2.03%, "B"(2.77% and 3.20% and "C" (0.91% and 2.05%; Fibres "A" (49.02% and 37.02%, "B" (28.40% and 23.26% and "C" (37.50% and 26.66% respectively. The substrate "A" showed 0.048% of iron and "C" 0.14% of magnesium, 0.31% of potassium and 0.26% of calcium. In the substrate "B" the quantity of the minerals were very low in comparison to the other substrates. The residues after the harvest of mushroom could be used as fertiliser or as complement in the composition for animal feed.

  14. Radiosensitivity study and radiation effects on morphology characterization of grey oyster mushroom Pleurotus sajor-caju

    Energy Technology Data Exchange (ETDEWEB)

    Rashid, Rosnani Abdul; Awang, Mat Rasol; Mohamad, Azhar; Mutaat, Hassan Hamdani; Maskom, Mohd Meswan [Bioprocess Group, Agrotechnology and Biosciences Division, Malaysian Nuclear Agency, Bangi 43600, Selangor (Malaysia); Daud, Fauzi; Senafi, Sahidan [School of Bioscience and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, Bangi 43600, Selangor (Malaysia)

    2014-09-03

    Radiosensitive dosage and morphology characterization of irradiated grey oyster mushroom Pleurotus sajor-caju by gamma rays was investigated due to effects of irradiation. In order to establish the effect, mycelium of P. sajor-caju was irradiated by gamma rays at dose 0.1 to 8.0 kGy with dose rate 0.227 Gy sec{sup −1}. The irradiation of mycelia was carried out at the radiation facility in Malaysian Nuclear Agency. The radiosensitivity study was performed by evaluating the percentage of survival irradiated mycelia. The lethal dose of the mycelium P. sajor-caju was determined at 4.0 kGy and LD{sub 50} to be equal at 2.2 kGy. The radiation effects on morphology were evaluated based on growth rate of irradiated mycelia, mycelia types, colonization period on substrate, morphology of fruit bodies and yields. The results shown growth rate of irradiated mycelium was slightly lower than the control and decreased as the dose increased. Irradiation was found can induced the primordia formation on PDA and the BE of irradiated seed is higher than to control. The irradiation is proven to be useful for generating new varieties of mushroom with commercial value to the industry.

  15. Functional expression of a valencene dioxygenase from Pleurotus sapidus in E. coli.

    Science.gov (United States)

    Zelena, Kateryna; Krings, Ulrich; Berger, Ralf G

    2012-03-01

    Valencene dioxygenase (ValOx) from the edible basidiomycete Pleurotus sapidus converted the sesquiterpene (+)-valencene to the valuable grapefruit flavour (+)-nootkatone and to nootkatols through intermediate hydroperoxides. Expression of the enzyme was carried out in the cytosol and periplasm of Escherichia coli. The heterologous production led to high yields of inclusion bodies. The poor yield of soluble recombinant protein was improved by various strategies including cold shock expression, chaperone co-expression, and employment of mutant E. coli strains. Up to 60 mg of the biologically active, soluble ValOx was produced by cold shock under control of the cspA promoter at 8 °C in the BL21(DE3)Star strain and co-expression of the E. coli trigger factor. The recombinant enzyme, purified using the N-terminal His tag, showed the catalytic properties of the wild-type enzyme, as was confirmed by the LC-MS analysis of hydroperoxide intermediates and GC-MS analysis of the volatile products. Copyright © 2011 Elsevier Ltd. All rights reserved.

  16. Radiocesium concentrations in wild mushrooms and characteristics of cesium accumulation by the edible mushroom (Pleurotus ostreatus)

    International Nuclear Information System (INIS)

    Sugiyama, Hideo; Terada, Hiroshi; Shibata, Hisashi; Morita, Yohoji; Kato, Fumio

    2000-01-01

    Mushrooms collected from a sub-alpine forest of Mt. Fuji and some other locations in Japan in 1996 were analyzed for radiocesium. The 137 Cs concentrations in 37 mushrooms varied widely from 1.6 to 783 Bqkg -1 fresh wt. The characteristics of Cs accumulation were analyzed by culturing fruiting bodies of the edible mushroom Pleurotus ostreatus (Fr.) Kummer Y-1 (P. ostreatus Y-1). The 137 Cs and stable Cs accumulation expressed as the concentration ratio (CR, 137 Cs or Cs concentration in the dried fruiting body/ 137 Cs or Cs concentration in the fresh medium) were in good agreement, indicating similar migration. The CR of Cs grown on medium containing both 0.1% Cs and 0.1% K, 10.2, showed a decrease of about 30 percent as compared with that containing 0.1% Cs only. These CR values suggested that Cs accumulation by the fruiting bodies of P. ostreatus Y-1 is affected by the presence of K similarly to previous observations in the mycelia. The 133 Cs-NMR spectra from the fruiting bodies of P. ostreatus Y-1 showed two resonance signals, whereas those from the media after harvesting of fruiting bodies showed only one signal. Just before growth of the fruiting bodies, bunches consisting of many mycelia were observed by scanning electron microscopy (SEM). No significant differences in the elemental distribution (Cs, K, P and C) were detected in the mycelium surface by SEM equipped with an energy dispersive X-ray microanalyzer. (author)

  17. Somatic Embryogenesis in Olive (Olea europaea L. subsp. europaea var. sativa and var. sylvestris).

    Science.gov (United States)

    Rugini, Eddo; Silvestri, Cristian

    2016-01-01

    Protocols for olive somatic embryogenesis from zygotic embryos and mature tissues have been described for both Olea europaea sub. europaea var. sativa and var. sylvestris. Immature zygotic embryos (no more than 75 days old), used after fruit collection or stored at 12-14 °C for 2-3 months, are the best responsive explants and very slightly genotype dependent, and one single protocol can be effective for a wide range of genotypes. On the contrary, protocols for mature zygotic embryos and for mature tissue of cultivars are often genotype specific, so that they may require many adjustments according to genotypes. The use of thidiazuron and cefotaxime seems to be an important trigger for induction phase particularly for tissues derived from cultivars. Up to now, however, the application of this technique for large-scale propagation is hampered also by the low rate of embryo germination; it proves nonetheless very useful for genetic improvement.

  18. Delice(Olea europea var. oleaster L.) ile zeytin (Olea europea var.sativa) arasında anatomik ve palinojik ayrıcalıklar (The Anatomic And Palynological Differences Between Olea europea var. oleaster L. AND Olea europea var.sativa)

    OpenAIRE

    Kaya, Zafer

    1991-01-01

    Delice(Olea europea var. oleaster L.) ile zeytin (Olea europea var.sativa) arasında anatomik ve palinojik ayrıcalıklar (The Anatomic And Palynological Differences Between Olea europea var. oleaster L. AND Olea europea var.sativa)

  19. Chromosome behaviour in Rhoeo spathacea var. variegata.

    Science.gov (United States)

    Lin, Y J

    1980-01-01

    Rhoeo spathacea var. variegata is unusual in that its twelve chromosomes are arranged in a ring at meiosis. The order of the chromosomes has been established, and each chromosome arm has been designated a letter in accordance with the segmental interchange theory. Chromosomes are often irregularly orientated at metaphase I. Chromosomes at anaphase I are generally distributed equally (6-6, 58.75%) although not necessarily balanced. Due to adjacent distribution, 7-5 distribution at anaphase I was frequently observed (24.17%), and due to lagging, 6-1-5 and 5-2-5 distributions were also observed (10.83% and 3.33% respectively). Three types of abnormal distribution, 8-4, 7-1-4 and 6-2-4 were observed very infrequently (2.92% total), and their possible origins are discussed. Irregularities, such as adjacent distribution and lagging, undoubtedly reduce the fertility of the plant because of the resulting unbalanced gametes.

  20. 1D-VAR Retrieval Using Superchannels

    Science.gov (United States)

    Liu, Xu; Zhou, Daniel; Larar, Allen; Smith, William L.; Schluessel, Peter; Mango, Stephen; SaintGermain, Karen

    2008-01-01

    Since modern ultra-spectral remote sensors have thousands of channels, it is difficult to include all of them in a 1D-var retrieval system. We will describe a physical inversion algorithm, which includes all available channels for the atmospheric temperature, moisture, cloud, and surface parameter retrievals. Both the forward model and the inversion algorithm compress the channel radiances into super channels. These super channels are obtained by projecting the radiance spectra onto a set of pre-calculated eigenvectors. The forward model provides both super channel properties and jacobian in EOF space directly. For ultra-spectral sensors such as Infrared Atmospheric Sounding Interferometer (IASI) and the NPOESS Airborne Sounder Testbed Interferometer (NAST), a compression ratio of more than 80 can be achieved, leading to a significant reduction in computations involved in an inversion process. Results will be shown applying the algorithm to real IASI and NAST data.

  1. Mutation breeding and submerged fermentation of a Pleurotus polysaccharide high-yield strain with low-energy heavy ions implantation

    International Nuclear Information System (INIS)

    Chen Henglei; Wan Honggui; Lv Changwu; Zeng Xianxian

    2010-01-01

    Pleurotus polysaccharide high-yield strains were selected through a method of auxotrophic primary screening and Shake-flask fermentation re-screening after low-energy heavy ions (the fluence of 1.2 x 10 16 N + /cm 2 at the energy of 15 keV) stepwise implantation. Two Pleurotus polysaccharide high-yield strains, PFPH-1 and PFPH-2, were selected with stable mycelium polysaccharide yield. The mycelium polysaccharide yield of PFPH-1 and PFPH-2 increased by 46.55% and 75.14%, respectively, compared to the original strain. The accumulation of mycelium biomass and intracellular polysaccharides were monitored in the submerged fermentation of Pleurotus ferulae by supplementation of various carbon and nitrogen sources as well as inorganic salts and pH alteration. The optima1 submerged fermentation medium favoring the accumulation of mycelium biomass and intracellular polysaccharides of PFPH-2 consisted of 1.0% wheat flour, 2.0% sucrose, 2.0% soybean flour, 1.5% bran extract, 0.2% K 2 HPO 4 , and 0.15% MgSO 4 ·7H 2 O, with a fittest pH value of 5.64. The orthogonal combination of the optimal carbon and nitrogen sources with inorganic salts indicates a synergistic effect on the accumulation of mycelium biomass and intracellular polysaccharides in the submerged fermentation of PFPH-2. The yield of mycelium polysaccharides of PFPH-2 increased to 903.73 ± 1.23 mg·L -1 by the end of fermentation. (authors)

  2. Pitfalls in VAR based return decompositions: A clarification

    DEFF Research Database (Denmark)

    Engsted, Tom; Pedersen, Thomas Quistgaard; Tanggaard, Carsten

    in their analysis is not "cashflow news" but "inter- est rate news" which should not be zero. Consequently, in contrast to what Chen and Zhao claim, their decomposition does not serve as a valid caution against VAR based decompositions. Second, we point out that in order for VAR based decompositions to be valid......Based on Chen and Zhao's (2009) criticism of VAR based return de- compositions, we explain in detail the various limitations and pitfalls involved in such decompositions. First, we show that Chen and Zhao's interpretation of their excess bond return decomposition is wrong: the residual component...

  3. New sesquiterpenoids from the edible mushroom Pleurotus cystidiosus and their inhibitory activity against α-glucosidase and PTP1B.

    Science.gov (United States)

    Tao, Qiao-Qiao; Ma, Ke; Bao, Li; Wang, Kai; Han, Jun-Jie; Zhang, Jin-Xia; Huang, Chen-Yang; Liu, Hong-Wei

    2016-06-01

    Nine new sesquiterpenoids, clitocybulol derivatives, clitocybulols G-O (1-9) and three known sesquiterpenoids, clitocybulols C-E (10-12), were isolated from the solid culture of the edible fungus Pleurotus cystidiosus. The structures of compounds 1-12 were determined by spectroscopic methods. The absolute configurations of compounds 1-9 were assigned via the circular dichroism (CD) data analysis. Compounds 1, 6 and 10 showed moderate inhibitory activity against protein tyrosine phosphatase-1B (PTP1B) with IC50 values of 49.5, 38.1 and 36.0μM, respectively. Copyright © 2016. Published by Elsevier B.V.

  4. How can the origin of the decay var-phi →3π be determined?

    International Nuclear Information System (INIS)

    Achasov, N.N.; Kozhevnikov, A.A.

    1992-01-01

    It is shown that the interference pattern in the region √s = 1.05 GeV in the reaction e + e - →ω, var-phi →3π can be used to determine unambiguously whether the decay var-phi →3π occurs because of var-phi ω mixing, var-phi →ω→3π, or because of the direct transition var-phi →3π. 8 refs., 3 figs., 1 tab

  5. EVALUACIÓN DE LOS PARÁMETROS PRODUCTIVOS DE LA SEMILLA DE Pleurotus ostreatus PROPAGADA EN DIFERENTES MEDIOS DE CULTIVO AVALIAÇÃO DOS PARÂMETROS DE PRODUÇÃO DA SEMENTÉ DE Pleurotus ostreatus DISSEMINADAS EM DIFERENTES MEIOS DE CULTURA EVALUATION OF PARAMETERS PRODUCTION OF THE SEED Pleurotus ostreatus SPREED IN DIFFERENT CULTURE MEDIA

    Directory of Open Access Journals (Sweden)

    MARÍA DEL PILAR RÍOS

    2010-12-01

    Full Text Available Se evaluaron medios alternativos para la propagación de Pleurotus ostreatus y se comparó su comportamiento frente a un medio comercial. La respuesta a estos medios fue medida mediante la adaptación del hongo en cebada para la obtención de semilla comercial, y ésta a su vez en la respuesta a un sustrato a base de bagazo de caña para la obtención de orellanas. En la primera fase se obtuvo y sembró el hongo en un medio sólido de extracto de papa a dos concentraciones y tres valores de pH, utilizando un diseño factorial 2x3 (pH vs concentración de extracto de papa. En la segunda fase se midió el crecimiento de Pleurotus ostreatus inoculado en cebada hidratada esterilizada mediante un diseño completamente al azar 3x3. En la tercera se evaluó la colonización y fructificación del hongo en bagazo de caña usando parámetros como eficiencia biológica, rendimiento y tasa de producción semilla, con un diseño completamente al azar 3x3. El medio alternativo con pH 5,0 fue el más adecuado para el crecimiento del Pleurotus ostreatus, demostrando su adaptabilidad a medios con alto contenido de carbohidratos, cuyos rendimientos fueron apropiados para obtener niveles de producción competitivos en crecimiento y fructificación, disminuyendo así el tiempo de incubación y cosecha.Foram avaliados os meios alternativos para a propagação de fungos Pleurotus ostreatus e se comparou o seu comportamento em um ambiente comercial. A resposta a esses meios foi medida pela adaptação do fungo em cevada para a obtenção de sementes comerciais e este por sua vez, em resposta a um substrato a base de bagaço de cana para a produção de "Orellana". Na primeira fase foi obtida e plantou o fungo em meio sólido de extrato de batata a duas concentrações e três valores de pH, utilizando um design fatorial 2x3 (pH vs concentração de extrato de batata. Na segunda fase, mediu o crescimento de Pleurotus ostreatus inoculadas em cevada estéril úmida em 3x

  6. Activation and clustering of a Plasmodium falciparum var gene are affected by subtelomeric sequences.

    Science.gov (United States)

    Duffy, Michael F; Tang, Jingyi; Sumardy, Fransisca; Nguyen, Hanh H T; Selvarajah, Shamista A; Josling, Gabrielle A; Day, Karen P; Petter, Michaela; Brown, Graham V

    2017-01-01

    The Plasmodium falciparum var multigene family encodes the cytoadhesive, variant antigen PfEMP1. P. falciparum antigenic variation and cytoadhesion specificity are controlled by epigenetic switching between the single, or few, simultaneously expressed var genes. Most var genes are maintained in perinuclear clusters of heterochromatic telomeres. The active var gene(s) occupy a single, perinuclear var expression site. It is unresolved whether the var expression site forms in situ at a telomeric cluster or whether it is an extant compartment to which single chromosomes travel, thus controlling var switching. Here we show that transcription of a var gene did not require decreased colocalisation with clusters of telomeres, supporting var expression site formation in situ. However following recombination within adjacent subtelomeric sequences, the same var gene was persistently activated and did colocalise less with telomeric clusters. Thus, participation in stable, heterochromatic, telomere clusters and var switching are independent but are both affected by subtelomeric sequences. The var expression site colocalised with the euchromatic mark H3K27ac to a greater extent than it did with heterochromatic H3K9me3. H3K27ac was enriched within the active var gene promoter even when the var gene was transiently repressed in mature parasites and thus H3K27ac may contribute to var gene epigenetic memory. © 2016 Federation of European Biochemical Societies.

  7. VAr reserve concept applied to a wind power plant

    DEFF Research Database (Denmark)

    Martinez, Jorge; Kjær, Philip C.; Rodriguez, Pedro

    2011-01-01

    to wind power plants. This paper proposes two different VAr reserve control strategies for a wind power plant. The amount of dynamic VAr available most of the operation time, makes the wind power plant (WPP) a good candidate to include a VAr reserve management system. Two different ways of implementing...... a VAr management system are proposed and analyzed. Such a reactive power reserve may be provided by the wind power plant since the amount of reactive power installed for most active power working points exceeds the demand required by the grid operator. Basically, this overrated reactive power capacity...... is a consequence of sizing wind turbine facilities for maximum active power level. The reactive power losses, due to active power transportation inside the plant (normally two transformers), and P-Q wind turbine characteristics define the P-Q reserve chart. By utilizing the intrinsic overrated reactive power...

  8. Molt disruption and mortality of Locusta migratoria var. manilensis ...

    African Journals Online (AJOL)

    IGRs) on the oriental migratory locust Locusta migratoria var. manilensis were assessed. Under laboratory conditions, at the highest tested dose rate of 300 ppm, the percent mortality and molt inhibition after two weeks for the five tested ...

  9. ClinVar data parsing [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Xiaolei Zhang

    2017-05-01

    Full Text Available This software repository provides a pipeline for converting raw ClinVar data files into analysis-friendly tab-delimited tables, and also provides these tables for the most recent ClinVar release. Separate tables are generated for genome builds GRCh37 and GRCh38 as well as for mono-allelic variants and complex multi-allelic variants. Additionally, the tables are augmented with allele frequencies from the ExAC and gnomAD datasets as these are often consulted when analyzing ClinVar variants. Overall, this work provides ClinVar data in a format that is easier to work with and can be directly loaded into a variety of popular analysis tools such as R, python pandas, and SQL databases.

  10. Immunogenic Properties of Ricinus Communis Var Minor Seed on ...

    African Journals Online (AJOL)

    Prof. Ogunji

    1College of Health Technology, Zawan, Plateau State.2Department of ... Ricinus communis var minor seed included in their feed (5g/100g body weight). ... White Blood cell Count (WBC) count and lymphocytosis in the differential count.

  11. Influence of xylem ray integrity and degree of polymerization on bending strength of beech wood decayed by Pleurotus ostreatus and Trametes versicolor

    Science.gov (United States)

    Ehsan Bari; Reza Oladi; Olaf Schmidt; Carol A. Clausen; Katie Ohno; Darrel D. Nicholas; Mehrdad Ghodskhah Daryaei; Maryam Karim

    2015-01-01

    The scope of this research was to evaluate the influence of xylem ray (XR) and degree of polymerization (DP) of holocellulose in Oriental beech wood (Fagus orientalis Lipsky.) on impact bending strength against two white-rot fungi. Beech wood specimens, exposed to Pleurotus ostreatus and Trametes versicolor, were evaluated for...

  12. Orientation of the Fiscal Policy in Tunisia: Structural VAR Analysis

    Directory of Open Access Journals (Sweden)

    Wissem Khanfir

    2017-06-01

    Full Text Available The objective of this paper is to indicate the orientation of fiscal policy in Tunisia, using the structural budget balance, during the period 1972-2014. For this purpose, we estimate a structural VAR model consisting of the fiscal deficit to current GDP ratio and the volume of economic activity represented by the real GDP. We estimate bivariate structural VAR in order to decompose fiscal deficit fluctuations into different disturbances.

  13. An orientin derivative isolated from Passiflora tripartita var. mollissima

    OpenAIRE

    Ramos, Freddy A.; Castellanos, Leonardo; López, César; Palacios, Lizeth; Duque, Carmenza; Pacheco, Ricardo; Guzmán, Antonio

    2010-01-01

    Passiflora tripartita var. mollisima (banana passion fruit) is an edible fruit widespread in the Andean highlands of Colombia and Ecuador. The fruit is used for juices as well as for the sedative properties of the leaves. As a contribution to the chemical characterization of this species, a new compound, 4'- methoxyluteolin-8-C-6”acetylglucopyranoside, was isolated from the ethanolic extract of Passiflora tripartita var. mollisima leaves and identified by spectroscopical data (NMR, MS, UV).

  14. Da abort ikke var en sag for kvinden

    DEFF Research Database (Denmark)

    Schultz, Annette Østergaard

    2013-01-01

    Case fra tiden før 1973, hvor der ikke var fri abort i Danmark. Sagen er fundet i Mødrehjælpens arkiv og giver som andre sager indblik i kvindens situation. Led i serien: Nyt i arkivet.......Case fra tiden før 1973, hvor der ikke var fri abort i Danmark. Sagen er fundet i Mødrehjælpens arkiv og giver som andre sager indblik i kvindens situation. Led i serien: Nyt i arkivet....

  15. Saccharomyces cerevisiae var. boulardii fungemia following probiotic treatment

    OpenAIRE

    Appel-da-Silva, Marcelo C.; Narvaez, Gabriel A.; Perez, Leandro R.R.; Drehmer, Laura; Lewgoy, Jairo

    2017-01-01

    Probiotics are commonly prescribed as an adjuvant in the treatment of antibiotic-associated diarrhea caused by Clostridium difficile. We report the case of an immunocompromised 73-year-old patient on chemotherapy who developed Saccharomyces cerevisiae var. boulardii fungemia in a central venous catheter during treatment of antibiotic-associated pseudomembranous colitis with the probiotic Saccharomyces cerevisiae var. boulardii. Fungemia was resolved after interruption of probiotic administrat...

  16. VAR Methodology Used for Exchange Risk Measurement and Prevention

    Directory of Open Access Journals (Sweden)

    Florentina Balu

    2006-05-01

    Full Text Available In this article we discuss one of the modern risk measuring techniques Value-at-Risk (VaR. Currently central banks in major money centers, under the auspices of the BIS Basle Committee, adopt the VaR system to evaluate the market risk of their supervised banks. Banks regulators ask all commercial banks to report VaRs with their internal models. Value at risk (VaR is a powerful tool for assessing market risk, but it also imposes a challenge. Its power is its generality. Unlike market risk metrics such as the Greeks, duration and convexity, or beta, which are applicable to only certain asset categories or certain sources of market risk, VaR is general. It is based on the probability distribution for a portfolio’s market value. Value at Risk (VAR calculates the maximum loss expected (or worst case scenario on an investment, over a given time period and given a specified degree of confidence. There are three methods by which VaR can be calculated: the historical simulation, the variance-covariance method and the Monte Carlo simulation. The variance-covariance method is easiest because you need to estimate only two factors: average return and standard deviation. However, it assumes returns are well-behaved according to the symmetrical normal curve and that historical patterns will repeat into the future. The historical simulation improves on the accuracy of the VAR calculation, but requires more computational data; it also assumes that “past is prologue”. The Monte Carlo simulation is complex, but has the advantage of allowing users to tailor ideas about future patterns that depart from historical patterns.

  17. VAR Methodology Used for Exchange Risk Measurement and Prevention

    Directory of Open Access Journals (Sweden)

    Ion Stancu

    2006-03-01

    Full Text Available In this article we discuss one of the modern risk measuring techniques Value-at-Risk (VaR. Currently central banks in major money centers, under the auspices of the BIS Basle Committee, adopt the VaR system to evaluate the market risk of their supervised banks. Banks regulators ask all commercial banks to report VaRs with their internal models. Value at risk (VaR is a powerful tool for assessing market risk, but it also imposes a challenge. Its power is its generality. Unlike market risk metrics such as the Greeks, duration and convexity, or beta, which are applicable to only certain asset categories or certain sources of market risk, VaR is general. It is based on the probability distribution for a portfolio’s market value. Value at Risk (VAR calculates the maximum loss expected (or worst case scenario on an investment, over a given time period and given a specified degree of confidence. There are three methods by which VaR can be calculated: the historical simulation, the variance-covariance method and the Monte Carlo simulation. The variance-covariance method is easiest because you need to estimate only two factors: average return and standard deviation. However, it assumes returns are well-behaved according to the symmetrical normal curve and that historical patterns will repeat into the future. The historical simulation improves on the accuracy of the VAR calculation, but requires more computational data; it also assumes that “past is prologue”. The Monte Carlo simulation is complex, but has the advantage of allowing users to tailor ideas about future patterns that depart from historical patterns.

  18. Effect of Agroforestry Residues Partially Biodegraded by Pleurotus Ostreatus (Pleurotaceae on Tomato Seedlings Development

    Directory of Open Access Journals (Sweden)

    Jorge Alberto Luna Fontalvo

    2013-05-01

    Se evaluó el desarrollo de plántulas de tomate (planta bioindicadora de toxicidad en suelos con aserrín y cascarilla de arroz parcialmente biodegradados por Pleurotus Ostreatus bajo condiciones de invernadero. Se determinaron los componentes orgánicos (carbono, celulosa, lignina, extraíbles y materia orgánica e inorgánicos (nitrógeno, fósforo y pH antes y después de inocular el hongo en el aserrín y la cascarilla de arroz. Se realizaron mezclas de cada sustrato con un suelo pobre en nutrientes en proporciones iguales (1:1 y se les determinó el porcentaje de humedad. El experimento estuvo constituido por un diseño completamente aleatorio, con dos grupos de seis tratamientos para cada sustrato, a los 30 días se determinaron los parámetros de crecimiento y desarrollo de las plántulas. Los sustratos biodegradados reportaron bajo contenido de C, N y P. El tratamiento aserrín biodegradado + suelo fertilizado (ASB + SF, presentó los mejores resultados en número de hojas (12,9, altura de las plantas (25,94 cm, longitud radical (5,92 cm, peso seco (0,138 g y peso fresco (1,012 g. El sustrato ASB + SF puede funcionar como sustrato favorable para el cultivo de plántulas de tomate debido a que aporta los nutrientes necesarios para el buen crecimiento de las plántulas. En la cascarilla de arroz las plantas no crecieron adecuadamente para conseguir ser trasplantadas.

  19. Use of Irradiation to Extend the Shelf Life of Dried White Oyster Mushroom (Pleurotus ostreatus)

    International Nuclear Information System (INIS)

    Idrus Kadir

    2010-01-01

    Irradiation is an alternative technology to extend the shelf life of food-stuffs. White oyster mushroom (Pleurotus ostreatus) which is a perishable food stuff having a short shelf life. Effects of gamma irradiation at the dose of 5 kGy on the quality of dried white oyster mushroom during storage was observed. The objective of the experiment was to improve the hygienic quality and to extend the shelf life of dried white oyster mushroom using irradiation technology. Fresh mushroom was cleaned, sorted, washed, and drained. The mushroom was then dried in two ways, namely: sun drying method and electrical oven drying method. Dried mushroom was vacuum packed in polypropylene (PP) pouch then irradiated at a of dose 5 kGy and an unirradiated control was also applied. The vacuum packed samples was stored at low temperature (18-20 o C) with a relative humidity (RH) of 65-70% and observed periodically every month up to 3 months of storage. The samples were analyzed according to the following parameters i.e, : total bacterial count, total mould and yeast count, moisture content, pH, a w , contents of protein, fat, carbohydrate, carotenoid and organoleptic properties, respectively. The results showed that irradiation at the dose of 5 kGy could eliminate significantly microbial growth 2 log cycle in the samples, while there were no changes in physico-chemical and organoleptic properties up to 3 months of storage, while control samples were still acceptable only up to 2 months of storage. (author)

  20. Antihyperlipidemic activities of Pleurotus ferulae on biochemical and histological function in hypercholesterolemic rats

    Directory of Open Access Journals (Sweden)

    Nuhu Alam

    2011-01-01

    Full Text Available Background: Pleurotus ferulae is an edible mushroom has been widely used for nutritional and medicinal purposes. Irrespective of the medicinal importance or therapeutic potentials of P. ferulae, there have not been studies on anti-hyperlipidemic properties. Therefore, the present study investigates the effects of dietary P. ferulae fruiting bodies on plasma and feces biochemical and on the liver histological status in hypercholesterolemic rats. Methods: Six weeks old female Sprague-Dawley albino rats were divided into three groups of 10 rats each. Then biochemical and histological examinations were performed. Results: Feeding of a diet containing 5% P. ferulae fruiting bodies to hypercholesterolemic rat reduced plasma total cholesterol, triglyceride, low-density lipoprotein (LDL, total lipid, phospholipids, and LDL/high-density lipoprotein ratio by 30.02, 49.31, 71.15, 30.23, 21.93, and 65.31%, respectively. Mushroom also significantly reduced body weight in hypercholesterolemic rats. However, it had no adverse effects on plasma albumin, total bilirubin, direct bilirubin, creatinin, blood urea nitrogen, uric acid, glucose, total protein, calcium, sodium, potassium, chloride, inorganic phosphate, magnesium, and enzyme profiles. Feeding mushroom increased total lipid and cholesterol excretion in feces. The plasma lipoprotein fraction, separated by agarose gel electrophoresis, indicated that P. ferulae significantly reduced plasma β and pre-β-lipoprotein, while increased the α-lipoprotein. A histological study of hepatic cells by conventional hematoxylin-eosin and oil red O staining showed normal findings for mushroom-fed hypercholesterolemic rats. Conclusions: The present study suggests that 5% P. ferulae diet supplement provides health benefits, at least partially, by acting on the atherogenic lipid profile in hypercholesterolemic rats.

  1. Anti-Growth Factors Associated with Pleurotus ostreatus in a Submerged Liquid Fermentation

    Directory of Open Access Journals (Sweden)

    Juliet B. Akinyele

    2012-09-01

    Full Text Available Aims: Previous studies had revealed that cultivation of Pleurotus ostreatus is often met with a lot of challenges ranging from environmental to biological factors which adversely affect the successful cultivation of the mushroom. Hence, a need to determine factors against mycelia colonization of substrate during mushroom’s cultivation.Methodology and Result: Conventional streak method was employed to establish the percentage inhibition as well as intercolony distance between the test organisms obtained from the infected substrate and mycelia of the mushroom during substrate colonization. The test organisms are: a fungus, Kutilakesopsis macalpineae and a bacterium,Pseudomonas tolaasii. The effect of pH and temperature on the mycelia growth of P. ostreatus was also investigated. There was a gradual increase in the percentage inhibition from 33.3 % at 24 h to 75.0 % at 168 h for K. macalpineae and 37.5 % at 24 h to 70.0 at 168 h for P. tolaasii. The inter-colony distance between the antagonists and the mushroom mycelium gradually decreased. Optical density of the mycelium growth was at its optimum at pH 4.5 and temperature of25 °C respectively. In vitro study also showed a significant increase in the optical density from 0.855±0.03 at 24 h to 1.316±0.02 at 168 h in the absence of test antagonist as against 0.812±0.06 and 0.79±0.02 at 24 h to 1.103±0.03 and 0.902±0.03 at 168 h when K. macalpineae and P.tolaasii were used as test antagonistic respectively.Conclusion, significance and impact of study: Sterilization of substrate is essential to avoid contamination during mycelia colonization. Also, slightly acidic medium and temperature control is necessary for high yield of fruit bodies.

  2. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  3. Growth and fruit body formation of Pleurotus ostreatus on media supplemented with inorganic selenium

    Directory of Open Access Journals (Sweden)

    Savić Milena D.

    2009-01-01

    Full Text Available Selenium is a trace mineral chemically related to sulfur and tellurium. In the body selenium combines with protein molecules to form selenoproteins and it is distributed in low concentrations and unequally in air, soil and water all over the world. Edible mushrooms are known to be selenium accumulators. Since mushrooms contain relatively high protein levels, and they can accumulate large amounts of selenium, it is reasonable to expect that selenium could be incorporated into proteins. The growth of mycelia and fruit body formation of different medicinal mushroom strains of Pleurotus ostreatus (Hk-35 and P70 over the wide range of concentrations of inorganic form of selenium were examined. Mushrooms were cultivated on agar base media and on substrates based on sawdust. Vegetative growths of mycelium were measured as colony diameter in pure cultures supplemented with inorganic form of Se supplements, prepared as Na2SeO4 and Na2SeO3 in concentrations of: 1, 10, 25, 50, 75, 100 and 150 mg/l. Inorganic form of Se supplements, showed stimulation effects (in concentration of 1-50 mg/l and toxic effects in higher concentration. On the standard industrial sawdust based substrate, supplemented with 100 mg/kg Na2SeO4 and Na2SeO3, accumulation of Se in fruit bodies was determined by the method of flameless atomic absorption spectrophotometer. The readings were performed on Varian SpectrAA-10 spectrophotometer equipped with VGA-76. Se as Na2SeO4 and Na2SeO3 was effectively taken up from substrates and accumulated in fruit bodies. Mushrooms accumulated selenium between 120 and 250 mg/kg dry weight. In mushrooms cultivated without Se supplement, Se contents were only about 1 mg/kg and in substrate about 0.1 mg/kg.

  4. Development and evaluation of Pleurotus tuber-regium-cornstarch composite as a direct compression multifunctional excipient.

    Science.gov (United States)

    Okoye, Ebere I; Onyekweli, Anthony O

    2016-01-01

    The aim was to develop a novel excipient from Pleurotus tuber-regium (PT)-cornstarch (CS) mixture and evaluate its multifunctional characteristics in tablet formulation. Composites were generated from dephytochemicalized PT and CS combined at 1:1 to 4:1 ratios and pregelatinized in a hot water bath at 65°C ± 2°C for 5 min. The paste was dried, pulverized, and screened through 150-μm sieve. PT-CS physical mixtures were prepared and their characteristics/functionalities in tableting chloroquine were compared to those of composites and microcrystalline cellulose (Avicel(®)). PT ash value was 0.40 ± 0.09% and heavy metal contents were below official limits. PT's differential scanning calorimetric (DSC) thermogram depicted broad melting peak at 329.5°C; this peak was attenuated by the presence of CS. Fourier transform infrared (FTIR) spectra predicted compatibility between PT and CS. Composites consolidated better and also flowed better than physical mixtures and Avicel(®). Increasing PT content enhanced the excipients' swellabilities, and composites possessed significantly (P plastic deformation with yield pressures significantly (P plastic deformation. The mechanical properties of chloroquine tablets were acceptable, with the 1:4 (PT:CS) imparting the best properties. Mean disintegration times for the commercial comparator and Avicel(®) -containing tablets were significantly higher (P < 0.05) than those of composites. Drug release from tablets formulated with composites were similar to the commercial comparator, but significantly higher (P < 0.05) than those of Avicel(®). The novel composites are excellent multifunctional excipients, the best (PT:CS 1:4) one showcasing potentially better mechanical functionality than Avicel(®), a popular multifunctional excipient.

  5. High temperature induced disruption of the cell wall integrity and structure in Pleurotus ostreatus mycelia.

    Science.gov (United States)

    Qiu, Zhiheng; Wu, Xiangli; Gao, Wei; Zhang, Jinxia; Huang, Chenyang

    2018-05-30

    Fungal cells are surrounded by a tight cell wall to protect them from harmful environmental conditions and to resist lysis. The synthesis and assembly determine the shape, structure, and integrity of the cell wall during the process of mycelial growth and development. High temperature is an important abiotic stress, which affects the synthesis and assembly of cell walls. In the present study, the chitin and β-1,3-glucan concentrations in the cell wall of Pleurotus ostreatus mycelia were changed after high-temperature treatment. Significantly higher chitin and β-1,3-glucan concentrations were detected at 36 °C than those incubated at 28 °C. With the increased temperature, many aberrant chitin deposition patches occurred, and the distribution of chitin in the cell wall was uneven. Moreover, high temperature disrupts the cell wall integrity, and P. ostreatus mycelia became hypersensitive to cell wall-perturbing agents at 36 °C. The cell wall structure tended to shrink or distorted after high temperature. The cell walls were observed to be thicker and looser by using transmission electron microscopy. High temperature can decrease the mannose content in the cell wall and increase the relative cell wall porosity. According to infrared absorption spectrum, high temperature broke or decreased the glycosidic linkages. Finally, P. ostreatus mycelial cell wall was easily degraded by lysing enzymes after high-temperature treatment. In other words, the cell wall destruction caused by high temperature may be a breakthrough for P. ostreatus to be easily infected by Trichoderma.

  6. EFEKTIVITAS PEMBERIAN AIR LERI TERHADAP PERTUMBUHAN DAN HASIL JAMUR TIRAM PUTIH (Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Ummu Kalsum

    2011-09-01

    Full Text Available White oyster mushroom is kind of consumed mushroom that has delicious taste and efficacious drug. Mushroom need nutrition addition to increase growth and development so that better production, like nutrition from rice washing water. The contain are carbon element, nitrogen, mineral and vitamin B. This experiment aim to determine addition of rice washing water effect, optimal volume and time interval on growth and yield of white oyster mushroom (Pleurotus ostreatus. This experiment is carried out at mushroom’s house Maduraya Agro Kamal. The research design used was factorial completely randomized design with two factors. First factor is addition rice washing water volume with 4 level, that is without addition rice washing water (A0, addition rice washing water as much as 20 ml/1000 g substrat (A1, 40 ml/1000 g substrat (A2 and 60 ml/1000 g substrat (A3. Second factor is addition time interval that consists of 2 level, that is 2 days (B1 and 4 days (B2. Experiment result shows that interaction between volume treatment and addition time interval give effect on fruit body total. Addition rice washing water volume treatment give real effect on maximal pileus fruit width. While addition time interval treatment does not give significant difference on all parameters but it can increase pileus fruit width, total weight and biological efficiency. Interaction of volume treatment and addition time interval is the best combination is volume treatment 40 ml/1000 g substrat with time interval 2 days (A2B1, this matter is showed in lot fruit body total as big as 8,871 fruit. Addition rice washing water volume 40 ml/1000 g substrat is the best volume that indicated from first bud appear, first harvest time, total weight and biological efficiency.

  7. VALOR NUTRICIONAL DEL HENO DE TRANSVALA INOCULADO CON EL HONGO Pleurotus ostreatus sp

    Directory of Open Access Journals (Sweden)

    Rodolfo WingChing-Jones

    2009-01-01

    Full Text Available Se analizó el valor nutricional del heno de Transvala utilizado en la producción del hongo comestible Pleurotus ostreatus. El heno fue analizado antes de inocular el hongo y después de la cosecha. Se determinó: materia seca (MS, proteína cruda (PC, extracto etéreo (EE, ceniza (Ce, digestibilidad in vitro de la MS (DIVMS, carbohidratos no fibrosos (CNF, fibra detergente neutro (FDN, fibra detergente ácido (FDA, lignina, nitrógeno ligado a la fibra detergente neutro (N-FDN y a la fibra detergente ácida (N-FDA, nutrimentos digestibles totales (NDT (1X, energía digestible (ED, energía metabolizable (EM, energía neta de lactancia (ENl, energía de mantenimiento (ENm y energía neta de ganancia (ENg. Sobresalen niveles bajos de PC, DIVMS y NDT; y valores altos de lignina, FDN y FDA. El contenido de MS, FDN, hemicelulosa (He, lignina, CNF y EE presentó diferencias significativas, debidas al crecimiento del hongo. La variación en calidad en estas variables fue de (- 48,75%, (- 24,76%, (- 80,22%, (- 27,94%, (+ 51,52% y (- 26,13%, respectivamente. La mejoría en la calidad nutricional del heno, después de la cosecha del hongo, no es tan significativa como para cambiar la perspectiva en su uso dentro de la ración total de rumiantes, por lo que el beneficio del heno se basa más en aspectos físicos que nutricionales.

  8. Optimization of cultural conditions for biosurfactant production by Pleurotus djamor in solid state fermentation.

    Science.gov (United States)

    Velioglu, Zulfiye; Ozturk Urek, Raziye

    2015-11-01

    Being eco-friendly, less toxic, more biodegradable and biocompatible, biological surfactants have higher activity and stability compared to synthetic ones. In spite of the fact that there are abundant benefits of biosurfactants over the synthetic congeners, the problem related with the economical and large scale production proceeds. The utilization of several industrial wastes in the production media as substrates reduces the production cost. This current study aims optimization of biosurfactant production conditions by Pleurotus djamor, grown on sunflower seed shell, grape wastes or potato peels as renewable cheap substrates in solid state fermentation. After determination of the best substrate for biosurfactant production, we indicate optimum size and amount of solid substrate, volume of medium, temperature, pH and Fe(2+) concentrations on biosurfactant production. In optimum conditions, by reducing water surface tension to 28.82 ± 0.3 mN/m and having oil displacement diameter of 3.9 ± 0.3 cm, 10.205 ± 0.5 g/l biosurfactant was produced. Moreover, chemical composition of biosurfactant produced in optimum condition was determined by FTIR. Lastly, laboratory's large-scale production was carried out in optimum conditions in a tray bioreactor designed by us and 8.9 ± 0.5 g/l biosurfactant was produced with a significant surface activity (37.74 ± 0.3 mN/m). With its economical suggestions and applicability of laboratory's large-scale production, this work indicates the possibility of using low cost agro-industrial wastes as renewable substrates for biosurfactant production. Therefore, using economically produced biosurfactant will reduce cost in several applications such as bioremediation, oil recovery and biodegradation of toxic chemicals. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  9. Performance of Pleurotus pulmonarius mushroom grown on maize stalk residues supplemented with various levels of maize flour and wheat bran

    Directory of Open Access Journals (Sweden)

    Senzosenkosi Surprise MKHIZE

    2017-10-01

    Full Text Available Abstract The use of supplemented agricultural waste in mushroom cultivation can be one of the environmentally friendly strategies for poverty alleviation. The study evaluated the performance of Pleurotus pulmonarius mushroom grown on maize stalk supplemented with varying levels of wheat bran (WB and maize flour (MF. A completely random design was used for the experiments. It was observed that Pleurotus pulmonarius was significantly affected by varying levels of supplementation, as 20% WB supplementation encountered higher contamination. The lower supplementation levels gave significantly shorter colonisation period with better mycelial growth rate (MGR. The 2% MF, 2% WB and 4% WB gave significantly higher MGR and faster colonisation. The shortest pinning time (TP was observed at the first flush with the minimum of 2 days. Higher supplementation levels gave maximum yield and biological efficiency (BE. With further increase of supplementation above a 12% WB and 14% MF, the BE and yield declined. Lower supplementation levels resulted in quicker colonisation period and improved growth rate, whereas high supplementation gave better production in terms of yield and BE. Therefore, for the purpose of maximum production, 12% WB and 14% MF may be recommended while for fast production time, 2% MF and 2% WB are recommended.

  10. Performance of Pleurotus ostreatus mushroom grown on maize stalk residues supplemented with various levels of maize flour and wheat bran

    Directory of Open Access Journals (Sweden)

    Senzosenkosi Surprise MKHIZE

    Full Text Available Abstract Improving the performance of mushroom in terms of high production and fast growth rate is essential in mushroom cultivation. In the present study the performance of Pleurotus ostreatus was evaluated using varying levels of wheat bran (WB and maize flour (MF. The results indicated that Pleurotus ostreatus was highly influenced by different levels of supplementation, with 8% WB, 18% WB and 2% MF having higher contamination rate. The low levels of supplementation gave significantly better mycelial growth rate (MGR and shorter colonisation period as observed that the control had highest MGR whereby 20% MF had lowest MGR. The pinning time (TP was shortest at the first flush with minimum of 3 days (12% MF. The higher levels of supplementation showed maximum biological efficiency (BE such as 14% MF, 12% WB and 14% WB. The yield was also higher at high levels of supplementation such as 20% MF and 8% MF being the exception in the lower levels. Based on the results it was observed that for fast production of oyster mushroom there is no need to supplement the maize stalk substrate but for improved productivity supplements can be added up to certain limits such as 14% MF and 12 WB.

  11. DETERIORATION AND SOME OF APPLIED PRESERVATION TECHNIQUES FOR COMMON MUSHROOMS (AGARICUS BISPORUS, FOLLOWED BY LENTINUS EDODES, PLEUROTUS SPP.

    Directory of Open Access Journals (Sweden)

    Hamid Akbarirad

    2013-06-01

    Full Text Available Mushrooms are consider as a nutritional and health beneficial product. Three most cultivated mushrooms worldwide are Agaricus bisporus, Lentinus edodes and Pleurotus spp. Mushrooms are highly perishable. They tend to lose quality after harvest, mainly because of their high respiration rate and the fact that they have no barrier to protect them from water loss. Mushrooms’ shelf-life is limited to a few days under normal refrigeration conditions, which is a constraint on the distribution and marketing of fresh product, making extension of mushroom’s shelf life a constant quest. Modified atmosphere packaging provides an affordable packaging system that partly avoids enzymatic browning, fermentation and other biochemical processes by maintaining a controlled gas atmosphere. However, modified atmosphere packaging conditions should be carefully designed. Inappropriate modified atmosphere conditions may be ineffective or even shorten the shelf life of the product due to damage of tissues. Preservation techniques and specially use of MAP, specifically for Agaricus, Lentinus edodes and Pleurotus, is reviewed.

  12. Determination of Cr, Cu, Fe, Ni, Pb and Zn by ICP-OES in mushroom samples from Sakarya, Turkey

    Directory of Open Access Journals (Sweden)

    Esra Altıntığ

    2017-06-01

    Full Text Available Russula cyanoxantha, Russula delica, Lactarius salmonicolor, Lactarius deliciosus, Pleurotus eryngii, Pleurotus ostreatus, Agaricus bisporus, Suillus luteus, Pleurotus spp and Boletus edulis were collected from Sakarya-Turkey respectively. Also canned food in the form of the Pleurotus eryngii, Pleurotus ostreatus, and Lactarius salmonicolor mushrooms were used for the examination. Trace metal concentrations found in these mushrooms were determined inductively using coupled plasma optic emission spectrometry microwave processes. The results were obtained for (Cr 0.3-26.65, (Cu 17.38-132.75, (Fe 26.3-225.40, (Ni 2.57-39.28, (Pb 11.52-185.20, and (Zn 22.86-126.84 mg/kg. The accuracy of the method was checked by the standard reference material; tea leaves (INCY-TL-1 and tomato leaves (1573a.

  13. Genetic analisys of a cross of gaillon (Brassica oleracea var. alboglabra) with cauliflower (B.oleracea var. botrytis)

    OpenAIRE

    Spini, Vanessa B.M.G.; Kerr, Warwick Estevam

    2000-01-01

    The cauliflower (Brassica oleracea var. botrytis) is an annual vegetable cultivated in Southern and Southwestern Brazil with limited production in the Northeast and Centralwest. A variety of Chinese kale, "kaai laan" or "gaillon" (Brassica oleracea var. alboglabra), produces seeds at high temperatures and therefore can do so in North and Northeastern Brazil. Gaillon and cauliflower were crossed 55 times using 10 gaillon plants as mothers and 4 cauliflower plants as pollen donors. From these c...

