WorldWideScience

Sample records for platforms phylogenetic relationships

  1. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    NIRAJ SINGH

    for phylogenetic analysis of Gladiolus and related taxa using combined datasets from chloroplast genome. The psbA–trnH ... phylogenetic relationships among cultivars could be useful for hybridization programmes for further improvement of the crop. [Singh N. ... breeding in nature, and exhibited diverse pollination mech-.

  2. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    Navya

    2 attached at the base of tree as the diverging Iridaceae relative's lineage. Present study revealed that psbA-trnH region are useful in addressing questions of phylogenetic relationships among the Gladiolus cultivars, as these intergenic spacers are more variable and have more phylogenetically informative sites than the ...

  3. Phylogenetic relationships among Maloideae species

    Science.gov (United States)

    The Maloideae is a highly diverse sub-family of the Rosaceae containing several agronomically important species (Malus sp. and Pyrus sp.) and their wild relatives. Previous phylogenetic work within the group has revealed extensive intergeneric hybridization and polyploidization. In order to develop...

  4. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    2017-03-03

    Mar 3, 2017 ... 2Department of Botany, D. S. B. Campus, Kumaun University, Nainital 263 001, India ... Rana T. S. 2017 Nucleotide diversity and phylogenetic relationships ... Anderson and Park 1989). ..... Edgewood Press, Edgewood, USA.

  5. Phenotypic diversity and phylogenetic relationship between the ...

    African Journals Online (AJOL)

    Phenotypic diversity and phylogenetic relationship between the Bakosi/Baweri and other pig breeds ( Sus scrofa Domesticus ) in the humid forest with monomodal rainfall agro-ecological zone of Cameroon.

  6. Phylogenetic relationship among Kenyan sorghum germplasms ...

    African Journals Online (AJOL)

    Mr Kiboi

    phylogenetic relationships based on 10 DNA fragments at AltSB loci with SbMATE, ORF9 and MITE primers. .... estimate the overall genetic diversity in Kenyan sorghum lines: Cheprot et al. 3529 ..... EARN project and Generation Challenge (GCP), ... genetics and molecular biology of plant aluminum resistance and toxicity.

  7. Molecular characterization and phylogenetic relationships among ...

    African Journals Online (AJOL)

    Molecular characterization and phylogenetic relationships among and within species of Phalaenopsis (Epidendroideae: Orchidaceae) based on RAPD analysis. ... Ph. parishii, Ph. labbi nepal, Ph. speciosa, Ph. lobbi yellow, Ph. venosa, Ph. hieroglyphica, and Ph. maculata; the third group consisted of Ph. minho princess, ...

  8. Phylogenetic diversity and relationships among species of genus ...

    African Journals Online (AJOL)

    Fifty six Nicotiana species were used to construct phylogenetic trees and to asses the genetic relationships between them. Genetic distances estimated from RAPD analysis was used to construct phylogenetic trees using Phylogenetic Inference Package (PHYLIP). Since phylogenetic relationships estimated for closely ...

  9. Atelinae phylogenetic relationships: the trichotomy revived?

    Science.gov (United States)

    Collins, A C

    2004-08-01

    This research examines phylogenetic relationships between members of the Atelinae subfamily (Alouatta, Ateles, Brachyteles, and Lagothrix), based on analysis of three genetic regions. Two loci, cytochrome c oxidase subunit II (COII) and the hypervariable I portion of the control region, are part of the mitochondrial genome. The other is a single-copy nuclear gene, Aldolase A Intron V. Analysis of these genetic regions provides support for tribe Alouattini containing the Alouatta species, while tribe Atelini contains the other three genera. However, these three genetic regions produce conflicting results for relationships among tribe Atelini members. Previous genetic studies supported grouping Brachyteles with Lagothrix, leaving Ateles in a separate subclade. The present data sets vary based on the genetic region analyzed and method of analysis suggesting all possible cladistic relationships. These results are more consistent with investigations of morphology and behavior among these primates. The primary cause of discrepancy between this study and previous genetic studies is postulated to reside in increased sampling in the present study of genetic variation among members of the Atelinae, specifically Ateles. The present study utilized samples of Ateles from all postulated species for this genetically variable primate, while previous studies used only one or two species of Ateles. This paper demonstrates that shifting relationships are produced when different species of Ateles are used to reconstruct phylogenies. This research concludes that a trichotomy should still be supported between members of tribe Atelini until further analyses, which include additional Atelinae haplotypes are conducted. Copyright 2003 Wiley-Liss, Inc.

  10. Ultrastructure, biology, and phylogenetic relationships of kinorhyncha.

    Science.gov (United States)

    Neuhaus, Birger; Higgins, Robert P

    2002-07-01

    The article summarizes current knowledge mainly about the (functional) morphology and ultrastructure, but also about the biology, development, and evolution of the Kinorhyncha. The Kinorhyncha are microscopic, bilaterally symmetrical, exclusively free-living, benthic, marine animals and ecologically part of the meiofauna. They occur throughout the world from the intertidal to the deep sea, generally in sediments but sometimes associated with plants or other animals. From adult stages 141 species are known, but 38 species have been described from juvenile stages. The trunk is arranged into 11 segments as evidenced by cuticular plates, sensory spots, setae or spines, nervous system, musculature, and subcuticular glands. The ultrastructure of several organ systems and the postembryonic development are known for very few species. Almost no data are available about the embryology and only a single gene has been sequenced for a single species. The phylogenetic relationships within Kinorhyncha are unresolved. Priapulida, Loricifera, and Kinorhyncha are grouped together as Scalidophora, but arguments are found for every possible sistergroup relationship within this taxon. The recently published Ecdysozoa hypothesis suggests a closer relationship of the Scalidophora, Nematoda, Nematomorpha, Tardigrada, Onychophora, and Arthropoda.

  11. Phylogenetic relationships of African sunbird-like warblers: Moho ...

    African Journals Online (AJOL)

    Phylogenetic relationships of African sunbird-like warblers: Moho ( Hypergerus atriceps ), Green Hylia ( Hylia prasina ) and Tit-hylia ( Pholidornis rushiae ) ... different points in avian evolution reduces the phylogenetic signal in molecular sequence data, making difficult the reconstruction of relationships among taxa resulting ...

  12. Phylogenetic relationships of the lancelets of the genus ...

    African Journals Online (AJOL)

    phylogenetic relationships of the Branchiostoma lancelets from South (Xiamen) and North (Qingdao and Rizhao) China, and phylogenetic trees constructed also included the existing data from Japanese waters. The genetic distances of the lancelets between South and North China averaged 0.19, 0.21, and 0.17 based on ...

  13. Mitochondrial DNA sequence-based phylogenetic relationship ...

    Indian Academy of Sciences (India)

    cophaga ranges from 0.037–0.106 and 0.049–0.207 for COI and ND5 genes, respectively (tables 2 and 3). Analysis of genetic distance on the basis of sequence difference for both the mitochondrial genes shows very little genetic difference. The discrepancy in the phylogenetic trees based on individ- ual genes may be due ...

  14. Vertical Relationships within Platform Marketplaces

    Directory of Open Access Journals (Sweden)

    Mark J. Tremblay

    2016-07-01

    Full Text Available In two-sided markets a platform allows consumers and sellers to interact by creating sub-markets within the platform marketplace. For example, Amazon has sub-markets for all of the different product categories available on its site, and smartphones have sub-markets for different types of applications (gaming apps, weather apps, map apps, ridesharing apps, etc.. The network benefits between consumers and sellers depend on the mode of competition within the sub-markets: more competition between sellers lowers product prices, increases the surplus consumers receive from a sub-market, and makes platform membership more desirable for consumers. However, more competition also lowers profits for a seller which makes platform membership less desirable for a seller and reduces seller entry and the number of sub-markets available on the platform marketplace. This dynamic between seller competition within a sub-market and agents’ network benefits leads to platform pricing strategies, participation decisions by consumers and sellers, and welfare results that depend on the mode of competition. Thus, the sub-market structure is important when investigating platform marketplaces.

  15. Phylogenetic relationships among members of the Pachydactylus ...

    African Journals Online (AJOL)

    The Pachydactylus capensis group is a phenetically-defined assemblage of five small-bodied geckos broadly distributed in eastern southern Africa. Several additional small-bodied Pachydactylus have been historically considered subspecies of P. capensis or members of this group. To assess evolutionary relationships ...

  16. Phylogenetic relationships within and among Brassica species from ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-05-02

    May 2, 2008 ... Inappropriate tree reconstruction methods would pose a problem only in the basal relationships rather than in terminal taxa; the paraphyly observed in this study applied mostly to terminal taxa. This study recovered sufficient phylogenetic characters to separate accessions of the same species, making.

  17. Phylogenetic relationships among species of Lutzomyia, subgenus Lutzomyia (Diptera: Psychodidae).

    Science.gov (United States)

    Pinto, Israel S; Filho, José D Andrade; Santos, Claudiney B; Falqueto, Aloísio; Leite, Yuri L R

    2010-01-01

    Lutzomyia França is the largest and most diverse sand fly genus in the New World and contains all the species involved in the transmission of American visceral leishmaniasis (AVL). Morphological characters were used to test the monophyly and to infer phylogenetic relationships among members of the Lutzomyia subgenus. Fifty-two morphological characters from male and female adult specimens belonging to 18 species of Lu. (Lutzomyia) were scored and analyzed. The resulting phylogeny confirms the monophyly of this subgenus and reveals four main internal clades. These four clades, however, do not support the classification of the subgenus in two series, longipalpis and cavernicola, because neither is necessarily monophyletic. Knowledge on phylogenetic relationships among these relevant vectors of AVL should be used as a tool for monitoring target taxa and a first step for establishing an early warning system for disease control.

  18. Phylogenetically informed logic relationships improve detection of biological network organization

    Science.gov (United States)

    2011-01-01

    Background A "phylogenetic profile" refers to the presence or absence of a gene across a set of organisms, and it has been proven valuable for understanding gene functional relationships and network organization. Despite this success, few studies have attempted to search beyond just pairwise relationships among genes. Here we search for logic relationships involving three genes, and explore its potential application in gene network analyses. Results Taking advantage of a phylogenetic matrix constructed from the large orthologs database Roundup, we invented a method to create balanced profiles for individual triplets of genes that guarantee equal weight on the different phylogenetic scenarios of coevolution between genes. When we applied this idea to LAPP, the method to search for logic triplets of genes, the balanced profiles resulted in significant performance improvement and the discovery of hundreds of thousands more putative triplets than unadjusted profiles. We found that logic triplets detected biological network organization and identified key proteins and their functions, ranging from neighbouring proteins in local pathways, to well separated proteins in the whole pathway, and to the interactions among different pathways at the system level. Finally, our case study suggested that the directionality in a logic relationship and the profile of a triplet could disclose the connectivity between the triplet and surrounding networks. Conclusion Balanced profiles are superior to the raw profiles employed by traditional methods of phylogenetic profiling in searching for high order gene sets. Gene triplets can provide valuable information in detection of biological network organization and identification of key genes at different levels of cellular interaction. PMID:22172058

  19. Phylogenetic relationships of Hemiptera inferred from mitochondrial and nuclear genes.

    Science.gov (United States)

    Song, Nan; Li, Hu; Cai, Wanzhi; Yan, Fengming; Wang, Jianyun; Song, Fan

    2016-11-01

    Here, we reconstructed the Hemiptera phylogeny based on the expanded mitochondrial protein-coding genes and the nuclear 18S rRNA gene, separately. The differential rates of change across lineages may associate with long-branch attraction (LBA) effect and result in conflicting estimates of phylogeny from different types of data. To reduce the potential effects of systematic biases on inferences of topology, various data coding schemes, site removal method, and different algorithms were utilized in phylogenetic reconstruction. We show that the outgroups Phthiraptera, Thysanoptera, and the ingroup Sternorrhyncha share similar base composition, and exhibit "long branches" relative to other hemipterans. Thus, the long-branch attraction between these groups is suspected to cause the failure of recovering Hemiptera under the homogeneous model. In contrast, a monophyletic Hemiptera is supported when heterogeneous model is utilized in the analysis. Although higher level phylogenetic relationships within Hemiptera remain to be answered, consensus between analyses is beginning to converge on a stable phylogeny.

  20. Assessment of phylogenetic sensitivity for reconstructing HIV-1 epidemiological relationships.

    Science.gov (United States)

    Beloukas, Apostolos; Magiorkinis, Emmanouil; Magiorkinis, Gkikas; Zavitsanou, Asimina; Karamitros, Timokratis; Hatzakis, Angelos; Paraskevis, Dimitrios

    2012-06-01

    Phylogenetic analysis has been extensively used as a tool for the reconstruction of epidemiological relations for research or for forensic purposes. It was our objective to assess the sensitivity of different phylogenetic methods and various phylogenetic programs to reconstruct epidemiological links among HIV-1 infected patients that is the probability to reveal a true transmission relationship. Multiple datasets (90) were prepared consisting of HIV-1 sequences in protease (PR) and partial reverse transcriptase (RT) sampled from patients with documented epidemiological relationship (target population), and from unrelated individuals (control population) belonging to the same HIV-1 subtype as the target population. Each dataset varied regarding the number, the geographic origin and the transmission risk groups of the sequences among the control population. Phylogenetic trees were inferred by neighbor-joining (NJ), maximum likelihood heuristics (hML) and Bayesian methods. All clusters of sequences belonging to the target population were correctly reconstructed by NJ and Bayesian methods receiving high bootstrap and posterior probability (PP) support, respectively. On the other hand, TreePuzzle failed to reconstruct or provide significant support for several clusters; high puzzling step support was associated with the inclusion of control sequences from the same geographic area as the target population. In contrary, all clusters were correctly reconstructed by hML as implemented in PhyML 3.0 receiving high bootstrap support. We report that under the conditions of our study, hML using PhyML, NJ and Bayesian methods were the most sensitive for the reconstruction of epidemiological links mostly from sexually infected individuals. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. Phylogenetic relationships, diversification and expansion of chili peppers (Capsicum, Solanaceae)

    Science.gov (United States)

    Carrizo García, Carolina; Barfuss, Michael H. J.; Sehr, Eva M.; Barboza, Gloria E.; Samuel, Rosabelle; Moscone, Eduardo A.; Ehrendorfer, Friedrich

    2016-01-01

    Background and Aims Capsicum (Solanaceae), native to the tropical and temperate Americas, comprises the well-known sweet and hot chili peppers and several wild species. So far, only partial taxonomic and phylogenetic analyses have been done for the genus. Here, the phylogenetic relationships between nearly all taxa of Capsicum were explored to test the monophyly of the genus and to obtain a better knowledge of species relationships, diversification and expansion. Methods Thirty-four of approximately 35 Capsicum species were sampled. Maximum parsimony and Bayesian inference analyses were performed using two plastid markers (matK and psbA-trnH) and one single-copy nuclear gene (waxy). The evolutionary changes of nine key features were reconstructed following the parsimony ancestral states method. Ancestral areas were reconstructed through a Bayesian Markov chain Monte Carlo analysis. Key Results Capsicum forms a monophyletic clade, with Lycianthes as a sister group, following both phylogenetic approaches. Eleven well-supported clades (four of them monotypic) can be recognized within Capsicum, although some interspecific relationships need further analysis. A few features are useful to characterize different clades (e.g. fruit anatomy, chromosome base number), whereas some others are highly homoplastic (e.g. seed colour). The origin of Capsicum is postulated in an area along the Andes of western to north-western South America. The expansion of the genus has followed a clockwise direction around the Amazon basin, towards central and south-eastern Brazil, then back to western South America, and finally northwards to Central America. Conclusions New insights are provided regarding interspecific relationships, character evolution, and geographical origin and expansion of Capsicum. A clearly distinct early-diverging clade can be distinguished, centred in western–north-western South America. Subsequent rapid speciation has led to the origin of the remaining clades. The

  2. Different relationships between temporal phylogenetic turnover and phylogenetic similarity and in two forests were detected by a new null model.

    Science.gov (United States)

    Huang, Jian-Xiong; Zhang, Jian; Shen, Yong; Lian, Ju-yu; Cao, Hong-lin; Ye, Wan-hui; Wu, Lin-fang; Bin, Yue

    2014-01-01

    Ecologists have been monitoring community dynamics with the purpose of understanding the rates and causes of community change. However, there is a lack of monitoring of community dynamics from the perspective of phylogeny. We attempted to understand temporal phylogenetic turnover in a 50 ha tropical forest (Barro Colorado Island, BCI) and a 20 ha subtropical forest (Dinghushan in southern China, DHS). To obtain temporal phylogenetic turnover under random conditions, two null models were used. The first shuffled names of species that are widely used in community phylogenetic analyses. The second simulated demographic processes with careful consideration on the variation in dispersal ability among species and the variations in mortality both among species and among size classes. With the two models, we tested the relationships between temporal phylogenetic turnover and phylogenetic similarity at different spatial scales in the two forests. Results were more consistent with previous findings using the second null model suggesting that the second null model is more appropriate for our purposes. With the second null model, a significantly positive relationship was detected between phylogenetic turnover and phylogenetic similarity in BCI at a 10 m×10 m scale, potentially indicating phylogenetic density dependence. This relationship in DHS was significantly negative at three of five spatial scales. This could indicate abiotic filtering processes for community assembly. Using variation partitioning, we found phylogenetic similarity contributed to variation in temporal phylogenetic turnover in the DHS plot but not in BCI plot. The mechanisms for community assembly in BCI and DHS vary from phylogenetic perspective. Only the second null model detected this difference indicating the importance of choosing a proper null model.

  3. Phylogenetic relationships, diversification and expansion of chili peppers (Capsicum, Solanaceae).

    Science.gov (United States)

    Carrizo García, Carolina; Barfuss, Michael H J; Sehr, Eva M; Barboza, Gloria E; Samuel, Rosabelle; Moscone, Eduardo A; Ehrendorfer, Friedrich

    2016-07-01

    Capsicum (Solanaceae), native to the tropical and temperate Americas, comprises the well-known sweet and hot chili peppers and several wild species. So far, only partial taxonomic and phylogenetic analyses have been done for the genus. Here, the phylogenetic relationships between nearly all taxa of Capsicum were explored to test the monophyly of the genus and to obtain a better knowledge of species relationships, diversification and expansion. Thirty-four of approximately 35 Capsicum species were sampled. Maximum parsimony and Bayesian inference analyses were performed using two plastid markers (matK and psbA-trnH) and one single-copy nuclear gene (waxy). The evolutionary changes of nine key features were reconstructed following the parsimony ancestral states method. Ancestral areas were reconstructed through a Bayesian Markov chain Monte Carlo analysis. Capsicum forms a monophyletic clade, with Lycianthes as a sister group, following both phylogenetic approaches. Eleven well-supported clades (four of them monotypic) can be recognized within Capsicum, although some interspecific relationships need further analysis. A few features are useful to characterize different clades (e.g. fruit anatomy, chromosome base number), whereas some others are highly homoplastic (e.g. seed colour). The origin of Capsicum is postulated in an area along the Andes of western to north-western South America. The expansion of the genus has followed a clockwise direction around the Amazon basin, towards central and south-eastern Brazil, then back to western South America, and finally northwards to Central America. New insights are provided regarding interspecific relationships, character evolution, and geographical origin and expansion of Capsicum A clearly distinct early-diverging clade can be distinguished, centred in western-north-western South America. Subsequent rapid speciation has led to the origin of the remaining clades. The diversification of Capsicum has culminated in the origin

  4. An attempt to reconstruct phylogenetic relationships within Caribbean nummulitids: simulating relationships and tracing character evolution

    Science.gov (United States)

    Eder, Wolfgang; Ives Torres-Silva, Ana; Hohenegger, Johann

    2017-04-01

    Phylogenetic analysis and trees based on molecular data are broadly applied and used to infer genetical and biogeographic relationship in recent larger foraminifera. Molecular phylogenetic is intensively used within recent nummulitids, however for fossil representatives these trees are only of minor informational value. Hence, within paleontological studies a phylogenetic approach through morphometric analysis is of much higher value. To tackle phylogenetic relationships within the nummulitid family, a much higher number of morphological character must be measured than are commonly used in biometric studies, where mostly parameters describing embryonic size (e.g., proloculus diameter, deuteroloculus diameter) and/or the marginal spiral (e.g., spiral diagrams, spiral indices) are studied. For this purpose 11 growth-independent and/or growth-invariant characters have been used to describe the morphological variability of equatorial thin sections of seven Carribbean nummulitid taxa (Nummulites striatoreticulatus, N. macgillavry, Palaeonummulites willcoxi, P.floridensis, P. soldadensis, P.trinitatensis and P.ocalanus) and one outgroup taxon (Ranikothalia bermudezi). Using these characters, phylogenetic trees were calculated using a restricted maximum likelihood algorithm (REML), and results are cross-checked by ordination and cluster analysis. Square-change parsimony method has been run to reconstruct ancestral states, as well as to simulate the evolution of the chosen characters along the calculated phylogenetic tree and, independent - contrast analysis was used to estimate confidence intervals. Based on these simulations, phylogenetic tendencies of certain characters proposed for nummulitids (e.g., Cope's rule or nepionic acceleration) can be tested, whether these tendencies are valid for the whole family or only for certain clades. At least, within the Carribean nummulitids, phylogenetic trends along some growth-independent characters of the embryo (e.g., first

  5. Phylogenetic relationships and evolutionary patterns of the order Collodaria (Radiolaria.

    Directory of Open Access Journals (Sweden)

    Yoshiyuki Ishitani

    Full Text Available Collodaria are the only group of Radiolaria that has a colonial lifestyle. This group is potentially the most important plankton in the oligotrophic ocean because of its large biomass and the high primary productivity associated with the numerous symbionts inside a cell or colony. The evolution of Collodaria could thus be related to the changes in paleo-productivity that have affected organic carbon fixation in the oligotrophic ocean. However, the fossil record of Collodaria is insufficient to trace their abundance through geological time, because most collodarians do not have silicified shells. Recently, molecular phylogeny based on nuclear small sub-unit ribosomal DNA (SSU rDNA confirmed Collodaria to be one of five orders of Radiolaria, though the relationship among collodarians is still unresolved because of inadequate taxonomic sampling. Our phylogenetic analysis has revealed four novel collodarian sequences, on the basis of which collodarians can be divided into four clades that correspond to taxonomic grouping at the family level: Thalassicollidae, Collozoidae, Collosphaeridae, and Collophidae. Comparison of the results of our phylogenetic analyses with the morphological characteristics of each collodarian family suggests that the first ancestral collodarians had a solitary lifestyle and left no silica deposits. The timing of events estimated from molecular divergence calculations indicates that naked collodarian lineages first appeared around 45.6 million years (Ma ago, coincident with the diversification of diatoms in the pelagic oceans. Colonial collodarians appeared after the formation of the present ocean circulation system and the development of oligotrophic conditions in the equatorial Pacific (ca. 33.4 Ma ago. The divergence of colonial collodarians probably caused a shift in the efficiency of primary production during this period.

  6. Phylogenetic Relationships and Evolutionary Patterns of the Order Collodaria (Radiolaria)

    Science.gov (United States)

    Ishitani, Yoshiyuki; Ujiié, Yurika; de Vargas, Colomban; Not, Fabrice; Takahashi, Kozo

    2012-01-01

    Collodaria are the only group of Radiolaria that has a colonial lifestyle. This group is potentially the most important plankton in the oligotrophic ocean because of its large biomass and the high primary productivity associated with the numerous symbionts inside a cell or colony. The evolution of Collodaria could thus be related to the changes in paleo-productivity that have affected organic carbon fixation in the oligotrophic ocean. However, the fossil record of Collodaria is insufficient to trace their abundance through geological time, because most collodarians do not have silicified shells. Recently, molecular phylogeny based on nuclear small sub-unit ribosomal DNA (SSU rDNA) confirmed Collodaria to be one of five orders of Radiolaria, though the relationship among collodarians is still unresolved because of inadequate taxonomic sampling. Our phylogenetic analysis has revealed four novel collodarian sequences, on the basis of which collodarians can be divided into four clades that correspond to taxonomic grouping at the family level: Thalassicollidae, Collozoidae, Collosphaeridae, and Collophidae. Comparison of the results of our phylogenetic analyses with the morphological characteristics of each collodarian family suggests that the first ancestral collodarians had a solitary lifestyle and left no silica deposits. The timing of events estimated from molecular divergence calculations indicates that naked collodarian lineages first appeared around 45.6 million years (Ma) ago, coincident with the diversification of diatoms in the pelagic oceans. Colonial collodarians appeared after the formation of the present ocean circulation system and the development of oligotrophic conditions in the equatorial Pacific (ca. 33.4 Ma ago). The divergence of colonial collodarians probably caused a shift in the efficiency of primary production during this period. PMID:22567112

  7. Resolving ambiguity in the phylogenetic relationship of genotypes A, B, and C of hepatitis B virus

    Science.gov (United States)

    2013-01-01

    Background Hepatitis B virus (HBV) is an important infectious agent that causes widespread concern because billions of people are infected by at least 8 different HBV genotypes worldwide. However, reconstruction of the phylogenetic relationship between HBV genotypes is difficult. Specifically, the phylogenetic relationships among genotypes A, B, and C are not clear from previous studies because of the confounding effects of genotype recombination. In order to clarify the evolutionary relationships, a rigorous approach is required that can effectively explore genetic sequences with recombination. Result In the present study, phylogenetic relationship of the HBV genotypes was reconstructed using a consensus phylogeny of phylogenetic trees of HBV genome segments. Reliability of the reconstructed phylogeny was extensively evaluated in agreements of local phylogenies of genome segments. The reconstructed phylogenetic tree revealed that HBV genotypes B and C had a closer phylogenetic relationship than genotypes A and B or A and C. Evaluations showed the consensus method was capable to reconstruct reliable phylogenetic relationship in the presence of recombinants. Conclusion The consensus method implemented in this study provides an alternative approach for reconstructing reliable phylogenetic relationships for viruses with possible genetic recombination. Our approach revealed the phylogenetic relationships of genotypes A, B, and C of HBV. PMID:23758960

  8. Phylogenetic relationships within and among Brassica species from ...

    African Journals Online (AJOL)

    Consequently, two potentially susceptible B. napus accessions were identified. The high polymorphic information content (PIC) and number of phylogenetically informative bands established RAPD as a useful tool for phylogenetic reconstruction, quantification of genetic diversity for conservation, cultivar classification and ...

  9. Exploring the relationship between sequence similarity and accurate phylogenetic trees.

    Science.gov (United States)

    Cantarel, Brandi L; Morrison, Hilary G; Pearson, William

    2006-11-01

    We have characterized the relationship between accurate phylogenetic reconstruction and sequence similarity, testing whether high levels of sequence similarity can consistently produce accurate evolutionary trees. We generated protein families with known phylogenies using a modified version of the PAML/EVOLVER program that produces insertions and deletions as well as substitutions. Protein families were evolved over a range of 100-400 point accepted mutations; at these distances 63% of the families shared significant sequence similarity. Protein families were evolved using balanced and unbalanced trees, with ancient or recent radiations. In families sharing statistically significant similarity, about 60% of multiple sequence alignments were 95% identical to true alignments. To compare recovered topologies with true topologies, we used a score that reflects the fraction of clades that were correctly clustered. As expected, the accuracy of the phylogenies was greatest in the least divergent families. About 88% of phylogenies clustered over 80% of clades in families that shared significant sequence similarity, using Bayesian, parsimony, distance, and maximum likelihood methods. However, for protein families with short ancient branches (ancient radiation), only 30% of the most divergent (but statistically significant) families produced accurate phylogenies, and only about 70% of the second most highly conserved families, with median expectation values better than 10(-60), produced accurate trees. These values represent upper bounds on expected tree accuracy for sequences with a simple divergence history; proteins from 700 Giardia families, with a similar range of sequence similarities but considerably more gaps, produced much less accurate trees. For our simulated insertions and deletions, correct multiple sequence alignments did not perform much better than those produced by T-COFFEE, and including sequences with expressed sequence tag-like sequencing errors did not

  10. Phylogenetic versus functional signals in the evolution of form-function relationships in terrestrial vision.

    Science.gov (United States)

    Motani, Ryosuke; Schmitz, Lars

    2011-08-01

    Phylogeny is deeply pertinent to evolutionary studies. Traits that perform a body function are expected to be strongly influenced by physical "requirements" of the function. We investigated if such traits exhibit phylogenetic signals, and, if so, how phylogenetic noises bias quantification of form-function relationships. A form-function system that is strongly influenced by physics, namely the relationship between eye morphology and visual optics in amniotes, was used. We quantified the correlation between form (i.e., eye morphology) and function (i.e., ocular optics) while varying the level of phylogenetic bias removal through adjusting Pagel's λ. Ocular soft-tissue dimensions exhibited the highest correlation with ocular optics when 1% of phylogenetic bias expected from Brownian motion was removed (i.e., λ= 0.01); the value for hard-tissue data were 8%. A small degree of phylogenetic bias therefore exists in morphology despite of the stringent functional constraints. We also devised a phylogenetically informed discriminant analysis and recorded the effects of phylogenetic bias on this method using the same data. Use of proper λ values during phylogenetic bias removal improved misidentification rates in resulting classifications when prior probabilities were assumed to be equal. Even a small degree of phylogenetic bias affected the classification resulting from phylogenetically informed discriminant analysis. © 2011 The Author(s). Evolution© 2011 The Society for the Study of Evolution.

  11. Phylogenetic relationships of Chaetomium isolates based on the ...

    African Journals Online (AJOL)

    Molecular characterization of 18 Chaetomium isolates collected from India based on the internal transcribed spacer (ITS) region of the rRNA gene sequences was done. Phylogenetic analysis of full length ITS region showed that Chaetomium globosum isolates, Cg1, Cg2, Cg6, Cg11 and Cg15, Chaetomium spp. isolates, ...

  12. Host specificity and phylogenetic relationships of chicken and turkey parvoviruses

    Science.gov (United States)

    Previous reports indicate that the newly discovered chicken parvoviruses (ChPV) and turkey parvoviruses (TuPV) are very similar to each other, yet they represent different species within a new genus of Parvoviridae. Currently, strain classification is based on the phylogenetic analysis of a 561 bas...

  13. Phylogenetic relationships of Chaetomium isolates based on the ...

    African Journals Online (AJOL)

    Biotech Unit

    2013-02-27

    Feb 27, 2013 ... Phylogenetic analysis of Chaetomium species. The evolutionary history was inferred using the maximum parsimony method. The bootstrap consensus tree inferred from. 1000 replicates is taken to represent the evolutionary history of the taxa analyzed (Felsenstein, 1985). The MP tree was obtained using.

  14. Complete mitochondrial genome of threatened mahseer Tor tor (Hamilton 1822) and its phylogenetic relationship within Cyprinidae family.

    Science.gov (United States)

    Pavan-Kumar, A; Raman, Sudhanshu; Koringa, Prakash G; Patel, Namrata; Shah, Tejas; Singh, Rajeev K; Krishna, Gopal; Joshi, C G; Gireesh-Babu, P; Chaudhari, Aparna

    2016-12-01

    The mahseers (Tor, Neolissochilus and Naziritor) are an important group of fishes endemic to Asia with the conservation status of most species evaluated as threatened. Conservation plans to revive these declining wild populations are hindered by unstable taxonomy. Molecular phylogeny studies with mitochondrial genome have been successfully used to reconstruct the phylogenetic tree and to resolve taxonomic ambiguity. In the present study, complete mitochondrial genome of Tor tor has been sequenced using ion torrent next-generation sequencing platform with coverage of more than 1000 x. Comparative mitogenome analysis shows higher divergence value at ND1 gene than COI gene. Further, occurrence of a distinct genetic lineage of T. tor is revealed. The phylogenetic relationship among mahseer group has been defined as Neolissochilus hexagonolepis ((T. sinensis (T. putitora, T. tor), (T. khudree, T. tambroides)).

  15. Delineation of Streptococcus dysgalactiae, its subspecies, and its clinical and phylogenetic relationship to Streptococcus pyogenes

    DEFF Research Database (Denmark)

    Jensen, Anders; Kilian, Mogens

    2011-01-01

    The close phylogenetic relationship of the important pathogen Streptococcus pneumoniae and several species of commensal streptococci, particularly Streptococcus mitis and Streptococcus pseudopneumoniae, and the recently demonstrated sharing of genes and phenotypic traits previously considered...

  16. Phylogenetic relationships among populations of Pristurus rupestris Blanford,1874 (Sauria: Sphaerodactylidae) in southern Iran

    OpenAIRE

    YOUSOFI, SUGOL; POUYANI, ESKANDAR RASTEGAR; HOJATI, VIDA

    2015-01-01

    We examined intraspecific relationships of the subspecies Pristurus rupestris iranicus from the northern Persian Gulf area (Hormozgan, Bushehr, and Sistan and Baluchestan provinces). Phylogenetic relationships among these samples were estimated based on the mitochondrial cytochrome b gene. We used three methods of phylogenetic tree reconstruction (maximum likelihood, maximum parsimony, and Bayesian inference). The sampled populations were divided into 5 clades but exhibit little genetic diver...

  17. Assessing the relationships between phylogenetic and functional singularities in sharks (Chondrichthyes).

    Science.gov (United States)

    Cachera, Marie; Le Loc'h, François

    2017-08-01

    The relationships between diversity and ecosystem functioning have become a major focus of science. A crucial issue is to estimate functional diversity, as it is intended to impact ecosystem dynamics and stability. However, depending on the ecosystem, it may be challenging or even impossible to directly measure ecological functions and thus functional diversity. Phylogenetic diversity was recently under consideration as a proxy for functional diversity. Phylogenetic diversity is indeed supposed to match functional diversity if functions are conservative traits along evolution. However, in case of adaptive radiation and/or evolutive convergence, a mismatch may appear between species phylogenetic and functional singularities. Using highly threatened taxa, sharks, this study aimed to explore the relationships between phylogenetic and functional diversities and singularities. Different statistical computations were used in order to test both methodological issue (phylogenetic reconstruction) and overall a theoretical questioning: the predictive power of phylogeny for function diversity. Despite these several methodological approaches, a mismatch between phylogeny and function was highlighted. This mismatch revealed that (i) functions are apparently nonconservative in shark species, and (ii) phylogenetic singularity is not a proxy for functional singularity. Functions appeared to be not conservative along the evolution of sharks, raising the conservational challenge to identify and protect both phylogenetic and functional singular species. Facing the current rate of species loss, it is indeed of major importance to target phylogenetically singular species to protect genetic diversity and also functionally singular species in order to maintain particular functions within ecosystem.

  18. Conformation of phylogenetic relationship of Penaeidae shrimp based on morphometric and molecular investigations.

    Science.gov (United States)

    Rajakumaran, P; Vaseeharan, B; Jayakumar, R; Chidambara, R

    2014-01-01

    Understanding of accurate phylogenetic relationship among Penaeidae shrimp is important for academic and fisheries industry. The Morphometric and Randomly amplified polymorphic DNA (RAPD) analysis was used to make the phylogenetic relationsip among 13 Penaeidae shrimp. For morphometric analysis forty variables and total lengths of shrimp were measured for each species, and removed the effect of size variation. The size normalized values obtained was subjected to UPGMA (Unweighted Pair-Group Method with Arithmetic Mean) cluster analysis. For RAPD analysis, the four primers showed reliable differentiation between species, and used correlation coefficient between the DNA banding patterns of 13 Penaeidae species to construct UPGMA dendrogram. Phylogenetic relationship from morphometric and molecular analysis for Penaeidae species found to be congruent. We concluded that as the results from morphometry investigations concur with molecular one, phylogenetic relationship obtained for the studied Penaeidae are considered to be reliable.

  19. Phylogenetic relationships among anuran trypanosomes as revealed by riboprinting.

    Science.gov (United States)

    Clark, C G; Martin, D S; Diamond, L S

    1995-01-01

    Twenty trypanosome isolates from Anura (frogs and toads) assigned to several species were characterized by riboprinting-restriction enzyme digestion of polymerase chain reaction amplified small subunit ribosomal RNA genes. Restriction site polymorphisms allowed distinction of all the recognized species and no intraspecific variation in riboprint patterns was detected. Phylogenetic reconstruction using parsimony and distance estimates based on restriction fragment comigration showed Trypanosoma chattoni to be only distantly related to the other species, while T. ranarum and T. fallisi appear to be sister taxa despite showing non-overlapping host specificities.

  20. Contrasting HIV phylogenetic relationships and V3 loop protein similarities

    Energy Technology Data Exchange (ETDEWEB)

    Korber, B. (Los Alamos National Lab., NM (United States) Santa Fe Inst., NM (United States)); Myers, G. (Los Alamos National Lab., NM (United States))

    1992-01-01

    At least five distinct sequence subtypes of HIV-I can be identified from the major centers of the AMS pandemic. While it is too early to tell whether these subtypes are serologically or phenotypically similar or distinct in terms of properties such as pathogenicity and transmissibility, we can begin to investigate their potential for phenotypic divergence at the protein sequence level. Phylogenetic analysis of HIV DNA sequences is being widely used to examine lineages of different viral strains as they evolve and spread throughout the globe. We have identified five distinct HIV-1 subtypes (designated A-E), or clades, based on phylogenetic clustering patterns generated from genetic information from both the gag and envelope (env) genes from a spectrum of international isolates. Our initial observations concerning both HIV-1 and HIV-2 sequences indicate that conserved patterns in protein chemistry may indeed exist across distant lineages. Such patterns in V3 loop amino acid chemistry may be indicative of stable lineages or convergence within this highly variable, though functionally and immunologically critical, region. We think that there may be parallels between the apparently stable HIV-2 V3 lineage and the previously mentioned HIV-1 V3 loops which are very similar at the protein level despite being distant by cladistic analysis, and which do not possess the distinctive positively charged residues. Highly conserved V3 loop protein sequences are also encountered in SIVAGMs and CIVs (chimpanzee viral strains), which do not appear to be pathogenic in their wild-caught natural hosts.

  1. Contrasting HIV phylogenetic relationships and V3 loop protein similarities

    Energy Technology Data Exchange (ETDEWEB)

    Korber, B. [Los Alamos National Lab., NM (United States)]|[Santa Fe Inst., NM (United States); Myers, G. [Los Alamos National Lab., NM (United States)

    1992-12-31

    At least five distinct sequence subtypes of HIV-I can be identified from the major centers of the AMS pandemic. While it is too early to tell whether these subtypes are serologically or phenotypically similar or distinct in terms of properties such as pathogenicity and transmissibility, we can begin to investigate their potential for phenotypic divergence at the protein sequence level. Phylogenetic analysis of HIV DNA sequences is being widely used to examine lineages of different viral strains as they evolve and spread throughout the globe. We have identified five distinct HIV-1 subtypes (designated A-E), or clades, based on phylogenetic clustering patterns generated from genetic information from both the gag and envelope (env) genes from a spectrum of international isolates. Our initial observations concerning both HIV-1 and HIV-2 sequences indicate that conserved patterns in protein chemistry may indeed exist across distant lineages. Such patterns in V3 loop amino acid chemistry may be indicative of stable lineages or convergence within this highly variable, though functionally and immunologically critical, region. We think that there may be parallels between the apparently stable HIV-2 V3 lineage and the previously mentioned HIV-1 V3 loops which are very similar at the protein level despite being distant by cladistic analysis, and which do not possess the distinctive positively charged residues. Highly conserved V3 loop protein sequences are also encountered in SIVAGMs and CIVs (chimpanzee viral strains), which do not appear to be pathogenic in their wild-caught natural hosts.

  2. The phylogenetic relationships among infraorders and superfamilies of Diptera based on morphological evidence

    DEFF Research Database (Denmark)

    Lambkin, Christine L.; Sinclair, Bradley J.; Pape, Thomas

    2013-01-01

    Members of the megadiverse insect order Diptera (flies) have successfully colonized all continents and nearly all habitats. There are more than 154 000 described fly species, representing 1012% of animal species. Elucidating the phylogenetic relationships of such a large component of global...... biodiversity is challenging, but significant advances have been made in the last few decades. Since Hennig first discussed the monophyly of major groupings, Diptera has attracted much study, but most researchers have used non-numerical qualitative methods to assess morphological data. More recently......, quantitative phylogenetic methods have been used on both morphological and molecular data. All previous quantitative morphological studies addressed narrower phylogenetic problems, often below the suborder or infraorder level. Here we present the first numerical analysis of phylogenetic relationships...

  3. Phylogenetic relationships of the South American Doradoidea (Ostariophysi: Siluriformes

    Directory of Open Access Journals (Sweden)

    José L. O. Birindelli

    Full Text Available A phylogenetic analysis based on 311 morphological characters is presented for most species of the Doradidae, all genera of the Auchenipteridae, and representatives of 16 other catfish families. The hypothesis that was derived from the six most parsimonious trees support the monophyly of the South American Doradoidea (Doradidae plus Auchenipteridae, as well as the monophyly of the clade Doradoidea plus the African Mochokidae. In addition, the clade with Sisoroidea plus Aspredinidae was considered sister to Doradoidea plus Mochokidae. Within the Auchenipteridae, the results support the monophyly of the Centromochlinae and Auchenipterinae. The latter is composed of Tocantinsia, and four monophyletic units, two small with Asterophysusand Liosomadoras, and Pseudotatiaand Pseudauchenipterus, respectively, and two large ones with the remaining genera. Within the Doradidae, parsimony analysis recovered Wertheimeriaas sister to Kalyptodoras, composing a clade sister to all remaining doradids, which include Franciscodorasand two monophyletic groups: Astrodoradinae (plus Acanthodorasand Agamyxis and Doradinae (new arrangement. Wertheimerinae, new subfamily, is described for Kalyptodoras and Wertheimeria. Doradinae is corroborated as monophyletic and composed of four groups, one including Centrochirand Platydoras, the other with the large-size species of doradids (except Oxydoras, another with Orinocodoras, Rhinodoras, and Rhynchodoras, and another with Oxydorasplus all the fimbriate-barbel doradids. Based on the results, the species of Opsodoras are included in Hemidoras; and Tenellus, new genus, is described to include Nemadoras trimaculatus, N. leporhinusand Nemadoras ternetzi. Due to conflicting hypotheses of the phylogenetic position of Acanthodoras, Agamyxis, and Franciscodoras, these are considered as incertae sedisin Doradidae. All suprageneric taxa of the Doradoidea are diagnosed based on synapomorphic morphological characteristics.

  4. Current Understanding of Ecdysozoa and its Internal Phylogenetic Relationships.

    Science.gov (United States)

    Giribet, Gonzalo; Edgecombe, Gregory D

    2017-09-01

    Twenty years after its proposal, the monophyly of molting protostomes-Ecdysozoa-is a well-corroborated hypothesis, but the interrelationships of its major subclades are more ambiguous than is commonly appreciated. Morphological and molecular support for arthropods, onychophorans and tardigrades as a clade (Panarthropoda) continues to be challenged by a grouping of tardigrades with Nematoida in some molecular analyses, although onychophorans are consistently recovered as the sister group of arthropods. The status of Cycloneuralia and Scalidophora, each proposed by morphologists in the 1990s and widely employed in textbooks, is in flux: Cycloneuralia is typically non-monophyletic in molecular analyses, and Scalidophora is either contradicted or incompletely tested because of limited genomic and transcriptomic data for Loricifera, Kinorhyncha, and Priapulida. However, novel genomic data across Ecdysozoa should soon be available to tackle these difficult phylogenetic questions. The Cambrian fossil record indicates crown-group members of various ecdysozoan phyla as well as stem-group taxa that assist with reconstructing the most recent common ancestor of panarthropods and cycloneuralians. © The Author 2017. Published by Oxford University Press on behalf of the Society for Integrative and Comparative Biology. All rights reserved. For permissions please email: journals.permissions@oup.com.

  5. Phylogenetic relationships of North American Gomphidae and their close relatives

    Science.gov (United States)

    Intrafamilial relationships among clubtail dragonflies (Gomphidae) have been the subject of many morphological studies, but have not yet been systematically evaluated using molecular data. Here we present the first molecular phylogeny of Gomphidae. We include six of the eight sub...

  6. Phylogenetic relationships among vietnamese cocoa accessions using a non-coding region of the chloroplast dna

    International Nuclear Information System (INIS)

    Ha, L.T.V.; Dung, T.N.; Phuoc, P.H.D.

    2017-01-01

    Cocoa cultivation has increased in tropical areas around the world, including Vietnam, due to the high demand of cocoa beans for chocolate production. The genetic diversity of cocoa genotypes is recognized to be complex, however, their phylogenetic relationships need to be clarified. The present study aimed to classify the cocoa genotypes, that are imported and cultivated in Vietnam, based on a chloroplast DNA region. Sixty-three Vietnamese Cocoa accessions were collected from different regions in Southern Vietnam. Their phylogenetic relationships were identified using the universal primers c-B49317 and d-A49855 from the chloroplast DNA region. The sequences were situated in the trnL intron genes which are identify the closest terrestrial plant species of the chloroplast genome. DNA sequences were determined and subjected to an analysis of the phylogenetic relationship using the maximum evolution method. The genetic analysis showed clustering of 63 cocoa accessions in three groups: the domestically cultivated Trinitario group, the Indigenous cultivars, and the cultivations from Peru. The analyzed sequencing data also illustrated that the TD accessions and CT accessions were related genetically closed. Based on those results the genetic relation between PA and NA accessions was established as the hybrid origins of the TD and CT accessions. Some foreign accessions, including UIT, SCA and IMC accessions were confirmed of their genetic relationship. The present study is the first report of phylogenetic relationships of Vietnamese cocoa collections. The cocoa program in Vietnam has been in development for thirty years. (author)

  7. A phylogenetic perspective on the individual species-area relationship in temperate and tropical tree communities.

    Science.gov (United States)

    Yang, Jie; Swenson, Nathan G; Cao, Min; Chuyong, George B; Ewango, Corneille E N; Howe, Robert; Kenfack, David; Thomas, Duncan; Wolf, Amy; Lin, Luxiang

    2013-01-01

    Ecologists have historically used species-area relationships (SARs) as a tool to understand the spatial distribution of species. Recent work has extended SARs to focus on individual-level distributions to generate individual species area relationships (ISARs). The ISAR approach quantifies whether individuals of a species tend have more or less species richness surrounding them than expected by chance. By identifying richness 'accumulators' and 'repellers', respectively, the ISAR approach has been used to infer the relative importance of abiotic and biotic interactions and neutrality. A clear limitation of the SAR and ISAR approaches is that all species are treated as evolutionarily independent and that a large amount of work has now shown that local tree neighborhoods exhibit non-random phylogenetic structure given the species richness. Here, we use nine tropical and temperate forest dynamics plots to ask: (i) do ISARs change predictably across latitude?; (ii) is the phylogenetic diversity in the neighborhood of species accumulators and repellers higher or lower than that expected given the observed species richness?; and (iii) do species accumulators, repellers distributed non-randomly on the community phylogenetic tree? The results indicate no clear trend in ISARs from the temperate zone to the tropics and that the phylogenetic diversity surrounding the individuals of species is generally only non-random on very local scales. Interestingly the distribution of species accumulators and repellers was non-random on the community phylogenies suggesting the presence of phylogenetic signal in the ISAR across latitude.

  8. Phylogenetic relationships in the "grossulariae" species group of the genus Aphis (Hemiptera: Sternorrhyncha: Aphididae): Molecular evidence

    DEFF Research Database (Denmark)

    Turcinaviciene, Jorga; Rakauskas, Rimantas; Pedersen, Bo Vest

    2006-01-01

    Phylogenetic relationships among Palaearctic Ribes and/or Onagraceae inhabiting Aphis species from five countries were examined using mitochondrial gene cytochrome oxidase I (CO-I) and nuclear gene elongation factor 1 a (EF-1a) sequences. There was no major conflict between the trees obtained fro...

  9. SICLE: a high-throughput tool for extracting evolutionary relationships from phylogenetic trees

    Directory of Open Access Journals (Sweden)

    Dan F. DeBlasio

    2016-08-01

    Full Text Available We present the phylogeny analysis software SICLE (Sister Clade Extractor, an easy-to-use, high-throughput tool to describe the nearest neighbors to a node of interest in a phylogenetic tree as well as the support value for the relationship. The application is a command line utility that can be embedded into a phylogenetic analysis pipeline or can be used as a subroutine within another C++ program. As a test case, we applied this new tool to the published phylome of Salinibacter ruber, a species of halophilic Bacteriodetes, identifying 13 unique sister relationships to S. ruber across the 4,589 gene phylogenies. S. ruber grouped with bacteria, most often other Bacteriodetes, in the majority of phylogenies, but 91 phylogenies showed a branch-supported sister association between S. ruber and Archaea, an evolutionarily intriguing relationship indicative of horizontal gene transfer. This test case demonstrates how SICLE makes it possible to summarize the phylogenetic information produced by automated phylogenetic pipelines to rapidly identify and quantify the possible evolutionary relationships that merit further investigation. SICLE is available for free for noncommercial use at http://eebweb.arizona.edu/sicle/.

  10. SICLE: a high-throughput tool for extracting evolutionary relationships from phylogenetic trees.

    Science.gov (United States)

    DeBlasio, Dan F; Wisecaver, Jennifer H

    2016-01-01

    We present the phylogeny analysis software SICLE (Sister Clade Extractor), an easy-to-use, high-throughput tool to describe the nearest neighbors to a node of interest in a phylogenetic tree as well as the support value for the relationship. The application is a command line utility that can be embedded into a phylogenetic analysis pipeline or can be used as a subroutine within another C++ program. As a test case, we applied this new tool to the published phylome of Salinibacter ruber, a species of halophilic Bacteriodetes, identifying 13 unique sister relationships to S. ruber across the 4,589 gene phylogenies. S. ruber grouped with bacteria, most often other Bacteriodetes, in the majority of phylogenies, but 91 phylogenies showed a branch-supported sister association between S. ruber and Archaea, an evolutionarily intriguing relationship indicative of horizontal gene transfer. This test case demonstrates how SICLE makes it possible to summarize the phylogenetic information produced by automated phylogenetic pipelines to rapidly identify and quantify the possible evolutionary relationships that merit further investigation. SICLE is available for free for noncommercial use at http://eebweb.arizona.edu/sicle/.

  11. Multigene analysis of lophophorate and chaetognath phylogenetic relationships.

    Science.gov (United States)

    Helmkampf, Martin; Bruchhaus, Iris; Hausdorf, Bernhard

    2008-01-01

    Maximum likelihood and Bayesian inference analyses of seven concatenated fragments of nuclear-encoded housekeeping genes indicate that Lophotrochozoa is monophyletic, i.e., the lophophorate groups Bryozoa, Brachiopoda and Phoronida are more closely related to molluscs and annelids than to Deuterostomia or Ecdysozoa. Lophophorates themselves, however, form a polyphyletic assemblage. The hypotheses that they are monophyletic and more closely allied to Deuterostomia than to Protostomia can be ruled out with both the approximately unbiased test and the expected likelihood weights test. The existence of Phoronozoa, a putative clade including Brachiopoda and Phoronida, has also been rejected. According to our analyses, phoronids instead share a more recent common ancestor with bryozoans than with brachiopods. Platyhelminthes is the sister group of Lophotrochozoa. Together these two constitute Spiralia. Although Chaetognatha appears as the sister group of Priapulida within Ecdysozoa in our analyses, alternative hypothesis concerning chaetognath relationships could not be rejected.