  14. Cultivo do cogumelo Pleurotus sajor-caju em diferentes resíduos agrícolas Cultivation of the mushroom Pleurotus sajor-caju in different agricultural residues

    Directory of Open Access Journals (Sweden)

    Eustáquio Souza Dias

    2003-12-01

    Full Text Available Diferentes resíduos agrícolas disponíveis na região sul de Minas Gerais foram testados para o cultivo do cogumelo Pleurotus sajor-caju. Foram avaliados os seguintes substratos: palha de feijão pura (PFP, palha de milho pura (PMP, casca de café pura (CCP, palha de feijão enriquecida com 2% de calcário, 2% de gesso e 10% de farelo de trigo (PFE, palha de milho enriquecida (PME e casca de café enriquecida (CCE. Todos os substratos receberam 2% de inoculante e foram incubados a 24°C. Após a colonização, os sacos foram mantidos abertos em ambiente a 24°C e umidade a 80%. PFP, PFE e PME apresentaram os melhores resultados na produção de cogumelos, com uma eficiência biológica de 85,7; 81,4 e 83,4%, respectivamente. A palha de feijão foi considerada o melhor resíduo para a produção do cogumelo P. sajor-caju, porque apresentou a melhor eficiência biológica sem necessidade de enriquecimento.Several agricultural residues available in the South of Minas Gerais were tested for cultivation of the mushroom Pleurotus sajor-caju. The following substrates were investigated: Bean (BS, Corn (CS straws and Coffee husk (CH without nutrient supplementation and straws of bean (BSS, corn (CSS and coffee husk (CHS supplemented with 2% of CaCO3, 2% of gypsum and 10% of wheat flour. All the substrates were inoculated with 2% of spawn and incubated at 24ºC. After the fungi had colonized the substrate, the plastic bags were open and maintained at room temperature with 80% of humidity. BS, BSS and CSS showed higher mushroom production than the others, showing a biological efficiency of 85.7, 81.4 and 83.6% respectively. The beans straw (BS without nutrient supplementation was considered the best residue for the growth and cultivation of the mushroom Pleurotus sajor-caju. This substrate showed higher levels of biological efficiency than the others substrates analysed.

  15. Some tests for parameter constancy in cointegrated VAR-models

    DEFF Research Database (Denmark)

    Hansen, Henrik; Johansen, Søren

    1999-01-01

    Some methods for the evaluation of parameter constancy in vector autoregressive (VAR) models are discussed. Two different ways of re-estimating the VAR model are proposed; one in which all parameters are estimated recursively based upon the likelihood function for the first observations, and anot...... be applied to test the constancy of the long-run parameters in the cointegrated VAR-model. All results are illustrated using a model for the term structure of interest rates on US Treasury securities. ......Some methods for the evaluation of parameter constancy in vector autoregressive (VAR) models are discussed. Two different ways of re-estimating the VAR model are proposed; one in which all parameters are estimated recursively based upon the likelihood function for the first observations......, and another in which the cointegrating relations are estimated recursively from a likelihood function, where the short-run parameters have been concentrated out. We suggest graphical procedures based on recursively estimated eigenvalues to evaluate the constancy of the long-run parameters in the model...

  16. Caracterización de la lacasa obtenida por dos métodos de producción con Pleurotus ostreatus Characterising laccase obtained by two production methods using Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Martínez César

    2003-12-01

    Full Text Available El objetivo de este trabajo fue caracterizar y evaluar diferentes métodos de purificación y separación cromatográfica de un caldo rico en enzima lacasa, producida por una variedad del basidiomycete Pleurotus ostreatus. Se llevaron a cabo dos procesos de producción, a saber: a FES (Fermentación en Estado Sólido; b fermentación en sumergido. El proceso de FES se basó en la producción de un extracto de caldo crudo rico en enzima lacasa a partir del crecimiento micelial sobre salvado con vinaza en relación 1:1 w/v duran te 20 días. Se obtuvo un caldo crudo con una actividad promedio de 20 U/ml. En el caso del proceso de fermentación en sumergido, se trabajó con el medio reportado por Hublick y Schinner (2000 con algunas modificaciones, y se obtuvo un crecimiento del hongo en forma de pellets, en un período de 15 días, con actividad promedio de 10 U/ml en el caldo crudo. Las isoenzimas aisladas en los procesos cromatográficos se caracterizaron de acuerdo a sus propiedades moleculares y cinéticas, se determinó su peso molecular por electroforesis de placa vertical (SDS-PAGE y sus parámetros cinéticos, por ejemplo estabilidad, en un rango de temperatura y pH. Palabras clave: lacasa; Pleurotus ostreatus; fermentación en estado sólido (FES; fermentación en sumergido; isoenzimas; laccase; Pleurotus ostreatus; Solid State Fermentation (SSF; Submerged Fermentation; isoenzymesThis project was designed for characterising and evaluating different methods of chromatographic separation and purification regarding a laccase enzyme-rich broth produced by Pleurotus ostreatus, a variety of basidiomycetes. SSF (Solid State Fermentation and Submerged Fermentation production processes were employed. The SSF process was based on producing a raw broth rich in laccase enzyme from mycelium grown on bran with 1:1 vinasse w/v for 20 days. A raw broth was obtained having an average 20 U/ml activity. The medium reported by Hublick and Schinner (2000

  17. EFFECTS OF MONETARY POLICY IN ROMANIA - A VAR APPROACH

    Directory of Open Access Journals (Sweden)

    Iulian Popescu

    2012-10-01

    Full Text Available Understanding how monetary policy decisions affect inflation and other economic variables is particularly important. In this paper we consider the implications of monetary policy under the inflation targeting regime in Romania, based on an autoregressive vector method including recursive VAR and structural VAR (SVAR. Therefore, we focus on assessing the extent and persistence of monetary policy effects on gross domestic product (GDP, price level, extended monetary aggregate (M3 and exchange rate. The main results of VAR analysis reflect a negative response of consumer price index (CPI, GDP and M3 and positive nominal exchange rate behaviour to a monetary policy shock, and also a limited impact of a short-term interest rate shock in explaining the consumer prices, production and exchange rate fluctuations.

  18. In Vitro Antimicrobial and Antioxidant Activities of Ethanolic Extract of Lyophilized Mycelium of Pleurotus ostreatus PQMZ91109

    Directory of Open Access Journals (Sweden)

    Emanuel Vamanu

    2012-03-01

    Full Text Available The antioxidant and antimicrobial potential of the ethanolic extract of Pleurotus ostreatus PQMZ91109 mycelium was determined based on inorganic and organic nitrogen sources in the culture medium. The presence of ammonium sulfate resulted in a greater accumulation of bioactive compounds compared with the organic ones. This finding was also confirmed by the low values of the ascertained EC50 and minimum inhibitory concentration (MICs. Among the organic sources, peptone followed by corn extract, led to a more important radical-scavenging activity. The extracts selectively inhibited the tested strains, mainly the two of the genus Candida, at an MIC value of 1.25 mg/mL. The antioxidant potential was evaluated by the inhibition capacity of the 2,2-diphenyl-1-picrylhydrazyl (DPPH radical, β-carotene-linoleic acid, which is the reducing power. In addition, the quantity of the compounds with antioxidant effects confirmed the data obtained, they being present in the extracts.

  19. Biological transformation of anthracene in soil by Pleurotus ostreatus under solid-state fermentation conditions using wheat bran and compost

    International Nuclear Information System (INIS)

    Vargas, M C; Rodriguez, R; Sanchez, F; Ramirez, N

    2001-01-01

    Pleurotus ostreatus was grown in a soil mixture contaminated with anthracene, wheat bran and compost, in varying combinations. Assays with added bacteria and reinoculation of the fungus were also included. The results indicated that in many of the combinations, most of the anthracene was removed at the earliest sample time, 15 days. The most effective combination was spiked (anthracene-added) soil, fungus and compost and the addition of acclimated bacteria to this mixture inhibited anthracene removal. Analyses of extract by high-pressure liquid chromatography HPLC indicated that - anthraquinone, was the major metabolite formed. The results of this study indicate that solid-state fermentation of anthracene-contaminated soils using P. ostreatus in combination with wheat bran and compost additives can produce an accelerated rate of biological removal of anthracene from the soil

  20. Water-Soluble Polysaccharide Extracts from the Oyster Culinary-Medicinal Mushroom Pleurotus ostreatus (Agaricomycetes) with HMGCR Inhibitory Activity.

    Science.gov (United States)

    Gil-Ramirez, Alicia; Smiderle, Fhernanda R; Morales, Diego; Govers, Coen; Synytsya, Andriy; Wichers, Harry J; Iacomini, Marcello; Soler-Rivas, Cristina

    2017-01-01

    Water extracts from Pleurotus ostreatus containing no statins showed 3-hydroxy-3-methyl-glutaryl CoA reductase (HMGCR) inhibitory activity (in vitro) that might be due to specific water-soluble polysaccharides (WSPs); when isolated and deproteinized, increasing concentrations of the WSP extract induced higher inhibition. The WSP extract contained mainly β-glucans, mannogalactans, and glycogen (e.g., α-glucans), although derivatives or fragments with lower molecular weights (between 14 and 3.5 kDa) were present and were able to induce the inhibitory activity. The extract contained more β-(1→3)-glucans than β-(11→3),(11→6)-glucans, and they partially survived digestion and managed to pass through Caco2 cell monolayers to the lower compartment after in vitro digestion and transport experiments. The WSP might also modulate Caco2 membrane integrity.

  1. The fungistatic activity of organic selenium and its application to the production of cultivated mushrooms Agaricus bisporus and Pleurotus spp.

    Directory of Open Access Journals (Sweden)

    Savic Milena

    2012-01-01

    Full Text Available The activity of organic selenium against pathogenic molds and its use as a potential selenium source in the production of enriched mushrooms were examined. The effect of commercial selenized yeast on mycelia growth was examined using a method with mycelia disks and a well diffusion method. For mushroom enrichment, different concentrations of selenium were added to a growth substrate. The results presented in this paper suggest that the most suitable concentration of selenized yeast that inhibits the growth of the mycopathogenic molds is 70-100 mg/kg of selenium. With the addition of this concentration to the substrate, mushroom fruit bodies will uptake a high level of selenium, about 100 μg/g for Pleurotus spp., and 200 μg/g for Agaricus bisporus in dry weight of the mushroom. Thereby a double effect in the cultivation of mushrooms is achieved. [Projekat Ministarstva nauke Republike Srbije, br. III 46010 and br. III46001

  2. Use of oil palm kernel meal as a supplement material for abalone mushroom (Pleurotus cystidiosus O.K. Miller cultivation

    Directory of Open Access Journals (Sweden)

    Petcharat, V. and

    2004-09-01

    Full Text Available The objective of this study was to determine the optimum rate of oil palm kernel meal, for an abalone mushroom (Pleurotus cystidiosus cultivation. Different concentrations of oil palm kernel meal (5- 20% were added to pararubber sawdust and used to grow the abalone mushroom in plastic bags. Growth rate of the mycelia, number of days from watering to harvesting and yield were compared to those on 94% sawdust + 5% rice bran + 1% Ca(OH2. The results showed that 10% oil palm kernel meal was the optimum concentration for abalone mushroom cultivation. Yield on 950 g/bag of 89% sawdust + 10% oil palm kernel meal + 1% Ca(OH2 was 202.12 g/bag (B.E. = 60.79% during 120 days of havesting time. Addition of higher concentration of oil palm kernel meal (15-20% did not increase yield of the basidiocarps.

  3. To the issue of increasing efficiency of VAR compensation

    Directory of Open Access Journals (Sweden)

    Світлана Костянтинівна Поднебенна

    2015-11-01

    Full Text Available This article describes the features of VAR compensation of variable loads. One of the most common non-symmetric non-linear power consumers are welding power sources. Time and duration of the work of these sources vary randomly. To compensate the consumption of reactive power on the basis of consumption data from the three-phase electricity meters is inefficient. Compensation devices power should be calculated taking into account the asymmetrical consumption/generation of reactive power per phase and changing consumption patterns. Thyristor-controlled reactor, thyristor-switched capacitors, hybrid VAR compensators, active compensators (STATCOMs, «dynamic capacitors» can be used as the VAR compensation devices. Thyristor-controlled reactors can provide smooth regulation of reactive power, but they have high weight and size parameters and are additional sources of higher harmonics. Thyristor-switched capacitors provide stepwise adjustment of reactive power and are subject to the current higher harmonics. Hybrid VAR compensators make it possible to isolate capacitors from the higher harmonics and ensure smooth regulation, which is achieved by active filter introduction to the reactive power compensation devices based on thyristor-switched capacitors. However, this increases the cost of a compensator and complicates its control system. STATCOMs provide smooth regulation of reactive power, but they are too expensive.Perspective direction in the development of effective VAR compensation devices is «dynamic capacitor». As a result of a feasibility study the prospects for further research of electrical grids power efficiency through the development of effective devices for VAR compensation have been established

  4. New prediction for the direct CP-violating parameter var-epsilon prime/var-epsilon and the ΔI=1/2 rule

    International Nuclear Information System (INIS)

    Wu, Yue-Liang

    2001-01-01

    The low-energy dynamics of QCD is investigated with special attention paid to the matching between QCD and chiral perturbation theory (ChPT), and also to some useful algebraic chiral operator relations which survive even when we include chiral loop corrections. It then allows us to evaluate the hadronic matrix elements below the energy scale Λ χ ≅1GeV. Based on the new analyses, we present a consistent prediction for both the direct CP-violating parameter var-epsilonprime/var-epsilon and the ΔI=1/2 rule in kaon decays. In the leading 1/N c approximation, the isospin amplitudes A 0 and A 2 are found to agree well with the data, and the direct CP-violating parameter var-epsilonprime/var-epsilon is predicted to be large, which also confirms our earlier conclusion. Its numerical value is var-epsilonprime/var-epsilon=23.6 -7.8 +12.4 x10 -4 (Imλ t /= 1.2x10 -4 ) which is no longer sensitive to the strange quark mass due to the matching conditions. Taking into account a simultaneous consistent analysis on the isospin amplitudes A 0 and A 2 , the ratio var-epsilonprime/var-epsilon is in favor of the values var-epsilonprime/var-epsilon=(20±9)x10 -4

  5. Saccharomyces cerevisiae var. boulardii fungemia following probiotic treatment

    Directory of Open Access Journals (Sweden)

    Marcelo C. Appel-da-Silva

    2017-12-01

    Full Text Available Probiotics are commonly prescribed as an adjuvant in the treatment of antibiotic-associated diarrhea caused by Clostridium difficile. We report the case of an immunocompromised 73-year-old patient on chemotherapy who developed Saccharomyces cerevisiae var. boulardii fungemia in a central venous catheter during treatment of antibiotic-associated pseudomembranous colitis with the probiotic Saccharomyces cerevisiae var. boulardii. Fungemia was resolved after interruption of probiotic administration without the need to replace the central venous line. Keywords: Saccharomyces, Probiotics, Fungemia, Critical illness, Clostridium difficile

  6. The Vibrio cholerae var regulon encodes a metallo-β-lactamase and an antibiotic efflux pump, which are regulated by VarR, a LysR-type transcription factor.

    Directory of Open Access Journals (Sweden)

    Hong-Ting Victor Lin

    Full Text Available The genome sequence of V. cholerae O1 Biovar Eltor strain N16961 has revealed a putative antibiotic resistance (var regulon that is predicted to encode a transcriptional activator (VarR, which is divergently transcribed relative to the putative resistance genes for both a metallo-β-lactamase (VarG and an antibiotic efflux-pump (VarABCDEF. We sought to test whether these genes could confer antibiotic resistance and are organised as a regulon under the control of VarR. VarG was overexpressed and purified and shown to have β-lactamase activity against penicillins, cephalosporins and carbapenems, having the highest activity against meropenem. The expression of VarABCDEF in the Escherichia coli (ΔacrAB strain KAM3 conferred resistance to a range of drugs, but most significant resistance was to the macrolide spiramycin. A gel-shift analysis was used to determine if VarR bound to the promoter regions of the resistance genes. Consistent with the regulation of these resistance genes, VarR binds to three distinct intergenic regions, varRG, varGA and varBC located upstream and adjacent to varG, varA and varC, respectively. VarR can act as a repressor at the varRG promoter region; whilst this repression was relieved upon addition of β-lactams, these did not dissociate the VarR/varRG-DNA complex, indicating that the de-repression of varR by β-lactams is indirect. Considering that the genomic arrangement of VarR-VarG is strikingly similar to that of AmpR-AmpC system, it is possible that V. cholerae has evolved a system for resistance to the newer β-lactams that would prove more beneficial to the bacterium in light of current selective pressures.

  7. 21 CFR 173.145 - Alpha-Galactosidase derived from Mortierella vinaceae var. raffinoseutilizer.

    Science.gov (United States)

    2010-04-01

    ... vinaceae var. raffinoseutilizer. 173.145 Section 173.145 Food and Drugs FOOD AND DRUG ADMINISTRATION... Alpha-Galactosidase derived from Mortierella vinaceae var. raffinoseutilizer. The food additive alpha-galactosidase and parent mycelial microorganism Mortierella vinaceae var. raffinoseutilizer may be safely used...

  8. Morphological and genetic differences between Coptis japonica var. anemonifolia H. Ohba and Coptis japonica var. major Satake in Hokuriku area.

    Science.gov (United States)

    Kitamura, Masashi; Ando, Hirokazu; Sasaki, Yohei

    2018-03-01

    Coptis japonica is widely distributed in Japan, and its dried rhizome is a source of the domestic herbal medicine Coptidis Rhizoma ( Oren). There are three varieties of C. japonica, two of which, namely, C. japonica var. anemonifolia and C. japonica var. major, are important as sources of traditional medicines. Coptis japonica var. anemonifolia and C. japonica var. major are distinguishable on the basis of their ternate or biternate compound leaves, respectively. In the Hokuriku area, where both C. japonica var. anemonifolia and C. japonica var. major grow naturally, some individual plants cannot be identified unambiguously on the basis of leaf morphology because changes in leaf morphology may occur due to intra-variety variation or crossbreeding between the two varieties. In addition, genetic differences between the two varieties have remained unclear. In this study, we employed new genetic and morphological classification approaches to discriminate between the two varieties. Based on the single nucleotide polymorphisms of the tetrahydroberberine oxidase gene, we found four conserved SNPs between the two varieties and were able to classify C. japonica into two varieties and crossbreeds. Furthermore, we introduced a new leaf type index based on the overall degree of leaflet dissection calculated by surface area of a leaflet and length of leaflet margin and petiolule. Using our new index we were able to discriminate between the two varieties and their crossbreeds more accurately than is possible with the conventional discrimination method. Our genetic and morphological classification methods may be used as novel benchmarks to discriminate between the two varieties and their crossbreeds.

  9. Integration of Artificial Neural Network Modeling and Genetic Algorithm Approach for Enrichment of Laccase Production in Solid State Fermentation by Pleurotus ostreatus

    OpenAIRE

    Potu Venkata Chiranjeevi; Moses Rajasekara Pandian; Sathish Thadikamala

    2014-01-01

    Black gram husk was used as a solid substrate for laccase production by Pleurotus ostreatus, and various fermentation conditions were optimized based on an artificial intelligence method. A total of six parameters, i.e., temperature, inoculum concentration, moisture content, CuSO4, glucose, and peptone concentrations, were optimized. A total of 50 experiments were conducted, and the obtained data were modeled by a hybrid of artificial neural network (ANN) and genetic algorithm (GA) approaches...

  10. A Macrosphelide as the Unexpected Product of a Pleurotus ostreatus Strain-Mediated Biotransformation of Halolactones Containing the gem-Dimethylcyclohexane Ring. Part 1

    Directory of Open Access Journals (Sweden)

    Katarzyna Wińska

    2016-06-01

    Full Text Available The aim of the study was to obtain new compounds during biotransformation of two halocompounds, the δ-bromo and δ-iodo-γ-bicyclolactones 1 and 2. Unexpectedly Pleurotus ostreatus produced together with the hydroxylactone, 2-hydroxy-4,4-dimethyl-9-oxabicyclo[4.3.0]nonane-8-one (3, its own metabolite (3S,9S,15S-(6E,12E-3,9,15-trimethyl-4,10,16-trioxacyclohexa-deca-6,12-diene-1,5,8,11,14-pentaone (4. The method presented here, in which this macrosphelide 4 was obtained by biotransformation, has not been previously described in the literature. To the best of our knowledge, this compound has been prepared only by chemical synthesis to date. This is the first report on the possibility of the biosynthesis of this compound by the Pleurotus ostreatus strain. The conditions and factors, like temperature, salts, organic solvents, affecting the production of this macrosphelide by Pleurotus ostreatus strain were examined. The highest yield of macroshphelide production was noticed for halolactones, as well with iodide, bromide, iron and copper (2+ ions as inductors.

  11. Effects of Pleurotus sapidus (Schulzer Sacc. treatment on nutrient composition and ruminal fermentability of barley straw, barley rootless, and a mixture of the two

    Directory of Open Access Journals (Sweden)

    Alfonso Soto-Sánchez

    2015-09-01

    Full Text Available Barley (Hordeum vulgare L., and its derivatives, ranks fourth in cereal production worldwide, and the Pleurotus species are among the most efficient types of lignocellulolytic white-rot fungi. The objective of this research study was to evaluate the degradation of barley straw and barley rootless with an inoculum of Pleurotus to improve their nutritional availability as a food source for ruminants. Two experiments were conducted; the first was to determine the effects of inoculation of Pleurotus sapidus (Schulzer Sacc. (PS in barley straw (BS, barley rootless (BR, and a 75% BS and 25% BR mixture (M. The second experiment was to evaluate the same substrates in vitro ruminal fermentation. Barley rootless had better organic matter (OM degradability than BS after 24 h incubation with PS. The protein content in BR was higher than in BS (P < 0.01. Enzyme activities had the highest concentration from the start of fermentation, and in vitro dry matter (DM degradability in BS and BR increased after 8 and 24 d fermentation, respectively (P < 0.05. Propionic acid concentration was enhanced after 16 d fermentation in BR (P < 0.5. The use of BS combined with BR exhibited better fermentation; this result provides relevant information for integrating BR with other substrates and improving the use of straw, which can be more nutritionally available for feeding ruminants.

  12. Shelf-life increase of fresh mushrooms Pleurotus sajor-caju using gamma radiation

    International Nuclear Information System (INIS)

    Moda, Evelise Moncaio

    2008-01-01

    The production and consumption of edible mushrooms has been increasing in the last years due to its nutritional composition and sensory quality. The irradiation of mushrooms has been used with the purpose of maintaining the fresh product characteristics during shelf-life. The present study evaluated the effect of different radiation doses on the conservation of mushrooms Pleurotus sajor-caju, through by chemical, physical, microbiological and sensorial parameters. The packaging consisted on polystyrene trays with 250 g of sample, wrapped in polyvinyl chloride (PVC). The mushrooms were irradiated with doses of 125, 250, 500 and 750 Gy in a Gamma cell 220 type irradiator, and stored at 4 ± 1 deg C and 90% UR for 10 days. The proximate composition (moisture, crude fibre, total protein, total fat and ash), total soluble solids, pH, texture, color (L, a, b, Chroma and ho), enzymatic activity (polyphenoloxidase and peroxidase), microbiological (total coliform, Escherichia coli and total psychotropic bacteria) and sensory evaluation (color, taste and appearance) were determined in the 1st, 5th and 10th storage days. For the respiratory rate analysis, 30 g of sample were placed in jars and stored at 4 ± 1 deg C and 90% UR for 8 days. CO 2 was analyzed every day using a gaseous chromatograph. The results were submitted to variance analysis and average test using the SAS statistical package. The total protein and total fat values did not differ significantly between treatments or storage periods, while the moisture, crude fibre and ash values differ between treatments and periods. The dose of 750 Gy darkness the mushroom in the last evaluation, and texture was better in control during the storage period. The color (L, a), texture and proximate composition values did not differ significantly between treatments or storage periods. A significant increase was observed for soluble solids, b * and enzymatic activity values in all treatments at the end of the storage period

  13. Ochratoxin A production by strains of Aspergillus niger var. niger.

    Science.gov (United States)

    Abarca, M L; Bragulat, M R; Castellá, G; Cabañes, F J

    1994-01-01

    In a survey of the occurrence of ochratoxin A (OA)-positive strains isolated from feedstuffs, two of the 19 isolates of Aspergillus niger var. niger that were studied produced OA in 2% yeast extract-15% sucrose broth and in corn cultures. This is the first report of production of OA by this species. PMID:8074536

  14. Micropropagation of Caralluma stalagmifera var. longipetala : A rare ...

    African Journals Online (AJOL)

    An efficient in vitro protocol has been developed for the multiplication of shoots and conservation of a rare succulent medicinal plant Caralluma stalagmifera var. longipetala growing wildly in Karnataka State. Proliferation of multiple shoots was achieved on Murashige and Skoog's (MS) medium supplemented with various ...

  15. Chemical composition of essential oil of Psidium cattleianum var ...

    African Journals Online (AJOL)

    The aim of this study was to investigate the essential oil composition of Psidium cattleianum var. lucidum from South Africa. The essential oils were extracted by hydrodistillation and the components were identified by gas chromatography coupled to mass spectrometry (GC-MS) to determine the chemical composition of the ...

  16. Testing for Granger causality in large mixed-frequency VARs

    NARCIS (Netherlands)

    Götz, T.B.; Hecq, A.W.

    2014-01-01

    In this paper we analyze Granger causality testing in a mixed-frequency VAR, originally proposed by Ghysels (2012), where the difference in sampling frequencies of the variables is large. In particular, we investigate whether past information on a low-frequency variable help in forecasting a

  17. Impacts of Bacillus thuringiensis var. israelensis and Bacillus ...

    African Journals Online (AJOL)

    The study assessed the impact of bio-larvicides- Bacillus thuringiensis var. israelensis (Bti) and B. sphaericus (Bs) on anopheline mosquito larval densities in four selected areas of Lusaka urban district. Larval densities were determined using a standard WHO protocol at each study area prior to and after larviciding.

  18. The identity of zostera marina var. angustifolia Hornemann (Potamogetonaceae)

    NARCIS (Netherlands)

    Hartog, den C.

    1972-01-01

    Since Hornemann (Fl. Dan. 9, 1816, p. 3, pl. 1501) published the name Zostera marina var. angustifolia together with a very poor drawing and the extremely short diagnosis ‘foliis subenerviis’ several interpretations of the identity of this taxon have been given. Some authors regarded it as a

  19. A Bootstrap Cointegration Rank Test for Panels of VAR Models

    DEFF Research Database (Denmark)

    Callot, Laurent

    functions of the individual Cointegrated VARs (CVAR) models. A bootstrap based procedure is used to compute empirical distributions of the trace test statistics for these individual models. From these empirical distributions two panel trace test statistics are constructed. The satisfying small sample...

  20. Local cabbage ( Brassica oleracea var. capitata L.) populations from ...

    African Journals Online (AJOL)

    In previous experiments, we were able to augment cabbages (Brassica oleracea L. var. capitata L.) with two new local open pollinated (OP) populations and one cultivar. The type of use indicated that these are cabbages with thinner and juicier leaves, which predisposes their heads for fine grating and also makes their ...

  1. Fiscal developments and financial stress: a threshold VAR analysis

    Czech Academy of Sciences Publication Activity Database

    Afonso, A.; Baxa, Jaromír; Slavík, M.

    2011-01-01

    Roč. 2011, č. 1319 (2011), s. 1-60 ISSN 1725-2806 Institutional research plan: CEZ:AV0Z10750506 Keywords : fiscal policy * financial markets * threshold VAR Subject RIV: AH - Economics http://library.utia.cas.cz/separaty/2011/E/baxa-0364091.pdf

  2. Anogeissus sericea var. nummalaria King ex Duthie (Combretaceae ...

    Indian Academy of Sciences (India)

    Anogeissus sericea var. nummalaria King ex Duthie (Combretaceae) is moderate sized multipurpose hard wood tree of dry deciduous forests with drooping branches and yellow to brownish-yellow flowers. it is endemic to Rajasthan and is considered to be a threatened tree of the region due to over exploitation for timber ...

  3. Fast Responding Voltage Regulator and Dynamic VAR Compensator

    Energy Technology Data Exchange (ETDEWEB)

    Divan, Deepak [Varentec, Incorporated, San Jose, CA (United States); Moghe, Rohit [Varentec, Incorporated, San Jose, CA (United States); Tholomier, Damien [Varentec, Incorporated, San Jose, CA (United States)

    2014-12-31

    The objectives of this project were to develop a dynamic VAR compensator (DVC) for voltage regulation through VAR support to demonstrate the ability to achieve greater levels of voltage control on electricity distribution networks, and faster response compared to existing grid technology. The goal of the project was to develop a prototype Fast Dynamic VAR Compensator (Fast DVC) hardware device, and this was achieved. In addition to developing the dynamic VAR compensator device, Varentec in partnership with researchers at North Carolina State University (NCSU) successfully met the objectives to model the potential positive impact of such DVCs on representative power networks. This modeling activity validated the ability of distributed dynamic VAR compensators to provide fast voltage regulation and reactive power control required to respond to grid disturbances under high penetration of fluctuating and intermittent distributed energy resources (DERs) through extensive simulation studies. Specifically the following tasks were set to be accomplished: 1) Development of dynamic VAR compensator to support dynamic voltage variations on the grid through VAR control 2) Extensive testing of the DVC in the lab environment 3) Present the operational DVC device to the DOE at Varentec’s lab 4) Formulation of a detailed specification sheet, unit assembly document, test setup document, unit bring-up plan, and test plan 5) Extensive simulations of the DVC in a system with high PV penetration. Understanding the operation with many DVC on a single distribution system 6) Creation and submittal of quarterly and final reports conveying the design documents, unit performance data, modeling simulation charts and diagrams, and summary explanations of the satisfaction of program goals. This report details the various efforts that led to the development of the Fast DVC as well as the modeling & simulation results. The report begins with the introduction in Section II which outlines the

  4. Chemopreventive and Anticancer Activities of Allium victorialis var. platyphyllum Extracts.

    Science.gov (United States)

    Kim, Hyun-Jeong; Park, Min Jeong; Park, Hee-Juhn; Chung, Won-Yoon; Kim, Ki-Rim; Park, Kwang-Kyun

    2014-09-01

    Allium victorialis var. platyphyllum is an edible perennial herb and has been used as a vegetable or as a Korean traditional medicine. Allium species have received much attention owing to their diverse pharmacological properties, including antioxidative, anti-inflammatory, and anticancer activities. However, A. victorialis var. platyphyllum needs more study. The chemopreventive potential of A. victorialis var. platyphyllum methanol extracts was examined by measuring 12-O-tetra-decanoylphorbol 13-acetate (TPA)-induced superoxide anion production in the differentiated HL-60 cells, TPA-induced mouse ear edema, and Ames/Salmonella mutagenicity. The apoptosis-inducing capabilities of the extracts were evaluated by the 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide assay, 4',6-diamidino-2-phenylindole staining, and the DNA fragmentation assay in human colon cancer HT-29 cells. Antimetastatic activities of the extracts were also investigated in an experimental mouse lung metastasis model. The methanol extracts of A. victorialis var. platyphyllum rhizome (AVP-R) and A. victorialis var. platyphyllum stem (AVP-S) dose-dependently inhibited the TPA-induced generation of superoxide anion in HL-60 cells and TPA-induced ear edema in mice, as well as 7,12-dimethylbenz[a]anthracene (DMBA) and tert-butyl hydroperoxide (t-BOOH) -induced bacterial mutagenesis. AVP-R and AVP-S reduced cell viability in a dose-related manner and induced apoptotic morphological changes and internucleosomal DNA fragmentation in HT-29 cells. In the experimental mouse lung metastasis model, the formation of tumor nodules in lung tissue was significantly inhibited by the treatment of the extracts. AVP-R and AVP-S possess antioxidative, anti-inflammatory, antimutagenic, proapoptotic, and antimetastatic activities. Therefore, these extracts can serve as a beneficial supplement for the prevention and treatment of cancer.

  5. Amanitin and phallotoxin concentration in Amanita phalloides var. alba mushroom.

    Science.gov (United States)

    Kaya, Ertugrul; Yilmaz, Ismail; Sinirlioglu, Zeynep Aydin; Karahan, Selim; Bayram, Recep; Yaykasli, Kursat Oguz; Colakoglu, Serdar; Saritas, Ayhan; Severoglu, Zeki

    2013-12-15

    Although rarely seen, Amanita phalloides var. alba, a variety of A. phalloides type mushrooms, causes mushroom poisoning resulting in death. Since it is frequently confused with some edible mushrooms due to its white colored cap and macroscopic appearance, it becomes important in toxicological terms. Knowledge of the toxin amount contained in this mushroom type is invaluable in the treatment of cases involving poisoning. In this study, we examined the toxin levels of various parts of the A. phalloides var. alba mushroom growing Duzce region of Turkey. Toxin analyses were carried out for A. phalloides var. alba, which were collected from the forests Duzce region of Turkey in 2011, as a whole and also separately in its spore, pileus, gills, stipe and volva parts. The alpha amanitin, beta amanitin, gamma amanitin, phalloidin and phallacidine analyses of the mushrooms were carried out using the RP-HPLC method. A genetic analysis of the mushroom showed that it had similar genetic characteristics as A. phalloides and was a variety of it. The lowest toxins quantity was detected in spores, volva and stipe among all parts of the mushroom. The maximum amount of amatoxins was measured in the gills. The pileus also contained a high amount of amatoxins. Generally, amatoxins and phallotoxin concentrations were lower as compared to A. phalloides, but interestingly all toxins other than gamma toxin were higher in the spores of A. phalloides var. alba. The amount of toxin in all of its parts had sufficient concentrations to cause death. With this study, the amatoxin and phallotoxin concentrations in A. phalloides var. alba mushroom and in its parts have been revealed in detail for the first time. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. A comprehensive market-based scheme for VAR management and pricing in the electricity markets

    Energy Technology Data Exchange (ETDEWEB)

    El-Araby, E.E. [Qassim Univ., Alqassim, Meldia (Saudi Arabia). Dept. of Electrical Engineering

    2009-07-01

    In order to enable a power system to operate within an acceptable degree of reliability and security, the provision of VAR ancillary services from the VAR sources in electricity markets is the most effective method. The procurement of VAR services is particularly problematic for transmission operators as it relates to pricing mechanism and various technical issues during system operation. This paper proposed an integrated market-based approach for pricing VAR service in the electricity market. The paper was an extension of the authors' proposal for the provision of the VAR service from dynamic VAR sources in a competitive market-based environment. The formulation was modified to include VAR utilization payment and possible power system transition states multiple base cases and contingencies with their associated occurrence probabilities. The paper discussed the basic terms of the proposed approach including the VAR market objective and generator VAR output and its compensation. The mathematical formulation that considered VAR capacity payment, utilization payment and operating costs under the previous transition states in a unified single problem were introduced. The overall problem formulation and solution algorithm were also presented as a large-scale mixed integer nonlinear optimization problem. It was concluded that the proposed method was suited for the simulation and analysis of the existing VAR market. 8 refs., 3 tabs., 5 figs., 2 appendices.

  7. EFEITO FUNGITÓXICO DO ÓLEO DE NIM SOBRE Metarhizium anisopliae var. acridum e Metarhizium anisopliae var. anisopliae

    Directory of Open Access Journals (Sweden)

    Álison Bruno da Silva Santos

    2009-01-01

    Full Text Available Plague control is based almost exclusively on application of chemical substances, however these products are toxic to men and animals and cause odd effects on environment quality. In Plague Integrated Management (PIM, the use of selected insecticides and entomopathogenic fungi should be considered as one viable strategy for plague control in agriculture. This work aimed to evaluate, in laboratory, the compatibility of the entomopathogenic fungi Metarhizium anisopliae var. acridum and Metarhizium anisopliae var. anisopliae with the oil of Nim. The addition of the product was made to the potato-dextrose-agar medium still liquid (±45°C, in a way that the final concentration obeyed 50% of the producer's recommendation. After fungi inoculation, the dishes were incubated in a cimatized room at 28°C, photophase of 12 hours and relative humidity of 75±5% for 12 day period. The number of conidia per colonie was counted with a Neubauer chamber. Statistic delineament was entirely in random, with two treatments (PDA with insecticide, and a control group (PDA without insecticide, and 9 repetitions for each treatment. The results showed that the insecticide inhibited conidial production in Metarhizium anisopliae var. anisopliae strains when compared to the control group. The diameter of Metarhizium anisopliae var. acridum colonies suffered significative reduction in its size, compared to control. The tested insecticide, in the concentration and formulation used, presented compatibility with the tested strains.

  8. Metabolomic variation of brassica rapa var. rapa (var. raapstelen) and raphanus sativus l. at different developmental stages

    NARCIS (Netherlands)

    Jahangir, M.; Abdel-Farid, I.B.; Vos, de C.H.R.; Jonker, H.H.; Choi, Y.H.; Verpoorte, R.

    2014-01-01

    Brassica rapa (var. raapstelen) and Raphanus sativus (red radish) are being used as food and fodder while also known as model in recent plant research due to the diversity of metabolites as well as genetic resemblance to Arabidopsis. This study explains the change in metabolites (amino acids,

  9. Biodegradation of remazol brilliant blue R by ligninolytic enzymatic complex produced by Pleurotus ostreatus Biodegradação do azul brilhante de remazol R pelo complexo enzimático ligninolítico produzido por Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Kátia Maria Gomes Machado

    2006-12-01

    Full Text Available Pleurotus ostreatus ("shimeji" is produced in Brazil on a commercial scale using various lignocellulosic residues. Efforts have been made to reuse the culture residue to obtain products of greater aggregate value such as enzymes or in processes of bioremediation. We evaluated the Remazol brilliant blue R (RBBR degradation potential of extracts from solid substrate colonized by P. ostreatus and extracts from residue of the "shimeji" mushroom yield. Colonized substrates and residue were provided by Toyobo do Brasil Ltda. Extraction was performed with sodium acetate buffer (50 mM, pH 4.6. RBBR decolorization was monitored at 592 nm and peroxidase and laccase activities were measured by monitoring the oxidation of ABTS. Horseradish peroxidase was used as reference. The time of growth of P. ostreatus influenced RBBR degradation and peroxidase and laccase activities. Concentration of 1 mM H2O2 and pH 4.0 were the best for RBBR decolorization. Complete RBBR decolorization was obtained with the addition of only one aliquot of 50 µL of 1 mM H2O2. The stability of the extracts was higher when they were kept under refrigeration than when stored frozen. The potential application of the ligninolytic complex derived from P. ostreatus and mushroom residue for xenobiotic degradation was demonstrated.Pleurotus ostreatus ("shimeji" é produzido no Brasil em escala comercial empregando-se vários resíduos lignocelulósicos. Esforços têm sido feitos para reaproveitamento do resíduo do cultivo em produtos de maior valor agregado, como enzimas ou sua aplicação em processos de biorremediação. Foi feita avaliação do potencial de degradação do azul brilhante de remazol (RBBR por extratos obtidos de substratos sólidos colonizados por P. ostreatus e por extratos do resíduo da produção do cogumelo "shimeji". Substratos colonizados e o resíduo foram fornecidos pela Toyobo do Brasil Ltda. Extração foi feita com tampão acetato de sódio (50 mM, pH 4

  10. Can reported VaR be used as an indicator of the volatility of share prices? Evidence from UK banks.

    OpenAIRE

    Ou, Shian Kao

    2006-01-01

    Value at Risk (VaR) is used as an indicator to measure the risks contained in a firm. With the uprising development of VaR theory and computational techniques, the VaR is nowadays adopted by banks and reported in annual reports. Since the method to calculate VaR is questioned, and the reported VaR can not be thoroughly audited, this paper attempts to find the relationship between the reported VaR and the volatility of share price for UK listed banks. This paper reviews literature about VaR an...

  11. Foco de leishmaniasis en El Hobo, municipio de El Carmen de Bolívar, Bolívar, Colombia

    Directory of Open Access Journals (Sweden)

    Luis Alberto Cortés

    2006-10-01

    Full Text Available Introducción. Se describen las características epidemiológica e importancia de la especies de Lutzomyia presentes en un foco de leishmaniasis en la vereda El Hobo Carmen de Bolívar, departamento de Bolívar. Objetivos. Obtener un conocimiento preliminar de la transmisión de leishmaniasis en la vereda El Hobo Carmen de Bolívar. Materiales y métodos. Se analizaron datos epidemiológicos y se realizaron capturas de flebótomos con trampas CDC y cebo humano en la vereda El Hobo. Para establecer la sero prevalencia de leishmaniasis visceral canina se hizo un estudio en perros mediante la técnica de inmunofluorescencia indirecta. Resultados. Se capturaron nueve especies de Lutzomyia: L. trinidadensis, L. evansi, L .cayennensis, L. venezuelensis, L. gomezi,L. dubitans, L. ylephiletor, L. yuilli, y L. walkeri. Las especie de mayor importancia por sus implicaciones en la transmisión de leishmaniasis cutánea y visceral fueron L. gomezi, y L. evansi respectivamente. Se reporta por primera vez para Bolívar especimenes de L. venezuelensis, L. dubitans, L. ylephiletor, L. yuilli, y L. walkeri. Se determinó una prevalencia de leishmaniasis visceral del 36% en los caninos estudiados. Según los reportes epidemiológicos, en el 2002 en el municipio de Carmen de Bolívar la leishmaniasis cutánea mostró un aumento del 40% y la leishmaniasis visceral canina del 80% de los casos con respecto al 2001, debido al brote presentado en la vereda El Hobo Conclusiones. Los resultados determinan a la vereda El Hobo como una zona de riesgo potencial de transmisión de leishmaniasis cutánea y visceral.

  12. Identification of the relationship between Chinese Adiantum reniforme var. sinense and Canary Adiantum reniforme.

    Science.gov (United States)

    Wang, Ai-Hua; Sun, Ye; Schneider, Harald; Zhai, Jun-Wen; Liu, Dong-Ming; Zhou, Jin-Song; Xing, Fu-Wu; Chen, Hong-Feng; Wang, Fa-Guo

    2015-02-05

    There are different opinions about the relationship of two disjunctively distributed varieties Adiantum reniforme L. var. sinense Y.X.Lin and Adiantum reniforme L. Adiantum reniforme var. sinense is an endangered fern only distributed in a narrowed region of Chongqing city in China, while Adiantum reniforme var. reniforme just distributed in Canary Islands and Madeira off the north-western African coast. To verify the relationship of these two taxa, relative phylogenetic analyses, karyotype analyses, microscopic spore observations and morphological studies were performed in this study. Besides, divergence time between A. reniforme var. sinense and A. reniforme var. reniforme was estimated using GTR model according to a phylogeny tree constructed with the three cpDNA markers atpA, atpB, and rbcL. Phylogenetic results and divergence time analyses--all individuals of A. reniforme var. sinense from 4 different populations (representing all biogeographic distributions) were clustered into one clade and all individuals of A. reniforme var. reniforme from 7 different populations (all biogeographic distributions are included) were clustered into another clade. The divergence between A. reniforme var. reniforme and A. reniforme var. sinense was estimated to be 4.94 (2.26-8.66) Myr. Based on karyotype analyses, A. reniforme var. reniforme was deduced to be hexaploidy with 2n = 180, X = 30, while A. reniforme var. sinense was known as tetraploidy. Microscopic spore observations suggested that surface ornamentation of A. reniforme var. reniforme is psilate, but that of A. reniforme var. sinense is rugate. Leaf blades of A. reniforme var. sinense are membranous and reniform and with several obvious concentric rings, and leaves of A. reniforme var. reniforme are pachyphyllous and coriaceous and are much rounder and similar to palm. Adiantum reniforme var. sinense is an independent species rather than the variety of Adiantum reniforme var. reniforme. As a result, we

  13. [Photosynthetic parameters and physiological indexes of Paris polyphylla var. yunnanensis influenced by arbuscular mycorrhizal fungi].

    Science.gov (United States)

    Wei, Zheng-xin; Guo, Dong-qin; Li, Hai-feng; Ding, Bo; Zhang, Jie; Zhou, Nong; Yu, Jie

    2015-10-01

    Through potted inoculation test at room temperature and indoor analysis, the photosynthetic parameters and physiological and biochemical indexes of Paris polyphylla var. yunnanensis were observed after 28 arbuscular mycorrhizal (AM) fungi were injected into the P. polyphylla var. yunnanensis growing in a sterile soil environment. The results showed that AM fungi established a good symbiosis with P. polyphylla var. yunnanensis. The AM fungi influenced the photosynthetic parameters and physiological and biochemical indexes of P. polyphylla var. yunnanensis. And the influences were varied depending on different AM fungi. The application of AM fungi improved photosynthesis intensity of P. polyphylla var. yunnanensis mesophyll cells, the contents of soluble protein and soluble sugar, protective enzyme activity of P. polyphylla var. yunnanensis leaf, which was beneficial to resist the adverse environment and promote the growth of P. polyphylla var. yunnanensis. Otherwise, there was a certain mutual selectivity between P. polyphylla var. yunnanensis and AM fungi. From the comprehensive effect of inoculation, Racocetra coralloidea, Scutellospora calospora, Claroideoglomus claroideum, S. pellucida and Rhizophagus clarus were the most suitable AM fungi to P. polyphylla var. yunnanensis when P. polyphylla var. yunnanensis was planted in the field.

  14. [Physiological characteristics of Pinus densiflora var. zhangwuensis and Pinus sylvestris var. mongolica seedlings on sandy lands under salt-alkali stresses].

    Science.gov (United States)

    Meng, Peng; Li, Yu-Ling; Zhang, Bai-xi

    2013-02-01

    For the popularization of Pinus densiflora var. zhangwuensis, a new afforestation tree species on the desertified and salinized-alkalized lands in Northern China, and to evaluate the salinity-alkalinity tolerance of the tree species and to better understand the tolerance mechanisms, a pot experiment with 4-year old P. densiflora var. zhangwuensis and P. sylvestris var. mongolica was conducted to study their seedlings growth and physiological and biochemical indices under the effects of three types salt (NaCl, Na2CO3, and NaHCO3 ) stresses and of alkali (NaOH) stress. Under the salt-alkali stresses, the injury level of P. densiflora var. zhangwuensis was lower, and the root tolerance index was higher. The leaf catalase (CAT) activity increased significantly by 22. 6 times at the most, as compared with the control; the leaf malondialdehyde (MDA) content had no significant increase; the leaf chlorophyll (Chl) content had a smaller decrement; and the leaf water content (LWC) increased slightly. P. sylvestris var. mongolica responded differently to the salt-alkali stresses. Its leaf CAT activity had less change, MDA content increased significantly, Chl content had significant decrease, and LWC decreased slightly. It was suggested that P. densi-flora var. zhangwuensis had a greater salinity-alkalinity tolerance than P. sylvestris var. mongolica. The higher iron concentration in P. densiflora var. zhangwuensis needles enhanced the CAT activity and Chl content, whereas the higher concentrations of zinc and copper were associated with the stronger salinity-alkalinity tolerance.

  15. USO DEL BAGAZO ENRIQUECIDO CON EL HONGO Pleurotus ostreatus, EN DIETAS PARA BOVINOS ESTABULADOS EN CEBA UTILIZAÇÃO DO BAGAÇO ENRIQUECIDO COMO FUNGO Pleurotus ostreatus, EM DIETAS PARA BOVINOS ESTABULADOS EM ENGORDA Pleurotus ostreatus ENRICHED SUGAR CANEHUSKS UTILIZATION ON INDOOR CATTLEFATTENING DIETS

    Directory of Open Access Journals (Sweden)

    NATALIA LIZETTE CASTAÑO

    2012-12-01

    Full Text Available En la elaboración de la panela, entre el 40 y 54% es bagazo, el cual se caracteriza portener baja proteína y energía, altos compuestos lignocelulósicos, acompañado de una baja digestibilidad, por ello, tradicionalmente ha sido utilizado como combustiblepara las hornillas. El presente trabajo, evaluó el uso del bagazo enriquecido con el hongo Pleurotus ostreatus, como suplemento en dietas para bovinos, frente a otros tratamientos con y sin suplementación comercial. A todos los animales se les suministró una dieta balanceada que consistía en 18 Kg de pasto king grass (Saccharum sinense, 6 Kg de caña (Saccharum officinarum, 3 Kg de cogollo de caña (Saccharum officinarum, 3 Kg de gallinaza y 0,6 Kg de miel de panela, y suplemento ofrecido ad libitum a los tratamientos que lo requerían. Se analizaron las variables ganancia diaria de peso, conversión alimenticia, consumo de materiaseca y el efecto costo beneficio de la suplementación. No se presentaron diferencias significativas (PNa elaboração da rapadura, entre o 40% e 54% é bagaço, o qual se caracteriza por ter baixa proteína e energia, alto composto lignocelulósicos, acompanhado por uma baixa digestibilidade, portanto, tradicionalmente tem sido usado como combustível para os queimadores. Este trabalho avaliou o uso do bagaço enriquecido com o fungo Pleurotus ostreatus como suplemento em dietas para bovinos, comparado com outros tratamentos com e sem suplementação comercial. Aos animais todos foi subministrado uma dieta equilibrada que consistia de 18 Kg de grama king grass (Saccharum sinense, 6 Kg de cana (Saccharum officinarum, 3 Kg de broto de cana (Saccharum officinarum, 3 Kg de estrume e 0,6 Kg de mel de rapadura e suplemento oferecido ad libitum aos tratamentos que o requeiram. Analisaram-se as variáveis: ganho diário de peso, conversão alimentar e consumo de matéria seca e o efeito de custo benefício da suplementação. Não apresentaram diferen

  16. The complete chloroplast genome sequence of Dianthus superbus var. longicalycinus.

    Science.gov (United States)

    Gurusamy, Raman; Lee, Do-Hyung; Park, SeonJoo

    2016-05-01

    The complete chloroplast genome (cpDNA) sequence of Dianthus superbus var. longicalycinus is an economically important traditional Chinese medicine was reported and characterized. The cpDNA of Dianthus superbus var. longicalycinus is 149,539 bp, with 36.3% GC content. A pair of inverted repeats (IRs) of 24,803 bp is separated by a large single-copy region (LSC, 82,805 bp) and a small single-copy region (SSC, 17,128 bp). It encodes 85 protein-coding genes, 36 tRNA genes and 8 rRNA genes. Of 129 individual genes, 13 genes encoded one intron and three genes have two introns.

  17. [Study on quality standard of Mucuna pruriens var. utilis].

    Science.gov (United States)

    Wu, Shi-Hong; Jiang, Wei-Zhe; Lv, Li; Wu, Ling-Ling; Lv, Cong; Shi, Xiao-Xia; Su, Gui-Liang

    2009-03-01

    To provide scientific basis for the utilization and development of Mucuna pruriens var. utilis by establishing its quality control standard. The bioactive constituents were analyzed by TLC and HPLC. Moisture, ash and the extracts of Mucuna pruriens var. utilis were all determined. The TLC spots of levodopa had similar color with the control group at the same position. The results of HPLC quantitative analysis showed that the linear range of levodopa was 26.45 to approximately 132.25 microg/mL, r = 0.9992, and the average recovery rate was 103.8%, RSD = 1.85%. This method is convenient, accurate, reliable with good reproducibility, so it can be used to establish quality standard for the medicinal material.

  18. BRINE SHRIMP LETHALITY BIOASSAY OF GLAUCIUM GRANDIFLORUM VAR. GRANDIFLORUM

    OpenAIRE

    A. SARI, Ç. ÜNSAL, İ. SARIOĞLU, A. SARI, Ç. ÜNSAL, İ. SARIOĞLU

    2013-01-01

    Türkiye'nin 3 farklı bölgesinden toplanan Glaucium grandiflorum Boiss. et Huet var. grandiflorum örneklerinin toprak üstü kısımlarından elde edilen alkaloit ekstreleri ve bu ekstrelerden elde edilen majör alkaloitler allokriptopin, protopİn, (+)-izokoridin, (+)-korİdin üzerinde brİne shrimp lethality testi yapılarak sitotoksisiteleri İncelenmiştir. Glaucium grandiflorum var. grandiflorum türünün 3 örneği de önemli oranda sitotoksik aktİvite göstermiştir. Allokriptopin, protopin, (+)-izok...

  19. Inflows and their Macroeconomic Impact in India a VAR Analysis

    Directory of Open Access Journals (Sweden)

    Narayan Sethi

    2012-12-01

    Full Text Available The present study attempts to examine the effects of private foreign capital inflows (FINV on macroeconomic variables in India. The study also examines the trends and composition of capital inflows into India. Using the Vector Autoregression (VAR method, this paper specifically examines effects of private foreign capital inflows (FINV on macroeconomic variables in India. This study is based on the monthly data from 1995:04 to 2011:07 and incorporating the macroeconomic variables such as exchange rate (EXR, inflation, money supply (M3, export (EXPO, import (IMP, foreign exchange reserve (FOREX and economic growth (IIP as proxy of GDP. The important observations emerge from the VAR analysis which shows there is dynamic short and long equilibrium relationship between few macroeconomic variables like exchange rate (EXR, foreign exchange reserve (FOREX, index of industrial production (IIP and money supply (M3 with private foreign capital inflows (FINV during the study period from 1995:04 to 2011:07

  20. VaR: Exchange Rate Risk and Jump Risk

    Directory of Open Access Journals (Sweden)

    Fen-Ying Chen

    2010-01-01

    Full Text Available Incorporating the Poisson jumps and exchange rate risk, this paper provides an analytical VaR to manage market risk of international portfolios over the subprime mortgage crisis. There are some properties in the model. First, different from past studies in portfolios valued only in one currency, this model considers portfolios not only with jumps but also with exchange rate risk, that is vital for investors in highly integrated global financial markets. Second, in general, the analytical VaR solution is more accurate than historical simulations in terms of backtesting and Christoffersen's independence test (1998 for small portfolios and large portfolios. In other words, the proposed model is reliable not only for a portfolio on specific stocks but also for a large portfolio. Third, the model can be regarded as the extension of that of Kupiec (1999 and Chen and Liao (2009.

  1. MANAGEMENT OF Amburana cearensis var. acreana IN ACRE STATE, BRAZIL

    Directory of Open Access Journals (Sweden)

    Evaldo Muñoz Braz

    2014-06-01

    Full Text Available http://dx.doi.org/10.5902/1980509814586This work has as its objectives: a to assess the geographical distribution and population structure of Amburana cearensis var. acreana; b to calculate sustainable cutting rates, according to stipulated cutting cycles, and c to simulate the projected recovery potential in volume based on the calculated cutting rate. It was used data from sustainable forest management plans, and the results will contribute for future decisions about its endangered condition. The results did not corroborate the information that Amburana cearensis var. acreana is endangered in Acre state. However the management sustainability will only be feasible if considered the ideal remaining population structure and the estimative of the optimal cutting rate according to the cutting cycle.

  2. Probiotic Activity of Saccharomyces cerevisiae var. boulardii Against Human Pathogens

    Directory of Open Access Journals (Sweden)

    Katarzyna Rajkowska

    2012-01-01

    Full Text Available Infectious diarrhoea is associated with a modification of the intestinal microflora and colonization of pathogenic bacteria. Tests were performed for seven probiotic yeast strains of Saccharomyces cerevisiae var. boulardii, designated for the prevention and treatment of diarrhoea. To check their possible effectiveness against diarrhoea of different etiologies, the activity against a variety of human pathogenic or opportunistic bacteria was investigated in vitro. In mixed cultures with S. cerevisiae var. boulardii, a statistically significant reduction was observed in the number of cells of Listeria monocytogenes, Pseudomonas aeruginosa and Staphylococcus aureus, by even 55.9 % in the case of L. monocytogenes compared with bacterial monocultures. The influence of yeasts was mostly associated with the shortening of the bacterial lag phase duration, more rapid achievement of the maximum growth rates, and a decrease by 4.4–57.1 % (L. monocytogenes, P. aeruginosa, or an increase by 1.4–70.6 % (Escherichia coli, Enterococcus faecalis, Salmonella Typhimurium in the exponential growth rates. Another issue included in the research was the ability of S. cerevisiae var. boulardii to bind pathogenic bacteria to its cell surface. Yeasts have shown binding capacity of E. coli, S. Typhimurium and additionally of S. aureus, Campylobacter jejuni and E. faecalis. However, no adhesion of L. monocytogenes and P. aeruginosa to the yeast cell wall was noted. The probiotic activity of S. cerevisiae var. boulardii against human pathogens is related to a decrease in the number of viable and active cells of bacteria and the binding capacity of yeasts. These processes may limit bacterial invasiveness and prevent bacterial adherence and translocation in the human intestines.

  3. Phytochemical study of the flavonoids of acacia nilotica var astringens

    International Nuclear Information System (INIS)

    El Gazali, N. A.

    2006-08-01

    The barks of acaica nilotica var astringens were extracted with 95% ethanol. Qualitative tests on the alcoholic extractives were negative for alkaloids and positive for steroids, tannins and flavonoids. Fractionation of the alcoholic extract over silica gel using acetone: methanol (4:1) gave a pure compound-compound 1. The structure of compound 1 was deduced on the basis of its IR, UV, NMR and mass spectra and the following structure was suggested.(Author)

  4. Fiscal developments and financial stress: a threshold VAR analysis

    Czech Academy of Sciences Publication Activity Database

    Afonso, A.; Baxa, Jaromír; Slavík, M.

    2018-01-01

    Roč. 54, č. 2 (2018), s. 395-423 ISSN 0377-7332 R&D Projects: GA ČR(CZ) GBP402/12/G097 Institutional support: RVO:67985556 Keywords : Fiscal policy * Financial markets * Threshold VAR Subject RIV: AH - Economic s OBOR OECD: Applied Economic s, Econometrics Impact factor: 0.645, year: 2016 http://library.utia.cas.cz/separaty/2018/E/baxa-0488303.pdf

  5. A Structural VAR Approach to Estimating Budget Balance Targets

    OpenAIRE

    Robert A Buckle; Kunhong Kim; Julie Tam

    2001-01-01

    The Fiscal Responsibility Act 1994 states that, as a principle of responsible fiscal management, a New Zealand government should ensure total Crown debt is at a prudent level by ensuring total operating expenses do not exceed total operating revenues. In this paper a structural VAR model is estimated to evaluate the impact on the government's cash operating surplus (or budget balance) of four independent disturbances: supply, fiscal, real private demand, and nominal disturbances. Based on the...

  6. REDESCUBRIMIENTO DE MYRRHINIUM ATROPURPUREUM VAR. OCTANDRUM (MYRTACEAE: MYRTINAE EN COLOMBIA

    Directory of Open Access Journals (Sweden)

    PARRA-O. CARLOS

    2003-12-01

    Full Text Available Se documenta el redescubrimiento de Myrrhinium atropurpureum var. octandrum(Myrteae DC., Myrtaceae, taxón prácticamente desconocido en Colombia. Se presentala descripción del taxón, así como notas sobre su distribución en Colombia, elhábitat en que se desarrolla y su posible estatus dentro de las categorías de la ListaRoja de la UICN.

  7. Labor Costs and Foreign Direct Investment: A Panel VAR Approach

    OpenAIRE

    Bahar Bayraktar-Sağlam; Selin Sayek Böke

    2017-01-01

    This paper examines the endogenous interaction between labor costs and Foreign Direct Investment (FDI) in the OECD countries via the Panel VAR approach under system GMM estimates for the period 1995–2009. The available data allows identifying the relevance of the components of labor costs, and allows a detailed analysis across different sectors. Empirical findings have revealed that sectoral composition of FDI and the decomposition of labor costs play a significant role in investigating the d...

  8. Scalable and Flexible Multiview MAX-VAR Canonical Correlation Analysis

    Science.gov (United States)

    Fu, Xiao; Huang, Kejun; Hong, Mingyi; Sidiropoulos, Nicholas D.; So, Anthony Man-Cho

    2017-08-01

    Generalized canonical correlation analysis (GCCA) aims at finding latent low-dimensional common structure from multiple views (feature vectors in different domains) of the same entities. Unlike principal component analysis (PCA) that handles a single view, (G)CCA is able to integrate information from different feature spaces. Here we focus on MAX-VAR GCCA, a popular formulation which has recently gained renewed interest in multilingual processing and speech modeling. The classic MAX-VAR GCCA problem can be solved optimally via eigen-decomposition of a matrix that compounds the (whitened) correlation matrices of the views; but this solution has serious scalability issues, and is not directly amenable to incorporating pertinent structural constraints such as non-negativity and sparsity on the canonical components. We posit regularized MAX-VAR GCCA as a non-convex optimization problem and propose an alternating optimization (AO)-based algorithm to handle it. Our algorithm alternates between {\\em inexact} solutions of a regularized least squares subproblem and a manifold-constrained non-convex subproblem, thereby achieving substantial memory and computational savings. An important benefit of our design is that it can easily handle structure-promoting regularization. We show that the algorithm globally converges to a critical point at a sublinear rate, and approaches a global optimal solution at a linear rate when no regularization is considered. Judiciously designed simulations and large-scale word embedding tasks are employed to showcase the effectiveness of the proposed algorithm.

  9. Bioavailability and Digestibility of Nutrients from the Dried Oyster Culinary-Medicinal Mushroom, Pleurotus ostreatus (Agaricomycetes): In Vivo Experiments.

    Science.gov (United States)

    Regula, Julita; Suliburska, Joanna; Siwulski, Marek

    2016-01-01

    There is a limited number of publications on the bioavailability and digestibility of nutrients contained in macrofungi. The aim of this study was to assess the bioavailability and digestibility of macronutrients using in vivo experiments on laboratory animals. The experiments were conducted with the commercial oyster mushroom Pleurotus ostreatus. Semisynthetic diets were prepared based on the modified AIN-93M diet and were supplemented with 4% and 8% mushroom powder. Between days 4 and 13, apparent digestibility indexes were determined for all animals using the conventional balance method. The hematological indexes-that is, hemoglobin, hematocrit, red blood cells, white blood cells, mean corpuscular volume, mean corpuscular hemoglobin, and mean corpuscular hemoglobin concentration-were determined using a Sysmex K-1000 hematological analyzer. Feeding rats with semisynthetic diets supplemented with dried oyster mushroom had no negative effect on body weight gain or feeding efficiency, expressed in the amount of body weight gain per unit of metabolic energy uptake. Introduction of dried oyster mushroom to the diet resulted in reduced digestibility of the diet and the protein and fat it contained, as well as decreased apparent energy availability. These changes were dependent on the volume of dried mushroom added to the semisynthetic diet. The addition of dried oyster mushroom to the semisynthetic diet considerably reduced passage time through the alimentary tract of rats.

  10. Radiation pasteurised oil palm empty fruit bunch fermented with Pleurotus sajor-caju as feed supplement to ruminants

    Energy Technology Data Exchange (ETDEWEB)

    Awang, M.R.; Mutaat, H.H.; Mahmud, M.S. (Ministry of Science, Technology and the Environment (Malaysia). Nuclear Energy Unit) (and others)

    In solid state fermentation, Pleurotus sajor-caju has been found to be able to degrade at least 30% oil palm Empty Fruit Bunch (EFB) fibre leaving 70% useful materials. Conditions under which fermentation occurred were investigated. It was found that, in the temperature range 25-28[sup o]C, relative pH 6-8, moisture 60-70% and medium composition of CaCO[sub 3]: were the optimum conditions. The results showed in fermented products that there were substantial reductions in cellulosic component such as crude fibre (CF, 18%); acid detergent fibre (ADF, 45%), neutral detergent fibre (NDF, 61%) and acd detergent lignin (ADL, 14%). However, crude protein (CP, 10%) increase resulted from single cell protein enrichment of mycelial microbial mass. The mass reductions of substrate in the fermentation process corresponds to CO[sub 2] released during fermentation. A digestibility study has been carried out to determine the usefulness of this product to ruminants. Aflatoxin content was low in both the initial substrates and products. Based on nutritional value and low content of aflatoxins, the product is useful as a source of roughage to ruminants. (author).

  11. Radiation pasteurised oil palm empty fruit bunch fermented with Pleurotus sajor-caju as feed supplement to ruminants

    International Nuclear Information System (INIS)

    Awang, M.R.; Mutaat, H.H.; Mahmud, M.S.

    1993-01-01

    In solid state fermentation, Pleurotus sajor-caju has been found to be able to degrade at least 30% oil palm Empty Fruit Bunch (EFB) fibre leaving 70% useful materials. Conditions under which fermentation occurred were investigated. It was found that, in the temperature range 25-28 o C, relative pH 6-8, moisture 60-70% and medium composition of CaCO 3 : were the optimum conditions. The results showed in fermented products that there were substantial reductions in cellulosic component such as crude fibre (CF, 18%); acid detergent fibre (ADF, 45%), neutral detergent fibre (NDF, 61%) and acd detergent lignin (ADL, 14%). However, crude protein (CP, 10%) increase resulted from single cell protein enrichment of mycelial microbial mass. The mass reductions of substrate in the fermentation process corresponds to CO 2 released during fermentation. A digestibility study has been carried out to determine the usefulness of this product to ruminants. Aflatoxin content was low in both the initial substrates and products. Based on nutritional value and low content of aflatoxins, the product is useful as a source of roughage to ruminants. (author)

  12. Submerged Cultivation of Mycelium with High Ergothioneine Content from the Culinary-Medicinal Golden Oyster Mushroom, Pleurotus citrinopileatus (Higher Basidiomycetes).

    Science.gov (United States)

    Lin, Shin-Yi; Chien, Shih-Chang; Wang, Sheng-Yang; Mau, Jeng-Leun

    2015-01-01

    The optimization of submerged culture of the culinary-medicinal golden oyster mushroom, Pleurotus citrinopileatus, was studied using a one-factor-at-a-time, two-stage stimulation and central composite rotatable design to produce mycelia with high ergothioneine content. The optimal culture conditions for mycelia harvested at day 22 were a temperature of 25°C, an inoculation ratio of 5%, 2% glucose, 0.5% yeast extract, and adjustment of the initial pH value to 10. The biomass and ergothioneine content were 8.28 g/L and 10.65 mg/g dry weight (dw), respectively. The addition of an amino acid precursor increased the ergothioneine content of mycelia; cysteine was the most effective. In addition, the results obtained from central composite rotatable design showed that the recommended combination for cysteine, histidine, and methionine was 8, 4, and 0.5 mmol/L, respectively. The predicted ergothioneine content was 13.90 mg/g dw, whereas the experimental maximal ergothioneine content was 14.57 mg/g dw. With the addition of complex precursors and under optimal culture conditions, mycelia harvested at days 16-20 had higher ergothioneine content. Accordingly, the information obtained could be used to produce mycelia with high ergothioneine content.

  13. Radiation pasteurised oil palm empty fruit bunch fermented with Pleurotus sajor-caju as feed supplement to ruminants

    Science.gov (United States)

    Awang, Mat Rasol; Mutaat, Hassan Hamdani; Mahmud, Mohd. Shukri; Wan Husain, Wan Badrin; Osman, Tajuddin; Bakar, Khomsaton Abu; Kassim, Asmahwati; Wan Mahmud, Zal U'yun; Manaf, Ishak; Kume, Tamikazu; Hashimoto, Shoji

    1993-10-01

    In solid state fermentation, Pleurotus sajor-caju has been found to be able to degrade at least 30% oil palm empty Fruit Bunch (EFB) fibre leaving 70 % useful materials. Conditions under which fermentation carried out were investigated. It was found that, in the temperature range between 25- 28 °C, relative ph between 6-8, moisture between 60-70 % and medium composition of CaCO 3: rice bran 2 %: 5 % were the optimum conditions. The results showed in fermented products that, there were substantial reduction in cellulosic component such as Crude Fiber (CF, 18 %); Acid Detergent Fibre (ADF, 45 %), Neutral Detergent Fibre (NDF, 61 %) and Acid Detergent Lignin (ADL, 14 %). However, Crude Protein (CP, 10%) increased resulted from single cell protein enrichment of mycelial microbial mass. The mass reductions of substrate in fermentation process corresponds to the CO 2 released during fermentation. Hence, attributable to the decreased in content of CF, ADF, NDF, and ADL. The digestibility study has also been carried out to determine the useful level of this product to ruminant. Aflatoxin content was detected low in both the initial substrates and products. Based on nutritional value and low content of aflatoxin, the product is useful as a source of roughage to ruminant.

  14. Effect of light and atmosphere on the cultivation of the golden oyster culinary-medicinal mushroom, Pleurotus citrinopileatus (higher Basidiomycetes).

    Science.gov (United States)

    Hu, Shu-Hui; Wu, Chiu-Yeh; Chen, Yu-Kuei; Wang, Jinn-Chyi; Chang, Sue-Joan

    2013-01-01

    With an aim to explore the productivity and quality of the fruiting body of culinary-medicinal golden oyster mushroom Pleurotus citrinopileatus, the carbon dioxide (CO₂) concentration of the ambient atmosphere was adjusted and a light-emitting diode panel was used to illuminate the colonized mycelium at different wavelengths. Biological efficiency and yield were higher at CO₂ levels of 0.05 and 0.1% than other tested CO₂ levels, and the mature fruiting body showed the highest yellow value at a CO₂ level of 0.1% (of all tested CO₂ levels). The highest biological efficiency and yield was obtained at the 720-nm wavelength. The ergosterol content of the pileus of the fruiting body was higher than that of the stipe in any flush time at a 720-nm wavelength of light and a CO₂ concentration of 0.1%. The decreased percentages of cellulose and lignin at the appearance of primordia were larger than those of mycelial growth duration. The fruiting quality of P. citrinopileatus might thus be enhanced by 720-nm illumination and an atmosphere with a CO₂ concentration of 0.1 to 0.15%.

  15. Analysis of Major Nutritional Components of Pleurotus pulmonarius During the Cultivation in Different Indoor Environmental Conditions on Sawdust

    Directory of Open Access Journals (Sweden)

    Tariqul Islam

    2017-03-01

    Full Text Available Pleurotus pulmonarius was cultivated in three different environmental conditions, in ambient indoor environment (System 1, in humidifying without ventilation (System 2 and in humidifying with ventilation (System 3 to analyse the major nutritional contents. Sawdust was the main substrate for all the cultivation systems. The lowest temperature and the highest optimal humidity were found in System 3. The temperature and humidity had shown statistically significant among the three cultivation Systems. The highest numbers of flushes was found both in System 2 and System 3 but System 1 was produced mushrooms till 3rd flush. About 29.5%, 28.3%, 28.5% protein; 59.0%, 55.8%, 54.3% carbohydrate and 3.8%, 3.5%, 3.3% lipid were found in System 1, System 2 and System 3 respectively. The protein, carbohydrate, and lipid contents were shown statistically insignificant among the cultivation systems. The highest value of protein, carbohydrate and lipid were found for the sample of 1st flush in all the cultivation systems but the values were started to decrease with the increased numbers of flushes significantly. So, this study shown that, although the environmental conditions of the three cultivation systems were varied significantly but the protein, carbohydrate and lipid contents were existed their normal values in all cases but the values were decreased by the increased numbers of flushes.

  16. Total Phenolics, Flavonoids, Tannin Contents and Antioxidant Properties of Pleurotus ostreatus Cultivated on Different Wastes and Sawdust

    Directory of Open Access Journals (Sweden)

    Ayşenur Yılmaz

    2017-01-01

    Full Text Available In this study, the usage possibilities of some agro-industrial wastes such as; peanut wastes, potatoes farm wastes, walnut and orange tree sawdust in Pleurotus ostreatus cultivation were investigated and total phenolic, flavonoid, condensed tannin content and antioxidant properties of these methanolic mushroom extracts were examined. For the determination of the total phenolic contents, the Folin-Ciocalteau procedure was used. The content of total flavonoid present in the methanolic extracts was measured using a spectrophotometric assay. Condensed tannins were determined according to the method by Julkunen-Tıtto. The antioxidant capacity was determined using ferric reducing antioxidant power (FRAP and free radical scavenging activity of DPPH. The highest total phenolic content (2.672 ± 0.003 mg GAE/g was found in mushroom cultivated on walnut sawdust. The highest condensed tannin (1.011 ± 0.088 CE mg/g and ferric reducing antioxidant power (FRAP (12.332 ± 0.017 μmol FeSO4.7H2O/g were observed in the same mushroom extract. The highest total flavonoid and free radical scavenging activity of DPPH were found in extract of mushroom cultivated on potatoes handle. Bioactive properties of P. ostreatus cultivated on walnut tree sawdust were generally exhibited remarkable results.

  17. Production of bio-fertilizer from microwave vacuum pyrolysis of waste palm shell for cultivation of oyster mushroom (Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Nam Wai Lun

    2017-01-01

    Full Text Available Microwave vacuum pyrolysis of waste palm shell (WPS was performed to produce biochar, which was then tested as bio-fertilizer in growing Oyster mushroom (Pleurotus ostreatus. The pyrolysis approach generated a biochar containing a highly porous structure with a high BET surface area (up to 1250 m2/g and a low moisture content (≤ 10 wt%, exhibiting desirable adsorption properties to be used as bio-fertilizer since it can act as a housing that provides many sites on which living microorganisms (mycelium or plant-growth promoting bacteria and organic nutrients can be attached or adsorbed onto. This could in turn stimulate plant growth by increasing the availability and supply of nutrients to the targeted host plant. The results from growing Oyster mushroom using the biochar record an impressive growth rate and a monthly production of up to about 550 g of mushroom. The shorter time for mycelium growth on whole baglog (30 days and the highest yield of Oyster mushroom (550 g was obtained from the cultivation medium added with 20 g of biochar. Our results demonstrate that the biochar-based bio-fertilizer produce from microwave vacuum pyrolysis of WPS show exceptional promise as an alternative growing substrate for mushroom cultivation.

  18. Cultivation of oyster mushroom Pleurotus ostreatus on date-palm leaves mixed with other agro-wastes in Saudi Arabia.

    Science.gov (United States)

    Alananbeh, Kholoud M; Bouqellah, Nahla A; Al Kaff, Nadia S

    2014-12-01

    Promoting the use of agricultural waste is one of the newly prepared water and environment friendly agriculture strategies in the Kingdom of Saudi Arabia (KSA). The objective of this research was to study the efficiency of cultivating oyster mushroom (Pleurotus ostreatus) on date palm wastes mixed with other agricultural wastes available in KSA. Four agricultural wastes were mixed with date palm leaves at different ratios, with two supplements and three spawn rates were used. Wheat straw mixed with date palm at ratio of 25 (date palm): 75 (agro-waste) showed the best results in most of the parameters measured. Corn meal was superior over wheat bran as a supplement in all treatments. Parameter values increased with the increase of the spawn rate of P. ostreatus. Treatments with date palm leave wastes contained higher carbohydrates and fibers. No significant differences were found among the fruiting bodies produced on the different agro-wastes studied for the different proximates analyzed. Analyses of metal concentration showed that potassium was the highest in all the treatments tested followed by Na, Mg, Ca, and Zn. This is the first study that reported the success of growing oyster mushroom on date palm leaf wastes mixed with other agro-wastes obtainable in KSA.

  19. Production of bio-fertilizer from microwave vacuum pyrolysis of waste palm shell for cultivation of oyster mushroom (Pleurotus ostreatus)

    Science.gov (United States)

    Lun Nam, Wai; Huan Su, Man; Phang, Xue Yee; Chong, Min Yee; Keey Liew, Rock; Ma, Nyuk Ling; Lam, Su Shiung

    2017-11-01

    Microwave vacuum pyrolysis of waste palm shell (WPS) was performed to produce biochar, which was then tested as bio-fertilizer in growing Oyster mushroom (Pleurotus ostreatus). The pyrolysis approach generated a biochar containing a highly porous structure with a high BET surface area (up to 1250 m2/g) and a low moisture content (≤ 10 wt%), exhibiting desirable adsorption properties to be used as bio-fertilizer since it can act as a housing that provides many sites on which living microorganisms (mycelium or plant-growth promoting bacteria) and organic nutrients can be attached or adsorbed onto. This could in turn stimulate plant growth by increasing the availability and supply of nutrients to the targeted host plant. The results from growing Oyster mushroom using the biochar record an impressive growth rate and a monthly production of up to about 550 g of mushroom. The shorter time for mycelium growth on whole baglog (30 days) and the highest yield of Oyster mushroom (550 g) was obtained from the cultivation medium added with 20 g of biochar. Our results demonstrate that the biochar-based bio-fertilizer produce from microwave vacuum pyrolysis of WPS show exceptional promise as an alternative growing substrate for mushroom cultivation.

  20. Differential response of oyster shell powder on enzyme profile and nutritional value of oyster mushroom Pleurotus florida PF05.

    Science.gov (United States)

    Naraian, Ram; Narayan, Om Prakash; Srivastava, Jatin

    2014-01-01

    Oyster mushroom Pleurotus florida was cultivated on different combinations of wheat straw (WS) as basal substrate and oyster shell powder (OSP) supplement. The OSP supplementation considerably responded to different cultivation phases. The mycelium grew fast and showed rapid growth rate (8.91 mmd(-1)) in WS + OSP (97 + 3) combination while WS + OSP (92 + 8) showed maximum laccase (3.133 U/g) and Mn peroxidase (MnP) activities (0.091 U/g). The climax level of laccase (5.433 U/g) and MnP (0.097 U/g) was recorded during fruit body initiation in WS + OSP (97 + 3) and WS + OSP (98 + 2) combinations, respectively. The WS + OSP (97 + 3) combination represented the best condition for mushroom cultivation and produced the highest biological efficiency (147%). In addition, protein and lipid contents in fruit bodies were slightly improved in response to OSP. The carbohydrate was significantly increased by raising concentration of OSP. The highest values of protein, carbohydrate, and lipid noted were 31.3 μg/g, 0.0639 (g/g), and 0.373 (g/g) correspondingly. Conclusively it was evident that lower concentrations of OSP acted positively and relatively to higher concentrations and improved nutritional content which may suitably be used to enhance both yield and nutritional values of mushroom.

  1. Pengaruh mutasi dengan radiasi sinar gamma (CO₆₀ terhadap produktivitas jamur tiram abu-abu (Pleurotus sajur-caju

    Directory of Open Access Journals (Sweden)

    Ira Djajanegara

    2012-02-01

    Full Text Available Irradiation aplied to living organisms may have positive or negative effects on physiological and morphological properties of the organisms. One way to gain genetic variation with better properties than the parental strain is by Gamma (Co 60 radiation application. During this experiment, Gama (Co 60 rays was applied to the grey oyster (Pleurotus sajur-caju mushroom mycellia during exponential phase. Radiation was applied at 0.75 KGray with dose velocity of 1.149 KGray. Analysis of mushroom productivity performances indicate that diameter of mycellia, fresh weight, dry weight, diameter of fruit body and the amount of fruit body of the mutant and control were not significantly different. However, the isozyme pattern showed a different pattern between the mutant and the control which indicates that mutation process has already occured. These data show that mutation did not affect the productivity of the mushroom. Therefore, mutation may affect the nutritional quality of the mushroom instead. Further experiment to verify this possibility is suggested.

  2. Intrastrain Comparison of the Chemical Composition and Antioxidant Activity of an Edible Mushroom, Pleurotus giganteus, and Its Potent Neuritogenic Properties

    Directory of Open Access Journals (Sweden)

    Chia-Wei Phan

    2014-01-01

    Full Text Available Two strains of Pleurotus giganteus (commercial and wild were tested for their ability to induce neurite outgrowth in rat pheochromocytoma (PC12 and mouse neuroblastoma-2a (N2a cells. Treatment with the mushroom extracts resulted in neuronal differentiation and neuronal elongation, but not nerve growth factor (NGF production. Linoleic acid (4.5–5.0%, w/w which is a major fatty acid present in the ethanol extract promoted NGF biosynthesis when augmented with low concentration of NGF (5 ng/mL. The two strains of mushroom were found to be high in protein (154–192 g kg−1, total polysaccharides, phenolics, and flavonoids as well as vitamins B1, B2, and B3. The total phenolics present in the mushroom extracts were positively correlated to the antioxidant activity (free radical scavenging, ferric reducing power, and lipid peroxidation inhibition. To conclude, P. giganteus could potentially be used in well-balanced diet and as a source of dietary antioxidant to promote neuronal health.

  3. Kinetics, equilibrium and thermodynamic studies on biosorption of Ag(I) from aqueous solution by macrofungus Pleurotus platypus.

    Science.gov (United States)

    Das, Devlina; Das, Nilanjana; Mathew, Lazar

    2010-12-15

    Reports are available on silver binding capacity of some microorganisms. However, reports on the equilibrium studies on biosorption of silver by macrofungi are seldom known. The present study was carried out in a batch system using dead biomass of macrofungus Pleurotus platypus for the sorption of Ag(I). P. platypus exhibited the highest silver uptake of 46.7 mg g(-1) of biomass at pH 6.0 in the presence of 200 mg L(-1) Ag(I) at 20°C. Kinetic studies based on fractional power, zero order, first order, pseudo-first order, Elovich, second order and pseudo-second order rate expressions have been carried out. The results showed a very good compliance with the pseudo-first order model. The experimental data were analyzed using two parameter isotherms (Langmuir, Freundlich, Dubinin-Radushkevich, Temkin and Halsey), three parameter isotherms (Redlich-Peterson, Sips, Khan, Koble-Corrigan, Hill, Toth, Radke-Prausmitz, Jossens, Langmuir-Freundlich), four parameter isotherms (Weber-van Vliet, Fritz-Schlunder, Baudu) and five parameter isotherm (Fritz-Schlunder). Thermodynamic parameters of the biosorption (ΔG, ΔH and ΔS) were also determined. The present study confirmed that macrofungus P. platypus may be used as a cost effective efficient biosorbent for the removal of Ag(I) ions from aqueous solution. Copyright © 2010 Elsevier B.V. All rights reserved.

  4. Separation of active laccases from Pleurotus sapidus culture supernatant using aqueous two-phase systems in centrifugal partition chromatography.

    Science.gov (United States)

    Schwienheer, C; Prinz, A; Zeiner, T; Merz, J

    2015-10-01

    For the production of bio active compounds, e.g., active enzymes or antibodies, a conserved purification process with a minimum loss of active compounds is necessary. In centrifugal partition chromatography (CPC), the separation effect is based on the different distribution of the components to be separated between two immiscible liquid phases. Thereby, one liquid phase is kept stationary in chambers by a centrifugal field and the mobile phase is pumped through via connecting ducts. Aqueous two phase systems (ATPS) are known to provide benign conditions for biochemical products and seem to be promising when used in CPC for purification tasks. However, it is not known if active biochemical compounds can "survive" the conditions in a CPC where strong shear forces can occur due to the two-phasic flow under centrifugal forces. Therefore, this aspect has been faced within this study by the separation of active laccases from a fermentation broth of Pleurotus sapidus. After selecting a suitable ATPS and operating conditions, the activity yield was calculated and the preservation of the active enzymes could be observed. Therefore, CPC could be shown as potentially suitable for the purification of bio-active compounds. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. The Management of Humidifying Treatment for Low Contamination Risks During Indoor Cultivation of Grey Oyster Mushroom (Pleurotus pulmonarius

    Directory of Open Access Journals (Sweden)

    Islam Md. Tariqul

    2017-01-01

    Full Text Available In this study, grey oyster mushroom (Pleurotus pulmonarius was cultivated in indoor controlled environment to seeking out the possible risks of contamination and ways of treatment to avoid the contamination. For this, mushroom was cultivated in providing artificial humidifying and ventilation system to ensure optimum humidity (80-90% and fresh air recirculation in different ways of treatment. The ways of treatment were included as in position of humidifier, frequency of humidifying, plastic cork of bags opening part and cleaning of humidifier water container. Maximum percentages of bag contamination (2.5-25.30%, cap contamination (5.6-30.75%, stalk contamination (4.75-23.25% and root contamination (2.6-18.45% were found in front to front humidifier position, long humidifying with long interval frequency, without plastic cork, without cleaning and bi-monthly cleaning of humidifier water container treatment but no diseases and pest infection was found. Whereas, very low percentages of contamination (0.1-0.5% were found in surrounding humidifying position, short humidifying duration with short interval frequency, with plastic cork and weekly cleaning of humidifier water container treatment.

  6. Assessment of Gardening Wastes as a Co-Substrate for Diapers Degradation by the Fungus Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Rosa María Espinosa-Valdemar

    2015-05-01

    Full Text Available Waste with high biomass content generated in cities in developing countries is sent to landfills or open dumps. This research aims to degrade biomass content in urban waste through cultivation, at pilot scale, of the edible mushroom Pleurotus ostreatus. First, the number of diapers used by one baby per week was measured with a survey in day care facilities. Then, cellulose content of diapers was assessed. Finally, cultivation of P. ostreatus was carried out using as substrate a mixture of diapers with gardening waste, a co-substrate readily available at urban settings. The factors assessed were strain of P. ostreatus (grey BPR-81, white BPR-5, conditioning of the substrate (diapers with and without plastic and co-substrate (wheat straw, grass, and withered leaves. Results show that diapers are a valuable source of biomass, as generation of diapers with urine is 15.3 kg/child/month and they contain 50.2% by weight of cellulose. The highest reductions in dry weight and volume (>64% of substrates was achieved with the substrate diaper without plastic and co-substrate wheat straw. Although diapers with plastic and grass and leaves showed lower degradation, they achieved efficiencies that make them suitable as a co-substrate (>40%, considering that their biomass is currently confined in landfills.

  7. Statistical optimization of ultraviolet irradiate conditions for vitamin D₂ synthesis in oyster mushrooms (Pleurotus ostreatus using response surface methodology.

    Directory of Open Access Journals (Sweden)

    Wei-Jie Wu

    Full Text Available Response surface methodology (RSM was used to determine the optimum vitamin D2 synthesis conditions in oyster mushrooms (Pleurotus ostreatus. Ultraviolet B (UV-B was selected as the most efficient irradiation source for the preliminary experiment, in addition to the levels of three independent variables, which included ambient temperature (25-45°C, exposure time (40-120 min, and irradiation intensity (0.6-1.2 W/m2. The statistical analysis indicated that, for the range which was studied, irradiation intensity was the most critical factor that affected vitamin D2 synthesis in oyster mushrooms. Under optimal conditions (ambient temperature of 28.16°C, UV-B intensity of 1.14 W/m2, and exposure time of 94.28 min, the experimental vitamin D2 content of 239.67 µg/g (dry weight was in very good agreement with the predicted value of 245.49 µg/g, which verified the practicability of this strategy. Compared to fresh mushrooms, the lyophilized mushroom powder can synthesize remarkably higher level of vitamin D2 (498.10 µg/g within much shorter UV-B exposure time (10 min, and thus should receive attention from the food processing industry.

  8. PRODUKTIVITAS JAMUR TIRAM PUTIH (Pleurotus ostreatus PADA MEDIA LIMBAH SEKAM PADI DAN DAUN PISANG KERING SEBAGAI MEDIA ALTERNATIF

    Directory of Open Access Journals (Sweden)

    Suparti Suparti

    2015-08-01

    Full Text Available Jamur tiram putih (Pleurotus ostreatus merupakan jenis jamur pangan yang banyak dikonsumsi mengandung protein 27%. Kandungan protein pada jamur tiram putih dapat dipengaruhi oleh komposisi media tanam seperti selulosa, hemiselulosa, lignin dan nutrisi tambahan. Sekam padi dan daun pisang kering merupakan salah satu limbah organik yang dapat digunakan sebagai media alternatif untuk meningkatkan produktivitas jamur tiram putih.Tujuan penelitian ini adalah untuk mengetahui produktivitas jamur tiram putih yang ditumbuhkan pada media  limbah sekam padi dan daun pisang kering sebagai media alternatif. Jenis penelitian eksperimen dengan metode rancangan acak lengkap (RAL dua faktor yaitu faktor 1 penambahan sekam padi dan faktor 2 daun pisang kering (0%, 5%, 10%, 15%, masing-masing  dengan empat perlakuan dan dua kali ulangan.  Hasil analisis data menunjukkan bahwa penambahan sekam padi dan daun pisang kering  15% (S3T3 memberikan pengaruh nyata terhadap lama penyebaran miselium, jumlah badan buah dan berat segar jamur tiram putih.Perlakuan yang paling baik untuk pertumbuhan jamur pada perlakuan S3T3, dengan rata-rata lama penyebaran miselium 25,5 hari, jumlah badan buah 64,5 buah dan berat segar yang dihasilkan 402,5. Hasil data tersebut lebih tinggi dibandingkan dengan perlakuan yang lain.

  9. Evaluation of the proximate quality of the combination of Tuna (Thunnus albacares) and white oyster mushroom (Pleurotus ostreatus) nuggets

    Science.gov (United States)

    Yufidasari, H. S.; Prihanto, A. A.; Nurdiani, R.; Jaziri, A. A.

    2018-04-01

    Nugget is a processed meat product which has great market demand but need variations to increase its nutritional content. Tuna is rich in omega-3 protein, vitamins, and minerals. White oyster mushrooms have high nutritional content which are about 23-33% protein, 36-68 % carbohydrates and 12-22 % amino acids. The purpose of this research is to evaluate the chemical quality of Tuna nugget (Thunnus albacores) with combination of white oyster mushroom (Pleurotus ostreatus). Complete Randomized Design (RAL) with parameters of Tuna and white oyster mushroom formulation, TJ1 (70 % Tuna: 30 % white oyster mushroom), TJ2 (50 % Tuna: 50 % white oyster mushroom), TJ3 (30 % Tuna: 70 % white oyster mushroom), and Control or K Treatment (100 % Tuna) is used. Results of Tuna nuggets with white oyster mushroom combination showed the highest value of water content in TJ3 50.14 %, protein K 19.6 %, fat TJ3 22.98 %, ash K 3.99 % and 2.47 % crude fiber. From these results, there is a need for further research on fat, ash and coarse fiber content that is used in the manufacture of fish nuggets combined with oyster mushrooms because it failed to meet Indonesian National Standard (SNI).

  10. Influence of calcium and silicon supplementation into Pleurotus ostreatus substrates on quality of fresh and canned mushrooms.

    Science.gov (United States)

    Thongsook, T; Kongbangkerd, T

    2011-08-01

    Supplements of gypsum (calcium source), pumice (silicon source) and pumice sulfate (silicon and calcium source) into substrates for oyster mushrooms (Pleurotus ostreatus) were searched for their effects on production as well as qualities of fresh and canned mushrooms. The addition of pumice up to 30% had no effect on total yield, size distribution and cap diameters. The supplementation of gypsum at 10% decreased the total yield; and although gypsum at 5% did not affect total yield, the treatment increased the proportion of large-sized caps. High content (>10%) of pumice sulfate resulted in the lower yield. Calcium and silicon contents in the fruit bodies were not influenced by supplementations. The centrifugal drip loss values and solid content of fresh mushrooms, and the percentage of weight gained and firmness of canned mushrooms, cultivated in substrates supplemented with gypsum, pumice and pumice sulfate were significantly (p≤0.05) higher than those of the control. Scanning electron micrographs revealed the more compacted hyphae of mushroom stalks supplemented with silicon and/or calcium after heat treatment, compared to the control. Supplementation of P. ostreatus substrates with 20% pumice was the most practical treatment because it showed no effect on yield and the most cost-effective.

  11. A dioxygenase of Pleurotus sapidus transforms (+)-valencene regio-specifically to (+)-nootkatone via a stereo-specific allylic hydroperoxidation.

    Science.gov (United States)

    Krügener, Sven; Krings, Ulrich; Zorn, Holger; Berger, Ralf G

    2010-01-01

    A selective and highly efficient allylic oxidation of the sesquiterpene (+)-valencene to the grapefruit flavour compound (+)-nootkatone was achieved with lyophilisate of the edible mushroom Pleurotus sapidus. The catalytic reaction sequence was elucidated through the identification of intermediate, (+)-valencene derived hydroperoxides. A specific staining of hydroperoxides allowed the semi-preparative isolation of two secondary (+)-valencene hydroperoxides, 6(R)-Isopropenyl-4(R),4a(S)-dimethyl-2,3,4,4a,5,6,7,8-octahydro-naphthalen-4(S)-yl-hydroperoxide and 6(R)-Isopropenyl-4(R),4a(S)-dimethyl-2,3,4,4a,5,6,7,8-octahydro-naphthalen-2(R)-yl-hydroperoxide. Chemical reduction of the biotransformation products yielded a tertiary alcohol identified as 2(R)-Isopropenyl-8(R),8a(S)-dimethyl-1,3,4,7,8,8a-hexahydro-2H-naphthalen-4a(R)-ol. This suggested a lipoxygenase-type oxidation of (+)-valencene via secondary and tertiary hydroperoxides and confirmed homology data of the key enzyme obtained previously from amino acid sequencing.

  12. Mutation induction of pleurotus ferulae by low-energy N+ ion implantation and characters of the selected mutant

    International Nuclear Information System (INIS)

    Chen Henglei; Wan Honggui; Zhang Jun; Zeng Xianxian

    2008-01-01

    In order to obtain Pleurotus ferulae with high temperature tolerance, mycelium mono-cells of wild type strain ACK was treated by nitrogen ion (5-30 keV, 1.5x10 15 -1.5x10 16 cm -2 ) implantation, and mutant CGMCC1762 was selected through auxotrophy screening method, which was Lys, VB6 auxotrophy stress with high temperature. We found that during riper period the surface layer mycelium of the mutant was not aging neither grew tegument even above 30 degree C. The mycelium endurable temperature of the mutant was increased 7 degree C compared with that of the wild type strain. The fruiting bodies growth temperature of the mutant was 16-20 degree C in daytime and was 6-12 degree C at night. The highest growth temperature of fruiting bodies of the mutant was increased by 5 degree C than that of original strain. Through three generation investigation, we found that the mutant CGMCC1762 was stable with high temperature tolerance. (authors)

  13. Metabolomic variation of brassica rapa var. rapa (var. raapstelen) and raphanus sativus l. at different developmental stages

    International Nuclear Information System (INIS)

    Jahangir, M.; Farid, I.B.A.

    2014-01-01

    Brassica rapa (var. raapstelen) and Raphanus sativus (red radish) are being used as food and fodder while also known as model in recent plant research due to the diversity of metabolites as well as genetic resemblance to Arabidopsis. This study explains the change in metabolites (amino acids, organic acids, chlorophyll, carotenoids, tocopherols, ascorbic acid, sucrose, phenylpropanoids and glucosinolates) during plant development. In present study the metabolomic variation in relation to plant growth has been evaluated, for Brassica rapa (var. raapstelen) and red radish (Raphanus sativus) at three different developmental stages. A non-targeted and targeted metabolomic approach by NMR and HPLC in combination with Principal component analysis (PCA) of the data was used to identify phytochemicals being influenced by plant growth. The results lead to the better understanding of metabolic changes during plant development and show the importance of plant age with respect to the metabolomic profile of vegetables. (author)

  14. Complete mitochondrial genome of Xingguo red carp (Cyprinus carpio var. singuonensis) and purse red carp (Cyprinus carpio var. wuyuanensis).

    Science.gov (United States)

    Hu, Guang-Fu; Liu, Xiang-Jiang; Li, Zhong; Liang, Hong-Wei; Hu, Shao-Na; Zou, Gui-Wei

    2016-01-01

    The complete mitochondrial genomes of Xingguo red carp (Cyprinus carpio var. singuonensis) and purse red carp (Cyprinus carpio var. wuyuanensis) were sequenced. Comparison of these two mitochondrial genomes revealed that the mtDNAs of these two common carp varieties were remarkably similar in genome length, gene order and content, and AT content. However, size variation between these two mitochondrial genomes presented here showed 39 site differences in overall length. About 2 site differences were located in rRNAs, 3 in tRNAs, 3 in the control region, 31 in protein-coding genes. Thirty-one variable bases in the protein-coding regions between the two varieties mitochondrial sequences led to three variable amino acids, which were mainly located in the protein ND5 and ND4.