  12. [Comparative leaf anatomy and phylogenetic relationships of 11 species of Laeliinae with emphasis on Brassavola (Orchidaceae)].

    Science.gov (United States)

    Noguera-Savelli, Eliana; Jáuregui, Damelis

    2011-09-01

    Brassavola inhabits a wide altitude range and habitat types from Northern Mexico to Northern Argentina. Classification schemes in plants have normally used vegetative and floral characters, but when species are very similar, as in this genus, conflicts arise in species delimitation, and alternative methods should be applied. In this study we explored the taxonomic and phylogenetic value of the anatomical structure of leaves in Brassavola; as ingroup, seven species of Brassavola were considered, and as an outgroup Guarianthe skinneri, Laelia anceps, Rhyncholaelia digbyana and Rhyncholaelia glauca were evaluated. Leaf anatomical characters were studied in freehand cross sections of the middle portion with a light microscope. Ten vegetative anatomical characters were selected and coded for the phylogenetic analysis. Phylogenetic reconstruction was carried out under maximum parsimony using the program NONA through WinClada. Overall, Brassavola species reveal a wide variety of anatomical characters, many of them associated with xeromorphic plants: thick cuticle, hypodermis and cells of the mesophyll with spiral thickenings in the secondary wall. Moreover, mesophyll is either homogeneous or heterogeneous, often with extravascular bundles of fibers near the epidermis at both terete and flat leaves. All vascular bundles are collateral, arranged in more than one row in the mesophyll. The phylogenetic analysis did not resolve internal relationships of the genus; we obtained a polytomy, indicating that the anatomical characters by themselves have little phylogenetic value in Brassavola. We concluded that few anatomical characters are phylogenetically important; however, they would provide more support to elucidate the phylogenetic relantionships in the Orchidaceae and other plant groups if they are used in conjunction with morphological and/or molecular characters.

  13. Comparative analyses of plastid genomes from fourteen Cornales species: inferences for phylogenetic relationships and genome evolution.

    Science.gov (United States)

    Fu, Chao-Nan; Li, Hong-Tao; Milne, Richard; Zhang, Ting; Ma, Peng-Fei; Yang, Jing; Li, De-Zhu; Gao, Lian-Ming

    2017-12-08

    The Cornales is the basal lineage of the asterids, the largest angiosperm clade. Phylogenetic relationships within the order were previously not fully resolved. Fifteen plastid genomes representing 14 species, ten genera and seven families of Cornales were newly sequenced for comparative analyses of genome features, evolution, and phylogenomics based on different partitioning schemes and filtering strategies. All plastomes of the 14 Cornales species had the typical quadripartite structure with a genome size ranging from 156,567 bp to 158,715 bp, which included two inverted repeats (25,859-26,451 bp) separated by a large single-copy region (86,089-87,835 bp) and a small single-copy region (18,250-18,856 bp) region. These plastomes encoded the same set of 114 unique genes including 31 transfer RNA, 4 ribosomal RNA and 79 coding genes, with an identical gene order across all examined Cornales species. Two genes (rpl22 and ycf15) contained premature stop codons in seven and five species respectively. The phylogenetic relationships among all sampled species were fully resolved with maximum support. Different filtering strategies (none, light and strict) of sequence alignment did not have an effect on these relationships. The topology recovered from coding and noncoding data sets was the same as for the whole plastome, regardless of filtering strategy. Moreover, mutational hotspots and highly informative regions were identified. Phylogenetic relationships among families and intergeneric relationships within family of Cornales were well resolved. Different filtering strategies and partitioning schemes do not influence the relationships. Plastid genomes have great potential to resolve deep phylogenetic relationships of plants.

  14. The phylogenetic relationships of endemic Australasian trichostrongylin families (Nematoda: Strongylida) parasitic in marsupials and monotremes.

    Science.gov (United States)

    Chilton, Neil B; Huby-Chilton, Florence; Koehler, Anson V; Gasser, Robin B; Beveridge, Ian

    2015-10-01

    The phylogenetic relationships of the endemic (or largely endemic) Australasian trichostrongylin nematode families Herpetostrongylidae, Mackerrastrongylidae and Nicollinidae as well as endemic trichostrongylin nematodes currently placed in the families Trichostrongylidae and Molineidae were examined using the complete large subunit (28S) ribosomal RNA gene. The Herpetostrongylinae proved to be monophyletic. However, representatives of the Nicollinidae nested with the Herpetostrongylinae. The Mackerrastrongylidae was also a monophyletic group and included Peramelistrongylus, currently classified within the Trichostrongylidae. The Globocephaloidinae, currently considered to be a subfamily of the Herpetostrongylidae, was excluded from the family in the current analysis. Ollulanus and Libyostrongylus, included for the first time in a molecular phylogenetic analysis, were placed within the Trichostrongylidae. This study provided strong support for the Herpetostrongylidae (including within it the Nicollinidae, but excluding the Globocephaloidinae) and the Mackerrastrongylidae as monophyletic assemblages. Additional studies are required to resolve the relationships of the remaining endemic Australasian trichostrongylin genera.

  15. Possible sister groups and phylogenetic relationships among selected North Pacific and North Atlantic Rhodophyta

    Science.gov (United States)

    Lindstrom, Sandra C.

    1987-09-01

    Although the cool temperate (boreal) waters of the N. Pacific and N. Atlantic share many similar if not identical species, there have been few studies to test the identity of these species pairs. Whereas such tests are important from a taxonomic perspective, they tell us little if anything about biogeographic relationships. A more useful approach is one employing phylogenetic systematics (cladistics). The interpretation of phylogenetic diagrams (cladograms) in terms of biogeographic area relationships is explained. It is argued that cladistic analyses of taxa occurring in the cool temperate waters of the northern oceans can provide biogeographic tracks, which in turn can suggest the origins and migrations of species and possibly even floras. A number of cool temperate taxa that appear particularly amenable to this approach are discussed, including genera in the Palmariaceae, Corallinaceae, Dumontiaceae, Solieriaceae, Petrocelidaceae, Ceramiaceae and Rhodomelaceae.

  16. PHYLOGENETIC RELATIONSHIPS AMONG VIETNAMESE COCOA ACCESSIONS USING A NON-CODING REGION OF THE CHLOROPLAST DNA

    OpenAIRE

    Lam Thi, Viet Ha; D.T., Khang; Everaert, Helena; T.N, Dung; P.H.D, Phuoc; H.T., Toan; Dewettinck, Koen; Messens, Kathy

    2017-01-01

    Cocoa (Theobroma cacao L.) cultivation has increased in tropical areas around the world, including Vietnam, due to the high demand of cocoa beans for chocolate production. The genetic diversity of cocoa genotypes is recognized to be complex, however, their phylogenetic relationships need to be clarified. The present study aimed to classify the cocoa genotypes that are imported and cultivated in Vietnam based on a chloroplast DNA region. Sixty-three Vietnamese Cocoa accessions were collected f...

  17. Phylogenetic Relationships of Pseudorasbora, Pseudopungtungia, and Pungtungia (Teleostei; Cypriniformes; Gobioninae Inferred from Multiple Nuclear Gene Sequences

    Directory of Open Access Journals (Sweden)

    Keun-Yong Kim

    2013-01-01

    Full Text Available Gobionine species belonging to the genera Pseudorasbora, Pseudopungtungia, and Pungtungia (Teleostei; Cypriniformes; Cyprinidae have been heavily studied because of problems on taxonomy, threats of extinction, invasion, and human health. Nucleotide sequences of three nuclear genes, that is, recombination activating protein gene 1 (rag1, recombination activating gene 2 (rag2, and early growth response 1 gene (egr1, from Pseudorasbora, Pseudopungtungia, and Pungtungia species residing in China, Japan, and Korea, were analyzed to elucidate their intergeneric and interspecific phylogenetic relationships. In the phylogenetic tree inferred from their multiple gene sequences, Pseudorasbora, Pseudopungtungia and Pungtungia species ramified into three phylogenetically distinct clades; the “tenuicorpa” clade composed of Pseudopungtungia tenuicorpa, the “parva” clade composed of all Pseudorasbora species/subspecies, and the “herzi” clade composed of Pseudopungtungia nigra, and Pungtungia herzi. The genus Pseudorasbora was recovered as monophyletic, while the genus Pseudopungtungia was recovered as polyphyletic. Our phylogenetic result implies the unstable taxonomic status of the genus Pseudopungtungia.

  18. Phylogenetic groups among Klebsiella pneumoniae isolates from Brazil: relationship with antimicrobial resistance and origin.

    Science.gov (United States)

    de Melo, Maíra Espíndola Silva; Cabral, Adriane Borges; Maciel, Maria Amélia Vieira; da Silveira, Vera Magalhães; de Souza Lopes, Ana Catarina

    2011-05-01

    The objectives of this study were to determine the distribution of phylogenetic groups among Klebsiella pneumoniae isolates from Recife, Brazil and to assess the relationship between the groups and the isolation sites and resistance profile. Ninety four isolates of K. pneumoniae from hospital or community infections and from normal microbiota were analyzed by gyrA PCR-RFLP, antibiotic susceptibility, and adonitol fermentation. The results revealed the distinction of three phylogenetic groups, as it has also been reported in Europe, showing that these clusters are highly conserved within K. pneumoniae. Group KpI was dominantly represented by hospital and community isolates while groups KpII and KpIII displayed mainly normal microbiota isolates. The resistance to third generation cephalosporins, aztreonam, imipenem, amoxicillin/clavulanic acid, and streptomycin was only observed in KpI. The percentage of resistance was higher in KpI, followed by KpII and KpIII. The differences in the distribution of K. pneumoniae phylogenetic groups observed in this study suggest distinctive clinical and epidemiological characteristics among the three groups, which is important to understand the epidemiology of infections caused by this organism. This is the first study in Brazil on K. pneumoniae isolates from normal microbiota and community infections regarding the distribution of phylogenetic groups based on the gyrA gene.

  19. Evidence for a close phylogenetic relationship between Melissococcus pluton, the causative agent of European foulbrood disease, and the genus Enterococcus.

    Science.gov (United States)

    Cai, J; Collins, M D

    1994-04-01

    The 16S rRNA gene sequence of Melissococcus pluton, the causative agent of European foulbrood disease, was determined in order to investigate the phylogenetic relationships between this organism and other low-G + C-content gram-positive bacteria. A comparative sequence analysis revealed that M. pluton is a close phylogenetic relative of the genus Enterococcus.

  20. Phylogenetic relationships of typical antbirds (Thamnophilidae and test of incongruence based on Bayes factors

    Directory of Open Access Journals (Sweden)

    Nylander Johan AA

    2004-07-01

    Full Text Available Abstract Background The typical antbirds (Thamnophilidae form a monophyletic and diverse family of suboscine passerines that inhabit neotropical forests. However, the phylogenetic relationships within this assemblage are poorly understood. Herein, we present a hypothesis of the generic relationships of this group based on Bayesian inference analyses of two nuclear introns and the mitochondrial cytochrome b gene. The level of phylogenetic congruence between the individual genes has been investigated utilizing Bayes factors. We also explore how changes in the substitution models affected the observed incongruence between partitions of our data set. Results The phylogenetic analysis supports both novel relationships, as well as traditional groupings. Among the more interesting novel relationship suggested is that the Terenura antwrens, the wing-banded antbird (Myrmornis torquata, the spot-winged antshrike (Pygiptila stellaris and the russet antshrike (Thamnistes anabatinus are sisters to all other typical antbirds. The remaining genera fall into two major clades. The first includes antshrikes, antvireos and the Herpsilochmus antwrens, while the second clade consists of most antwren genera, the Myrmeciza antbirds, the "professional" ant-following antbirds, and allied species. Our results also support previously suggested polyphyly of Myrmotherula antwrens and Myrmeciza antbirds. The tests of phylogenetic incongruence, using Bayes factors, clearly suggests that allowing the gene partitions to have separate topology parameters clearly increased the model likelihood. However, changing a component of the nucleotide substitution model had much higher impact on the model likelihood. Conclusions The phylogenetic results are in broad agreement with traditional classification of the typical antbirds, but some relationships are unexpected based on external morphology. In these cases their true affinities may have been obscured by convergent evolution and

  1. Application of multigene phylogenetics and site-stripping to resolve intraordinal relationships in the Rhodymeniales (Rhodophyta).

    Science.gov (United States)

    Filloramo, Gina V; Saunders, Gary W

    2016-06-01

    Previous molecular assessments of the red algal order Rhodymeniales have confirmed its monophyly and distinguished the six currently recognized families (viz. Champiaceae, Faucheaceae, Fryeellaceae, Hymenocladiaceae, Lomentariaceae, and Rhodymeniaceae); however, relationships among most of these families have remained unresolved possibly as a result of substitution saturation at deeper phylogenetic nodes. The objective of the current study was to improve rhodymenialean systematics by increasing taxonomic representation and using a more robust multigene dataset of mitochondrial (COB, COI/COI-5P), nuclear (LSU, EF2) and plastid markers (psbA, rbcL). Additionally, we aimed to prevent phylogenetic inference problems associated with substitution saturation (particularly at the interfamilial nodes) by removing fast-evolving sites and analyzing a series of progressively more conservative alignments. The Rhodymeniales was resolved as two major lineages: (i) the Fryeellaceae as sister to the Faucheaceae and Lomentariaceae; and (ii) the Rhodymeniaceae allied to the Champiaceae and Hymenocladiaceae. Support at the interfamilial nodes was highest when 20% of variable sites were removed. Inclusion of Binghamiopsis, Chamaebotrys, and Minium, which were absent in previous phylogenetic investigations, established their phylogenetic affinities while assessment of two genera consistently polyphyletic in phylogenetic analyses, Erythrymenia and Lomentaria, resulted in the proposition of the novel genera Perbella and Fushitsunagia. The taxonomic position of Drouetia was reinvestigated with re-examination of holotype material of D. coalescens to clarify tetrasporangial development in this genus. In addition, we added three novel Australian species to Drouetia as a result of ongoing DNA barcoding assessments-D. aggregata sp. nov., D. scutellata sp. nov., and D. viridescens sp. nov. © 2016 Phycological Society of America.

  2. A contribution to the understanding of phylogenetic relationships among species of the genus Octopus (Octopodidae: Cephalopoda

    Directory of Open Access Journals (Sweden)

    María Soledad Acosta-Jofré

    2011-11-01

    Full Text Available Many species of the genus Octopus are important resources for fisheries worldwide. Its approximately 200 species show a strong similarity in structural morphology and a wide diversity in skin coloration and patterning, behaviour and life strategies that have hampered the study of phylogenetic relationships. We used a Bayesian approach to estimate as yet unknown phylogenetic relationships among O. tehuelchus from the southwestern Atlantic, new specimens of O. mimus (Chile and Peru and other Octopus species, and used Bayes factors to test phylogenetic hypotheses. O. tehuelchus was more closely related to the genera Callistoctopus, Grimpella and Macroctopus than to Octopus, and therefore its generic placement may need a revision. O. vulgaris specimens from Costa Rica (Pacific Ocean and O. oculifer grouped with O. mimus. Bayes factors showed positive evidence in favor of this grouping and therefore these individuals could have been misidentified, being in fact O. mimus. O. vulgaris specimens from the Costa Rican Caribbean were more related to O. mimus than to other O. vulgaris and could represent a cryptic species. The remaining O. vulgaris clustered with O. tetricus. Bayes factors found strong evidence against the monophyly of O. vulgaris as currently defined, giving statistical support to the monophyly of an O. vulgaris s. str. + O. tetricus group proposed previously by other authors.

  3. Analysis of plasmid genes by phylogenetic profiling and visualization of homology relationships using Blast2Network

    Directory of Open Access Journals (Sweden)

    Bazzicalupo Marco

    2008-12-01

    Full Text Available Abstract Background Phylogenetic methods are well-established bioinformatic tools for sequence analysis, allowing to describe the non-independencies of sequences because of their common ancestor. However, the evolutionary profiles of bacterial genes are often complicated by hidden paralogy and extensive and/or (multiple horizontal gene transfer (HGT events which make bifurcating trees often inappropriate. In this context, plasmid sequences are paradigms of network-like relationships characterizing the evolution of prokaryotes. Actually, they can be transferred among different organisms allowing the dissemination of novel functions, thus playing a pivotal role in prokaryotic evolution. However, the study of their evolutionary dynamics is complicated by the absence of universally shared genes, a prerequisite for phylogenetic analyses. Results To overcome such limitations we developed a bioinformatic package, named Blast2Network (B2N, allowing the automatic phylogenetic profiling and the visualization of homology relationships in a large number of plasmid sequences. The software was applied to the study of 47 completely sequenced plasmids coming from Escherichia, Salmonella and Shigella spps. Conclusion The tools implemented by B2N allow to describe and visualize in a new way some of the evolutionary features of plasmid molecules of Enterobacteriaceae; in particular it helped to shed some light on the complex history of Escherichia, Salmonella and Shigella plasmids and to focus on possible roles of unannotated proteins. The proposed methodology is general enough to be used for comparative genomic analyses of bacteria.

  4. Phylogenetic relationships of Malaysia's long-tailed macaques, Macaca fascicularis, based on cytochrome b sequences.

    Science.gov (United States)

    Abdul-Latiff, Muhammad Abu Bakar; Ruslin, Farhani; Fui, Vun Vui; Abu, Mohd-Hashim; Rovie-Ryan, Jeffrine Japning; Abdul-Patah, Pazil; Lakim, Maklarin; Roos, Christian; Yaakop, Salmah; Md-Zain, Badrul Munir

    2014-01-01

    Phylogenetic relationships among Malaysia's long-tailed macaques have yet to be established, despite abundant genetic studies of the species worldwide. The aims of this study are to examine the phylogenetic relationships of Macaca fascicularis in Malaysia and to test its classification as a morphological subspecies. A total of 25 genetic samples of M. fascicularis yielding 383 bp of Cytochrome b (Cyt b) sequences were used in phylogenetic analysis along with one sample each of M. nemestrina and M. arctoides used as outgroups. Sequence character analysis reveals that Cyt b locus is a highly conserved region with only 23% parsimony informative character detected among ingroups. Further analysis indicates a clear separation between populations originating from different regions; the Malay Peninsula versus Borneo Insular, the East Coast versus West Coast of the Malay Peninsula, and the island versus mainland Malay Peninsula populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo's population was distinguished from Peninsula's population (99% and 100% bootstrap value in NJ and MP respectively and 1.00 posterior probability in Bayesian trees). The East coast population was separated from other Peninsula populations (64% in NJ, 66% in MP and 0.53 posterior probability in Bayesian). West coast populations were divided into 2 clades: the North-South (47%/54% in NJ, 26/26% in MP and 1.00/0.80 posterior probability in Bayesian) and Island-Mainland (93% in NJ, 90% in MP and 1.00 posterior probability in Bayesian). The results confirm the previous morphological assignment of 2 subspecies, M. f. fascicularis and M. f. argentimembris, in the Malay Peninsula. These populations should be treated as separate genetic entities in order to conserve the genetic diversity of Malaysia's M. fascicularis. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations in Malaysia.

  5. PHYLOGENETIC RELATIONSHIPS AMONGST 10 Durio SPECIES BASED ON PCR-RFLP ANALYSIS OF TWO CHLOROPLAST GENES

    Directory of Open Access Journals (Sweden)

    Panca J. Santoso

    2013-07-01

    Full Text Available Twenty seven species of Durio have been identified in Sabah and Sarawak, Malaysia, but their relationships have not been studied. This study was conducted to analyse phylogenetic relationships amongst 10 Durio species in Malaysia using PCR-RFLP on two chloroplast DNA genes, i.e. ndhC-trnV and rbcL. DNAs were extracted from young leaves of 11 accessions from 10 Durio species collected from the Tenom Agriculture Research Station, Sabah, and University Agriculture Park, Universiti Putra Malaysia. Two pairs of oligonucleotide primers, N1-N2 and rbcL1-rbcL2, were used to flank the target regions ndhC-trnV and rbcL. Eight restriction enzymes, HindIII, BsuRI, PstI, TaqI, MspI, SmaI, BshNI, and EcoR130I, were used to digest the amplicons. Based on the results of PCR-RFLP on ndhC-trnV gene, the 10 Durio species were grouped into five distinct clusters, and the accessions generally showed high variations. However, based on the results of PCR-RFLP on the rbcL gene, the species were grouped into three distinct clusters, and generally showed low variations. This means that ndhC-trnV gene is more reliable for phylogenetic analysis in lower taxonomic level of Durio species or for diversity analysis, while rbcL gene is reliable marker for phylogenetic analysis at higher taxonomic level. PCR-RFLP on the ndhC-trnV and rbcL genes could therefore be considered as useful markers to phylogenetic analysis amongst Durio species. These finding might be used for further molecular marker assisted in Durio breeding program.

  6. Bryozoans are returning home: recolonization of freshwater ecosystems inferred from phylogenetic relationships.

    Science.gov (United States)

    Koletić, Nikola; Novosel, Maja; Rajević, Nives; Franjević, Damjan

    2015-01-01

    Bryozoans are aquatic invertebrates that inhabit all types of aquatic ecosystems. They are small animals that form large colonies by asexual budding. Colonies can reach the size of several tens of centimeters, while individual units within a colony are the size of a few millimeters. Each individual within a colony works as a separate zooid and is genetically identical to each other individual within the same colony. Most freshwater species of bryozoans belong to the Phylactolaemata class, while several species that tolerate brackish water belong to the Gymnolaemata class. Tissue samples for this study were collected in the rivers of Adriatic and Danube basin and in the wetland areas in the continental part of Croatia (Europe). Freshwater and brackish taxons of bryozoans were genetically analyzed for the purpose of creating phylogenetic relationships between freshwater and brackish taxons of the Phylactolaemata and Gymnolaemata classes and determining the role of brackish species in colonizing freshwater and marine ecosystems. Phylogenetic relationships inferred on the genes for 18S rRNA, 28S rRNA, COI, and ITS2 region confirmed Phylactolaemata bryozoans as radix bryozoan group. Phylogenetic analysis proved Phylactolaemata bryozoan's close relations with taxons from Phoronida phylum as well as the separation of the Lophopodidae family from other families within the Plumatellida genus. Comparative analysis of existing knowledge about the phylogeny of bryozoans and the expansion of known evolutionary hypotheses is proposed with the model of settlement of marine and freshwater ecosystems by the bryozoans group during their evolutionary past. In this case study, brackish bryozoan taxons represent a link for this ecological phylogenetic hypothesis. Comparison of brackish bryozoan species Lophopus crystallinus and Conopeum seurati confirmed a dual colonization of freshwater ecosystems throughout evolution of this group of animals.

  7. The complete mitochondrial genome of Sesarmops sinensis reveals gene rearrangements and phylogenetic relationships in Brachyura.

    Science.gov (United States)

    Tang, Bo-Ping; Xin, Zhao-Zhe; Liu, Yu; Zhang, Dai-Zhen; Wang, Zheng-Fei; Zhang, Hua-Bin; Chai, Xin-Yue; Zhou, Chun-Lin; Liu, Qiu-Ning

    2017-01-01

    Mitochondrial genome (mitogenome) is very important to understand molecular evolution and phylogenetics. Herein, in this study, the complete mitogenome of Sesarmops sinensis was reported. The mitogenome was 15,905 bp in size, and contained 13 protein-coding genes (PCGs), two ribosomal RNA (rRNA) genes, 22 transfer RNA (tRNA) genes, and a control region (CR). The AT skew and the GC skew are both negative in the mitogenomes of S. sinensis. The nucleotide composition of the S. sinensis mitogenome was also biased toward A + T nucleotides (75.7%). All tRNA genes displayed a typical mitochondrial tRNA cloverleaf structure, except for the trnS1 gene, which lacked a dihydroxyuridine arm. S. sinensis exhibits a novel rearrangement compared with the Pancrustacean ground pattern and other Brachyura species. Based on the 13 PCGs, the phylogenetic analysis showed that S. sinensis and Sesarma neglectum were clustered on one branch with high nodal support values, indicating that S. sinensis and S. neglectum have a sister group relationship. The group (S. sinensis + S. neglectum) was sister to (Parasesarmops tripectinis + Metopaulias depressus), suggesting that S. sinensis belongs to Grapsoidea, Sesarmidae. Phylogenetic trees based on amino acid sequences and nucleotide sequences of mitochondrial 13 PCGs using BI and ML respectively indicate that section Eubrachyura consists of four groups clearly. The resulting phylogeny supports the establishment of a separate subsection Potamoida. These four groups correspond to four subsections of Raninoida, Heterotremata, Potamoida, and Thoracotremata.

  8. Molecular and morphological analyses reveal phylogenetic relationships of stingrays focusing on the family Dasyatidae (Myliobatiformes.

    Directory of Open Access Journals (Sweden)

    Kean Chong Lim

    Full Text Available Elucidating the phylogenetic relationships of the current but problematic Dasyatidae (Order Myliobatiformes was the first priority of the current study. Here, we studied three molecular gene markers of 43 species (COI gene, 33 species (ND2 gene and 34 species (RAG1 gene of stingrays to draft out the phylogenetic tree of the order. Nine character states were identified and used to confirm the molecularly constructed phylogenetic trees. Eight or more clades (at different hierarchical level were identified for COI, ND2 and RAG1 genes in the Myliobatiformes including four clades containing members of the present Dasyatidae, thus rendering the latter non-monophyletic. The uncorrected p-distance between these four 'Dasytidae' clades when compared to the distance between formally known families confirmed that these four clades should be elevated to four separate families. We suggest a revision of the present classification, retaining the Dasyatidae (Dasyatis and Taeniurops species but adding three new families namely, Neotrygonidae (Neotrygon and Taeniura species, Himanturidae (Himantura species and Pastinachidae (Pastinachus species. Our result indicated the need to further review the classification of Dasyatis microps. By resolving the non-monophyletic problem, the suite of nine character states enables the natural classification of the Myliobatiformes into at least thirteen families based on morphology.

  9. EvoCor: a platform for predicting functionally related genes using phylogenetic and expression profiles.

    Science.gov (United States)

    Dittmar, W James; McIver, Lauren; Michalak, Pawel; Garner, Harold R; Valdez, Gregorio

    2014-07-01

    The wealth of publicly available gene expression and genomic data provides unique opportunities for computational inference to discover groups of genes that function to control specific cellular processes. Such genes are likely to have co-evolved and be expressed in the same tissues and cells. Unfortunately, the expertise and computational resources required to compare tens of genomes and gene expression data sets make this type of analysis difficult for the average end-user. Here, we describe the implementation of a web server that predicts genes involved in affecting specific cellular processes together with a gene of interest. We termed the server 'EvoCor', to denote that it detects functional relationships among genes through evolutionary analysis and gene expression correlation. This web server integrates profiles of sequence divergence derived by a Hidden Markov Model (HMM) and tissue-wide gene expression patterns to determine putative functional linkages between pairs of genes. This server is easy to use and freely available at http://pilot-hmm.vbi.vt.edu/. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Mitochondrial DNA genomes organization and phylogenetic relationships analysis of eight anemonefishes (pomacentridae: amphiprioninae.

    Directory of Open Access Journals (Sweden)

    Jianlong Li

    Full Text Available Anemonefishes (Pomacentridae Amphiprioninae are a group of 30 valid coral reef fish species with their phylogenetic relationships still under debate. The eight available mitogenomes of anemonefishes were used to reconstruct the molecular phylogenetic tree; six were obtained from this study (Amphiprion clarkii, A. frenatus, A. percula, A. perideraion, A. polymnus and Premnas biaculeatus and two from GenBank (A. bicinctus and A. ocellaris. The seven Amphiprion species represent all four subgenera and P. biaculeatus is the only species from Premnas. The eight mitogenomes of anemonefishes encoded 13 protein-coding genes, two rRNA genes, 22 tRNA genes and two main non-coding regions, with the gene arrangement and translation direction basically identical to other typical vertebrate mitogenomes. Among the 13 protein-coding genes, A. ocellaris (AP006017 and A. percula (KJ174497 had the same length in ND5 with 1,866 bp, which were three nucleotides less than the other six anemonefishes. Both structures of ND5, however, could translate to amino acid successfully. Only four mitogenomes had the tandem repeats in D-loop; the tandem repeats were located in downstream after Conserved Sequence Block rather than the upstream and repeated in a simply way. The phylogenetic utility was tested with Bayesian and Maximum Likelihood methods using all 13 protein-coding genes. The results strongly supported that the subfamily Amphiprioninae was monophyletic and P. biaculeatus should be assigned to the genus Amphiprion. Premnas biaculeatus with the percula complex were revealed to be the ancient anemonefish species. The tree forms of ND1, COIII, ND4, Cytb, Cytb+12S rRNA, Cytb+COI and Cytb+COI+12S rRNA were similar to that 13 protein-coding genes, therefore, we suggested that the suitable single mitochondrial gene for phylogenetic analysis of anemonefishes maybe Cytb. Additional mitogenomes of anemonefishes with a combination of nuclear markers will be useful to

  11. Complete mitochondrial genomes elucidate phylogenetic relationships of the deep-sea octocoral families Coralliidae and Paragorgiidae

    Science.gov (United States)

    Figueroa, Diego F.; Baco, Amy R.

    2014-01-01

    In the past decade, molecular phylogenetic analyses of octocorals have shown that the current morphological taxonomic classification of these organisms needs to be revised. The latest phylogenetic analyses show that most octocorals can be divided into three main clades. One of these clades contains the families Coralliidae and Paragorgiidae. These families share several taxonomically important characters and it has been suggested that they may not be monophyletic; with the possibility of the Coralliidae being a derived branch of the Paragorgiidae. Uncertainty exists not only in the relationship of these two families, but also in the classification of the two genera that make up the Coralliidae, Corallium and Paracorallium. Molecular analyses suggest that the genus Corallium is paraphyletic, and it can be divided into two main clades, with the Paracorallium as members of one of these clades. In this study we sequenced the whole mitochondrial genome of five species of Paragorgia and of five species of Corallium to use in a phylogenetic analysis to achieve two main objectives; the first to elucidate the phylogenetic relationship between the Paragorgiidae and Coralliidae and the second to determine whether the genera Corallium and Paracorallium are monophyletic. Our results show that other members of the Coralliidae share the two novel mitochondrial gene arrangements found in a previous study in Corallium konojoi and Paracorallium japonicum; and that the Corallium konojoi arrangement is also found in the Paragorgiidae. Our phylogenetic reconstruction based on all the protein coding genes and ribosomal RNAs of the mitochondrial genome suggest that the Coralliidae are not a derived branch of the Paragorgiidae, but rather a monophyletic sister branch to the Paragorgiidae. While our manuscript was in review a study was published using morphological data and several fragments from mitochondrial genes to redefine the taxonomy of the Coralliidae. Paracorallium was subsumed

  12. Phylogenetic Relationships of Five Asian Schilbid Genera Including Clupisoma (Siluriformes: Schilbeidae.

    Directory of Open Access Journals (Sweden)

    Jing Wang

    Full Text Available The phylogenetic relationships of Asian schilbid catfishes of the genera Clupisoma, Ailia, Horabagrus, Laides and Pseudeutropius are poorly understood, especially those of Clupisoma. Herein, we reconstruct the phylogeny of 38 species of catfishes belonging to 28 genera and 14 families using the concatenated mitochondrial genes COI, cytb, and 16S rRNA, as well as the nuclear genes RAG1 and RAG2. The resulting phylogenetic trees consistently place Clupisoma as the sister taxon of Laides, and the five representative Asian schilbid genera form two monophyletic groups with the relationships (Ailia (Laides, Clupisoma and (Horabagrus, Pseudeutropius. The so-called "Big Asia" lineage relates distantly to African schilbids. Independent analyses of the mitochondrial and nuclear DNA data yield differing trees for the two Asian schilbid groups. Analyses of the mitochondrial gene data support a sister-group relationship for (Ailia (Laides, Clupisoma and the Sisoroidea and a sister-taxon association of (Horabagrus, Pseudeutropius and the Bagridae. In contrast, analyses of the combined nuclear data indicate (Ailia (Laides, Clupisoma to be the sister group to (Horabagrus, Pseudeutropius. Our results indicate that the Horabagridae, recognized by some authors as consisting of Horabagrus, Pseudeutropius and Clupisoma does not include the latter genus. We formally erect a new family, Ailiidae fam. nov. for a monophyletic Asian group comprised of the genera Ailia, Laides and Clupisoma.

  13. [Telomere length and phylogenetic relationship of Baikal and Siberian planarians (Turbellaria, Tricladida)].

    Science.gov (United States)

    Koroleva, A G; Evtushenko, E V; Timoshkin, O A; Vershinin, A V; Kiril'chik, S V

    2013-01-01

    Dynamics of the telomeric DNA (tDNA) and the phylogeny of the Baikal and Siberian planarians have been studied based on the analysis of the 18S rDNA and beta-actin gene fragments. A relationship between tDNA and the planarians size has been demonstrated. Giant planarians with a minor exception have longer tDNA than little planarians. Phylogenetic affinity between the species that have the stretched tracks of tDNA, big size and similar habitats may indicate possible role of tDNA in the development of the indefinite regenerative capacity of planarians.

  14. Contribution of WUSCHEL-related homeobox (WOX genes to identify the phylogenetic relationships among Petunia species

    Directory of Open Access Journals (Sweden)

    Ana Lúcia Anversa Segatto

    Full Text Available Abstract Developmental genes are believed to contribute to major changes during plant evolution, from infrageneric to higher levels. Due to their putative high sequence conservation, developmental genes are rarely used as molecular markers, and few studies including these sequences at low taxonomic levels exist. WUSCHEL-related homeobox genes (WOX are transcription factors exclusively present in plants and are involved in developmental processes. In this study, we characterized the infrageneric genetic variation of Petunia WOX genes. We obtained phylogenetic relationships consistent with other phylogenies based on nuclear markers, but with higher statistical support, resolution in terminals, and compatibility with flower morphological changes.

  15. Phylogenetic analyses of Vitis (Vitaceae) based on complete chloroplast genome sequences: effects of taxon sampling and phylogenetic methods on resolving relationships among rosids.

    Science.gov (United States)

    Jansen, Robert K; Kaittanis, Charalambos; Saski, Christopher; Lee, Seung-Bum; Tomkins, Jeffrey; Alverson, Andrew J; Daniell, Henry

    2006-04-09

    The Vitaceae (grape) is an economically important family of angiosperms whose phylogenetic placement is currently unresolved. Recent phylogenetic analyses based on one to several genes have suggested several alternative placements of this family, including sister to Caryophyllales, asterids, Saxifragales, Dilleniaceae or to rest of rosids, though support for these different results has been weak. There has been a recent interest in using complete chloroplast genome sequences for resolving phylogenetic relationships among angiosperms. These studies have clarified relationships among several major lineages but they have also emphasized the importance of taxon sampling and the effects of different phylogenetic methods for obtaining accurate phylogenies. We sequenced the complete chloroplast genome of Vitis vinifera and used these data to assess relationships among 27 angiosperms, including nine taxa of rosids. The Vitis vinifera chloroplast genome is 160,928 bp in length, including a pair of inverted repeats of 26,358 bp that are separated by small and large single copy regions of 19,065 bp and 89,147 bp, respectively. The gene content and order of Vitis is identical to many other unrearranged angiosperm chloroplast genomes, including tobacco. Phylogenetic analyses using maximum parsimony and maximum likelihood were performed on DNA sequences of 61 protein-coding genes for two datasets with 28 or 29 taxa, including eight or nine taxa from four of the seven currently recognized major clades of rosids. Parsimony and likelihood phylogenies of both data sets provide strong support for the placement of Vitaceae as sister to the remaining rosids. However, the position of the Myrtales and support for the monophyly of the eurosid I clade differs between the two data sets and the two methods of analysis. In parsimony analyses, the inclusion of Gossypium is necessary to obtain trees that support the monophyly of the eurosid I clade. However, maximum likelihood analyses place

  16. Phylogenetic analyses of Vitis (Vitaceae based on complete chloroplast genome sequences: effects of taxon sampling and phylogenetic methods on resolving relationships among rosids

    Directory of Open Access Journals (Sweden)

    Alverson Andrew J

    2006-04-01

    Full Text Available Abstract Background The Vitaceae (grape is an economically important family of angiosperms whose phylogenetic placement is currently unresolved. Recent phylogenetic analyses based on one to several genes have suggested several alternative placements of this family, including sister to Caryophyllales, asterids, Saxifragales, Dilleniaceae or to rest of rosids, though support for these different results has been weak. There has been a recent interest in using complete chloroplast genome sequences for resolving phylogenetic relationships among angiosperms. These studies have clarified relationships among several major lineages but they have also emphasized the importance of taxon sampling and the effects of different phylogenetic methods for obtaining accurate phylogenies. We sequenced the complete chloroplast genome of Vitis vinifera and used these data to assess relationships among 27 angiosperms, including nine taxa of rosids. Results The Vitis vinifera chloroplast genome is 160,928 bp in length, including a pair of inverted repeats of 26,358 bp that are separated by small and large single copy regions of 19,065 bp and 89,147 bp, respectively. The gene content and order of Vitis is identical to many other unrearranged angiosperm chloroplast genomes, including tobacco. Phylogenetic analyses using maximum parsimony and maximum likelihood were performed on DNA sequences of 61 protein-coding genes for two datasets with 28 or 29 taxa, including eight or nine taxa from four of the seven currently recognized major clades of rosids. Parsimony and likelihood phylogenies of both data sets provide strong support for the placement of Vitaceae as sister to the remaining rosids. However, the position of the Myrtales and support for the monophyly of the eurosid I clade differs between the two data sets and the two methods of analysis. In parsimony analyses, the inclusion of Gossypium is necessary to obtain trees that support the monophyly of the eurosid I clade

  17. Supermatrix and species tree methods resolve phylogenetic relationships within the big cats, Panthera (Carnivora: Felidae).

    Science.gov (United States)

    Davis, Brian W; Li, Gang; Murphy, William J

    2010-07-01

    The pantherine lineage of cats diverged from the remainder of modern Felidae less than 11 million years ago and consists of the five big cats of the genus Panthera, the lion, tiger, jaguar, leopard, and snow leopard, as well as the closely related clouded leopard. A significant problem exists with respect to the precise phylogeny of these highly threatened great cats. Despite multiple publications on the subject, no two molecular studies have reconstructed Panthera with the same topology. These evolutionary relationships remain unresolved partially due to the recent and rapid radiation of pantherines in the Pliocene, individual speciation events occurring within less than 1 million years, and probable introgression between lineages following their divergence. We provide an alternative, highly supported interpretation of the evolutionary history of the pantherine lineage using novel and published DNA sequence data from the autosomes, both sex chromosomes and the mitochondrial genome. New sequences were generated for 39 single-copy regions of the felid Y chromosome, as well as four mitochondrial and four autosomal gene segments, totaling 28.7 kb. Phylogenetic analysis of these new data, combined with all published data in GenBank, highlighted the prevalence of phylogenetic disparities stemming either from the amplification of a mitochondrial to nuclear translocation event (numt), or errors in species identification. Our 47.6 kb combined dataset was analyzed as a supermatrix and with respect to individual partitions using maximum likelihood and Bayesian phylogenetic inference, in conjunction with Bayesian Estimation of Species Trees (BEST) which accounts for heterogeneous gene histories. Our results yield a robust consensus topology supporting the monophyly of lion and leopard, with jaguar sister to these species, as well as a sister species relationship of tiger and snow leopard. These results highlight new avenues for the study of speciation genomics and

  18. AFLP analysis of genetic diversity and phylogenetic relationships of Brassica oleracea in Ireland.

    Science.gov (United States)

    El-Esawi, Mohamed A; Germaine, Kieran; Bourke, Paula; Malone, Renee

    2016-01-01

    Brassica oleracea L. is one of the most economically important vegetable crop species of the genus Brassica L. This species is threatened in Ireland, without any prior reported genetic studies. The use of this species is being very limited due to its imprecise phylogeny and uncompleted genetic characterisation. The main objective of this study was to assess the genetic diversity and phylogenetic relationships of a set of 25 Irish B. oleracea accessions using the powerful amplified fragment length polymorphism (AFLP) technique. A total of 471 fragments were scored across all the 11 AFLP primer sets used, out of which 423 (89.8%) were polymorphic and could differentiate the accessions analysed. The dendrogram showed that cauliflowers were more closely related to cabbages than kales were, and accessions of some cabbage types were distributed among different clusters within cabbage subgroups. Approximately 33.7% of the total genetic variation was found among accessions, and 66.3% of the variation resided within accessions. The total genetic diversity (HT) and the intra-accessional genetic diversity (HS) were 0.251 and 0.156, respectively. This high level of variation demonstrates that the Irish B. oleracea accessions studied should be managed and conserved for future utilisation and exploitation in food and agriculture. In conclusion, this study addressed important phylogenetic questions within this species, and provided a new insight into the inclusion of four accessions of cabbages and kales in future breeding programs for improving varieties. AFLP markers were efficient for assessing genetic diversity and phylogenetic relationships in Irish B. oleracea species. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  19. Phylogenetic relationships and evolution of growth form in Cactaceae (Caryophyllales, Eudicotyledoneae).

    Science.gov (United States)

    Hernández-Hernández, Tania; Hernández, Héctor M; De-Nova, J Arturo; Puente, Raul; Eguiarte, Luis E; Magallón, Susana

    2011-01-01

    Cactaceae is one of the most charismatic plant families because of the extreme succulence and outstanding diversity of growth forms of its members. Although cacti are conspicuous elements of arid ecosystems in the New World and are model systems for ecological and anatomical studies, the high morphological convergence and scarcity of phenotypic synapomorphies make the evolutionary relationships and trends among lineages difficult to understand. We performed phylogenetic analyses implementing parsimony ratchet and likelihood methods, using a concatenated matrix with 6148 bp of plastid and nuclear markers (trnK/matK, matK, trnL-trnF, rpl16, and ppc). We included 224 species representing approximately 85% of the family's genera. Likelihood methods were used to perform an ancestral character reconstruction within Cactoideae, the richest subfamily in terms of morphological diversity and species number, to evaluate possible growth form evolutionary trends. Our phylogenetic results support previous studies showing the paraphyly of subfamily Pereskioideae and the monophyly of subfamilies Opuntioideae and Cactoideae. After the early divergence of Blossfeldia, Cactoideae splits into two clades: Cacteae, including North American globose and barrel-shaped members, and core Cactoideae, including the largest diversity of growth forms distributed throughout the American continent. Para- or polyphyly is persistent in different parts of the phylogeny. Main Cactoideae clades were found to have different ancestral growth forms, and convergence toward globose, arborescent, or columnar forms occurred in different lineages. Our study enabled us to provide a detailed hypothesis of relationships among cacti lineages and represents the most complete general phylogenetic framework available to understand evolutionary trends within Cactaceae.

  20. Phylogenetic relationships, character evolution, and taxonomic implications within the slipper lobsters (Crustacea: Decapoda: Scyllaridae).

    Science.gov (United States)

    Yang, Chien-Hui; Bracken-Grissom, Heather; Kim, Dohyup; Crandall, Keith A; Chan, Tin-Yam

    2012-01-01

    The slipper lobsters belong to the family Scyllaridae which contains a total of 20 genera and 89 species distributed across four subfamilies (Arctidinae, Ibacinae, Scyllarinae, and Theninae). We have collected nucleotide sequence data from regions of five different genes (16S, 18S, COI, 28S, H3) to estimate phylogenetic relationships among 54 species from the Scyllaridae with a focus on the species rich subfamily Scyllarinae. We have included in our analyses at least one representative from all 20 genera in the Scyllaridae and 35 of the 52 species within the Scyllarinae. Our resulting phylogenetic estimate shows the subfamilies are monophyletic, except for Ibacinae, which has paraphyletic relationships among genera. Many of the genera within the Scyllarinae form non-monophyletic groups, while the genera from all other subfamilies form well supported clades. We discuss the implications of this history on the evolution of morphological characters and ecological transitions (nearshore vs. offshore) within the slipper lobsters. Finally, we identify, through ancestral state character reconstructions, key morphological features diagnostic of the major clades of diversity within the Scyllaridae and relate this character evolution to current taxonomy and classification. Copyright © 2011 Elsevier Inc. All rights reserved.

  1. Species boundaries and phylogenetic relationships in the critically endangered Asian box turtle genus Cuora.

    Science.gov (United States)

    Spinks, Phillip Q; Thomson, Robert C; Zhang, YaPing; Che, Jing; Wu, Yonghua; Shaffer, H Bradley

    2012-06-01

    Turtles are currently the most endangered major clade of vertebrates on earth, and Asian box turtles (Cuora) are in catastrophic decline. Effective management of this diverse turtle clade has been hampered by human-mediated, and perhaps natural hybridization, resulting in discordance between mitochondrial and nuclear markers and confusion regarding species boundaries and phylogenetic relationships among hypothesized species of Cuora. Here, we present analyses of mitochondrial and nuclear DNA data for all 12 currently hypothesized species to resolve both species boundaries and phylogenetic relationships. Our 15-gene, 40-individual nuclear data set was frequently in conflict with our mitochondrial data set; based on its general concordance with published morphological analyses and the strength of 15 independent estimates of evolutionary history, we interpret the nuclear data as representing the most reliable estimate of species boundaries and phylogeny of Cuora. Our results strongly reiterate the necessity of using multiple nuclear markers for phylogeny and species delimitation in these animals, including any form of DNA "barcoding", and point to Cuora as an important case study where reliance on mitochondrial DNA can lead to incorrect species identification. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. Phylogenetic relationships in Peniocereus (Cactaceae) inferred from plastid DNA sequence data.

    Science.gov (United States)

    Arias, Salvador; Terrazas, Teresa; Arreola-Nava, Hilda J; Vázquez-Sánchez, Monserrat; Cameron, Kenneth M

    2005-10-01

    The phylogenetic relationships of Peniocereus (Cactaceae) species were studied using parsimony analyses of DNA sequence data. The plastid rpl16 and trnL-F regions were sequenced for 98 taxa including 17 species of Peniocereus, representatives from all genera of tribe Pachycereeae, four genera of tribe Hylocereeae, as well as from three additional outgroup genera of tribes Calymmantheae, Notocacteae, and Trichocereeae. Phylogenetic analyses support neither the monophyly of Peniocereus as currently circumscribed, nor the monophyly of tribe Pachycereeae since species of Peniocereus subgenus Pseudoacanthocereus are embedded within tribe Hylocereeae. Furthermore, these results show that the eight species of Peniocereus subgenus Peniocereus (Peniocereus sensu stricto) form a well-supported clade within subtribe Pachycereinae; P. serpentinus is also a member of this subtribe, but is sister to Bergerocactus. Moreover, Nyctocereus should be resurrected as a monotypic genus. Species of Peniocereus subgenus Pseudoacanthocereus are positioned among species of Acanthocereus within tribe Hylocereeae, indicating that they may be better classified within that genus. A number of morphological and anatomical characters, especially related to the presence or absence of dimorphic branches, are discussed to support these relationships.

  3. A Molecular Assessment of Phylogenetic Relationships and LineageDiversification Within the Family Salamandridae (Amphibia, Caudata)

    Energy Technology Data Exchange (ETDEWEB)

    Weisrock, David W.; Papenfuss, Theodore J.; Macey, J. Robert; Litvinchuk, Spartak N.; Polymeni, Rosa; Ugurtas, Ismail H.; Zhao, Ermi; Larson, Allan

    2005-08-08

    Phylogenetic relationships among species of the salamanderfamily Salamandridae are investigated using nearly 3000 nucleotide basesof newly reported mitochondrial DNA sequence data from the mtDNA genicregion spanning the genes tRNALeu-COI. This study uses nearlycomprehensive species-level sampling to provide the first completephylogeny for the Salamandridae. Deep phylogenetic relationships amongthe three most divergent lineages in the family Salamandrina terdigitata,a clade comprising the "True" salamanders, and a clade comprising allnewts except S. terdigitata are difficult to resolve. However, mostrelationships within the latter two lineages are resolved with robustlevels of branch support. The genera Euproctus and Triturus arestatistically shown to be nonmonophyletic, instead each contains adiverse set of lineages positioned within the large newt clade. The genusParamesotriton is also resolve as a nonmonophyletic group, with the newlydescribed species P. laoensis constituting a divergent lineage placed ina sister position to clade containing all Pachytriton species and allremaining Paramesotriton species. Sequence divergences between P.laoensis and other Paramesotriton species are as great as those comparingP. laoensis and species of the genera Cynops and Pachytriton. Analyses oflineage diversification across the Salamandridae indicate that, despiteits exceptional diversity, lineage accumulation appears to have beenconstant across time, indicating that it does not represent a truespecies radiation.

  4. Phylogenetic relationships between Sarcocystis species from reindeer and other Sarcocystidae deduced from ssu rRNA gene sequences

    DEFF Research Database (Denmark)

    Dahlgren, S.S.; Oliveira, Rodrigo Gouveia; Gjerde, B.

    2008-01-01

    any effect on previously inferred phylogenetic relationships within the Sarcocystidae. The complete small subunit (ssu) rRNA gene sequences of all six Sarcocystis species from reindeer were used in the phylogenetic analyses along with ssu rRNA gene sequences of 85 other members of the Coccidea. Trees...... the six species in phylogenetic analyses of the Sarcocystidae, and also to investigate the phylogenetic relationships between the species from reindeer and those from other hosts. The study also aimed at revealing whether the inclusion of six Sarcocystis species from the same intermediate host would have....... tarandivulpes, formed a sister group to other Sarcocystis species with a canine definitive host. The position of S. hardangeri on the tree suggested that it uses another type of definitive host than the other Sarcocystis species in this clade. Considering the geographical distribution and infection intensity...

  5. Phylogenetic relationships and divergence dates of softshell turtles (Testudines: Trionychidae) inferred from complete mitochondrial genomes.