  15. VAR, stress-testing and supplementary methodologies: uses and constraints in energy risk management

    International Nuclear Information System (INIS)

    Senior, Brian

    1999-01-01

    This chapter lists some of the special risks associated with a range of energy markets, and questions what is risk. Market risk, the use of value-at-risk (VAR) for measuring and managing market risk, use of VAR in the banking sector, back-testing of VAR, the corporate sector, making investment decisions, and the need for additional methods of risk analysis are discussed. Scenario analysis and stress testing, liquidity, and combining VAR and stress-testing are described. Credit risk and the quantitative analysis of credit risk are addressed, and operational risk, and organisational challenges are considered. Panels present examples of a simple VAR calculation and give descriptions of VAR in corporate decisions, the measurement of liquidity, and the use of the Greeks in decisions on day to day trading and risk management

  16. Mosquito Passage Dramatically Changes var Gene Expression in Controlled Human Plasmodium falciparum Infections.

    Science.gov (United States)

    Bachmann, Anna; Petter, Michaela; Krumkamp, Ralf; Esen, Meral; Held, Jana; Scholz, Judith A M; Li, Tao; Sim, B Kim Lee; Hoffman, Stephen L; Kremsner, Peter G; Mordmüller, Benjamin; Duffy, Michael F; Tannich, Egbert

    2016-04-01

    Virulence of the most deadly malaria parasite Plasmodium falciparum is linked to the variant surface antigen PfEMP1, which is encoded by about 60 var genes per parasite genome. Although the expression of particular variants has been associated with different clinical outcomes, little is known about var gene expression at the onset of infection. By analyzing controlled human malaria infections via quantitative real-time PCR, we show that parasite populations from 18 volunteers expressed virtually identical transcript patterns that were dominated by the subtelomeric var gene group B and, to a lesser extent, group A. Furthermore, major changes in composition and frequency of var gene transcripts were detected between the parental parasite culture that was used to infect mosquitoes and Plasmodia recovered from infected volunteers, suggesting that P. falciparum resets its var gene expression during mosquito passage and starts with the broad expression of a specific subset of var genes when entering the human blood phase.

  17. Twenty novel polymorphic microsatellite primers in the critically endangered Melastoma tetramerum var. tetramerum (Melastomataceae).

    Science.gov (United States)

    Narita, Ayu; Izuno, Ayako; Komaki, Yoshiteru; Tanaka, Takefumi; Murata, Jin; Isagi, Yuji

    2016-09-01

    Microsatellite markers were identified for Melastoma tetramerum var. tetramerum (Melastomataceae), a critically endangered shrub endemic to the Bonin Islands, to reveal genetic characteristics in wild and restored populations. Using next-generation sequencing, 27 microsatellite markers were identified. Twenty of these markers were polymorphic in M. tetramerum var. tetramerum, with two to nine alleles per locus and expected heterozygosity ranging from 0.10 to 0.71. Among the 20 polymorphic markers, 15 were applicable to other closely related taxa, namely M. tetramerum var. pentapetalum, M. candidum var. candidum, and M. candidum var. alessandrense. These markers can be potentially useful to investigate the genetic diversity, population genetic structure, and reproductive ecology of M. tetramerum var. tetramerum as well as of the three related taxa to provide appropriate genetic information for conservation.

  18. Foliar flavonoids from Tanacetum vulgare var. boreale and their geographical variation.

    Science.gov (United States)

    Uehara, Ayumi; Akiyama, Shinobu; Iwashina, Tsukasa

    2015-03-01

    Foliar flavonoids of Tanacetum vulgare var. boreale were isolated. Eight flavonoid glycosides, 7-O-glucosides of apigenin, luteolin, scutellarein and 6- hydroxyluteolin, and 7-O-glucuronides of apigenin, luteolin, chrysoeriol and eriodictyol were identified. Moreover, eight flavonoid aglycones, apigenin, luteolin, hispidulin, nepetin, eupatilin, jaceosidin, pectolinarigenin and axillarin were also isolated and identified. The flavonoid composition of two varieties of T. vulgare, i.e. var. boreale and var. vulgare, were compared. All samples of var. boreale and one sample of var. vulgare had the same flavonoid pattern, and could be distinguished from almost all the samples of var. vulgare. Thus, the occurrence of chemotypes, which are characterized by either the presence or absence of scutellarein 7-O-glucoside, eriodictyol 7-O-glucuronide and pectolinarigenin was shown in T. vulgare sensu lato.

  19. Antisense long noncoding RNAs regulate var gene activation in the malaria parasite Plasmodium falciparum.

    Science.gov (United States)

    Amit-Avraham, Inbar; Pozner, Guy; Eshar, Shiri; Fastman, Yair; Kolevzon, Netanel; Yavin, Eylon; Dzikowski, Ron

    2015-03-03

    The virulence of Plasmodium falciparum, the causative agent of the deadliest form of human malaria, is attributed to its ability to evade human immunity through antigenic variation. These parasites alternate between expression of variable antigens, encoded by members of a multicopy gene family named var. Immune evasion through antigenic variation depends on tight regulation of var gene expression, ensuring that only a single var gene is expressed at a time while the rest of the family is maintained transcriptionally silent. Understanding how a single gene is chosen for activation is critical for understanding mutually exclusive expression but remains a mystery. Here, we show that antisense long noncoding RNAs (lncRNAs) initiating from var introns are associated with the single active var gene at the time in the cell cycle when the single var upstream promoter is active. We demonstrate that these antisense transcripts are incorporated into chromatin, and that expression of these antisense lncRNAs in trans triggers activation of a silent var gene in a sequence- and dose-dependent manner. On the other hand, interference with these lncRNAs using complement peptide nucleic acid molecules down-regulated the active var gene, erased the epigenetic memory, and induced expression switching. Altogether, our data provide evidence that these antisense lncRNAs play a key role in regulating var gene activation and mutually exclusive expression.

  20. Pengaruh Campuran Ampas Tebu Dan Alang-Alang (Imperata Cylindrica) Sebagai Media Pertumbuhan Terhadap Kandungan Nutrisi Jamur Tiram Putih (Pleurotus Ostreatus)

    OpenAIRE

    Naila, Ishmatun; Purnomo, Adi Setyo

    2016-01-01

    Penelitian ini bertujuan untuk mengetahui pengaruh ampas tebu dan alang-alang (Imperata cylindrica) sebagai media pertumbuhan jamur tiram putih (Pleurotus ostreatus) terhadap kandungan nutrisinya. Ampas tebu dan alang-alang dipilih sebagai media pertumbuhan alternatif, karena tidak hanya mengandung lignoseluosa, tapi juga tersedia berlimpah di lingkungan. Variasi komposisi ampas tebu:alang-alang yang digunakan adalah 75:25 (A1); 50:50 (A2); 25:75 (A3); 0:100 (A4); dan 100:0 (A5). Pada penelit...

  1. Incidencia del medio y de las condiciones de cultivo en el potencial como nutriceútico de tres especies del genero Pleurotus

    OpenAIRE

    Chegwin Angarita, Carolina

    2014-01-01

    El cultivo biotecnológico empleando fermentaciones en estado líquido de hongos del género Pleurotus, usando salvado de trigo y harinas de cereales y leguminosas como fuentes de carbono no convencionales, en busca de evaluar el efecto del cambio de algunas condiciones del proceso sobre la composición tanto de los micelios como de los caldos agotados y por ende del potencial como nutriceútico del mismo, para posteriormente evaluar la aplicabilidad de dicho producto en la obtención de fructifica...

  2. Comparison between 3D-Var and 4D-Var data assimilation methods for the simulation of a heavy rainfall case in central Italy

    Science.gov (United States)

    Mazzarella, Vincenzo; Maiello, Ida; Capozzi, Vincenzo; Budillon, Giorgio; Ferretti, Rossella

    2017-08-01

    This work aims to provide a comparison between three dimensional and four dimensional variational data assimilation methods (3D-Var and 4D-Var) for a heavy rainfall case in central Italy. To evaluate the impact of the assimilation of reflectivity and radial velocity acquired from Monte Midia Doppler radar into the Weather Research Forecasting (WRF) model, the quantitative precipitation forecast (QPF) is used.The two methods are compared for a heavy rainfall event that occurred in central Italy on 14 September 2012 during the first Special Observation Period (SOP1) of the HyMeX (HYdrological cycle in Mediterranean EXperiment) campaign. This event, characterized by a deep low pressure system over the Tyrrhenian Sea, produced flash floods over the Marche and Abruzzo regions, where rainfall maxima reached more than 150 mm 24 h-1.To identify the best QPF, nine experiments are performed using 3D-Var and 4D-Var data assimilation techniques. All simulations are compared in terms of rainfall forecast and precipitation measured by the gauges through three statistical indicators: probability of detection (POD), critical success index (CSI) and false alarm ratio (FAR). The assimilation of conventional observations with 4D-Var method improves the QPF compared to 3D-Var. In addition, the use of radar measurements in 4D-Var simulations enhances the performances of statistical scores for higher rainfall thresholds.

  3. Biological effects and ISSR analysis of 60Co γ-irradiation on edible mushroom mycelia

    International Nuclear Information System (INIS)

    Cai Weiming; Feng Weilin; Jin Qunli; Fan Lijun; Wu Yongzhi

    2009-01-01

    Mycelia of Agaricus bitorquis, Flammulina velutipes and Pleurotus eryngii were irradiated by 60 Co γ-rays at the dose of 0, 200, 500 and 800 Gy. The results showed that irradiation inhibited their mycelia growth positively. Of the three edible mushroom, Agaricus bitorquis was the most sensitive one to irradiation, its mycelia died at the dose of 800 Gy. Germination rate, growth rate and vigor of all mycelia irradiated with un-lethal doses increased along with the times of transfer of culture. Electrical conductivity (EC) analysis showed that irradiation increased EC of leaching solution of mycelia positively. The EC of leaching solution of mycelia of Flammulina velutipes and Pleurotus eryngii irradiated with 500 Gy, Agaricus bitorquis irradiated with 200 Gy, were significantly higher than CK. ISSR analysis revealed that 60 Co γ irradiation effect on DNA variation of Agaricus bitorquis, Flammulina velutipes and pleurotus eryngii mycelia in varying degrees. Number of polymorphic bands changed after irradiation. Flawing bands and increasing bands were observed in amplified bands of 14 selected ISSR primers. The ISSR variation rates of Agaricus bitorquis for 200 Gy and 599 Gy treatments were 33.3% and 50.5%; the ISSR variation rates of Flammulina velutipes for 200 Gy, 500 Gy and 800 Gy treatments were 2.3%, 2.3% and 3.1%, that of Pleurotus eryngii were 8.6%, 13.4% and 20.0%. It is possible to use 60 Co γ irradiation as a mutagen to screen new mushroom varieties. (authors)

  4. Bio-softening of mature coconut husk for facile coir recovery.

    Science.gov (United States)

    Suganya, D S; Pradeep, S; Jayapriya, J; Subramanian, S

    2007-06-01

    Bio-softening of the mature coconut husk using Basidiomyceteous fungi was attempted to recover the soft and whiter fibers. The process was faster and more efficient in degrading lignin and toxic phenolics. Phanerochaete chrysosporium, Pleurotus eryngii and Ceriporiopsis subvermispora were found to degrade lignin efficiently without any appreciable loss of cellulose, yielding good quality fiber ideal for dyeing.

  5. Cambios en las propiedades físicas de un Inceptisol por la adición de substrato degradado con el hongo Pleurotus ostreatus Changes on physical properties of an Inceptisol influence of the degraded substrate by Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Herminio Paredes Valencia

    2010-01-01

    Full Text Available Para evaluar el efecto del substrato orgánico (aserrín de madera y 'estopa' de coco enriquecido con 40% de volúmenes iguales de hojas de plátano (Mussa sp., kudzú tropical (Pueraria phaseoloides y botón de oro (Tithonia diversifolia degradado por el hongo Pleurotus ostreatus (SDP sobre algunas propiedades físicas de un Inceptisol de Buenaventura, Valle del Cauca, Colombia, se incorporaron dosis crecientes de éste (0, 1.25, 2.5, 5, 10, 20, 40 y 80 g/kg en el suelo tamizado en malla de 2 mm. La mezcla se utilizó en materos sembrados con maíz durante 4 meses, momento en el cual se tomaron muestras para determinar los cambios en las propiedades del suelo. Se usó un diseño completamente al azar, con ocho tratamientos, cuatro repeticiones y dos profundidades de muestreo. La correlación entre la cantidad de SDP incorporado y la mayoría de propiedades físicas evaluadas fue altamente significativa. Comparadas con el control (sin SDP, las dosis de 20, 40 y 80 g/kg redujeron significativamente la densidad aparente del suelo, al tiempo que incrementaron la porosidad total, la macroporosidad, la retención de humedad a bajas tensiones y el contenido de materia orgánica. En las dosis de 40 y 80 g/kg se observó una reducción significativa de la susceptibilidad a la compactación, lo mismo que un incremento en el diámetro promedio ponderado de los agregados estables al agua. Los incrementos de la conductividad hidráulica saturada y la permeabilidad al aire no fueron significativos en relación con el control.To evaluate the effect of the degraded substrate by the mushroom Pleurotus ostreatus (DSP on some physical properties of an Inceptisol from Buenaventura, Colombia, different doses of DSP (0, 1.25, 2.5, 5, 10, 20, 40 and 80 g.kg-1 were incorporated in 2 mm-sieved soil. The mixtures were placed in pots and planted with maize during four months in a green house until the sampling time. Complete randomized design, with eight treatments, four

  6. Plasmodium falciparum var Gene Silencing Is Determined by cis DNA Elements That Form Stable and Heritable Interactions ▿

    Science.gov (United States)

    Swamy, Lakshmi; Amulic, Borko; Deitsch, Kirk W.

    2011-01-01

    Antigenic variation in the human malaria parasite Plasmodium falciparum depends on the transcriptional regulation of the var gene family. In each individual parasite, mRNA is expressed exclusively from 1 var gene out of ∼60, while the rest of the genes are transcriptionally silenced. Both modifications to chromatin structure and DNA regulatory elements associated with each var gene have been implicated in the organization and maintenance of the silent state. Whether silencing is established at the level of entire chromosomal regions via heterochromatin spreading or at the level of individual var promoters through the action of a silencing element within each var intron has been debated. Here, we consider both possibilities, using clonal parasite lines carrying chromosomally integrated transgenes. We confirm a previous finding that the loss of an adjacent var intron results in var promoter activation and further show that transcriptional activation of a var promoter within a cluster does not affect the transcriptional activity of neighboring var promoters. Our results provide more evidence for the hypothesis that var genes are primarily silenced at the level of an individual gene, rather than by heterochromatin spreading. We also tested the intrinsic directionality of an intron's silencing effect on upstream or downstream var promoters. We found that an intron is capable of silencing in either direction and that, once established, a var promoter-intron pair is stably maintained through many generations, suggesting a possible role in epigenetic memory. This study provides insights into the regulation of endogenous var gene clusters. PMID:21317310

  7. Resistance to Southern Root-knot Nematode (Meloidogyne incognita) in Wild Watermelon (Citrullus lanatus var. citroides).

    Science.gov (United States)

    Thies, Judy A; Ariss, Jennifer J; Kousik, Chandrasekar S; Hassell, Richard L; Levi, Amnon

    2016-03-01

    Southern root-knot nematode (RKN, Meloidogyne incognita) is a serious pest of cultivated watermelon (Citrullus lanatus var. lanatus) in southern regions of the United States and no resistance is known to exist in commercial watermelon cultivars. Wild watermelon relatives (Citrullus lanatus var. citroides) have been shown in greenhouse studies to possess varying degrees of resistance to RKN species. Experiments were conducted over 2 yr to assess resistance of southern RKN in C. lanatus var. citroides accessions from the U.S. Watermelon Plant Introduction Collection in an artificially infested field site at the U.S. Vegetable Laboratory in Charleston, SC. In the first study (2006), 19 accessions of C. lanatus var. citroides were compared with reference entries of Citrullus colocynthis and C. lanatus var. lanatus. Of the wild watermelon accessions, two entries exhibited significantly less galling than all other entries. Five of the best performing C. lanatus var. citroides accessions were evaluated with and without nematicide at the same field site in 2007. Citrullus lanatus var. citroides accessions performed better than C. lanatus var. lanatus and C. colocynthis. Overall, most entries of C. lanatus var. citroides performed similarly with and without nematicide treatment in regard to root galling, visible egg masses, vine vigor, and root mass. In both years of field evaluations, most C. lanatus var. citroides accessions showed lesser degrees of nematode reproduction and higher vigor and root mass than C. colocynthis and C. lanatus var. lanatus. The results of these two field evaluations suggest that wild watermelon populations may be useful sources of resistance to southern RKN.

  8. Methods for Detection of Phytophthora fragariae var. rubi on Raspberry

    Directory of Open Access Journals (Sweden)

    Mirjana Koprivica

    2009-01-01

    Full Text Available Phytophthora fragariae var. rubi (Wilcox & Duncan, a causal agent of raspberry root rot, is a serious soil-borne pathogen listed by EPPO as an A2 quarantine pest. Root samples were collected from badly diseased raspberry plants showing a variety of characteristic and often dramatic symptoms during surveys carried out in western Serbia in 2002. Identification of the causal agent was performed in collaboration work with the Scottish Crop Research Institute (S.C.R.I., Dundee, UK. Necrotic roots were plated on selective French bean agar (incorporating ampicilin, ryfamicin, bavistin and hymexasol. Detection of isolates was based on cultural and morphological features compared with referent cultures. DNA was extracted directly from the sampled roots using extraction buffer (200 mM Tris- HCl pH 8.5, 250 mM NaCl, 25 mM EDTA, 0.5% SDS, purified by multi spin separation columns [Thistle Scientific (Axygen] or in 24:1 mixture of chlorophorm- iso-amyl alcohol and amplified by nested PCR (ITS4 and DC6 for first round, DC1and DC5 for second round. Diluted DNA extracts were also amplified by conventional PCR with modified ”universal” Phytophthora primers (ITS 6, ITS 7 and ITS 8, Cooke et al., 2000 and digested with Msp1. Digestion patterns of the universal primers PCR product from infected roots matched those of Scottish strains. P. fragariae var. rubi occured on 8 out of 14 sites. Our results indicate that nested PCR (ITS4 and DC6 for first round, DC1 and DC5 for second round or digestion of the ”universal” Phytophthora primers PCR product for detection of P. fragariae var. rubi are more sensitive and less time-consuming and therefore recommended for use.

  9. Complete plastid genome of Astragalus mongholicus var. nakaianus (Fabaceae).

    Science.gov (United States)

    Choi, In-Su; Kim, Joo-Hwan; Choi, Byoung-Hee

    2016-07-01

    The first complete plastid genome (plastome) of the largest angiosperm genus, Astragalus, was sequenced for the Korean endangered endemic species A. mongholicus var. nakaianus. Its genome is relatively short (123,633 bp) because it lacks an Inverted Repeat (IR) region. It comprises 110 genes, including four unique rRNAs, 30 tRNAs, and 76 protein-coding genes. Similar to other closely related plastomes, rpl22 and rps16 are absent. The putative pseudogene with abnormal stop codons is atpE. This plastome has no additional inversions when compared with highly variable plastomes from IRLC tribes Fabeae and Trifolieae. Our phylogenetic analysis confirms the non-monophyly of Galegeae.

  10. Labor Costs and Foreign Direct Investment: A Panel VAR Approach

    Directory of Open Access Journals (Sweden)

    Bahar Bayraktar-Sağlam

    2017-09-01

    Full Text Available This paper examines the endogenous interaction between labor costs and Foreign Direct Investment (FDI in the OECD countries via the Panel VAR approach under system GMM estimates for the period 1995–2009. The available data allows identifying the relevance of the components of labor costs, and allows a detailed analysis across different sectors. Empirical findings have revealed that sectoral composition of FDI and the decomposition of labor costs play a significant role in investigating the dynamic association between labor costs and FDI. Further, results suggest that labor market policies should focus on productivity-enhancing tools in addition to price hindering tools.

  11. Phenolic compounds from the roots of Valeriana officinalis var. latifolia

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Peng-Cheng; Ran, Xin-Hui; Luo, Huai-Rong; Liu, Yu-Qing; Zhou Jun [State Key Laboratory of Phytochemistry and Plant Resources in West China. Kunming Institute of Botany, Chinese Academy of Sciences (China); Ma, Qing-Yun; Zhao, You-Xing, E-mail: zhoujun3264@yahoo.com.cn, E-mail: zhaoyouxing@itbb.org.cn [Key Laboratory of Biology and Genetic Resources of Tropical Crops. Ministry of Agriculture, Institute of Tropical Bioscience and Biotechnology. Chinese Academy of Tropical Agriculture Sciences (China)

    2013-09-15

    A new benzofuran neolignan, dihydrodehydrodiconiferyl alcohol 9-isovalerate, along with ten known phenolic compounds, olivil, pinoresinol, 8-hydroxypinoresinol, pinorespiol, 8-hydroxy- 7-epipinoresinol, trans-p-hydroxyphenyl- propenoic acid, cis-p-hydroxyphenyl-propenoic acid, ferulic acid, isoferulic acid and isovanillin were isolated from the roots of Valeriana officinalis var. latifolia. Their structures and configurations were elucidated on the basis of spectroscopic methods. The inhibitory activity for acetylcholinesterase (AChE) and enhancing activity on nerve growth factor (NGF)-mediated neurite outgrowth in PC12 cells of dihydrodehydrodiconiferyl alcohol 9-isovaterate and olivil were evaluated. (author)

  12. Phytochemical Studies on Polygonum barbatum (L. Hara var. barbata (Polygonaceae

    Directory of Open Access Journals (Sweden)

    M. Abdul Mazid

    2011-01-01

    Full Text Available Polygonum barbatum (L. Hara var. barbata (Polygonaceae, commonly known as ‘bekhanjabaj’, is a Bangladeshi perennial herb. A combination of the normal phase column chromatography and preparative thin layer chromatography on silica gel afforded sitosterone (1 from the petroleum ether fraction, and viscozulenic acid (2 and acetophenone (3 from the chloroform fraction of the methanol extract of the aerial parts of this plant . The free-radical-scavenging properties the isolated compounds 1-3 were evaluated by the 2,2-diphenyl-1-picryl-hydrazyl (DPPH assay.

  13. Radioactivity in a mountain ecosystem: the Haut Bassin du Var

    International Nuclear Information System (INIS)

    2002-01-01

    After the Chernobyl accident, the IPSN realized a study of the radioactive fallout in the mountain area of the Var (France). Today the main radionuclides are the cesium 134 and 137, others disappeared because of their short half-life. In this paper, the artificial radioactivity of soils and sediments is concerned. The study shows a concentration of the contamination in some specific areas, especially in soils abounding in organic matter. The dose measured can not lead to significant exposures. (A.L.B.)

  14. An unusual variant of Trichophyton tonsurans var. sulfureum.

    Science.gov (United States)

    Padhye, A A; Weitzman, I; Domenech, E

    1994-01-01

    A fungus, recovered from a skin lesion of a patient, produced velvety to powdery, white to deep yellow colonies on Sabouraud glucose agar. Microscopically, it produced a large number of cylindric, smooth-walled, three- to eight-celled macroconidia but failed to produce microconidia on a variety of nutritional media such as rice grains, cornmeal dextrose, potato dextrose, Sabouraud glucose, oatmeal and lactrimel agars. It hydrolysed urea in 7 days, perforated hair in vitro and required thiamine for growth. This isolate represents an atypical variant of Trichophyton tonsurans var. sufureum subvar. perforans.

  15. Phenolic compounds from the roots of Valeriana officinalis var. latifolia

    International Nuclear Information System (INIS)

    Wang, Peng-Cheng; Ran, Xin-Hui; Luo, Huai-Rong; Liu, Yu-Qing; Zhou Jun; Ma, Qing-Yun; Zhao, You-Xing

    2013-01-01

    A new benzofuran neolignan, dihydrodehydrodiconiferyl alcohol 9-isovalerate, along with ten known phenolic compounds, olivil, pinoresinol, 8-hydroxypinoresinol, pinorespiol, 8-hydroxy- 7-epipinoresinol, trans-p-hydroxyphenyl- propenoic acid, cis-p-hydroxyphenyl-propenoic acid, ferulic acid, isoferulic acid and isovanillin were isolated from the roots of Valeriana officinalis var. latifolia. Their structures and configurations were elucidated on the basis of spectroscopic methods. The inhibitory activity for acetylcholinesterase (AChE) and enhancing activity on nerve growth factor (NGF)-mediated neurite outgrowth in PC12 cells of dihydrodehydrodiconiferyl alcohol 9-isovaterate and olivil were evaluated. (author)

  16. Mitigation of voltage fluctuations with an Adaptive Var Compensator (AVC)

    Energy Technology Data Exchange (ETDEWEB)

    Chan, F [TransAlta Utilities Corp., Calgary, AB (Canada); Castanheira, A

    1997-04-01

    The installation of an Adaptive Var Compensator (AVC) to remedy a voltage flicker problem at the TIMEU sawmill in Fort Assiniboine, Alberta, was described. The TIMEU sawmill is a 980 kVA load at the end of a 25 kV feeder. Two older style J bar type saws, each driven by a 200 Hp motor, are used to operate the wood processing services. The sawing and chipping process resulted in the generation of significant voltage flicker on the 25 kV distribution system. The AVC provided cycle per cycle reactive compensation and voltage support; no further complaints of flicker were received.

  17. Bioprospecting of powdered pineapple rind as an organic supplement of composted sawdust for Pleurotus ostreatus mushroom cultivation.

    Science.gov (United States)

    Narh Mensah, Deborah L; Addo, Peter; Dzomeku, Matilda; Obodai, Mary

    2018-03-01

    Pineapple rind is a by-product of the pineapple processing industry and contains nutrients and other compounds which must be utilized as a bioresource for socio-economic benefits while preventing the potential problems of improper agroindustrial biomass disposal methods. Pleurotus ostreatus is an edible oyster mushroom with medicinal properties and can be cultivated on various agroindustrial biomass, including sawdust containing supplements. Pineapple rind was powdered and used as a supplement of composted sawdust at 2%, 5%, 10%, 12%, 15%, and 20% (w/w) on dry weight basis. A control treatment consisted of composted sawdust supplemented with rice bran at 12% (the most utilized composition in Ghana). P. ostreatus strain EM-1 was cultivated on these treatments. Factors investigated included the spawn run period, yield, fruiting body weight and size, biological efficiency, and nutritional composition (proximate composition and Copper, Zinc and Lead content) of fruiting bodies harvested from selected high-yielding treatments and the control treatment. Full colonization of all treatments occurred by the 34th day of incubation. Enhanced yield, fruiting body weight and size, and biological efficiency were generally recorded with supplementation at lower concentrations (2% and 5%) compared to treatments supplemented at higher concentrations. There was also a supplement concentration-dependent alteration of the nutritional composition of the mushroom. Powdered pineapple rind can be utilized as an organic supplement at relatively low concentrations in composted sawdust for P. ostreatus strain EM-1 cultivation. The use of lower concentrations of powdered pineapple rind in composted sawdust is advantageous as relatively less input will be required to produce higher P. ostreatus strain EM-1 yields. Utilization of pineapple rind for mushroom cultivation will extend the pineapple plant value chain, intensify mushroom production in a sustainable way, and minimize agricultural

  18. An environmentally friendly and cost effective technique for the commercial cultivation of oyster mushroom [Pleurotus florida (Mont.) Singer].

    Science.gov (United States)

    Panjikkaran, Seeja Thomachan; Mathew, Deepu

    2013-03-15

    The existing protocol for the cultivation of oyster mushroom (Pleurotus florida) in polyethylene bags leads to environmental pollution amounting to 18 g of polyethylene per 450 g of mushroom, which is the average biological efficiency achieved from a bag. Thus the projected annual global pollution amounts to 2 million tones, corresponding to the production of 48 million tones. Experiments were conducted at Kerala Agricultural University, India, to formulate an oyster mushroom cultivation strategy that reduces this pollution level. Pooled results of experiments at the institute's and farmers' units have shown that reusable plastic buckets having perforations of 1.5 cm × 1.0 cm throughout the side walls could be used to substitute polyethylene bags, while following the standard cultivation protocols. Cultivation in perforated buckets has recorded a biological efficiency of 435.69 ± 56.75 g in 47.07 ± 5.22 days against 459.11 ± 53.52 g in 38.05 ± 4.54 days in polyethylene bags. The rate of contamination in buckets was significantly lower than that in bags: 9.28 ± 2.12 and 12.60 ± 3.73% respectively. Reusable plastic buckets with perforations on the side walls could be used to substitute the conventional polyethylene bags in oyster mushroom cultivation, with no significant difference in yield. Losses due to slight increase in crop duration in buckets will be compensated with a lower rate of contamination. For a unit having a daily output of 100 kg, it was estimated that during 10 years of permanent cultivation following this technique, the cost of cultivation could be reduced to one-tenth and the environmental pollution reduced by at least 730 000 non-degradable polyethylene bags. © 2012 Society of Chemical Industry.

  19. Inhibition of platelet aggregation and in vitro free radical scavenging activity of dried fruiting bodies of Pleurotus eous.

    Science.gov (United States)

    Suseem, S R; Saral, Mary

    2015-07-01

    To evaluate the ethyl acetate, methanol and aqueous extracts of dried fruiting bodies of Pleurotus eous for its anti-platelet activity on human volunteer's blood. And also to analyze the free radical scavenging property of the extracts of P.eous by using various in vitro models. Anti-platelet activity of dried fruiting bodies of P.eous was evaluated by in vitro model using blood platelets. Inhibition of platelet aggregation was monitored after pre-incubation of platelets with the crude extracts of mushroom P.eous. Antioxidant activities of extracts of P.eous were evaluated by different in vitro experiments, namely, 1, 1-diphenyl-2-picryl hydrazyl (DPPH), superoxide, hydroxyl radical and lipid peroxide radical models. Crude extracts of mushroom P.eous inhibited platelet aggregation dose-dependently which was induced by adenosine diphosphate (ADP). At a maximum concentration of 10 mg/mL, methanol extract effected 64.02% inhibition of lipid per-oxidation and 50.12% scavenging effect on superoxide anion radical. Aqueous extract of P.eous have shown 69.43% chelating ability on ferrous ions, 24.27% scavenging effect on hydroxyl radical and 49.57% scavenging effect on DPPH radical at 10 mg/mL. Increasing concentrations of the extract were found to cause progressively decreasing of the intensity of absorbance. Anti-platelet effects could be related in part to the polyphenolic compounds present in the extracts. Antioxidant activity results indicated the free radical scavenging property of the extracts of P.eous which might be due to the high content of phenolic compounds and flavonoids.

  20. Characterization and immunomodulatory effects of glucans from Pleurotus albidus, a promising species of mushroom for farming and biomass production.

    Science.gov (United States)

    Castro-Alves, Victor Costa; Gomes, Daniel; Menolli, Nelson; Sforça, Maurício Luís; Nascimento, João Roberto Oliveira do

    2017-02-01

    Polysaccharides from a number of mushroom species are recognized as functional food ingredients with potential health benefits, including immunomodulatory effects. In this study, polysaccharides extracted from the basidiome with cold water (BaCW), hot water (BaHW), and hot alkali (BaHA) solution, and exo- (MyEX) and endopolysaccharides (MyEN) from the submerged culture of Pleurotus albidus, a promising species for farming and biomass production, were analyzed for their chemical composition and structure and immunomodulatory effects on macrophages. Compositional (HPAEC-PAD and HPSEC-RID/MWD) and structural (FT-IR, 1D- and 2D-NMR) analyses identified BaCW and MyEX as β-(1,6)-branched β-(1,3)-glucans, BaHW and MyEN as α-(1,3)-(1,2)-branched α-(1,6)-glucans, and BaHA as a mixture of α-(1,6)- and β-(1,3)-glucans. BaCW and MyEX stimulated the production of tumor necrosis factor alpha (TNF-α) and nitric oxide (NO), but not interleukin-6 (IL-6), and decreased phagocytosis of zymosan particles. In contrast, BaHW and MyEN induced TNF-α, NO and IL-6 production, and increased zymosan phagocytosis, while BaHA displayed intermediary effects in comparison the other polysaccharides. In conclusion, the basidiome and the submerged culture of P. albidus are sources of easily extractable α- and β-glucans with potential immunomodulatory effects. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Use of Pleurotus sajor-caju in upgrading green jute plants and jute sticks as ruminant feed

    Directory of Open Access Journals (Sweden)

    Zinat Mahal

    2013-01-01

    Full Text Available In this study, superfluous jute plants and jute stick were converted into upgraded animal feed by solid state fermentation (SSF using a cellulolytic fungus, Pleurotus sajor-caju. Prior to fermentation, substrates were subjected to several pretreatments such as soaking with water overnight and alkali or lime pretreatment. SSF was carried out with 20 g of substrate in 100 ml conical flask and was incubated at 30C for 8 weeks. In all treatments, the highest amount of reducing sugar, soluble protein as well as the cellulolytic activities of three enzymes viz. cellobiase, carboxymethyl cellulase and avicelase were obtained at 6th week of fermentation. Compared to raw, unsoaked substrates, soaking treatment alone could produce 10% more soluble protein in both substrates whereas reducing sugar increment was 5% and 6% in jute sticks and jute plants, respectively. From all treatments, combination of soaking and lime treatment in green jute plants yielded higher value than jute sticks in terms of reducing sugar, soluble protein and enzymatic activity. The radiation doses at 20, 30 and 40 kGy appeared to have no effect on sugar and protein accretion. During eight weeks of fermentation, relatively higher cellobiase activity was found compared to that of carboxymethyl cellulase and avicelase. The present investigation indicates that fungal conversion with pretreatment can turn these lignocellulosic agro-wastes to a nutritionally enriched animal feed by increasing the crude protein and reducing sugar content. However, further research is necessary to develop strategies for industrial scale production to overcome the crisis of nutritionally improved animal feed.

  2. Screening of antagonistic bacteria against the green mold disease (Trichoderma harzianum Rifai of Grey Oyster Mushroom (Pleurotus pulmonarius (Fr. Quel.

    Directory of Open Access Journals (Sweden)

    Nualsri, C.

    2005-01-01

    Full Text Available A total of 174 strains of bacteria antagonistic against the green mold (Trichoderma harzianum, isolated from cultivating bags and fruiting bodies of the mushrooms, were screened for effects on mushroom mycelia and ability to control the green mold disease. Twenty-eight of them promoted the primodia formation of the Pleurotus pulmonarius mycelia on agar plates. Twenty-two isolates were selected and further tested in a mushroom house. Cell suspension of each isolate was prepared and sprayed onto the spawn surface of P. pulmonarius. Fifteen isolates shortened the times required from watering to 2nd and 3rd flushing and increased yield of the basidiocarps by 1.1-34.3% over 30 days. Six isolates of bacteria which showed an inhibitory effect against T. harzianum, enhanced primordia formation and increased yield of P. pulmonarius were selected and used for control testing in a cultivation house. The suspension of each isolate was sprayed onto the spawn surface immediately after exposure to the air in the mushroom house, followed by spore suspension of T. harzianum two days later. The number of infected bags was counted at 30 days after inoculation and the cumulative yield was compared after 60 days. The results showed that bacteria isolate B012-022 was highly effective in suppressing the green mold disease.Only 6.7% of the cultivating bags were found to be infected by T. harzianum when bacteria isolate B012-022 was applied. Cumulative yield obtained from 900 g of 94% sawdust + 5% rice bran + 1% Ca(OH2 was 300.0 g/bag after 60 days, 71.1% higher than the bags infected by the green mold and without bacterial spraying. Identification of the six bacterial isolates showed all to be Bacillus spp.

  3. Comparison of the specificity of antibodies to VAR2CSA in Cameroonian multigravidae with and without placental malaria

    DEFF Research Database (Denmark)

    Babakhanyan, Anna; Fang, Rui; Wey, Andrew

    2015-01-01

    BACKGROUND: Antibodies (Ab) to VAR2CSA prevent Plasmodium falciparum-infected erythrocytes from sequestrating in the placenta, i.e., prevent placental malaria (PM). The specificity of Ab to VAR2CSA associated with absence of PM is unknown. Accordingly, differences in the specificity of Ab to VAR2......CSA were compared between multigravidae with and without PM who had Ab to VAR2CSA. METHODS: In a retrospective case-control study, plasma collected from Cameroonian multigravidae with (n = 96) and without (n = 324) PM were screened in 21 assays that measured antibody levels to full length VAR2CSA (FV2......), individual VAR2CSA DBL domains, VAR2CSA domains from different genetic backgrounds (variants), as well as proportion of high avidity Ab to FV2. RESULTS: Multigravidae with and without PM had similar levels of Ab to FV2, the six VAR2CSA DBL domains and different variants, while the proportion of high avidity...

  4. The production of Pleurotus sajor-caju in peach palm leaves (Bactris gasipaes and evaluation of its use to enrich wheat flour

    Directory of Open Access Journals (Sweden)

    Paula Fernanda Bomfim Oliveira Cogorni

    2014-06-01

    Full Text Available The aim of this study was to evaluate of Pleurotus sajor-caju production in peach palm leaves and the addition of different fractions of mushroom powder to wheat flour to increase its nutritional value without changing its characteristics. The best yield (48.4%, biologic efficiency (4.5%, and Pr (0.36 g/day values were obtained using 20% inoculum fraction and 10% rice bran fraction. The Pleurotus sajor-caju fruiting body cultivated under these conditions had the following composition in 100 g: 29.91 g (carbohydrates, 42.92 g (proteins, 1.24 g (lipids, 15.93 g (fibers, 7.42 g (ashes, 1.6 g (phosphorus, 2.7 g (potassium, 8.73 mg (iron, 23.75 mg (sodium, 0.34 mg (thiamine, and 0.57 mg (riboflavin. The wheat flour with mushroom powder had reduced sugar content, but it did not have increased fat content. The fiber, protein, phosphorus, potassium, iron, and riboflavin contents were increased mainly when 10% mushroom powder was added to the wheat flour. Furthermore, this flour does not undergo drastic alterations in its physicochemical characteristics such as in moisture, wet gluten, color, and falling number.

  5. Effect of gamma irradiation on the structure of corn stalks and their subsequent bioconversion into protein-rich mycelial biomass of pleurotus sajor-caju

    Energy Technology Data Exchange (ETDEWEB)

    Awafo, V [Quebec Univ., Montreal, PQ (Canada)

    1994-12-31

    Lignocellulosic biomass like corn stalk is an abundant and renewable resource from which food, feed and chemicals may be derived. Enzymatic hydrolysis of native lignocellulosic material is prohibitively slow due to their compositional heterogeneity and structural complexity. In this work, ground corn stalks (20 mesh) were subjected to gamma irradiation (10-170 Mrads) as pretreatments to make them more susceptible for bioconversion into protein-rich mycelial biomass of Pleurotus sajor-caju NRRL 18757. The irradiation was carried out in air in a {sup 60}Co Underwater Calibrator (UC-15, Nordion International) at a dose rate of 2.5 Mrads/h as measured by Fricke dosimetry. No apparent structural differences were observed under the light microscope. However, the protein synthesis and the proportion of mycelial biomass increased with the increase in both the dose of irradiation and time of fermentation during the bioconversion of 1% corn stalk into mycelial biomass of Pleurotus sajor-caju. Gamma irradiation at the dose of 50 Mrads or lower did not produce any appreciable increase in the amount of protein synthesised. At 170 Mrads, the final product contained 28% protein representing a 2-fold increase from non-irradiated corn stalk and an efficiency of 36% conversion of total utilizable polysaccharides of corn stalks into mycelial biomass. The lag phase during mycelial biomass production was much more prolonged at very high doses indicating possible production of some toxic substances during irradiation. (author). 2 tabs., 6 figs.

  6. The comparative study on screening of pleurotus polysaccharide high-yield strains by use of ion beam implantation and composite mutagenesis

    International Nuclear Information System (INIS)

    Wang Lianfeng; Chen Henglei; Zhang Jun; Zeng Xianxian

    2009-01-01

    In order to screen pleurotus mycelium polysaccharide high-yield strains, the comparative study was made by use of ion beam implantation and composite mutagenesis before screening. The treating mycelium pellet of pleurotus ferulae tentatively with ion beam implantation was performed at the first. Two polysaccharide high-yield strains, PFPH-1and PFPH-2, were selected using fermentation quantitative screening after auxotrophy qualitative primary screening. It has been found that the polysaccharide yield of the mutants is 551.80mg/L and 659.46mg/L respectively,which increases by 46.55% and 75.14% respectively compared to that of initial strain. Then PFPH-1and PFPH-2, as the original strain, is exposed to ultraviolet light and is suffered by additive of LiCl respectively. The results indicate that the polysaccharide yield of strains 1,9 and 10 decreases by 27%, 38% and 37% respectively compared to that of PFPH-1 meanwhile the polysaccharide yield of strain 17 decreases by 28% compared to that of PFPH-2 after high-flux qualitative primary screening. In this study, composite mutagenesis with exposure of ultra-violet and additive of lithium chloride shows some negative effects. (authors)

  7. Further elucidation of the taxonomic relationships and geographic distribution of Escobaria sneedii var. sneedii, E. sneedii var. leei, and E. guadalupensis (Cactaceae)

    Science.gov (United States)

    Marc A. Baker

    2007-01-01

    Individuals of E. sneedii var. sneedii were found to occur in greater abundance within the Guadalupe Mountains than was previously recorded. No additional populations morphologically intermediate between E. guadalupensis and E. sneedii were found. Taxonomic affiliation and geographic...

  8. Scleria neesii Kunth var. gadchiroliensis (Cyperaceae, a New Variety from Central India

    Directory of Open Access Journals (Sweden)

    Milind M. Sardesai

    2015-12-01

    Full Text Available A new variety of Scleria P. J. Bergius (Cyperaceae S. neesii Kunth var. gadchiroliensis from Central India is described here with description, line-drawing, photographic illustration and notes. It resembles with S. neesii Kunth var. neesii in overall morphology but differs in having milky white nuts covered with ribbon like hairs on distinct stalk.

  9. Silence, Metaperformance, and Communication in Pedro Almodóvar's "Hable con ella"

    Science.gov (United States)

    Fellie, Maria C.

    2016-01-01

    Many scenes in Pedro Almodóvar's "Hable con ella" (2002) include shots of metaperformances such as silent films, dances, television shows, concerts, and bullfights. Spectators often observe passive characters who are in turn observing. By presenting these performances within cinematic performance, Almodóvar highlights our role as viewers…

  10. A Stochastic Dominance Approach to the Basel III Dilemma: Expected Shortfall or VaR?

    NARCIS (Netherlands)

    C-L. Chang (Chia-Lin); J.A. Jiménez-Martín (Juan-Ángel); E. Maasoumi (Esfandiar); M.J. McAleer (Michael); T. Pérez-Amaral (Teodosio)

    2015-01-01

    markdownabstract__Abstract__ The Basel Committee on Banking Supervision (BCBS) (2013) recently proposed shifting the quantitative risk metrics system from Value-at-Risk (VaR) to Expected Shortfall (ES). The BCBS (2013) noted that “a number of weaknesses have been identified with using VaR for

  11. Generation of antigenic diversity in Plasmodium falciparum by structured rearrangement of Var genes during mitosis.

    Directory of Open Access Journals (Sweden)

    Antoine Claessens

    2014-12-01

    Full Text Available The most polymorphic gene family in P. falciparum is the ∼60 var genes distributed across parasite chromosomes, both in the subtelomeres and in internal regions. They encode hypervariable surface proteins known as P. falciparum erythrocyte membrane protein 1 (PfEMP1 that are critical for pathogenesis and immune evasion in Plasmodium falciparum. How var gene sequence diversity is generated is not currently completely understood. To address this, we constructed large clone trees and performed whole genome sequence analysis to study the generation of novel var gene sequences in asexually replicating parasites. While single nucleotide polymorphisms (SNPs were scattered across the genome, structural variants (deletions, duplications, translocations were focused in and around var genes, with considerable variation in frequency between strains. Analysis of more than 100 recombination events involving var exon 1 revealed that the average nucleotide sequence identity of two recombining exons was only 63% (range: 52.7-72.4% yet the crossovers were error-free and occurred in such a way that the resulting sequence was in frame and domain architecture was preserved. Var exon 1, which encodes the immunologically exposed part of the protein, recombined in up to 0.2% of infected erythrocytes in vitro per life cycle. The high rate of var exon 1 recombination indicates that millions of new antigenic structures could potentially be generated each day in a single infected individual. We propose a model whereby var gene sequence polymorphism is mainly generated during the asexual part of the life cycle.

  12. Clinical development of a VAR2CSA-based placental malaria vaccine PAMVAC

    DEFF Research Database (Denmark)

    Gbédandé, Komi; Fievet, Nadine; Viwami, Firmine

    2017-01-01

    Background  The antigen VAR2CSA plays a pivotal role in the pathophysiology of pregnancy-associated malaria (PAM) caused by Plasmodium falciparum. A VAR2CSA-based vaccine candidate, PAMVAC, is under development by an EU-funded multi-country consortium (PlacMalVac project). As part of PAMVAC...

  13. Abelmoschus manihot var. pungens (Roxburgh Hochreutiner (Malvaceae, A Newly Naturalized Plant in Taiwan

    Directory of Open Access Journals (Sweden)

    Szu-I Hsieh

    2013-06-01

    Full Text Available Abelmoschus manihot var. pungens (Roxburgh Hochreutiner is naturalized in abandoned land of central Taiwan. The distinguished characteristics of A. manihot var. pungens include the ovate-lanceolate epicalyx lobes, distinct prickly hairs all over the plant, and even over the margins of its epicalyx lobes. Descriptions, line drawings and photos of this species are provided.

  14. Essays on Imperfect Knowledge Economics, Structural Change, and Persistence in the Cointegrated VAR Model

    DEFF Research Database (Denmark)

    Tabor, Morten Nyboe

    2014-01-01

    conrm the original intuition behind the attempt to combine IKE and the econometric approach based on the cointegrated VAR model, that the parameter-instability of IKE models could potentially be an important source of the persistence found empirically in estimated cointegrated VAR models...

  15. Waarnemingen aan Equisetum arvense L. var. serotinum F.W. Meyer

    NARCIS (Netherlands)

    Hoek, van L.

    1978-01-01

    Observations during six successive years in a cultivated clone of Equisetum arvense L. var. serotinum F. W. Meyer made it possible to study various types of fertile, sterile, and homophyadic stems developing in this clone. As E. arvense var. varium Milde, E. arvense f. sanguineum Luerss., and E.

  16. Computing level-impulse responses of log-specified VAR systems

    NARCIS (Netherlands)

    Wieringa, J.E.; Horvath, C.

    2005-01-01

    Impulse response functions (IRFs) are often used to analyze the dynamic behavior of a vector autoregressive (VAR) system. In many applications of VAR modelling, the variables are log-transformed before the model is estimated. If this is the case, the results of the IRFs do not have a direct

  17. Generation of antigenic diversity in Plasmodium falciparum by structured rearrangement of Var genes during mitosis.

    Science.gov (United States)

    Claessens, Antoine; Hamilton, William L; Kekre, Mihir; Otto, Thomas D; Faizullabhoy, Adnan; Rayner, Julian C; Kwiatkowski, Dominic

    2014-12-01

    The most polymorphic gene family in P. falciparum is the ∼60 var genes distributed across parasite chromosomes, both in the subtelomeres and in internal regions. They encode hypervariable surface proteins known as P. falciparum erythrocyte membrane protein 1 (PfEMP1) that are critical for pathogenesis and immune evasion in Plasmodium falciparum. How var gene sequence diversity is generated is not currently completely understood. To address this, we constructed large clone trees and performed whole genome sequence analysis to study the generation of novel var gene sequences in asexually replicating parasites. While single nucleotide polymorphisms (SNPs) were scattered across the genome, structural variants (deletions, duplications, translocations) were focused in and around var genes, with considerable variation in frequency between strains. Analysis of more than 100 recombination events involving var exon 1 revealed that the average nucleotide sequence identity of two recombining exons was only 63% (range: 52.7-72.4%) yet the crossovers were error-free and occurred in such a way that the resulting sequence was in frame and domain architecture was preserved. Var exon 1, which encodes the immunologically exposed part of the protein, recombined in up to 0.2% of infected erythrocytes in vitro per life cycle. The high rate of var exon 1 recombination indicates that millions of new antigenic structures could potentially be generated each day in a single infected individual. We propose a model whereby var gene sequence polymorphism is mainly generated during the asexual part of the life cycle.

  18. Numerical and structural chromosome aberrations in cauliflower (Brassica oleracea var. botrytis) and Arabidopsis thaliana

    NARCIS (Netherlands)

    Ji, X.

    2014-01-01

    Numerical and structural chromosome aberrations in cauliflower (Brassica oleracea var. botrytis) and Arabidopsis thaliana.

    I studied numerical and structural chromosome aberrations in cauliflower (Brassica oleracea var. botrytis) and

  19. Pleurotus ostreatus Yetiştiriciliğinde Katkı Maddesi Olarak Mısır Silajının Kullanımı

    Directory of Open Access Journals (Sweden)

    Beyhan Kibar

    2016-05-01

    Full Text Available Bu çalışma Pleurotus ostreatus mantarı yetiştiriciliğinde mısır silajının katkı maddesi olarak kullanım durumunu belirlemek amacıyla yapılmıştır. Çalışmada buğday samanına farklı oranlarda (%5, 10, 15 ve 20 mısır silajı ilave edilerek hazırlanan yetiştirme ortamları, verim ve morfolojik özellikler bakımından kontrol ile (%95 buğday samanı+%5 buğday kepeği karşılaştırılmıştır. Yetiştirme ortamlarının hazırlanmasında kullanılan materyallerin her birinin başlangıçtaki ve hazırlanan yetiştirme ortamlarının sterilizasyondan sonraki pH, karbon (C ve azot (N miktarı, C:N oranı ve mineral madde (K, P, Mg, Zn, Fe ve Mn içerikleri tespit edilmiştir. Verim bakımından kontrol ve farklı oranlarda mısır silajı ilave edilerek hazırlanan yetiştirme ortamları arasındaki farklılık istatistiki olarak önemli (P<0.05, morfolojik özellikler (şapka uzunluğu, sap uzunluğu ve sap kalınlığı bakımından ise önemsiz bulunmuştur. En yüksek verim (220.13 g kg-1 ortam buğday samanına %10 oranında mısır silajının ilave edilmesiyle hazırlanan yetiştirme ortamından, en düşük verim (153.75 g kg-1 ortam ise kontrol ortamından elde edilmiştir. Mısır silajının P. ostreatus yetiştiriciliğinde buğday kepeğine alternatif iyi ve ucuz bir katkı maddesi olarak kullanılabileceği sonucuna varılmıştır.

  20. Comparative anatomy of the leaves of Piper lepturum(Kunth) C.DC. var. lepturum and Piper lepturum var. angustifolium (C.DC.) Yunck.

    OpenAIRE

    Machado, Nelson Santana de Oliveira; Pereira, Flaviane Gomes; Santos, Paulo Roberto Dias dos; Costa, Cecília Gonçalves; Guimarães, Elsie Franklin

    2015-01-01

    This study showed anatomical differences related to Piper lepturumvar. lepturum and P. lepturum var. angustifolium species, sometimes considered varieties and in other cases synonyms. For histological analysis, fully expanded leaves were collected and for analysis by scanning electron microscope (SEM), fragments from the midrib were fixed on both leaf surfaces. The two species revealed differences in plant anatomy and it was observed that the stem of P. lepturum var. lepturum showed persisten...

  1. Antioxidant potency of white (Brassica oleracea L. var. capitata) and Chinese (Brassica rapa L. var. pekinensis (Lour.)) cabbage: The influence of development stage, cultivar choice and seed selection

    Czech Academy of Sciences Publication Activity Database

    Šamec, D.; Piljac-Žegarac, J.; Bogovic, M.; Habjanic, K.; Grúz, Jiří

    2011-01-01

    Roč. 128, č. 2 (2011), s. 78-83 ISSN 0304-4238 R&D Projects: GA AV ČR KAN200380801; GA ČR GA301/08/1649 Institutional research plan: CEZ:AV0Z50380511 Keywords : Antimicrobial activity * Antioxidant capacity * Brassica oleracea L. var. capitata * rapa L. var. pekinensis Lour * Cabbage Subject RIV: EF - Botanics Impact factor: 1.527, year: 2011

  2. METODE VECTOR AUTOREGRESSIVE (VAR DALAM PERAMALAN JUMLAH WISATAWAN MANCANEGARA KE BALI

    Directory of Open Access Journals (Sweden)

    TJOK GDE SAHITYAHUTTI RANANGGA

    2018-05-01

    Full Text Available The purposes of this research were to model and to forecast the number of foreign tourists (Australia, China, and Japan arrival to Bali using vector autoregressive (VAR method. The estimated of VAR model obtained to forecast the number of foreign tourists to Bali is the sixth order VAR (VAR(6.We used multivariate least square method to estimate the VAR(6’s parameters.The mean absolute percentage error (MAPE in this model were as follows 6.8% in predicting the number of Australian tourists, 15.9% in predicting the number of Chinese tourists, and 9% in predicting the number of Japanese tourists. The prediction of Australian, Chinese, and Japanese tourists arrival to Bali for July 2017 to December 2017 tended  to experience up and downs that were not too high compared to the previous months.

  3. Phyllactinia mali and Podosphaera tridactyla var. tridactyla – new hosts of Ampelomyces quisqualis

    Directory of Open Access Journals (Sweden)

    Beata Czerniawska

    2014-08-01

    Full Text Available In 2002, the occurrence of fungi of the order Erysiphales on plants of the Słowiański Park located in Goorzów Wielkopolski was investigated. Plant samples were collected once a month, from August to November. The samples examined were above ground plant parts colonized by powdery mildew fungi. A total of 78 samples were collected. Apart from 14 species of the order Erysiphales, Ampelomyces quisqualis parasitizing on Erysiphe cichoracearum var. cichoracearum, Phyllactinia mali and Podosphaera tridactyl var. tridactyla was found. Ampelomyces quisqualis affected hyphae, oidia, and young cleistothecia of P. mali. In contrast, in E. cichoracearum var. cichoracearum, Po. tridactyle var. tridactyla, this hyperparasite colonized only hyphae and oidia. This paper for the first trime informs of A. quisqualis parasitizing on P. mali and Po. tridactyla var. tridactyla.

  4. MODEL NON LINIER GARCH (NGARCH UNTUK MENGESTIMASI NILAI VALUE at RISK (VaR PADA IHSG

    Directory of Open Access Journals (Sweden)

    I KOMANG TRY BAYU MAHENDRA

    2015-06-01

    Full Text Available In investment, risk measurement is important. One of risk measure is Value at Risk (VaR. There are many methods that can be used to estimate risk based on VaR framework. One of them Non Linier GARCH (NGARCH model. In this research, determination of VaR used NGARCH model. NGARCH model allowed for asymetric behaviour in the volatility such that “good news” or positive return and “bad news” or negative return. Based on calculations of VaR, the higher of the confidence level and the longer the investment period, the risk was greater. Determination of VaR using NGARCH model was less than GARCH model.

  5. [A survey on ecological environment of wild Adiantum reniforme var. sinense in Three Gorges Reservoir region].

    Science.gov (United States)

    Xie, Zhong-de; Jia, Han; Fu, Shao-Zhi; Gao, Wen-Yuan; Zhang, Zhi-Wei; Sun, Wei

    2017-11-01

    The study aims at investigating the ecological environment Adiantum reniforme var. sinense of in Three Gorges Reservoir region, and providing a reference basis for the protection of resources and artificial cultivation of A. reniforme var. sinense. By using the method of investigation, field survey and experimental analysis, the vegetation, natural geographical environment, climate, soil nutrients of A. reniforme var. sinense were studied and analyzed. The survey found that A. reniforme var. sinense distribution area reduced fast in Three Gorges region, a lot of distribution has diminished and vanished due to excessive digging, currently only in 3 towns of Wanzhou there exist 4 wild distribution areas. The growth of A. reniforme var. sinense needs an environment with low altitude, steep slope and thin soil, northeast slope, canopy height and warm and humid climate characteristics, and the soil in distribution has the characteristics of high organic matter, available nitrogen, available potassium, and low available phosphorus content. Copyright© by the Chinese Pharmaceutical Association.

  6. Empirical analysis on future-cash arbitrage risk with portfolio VaR

    Science.gov (United States)

    Chen, Rongda; Li, Cong; Wang, Weijin; Wang, Ze

    2014-03-01

    This paper constructs the positive arbitrage position by alternating the spot index with Chinese Exchange Traded Fund (ETF) portfolio and estimating the arbitrage-free interval of futures with the latest trade data. Then, an improved Delta-normal method was used, which replaces the simple linear correlation coefficient with tail dependence correlation coefficient, to measure VaR (Value-at-risk) of the arbitrage position. Analysis of VaR implies that the risk of future-cash arbitrage is less than that of investing completely in either futures or spot market. Then according to the compositional VaR and the marginal VaR, we should increase the futures position and decrease the spot position appropriately to minimize the VaR, which can minimize risk subject to certain revenues.

  7. Molecular structures of fructans from Agave tequilana Weber var. azul.

    Science.gov (United States)

    Lopez, Mercedes G; Mancilla-Margalli, Norma A; Mendoza-Diaz, Guillermo

    2003-12-31

    Agave plants utilize crassulacean acid metabolism (CAM) for CO(2) fixation. Fructans are the principal photosynthetic products generated by agave plants. These carbohydrates are fructose-bound polymers frequently with a single glucose moiety. Agave tequilana Weber var. azul is an economically important CAM species not only because it is the sole plant allowed for tequila production but because it is a potential source of prebiotics. Because of the large amounts of carbohydrates in A. tequilana, in this study the molecular structures of its fructans were determined by fructan derivatization for linkage analysis coupled with gas chromatography-mass spectrometry (GC-MS), nuclear magnetic resonance (NMR), and matrix-assisted laser desorption time-of-flight mass spectrometry (MALDI-TOF-MS). Fructans were extracted from 8-year-old A. tequilana plants. The linkage types present in fructans from A. tequilana were determined by permethylation followed by reductive cleavage, acetylation, and finally GC-MS analysis. Analysis of the degree of polymerization (DP) estimated by (1)H NMR integration and (13)C NMR and confirmed by MALDI-TOF-MS showed a wide DP ranging from 3 to 29 units. All of the analyses performed demonstrated that fructans from A. tequilana consist of a complex mixture of fructooligosaccharides containing principally beta(2 --> 1) linkages, but also beta(2 --> 6) and branch moieties were observed. Finally, it can be stated that fructans from A. tequilana Weber var. azul are not an inulin type as previously thought.

  8. Baccharis megapotamica var. weirii poisoning in water buffalo (Bubalus bubalis).

    Science.gov (United States)

    Oliveira-Filho, José C; Carmo, Priscila M S; Lucena, Ricardo B; Pierezan, Felipe; Barros, Claudio S L

    2011-05-01

    An outbreak of an acute disease in buffalo (Bubalus bubalis) caused by the ingestion of Baccharis megapotamica var. weirii occurred in the southern region of Brazil. Ten out of 50 buffalo died 24-48 hr after being introduced into a pasture containing abundant amounts of the plant. Factors influencing the ingestion of the plant and consequent toxicosis included hunger, stress caused by shipment, and unfamiliarity with the plant. Clinical signs included serous ocular discharge, incoordination, mild bloat, and muscle trembling. One buffalo was necropsied. Gross findings included dehydration, abundant liquid in the rumen, reddening of the mucosa of forestomachs, abomasum, and intestine, and edema of the wall of the rumen. The main histologic lesions were superficial to full thickness degeneration and necrosis of the stratified epithelium lining the forestomachs, necrosis of the intestinal mucosa, and widespread lymphoid necrosis. A calf (Bos taurus) was fed a single dose of 5 g/kg/body weight of B. megapotamica var. weirii harvested from the same site where the buffalo died. Twenty hours after the administration of the plant this calf died with clinical signs and lesions similar to those observed in the naturally poisoned buffalo. © 2011 The Author(s)

  9. DGA-based VAR rescheduling for transmission loss reduction

    Energy Technology Data Exchange (ETDEWEB)

    Mishra, S. [Indian Inst. of Technology, Delhi (India); Taylor, G.A. [Brunel Univ., London (United Kingdom). Brunel Inst. of Power Systems; Reddy, J.B.V. [Government of India, New Delhi (India). Dept. of Science and Technology; Naeem, M.H. [Multimedia Univ. (Malaysia). Faculty of Engineering

    2009-07-01

    Power losses in power transmission lines can be minimized by adjusting transformer taps and switchable VAR sources. Optimal power flow (OPF) is a static, nonlinear, multi-objective optimization challenge in which the optimal settings of control variables must be determined for minimizing the cost of generation, emissions, transmission losses and voltage and power flow deviations. OPF is important in power system operation because a small savings per hour can mean a large annual savings. This paper presented a method to reduce transmission power losses using a Differential Genetic Algorithm (DGA) for VAR rescheduling. The New England 39-bus power system was used as a test case. Power losses were minimized by changing the tap settings of various transformers and by varying the injected reactive power. The paper showed that certain buses in the system can improve the voltage profile and reduce transmission losses through reactive power injections from capacitor banks. In this study, minimum reactive power output of generators was maintained at zero to ensure that the generators did not draw reactive power. The DGA was shown to produce better results than the Conventional Genetic Algorithm in terms of power loss minimization. 12 refs., 1 tab., 2 figs.

  10. Parasitosis intestinales en vendedores ambulantes de comida en Ciudad Bolívar, estado Bolívar, Venezuela | Intestinal parasitosis in food handlers from ciudad Bolívar, Bolívar state, Venezuela

    Directory of Open Access Journals (Sweden)

    Ixora Requena

    2017-11-01

    Full Text Available A descriptive study was performed to determine the prevalence of intestinal parasites in a sample of apparently healthy individuals who sold food in streets in Los Proceres of Ciudad Bolívar, Bolívar State. Fecal samples were collected from 85 individuals, which were analyzed by means of direct examination, qualitative Kato, spontaneous sedimentation and Kinyoun staining. Each individual was filled a clinical epidemiological record and underwent anamnesis and oriented clinical examination. The assessed group comprised 50 women and 35 men with ages 14 to 57 years (mean 15.25 ± 4.21 years. From this group, 50 persons (58.82% were parasitized mainly by Blastocystis spp. (42.22%, Endolimax nana (11.11%, Entamoeba coli (6.67%, Giardia intestinalis (11.11%, Cryptosporidium spp. (11.11% and Cystoisospora belli (4.44%. There was no preference for gender or age (p > 0.05, and persons aged 20 to 25 years were the most affected group. Monoparasitism was observed in 56% (n = 28 cases and 44% (n = 22 of cases had other associated parasites, being the most frequent association between Blastocystis spp with Entamoeba coli and Endolimax nana. It is concluded that there is a high prevalence of intestinal parasitosis among street food handlers.

  11. The Development and Application of an Integrated VAR Process Model

    Science.gov (United States)

    Ballantyne, A. Stewart

    2016-07-01

    The VAR ingot has been the focus of several modelling efforts over the years with the result that the thermal regime in the ingot can be simulated quite realistically. Such models provide important insight into solidification of the ingot but present some significant challenges to the casual user such as a process engineer. To provide the process engineer with a tool to assist in the development of a melt practice, a comprehensive model of the complete VAR process has been developed. A radiation heat transfer simulation of the arc has been combined with electrode and ingot models to develop a platform which accepts typical operating variables (voltage, current, and gap) together with process parameters (electrode size, crucible size, orientation, water flow, etc.) as input data. The output consists of heat flow distributions and solidification parameters in the form of text, comma-separated value, and visual toolkit files. The resulting model has been used to examine the relationship between the assumed energy distribution in the arc and the actual energy flux which arrives at the ingot top surface. Utilizing heat balance information generated by the model, the effects of electrode-crucible orientation and arc gap have been explored with regard to the formation of ingot segregation defects.

  12. Physicochemical traits of Dekoko (Pisum sativum var. abyssinicum) seeds.

    Science.gov (United States)

    Yemane, Asgedom; Skjelvåg, Arne O

    2003-01-01

    Dekoko (Pisum sativum var. abyssinicum) has high appreciation for its taste and obtains a premium price in local markets compared to Ater (Pisum sativum var. sativum). However, data on the physicochemical traits of Dekoko seeds were lacking. This paper reports on the physicochemical features of Dekoko and compares the results with that of Ater. Seed weight and seed volume were 36 and 30%, respectively, higher in Ater, while water absorption, percent seed swelling, and percent husk were higher in Dekoko. Cooking time was shorter for Dekoko than Ater seeds. Decortication reduced cooking time on average by 39 and 45 min in Dekoko and Ater, respectively. Cotyledon flour of Dekoko contained 251 g crude protein, 19 g fat, 31.7 g total sugars, 370 g starch, and 130 g neutral detergent fiber per kilogram DM. These traits were significantly higher in Dekoko than in Ater, except for starch, which was higher in the latter. Arginine, asparagine, and glutamine occurred in larger proportions, and collectively contributed about 39% to the total amino acids in both varieties. Lysine contributed about 7%, while sulfur containing amino acids constituted about 3.0 and 2.3% of the total amino acids in Dekoko and Ater, respectively. Ca and Mg were higher in Ater, while P was higher in Dekoko. Based on the observations it was concluded that Dekoko is a suitable supplementary protein source for a cereal-based diet.

  13. USO DE HOJARASCA DE ROBLE y BAGAZO DE CAÑA EN LA PRODUCCIÓN DE Pleurotus ostreatus USO DA SERAPILHEIRA DE CARVALHO E BAGAÇO DA CANA NA PRODUÇÃO DO Pleurotus ostreatus USE OF THE OAK DEAD LEAVES AND SUGAR CANE BAGASSE IN THE Pleurotus ostreatus PRODUCTION

    Directory of Open Access Journals (Sweden)

    PILAR SUDIANY VARGAS

    2012-06-01

    Full Text Available Se evaluó hojarasca de roble en un relicto de bosque en la Vereda La Capilla de Cajibío (Cauca durante 6 meses, como sustrato para el crecimiento del hongo Pleurotus ostreatus, eligiendo árboles maduros con DAP entre 35 y 37 cm, obteniéndose un promedio de 7,41 kg de hojarasca por árbol. Se evaluó el crecimiento del hongo en hojarasca mezclada con bagazo de caña y 5 sustratos: T1: bagazo 100%, T2: roble 100%, T3: roble 75% y 25% de bagazo, T4: roble 50% y 50% bagazo y T5: roble 25% y 75% bagazo, logrando eficiencias biológicas de 221,1%, 44,35%, 52,78%, 90,30% y 109,12% respectivamente. Se observó relación inversa entre el contenido de hoja de roble y las eficiencias debido a la naturaleza coriácea y cerosa de la hoja. La mayoría de los carpóforos presentaron 5 a 12 cm de diámetro y contaminación causada por hongos competidores del género Trichoderma sp. Se detectaron cambios en la composición del sustrato agotado, principalmente incremento de minerales y proteínas y disminución de fibra en el bagazo de caña y en la hojarasca de roble, siendo apto para alimentación de animales poligástricos por el contenido de proteína micelial, presencia de celulosa y menor contenido de lignina.Avaliamos a produção de serapilheira em uma floresta na aldeia La Capilla de Cajibío, (Cauca, por 6 meses, como substrato para o crescimento do fungo Pleurotus ostreatus, escolhendo árvores maduras com DAP entre 35 e 37 cm, produzindo uma media de 7,41 kg de lixo por árvore. Avaliou-se o crescimento do fungo em folhas misturadas com bagaço de cana e 5 substratos: T1: bagaço de 100%, T2: carvalho de 100%, T3: carvalho 75% e 25% de bagaço, T4: carvalho 50% e bagaço 50% e T5: carvalho de 25% e 75% do bagaço, alcançando eficiências biológicas de 221,1%, 44,35%, 52,78%, 90,30% e 109,12%, respectivamente. Era uma associação inversa entre o conteúdo de folha de carvalho e eficiência devido à natureza de couro, folha waxy. A maioria dos

  14. Optimizing expression of the pregnancy malaria vaccine candidate, VAR2CSA in Pichia pastoris.

    Science.gov (United States)

    Avril, Marion; Hathaway, Marianne J; Cartwright, Megan M; Gose, Severin O; Narum, David L; Smith, Joseph D

    2009-06-29

    VAR2CSA is the main candidate for a vaccine against pregnancy-associated malaria, but vaccine development is complicated by the large size and complex disulfide bonding pattern of the protein. Recent X-ray crystallographic information suggests that domain boundaries of VAR2CSA Duffy binding-like (DBL) domains may be larger than previously predicted and include two additional cysteine residues. This study investigated whether longer constructs would improve VAR2CSA recombinant protein secretion from Pichia pastoris and if domain boundaries were applicable across different VAR2CSA alleles. VAR2CSA sequences were bioinformatically analysed to identify the predicted C11 and C12 cysteine residues at the C-termini of DBL domains and revised N- and C-termimal domain boundaries were predicted in VAR2CSA. Multiple construct boundaries were systematically evaluated for protein secretion in P. pastoris and secreted proteins were tested as immunogens. From a total of 42 different VAR2CSA constructs, 15 proteins (36%) were secreted. Longer construct boundaries, including the predicted C11 and C12 cysteine residues, generally improved expression of poorly or non-secreted domains and permitted expression of all six VAR2CSA DBL domains. However, protein secretion was still highly empiric and affected by subtle differences in domain boundaries and allelic variation between VAR2CSA sequences. Eleven of the secreted proteins were used to immunize rabbits. Antibodies reacted with CSA-binding infected erythrocytes, indicating that P. pastoris recombinant proteins possessed native protein epitopes. These findings strengthen emerging data for a revision of DBL domain boundaries in var-encoded proteins and may facilitate pregnancy malaria vaccine development.

  15. Optimizing expression of the pregnancy malaria vaccine candidate, VAR2CSA in Pichia pastoris

    Directory of Open Access Journals (Sweden)

    Narum David L

    2009-06-01

    Full Text Available Abstract Background VAR2CSA is the main candidate for a vaccine against pregnancy-associated malaria, but vaccine development is complicated by the large size and complex disulfide bonding pattern of the protein. Recent X-ray crystallographic information suggests that domain boundaries of VAR2CSA Duffy binding-like (DBL domains may be larger than previously predicted and include two additional cysteine residues. This study investigated whether longer constructs would improve VAR2CSA recombinant protein secretion from Pichia pastoris and if domain boundaries were applicable across different VAR2CSA alleles. Methods VAR2CSA sequences were bioinformatically analysed to identify the predicted C11 and C12 cysteine residues at the C-termini of DBL domains and revised N- and C-termimal domain boundaries were predicted in VAR2CSA. Multiple construct boundaries were systematically evaluated for protein secretion in P. pastoris and secreted proteins were tested as immunogens. Results From a total of 42 different VAR2CSA constructs, 15 proteins (36% were secreted. Longer construct boundaries, including the predicted C11 and C12 cysteine residues, generally improved expression of poorly or non-secreted domains and permitted expression of all six VAR2CSA DBL domains. However, protein secretion was still highly empiric and affected by subtle differences in domain boundaries and allelic variation between VAR2CSA sequences. Eleven of the secreted proteins were used to immunize rabbits. Antibodies reacted with CSA-binding infected erythrocytes, indicating that P. pastoris recombinant proteins possessed native protein epitopes. Conclusion These findings strengthen emerging data for a revision of DBL domain boundaries in var-encoded proteins and may facilitate pregnancy malaria vaccine development.

  16. [Leishmaniasis transmission focus in El Hobo, Carmen de Bolívar, Bolívar, Colombia].

    Science.gov (United States)

    Cortés, Luis Alberto

    2006-10-01

    The epidemiological characteristics and the importance of the Lutzomyia species present in a leishmaniasis focus in the village El Hobo, Carmen de Bolívar, Department of Bolivar, Colombia, are described. To obtain a preliminary assessment of leishmaniasis transmission in the village of El Hobo, Carmen de Bolívar. Epidemiological data were analyzed and sandflies were collected with CDC traps and on protected human volunteers in the village of El Hobo. Sero prevalence of canine visceral leishmaniasis in dogs was evaluated using indirect inmunofluorescence (IFAT). Nine Lutzomyia species were collected: L. trinidadensis, L. evansi, L. cayennensis, L. venezuelensis, L. gomezi, L. dubitans, L. ylephiletor, L. yuilli, and L. walkeri. The species of greater importance based on their implication in the transmission of cutaneous and visceral leishmaniasis were L. gomezi, and L. evansi respectively. Specimens of L. venezuelensis, L. dubitans, L. ylephiletor, L. yuilli, and L. walkeri are reported for the first time for the Department of Bolivar. The sero prevalence of visceral leishmaniasis in dogs was 36%. According to the epidemiological records, in 2002 the municipality of Carmen de Bolivar presented a 40% increase in cases of cutaneous leishmaniasis and an 80% increase in canine visceral leishmaniasis as compared to 2001, due to the outbreak in the village of El Hobo. The results indicate that the village of El Hobo is an area of potential risk for transmission of both cutaneous and visceral leishmaniasis.

  17. A molecular epidemiological study of var gene diversity to characterize the reservoir of Plasmodium falciparum in humans in Africa.

    Directory of Open Access Journals (Sweden)

    Donald S Chen

    2011-02-01

    Full Text Available The reservoir of Plasmodium infection in humans has traditionally been defined by blood slide positivity. This study was designed to characterize the local reservoir of infection in relation to the diverse var genes that encode the major surface antigen of Plasmodium falciparum blood stages and underlie the parasite's ability to establish chronic infection and transmit from human to mosquito.We investigated the molecular epidemiology of the var multigene family at local sites in Gabon, Senegal and Kenya which differ in parasite prevalence and transmission intensity. 1839 distinct var gene types were defined by sequencing DBLα domains in the three sites. Only 76 (4.1% var types were found in more than one population indicating spatial heterogeneity in var types across the African continent. The majority of var types appeared only once in the population sample. Non-parametric statistical estimators predict in each population at minimum five to seven thousand distinct var types. Similar diversity of var types was seen in sites with different parasite prevalences.Var population genomics provides new insights into the epidemiology of P. falciparum in Africa where malaria has never been conquered. In particular, we have described the extensive reservoir of infection in local African sites and discovered a unique var population structure that can facilitate superinfection through minimal overlap in var repertoires among parasite genomes. Our findings show that var typing as a molecular surveillance system defines the extent of genetic complexity in the reservoir of infection to complement measures of malaria prevalence. The observed small scale spatial diversity of var genes suggests that var genetics could greatly inform current malaria mapping approaches and predict complex malaria population dynamics due to the import of var types to areas where no widespread pre-existing immunity in the population exists.

  18. A Molecular Epidemiological Study of var Gene Diversity to Characterize the Reservoir of Plasmodium falciparum in Humans in Africa

    Science.gov (United States)

    Leliwa-Sytek, Aleksandra; Smith, Terry-Ann; Peterson, Ingrid; Brown, Stuart M.; Migot-Nabias, Florence; Deloron, Philippe; Kortok, Moses M.; Marsh, Kevin; Daily, Johanna P.; Ndiaye, Daouda; Sarr, Ousmane; Mboup, Souleymane; Day, Karen P.

    2011-01-01

    Background The reservoir of Plasmodium infection in humans has traditionally been defined by blood slide positivity. This study was designed to characterize the local reservoir of infection in relation to the diverse var genes that encode the major surface antigen of Plasmodium falciparum blood stages and underlie the parasite's ability to establish chronic infection and transmit from human to mosquito. Methodology/Principal Findings We investigated the molecular epidemiology of the var multigene family at local sites in Gabon, Senegal and Kenya which differ in parasite prevalence and transmission intensity. 1839 distinct var gene types were defined by sequencing DBLα domains in the three sites. Only 76 (4.1%) var types were found in more than one population indicating spatial heterogeneity in var types across the African continent. The majority of var types appeared only once in the population sample. Non-parametric statistical estimators predict in each population at minimum five to seven thousand distinct var types. Similar diversity of var types was seen in sites with different parasite prevalences. Conclusions/Significance Var population genomics provides new insights into the epidemiology of P. falciparum in Africa where malaria has never been conquered. In particular, we have described the extensive reservoir of infection in local African sites and discovered a unique var population structure that can facilitate superinfection through minimal overlap in var repertoires among parasite genomes. Our findings show that var typing as a molecular surveillance system defines the extent of genetic complexity in the reservoir of infection to complement measures of malaria prevalence. The observed small scale spatial diversity of var genes suggests that var genetics could greatly inform current malaria mapping approaches and predict complex malaria population dynamics due to the import of var types to areas where no widespread pre-existing immunity in the population

  19. A novel virus-like particle based vaccine platform displaying the placental malaria antigen VAR2CSA

    DEFF Research Database (Denmark)

    Thrane, Susan; Janitzek, Christoph M; Agerbæk, Mette Ø

    2015-01-01

    , this difference was not statistically significant after 3rd immunization. Importantly, the VLP-VAR2CSA induced antibodies were functional in inhibiting the binding of parasites to CSA. This study demonstrates that the described Avi-L1 VLP-platform may serve as a versatile system for facilitating optimal VLP......SA-VAR2CSA vaccines induced higher antibody titers than the soluble naked VAR2CSA vaccine after three immunizations. The VAR2CSA Avi-L1 VLP vaccine induced statistically significantly higher endpoint titres compared to the soluble mSA-VAR2CSA vaccine, after 1st and 2nd immunization; however...

  20. iVAR: a program for imputing missing data in multivariate time series using vector autoregressive models.

    Science.gov (United States)

    Liu, Siwei; Molenaar, Peter C M

    2014-12-01

    This article introduces iVAR, an R program for imputing missing data in multivariate time series on the basis of vector autoregressive (VAR) models. We conducted a simulation study to compare iVAR with three methods for handling missing data: listwise deletion, imputation with sample means and variances, and multiple imputation ignoring time dependency. The results showed that iVAR produces better estimates for the cross-lagged coefficients than do the other three methods. We demonstrate the use of iVAR with an empirical example of time series electrodermal activity data and discuss the advantages and limitations of the program.

  1. Análise química de corpos de frutificação de Pleurotus sajor-caju cultivado em diferentes concentrações de nitrogênio Chemical analysis of fructification bodies of Pleurotus sajor-caju cultivated in several nitrogen concentrations

    Directory of Open Access Journals (Sweden)

    Evânia Geralda Silva

    2007-03-01

    Full Text Available Os cogumelos do gênero Pleurotus normalmente crescem bem em substratos mais pobres em nitrogênio, ao contrário dos cogumelos Agaricus que requerem substratos com relação C/N mais estreita. Por outro lado, os valores nutricionais do cogumelo dependem da composição química do substrato utilizado e das condições de cultivo. Este trabalho teve como objetivo avaliar o teor de proteína dos corpos de frutificação do cogumelo Pleurotus sajor-caju cultivado em capim coast-cross, bagaço de cana-de-açúcar, farelo de trigo e diferentes teores de nitrogênio. Apenas os substratos com teores de nitrogênio de 0,65 a 1,30% foram colonizados, enquanto que nos substratos com 1,75 e 2,20% de nitrogênio não houve colonização. Não houve diferença significativa na produção de cogumelos, porém o teor de proteína dos cogumelos produzidos no substrato com 1,30% de N foi significativamente superior em relação aos substratos com menor teor de N.Mushrooms of Pleurotus genus usually grow well in substrates containing low amounts of nitrogen, whereas Agaricus mushrooms require substrates with a high content of nitrogen. On the other hand, the nutritional values of mushrooms depend on the chemical composition of the substrate in use and the conditions of cultivation. The aim of this work is to measure the protein content of the fructification bodies of Pleurotus sajor-caju cultivated in coast-cross grass, sugar cane bagasse, whole wheat meal and various nitrogen concentrations. Only the substrates with nitrogen content ranging from 0.65 to 1.30% were colonized, while in the substrates with 1.75 and 2.20% of nitrogen, colonization did not occur. There was no significant difference in the production of mushrooms, however the protein content of the mushrooms produced on the substrate with 1.30% of N was considerably higher in relation to those mushrooms grown in substrates with a reduced nitrogen content.

  2. Anti-adipogenic effects of extracts of Ficus deltoidea var. deltoidea and var. angustifolia on 3T3-L1 adipocytes.

    Science.gov (United States)

    Woon, Shiau Mei; Seng, Yew Wei; Ling, Anna Pick Kiong; Chye, Soi Moi; Koh, Rhun Yian

    2014-03-01

    This study examined the anti-adipogenic effects of extracts of Ficus deltoidea var. deltoidia and var. angustifolia, a natural slimming aid, on 3T3-L1 adipocytes. Methanol and water extracts of leaves of the F. deltoidea varieties were analyzed to determine their total flavonoid content (TFC) and total phenolic content (TPC), respectively. The study was initiated by determining the maximum non-toxic dose (MNTD) of the methanol and water extracts for 3T3-L1 preadipocytes. Possible anti-adipogenic effects were then examined by treating 2-d post confluent 3T3-L1 preadipocytes with either methanol extract or water extract at MNTD and half MNTD (½MNTD), after which the preadipocytces were induced to form mature adipocytes. Visualisation and quantification of lipid content in mature adipocytes were carried out through oil red O staining and measurement of optical density (OD) at 520 nm, respectively. The TFCs of the methanol extracts were 1.36 and 1.97 g quercetin equivalents (QE)/100 g dry weight (DW), while the TPCs of the water extracts were 5.61 and 2.73 g gallic acid equivalents (GAE)/100 g DW for var. deltoidea and var. angustilofia, respectively. The MNTDs determined for methanol and water extracts were (300.0 ± 28.3) and (225.0 ± 21.2) µg/ml, respectively, for var. deltoidea, while much lower MNTDs [(60.0 ± 2.0) µg/ml for methanol extracts and (8.0 ± 1.0) µg/ml for water extracts] were recorded for var. angustifolia. Studies revealed that the methanol extracts of both varieties and the water extracts of var. angustifolia at either MNTD or ½MNTD significantly inhibited the maturation of preadipocytes. The inhibition of the formation of mature adipocytes indicated that leaf extracts of F. deltoidea could have potential anti-obesity effects.

  3. A hybrid PSO technique for procuring VAR ancillary service in the deregulated electricity markets

    Energy Technology Data Exchange (ETDEWEB)

    El-Araby, E.E. [Department of Electrical Engineering, Suez Canal University (Egypt); Yorino, Naoto [Department of Artificial Complex Systems Engineering, Hiroshima University (Japan)

    2010-07-15

    This paper develops a new market-based technique for acquiring VAR ancillary service in the electricity market. The main objective of the developed market is to enable transmission operator ''TO'' to procure VAR service in a long term contract from the critical VAR providers that satisfy minimum VAR service payment while maintaining system security. Reactive power control problem for voltage stability is introduced into the VAR market problem in an explicit manner for normal and emergency states. An integration of particle swarm optimization ''PSO'' is presented with successive linear programming ''SLP'' for dealing with the VAR ancillary service problem. The problem is formulated as a large-scale nonlinear constrained optimization problem with a non-differentiable objective function representing VAR payment and operational costs. This type of problem is hard to be treated straightforwardly by the classical optimization methods. Therefore, we propose here a two-layer hybrid PSO/SLP approach, which is suited for carrying out the difficulties associated with non-differentiable and discontinuous objective functions. The proposed method has been examined on the standard IEEE 57 bus-system and compared with GA/SLP method to demonstrate its capability. (author)

  4. [Correlation between distribution of rhizospheric microorganisms and contents of steroidal saponins of Paris polyphylla var. yunnanensis].

    Science.gov (United States)

    Zhou, Nong; Qi, Wen-hua; Xiao, Guo-sheng; Ding, Bo; Zhang, Hua; Guo, Dong-qin; Shen, Wei

    2015-03-01

    In this paper, the varying pattern of the amount of rhizospheric microorganisms, including bacteria, actinomycetes and fungus, was observed during the cultivation of Paris polyphylla var. yunnanensis. And the correlations between number of rhizospheric microorganisms and the quality of P. polyphylla var. yunnanensis were also studied. The results showed that the rhizospheric microorganism source of P. polyphylla var. yunnanensis was rich. The distribution of rhizospheric microorganisms (soil bacteria, fungus, actinomycetes, potassium-solubilizing bacteria, inorganic phosphorus-solubilizing bacteria, organic phosphorus-solubilizing bacteria) collected from different origin places existed significant difference (P the amount of actinomycetes > the amount of fungus. The medicinal quality of P. polyphylla var. yunnanensis was influenced by their habits, and the increase of cultivation years caused the obvious decrease of the quality of P. polyphylla var. yunnanensis. Therefore, the increase of cultivation years will cause the variation of the soil micro-ecology flora, and decrease the nutrient absorption and the utilization of P. polyphylla var. yunnanensis, which will make the decrease of the medical quality of P. polyphylla var. yunnanensis.

  5. [Autotoxicity of aqueous extracts from plant of cultivated Astragalus membranaceus var. mongholicus].

    Science.gov (United States)

    Zhang, Xin-Hui; Lang, Duo-Yong; Chen, Jing; Zhao, Yun-Sheng; Wu, Xiu-Li; Fu, Xue-Yan

    2014-02-01

    To exploring the relationship between continuous cropping obstacle and autotoxicity of Astragalus membranaceus var. mongholicus, autotoxic effect of plant aqueous extract were determined. Distilled water (CK), aqueous extract of plant, including root, stem and leaf (12.5, 25, 50 and 100 mg/mL respectively)were applied to testing their effect on early growth of Astragalus membranaceus var. mongholicus. Specifically, seed germination rate, germination index, emergence rate, elongation of radical and embryo, and seedling vigor index were determined. The aqueous extract of root, stem, and leaf at 25 mg/mL significantly inhibited the seed germination and seedling growth of Astragalus membranaceus var. mongholicus, and this inhibitory effect generally increased with the increase of the concentration of aqueous extracts. To the comprehensive allelopathic effect, the extracts from Astragalus membranaceus var. mongholicus stem were more inhibitory than those from leaf and root. The germination index and seedling vigor index were more sensitive to extract than other determined parameters. Aqueous extracts from Astragalus membranaceus var. mongholicus plant gave inhibitory effects on Astragalus. membranaceus var. mongholicus germination and seedling growth, and this inhibitory effect generally increased with the increases of aqueous extract concentration at a certain ranges. In conclusion, there is an autotoxicity in continuous cropping of Astragalus membranaceus var. mongholicus.

  6. Phosphorylation of SU(VAR3-9 by the chromosomal kinase JIL-1.

    Directory of Open Access Journals (Sweden)

    Joern Boeke

    2010-04-01

    Full Text Available The histone methyltransferase SU(VAR3-9 plays an important role in the formation of heterochromatin within the eukaryotic nucleus. Several studies have shown that the formation of condensed chromatin is highly regulated during development, suggesting that SU(VAR3-9's activity is regulated as well. However, no mechanism by which this may be achieved has been reported so far. As we and others had shown previously that the N-terminus of SU(VAR3-9 plays an important role for its activity, we purified interaction partners from Drosophila embryo nuclear extract using as bait a GST fusion protein containing the SU(VAR3-9 N-terminus. Among several other proteins known to bind Su(VAR3-9 we isolated the chromosomal kinase JIL-1 as a strong interactor. We show that SU(VAR3-9 is a substrate for JIL-1 in vitro as well as in vivo and map the site of phosphorylation. These findings may provide a molecular explanation for the observed genetic interaction between SU(VAR3-9 and JIL-1.

  7. Nutritional and neutraceutical composition of five wild culinary-medicinal species of genus Pleurotus (higher Basidiomycetes) from northwest India.

    Science.gov (United States)

    Atri, N; Sharma, Sapan Kumar; Joshi, Robin; Gulati, Ashu; Gulati, Arvind

    2013-01-01

    Five wild culinary-medicinal species of genus Pleurotus (Fr.) P. Kumm. (P. floridanus Singer, P. pulmonarius (Fr.) Quél., P. sapidus Quél., P. cystidiosus O.K. Miller, and P. sajor-caju (Fr.) Singer), collected from different localities of Northwest India, were studied for their nutritional and nutraceutical composition. Composition analysis of nutrients involved determining proteins, fats, ash, fiber, and carbohydrates using standard biochemical techniques. Minerals were estimated by an atomic absorption spectrophotometer and toxic metals were determined by the Reinsch test method. The analysis of nutraceuticals included determination of sugars by high-performance liquid chromatography, fatty acids by gas chromatography, and antioxidants such as β-carotene, lycopene, and total phenolic compounds with methanolic extract using a colorimetric assay. In the samples analyzed, carbohydrates dominated over protein and other macronutrients. Carbohydrates ranged from 85.86 to 88.38%, protein 0.98 to 2.17%, crude fat 0.62 to 0.84%, crude fibers 2.76 to 3.12%, and ash content 1.03 to 2.20%. Macro- and microminerals (calcium, magnesium, sodium, potassium, copper, zinc, and iron) also were found in substantial amount, whereas toxic metals (lead, silver, arsenic, mercury, and antimony) were not detected. Three main sugars-sucrose (0.338-2.011%), glucose (0.553-0.791%), and xylose (0.01%)-were detected. Among fatty acids, monounsaturated fatty (37.17-68.29%) acids were documented in a higher proportion than saturated fatty acids (26.07-47.77%). In terms of antioxidant composition, all species contained ascorbic acid, phenols, carotene, and lycopene. Ascorbic acid content ranged from 0.46 to 0.49 mg/100 g, total phenolic compounds ranged from 6.76 to 16.92 mg/100 g of gallic acid, β-carotene ranged from 0.134 to 0.221 μg/100 g, and lycopene from 0.055 to 0 .075 μg/100 g.

  8. Pleurotus giganteus (Berk.) Karunarathna & K.D. Hyde: Nutritional value and in vitro neurite outgrowth activity in rat pheochromocytoma cells.

    Science.gov (United States)

    Phan, Chia-Wei; Wong, Wei-Lun; David, Pamela; Naidu, Murali; Sabaratnam, Vikineswary

    2012-07-19

    Drugs dedicated to alleviate neurodegenerative diseases like Parkinson's and Alzheimer's have always been associated with debilitating side effects. Medicinal mushrooms which harness neuropharmacological compounds offer a potential possibility for protection against such diseases. Pleurotus giganteus (formerly known as Panus giganteus) has been consumed by the indigenous people in Peninsular Malaysia for many years. Domestication of this wild mushroom is gaining popularity but to our knowledge, medicinal properties reported for this culinary mushroom are minimal. The fruiting bodies P. giganteus were analysed for its nutritional values. Cytotoxicity of the mushroom's aqueous and ethanolic extracts towards PC12, a rat pheochromocytoma cell line was assessed by using 3-[4,5-dimethythiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) assay. Neurite outgrowth stimulation assay was carried out with nerve growth factor (NGF) as control. To elucidate signaling mechanisms involved by mushroom extract-induced neurite outgrowth, treatment of specific inhibitor for MEK/ERK and PI3K signalling pathway was carried out. The fruiting bodies of P. giganteus were found to have high carbohydrate, dietary fibre, potassium, phenolic compounds and triterpenoids. Both aqueous and ethanolic extracts induced neurite outgrowth of PC12 cells in a dose- and time-dependant manner with no detectable cytotoxic effect. At day 3, 25 μg/ml of aqueous extract and 15 μg/ml of ethanolic extract showed the highest percentage of neurite-bearing cells, i.e. 31.7 ± 1.1% and 33.3 ± 0.9%; respectively. Inhibition treatment results suggested that MEK/ERK and PI3K/Akt are responsible for neurite outgrowth of PC12 cells stimulated by P. giganteus extract. The high potassium content (1345.7 mg/100 g) may be responsible for promoting neurite extension, too. P. giganteus contains bioactive compounds that mimic NGF and are responsible for neurite stimulation. Hence, this mushroom may be

  9. Sporozoite Route of Infection Influences In Vitro var Gene Transcription of Plasmodium falciparum Parasites From Controlled Human Infections.