    Science.gov (United States)

    Li, H; Liu, J; Xiong, L; Zhang, H; Zhou, H; Yin, H; Jing, W; Li, J; Shi, Q; Wang, Y; Liu, J; Nie, L

    2017-05-01

    The softshell turtles (Trionychidae) are one of the most widely distributed reptile groups in the world, and fossils have been found on all continents except Antarctica. The phylogenetic relationships among members of this group have been previously studied; however, disagreements regarding its taxonomy, its phylogeography and divergence times are still poorly understood as well. Here, we present a comprehensive mitogenomic study of softshell turtles. We sequenced the complete mitochondrial genomes of 10 softshell turtles, in addition to the GenBank sequence of Dogania subplana, Lissemys punctata, Trionyx triunguis, which cover all extant genera within Trionychidae except for Cyclanorbis and Cycloderma. These data were combined with other mitogenomes of turtles for phylogenetic analyses. Divergence time calibration and ancestral reconstruction were calculated using BEAST and RASP software, respectively. Our phylogenetic analyses indicate that Trionychidae is the sister taxon of Carettochelyidae, and support the monophyly of Trionychinae and Cyclanorbinae, which is consistent with morphological data and molecular analysis. Our phylogenetic analyses have established a sister taxon relationship between the Asian Rafetus and the Asian Palea + Pelodiscus + Dogania + Nilssonia + Amyda, whereas a previous study grouped the Asian Rafetus with the American Apalone. The results of divergence time estimates and area ancestral reconstruction show that extant Trionychidae originated in Asia at around 108 million years ago (MA), and radiations mainly occurred during two warm periods, namely Late Cretaceous-Early Eocene and Oligocene. By combining the estimated divergence time and the reconstructed ancestral area of softshell turtles, we determined that the dispersal of softshell turtles out of Asia may have taken three routes. Furthermore, the times of dispersal seem to be in agreement with the time of the India-Asia collision and opening of the Bering Strait, which

  6. Introgression evidence and phylogenetic relationships among three (ParaMisgurnus species as revealed by mitochondrial and nuclear DNA markers

    Directory of Open Access Journals (Sweden)

    Jakovlić I.

    2013-01-01

    Full Text Available The taxonomy of (ParaMisgurnus genera is still debated. We therefore used mitochondrial and nuclear DNA markers to analyze the phylogenetic relationships among Misgurnus anguillicaudatus, Paramisgurnus dabryanus and Misgurnus fossilis. Differing phylogenetic signals from mitochondrial and nuclear marker data suggest an introgression event in the history of M. anguillicaudatus and M. mohoity. No substantial genetic evidence was found that Paramisgurnus dabryanus should be classified as a separate genus.

  7. Assessment of genetic diversity and phylogenetic relationships of Korean native chicken breeds using microsatellite markers

    Directory of Open Access Journals (Sweden)

    Joo Hee Seo

    2017-10-01

    Full Text Available Objective This study was conducted to investigate the basic information on genetic structure and characteristics of Korean Native chickens (NC and foreign breeds through the analysis of the pure chicken populations and commercial chicken lines of the Hanhyup Company which are popular in the NC market, using the 20 microsatellite markers. Methods In this study, the genetic diversity and phylogenetic relationships of 445 NC from five different breeds (NC, Leghorn [LH], Cornish [CS], Rhode Island Red [RIR], and Hanhyup [HH] commercial line were investigated by performing genotyping using 20 microsatellite markers. Results The highest genetic distance was observed between RIR and LH (18.9%, whereas the lowest genetic distance was observed between HH and NC (2.7%. In the principal coordinates analysis (PCoA illustrated by the first component, LH was clearly separated from the other groups. The correspondence analysis showed close relationship among individuals belonging to the NC, CS, and HH lines. From the STRUCTURE program, the presence of 5 clusters was detected and it was found that the proportion of membership in the different clusters was almost comparable among the breeds with the exception of one breed (HH, although it was highest in LH (0.987 and lowest in CS (0.578. For the cluster 1 it was high in HH (0.582 and in CS (0.368, while for the cluster 4 it was relatively higher in HH (0.392 than other breeds. Conclusion Our study showed useful genetic diversity and phylogenetic relationship data that can be utilized for NC breeding and development by the commercial chicken industry to meet consumer demands.

  8. Reconstruction of family-level phylogenetic relationships within Demospongiae (Porifera using nuclear encoded housekeeping genes.

    Directory of Open Access Journals (Sweden)

    Malcolm S Hill

    Full Text Available Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges.We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha, but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosa(p, Myxospongiae(p, Spongillida(p, Haploscleromorpha(p (the marine haplosclerids and Democlavia(p. We found conflicting results concerning the relationships of Keratosa(p and Myxospongiae(p to the remaining demosponges, but our results strongly supported a clade of Haploscleromorpha(p+Spongillida(p+Democlavia(p. In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillida(p are sister to Haploscleromorpha(p rather than part of Democlavia(p. Within Keratosa(p, we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiae(p, Chondrosida and Verongida were monophyletic. A well-supported clade within Democlavia(p, Tetractinellida(p, composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis, was consistently revealed as the sister group to all other members of Democlavia(p. Within Tetractinellida(p, we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae, and polyphyly of Hadromerida and Halichondrida.These results, using an independent nuclear gene set, confirmed

  9. Reconstruction of family-level phylogenetic relationships within Demospongiae (Porifera) using nuclear encoded housekeeping genes.

    Science.gov (United States)

    Hill, Malcolm S; Hill, April L; Lopez, Jose; Peterson, Kevin J; Pomponi, Shirley; Diaz, Maria C; Thacker, Robert W; Adamska, Maja; Boury-Esnault, Nicole; Cárdenas, Paco; Chaves-Fonnegra, Andia; Danka, Elizabeth; De Laine, Bre-Onna; Formica, Dawn; Hajdu, Eduardo; Lobo-Hajdu, Gisele; Klontz, Sarah; Morrow, Christine C; Patel, Jignasa; Picton, Bernard; Pisani, Davide; Pohlmann, Deborah; Redmond, Niamh E; Reed, John; Richey, Stacy; Riesgo, Ana; Rubin, Ewelina; Russell, Zach; Rützler, Klaus; Sperling, Erik A; di Stefano, Michael; Tarver, James E; Collins, Allen G

    2013-01-01

    Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges. We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha), but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosa(p), Myxospongiae(p), Spongillida(p), Haploscleromorpha(p) (the marine haplosclerids) and Democlavia(p). We found conflicting results concerning the relationships of Keratosa(p) and Myxospongiae(p) to the remaining demosponges, but our results strongly supported a clade of Haploscleromorpha(p)+Spongillida(p)+Democlavia(p). In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillida(p)) are sister to Haploscleromorpha(p) rather than part of Democlavia(p). Within Keratosa(p), we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiae(p), Chondrosida and Verongida were monophyletic. A well-supported clade within Democlavia(p), Tetractinellida(p), composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis), was consistently revealed as the sister group to all other members of Democlavia(p). Within Tetractinellida(p), we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae), and polyphyly of Hadromerida and Halichondrida. These results, using an independent nuclear gene set

  10. [Irritable bowel syndrome: frequency and phylogenetic relationship of Blastocystis sp. from Mexican patients].

    Science.gov (United States)

    Ramírez-Miranda, M E; Jiménez-González, D E; Rodríguez-Campa, M E; González-Angulo, A; Hernández-Castellanos, R; Sara Arroyo-Escalante, A; Romero-Valdovinos, M; Martínez-Hernández, F; Flisser, A; Maravilla, P

    2011-01-01

    Recent studies reported increased presence of Blastocystis in patients with Irritable Bowel Syndrome (IBS) and an etiologic role has been proposed. The pathogenic role of Blastocystis is controversial, because it is frequently found not only in individuals with enteric symptoms but also in healthy and asymptomatic subjects. Furthermore, there are few studies of blastocistosis in Mexico. To assess the frequency of Blastocystis sp. in IBS patients using molecular techniques and to describe its phylogenetic relationship with sequences of other countries. IBS patients according to Rome III criteria were enrolled. In all patients evaluations included: colonoscopies, coproparasitoscopic studies, coproculture, fecal virus screening. PCR and sequencing for Blastocystis sp. were also performed. We recruited 11 men and 51 women with a mean age of 45.6 (SD ± 15.7) years. Eighty-six percent of the IBS patients presented a normal colonoscopy, 8% showed polyps and 6% diverticular disease. Blastocystis sp. was identified in 25% patients (all of them with normal colonoscopy), while two patients had Endolimax nana and Entamoeba histolytica/E. dispar, respectively. Phylogenetic analysis showed that major sequences of Mexican carriers clustered together with sequences of parasites from Japan and Denmark; furthermore, two sequences from IBS patients were grouped in a single cluster. Blastocystis sp. was identified in 25% of the IBS patients. Our data support the hypothesis of clonal lineages in distinct geographical areas in the world.

  11. Phylogenetic relationship of Hepatozoon blood parasites found in snakes from Africa, America and Asia.

    Science.gov (United States)

    Haklová, B; Majláthová, V; Majláth, I; Harris, D J; Petrilla, V; Litschka-Koen, T; Oros, M; Peťko, B

    2014-03-01

    The blood parasites from the genus Hepatozoon Miller, 1908 (Apicomplexa: Adeleida: Hepatozoidae) represent the most common intracellular protozoan parasites found in snakes. In the present study, we examined 209 individuals of snakes, from different zoogeographical regions (Africa, America, Asia and Europe), for the occurrence of blood parasites using both molecular and microscopic examination methods, and assess phylogenetic relationships of all Hepatozoon parasites from snakes for the first time. In total, 178 blood smears obtained from 209 individuals, representing 40 species, were examined, from which Hepatozoon unicellular parasites were found in 26 samples (14·6% prevalence). Out of 180 samples tested by molecular method polymerase chain reaction (PCR), the presence of parasites was observed in 21 individuals (prevalence 11·6%): 14 snakes from Africa belonging to six genera (Dendroaspis, Dispholidus, Mehelya, Naja, Philothamnus and Python), five snakes from Asia from the genus Morelia and two snakes from America, from two genera (Coluber and Corallus). The intensity of infection varied from one to 1433 infected cells per 10 000 erythrocytes. Results of phylogenetic analyses (Bayesian and Maximum Likelihood) revealed the existence of five haplotypes divided into four main lineages. The present data also indicate neither geographical pattern of studied Hepatozoon sp., nor congruency in the host association.

  12. Phylogenetic relationships of Palaearctic Formica species (Hymenoptera, Formicidae based on mitochondrial cytochrome B sequences.

    Directory of Open Access Journals (Sweden)

    Anna V Goropashnaya

    Full Text Available Ants of genus Formica demonstrate variation in social organization and represent model species for ecological, behavioral, evolutionary studies and testing theoretical implications of the kin selection theory. Subgeneric division of the Formica ants based on morphology has been questioned and remained unclear after an allozyme study on genetic differentiation between 13 species representing all subgenera was conducted. In the present study, the phylogenetic relationships within the genus were examined using mitochondrial DNA sequences of the cytochrome b and a part of the NADH dehydrogenase subunit 6. All 23 Formica species sampled in the Palaearctic clustered according to the subgeneric affiliation except F. uralensis that formed a separate phylogenetic group. Unlike Coptoformica and Formica s. str., the subgenus Serviformica did not form a tight cluster but more likely consisted of a few small clades. The genetic distances between the subgenera were around 10%, implying approximate divergence time of 5 Myr if we used the conventional insect divergence rate of 2% per Myr. Within-subgenus divergence estimates were 6.69% in Serviformica, 3.61% in Coptoformica, 1.18% in Formica s. str., which supported our previous results on relatively rapid speciation in the latter subgenus. The phylogeny inferred from DNA sequences provides a necessary framework against which the evolution of social traits can be compared. We discuss implications of inferred phylogeny for the evolution of social traits.

  13. Genetic diversity and phylogenetic relationship in different genotypes of cotton for future breeding

    Directory of Open Access Journals (Sweden)

    Jehan

    2017-11-01

    Full Text Available Background: To make the plants well adapted and more resistant to diseases and other environmental stresses there is always a need to improve the quality of plant’s genome i.e. to increase its genetic diversity. Methods: In the present study six variety and six lines of cotton were investigated for their genetic diversity and phylogenetic relationship. For this purpose 35 different RAPD primers obtained from the Gene Link Technologies, USA were used. Results: Among 35 RAPD primers, 13 primers produced reproducible PCR bands while the rest failed to show any amplification product. Our results indicated that the total count of the reproducible bands was 670 and polymorphic loci were counted to be 442 which constitute 66% of total loci. Phylogenetic analysis revealed two major groups each consists of 7 and 5 genotypes respectively. Genotypes Lp1 and Tp4 were placed at maximum genetic distance and in separate groups and could be utilized for future cotton breeding. Conclusions: RAPD analysis is a cheaper and time saving technique for the determination of genetic diversity of different cotton genotypes. Cotton genotype Lp1 and Tp4 could be the best candidates for future breeding programs as both genotypes are genetically distant from each other.

  14. The phylogenetic relationships of basal archosauromorphs, with an emphasis on the systematics of proterosuchian archosauriforms

    Science.gov (United States)

    2016-01-01

    The early evolution of archosauromorphs during the Permo-Triassic constitutes an excellent empirical case study to shed light on evolutionary radiations in deep time and the timing and processes of recovery of terrestrial faunas after a mass extinction. However, macroevolutionary studies of early archosauromorphs are currently limited by poor knowledge of their phylogenetic relationships. In particular, one of the main early archosauromorph groups that need an exhaustive phylogenetic study is “Proterosuchia,” which as historically conceived includes members of both Proterosuchidae and Erythrosuchidae. A new data matrix composed of 96 separate taxa (several of them not included in a quantitative phylogenetic analysis before) and 600 osteological characters was assembled and analysed to generate a comprehensive higher-level phylogenetic hypothesis of basal archosauromorphs and shed light on the species-level interrelationships of taxa historically identified as proterosuchian archosauriforms. The results of the analysis using maximum parsimony include a polyphyletic “Prolacertiformes” and “Protorosauria,” in which the Permian Aenigmastropheus and Protorosaurus are the most basal archosauromorphs. The enigmatic choristoderans are either found as the sister-taxa of all other lepidosauromorphs or archosauromorphs, but consistently placed within Sauria. Prolacertids, rhynchosaurs, allokotosaurians and tanystropheids are the major successive sister clades of Archosauriformes. The Early Triassic Tasmaniosaurus is recovered as the sister-taxon of Archosauriformes. Proterosuchidae is unambiguosly restricted to five species that occur immediately after and before the Permo-Triassic boundary, thus implying that they are a short-lived “disaster” clade. Erythrosuchidae is composed of eight nominal species that occur during the Early and Middle Triassic. “Proterosuchia” is polyphyletic, in which erythrosuchids are more closely related to Euparkeria and more

  15. Phylogenetic relationship among East Asian species of the Stegana genus group (Diptera, Drosophilidae).

    Science.gov (United States)

    Li, Tong; Gao, Jian-jun; Lu, Jin-ming; Ji, Xing-lai; Chen, Hong-wei

    2013-01-01

    The phylogenetic relationship among 27 East Asian species of the Stegana genus group was reconstructed using DNA sequences of mitochondrial (COI and ND2) and nuclear (28S) genes. The results lent support to the current generic/subgeneric taxonomic classification in the genus group with the exceptions of the paraphyly of the genus Parastegana and the subgenus Oxyphortica in the genus Stegana. The ancestral areas and divergence times in the genus group were reconstructed/estimated, and accordingly, the biogeographical history of this important clade was discussed. It was proposed that, the evolution of the plant family Fagaceae, especially Quercus, may have played a certain role in facilitating the diversification of the Stegana genus group. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Molecular cytogenetic (FISH and genome analysis of diploid wheatgrasses and their phylogenetic relationship.

    Directory of Open Access Journals (Sweden)

    Gabriella Linc

    Full Text Available This paper reports detailed FISH-based karyotypes for three diploid wheatgrass species Agropyron cristatum (L. Beauv., Thinopyrum bessarabicum (Savul.&Rayss A. Löve, Pseudoroegneria spicata (Pursh A. Löve, the supposed ancestors of hexaploid Thinopyrum intermedium (Host Barkworth & D.R.Dewey, compiled using DNA repeats and comparative genome analysis based on COS markers. Fluorescence in situ hybridization (FISH with repetitive DNA probes proved suitable for the identification of individual chromosomes in the diploid JJ, StSt and PP genomes. Of the seven microsatellite markers tested only the (GAAn trinucleotide sequence was appropriate for use as a single chromosome marker for the P. spicata AS chromosome. Based on COS marker analysis, the phylogenetic relationship between diploid wheatgrasses and the hexaploid bread wheat genomes was established. These findings confirmed that the J and E genomes are in neighbouring clusters.

  17. Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation

    Science.gov (United States)

    Hsueh, Yi-Huang; Huang, Kai-Yao; Kunene, Sikhumbuzo Charles; Lee, Tzong-Yi

    2017-01-01

    Poly-γ-glutamic acid (γ-PGA) is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE, a biosynthesis gene cluster of γ-PGA, and pgdS, a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production. PMID:29215550

  18. Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation.

    Science.gov (United States)

    Hsueh, Yi-Huang; Huang, Kai-Yao; Kunene, Sikhumbuzo Charles; Lee, Tzong-Yi

    2017-12-07

    Poly-γ-glutamic acid (γ-PGA) is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE , a biosynthesis gene cluster of γ-PGA, and pgdS , a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production.

  19. Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation

    Directory of Open Access Journals (Sweden)

    Yi-Huang Hsueh

    2017-12-01

    Full Text Available Poly-γ-glutamic acid (γ-PGA is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE, a biosynthesis gene cluster of γ-PGA, and pgdS, a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production.

  20. Unraveling the phylogenetic relationships of the Eccoptochilinae, an enigmatic array of ordovician cheirurid trilobites.

    Directory of Open Access Journals (Sweden)

    I Wesley Gapp

    Full Text Available The Cheiruridae are a diverse group of trilobites and several subfamilies within the clade have been the focus of recent phylogenetic studies. This paper focuses on the relationships of one of those subfamilies, the Ordovician Eccoptochilinae. We analyze sixteen species from six genera within the traditionally defined group, using the pilekiid Anacheirurus frederici as an outgroup. To assess the monophyly of the Eccoptochilinae seven sphaerexochine species, Kawina arnoldi, Sphaerexochus arenosus, S. atacius, S. latifrons, S. mirus, S. parvus, and S. scabridus were included in the analysis as well. The results of this analysis show that the genus Eccoptochile represents a paraphyletic grade and species traditionally assigned to Parasphaerexochus and Skelipyx plot within Pseudosphaerexochus. Also, representative species of Sphaerexochinae plot within the traditionally defined Eccoptochilinae, suggesting Eccoptochilinae itself is paraphyletic. To resolve this, we propose all species of Pseudosphaerexochus be placed within Sphaerexochinae and Eccoptochilinae be restricted to a monotypic Eccoptochile clavigera.

  1. Diversity of Kale (Brassica oleracea var. sabellica): Glucosinolate Content and Phylogenetic Relationships.

    Science.gov (United States)

    Hahn, Christoph; Müller, Anja; Kuhnert, Nikolai; Albach, Dirk

    2016-04-27

    Recently, kale has become popular due to nutritive components beneficial for human health. It is an important source of phytochemicals such as glucosinolates that trigger associated cancer-preventive activity. However, nutritional value varies among glucosinolates and among cultivars. Here, we start a systematic determination of the content of five glucosinolates in 25 kale varieties and 11 non-kale Brassica oleracea cultivars by HPLC-DAD-ESI-MS(n) and compare the profiles with results from the analysis of SNPs derived from a KASP genotyping assay. Our results demonstrate that the glucosinolate levels differ markedly among varieties of different origin. Comparison of the phytochemical data with phylogenetic relationships revealed that the common name kale refers to at least three different groups. German, American, and Italian kales differ morphologically and phytochemically. Landraces do not show outstanding glucosinolate levels. Our results demonstrate the diversity of kale and the importance of preserving a broad genepool for future breeding purposes.

  2. Genetic variation and phylogenetic relationships of the ectomycorrhizal Floccularia luteovirens on the Qinghai-Tibet Plateau.

    Science.gov (United States)

    Xing, Rui; Gao, Qing-Bo; Zhang, Fa-Qi; Fu, Peng-Cheng; Wang, Jiu-Li; Yan, Hui-Ying; Chen, Shi-Long

    2017-08-01

    Floccularia luteovirens, as an ectomycorrhizal fungus, is widely distributed in the Qinghai-Tibet Plateau. As an edible fungus, it is famous for its unique flavor. Former studies mainly focus on the chemical composition and genetic structure of this species. However, the phylogenetic relationship between genotypes remains unknown. In this study, the genetic variation and phylogenetic relationship between the genotypes of F. luteovirens in Qinghai-Tibet Plateau was estimated through the analysis on two protein-coding genes (rpb1 and ef-1α) from 398 individuals collected from 24 wild populations. The sample covered the entire range of this species during all the growth seasons from 2011 to 2015. 13 genotypes were detected and moderate genetic diversity was revealed. Based on the results of network analysis, the maximum likelihood (ML), maximum parsimony (MP), and Bayesian inference (BI) analyses, the genotypes H-1, H-4, H-6, H-8, H-10, and H-11 were grouped into one clade. Additionally, a relatively higher genotype diversity (average h value is 0.722) and unique genotypes in the northeast edge of Qinghai- Tibet plateau have been found, combined with the results of mismatch analysis and neutrality tests indicated that Southeast Qinghai-Tibet plateau was a refuge for F. luteovirens during the historical geological or climatic events (uplifting of the Qinghai-Tibet Plateau or Last Glacial Maximum). Furthermore, the present distribution of the species on the Qinghai-Tibet plateau has resulted from the recent population expansion. Our findings provide a foundation for the future study of the evolutionary history and the speciation of this species.

  3. The SOD gene family in tomato: identification, phylogenetic relationships and expression patterns

    Directory of Open Access Journals (Sweden)

    kun feng

    2016-08-01

    Full Text Available Superoxide dismutases (SODs are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L. is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.

  4. Re-visiting phylogenetic and taxonomic relationships in the genus Saga (Insecta: Orthoptera.

    Directory of Open Access Journals (Sweden)

    Balázs Kolics

    Full Text Available Twelve of the 13 bushcricket species of the Saga genus are bisexuals and diploids, except the parthenogenetic and tetraploid bush cricket, Saga pedo. Despite a continuous research effort stretching through the 1900s, the taxonomic relationships of the Saga species are still disputed. In this study, our primary aim was to reveal natural relationships of the European Saga species and three of their Asian relatives, with special attention to the problematic taxonomy of two subspecies: S. campbelli campbelli and S. c. gracilis. Following a phylogenetic analysis of eight species, a comprehensive study was carried out on the above three taxa by using acoustic and morphometric approaches in parallel. Our phylogenetic data showed that European Saga species evolved from a monophyletic lineage. The geographical transitional species S. cappadocica was positioned between European and Asian lineages supporting the idea that the European Saga lineage originated phylogeographically from the Asian clade. The above results showed better agreement with the morphological data than with earlier ones based either on karyology or acoustic information only. After reviewing our data, we concluded that Saga pedo has most likely evolved from S. c. gracilis and not from S. rammei or S. ephippigera, as proposed by earlier studies. S. c. gracilis shares the same ITS2 haplotype with S. pedo, indicating that the latter could have evolved from populations of the former, probably through whole genome duplication. Based on acoustic and morphometric differences, we propose to elevate the two subspecies, S. campbelli campbelli and S. c. gracilis, to species level status, as Saga gracilis Kis 1962, and Saga campbelli Uvarov 1921. The present work sets the stage for future genetic and experimental investigations of Saginae and highlights the need for additional comprehensive analysis involving more Asian Saga species.

  5. Re-visiting phylogenetic and taxonomic relationships in the genus Saga (Insecta: Orthoptera).

    Science.gov (United States)

    Kolics, Balázs; Ács, Zoltán; Chobanov, Dragan Petrov; Orci, Kirill Márk; Qiang, Lo Shun; Kovács, Balázs; Kondorosy, Előd; Decsi, Kincső; Taller, János; Specziár, András; Orbán, László; Müller, Tamás

    2012-01-01

    Twelve of the 13 bushcricket species of the Saga genus are bisexuals and diploids, except the parthenogenetic and tetraploid bush cricket, Saga pedo. Despite a continuous research effort stretching through the 1900s, the taxonomic relationships of the Saga species are still disputed. In this study, our primary aim was to reveal natural relationships of the European Saga species and three of their Asian relatives, with special attention to the problematic taxonomy of two subspecies: S. campbelli campbelli and S. c. gracilis. Following a phylogenetic analysis of eight species, a comprehensive study was carried out on the above three taxa by using acoustic and morphometric approaches in parallel. Our phylogenetic data showed that European Saga species evolved from a monophyletic lineage. The geographical transitional species S. cappadocica was positioned between European and Asian lineages supporting the idea that the European Saga lineage originated phylogeographically from the Asian clade. The above results showed better agreement with the morphological data than with earlier ones based either on karyology or acoustic information only. After reviewing our data, we concluded that Saga pedo has most likely evolved from S. c. gracilis and not from S. rammei or S. ephippigera, as proposed by earlier studies. S. c. gracilis shares the same ITS2 haplotype with S. pedo, indicating that the latter could have evolved from populations of the former, probably through whole genome duplication. Based on acoustic and morphometric differences, we propose to elevate the two subspecies, S. campbelli campbelli and S. c. gracilis, to species level status, as Saga gracilis Kis 1962, and Saga campbelli Uvarov 1921. The present work sets the stage for future genetic and experimental investigations of Saginae and highlights the need for additional comprehensive analysis involving more Asian Saga species.

  6. Biometrical studies upon hominoid teeth: the coefficient of variation, sexual dimorphism and questions of phylogenetic relationship.

    Science.gov (United States)

    Blumenberg, B

    1985-01-01

    Sexual dimorphism as a function of variation in hominoid tooth metrics has been investigated for four groups of taxa: Recent great apes (two subfamilies), Dryopiths (one subfamily), Ramapiths (one subfamily) and hominids (one family). Gorilla, and to a lesser extent Pan, appear characterized by very high levels of sexual dimorphism and meet several criteria for statistical outliers. Recent great apes are the only group exhibiting consistently high levels of sexual dimorphism. Ramapiths are the only group characterized by low levels of sexual dimorphism and their relative canine length is most similar to Dryopiths. Both Dryopiths and hominids contain taxa with low and intermediate levels of sexual dimorphism. The Gingerich and Shoeninger hypothesis relating coefficients of variation to occlusal complexity is supported. Non-parametric statistics suggest that homogeneity of coefficient of variation profiles over most of the tooth row is characteristic of only the Dryopiths and a composite data set composed of the Dryopith plus Ramapith tooth measurements. Oxnard's model for the multifactorial basis of multiple sexual dimorphisms is also supported. The Dryopith and hominid patterns of sexual dimorphism are similar, an observation that suggests phylogenetic relationship. At the taxonomic level of subfamily or family, sexual dimorphism is a character of cladistic usefulness and possible phylogenetic valence. Assuming that breeding system and sexual dimorphism are functional correlates as many workers suggest, then Ramapithecus sp. China, Sivapithecus indicus and possibly Australopithecus boisei are good candidates for having possessed monogamous breeding/social structures. All Dryopith taxa, S. sivalensis, Sivapithecus sp. China, A. afarensis, Homo habilis and H. erectus emerge as the best candidates for having possessed a polygynous breeding/social structure. No biometrical affinities of Ramapiths with hominids can be demonstrated and some phylogenetic relationship with

  7. Exploring Phylogenetic Relationships within Myriapoda and the Effects of Matrix Composition and Occupancy on Phylogenomic Reconstruction.

    Science.gov (United States)

    Fernández, Rosa; Edgecombe, Gregory D; Giribet, Gonzalo

    2016-09-01

    Myriapods, including the diverse and familiar centipedes and millipedes, are one of the dominant terrestrial arthropod groups. Although molecular evidence has shown that Myriapoda is monophyletic, its internal phylogeny remains contentious and understudied, especially when compared to those of Chelicerata and Hexapoda. Until now, efforts have focused on taxon sampling (e.g., by including a handful of genes from many species) or on maximizing matrix size (e.g., by including hundreds or thousands of genes in just a few species), but a phylogeny maximizing sampling at both levels remains elusive. In this study, we analyzed 40 Illumina transcriptomes representing 3 of the 4 myriapod classes (Diplopoda, Chilopoda, and Symphyla); 25 transcriptomes were newly sequenced to maximize representation at the ordinal level in Diplopoda and at the family level in Chilopoda. Ten supermatrices were constructed to explore the effect of several potential phylogenetic biases (e.g., rate of evolution, heterotachy) at 3 levels of gene occupancy per taxon (50%, 75%, and 90%). Analyses based on maximum likelihood and Bayesian mixture models retrieved monophyly of each myriapod class, and resulted in 2 alternative phylogenetic positions for Symphyla, as sister group to Diplopoda + Chilopoda, or closer to Diplopoda, the latter hypothesis having been traditionally supported by morphology. Within centipedes, all orders were well supported, but 2 deep nodes remained in conflict in the different analyses despite dense taxon sampling at the family level. Relationships among centipede orders in all analyses conducted with the most complete matrix (90% occupancy) are at odds not only with the sparser but more gene-rich supermatrices (75% and 50% supermatrices) and with the matrices optimizing phylogenetic informativeness or most conserved genes, but also with previous hypotheses based on morphology, development, or other molecular data sets. Our results indicate that a high percentage of ribosomal

  8. Improving the precision of the structure-function relationship by considering phylogenetic context.

    Directory of Open Access Journals (Sweden)

    2005-06-01

    Full Text Available Understanding the relationship between protein structure and function is one of the foremost challenges in post-genomic biology. Higher conservation of structure could, in principle, allow researchers to extend current limitations of annotation. However, despite significant research in the area, a precise and quantitative relationship between biochemical function and protein structure has been elusive. Attempts to draw an unambiguous link have often been complicated by pleiotropy, variable transcriptional control, and adaptations to genomic context, all of which adversely affect simple definitions of function. In this paper, I report that integrating genomic information can be used to clarify the link between protein structure and function. First, I present a novel measure of functional proximity between protein structures (F-score. Then, using F-score and other entirely automatic methods measuring structure and phylogenetic similarity, I present a three-dimensional landscape describing their inter-relationship. The result is a "well-shaped" landscape that demonstrates the added value of considering genomic context in inferring function from structural homology. A generalization of methodology presented in this paper can be used to improve the precision of annotation of genes in current and newly sequenced genomes.

  9. Evaluating the relationship between evolutionary divergence and phylogenetic accuracy in AFLP data sets.

    Science.gov (United States)

    García-Pereira, María Jesús; Caballero, Armando; Quesada, Humberto

    2010-05-01

    Using in silico amplified fragment length polymorphism (AFLP) fingerprints, we explore the relationship between sequence similarity and phylogeny accuracy to test when, in terms of genetic divergence, the quality of AFLP data becomes too low to be informative for a reliable phylogenetic reconstruction. We generated DNA sequences with known phylogenies using balanced and unbalanced trees with recent, uniform and ancient radiations, and average branch lengths (from the most internal node to the tip) ranging from 0.02 to 0.4 substitutions per site. The resulting sequences were used to emulate the AFLP procedure. Trees were estimated by maximum parsimony (MP), neighbor-joining (NJ), and minimum evolution (ME) methods from both DNA sequences and virtual AFLP fingerprints. The estimated trees were compared with the reference trees using a score that measures overall differences in both topology and relative branch length. As expected, the accuracy of AFLP-based phylogenies decreased dramatically in the more divergent data sets. Above a divergence of approximately 0.05, AFLP-based phylogenies were largely inaccurate irrespective of the distinct topology, radiation model, or phylogenetic method used. This value represents an upper bound of expected tree accuracy for data sets with a simple divergence history; AFLP data sets with a similar divergence but with unbalanced topologies and short ancestral branches produced much less accurate trees. The lack of homology of AFLP bands quickly increases with divergence and reaches its maximum value (100%) at a divergence of only 0.4. Low guanine-cytosine (GC) contents increase the number of nonhomologous bands in AFLP data sets and lead to less reliable trees. However, the effect of the lack of band homology on tree accuracy is surprisingly small relative to the negative impact due to the low information content of AFLP characters. Tree-building methods based on genetic distance displayed similar trends and outperformed parsimony

  10. Phylogenetic Relationships of Citrus and Its Relatives Based on matK Gene Sequences

    Science.gov (United States)

    Penjor, Tshering; Uehara, Miki; Ide, Manami; Matsumoto, Natsumi; Matsumoto, Ryoji

    2013-01-01

    The genus Citrus includes mandarin, orange, lemon, grapefruit and lime, which have high economic and nutritional value. The family Rutaceae can be divided into 7 subfamilies, including Aurantioideae. The genus Citrus belongs to the subfamily Aurantioideae. In this study, we sequenced the chloroplast matK genes of 135 accessions from 22 genera of Aurantioideae and analyzed them phylogenetically. Our study includes many accessions that have not been examined in other studies. The subfamily Aurantioideae has been classified into 2 tribes, Clauseneae and Citreae, and our current molecular analysis clearly discriminate Citreae from Clauseneae by using only 1 chloroplast DNA sequence. Our study confirms previous observations on the molecular phylogeny of Aurantioideae in many aspects. However, we have provided novel information on these genetic relationships. For example, inconsistent with the previous observation, and consistent with our preliminary study using the chloroplast rbcL genes, our analysis showed that Feroniella oblata is not nested in Citrus species and is closely related with Feronia limonia. Furthermore, we have shown that Murraya paniculata is similar to Merrillia caloxylon and is dissimilar to Murraya koenigii. We found that “true citrus fruit trees” could be divided into 2 subclusters. One subcluster included Citrus, Fortunella, and Poncirus, while the other cluster included Microcitrus and Eremocitrus. Compared to previous studies, our current study is the most extensive phylogenetic study of Citrus species since it includes 93 accessions. The results indicate that Citrus species can be classified into 3 clusters: a citron cluster, a pummelo cluster, and a mandarin cluster. Although most mandarin accessions belonged to the mandarin cluster, we found some exceptions. We also obtained the information on the genetic background of various species of acid citrus grown in Japan. Because the genus Citrus contains many important accessions, we have

  11. Phylogenetic relationships of citrus and its relatives based on matK gene sequences.

    Directory of Open Access Journals (Sweden)

    Tshering Penjor

    Full Text Available The genus Citrus includes mandarin, orange, lemon, grapefruit and lime, which have high economic and nutritional value. The family Rutaceae can be divided into 7 subfamilies, including Aurantioideae. The genus Citrus belongs to the subfamily Aurantioideae. In this study, we sequenced the chloroplast matK genes of 135 accessions from 22 genera of Aurantioideae and analyzed them phylogenetically. Our study includes many accessions that have not been examined in other studies. The subfamily Aurantioideae has been classified into 2 tribes, Clauseneae and Citreae, and our current molecular analysis clearly discriminate Citreae from Clauseneae by using only 1 chloroplast DNA sequence. Our study confirms previous observations on the molecular phylogeny of Aurantioideae in many aspects. However, we have provided novel information on these genetic relationships. For example, inconsistent with the previous observation, and consistent with our preliminary study using the chloroplast rbcL genes, our analysis showed that Feroniella oblata is not nested in Citrus species and is closely related with Feronia limonia. Furthermore, we have shown that Murraya paniculata is similar to Merrillia caloxylon and is dissimilar to Murraya koenigii. We found that "true citrus fruit trees" could be divided into 2 subclusters. One subcluster included Citrus, Fortunella, and Poncirus, while the other cluster included Microcitrus and Eremocitrus. Compared to previous studies, our current study is the most extensive phylogenetic study of Citrus species since it includes 93 accessions. The results indicate that Citrus species can be classified into 3 clusters: a citron cluster, a pummelo cluster, and a mandarin cluster. Although most mandarin accessions belonged to the mandarin cluster, we found some exceptions. We also obtained the information on the genetic background of various species of acid citrus grown in Japan. Because the genus Citrus contains many important accessions

  12. Phylogenetic relationships of citrus and its relatives based on matK gene sequences.

    Science.gov (United States)

    Penjor, Tshering; Yamamoto, Masashi; Uehara, Miki; Ide, Manami; Matsumoto, Natsumi; Matsumoto, Ryoji; Nagano, Yukio

    2013-01-01

    The genus Citrus includes mandarin, orange, lemon, grapefruit and lime, which have high economic and nutritional value. The family Rutaceae can be divided into 7 subfamilies, including Aurantioideae. The genus Citrus belongs to the subfamily Aurantioideae. In this study, we sequenced the chloroplast matK genes of 135 accessions from 22 genera of Aurantioideae and analyzed them phylogenetically. Our study includes many accessions that have not been examined in other studies. The subfamily Aurantioideae has been classified into 2 tribes, Clauseneae and Citreae, and our current molecular analysis clearly discriminate Citreae from Clauseneae by using only 1 chloroplast DNA sequence. Our study confirms previous observations on the molecular phylogeny of Aurantioideae in many aspects. However, we have provided novel information on these genetic relationships. For example, inconsistent with the previous observation, and consistent with our preliminary study using the chloroplast rbcL genes, our analysis showed that Feroniella oblata is not nested in Citrus species and is closely related with Feronia limonia. Furthermore, we have shown that Murraya paniculata is similar to Merrillia caloxylon and is dissimilar to Murraya koenigii. We found that "true citrus fruit trees" could be divided into 2 subclusters. One subcluster included Citrus, Fortunella, and Poncirus, while the other cluster included Microcitrus and Eremocitrus. Compared to previous studies, our current study is the most extensive phylogenetic study of Citrus species since it includes 93 accessions. The results indicate that Citrus species can be classified into 3 clusters: a citron cluster, a pummelo cluster, and a mandarin cluster. Although most mandarin accessions belonged to the mandarin cluster, we found some exceptions. We also obtained the information on the genetic background of various species of acid citrus grown in Japan. Because the genus Citrus contains many important accessions, we have

  13. 16S ribosomal RNA sequence analysis for determination of phylogenetic relationship among methylotrophs.

    Science.gov (United States)

    Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S

    1990-01-01

    16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.

  14. Phylogenetic relationships in Asarum: Effect of data partitioning and a revised classification.

    Science.gov (United States)

    Sinn, Brandon T; Kelly, Lawrence M; Freudenstein, John V

    2015-05-01

    Generic boundaries and infrageneric relationships among the charismatic temperate magnoliid Asarum sensu lato (Aristolochiaceae) have long been uncertain. Previous molecular phylogenetic analyses used either plastid or nuclear loci alone and varied greatly in their taxonomic implications for the genus. We analyzed additional molecular markers from the nuclear and plastid genomes, reevaluated the possibility of a derived loss of autonomous self-pollination, and investigated the topological effects of matrix-partitioning-scheme choice. We sequenced seven plastid regions and the nuclear ITS1-ITS2 region of 58 individuals representing all previously recognized Asarum s.l. segregate genera and the monotypic genus Saruma. Matrices were partitioned using common a priori partitioning schemes and PartitionFinder. Topologies that were recovered using a priori partitioning of matrices differed from those recovered using a PartitionFinder-selected scheme, and by analysis method. We recovered six monophyletic groups that we circumscribed into three subgenera and six sections. Putative fungal mimic characters served as synapomorphies only for subgenus Heterotropa. Subgenus Geotaenium, a new subgenus, was recovered as sister to the remainder of Asarum by ML analyses of highly partitioned datasets. Section Longistylis, also newly named, is sister to section Hexastylis. Our analyses do not unambiguously support a single origin for all fungal-mimicry characters. Topologies recovered through the analysis of PartitionFinder-optimized matrices can differ drastically from those inferred from a priori partitioned matrices, and by analytical method. We recommend that investigators evaluate the topological effects of matrix partitioning using multiple methods of phylogenetic reconstruction. © 2015 Botanical Society of America, Inc.

  15. The complete genome structure and phylogenetic relationship of infectious hematopoietic necrosis virus

    Science.gov (United States)

    Morzunov , Sergey P.; Winton, James R.; Nichol, Stuart T.

    1995-01-01

    Infectious hematopoietic necrosis virus (IHNV), a member of the family Rhabdoviridae, causes a severe disease with high mortality in salmonid fish. The nucleotide sequence (11, 131 bases) of the entire genome was determined for the pathogenic WRAC strain of IHNV from southern Idaho. This allowed detailed analysis of all 6 genes, the deduced amino acid sequences of their encoded proteins, and important control motifs including leader, trailer and gene junction regions. Sequence analysis revealed that the 6 virus genes are located along the genome in the 3′ to 5′ order: nucleocapsid (N), polymerase-associated phosphoprotein (P or M1), matrix protein (M or M2), surface glycoprotein (G), a unique non-virion protein (NV) and virus polymerase (L). The IHNV genome RNA was found to have highly complementary termini (15 of 16 nucleotides). The gene junction regions display the highly conserved sequence UCURUC(U)7RCCGUG(N)4CACR (in the vRNA sense), which includes the typical rhabdovirus transcription termination/polyadenylation signal and a novel putative transcription initiation signal. Phylogenetic analysis of M, G and L protein sequences allowed insights into the evolutionary and taxonomic relationship of rhabdoviruses of fish relative to those of insects or mammals, and a broader sense of the relationship of non-segmented negative-strand RNA viruses. Based on these data, a new genus, piscivirus, is proposed which will initially contain IHNV, viral hemorrhagic septicemia virus and Hirame rhabdovirus.

  16. Intraspecific relationship within the genus convolvulus l. inferred by rbcl gene using different phylogenetic approaches

    International Nuclear Information System (INIS)

    Kausar, S.; Qamarunnisa, S.

    2016-01-01

    A molecular systematics analysis was conducted using sequence data of chloroplast rbcL gene for the genus Convolvulus L., by distance and character based phylogenetic methods. Fifteen representative members from genus Convolvulus L., were included as in group whereas two members from a sister family Solanaceae were taken as out group to root the tree. Intraspecific relationships within Convolvulus were inferred by distance matrix, maximum parsimony and bayesian analysis. Transition/transversion ratio was also calculated and it was revealed that in the investigated Convolvulus species, transitional changes were more prevalent in rbcL gene. The nature of rbcL gene in the present study was observed to be conserved, as it does not show major variations between examined species. Distance matrix represented the minimal genetic variations between some species (C. glomeratus and C. pyrrhotrichus), thus exhibiting them as close relatives. The result of parsimonious and bayesian analysis revealed almost similar clades however maximum parsimony based tree was unable to establish relationship between some Convolvulus species. The bayesian inference method was found to be the method of choice for establishing intraspecific associations between Convolvulus species using rbcL data as it clearly defined the connections supported by posterior probability values. (author)

  17. Mitochondrial DNA sequence-based phylogenetic relationship of Trichiurus lepturus (Perciformes: Trichiuridae) from the Persian Gulf

    Science.gov (United States)

    Tamadoni Jahromi, S.; Mohd Noor, S. A.; Pirian, K.; Dehghani, R.; Nazemi, M.; Khazaali, A.

    2016-01-01

    In this study, mitochondrial DNA analysis using 16S ribosomal DNA (rDNA) was performed to investigate the phylogeny relationship of Trichiurus lepturus in the Persian Gulf compared to the other investigated area. The amplification of 16S rDNA resulted in a product of 600 bp in all samples. The results showed that the isolated strain belongs to T. lepturus showing 42 divergence sites among the same reported partial sequences of 16S rRNA gene from the other area (West Atlantic and Indo-Pacific area). Phylogeny results showed that all 18 haplotypes of the species clustered into five clades with reasonably high bootstrap support of values (>64%). Overall, the tree topology for both phylogenetic and phenetic trees for 16S rDNA was similar. Both trees exposed two major clusters, one wholly containing the haplotypes of the T. lepturus species belonging to Indo-Pacific area with two major sister groups including Persian Gulf specimen and the other cleared the Western Atlantic and Japan individuals clustered in another distinct clade supporting the differentiation between the two areas. Phylogenic relationship observed between the Persian Gulf and the other Indo-Pacific Individuals suggested homogeneity between two mentioned areas. PMID:27822250

  18. Phylogenetic relationships of the Orang Asli and Iban of Malaysia based on maternal markers.

    Science.gov (United States)

    Ang, K C; Leow, J W H; Yeap, W K; Hood, S; Mahani, M C; Md-Zain, B M

    2011-04-12

    Malaysia remains as a crossroad of different cultures and peoples, and it has long been recognized that studying its population history can provide crucial insight into the prehistory of Southeast Asia as a whole. The earliest inhabitants were the Orang Asli in Peninsular Malaysia and the indigenous groups in Sabah and Sarawak. Although they were the earliest migrants in this region, these tribes are divided geographically by the South China Sea. We analyzed DNA sequences of 18 Orang Asli using mitochondrial DNA extracted from blood samples, each representing one sub-tribe, and from five Sarawakian Iban. Mitochondrial DNA was extracted from hair samples in order to examine relationships with the main ethnic groups in Malaysia. The D-loop region and cytochrome b genes were used as the candidate loci. Phylogenetic relationships were investigated using maximum parsimony and neighbor joining algorithms, and each tree was subjected to bootstrap analysis with 1000 replicates. Analyses of the HVS I region showed that the Iban are not a distinct group from the Orang Asli; they form a sub-clade within the Orang Asli. Based on the cytochrome b gene, the Iban clustered with the Orang Asli in the same clade. We found evidence for considerable gene flow between Orang Asli and Iban. We concluded that the Orang Asli, Iban and the main ethnic groups of Malaysia are probably derived from a common ancestor. This is in agreement with a single-route migration theory, but it does not dismiss a two-route migration theory.

  19. Relationships among North American and Japanese Laetiporus isolates inferred from molecular phylogenetics and single-spore incompatibility reactions

    Science.gov (United States)

    Mark T. Banik; Daniel L. Lindner; Yuko Ota; Tsutomu Hattori

    2010-01-01

    Relationships were investigated among North American and Japanese isolates of Laetiporus using phylogenetic analysis of ITS sequences and single-spore isolate incompatibility. Single-spore isolate pairings revealed no significant compatibility between North American and Japanese isolates. ITS analysis revealed 12 clades within the core ...

  20. PHYLOGENETIC RELATIONSHIP OF THE RED TIDE DINOFLAGELLATE GYMNODINIUM BREVE TO OTHER MEMBERS OF THE GENERA GYMNODINIUM AND GYRODINIUM

    Science.gov (United States)

    Phylogenetic relationships between the red-tide dinoflagellate Gymnodinium breve and other members of the genera Gymnodinium and Gyrodinium have not been studied at the molecular level. G. breve is most noted for its production of brevetoxin, which has been linked to extensive f...

  1. The importance of species phylogenetic relationships and species traits for the intensity of plant-soil feedback

    Czech Academy of Sciences Publication Activity Database

    Münzbergová, Zuzana; Šurinová, Mária

    2015-01-01

    Roč. 6, č. 11 (2015), s. 1-16 ISSN 2150-8925 R&D Projects: GA ČR(CZ) GA15-11635S Institutional support: RVO:67985939 Keywords : phylogenetic relationships * species traits * plant-soil feedback Subject RIV: EF - Botanics Impact factor: 2.287, year: 2015

  2. Phylogenetic relationships of cone snails endemic to Cabo Verde based on mitochondrial genomes.

    Science.gov (United States)

    Abalde, Samuel; Tenorio, Manuel J; Afonso, Carlos M L; Uribe, Juan E; Echeverry, Ana M; Zardoya, Rafael

    2017-11-25

    Due to their great species and ecological diversity as well as their capacity to produce hundreds of different toxins, cone snails are of interest to evolutionary biologists, pharmacologists and amateur naturalists alike. Taxonomic identification of cone snails still relies mostly on the shape, color, and banding patterns of the shell. However, these phenotypic traits are prone to homoplasy. Therefore, the consistent use of genetic data for species delimitation and phylogenetic inference in this apparently hyperdiverse group is largely wanting. Here, we reconstruct the phylogeny of the cones endemic to Cabo Verde archipelago, a well-known radiation of the group, using mitochondrial (mt) genomes. The reconstructed phylogeny grouped the analyzed species into two main clades, one including Kalloconus from West Africa sister to Trovaoconus from Cabo Verde and the other with a paraphyletic Lautoconus due to the sister group relationship of Africonus from Cabo Verde and Lautoconus ventricosus from Mediterranean Sea and neighboring Atlantic Ocean to the exclusion of Lautoconus endemic to Senegal (plus Lautoconus guanche from Mauritania, Morocco, and Canary Islands). Within Trovaoconus, up to three main lineages could be distinguished. The clade of Africonus included four main lineages (named I to IV), each further subdivided into two monophyletic groups. The reconstructed phylogeny allowed inferring the evolution of the radula in the studied lineages as well as biogeographic patterns. The number of cone species endemic to Cabo Verde was revised under the light of sequence divergence data and the inferred phylogenetic relationships. The sequence divergence between continental members of the genus Kalloconus and island endemics ascribed to the genus Trovaoconus is low, prompting for synonymization of the latter. The genus Lautoconus is paraphyletic. Lautoconus ventricosus is the closest living sister group of genus Africonus. Diversification of Africonus was in allopatry

  3. Phylogenetic relationships and evolutionary history of the reef fish family Labridae.

    Science.gov (United States)

    Westneat, Mark W; Alfaro, Michael E

    2005-08-01

    The family Labridae (including scarines and odacines) contains 82 genera and about 600 species of fishes that inhabit coastal and continental shelf waters in tropical and temperate oceans throughout the world. The Labridae (the wrasses) is the fifth largest fish family and second largest marine fish family, and is one of the most morphologically and ecologically diversified families of fishes in size, shape, and color. Labrid phylogeny is a long-standing problem in ichthyology that is part of the larger question of relationships within the suborder Labroidei. A phylogenetic analysis of labrids was conducted to investigate relationships among the six classical tribes of wrasses, the affinities of the wrasses to the parrotfishes (scarines), and the broad phylogenetic structure among labrid genera. Four gene fragments were sequenced from 98 fish species, including 84 labrid fishes and 14 outgroup taxa. Taxa were chosen from all major labrid clades and most major global ocean regions where labrid fishes exist, as well as cichlid, pomacentrid, and embiotocid outgroups. From the mitochondrial genome we sequenced portions of 12S rRNA (1000 bp) and 16S rRNA (585 bp), which were aligned by using a secondary structure model. From the nuclear genome, we sequenced part of the protein-coding genes RAG2 (846 bp) and Tmo4C4 (541 bp). Maximum likelihood, maximum parsimony, and Bayesian analyses on the resulting 2972 bp of DNA sequence produced similar topologies that confirm the monophyly of a family Labridae that includes the parrotfishes and butterfishes and strong support for many previously identified taxonomic subgroups. The tribe Hypsigenyini (hogfishes, tuskfishes) is the sister group to the remaining labrids and includes odacines and the chisel-tooth wrasse Pseudodax moluccanus, a species previously considered close to scarines. Cheilines and scarines are sister-groups, closely related to the temperate Labrini, and pseudocheilines and cheilines are split in all phylogenies

  4. Open Reading Frame Phylogenetic Analysis on the Cloud

    Directory of Open Access Journals (Sweden)

    Che-Lun Hung

    2013-01-01

    Full Text Available Phylogenetic analysis has become essential in researching the evolutionary relationships between viruses. These relationships are depicted on phylogenetic trees, in which viruses are grouped based on sequence similarity. Viral evolutionary relationships are identified from open reading frames rather than from complete sequences. Recently, cloud computing has become popular for developing internet-based bioinformatics tools. Biocloud is an efficient, scalable, and robust bioinformatics computing service. In this paper, we propose a cloud-based open reading frame phylogenetic analysis service. The proposed service integrates the Hadoop framework, virtualization technology, and phylogenetic analysis methods to provide a high-availability, large-scale bioservice. In a case study, we analyze the phylogenetic relationships among Norovirus. Evolutionary relationships are elucidated by aligning different open reading frame sequences. The proposed platform correctly identifies the evolutionary relationships between members of Norovirus.