    Science.gov (United States)

    Dimonte, Sandra; Bruske, Ellen I; Hass, Johanna; Supan, Christian; Salazar, Carmen L; Held, Jana; Tschan, Serena; Esen, Meral; Flötenmeyer, Matthias; Koch, Iris; Berger, Jürgen; Bachmann, Anna; Sim, Betty K L; Hoffman, Stephen L; Kremsner, Peter G; Mordmüller, Benjamin; Frank, Matthias

    2016-09-15

    Antigenic variation in Plasmodium falciparum is mediated by the multicopy var gene family. Each parasite possesses about 60 var genes, and switching between active var loci results in antigenic variation. In the current study, the effect of mosquito and host passage on in vitro var gene transcription was investigated. Thirty malaria-naive individuals were inoculated by intradermal or intravenous injection with cryopreserved, isogenic NF54 P. falciparum sporozoites (PfSPZ) generated from 1 premosquito culture. Microscopic parasitemia developed in 22 individuals, and 21 in vitro cultures were established. The var gene transcript levels were determined in early and late postpatient cultures and in the premosquito culture. At the early time point, all cultures preferentially transcribed 8 subtelomeric var genes. Intradermal infections had higher var gene transcript levels than intravenous infections and a significantly longer intrahost replication time (P = .03). At the late time point, 9 subtelomeric and 8 central var genes were transcribed at the same levels in almost all cultures. Premosquito and late postpatient cultures transcribed the same subtelomeric and central var genes, except for var2csa  The duration of intrahost replication influences in vitro var gene transcript patterns. Differences between premosquito and postpatient cultures decrease with prolonged in vitro growth. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  10. Cultivation of Pleurotus sajor-caju on banana stalk and Bahia grass based substrates Cultivo de Pleurotus sajor-caju em substratos a base de grama batatais e engaço de bananeira

    Directory of Open Access Journals (Sweden)

    Félix G de Siqueira

    2011-06-01

    Full Text Available Banana stalks and Bahia grass were utilized as basic starting materials for the production of the mushroom Pleurotus sajor-caju. Banana stalks were combined with other waste or supplement products (wheat bran, coast-cross hay, bean straw and cotton textile mill to obtain different nitrogen concentrations. Since Bahia grass is relatively rich in protein, it was combined with other substrates (banana stalk, coast-cross hay and bean straw to maintain a substrate nitrogen concentration of about 1.5%. Banana stalks and Bahia grass were both more efficient in the production of the mushroom P. sajor-caju when utilized without the addition of other substrates, with biological efficiencies of 74.4% and 74.12%, respectively. When combined with other substrates or grasses, there was a drop in biological efficiency, independent of the concentration of nitrogen. Furthermore, the addition of protein-rich waste to banana stalks resulted in a decrease or absence of fructification, which indicates that high concentrations of nitrogen in the cultivation substrate may hinder the cultivation of this mushroom. On the other hand, results reveal that the ideal concentration of nitrogen may depend on other physicochemical factors and these factors may determine the success in cultivating P. sajor-caju. Therefore, we conclude that P. sajor-caju may be cultivated on banana stalk and Bahia grass as pure substrates, not being necessary their supplementation or combine them with another substrates.O engaço de bananeira e a grama batatais foram utilizados como matérias-primas básicas para a produção do substrato de cultivo do cogumelo Pleurotus sajor-caju. O engaço de bananeira foi combinado com outros resíduos (farelo de trigo, capim "Coast-cross", palha de feijão e resíduo de lixadeira de algodão, com o objetivo de se obter substratos com diferentes concentrações de nitrogênio. Como a grama batatais é relativamente rica em proteína, a mesma foi combinada com

  11. Substratum formulation for laccase and mycelial biomass production of Pleurotus ostreatusFormulação de substratos na produção de biomassa micelial e de lacase de Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Juliana Silveira do Valle

    2012-10-01

    Full Text Available Pleurotus ostreatus is a producer of biomass and laccase, an enzyme used in fermentation processes for the hydrolysis of lignocellulosic substrate, with potential use in biofuel production and animal feed. Thus, there is a need to seek more appropriate regional substrate for the production of mycelial biomass and laccase. Hence, the aim of this study was to evaluate the effect of physical and chemical characteristics of agro-industrial byproducts in a substratum formulation for the mycelial growth and laccase production by P. ostreatus. The experiment was conducted with the milled raw materials: soy fiber, wheat bran, rice bran, corn grain and corn cob that were separated according to size and analyzed for carbon/nitrogen (C/N ratio. Mycelial growth was evaluated on substratum in cylindrical tubes of borosilicate. Then laccase production was assessed using a 26-2 fractional factorial design with the variables: raw material granulometry and addition of minerals (copper, zinc, iron, cadmium and magnesium in the substrate. The production of laccase was determined by oxidation of ABTS (2,2’-bisazin-(3-ethylbenzothiazoline-6-sulfonic acid. The results indicate that the most important factor for mycelial growth is the holding capacity of oxygen in the substratum. For mycelial growth of P. ostreatus the corn cob and wheat bran are the best components for the substrate. The other raw materials reduced the mycelial growth. However the most important factor for the induction of laccase production is the reduction of particle size, increasing the contact area between the mycelium and the substratum. Pleurotus ostreatus é um produtor de biomassa e lacase, enzima utilizada em processos fermentativos para a hidrólise de substratos lignocelulósicos, com potencial de utilização na produção de biocombustíveis e na alimentação animal. Desta forma, há a necessidade de buscar substratos regionais mais apropriados para a produção de biomassa micelial

  12. Cloning of the Repertoire of Individual Plasmodium falciparum var Genes Using Transformation Associated Recombination (TAR)

    Science.gov (United States)

    Schmid, Christoph D.; Bühlmann, Tobias; Louis, Edward J.; Beck, Hans-Peter

    2011-01-01

    One of the major virulence factors of the malaria causing parasite is the Plasmodium falciparum encoded erythrocyte membrane protein 1 (PfEMP1). It is translocated to It the membrane of infected erythrocytes and expressed from approximately 60 var genes in a mutually exclusive manner. Switching of var genes allows the parasite to alter functional and antigenic properties of infected erythrocytes, to escape the immune defense and to establish chronic infections. We have developed an efficient method for isolating VAR genes from telomeric and other genome locations by adapting transformation-associated recombination (TAR) cloning, which can then be analyzed and sequenced. For this purpose, three plasmids each containing a homologous sequence representing the upstream regions of the group A, B, and C var genes and a sequence homologous to the conserved acidic terminal segment (ATS) of var genes were generated. Co-transfection with P. falciparum strain ITG2F6 genomic DNA in yeast cells yielded 200 TAR clones. The relative frequencies of clones from each group were not biased. Clones were screened by PCR, as well as Southern blotting, which revealed clones missed by PCR due to sequence mismatches with the primers. Selected clones were transformed into E. coli and further analyzed by RFLP and end sequencing. Physical analysis of 36 clones revealed 27 distinct types potentially representing 50% of the var gene repertoire. Three clones were selected for sequencing and assembled into single var gene containing contigs. This study demonstrates that it is possible to rapidly obtain the repertoire of var genes from P. falciparum within a single set of cloning experiments. This technique can be applied to individual isolates which will provide a detailed picture of the diversity of var genes in the field. This is a powerful tool to overcome the obstacles with cloning and assembly of multi-gene families by simultaneously cloning each member. PMID:21408186

  13. Tillers induction in Bactris gasipaes var. gasipaes seedlings

    Directory of Open Access Journals (Sweden)

    Ernani Augusto Ochekoski Mossanek

    2014-04-01

    Full Text Available Bactris gasipaes produces heart-of-palm. Peach palm is a perennial crop that has a tillering capacity, being an alternative to illegal extraction. There is a lack of studies about vegetative propagation technics for this species. The present study aimed to analyze different tillering induction methods in Bactris gasipaes var. gasipaes seedlings in four different seasons. The treatments were: 1 stem bending; 2 stem bending and application of 150 mg kg-1 of benzylaminopurine; 3 stem bending and application of 150 mg kg-1 of gibberellic acid and; 4 stem girdling. The experimental design was random with 4 replicates of 20 plants per treatment. Anatomical analyses were conducted at the stem, and the tillering and mortality of the treated plants were evaluated. It was possible to identify the stem tissues and the meristematic apex site by anatomical analysis. The stem bending treatments were inefficient; but girdling presented potential as tillers inducer.

  14. BASIC ANATOMICAL PROPERTIES of Ammannia auriculata var. arenaria (LYTHRACEAE

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2016-12-01

    Full Text Available This study was performed in order to define some anatomical characteristics of Ammannia auriculata Willd. var. arenaria (Kunth Koehne (Lythraceae to ensure a proper identification of the species and prevent confusion with other plants. Roots, leaves and stems of the plants were fixed in Formalin-Aceto-Alcohol (FAA, stained with various dyes, examined under a microscope and their photos were taken. The microscopic investigations of the plant parts revealed that 1 the leaf anatomy showed partly mezophyte character, the stem and roots beared aquatic characters with a wide aeranchymatic cortex and 2 thick lignified secondary xylem tissue in the roots and stems were located outwards of the stele. The results were compared with those of similar studies.

  15. Intraspecific Variation in Carotenoids of Brassica oleracea var. sabellica.

    Science.gov (United States)

    Mageney, Vera; Baldermann, Susanne; Albach, Dirk C

    2016-04-27

    Carotenoids are best known as a source of natural antioxidants. Physiologically, carotenoids are part of the photoprotection in plants as they act as scavengers of reactive oxygen species (ROS). An important source of carotenoids in European food is Brassica oleracea. Focusing on the most abundant carotenoids, we estimated the contents of ß-carotene, (9Z)-neoxanthin, zeaxanthin, and lutein as well as those of chlorophylls a and b to assess their variability in Brassica oleracea var. sabellica. Our analyses included more than 30 cultivars categorized in five distinct sets grouped according to morphological characteristics or geographical origin. Our results demonstrated specific carotenoid patterns characteristic for American, Italian, and red-colored kale cultivars. Moreover, we demonstrated a tendency of high zeaxanthin proportions under traditional harvest conditions, which accord to low-temperature regimes. We also compared the carotenoid patterns of self-generated hybrid lines. Corresponding findings indicated that crossbreeding has a high potential for carotenoid content optimization in kale.

  16. Citogenética de Guazuma ulmifolia var. Ulmifolia (Sterculiaceae

    Directory of Open Access Journals (Sweden)

    Fernando Tapia-Pastrana

    2007-01-01

    Full Text Available Se utilizó una metodología de extendido en superficie y secado al aire para obtener por vez primera el cariotipo somático de una población de Guazuma ulmifolia var. ulmifolia. El número cromosómico diploide 2n = 16 obtenido a partir de meristemos radiculares confirma recuentos anteriores. La fórmula cariotípica fue 14m + 2st con una ligera asimetría (T.F.% = 42,19. La longitud cromosómica total haploide fue de 11,65 µm con un intervalo cromosómico de 1,11 - 2,05 µm. Los organizadores nucleolares asociados a constricciones secundarias ubicados en el par 3 (m y el polimorfismo que exhibe el par 8 (st pueden ser empleados como marcadores citogenéticos en futuros estudios de otras especies y variedades del género.

  17. Effects of ionizing radiation on Capsicum baccatum var. pendulum (Solanaceae)

    International Nuclear Information System (INIS)

    Scaldaferro, M.A.; Prina, A.R.; Moscone, E.A.; Kwasniewska, J.

    2013-01-01

    Cytogenetic and somatic effects of various x-ray treatments were evaluated in pepper, Capsicum baccatum var. pendulum cv. “Cayenne”, with the aim to assess optimal conditions for obtaining viable lines. The cytogenetic effects were quantified by counting chromosome aberrations. The level of DNA fragmentation was estimated with TUNEL test (terminal transferase mediated dUTP-fluorescein nick end labeling). Irradiation to 20 Gy with 16-h presoaking can be a suitable treatment of the selected pepper cultivar for a mutagenesis program. - Highlights: • Cytogenetic and somatic effects of x-rays treatments in Capsicum were evaluated. • Frequencies of chromosome aberrations correlated with radiation doses. • Highest frequency of chromosome aberrations occurred with 20 Gy+soaking seeds. • In TUNEL test, the nuclei with DNA fragmentation were higher than in the control. • The strongest effects were observed with doses of 300 Gy or 20 Gy after soaking

  18. Forecasting Macedonian Business Cycle Turning Points Using Qual Var Model

    Directory of Open Access Journals (Sweden)

    Petrovska Magdalena

    2016-09-01

    Full Text Available This paper aims at assessing the usefulness of leading indicators in business cycle research and forecast. Initially we test the predictive power of the economic sentiment indicator (ESI within a static probit model as a leading indicator, commonly perceived to be able to provide a reliable summary of the current economic conditions. We further proceed analyzing how well an extended set of indicators performs in forecasting turning points of the Macedonian business cycle by employing the Qual VAR approach of Dueker (2005. In continuation, we evaluate the quality of the selected indicators in pseudo-out-of-sample context. The results show that the use of survey-based indicators as a complement to macroeconomic data work satisfactory well in capturing the business cycle developments in Macedonia.

  19. Controlling pool depth during VAR of Alloy 718

    Science.gov (United States)

    Lopez, F.; Beaman, J.; Williamson, R.; Evans, D.

    2016-07-01

    A longtime goal of superalloy producers has been to control the geometry of the liquid pool in solidifying ingots. Accurate pool depth control at appropriate values is expected to result in ingots free of segregation defects. This article describes an industrial VAR experiment in which a 430mm (17 in) diameter Alloy 718 electrode was melted into a 510mm (20 in) ingot. In the experiment, the depth of the liquid pool at the mid-radius was controlled to three different set-points: 137 mm (nominal), 193 mm (deep) and 118 mm (shallow). At each level, the pool depth was marked by a power cutback of several minutes. The ingot was sectioned and longitudinal slices were cut out. Analysis of the photographed ingot revealed that accurate control was obtained for both the nominal and deep pool cases, while the third one was not conclusive.

  20. Solidification Mapping of a Nickel Alloy 718 Laboratory VAR Ingot

    Science.gov (United States)

    Watt, Trevor J.; Taleff, Eric M.; Lopez, Felipe; Beaman, Joe; Williamson, Rodney

    The solidification microstructure of a laboratory-scale Nickel alloy 718 vacuum arc remelted (VAR) ingot was analyzed. The cylindrical, 210-mm-diameter ingot was sectioned along a plane bisecting it length-wise, and this mid-plane surface was ground and etched using Canada's reagent to reveal segregation contrast. Over 350 photographs were taken of the etched mid-plane surface and stitched together to form a single mosaic image. Image data in the resulting mosaic were processed using a variety of algorithms to extract quantities such as primary dendrite orientation, primary dendrite arm spacing (PDAS), and secondary dendrite arm spacing (SDAS) as a function of location. These quantities were used to calculate pool shape and solidification rate during solidification using existing empirical relationships for Nickel Alloy 718. The details and outcomes of this approach, along with the resulting comparison to experimental processing conditions and computational models, are presented.

  1. Evaluación del crecimiento y producción de biomasa de dos cepas del género Pleurotus spp., cultivadas en un medio agar con diferentes sustratos

    Directory of Open Access Journals (Sweden)

    Carol Daniela Coello-Loor

    2017-12-01

    Full Text Available La velocidad de crecimiento radial (VCR (mm.h-1 y la producción de biomasa (PB (g.g-1 de sustrato seco son técnicas que puedan establecer el grado de adaptación y desarrollo de los hongos del género Pleurotus spp., a distintos sustratos que podrían emplearse en una fermentación en medio sólido. Las especies fueron Pleurotus sapidus (Ps y Pleurotus ostreatus IE8 (Po. El medio de cultivo sintético empleado fue el papa dextrosa agar (PDA, con un pH que va de 5.6 a 5.9, ideal para el crecimiento de hongos, tiene todos los componentes nutritivos, y ligera acidez que logran la inhibición del desarrollo de bacterias; diluido en 4 diferentes soluciones preparadas con los materiales residuales (solución cascarilla de arroz CaPDA, solución cáscara de maracuyá CmPDA, solución mezcla 50% Cascarilla de arroz+50% Cáscara de maracuyá CaCmPDA y agua destilada+PDA con el propósito de observar el crecimiento radial cada 24 horas y la producción de biomasa fúngica de estos hongos lignocelulósicos por su periodo de incubación y la adaptación a nivel in vitro. Los tratamientos que presentaron mejor comportamiento VCR fueron el PoCaPDA (0.569 y el PoCaCmPDA (0.549; la cepa que reporto valores más altos en VCR y PB fue el Pleurotus ostreatus y el mejor medio de cultivo fue el CaPDA, en ambas variables; mientras, la mayor producción de biomasa fue en Pleurotus sapidus en CaPDA (0.1727 y el Pleurotus ostreatus IE8 en CmPDA (0.1722, CaPDA (0.1706 y PDA (0.1694.

  2. Aberrant meiotic behavior in Agave tequilana Weber var. azul.

    Science.gov (United States)

    Ruvalcaba-Ruiz, Domingo; Rodríguez-Garay, Benjamin

    2002-10-23

    Agave tequilana Weber var. azul, is the only one variety permitted by federal law in México to be used for tequila production which is the most popular contemporary alcoholic beverage made from agave and recognized worldwide. Despite the economic, genetic, and ornamental value of the plant, it has not been subjected to detailed cytogenetic research, which could lead to a better understanding of its reproduction for future genetic improvement. The objective of this work was to study the meiotic behavior in pollen mother cells and its implications on the pollen viability in Agave tequilana Weber var. azul. The analysis of Pollen Mother Cells in anaphase I (A-I) showed 82.56% of cells with a normal anaphase and, 17.44% with an irregular anaphase. In which 5.28% corresponded to cells with side arm bridges (SAB); 3.68% cells with one bridge and one fragment; 2.58% of irregular anaphase showed cells with one or two lagging chromosomes and 2.95% showed one acentric fragment; cells with two bridges and cells with two bridges and one acentric fragment were observed in frequencies of 1.60% and 1.35% respectively. In anaphase II some cells showed bridges and fragments too. Aberrant A-I cells had many shrunken or empty pollen grains (42.00%) and 58.00 % viable pollen. The observed meiotic irregularities suggest that structural chromosome aberrations have occurred, such as heterozygous inversions, sister chromatid exchanges, deletions and duplications which in turn are reflected in a low pollen viability.

  3. Aberrant meiotic behavior in Agave tequilana Weber var. azul

    Directory of Open Access Journals (Sweden)

    Rodríguez-Garay Benjamin

    2002-10-01

    Full Text Available Abstract Background Agave tequilana Weber var. azul, is the only one variety permitted by federal law in México to be used for tequila production which is the most popular contemporary alcoholic beverage made from agave and recognized worldwide. Despite the economic, genetic, and ornamental value of the plant, it has not been subjected to detailed cytogenetic research, which could lead to a better understanding of its reproduction for future genetic improvement. The objective of this work was to study the meiotic behavior in pollen mother cells and its implications on the pollen viability in Agave tequilana Weber var. azul. Results The analysis of Pollen Mother Cells in anaphase I (A-I showed 82.56% of cells with a normal anaphase and, 17.44% with an irregular anaphase. In which 5.28% corresponded to cells with side arm bridges (SAB; 3.68% cells with one bridge and one fragment; 2.58% of irregular anaphase showed cells with one or two lagging chromosomes and 2.95% showed one acentric fragment; cells with two bridges and cells with two bridges and one acentric fragment were observed in frequencies of 1.60% and 1.35% respectively. In anaphase II some cells showed bridges and fragments too. Aberrant A-I cells had many shrunken or empty pollen grains (42.00% and 58.00 % viable pollen. Conclusion The observed meiotic irregularities suggest that structural chromosome aberrations have occurred, such as heterozygous inversions, sister chromatid exchanges, deletions and duplications which in turn are reflected in a low pollen viability.

  4. Positive selection of Plasmodium falciparum parasites with multiple var2csa-type PfEMP1 genes during the course of infection in pregnant women

    DEFF Research Database (Denmark)

    Sander, Adam F; Salanti, Ali; Lavstsen, Thomas

    2011-01-01

    multiple genes coding for different VAR2CSA proteins, and parasites with >1 var2csa gene appear to be more common in pregnant women with placental malaria than in nonpregnant individuals. We present evidence that, in pregnant women, parasites containing multiple var2csa-type genes possess a selective...... advantage over parasites with a single var2csa gene. Accumulation of parasites with multiple copies of the var2csa gene during the course of pregnancy was also correlated with the development of antibodies involved in blocking VAR2CSA adhesion. The data suggest that multiplicity of var2csa-type genes...

  5. Occurrence of pathotypes of Phoma medicaginis var. pinodella (Jones Boerema in the Olsztyn district

    Directory of Open Access Journals (Sweden)

    Helena Furgał-Węgrzycka

    2013-12-01

    Full Text Available The causal agents of leaves and pods spot-pot of peas and field peas in the Olsztyn district was the fungus Phoma medicaginis var. pinodella. Investigated isolates of P. medicaginis var. pinodella differed by macroscopic and microscopic features. From diseases leaves and pods of peas and field peas obtained also saprophytic fungi among which Alternaria alternata, Botrytis cinerea, Cladosporium cladosporioides, Epicoccum purpurascens, Stemphylium botryosum, Sordaria fimicola and mycelia sterilia were dominated. In the study on the identification and distribution of pathotypes of P. medicaginis var. pinodella six pathotypes were identified among which pathotype 3 were dominated. The identified pathotypes differed by macroscopic and microscopic features.

  6. Application of superconducting coils to VAR control in electric power systems: a proposal

    International Nuclear Information System (INIS)

    Boenig, H.J.; Hassenzahl, W.V.

    1979-11-01

    During the last eight years, static VAR-control systems with thyristor-controlled, room-temperature reactors have been used in electrical systems for voltage control and system stabilization. In this proposal, we describe a new static VAR-control system that uses an asymmetrically controlled Graetz bridge and a superconducting dc coil. Preliminary studies indicate that the proposed system will have lower overall losses and that its capital cost and electrical characteristics are comparable to those of a conventional system. Three- and four-year programs for developing the electronic circuitry and superconducting coils for VAR control, culminating in the installation and testing of an approx. 40-MVAR system, are proposed

  7. Evidence for in vitro and in vivo expression of the conserved VAR3 (type 3) plasmodium falciparum erythrocyte membrane protein 1

    DEFF Research Database (Denmark)

    Wang, Christian W; Lavstsen, Thomas; Bengtsson, Dominique C

    2012-01-01

    ABSTRACT: BACKGROUND: Members of the Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) adhesion antigen family are major contributors to the pathogenesis of P. falciparum malaria infections. The PfEMP1-encoding var genes are among the most diverse sequences in nature, but three genes......, var1, var2csa and var3 are found conserved in most parasite genomes. The most severe forms of malaria disease are caused by parasites expressing a subset of antigenically conserved PfEMP1 variants. Thus the ubiquitous and conserved VAR3 PfEMP1 is of particular interest to the research field. Evidence...... of VAR3 expression on the infected erythrocyte surface has never been presented, and var3 genes have been proposed to be transcribed and expressed differently from the rest of the var gene family members. METHODS: In this study, parasites expressing VAR3 PfEMP1 were generated using anti-VAR3 antibodies...

  8. Genetic analisys of a cross of gaillon (Brassica oleracea var. alboglabra with cauliflower (B.oleracea var. botrytis

    Directory of Open Access Journals (Sweden)

    Vanessa B.M.G. Spini

    2000-03-01

    Full Text Available The cauliflower (Brassica oleracea var. botrytis is an annual vegetable cultivated in Southern and Southwestern Brazil with limited production in the Northeast and Centralwest. A variety of Chinese kale, "kaai laan" or "gaillon" (Brassica oleracea var. alboglabra, produces seeds at high temperatures and therefore can do so in North and Northeastern Brazil. Gaillon and cauliflower were crossed 55 times using 10 gaillon plants as mothers and 4 cauliflower plants as pollen donors. From these crosses, in the F2 generation, 612 plants with inflorescence like gaillon and 48 plants with inflorescence like cauliflower were obtained, in a proportion similar to 15:1, implying that 2 pairs of genes entered into formation of the cauliflower inflorescence type. In order to study flower color, 339 plants were analyzed: 274 presented white flowers and 65, yellow flowers, denoting that this caracter is determined by 1 pair of genes, white being dominant over yellow; white flowers had a slighly higher adaptive value in our population. The characteristic waxy leaf showed a proportion of 3 waxy plants for 1 not waxy, indicating the action of one pair of genes.A couve-flor (Brassica oleracea var. botrytis é um vegetal anual e tem seu cultivo no Brasil limitado às regiões Sul e Sudeste, com pequena produção no Nordeste e Centro-Oeste. Uma variedade de couve da China, "kaai laan" ou "gaillon" (Brassica oleracea var. alboglabra, produz sementes em altas temperaturas e, portanto, é apta a produzir sementes no Norte e Nordeste do Brasil. Gaillon e couve-flor foram cruzados. Foram feitos 55 cruzamentos usando 10 plantas de gaillon como mãe e 4 plantas de couve-flor como doadores de pólen. Desses cruzamentos, na geração F2, 612 plantas com inflorescência tipo gaillon e 48 plantas com inflorescência tipo couve-flor foram obtidas, em proporção similar a 15:1, demonstrando que 2 pares de genes estão envolvidos na formação da inflorescência em couve

  9. Refusion of zircaloy scraps by VAR (vacuum arc remelting): preliminary results; Fusao de cavacos de zircaloy por VAR: resultados preliminares

    Energy Technology Data Exchange (ETDEWEB)

    Pereira, L.A.T.; Mucsi, C.S.; Sato, I.M.; Rossi, J.L.; Martinez, L.G., E-mail: lgallego@ipen.b [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Correa, H.P.S. [Universidade Federal do Mato Grosso do Sul (UFMS), Campo Grande, MS (Brazil); Orlando, M.T.D. [Universidade Federal do Espirito Santo (UFES), Vitoria, ES (Brazil)

    2010-07-01

    Fuel elements and structural components of the core of PWR nuclear reactors are made in zirconium alloys known as Zircaloy. Machining chips and shavings resulting from the manufacturing of these components can not be discarded as scrap, once these alloys are strategic materials for the nuclear area, have high costs and are not produced in Brazil on an industrial bases and, consequently, are imported for the manufacture of nuclear fuel. The reuse of Zircaloy chips has economic, strategic and environmental aspects. In this work is proposed a process for recycling Zircaloy scraps using a VAR (vacuum arc remelting) furnace in order to obtain ingots suitable for the manufacture of components of the reactors. The ingots obtained are being studied in order to verify the influence of processing on composition and microstructure of the remelted material. In this work are presented preliminary results of the composition of obtained ingots compared to start material and the resulting microstructure. (author)

  10. The effect of temperature on the nutritional quality of feed from biological treated oil palm empty fruit bunch by Pleurotus sajor caju

    International Nuclear Information System (INIS)

    Mat Rasol Awang; Hassan Hamdani Mutaat; Yusri Atan; Tamikazu Kume; Shoji Hashimoto; Shinpei Matsuhashi

    1998-01-01

    In solid state fermentation, Pleurotus sajor caju degrades oil palm Empty Fruit Bunch (EFB) fibre to give a useful feed material (1). Its chemical composition, dry matter digestibility both in vitro and in vivo have been characterised and described previously (2). However, the performance of this microorganism in degradation activity has not been described. Since CO sub 2 is the most important metabolic product of this fermentation, the microbial degradation activity is directly related to the rate and total CO sub 2 evolved in the fermentation. In this work a range of temperature were selected for fermentation, aiming to suit its practical application for countries of tropical climate in general, particularly Malaysia. The nutritional quality of fermented products obtained from the fermentation at different temperature were analysed and discussed

  11. Mutation Induction In White Oyster Mushroom (Pleurotus Ostreatus) Using GAMMA Irradiation And Analyzing Genetic Diversity Of Induced Mutants By RAPD.PCR

    International Nuclear Information System (INIS)

    Mohammed, H.M; Soliman, S.S.A; Shawky, A.S.H; Mahgoub, E.M.I

    2013-01-01

    The present study aimed to understand the effect of gamma rays on three strains of white oyster mushroom Pleurotus ostreatus and induction of new benefit mutants. Five different doses, i.e., 0.25,0.5,0.75, and 1.00 KGy of gamma rays were used. Twelve morphological criteria were measured. The result confirmed the existence of different response of three strains to different doses of radiation. The 21 strain as a control, the first flush was misshapen, but the second flush gave normal fruit, while mutant Po 21-3 gave excellent growth performance for the shape, colour, fruit diameter and stem length, while slightly decrease in wet and dry total matter per bag and flushes numbers were found.The po 21-2 mutant considered as important mutant because slightly increased in wet and dry total matter than the control, and had short stem length. This mutant Po 21 -2 gave spores, while the control was sporeless. Control of strain 22 possessed good performance for fruit characterization but it forms fruits less than its primordial it formed (semi maturation less strain) per bag, While po 22-l and Po 22-2 appeared good performance, in addition high yielding as wet and dry total matter and faster flushing. The control of strain 66 had a good growth performance, and the four mutants for this strain is very good too they had excellent growth performance; Po 66-1 and Po 66-3 mutants had significant and highly significant values for wet matter than the control (21.04, 21.64 and 12.27) for (Po 66-1, Po 66-4, control). As well as more important criteria there were taken as short fruit stem length and fruit number/bag. These results confirmed the important of Po 66-4 followed by po 66-1 in next breeding and production programs for white oyster mushroom (Pleurotus ostreatus).the RAPD PCR results showed the oligonucleotide OPB-10, OPA-05 and OPC-02 presented the highest percentage of RAPD polymorphism (80⁒, 80⁒, 66.6⁒). The pattern obtained with OPB-10 oligonucleotide for strains

  12. Isolation and Optimization of Inter-Simple Sequence Repeat (ISSR) Technique For Pleurotus Sajor Caju Towards Environmental Study in Support of the Country's Nuclear Power Programme

    International Nuclear Information System (INIS)

    Rosnani Abdul Rashid; Azhar Mohamad; Mat Rasol Awang; Hassan Hamdani Mutaat; Shaiful Azuar Mohamad; Affrida Abu Hasan; Mohd Meswan Maskom; Siti Khadijah Mohd Nahar

    2013-01-01

    Mushroom can be used as a biological indicator in assessing radiological impact on the environment. Radiological effect would be reflected through morphological changes as well as those changes at molecular level. For this purpose, a preliminary work was conducted, which included DNA isolation, optimization of PCR parameters for Inter-Simple Sequence Repeat (ISSR) and primers screening on Pleurotus sajor caju mushroom strains from Nuclear Malaysia's Sterifeed Mushrooms Collection Centre. In this work, DNA isolation technique from cap and stalk of fruit body were optimized and quantified. It was found that stalk produced highest amount of genomic DNA at 304.01 ng/ μl and cap at 149.00 ng/ μl. A total of 100 ISSR primers were tested and 51 primers were successfully amplified. These primers will be used further for dose response evaluation and molecular profiling in mushroom species. (author)

  13. Elucidation of the regio- and chemoselectivity of enzymatic allylic oxidations with Pleurotus sapidus – conversion of selected spirocyclic terpenoids and computational analysis

    Directory of Open Access Journals (Sweden)

    Verena Weidmann

    2013-10-01

    Full Text Available Allylic oxidations of olefins to enones allow the efficient synthesis of value-added products from simple olefinic precursors like terpenes or terpenoids. Biocatalytic variants have a large potential for industrial applications, particularly in the pharmaceutical and food industry. Herein we report efficient biocatalytic allylic oxidations of spirocyclic terpenoids by a lyophilisate of the edible fungus Pleurotus sapidus. This ‘’mushroom catalysis’’ is operationally simple and allows the conversion of various unsaturated spirocyclic terpenoids. A number of new spirocyclic enones have thus been obtained with good regio- and chemoselectivity and chiral separation protocols for enantiomeric mixtures have been developed. The oxidations follow a radical mechanism and the regioselectivity of the reaction is mainly determined by bond-dissociation energies of the available allylic CH-bonds and steric accessibility of the oxidation site.

  14. Komparasi Laju Pertumbuhan Miselium Jamur Tiram Putih (Pleurotus ostreatus (Jacq. ex Fr Kummer pada Komposisi Media Bibit (F3 dan Baglog yang Berbeda

    Directory of Open Access Journals (Sweden)

    I MADE SUDARMA

    2015-09-01

    Full Text Available The growth rate comparison of white oyster mushroom (Pleurotus ostreatus (Jacq. ex FrKummer mycelium in the composition of different seed (F3 and baglog media . Cultivation ofoyster mushroom (Pleurotus ostreatus (Jacq. ex Fr Kummer has grown rapidly along with the increasein income and health awareness. Oyster mushrooms growing need for media with a particular compositionin order to grow optimally. Oyster mushroom production is determined by the quality of the seeds (F3is used, which is sourced from the media with good quality and composition. The research aimed todetermine the rate of growth of white oyster mushroom mycelium in the different composition of seedmedium (F3 (sawdust: fine bran: corn flour: CaCO3 . The experiments was conducted at nurseriesand oyster mushroom development, Jl. Siulan Gang Zella No. 7 Denpasar, from June to August 2013.Each treatment contained 50 bottles, and 10 bottles only used as a sample, in environmental conditionswith temperature and humidity ranges, 20-29oC and 59-86% respectively . T-test was used todifferentiate the growth rate of white oyster mushroom mycelium with different compositions. Theresults showed that seeds (F3 derived from the growing media composition, sawdust (1 week old:fine bran: corn flour: CaCO3 (10:4:2:0,5 significantly different and better than the composition sawdust(age 1 month : fine bran: corn flour (20:2:1:0.5, with a growth rate of mycelium in a mean 6.14±0.56cm/week and 1,81±0,82 cm/week, respectively. Spawn running in baglog with media composition10:4:2:0.5 was 2.77±1.22cm/week, but with composition media 20:2:1:0.5 mycelium could not grow.Effect of temperature and humidity on the growth rate of white oyster mushroom mycelium in seedmedia (F3 is not significantly.

  15. Extracellular polysaccharide production by a strain of Pleurotus djamor isolated in the south of Brazil and antitumor activity on Sarcoma 180

    Directory of Open Access Journals (Sweden)

    Gisele Martini Borges

    2013-12-01

    Full Text Available Polysaccharides with medicinal properties can be obtained from fruiting bodies, mycelium and culture broth of several fungus species. This work was carried out in batch culture using a stirred tank reactor with two different initial glucose concentrations (40-50 g/L and pH values (3.0-4.0 to enhance extracellular polysaccharides production by Pleurotus djamor UNIVILLE 001 and evaluate antitumor effect of intraperitonial administration of Pleurotus djamor extract on sarcoma 180 animal model. According to factorial design, the low pH value (pH 3.0 led to a gain of 1.6 g/L on the extracellular polysaccharide concentration, while glucose concentration in the tested range had no significant effect on the concentration of polysaccharide. With 40 g/L initial glucose concentration and pH 3.0, it was observed that yield factor of extracellular polysaccharide on substrate (Y P/S = 0.072 and maximum extracellular polysaccharide productivity (Q Pmax = 11.26 mg/L.h were about 188% and 321% respectively higher than those obtained in the experiment performed at pH 4.0. Under these conditions, the highest values of the yield factor of biomass on substrate (Y X/S = 0.24 and maximal biomass productivity (Q Xmax = 32.2 mg/L.h were also reached. In tumor response study, mean tumor volume on the 21th day was 35.3 cm³ in untreated group and 1.6 cm³ in treated group (p = 0.05 with a tumor inhibition rate of 94%. These impressive results suggests an inhibitory effect of P.djamor extract on cancer cells.

  16. ESTIMATING RISK ON THE CAPITAL MARKET WITH VaR METHOD

    Directory of Open Access Journals (Sweden)

    Sinisa Bogdan

    2015-06-01

    Full Text Available The two basic questions that every investor tries to answer before investment are questions about predicting return and risk. Risk and return are generally considered two positively correlated sizes, during the growth of risk it is expected increase of return to compensate the higher risk. The quantification of risk in the capital market represents the current topic since occurrence of securities. Together with estimated future returns it represents starting point of any investment. In this study it is described the history of the emergence of VaR methods, usefulness in assessing the risks of financial assets. Three main Value at Risk (VaR methodologies are decribed and explained in detail: historical method, parametric method and Monte Carlo method. After the theoretical review of VaR methods it is estimated risk of liquid stocks and portfolio from the Croatian capital market with historical and parametric VaR method, after which the results were compared and explained.

  17. Comparison of historically simulated VaR: Evidence from oil prices

    International Nuclear Information System (INIS)

    Costello, Alexandra; Asem, Ebenezer; Gardner, Eldon

    2008-01-01

    Cabedo and Moya [Cabedo, J.D., Moya, I., 2003. Estimating oil price 'Value at Risk' using the historical simulation approach. Energy Economics 25, 239-253] find that ARMA with historical simulation delivers VaR forecasts that are superior to those from GARCH. We compare the ARMA with historical simulation to the semi-parametric GARCH model proposed by Barone-Adesi et al. [Barone-Adesi, G., Giannopoulos, K., Vosper, L., 1999. VaR without correlations for portfolios of derivative securities. Journal of Futures Markets 19 (5), 583-602]. The results suggest that the semi-parametric GARCH model generates VaR forecasts that are superior to the VaR forecasts from the ARMA with historical simulation. This is due to the fact that GARCH captures volatility clustering. Our findings suggest that Cabedo and Moya's conclusion is mainly driven by the normal distributional assumption imposed on the future risk structure in the GARCH model. (author)

  18. Modeling and Analysis of a Three-Phase Solid-State Var ...

    African Journals Online (AJOL)

    Modeling and Analysis of a Three-Phase Solid-State Var Compensator (SSVC) ... Nigerian Journal of Technology. Journal Home ... The problems associated with the flow of reactive power in transmission and distribution lines are well known.

  19. Equisetum hyemale L. var. affine (Engelm.) A.A. Eaton in Schoorl

    NARCIS (Netherlands)

    Swolfs, Aart G.

    1996-01-01

    A giant form of the Northamerican Equisetum hyemale var. affine has been planted a decade ago near the coast, where it has naturalized since. It is suggested that other Northamerican introductions of this extremely variable taxon may have remained unnoticed.

  20. Larvicidal activity of Bacillus thuringiensis var. israelensis Cry11Aa toxin against Haemonchus contortus.

    Science.gov (United States)

    DE Lara, Ana Paula DE Souza Stori; Lorenzon, Lucas Bigolin; Vianna, Ana Muñoz; Santos, Francisco Denis Souza; Pinto, Luciano Silva; Aires Berne, Maria Elisabeth; Leite, Fábio Pereira Leivas

    2016-10-01

    Effective control of gastrointestinal parasites is necessary in sheep production. The development of anthelmintics resistance is causing the available chemically based anthelmintics to become less effective. Biological control strategies present an alternative to this problem. In the current study, we tested the larvicidal effects of Bacillus thuringiensis var. israelensis Cry11Aa toxin against Haemonchus contortus larvae. Bacterial suspensions [2 × 108 colony-forming units (CFU) g-1 of the feces] of B. thuringiensis var. israelensis and recombinant Escherichia coli expressing Cry11Aa toxin were added to naturally H. contortus egg-contaminated feces. The larvae were quantified, and significant reductions of 62 and 81% (P var. israelensis and recombinant E. coli expressing Cry11Aa toxin were then orally administered to lambs naturally infected with H. contortus. Twelve hours after administration, feces were collected and submitted to coprocultures. Significant larvae reductions (P var. israelensis is a promising new class of biological anthelmintics for treating sheep against H. contortus.

  1. Shelf-life increase of fresh mushrooms Pleurotus sajor-caju using gamma radiation;Aumento da vida util de cogumelos Pleurotus sajor-caju in natura com aplicacao de radiacao gama

    Energy Technology Data Exchange (ETDEWEB)

    Moda, Evelise Moncaio

    2008-07-01

    The production and consumption of edible mushrooms has been increasing in the last years due to its nutritional composition and sensory quality. The irradiation of mushrooms has been used with the purpose of maintaining the fresh product characteristics during shelf-life. The present study evaluated the effect of different radiation doses on the conservation of mushrooms Pleurotus sajor-caju, through by chemical, physical, microbiological and sensorial parameters. The packaging consisted on polystyrene trays with 250 g of sample, wrapped in polyvinyl chloride (PVC). The mushrooms were irradiated with doses of 125, 250, 500 and 750 Gy in a Gamma cell 220 type irradiator, and stored at 4 +- 1 deg C and 90% UR for 10 days. The proximate composition (moisture, crude fibre, total protein, total fat and ash), total soluble solids, pH, texture, color (L, a, b, Chroma and ho), enzymatic activity (polyphenoloxidase and peroxidase), microbiological (total coliform, Escherichia coli and total psychotropic bacteria) and sensory evaluation (color, taste and appearance) were determined in the 1st, 5th and 10th storage days. For the respiratory rate analysis, 30 g of sample were placed in jars and stored at 4 +- 1 deg C and 90% UR for 8 days. CO{sub 2} was analyzed every day using a gaseous chromatograph. The results were submitted to variance analysis and average test using the SAS statistical package. The total protein and total fat values did not differ significantly between treatments or storage periods, while the moisture, crude fibre and ash values differ between treatments and periods. The dose of 750 Gy darkness the mushroom in the last evaluation, and texture was better in control during the storage period. The color (L, a), texture and proximate composition values did not differ significantly between treatments or storage periods. A significant increase was observed for soluble solids, b{sup *} and enzymatic activity values in all treatments at the end of the storage

  2. Taxonomic study on Japanese Salvia (Lamiaceae): Phylogenetic position of S. akiensis, and polyphyletic nature of S. lutescens var. intermedia.

    Science.gov (United States)

    Takano, Atsuko

    2017-01-01

    Both Salvia akiensis and S. lutescens (Lamiaceae) are endemic to Japan. Salvia akiensis was recently described in 2014 in the Chugoku (= SW Honshu) region, and each four varieties of S. lutescens distributed allopatrically. Among varieties in S. lutescens , var. intermedia show a disjunctive distribution in the Kanto (=E Honshu) and Kinki (= W Honshu) regions. Recent field studies of S. lutescens var. intermedia revealed several morphological differences between the Kanto and Kinki populations. Here, I evaluated these differences among Salvia lutescens var. intermedia and its allies with morphological analysis and molecular phylogenetic analyses of nuclear ribosomal DNA (internal and external transcribed spacer regions) and plastid DNA ( ycf1-rps15 spacer, rbcL , and trnL-F ) sequences. Both morphological analysis and molecular phylogenetic analyses showed that S. lutescens var. intermedia from the Kinki region and var. lutescens were closely related to each other. However, var. intermedia from the Kanto region exhibited an association with S. lutescens var. crenata and var. stolonifera, which also grew in eastern Japan, rather than var. intermedia in the Kinki region. These results indicated that S. lutescens var. intermedia is not a taxon with a disjunctive distribution, but a combination of two or more allopatric taxa. Present study also suggested that S. akiensis was most closely related to S. omerocalyx .

  3. Influence of beetroot (Beta vulgaris var. cruenta) on mice leukocytes increase

    OpenAIRE

    Amaro, Jony

    2014-01-01

    Background: Beetroot is a flavonoid-containing Mediterranean plant used for food and medicinal purposes. Objectives: To determine the influence of Beta vulgaris var. cruenta extract consumption in increasing albino mice leukocytes. Design: Experimental study. Setting: School N° 1182 bioterium. Biologic material: Twenty male Balb/c albino mice weighing 24 g average. Interventions: Two groups of ten mice each were formed; the experimental group received Beta vulgaris var. cruenta extract at 250...

  4. Characterization of flavonoids in Millettia nitida var. hirsutissima by HPLC/DAD/ESI-MS n

    OpenAIRE

    Ye, Min; Yang, Wen-Zhi; Liu, Ke-Di; Qiao, Xue; Li, Bei-Jia; Cheng, Jun; Feng, Jie; Guo, De-An; Zhao, Yu-Ying

    2011-01-01

    Millettia nitida var. hirsutissima is a Chinese herbal medicine used for the treatment of gynecological diseases. An HPLC/DAD/ESI-MSn method was established for the rapid separation and characterization of bioactive flavonoids in M. nitida var. hirsutissima. A total of 32 flavonoids were detected, of which 14 compounds were unambiguously characterized by comparing their retention time, UV, and MS spectra with those of the reference standards, and the others were tentatively identified based o...

  5. [Content and distribution of active components in cultivated and wild Taxus chinensis var. mairei plants].

    Science.gov (United States)

    Yu, Shao-Shuai; Sun, Qi-Wu; Zhang, Xiao-Ping; Tian, Sheng-Ni; Bo, Pei-Lei

    2012-10-01

    Taxus chinensis var. mairei is an endemic and endangered plant species in China. The resources of T. chinensis var. mairei have been excessively exploited due to its anti-cancer potential, accordingly, the extant T. chinensis var. mairei population is decreasing. In this paper, ultrasonic extraction and HPLC were adopted to determine the contents of active components paclitaxel, 7-xylosyltaxol and cephalomannine in cultivated and wild T. chinensis var. mairei plants, with the content distribution of these components in different parts of the plants having grown for different years and at different slope aspects investigated. There existed obvious differences in the contents of these active components between cultivated and wild T. chinensis var. mairei plants. The paclitaxel content in the wild plants was about 0.78 times more than that in the cultivated plants, whereas the 7-xylosyltaxol and cephalomannine contents were slishtly higher in the cultivated plants. The differences in the three active components contents between different parts and tree canopies of the plants were notable, being higher in barks and upper tree canopies. Four-year old plants had comparatively higher contents of paclitaxel, 7-xylosyltaxol and cephalomannine (0.08, 0.91 and 0.32 mg x g(-1), respectively), and the plants growing at sunny slope had higher contents of the three active components, with significant differences in the paclitaxel and 7-xylosyltaxol contents and unapparent difference in the cephalomannine content of the plants at shady slope. It was suggested that the accumulation of the three active components in T. chinensis var. mairei plants were closely related to the sunshine conditions. To appropriately increase the sunshine during the artificial cultivation of T. chinensis var. mairei would be beneficial to the accumulation of the three active components in T. chinensis var. mairei plants.

  6. Exact eigenstates and open-quotes trivialityclose quotes of λ(var-phi *var-phi)2 theory in the Feshbach-Villars formulation

    International Nuclear Information System (INIS)

    Darewych, J.W.

    1997-01-01

    The complex scalar (Klein-Gordon) quantum field theory (QFT) with a λ(var-phi * var-phi) 2 interaction is considered in the Feshbach-Villars formulation. It is shown that exact few-particle eigenstates of the QFT Hamiltonian can be obtained. The resulting relativistic few-body equations correspond to Klein-Gordon particles interacting via delta-function, or open-quotes contact,close quotes potentials. Momentum-space solutions of the two-body equation yield a open-quotes trivialclose quotes unity S matrix. copyright 1997 The American Physical Society

  7. Feasibility of Stochastic Voltage/VAr Optimization Considering Renewable Energy Resources for Smart Grid

    Science.gov (United States)

    Momoh, James A.; Salkuti, Surender Reddy

    2016-06-01

    This paper proposes a stochastic optimization technique for solving the Voltage/VAr control problem including the load demand and Renewable Energy Resources (RERs) variation. The RERs often take along some inputs like stochastic behavior. One of the important challenges i. e., Voltage/VAr control is a prime source for handling power system complexity and reliability, hence it is the fundamental requirement for all the utility companies. There is a need for the robust and efficient Voltage/VAr optimization technique to meet the peak demand and reduction of system losses. The voltages beyond the limit may damage costly sub-station devices and equipments at consumer end as well. Especially, the RERs introduces more disturbances and some of the RERs are not even capable enough to meet the VAr demand. Therefore, there is a strong need for the Voltage/VAr control in RERs environment. This paper aims at the development of optimal scheme for Voltage/VAr control involving RERs. In this paper, Latin Hypercube Sampling (LHS) method is used to cover full range of variables by maximally satisfying the marginal distribution. Here, backward scenario reduction technique is used to reduce the number of scenarios effectively and maximally retain the fitting accuracy of samples. The developed optimization scheme is tested on IEEE 24 bus Reliability Test System (RTS) considering the load demand and RERs variation.

  8. Working alliance inventory applied to virtual and augmented reality (WAI-VAR): psychometrics and therapeutic outcomes.

    Science.gov (United States)

    Miragall, Marta; Baños, Rosa M; Cebolla, Ausiàs; Botella, Cristina

    2015-01-01

    This study examines the psychometric properties of the Working Alliance Inventory-Short (WAI-S) adaptation to Virtual Reality (VR) and Augmented Reality (AR) therapies (WAI-VAR). The relationship between the therapeutic alliance (TA) with VR and AR and clinically significant change (CSC) is also explored. Seventy-five patients took part in this study (74.7% women, M age = 34.41). Fear of flying and adjustment disorder patients received VR therapy, and cockroach phobia patients received AR therapy. Psychometric properties, CSC, one-way ANOVA, Spearman's Correlations and Multiple Regression were calculated. The WAI-VAR showed a unidimensional structure, high internal consistency and adequate convergent validity. "Not changed" patients scored lower on the WAI-VAR than "improved" and "recovered" patients. Correlation between the WAI-VAR and CSC was moderate. The best fitting model for predicting CSC was a linear combination of the TA with therapist (WAI-S) and the TA with VR and AR (WAI-VAR), due to the latter variable slightly increased the percentage of variability accounted for in CSC. The WAI-VAR is the first validated instrument to measure the TA with VR and AR in research and clinical practice. This study reveals the importance of the quality of the TA with technologies in achieving positive outcomes in the therapy.