  5. Morphometric relationship, phylogenetic correlation, and character evolution in the species-rich genus Aphis (Hemiptera: Aphididae.

    Directory of Open Access Journals (Sweden)

    Hyojoong Kim

    2010-07-01

    Full Text Available The species-rich genus Aphis consists of more than 500 species, many of them host-specific on a wide range of plants, yet very similar in general appearance due to convergence toward particular morphological types. Most species have been historically clustered into four main phenotypic groups (gossypii, craccivora, fabae, and spiraecola groups. To confirm the morphological hypotheses between these groups and to examine the characteristics that determine them, multivariate morphometric analyses were performed using 28 characters measured/counted from 40 species. To infer whether the morphological relationships are correlated with the genetic relationships, we compared the morphometric dataset with a phylogeny reconstructed from the combined dataset of three mtDNA and one nuclear DNA regions.Based on a comparison of morphological and molecular datasets, we confirmed morphological reduction or regression in the gossypii group unlike in related groups. Most morphological characteristics of the gossypii group were less variable than for the other groups. Due to these, the gossypii group could be morphologically well separated from the craccivora, fabae, and spiraecola groups. In addition, the correlation of the rates of evolution between morphological and DNA datasets was highly significant in their diversification.The morphological separation between the gossypii group and the other species-groups are congruent with their phylogenetic relationships. Analysis of trait evolution revealed that the morphological traits found to be significant based on the morphometric analyses were confidently correlated with the phylogeny. The dominant patterns of trait evolution resulting in increased rates of short branches and temporally later evolution are likely suitable for the modality of Aphis speciation because they have adapted species-specifically, rapidly, and more recently on many different host plants.

  6. Nuclear and cpDNA sequences combined provide strong inference of higher phylogenetic relationships in the phlox family (Polemoniaceae).

    Science.gov (United States)

    Johnson, Leigh A; Chan, Lauren M; Weese, Terri L; Busby, Lisa D; McMurry, Samuel

    2008-09-01

    Members of the phlox family (Polemoniaceae) serve as useful models for studying various evolutionary and biological processes. Despite its biological importance, no family-wide phylogenetic estimate based on multiple DNA regions with complete generic sampling is available. Here, we analyze one nuclear and five chloroplast DNA sequence regions (nuclear ITS, chloroplast matK, trnL intron plus trnL-trnF intergeneric spacer, and the trnS-trnG, trnD-trnT, and psbM-trnD intergenic spacers) using parsimony and Bayesian methods, as well as assessments of congruence and long branch attraction, to explore phylogenetic relationships among 84 ingroup species representing all currently recognized Polemoniaceae genera. Relationships inferred from the ITS and concatenated chloroplast regions are similar overall. A combined analysis provides strong support for the monophyly of Polemoniaceae and subfamilies Acanthogilioideae, Cobaeoideae, and Polemonioideae. Relationships among subfamilies, and thus for the precise root of Polemoniaceae, remain poorly supported. Within the largest subfamily, Polemonioideae, four clades corresponding to tribes Polemonieae, Phlocideae, Gilieae, and Loeselieae receive strong support. The monogeneric Polemonieae appears sister to Phlocideae. Relationships within Polemonieae, Phlocideae, and Gilieae are mostly consistent between analyses and data permutations. Many relationships within Loeselieae remain uncertain. Overall, inferred phylogenetic relationships support a higher-level classification for Polemoniaceae proposed in 2000.

  7. Phylogenetic relationships of the Fox (Forkhead) gene family in the Bilateria

    Science.gov (United States)

    Mazet, Francoise; Yu, Jr Kai; Liberles, David A.; Holland, Linda Z.; Shimeld, Sebastian M.

    2003-01-01

    The Forkhead or Fox gene family encodes putative transcription factors. There are at least four Fox genes in yeast, 16 in Drosophila melanogaster (Dm) and 42 in humans. Recently, vertebrate Fox genes have been classified into 17 groups named FoxA to FoxQ. Here, we extend this analysis to invertebrates, using available sequences from D. melanogaster, Anopheles gambiae (Ag), Caenorhabditis elegans (Ce), the sea squirt Ciona intestinalis (Ci) and amphioxus Branchiostoma floridae (Bf), from which we also cloned several Fox genes. Phylogenetic analyses lend support to the previous overall subclassification of vertebrate genes, but suggest that four subclasses (FoxJ, L, N and Q) could be further subdivided to reflect their relationships to invertebrate genes. We were unable to identify orthologs of Fox subclasses E, H, I, J, M and Q1 in D. melanogaster, A. gambiae or C. elegans, suggesting either considerable loss in ecdysozoans or the evolution of these subclasses in the deuterostome lineage. Our analyses suggest that the common ancestor of protostomes and deuterostomes had a minimum complement of 14 Fox genes.

  8. New insights into the phylogenetic relationships, character evolution, and phytogeographic patterns of Calceolaria (Calceolariaceae).

    Science.gov (United States)

    Cosacov, Andrea; Sérsic, Alicia N; Sosa, Victoria; De-Nova, J Arturo; Nylinder, Stephan; Cocucci, Andrea A

    2009-12-01

    Biogeographical patterns and diversification processes in Andean and Patagonian flora are not yet well understood. Calceolaria is a highly diversified genus of these areas, representing one of the most specialized plant-pollinator systems because flowers produce nonvolatile oils, a very unusual floral reward. Phylogenetic analyses with molecular (ITS and matK) and morphological characters from 103 Calceolaria species were conducted to examine relationships, to understand biogeographic patterns, and to detect evolutionary patterns of floral and ecological characters. Total evidence analysis retrieved three major clades, which strongly correspond to the three previously recognized subgenera, although only subgenus Rosula was retrieved as a monophyletic group. A single historical event explains the expansion from the southern to central Andes, while different parallel evolutionary lines show a northward expansion from the central to northern Andes across the Huancabamba Deflection, an important geographical barrier in northern Peru. Polyploidy, acquisition of elaiophores, and a nototribic pollination mechanism are key aspects of the evolutionary history of Calceolaria. Pollination interactions were more frequently established with Centris than with Chalepogenus oil-collecting bee species. The repeated loss of the oil gland and shifts to pollen as the only reward suggest an evolutionary tendency from highly to moderately specialized pollination systems.

  9. Phylogenetic relationships of the Cochliopinae (Rissooidea: Hydrobiidae): an enigmatic group of aquatic gastropods.

    Science.gov (United States)

    Liu, H P; Hershler, R; Thompson, F G

    2001-10-01

    Phylogenetic analysis based on a partial sequence of the mitochondrial cytochrome c oxidase subunit I gene was performed for 26 representatives of the aquatic gastropod subfamily Cochliopinae, 6 additional members of the family Hydrobiidae, and outgroup species of the families Rissoidae and Pomatiopsidae. Maximum-parsimony analysis yielded a single shortest tree which resolved two monophyletic groups: (1) a clade containing all cochliopine taxa with the exception of Antroselates and (2) a clade composed of Antroselates and the hydrobiid genus Amnicola. The clade containing both of these monophyletic groups was depicted as more closely related to members of the family Pomatiopsidae than to other hydrobiid snails which were basally positioned in our topology. New anatomical evidence supports recognition of the cochliopine and Antroselates-Amnicola clades, and structure within the monophyletic group of cochliopines is largely congruent with genitalic characters. However, the close relationship between the Pomatiopsidae and these clades is in conflict with commonly accepted classifications and suggests that a widely accepted scenario for genitalic evolution in these snails is in need of further study. Copyright 2001 Academic Press.

  10. Phylogenetic relationships among East African haplochromine fish as revealed by short interspersed elements (SINEs).

    Science.gov (United States)

    Terai, Yohey; Takezaki, Naoko; Mayer, Werner E; Tichy, Herbert; Takahata, Naoyuki; Klein, Jan; Okada, Norihiro

    2004-01-01

    Genomic DNA libraries were prepared from two endemic species of Lake Victoria haplochromine (cichlid) fish and used to isolate and characterize a set of short interspersed elements (SINEs). The distribution and sequences of the SINEs were used to infer phylogenetic relationships among East African haplochromines. The SINE-based classification divides the fish into four groups, which, in order of their divergence from a stem lineage, are the endemic Lake Tanganyika flock (group 1); fish of the nonendemic, monotypic, widely distributed genus Astatoreochromis (group 2); the endemic Lake Malawi flock (group 3); and group 4, which contains fish from widely dispersed East African localities including Lakes Victoria, Edward, George, Albert, and Rukwa, as well as many rivers. The group 4 haplochromines are characterized by a subset of polymorphic SINEs, each of which is present in some individuals and absent in others of the same population at a given locality, the same morphologically defined species, and the same mtDNA-defined haplogroup. SINE-defined group 4 contains six of the seven previously described mtDNA haplogroups. One of the polymorphic SINEs appears to be fixed in the endemic Lake Victoria flock; four others display the presence-or-absence polymorphism within the species of this flock. These findings have implications for the origin of Lake Victoria cichlids and for their founding population sizes.

  11. Phylogenetic relationships and evolutionary history of the greater horseshoe bat, Rhinolophus ferrumequinum, in Northeast Asia.

    Science.gov (United States)

    Liu, Tong; Sun, Keping; Park, Yung Chul; Feng, Jiang

    2016-01-01

    The greater horseshoe bat, Rhinolophus ferrumequinum , is an important model organism for studies on chiropteran phylogeographic patterns. Previous studies revealed the population history of R. ferrumequinum from Europe and most Asian regions, yet there continue to be arguments about their evolutionary process in Northeast Asia. In this study, we obtained mitochondrial DNA cyt b and D-loop data of R. ferrumequinum from Northeast China, South Korea and Japan to clarify their phylogenetic relationships and evolutionary process. Our results indicate a highly supported monophyletic group of Northeast Asian greater horseshoe bats, in which Japanese populations formed a single clade and clustered into the mixed branches of Northeast Chinese and South Korean populations. We infer that R. ferrumequinum in Northeast Asia originated in Northeast China and South Korea during a cold glacial period, while some ancestors likely arrived in Japan by flying or land bridge and subsequently adapted to the local environment. Consequently, during the warm Eemian interglaciation, the Korea Strait, between Japan and South Korea, became a geographical barrier to Japanese and inland populations, while the Changbai Mountains, between China and North Korea, did not play a significant role as a barrier between Northeast China and South Korea populations.

  12. Phylogenetic relationships in Demodex mites (Acari: Demodicidae) based on mitochondrial 16S rDNA partial sequences.

    Science.gov (United States)

    Zhao, Ya-E; Wu, Li-Ping

    2012-09-01

    To confirm phylogenetic relationships in Demodex mites based on mitochondrial 16S rDNA partial sequences, mtDNA 16S partial sequences of ten isolates of three Demodex species from China were amplified, recombined, and sequenced and then analyzed with two Demodex folliculorum isolates from Spain. Lastly, genetic distance was computed, and phylogenetic tree was reconstructed. MEGA 4.0 analysis showed high sequence identity among 16S rDNA partial sequences of three Demodex species, which were 95.85 % in D. folliculorum, 98.53 % in Demodex canis, and 99.71 % in Demodex brevis. The divergence, genetic distance, and transition/transversions of the three Demodex species reached interspecies level, whereas there was no significant difference of the divergence (1.1 %), genetic distance (0.011), and transition/transversions (3/1) of the two geographic D. folliculorum isolates (Spain and China). Phylogenetic trees reveal that the three Demodex species formed three separate branches of one clade, where D. folliculorum and D. canis gathered first, and then gathered with D. brevis. The two Spain and five China D. folliculorum isolates did not form sister clades. In conclusion, 16S mtDNA are suitable for phylogenetic relationship analysis in low taxa (genus or species), but not for intraspecies determination of Demodex. The differentiation among the three Demodex species has reached interspecies level.

  13. Phylogenetic relationships of Malaysia's pig-tailed macaque Macaca nemestrina based on D-loop region sequences

    Science.gov (United States)

    Abdul-Latiff M. A., B.; Ampeng, A.; Yaakop, S.; Md-Zain B., M.

    2014-09-01

    Phylogenetic relationships among Malaysian pig-tailed macaques have never been established even though the data are crucial in aiding conservation plan for the species. The aims of this study is to establish the phylogenetic relationships of Macaca nemestrina in Malaysia. A total of 21 genetic samples of M. nemestrina yielding 458 bp of D-loop sequences were used in phylogenetic analyses, in addition to one sample of M. fascicularis which was used as an outgroup. Sequence character analysis revealed that D-loop locus contains 23% parsimony informative character detected among the ingroups. Further analysis indicated a clear separation between populations originating from different regions; the Malay Peninsula populations are separated from Borneo Insular population; and Perak population formed a distinctive clade within Peninsular Malaysia populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo population was distinguished from Peninsula population (100% bootstrap value in the NJ, MP, 1.00 posterior probability in Bayesian trees). Perak's population was separated from other Peninsula populations (100% in NJ, 99% in MP and 1.00 in Bayesian). D-loop region of mtDNA is proven to be a suitable locus in studying the separation of M. nemestrina at population level. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations in Malaysia.

  14. The complete chloroplast genome sequence of Ampelopsis: gene organization, comparative analysis and phylogenetic relationships to other angiosperms

    Directory of Open Access Journals (Sweden)

    Gurusamy eRaman

    2016-03-01

    Full Text Available Ampelopsis brevipedunculata is an economically important plant that belongs to the Vitaceae family of angiosperms. The phylogenetic placement of Vitaceae is still unresolved. Recent phylogenetic studies suggested that it should be placed in various alternative families including Caryophyllaceae, asteraceae, Saxifragaceae, Dilleniaceae, or with the rest of the rosid families. However, these analyses provided weak supportive results because they were based on only one of several genes. Accordingly, complete chloroplast genome sequences are required to resolve the phylogenetic relationships among angiosperms. Recent phylogenetic analyses based on the complete chloroplast genome sequence suggested strong support for the position of Vitaceae as the earliest diverging lineage of rosids and placed it as a sister to the remaining rosids. These studies also revealed relationships among several major lineages of angiosperms; however, they highlighted the significance of taxon sampling for obtaining accurate phylogenies. In the present study, we sequenced the complete chloroplast genome of A. brevipedunculata and used these data to assess the relationships among 32 angiosperms, including 18 taxa of rosids. The Ampelopsis chloroplast genome is 161,090 bp in length, and includes a pair of inverted repeats of 26,394 bp that are separated by small and large single copy regions of 19,036 bp and 89,266 bp, respectively. The gene content and order of Ampelopsis is identical to many other unrearranged angiosperm chloroplast genomes, including Vitis and tobacco. A phylogenetic tree constructed based on 70 protein-coding genes of 33 angiosperms showed that both Saxifragales and Vitaceae diverged from the rosid clade and formed two clades with 100% bootstrap value. The position of the Vitaceae is sister to Saxifragales, and both are the basal and earliest diverging lineages. Moreover, Saxifragales forms a sister clade to Vitaceae of rosids. Overall, the results of

  15. Phylogenetic relationships of Erysimum (Brassicaceae from the Baetic Mountains (SE Iberian Peninsula

    Directory of Open Access Journals (Sweden)

    Abdelaziz, Mohamed

    2014-06-01

    Full Text Available The Baetic mountains, located in the southern Iberian Peninsula, is a major hotspot of biodiversity in the Mediterranean Basin, constituting one of the most important glacial refugia for vascular plants in Europe. Despite their relatively limited extension, the Baetic Mountains contain almost 50% of the total endemic Erysimum species in the Iberian Peninsula. The broadly distributed Erysimum genus has diversified profusely in the Mediterranean region, with more than a hundred species described in the area, out of a total of c. 200 species included in the genus. We used two plastid DNA regions (ndhF and trnT-L and one nuclear DNA region (ITS1-5.8S rDNA-ITS2, with 3,556 bp total length, to carry out phylogenetic analysis by Bayesian inference, maximum likelihood and maximum parsimony, in order to explore the evolutionary relationships between the Erysimum species inhabiting these ranges. Analyses of concatenated sequences from the two genomes identified two main clades with no overlap in species composition so that samples from the same species fell within the same major clade. The phylogenetic relationships depicted by those two clades do not give support to the E. nevadense group, previously proposed on taxonomic grounds. In addition, our results indicated recurrent changes in flower colour in the Baetic Erysimum species although, alternatively, reticulate evolution, which is suggested by incongruent position of taxa in the different trees, may have also affected this trait.Las cordilleras Béticas, localizadas en el sudeste de la Península Ibérica, representan una importante zona para la biodiversidad de la cuenca mediterránea, constituyendo uno de los refugios glaciares más destacados de plantas vasculares en Europa. A pesar de su extensión relativamente limitada, las cordilleras Béticas albergan casi el 50% del total de las especies endémicas de Erysimum de la Península Ibérica. Erysimum es un género ampliamente distribuido, que se

  16. Genetic diversity and phylogenetic relationship of Indonesian Local goats using microsatellite DNA markers

    Directory of Open Access Journals (Sweden)

    M Syamsul Arifin Zein

    2012-03-01

    Full Text Available Genetic diversity is important information in the process of conservation and sustainable utilization of animal genetic resources. Thirteen microsatellite markers were used to estimate the degree of genetic diversity on five Indonesian local goats. Results showed the highest average allele diversity present in the locus MAF70 (5.6 ± 2.9, and the lowest was in the locus MAF035 (1.6 ± 0.6, the average number of alleles per locus was 6 ± 2.3. The lowest average alleles diversity present was in the Gembrong goat (2.2 ± 1.1 and the highest was in the Jawarandu goat (4.9 ± 2.2. There is a unique alleles at loci MCM527 and present in all Indonesian local goat with the highest allele frequency on Peranakan Etawa (37.2% and lowest in Gembrong goat (7.9%. H0 ranged from 0.372 ± 0.173 (Gembrong to 0.540 ± 0.204 (Peranakan Etawa, and HE ranging from 0.249 ± 0.196 (Gembrong to 0.540 ± 0.212 (Peranakan Etawa.The genetic differentiation for inbreeding among population (FIS, within population (FIT, and average genetic differention (FST were 0,0208 (2,08%, 0,1532 (15,32%, and 0,1352 (13,52%, respectively. Locus ILSTS029, BMS1494, MAF035 and INRA0132 had a low PIC value (PIC 0.5. Phylogenetic relationship was consistent with the history of its development based on Kacang goat except was for Gembrong Goat. This research information can be used for conservation strategies and breeding programs on each population of Indonesian local goat.

  17. A phylogenetic analysis of normal modes evolution in enzymes and its relationship to enzyme function.

    Science.gov (United States)

    Lai, Jason; Jin, Jing; Kubelka, Jan; Liberles, David A

    2012-09-21

    Since the dynamic nature of protein structures is essential for enzymatic function, it is expected that functional evolution can be inferred from the changes in protein dynamics. However, dynamics can also diverge neutrally with sequence substitution between enzymes without changes of function. In this study, a phylogenetic approach is implemented to explore the relationship between enzyme dynamics and function through evolutionary history. Protein dynamics are described by normal mode analysis based on a simplified harmonic potential force field applied to the reduced C(α) representation of the protein structure while enzymatic function is described by Enzyme Commission numbers. Similarity of the binding pocket dynamics at each branch of the protein family's phylogeny was analyzed in two ways: (1) explicitly by quantifying the normal mode overlap calculated for the reconstructed ancestral proteins at each end and (2) implicitly using a diffusion model to obtain the reconstructed lineage-specific changes in the normal modes. Both explicit and implicit ancestral reconstruction identified generally faster rates of change in dynamics compared with the expected change from neutral evolution at the branches of potential functional divergences for the α-amylase, D-isomer-specific 2-hydroxyacid dehydrogenase, and copper-containing amine oxidase protein families. Normal mode analysis added additional information over just comparing the RMSD of static structures. However, the branch-specific changes were not statistically significant compared to background function-independent neutral rates of change of dynamic properties and blind application of the analysis would not enable prediction of changes in enzyme specificity. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. Phylogenetic Relationships of the Fern Cyrtomium falcatum (Dryopteridaceae from Dokdo Island Based on Chloroplast Genome Sequencing

    Directory of Open Access Journals (Sweden)

    Gurusamy Raman

    2016-12-01

    Full Text Available Cyrtomium falcatum is a popular ornamental fern cultivated worldwide. Native to the Korean Peninsula, Japan, and Dokdo Island in the Sea of Japan, it is the only fern present on Dokdo Island. We isolated and characterized the chloroplast (cp genome of C. falcatum, and compared it with those of closely related species. The genes trnV-GAC and trnV-GAU were found to be present within the cp genome of C. falcatum, whereas trnP-GGG and rpl21 were lacking. Moreover, cp genomes of Cyrtomium devexiscapulae and Adiantum capillus-veneris lack trnP-GGG and rpl21, suggesting these are not conserved among angiosperm cp genomes. The deletion of trnR-UCG, trnR-CCG, and trnSeC in the cp genomes of C. falcatum and other eupolypod ferns indicates these genes are restricted to tree ferns, non-core leptosporangiates, and basal ferns. The C. falcatum cp genome also encoded ndhF and rps7, with GUG start codons that were only conserved in polypod ferns, and it shares two significant inversions with other ferns, including a minor inversion of the trnD-GUC region and an approximate 3 kb inversion of the trnG-trnT region. Phylogenetic analyses showed that Equisetum was found to be a sister clade to Psilotales-Ophioglossales with a 100% bootstrap (BS value. The sister relationship between Pteridaceae and eupolypods was also strongly supported by a 100% BS, but Bayesian molecular clock analyses suggested that C. falcatum diversified in the mid-Paleogene period (45.15 ± 4.93 million years ago and might have moved from Eurasia to Dokdo Island.

  19. Phylogenetic relationships and morphological evolution in Lentinus, Polyporellus and Neofavolus, emphasizing southeastern Asian taxa.

    Science.gov (United States)

    Seelan, Jaya Seelan Sathiya; Justo, Alfredo; Nagy, Laszlo G; Grand, Edward A; Redhead, Scott A; Hibbett, David

    2015-01-01

    The genus Lentinus (Polyporaceae, Basidiomycota) is widely documented from tropical and temperate forests and is taxonomically controversial. Here we studied the relationships between Lentinus subg. Lentinus sensu Pegler (i.e. sections Lentinus, Tigrini, Dicholamellatae, Rigidi, Lentodiellum and Pleuroti and polypores that share similar morphological characters). We generated sequences of internal transcribed spacers (ITS) and partial 28S regions of nuc rDNA and genes encoding the largest subunit of RNA polymerase II (RPB1), focusing on Lentinus subg. Lentinus sensu Pegler and the Neofavolus group, combined these data with sequences from GenBank (including RPB2 gene sequences) and performed phylogenetic analyses with maximum likelihood and Bayesian methods. We also evaluated the transition in hymenophore morphology between Lentinus, Neofavolus and related polypores with ancestral state reconstruction. Single-gene phylogenies and phylogenies combining ITS and 28S with RPB1 and RPB2 genes all support existence of a Lentinus/Polyporellus clade and a separate Neofavolus clade. Polyporellus (represented by P. arcularius, P. ciliatus, P. brumalis) forms a clade with species representing Lentinus subg. Lentinus sensu Pegler (1983), excluding L. suavissimus. Lentinus tigrinus appears as the sister group of Polyporellus in the four-gene phylogeny, but this placement was weakly supported. All three multigene analyses and the single-gene analysis using ITS strongly supported Polyporus tricholoma as the sister group of the Lentinus/Polyporellus clade; only the 28S rRNA phylogeny failed to support this placement. Under parsimony the ancestral hymenophoral configuration for the Lentinus/Polyporellus clade is estimated to be circular pores, with independent transitions to angular pores and lamellae. The ancestral state for the Neofavolus clade is estimated to be angular pores, with a single transition to lamellae in L. suavissimus. We propose that Lentinus suavissimus (section

  20. Phylogenetic relationships of rollers (Coraciidae) based on complete mitochondrial genomes and fifteen nuclear genes.

    Science.gov (United States)

    Johansson, Ulf S; Irestedt, Martin; Qu, Yanhua; Ericson, Per G P

    2018-04-06

    The rollers (Coraciidae) constitute a relative small avian family with ca. 12 species distributed in Africa, western and southern Eurasia, and eastern Australia. In this study we examine the phylogenetic relationships of all species currently recognized in the family, including two taxa whose taxonomic status is currently contested. By using shotgun sequencing on degraded DNA from museum study skins we have been able to recover complete mitochondrial genomes as well as 15 nuclear genes for in total 16 taxa. The gene sequences were analyzed both concatenated in a maximum likelihood framework as well in a species tree approach using MP-EST. The different analytical approaches yield similar, highly supported trees and support the current division of the rollers into two genera, Coracias and Eurystomus. The only conflict relates to the placement of the Blue-bellied Roller (C. cyanogaster), where the mitochondrial, and the concatenated nuclear and mitochondrial data set, place this taxon as sister to the other Coracias species, whereas nuclear data and the species tree analysis place it as the sister taxon of C. naevia and C. spatulatus. All analyses place the Eurasian roller (C. garrulus) with the two African species, Abyssinian Roller (C. abyssinica) and Liliac-breasted Roller (C. caudatus), and place this clade as the sister group to the Asian Coracias rollers. In addition, our results support a sister group relationship between the morphologically rather dissimilar Purple Roller (C. naevia) and Racquet-tailed Roller (C. spatulatus) and also support the division of Eurystomus in an African and an Asian clade. However, within the Asian clade the Azure Roller (E. azureus) from Halmahera appears to be nested within the Dollarbird (E. orientalis), indicating that that this taxon is a morphological divergent, but a rather recent offshoot, of the widespread Dollarbird. Similarly, the Purple-winged Roller (C. temminickii) from Sulawesi group together with C. benghalensis

  1. Comparative analysis of DNA polymorphisms and phylogenetic relationships among Syzygium cumini Skeels based on phenotypic characters and RAPD technique.

    Science.gov (United States)

    Singh, Jitendra P; Singh, Ak; Bajpai, Anju; Ahmad, Iffat Zareen

    2014-01-01

    The Indian black berry (Syzygium cumini Skeels) has a great nutraceutical and medicinal properties. As in other fruit crops, the fruit characteristics are important attributes for differentiation were also determined for different accessions of S. cumini. The fruit weight, length, breadth, length: breadth ratio, pulp weight, pulp content, seed weight and pulp: seed ratio significantly varied in different accessions. Molecular characterization was carried out using PCR based RAPD technique. Out of 80 RAPD primers, only 18 primers produced stable polymorphisms that were used to examine the phylogenetic relationship. A sum of 207 loci were generated out of which 201 loci found polymorphic. The average genetic dissimilarity was 97 per cent among jamun accessions. The phylogenetic relationship was also determined by principal coordinates analysis (PCoA) that explained 46.95 per cent cumulative variance. The two-dimensional PCoA analysis showed grouping of the different accessions that were plotted into four sub-plots, representing clustering of accessions. The UPGMA (r = 0.967) and NJ (r = 0.987) dendrogram constructed based on the dissimilarity matrix revealed a good degree of fit with the cophenetic correlation value. The dendrogram grouped the accessions into three main clusters according to their eco-geographical regions which given useful insight into their phylogenetic relationships.

  2. Technical Basis of Scaling Relationships for the Pretreatment Engineering Platform

    Energy Technology Data Exchange (ETDEWEB)

    Kuhn, William L.; Arm, Stuart T.; Huckaby, James L.; Kurath, Dean E.; Rassat, Scot D.

    2008-07-15

    Pacific Northwest National Laboratory has been tasked by Bechtel National Inc. (BNI) on the River Protection Project-Waste Treatment Plant (RPP-WTP) project to perform research and development activities. The Pretreatment Engineering Platform (PEP) is being designed and constructed as part of a plan to respond to an issue raised by the WTP External Flowsheet Review Team (EFRT) entitled “Undemonstrated Leaching Processes” and numbered M12. The PEP replicates the WTP leaching process using prototypic equipment and control strategies. The approach for scaling PEP performance data to predict WTP performance is critical to the successful resolution of the EFRT issue. This report describes the recommended PEP scaling approach, PEP data interpretation and provides recommendations on test conduct and data requirements.

  3. Technical Basis of Scaling Relationships for the Pretreatment Engineering Platform

    International Nuclear Information System (INIS)

    Kuhn, William L.; Arm, Stuart T.; Huckaby, James L.; Kurath, Dean E.; Rassat, Scot D.

    2008-01-01

    Pacific Northwest National Laboratory has been tasked by Bechtel National Inc. (BNI) on the River Protection Project-Waste Treatment Plant (RPP-WTP) project to perform research and development activities. The Pretreatment Engineering Platform (PEP) is being designed and constructed as part of a plan to respond to an issue raised by the WTP External Flowsheet Review Team (EFRT) entitled 'Undemonstrated Leaching Processes' and numbered M12. The PEP replicates the WTP leaching process using prototypic equipment and control strategies. The approach for scaling PEP performance data to predict WTP performance is critical to the successful resolution of the EFRT issue. This report describes the recommended PEP scaling approach, PEP data interpretation and provides recommendations on test conduct and data requirements

  4. Phylogenetic relationships and acaricidal effects of Beauveria bassiana obtained from cattle farm soils against Rhipicephalus microplus.

    Science.gov (United States)

    Fernández-Salas, Agustin; Alonso Díaz, Miguel Angel; Alonso Morales, Rogelio Alejandro; Lezama-Gutierrez, Roberto; Cervantes-Chávez, José Antonio

    2018-03-16

    The objectives of the present study were to isolate Beauveria bassiana strains from cattle farms soils, to analyze the phylogenetic relationships among the isolated fungi strains, and to determine the acaricidal effect of B. bassiana isolates on Rhipicephalus microplus engorged ticks, resistant or susceptible to chemical acaricides. Six strains of Beauveria bassiana were obtained and isolated from cattle farms soils by Galleria bait method in Mexican tropics and the acaricidal effect was assessed against 2 populations of R. microplus ("Media Joya" resistant strain or "CLAR" susceptible strain to chemical acaricides) using the adult immersion test. The BbV03 strain produced an 86.7% and a 60% of mortality on resistant and susceptible ticks on day 20, respectively; whereas the mortality scored with the BbV04 strain was 66.7% and 53.5% on resistant and susceptible ticks at the same day, respectively. The BbV03 and BbV04 strains reduced egg-laying on both R. microplus populations. There were not statistical differences in the acaricidal effect of B. bassiana strains, between the R. microplus susceptible or resistant populations (P > 0.05). The BbV03 strain was the most virulent against R. microplus with a LC50 of 2 x 107 and a LC99 of 7 x 108 conidia/ml. We found that the 6 B. bassiana isolated were clustered into the same clade with other previously reported B. bassiana strains (from GenBank); however, they were separated into 3 different sub-clades. This study shows that some B. bassiana strains might be a promising coadjuvant alternative for biological tick control, including those that are resistant to chemical acaricides. Beauveria bassiana is present in the pastures of tropic cattle farms and there are genetic variations between members of the bassiana specie that are living in this ecosystem. This last showed that B. bassiana might play an important roll in the natural control of R. microplus at paddocks of cattle farms.

  5. Platforms.

    Science.gov (United States)

    Josko, Deborah

    2014-01-01

    The advent of DNA sequencing technologies and the various applications that can be performed will have a dramatic effect on medicine and healthcare in the near future. There are several DNA sequencing platforms available on the market for research and clinical use. Based on the medical laboratory scientist or researcher's needs and taking into consideration laboratory space and budget, one can chose which platform will be beneficial to their institution and their patient population. Although some of the instrument costs seem high, diagnosing a patient quickly and accurately will save hospitals money with fewer hospital stays and targeted treatment based on an individual's genetic make-up. By determining the type of disease an individual has, based on the mutations present or having the ability to prescribe the appropriate antimicrobials based on the knowledge of the organism's resistance patterns, the clinician will be better able to treat and diagnose a patient which ultimately will improve patient outcomes and prognosis.

  6. Phylogenetic relationships of true butterflies (Lepidoptera: Papilionoidea) inferred from COI, 16S rRNA and EF-1α sequences.

    Science.gov (United States)

    Kim, Man Il; Wan, Xinlong; Kim, Min Jee; Jeong, Heon Cheon; Ahn, Neung-Ho; Kim, Ki-Gyoung; Han, Yeon Soo; Kim, Iksoo

    2010-11-01

    The molecular phylogenetic relationships among true butterfly families (superfamily Papilionoidea) have been a matter of substantial controversy; this debate has led to several competing hypotheses. Two of the most compelling of those hypotheses involve the relationships of (Nymphalidae + Lycaenidae) + (Pieridae + Papilionidae) and (((Nymphalidae + Lycaenidae) + Pieridae) + Papilionidae). In this study, approximately 3,500 nucleotide sequences from cytochrome oxidase subunit I (COI), 16S ribosomal RNA (16S rRNA), and elongation factor-1 alpha (EF-1α) were sequenced from 83 species belonging to four true butterfly families, along with those of three outgroup species belonging to three lepidopteran superfamilies. These sequences were subjected to phylogenetic reconstruction via Bayesian Inference (BI), Maximum Likelihood (ML), and Maximum Parsimony (MP) algorithms. The monophyletic Pieridae and monophyletic Papilionidae evidenced good recovery in all analyses, but in some analyses, the monophylies of the Lycaenidae and Nymphalidae were hampered by the inclusion of single species of the lycaenid subfamily Miletinae and the nymphalid subfamily Danainae. Excluding those singletons, all phylogenetic analyses among the four true butterfly families clearly identified the Nymphalidae as the sister to the Lycaenidae and identified this group as a sister to the Pieridae, with the Papilionidae identified as the most basal linage to the true butterfly, thus supporting the hypothesis: (Papilionidae + (Pieridae + (Nymphalidae + Lycaenidae))).

  7. Analysis of Fatty Acid and Growth Profiles in Ten Shewanella spp. to Associate Phylogenetic Relationships

    Science.gov (United States)

    2015-10-25

    microorganisms from the same genus using physiological responses. To understand these changes, a shift in fatty acid length distributions and growth of...phylogenetically dissimilar microorganisms from the same genus using physiological responses. To understand these changes, a shift in fatty acid length...region contaminated with metals: relation with ecological characteristics and soil respiration. J. Biorem. Biodegrad . 6, 1000274/1000271-1000274

  8. Phylogenetic relationships of Malayan gaur with other species of the genus Bos based on cytochrome b gene DNA sequences.

    Science.gov (United States)

    Rosli, M K A; Zakaria, S S; Syed-Shabthar, S M F; Zainal, Z Z; Shukor, M N; Mahani, M C; Abas-Mazni, O; Md-Zain, B M

    2011-03-22

    The Malayan gaur (Bos gaurus hubbacki) is one of the three subspecies of gaurs that can be found in Malaysia. We examined the phylogenetic relationships of this subspecies with other species of the genus Bos (B. javanicus, B. indicus, B. taurus, and B. grunniens). The sequence of a key gene, cytochrome b, was compared among 20 Bos species and the bongo antelope, used as an outgroup. Phylogenetic reconstruction was employed using neighbor joining and maximum parsimony in PAUP and Bayesian inference in MrBayes 3.1. All tree topologies indicated that the Malayan gaur is in its own monophyletic clade, distinct from other species of the genus Bos. We also found significant branching differences in the tree topologies between wild and domestic cattle.

  9. Phylogenetic relationships of Malaysia’s long-tailed macaques, Macaca fascicularis, based on cytochrome b sequences

    Science.gov (United States)

    Abdul-Latiff, Muhammad Abu Bakar; Ruslin, Farhani; Fui, Vun Vui; Abu, Mohd-Hashim; Rovie-Ryan, Jeffrine Japning; Abdul-Patah, Pazil; Lakim, Maklarin; Roos, Christian; Yaakop, Salmah; Md-Zain, Badrul Munir

    2014-01-01

    Abstract Phylogenetic relationships among Malaysia’s long-tailed macaques have yet to be established, despite abundant genetic studies of the species worldwide. The aims of this study are to examine the phylogenetic relationships of Macaca fascicularis in Malaysia and to test its classification as a morphological subspecies. A total of 25 genetic samples of M. fascicularis yielding 383 bp of Cytochrome b (Cyt b) sequences were used in phylogenetic analysis along with one sample each of M. nemestrina and M. arctoides used as outgroups. Sequence character analysis reveals that Cyt b locus is a highly conserved region with only 23% parsimony informative character detected among ingroups. Further analysis indicates a clear separation between populations originating from different regions; the Malay Peninsula versus Borneo Insular, the East Coast versus West Coast of the Malay Peninsula, and the island versus mainland Malay Peninsula populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo’s population was distinguished from Peninsula’s population (99% and 100% bootstrap value in NJ and MP respectively and 1.00 posterior probability in Bayesian trees). The East coast population was separated from other Peninsula populations (64% in NJ, 66% in MP and 0.53 posterior probability in Bayesian). West coast populations were divided into 2 clades: the North-South (47%/54% in NJ, 26/26% in MP and 1.00/0.80 posterior probability in Bayesian) and Island-Mainland (93% in NJ, 90% in MP and 1.00 posterior probability in Bayesian). The results confirm the previous morphological assignment of 2 subspecies, M. f. fascicularis and M. f. argentimembris, in the Malay Peninsula. These populations should be treated as separate genetic entities in order to conserve the genetic diversity of Malaysia’s M. fascicularis. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations

  10. Using phylogenetic and ionomic relationships to predict the uptake of radionuclides by any plant species

    Energy Technology Data Exchange (ETDEWEB)

    Willey, Neil J.; Siasou, Eleni [Centre for Research In Biosciences, University of the West of England, Coldharbour Lane, Frenchay, Bristol BS16 1QY (United Kingdom)

    2014-07-01

    It is not practical to empirically derive soil-to-plant TFs for all soil-plant combinations that are important in radiological assessments, so predictions for a range of species on different soils types are frequently impossible because TFs are unknown. This severely hampers predictions of both doses to biota and of the contamination of a variety of food chains with radioisotopes. Compilations of TFs in themselves provide no fundamental understanding of the plant factors that control the soil-to-plant transfer of radionuclides and thus no method of prediction. We have developed methods for the meta-analyses of radionuclide transfer data that can be used to make predictions of the transfer of radionuclides into any plants species for which TFs do not exist based on an understand of the plant factors that control radionuclide uptake. There is no reason a priori to think that variation in TF should be constrained by species. The species is, essentially, a reproductive unit and variation in many plant traits, some of which might control radionuclide uptake, occurs at taxonomic levels above the species. In the last 15 years genomic information has transformed the understanding of the evolutionary relationships of the living world so that new 'trees of life' (phylogenies) are now available. Using a Residual Maximum Likelihood modeling procedure to compile a significant proportion of all existing TF data onto a single scale, we here present a synthesis of the influence of phylogeny on variation in soil-to-plant TFs for radioisotopes of Cs, Sr, Co, I, Tc, and S. We show that a significant proportion of variation in TF is associated with major branches of the phylogeny of angiosperms (flowering plants) so that knowledge of a species' position on the phylogeny can be used to make predictions of transfer relative to other species. These phylogenetically-based predictions of relative transfer to any species can be used to make absolute predictions to any species

  11. Phylogenetic relationships of the intercellular fish pathogen Ichthyophonus hoferi and fungi, choanoflagellates and the rosette agent

    DEFF Research Database (Denmark)

    Spanggaard, Bettina; Skouboe, P.; Rossen, L.

    1996-01-01

    Ichthyophonus hoferi Plehn and Mulsow, 1911 is thought to be one of the few pathogenic fungal infections of marine fish. The result of an attack is severe epizootics in herring stocks with drastic reduction in the population as a consequence. The exact phylogenetic position of the genus Ichthyoph......Ichthyophonus hoferi Plehn and Mulsow, 1911 is thought to be one of the few pathogenic fungal infections of marine fish. The result of an attack is severe epizootics in herring stocks with drastic reduction in the population as a consequence. The exact phylogenetic position of the genus...... Ichthyophonus is not known. In the present study, a combination of molecular data, ultrastructure and biochemical characters were utilized to investigate the phylogeny of I. hoferi. The genomic DNA encoding the small subunit ribosomal RNA (18S rRNA) was amplified and sequenced. Comparisons with other eukaryotic...

  12. Phylogenetic relationships among Neoechinorhynchus species (Acanthocephala: Neoechinorhynchidae) from North-East Asia based on molecular data.

    Science.gov (United States)

    Malyarchuk, Boris; Derenko, Miroslava; Mikhailova, Ekaterina; Denisova, Galina

    2014-02-01

    Phylogenetic and statistical analyses of DNA sequences of two genes, cytochrome oxidase subunit 1 (cox 1) of the mitochondrial DNA and 18S subunit of the nuclear ribosomal RNA (18S rRNA), was used to characterize Neoechinorhynchus species from fishes collected in different localities of North-East Asia. It has been found that four species can be clearly recognized using molecular markers-Neoechinorhynchus tumidus, Neoechinorhynchus beringianus, Neoechinorhynchus simansularis and Neoechinorhynchus salmonis. 18S sequences ascribed to Neoechinorhynchus crassus specimens from North-East Asia were identical to those of N. tumidus, but differed substantially from North American N. crassus. We renamed North-East Asian N. crassus specimens to N. sp., although the possibility that they represent a subspecies of N. tumidus cannot be excluded, taking into account a relatively small distance between cox 1 sequences of North-East Asian specimens of N. crassus and N. tumidus. Maximum likelihood, maximum parsimony and Bayesian inference analyses were performed for phylogeny reconstruction. All the phylogenetic trees showed that North-East Asian species of Neoechinorhynchus analyzed in this study represent independent clades, with the only exception of N. tumidus and N. sp. for 18S data. Phylogenetic analysis has shown that the majority of species sampled (N. tumidus+N. sp., N. simansularis and N. beringianus) are probably very closely related, while N. salmonis occupies separate position in the trees, possibly indicating a North American origin of this species. © 2013.

  13. Endosymbiosis In Statu Nascendi: Close Phylogenetic RelationshipBetween Obligately Endosymbiotic and Obligately Free-LivingPolynucleobacter Strains (Betaproteobacteria)

    Energy Technology Data Exchange (ETDEWEB)

    Vannini, Claudia; Pockl, Matthias; Petroni, Giulio; Wu, Qinglong; Lang, Elke; Stackebrandt, Erko; Schrallhammer, Martina; Richardson, PaulM.; Hahn, Martin W.

    2006-07-21

    Bacterial strains affiliated to the phylogenetically shallowsubcluster C (PnecC) of the 28 Polynucleobacter cluster, which ischaracterized by a minimal 16S rRNA gene sequence similarity of approx.98.5 percent, have been reported to occur as obligate endosymbionts of 30ciliates (Euplotes spp.), as well as to occur as free-living cells in thepelagic zone of freshwater habitats. We investigated if these two groupsof closely related bacteria represent 32 strains fundamentally differingin lifestyle, or if they simply represent different stages of afacultative endosymbiotic lifestyle. The phylogenetic analysis of 16SrRNA gene and 16S34 23S ITS sequences of five endosymbiont strains fromtwo different Euplotes species and 40 pure culture strains demonstratedhost-species-specific clustering of the endosymbiont 36 sequences withinthe PnecC subcluster. The sequences of the endosymbionts showedcharacteristics indicating an obligate endosymbiotic lifestyle.Cultivation experiments 38 revealed fundamental differences inphysiological adaptations, and determination of the genome sizesindicated a slight size reduction in endosymbiotic strains. We concludethat the 40 two groups of PnecC bacteria represent obligately free-livingand obligately endosymbiotic strains, respectively, and do not representdifferent stages of the same complex lifecycle. 42 These closely relatedstrains occupy completely separated ecological niches. To our bestknowledge, this is the closest phylogenetic relationship between obligateendosymbionts and 44 obligately free-living bacteria everrevealed.

  14. Comprehensive transcriptome analysis provides new insights into nutritional strategies and phylogenetic relationships of chrysophytes

    Directory of Open Access Journals (Sweden)

    Daniela Beisser

    2017-01-01

    Full Text Available Background Chrysophytes are protist model species in ecology and ecophysiology and important grazers of bacteria-sized microorganisms and primary producers. However, they have not yet been investigated in detail at the molecular level, and no genomic and only little transcriptomic information is available. Chrysophytes exhibit different trophic modes: while phototrophic chrysophytes perform only photosynthesis, mixotrophs can gain carbon from bacterial food as well as from photosynthesis, and heterotrophs solely feed on bacteria-sized microorganisms. Recent phylogenies and megasystematics demonstrate an immense complexity of eukaryotic diversity with numerous transitions between phototrophic and heterotrophic organisms. The question we aim to answer is how the diverse nutritional strategies, accompanied or brought about by a reduction of the plasmid and size reduction in heterotrophic strains, affect physiology and molecular processes. Results We sequenced the mRNA of 18 chrysophyte strains on the Illumina HiSeq platform and analysed the transcriptomes to determine relations between the trophic mode (mixotrophic vs. heterotrophic and gene expression. We observed an enrichment of genes for photosynthesis, porphyrin and chlorophyll metabolism for phototrophic and mixotrophic strains that can perform photosynthesis. Genes involved in nutrient absorption, environmental information processing and various transporters (e.g., monosaccharide, peptide, lipid transporters were present or highly expressed only in heterotrophic strains that have to sense, digest and absorb bacterial food. We furthermore present a transcriptome-based alignment-free phylogeny construction approach using transcripts assembled from short reads to determine the evolutionary relationships between the strains and the possible influence of nutritional strategies on the reconstructed phylogeny. We discuss the resulting phylogenies in comparison to those from established approaches

  15. Continuous osteological characters in the reconstruction of phylogenetic relationships of the six Euro-Mediterranean mullet species (Mugilidae).

    Science.gov (United States)

    Antović, Ivanka

    2013-09-01

    Sixty-three continuous osteological characters (18 skull continuous characters and the total length of neurocranium, 45 continuous characters of 15 elements of the viscerodermal skeleton) were analyzed and included in the reconstruction of phylogenetic relationships of the six Euro-Mediterranean mullet species from the South Adriatic Sea: Mugil cephalus Linnaeus, 1758; Liza saliens Risso, 1810; Liza aurata Risso, 1810; Liza ramada Risso, 1826; Chelon labrosus Risso, 1826 and Oedalechilus labeo Cuvier, 1829. The study reveals that Sphyraenidae was separated clearly from Mugilidae, C. labrosus and three Liza species form a common cluster (L. ramada and L. saliens being the closest), while O. labeo and M. cephalus cluster together.

  16. Phylogenetic relationships of leopard frogs (Rana pipiens complex) from an isolated coastal mountain range in southern Sonora, Mexico.

    Science.gov (United States)

    Pfeiler, E; Markow, T A

    2008-10-01

    Mitochondrial DNA sequence data from the control region and 12S rRNA in leopard frogs from the Sierra El Aguaje of southern Sonora, Mexico, together with GenBank sequences, were used to infer taxonomic identity and provide phylogenetic hypotheses for relationships with other members of the Rana pipiens complex. We show that frogs from the Sierra El Aguaje belong to the Rana berlandieri subgroup, or Scurrilirana clade, of the R. pipiens group, and are most closely related to Rana magnaocularis from Nayarit, Mexico. We also provide further evidence that Rana magnaocularis and R. yavapaiensis are close relatives.

  17. Co-circulating serotypes in a dengue fever outbreak: Differential hematological profiles and phylogenetic relationships among viruses.

    Science.gov (United States)

    Carmo, Andreia Moreira Dos Santos; Suzuki, Rodrigo Buzinaro; Cabral, Aline Diniz; Costa, Renata Torres da; Massari, Gabriela Pena; Riquena, Michele Marcondes; Fracasso, Helio Augusto Alves; Eterovic, Andre; Marcili, Arlei; Sperança, Márcia Aparecida

    2017-05-01

    Dengue virus, represented by four distinct, genetically diverse serotypes, is the etiologic agent of asymptomatic to severe hemorrhagic diseases. The spatiotemporal dynamics of dengue serotypes and its association to specific diseases vary among the different regions worldwide. By 2007, and in São Paulo State, Brazil, dengue-case concentration in urban centers had changed to increased incidence in small- and medium-sized towns, the case of Marília. The aim of this article was to distinguish dengue serotypes circulating during the 2007 Marília outbreak and define their association to demographic and hematological patient profiles, as well as the phylogenetic relationships among the different viruses. PCR amplicons corresponding to the junction of capsid and dengue pre-membrane encoding genes, obtained from dengue serologically positive patients, were sequenced. Hematological and demographic data of patients with different Dengue serotypes were evaluated by univariate and bivariate statistics. Dengue PCR sequences were used in phylogenetic relationships analyzed for maximum parsimony. Molecular typing confirmed co-circulation of the dengue serotypes 1 (DENV1) and 3 (DENV3), which presented divergent correlation patterns with regard to hematological descriptors. The increase in atypical lymphocytes, a likely indication of virus load, could be significantly associated to a decrease in leukocyte counts in the DENV3 group and platelet in the DENV1. Phylogenetic reconstitution revealed the introduction of DENV1 from northern Brazil and local divergence of DENV3 by either microevolution or viral introduction from other geographical regions or both. Dengue dynamics showed regional molecular-epidemiologic specificity, which has important implications for introduction of vaccines, disease management, and transmission control. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Molecular characterization of Hepatozoon sp. from Brazilian dogs and its phylogenetic relationship with other Hepatozoon spp.

    Science.gov (United States)

    Forlano, M D; Teixeira, K R S; Scofield, A; Elisei, C; Yotoko, K S C; Fernandes, K R; Linhares, G F C; Ewing, S A; Massard, C L

    2007-04-10

    To characterize phylogenetically the species which causes canine hepatozoonosis at two rural areas of Rio de Janeiro State, Brazil, we used universal or Hepatozoon spp. primer sets for the 18S SSU rRNA coding region. DNA extracts were obtained from blood samples of thirteen dogs naturally infected, from four experimentally infected, and from five puppies infected by vertical transmission from a dam, that was experimentally infected. DNA of sporozoites of Hepatozoon americanum was used as positive control. The amplification of DNA extracts from blood of dogs infected with sporozoites of Hepatozoon spp. was observed in the presence of primers to 18S SSU rRNA gene of Hepatozoon spp., whereas DNA of H. americanum sporozoites was amplified in the presence of either universal or Hepatozoon spp.-specific primer sets; the amplified products were approximately 600bp in size. Cloned PCR products obtained from DNA extracts of blood from two dogs experimentally infected with Hepatozoon sp. were sequenced. The consensus sequence, derived from six sequence data sets, were blasted against sequences of 18S SSU rRNA of Hepatozoon spp. available at GenBank and aligned to homologous sequences to perform the phylogenetic analysis. This analysis clearly showed that our sequence clustered, independently of H. americanum sequences, within a group comprising other Hepatozoon canis sequences. Our results confirmed the hypothesis that the agent causing hepatozoonosis in the areas studied in Brazil is H. canis, supporting previous reports that were based on morphological and morphometric analyses.