  9. The effect of extract of Punica granatum var. pleniflora for treatment of minor recurrent aphthous stomatitis.

    Science.gov (United States)

    Gavanji, Shahin; Larki, Behrouz; Bakhtari, Azizollah

    2014-06-01

    Herbal drugs are considered alternative agents and have been used for several years around the world. Recurrent aphthous stomatitis (RAS) is one of the most common problems recognized by dentists and skin specialists. This problem is characterized by recurring, painful, small oral mucosal ulcers with a round or oval aspect that mostly appear in keratinized mucosa, cheeks, and on the surface of the mouth under the tongue. In our experiment, the alcoholic and water extracts of Punica granatum var. pleniflora, P. granatum var. Sweet Alak, and P. granatum var. Saveh Black were tested on minor RAS. The study was carried out using the double-blind method. The study population consisted of 210 participants, of whom 69 were females (32%) and 141 were males (68%). In addition to checking several factors, the pain and the degree of the participant's satisfaction had been determined based on visual analog scale. Data analysis was done in the form of a nonparametric method using Kruskal-Wallis test and SPSS version 20 software. The results show that the alcoholic and water extracts of P. granatum var. pleniflora have a meaningful therapeutic effect on minor RAS. Results from the antioxidant activity and its relation to total phenolics show that P. granatum var. pleniflora and P. granatum var. Sweet Alak are rich in phenols. The water and alcoholic extracts of P. granatum varpleniflora decreased the entire time of complete treatment, and the treatment was meaningfully satisfactory for patients who participated in this experiment.

  10. Arundina graminifolia var. revoluta (Arethuseae, Orchidaceae) has fern-type rheophyte characteristics in the leaves.

    Science.gov (United States)

    Yorifuji, Eri; Ishikawa, Naoko; Okada, Hiroshi; Tsukaya, Hirokazu

    2015-03-01

    Morphological and molecular variation between Arundina graminifolia var. graminifolia and the dwarf variety, A. graminifolia var. revoluta, was examined to assess the validity of their taxonomic characteristics and genetic background for identification. Morphological analysis in combination with field observations indicated that A. graminifolia var. revoluta is a rheophyte form of A. graminifolia characterized by narrow leaves, whereas the other morphological characteristics described for A. graminifolia var. revoluta, such as smaller flowers and short stems, were not always accompanied by the narrower leaf phenotype. Molecular analysis based on matK sequences indicated that only partial differentiation has occurred between A. graminifolia var. graminifolia and A. graminifolia var. revoluta. Therefore, we should consider the rheophyte form an ecotype rather than a variety. Anatomical observations of the leaves revealed that the rheophyte form of A. graminifolia possessed characteristics of the rheophytes of both ferns and angiosperms, such as narrower palisade tissue cells and thinner spongy tissue cells, as well as fewer cells in the leaf-width direction and fewer mesophyll cell layers.

  11. Penetration, Post-penetration Development, and Reproduction of Meloidogyne incognita on Cucumis melo var. texanus.

    Science.gov (United States)

    Faske, T R

    2013-03-01

    Cucumis melo var. texanus, a wild melon commonly found in the southern United States and two accessions, Burleson Co. and MX 1230, expressed resistance to Meloidogyne incognita in preliminary experiments. To characterize the mechanism of resistance, we evaluated root penetration, post-penetration development, reproduction, and emigration of M. incognita on these two accessions of C. melo var. texanus. Additionally, we evaluated 22 accessions of C. melo var. texanus for their reaction against M. incognita in a greenhouse experiment. Fewer (P ≤ 0.05) J2 penetrated the root system of C. melo var. texanus accessions (Burleson Co. and MX 1230) and C. metuliferus (PI 482452) (resistant control), 7 days after inoculation (DAI) than in C. melo 'Hales Best Jumbo' (susceptible control). A delayed (P ≤ 0.05) rate of nematode development was observed at 7, 14, and 21 DAI that contributed to lower (P ≤ 0.05) egg production on both accessions and C. metuliferus compared with C. melo. Though J2 emigration was observed on all Cucumis genotypes a higher (P ≤ 0.05) rate of J2 emigration was observed from 3 to 6 DAI on accession Burleson Co. and C. metuliferus than on C. melo. The 22 accessions of C. melo var. texanus varied relative to their reaction to M. incognita with eight supporting similar levels of nematode reproduction to that of C. metuliferus. Cucumis melo var. texanus may be a useful source of resistance against root-knot nematode in melon.

  12. Characterization of the antigenicity of Cpl1, a surface protein of Cryptococcus neoformans var. neoformans.

    Science.gov (United States)

    Cai, Jian-Piao; Liu, Ling-Li; To, Kelvin K W; Lau, Candy C Y; Woo, Patrick C Y; Lau, Susanna K P; Guo, Yong-Hui; Ngan, Antonio H Y; Che, Xiao-Yan; Yuen, Kwok-Yung

    2015-01-01

    Cryptococcus neoformans var. neoformans is an important fungal pathogen. The capsule is a well established virulence factor and a target site for diagnostic tests. The CPL1 gene is required for capsular formation and virulence. The protein product Cpl1 has been proposed to be a secreted protein, but the characteristics of this protein have not been reported. Here we sought to characterize Cpl1. Phylogenetic analysis showed that the Cpl1 of C. neoformans var. neoformans and the Cpl1 orthologs identified in C. neoformans var. grubii and C. gattii formed a distinct cluster among related fungi; while the putative ortholog found in Trichosporon asahii was distantly related to the Cryptococcus cluster. We expressed Cpl1 abundantly as a secreted His-tagged protein in Pichia pastoris. The protein was used to immunize guinea pigs and rabbits for high titer mono-specific polyclonal antibody that was shown to be highly specific against the cell wall of C. neoformans var. neoformans and did not cross react with C. gattii, T. asahii, Aspergillus spp., Candida spp. and Penicillium spp. Using the anti-Cpl1 antibody, we detected Cpl1 protein in the fresh culture supernatant of C. neoformans var. neoformans and we showed by immunostaining that the Cpl1 protein was located on the surface. The Cpl1 protein is a specific surface protein of C. neoformans var. neoformans. © 2015 by The Mycological Society of America.

  13. Efficient transformation and expression of gfp gene in Valsa mali var. mali.

    Science.gov (United States)

    Chen, Liang; Sun, Gengwu; Wu, Shujing; Liu, Huixiang; Wang, Hongkai

    2015-01-01

    Valsa mali var. mali, the causal agent of valsa canker of apple, causes great loss of apple production in apple producing regions. The pathogenic mechanism of the pathogen has not been studied extensively, thus a suitable gene marker for pathogenic invasion analysis and a random insertion of T-DNA for mutants are desirable. In this paper, we reported the construction of a binary vector pKO1-HPH containing a positive selective gene hygromycin phosphotransferase (hph), a reporter gene gfp conferring green fluorescent protein, and an efficient protocol for V. mali var. mali transformation mediated by Agrobacterium tumefaciens. A transformation efficiency up to about 75 transformants per 10(5) conidia was achieved when co-cultivation of V. mali var. mali and A. tumefaciens for 48 h in A. tumefaciens inductive medium agar plates. The insertions of hph gene and gfp gene into V. mali var. mali genome verified by polymerase chain reaction and southern blot analysis showed that 10 randomly-selected transformants exhibited a single, unique hybridization pattern. This is the first report of A. tumefaciens-mediated transformation of V. mali var mali carrying a 'reporter' gfp gene that stably and efficiently expressed in the transformed V. mali var. mali species.

  14. Semi-nonparametric VaR forecasts for hedge funds during the recent crisis

    Science.gov (United States)

    Del Brio, Esther B.; Mora-Valencia, Andrés; Perote, Javier

    2014-05-01

    The need to provide accurate value-at-risk (VaR) forecasting measures has triggered an important literature in econophysics. Although these accurate VaR models and methodologies are particularly demanded for hedge fund managers, there exist few articles specifically devoted to implement new techniques in hedge fund returns VaR forecasting. This article advances in these issues by comparing the performance of risk measures based on parametric distributions (the normal, Student’s t and skewed-t), semi-nonparametric (SNP) methodologies based on Gram-Charlier (GC) series and the extreme value theory (EVT) approach. Our results show that normal-, Student’s t- and Skewed t- based methodologies fail to forecast hedge fund VaR, whilst SNP and EVT approaches accurately success on it. We extend these results to the multivariate framework by providing an explicit formula for the GC copula and its density that encompasses the Gaussian copula and accounts for non-linear dependences. We show that the VaR obtained by the meta GC accurately captures portfolio risk and outperforms regulatory VaR estimates obtained through the meta Gaussian and Student’s t distributions.

  15. Lentinula edodes and Pleurotus ostreatus: functional food with antioxidant -antimicrobial activityand an important source of Vitamin D and medicinal compounds

    Directory of Open Access Journals (Sweden)

    Simone Parola

    2017-10-01

    Full Text Available Background: Mushrooms produce a large amount of medicinal compounds, and are also an optimal source of fibres, proteins, vitamins (like groups B and D, and other micronutrients including potassium, magnesium, etc. Consequently, mushrooms are commonly considered to be functional foods. Many works report the high biological potentials of medicinal mushrooms involving their antibacterial, hypoglycaemic, anticholesterolemic, radical scavenging, and anti-inflammatory effects. Context and purpose of this study: First off, this work aimed to find strains of Lentinula edodes and Pleurotus ostreatus from a bank of edible mushrooms bought from international strain banks (Table I that could possess health benefit related properties, such as a radical scavenging activity (antioxidant effect, antibacterial effects against common pathogenic bacteria, and being able to produce interesting nutrients and secondary metabolites. As the fungal bank comprises of 20 strains of L. edodes and 20 strains of P. ostreatus, a first screening was made by the selection of 13 strains for each mushroom able to grow in multiple wood types or that were particularly productive and had proved good growth reproducibility over the last 5 years. This work also studied the correlation between culture conditions and mushroom quality in terms of the previously reported properties. Comparison among the selected strains was operated by the assessment of antioxidant and antimicrobial activities after different sample treatments. Furthermore, an initial optimization of the analytic techniques was produced for the direct estimation of important secondary metabolites and nutrients by means of HPLC-MS/MS technique. Further research will encompass an evaluation of transformation processes (drying, freezing, rehydration, cooking, etc. impact on radical scavenging, antibacterial activity, and possible degradation/loss of nutraceutically important substances such as vitamin D2, ergothioneine

  16. In vitro antioxidant and anticancer effects of solvent fractions from Prunella vulgaris var. lilacina.

    Science.gov (United States)

    Hwang, Yu-Jin; Lee, Eun-Ju; Kim, Haeng-Ran; Hwang, Kyung-A

    2013-11-09

    Recently, considerable attention has been focused on exploring the potential antioxidant properties of plant extracts or isolated products of plant origin. Prunella vulgaris var. lilacina is widely distributed in Korea, Japan, China, and Europe, and it continues to be used to treat inflammation, eye pain, headache, and dizziness. However, reports on the antioxidant activities of P. vulgaris var. lilacina are limited, particularly concerning the relationship between its phenolic content and antioxidant capacity. In this study, we investigated the antioxidant and anticancer activities of an ethanol extract from P. vulgaris var. lilacina and its fractions. Dried powder of P. vulgaris var. lilacina was extracted with ethanol, and the extract was fractionated to produce the hexane fraction, butanol fraction, chloroform fraction and residual water fraction. The phenolic content was assayed using the Folin-Ciocalteu colorimetric method. Subsequently, the antioxidant activities of the ethanol extract and its fractions were analyzed employing various antioxidant assay methods including DPPH, FRAP, ABTS, SOD activity and production of reactive oxygen species. Additionally, the extract and fractions were assayed for their ability to exert cytotoxic activities on various cancer cells using the MTT assay. We also investigated the expression of genes associated with apoptotic cell death by RT-PCR. The total phenolic contents of the ethanol extract and water fraction of P. vulgaris var. lilacina were 303.66 and 322.80 mg GAE/g dry weight (or fractions), respectively. The results showed that the ethanol extract and the water fraction of P. vulgaris var. lilacina had higher antioxidant content than other solvent fractions, similar to their total phenolic content. Anticancer activity was also tested using the HepG2, HT29, A549, MKN45 and HeLa cancer cell lines. The results clearly demonstrated that the P. vulgaris var. lilacina ethanol extract induced significant cytotoxic effects

  17. Chiasma failures and chromosome association in Rhoeo spathacea var. variegata.

    Science.gov (United States)

    Lin, Y J

    1982-01-01

    In Rhoeo spathacea var. variegata (2n = 2x = 12), the most frequent meiotic configuration was the chain-of-12 chromosomes (36%) and the second most frequent was the ring-of-12 chromosomes (25.6%). All six possible two-chain situations and eleven of the twelve possible three-chain situations were observed. A maximum of five chains was observed in four cells. The size of chains ranged from on through twelve chromosomes. The mean number of chiasma failures was 1.36 +/- 0.07 per cell and 0.1133 per pair of chromosome arms. Because the observed frequencies of various configurations agree with the expected, which were calculated under the assumption that chiasma failure is equally likely at each of the twelve positions around the ring, it was concluded that chiasma failures occurred at random among the arm-positions. Due to the lengths of arm-pairs in the ring vary considerably, the randomness may mean that chiasma formation was restricted to small terminal regions on all chromosomes.

  18. Bauhinia variegata var. variegata lectin: isolation, characterization, and comparison.

    Science.gov (United States)

    Chan, Yau Sang; Ng, Tzi Bun

    2015-01-01

    Bauhinia variegata var. variegata seeds are rich in proteins. Previously, one of the major storage proteins of the seeds was found to be a trypsin inhibitor that possessed various biological activities. By using another purification protocol, a glucoside- and galactoside-binding lectin that demonstrated some differences from the previously reported B. variegata lectin could be isolated from the seeds. It involved affinity chromatography on Affi-gel blue gel, ion exchange chromatography on Q-Sepharose and Mono Q, and also size exclusion chromatography on Superdex 75. The lectin was not retained on Affi-gel blue gel but interacted with Q-Sepharose. The lectin was a 64-kDa protein with two 32-kDa subunits. It had low thermostability (stable up to 50 °C) and moderate pH stability (stable in pH 3-10). It exhibited anti-proliferative activity on nasopharyngeal carcinoma HONE1 cells with an IC50 of 12.8 μM after treatment for 48 h. It also slightly inhibited the growth of hepatoma HepG2 cells. The lectin may have potential in aiding cancer treatments.

  19. Bioactive phenylpropanoid analogues from Piper betle L. var. birkoli leaves.

    Science.gov (United States)

    Atiya, Akhtar; Sinha, Barij Nayan; Lal, Uma Ranjan

    2017-11-01

    Phytochemical analyses of the chloroform extract of Piper betle L. var. birkoli, Piperaceae, leaves led to the isolation of two new phenylpropanoid analogues: bis-chavicol dodecanoyl ester (2) and bis-hydroxychavicol dodecanoyl ester (3), along with one known compound: allyl-3-methoxy-4-hydroxybenzene (1) on the basis of spectroscopic data 1D ( 1 H and 13 C) and 2D ( 1 H- 1 H COSY and HMBC) NMR, as well as ESI-MS, FT-IR, HR-ESI-MS and LC-ESI-MS. Compound 2 and 3 exhibited excellent antioxidant DPPH radical scavenging activity with IC 50 values of 12.67 μg/mL and 1.08 μg/mL compared to ascorbic acid as a standard antioxidant drug with IC 50 value of 6.60 μg/mL. Evaluation of cytotoxic activity against two human oral cancer cell lines (AW13516 and AW8507) showed significant effect with GI 50 values of 19.61 and 23.01 μg/mL for compound 2 and 10.25 and 13.12 μg/mL for compound 3, compared to Doxorubicin ® as a standard cytotoxic drug with GI 50 value of < 10 μg/mL.

  20. Foam separation of Pseudomonas fluorescens and Bacillus subtilis var. niger.

    Science.gov (United States)

    Grieves, R B; Wang, S L

    1967-01-01

    An experimental investigation established the effect of the presence of inorganic salts on the foam separation of Pseudomonas fluorescens and of Bacillus subtilis var. niger (B. globigii) from aqueous suspension by use of a cationic surfactant. For P. fluorescens, 5.0 mueq/ml of NaCl, KCl, Na(2)SO(4), K(2)SO(4), CaCl(2), CaSO(4), MgCl(2), or MgSO(4) produced increases in the cell concentration in the residual suspension (not carried into the foam) from 2.9 x 10(5) up to 1.6 x 10(6) to 2.8 x 10(7) cells per milliliter (initial suspensions contain from 3.3 x 10(7) to 4.8 x 10(7) cells per milliliter). The exceptional influence of magnesium was overcome by bringing the cells into contact first with the surfactant and then the salt. For B. subtilis, the presence of 5.0 mueq/ml of any of the eight salts increased the residual cell concentration by one order of magnitude from 1.2 x 10(4) to about 4.0 x 10(5) cells per milliliter. This occurred regardless of the sequence of contact as long as the surfactant contact period was sufficient. The presence of salts increased collapsed foam volumes with P. fluorescens and decreased collapsed foam volumes with B. subtilis.

  1. MORFOGÉNESIS IN VITRO DE Pseudotsuga menziesii VAR. glauca

    Directory of Open Access Journals (Sweden)

    María Guadalupe Carrillo-Benítez

    2011-01-01

    Full Text Available Se evaluó la respuesta morfogénica a partir de embriones cigóticos cultivados in vitro de semilla almacenada (un año de Pseudotsuga menziesii var. glauca recolectada en Tlaxcala. Las semillas fueron desinfestadas con detergente y H2O2 (3 % v/v durante 48 h en agitación a 50 rpm, cultivadas en el medio de Murashige y Skoog (1962 sin reguladores. La germinación ocurrió después de siete días y posteriormente subcultivados a un medio MS con 2,4-D (3 mg·L-1 y BA (1 mg·L-1. Con los callos obtenidos en un medio HS se evaluaron tres concentraciones de ABA para promover formación de estructuras embrionarias, presentándose el mejor tratamiento con concentración de 10.0 mg·L-1 (P<.0001. El mejor desarrollo de plántulas se presentó empleando un medio Murashige y Skoog (1962 con sacarosa al 6 %. Se usaron micorrizas para mejor adaptación de plántulas a suelo. No hubo formación de raíces.

  2. Chemical constituents and biological activities of Dianthus elegans var. elegans.

    Science.gov (United States)

    Mutlu, Kiymet; Sarikahya, Nazli Boke; Nalbantsoy, Ayse; Kirmizigul, Suheyla

    2018-06-01

    Chemical investigation of the aerial parts of Dianthus elegans var. elegans afforded two previously undescribed saponins, named dianosides M-N (1-2), together with four oleanane-type triterpenoid glycosides (3-6). Their structures were elucidated as 3-O-α-L-arabinofuranosyl-16α-hydroxyolean-12-ene-23α, 28β-dioic acid (1) and 3-O-α-L-arabinofuranosyl-(1 → 3)-β-D-glucopyranosyl 16α-hydroxyolean-12-ene-23α-oic acid, 28-O-β-D-glucopyranosyl-(1 → 6)-β-D-glycosyl ester (2) by chemical and extensive spectroscopic methods including IR, 1D, 2D NMR and HRESIMS. Both of the saponins were evaluated for their cytotoxicities against HEK-293, A-549 and HeLa human cancer cells using the MTT method. All compounds showed no substantial cytotoxic activity against tested cell lines. However, dianosides M-N and the n-butanol fraction exhibited considerable haemolysis in human erythrocyte cells. The immunomodulatory properties of dianosides M-N were also evaluated in activated whole blood cells by PMA plus ionomycin. Dianosides M-N increased IL-1β concentration significantly whereas the n-butanol fraction slightly augmented IL-1β secretion. All compounds did not change IL-2 and IFN-γ levels considerably.

  3. The R + var-epsilon R2 cosmology

    International Nuclear Information System (INIS)

    Morris, M.S.

    1988-01-01

    This thesis presents the study of a model cosmology based on the R + var-epsilon R 2 gravitational Lagrangian. It may be roughly divided into two distinct parts. First, the classical inflationary scenario is developed. Then, the formalism of quantum cosmology is employed to determined initial conditions for the classical model. In the work on the classical model, the evolution equations for an isotropic and homogeneous universe are solved to exhibit both early-time inflation and a smooth transition to subsequent radiation-dominated behavior. Then perturbations on this isotropic background are evolved through the model to provide constraints on the model parameters from the observational limits on anisotropy today. In the work on the wave function, the two boundary conditions of Vilenkin and Hartle and Hawking are compared. The wave functions obtained are restricted to the initial edge of classical Lorentzian inflationary trajectories as distributions over initial conditions for the classical inflationary model. It is found that Vilenkin's wave function prefers the universe to undergo a great deal of inflation, whereas Hartle and Hawking's wave function prefers the universe to undergo little inflation. Finally, both boundary conditions are shown to require the inhomogeneous perturbative modes start out in their ground states

  4. Micropropagation of globe artichoke (Cynara cardunculus L. var. scolymus).

    Science.gov (United States)

    Iapichino, Giovanni

    2013-01-01

    The globe artichoke (Cynara cardunculus L. var. scolymus) is a perennial plant cultivated in the Mediterranean region and the Americas for its edible young flower heads. Although vegetative propagation by offshoots or by "ovoli" (underground dormant axillary buds) has been the primary method of propagation, the potential for the diffusion of diseases and the phenotypic variability can be very high. The propagation of this species by axillary shoot proliferation from in vitro-cultured meristems produces systemic pathogen-free plants and a higher multiplication rate as compared to that obtained by conventional agamic multiplication. Axillary shoot proliferation can be induced from excised shoot apices cultured on Murashige and Skoog agar solidified medium supplemented with various concentrations of cytokinins and auxins, depending on genotype. For the production of virus-free plants, meristems, 0.3-0.8 mm long are excised from shoot apices and surface sterilized. The transfer of artichoke microshoots to a medium lacking cytokinins or with low cytokinin concentration is critical for rooting. Adventitious roots develop within 3-5 weeks after transfer to root induction MS medium containing NAA or IAA at various concentrations. However, in vitro rooting frequency rate is dependent on the genotype and the protocol used. Acclimatization of in vitro microshoots having 3-4 roots is successfully accomplished; plantlets develop new roots in ex vitro conditions and continue to grow.

  5. VAR control in distribution systems by using artificial intelligence techniques

    Energy Technology Data Exchange (ETDEWEB)

    Golkar, M.A. [Curtin Univ. of Technology, Sarawak (Malaysia). School of Engineering and Science

    2005-07-01

    This paper reviewed artificial intelligence techniques used in VAR control systems. Reactive power controls in distribution systems were also reviewed. While artificial intelligence methods are widely used in power control systems, the techniques require extensive human knowledge bases and experiences in order to operate correctly. Expert systems use knowledge and interface procedures to solve problems that often require human expertise. Expert systems often cause knowledge bottlenecks as they are unable to learn or adopt to new situations. While neural networks possess learning ability, they are computationally expensive. However, test results in recent neural network studies have demonstrated that they work well in a variety of loading conditions. Fuzzy logic techniques are used to accurately represent the operational constraints of power systems. Fuzzy logic has an advantage over other artificial intelligence techniques as it is able to remedy uncertainties in data. Evolutionary computing algorithms use probabilistic transition rules which can search complicated data to determine optimal constraints and parameters. Over 95 per cent of all papers published on power systems use genetic algorithms. It was concluded that hybrid systems using various artificial intelligence techniques are now being used by researchers. 69 refs.

  6. Ortopnea y hemoptisis en un varón joven

    Directory of Open Access Journals (Sweden)

    Jacobo Silva

    2005-04-01

    Full Text Available Varón de 21 años visitado en urgencias por ortopnea, hemoptisis y disnea. La radiografía detectó redistribución en hemitórax izquierdo, el ecocardiograma una masa intraauricular izquierda que protruía en el ventrículo izquierdo a través de la válvula mitral, produciendo obstrucción crítica, y la tomografía computarizada (TC una masa que ocupaba la aurícula izquierda desde la vena pulmonar superior izquierda (Fig. 1. Por vía transeptal superior se reseca una masa multilobulada de 6 × 7 cm, con base de implantación en el techo auricular (Fig. 2, que se reconstruyó con pericardio autólogo. La histopatología confirma el diagnóstico de leiomiosarcoma de vena pulmonar muy diferenciado. Al paciente se le dio el alta a los siete días.

  7. la Universidad Simón Bolívar

    Directory of Open Access Journals (Sweden)

    Jennie Brand Barajas

    2003-01-01

    Full Text Available La presente investigación es un estudio de caso sobre la identidad institucional de los docentes de la Universidad Simón Bolívar (USB desde la filosofía, ideario y misión, los cuales la definen como una institución de educación superior privada católica con carisma franciscano. La pregunta central es: ¿cómo se ha identificado el docente con la USB? Los propósitos parten de un análisis de los documentos de la universidad para explicitar la identidad y, a partir de ello, conocer el perfil del docente para explorar cómo se relaciona con la institución. Se tiene como supuesto que la falta de una definición explícita de la identidad institucional por parte de la USB obstaculiza la identificación del docente. El andamiaje teórico se basa en la construcción y reconstrucción colectiva de la identidad institucional.

  8. Toxicological assessment of nattokinase derived from Bacillus subtilis var. natto.

    Science.gov (United States)

    Lampe, Bradley J; English, J Caroline

    2016-02-01

    Subtilisin NAT, commonly known as "nattokinase," is a fibrinolytic enzyme produced by the bacterial strain B. subtilis var. natto, which plays a central role in the fermentation of soybeans into the popular Japanese food natto. Recent studies have reported on the potential anticoagulatory and antihypertensive effects of nattokinase administration in humans, with no indication of adverse effects. To evaluate the safety of nattokinase in a more comprehensive manner, several GLP-compliant studies in rodents and human volunteers have been conducted with the enzyme product, NSK-SD (Japan Bio Science Laboratory Co., Ltd., Japan). Nattokinase was non-mutagenic and non-clastogenic in vitro, and no adverse effects were observed in 28-day and 90-day subchronic toxicity studies conducted in Sprague-Dawley rats at doses up to 167 mg/kg-day and 1000 mg/kg-day, respectively. Mice inoculated with 7.55 × 10(8) CFU of the enzyme-producing bacterial strain showed no signs of toxicity or residual tissue concentrations of viable bacteria. Additionally consumption of 10 mg/kg-day nattokinase for 4 weeks was well tolerated in healthy human volunteers. These findings suggest that the oral consumption of nattokinase is of low toxicological concern. The 90-day oral subchronic NOAEL for nattokinase in male and female Sprague-Dawley rats is 1000 mg/kg-day, the highest dose tested. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  9. Genomic resources and draft assemblies of the human and porcine varieties of scabies mites, Sarcoptes scabiei var. hominis and var. suis.

    Science.gov (United States)

    Mofiz, Ehtesham; Holt, Deborah C; Seemann, Torsten; Currie, Bart J; Fischer, Katja; Papenfuss, Anthony T

    2016-06-02

    The scabies mite, Sarcoptes scabiei, is a parasitic arachnid and cause of the infectious skin disease scabies in humans and mange in other animal species. Scabies infections are a major health problem, particularly in remote Indigenous communities in Australia, where secondary group A streptococcal and Staphylococcus aureus infections of scabies sores are thought to drive the high rate of rheumatic heart disease and chronic kidney disease. We sequenced the genome of two samples of Sarcoptes scabiei var. hominis obtained from unrelated patients with crusted scabies located in different parts of northern Australia using the Illumina HiSeq. We also sequenced samples of Sarcoptes scabiei var. suis from a pig model. Because of the small size of the scabies mite, these data are derived from pools of thousands of mites and are metagenomic, including host and microbiome DNA. We performed cleaning and de novo assembly and present Sarcoptes scabiei var. hominis and var. suis draft reference genomes. We have constructed a preliminary annotation of this reference comprising 13,226 putative coding sequences based on sequence similarity to known proteins. We have developed extensive genomic resources for the scabies mite, including reference genomes and a preliminary annotation.

  10. Trans-acting GC-rich non-coding RNA at var expression site modulates gene counting in malaria parasite.

    Science.gov (United States)

    Guizetti, Julien; Barcons-Simon, Anna; Scherf, Artur

    2016-11-16

    Monoallelic expression of the var multigene family enables immune evasion of the malaria parasite Plasmodium falciparum in its human host. At a given time only a single member of the 60-member var gene family is expressed at a discrete perinuclear region called the 'var expression site'. However, the mechanism of var gene counting remains ill-defined. We hypothesize that activation factors associating specifically with the expression site play a key role in this process. Here, we investigate the role of a GC-rich non-coding RNA (ncRNA) gene family composed of 15 highly homologous members. GC-rich genes are positioned adjacent to var genes in chromosome-central gene clusters but are absent near subtelomeric var genes. Fluorescence in situ hybridization demonstrates that GC-rich ncRNA localizes to the perinuclear expression site of central and subtelomeric var genes in trans. Importantly, overexpression of distinct GC-rich ncRNA members disrupts the gene counting process at the single cell level and results in activation of a specific subset of var genes in distinct clones. We identify the first trans-acting factor targeted to the elusive perinuclear var expression site and open up new avenues to investigate ncRNA function in antigenic variation of malaria and other protozoan pathogens. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Comparative ozone responses of cutleaf coneflowers (Rudbeckia laciniata var. digitata, var. ampla) from Rocky Mountain and Great Smoky Mountains National Parks, USA.

    Science.gov (United States)

    Neufeld, Howard S; Johnson, Jennifer; Kohut, Robert

    2018-01-01

    Cutleaf coneflower (Rudbeckia laciniata L. var. digitata) is native to Great Smoky Mountains National Park (GRSM) and an ozone bioindicator species. Variety ampla, whose ozone sensitivity is less well known, is native to Rocky Mountain National Park (ROMO). In the early 2000s, researchers found putative ozone symptoms on var. ampla and rhizomes were sent to Appalachian State University to verify that the symptoms were the result of ozone exposure. In 2011, potted plants were exposed to ambient ozone from May to August. These same plants were grown in open-top chambers (OTCs) in 2012 and 2013, and exposed to charcoal-filtered (CF), non-filtered (NF), elevated ozone (EO), NF+50ppb in 2012 for 47days and NF+30/NF+50ppb ozone in 2013 for 36 and 36days, respectively. Ozone symptoms similar to those found in ROMO (blue-black adaxial stippling) were reproduced both in ambient air and in the OTCs. Both varieties exhibited foliar injury in the OTCs in an exposure-dependent manner, verifying that symptoms resulted from ozone exposure. In two of the three study years, var. digitata appeared more sensitive than var. ampla. Exposure to EO caused reductions in ambient photosynthetic rate (A) and stomatal conductance (g s ) for both varieties. Light response curves indicated that ozone reduced A, g s , and the apparent quantum yield while it increased the light compensation point. In CF air, var. ampla had higher light saturated A (18.2±1.04 vs 11.6±0.37μmolm -2 s -1 ), higher light saturation (1833±166.7 vs 1108±141.7μmolm -2 s -1 ), and lower Ci/Ca ratio (0.67±0.01 vs 0.77±0.01) than var. digitata. Coneflowers in both Parks are adversely affected by exposure to ambient ozone and if ozone concentrations increase in the Rocky Mountains, greater amounts of injury on var. ampla can be expected. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. [Gene cloning and bioinformatics analysis of SABATH methyltransferase in Lonicera japonica var. chinensis].

    Science.gov (United States)

    Yu, Xiao-Dan; Jiang, Chao; Huang, Lu-Qi; Qin, Shuang-Shuang; Zeng, Xiang-Mei; Chen, Ping; Yuan, Yuan

    2013-08-01

    To clone SABATH methyltransferase (rLjSABATHMT) gene in Lonicera japonica var. chinensis, and compare the gene expression and intron sequence of SABATH methyltransferase orthologous in L. japonica with L. japonica var. chinensis. It provide a basis for gene regulate the formation of L. japonica floral scents. The cDNA and genome sequences of LjSABATHMT from L. japonica var. chinensis were cloned according to the gene fragments in cDNA library. The LjSABATHMT protein was characterized by bioinformatics analysis. SABATH family phylogenetic tree were built by MEGA 5.0. The transcripted level of SABATHMT orthologous were analyzed in different organs and different flower periods of L. japonica and L. japonica var. chinensis using RT-PCR analysis. Intron sequences of SABATHMT orthologous were also analyzied. The cDNA of LjSABATHMT was 1 251 bp, had a complete coding frame with 365 amino acids. The protein had the conservative SABATHMT domain, and phylogenetic tree showed that it may be a salicylic acid/benzoic acid methyltransferase. Higher expression of SABATH methyltransferase orthologous was found in flower. The intron sequence of L. japonica and L. japonica var. chinensis had rich polymorphism, and two SNP are unique genotype of L. japonica var. chinensis. The motif elements in two orthologous genes were significant differences. The intron difference of SABATH methyltransferase orthologous could be inducing to difference of gene expression between L. japonica and L. japonica var. chinensis. These results will provide important base on regulating active compounds of L. japonica.

  13. Influence of LAR and VAR on Para-Aminopyridine Antimalarials Targetting Haematin in Chloroquine-Resistance.

    Science.gov (United States)

    Warhurst, David C; Craig, John C; Raheem, K Saki

    2016-01-01

    Antimalarial chloroquine (CQ) prevents haematin detoxication when CQ-base concentrates in the acidic digestive vacuole through protonation of its p-aminopyridine (pAP) basic aromatic nitrogen and sidechain diethyl-N. CQ export through the variant vacuolar membrane export channel, PFCRT, causes CQ-resistance in Plasmodium falciparum but 3-methyl CQ (sontochin SC), des-ethyl amodiaquine (DAQ) and bis 4-aminoquinoline piperaquine (PQ) are still active. This is determined by changes in drug accumulation ratios in parasite lipid (LAR) and in vacuolar water (VAR). Higher LAR may facilitate drug binding to and blocking PFCRT and also aid haematin in lipid to bind drug. LAR for CQ is only 8.3; VAR is 143,482. More hydrophobic SC has LAR 143; VAR remains 68,523. Similarly DAQ with a phenol substituent has LAR of 40.8, with VAR 89,366. In PQ, basicity of each pAP is reduced by distal piperazine N, allowing very high LAR of 973,492, retaining VAR of 104,378. In another bis quinoline, dichlorquinazine (DCQ), also active but clinically unsatisfactory, each pAP retains basicity, being insulated by a 2-carbon chain from a proximal nitrogen of the single linking piperazine. While LAR of 15,488 is still high, the lowest estimate of VAR approaches 4.9 million. DCQ may be expected to be very highly lysosomotropic and therefore potentially hepatotoxic. In 11 pAP antimalarials a quadratic relationship between logLAR and logResistance Index (RI) was confirmed, while log (LAR/VAR) vs logRI for 12 was linear. Both might be used to predict the utility of structural modifications.

  14. Alastrim, varíola é? Is allastrim small pox?

    Directory of Open Access Journals (Sweden)

    Luiz Antonio Teixeira

    2000-06-01

    Full Text Available Este artigo trata de uma controvérsia científica havida em São Paulo entre 1910 e 1913, que opôs dois destacados médicos da cidade: Antonio Carini, diretor do Instituto Pasteur de São Paulo, e Emílio Ribas, diretor do Serviço Sanitário. A questão em jogo era a classificação de uma doença que reinava no estado. Para Carini tratava-se de varíola, para Ribas era uma entidade mórbida chamada de alastrim. A polêmica teve início na Sociedade de Medicina e Cirurgia e, posteriormente, migrou para outros fóruns, incorporando novos personagens. A apresentação e discussão dessa controvérsia objetiva contribuiu para a compreensão do processo de construção e estabilização de um consenso científico no campo das ciências biomédicas.Between 1910 and 1913, two renowned physicians in the city of São Paulo found themselves engaged in a scientific controversy regarding the classification of a disease then assailing the state. Antonio Carini, director of the Instituto Pasteur de São Paulo, believed the illness to be small pox, while Emílio Ribas, director of the Serviço Sanitário, claimed it was allastrim, or milk pox. The controversy started in the Sociedade de Medicina e Cirurgia but later migrated to other forums and came to incorporate other figures as well. This presentation and discussion of the polemic is meant as a contribution to our understanding of the process by which a scientific consensus is constructed and solidified within the field of the biomedical sciences.

  15. [Micromorphology of pejibaye leaflets Bactris gasipaes (Arecaceae) var. diamonds-10].

    Science.gov (United States)

    Sánchez-Chacón, Ethel; Alvarado-Rodríguez, Olman; Rodríguez-Arrieta, Alexander; Gómez-Alpízar, Luis

    2016-09-01

    Bactris gasipaes is widely cultivated for the consumption of palm hearts and fruits. The present work describes the micro morphological characteristics of leaflets from adult plants of B. gasipaes, thornless variety Diamantes-10, collected in the Diamantes Experimental Station in Guápiles, Costa Rica. We collected 25 leaflets and analyses were performed with a combination of microscopy techniques: light microscopy, scanning electron microscopy and transmission electron microscopy to study their structure. Our results showed that leaflets have abundant epicuticular wax on adaxial and abaxial surfaces. Analyses from the epidermis indicated that it is composed of isodiametric cells, and it is also evident that hypodermis cells have rectangular shape and are larger than the other epidermal cells. We observed stomata on both surfaces, but they were more abundant in the abaxial surface. On the other hand, the epidermis showed the presence of trichomes with three different morphologies. In the parenchyma, cells are large and not well defined, and we observed the presence of astroesclereids, and compact groups of fiber bundles between parenchyma cells. The central vein has several vascular bundles, arranged in a continuous manner, and they are surrounded by sclerotic tissue; some of these fibers presented live protoplasts. All minor veins showed the same anatomy as the central vein. In these veins, the vessel elements of protoxylem and metaxylem showed scalariform ornaments on their walls. Phloem is located towards the adaxial surface of the vein and we observed sieve and companion cells surrounded by fibers and parenchyma cells. The companion cells presented branched plasmodesmata attached to a sieve element, and in these elements we found protein bodies called P-protein. The main anatomical difference in the leaflets of the var. Diamantes-10, compared to the other varieties of B. gasipaes K, is the lack of thorns; the other morphological features seem to be conserved.

  16. Chemical Constituents from Solanum glabratum Dunal var. sepicula

    Directory of Open Access Journals (Sweden)

    Essam Abdel-Sattar

    2015-01-01

    Full Text Available In the course of screening program of Saudi plants for their potential biological activity, the methanolic extract of Solanum glabratum Dunal var. sepicula as well as its different fractions were tested for its possible cytoxicity in prostate cancer (PC3 and colon cancer (HT29 cell lines using the MTT assay. In the present study, three spirostan saponins and one flavonoid glycoside were isolated from the active n-butanol fraction through a bio-guided fractionation approach. Two new saponin glycosides were identified as 23-β-D-glucopyranosyl (23S, 25R-spirost-5-en-3, 23 diol 3-O-α-L-rhamnopyranosyl-(1→2-O-[α-L-rhamnopyranosyl-(1→4]-β-D-glucopyranoside (2 and (25R-spirost-5-en-3-ol 3-O-α-L-rhamnopyranosyl-(1→2-O-[β-D-glucopyranosyl-(1→3]-β-D-galactopyranoside (3. In addition, two known compounds were also isolated and identified as isorhamnetin-3-O-α-L-rhamnopyranosyl (1→6 β-D-glucopyranoside (1 and (23S, 25R-spirost-5-en-3, 23 diol 3-O-α-L-rhamnopyranosyl-(1→2-O-[α-L-rhamnopyranosyl-(1→4]-β-D-glucopyranoside (4. The structures of the isolated compounds were elucidated based on their MS, one dimensional and extensive two dimensional NMR spectral data. Among the isolated metabolites, compound 3 showed the highest cytotoxic activity in both PC3 and HT29 cell lines with an IC 50 values of 14.8 and 19.5 m g/mL, respectively.

  17. Inheritance of bacterial spot resistance in Capsicum annuum var. annuum.

    Science.gov (United States)

    Silva, L R A; Rodrigues, R; Pimenta, S; Correa, J W S; Araújo, M S B; Bento, C S; Sudré, C P

    2017-04-20

    Since 2008, Brazil is the largest consumer of agrochemicals, which increases production costs and risks of agricultural products, environment, and farmers' contamination. Sweet pepper, which is one of the main consumed vegetables in the country, is on top of the list of the most sprayed crops. The bacterial spot, caused by Xanthomonas spp, is one of the most damaging diseases of pepper crops. Genetic resistant consists of a suitable way of disease control, but development of durable resistant cultivars as well as understanding of plant-bacterium interaction is being a challenge for plant breeders and pathologists worldwide. Inheritance of disease resistance is often variable, depending on genetic background of the parents. The knowledge of the genetic base controlling such resistance is the first step in a breeding program aiming to develop new genotypes, bringing together resistance and other superior agronomic traits. This study reports the genetic basis of bacterial spot resistance in Capsicum annuum var. annuum using mean generation analysis from crosses between accessions UENF 2285 (susceptible) and UENF 1381 (resistant). The plants of each generation were grown in a greenhouse and leaflets were inoculated with bacterial strain ENA 4135 at 10 5 CFU/mL in 1.0 cm 2 of the mesophyll. Evaluations were performed using a scoring scale whose grades ranged from 1.0 (resistant) to 5.0 (susceptible), depending on symptom manifestation. Genetic control of bacterial spot has a quantitative aspect, with higher additive effect. The quantitative analysis showed that five genes were the minimum number controlling bacterial spot resistance. Additive effect was higher (6.06) than dominant (3.31) and explained 86.36% of total variation.

  18. VAR Portfolio Optimal: Perbandingan Antara Metode Markowitz dan Mean Absolute Deviation

    Directory of Open Access Journals (Sweden)

    R. Agus Sartono

    2009-05-01

    Full Text Available Portfolio selection method which have been introduced by Harry Markowitz (1952 used variance or deviation standard as a measure of risk. Kanno and Yamazaki (1991 introduced another method and used mean absolute deviation as a measure of risk instead of variance. The Value-at Risk (VaR is a relatively new method to capitalized risk that been used by financial institutions. The aim of this research is compare between mean variance and mean absolute deviation of two portfolios. Next, we attempt to assess the VaR of two portfolios using delta normal method and historical simulation. We use the secondary data from the Jakarta Stock Exchange – LQ45 during 2003. We find that there is a weak-positive correlation between deviation standard and return in both portfolios. The VaR nolmal delta based on mean absolute deviation method eventually is higher than the VaR normal delta based on mean variance method. However, based on the historical simulation the VaR of two methods is statistically insignificant. Thus, the deviation standard is sufficient measures of portfolio risk.Keywords: optimalisasi portofolio, mean-variance, mean-absolute deviation, value-at-risk, metode delta normal, metode simulasi historis

  19. Population genomics of the immune evasion (var genes of Plasmodium falciparum.

    Directory of Open Access Journals (Sweden)

    Alyssa E Barry

    2007-03-01

    Full Text Available Var genes encode the major surface antigen (PfEMP1 of the blood stages of the human malaria parasite Plasmodium falciparum. Differential expression of up to 60 diverse var genes in each parasite genome underlies immune evasion. We compared the diversity of the DBLalpha domain of var genes sampled from 30 parasite isolates from a malaria endemic area of Papua New Guinea (PNG and 59 from widespread geographic origins (global. Overall, we obtained over 8,000 quality-controlled DBLalpha sequences. Within our sampling frame, the global population had a total of 895 distinct DBLalpha "types" and negligible overlap among repertoires. This indicated that var gene diversity on a global scale is so immense that many genomes would need to be sequenced to capture its true extent. In contrast, we found a much lower diversity in PNG of 185 DBLalpha types, with an average of approximately 7% overlap among repertoires. While we identify marked geographic structuring, nearly 40% of types identified in PNG were also found in samples from different countries showing a cosmopolitan distribution for much of the diversity. We also present evidence to suggest that recombination plays a key role in maintaining the unprecedented levels of polymorphism found in these immune evasion genes. This population genomic framework provides a cost effective molecular epidemiological tool to rapidly explore the geographic diversity of var genes.

  20. Antidepressant-like Effect of Kaempferol and Quercitirin, Isolated from Opuntia ficus-indica var. saboten.

    Science.gov (United States)

    Park, Soo-Hyun; Sim, Yun-Beom; Han, Pyung-Lim; Lee, Jin-Koo; Suh, Hong-Won

    2010-06-01

    Opuntia ficus-indica var. saboten. is widely cultivated in Jeju Island (South Korea) for use in manufacture of health foods. This study described antidepressant effect of two flavonoids (kaempferol and quercitrin) isolated from the Opuntia ficus-indica var. saboten. The expression of the hypothalamic POMC mRNA or plasma β-endorphin levels were increased by extract of Opuntia ficus-indica var. saboten or its flavoniods administered orally. In addition, antidepressant activity was studied using tail suspension test (TST), forced swimming test (FST) and rota-rod test in chronically restraint immobilization stress group in mice. After restraint stress (2 hrs/day for 14 days), animals were kept in cage for 14 days without any further stress, bet with drugs. Mice were fed with a diet supplemented for 14 days and during the behavioral test period with kaempferol or quercitrin (30 mg/kg/day). POMC mRNA or plasma β-endorphin level was increased by extract of Opuntia ficus-indica var. saboten and its flavoniods. In addition, immobility time in TST and FST was significantly reduced by kaempferol or quercitrin. In rota-rod test, the time of permanence was maintained to the semblance of control group in turning at 15 rpm. Our results suggest that two flavonoids (kaempferol and quercitrin) isolated from the Opuntia ficus-indica var. saboten. show a potent antidepressant effect.

  1. Antidepressant-like Effect of Kaempferol and Quercitirin, Isolated from Opuntia ficus-indica var. saboten

    Science.gov (United States)

    Park, Soo-Hyun; Sim, Yun-Beom; Han, Pyung-Lim; Lee, Jin-Koo

    2010-01-01

    Opuntia ficus-indica var. saboten. is widely cultivated in Jeju Island (South Korea) for use in manufacture of health foods. This study described antidepressant effect of two flavonoids (kaempferol and quercitrin) isolated from the Opuntia ficus-indica var. saboten. The expression of the hypothalamic POMC mRNA or plasma β-endorphin levels were increased by extract of Opuntia ficus-indica var. saboten or its flavoniods administered orally. In addition, antidepressant activity was studied using tail suspension test (TST), forced swimming test (FST) and rota-rod test in chronically restraint immobilization stress group in mice. After restraint stress (2 hrs/day for 14 days), animals were kept in cage for 14 days without any further stress, bet with drugs. Mice were fed with a diet supplemented for 14 days and during the behavioral test period with kaempferol or quercitrin (30 mg/kg/day). POMC mRNA or plasma β-endorphin level was increased by extract of Opuntia ficus-indica var. saboten and its flavoniods. In addition, immobility time in TST and FST was significantly reduced by kaempferol or quercitrin. In rota-rod test, the time of permanence was maintained to the semblance of control group in turning at 15 rpm. Our results suggest that two flavonoids (kaempferol and quercitrin) isolated from the Opuntia ficus-indica var. saboten. show a potent antidepressant effect. PMID:22110339

  2. PERHITUNGAN VaR PORTOFOLIO SAHAM MENGGUNAKAN DATA HISTORIS DAN DATA SIMULASI MONTE CARLO

    Directory of Open Access Journals (Sweden)

    WAYAN ARTHINI

    2012-09-01

    Full Text Available Value at Risk (VaR is the maximum potential loss on a portfolio based on the probability at a certain time.  In this research, portfolio VaR values calculated from historical data and Monte Carlo simulation data. Historical data is processed so as to obtain stock returns, variance, correlation coefficient, and variance-covariance matrix, then the method of Markowitz sought proportion of each stock fund, and portfolio risk and return portfolio. The data was then simulated by Monte Carlo simulation, Exact Monte Carlo Simulation and Expected Monte Carlo Simulation. Exact Monte Carlo simulation have same returns and standard deviation  with historical data, while the Expected Monte Carlo Simulation satistic calculation similar to historical data. The results of this research is the portfolio VaR  with time horizon T=1, T=10, T=22 and the confidence level of 95 %, values obtained VaR between historical data and Monte Carlo simulation data with the method exact and expected. Value of VaR from both Monte Carlo simulation is greater than VaR historical data.