  19. Molecular Identification and Phylogenetic Relationships of Pleurotus spp. Diversity in Malaysia by ITS Marker

    International Nuclear Information System (INIS)

    Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)

  20. Genetic variation and phylogenetic relationship analysis of Jatropha curcas L. inferred from nrDNA ITS sequences.

    Science.gov (United States)

    Guo, Guo-Ye; Chen, Fang; Shi, Xiao-Dong; Tian, Yin-Shuai; Yu, Mao-Qun; Han, Xue-Qin; Yuan, Li-Chun; Zhang, Ying

    2016-01-01

    Genetic variation and phylogenetic relationships among 102 Jatropha curcas accessions from Asia, Africa, and the Americas were assessed using the internal transcribed spacer region of nuclear ribosomal DNA (nrDNA ITS). The average G+C content (65.04%) was considerably higher than the A+T (34.96%) content. The estimated genetic diversity revealed moderate genetic variation. The pairwise genetic divergences (GD) between haplotypes were evaluated and ranged from 0.000 to 0.017, suggesting a higher level of genetic differentiation in Mexican accessions than those of other regions. Phylogenetic relationships and intraspecific divergence were inferred by Bayesian inference (BI), maximum parsimony (MP), and median joining (MJ) network analysis and were generally resolved. The J. curcas accessions were consistently divided into three lineages, groups A, B, and C, which demonstrated distant geographical isolation and genetic divergence between American accessions and those from other regions. The MJ network analysis confirmed that Central America was the possible center of origin. The putative migration route suggested that J. curcas was distributed from Mexico or Brazil, via Cape Verde and then split into two routes. One route was dispersed to Spain, then migrated to China, eventually spreading to southeastern Asia, while the other route was dispersed to Africa, via Madagascar and migrated to China, later spreading to southeastern Asia. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  1. [Sequence of the ITS region of nuclear ribosomal DNA(nrDNA) in Xinjiang wild Dianthus and its phylogenetic relationship].

    Science.gov (United States)

    Zhang, Lu; Cai, You-Ming; Zhuge, Qiang; Zou, Hui-Yu; Huang, Min-Ren

    2002-06-01

    Xinjiang is a center of distribution and differentiation of genus Dianthus in China, and has a great deal of species resources. The sequences of ITS region (including ITS-1, 5.8S rDNA and ITS-2) of nuclear ribosomal DNA from 8 species of genus Dianthus wildly distributed in Xinjiang were determined by direct sequencing of PCR products. The result showed that the size of the ITS of Dianthus is from 617 to 621 bp, and the length variation is only 4 bp. There are very high homogeneous (97.6%-99.8%) sequences between species, and about 80% homogeneous sequences between genus Dianthus and outgroup. The sequences of ITS in genus Dianthus are relatively conservative. In general, there are more conversion than transition in the variation sites among genus Dianthus. The conversion rates are relatively high, and the ratios of conversion/transition are 1.0-3.0. On the basis of phylogenetic analysis of nucleotide sequences the species of Dianthus in China would be divided into three sections. There is a distant relationship between sect. Barbulatum Williams and sect. Dianthus and between sect. Barbulatum Williams and sect. Fimbriatum Williams, and there is a close relationship between sect. Dianthus and sect. Fimbriatum Williams. From the phylogenetic tree of ITS it was found that the origin of sect. Dianthusis is earlier than that of sect. Fimbriatum Williams and sect. Barbulatum Williams.

  2. Genome-wide analysis of SINA family in plants and their phylogenetic relationships.

    Science.gov (United States)

    Wang, Meng; Jin, Ying; Fu, Junjie; Zhu, Yun; Zheng, Jun; Hu, Jian; Wang, Guoying

    2008-06-01

    SINA genes in plants are part of a multigene family with 5 members in Arabidopsis thaliana, 10 members in Populus trichocarpa, 6 members in Oryza sativa, at least 6 members in Zea mays and at least 1 member in Physcomitrella patens. Six members in maize were confirmed by RT-PCR. All SINAs have one RING domain and one SINA domain. These two domains are highly conserved in plants. According to the motif organization and phylogenetic tree, SINA family members were divided into 2 groups. In addition, through semi-quantitative RT-PCR analysis of maize members and Digital Northern analysis of Arabidopsis and rice members, we found that the tissue expression patterns are more diverse in monocot than in Arabidopsis.

  3. Phylogenetic relationships and host range of Rhizobium spp. that nodulate Phaseolus vulgaris L.

    Science.gov (United States)

    Hernandez-Lucas, I; Segovia, L; Martinez-Romero, E; Pueppke, S G

    1995-07-01

    We determined the nucleotide sequences of 16S rRNA gene segments from five Rhizobium strains that have been isolated from tropical legume species. All share the capacity to nodulate Phaseolus vulgaris L., the common bean. Phylogenetic analysis confirmed that these strains are of two different chromosomal lineages. We defined the host ranges of two strains of Rhizobium etli and three strains of R. tropici, comparing them with those of the two most divergently related new strains. Twenty-two of the 43 tested legume species were nodulated by three or more of these strains. All seven strains have broad host ranges that include woody species such as Albizia lebbeck, Gliricidia maculata, and Leucaena leucocephala.

  4. Phylogenetic relationships of German heavy draught horse breeds inferred from mitochondrial DNA D-loop variation.

    Science.gov (United States)

    Aberle, K S; Hamann, H; Drögemüller, C; Distl, O

    2007-04-01

    We analysed a 610-bp mitochondrial (mt)DNA D-loop fragment in a sample of German draught horse breeds and compared the polymorphic sites with sequences from Arabian, Hanoverian, Exmoor, Icelandic, Sorraia and Przewalski's Horses as well as with Suffolk, Shire and Belgian horses. In a total of 65 horses, 70 polymorphic sites representing 47 haplotypes were observed. The average percentage of polymorphic sites was 11.5% for the mtDNA fragment analysed. In the nine different draught horse breeds including South German, Mecklenburg, Saxon Thuringa coldblood, Rhenisch German, Schleswig Draught Horse, Black Forest Horse, Shire, Suffolk and Belgian, 61 polymorphic sites and 24 haplotypes were found. The phylogenetic analysis failed to show monophyletic groups for the draught horses. The analysis indicated that the draught horse populations investigated consist of diverse genetic groups with respect to their maternal lineage.

  5. Phylogenetic relationships among amphisbaenian reptiles based on complete mitochondrial genomic sequences.

    Science.gov (United States)

    Macey, J Robert; Papenfuss, Theodore J; Kuehl, Jennifer V; Fourcade, H Mathew; Boore, Jeffrey L

    2004-10-01

    Complete mitochondrial genomic sequences are reported from 12 members in the four families of the reptile group Amphisbaenia. Analysis of 11,946 aligned nucleotide positions (5797 informative) produces a robust phylogenetic hypothesis. The family Rhineuridae is basal and Bipedidae is the sister taxon to the Amphisbaenidae plus Trogonophidae. Amphisbaenian reptiles are surprisingly old, predating the breakup of Pangaea 200 million years before present, because successive basal taxa (Rhineuridae and Bipedidae) are situated in tectonic regions of Laurasia and nested taxa (Amphisbaenidae and Trogonophidae) are found in Gondwanan regions. Thorough sampling within the Bipedidae shows that it is not tectonic movement of Baja California away from the Mexican mainland that is primary in isolating Bipes species, but rather that primary vicariance occurred between northern and southern groups. Amphisbaenian families show parallel reduction in number of limbs and Bipes species exhibit parallel reduction in number of digits. A measure is developed for comparing the phylogenetic information content of various genes. A synapomorphic trait defining the Bipedidae is a shift from the typical vertebrate mitochondrial gene arrangement to the derived state of trnE and nad6. In addition, a tandem duplication of trnT and trnP is observed in Bipes biporus with a pattern of pseudogene formation that varies among populations. The first case of convergent rearrangement of the mitochondrial genome among animals demonstrated by complete genomic sequences is reported. Relative to most vertebrates, the Rhineuridae has the block nad6, trnE switched in order with the block cob, trnT, trnP, as they are in birds.

  6. Phylogenetic relationships among amphisbaenian reptiles based on complete mitochondrial genomic sequences

    Energy Technology Data Exchange (ETDEWEB)

    Macey, J. Robert; Papenfuss, Theodore J.; Kuehl, Jennifer V.; Fourcade, H. Matthew; Boore, Jeffrey L.

    2004-05-19

    Complete mitochondrial genomic sequences are reported from 12 members in the four families of the reptile group Amphisbaenia. Analysis of 11,946 aligned nucleotide positions (5,797 informative) produces a robust phylogenetic hypothesis. The family Rhineuridae is basal and Bipedidae is the sister taxon to the Amphisbaenidae plus Trogonophidae. Amphisbaenian reptiles are surprisingly old, predating the breakup of Pangaea 200 million years before present, because successive basal taxa (Rhineuridae and Bipedidae) are situated in tectonic regions of Laurasia and nested taxa (Amphisbaenidae and Trogonophidae) are found in Gondwanan regions. Thorough sampling within the Bipedidae shows that it is not tectonic movement of Baja California away from the Mexican mainland that is primary in isolating Bipes species, but rather that primary vicariance occurred between northern and southern groups. Amphisbaenian families show parallel reduction in number of limbs and Bipes species exhibit parallel reduction in number of digits. A measure is developed for comparing the phylogenetic information content of various genes. A synapomorphic trait defining the Bipedidae is a shift from the typical vertebrate mitochondrial gene arrangement to the derived state of trnE and nad6. In addition, a tandem duplication of trnT and trnP is observed in B. biporus with a pattern of pseudogene formation that varies among populations. The first case of convergent rearrangement of the mitochondrial genome among animals demonstrated by complete genomic sequences is reported. Relative to most vertebrates, the Rhineuridae has the block nad6, trnE switched in order with cob, trnT, trnP, as they are in birds.

  7. [Relationship between occupational stress and mental health in offshore oil platform workers].

    Science.gov (United States)

    Wu, Hongtao; Xiao, Taiqin; Zou, Jianfang; Shan, Yongle; Li, Zijian

    2014-02-01

    To investigate the relationship between occupational stress and mental health in offshore oil platform workers and to provide a scientific basis for protection of their mental health. A total of 768 workers on offshore oil platform were surveyed with the Occupational Stress Inventory Revised Edition and Symptom Check List-90 (SCL-90). The total score of Occupational Role Questionnaire (ORQ) for the workers (160.27±24.63) was significantly lower than the national norm (166.52±27.01) (P 0.05), but the items of recreation, social support, and rational/cognitive found significant difference (P work seniority, education background, drinking, role overload, role insufficiency, role ambiguity, responsibility, physical environment, and rational/cognitive conduct impacted the score of SCL-90 (P mental health of workers on offshore oil platform is related to occupational stress, and role overload, role ambiguity, physical environment, and rational/cognitive conduct, etc, are closely associated with the workers' mental health.

  8. New insights on the phylogenetic relationships among the traditional Philodendron subgenera and the other groups of the Homalomena clade (Araceae).

    Science.gov (United States)

    Vasconcelos, Santelmo; Soares, Maria de Lourdes; Sakuragui, Cássia M; Croat, Thomas B; Oliveira, Guilherme; Benko-Iseppon, Ana M

    2018-05-19

    Philodendron (Araceae) is one of the largest Neotropical plant genera, with approximately 500 species and at least 1000 species predicted. There is a considerable ecological diversity in the group, although most species occur in the humid forests of tropical America. Despite being relatively well-studied in taxonomic analyses, the relationships among the traditional morphological groups of the genus are not well-established, mainly regarding the three traditional subgenera, referred here as Philodendron sensu lato (s.l.), P. subg. Pteromischum, P. subg. Philodendron and P. subg. Meconostigma, which was recently recognized as a separate genus, Thaumatophyllum. Therefore, the present work evaluates the phylogenetic position and the monophyly of Philodendron s.l. and its three main subdivisions, and the sister groups within the Homalomena clade, which also includes the Neotropical genus Adelonema, the two Asian genera Homalomena and Furtadoa, and the two African genera Cercestis and Culcasia, by means of molecular phylogenetic approaches including chloroplast DNA (atpF-atpH, rpl32-trnL, trnQ-5'-rps16 and trnV-ndhC) and nuclear (ITS2) markers. The monophyly of Philodendron s.l. and its three lineages is confirmed and our analyses corroborate previous morphologic data indicating Thaumatophyllum as sister to the clade formed by P. subg. Pteromischum and P. subg. Philodendron. Copyright © 2018 Elsevier Inc. All rights reserved.

  9. Phylogenetic relationships among zooxanthellae (Symbiodinium) associated to excavating sponges (Cliona spp.) reveal an unexpected lineage in the Caribbean.

    Science.gov (United States)

    Granados, C; Camargo, C; Zea, S; Sánchez, J A

    2008-11-01

    Phylogenetic relationships of symbiotic dinoflagellate lineages, distributed in all tropical and subtropical seas, suggest strategies for long distance dispersal but at the same time strong host specialization. Zooxanthellae (Symbiodinium: Dinophyta), which are associated to diverse shallow-water cnidarians, also engage in symbioses with some sponge species of the genus Cliona. In the Caribbean, zooxanthellae-bearing Cliona has recently become abundant due to global warming, overfishing, and algae abundance. Using molecular techniques, the symbionts from five excavating species (Clionacaribbaea, C. tenuis, C. varians, C. aprica and C. laticavicola) from the southern and southwestern Caribbean were surveyed. Several DNA sequence regions were used in order to confirm zooxanthellae identity; 18S rDNA, domain V of chloroplast large subunit (cp23S), internal transcribed spacer 2 (ITS2), and ITS2 secondary structure. Sequence analyses corroborated the presence of three zooxanthellae clades: A, B, and G. Presence of clades A and B in common boring sponges of the Caribbean fit with the general pattern of the province. The discovery of clade G for the first time in any organism of the Atlantic Ocean leads us to consider this unusual finding as a phylogenetic relict through common ancestors of sponge clades or an invasion of the sponge from the Indo-Pacific.

  10. The amino acid sequences of two alpha chains of hemoglobins from Komodo dragon Varanus komodoensis and phylogenetic relationships of amniotes.

    Science.gov (United States)

    Fushitani, K; Higashiyama, K; Moriyama, E N; Imai, K; Hosokawa, K

    1996-09-01

    To elucidate phylogenetic relationships among amniotes and the evolution of alpha globins, hemoglobins were analyzed from the Komodo dragon (Komodo monitor lizard) Varanus komodoensis, the world's largest extant lizard, inhabiting Komodo Islands, Indonesia. Four unique globin chains (alpha A, alpha D, beta B, and beta C) were isolated in an equal molar ratio by high performance liquid chromatography from the hemolysate. The amino acid sequences of two alpha chains were determined. The alpha D chain has a glutamine at E7 as does an alpha chain of a snake, Liophis miliaris, but the alpha A chain has a histidine at E7 like the majority of hemoglobins. Phylogenetic analyses of 19 globins including two alpha chains of Komodo dragon and ones from representative amniotes showed the following results: (1) The a chains of squamates (snakes and lizards), which have a glutamine at E7, are clustered with the embryonic alpha globin family, which typically includes the alpha D chain from birds; (2) birds form a sister group with other reptiles but not with mammals; (3) the genes for embryonic and adult types of alpha globins were possibly produced by duplication of the ancestral alpha gene before ancestral amniotes diverged, indicating that each of the present amniotes might carry descendants of the two types of alpha globin genes; (4) squamates first split off from the ancestor of other reptiles and birds.

  11. Phylogenetic relationship and Fourier-transform infrared spectroscopy-derived lipid determinants of lifespan parameters in the Saccharomyces cerevisiae yeast.

    Science.gov (United States)

    Molon, Mateusz; Zebrowski, Jacek

    2017-06-01

    Yeast ageing has been gaining much attention in gerontology research, yet the process itself is still not entirely clear. One of the constraints related to the use of the Saccharomyces cerevisiae yeast in studies is the ambiguity of the results concerning ageing determinants for different genetic backgrounds. In this paper, we compare reproductive potentials and lifespans of seven widely used haploid laboratory strains differing in daughter cells production capabilities and highlight the importance of choosing an appropriate genotype for the studies on ageing. Moreover, we show here links between post-reproductive lifespan and lipid metabolism, as well as between reproductive potential, reproductive lifespan and phylogenetic relationship. Using FTIR spectroscopy that generated a biochemical fingerprint of cells, coupled with chemometrics, we found that the band of carbonyl (C = O) stretching vibration discriminates the strains according to post-reproductive lifespan. The results indicated that prolonged post-reproductive lifespan was associated with relatively lower amount of fatty acids esterified to phospholipids compared to a free acid pool, thus implying phospholipid metabolism for the post-reproductive lifespan of yeast. In addition, phylogenetic analysis showed a correlation between nucleotide similarity and the reproductive potential or reproductive lifespan, but not to the longevity expressed in time units. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  12. Phylogenetic incongruence in E. coli O104: understanding the evolutionary relationships of emerging pathogens in the face of homologous recombination.

    Directory of Open Access Journals (Sweden)

    Weilong Hao

    Full Text Available Escherichia coli O104:H4 was identified as an emerging pathogen during the spring and summer of 2011 and was responsible for a widespread outbreak that resulted in the deaths of 50 people and sickened over 4075. Traditional phenotypic and genotypic assays, such as serotyping, pulsed field gel electrophoresis (PFGE, and multilocus sequence typing (MLST, permit identification and classification of bacterial pathogens, but cannot accurately resolve relationships among genotypically similar but pathotypically different isolates. To understand the evolutionary origins of E. coli O104:H4, we sequenced two strains isolated in Ontario, Canada. One was epidemiologically linked to the 2011 outbreak, and the second, unrelated isolate, was obtained in 2010. MLST analysis indicated that both isolates are of the same sequence type (ST678, but whole-genome sequencing revealed differences in chromosomal and plasmid content. Through comprehensive phylogenetic analysis of five O104:H4 ST678 genomes, we identified 167 genes in three gene clusters that have undergone homologous recombination with distantly related E. coli strains. These recombination events have resulted in unexpectedly high sequence diversity within the same sequence type. Failure to recognize or adjust for homologous recombination can result in phylogenetic incongruence. Understanding the extent of homologous recombination among different strains of the same sequence type may explain the pathotypic differences between the ON2010 and ON2011 strains and help shed new light on the emergence of this new pathogen.

  13. Enabling online studies of conceptual relationships between medical terms: developing an efficient web platform.

    Science.gov (United States)

    Albin, Aaron; Ji, Xiaonan; Borlawsky, Tara B; Ye, Zhan; Lin, Simon; Payne, Philip Ro; Huang, Kun; Xiang, Yang

    2014-10-07

    The Unified Medical Language System (UMLS) contains many important ontologies in which terms are connected by semantic relations. For many studies on the relationships between biomedical concepts, the use of transitively associated information from ontologies and the UMLS has been shown to be effective. Although there are a few tools and methods available for extracting transitive relationships from the UMLS, they usually have major restrictions on the length of transitive relations or on the number of data sources. Our goal was to design an efficient online platform that enables efficient studies on the conceptual relationships between any medical terms. To overcome the restrictions of available methods and to facilitate studies on the conceptual relationships between medical terms, we developed a Web platform, onGrid, that supports efficient transitive queries and conceptual relationship studies using the UMLS. This framework uses the latest technique in converting natural language queries into UMLS concepts, performs efficient transitive queries, and visualizes the result paths. It also dynamically builds a relationship matrix for two sets of input biomedical terms. We are thus able to perform effective studies on conceptual relationships between medical terms based on their relationship matrix. The advantage of onGrid is that it can be applied to study any two sets of biomedical concept relations and the relations within one set of biomedical concepts. We use onGrid to study the disease-disease relationships in the Online Mendelian Inheritance in Man (OMIM). By crossvalidating our results with an external database, the Comparative Toxicogenomics Database (CTD), we demonstrated that onGrid is effective for the study of conceptual relationships between medical terms. onGrid is an efficient tool for querying the UMLS for transitive relations, studying the relationship between medical terms, and generating hypotheses.

  14. Phylogenetic relationships of seven previously unclassified viruses within the family Rhabdoviridae using partial nucleoprotein gene sequences.

    Science.gov (United States)

    Kuzmin, I V; Hughes, G J; Rupprecht, C E

    2006-08-01

    Partial nucleoprotein (N) gene sequences of the rhabdoviruses Obodhiang (OBOV), Kotonkon (KOTV), Rochambeau (RBUV), Kern canyon (KCV), Mount Elgon bat (MEBV), Kolongo (KOLV) and Sandjimba (SJAV) were generated and their phylogenetic positions within the family Rhabdoviridae were determined. Both OBOV and KOTV were placed within the genus Ephemerovirus. RBUV was joined to the same cluster, but more distantly. MEBV and KCV were grouped into a monophyletic cluster (putative genus) with Oita virus (OITAV). These three viruses, originating from different regions of the world, were all isolated from insectivorous bats and may be specific for these mammals. African avian viruses KOLV and SJAV were joined to each other and formed another clade at the genus level. Further, they were grouped with the recently characterized rhabdovirus Tupaia virus (TRV). Although the genetic distance was great, the grouping was supported by consistent bootstrap values. This observation suggests that viruses of this group may be distributed widely in the Old World. Non-synonymous/synonymous substitution ratio estimations (dN/dS) using a partial N gene fragment (241 codons) for the three rhabdovirus genera revealed contrasting patterns of evolution, where dN/dS values follow the pattern Ephemerovirus > Vesiculovirus > Lyssavirus. The magnitude of this ratio corresponds well with the number of negatively selected codons. The accumulation of dS appears evenly distributed along the gene fragment for all three genera. These estimations demonstrated clearly that lyssaviruses are subjected to the strongest constraints against amino acid substitutions, probably related to their particular niche and unique pathobiology.

  15. Genetic characterization, molecular epidemiology, and phylogenetic relationships of insect-specific viruses in the taxon Negevirus.

    Science.gov (United States)

    Nunes, Marcio R T; Contreras-Gutierrez, María Angélica; Guzman, Hilda; Martins, Livia C; Barbirato, Mayla Feitoza; Savit, Chelsea; Balta, Victoria; Uribe, Sandra; Vivero, Rafael; Suaza, Juan David; Oliveira, Hamilton; Nunes Neto, Joaquin P; Carvalho, Valeria L; da Silva, Sandro Patroca; Cardoso, Jedson F; de Oliveira, Rodrigo Santo; da Silva Lemos, Poliana; Wood, Thomas G; Widen, Steven G; Vasconcelos, Pedro F C; Fish, Durland; Vasilakis, Nikos; Tesh, Robert B

    2017-04-01

    The recently described taxon Negevirus is comprised of a diverse group of insect-specific viruses isolated from mosquitoes and phlebotomine sandflies. In this study, a comprehensive genetic characterization, molecular, epidemiological and evolutionary analyses were conducted on nearly full-length sequences of 91 new negevirus isolates obtained in Brazil, Colombia, Peru, Panama, USA and Nepal. We demonstrated that these arthropod restricted viruses are clustered in two major phylogenetic groups with origins related to three plant virus genera (Cilevirus, Higrevirus and Blunevirus). Molecular analyses demonstrated that specific host correlations are not present with most negeviruses; instead, high genetic variability, wide host-range, and cross-species transmission were noted. The data presented here also revealed the existence of five novel insect-specific viruses falling into two arthropod-restrictive virus taxa, previously proposed as distinct genera, designated Nelorpivirus and Sandewavirus. Our results provide a better understanding of the molecular epidemiology, evolution, taxonomy and stability of this group of insect-restricted viruses. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Tracking the Origin and Deciphering the Phylogenetic Relationship of Porcine Epidemic Diarrhea Virus in Ecuador

    Directory of Open Access Journals (Sweden)

    Maritza Barrera

    2017-01-01

    Full Text Available In 2010, new Chinese strains of porcine epidemic diarrhea virus (PEDV, clinically more severe than the classical strains, emerged. These strains were spread to United States in 2013 through an intercontinental transmission from China with further spreading across the world, evidencing the emergent nature of these strains. In the present study, an analysis of PEDV field sequences from Ecuador was conducted by comparing all the PEDV S gene sequences available in the GenBank database. Phylogenetic comparisons and Bayesian phylogeographic inference based on complete S gene sequences were also conducted to track the origin and putative route of PEDV. The sequence from the PED-outbreak in Ecuador was grouped into the clade II of PEDV genogroup 2a together with other sequences of isolates from Mexico, Canada, and United States. The phylogeographic study revealed the emergence of the Chinese PEDV strains, followed by spreading to US in 2013, from US to Korea, and later the introduction of PEDV to Canada, Mexico, and Ecuador directly from the US. The sources of imports of live swine in Ecuador in 2014 were mainly from Chile and US. Thus, this movement of pigs is suggested as the main way for introducing PEDV to Ecuador.

  17. Phylogenetic Relationship of Phosphate Solubilizing Bacteria according to 16S rRNA Genes

    Directory of Open Access Journals (Sweden)

    Mohammad Bagher Javadi Nobandegani

    2015-01-01

    Full Text Available Phosphate solubilizing bacteria (PSB can convert insoluble form of phosphorous to an available form. Applications of PSB as inoculants increase the phosphorus uptake by plant in the field. In this study, isolation and precise identification of PSB were carried out in Malaysian (Serdang oil palm field (University Putra Malaysia. Identification and phylogenetic analysis of 8 better isolates were carried out by 16S rRNA gene sequencing in which as a result five isolates belong to the Beta subdivision of Proteobacteria, one isolate was related to the Gama subdivision of Proteobacteria, and two isolates were related to the Firmicutes. Bacterial isolates of 6upmr, 2upmr, 19upmnr, 10upmr, and 24upmr were identified as Alcaligenes faecalis. Also, bacterial isolates of 20upmnr and 17upmnr were identified as Bacillus cereus and Vagococcus carniphilus, respectively, and bacterial isolates of 31upmr were identified as Serratia plymuthica. Molecular identification and characterization of oil palm strains as the specific phosphate solubilizer can reduce the time and cost of producing effective inoculate (biofertilizer in an oil palm field.

  18. Phylogenetic relationships of three new microsporidian isolates from the silkworm, Bombyx mori.

    Science.gov (United States)

    Nageswara Rao, S; Muthulakshmi, M; Kanginakudru, S; Nagaraju, J

    2004-07-01

    The pathogenicity, mode of transmission, tissue specificity of infection and the small subunit rRNA (SSU-rRNA) gene sequences of the three new microsporidian isolates from the silkworm Bombyx mori were studied. Out of the three, NIK-2r revealed life cycle features and SSU-rRNA gene sequence similar to Nosema bombycis, suggesting that it is N. bombycis. The other two, NIK-4m and NIK-3h, differed from each other as well as from N. bombycis. NIK-4m was highly pathogenic and did not show any vertical transmission, in accordance with the apparent lack of gonadal infection, whereas NIK-3h was less pathogenic and vertical transmission was not detected but could not be excluded. Phylogenetic analysis based on SSU-rRNA gene sequence placed NIK-3h and NIK-4m in a distinct clade that included almost all the Vairimorpha species and Nosema species that infect lepidopteran and non-lepidopteran hosts, while NIK-2r was included in a clade containing almost all the Nosema isolates that infect only lepidopteran hosts. Thus, we have presented molecular evidence that one of the three isolates is in fact the type species N. bombycis, while the other two isolates are Vairimorpha spp. There was distinct separation of microsporidian isolates infecting only lepidopteran hosts and those infecting lepidopteran and non-lepidopteran hosts, reflecting possible co-evolution of hosts and microsporidian isolates.

  19. Coptobrycon bilineatus (Ellis, 1911 (Characiformes: Characidae: redescription and comments on its phylogenetic relationships

    Directory of Open Access Journals (Sweden)

    Francisco Langeani

    Full Text Available Coptobrycon bilineatus (Ellis, 1911 is redescribed on the basis of specimens from the District of Paranapiacaba, Municipality of Santo André, upper rio Tietê, and additional ones recently collected in a small coastal river system of Serra do Mar, very near the headwaters of the rio Tietê. The genus was compared to other Characidae lacking a supraorbital, and it seems to be more phylogenetically related to Grundulus based on the possession of various putative apomorphic character states related to: the absence of a rhinosphenoid and fourth, fifth (sometimes and sixth infraorbitals; nasal pores separated; nares with up to six nasal lamellae; cephalic laterosensory system poorly developed on supraorbital and infraorbital series; and a globose scapula. Furthermore, Coptobrycon and Grundulus are characterized by the absence of the adipose fin, of the supraorbital laterosensory series on the parietal, and of the humeral spot, and by the reduction of lateral musculature in front of the first pleural rib and between the first and second pleural ribs. Biogeographic comments are also provided.

  20. Complete mitochondrial genome of Porzana fusca and Porzana pusilla and phylogenetic relationship of 16 Rallidae species.

    Science.gov (United States)

    Chen, Peng; Han, Yuqing; Zhu, Chaoying; Gao, Bin; Ruan, Luzhang

    2017-12-01

    The complete mitochondrial genome sequences of Porzana fusca and Porzana pusilla were determined. The two avian species share a high degree of homology in terms of mitochondrial genome organization and gene arrangement. Their corresponding mitochondrial genomes are 16,935 and 16,978 bp and consist of 37 genes and a control region. Their PCGs were both 11,365 bp long and have similar structure. Their tRNA gene sequences could be folded into canonical cloverleaf secondary structure, except for tRNA Ser (AGY) , which lost its "DHU" arm. Based on the concatenated nucleotide sequences of the complete mitochondrial DNA genes of 16 Rallidae species, reconstruction of phylogenetic trees and analysis of the molecular clock of P. fusca and P. pusilla indicated that these species from a sister group, which in turn are sister group to Rallina eurizonoides. The genus Gallirallus is a sister group to genus Lewinia, and these groups in turn are sister groups to genus Porphyrio. Moreover, molecular clock analyses suggested that the basal divergence of Rallidae could be traced back to 40.47 (41.46‒39.45) million years ago (Mya), and the divergence of Porzana occurred approximately 5.80 (15.16‒0.79) Mya.

  1. Phylogenetic Characterization of Encephalitozoon Romaleae (Microsporidia) from a Grasshopper Host: Relationship to Encephalitozoon spp. Infecting Humans

    Science.gov (United States)

    Encephalitozoon species are the most common microsporidian pathogens of humans and domesticated animals. We recently discovered a new microsporidium, Encephalitozoon romaleae, infecting the eastern lubber grasshopper Romalea microptera. To understand its evolutionary relationships, we compared par...

  2. Veronica: Chemical characters for the support of phylogenetic relationships based on nuclear ribosomal and plastid DNA sequence data

    DEFF Research Database (Denmark)

    Albach, Dirk C.; Jensen, Søren Rosendal; Özgökce, Fevzi

    2005-01-01

    Molecular phylogenetic analyses have revealed many relationships in Veronica (Plantaginaceae) never anticipated before. However, phytochemical characters show good congruence with DNA-based analyses. We have analysed a combined data set of 49 species and subspecies derived from the nuclear...... are monophyletic sister groups with the annual species consecutive sisters to them. All species of Veronica that contain cornoside are found in this subgenus, although some species seem to have secondarily lost the ability to produce this compound. Subgenera Pocilla and Pentasepalae are well supported sister...... species in the genus analysed to date to contain melittoside and globularifolin. Subgenus Pentasepalae appears to be a clade of diverse lineages from southwestern Asia and a single European clade. Species shown to have 6-hydroxyflavones do not form a monophyletic group. Subgenus Pseudolysimachium seems...

  3. Phylogenetic relationships of hexaploid large-sized barbs (genus Labeobarbus, Cyprinidae) based on mtDNA data.

    Science.gov (United States)

    Tsigenopoulos, Costas S; Kasapidis, Panagiotis; Berrebi, Patrick

    2010-08-01

    The phylogenetic relationships among species of the Labeobarbus genus (Teleostei, Cyprinidae) which comprises large body-sized hexaploid taxa were inferred using complete cytochrome b mitochondrial gene sequences. Molecular data suggest two main evolutionary groups which roughly correspond to a Northern (Middle East and Northwest Africa) and a sub-Saharan lineage. The splitting of the African hexaploids from their Asian ancestors and their subsequent diversification on the African continent occurred in the Late Miocene, a period in which other cyprinins also invaded Africa and radiated in the Mediterranean region. Finally, systematic implications of these results to the taxonomic validity of genera or subgenera such as Varicorhinus, Kosswigobarbus, Carasobarbus and Capoeta are further discussed. Copyright 2010 Elsevier Inc. All rights reserved.

  4. Phylogenetic relationships and generic delimitation in Inuleae subtribe Inulinae (Asteraceae) based on ITS and cpDNA sequence data

    DEFF Research Database (Denmark)

    Englund, Marcus; Pornpongrungrueng, Pimwadee; Gustafsson, Mats

    2009-01-01

    Phylogenetic relationships in Inuleae subtribe Inulinae (Asteraceae) were investigated. DNA sequence data from three chloroplast regions (ndhF, trnL-F and psbA-trnH) and the nuclear ribosomal internal transcribed spacer (ITS) region were analysed separately and in combination using parsimony...... and Bayesian inference. A total of 163 ingroup taxa were included, of which 60 were sampled for all four markers. Conflicts between chloroplast and nuclear data were assessed using partitioned Bremer support (PBS). Rather than averaging PBS over several trees from constrained searches, individual trees were...... considered by evaluating PBS ranges. Criteria to be used in the detection of a significant conflict between data partitions are proposed. Three nodes in the total data tree were found to encompass significant conflict that could result from ancient hybridization. Neither of the large, heterogeneous...

  5. Chloroplast genes as genetic markers for inferring patterns of change, maternal ancestry and phylogenetic relationships among Eleusine species.

    Science.gov (United States)

    Agrawal, Renuka; Agrawal, Nitin; Tandon, Rajesh; Raina, Soom Nath

    2014-01-01

    Assessment of phylogenetic relationships is an important component of any successful crop improvement programme, as wild relatives of the crop species often carry agronomically beneficial traits. Since its domestication in East Africa, Eleusine coracana (2n = 4x = 36), a species belonging to the genus Eleusine (x = 8, 9, 10), has held a prominent place in the semi-arid regions of India, Nepal and Africa. The patterns of variation between the cultivated and wild species reported so far and the interpretations based upon them have been considered primarily in terms of nuclear events. We analysed, for the first time, the phylogenetic relationship between finger millet (E. coracana) and its wild relatives by species-specific chloroplast deoxyribonucleic acid (cpDNA) polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and chloroplast simple sequence repeat (cpSSR) markers/sequences. Restriction fragment length polymorphism of the seven amplified chloroplast genes/intergenic spacers (trnK, psbD, psaA, trnH-trnK, trnL-trnF, 16S and trnS-psbC), nucleotide sequencing of the chloroplast trnK gene and chloroplast microsatellite polymorphism were analysed in all nine known species of Eleusine. The RFLP of all seven amplified chloroplast genes/intergenic spacers and trnK gene sequences in the diploid (2n = 16, 18, 20) and allotetraploid (2n = 36, 38) species resulted in well-resolved phylogenetic trees with high bootstrap values. Eleusine coracana, E. africana, E. tristachya, E. indica and E. kigeziensis did not show even a single change in restriction site. Eleusine intermedia and E. floccifolia were also shown to have identical cpDNA fragment patterns. The cpDNA diversity in Eleusine multiflora was found to be more extensive than that of the other eight species. The trnK gene sequence data complemented the results obtained by PCR-RFLP. The maternal lineage of all three allotetraploid species (AABB, AADD) was the same, with E. indica being the

  6. The evolution of giant flightless birds and novel phylogenetic relationships for extinct fowl (Aves, Galloanseres)

    Science.gov (United States)

    Worthy, Trevor H.; Degrange, Federico J.; Handley, Warren D.; Lee, Michael S. Y.

    2017-10-01

    The extinct dromornithids, gastornithids and phorusrhacids are among the most spectacular birds to have ever lived, with some giants exceeding 500 kg. The affinities and evolution of these and other related extinct birds remain contentious, with previous phylogenetic analyses being affected by widespread convergence and limited taxon sampling. We address these problems using both parsimony and tip-dated Bayesian approaches on an expansive taxon set that includes all key extinct flightless and flighted (e.g. Vegavis and lithornithids) forms, an extensive array of extant fowl (Galloanseres), representative Neoaves and palaeognaths. The Paleogene volant Lithornithidae are recovered as stem palaeognaths in the Bayesian analyses. The Galloanseres comprise four clades inferred to have diverged in the Late Cretaceous on Gondwana. In addition to Anseriformes and Galliformes, we recognize a robust new clade (Gastornithiformes) for the giant flightless Dromornithidae (Australia) and Gastornithidae (Eurasia, North America). This clade exhibits parallels to ratite palaeognaths in that flight presumably was lost and giant size attained multiple times. A fourth clade is represented by the Cretaceous Vegavis (Antarctica), which was strongly excluded from Anseriformes; thus, a crucial molecular calibration point needs to be reconsidered. The presbyornithids Wilaru (Australia) and Presbyornis (Northern Hemisphere) are robustly found to be the sister group to Anatoidea (Anseranatidae + Anatidae), a relatively more basal position than hitherto recognized. South America's largest bird, Brontornis, is not a galloansere, but a member of Neoaves related to Cariamiformes; therefore, giant Galloanseres remain unknown from this continent. Trait analyses showed that while gigantism and flightlessness evolved repeatedly in groups, diet is constrained by phylogeny: all giant Galloanseres and palaeognaths are herbivores or mainly herbivorous, and giant neoavians are zoophagous or omnivorous.

  7. A comparative ZOO-FISH analysis in bats elucidates the phylogenetic relationships between Megachiroptera and five microchiropteran families.

    Science.gov (United States)

    Volleth, M; Heller, K G; Pfeiffer, R A; Hameister, H

    2002-01-01

    Fluorescence in-situ hybridization with human whole chromosome painting probes (WCPs) was applied to compare the karyotypes of members of five bat families. Twenty-five evolutionarily conserved units (ECUs) were identified by ZOO-FISH analysis. In 10 of these 25 ECUs, thorough GTG-band comparison revealed an identical banding pattern in all families studied. Differences in the remaining ECUs were used as characters to judge the phylogenetic relationships within Chiroptera. Close relationships were found between Rhinolophidae and Hipposideridae. Also closely related are the representatives of the yangochiropteran families Phyllostomidae (genus studied: Glossophaga, Volleth et al. 1999), Molossidae and Vespertilionidae. All microchiropteran species studied here share four common features not found in the megachiropteran species Eonycteris spelaea. Two of these are considered as derived characters with a high probability of parallel evolution. On the other hand, Eonycteris shares one common, probably derived feature with the rhinolophoid families Rhinolophidae and Hipposideridae and an additional one only with Hipposideridae. At the moment, the relationships between Yangochiroptera, Rhinolophoidea and Megachiroptera must be left in an unsolved trichotomy. Comparison of neighboring segment combinations found in Chiroptera with those found in other mammalian taxa revealed six synapomorphic features for Chiroptera. Therefore, for karyological reasons, monophyly of Chiroptera is strongly supported.

  8. Karyotypic evolution and phylogenetic relationships in the order Chiroptera as revealed by G-banding comparison and chromosome painting.

    Science.gov (United States)

    Ao, Lei; Mao, Xiuguang; Nie, Wenhui; Gu, Xiaoming; Feng, Qing; Wang, Jinhuan; Su, Weiting; Wang, Yingxiang; Volleth, Marianne; Yang, Fengtang

    2007-01-01

    Bats are a unique but enigmatic group of mammals and have a world-wide distribution. The phylogenetic relationships of extant bats are far from being resolved. Here, we investigated the karyotypic relationships of representative species from four families of the order Chiroptera by comparative chromosome painting and banding. A complete set of painting probes derived from flow-sorted chromosomes of Myotis myotis (family Vespertilionidae) were hybridized onto metaphases of Cynopterus sphinx (2n = 34, family Pteropodidae), Rhinolophus sinicus (2n=36, family Rhinolophidae) and Aselliscus stoliczkanus (2n=30, family Hipposideridae) and delimited 27, 30 and 25 conserved chromosomal segments in the three genomes, respectively. The results substantiate that Robertsonian translocation is the main mode of chromosome evolution in the order Chiroptera, with extensive conservation of whole chromosomal arms. The use of M. myotis (2n=44) probes has enabled the integration of C. sphinx, R. sinicus and A. stoliczkanus chromosomes into the previously established comparative maps between human and Eonycteris spelaea (2n=36), Rhinolophus mehelyi (2n=58), Hipposideros larvatus (2n=32), and M. myotis. Our results provide the first cytogenetic signature rearrangement that supports the grouping of Pteropodidae and Rhinolophoidea in a common clade (i.e. Pteropodiformes or Yinpterochiroptera) and thus improve our understanding on the karyotypic relationships and genome phylogeny of these bat species.

  9. Phylogenetic relationships within the cyst-forming nematodes (Nematoda, Heteroderidae) based on analysis of sequences from the ITS regions of ribosomal DNA.

    Science.gov (United States)

    Subbotin, S A; Vierstraete, A; De Ley, P; Rowe, J; Waeyenberge, L; Moens, M; Vanfleteren, J R

    2001-10-01

    The ITS1, ITS2, and 5.8S gene sequences of nuclear ribosomal DNA from 40 taxa of the family Heteroderidae (including the genera Afenestrata, Cactodera, Heterodera, Globodera, Punctodera, Meloidodera, Cryphodera, and Thecavermiculatus) were sequenced and analyzed. The ITS regions displayed high levels of sequence divergence within Heteroderinae and compared to outgroup taxa. Unlike recent findings in root knot nematodes, ITS sequence polymorphism does not appear to complicate phylogenetic analysis of cyst nematodes. Phylogenetic analyses with maximum-parsimony, minimum-evolution, and maximum-likelihood methods were performed with a range of computer alignments, including elision and culled alignments. All multiple alignments and phylogenetic methods yielded similar basic structure for phylogenetic relationships of Heteroderidae. The cyst-forming nematodes are represented by six main clades corresponding to morphological characters and host specialization, with certain clades assuming different positions depending on alignment procedure and/or method of phylogenetic inference. Hypotheses of monophyly of Punctoderinae and Heteroderinae are, respectively, strongly and moderately supported by the ITS data across most alignments. Close relationships were revealed between the Avenae and the Sacchari groups and between the Humuli group and the species H. salixophila within Heteroderinae. The Goettingiana group occupies a basal position within this subfamily. The validity of the genera Afenestrata and Bidera was tested and is discussed based on molecular data. We conclude that ITS sequence data are appropriate for studies of relationships within the different species groups and less so for recovery of more ancient speciations within Heteroderidae. Copyright 2001 Academic Press.

  10. Orders out of chaos--molecular phylogenetics reveals the complexity of shark and stingray tapeworm relationships.

    Science.gov (United States)

    Caira, Janine N; Jensen, Kirsten; Waeschenbach, Andrea; Olson, Peter D; Littlewood, D Timothy J

    2014-01-01

    elasmobranch cestodes. Across analyses, the sister group to the clade of "terrestrial" cestode orders was found to be an elasmobranch-hosted genus, as was the sister to the freshwater fish- and tetrapod-hosted Proteocephalidea. Whilst further data are required to resolve outstanding nomenclatural and phylogenetic issues, the present analyses contribute significantly to an understanding of the evolutionary radiation of the entire Cestoda. Clearly, elasmobranch tapeworms comprise the backbone of cestode phylogeny. Copyright © 2013 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

  11. Phylogenetic relationships in Epidendroideae (Orchidaceae), one of the great flowering plant radiations: progressive specialization and diversification.

    Science.gov (United States)

    Freudenstein, John V; Chase, Mark W

    2015-03-01

    The largest subfamily of orchids, Epidendroideae, represents one of the most significant diversifications among flowering plants in terms of pollination strategy, vegetative adaptation and number of species. Although many groups in the subfamily have been resolved, significant relationships in the tree remain unclear, limiting conclusions about diversification and creating uncertainty in the classification. This study brings together DNA sequences from nuclear, plastid and mitochrondrial genomes in order to clarify relationships, to test associations of key characters with diversification and to improve the classification. Sequences from seven loci were concatenated in a supermatrix analysis for 312 genera representing most of epidendroid diversity. Maximum-likelihood and parsimony analyses were performed on this matrix and on subsets of the data to generate trees and to investigate the effect of missing values. Statistical character-associated diversification analyses were performed. Likelihood and parsimony analyses yielded highly resolved trees that are in strong agreement and show significant support for many key clades. Many previously proposed relationships among tribes and subtribes are supported, and some new relationships are revealed. Analyses of subsets of the data suggest that the relatively high number of missing data for the full analysis is not problematic. Diversification analyses show that epiphytism is most strongly associated with diversification among epidendroids, followed by expansion into the New World and anther characters that are involved with pollinator specificity, namely early anther inflexion, cellular pollinium stalks and the superposed pollinium arrangement. All tested characters show significant association with speciation in Epidendroideae, suggesting that no single character accounts for the success of this group. Rather, it appears that a succession of key features appeared that have contributed to diversification, sometimes in

  12. Phylogenetic relationships of geckos of the genus Nactus and their relatives (Squamata: Gekkonidae

    Directory of Open Access Journals (Sweden)

    Todd R. Jackman

    2008-05-01

    Full Text Available We employed nuclear and mitochondrial DNA sequence data to investigate relationships within the gekkonid genus Nactus and between Nactus and other gekkonid genera. Nuclear (RAG-1, PDC and mitochondrial (ND2 data provide strong support for conflicting patterns of relationship among bisexual New Guinean species of Nactus and the unisexual oceanic form N. pelagicus. This may be explained by an ancient mitochondrial introgression event between N. sphaerodactylodes and N. vankampeni, a recent selective sweep of mitochondrial DNA throughout N. vankampeni, and gene conflict stemming from the hybrid event that gave rise to N. pelagicus. Strong support from all data partitions is obtained for the sister group relationship of Nactus to a clade consisting of the Australian Heteronotia and the Southeast Asian Dixonius. Putative synapomorphies of the Nactus/Heteronotia/Dixonius clade include the reduction of the second phalanx of digit IV of the manus and the presence of regular rows of keeled (sometimes multicarinate dorsal tubercles on the dorsum. Nactus and Heteronotia both include parthenogenetic species formed via hybridogenesis. This is rare among geckos, and vertebrates in general, and at some level may also be synapomorphic. Dixonius is not known to have any all-female species, but “D. siamensis” consists of multiple chromosome “races” that mirror morphologically cryptic, but karyotypically distinct, species in the other two genera. The strong support for the Nactus/Heteronotia/Dixonius clade demonstrates that the leaf-toed digital morphology of Dixonius has evolved multiple times within the Gekkonidae and suggests that superficial digital morphology may be misleading with respect to gekkonid suprageneric relationships.

  13. Phylogenetic relationships in three species of canine Demodex mite based on partial sequences of mitochondrial 16S rDNA.

    Science.gov (United States)

    Sastre, Natalia; Ravera, Ivan; Villanueva, Sergio; Altet, Laura; Bardagí, Mar; Sánchez, Armand; Francino, Olga; Ferrer, Lluís

    2012-12-01

    The historical classification of Demodex mites has been based on their hosts and morphological features. Genome sequencing has proved to be a very effective taxonomic tool in phylogenetic studies and has been applied in the classification of Demodex. Mitochondrial 16S rDNA has been demonstrated to be an especially useful marker to establish phylogenetic relationships. To amplify and sequence a segment of the mitochondrial 16S rDNA from Demodex canis and Demodex injai, as well as from the short-bodied mite called, unofficially, D. cornei and to determine their genetic proximity. Demodex mites were examined microscopically and classified as Demodex folliculorum (one sample), D. canis (four samples), D. injai (two samples) or the short-bodied species D. cornei (three samples). DNA was extracted, and a 338 bp fragment of the 16S rDNA was amplified and sequenced. The sequences of the four D. canis mites were identical and shared 99.6 and 97.3% identity with two D. canis sequences available at GenBank. The sequences of the D. cornei isolates were identical and showed 97.8, 98.2 and 99.6% identity with the D. canis isolates. The sequences of the two D. injai isolates were also identical and showed 76.6% identity with the D. canis sequence. Demodex canis and D. injai are two different species, with a genetic distance of 23.3%. It would seem that the short-bodied Demodex mite D. cornei is a morphological variant of D. canis. © 2012 The Authors. Veterinary Dermatology © 2012 ESVD and ACVD.

  14. Phylogenetic Relationships of Cucullanidae (Nematoda), with Observations on Seuratoidea and the Monophyly of Cucullanus, Dichelyne and Truttaedacnitis.

    Science.gov (United States)

    Choudhury, Anindo; Nadler, Steven A

    2016-02-01

    The phylogenetic relationships of Cucullanidae were explored using near-complete sequences of the 18S rDNA (rRNA gene). Sequences (1,750-1,760 bp) were obtained from 7 species of Cucullanidae belonging to 3 genera, Cucullanus (2 spp.), Dichelyne (2 spp.), Truttaedacnitis (3 spp.), and 1 species of Quimperiidae ( Paraseuratum sp.). These sequences were aligned with those of 128 other nematode species available in GenBank, including 3 other cucullanids (Dichelyne mexicanus, Cucullanus robustus, and Cucullanus baylisi) and 2 non-cucullanid seuratoids (Paraquimperia africana, and Linstowinema sp.). Bayesian (BPP) and maximum likelihood (ML) analyses of 2 different datasets strongly supported a monophyletic Cucullanidae. Bayesian analysis placed this family as the sister group to a clade containing species of Diplogasterida, Strongylida, Rhabditida, and Tylenchida with very strong support. Neither BPP nor ML analyses recovered a close relationship of Cucullanidae to Ascaridida. None of the 3 non-cucullanid seuratoid species were sister to Cucullanidae, nor did they form a monophyletic group of their own, which questions the monophyly of Seuratoidea and the relationships among species within this superfamily. The 3 genera of cucullanids were also not monophyletic, although morphologically similar species such as the 2 species of Cucullanus from Neotropical catfishes and 2 species of Dichelyne from Nearctic ictalurid catfishes were sister taxa with strong support. The results were ambiguous with respect to the relationship of 2 Truttaedacnitis spp. in Nearctic freshwater fishes but do not support Truttaedacnitis heterodonti, a parasite of heterodontid sharks, as belonging to this genus. The study shows that all aspects of the conventional classification of Seuratoidea and its taxa should be scrutinized by even more extensive sampling across hosts and habitats.

  15. Studying the evolutionary relationships and phylogenetic trees of 21 groups of tRNA sequences based on complex networks.

    Science.gov (United States)

    Wei, Fangping; Chen, Bowen

    2012-03-01

    To find out the evolutionary relationships among different tRNA sequences of 21 amino acids, 22 networks are constructed. One is constructed from whole tRNAs, and the other 21 networks are constructed from the tRNAs which carry the same amino acids. A new method is proposed such that the alignment scores of any two amino acids groups are determined by the average degree and the average clustering coefficient of their networks. The anticodon feature of isolated tRNA and the phylogenetic trees of 21 group networks are discussed. We find that some isolated tRNA sequences in 21 networks still connect with other tRNAs outside their group, which reflects the fact that those tRNAs might evolve by intercrossing among these 21 groups. We also find that most anticodons among the same cluster are only one base different in the same sites when S ≥ 70, and they stay in the same rank in the ladder of evolutionary relationships. Those observations seem to agree on that some tRNAs might mutate from the same ancestor sequences based on point mutation mechanisms.

  16. Vertebrate hosts and phylogenetic relationships of amphibian trypanosomes from a potential invertebrate vector, Culex territans Walker (Diptera: Culicidae).

    Science.gov (United States)

    Bartlett-Healy, Kristen; Crans, Wayne; Gaugler, Randy

    2009-04-01

    The blood meals of field-collected female Culex territans (Diptera: Culicidae) were concurrently assayed for the presence of trypanosomes and for vertebrate host identification. We amplified vertebrate DNA in 42 of 119 females and made positive identification to the host species level in 29 of those samples. Of the 119 field-collected Cx. territans females, 24 were infected with trypanosomes. Phylogenetic analysis placed the trypanosomes in the amphibian portion of the aquatic clade of the Trypanosomatidae. These trypanosomes were isolated from Cx. territans females that had fed on the frog species Rana clamitans, R. catesbeiana, R. virgatipes, and Rana spp. Results support a potential new lineage of dipteran-transmitted amphibian trypanosomes may occur within the aquatic clade. The frequency in which female Cx. territans acquire trypanosomes, through diverse feeding habits, indicates a new relationship between amphibian trypanosomes and mosquitoes that has not been examined previously. Combining Trypanosoma species, invertebrate, and vertebrate hosts to existing phylogenies can elucidate trypanosome and host relationships.

  17. Higher level phylogenetic relationships within the bamboos (Poaceae: Bambusoideae) based on five plastid markers.

    Science.gov (United States)

    Kelchner, Scot A

    2013-05-01

    Bamboos are large perennial grasses of temperate and tropical forests worldwide. Two general growth forms exist: the economically and ecologically important woody bamboos (tribes Arundinarieae and Bambuseae), and the understory herbaceous bamboos (tribe Olyreae). Evolutionary relationships among the 1400+described species have been difficult to resolve with confidence. Comparative analysis of bamboo plastid (chloroplast) DNA has revealed three to five major lineages that show distinct biogeographic distributions. Taxon sampling across tribes and subtribes has been incomplete and most published data sets include a relatively small number of nucleotide characters. Branching order among lineages is often poorly supported, and in more than one study herbaceous bamboos form a clade within the woody bamboos. In this paper, the Bamboo Phylogeny Group presents the most complete phylogeny estimation to date of bamboo tribes and subtribes using 6.7 kb of coding and noncoding sequence data and 37 microstructural characters from the chloroplast genome. Quality of data is assessed, as is the possibility of long branch attraction, the degree of character conflict at key nodes in the tree, and the legitimacy of three alternative hypotheses of relationship. Four major plastid lineages are recognized: temperate woody, paleotropical woody, neotropical woody, and herbaceous bamboos. Woody bamboos are resolved as paraphyletic with respect to Olyreae but SH tests cannot reject monophyly of woody species (Arundinarieae+Bambuseae). Published by Elsevier Inc.

  18. [Phylogenetic relationships among the genera of Taxodiaceae and Cupressaceae from 28S rDNA sequences].

    Science.gov (United States)

    Li, Chun-Xiang; Yang, Qun

    2003-03-01

    DNA sequences from 28S rDNA were used to assess relationships between and within traditional Taxodiaceae and Cupressaceae s.s. The MP tree and NJ tree generally are similar to one another. The results show that Taxodiaceae and Cupressaceae s.s. form a monophyletic conifer lineage excluding Sciadopitys. In the Taxodiaceae-Cupressaceae s.s. monophyletic group, the Taxodiaceae is paraphyletic. Taxodium, Glyptostrobus and Cryptomeria forming a clade(Taxodioideae), in which Glyptostrobus and Taxodium are closely related and sister to Cryptomeria; Sequoia, Sequoiadendron and Metasequoia are closely related to each other, forming another clade (Sequoioideae), in which Sequoia and Sequoiadendron are closely related and sister to Metasequoia; the seven genera of Cupressaceae s.s. are found to be closely related to form a monophyletic lineage (Cupressoideae). These results are basically similar to analyses from chloroplast gene data. But the relationships among Taiwania, Sequoioideae, Taxodioideae, and Cupressoideae remain unclear because of the slow evolution rate of 28S rDNA, which might best be answered by sequencing more rapidly evolving nuclear genes.

  19. Phylogenetic relationships among the species of the genus testudo (Testudines : Testudinidae) inferred from mitochondrial 12S rRNA gene sequences

    NARCIS (Netherlands)

    van der Kuyl, Antoinette C.; Ph Ballasina, Donato L.; Dekker, John T.; Maas, Jolanda; Willemsen, Ronald E.; Goudsmit, Jaap

    2002-01-01

    To test phylogenetic relationships within the genus Testudo (Testudines: Testudinidae), we have sequenced a fragment of the mitochondrial (mt) 12S rRNA gene of 98 tortoise specimens belonging to the genera Testudo, Indotestudo, and Geochelone. Maximum likelihood and neighbor-joining methods identify

  20. Phylogenetic relationships of the Gomphales based on nuc-25S-rDNA, mit-12S-rDNA, and mit-atp6-DNA combined sequences

    Science.gov (United States)

    Admir J. Giachini; Kentaro Hosaka; Eduardo Nouhra; Joseph Spatafora; James M. Trappe

    2010-01-01

    Phylogenetic relationships among Geastrales, Gomphales, Hysterangiales, and Phallales were estimated via combined sequences: nuclear large subunit ribosomal DNA (nuc-25S-rDNA), mitochondrial small subunit ribosomal DNA (mit-12S-rDNA), and mitochondrial atp6 DNA (mit-atp6-DNA). Eighty-one taxa comprising 19 genera and 58 species...

  1. Phylogenetic relationships of the cultivated neotropical palm Bactris gasipaes (arecaceae) with its wild relatives inferred from chloroplast and nuclear DNA polymorphisms

    NARCIS (Netherlands)

    Couvreur, T.L.P.; Hahn, K.; Granville, de J.J.; Pham, J.L.; Ludena, B.; Pintaud, J.C.

    2007-01-01

    Peach palm (Bactris gasipaes Kunth.) is the only Neotropical palm domesticated since pre-Columbian times. It plays an important role not only at the local level due to its very nutritious fruits, but also in the international market for its gourmet palm heart. Phylogenetic relationships of the peach

  2. Diversification of Scrophularia (Scrophulariaceae) in the Western Mediterranean and Macaronesia--phylogenetic relationships, reticulate evolution and biogeographic patterns.

    Science.gov (United States)

    Scheunert, Agnes; Heubl, Günther

    2014-01-01

    The flora of the Mediterranean region and Macaronesia is characterized by high levels of species diversity and endemism. We examined phylogenetic relationships of Scrophularia within one of its secondary centers of diversity located in the Iberian Peninsula and adjacent Macaronesia. In total, 65 ingroup accessions from 45 species, representing an almost complete sampling of the region, were analyzed using sequences from the internal transcribed spacer region (ITS) and the plastid trnQ-rps16 intergenic spacer. Phylogenetic relationships were inferred using Bayesian inference, maximum likelihood and statistical parsimony networking. Incongruence between datasets was assessed with statistical tests and displayed by split networks. Biogeographic inferences incorporating information from both markers (despite low resolution in some parts of the trees) and all incongruent taxa were accomplished with a novel combination of methods, using trees generated with the taxon duplication approach as input for Bayesian binary MCMC (BBM) analysis as implemented in RASP. Nuclear and chloroplast markers support a clade which comprises the majority of Iberian and Macaronesian species and consists of three subclades. Analyses of the substantial incongruence observed among markers indicate reticulate evolution and suggest that Scrophularia species diversity in this region is largely attributable to hybridization; a combination of both polyploidy and dysploidy in the karyotypic evolution of Western Mediterranean Scrophularia taxa is proposed. Our results provide support for an ancient hybridization event between two widespread lineages, which resulted in an allopolyploid ancestor of the Iberian - Macaronesian group with 2n=58 chromosomes. The ancestor then diverged into the three main lineages present in the Iberian Peninsula, Northern Africa and Macaronesia today. Subsequent interspecific hybridizations at different ploidy levels additionally generated new species. Presumably

  3. Monophyly of Archaeplastida supergroup and relationships among its lineages in the light of phylogenetic and phylogenomic studies. Are we close to a consensus?

    Directory of Open Access Journals (Sweden)

    Paweł Mackiewicz

    2014-12-01

    Full Text Available One of the key evolutionary events on the scale of the biosphere was an endosymbiosis between a heterotrophic eukaryote and a cyanobacterium, resulting in a primary plastid. Such an organelle is characteristic of three eukaryotic lineages, glaucophytes, red algae and green plants. The three groups are usually united under the common name Archaeplastida or Plantae in modern taxonomic classifications, which indicates they are considered monophyletic. The methods generally used to verify this monophyly are phylogenetic analyses. In this article we review up-to-date results of such analyses and discussed their inconsistencies. Although phylogenies of plastid genes suggest a single primary endosymbiosis, which is assumed to mean a common origin of the Archaeplastida, different phylogenetic trees based on nuclear markers show monophyly, paraphyly, polyphyly or unresolved topologies of Archaeplastida hosts. The difficulties in reconstructing host cell relationships could result from stochastic and systematic biases in data sets, including different substitution rates and patterns, gene paralogy and horizontal/endosymbiotic gene transfer into eukaryotic lineages, which attract Archaeplastida in phylogenetic trees. Based on results to date, it is neither possible to confirm nor refute alternative evolutionary scenarios to a single primary endosymbiosis. Nevertheless, if trees supporting monophyly are considered, relationships inferred among Archaeplastida lineages can be discussed. Phylogenetic analyses based on nuclear genes clearly show the earlier divergence of glaucophytes from red algae and green plants. Plastid genes suggest a more complicated history, but at least some studies are congruent with this concept. Additional research involving more representatives of glaucophytes and many understudied lineages of Eukaryota can improve inferring phylogenetic relationships related to the Archaeplastida. In addition, alternative approaches not directly

  4. Phylogenetic Relationships between Four Salix L. Species Based on DArT Markers

    Directory of Open Access Journals (Sweden)

    Jerzy A. Przyborowski

    2013-12-01

    Full Text Available The objectives of this study were to evaluate the usefulness of DArT markers in genotypic identification of willow species and describe genetic relationships between four willow species: Salix viminalis, S. purpurea, S. alba and S. triandra. The experimental plant material comprised 53 willow genotypes of these four species, which are popularly grown in Poland. DArT markers seem to identify Salix species with a high degree of accuracy. As a result, the examined species were divided into four distinct groups which corresponded to the four analyzed species. In our study, we observed that S. triandra was very different genetically from the other species, including S. alba which is generally classified into the same subgenus of Salix. The above corroborates the findings of other authors who relied on molecular methods to reveal that the classification of S. triandra to the subgenus Salix was erroneous. The Principal Coordinate Analysis (PCoA and the neighbor-joining dendrogram also confirmed the clear division of the studied willow genotypes into four clusters corresponding to individual species. This confirmed the usefulness of DArT markers in taxonomic analyses and identification of willow species.

  5. Phylogenetic relationships of Vepris (Rutaceae inferred from chloroplast, nuclear, and morphological data.

    Directory of Open Access Journals (Sweden)

    Cynthia M Morton

    Full Text Available The tribe Toddalieae Hook. F. (Rutaceae has been controversial since its inception by Bentham and Hooker. The nine taxa examined, Acronychia J.R. & G.Foster, Diphasia Pierre, Diphasiopsis Mendonca, Fagaropsis Mildbr.ex. Siebenl., Oricia Pierre, Teclea Delile, Toddaliopsis Engl., Toddalia Juss. and Vepris Comm. ex. A. Juss, have been recognized under the tribe Toddalieae or Tribes Acronychia, Phellodendron and Toddalia. More recently Araliopsis Engl., Diphasia, Diphasiopsis, Oricia, Teclea, and Toddaliopsis have been incorporated into the genus Vepris, while Toddalia and Fagaropsis have continued to be recognized as closely related. For this study, sequence data of one non-coding chloroplast region (trnL-F and one nuclear region (ITS and various morphological characters, based on Mziray's taxonomic studies were examined to try to elucidate these relationships. This study found that the taxa Diphasia, Diphasiopsis, Oricia, Teclea, Toddaliopsis, Vepris, Toddalia eugeniifolia Engl. and Toddalia glomerata F. Hoffm. form a monophyletic group. Due to the amount of intrageneric and intraspecific variation, species delimitations were difficult to determine; however, these genera should be united into Vepris. The analyses also confirmed that Toddalia asiatica (L. Lam., Zanthoxylon sp. and Fagaropsis angolensis (Engl. H.M. Gardner are the closest relatives to this group.

  6. Phylogenetic relationships among Lactuca (Asteraceae) species and related genera based on ITS-1 DNA sequences.

    Science.gov (United States)

    Koopman, W J; Guetta, E; van de Wiel, C C; Vosman, B; van den Berg, R G

    1998-11-01

    Internal transcribed spacer (ITS-1) sequences from 97 accessions representing 23 species of Lactuca and related genera were determined and used to evaluate species relationships of Lactuca sensu lato (s.l.). The ITS-1 phylogenies, calculated using PAUP and PHYLIP, correspond better to the classification of Feráková than to other classifications evaluated, although the inclusion of sect. Lactuca subsect. Cyanicae is not supported. Therefore, exclusion of subsect. Cyanicae from Lactuca sensu Feráková is proposed. The amended genus contains the entire gene pool (sensu Harlan and De Wet) of cultivated lettuce (Lactuca sativa). The position of the species in the amended classification corresponds to their position in the lettuce gene pool. In the ITS-1 phylogenies, a clade with L. sativa, L. serriola, L. dregeana, L. altaica, and L. aculeata represents the primary gene pool. L. virosa and L. saligna, branching off closest to this clade, encompass the secondary gene pool. L. virosa is possibly of hybrid origin. The primary and secondary gene pool species are classified in sect. Lactuca subsect. Lactuca. The species L. quercina, L. viminea, L. sibirica, and L. tatarica, branching off next, represent the tertiary gene pool. They are classified in Lactuca sect. Lactucopsis, sect. Phaenixopus, and sect. Mulgedium, respectively. L. perennis and L. tenerrima, classified in sect. Lactuca subsect. Cyanicae, form clades with species from related genera and are not part of the lettuce gene pool.

  7. Phylogenetic relationships and genetic diversity of the Polypedates leucomystax complex in Thailand

    Directory of Open Access Journals (Sweden)

    Kittisak Buddhachat

    2018-01-01

    Full Text Available Taxonomic uncertainty of the Asian tree frog Polypedates leucomystax complex presents the challenging task of inferring its biogeographical history. Here, we describe its dispersion and the genetic relationships among different populations in Thailand, where we connect the population of the P. leucomystax complex of the Sunda Islands to the Indochina (mainland population based on analyses of 266 sequences of the mitochondrial cytochrome c oxidase subunit I (COI gene. Our maternal genealogy implies that there are four well-supported lineages in Thailand, consisting of Northern A (clade A: Polypedates sp., Nan (clade B: P. cf. impresus, Southern (clade C: P. cf. leucomystax and Northern D (clade D: P. cf. megacephalus, with Bayesian posterior probability >0.9. Phylogeny and haplotype networks indicate that clades A, B and D are sympatric. In contrast, clade C (P. cf. leucomystax and clade D (P. cf. megacephalus are genetically divergent due to the geographical barrier of the Isthmus of Kra, resulting in an allopatric distribution. Climatic conditions, in particular differences in rainfall on each side of the Isthmus of Kra, may play an important role in limiting the immigration of both clades. For the within-populations of either clades C or D, there was no significant correlation between geographic and genetic distance by the isolation-by-distance test, indicating intraspecific-dispersal of each clade. Population expansion occurred in clade C, whereas clade D showed a constant population. Taken together, the P. leucomystax complex in South East Asia may have diversified under climatic pressure, leading to allopatric and/or sympatric speciation.

  8. Phylogenetic relationships in the Festuca-Lolium complex (Loliinae; Poaceae: New insights from chloroplast sequences

    Directory of Open Access Journals (Sweden)

    Yajuan Cheng

    2016-07-01

    Full Text Available The species within the Lolium/Festuca grass complex have dispersed and colonized large areas of temperate global grasslands both naturally and by human intervention. The species within this grass complex represent some of the most important grass species both for amenity and agricultural use worldwide. There has been renewed interest by grass breeders in producing hybrid combinations between these species and several countries now market Festulolium varieties as a combination of genes from both genera. The two genera have been differentiated by their inflorescence structure, but controversy has surrounded the taxonomic classification of the Lolium-Festuca complex species for several decades. In order to better understand the complexities within the Lolium/Festuca complex and their genetic background, the phylogeny of important examplers from the Lolium-Festuca complex were reconstructed. In total 40 taxa representing the Festuca and Lolium species with Vulpia myuros and Brachypodium distachyon as outgroups were sampled, using two noncoding intergenic spacers (trnQ-rps16, trnH-psbA and one coding gene (rbcL. Maximum parsimony (MP, Bayesian inference (BI analyses based on each partition and combined plastid DNA dataset, and median-jointing network analysis were employed. The outcomes strongly suggested that the subgen. Schedonorus has a close relationship to Lolium, and it is also proposed to move the sect. Leucopoa from subgen. Leucopoa to Subgen. Schedonorus and to separate sect. Breviaristatae from the subgen. Leucopoa. We found that F. californica could be a lineage of hybrid origin because of its intermediate placement between the broad-leaved and fine-leaved clade.

  9. Analysis of mitochondrial DNA: taxonomic and phylogenetic relationships in two fish taxa (Pisces: Mugilidae and Cyprinidae).

    Science.gov (United States)

    Semina, A V; Polyakova, N E; Brykov, Vl A

    2007-12-01

    To solve some systematic questions as well as to study genetic variability and evolutionary relationships in two groups of fish belonging to the Mugilid (Mugilidae) and Cyprinid (Cyprinidae) families, we have used restriction fragment length polymorphism analysis of mitochondrial DNA (mtDNA) fragments amplified in polymerase chain reaction. The analysis of three mtDNA fragments of 7220 bp total length of six Mugilid species has shown that Mediterranean Liza aurata, L. ramada, L. saliens, and Chelon labrosus form a common cluster, L. aurata and C. labrosus being the closest relatives, whereas L. haematocheilus (syn. C. haematocheilus) of the Sea of Japan forms a sister group to the Mediterranean cluster. It was found that Chelon and Liza genera are paraphyletic, and therefore their division into two genera is unnatural and they should be synonymized. According to priority, Liza species should be ascribed to Chelon genus. Mugil cephalus is the most distant compared to the rest of the species studied. The level of genetic divergence between allopatric samples of M. cephalus from the Sea of Japan and the Mediterranean Sea has proved to be very high--4.5% of nucleotide substitutions. The analysis of four mtDNA fragments of 9340 bp total length of six Cyprinid species has shown that L. waleckii is the most genetically distant. Pseudaspius leptocephalus is a sister group to Tribolodon species. All Tribolodon species form a common cluster with T. sachalinensis as a root. The remaining species form two branches, one of which includes T. nakamurai and T. brandtii, another one combines T. hakonensis and a new form of Tribolodon revealed that is close to T. hakonensis by its mtDNA (2.4% of nucleotide substitutions). This new form might be an independent species.

  10. Phylogenetic relationships among Perissodactyla: secretoglobin 1A1 gene duplication and triplication in the Equidae family.

    Science.gov (United States)

    Côté, Olivier; Viel, Laurent; Bienzle, Dorothee

    2013-12-01

    Secretoglobin family 1A member 1 (SCGB 1A1) is a small anti-inflammatory and immunomodulatory protein that is abundantly secreted in airway surface fluids. We recently reported the existence of three distinct SCGB1A1 genes in the domestic horse genome as opposed to the single gene copy consensus present in other mammals. The origin of SCGB1A1 gene triplication and the evolutionary relationship of the three genes amongst Equidae family members are unknown. For this study, SCGB1A1 genomic data were collected from various Equus individuals including E. caballus, E. przewalskii, E. asinus, E. grevyi, and E. quagga. Three SCGB1A1 genes in E. przewalskii, two SCGB1A1 genes in E. asinus, and a single SCGB1A1 gene in E. grevyi and E. quagga were identified. Sequence analysis revealed that the non-synonymous nucleotide substitutions between the different equid genes coded for 17 amino acid changes. Most of these changes localized to the SCGB 1A1 central cavity that binds hydrophobic ligands, suggesting that this area of SCGB 1A1 evolved to accommodate diverse molecular interactions. Three-dimensional modeling of the proteins revealed that the size of the SCGB 1A1 central cavity is larger than that of SCGB 1A1A. Altogether, these findings suggest that evolution of the SCGB1A1 gene may parallel the separation of caballine and non-caballine species amongst Equidae, and may indicate an expansion of function for SCGB1A1 gene products. Copyright © 2013 Elsevier Inc. All rights reserved.

  11. Karyotype evolution and phylogenetic relationships of hamsters (Cricetidae, Muroidea, Rodentia) inferred from chromosomal painting and banding comparison.

    Science.gov (United States)

    Romanenko, Svetlana A; Volobouev, Vitaly T; Perelman, Polina L; Lebedev, Vladimir S; Serdukova, Natalya A; Trifonov, Vladimir A; Biltueva, Larisa S; Nie, Wenhui; O'Brien, Patricia C M; Bulatova, Nina Sh; Ferguson-Smith, Malcolm A; Yang, Fengtang; Graphodatsky, Alexander S

    2007-01-01

    The evolutionary success of rodents of the superfamily Muroidea makes this taxon the most interesting for evolution studies, including study at the chromosomal level. Chromosome-specific painting probes from the Chinese hamster and the Syrian (golden) hamster were used to delimit homologous chromosomal segments among 15 hamster species from eight genera: Allocricetulus, Calomyscus, Cricetulus, Cricetus, Mesocricetus, Peromyscus, Phodopus and Tscherskia (Cricetidae, Muroidea, Rodentia). Based on results of chromosome painting and G-banding, comparative maps between 20 rodent species have been established. The integrated maps demonstrate a high level of karyotype conservation among species in the Cricetus group (Cricetus, Cricetulus, Allocricetulus) with Tscherskia as its sister group. Species within the genera Mesocricetus and Phodopus also show a high degree of chromosomal conservation. Our results substantiate many of the conclusions suggested by other data and strengthen the topology of the Muroidea phylogenetic tree through the inclusion of genome-wide chromosome rearrangements. The derivation of the muroids karyotypes from the putative ancestral state involved centric fusions, fissions, addition of heterochromatic arms and a great number of inversions. Our results provide further insights into the karyotype relationships of all species investigated.

  12. Mitochondrial haplotype distribution and phylogenetic relationship of an endangered species Reeve's turtle (Mauremys reevesii in East Asia

    Directory of Open Access Journals (Sweden)

    Hong-Shik Oh

    2017-03-01

    Full Text Available This study was examined to reveal haplotype distribution and phylogenetic relationship using mitochondrial DNA CYTB gene sequences of Reeve’s turtle (Mauremys reevesii of East Asia. CYTB sequences of Reeve’s turtles were divided into 6 haplotypes (Hap01–Hap06. Chinese turtles were found in Hap01, Hap02, Hap04, and Hap05, and Hap01 was the highest frequency of 85.0%. Korean Turtles were found in Hap01, Hap03, Hap04, and Hap05, and Hap03 was the highest frequency of 52.1%. Although there was no haplotype which includes only the CYTB sequence exclusive for Reeve’s turtles of Korea, since no CYTB sequence of China was found in Hap03, it would be possible that Hap03 turtles of Korea are separated from those of China. The haplotypes of Reeve’s turtles of East Asia were monophyletic, which indicated that they had been evolved from a single maternal lineage, but went through local evolution after geographical migration and isolation in East Asia.

  13. Phylogenetic analysis of molecular and morphological data highlights uncertainty in the relationships of fossil and living species of Elopomorpha (Actinopterygii: Teleostei).

    Science.gov (United States)

    Dornburg, Alex; Friedman, Matt; Near, Thomas J

    2015-08-01

    Elopomorpha is one of the three main clades of living teleost fishes and includes a range of disparate lineages including eels, tarpons, bonefishes, and halosaurs. Elopomorphs were among the first groups of fishes investigated using Hennigian phylogenetic methods and continue to be the object of intense phylogenetic scrutiny due to their economic significance, diversity, and crucial evolutionary status as the sister group of all other teleosts. While portions of the phylogenetic backbone for Elopomorpha are consistent between studies, the relationships among Albula, Pterothrissus, Notacanthiformes, and Anguilliformes remain contentious and difficult to evaluate. This lack of phylogenetic resolution is problematic as fossil lineages are often described and placed taxonomically based on an assumed sister group relationship between Albula and Pterothrissus. In addition, phylogenetic studies using morphological data that sample elopomorph fossil lineages often do not include notacanthiform or anguilliform lineages, potentially introducing a bias toward interpreting fossils as members of the common stem of Pterothrissus and Albula. Here we provide a phylogenetic analysis of DNA sequences sampled from multiple nuclear genes that include representative taxa from Albula, Pterothrissus, Notacanthiformes and Anguilliformes. We integrate our molecular dataset with a morphological character matrix that spans both living and fossil elopomorph lineages. Our results reveal substantial uncertainty in the placement of Pterothrissus as well as all sampled fossil lineages, questioning the stability of the taxonomy of fossil Elopomorpha. However, despite topological uncertainty, our integration of fossil lineages into a Bayesian time calibrated framework provides divergence time estimates for the clade that are consistent with previously published age estimates based on the elopomorph fossil record and molecular estimates resulting from traditional node-dating methods. Copyright

  14. Recurrent hybridization and recent origin obscure phylogenetic relationships within the ‘white-headed’ gull (Larus sp.) complex

    Science.gov (United States)

    Sonsthagen, Sarah A.; Wilson, Robert E.; Chesser, Terry; Pons, Jean-Marc; Crochet, Pierre-Andre; Driscoll, Amy; Dove, Carla

    2016-01-01

    Species complexes that have undergone recent radiations are often characterized by extensive allele sharing due to recent ancestry and (or) introgressive hybridization. This can result in discordant evolutionary histories of genes and heterogeneous genomes, making delineating species limits difficult. Here we examine the phylogenetic relationships among a complex group of birds, the white-headed gulls (Aves: Laridae), which offer a unique window into the speciation process due to their recent evolutionary history and propensity to hybridize. Relationships were examined among 17 species (61 populations) using a multilocus approach, including mitochondrial and nuclear intron DNA sequences and microsatellite genotype information. Analyses of microsatellite and intron data resulted in some species-based groupings, although most species were not represented by a single cluster. Considerable allele and haplotype sharing among white-headed gull species was observed; no locus contained a species-specific clade. Despite this, our multilocus approach provided better resolution among some species than previous studies. Interestingly, most clades appear to correspond to geographic locality: our BEAST analysis recovered strong support for a northern European/Icelandic clade, a southern European/Russian clade, and a western North American/canus clade, with weak evidence for a high latitude clade spanning North America and northwestern Europe. This geographical structuring is concordant with behavioral observations of pervasive hybridization in areas of secondary contact. The extent of allele and haplotype sharing indicates that ecological and sexual selection are likely not strong enough to complete reproductive isolation within several species in the white-headed gull complex. This suggests that just a few genes are driving the speciation process.

  15. Honey bee dopamine and octopamine receptors linked to intracellular calcium signaling have a close phylogenetic and pharmacological relationship.

    Directory of Open Access Journals (Sweden)

    Kyle T Beggs

    Full Text Available BACKGROUND: Three dopamine receptor genes have been identified that are highly conserved among arthropod species. One of these genes, referred to in honey bees as Amdop2, shows a close phylogenetic relationship to the a-adrenergic-like octopamine receptor family. In this study we examined in parallel the functional and pharmacological properties of AmDOP2 and the honey bee octopamine receptor, AmOA1. For comparison, pharmacological properties of the honey bee dopamine receptors AmDOP1 and AmDOP3, and the tyramine receptor AmTYR1, were also examined. METHODOLOGY/PRINCIPAL FINDINGS: Using HEK293 cells heterologously expressing honey bee biogenic amine receptors, we found that activation of AmDOP2 receptors, like AmOA1 receptors, initiates a rapid increase in intracellular calcium levels. We found no evidence of calcium signaling via AmDOP1, AmDOP3 or AmTYR1 receptors. AmDOP2- and AmOA1-mediated increases in intracellular calcium were inhibited by 10 µM edelfosine indicating a requirement for phospholipase C-β activity in this signaling pathway. Edelfosine treatment had no effect on AmDOP2- or AmOA1-mediated increases in intracellular cAMP. The synthetic compounds mianserin and epinastine, like cis-(Z-flupentixol and spiperone, were found to have significant antagonist activity on AmDOP2 receptors. All 4 compounds were effective antagonists also on AmOA1 receptors. Analysis of putative ligand binding sites offers a possible explanation for why epinastine acts as an antagonist at AmDOP2 receptors, but fails to block responses mediated via AmDOP1. CONCLUSIONS/SIGNIFICANCE: Our results indicate that AmDOP2, like AmOA1, is coupled not only to cAMP, but also to calcium-signalling and moreover, that the two signalling pathways are independent upstream of phospholipase C-β activity. The striking similarity between the pharmacological properties of these 2 receptors suggests an underlying conservation of structural properties related to receptor

  16. Estimating phylogenetic relationships despite discordant gene trees across loci: the species tree of a diverse species group of feather mites (Acari: Proctophyllodidae).

    Science.gov (United States)

    Knowles, Lacey L; Klimov, Pavel B

    2011-11-01

    With the increased availability of multilocus sequence data, the lack of concordance of gene trees estimated for independent loci has focused attention on both the biological processes producing the discord and the methodologies used to estimate phylogenetic relationships. What has emerged is a suite of new analytical tools for phylogenetic inference--species tree approaches. In contrast to traditional phylogenetic methods that are stymied by the idiosyncrasies of gene trees, approaches for estimating species trees explicitly take into account the cause of discord among loci and, in the process, provides a direct estimate of phylogenetic history (i.e. the history of species divergence, not divergence of specific loci). We illustrate the utility of species tree estimates with an analysis of a diverse group of feather mites, the pinnatus species group (genus Proctophyllodes). Discord among four sequenced nuclear loci is consistent with theoretical expectations, given the short time separating speciation events (as evident by short internodes relative to terminal branch lengths in the trees). Nevertheless, many of the relationships are well resolved in a Bayesian estimate of the species tree; the analysis also highlights ambiguous aspects of the phylogeny that require additional loci. The broad utility of species tree approaches is discussed, and specifically, their application to groups with high speciation rates--a history of diversification with particular prevalence in host/parasite systems where species interactions can drive rapid diversification.

  17. Phylogenetic trees

    OpenAIRE

    Baños, Hector; Bushek, Nathaniel; Davidson, Ruth; Gross, Elizabeth; Harris, Pamela E.; Krone, Robert; Long, Colby; Stewart, Allen; Walker, Robert

    2016-01-01

    We introduce the package PhylogeneticTrees for Macaulay2 which allows users to compute phylogenetic invariants for group-based tree models. We provide some background information on phylogenetic algebraic geometry and show how the package PhylogeneticTrees can be used to calculate a generating set for a phylogenetic ideal as well as a lower bound for its dimension. Finally, we show how methods within the package can be used to compute a generating set for the join of any two ideals.

  18. Phylogenetic diversity and biodiversity indices on phylogenetic networks.

    Science.gov (United States)

    Wicke, Kristina; Fischer, Mareike

    2018-04-01

    In biodiversity conservation it is often necessary to prioritize the species to conserve. Existing approaches to prioritization, e.g. the Fair Proportion Index and the Shapley Value, are based on phylogenetic trees and rank species according to their contribution to overall phylogenetic diversity. However, in many cases evolution is not treelike and thus, phylogenetic networks have been developed as a generalization of phylogenetic trees, allowing for the representation of non-treelike evolutionary events, such as hybridization. Here, we extend the concepts of phylogenetic diversity and phylogenetic diversity indices from phylogenetic trees to phylogenetic networks. On the one hand, we consider the treelike content of a phylogenetic network, e.g. the (multi)set of phylogenetic trees displayed by a network and the so-called lowest stable ancestor tree associated with it. On the other hand, we derive the phylogenetic diversity of subsets of taxa and biodiversity indices directly from the internal structure of the network. We consider both approaches that are independent of so-called inheritance probabilities as well as approaches that explicitly incorporate these probabilities. Furthermore, we introduce our software package NetDiversity, which is implemented in Perl and allows for the calculation of all generalized measures of phylogenetic diversity and generalized phylogenetic diversity indices established in this note that are independent of inheritance probabilities. We apply our methods to a phylogenetic network representing the evolutionary relationships among swordtails and platyfishes (Xiphophorus: Poeciliidae), a group of species characterized by widespread hybridization. Copyright © 2018 Elsevier Inc. All rights reserved.

  19. Arthropod phylogenetics in light of three novel millipede (myriapoda: diplopoda) mitochondrial genomes with comments on the appropriateness of mitochondrial genome sequence data for inferring deep level relationships.

    Science.gov (United States)

    Brewer, Michael S; Swafford, Lynn; Spruill, Chad L; Bond, Jason E

    2013-01-01

    Arthropods are the most diverse group of eukaryotic organisms, but their phylogenetic relationships are poorly understood. Herein, we describe three mitochondrial genomes representing orders of millipedes for which complete genomes had not been characterized. Newly sequenced genomes are combined with existing data to characterize the protein coding regions of myriapods and to attempt to reconstruct the evolutionary relationships within the Myriapoda and Arthropoda. The newly sequenced genomes are similar to previously characterized millipede sequences in terms of synteny and length. Unique translocations occurred within the newly sequenced taxa, including one half of the Appalachioria falcifera genome, which is inverted with respect to other millipede genomes. Across myriapods, amino acid conservation levels are highly dependent on the gene region. Additionally, individual loci varied in the level of amino acid conservation. Overall, most gene regions showed low levels of conservation at many sites. Attempts to reconstruct the evolutionary relationships suffered from questionable relationships and low support values. Analyses of phylogenetic informativeness show the lack of signal deep in the trees (i.e., genes evolve too quickly). As a result, the myriapod tree resembles previously published results but lacks convincing support, and, within the arthropod tree, well established groups were recovered as polyphyletic. The novel genome sequences described herein provide useful genomic information concerning millipede groups that had not been investigated. Taken together with existing sequences, the variety of compositions and evolution of myriapod mitochondrial genomes are shown to be more complex than previously thought. Unfortunately, the use of mitochondrial protein-coding regions in deep arthropod phylogenetics appears problematic, a result consistent with previously published studies. Lack of phylogenetic signal renders the resulting tree topologies as suspect

  20. Arthropod phylogenetics in light of three novel millipede (myriapoda: diplopoda mitochondrial genomes with comments on the appropriateness of mitochondrial genome sequence data for inferring deep level relationships.

    Directory of Open Access Journals (Sweden)

    Michael S Brewer

    Full Text Available BACKGROUND: Arthropods are the most diverse group of eukaryotic organisms, but their phylogenetic relationships are poorly understood. Herein, we describe three mitochondrial genomes representing orders of millipedes for which complete genomes had not been characterized. Newly sequenced genomes are combined with existing data to characterize the protein coding regions of myriapods and to attempt to reconstruct the evolutionary relationships within the Myriapoda and Arthropoda. RESULTS: The newly sequenced genomes are similar to previously characterized millipede sequences in terms of synteny and length. Unique translocations occurred within the newly sequenced taxa, including one half of the Appalachioria falcifera genome, which is inverted with respect to other millipede genomes. Across myriapods, amino acid conservation levels are highly dependent on the gene region. Additionally, individual loci varied in the level of amino acid conservation. Overall, most gene regions showed low levels of conservation at many sites. Attempts to reconstruct the evolutionary relationships suffered from questionable relationships and low support values. Analyses of phylogenetic informativeness show the lack of signal deep in the trees (i.e., genes evolve too quickly. As a result, the myriapod tree resembles previously published results but lacks convincing support, and, within the arthropod tree, well established groups were recovered as polyphyletic. CONCLUSIONS: The novel genome sequences described herein provide useful genomic information concerning millipede groups that had not been investigated. Taken together with existing sequences, the variety of compositions and evolution of myriapod mitochondrial genomes are shown to be more complex than previously thought. Unfortunately, the use of mitochondrial protein-coding regions in deep arthropod phylogenetics appears problematic, a result consistent with previously published studies. Lack of phylogenetic

  1. Phylogenetic relationships and biogeography of the groundwater-dwelling amphipod genus Pseudoniphargus (Crustacea), with emphasis on the Iberian species

    NARCIS (Netherlands)

    Notenboom, Jos

    1988-01-01

    Numerical phylogenetic methods are applied in order to arrive at synapomorphic similarities between species of the stygobiont amphipod genus Pseudoniphargus. Character polarity is assessed by comparison with the relevant outgroups Parapseudoniphargus and Allomelita, within a cluster of presumedly

  2. Phylogenetic relationships within Echinococcus and Taenia tapeworms (Cestoda: Taeniidae): an inference from nuclear protein-coding genes.

    Science.gov (United States)

    Knapp, Jenny; Nakao, Minoru; Yanagida, Tetsuya; Okamoto, Munehiro; Saarma, Urmas; Lavikainen, Antti; Ito, Akira

    2011-12-01

    The family Taeniidae of tapeworms is composed of two genera, Echinococcus and Taenia, which obligately parasitize mammals including humans. Inferring phylogeny via molecular markers is the only way to trace back their evolutionary histories. However, molecular dating approaches are lacking so far. Here we established new markers from nuclear protein-coding genes for RNA polymerase II second largest subunit (rpb2), phosphoenolpyruvate carboxykinase (pepck) and DNA polymerase delta (pold). Bayesian inference and maximum likelihood analyses of the concatenated gene sequences allowed us to reconstruct phylogenetic trees for taeniid parasites. The tree topologies clearly demonstrated that Taenia is paraphyletic and that the clade of Echinococcus oligarthrus and Echinococcusvogeli is sister to all other members of Echinococcus. Both species are endemic in Central and South America, and their definitive hosts originated from carnivores that immigrated from North America after the formation of the Panamanian land bridge about 3 million years ago (Ma). A time-calibrated phylogeny was estimated by a Bayesian relaxed-clock method based on the assumption that the most recent common ancestor of E. oligarthrus and E. vogeli existed during the late Pliocene (3.0 Ma). The results suggest that a clade of Taenia including human-pathogenic species diversified primarily in the late Miocene (11.2 Ma), whereas Echinococcus started to diversify later, in the end of the Miocene (5.8 Ma). Close genetic relationships among the members of Echinococcus imply that the genus is a young group in which speciation and global radiation occurred rapidly. Copyright © 2011 Elsevier Inc. All rights reserved.

  3. Genetic Diversity and Phylogenetic Relationships of Cytochrome C Oxidase Subunit I in Cimex hemipterus (Hemiptera: Cimicidae) Populations in Malaysia.

    Science.gov (United States)

    Seri Masran, Siti Nor Ain; Ab Majid, Abdul Hafiz

    2017-07-01

    The tropical bed bug is scientifically recognized as a significant public health problem. While there is an increased awareness about their resurgence by medical and life science committees, efficient bed bug management still remains unresolved. The solution may soon arise, as information about bed bugs' infestation dynamics and systematics are becoming more distinguishable. Recent developments in studies about bed bugs are based on molecular intervention by determining their genetic variation and phylogeography. The aim of this study is to assess the phylogenetic relationships and genetic diversity among the populations of tropical bed bugs inhabiting Malaysia. A molecular genotyping study was conducted with 22 tropical bed bug populations composed of three individuals per population. The mitochondrial (COI) gene was used as a marker. The data obtained were analyzed using the T-Coffee, ClustalX, MEGA 6.0, and PAUP software. The results showed one main monophyletic clade that consisted of two groups: Ch01 and Ch02. Ch02 consists of samples from the Bandar Hilir population, differing from the other populations studied by one singleton base. However, as there were no changes in the amino acid, this singleton genetic variation was considered to have no effect on genetic differentiation. Ch01 shows similarity with some sequence of Cimex hemipterus (F.) from Thailand, suggesting an international diversity connection. The disparity index apparently suggests that all isolates are homogeneous populations and are supported by the low value of the mean pairwise distance between isolates. This study will increase the knowledge about phylogeographic diversity of tropical bed bug in Malaysia. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  4. Coalescent-Based Analyses of Genomic Sequence Data Provide a Robust Resolution of Phylogenetic Relationships among Major Groups of Gibbons

    Science.gov (United States)

    Shi, Cheng-Min; Yang, Ziheng

    2018-01-01

    Abstract The phylogenetic relationships among extant gibbon species remain unresolved despite numerous efforts using morphological, behavorial, and genetic data and the sequencing of whole genomes. A major challenge in reconstructing the gibbon phylogeny is the radiative speciation process, which resulted in extremely short internal branches in the species phylogeny and extensive incomplete lineage sorting with extensive gene-tree heterogeneity across the genome. Here, we analyze two genomic-scale data sets, with ∼10,000 putative noncoding and exonic loci, respectively, to estimate the species tree for the major groups of gibbons. We used the Bayesian full-likelihood method bpp under the multispecies coalescent model, which naturally accommodates incomplete lineage sorting and uncertainties in the gene trees. For comparison, we included three heuristic coalescent-based methods (mp-est, SVDQuartets, and astral) as well as concatenation. From both data sets, we infer the phylogeny for the four extant gibbon genera to be (Hylobates, (Nomascus, (Hoolock, Symphalangus))). We used simulation guided by the real data to evaluate the accuracy of the methods used. Astral, while not as efficient as bpp, performed well in estimation of the species tree even in presence of excessive incomplete lineage sorting. Concatenation, mp-est and SVDQuartets were unreliable when the species tree contains very short internal branches. Likelihood ratio test of gene flow suggests a small amount of migration from Hylobates moloch to H. pileatus, while cross-genera migration is absent or rare. Our results highlight the utility of coalescent-based methods in addressing challenging species tree problems characterized by short internal branches and rampant gene tree-species tree discordance. PMID:29087487

  5. Phylogenetic relationship of the Brazilian isolates of the rat lungworm Angiostrongylus cantonensis (Nematoda: Metastrongylidae employing mitochondrial COI gene sequence data

    Directory of Open Access Journals (Sweden)

    Monte Tainá CC

    2012-11-01

    Full Text Available Abstract Background The rat lungworm Angiostrongylus cantonensis can cause eosinophilic meningoencephalitis in humans. This nematode’s main definitive hosts are rodents and its intermediate hosts are snails. This parasite was first described in China and currently is dispersed across several Pacific islands, Asia, Australia, Africa, some Caribbean islands and most recently in the Americas. Here, we report the genetic variability among A. cantonensis isolates from different geographical locations in Brazil using mitochondrial cytochrome c oxidase subunit I (COI gene sequences. Methods The isolates of A. cantonensis were obtained from distinct geographical locations of Brazil. Genomic DNAs were extracted, amplified by polymerase reaction, purified and sequenced. A partial sequence of COI gene was determined to assess their phylogenetic relationship. Results The sequences of A. cantonensis were monophyletic. We identified a distinct clade that included all isolates of A. cantonensis from Brazil and Asia based on eight distinct haplotypes (ac1, ac2, ac3, ac4, ac5, ac6, ac7 and ac8 from a previous study. Interestingly, the Brazilian haplotype ac5 is clustered with isolates from Japan, and the Brazilian haplotype ac8 from Rio de Janeiro, São Paulo, Pará and Pernambuco states formed a distinct clade. There is a divergent Brazilian haplotype, which we named ac9, closely related to Chinese haplotype ac6 and Japanese haplotype ac7. Conclusion The genetic variation observed among Brazilian isolates supports the hypothesis that the appearance of A. cantonensis in Brazil is likely a result of multiple introductions of parasite-carrying rats, transported on ships due to active commerce with Africa and Asia during the European colonization period. The rapid spread of the intermediate host, Achatina fulica, also seems to have contributed to the dispersion of this parasite and the infection of the definitive host in different Brazilian regions.

  6. Phylogenetic relationship of the Brazilian isolates of the rat lungworm Angiostrongylus cantonensis (Nematoda: Metastrongylidae) employing mitochondrial COI gene sequence data

    Science.gov (United States)

    2012-01-01

    Background The rat lungworm Angiostrongylus cantonensis can cause eosinophilic meningoencephalitis in humans. This nematode’s main definitive hosts are rodents and its intermediate hosts are snails. This parasite was first described in China and currently is dispersed across several Pacific islands, Asia, Australia, Africa, some Caribbean islands and most recently in the Americas. Here, we report the genetic variability among A. cantonensis isolates from different geographical locations in Brazil using mitochondrial cytochrome c oxidase subunit I (COI) gene sequences. Methods The isolates of A. cantonensis were obtained from distinct geographical locations of Brazil. Genomic DNAs were extracted, amplified by polymerase reaction, purified and sequenced. A partial sequence of COI gene was determined to assess their phylogenetic relationship. Results The sequences of A. cantonensis were monophyletic. We identified a distinct clade that included all isolates of A. cantonensis from Brazil and Asia based on eight distinct haplotypes (ac1, ac2, ac3, ac4, ac5, ac6, ac7 and ac8) from a previous study. Interestingly, the Brazilian haplotype ac5 is clustered with isolates from Japan, and the Brazilian haplotype ac8 from Rio de Janeiro, São Paulo, Pará and Pernambuco states formed a distinct clade. There is a divergent Brazilian haplotype, which we named ac9, closely related to Chinese haplotype ac6 and Japanese haplotype ac7. Conclusion The genetic variation observed among Brazilian isolates supports the hypothesis that the appearance of A. cantonensis in Brazil is likely a result of multiple introductions of parasite-carrying rats, transported on ships due to active commerce with Africa and Asia during the European colonization period. The rapid spread of the intermediate host, Achatina fulica, also seems to have contributed to the dispersion of this parasite and the infection of the definitive host in different Brazilian regions. PMID:23130987

  7. Phylogenetic relationship of the Brazilian isolates of the rat lungworm Angiostrongylus cantonensis (Nematoda: Metastrongylidae) employing mitochondrial COI gene sequence data.

    Science.gov (United States)

    Monte, Tainá C C; Simões, Raquel O; Oliveira, Ana Paula M; Novaes, Clodoaldo F; Thiengo, Silvana C; Silva, Alexandre J; Estrela, Pedro C; Maldonado, Arnaldo

    2012-11-06

    The rat lungworm Angiostrongylus cantonensis can cause eosinophilic meningoencephalitis in humans. This nematode's main definitive hosts are rodents and its intermediate hosts are snails. This parasite was first described in China and currently is dispersed across several Pacific islands, Asia, Australia, Africa, some Caribbean islands and most recently in the Americas. Here, we report the genetic variability among A. cantonensis isolates from different geographical locations in Brazil using mitochondrial cytochrome c oxidase subunit I (COI) gene sequences. The isolates of A. cantonensis were obtained from distinct geographical locations of Brazil. Genomic DNAs were extracted, amplified by polymerase reaction, purified and sequenced. A partial sequence of COI gene was determined to assess their phylogenetic relationship. The sequences of A. cantonensis were monophyletic. We identified a distinct clade that included all isolates of A. cantonensis from Brazil and Asia based on eight distinct haplotypes (ac1, ac2, ac3, ac4, ac5, ac6, ac7 and ac8) from a previous study. Interestingly, the Brazilian haplotype ac5 is clustered with isolates from Japan, and the Brazilian haplotype ac8 from Rio de Janeiro, São Paulo, Pará and Pernambuco states formed a distinct clade. There is a divergent Brazilian haplotype, which we named ac9, closely related to Chinese haplotype ac6 and Japanese haplotype ac7. The genetic variation observed among Brazilian isolates supports the hypothesis that the appearance of A. cantonensis in Brazil is likely a result of multiple introductions of parasite-carrying rats, transported on ships due to active commerce with Africa and Asia during the European colonization period. The rapid spread of the intermediate host, Achatina fulica, also seems to have contributed to the dispersion of this parasite and the infection of the definitive host in different Brazilian regions.

  8. Reconstruction of phylogenetic relationships in a highly reticulate group with deep coalescence and recent speciation (Hieracium, Asteraceae).

    Science.gov (United States)

    Krak, K; Caklová, P; Chrtek, J; Fehrer, J

    2013-02-01

    Phylogeny reconstruction based on multiple unlinked markers is often hampered by incongruent gene trees, especially in closely related species complexes with high degrees of hybridization and polyploidy. To investigate the particular strengths and limitations of chloroplast DNA (cpDNA), low-copy nuclear and multicopy nuclear markers for elucidating the evolutionary history of such groups, we focus on Hieracium s.str., a predominantly apomictic genus combining the above-mentioned features. Sequences of the trnV-ndhC and trnT-trnL intergenic spacers were combined for phylogenetic analyses of cpDNA. Part of the highly variable gene for squalene synthase (sqs) was applied as a low-copy nuclear marker. Both gene trees were compared with previous results based on the multicopy external transcribed spacer (ETS) of the nuclear ribosomal DNA. The power of the different markers to detect hybridization varied, but they largely agreed on particular hybrid and allopolyploid origins. The same crown groups of species were recognizable in each dataset, but basal relationships were strongly incongruent among cpDNA, sqs and ETS trees. The ETS tree was considered as the best approximation of the species tree. Both cpDNA and sqs trees showed basal polytomies as well as merging or splitting of species groups of non-hybrid taxa. These patterns can be best explained by a rapid diversification of the genus with ancestral polymorphism and incomplete lineage sorting. A hypothetical scenario of Hieracium speciation based on all available (including non-molecular) evidence is depicted. Incorporation of seemingly contradictory information helped to better understand species origins and evolutionary patterns in this notoriously difficult agamic complex.

  9. Maternal phylogenetic relationships and genetic variation among Arabian horse populations using whole mitochondrial DNA D-loop sequencing.

    Science.gov (United States)

    Khanshour, Anas M; Cothran, Ernest Gus

    2013-09-13

    Maternal inheritance is an essential point in Arabian horse population genetics and strains classification. The mitochondrial DNA (mtDNA) sequencing is a highly informative tool to investigate maternal lineages. We sequenced the whole mtDNA D-loop of 251 Arabian horses to study the genetic diversity and phylogenetic relationships of Arabian populations and to examine the traditional strain classification system that depends on maternal family lines using native Arabian horses from the Middle East. The variability in the upstream region of the D-loop revealed additional differences among the haplotypes that had identical sequences in the hypervariable region 1 (HVR1). While the American-Arabians showed relatively low diversity, the Syrian population was the most variable and contained a very rare and old haplogroup. The Middle Eastern horses had major genetic contributions to the Western horses and there was no clear pattern of differentiation among all tested populations. Our results also showed that several individuals from different strains shared a single haplotype, and individuals from a single strain were represented in clearly separated haplogroups. The whole mtDNA D-loop sequence was more powerful for analysis of the maternal genetic diversity in the Arabian horses than using just the HVR1. Native populations from the Middle East, such as Syrians, could be suggested as a hot spot of genetic diversity and may help in understanding the evolution history of the Arabian horse breed. Most importantly, there was no evidence that the Arabian horse breed has clear subdivisions depending on the traditional maternal based strain classification system.