  3. Value at risk (VaR in uncertainty: Analysis with parametric method and black & scholes simulations

    Directory of Open Access Journals (Sweden)

    Humberto Banda Ortiz

    2014-07-01

    Full Text Available VaR is the most accepted risk measure worldwide and the leading reference in any risk management assessment. However, its methodology has important limitations which makes it unreliable in contexts of crisis or high uncertainty. For this reason, the aim of this work is to test the VaR accuracy when is employed in contexts of volatility, for which we compare the VaR outcomes in scenarios of both stability and uncertainty, using the parametric method and a historical simulation based on data generated with the Black & Scholes model. VaR main objective is the prediction of the highest expected loss for any given portfolio, but even when it is considered a useful tool for risk management under conditions of markets stability, we found that it is substantially inaccurate in contexts of crisis or high uncertainty. In addition, we found that the Black & Scholes simulations lead to underestimate the expected losses, in comparison with the parametric method and we also found that those disparities increase substantially in times of crisis. In the first section of this work we present a brief context of risk management in finance. In section II we present the existent literature relative to the VaR concept, its methods and applications. In section III we describe the methodology and assumptions used in this work. Section IV is dedicated to expose the findings. And finally, in Section V we present our conclusions.

  4. [Diversity and community structure of endophytic fungi from Taxus chinensis var. mairei].

    Science.gov (United States)

    2014-07-01

    A total of 628 endophytic fungi were isolated from 480 tissue segments of needles and branches of Taxus chinensis var. mairei. According to morphological characteristics and ITS sequences, they represented 43 taxa in 28 genera, of which 10 Hyphomycetes, 20 Coelomycetes, 12 Ascomycetes and 1 unknown fungus. Phomopsis mali was confirmed as the dominant species. In accordance with relative frequency, Alternaria alternata, Aureobasidium pullulans, Colletotrichum boninense, C. gloeosporioides, Epicoccum nigrum , Fungal sp., Fusarium lateritium, Glomerella cingulata, Magnaporthales sp. , Nigrospora oryzae, Pestalotiopsis maculiformans, P. microspora, Peyronellaea glomerata and Xylaria sp. 1 were more common in T. chinensis var. mairei. T. chinensis var. mairei were severely infected by endophytic fungi. Endophytic fungi were found in 81 percent of plant tissues with a high diversity. Distribution ranges of endophytic fungi were influenced by tissue properties. The colonization rate, richness, diversity of endophytic fungi in needles were obviously lower than in branches, and kinds of endophytic fungi between branches were more similar than those in needles, thus endophytic fungi had tissue preference. In addition, tissue age influenced the community structure of endophytic fungi. The elder branch tissues were, the higher colonization rate, richness, diversity of endophytic fungi were. Systematic studying the diversity and community structure of endophytic fungi in T. chinensis var. mairei and clarifying their distribution regularity in plant tissues would offer basic data and scientific basis for their development and utilization. Discussing the presence of fungal pathogens in healthy plant tissues would be of positive significance for source protection of T. chinensis var. mairei.

  5. Testing popular VaR models in EU new member and candidate states

    Directory of Open Access Journals (Sweden)

    Saša Žiković

    2007-12-01

    Full Text Available The impact of allowing banks to calculate their capital requirement based on their internal VaR models, and the impact of regulation changes on banks in transitional countries has not been well studied. This paper examines whether VaR models that are created and suited for developed markets apply to the volatile stock markets of EU new member and candidate states (Bulgaria, Romania, Croatia and Turkey. Nine popular VaR models are tested on five stock indexes from EU new member and candidate states. Backtesting results show that VaR models commonly used in developed stock markets are not well suited for measuring market risk in these markets. Presented findings bear very important implications that have to be addressed by regulators and risk practitioners operating in EU new member andcandidate states. Risk managers have to start thinking outside the frames set by their parent companies or else investors present in these markets may find themselves in serious trouble, dealing with losses that they have not been expecting. National regulators have to take into consideration that simplistic VaR models that are widely used in some developed countries are not well suited for these illiquid and developing stock markets.

  6. VarR controls colonization and virulence in the marine macroalgal pathogen Nautella italica R11

    Directory of Open Access Journals (Sweden)

    Melissa eGardiner

    2015-10-01

    Full Text Available There is increasing evidence to suggest that macroalgae (seaweeds are susceptible to infectious disease. However, to date, little is known about the mechanisms that facilitate the colonization and virulence of microbial seaweed pathogens. One well-described example of a seaweed disease is the bleaching of the red alga Delisea pulchra, which can be caused by the bacterium Nautella italica R11, a member of the Roseobacter clade. This pathogen contains a unique luxR-type gene, varR, which we hypothesize controls its colonization and virulence. We show here that a varR knock-out strain is deficient in its ability to cause disease in D. pulchra and is defective in biofilm formation and attachment to a common algal polysaccharide. Moreover complementation of the varR gene in trans can restore these functions to the wild type levels. Proteomic analysis of bacterial cells in planktonic and biofilm growth highlight the potential importance of nitrogen scavenging, mobilization of energy reserves, and stress resistance in the biofilm lifestyle of N. italica R11. Moreover, we show that VarR regulates the expression of a specific subset of biofilm-associated proteins. Taken together these data suggest that VarR controls colonization and persistence of N. italica R11 on the surface of a macroalgal host and that it is an important regulator of virulence.

  7. Evidence of strain structure in Plasmodium falciparum var gene repertoires in children from Gabon, West Africa.

    Science.gov (United States)

    Day, Karen P; Artzy-Randrup, Yael; Tiedje, Kathryn E; Rougeron, Virginie; Chen, Donald S; Rask, Thomas S; Rorick, Mary M; Migot-Nabias, Florence; Deloron, Philippe; Luty, Adrian J F; Pascual, Mercedes

    2017-05-16

    Existing theory on competition for hosts between pathogen strains has proposed that immune selection can lead to the maintenance of strain structure consisting of discrete, weakly overlapping antigenic repertoires. This prediction of strain theory has conceptual overlap with fundamental ideas in ecology on niche partitioning and limiting similarity between coexisting species in an ecosystem, which oppose the hypothesis of neutral coexistence. For Plasmodium falciparum , strain theory has been specifically proposed in relation to the major surface antigen of the blood stage, known as Pf EMP1 and encoded by the multicopy multigene family known as the var genes. Deep sampling of the DBLα domain of var genes in the local population of Bakoumba, West Africa, was completed to define whether patterns of repertoire overlap support a role of immune selection under the opposing force of high outcrossing, a characteristic of areas of intense malaria transmission. Using a 454 high-throughput sequencing protocol, we report extremely high diversity of the DBLα domain and a large parasite population with DBLα repertoires structured into nonrandom patterns of overlap. Such population structure, significant for the high diversity of var genes that compose it at a local level, supports the existence of "strains" characterized by distinct var gene repertoires. Nonneutral, frequency-dependent competition would be at play and could underlie these patterns. With a computational experiment that simulates an intervention similar to mass drug administration, we argue that the observed repertoire structure matters for the antigenic var diversity of the parasite population remaining after intervention.

  8. Subcellular distribution and chemical forms of thorium in Brassica juncea var. foliosa.

    Science.gov (United States)

    Zhou, Sai; Kai, Hailu; Zha, Zhongyong; Fang, Zhendong; Wang, Dingna; Du, Liang; Zhang, Dong; Feng, Xiaojie; Jin, Yongdong; Xia, Chuanqin

    2016-06-01

    Brassica juncea var. foliosa (B. juncea var. foliosa) is a promising species for thorium (Th) phytoextraction due to its large biomass, fast growth rate and high tolerance toward Th. To further understand the mechanisms of Th tolerance, the present study investigated the subcellular distribution and chemical forms of Th found in B. juncea var. foliosa Our results indicated that in both roots and leaves, Th contents in different parts of the cells follow the order of cell wall > membranes and soluble fraction > organelles. In particular, Transmission Electron Microscope (TEM) analysis showed that Th was abundantly located in cell walls of the roots. Additionally, when plants were exposed to different concentrations of Th, we have found that Th existed in B. juncea var. foliosa with different chemical forms. Much of the Th extracted by 2% acetic acid (HAc), 1 M NaCl and HCl in roots with the percentage distribution varied from 47.2% to 62.5%, while in leaves, most of the Th was in the form of residue and the subdominant amount of Th was extracted by HCl, followed by 2% HAc. This suggested that Th compartmentation in cytosol and integration with phosphate or proteins in cell wall might be responsible for the tolerance of B. juncea var. foliosa to the stress of Th. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Genome-wide analysis of SU(VAR)3-9 distribution in chromosomes of Drosophila melanogaster.

    Science.gov (United States)

    Maksimov, Daniil A; Laktionov, Petr P; Posukh, Olga V; Belyakin, Stepan N; Koryakov, Dmitry E

    2018-03-01

    Histone modifications represent one of the key factors contributing to proper genome regulation. One of histone modifications involved in gene silencing is methylation of H3K9 residue. Present in the chromosomes across different eukaryotes, this epigenetic mark is controlled by SU(VAR)3-9 and its orthologs. Despite SU(VAR)3-9 was discovered over two decades ago, little is known about the details of its chromosomal distribution pattern. To fill in this gap, we used DamID-seq approach and obtained high-resolution genome-wide profiles for SU(VAR)3-9 in two somatic (salivary glands and brain ganglia) and two germline (ovarian nurse cells and testes) tissues of Drosophila melanogaster. Analysis of tissue and developmental expression of SU(VAR)3-9-bound genes indicates that in the somatic tissues tested, as well as in the ovarian nurse cells, SU(VAR)3-9 tends to associate with transcriptionally silent genes. In contrast, in the testes, SU(VAR)3-9 shows preferential association with testis-specific genes, and its binding appears dynamic during spermatogenesis. In somatic cells, the mere presence/absence of SU(VAR)3-9 binding correlates with lower/higher expression. No such correlation is found in the male germline. Interestingly, transcription units in piRNA clusters (particularly flanks thereof) are frequently targeted by SU(VAR)3-9, and Su(var)3-9 mutation affects the expression of select piRNA species. Our analyses suggest a context-dependent role of SU(VAR)3-9. In euchromatin, SU(VAR)3-9 may serve to fine-tune the expression of individual genes, whereas in heterochromatin, chromosome 4, and piRNA clusters, it may act more broadly over large chromatin domains.

  10. Composição mineral de uma linhagem de Pleurotus ostreatus cultivada em resíduos madeireiros e agroindustriais da região amazônica Mineral composition of Pleurotus ostreatus strain grown in wood and agroindustrial residues from the Amazon region

    Directory of Open Access Journals (Sweden)

    Ceci Sales-Campos

    2009-12-01

    Full Text Available Os cogumelos do gênero Pleurotus são cultivados em diversos substratos lignocelulósicos, dada a atividade decompositora desses organismos proveniente de seu metabolismo enzimático. O presente estudo teve como objetivo analisar a composição mineral de Pleurotus ostreatus e dos substratos de cultivo preparados à base de resíduos madeireiros e agroindustriais da região amazônica. Foram analisados macro (P, K, Ca e Mg e micronutrientes (Fe, Zn, Cu, Mn e Na dos cogumelos e dos substratos. Os substratos foram formulados a partir da serragem de Simarouba amara Aubl. (marupá, Ochroma piramidale Cav. ex. Lam. (pau de balsa e de bagaços de Bactris gasipaes Kunth (pupunheira e de Saccharum officinarum (cana-de-açúcar. As amostras foram solubilizadas mediante digestão ácida (nítrico-peridrol. Os elementos Ca, Mg, Fe, Cu, Zn e Mn foram determinados por espectrometria de absorção atômica; o Na e K, por emissão atômica e o P, por colorimetria. A composição mineral do cogumelo variou com o substrato de cultivo. Os diferentes substratos possibilitaram a produção de um cogumelo rico em K, P, Mg e Fe, essenciais à nutrição e à saúde humana. O potássio foi o mineral de maior teor no cogumelo em todos os substratos testados (36,83-42,18 g.kg-1, seguido de fósforo (6,95-10,60 g.kg-1 e do magnésio (1,57-2,50 g.kg-1.Mushrooms belonging to the Pleurotus gender are grown in several lignocellulosic substrates due to the decomposing activity of these organisms that result from their enzymatic metabolism. The objective of the present study was to analyze the mineral composition of Pleurotus ostreatus and the cultivation substrates prepared with wood and agroindustrial residues from the Amazon region. Macro (P, K, Ca and Mg and micronutrients (Fe, Zn, Cu, Mn and Na of mushroom and substrates were analyzed. Substrates were formulated from Simarouba amara Aubl. and Ochroma piramidale Cav. ex. Lam. sawdust and crushed Bactris gasipaes Kunth

  11. Edible mushroom Pleurotus sajor-caju production on washed and supplemented sugarcane bagasse Produção do cogumelo comestível Pleurotus sajor-caju em bagaço de cana-de-açúcar lavado e suplementado

    Directory of Open Access Journals (Sweden)

    Evelise Moncaio Moda

    2005-04-01

    Full Text Available Traditionally, the cultivation of Pleurotus sajor-caju is performed on different composted and pasteurized agricultural residues. The objective of this study was to investigate whether traditional composting and pasteurization processes could be replaced by washed and supplemented (mineral or organic sugarcane bagasse. In one experiment, fresh sugarcane bagasse was immersed in hot water at 80°C for two hours (control or washed in fresh water for one hour using an adapted machine for residue treatment. In another experiment, fresh sugarcane bagasse was washed in fresh water (control, and supplemented with corn grits (organic supplementation, or supplemented with nutrient solution (mineral supplementation. In the first experiment, the washed bagasse presented a average biological efficiency (ABE of 19.16% with 44% contamination, and the pasteurized bagasse presented a ABE of 13.86% with 70% contamination. In the second experiment, corn grits presented the poorest performance, with a ABE of 15.66% and 60% contamination, while supplementation with the nutrient solution presented a ABE of 30.03%, whereas the control of 26.62%. Washing fresh sugarcane bagasse could suppress the pasteurized substrate in Pleurotus sajor-caju production, compensating a reduced ABE with a faster process.Tradicionalmente, o cultivo do Pleurotus sajor-caju é realizado utilizando-se diversos resíduos agrícolas, precedido dos processos de compostagem e pasteurização. O presente trabalho teve por objetivo comparar o processo de pasteurização com a lavagem do bagaço de cana-de-açúcar e avaliar formas de suplementação do bagaço, visando aumento na produtividade. No primeiro experimento, os colmos da cana-de-açúcar passaram por moenda para a extração do caldo, sendo em seguida desfibrados. No tratamento controle, o bagaço fresco foi pasteurizado em água a 80°C durante 2 horas e o outro tratamento consistiu na lavagem do bagaço fresco em centrífuga com

  12. Effect of the irradiation on Salmonella enteretidis var. typhimurium with gamma rays from 60Co

    International Nuclear Information System (INIS)

    Maliska, C.; Norberg, A.N.; Norberg, J.B.M.; Santos Souza, R.C. dos; Silva Tavares, P.R. da

    1988-01-01

    The use of ionizinf radiation to the destruction of microrganisms responsible for food deterioration, and productive of feeding toxinfections constitute their usefulness for actually peaceful goals of nuclear energy. The feeding toxinfections are, among us, produced in their most part by Salmonella enteritidis var. typhimurim. One hundred nineteen samples of milk containing about 150.000 bacteria per ml, by means doses ranging from 100 to 1.100 gy, two samples of surviving bacteria were again irradiated by doses up to 2.5000 Gy. The bacteria not previously irradiated were throughly killed by means of doses of 1.100 Gy. Salmonella enteritidis var. typhimurium was inactivated by means of 1.200 and 1.900 Gy doses. It was concluded that 60-Cobalt gamma radiation minimal lethal dose to Salmonella enteritidis var. typhimurium is 1.200 Gy; the re-irradiation to the survivors prompts the forthcoming of more resistant germs. (author) [pt

  13. High avidity antibodies to full-length VAR2CSA correlate with absence of placental malaria

    DEFF Research Database (Denmark)

    Tutterrow, Yeung Lo; Salanti, Ali; Avril, Marion

    2012-01-01

    VAR2CSA mediates sequestration of Plasmodium falciparum-infected erythrocytes in the placenta, increasing the risk of poor pregnancy outcomes. Naturally acquired antibodies (Ab) to placental parasites at delivery have been associated with improved pregnancy outcomes, but Ab levels and how early...... in pregnancy Ab must be present in order to eliminate placental parasites before delivery remains unknown. Antibodies to individual Duffy-binding like domains of VAR2CSA have been studied, but the domains lack many of the conformational epitopes present in full-length VAR2CSA (FV2). Thus, the purpose...... of this study was to describe the acquisition of Ab to FV2 in women residing in high and low transmission areas and determine how Ab levels during pregnancy correlate with clearance of placental parasites. Plasma samples collected monthly throughout pregnancy from pregnant women living in high and low...

  14. Tamarix arborea var. arborea and Tamarix parviflora: Two species valued for their adaptability to stress conditions.

    Science.gov (United States)

    Grisafi, Francesca; Oddo, Elisabetta; Gargano, Maria Letizia; Inzerillo, Simone; Russo, Gianni; Venturella, Giuseppe

    2016-03-01

    The choice of stress resistant and highly adaptable species is a fundamental step for landscaping and ornamental purposes in arid and coastal environments such as those in the Mediterranean basin. The genus Tamarix L. includes about 90 species with a high endurance of adversity. We investigated the water relations and photosynthetic response of Tamarix arborea (Sieb. ex Ehrenb.) Bge. var. arborea and T. parviflora DC. growing in an urban environment. Both species showed no evidence of drought or salt stress in summer, and appeared to follow two strategies with T. arborea var. arborea investing in high carbon gain at the beginning of the summer, and then reducing photosynthetic activity at the end of the season, and T. parviflora showing lower but constant levels of photosynthetic activity throughout the vegetative season. For landscaping and ornamental purposes, we suggest T. arborea var. arborea when a fast-growing, high-cover species is necessary, and T. parviflora when less-invasive species are required.

  15. Application of static var compensator on large synchronous motors based on linear optimization control design

    International Nuclear Information System (INIS)

    Soltani, J.; Fath Abadi, A.M.

    2003-01-01

    This paper describes the application of static var compensators, on an electrical distribution network containing two large synchronous motors, one of which is excited via a three-phase thyristor bridge rectifier. The second machine is excited via a diode bridge rectifier. Based on linear optimization control, the measurable feedback signals are applied to the control system loops of static var compensators and the excitation control loop of the first synchronous motor. The phase equations method was used to develop a computer program to model the distribution network. Computer results were obtained to demonstrate the system performance for some abnormal modes of operation. These results show that employing static var compensators based on the linear optimization control design for electrical distribution networks containing large synchronous motors is beneficial and may be considered a first stage of the system design

  16. The Burr X Pareto Distribution: Properties, Applications and VaR Estimation

    Directory of Open Access Journals (Sweden)

    Mustafa Ç. Korkmaz

    2017-12-01

    Full Text Available In this paper, a new three-parameter Pareto distribution is introduced and studied. We discuss various mathematical and statistical properties of the new model. Some estimation methods of the model parameters are performed. Moreover, the peaks-over-threshold method is used to estimate Value-at-Risk (VaR by means of the proposed distribution. We compare the distribution with a few other models to show its versatility in modelling data with heavy tails. VaR estimation with the Burr X Pareto distribution is presented using time series data, and the new model could be considered as an alternative VaR model against the generalized Pareto model for financial institutions.

  17. INDUCING RESISTANCE IN COTTON AGAINST COLLETOTRICHUM GOSSYPII VAR. CEPHALOSPORIOIDES WITH ESSENTIAL OILS

    Directory of Open Access Journals (Sweden)

    B. T. Santos

    2016-11-01

    Full Text Available This study aimed to evaluate the potential of essential oils of rosemary (Rosmarinus officinalis, baccharis (Baccharis trimera, lemon grass (Cymbopogon citratus, basil (Ocimum basilicum and eucalyptus (Corymbia citriodora in inducing resistance in cotton plants against C. gossypii var. cephalosporioides. The inductive effect of the essential oils was evaluated in plants growing in pots in the environment, which were treated with 1% essential oil at 47 days of age. 24 hours after elicitor treatment the plants were inoculated with a suspension of 1.5 x 105 conidia mL-1 of C. gossypii var. cephalosporioides. Five evaluations were performed disease and calculated the area under the disease progress curve. All essential oils showed potential for inducing resistance against cotton C. gossypii var. cephalosporioides.

  18. RBF neural network prediction on weak electrical signals in Aloe vera var. chinensis

    Science.gov (United States)

    Wang, Lanzhou; Zhao, Jiayin; Wang, Miao

    2008-10-01

    A Gaussian radial base function (RBF) neural network forecast on signals in the Aloe vera var. chinensis by the wavelet soft-threshold denoised as the time series and using the delayed input window chosen at 50, is set up to forecast backward. There was the maximum amplitude at 310.45μV, minimum -75.15μV, average value -2.69μV and Aloe vera var. chinensis respectively. The electrical signal in Aloe vera var. chinensis is a sort of weak, unstable and low frequency signals. A result showed that it is feasible to forecast plant electrical signals for the timing by the RBF. The forecast data can be used as the preferences for the intelligent autocontrol system based on the adaptive characteristic of plants to achieve the energy saving on the agricultural production in the plastic lookum or greenhouse.

  19. Identification and characterization of microsatellite markers in Pinus kesiya var. langbianensis (Pinaceae).

    Science.gov (United States)

    Cai, Nian-Hui; Xu, Yu-Lan; Wang, Da-Wei; Chen, Shi; Li, Gen-Qian

    2017-02-01

    Microsatellite primers were developed in Pinus kesiya var. langbianensis (Pinaceae), a species native to southwestern China, to investigate its genetic diversity and population structure in order to provide information for the conservation and management of this species. Using next-generation sequencing, a total of 2349 putative simple sequence repeat primer pairs were designed. Eighteen polymorphic markers in 60 individuals belonging to four populations of P. kesiya var. langbianensis were identified and characterized with two to 11 alleles per locus. The observed and expected heterozygosity ranged from 0.000 to 0.800 and 0.000 to 0.840, respectively. Each of these loci cross-amplified in the closely related species P. massoniana , P. densata , P. tabuliformis , and P. yunnanensis , with one to seven alleles per locus. The new markers are promising tools to study the population genetics of P. kesiya var. langbianensis and related species.

  20. Dynamics of anti-VAR2CSA immunoglobulin G response in a cohort of senegalese pregnant women

    DEFF Research Database (Denmark)

    Tuikue Ndam, N G; Salanti, A; Le-Hesran, J-Y

    2006-01-01

    demonstrated that a single P. falciparum infection was able to trigger a VAR2CSA-specific antibody response. Among women with infected placentas, women with high anti-VAR2CSA IgG levels at enrollment were more likely to present with a past infection than with an acute/chronic infection. CONCLUSIONS: Anti-VAR2...... (VSAPAM). Several studies have shown that 1 var gene, var2csa, is transcribed at high levels and expressed in CSA-binding Plasmodium falciparum parasites. METHODS: Plasma levels of anti-VAR2CSA immunoglobulin G (IgG) in Senegalese women were measured during pregnancy by enzyme-linked immunosorbent assay......, using 3 recombinant proteins representing 3 domains of the var2csa gene product. RESULTS: The 3 recombinant proteins were specifically recognized by plasma from pregnant women but not by control plasma. A parity-dependent recognition pattern was observed with 2 of the 3 VAR2CSA antigens. A kinetic study...

  1. 40 CFR 180.1243 - Bacillus subtilis var. amyloliquefaciens strain FZB24; exemption from the requirement of a...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Bacillus subtilis var... EXEMPTIONS FOR PESTICIDE CHEMICAL RESIDUES IN FOOD Exemptions From Tolerances § 180.1243 Bacillus subtilis... the requirement of a tolerance for residues of the Bacillus subtilis var. amyloliquefaciens strain...

  2. Several domains from VAR2CSA can induce Plasmodium falciparum adhesion-blocking antibodies

    DEFF Research Database (Denmark)

    Salanti, Ali; Resende, Mafalda; Ditlev, Sisse B

    2010-01-01

    . In this study, it is demonstrated that other domains of VAR2CSA also can induce antibodies with inhibitory activity. METHODS: All VAR2CSA domains from the 3D7 and HB3 parasites were produced in Baculovirus-transfected insect cells. Groups of three rats per protein were immunized and anti-sera were tested...

  3. [Effect of Water Extracts from Rhizosphere Soil of Cultivated Astragalus membranaceus var. mongholicus on It's Seed Germination and Physiological Characteristics].

    Science.gov (United States)

    Lang, Duo-yong; Fu, Xue-yan; Rong, Jia-wang; Zhang, Xin-hui

    2015-01-01

    To explore the relationship between continuous cropping obstacle and autotoxicity of Astragalus membranaceus var. mongholicus. Distilled water(CK), water extracts of rhizosphere soil(50, 100, 200 and 400 mg/mL) were applied to test their effect on early growth and physiological characteristics of Astragalus membranaceus var. mongholicus. The water extracts from rhizospher soil of cultivated Astragalus membranaceus var. mongholicus significantly increased seedling emergence rate, root length and vigor index of Astragalus membranaceus var. mongholicus seedling when at the concentration of 100 mg/mL or below, however,there was no significant effect at 200 mg/mL or higher. The water extracts from rhizosphere soil of cultivated Astragalus membranaceus var. mongholicus significantly reduced the SOD activity in Astragalus membranaceus var. mongholicus seedling at 400 mg/mL and POD activity at 200 mg/mL and 400 mg/mL,while significantly increased the MDA content. Water extracts from Astragalus membranaceus var. mongholicus rhizosphere soil significantly affected Astragalus membranaceus var. mongholicus germination and seedling growth in a concentration-dependent manner, generally, low concentrations increased the SOD and POD activity which improved seed germination and seedling growth, while high concentrations caused cell membrane damage of the seedling.

  4. JST Thesaurus Headwords and Synonyms: Brassica rapa var. peruviridis [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Brassica rapa var. peruviridis 名詞... 一般 * * * * コマツナ コマツナ コマツナ Thesaurus2015 200906099324987960 C LS06/LS72 UNKNOWN_2 Brassica rapa var . peruviridis

  5. Reversal of cisplatin resistance in non-small cell lung cancer stem cells by Taxus chinensis var.

    Science.gov (United States)

    Jiang, Y Q; Xu, X P; Guo, Q M; Xu, X C; Liu, Q Y; An, S H; Xu, J L; Su, F; Tai, J B

    2016-09-02

    Drug resistance in cells is a major impedance to successful treatment of lung cancer. Taxus chinensis var. inhibits the growth of tumor cells and promotes the synthesis of interleukins 1 and 2 and tumor necrosis factor, enhancing immune function. In this study, T. chinensis var.-induced cell death was analyzed in lung cancer cells (H460) enriched for stem cell growth in a defined serum-free medium. Taxus-treated stem cells were also analyzed for Rhodamine 123 (Rh-123) expression by flow cytometry, and used as a standard functional indicator of MDR. The molecular basis of T. chinensis var.-mediated drug resistance was established by real-time PCR analysis of ABCC1, ABCB1, and lung resistance-related protein (LRP) mRNA, and western blot analysis of MRP1, MDR1, and LRP. Our results revealed that stem cells treated with higher doses of T. chinensis var. showed significantly lower growth inhibition rates than did H460 cells (P var. and cisplatin was also significantly inhibited (P var. (P var.-treated stem cells showed significant downregulation of the ABCC1, ABCB1, and LRP mRNA and MRP1, MDR1, and LRP (P var.-mediated downregulation of MRP1, MDR1, and LRP might contribute to the reversal of drug resistance in non-small cell lung cancer stem cells.

  6. Erasing the Epigenetic Memory and Beginning to Switch—The Onset of Antigenic Switching of var Genes in Plasmodium falciparum

    Science.gov (United States)

    Fastman, Yair; Noble, Robert; Recker, Mario; Dzikowski, Ron

    2012-01-01

    Antigenic variation in Plasmodium falciparum is regulated by transcriptional switches among members of the var gene family, each expressed in a mutually exclusive manner and encoding a different variant of the surface antigens collectively named PfEMP1. Antigenic switching starts when the first merozoites egress from the liver and begin their asexual proliferation within red blood cells. By erasing the epigenetic memory we created parasites with no var background, similar to merozoites that egress from the liver where no var gene is expressed. Creating a null-var background enabled us to investigate the onset of antigenic switches at the early phase of infection. At the onset of switching, var transcription pattern is heterogeneous with numerous genes transcribed at low levels including upsA vars, a subtype that was implicated in severe malaria, which are rarely activated in growing cultures. Analysis of subsequent in vitro switches shows that the probability of a gene to turn on or off is not associated with its chromosomal position or promoter type per se but on intrinsic properties of each gene. We concluded that var switching is determined by gene specific associated switch rates rather than general promoter type or locus associated switch rates. In addition, we show that fine tuned reduction in var transcription increases their switch rate, indicating that transcriptional perturbation can alter antigenic switching. PMID:22461905

  7. An optimization approach for online identification of harmonic resonance due to pending Volt/VAr operation

    Science.gov (United States)

    McBee, Kerry D.

    The emphasis on creating a more efficient distribution system has led many utility companies to employ dynamic voltage and VAr compensation (Volt/VAr) applications that reduce energy demand, generation, and losses associated with the transmission and distribution of energy. To achieve these benefits, Volt/VAr applications rely upon algorithms to control voltage support equipment, such as transformer load tap changers, voltage regulators, and capacitor banks. The majority of these algorithms utilize metaheuristic programming methods to determine the Volt/VAr scheme that produces the most energy efficient operating conditions. It has been well documented that the interaction between capacitor bank reactance and the inductive reactance of a distribution system can produce parallel harmonic resonance that can damage utility and customer equipment. The Volt/VAr controlling algorithms that account for harmonics do so in an indirect manner that can mask harmonic resonance conditions. Unlike previous research endeavors, the primary focus of the method described within this dissertation is to identify Volt/VAr schemes that prevent harmonic resonance due to capacitor bank operation. Instead of a metaheuristic approach, the harmonic resonance identification algorithm relies upon constrained mixed integer nonlinear programming (MINLP), which is more suited for analyzing impedance characteristics created by the energized states of a system of capacitor banks. Utilizing a numerical approach improves the accuracy of identifying harmonic resonance conditions, while also reducing the complexity of the process by exclusively relying upon the system's admittance characteristics. The novel harmonic resonance identification method is applicable to distribution systems that are dynamically reconfigured, which can result in a number of unknown harmonic resonance producing conditions, a feature unavailable with existing controlling algorithms. The ability to identify all harmonic

  8. Potential for wind extraction from 4D-Var assimilation of aerosols and moisture

    Science.gov (United States)

    Zaplotnik, Žiga; Žagar, Nedjeljka

    2017-04-01

    We discuss the potential of the four-dimensional variational data assimilation (4D-Var) to retrieve the unobserved wind field from observations of atmospheric tracers and the mass field through internal model dynamics and the multivariate relationships in the background-error term for 4D-Var. The presence of non-linear moist dynamics makes the wind retrieval from tracers very difficult. On the other hand, it has been shown that moisture observations strongly influence both tropical and mid-latitude wind field in 4D-Var. We present an intermediate complexity model that describes nonlinear interactions between the wind, temperature, aerosols and moisture including their sinks and sources in the framework of the so-called first baroclinic mode atmosphere envisaged by A. Gill. Aerosol physical processes, which are included in the model, are the non-linear advection, diffusion and sources and sinks that exist as dry and wet deposition and diffusion. Precipitation is parametrized according to the Betts-Miller scheme. The control vector for 4D-Var includes aerosols, moisture and the three dynamical variables. The former is analysed univariately whereas wind field and mass field are analysed in a multivariate fashion taking into account quasi-geostrophic and unbalanced dynamics. The OSSE type of studies are performed for the tropical region to assess the ability of 4D-Var to extract wind-field information from the time series of observations of tracers as a function of the flow nonlinearity, the observations density and the length of the assimilation window (12 hours and 24 hours), in dry and moist environment. Results show that the 4D-Var assimilation of aerosols and temperature data is beneficial for the wind analysis with analysis errors strongly dependent on the moist processes and reliable background-error covariances.

  9. Kalman Filter or VAR Models to Predict Unemployment Rate in Romania?

    Directory of Open Access Journals (Sweden)

    Simionescu Mihaela

    2015-06-01

    Full Text Available This paper brings to light an economic problem that frequently appears in practice: For the same variable, more alternative forecasts are proposed, yet the decision-making process requires the use of a single prediction. Therefore, a forecast assessment is necessary to select the best prediction. The aim of this research is to propose some strategies for improving the unemployment rate forecast in Romania by conducting a comparative accuracy analysis of unemployment rate forecasts based on two quantitative methods: Kalman filter and vector-auto-regressive (VAR models. The first method considers the evolution of unemployment components, while the VAR model takes into account the interdependencies between the unemployment rate and the inflation rate. According to the Granger causality test, the inflation rate in the first difference is a cause of the unemployment rate in the first difference, these data sets being stationary. For the unemployment rate forecasts for 2010-2012 in Romania, the VAR models (in all variants of VAR simulations determined more accurate predictions than Kalman filter based on two state space models for all accuracy measures. According to mean absolute scaled error, the dynamic-stochastic simulations used in predicting unemployment based on the VAR model are the most accurate. Another strategy for improving the initial forecasts based on the Kalman filter used the adjusted unemployment data transformed by the application of the Hodrick-Prescott filter. However, the use of VAR models rather than different variants of the Kalman filter methods remains the best strategy in improving the quality of the unemployment rate forecast in Romania. The explanation of these results is related to the fact that the interaction of unemployment with inflation provides useful information for predictions of the evolution of unemployment related to its components (i.e., natural unemployment and cyclical component.

  10. Subcellular distribution and chemical forms of thorium in Brassica juncea var. foliosa

    International Nuclear Information System (INIS)

    Zhou, Sai; Kai, Hailu; Zha, Zhongyong; Fang, Zhendong; Wang, Dingna; Du, Liang; Zhang, Dong; Feng, Xiaojie; Jin, Yongdong; Xia, Chuanqin

    2016-01-01

    Brassica juncea var. foliosa (B. juncea var. foliosa) is a promising species for thorium (Th) phytoextraction due to its large biomass, fast growth rate and high tolerance toward Th. To further understand the mechanisms of Th tolerance, the present study investigated the subcellular distribution and chemical forms of Th found in B. juncea var. foliosa Our results indicated that in both roots and leaves, Th contents in different parts of the cells follow the order of cell wall > membranes and soluble fraction > organelles. In particular, Transmission Electron Microscope (TEM) analysis showed that Th was abundantly located in cell walls of the roots. Additionally, when plants were exposed to different concentrations of Th, we have found that Th existed in B. juncea var. foliosa with different chemical forms. Much of the Th extracted by 2% acetic acid (HAc), 1 M NaCl and HCl in roots with the percentage distribution varied from 47.2% to 62.5%, while in leaves, most of the Th was in the form of residue and the subdominant amount of Th was extracted by HCl, followed by 2% HAc. This suggested that Th compartmentation in cytosol and integration with phosphate or proteins in cell wall might be responsible for the tolerance of B. juncea var. foliosa to the stress of Th. - Highlights: • Brassica juncea var. foliosa can adapt to the stress of Th(<200 μM) under hydroponic condition. • Th was selectively distributed on cell wall, membranes and soluble fraction. • Th mainly existed in low-toxicity forms which were benefit for Th tolerance.

  11. [Investigation on Main Cultivation of Astragalus membranaceus var. mongholicus and Commercial Specifications Grades].

    Science.gov (United States)

    Zhang, He-ting; Wang, Jian; Cheng, Ming-en; Duan, Hai-yan; Peng, Hua-sheng

    2015-12-01

    To investigate the main cultivation areas of Astragalus membranaceus var. mongholicus, and to clarify its present cultivation status and commercial specification grades. Astragalus membranaceus var. mongholicus cultivated in Hunyuan and Ying County of Shanxi, Longxi, Weiyuan and Min County of Gansu and Wuchuan, Guyang and Chifeng of Inner Mongolia were investigated, including their ecological environment, cultivation history and present situation, harvesting and processing as well as commercial specification grades. The cultivation methods of Astragalus membranaceus var. mongholicus changed greatly in the main cultivation areas. In Gansu and Inner Mongolia, the current major cultivation method was 2 - 3 years of seedling transplantation method, while the 3 - 5 years of seed-directly-sowed method in Inner Mongolia had been almost abandoned, and the 6 - 8 years of mountain direct seeding method was still in application in Hunyuan county of Shanxi province. On the other hand, the harvest method of Astragalus membranaceus var. mongholicus had been gradually changed from manual harvesting in ancient times to the current mechanical harvesting although the latter method did more damage to environment of cultivation areas and the resource of Astragalus membranaceus var. mongholicus in regions Hunyuan county of Shanxi. Through investigating the processing methods of Astragalus membranaceus var. mongholicus in different cultivation areas, it was found that processing method varied from area to area, and no unified specifications had been formulated on processing methods in market. In addition, the current processing method was too complicated in processing the slices of prepared Astragali Radix and most were self processing by farmers themselves, creating market disorders. Moreover, the Astragali Radix products were basically without grading classification but sold as bulk cargo. It is urgent to unify the specifications and grades of Astragali Radix product, and standardize

  12. Murine Model for Preclinical Studies of Var2CSA-Mediated Pathology Associated with Malaria in Pregnancy

    Science.gov (United States)

    Dechavanne, Sebastien; Sousa, Patrícia M.; Barateiro, André; Cunha, Sónia F.; Nunes-Silva, Sofia; Lima, Flávia A.; Murillo, Oscar; Marinho, Claudio R. F.; Gangnard, Stephane; Srivastava, Anand; Braks, Joanna A.; Janse, Chris J.; Gamain, Benoit; Penha-Gonçalves, Carlos

    2016-01-01

    Plasmodium falciparum infection during pregnancy leads to abortions, stillbirth, low birth weight, and maternal mortality. Infected erythrocytes (IEs) accumulate in the placenta by adhering to chondroitin sulfate A (CSA) via var2CSA protein exposed on the P. falciparum IE membrane. Plasmodium berghei IE infection in pregnant BALB/c mice is a model for severe placental malaria (PM). Here, we describe a transgenic P. berghei parasite expressing the full-length var2CSA extracellular region (domains DBL1X to DBL6ε) fused to a P. berghei exported protein (EMAP1) and characterize a var2CSA-based mouse model of PM. BALB/c mice were infected at midgestation with different doses of P. berghei-var2CSA (P. berghei-VAR) or P. berghei wild-type IEs. Infection with 104 P. berghei-VAR IEs induced a higher incidence of stillbirth and lower fetal weight than P. berghei. At doses of 105 and 106 IEs, P. berghei-VAR-infected mice showed increased maternal mortality during pregnancy and fetal loss, respectively. Parasite loads in infected placentas were similar between parasite lines despite differences in maternal outcomes. Fetal weight loss normalized for parasitemia was higher in P. berghei-VAR-infected mice than in P. berghei-infected mice. In vitro assays showed that higher numbers of P. berghei-VAR IEs than P. berghei IEs adhered to placental tissue. Immunization of mice with P. berghei-VAR elicited IgG antibodies reactive to DBL1-6 recombinant protein, indicating that the topology of immunogenic epitopes is maintained between DBL1-6–EMAP1 on P. berghei-VAR and recombinant DBL1-6 (recDBL1-6). Our data suggested that impairments in pregnancy caused by P. berghei-VAR infection were attributable to var2CSA expression. This model provides a tool for preclinical evaluation of protection against PM induced by approaches that target var2CSA. PMID:27045035

  13. Controlling Kuka Industrial Robots : Flexible Communication Interface JOpenShowVar.

    OpenAIRE

    Sanfilippo, Filippo; Hatledal, Lars Ivar; Zhang, Houxiang; Fago, Massimiliano; Pettersen, Kristin Ytterstad

    2015-01-01

    JOpenShowVar is a Java open-source cross-platform communication interface to Kuka industrial robots. This novel interface allows for read-write use of the controlled manipulator variables and data structures. JOpenShowVar, which is compatible with all the Kuka industrial robots that use KUKA Robot Controller version 4 (KR C4) and KUKA Robot Controller version 2 (KR C2), runs as a client on a remote computer connected with the Kuka controller via TCP/IP. Even though only soft real-time applica...

  14. Phenyl ethers from cultured lichen mycobionts of Graphis scripta var. serpentina and G. rikuzensis.

    Science.gov (United States)

    Takenaka, Yukiko; Tanahashi, Takao; Nagakura, Naotaka; Hamada, Nobuo

    2003-07-01

    Spore-derived mycobionts of the lichen Graphis scripta var. serpentina and G. rikuzensis were cultivated on a malt-yeast extract medium supplemented with 10% sucrose and their metabolites were investigated. 3,3'-Dihydroxy-5,5'-dimethyldiphenyl ether was isolated from the cultures of the mycobionts of G. scripta var. serpentina, while a new phenyl ether, rikuzenol, along with two known diphenyl ethers, violaceol-I and violaceol-II, were isolated from those of G. rikuzensis. The structure of the new compound was determined by spectroscopic methods. Violaceol-I was chemically synthesized and interconversion between violaceol-I and violaceol-II was proven.

  15. Utilizing nanobody technology to target non-immunodominant domains of VAR2CSA

    DEFF Research Database (Denmark)

    Ditlev, Sisse B; Florea, Raluca; Nielsen, Morten A

    2014-01-01

    adhesion. However, the development of a VAR2CSA adhesion-blocking vaccine remains challenging due to (i) the large size of VAR2CSA and (ii) the extensive immune selection for polymorphisms and thereby non-neutralizing B-cell epitopes. Camelid heavy-chain-only antibodies (HcAbs) are known to target epitopes...... that are less immunogenic to classical IgG and, due to their small size and protruding antigen-binding loop, able to reach and recognize cryptic, conformational epitopes which are inaccessible to conventional antibodies. The variable heavy chain (VHH) domain is the antigen-binding site of camelid HcAbs, the so...

  16. Influence of intermittent preventive treatment on antibodies to VAR2CSA in pregnant Cameroonian women

    DEFF Research Database (Denmark)

    Babakhanyan, Anna; Tutterrow, Yeung L; Bobbili, Naveen

    2016-01-01

    Intermittent preventive treatment (IPT) and insecticide-treated bed nets are the standard of care for preventing malaria in pregnant women. Since these preventive measures reduce exposure to malaria, their influence on the antibody (Ab) response to the parasite antigen VAR2CSA was evaluated...... in pregnant Cameroonian women exposed to holoendemic malaria. Ab levels to full-length VAR2CSA (FV2), variants of the six Duffy binding like (DBL) domains, and proportion of high avidity Ab to FV2 were measured longitudinally in 92 women before and 147 women after IPT. As predicted, reduced exposure...

  17. The cross-ecosystem impact of deer on an endangered submerged macrophyte, Ranunculus nipponicus var. submersus

    Directory of Open Access Journals (Sweden)

    Hino Takafumi

    2015-07-01

    Full Text Available Macrophytes are a critical component of freshwater ecosystems and are often eaten by cervids. However, the impact of cervids on macrophytes is not well known. In this study, we investigated the effect of sika deer (Cervus nippon yesoensis on the endangered macrophyte Ranunculus nipponicus var. submersus in a spring stream in southwestern Hokkaido, Japan. We monitored the frequency of stream habitat use by deer by using sensor cameras in photography mode for four seasons. We also monitored deer feeding behavior on R. nipponicus var. submersus using sensor cameras in movie mode. To quantitatively evaluate the impact of deer on R. nipponicus var. submersus, we conducted a field experiment in which deer were excluded from part of the stream. We selected 10 pairs of adjacent patches of R. nipponicus var. submersus and set up exclosures covering one patch in each pair. We assessed the frequency of deer feeding and trampling on the control patches using the sensor cameras in photography mode and measured the mean macrophyte stem length in the exclosure and control patches every month for four seasons. To compare abiotic conditions between the exclosure and control patches, we investigated canopy openness, water depth, water temperature, electrical conductivity, pH, current velocity, and water quality at each patch during the growing season. The frequency of deer in the stream habitat was higher from spring to summer than in other seasons. Direct evidence of deer feeding behavior on R. nipponicus var. submersus was recorded using the sensor cameras. Deer often fed on and trampled on the control patches, particularly from spring to summer. The R. nipponicus var. submersus stem length was longer in the exclosure patches than in control patches (P 0.189. Stem growth of R. nipponicus var. submersus differed among seasons (P <0.001, and was low from winter to spring. In addition, exclosure and seasonality significantly affected stem length (P <0.001, and the

  18. Transient Stability Enhancement in Power System Using Static VAR Compensator (SVC

    Directory of Open Access Journals (Sweden)

    Youssef MOULOUDI

    2012-12-01

    Full Text Available In this paper, an indirect adaptive fuzzy excitation and static VAR (unit of reactive power, volt-ampere reactive compensator (SVC controller is proposed to enhance transient stability for the power system, which based on input-output linearization technique. A three-bus system, which contains a generator and static VAR compensator (SVC, is considered in this paper, the SVC is located at the midpoint of the transmission lines. Simulation results show that the proposed controller compared with a controller based on tradition linearization technique can enhance the transient stability of the power system under a large sudden fault, which may occur nearly at the generator bus terminal.

  19. Disruption of var2csa gene impairs placental malaria associated adhesion phenotype.

    Directory of Open Access Journals (Sweden)

    Nicola K Viebig

    Full Text Available Infection with Plasmodium falciparum during pregnancy is one of the major causes of malaria related morbidity and mortality in newborn and mothers. The complications of pregnancy-associated malaria result mainly from massive adhesion of Plasmodium falciparum-infected erythrocytes (IE to chondroitin sulfate A (CSA present in the placental intervillous blood spaces. Var2CSA, a member of the P. falciparum erythrocyte membrane protein 1 (PfEMP1 family is the predominant parasite ligand mediating CSA binding. However, experimental evidence suggests that other host receptors, such as hyaluronic acid (HA and the neonatal Fc receptor, may also support placental binding. Here we used parasites in which var2csa was genetically disrupted to evaluate the contribution of these receptors to placental sequestration and to identify additional adhesion receptors that may be involved in pregnancy-associated malaria. By comparison to the wild-type parasites, the FCR3delta var2csa mutants could not be selected for HA adhesion, indicating that var2csa is not only essential for IE cytoadhesion to the placental receptor CSA, but also to HA. However, further studies using different pure sources of HA revealed that the previously observed binding results from CSA contamination in the bovine vitreous humor HA preparation. To identify CSA-independent placental interactions, FCR3delta var2csa mutant parasites were selected for adhesion to the human placental trophoblastic BeWo cell line. BeWo selected parasites revealed a multi-phenotypic adhesion population expressing multiple var genes. However, these parasites did not cytoadhere specifically to the syncytiotrophoblast lining of placental cryosections and were not recognized by sera from malaria-exposed women in a parity dependent manner, indicating that the surface molecules present on the surface of the BeWo selected population are not specifically expressed during the course of pregnancy-associated malaria. Taken

  20. Description of rainfall variability in Br hat -samhita of Varâha-mihira

    OpenAIRE

    Iyengar, RN

    2004-01-01

    Br hat -samhita of Varâha-mihira (5–6th century AD) provides valuable information on the approach in ancient India towards monsoon rainfall, including its measurement and forecasting. In this context, we come across a description of the expected amount of total seasonal rainfall depending on the first rains under the 27 naks atras of Indian astronomy. This provides a rough statistical picture of what might have been the rainfall and its variability in the region around Ujjain, where Varâha-mi...