  10. Assessment of phylogenetic relationship of rare plant species collected from Saudi Arabia using internal transcribed spacer sequences of nuclear ribosomal DNA.

    Science.gov (United States)

    Al-Qurainy, F; Khan, S; Nadeem, M; Tarroum, M; Alaklabi, A

    2013-03-11

    The rare and endangered plants of any country are important genetic resources that often require urgent conservation measures. Assessment of phylogenetic relationships and evaluation of genetic diversity is very important prior to implementation of conservation strategies for saving rare and endangered plant species. We used internal transcribed spacer sequences of nuclear ribosomal DNA for the evaluation of sequence identity from the available taxa in the GenBank database by using the Basic Local Alignment Search Tool (BLAST). Two rare plant species viz, Heliotropium strigosum claded with H. pilosum (98% branch support) and Pancratium tortuosum claded with P. tenuifolium (61% branch support) clearly. However, some species, viz Scadoxus multiflorus, Commiphora myrrha and Senecio hadiensis showed close relationships with more than one species. We conclude that nuclear ribosomal internal transcribed spacer sequences are useful markers for phylogenetic study of these rare plant species in Saudi Arabia.

  11. Phylogenetic relationships of the glycoprotein gene of bovine ephemeral fever virus isolated from mainland China, Taiwan, Japan, Turkey, Israel and Australia

    Directory of Open Access Journals (Sweden)

    Zheng Fuying

    2012-11-01

    Full Text Available Abstract Background The glycoprotein (G gene sequences of bovine ephemeral fever virus (BEFV strains derived from mainland China have not been compared with those of the isolates from other countries or areas. Therefore, the G genes of four BEFV isolates obtained from mainland China were amplified and sequenced. A phylogenetic tree was constructed in order to compare and analyze the genetic relationships of the BEFV isolates derived from mainland China and different countries and areas. Results The complete BEFV G gene was successfully amplified and sequenced from four isolates that originated from mainland China. A total of fifty-one BEFV strains were analyzed based on the G gene sequence and were found to be highly conserved. A phylogenetic tree showed that the isolates were grouped into three distinct lineages depending on their source of origin. The antigenic sites of G1, G2 and G3 are conserved among the isolates, except for several substitutions in a few strains. Conclusions The phylogenetic relationships of the BEFV isolates that originated from mainland China, Taiwan, Japan, Turkey, Israel and Australia were closely related to their source of origin, while the antigenic sites G1, G2 and G3 are conserved among the BEFV isolates used in this work.

  12. Phylogenetic relationships of the freshwater alga Boldia erythrosiphon (Compsopogonales, Rhodophyta) based on 18S rRNA gene sequences

    NARCIS (Netherlands)

    Holton, R.W; Boele-Bos, S.A.; Stam, W.T.

    The nuclear small-subunit ribosomal DNA sequence from the freshwater red alga Boldia erythrosiphon Herndon emend Howard et Parker was determined. Phylogenetic analysis confirms the positioning of this species within the bangiophycidean order of the Compsopogonales. The results strongly suggest that

  13. Biogeographic links between southern Atlantic Forest and western South America: Rediscovery, re-description, and phylogenetic relationships of two rare montane anole lizards from Brazil.

    Science.gov (United States)

    Prates, Ivan; Melo-Sampaio, Paulo Roberto; Drummond, Leandro de Oliveira; Teixeira, Mauro; Rodrigues, Miguel Trefaut; Carnaval, Ana Carolina

    2017-08-01

    Data on species ranges and phylogenetic relationships are key in historical biogeographical inference. In South America, our understanding of the evolutionary processes that underlie biodiversity patterns varies greatly across regions. Little is known, for instance, about the drivers of high endemism in the southern montane region of the Atlantic Rainforest. In this region, former biogeographic connections with other South American ecosystems have been invoked to explain the phylogenetic affinities of a number of endemic taxa. This may also be the case of the montane anole lizards Anolis nasofrontalis and A. pseudotigrinus, known from few specimens collected more than 40years ago. We combine new genetic data with published sequences of species in the Dactyloa clade of Anolis to investigate the phylogenetic relationships of A. nasofrontalis and A. pseudotigrinus, as well as estimate divergence times from their closest relatives. Based on newly sampled and previously overlooked specimens, we provide a taxonomic re-description of those two taxa. Our phylogenetic analysis recovered six main clades within Dactyloa, five of which were previously referred to as species series (aequatorialis, heterodermus, latifrons, punctatus, roquet). A sixth clade clustered A. nasofrontalis and A. pseudotigrinus with A. dissimilis from western Amazonia, A. calimae from the Andes, A. neblininus from the Guiana Shield, and two undescribed Andean taxa. We therefore define a sixth species series within Dactyloa: the neblininus series. Close phylogenetic relationships between highly disjunct, narrowly-distributed anoles suggest that patches of suitable habitat connected the southern Atlantic Forest to western South America during the Miocene, in agreement with the age of former connections between the central Andes and the Brazilian Shield as a result of Andean orogeny. The data also support the view of recurrent evolution (or loss) of a twig anole-like phenotype in mainland anoles, in

  14. Re-Evaluation of Phylogenetic Relationships among Species of the Mangrove Genus Avicennia from Indo-West Pacific Based on Multilocus Analyses.

    Science.gov (United States)

    Li, Xinnian; Duke, Norman C; Yang, Yuchen; Huang, Lishi; Zhu, Yuxiang; Zhang, Zhang; Zhou, Renchao; Zhong, Cairong; Huang, Yelin; Shi, Suhua

    2016-01-01

    Avicennia L. (Avicenniaceae), one of the most diverse mangrove genera, is distributed widely in tropical and subtropical intertidal zones worldwide. Five species of Avicennia in the Indo-West Pacific region have been previously described. However, their phylogenetic relationships were determined based on morphological and allozyme data. To enhance our understanding of evolutionary patterns in the clade, we carried out a molecular phylogenetic study using wide sampling and multiple loci. Our results support two monophyletic clades across all species worldwide in Avicennia: an Atlantic-East Pacific (AEP) lineage and an Indo-West Pacific (IWP) lineage. This split is in line with biogeographic distribution of the clade. Focusing on the IWP branch, we reconstructed a detailed phylogenetic tree based on sequences from 25 nuclear genes. The results identified three distinct subclades, (1) A. rumphiana and A. alba, (2) A. officinalis and A. integra, and (3) the A. marina complex, with high bootstrap support. The results strongly corresponded to two morphological traits in floral structure: stigma position in relation to the anthers and style length. Using Bayesian dating methods we estimated diversification of the IWP lineage was dated to late Miocene (c. 6.0 million years ago) and may have been driven largely by the fluctuating sea levels since that time.

  15. Re-Evaluation of Phylogenetic Relationships among Species of the Mangrove Genus Avicennia from Indo-West Pacific Based on Multilocus Analyses.

    Directory of Open Access Journals (Sweden)

    Xinnian Li

    Full Text Available Avicennia L. (Avicenniaceae, one of the most diverse mangrove genera, is distributed widely in tropical and subtropical intertidal zones worldwide. Five species of Avicennia in the Indo-West Pacific region have been previously described. However, their phylogenetic relationships were determined based on morphological and allozyme data. To enhance our understanding of evolutionary patterns in the clade, we carried out a molecular phylogenetic study using wide sampling and multiple loci. Our results support two monophyletic clades across all species worldwide in Avicennia: an Atlantic-East Pacific (AEP lineage and an Indo-West Pacific (IWP lineage. This split is in line with biogeographic distribution of the clade. Focusing on the IWP branch, we reconstructed a detailed phylogenetic tree based on sequences from 25 nuclear genes. The results identified three distinct subclades, (1 A. rumphiana and A. alba, (2 A. officinalis and A. integra, and (3 the A. marina complex, with high bootstrap support. The results strongly corresponded to two morphological traits in floral structure: stigma position in relation to the anthers and style length. Using Bayesian dating methods we estimated diversification of the IWP lineage was dated to late Miocene (c. 6.0 million years ago and may have been driven largely by the fluctuating sea levels since that time.

  16. Revealing pancrustacean relationships: Phylogenetic analysis of ribosomal protein genes places Collembola (springtails in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers

    Directory of Open Access Journals (Sweden)

    Mariën J

    2008-03-01

    Full Text Available Abstract Background In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. Results In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length, of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Conclusion Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.

  17. Revealing pancrustacean relationships: phylogenetic analysis of ribosomal protein genes places Collembola (springtails) in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers.

    Science.gov (United States)

    Timmermans, M J T N; Roelofs, D; Mariën, J; van Straalen, N M

    2008-03-12

    In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length), of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.

  18. Phylogenetic Relationships among Species of Phellinus sensu stricto, Cause of White Trunk Rot of Hardwoods, from Northern North America

    Directory of Open Access Journals (Sweden)

    Nicholas J. Brazee

    2015-11-01

    Full Text Available Species in Phellinus s.s. are some of the most important wood-decaying fungal pathogens in northern temperate forests, yet data on species incidence in North America remains limited. Therefore, phylogenetic analyses were performed using four loci (ITS, nLSU, tef1 and rpb2 with isolates representing 13 species. Results of phylogenetic analyses using maximum likelihood and Bayesian inference revealed that eight species of Phellinus s.s. occur in North America, and include: P. alni, P. arctostaphyli, P. betulinus, P. lundellii, P. nigricans, P. tremulae and two undescribed species, P. NA1 and P. NA2. Meanwhile, P. tuberculosus, P. igniarius s.s., P. populicola, P. laevigatus s.s. and P. orienticus were not detected and appear restricted to Europe and/or Asia. The tef1 dataset outperformed all other loci used and was able to discriminate among all 13 of the currently known Phellinus s.s. species with significant statistical support. The internal transcribed spacer (ITS region performed well but a high level of intraspecific variation could lead to inflated taxa recognition. Phellinus alni exhibited the broadest host range, as demonstrated previously, and appears to be the most common species in northern hardwood (Acer-Betula-Fagus, northern floodplain (Fraxinus-Populus-Ulmus and coastal alder (Alnus forests of North America.

  19. A Universal Phylogenetic Tree.

    Science.gov (United States)

    Offner, Susan

    2001-01-01

    Presents a universal phylogenetic tree suitable for use in high school and college-level biology classrooms. Illustrates the antiquity of life and that all life is related, even if it dates back 3.5 billion years. Reflects important evolutionary relationships and provides an exciting way to learn about the history of life. (SAH)

  20. Incompletely resolved phylogenetic trees inflate estimates of phylogenetic conservatism.

    Science.gov (United States)

    Davies, T Jonathan; Kraft, Nathan J B; Salamin, Nicolas; Wolkovich, Elizabeth M

    2012-02-01

    The tendency for more closely related species to share similar traits and ecological strategies can be explained by their longer shared evolutionary histories and represents phylogenetic conservatism. How strongly species traits co-vary with phylogeny can significantly impact how we analyze cross-species data and can influence our interpretation of assembly rules in the rapidly expanding field of community phylogenetics. Phylogenetic conservatism is typically quantified by analyzing the distribution of species values on the phylogenetic tree that connects them. Many phylogenetic approaches, however, assume a completely sampled phylogeny: while we have good estimates of deeper phylogenetic relationships for many species-rich groups, such as birds and flowering plants, we often lack information on more recent interspecific relationships (i.e., within a genus). A common solution has been to represent these relationships as polytomies on trees using taxonomy as a guide. Here we show that such trees can dramatically inflate estimates of phylogenetic conservatism quantified using S. P. Blomberg et al.'s K statistic. Using simulations, we show that even randomly generated traits can appear to be phylogenetically conserved on poorly resolved trees. We provide a simple rarefaction-based solution that can reliably retrieve unbiased estimates of K, and we illustrate our method using data on first flowering times from Thoreau's woods (Concord, Massachusetts, USA).

  1. Pachyseris inattesa sp. n. (Cnidaria, Anthozoa, Scleractinia): A new reef coral species from the red sea and its phylogenetic relationships

    KAUST Repository

    Terraneo, Tullia I.; Berumen, Michael L.; Arrigoni, Roberto; Waheed, Zarinah; Bouwmeester, Jessica; Caragnano, Annalisa; Stefani, Fabrizio; Benzoni, Francesca

    2014-01-01

    A new scleractinian coral species, Pachyseris inattesa sp. n., is described from the Red Sea. Despite a superficial resemblance with some species in the agariciid genus Leptoseris with which it has been previously confused, P. inattesa sp. n. has micro-morphological characters typical of the genus Pachyseris. This genus, once part of the Agariciidae, is comprised of five extant species and is widely distributed throughout the tropical Indo-Pacific. It is currently incertae sedis as a result of recent molecular analysis and appears to be closely related to the Euphylliidae. A molecular phylogenetic reconstruction including P. inattesa sp. n., the genus type species P. rugosa, and P. speciosa, all present in the Red Sea, was performed using the mitochondrial intergenic spacer between COI and 16S-rRNA. The results confirm that P. inattesa sp. n. is a monophyletic lineage closely related to the other Pachyseris species examined. © Tullia I. Terraneo et al.

  2. A new subtype of hepatitis C virus genotype 1: complete genome and phylogenetic relationships of an Equatorial Guinea isolate.

    Science.gov (United States)

    Bracho, Maria Alma; Carrillo-Cruz, Francy Yolima; Ortega, Enrique; Moya, Andrés; González-Candelas, Fernando

    2006-06-01

    Hepatitis C virus (HCV) is the leading cause of chronic liver disease and is associated with hepatocellular carcinoma. However, there have been few studies on the distribution and genetic diversity of HCV isolates in non-developed countries. Here, the complete genome sequence of an HCV genotype 1 isolate from Equatorial Guinea is reported, the first complete HCV-1 genome of African origin. Phylogenetic analysis revealed that this sequence always grouped with sequences of genotype 1, but did not group clearly with any subtype described so far. An analysis of partial NS5B gene sequences with additional sequences of African origin also failed to find close similarities between the new sequence and any previously known isolate. Genetic divergence of the coding region of this new sequence with respect to the recognized subtypes of HCV-1 ranged from 20 to 22%. It is proposed that this isolate is a representative of a new, distinct variant of HCV subtype 1.

  3. Pachyseris inattesa sp. n. (Cnidaria, Anthozoa, Scleractinia): A new reef coral species from the red sea and its phylogenetic relationships

    KAUST Repository

    Terraneo, Tullia I.

    2014-08-13

    A new scleractinian coral species, Pachyseris inattesa sp. n., is described from the Red Sea. Despite a superficial resemblance with some species in the agariciid genus Leptoseris with which it has been previously confused, P. inattesa sp. n. has micro-morphological characters typical of the genus Pachyseris. This genus, once part of the Agariciidae, is comprised of five extant species and is widely distributed throughout the tropical Indo-Pacific. It is currently incertae sedis as a result of recent molecular analysis and appears to be closely related to the Euphylliidae. A molecular phylogenetic reconstruction including P. inattesa sp. n., the genus type species P. rugosa, and P. speciosa, all present in the Red Sea, was performed using the mitochondrial intergenic spacer between COI and 16S-rRNA. The results confirm that P. inattesa sp. n. is a monophyletic lineage closely related to the other Pachyseris species examined. © Tullia I. Terraneo et al.

  4. A Closer Look at Bacteroides: Phylogenetic Relationship and Genomic Implications of a Life in the Human Gut

    DEFF Research Database (Denmark)

    Karlsson, Fredrik H.; Ussery, David; Nielsen, Jens

    2011-01-01

    The human gut is extremely densely inhabited by bacteria mainly from two phyla, Bacteroidetes and Firmicutes, and there is a great interest in analyzing whole-genome sequences for these species because of their relation to human health and disease. Here, we do whole-genome comparison of 105...... of extracytoplasmic function σ factors (ECF σ factors) and two component systems for extracellular signal transduction compared to other Bacteroidetes/Chlorobi species. A whole-genome phylogenetic analysis shows a very little difference between the Parabacteroides and Bacteroides genera. Further analysis shows...... of members of the Bacteroidetes/Chlorobi phylum by whole genome comparison. Gut living Bacteroides have an enriched set of glycan, vitamin, and cofactor enzymes important for diet digestion....

  5. Phylogenetic relationships and timing of diversification in gonorynchiform fishes inferred using nuclear gene DNA sequences (Teleostei: Ostariophysi).

    Science.gov (United States)

    Near, Thomas J; Dornburg, Alex; Friedman, Matt

    2014-11-01

    The Gonorynchiformes are the sister lineage of the species-rich Otophysi and provide important insights into the diversification of ostariophysan fishes. Phylogenies of gonorynchiforms inferred using morphological characters and mtDNA gene sequences provide differing resolutions with regard to the sister lineage of all other gonorynchiforms (Chanos vs. Gonorynchus) and support for monophyly of the two miniaturized lineages Cromeria and Grasseichthys. In this study the phylogeny and divergence times of gonorynchiforms are investigated with DNA sequences sampled from nine nuclear genes and a published morphological character matrix. Bayesian phylogenetic analyses reveal substantial congruence among individual gene trees with inferences from eight genes placing Gonorynchus as the sister lineage to all other gonorynchiforms. Seven gene trees resolve Cromeria and Grasseichthys as a clade, supporting previous inferences using morphological characters. Phylogenies resulting from either concatenating the nuclear genes, performing a multispecies coalescent species tree analysis, or combining the morphological and nuclear gene DNA sequences resolve Gonorynchus as the living sister lineage of all other gonorynchiforms, strongly support the monophyly of Cromeria and Grasseichthys, and resolve a clade containing Parakneria, Cromeria, and Grasseichthys. The morphological dataset, which includes 13 gonorynchiform fossil taxa that range in age from Early Cretaceous to Eocene, was analyzed in combination with DNA sequences from the nine nuclear genes and a relaxed molecular clock to estimate times of evolutionary divergence. This "tip dating" strategy accommodates uncertainty in the phylogenetic resolution of fossil taxa that provide calibration information in the relaxed molecular clock analysis. The estimated age of the most recent common ancestor (MRCA) of living gonorynchiforms is slightly older than estimates from previous node dating efforts, but the molecular tip dating

  6. Mitochondrial genomes of Meloidogyne chitwoodi and M. incognita (Nematoda: Tylenchina): comparative analysis, gene order and phylogenetic relationships with other nematodes.

    Science.gov (United States)

    Humphreys-Pereira, Danny A; Elling, Axel A

    2014-01-01

    Root-knot nematodes (Meloidogyne spp.) are among the most important plant pathogens. In this study, the mitochondrial (mt) genomes of the root-knot nematodes, M. chitwoodi and M. incognita were sequenced. PCR analyses suggest that both mt genomes are circular, with an estimated size of 19.7 and 18.6-19.1kb, respectively. The mt genomes each contain a large non-coding region with tandem repeats and the control region. The mt gene arrangement of M. chitwoodi and M. incognita is unlike that of other nematodes. Sequence alignments of the two Meloidogyne mt genomes showed three translocations; two in transfer RNAs and one in cox2. Compared with other nematode mt genomes, the gene arrangement of M. chitwoodi and M. incognita was most similar to Pratylenchus vulnus. Phylogenetic analyses (Maximum Likelihood and Bayesian inference) were conducted using 78 complete mt genomes of diverse nematode species. Analyses based on nucleotides and amino acids of the 12 protein-coding mt genes showed strong support for the monophyly of class Chromadorea, but only amino acid-based analyses supported the monophyly of class Enoplea. The suborder Spirurina was not monophyletic in any of the phylogenetic analyses, contradicting the Clade III model, which groups Ascaridomorpha, Spiruromorpha and Oxyuridomorpha based on the small subunit ribosomal RNA gene. Importantly, comparisons of mt gene arrangement and tree-based methods placed Meloidogyne as sister taxa of Pratylenchus, a migratory plant endoparasitic nematode, and not with the sedentary endoparasitic Heterodera. Thus, comparative analyses of mt genomes suggest that sedentary endoparasitism in Meloidogyne and Heterodera is based on convergent evolution. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Phylogenetic relationships of Sarcocystis neurona of horses and opossums to other cyst-forming coccidia deduced from SSU rRNA gene sequences.

    Science.gov (United States)

    Elsheikha, Hany M; Lacher, David W; Mansfield, Linda S

    2005-11-01

    Phylogenetic analyses based on sequences of the nuclear-encoded small subunit rRNA (ssurRNA) gene were performed to examine the origin, phylogeny, and biogeographic relationships of Sarcocystis neurona isolates from opossums and horses from the State of Michigan, USA, in relation to other cyst-forming coccidia. A total of 31 taxa representing all recognized subfamilies and genera of Sarcocystidae were included in the analyses with clonal isolates of two opossum and two horse S. neurona. Phylogenies obtained by the four tree-building methods were consistent with the classical taxonomy based on morphological criteria. The "isosporid" coccidia Neospora, Toxoplasma, Besnoitia, Isospora lacking stieda bodies, and Hyaloklossia formed a sister group to the Sarcocystis spp. Sarcocystis species were divided into three main lineages; S. neurona isolates were located in the second lineage and clustered with S. mucosa, S. dispersa, S. lacertae, S. rodentifelis, S. muris, and Frenkelia spp. Alignment of S. neurona SSU rRNA gene sequences of Michigan opossum isolates (MIOP5, MIOP20) and a S. neurona Michigan horse isolate (MIH8) showed 100% identity. These Michigan isolates differed in 2/1085 bp (0.2%) from a Kentucky S. neurona horse isolate (SN5). Additionally, S. neurona isolates from horses and opossums were identical based on the ultrastructural features and PCR-RFLP analyses thus forming a phylogenetically indistinct group in these regions. These findings revealed the concordance between the morphological and molecular data and confirmed that S. neurona from opossums and horses originated from the same phylogenetic origin.

  8. Unveiling the Identity of Wenwan Walnuts and Phylogenetic Relationships of Asian Juglans Species Using Restriction Site-Associated DNA-Sequencing

    Directory of Open Access Journals (Sweden)

    Xian-Yun Mu

    2017-10-01

    Full Text Available Juglans species have considerable ecological and economic value worldwide. In China, Wenwan walnuts have been collected by aristocrats and noblemen for more than 2000 years. As a diversity center of Asian Juglans, five species are widely distributed in China. The most famous of these is Mahetao (J. hopeiensis, which is an uncharacterized species that is mostly cultivated. Wild J. hopeiensis individuals are very rare and are endemic to Hebei Province. Because of the minimal variations in previously used molecular markers and the heterogeneity between chloroplast and nuclear genomes, determining the phylogenetic relationships among the Juglans species has been challenging, and has hindered subsequent evolutionary inferences. In this study, we collected enough materials for both cultivated and wild Mahetao to construct well-resolved phylogenetic trees for Asian Juglans species. We used a high-throughput genome-wide restriction site-associated DNA sequencing method. Consequently, the identity of J. hopeiensis has been clearly resolved. Our results indicate that J. hopeiensis is a hybrid of J. regia and J. mandshurica. However, J. hopeiensis, J. regia and J. sigillata should be considered as a single species from section Juglans. Additionally, J. ailantifolia, J. cathayensis, and J. mandshurica likely represent one species from section Cardiocaryon according to morphological and molecular studies. These results are supported by population structure analysis and morphological comparison. We propose that J. hopeiensis trees growing in the wild should be conserved because of the economic value of their nuts. These trees may be of particular importance to impoverished communities. Furthermore, they may serve as a valuable genetic resource relevant for enhancing the production of edible walnuts. The 2b-RAD method is a viable option for future phylogenetic studies of Juglans species as well as other plant species.

  9. Hepatozoon canis in German red foxes (Vulpes vulpes) and their ticks: molecular characterization and the phylogenetic relationship to other Hepatozoon spp.

    Science.gov (United States)

    Najm, Nour-Addeen; Meyer-Kayser, Elisabeth; Hoffmann, Lothar; Pfister, Kurt; Silaghi, Cornelia

    2014-07-01

    In this study, the prevalence of Hepatozoon spp. in red foxes (Vulpes vulpes) and their ticks from Germany, as well as molecular characterizations and phylogenetic relationship to other Hepatozoon spp. were investigated. DNA extracts of 261 spleen samples and 1,953 ticks were examined for the presence of Hepatozoon spp. by a conventional polymerase chain reaction (PCR) targeting the 18S rRNA gene. The ticks included four tick species: Ixodes ricinus, Ixodes canisuga, Ixodes hexagonus and Dermacentor reticulatus. A total of 118/261 foxes (45.2%) and 148/1,953 ticks (7.5%) were Hepatozoon PCR-positive. Amplicons from 36 positive foxes and 41 positive ticks were sequenced. All sequences obtained from foxes and 39/41 from ticks had a 99% similarity to Hepatozoon canis, whereas two ticks' sequences had a 99% identity to Hepatozoon sp. The obtained Hepatozoon sequences in this study were phylogenetically related to other Hepatozoon sequences detected in other countries, which may represent strain variants. The high prevalence of H. canis DNA in red foxes in this study supports the suggested role of those animals in distribution of this parasite. Furthermore, detection of DNA of H. canis in foxes and all examined tick species collected from those foxes allows speculating about previously undescribed potential vectors for H. canis and suggests a potential role of the red fox in its natural endemic cycles.

  10. Diversity of 16S-23S rDNA internal transcribed spacer (ITS reveals phylogenetic relationships in Burkholderia pseudomallei and its near-neighbors.

    Directory of Open Access Journals (Sweden)

    Andrew P Liguori

    Full Text Available Length polymorphisms within the 16S-23S ribosomal DNA internal transcribed spacer (ITS have been described as stable genetic markers for studying bacterial phylogenetics. In this study, we used these genetic markers to investigate phylogenetic relationships in Burkholderia pseudomallei and its near-relative species. B. pseudomallei is known as one of the most genetically recombined bacterial species. In silico analysis of multiple B. pseudomallei genomes revealed approximately four homologous rRNA operons and ITS length polymorphisms therein. We characterized ITS distribution using PCR and analyzed via a high-throughput capillary electrophoresis in 1,191 B. pseudomallei strains. Three major ITS types were identified, two of which were commonly found in most B. pseudomallei strains from the endemic areas, whereas the third one was significantly correlated with worldwide sporadic strains. Interestingly, mixtures of the two common ITS types were observed within the same strains, and at a greater incidence in Thailand than Australia suggesting that genetic recombination causes the ITS variation within species, with greater recombination frequency in Thailand. In addition, the B. mallei ITS type was common to B. pseudomallei, providing further support that B. mallei is a clone of B. pseudomallei. Other B. pseudomallei near-neighbors possessed unique and monomorphic ITS types. Our data shed light on evolutionary patterns of B. pseudomallei and its near relative species.

  11. Phylogenetic relationships in the genus Leonardoxa (Leguminosae: Caesalpinioideae) inferred from chloroplast trnL intron and trnL-trnF intergenic spacer sequences.

    Science.gov (United States)

    Brouat, Carine; Gielly, Ludovic; McKey, Doyle

    2001-01-01

    The African genus LEONARDOXA: (Leguminosae: Caesalpinioideae) comprises two Congolean species and a group of four mostly allopatric subspecies principally located in Cameroon and clustered together in the L. africana complex. LEONARDOXA: provides a good opportunity to investigate the evolutionary history of ant-plant mutualisms, as it exhibits various grades of ant-plant interactions from diffuse to obligate and symbiotic associations. We present in this paper the first molecular phylogenetic study of this genus. We sequenced both the chloroplast DNA trnL intron (677 aligned base pairs [bp]) and trnL-trnF intergene spacer (598 aligned bp). Inferred phylogenetic relationships suggested first that the genus is paraphyletic. The L. africana complex is clearly separated from the two Congolean species, and the integrity of the genus is thus in question. In the L. africana complex, our data showed a lack of congruence between clades suggested by morphological and chloroplast characters. This, and the low level of molecular divergence found between subspecies, suggests gene flow and introgressive events in the L. africana complex.

  12. Phylogenetic relationships of Scomberomorus commerson using sequence analysis of the mtDNA D-loop region in the Persian Gulf, Oman Sea and Arabian Sea

    Directory of Open Access Journals (Sweden)

    Ana Mansourkiaei

    2016-04-01

    Full Text Available Abstract Narrow-barred Spanish mackerel, Scomberomorus commerson, is an epipelagic and migratory species of family Scombridae which have a significant role in terms of ecology and fishery. 100 samples were collected from the Persian Gulf, Oman Sea and Arabian Sea. Part of their dorsal fins was snipped and transferred to micro-tubes containing ethanol; then, DNAs were extracted and HRM-Real Time PCR was performed to designate representative specimens for sequencing. Phylogenetic relationships of S. commerson from Persian Gulf, Oman Sea and Arabian Sea were investigated using sequence data of mitochondrial DNA D-loop region. None clustered Neighbor Joining tree indicated the proximity amid S. commerson in four sites. As numbers demonstrated in sequence analyses of mitochondrial DNA D-Loop region a sublimely high degree of genetic similarity among S. commerson from the Persian Gulf and Oman Sea were perceived, thereafter, having one stock structure of S. commerson in four regions were proved, and this approximation can be merely justified by their migration process along the coasts of Oman Sea and Persian Gulf. Therefore, the assessment of distribution patterns of 20 haplotypes in the constructed phylogenetic tree using mtDNA D-Loop sequences ascertained that no significant clustering according to the sampling sites was concluded.

  13. [Relationship of job stress with job burnout and quality of work life in workers for offshore oil platforms].

    Science.gov (United States)

    Zhang, Y; Liu, X L; Wei, T D; Lan, Y J

    2017-03-20

    Objective: To evaluate the current status of job burnout and qual ity of work life (QWL) in workers for offshore oil platforms, and to analyze the relationship of job stress with job burnout and QWL and the direct and indirect effects of job stress on QWL. Methods: Cluster random sampling was used to select 382 work-ers for 8 oil platforms of China National Offshore Oil Corporation in October 2015. A self - designed questionnaire was used to collect the individual characteristics of subjects. The Quality of Work Life Scale (QWL7 - 32) , Occupa-tional Stress Inventory - Revised Edition (OSI - R) , and Maslach Burnout Inventory - General Survey (MBI - GS) were used to investigate the QWL, job stress, and job burnout of subjects. Results: Among all the workers for offshore oil platforms, 87.2% had mild job burnout. The total QWL score was 116.01 ± 16.73; 8.3% of the workers had poor QWL, and 68.5% had moderate QWL. QWL was reduced with heavier task, vaguer task, and increasing mental stress and physical stress ( P stress had di-rect and indirect effects on QWL; stress reaction had the most effect on QWL (total effect size - 0.509) , followed by social support (total effect size 0.444) . Conclusion: Most workers for offshore oil platforms have mild job burn-out and moderate QWL. Job stress is associated with job burnout and QWL, and stress reaction and social support have relatively high influence on QWL.

  14. Phylogenetic relationships of Semaphore geckos (Squamata: Sphaerodactylidae: Pristurus) with an assessment of the taxonomy of Pristurus rupestris.

    Science.gov (United States)

    Badiane, Arnaud; Garcia-Porta, Joan; Červenka, Jan; Kratochvíl, Lukáš; Sindaco, Roberto; Robinson, Michael D; Morales, Hernan; Mazuch, Tomáš; Price, Thomas; Amat, Fèlix; Shobrak, Mohammed Y; Wilms, Thomas; Simó-Riudalbas, Marc; Ahmadzadeh, Faraham; Papenfuss, Theodore J; Cluchier, Alexandre; Viglione, Julien; Carranza, Salvador

    2014-07-09

    A molecular phylogeny of the sphaerodactylid geckos of the genus Pristurus is inferred based on an alignment of 1845 base pairs (bp) of concatenated mitochondrial (12S) and nuclear (acm4, cmos, rag1 and rag2) genes for 80 individuals, representing 18 of the 23-26 species, and the three subspecies of P. rupestris. The results indicate that P. rupestris is polyphyletic and includes two highly divergent clades: the eastern clade, found in coastal Iran and throughout the Hajar Mountain range in northern Oman and eastern UAE; and the western clade, distributed from central coastal Oman, through Yemen, Saudi Arabia and north to southern Jordan. Inferred haplotype networks for the four nuclear genes show that the eastern and western clades of "P. rupestris" are highly differentiated and do not share any alleles. Moreover, although the two clades are differentiated by a morphological multivariate analysis, no one character or set of characters was found to be diagnostic. Based on the molecular analysis of specimens from the type locality of P. rupestris rupestris, the name P. rupestris is applied to the eastern clade. The name that should apply to the western clade cannot be clarified until morphological and genetic data for "P. rupestris" is available from the vicinity of Bosaso, Somalia, and therefore we refer to it as Pristurus sp. 1. The phylogenetic tree of Pristurus supports the hypothesis that P. celerrimus is sister to all the other species in the analyses and that the Socotra Archipelago was independently colonized a minimum of two times.

  15. The Efficacy of Consensus Tree Methods for Summarizing Phylogenetic Relationships from a Posterior Sample of Trees Estimated from Morphological Data.

    Science.gov (United States)

    O'Reilly, Joseph E; Donoghue, Philip C J

    2018-03-01

    Consensus trees are required to summarize trees obtained through MCMC sampling of a posterior distribution, providing an overview of the distribution of estimated parameters such as topology, branch lengths, and divergence times. Numerous consensus tree construction methods are available, each presenting a different interpretation of the tree sample. The rise of morphological clock and sampled-ancestor methods of divergence time estimation, in which times and topology are coestimated, has increased the popularity of the maximum clade credibility (MCC) consensus tree method. The MCC method assumes that the sampled, fully resolved topology with the highest clade credibility is an adequate summary of the most probable clades, with parameter estimates from compatible sampled trees used to obtain the marginal distributions of parameters such as clade ages and branch lengths. Using both simulated and empirical data, we demonstrate that MCC trees, and trees constructed using the similar maximum a posteriori (MAP) method, often include poorly supported and incorrect clades when summarizing diffuse posterior samples of trees. We demonstrate that the paucity of information in morphological data sets contributes to the inability of MCC and MAP trees to accurately summarise of the posterior distribution. Conversely, majority-rule consensus (MRC) trees represent a lower proportion of incorrect nodes when summarizing the same posterior samples of trees. Thus, we advocate the use of MRC trees, in place of MCC or MAP trees, in attempts to summarize the results of Bayesian phylogenetic analyses of morphological data.

  16. Morphological re-description and phylogenetic relationship of five myxosporean species of the family Myxobolidae infecting Nile tilapia.

    Science.gov (United States)

    Abdel-Gaber, Rewaida; Abdel-Ghaffar, Fathy; Maher, Sherein; El-Mallah, Al-Mahy; Al Quraishy, Saleh; Mehlhorn, Heinz

    2017-05-11

    Freshwater fish have a major economic and nutritional importance worldwide. Myxosporeans are highly dangerous parasites that infect different fish species, causing severe damage to a large number of economically important species, especially in aquaculture. We conducted a survey of myxosporean parasites infecting Nile tilapia Oreochromis niloticus (Perciformes: Cichlidae) collected from different localities along the River Nile passing through Giza province, Egypt. Out of 100 fish specimens collected, 45 were found to be naturally infected with these parasites in the region of the trunk kidney. Light microscopic examination revealed the presence of 5 distinct myxosporean species belonging to 2 different genera, viz. Myxobolus and Triangula, belonging to the family Myxobolidae; all 5 species have been previously described. Morphological characteristics, host specificity and geographical distribution, tissue tropism, and molecular analysis of the partial sequence of small subunit ribosomal DNA gene revealed that the recovered myxosporean species described herein were genetically distinct from other myxozoan species but had 95% sequence similarity to M. cerebralis. Also, phylogenetic analysis placed the present myxosporean species in the freshwater Myxobolus clade, which is a sister group of freshwater Myxobolus/Henneguya species.

  17. Analysis of Comparative Sequence and Genomic Data to Verify Phylogenetic Relationship and Explore a New Subfamily of Bacterial Lipases.

    Directory of Open Access Journals (Sweden)

    Malihe Masomian

    Full Text Available Thermostable and organic solvent-tolerant enzymes have significant potential in a wide range of synthetic reactions in industry due to their inherent stability at high temperatures and their ability to endure harsh organic solvents. In this study, a novel gene encoding a true lipase was isolated by construction of a genomic DNA library of thermophilic Aneurinibacillus thermoaerophilus strain HZ into Escherichia coli plasmid vector. Sequence analysis revealed that HZ lipase had 62% identity to putative lipase from Bacillus pseudomycoides. The closely characterized lipases to the HZ lipase gene are from thermostable Bacillus and Geobacillus lipases belonging to the subfamily I.5 with ≤ 57% identity. The amino acid sequence analysis of HZ lipase determined a conserved pentapeptide containing the active serine, GHSMG and a Ca(2+-binding motif, GCYGSD in the enzyme. Protein structure modeling showed that HZ lipase consisted of an α/β hydrolase fold and a lid domain. Protein sequence alignment, conserved regions analysis, clustal distance matrix and amino acid composition illustrated differences between HZ lipase and other thermostable lipases. Phylogenetic analysis revealed that this lipase represented a new subfamily of family I of bacterial true lipases, classified as family I.9. The HZ lipase was expressed under promoter Plac using IPTG and was characterized. The recombinant enzyme showed optimal activity at 65 °C and retained ≥ 97% activity after incubation at 50 °C for 1h. The HZ lipase was stable in various polar and non-polar organic solvents.

  18. Phylogenetic relationships within anuran clade Terrarana, with emphasis on the placement of Brazilian Atlantic rainforest frogs genus Ischnocnema (Anura: Brachycephalidae).

    Science.gov (United States)

    Canedo, Clarissa; Haddad, Célio F B

    2012-11-01

    We present a phylogenetic hypothesis of the anuran clade Terrarana based on partial sequences of nuclear (Tyr and RAG1) and mitochondrial (12S, tRNA-Val, and 16S) genes, testing the monophyly of Ischnocnema and its species series. We performed maximum parsimony, maximum likelihood, and Bayesian inference analyses on 364 terminals: 11 outgroup terminals and 353 ingroup Terrarana terminals, including 139 Ischnocnema terminals (accounting for 29 of the 35 named Ischnocnema species) and 214 other Terrarana terminals within the families Brachycephalidae, Ceuthomantidae, Craugastoridae, and Eleutherodactylidae. Different optimality criteria produced similar results and mostly recovered the currently accepted families and genera. According to these topologies, Ischnocnema is not a monophyletic group. We propose new combinations for three species, relocating them to Pristimantis, and render Eleutherodactylus bilineatus Bokermann, 1975 incertae sedis status within Holoadeninae. The rearrangements in Ischnocnema place it outside the northernmost Brazilian Atlantic rainforest, where the fauna of Terrarana comprises typical Amazonian genera. Copyright © 2012 Elsevier Inc. All rights reserved.

  19. Studies on Morphological and Phylogenetic Relationship of Salak Pondoh Varieties (Salacca zalacca (Gaert. Voss. at Sleman Highlands

    Directory of Open Access Journals (Sweden)

    NUR HIDAYAH

    2000-07-01

    Full Text Available The objectives of the study were to know the morphological variation of salak-plants (Salacca zalacca (Gaert. Voss. and their relationship. The study was conducted in May to April 2000, at Turi and Pakem of Sleman district, Yogyakarta. Samples were randomly taken, 5 plants of each variety were studied their morphological characters such as stem, leaf, flower and fruit. The data collected were then analyzed descriptive comparatively and their relationships were then determined. The result of the study indicate that there were at least 8 varieties of salak at Sleman district, green-, black-, yellow-, manggala-, red-yellow-, golden-, red-, and red-black pondoh. Morphological differences among varieties were markedly different. The closest relationship was found between variety of red-black- and black pondoh, while the farthest relationship among the varieties was manggala pondoh.

  20. The Relationship between Chief Information Officer Transformational Leadership and Computing Platform Operating Systems

    Science.gov (United States)

    Anderson, George W.

    2010-01-01

    The purpose of this study was to relate the strength of Chief Information Officer (CIO) transformational leadership behaviors to 1 of 5 computing platform operating systems (OSs) that may be selected for a firm's Enterprise Resource Planning (ERP) business system. Research shows executive leader behaviors may promote innovation through the use of…

  1. Phylogenetic relationship of the genus Gilbertella and related genera within the order Mucorales based on 5.8 S ribosomal DNA sequences.

    Science.gov (United States)

    Papp, T; Acs, Klára; Nyilasi, Ildikó; Nagy, Erzsébet; Vágvölgyi, Cs

    2003-01-01

    The complete ITS (internal transcribed spacer) region coding the ITS1, the ITS2 and the 5.8S rDNA was amplified by polymerase chain reaction from two strains of Gilbertella persicaria, six strains in the Mucoraceae (Mucor piriformis, M. rouxii, M. circinelloides, Rhizomucor miehei, R. pusillus and R. tauricus) and four strains representing three species of the Choanephoraceae (Blakeslea trispora, Choanephora infundibulifera and Poitrasia circinans). Sequences of the amplified DNA fragments were determined and analysed. G. persicaria belongs to the monogeneric family (Gilbertellaceae), however, originally it was described as Choanephora persicaria. The goal of this study was to reveal the phylogenetic relationship among fungi belonging to Gilbertellaceae, Choanephoraceae and Mucoraceae. Our results support that the "intermediate" position of this family is between Choanephoraceae and Mucoraceae.

  2. Probing the phylogenetic relationships of a few newly recorded intertidal zoanthids of Gujarat coast (India) with mtDNA COI sequences.

    Science.gov (United States)

    Joseph, Sneha; Poriya, Paresh; Kundu, Rahul

    2016-11-01

    The present study reports the phylogenetic relationship of six zoanthid species belonging to three genera, Isaurus, Palythoa, and Zoanthus identified using systematic computational analysis of mtDNA gene sequences. All six species are first recorded from the coasts of Kathiawar Peninsula, India. Genus: Isaurus is represented by Isaurus tuberculatus, genus Zoanthus is represented by Zoanthus kuroshio and Zoanthus sansibaricus, while genus Palythoa is represented by Palythoa tuberculosa, P. sp. JVK-2006 and Palythoa heliodiscus. Results of the present study revealed that among the various species observed along the coastline, a minimum of 99% sequence divergence and a maximum of 96% sequence divergence were seen. An interspecific divergence of 1-4% and negligible intraspecific divergence was observed. These results not only highlighted the efficiency of the COI gene region in species identification but also demonstrated the genetic variability of zoanthids along the Saurashtra coastline of the west coast of India.

  3. The emergence of lobsters: phylogenetic relationships, morphological evolution and divergence time comparisons of an ancient group (decapoda: achelata, astacidea, glypheidea, polychelida).

    Science.gov (United States)

    Bracken-Grissom, Heather D; Ahyong, Shane T; Wilkinson, Richard D; Feldmann, Rodney M; Schweitzer, Carrie E; Breinholt, Jesse W; Bendall, Matthew; Palero, Ferran; Chan, Tin-Yam; Felder, Darryl L; Robles, Rafael; Chu, Ka-Hou; Tsang, Ling-Ming; Kim, Dohyup; Martin, Joel W; Crandall, Keith A

    2014-07-01

    Lobsters are a ubiquitous and economically important group of decapod crustaceans that include the infraorders Polychelida, Glypheidea, Astacidea and Achelata. They include familiar forms such as the spiny, slipper, clawed lobsters and crayfish and unfamiliar forms such as the deep-sea and "living fossil" species. The high degree of morphological diversity among these infraorders has led to a dynamic classification and conflicting hypotheses of evolutionary relationships. In this study, we estimated phylogenetic relationships among the major groups of all lobster families and 94% of the genera using six genes (mitochondrial and nuclear) and 195 morphological characters across 173 species of lobsters for the most comprehensive sampling to date. Lobsters were recovered as a non-monophyletic assemblage in the combined (molecular + morphology) analysis. All families were monophyletic, with the exception of Cambaridae, and 7 of 79 genera were recovered as poly- or paraphyletic. A rich fossil history coupled with dense taxon coverage allowed us to estimate and compare divergence times and origins of major lineages using two drastically different approaches. Age priors were constructed and/or included based on fossil age information or fossil discovery, age, and extant species count data. Results from the two approaches were largely congruent across deep to shallow taxonomic divergences across major lineages. The origin of the first lobster-like decapod (Polychelida) was estimated in the Devonian (∼409-372 Ma) with all infraorders present in the Carboniferous (∼353-318 Ma). Fossil calibration subsampling studies examined the influence of sampling density (number of fossils) and placement (deep, middle, and shallow) on divergence time estimates. Results from our study suggest including at least 1 fossil per 10 operational taxonomic units (OTUs) in divergence dating analyses. [Dating; decapods; divergence; lobsters; molecular; morphology; phylogenetics.]. © The

  4. Phylogenetic relationships and pathogenicity variation of two Newcastle disease viruses isolated from domestic ducks in Southern China.

    Science.gov (United States)

    Kang, Yinfeng; Li, Yanling; Yuan, Runyu; Li, Xianwei; Sun, Minhua; Wang, Zhaoxiong; Feng, Minsha; Jiao, Peirong; Ren, Tao

    2014-08-12

    Newcastle disease (ND) is an OIE listed disease caused by virulent avian paramyxovirus type 1 (APMV-1) strains, which is enzootic and causes large economic losses in the poultry sector. Genotype VII and genotype IX NDV viruses were the predominant circulating genotype in China, which may possibly be responsible for disease outbreaks in chicken flocks in recent years. While ducks and geese usually have exhibited inapparent infections. In the present study, we investigate the complete genome sequence, the clinicopathological characterization and transmission of two virulent Newcastle disease viruses, SS-10 and NH-10, isolated from domestic ducks in Southern China in 2010. F, and the complete gene sequences based on phylogenetic analysis demonstrated that SS-10 (genotype VII) and NH-10 (genotype IX) belongs to class II. The deduced amino acid sequence was (112)R-R-Q-K/R-R-F(117) at the fusion protein cleavage site. Animal experiment results showed that the SS-10 virus isolated from ducks was highly pathogenic for chickens and geese, but low pathogenic for ducks. It could be detected from spleen, lung, kidney, trachea, small intestine, bursa of fabricius, thymus, pancreas and cecal tonsils, oropharyngeal and cloacal swabs, and could transmit to the naive contact birds. Moreover, it could transmit to chickens, ducks and geese by naive contact. However, the NH-10 virus isolated from ducks could infect some chickens, ducks and geese, but only caused chickens to die. Additionally, it could transmit to the naive contact chickens, ducks, and geese. The two NDV isolates exhibited different biological properties with respect to pathogenicity and transmission in chickens, ducks and geese. Therefore, no species-preference exists for chicken, duck or goose viruses and more attention should be paid to the trans-species transmission of VII NDVs between ducks, geese and chickens for the control and eradication of ND.

  5. Bacterial Communities in Women with Bacterial Vaginosis: High Resolution Phylogenetic Analyses Reveal Relationships of Microbiota to Clinical Criteria

    Science.gov (United States)

    Srinivasan, Sujatha; Hoffman, Noah G.; Morgan, Martin T.; Matsen, Frederick A.; Fiedler, Tina L.; Hall, Robert W.; Ross, Frederick J.; McCoy, Connor O.; Bumgarner, Roger; Marrazzo, Jeanne M.; Fredricks, David N.

    2012-01-01

    Background Bacterial vaginosis (BV) is a common condition that is associated with numerous adverse health outcomes and is characterized by poorly understood changes in the vaginal microbiota. We sought to describe the composition and diversity of the vaginal bacterial biota in women with BV using deep sequencing of the 16S rRNA gene coupled with species-level taxonomic identification. We investigated the associations between the presence of individual bacterial species and clinical diagnostic characteristics of BV. Methodology/Principal Findings Broad-range 16S rRNA gene PCR and pyrosequencing were performed on vaginal swabs from 220 women with and without BV. BV was assessed by Amsel’s clinical criteria and confirmed by Gram stain. Taxonomic classification was performed using phylogenetic placement tools that assigned 99% of query sequence reads to the species level. Women with BV had heterogeneous vaginal bacterial communities that were usually not dominated by a single taxon. In the absence of BV, vaginal bacterial communities were dominated by either Lactobacillus crispatus or Lactobacillus iners. Leptotrichia amnionii and Eggerthella sp. were the only two BV-associated bacteria (BVABs) significantly associated with each of the four Amsel’s criteria. Co-occurrence analysis revealed the presence of several sub-groups of BVABs suggesting metabolic co-dependencies. Greater abundance of several BVABs was observed in Black women without BV. Conclusions/Significance The human vaginal bacterial biota is heterogeneous and marked by greater species richness and diversity in women with BV; no species is universally present. Different bacterial species have different associations with the four clinical criteria, which may account for discrepancies often observed between Amsel and Nugent (Gram stain) diagnostic criteria. Several BVABs exhibited race-dependent prevalence when analyzed in separate groups by BV status which may contribute to increased incidence of BV in

  6. Genes versus environment: geography and phylogenetic relationships shape the chemical profiles of stingless bees on a global scale

    Science.gov (United States)

    Leonhardt, Sara D.; Rasmussen, Claus; Schmitt, Thomas

    2013-01-01

    Chemical compounds are highly important in the ecology of animals. In social insects, compounds on the body surface represent a particularly interesting trait, because they comprise different compound classes that are involved in different functions, such as communication, recognition and protection, all of which can be differentially affected by evolutionary processes. Here, we investigate the widely unknown and possibly antagonistic influence of phylogenetic and environmental factors on the composition of the cuticular chemistry of tropical stingless bees. We chose stingless bees because some species are unique in expressing not only self-produced compounds, but also compounds that are taken up from the environment. By relating the cuticular chemistry of 40 bee species from all over the world to their molecular phylogeny and geographical occurrence, we found that distribution patterns of different groups of compounds were differentially affected by genetic relatedness and biogeography. The ability to acquire environmental compounds was, for example, highly correlated with the bees' phylogeny and predominated in evolutionarily derived species. Owing to the presence of environmentally derived compounds, those species further expressed a higher chemical and thus functional diversity. In Old World species, chemical similarity of both environmentally derived and self-produced compounds was particularly high among sympatric species, even when they were less related to each other than to allopatric species, revealing a strong environmental effect even on largely genetically determined compounds. Thus, our findings do not only reveal an unexpectedly strong influence of the environment on the cuticular chemistry of stingless bees, but also demonstrate that even within one morphological trait (an insect's cuticular profile), different components (compound classes) can be differentially affected by different drivers (relatedness and biogeography), depending on the

  7. Genotyping of Capreolus pygargus fossil DNA from Denisova cave reveals phylogenetic relationships between ancient and modern populations.

    Directory of Open Access Journals (Sweden)

    Nadezhda V Vorobieva

    Full Text Available BACKGROUND: The extant roe deer (Capreolus Gray, 1821 includes two species: the European roe deer (C. capreolus and the Siberian roe deer (C. pygargus that are distinguished by morphological and karyotypical differences. The Siberian roe deer occupies a vast area of Asia and is considerably less studied than the European roe deer. Modern systematics of the Siberian roe deer remain controversial with 4 morphological subspecies. Roe deer fossilized bones are quite abundant in Denisova cave (Altai Mountains, South Siberia, where dozens of both extant and extinct mammalian species from modern Holocene to Middle Pleistocene have been retrieved. METHODOLOGY/PRINCIPAL FINDINGS: We analyzed a 629 bp fragment of the mitochondrial control region from ancient bones of 10 Holocene and four Pleistocene Siberian roe deer from Denisova cave as well as 37 modern specimen belonging to populations from Altai, Tian Shan (Kyrgyzstan, Yakutia, Novosibirsk region and the Russian Far East. Genealogical reconstructions indicated that most Holocene haplotypes were probably ancestral for modern roe deer populations of Western Siberia and Tian Shan. One of the Pleistocene haplotypes was possibly ancestral for modern Yakutian populations, and two extinct Pleistocene haplotypes were close to modern roe deer from Tian Shan and Yakutia. Most modern geographical populations (except for West Siberian Plains are heterogeneous and there is some tentative evidence for structure. However, we did not find any distinct phylogenetic signal characterizing particular subspecies in either modern or ancient samples. CONCLUSION/SIGNIFICANCE: Analysis of mitochondrial DNA from both ancient and modern samples of Siberian roe deer shed new light on understanding the evolutionary history of roe deer. Our data indicate that during the last 50,000 years multiple replacements of populations of the Siberian roe deer took place in the Altai Mountains correlating with climatic changes. The Siberian

  8. Stratigraphic and structural relationships between Meso-Cenozoic Lagonegro basin and coeval carbonate platforms in southern Apennines, Italy

    Science.gov (United States)

    Pescatore, Tullio; Renda, Pietro; Schiattarella, Marcello; Tramutoli, Mariano

    1999-12-01

    Stratigraphic studies and facies analysis integrated with a new geological and structural survey of the Meso-Cenozoic units outcropping in the Campania-Lucania Apennines, southern Italy, allowed us to restore the palaeogeographic pattern and the tectonic evolution of the chain during Oligo-Miocene times. The southern Apennines are a N150°-striking and NE-verging fold-and-thrust belt mainly derived from the deformation of the African-Apulian passive margin. Four wide belts with different features have been recognized in the chain area. From east to west the following units outcrop: (a) successions characterized by basinal to marginal facies, ranging in age from Cretaceous to Miocene, tectonically lying on Plio-Pleistocene foredeep deposits; (b) successions characterized by shallow-water, basinal and shelf-margin facies, ranging in age from middle Triassic to Miocene ('Lagonegro units'), overthrust on the previous ones; (c) Triassic to Miocene carbonate platform successions ('Apenninic platform units'), overthrust on the Lagonegro units; (d) Jurassic-Cretaceous to Miocene deep-water successions (ophiolite-bearing or 'internal' units and associated siliciclastic wedges), outcropping along the Tyrrhenian belt and the Calabria-Lucania boundary, overthrust on the Apenninic platform units. All these units tectonically lie on the buried Apulian platform which is covered, at least in the eastern sector of the chain, by Pliocene to Pleistocene foredeep deposits. Stratigraphic patterns of the Cretaceous to lower Miocene Lagonegro successions are coherent with the platform margin ones. Calcareous clastics of the Lagonegro basin are in fact supplied by an adjacent western platform, as inferred by several sedimentological evidences (slump and palaeocurrent directions and decreasing grain size towards the depocentre of the basin). Tectonic relationships among the different units of the chain — with particular emphasis on the Lagonegro and Apenninic platform units of the

  9. Suborbital Platforms as a Tool for a Symbiotic Relationship Between Scientists, Engineers, and Students

    Science.gov (United States)

    Chamberlin, Phillip C.

    2011-01-01

    Sounding rockets started in-situ space experimentation over 60 years ago with scientific experiments replacing warheads on captured V- 2 German rockets. Prior to this, and still today, suborbital platforms such as airplanes and high-altitude balloons have provided advantageous remote sensing observations advancing many areas of Earth and Space science. There is still a place for first-rate science in both stand-alone missions as well as providing complimentary measurements to the larger orbital missions. Along with the aforementioned science, the cost effectiveness and development times provided by sub-orbital platforms allows for perfect hands-on and first rate educational opportunities for undergraduate and graduate students. This talk will give examples and discuss the mutually beneficial opportunities that scientists and students obtain in development of suborbital missions. Also discussed will be how the next generation of space vehicles should help eliminate the number one obstacle to these programs - launch opportunities.

  10. Evaluation of serologic and antigenic relationships between middle eastern respiratory syndrome coronavirus and other coronaviruses to develop vaccine platforms for the rapid response to emerging coronaviruses.

    Science.gov (United States)

    Agnihothram, Sudhakar; Gopal, Robin; Yount, Boyd L; Donaldson, Eric F; Menachery, Vineet D; Graham, Rachel L; Scobey, Trevor D; Gralinski, Lisa E; Denison, Mark R; Zambon, Maria; Baric, Ralph S

    2014-04-01

    Middle East respiratory syndrome coronavirus (MERS-CoV) emerged in 2012, causing severe acute respiratory disease and pneumonia, with 44% mortality among 136 cases to date. Design of vaccines to limit the virus spread or diagnostic tests to track newly emerging strains requires knowledge of antigenic and serologic relationships between MERS-CoV and other CoVs.  Using synthetic genomics and Venezuelan equine encephalitis virus replicons (VRPs) expressing spike and nucleocapsid proteins from MERS-CoV and other human and bat CoVs, we characterize the antigenic responses (using Western blot and enzyme-linked immunosorbent assay) and serologic responses (using neutralization assays) against 2 MERS-CoV isolates in comparison with those of other human and bat CoVs.  Serologic and neutralization responses against the spike glycoprotein were primarily strain specific, with a very low level of cross-reactivity within or across subgroups. CoV N proteins within but not across subgroups share cross-reactive epitopes with MERS-CoV isolates. Our findings were validated using a convalescent-phase serum specimen from a patient infected with MERS-CoV (NA 01) and human antiserum against SARS-CoV, human CoV NL63, and human CoV OC43.  Vaccine design for emerging CoVs should involve chimeric spike protein containing neutralizing epitopes from multiple virus strains across subgroups to reduce immune pathology, and a diagnostic platform should include a panel of nucleocapsid and spike proteins from phylogenetically distinct CoVs.

  11. Molecular characterization and phylogenetic relationship of wild type 1 poliovirus strains circulating across Pakistan and Afghanistan bordering areas during 2010-2012.

    Directory of Open Access Journals (Sweden)

    Shahzad Shaukat

    Full Text Available Pakistan and Afghanistan share a long uncontrolled border with extensive population movement on both sides. Wild poliovirus transmission has never been interrupted in this block due to war against terrorism, poor public health infrastructure, misconceptions about polio vaccines and inadequate immunization activities. All these issues complicate the eradication operations and reinforce the complexity of wiping out poliomyelitis from this region. This study illustrates the origins and routes of cross-border wild poliovirus type 1 (WPV1 transmission during 2010-2012 between Pakistan and Afghanistan. Sequence analyses were conducted based on complete VP1 capsid protein sequences for WPV1 study strains to determine the origin of poliovirus genetic lineages and their evolutionary relationships. Phylogenetic tree was constructed from VP1 gene sequences applying Maximum Likelihood method using Kimura 2- parameter model in MEGA program v 5.0. A total of 72 (14.3% out of 502 wild-type 1 polioviruses were found circulating in border areas of both countries during 2010-2012. Molecular phylogenetic analysis classified these strains in to two sub-genotypes with four clusters and 18 lineages. Genetic data confirmed that the most of WPV1 lineages (12; 66.6% were transmitted from Pakistan to Afghanistan. However, the genetic diversity was significantly reduced during 2012 as most of the lineages were completely eliminated. In conclusion, Pakistan-Afghanistan block has emerged as a single poliovirus reservoir sharing the multiple poliovirus lineages due to uncontrolled movement of people across the borders between two countries. If it is neglected, it can jeopardize the extensive global efforts done so-far to eradicate the poliovirus infection. Our data will be helpful to devise the preventive strategies for effective control of wild poliovirus transmission in this region.

  12. Molecular characterization and phylogenetic relationships among microsporidian isolates infecting silkworm, Bombyx mori using small subunit rRNA (SSU-rRNA) gene sequence analysis.

    Science.gov (United States)

    Nath, B Surendra; Gupta, S K; Bajpai, A K

    2012-12-01

    The life cycle, spore morphology, pathogenicity, tissue specificity, mode of transmission and small subunit rRNA (SSU-rRNA) gene sequence analysis of the five new microsporidian isolates viz., NIWB-11bp, NIWB-12n, NIWB-13md, NIWB-14b and NIWB-15mb identified from the silkworm, Bombyx mori have been studied along with type species, NIK-1s_mys. The life cycle of the microsporidians identified exhibited the sequential developmental cycles that are similar to the general developmental cycle of the genus, Nosema. The spores showed considerable variations in their shape, length and width. The pathogenicity observed was dose-dependent and differed from each of the microsporidian isolates; the NIWB-15mb was found to be more virulent than other isolates. All of the microsporidians were found to infect most of the tissues examined and showed gonadal infection and transovarial transmission in the infected silkworms. SSU-rRNA sequence based phylogenetic tree placed NIWB-14b, NIWB-12n and NIWB-11bp in a separate branch along with other Nosema species and Nosema bombycis; while NIWB-15mb and NIWB-13md together formed another cluster along with other Nosema species. NIK-1s_mys revealed a signature sequence similar to standard type species, N. bombycis, indicating that NIK-1s_mys is similar to N. bombycis. Based on phylogenetic relationships, branch length information based on genetic distance and nucleotide differences, we conclude that the microsporidian isolates identified are distinctly different from the other known species and belonging to the genus, Nosema. This SSU-rRNA gene sequence analysis method is found to be more useful approach in detecting different and closely related microsporidians of this economically important domestic insect.

  13. First time molecular detection and phylogenetic relationships of torque teno sus virus 1 and 2 in domestic pigs in Uganda: further evidence for a global distribution

    Directory of Open Access Journals (Sweden)

    Brink Matilda

    2012-02-01

    Full Text Available Abstract Background Torque teno sus virus 1 (TTSuV1 and 2 (TTSuV2 are small, single-stranded circular DNA viruses belonging to the Anelloviridae family. Available studies clearly show that both viruses are widely distributed in the pig populations in America, Europe and Asia, although the impact of the infection is still unclear. Currently, the situation in domestic pig populations on the African continent is not known. Therefore, the aim of this study was to investigate the possible presence of the two viruses in domestic pigs in Uganda, and describe the phylogenetic relationships to those in the rest of the world. Results Ninety-five serum samples from six districts in Uganda were used, and PCR using TTSuV1 and 2 specific primers for the UTR region was run for viral nucleic acid detection. The positive samples were sequenced, and phylogenetic analyses performed in order to compare the Ugandan sequences with sequences from other parts of the world. The prevalence of TTSuV1 and 2 in the selected domestic pigs were estimated at 16.8% and 48.4% respectively, with co-infection found in 13.7%. The sequence identity was 90-100% between the Ugandan TTSuV1; and 63-100% between the Ugandan TTSuV2 sequences. Conclusion This is the first report on the presence of TTSuV1 and 2 in domestic pigs in Uganda. These results highlight the importance of screening for emerging viruses given the globalisation of human activities.

  14. Visualizing phylogenetic tree landscapes.

    Science.gov (United States)

    Wilgenbusch, James C; Huang, Wen; Gallivan, Kyle A

    2017-02-02

    Genomic-scale sequence alignments are increasingly used to infer phylogenies in order to better understand the processes and patterns of evolution. Different partitions within these new alignments (e.g., genes, codon positions, and structural features) often favor hundreds if not thousands of competing phylogenies. Summarizing and comparing phylogenies obtained from multi-source data sets using current consensus tree methods discards valuable information and can disguise potential methodological problems. Discovery of efficient and accurate dimensionality reduction methods used to display at once in 2- or 3- dimensions the relationship among these competing phylogenies will help practitioners diagnose the limits of current evolutionary models and potential problems with phylogenetic reconstruction methods when analyzing large multi-source data sets. We introduce several dimensionality reduction methods to visualize in 2- and 3-dimensions the relationship among competing phylogenies obtained from gene partitions found in three mid- to large-size mitochondrial genome alignments. We test the performance of these dimensionality reduction methods by applying several goodness-of-fit measures. The intrinsic dimensionality of each data set is also estimated to determine whether projections in 2- and 3-dimensions can be expected to reveal meaningful relationships among trees from different data partitions. Several new approaches to aid in the comparison of different phylogenetic landscapes are presented. Curvilinear Components Analysis (CCA) and a stochastic gradient decent (SGD) optimization method give the best representation of the original tree-to-tree distance matrix for each of the three- mitochondrial genome alignments and greatly outperformed the method currently used to visualize tree landscapes. The CCA + SGD method converged at least as fast as previously applied methods for visualizing tree landscapes. We demonstrate for all three mtDNA alignments that 3D

  15. Phylogenetic relationships among Brazilian howler monkeys, genus Alouatta (Platyrrhini, Atelidae, based on g1-globin pseudogene sequences

    Directory of Open Access Journals (Sweden)

    Carla Maria Meireles

    1999-09-01

    Full Text Available The genus Alouatta (howler monkeys is the most widely distributed of New World primates, and has been arranged in three species groups: the Central American Alouatta palliata group and the South American Alouatta seniculus and Alouatta caraya groups. While the latter is monotypic, the A. seniculus group encompasses at least three species (A. seniculus, A. belzebul and A. fusca. In the present study, approximately 600 base pairs of the g1-globin pseudogene were sequenced in the four Brazilian species (A. seniculus, A. belzebul, A. fusca and A. caraya. Maximum parsimony and maximum likelihood methods yielded phylogenetic trees with the same arrangement: {A. caraya [A. seniculus (A. fusca, A. belzebul]}. The most parsimonious tree had bootstrap values greater than 82% for all groupings, and strength of grouping values of at least 2, supporting the sister clade of A. fusca and A. belzebul. The study also confirmed the presence of a 150-base pair Alu insertion element and a 1.8-kb deletion in the g1-globin pseudogene in A. fusca, features found previously in the remaining three species. The cladistic classification based on molecular data agrees with those of morphological studies, with the monospecific A. caraya group being clearly differentiated from the A. seniculus group.Os guaribas, do gênero Alouatta, que são os primatas do Novo Mundo com maior distribuição geográfica, têm sido colocados em três grupos de espécies: o grupo Alouatta palliata da América central, e os grupos sulamericanos Alouatta seniculus e Alouatta caraya. Este último é monotípico, mas o grupo A. seniculus inclui pelo menos três espécies (A. seniculus, A. belzebul e A. fusca. Neste estudo, foram seqüenciados aproximadamente 600 pares de base do pseudogene globina g1 nas quatro espécies brasileiras (A. seniculus, A. belzebul, A. fusca e A. caraya. Os métodos de máxima parcimônia e máxima verossimilhança produziram árvores filogenéticas com o mesmo arranjo

  16. The unique rht-MOF platform, ideal for pinpointing the functionalization and CO 2 adsorption relationship

    KAUST Repository

    Luebke, Ryan

    2012-01-01

    The uniqueness of the rht-MOF platform, based on the singular (3,24)-connected net, allows for the facile design and synthesis of functionalized materials for desired applications. Here we designed a nitrogen-rich trefoil hexacarboxylate (trigonal tri-isophthalate) ligand, which serves to act as the trigonal molecular building block while concurrently coding the formation of the targeted truncated cuboctahedral supermolecular building block (in situ), and enhancing the CO 2 uptake in the resultant rht-MOF. © 2012 The Royal Society of Chemistry.

  17. Phylogenetic relationships among domesticated and wild species of Cucurbita (Cucurbitaceae) inferred from a mitochondrial gene: Implications for crop plant evolution and areas of origin.

    Science.gov (United States)

    Sanjur, Oris I; Piperno, Dolores R; Andres, Thomas C; Wessel-Beaver, Linda

    2002-01-08

    We have investigated the phylogenetic relationships among six wild and six domesticated taxa of Cucurbita using as a marker an intron region from the mitochondrial nad1 gene. Our study represents one of the first successful uses of a mtDNA gene in resolving inter- and intraspecific taxonomic relationships in Angiosperms and yields several important insights into the origins of domesticated Cucurbita. First, our data suggest at least six independent domestication events from distinct wild ancestors. Second, Cucurbita argyrosperma likely was domesticated from a wild Mexican gourd, Cucurbita sororia, probably in the same region of southwest Mexico that gave rise to maize. Third, the wild ancestor of Cucurbita moschata is still unknown, but mtDNA data combined with other sources of information suggest that it will probably be found in lowland northern South America. Fourth, Cucurbita andreana is supported as the wild progenitor of Cucurbita maxima, but humid lowland regions of Bolivia in addition to warmer temperate zones in South America from where C. andreana was originally described should possibly be considered as an area of origin for C. maxima. Fifth, our data support other molecular results that indicate two separate domestications in the Cucurbita pepo complex. The potential zone of domestication for one of the domesticated subspecies, C. pepo subsp. ovifera, includes eastern North America and should be extended to northeastern Mexico. The wild ancestor of the other domesticated subspecies, C. pepo subsp. pepo, is undiscovered but is closely related to C. pepo subsp. fraterna and possibly will be found in southern Mexico.

  18. Phylogenetic relationships and cryptic species diversity in the Brazilian egg-brooding tree frog, genus Fritziana Mello-Leitão 1937 (Anura: Hemiphractidae).

    Science.gov (United States)

    Walker, Marina; Lyra, Mariana L; Haddad, Célio F B

    2018-06-01

    The genus Fritziana (Anura: Hemiphractidae) comprises six described species (F. goeldii, F. ohausi, F. fissilis, F. ulei, F. tonimi, and F. izecksohni) that are endemic to the Brazilian Atlantic Forest. Although the genus has been the subject of studies dealing with its taxonomy, phylogeny, and systematics, there is considerable evidence for cryptic diversity hidden among the species. The present study aims to understand the genetic diversity and phylogenetic relationships among the species of Fritziana, as well as the relationships among populations within species. We analyzed 107 individuals throughout the distribution of the genus using three mitochondrial gene fragments (12S, 16S, and COI) and two nuclear genes (RAG1 and SLC8A3). Our data indicated that the species diversity in the genus Fritziana is underestimated by the existence of at least three candidate species hidden amongst the group of species with a closed dorsal pouch (i.e. F. fissilis and F. ulei). We also found four species presenting geographical population structures and high genetic diversity, and thus require further investigations. In addition, we found that two candidate species show a new arrangement for the tRNA-Phe gene, unique in Anura so far. Based on our results, we suggest that the conservation status of the species, as well as the species diversity in the genus Fritziana, needs to be reviewed. Copyright © 2018 Elsevier Inc. All rights reserved.

  19. The phylogenetic relationships among germplasm resources of wild ramie (boehmeria nivea l. gaud) in china based on trnl-f and its sequences

    International Nuclear Information System (INIS)

    Runqing, Y.; Baloch, S.U.; Lijun, L.; Dingxiang, P.

    2015-01-01

    Ramie (Boehmeria nivea L. Gaud) is an important fiber crop in China, which also possesses many wild species in genus Boehmeria Jacq. However, the taxonomic position of these species has not been settled. To determine the evolutionary relationships among the members of the genus Boehmeria, the combination of ITS and trnL-F sequences were used for molecular phylogenetic analyses of 31 ramie accessions (28 species and three varieties) including multiple materials collected in high-altitude regions that have not been previously reported (B. clidemioides var. diffusa, B. bicuspis and B. longispica). The ITS and trnL-F trees produced showed that Boehmeria was classified into four separate clusters. The Sect. Duretia, which has a high evolutionary level, clustered with Sects Zoilingeriana and Phyllostachys. The grouping pattern of clustering differed from traditional taxonomy and indicated possible interspecific hybridization among Boehmeria. We found that B. malabarica Wedd. var. leioclada of Sect. Boehmeria clustered into a clade with Sect. Tilocnide, providing solid support for the expansion of wild ramie core germplasm resources. The molecular results did not support the intraspecific geographic migration of Boehmeria. This study, therefore, established relationships among wild species which will help in ramie crop improvement programs. The results will be important for the collection and conservation of germplasm resources of Chinese wild ramie. (author)

  20. The phylogenetic relationships of insectivores with special reference to the lesser hedgehog tenrec as inferred from the complete sequence of their mitochondrial genome.

    Science.gov (United States)

    Nikaido, Masato; Cao, Ying; Okada, Norihiro; Hasegawa, Masami

    2003-02-01

    The complete mitochondrial genome of a lesser hedgehog tenrec Echinops telfairi was determined in this study. It is an endemic African insectivore that is found specifically in Madagascar. The tenrec's back is covered with hedgehog-like spines. Unlike other spiny mammals, such as spiny mice, spiny rats, spiny dormice and porcupines, lesser hedgehog tenrecs look amazingly like true hedgehogs (Erinaceidae). However, they are distinguished morphologically from hedgehogs by the absence of a jugal bone. We determined the complete sequence of the mitochondrial genome of a lesser hedgehog tenrec and analyzed the results phylogenetically to determine the relationships between the tenrec and other insectivores (moles, shrews and hedgehogs), as well as the relationships between the tenrec and endemic African mammals, classified as Afrotheria, that have recently been shown by molecular analysis to be close relatives of the tenrec. Our data confirmed the afrotherian status of the tenrec, and no direct relation was recovered between the tenrec and the hedgehog. Comparing our data with those of others, we found that within-species variations in the mitochondrial DNA of lesser hedgehog tenrecs appear to be the largest recognized to date among mammals, apart from orangutans, which might be interesting from the view point of evolutionary history of tenrecs on Madagascar.

  1. Predictive modelling for startup and investor relationship based on crowdfunding platform data

    Science.gov (United States)

    Alamsyah, Andry; Buono Asto Nugroho, Tri

    2018-03-01

    Crowdfunding platform is a place where startup shows off publicly their idea for the purpose to get their project funded. Crowdfunding platform such as Kickstarter are becoming popular today, it provides the efficient way for startup to get funded without liabilities, it also provides variety project category that can be participated. There is an available safety procedure to ensure achievable low-risk environment. The startup promoted project must accomplish their funded goal target. If they fail to reach the target, then there is no investment activity take place. It motivates startup to be more active to promote or disseminate their project idea and it also protect investor from losing money. The study objective is to predict the successfulness of proposed project and mapping investor trend using data mining framework. To achieve the objective, we proposed 3 models. First model is to predict whether a project is going to be successful or failed using K-Nearest Neighbour (KNN). Second model is to predict the number of successful project using Artificial Neural Network (ANN). Third model is to map the trend of investor in investing the project using K-Means clustering algorithm. KNN gives 99.04% model accuracy, while ANN best configuration gives 16-14-1 neuron layers and 0.2 learning rate, and K-Means gives 6 best separation clusters. The results of those models can help startup or investor to make decision regarding startup investment.

  2. Phylogenetic relationships of Iranian infectious hematopoietic necrosis virus of rainbow trout (Oncorhynchus mykiss) based on the glycoprotein gene

    Science.gov (United States)

    Adel, Milad; Amiri, Alireza Babaalian; Dada, Maryam; Kurath, Gael; Laktarashi, Bahram; Ghajari, Amrolah; Breyta, Rachel

    2016-01-01

    Infectious hematopoietic necrosis virus (IHNV), a member of family Rhabdoviridae and genus Novirhabdoviridae, causes a highly lethal disease of salmon and trout. In Iran IHNV was first detected in 2001 on farms rearing rainbow trout (Oncorhynchus mykiss). To evaluate the genetic relationships of IHNV from northern and western Iran, the sequences of a 651-nt region of the glycoprotein gene were determined for two Iranian isolates. These sequences were analyzed to evaluate their genetic relatedness to worldwide isolates representing the five known genogroups of IHNV. Iranian isolates were most closely related to European isolates within the genogroup E rather than those of North American genogroups U, M and L, or the Asian genogroup J. It appears that Iranian IHNV was most likely introduced to Iran from a source in Europe by the movement of contaminated fish eggs.

  3. Detection, Prevalence and Phylogenetic Relationships of Demodex spp and further Skin Prostigmata Mites (Acari, Arachnida) in Wild and Domestic Mammals.

    Science.gov (United States)

    Sastre, Natalia; Francino, Olga; Curti, Joseph N; Armenta, Tiffany C; Fraser, Devaughn L; Kelly, Rochelle M; Hunt, Erin; Silbermayr, Katja; Zewe, Christine; Sánchez, Armand; Ferrer, Lluís

    2016-01-01

    This study was conceived to detect skin mites in social mammals through real-time qPCR, and to estimate taxonomic Demodex and further Prostigmata mite relationships in different host species by comparing sequences from two genes: mitochondrial 16S rRNA and nuclear 18S rRNA. We determined the mite prevalence in the hair follicles of marmots (13%) and bats (17%). The high prevalence found in marmots and bats by sampling only one site on the body may indicate that mites are common inhabitants of their skin. Since we found three different mites (Neuchelacheles sp, Myobia sp and Penthaleus sp) in three bat species (Miotis yumanensis, Miotis californicus and Corynorhinus townsendii) and two different mites (both inferred to be members of the Prostigmata order) in one marmot species (Marmota flaviventris), we tentatively concluded that these skin mites 1) cannot be assigned to the same genus based only on a common host, and 2) seem to evolve according to the specific habitat and/or specific hair and sebaceous gland of the mammalian host. Moreover, two M. yumanensis bats harbored identical Neuchelacheles mites, indicating the possibility of interspecific cross-infection within a colony. However, some skin mites species are less restricted by host species than previously thought. Specifically, Demodex canis seems to be more transmissible across species than other skin mites. D. canis have been found mostly in dogs but also in cats and captive bats. In addition, we report the first case of D. canis infestation in a domestic ferret (Mustela putorius). All these mammalian hosts are related to human activities, and D. canis evolution may be a consequence of this relationship. The monophyletic Demodex clade showing closely related dog and human Demodex sequences also supports this likely hypothesis.

  4. Detection, Prevalence and Phylogenetic Relationships of Demodex spp and further Skin Prostigmata Mites (Acari, Arachnida in Wild and Domestic Mammals.

    Directory of Open Access Journals (Sweden)

    Natalia Sastre

    Full Text Available This study was conceived to detect skin mites in social mammals through real-time qPCR, and to estimate taxonomic Demodex and further Prostigmata mite relationships in different host species by comparing sequences from two genes: mitochondrial 16S rRNA and nuclear 18S rRNA. We determined the mite prevalence in the hair follicles of marmots (13% and bats (17%. The high prevalence found in marmots and bats by sampling only one site on the body may indicate that mites are common inhabitants of their skin. Since we found three different mites (Neuchelacheles sp, Myobia sp and Penthaleus sp in three bat species (Miotis yumanensis, Miotis californicus and Corynorhinus townsendii and two different mites (both inferred to be members of the Prostigmata order in one marmot species (Marmota flaviventris, we tentatively concluded that these skin mites 1 cannot be assigned to the same genus based only on a common host, and 2 seem to evolve according to the specific habitat and/or specific hair and sebaceous gland of the mammalian host. Moreover, two M. yumanensis bats harbored identical Neuchelacheles mites, indicating the possibility of interspecific cross-infection within a colony. However, some skin mites species are less restricted by host species than previously thought. Specifically, Demodex canis seems to be more transmissible across species than other skin mites. D. canis have been found mostly in dogs but also in cats and captive bats. In addition, we report the first case of D. canis infestation in a domestic ferret (Mustela putorius. All these mammalian hosts are related to human activities, and D. canis evolution may be a consequence of this relationship. The monophyletic Demodex clade showing closely related dog and human Demodex sequences also supports this likely hypothesis.

  5. The rhabdoviruses: biodiversity, phylogenetics, and evolution.

    Science.gov (United States)

    Kuzmin, I V; Novella, I S; Dietzgen, R G; Padhi, A; Rupprecht, C E

    2009-07-01

    Rhabdoviruses (family Rhabdoviridae) include a diversity of important pathogens of animals and plants. They share morphology and genome organization. The understanding of rhabdovirus phylogeny, ecology and evolution has progressed greatly during the last 30 years, due to enhanced surveillance and improved methodologies of molecular characterization. Along with six established genera, several phylogenetic groups at different levels were described within the Rhabdoviridae. However, comparative relationships between viral phylogeny and taxonomy remains incomplete, with multiple representatives awaiting further genetic characterization. The same is true for rhabdovirus evolution. To date, rather simplistic molecular clock models only partially describe the evolutionary dynamics of postulated viral lineages. Ongoing progress in viral evolutionary and ecological investigations will provide the platform for future studies of this diverse family.

  6. Phylogenetic relationships among extinct and extant turtles: the position of Pleurodira and the effects of the fossils on rooting crown-group turtles

    NARCIS (Netherlands)

    Sterli, J.

    2010-01-01

    The origin and evolution of the crown-group of turtles (Cryptodira + Pleurodira) is one of the most interesting topics in turtle evolution, second perhaps only to the phylogenetic position of turtles among amniotes. The present contribution focuses on the former problem, exploring the phylogenetic

  7. First amplification of Eimeria hessei DNA from the lesser horseshoe bat (Rhinolophus hipposideros) and its phylogenetic relationships with Eimeria species from other bats and rodents.

    Science.gov (United States)

    Afonso, Eve; Baurand, Pierre-Emmanuel; Tournant, Pierline; Capelli, Nicolas

    2014-04-01

    Although coccidian parasites of the genus Eimeria are among the best-documented parasites in bats, few Eimeria species found in bats have been characterised using molecular tools, and none of the characterised species are found in European countries. Phylogenetic relationships of Eimeria species that parasitise bats and rodents can be related to the morphology of oocysts, independently from host range, suggesting that these species are derived from common ancestors. In the present study, we isolated a partial sequence of the Eimeria hessei 18S rRNA gene from the lesser horseshoe bat (Rhinolophus hipposideros), a European bat species. Droppings from lesser horseshoe bats were collected from 11 maternity roosts located in France that were positive for the presence of the parasite. Through morphological characterisation, the oocysts detected in the lesser horseshoe bat droppings were confirmed to be E. hessei. The unique E. hessei sequence obtained through molecular analysis belonged to a clade that includes both rodent and bat Eimeria species. However, the E. hessei oocysts isolated from the bat droppings did not show morphological similarities to rodent Eimeria species. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Genetic divergence and phylogenetic relationships in grey mullets (Teleostei: Mugilidae) based on PCR-RFLP analysis of mtDNA segments.

    Science.gov (United States)

    Papasotiropoulos, V; Klossa-Kilia, E; Kilias, G; Alahiotis, S

    2002-04-01

    The genetic differentiation and phylogenetic relationships among five species of the Mugilidae family (Mugil cephalus, Chelon labrosus, Liza aurata, Liza ramada, and Liza saliens) were investigated at the mtDNA level, on samples taken from Messolongi lagoon-Greece. RFLP analysis of three PCR-amplified mtDNA gene segments (12s rRNA, 16s rRNA, and CO I) was used. Ten, eight, and nine restriction enzymes were found to have at least one recognition site at 12s rRNA, 16s rRNA, and CO I genes, respectively. Several fragment patterns were revealed to be species-specific, and thus they could be useful in species taxonomy as diagnostic markers, as well as for further evolutionary studies. Seven different haplotypes were detected. The greatest amount of genetic differentiation was observed at the interspecific level, while little variation was revealed at the intraspecific level. The highest values of nucleotide sequence divergence were observed between M. cephalus and all the other species, while the lowest was found between C. labrosus and L. saliens. Dendrograms obtained by the three different methods (UPGMA, Neighbor-Joining, and Dollo parsimony), were found to exhibit in all cases the same topology. According to this, the most distinct species is M. cephalus, while the other species are clustered in two separate groups, thefirst one containing L. aurata and L. ramada, the other L. saliens and C. labrosus. This last clustering makes the monophyletic origin of the genus Liza questionable.

  9. An appraisal of the phylogenetic relationships of Hypoptopomatini cascudinhos with description of two new genera and three new species (Siluriformes: Loricariidae

    Directory of Open Access Journals (Sweden)

    Maria Laura S. Delapieve

    2017-12-01

    Full Text Available ABSTRACT The discovery of three new taxa of Hypoptotopomatini with ambiguous generic assignment prompted a reanalysis of the phylogenetic relationships of the tribe. The analysis focused on a data matrix of 56 terminals and 107 morphological characters comprising the three new taxa, most species of Hypoptopoma and Otocinclus, and all other species of the tribe. The 162 maximally parsimonious trees of 382 steps, consistency index of 0.41, and retention index of 0.83 were then summarized in a strict consensus tree. The results confirm the monophyly of the Hypoptopomatini, recover four genera as monophyletic (Acestridium, Hypoptopoma, Niobichthys, and Otocinclus, revealed Hypoptopoma and Oxyropsis to be non-monophyletic; and revealed two new genera within Hypoptopomatini. Additionally, Otocinclus was found to be sister to a group with all remaining genera of the tribe; Acestridium and Niobichthys were found to be sister to each other and that clade sister to a group formed by ((Leptotocinclus + Hypoptopoma [part] + (Nannoxyropsis (Oxyropsis + Hypoptopoma [part]. Based on this framework, changes to the classification and the taxonomy of the Hypoptopomatini are suggested and the new taxa are described.

  10. Molecular differentiation and phylogenetic relationships of three Angiostrongylus species and Angiostrongylus cantonensis geographical isolates based on a 66-kDa protein gene of A. cantonensis (Nematoda: Angiostrongylidae).

    Science.gov (United States)

    Eamsobhana, Praphathip; Lim, Phaik Eem; Zhang, Hongman; Gan, Xiaoxian; Yong, Hoi Sen

    2010-12-01

    The phylogenetic relationships and molecular differentiation of three species of angiostrongylid nematodes (Angiostrongylus cantonensis, Angiostrongylus costaricensis and Angiostrongylus malaysiensis) were studied using the AC primers for a 66-kDa protein gene of A. cantonensis. The AC primers successfully amplified the genomic DNA of these angiostrongylid nematodes. No amplification was detected for the DNA of Ascaris lumbricoides, Ascaris suum, Anisakis simplex, Gnathostoma spinigerum, Toxocara canis, and Trichinella spiralis. The maximum-parsimony (MP) consensus tree and the maximum-likelihood (ML) tree both showed that the Angiostrongylus taxa could be divided into two major clades - Clade 1 (A. costaricensis) and Clade 2 (A. cantonensis and A. malaysiensis) with a full support bootstrap value. A. costaricensis is the most distant taxon. A. cantonensis is a sister group to A. malaysiensis; these two taxa (species) are clearly separated. There is no clear distinction between the A. cantonensis samples from four different geographical localities (Thailand, China, Japan and Hawaii); only some of the samples are grouped ranging from no support or low support to moderate support of bootstrap values. The published nucleotide sequences of A. cantonensis adult-specific native 66kDa protein mRNA, clone L5-400 from Taiwan (U17585) appear to be very distant from the A. cantonensis samples from Thailand, China, Japan and Hawaii, with the uncorrected p-distance values ranging from 26.87% to 29.92%.

  11. Testing the phylogenetic affinities of Southeast Asia's rarest geckos: Flap-legged geckos (Luperosaurus), Flying geckos (Ptychozoon) and their relationship to the pan-Asian genus Gekko.

    Science.gov (United States)

    Brown, Rafe M; Siler, Cameron D; Das, Indraneil; Min, Yong

    2012-06-01

    Some of Southeast Asia's most poorly known vertebrates include forest lizards that are rarely seen by field biologists. Arguably the most enigmatic of forest lizards from the Indo Australian archipelago are the Flap-legged geckos and the Flying geckos of the genera Luperosaurus and Ptychozoon. As new species have accumulated, several have been noted for their bizarre combination of morphological characteristics, seemingly intermediate between these genera and the pan-Asian gecko genus Gekko. We used the first multilocus phylogeny for these taxa to estimate their relationships, with particular attention to the phylogenetic placement of the morphologically intermediate taxa Ptychozoon rhacophorus, Luperosaurus iskandari, and L. gulat. Surprisingly, our results demonstrate that Luperosaurus is more closely related to Lepidodactylus and Pseudogekko than it is to Gekko but that some species currently classified as Luperosaurus are nested within Gekko. The Flying Gecko genus Ptychozoon is also nested within Gekko, suggesting that higher-level taxonomic revision of the generic boundaries within Southeast Asian gekkonines will be a priority for the immediate future. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. Some peculiarities of the relationship between uranium and phosphate of nodular phosphorites of the Russian Platform

    Energy Technology Data Exchange (ETDEWEB)

    Kozlov, A A [Vsesoyuznyj Nauchno-Issledovatel' skij Inst. Yadernoj Geofiziki i Geokhimii, Moscow (USSR)

    1976-02-01

    In nodular phosphorites of the Cenomanian stage of the central regions of the Russian platform the uranium content of phosphate ranges within 20 to 50x10/sup -4/%. The maximum concentrations of uranium are found in amorphous phosphates, the richest in humic colloid. Uranium found in the bone phosphate of fossil reptiles is uniformly distributed throughout the bone tissue area, its content amounting to 30 to 40x10/sup -4/%. As bone phosphate reaches its holocrystalline modification, the uranium compounds are substituted and the uranium concentration decreases to 0.2x10/sup -4/%, i.e. it becomes 200 times lower. The most intensive sorption of uranium by phosphate occurs under the reducing conditions of diagenesis which is characterized by the most comprehensive combination of uranium-sorption factors: the existence of various uranium compounds in solution, isomorphic substitutions of all kinds, adsorption of uranium compounds and organic matter on the surfaces of submicron crystalline phosphate compounds. A decrease in the intensity of sorption factors leads to a decrease in the uranium content of phosphate. Under the oxidative conditions prevailed during the formation of Khoperian silicophosphorites, uranium has been sorbed by the phosphate only in negligible amounts (0.1x10/sup -4/%) due to the lack of organic colloids and uranium compounds capable of isomorphic substitution.

  13. Phylogenetic relationships among domesticated and wild species of Cucurbita (Cucurbitaceae) inferred from a mitochondrial gene: Implications for crop plant evolution and areas of origin

    Science.gov (United States)

    Sanjur, Oris I.; Piperno, Dolores R.; Andres, Thomas C.; Wessel-Beaver, Linda

    2002-01-01

    We have investigated the phylogenetic relationships among six wild and six domesticated taxa of Cucurbita using as a marker an intron region from the mitochondrial nad1 gene. Our study represents one of the first successful uses of a mtDNA gene in resolving inter- and intraspecific taxonomic relationships in Angiosperms and yields several important insights into the origins of domesticated Cucurbita. First, our data suggest at least six independent domestication events from distinct wild ancestors. Second, Cucurbita argyrosperma likely was domesticated from a wild Mexican gourd, Cucurbita sororia, probably in the same region of southwest Mexico that gave rise to maize. Third, the wild ancestor of Cucurbita moschata is still unknown, but mtDNA data combined with other sources of information suggest that it will probably be found in lowland northern South America. Fourth, Cucurbita andreana is supported as the wild progenitor of Cucurbita maxima, but humid lowland regions of Bolivia in addition to warmer temperate zones in South America from where C. andreana was originally described should possibly be considered as an area of origin for C. maxima. Fifth, our data support other molecular results that indicate two separate domestications in the Cucurbita pepo complex. The potential zone of domestication for one of the domesticated subspecies, C. pepo subsp. ovifera, includes eastern North America and should be extended to northeastern Mexico. The wild ancestor of the other domesticated subspecies, C. pepo subsp. pepo, is undiscovered but is closely related to C. pepo subsp. fraterna and possibly will be found in southern Mexico. PMID:11782554

  14. Phylogenetic analysis, genetic diversity and relationships between the recently segregated species of Corynandra and Cleoserrata from the genus Cleome using DNA barcoding and molecular markers.

    Science.gov (United States)

    Tamboli, Asif Shabodin; Patil, Swapnil Mahadeo; Gholave, Avinash Ramchandra; Kadam, Suhas Kishor; Kotibhaskar, Shreya Vijaykumar; Yadav, Shrirang Ramchandra; Govindwar, Sanjay Prabhu

    2016-01-01

    Cleome is the largest genus in the family Cleomaceae and it is known for its various medicinal properties. Recently, some species from the Cleome genus (Cleome viscosa, Cleome chelidonii, Cleome felina and Cleome speciosa) are split into genera Corynandra (Corynandra viscosa, Corynandra chelidonii, Corynandra felina), and Cleoserrata (Cleoserrata speciosa). The objective of this study was to obtain DNA barcodes for these species for their accurate identification and determining phylogenetic relationships. Out of 10 screened barcoding regions, rbcL, matK and ITS1 regions showed higher PCR efficiency and sequencing success. This study added matK, rbcL and ITS1 barcodes for the identification of Corynandra chelidonii, Corynandra felina, Cleome simplicifolia and Cleome aspera species in existing barcode data. Corynandra chelidonii and Corynandra felina species belong to the Corynandra genus, but they are not grouped with the Corynandra viscosa species, however clustered with the Cleome species. Molecular marker analysis showed 100% polymorphism among the studied plant samples. Diversity indices for molecular markers were ranged from He=0.1115-0.1714 and I=0.2268-0.2700, which indicates a significant amount of genetic diversity among studied species. Discrimination of the Cleome and Corynandra species from Cleoserrata speciosa was obtained by two RAPD primers (OPA-4 and RAPD-17) and two ISSR primers (ISSR-1 and ISSR-2). RAPD and ISSR markers are useful for the genetic characterization of these studied species. The present investigation will be helpful to understand the relationships of Cleome lineages with Corynandra and Cleoserrata species. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  15. Serological and virological survey of hepatitis E virus (HEV) in animal reservoirs from Uruguay reveals elevated prevalences and a very close phylogenetic relationship between swine and human strains.

    Science.gov (United States)

    Mirazo, Santiago; Gardinali, Noemí R; Cecilia, D'Albora; Verger, Lorenzo; Ottonelli, Florencia; Ramos, Natalia; Castro, Gustavo; Pinto, Marcelo A; Ré, Viviana; Pisano, Belén; Lozano, Alejandra; de Oliveira, Jaqueline Mendes; Arbiza, Juan

    2018-01-01

    Hepatitis E virus (HEV) infection is an issue of public health concern in high-income and non-endemic countries. Increasing evidence supports the hypothesis of a zoonotic route as the main mode of infection in this epidemiological setting, since the transmission of genotypes HEV-3 and HEV-4 from reservoirs to humans has been demonstrated. In America, studies have confirmed the circulation of HEV in pig herds but the zoonotic role of wild boars has never been evaluated. Uruguay has a high burden of HEV- associated acute hepatitis, and a close phylogenetic relationship was observed among human HEV-3 strains and European isolates detected in swine. However in this context, swine herds have never been surveyed. Herein is reported a survey of HEV in swine herds, pigs at slaughter-house and free-living wild boar populations. Two-hundred and twenty sera and 150 liver tissue samples from domestic pigs, and 140 sera from wild boars were tested for HEV by ELISA and PCR-based approaches. All tested swine farms resulted seropositive with an overall rate of 46.8%. In turn, 22.1% of the wild boars had anti-HEV antibodies. HEV RNA was detected in 16.6% and 9.3% of liver samples from slaughter-age pigs and adult wild boars sera, respectively. Three strains from domestic pig were also amplified by nested-PCR approaches. By contrast, none of the positive samples obtained from wild boars could be confirmed by nested-PCR. Phylogenetic analysis revealed a very high nucleotide identity among swine strains and sequences obtained from humans in Uruguay. Results showed that HEV is widely distributed among swine herds in Uruguay. Additionally, this study evidences for the first time in the American continent that wild boar populations are a reservoir for HEV, though its zoonotic role remains to be elucidated. Altogether, data presented here suggest a high zoonotic risk of HEV transmission from swine to humans. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Phylogenetic relationships of Acheilognathidae (Cypriniformes: Cyprinoidea) as revealed from evidence of both nuclear and mitochondrial gene sequence variation: evidence for necessary taxonomic revision in the family and the identification of cryptic species.

    Science.gov (United States)

    Chang, Chia-Hao; Li, Fan; Shao, Kwang-Tsao; Lin, Yeong-Shin; Morosawa, Takahiro; Kim, Sungmin; Koo, Hyeyoung; Kim, Won; Lee, Jae-Seong; He, Shunping; Smith, Carl; Reichard, Martin; Miya, Masaki; Sado, Tetsuya; Uehara, Kazuhiko; Lavoué, Sébastien; Chen, Wei-Jen; Mayden, Richard L

    2014-12-01

    Bitterlings are relatively small cypriniform species and extremely interesting evolutionarily due to their unusual reproductive behaviors and their coevolutionary relationships with freshwater mussels. As a group, they have attracted a great deal of attention in biological studies. Understanding the origin and evolution of their mating system demands a well-corroborated hypothesis of their evolutionary relationships. In this study, we provide the most comprehensive phylogenetic reconstruction of species relationships of the group based on partitioned maximum likelihood and Bayesian methods using DNA sequence variation of nuclear and mitochondrial genes on 41 species, several subspecies and three undescribed species. Our findings support the monophyly of the Acheilognathidae. Two of the three currently recognized genera are not monophyletic and the family can be subdivided into six clades. These clades are further regarded as genera based on both their phylogenetic relationships and a reappraisal of morphological characters. We present a revised classification for the Acheilognathidae with five genera/lineages: Rhodeus, Acheilognathus (new constitution), Tanakia (new constitution), Paratanakia gen. nov., and Pseudorhodeus gen. nov. and an unnamed clade containing five species currently referred to as "Acheilognathus". Gene trees of several bitterling species indicate that the taxa are not monophyletic. This result highlights a potentially dramatic underestimation of species diversity in this family. Using our new phylogenetic framework, we discuss the evolution of the Acheilognathidae relative to classification, taxonomy and biogeography. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Phylogenetic relationships in Solanaceae and related species based on cpDNA sequence from plastid trnE-trnT region

    Directory of Open Access Journals (Sweden)

    Danila Montewka Melotto-Passarin

    2008-01-01

    Full Text Available Intergenic spacers of chloroplast DNA (cpDNA are very useful in phylogenetic and population genetic studiesof plant species, to study their potential integration in phylogenetic analysis. The non-coding trnE-trnT intergenic spacer ofcpDNA was analyzed to assess the nucleotide sequence polymorphism of 16 Solanaceae species and to estimate its ability tocontribute to the resolution of phylogenetic studies of this group. Multiple alignments of DNA sequences of trnE-trnT intergenicspacer made the identification of nucleotide variability in this region possible and the phylogeny was estimated by maximumparsimony and rooted with Convolvulaceae Ipomoea batatas, the most closely related family. Besides, this intergenic spacerwas tested for the phylogenetic ability to differentiate taxonomic levels. For this purpose, species from four other families wereanalyzed and compared with Solanaceae species. Results confirmed polymorphism in the trnE-trnT region at different taxonomiclevels.

  18. The influence of molecular markers and methods on inferring the phylogenetic relationships between the representatives of the Arini (parrots, Psittaciformes), determined on the basis of their complete mitochondrial genomes.

    Science.gov (United States)

    Urantowka, Adam Dawid; Kroczak, Aleksandra; Mackiewicz, Paweł

    2017-07-14

    Conures are a morphologically diverse group of Neotropical parrots classified as members of the tribe Arini, which has recently been subjected to a taxonomic revision. The previously broadly defined Aratinga genus of this tribe has been split into the 'true' Aratinga and three additional genera, Eupsittula, Psittacara and Thectocercus. Popular markers used in the reconstruction of the parrots' phylogenies derive from mitochondrial DNA. However, current phylogenetic analyses seem to indicate conflicting relationships between Aratinga and other conures, and also among other Arini members. Therefore, it is not clear if the mtDNA phylogenies can reliably define the species tree. The inconsistencies may result from the variable evolution rate of the markers used or their weak phylogenetic signal. To resolve these controversies and to assess to what extent the phylogenetic relationships in the tribe Arini can be inferred from mitochondrial genomes, we compared representative Arini mitogenomes as well as examined the usefulness of the individual mitochondrial markers and the efficiency of various phylogenetic methods. Single molecular markers produced inconsistent tree topologies, while different methods offered various topologies even for the same marker. A significant disagreement in these tree topologies occurred for cytb, nd2 and nd6 genes, which are commonly used in parrot phylogenies. The strongest phylogenetic signal was found in the control region and RNA genes. However, these markers cannot be used alone in inferring Arini phylogenies because they do not provide fully resolved trees. The most reliable phylogeny of the parrots under study is obtained only on the concatenated set of all mitochondrial markers. The analyses established significantly resolved relationships within the former Aratinga representatives and the main genera of the tribe Arini. Such mtDNA phylogeny can be in agreement with the species tree, owing to its match with synapomorphic features in

  19. Phylogenetic relationships and generic delimitation of Eurasian Aster (Asteraceae: Astereae) inferred from ITS, ETS and trnL-F sequence data

    Science.gov (United States)

    Li, Wei-Ping; Yang, Fu-Sheng; Jivkova, Todorka; Yin, Gen-Shen

    2012-01-01

    Background and Aims The classification and phylogeny of Eurasian (EA) Aster (Asterinae, Astereae, Asteraceae) remain poorly resolved. Some taxonomists adopt a broad definition of EA Aster, whereas others favour a narrow generic concept. The present study aims to delimit EA Aster sensu stricto (s.s.), elucidate the phylogenetic relationships of EA Aster s.s. and segregate genera. Methods The internal and external transcribed spacers of nuclear ribosomal DNA and the plastid DNA trnL-F region were used to reconstruct the phylogeny of EA Aster through maximum parsimony and Bayesian analyses. Key Results The analyses strongly support an Aster clade including the genera Sheareria, Rhynchospermum, Kalimeris (excluding Kalimeris longipetiolata), Heteropappus, Miyamayomena, Turczaninowia, Rhinactinidia, eastern Asian Doellingeria, Asterothamnus and Arctogeron. Many well-recognized species of Chinese Aster s.s. lie outside of the Aster clade. Conclusions The results reveal that EA Aster s.s. is both paraphyletic and polyphyletic. Sheareria, Rhynchospermum, Kalimeris (excluding K. longipetiolata), Heteropappus, Miyamayomena, Turczaninowia, Rhinactinidia, eastern Asian Doellingeria, Asterothamnus and Arctogeron should be included in Aster, whereas many species of Chinese Aster s.s. should be excluded. The recircumscribed Aster should be divided into two subgenera and nine sections. Kalimeris longipetiolata, Aster batangensis, A. ser. Albescentes, A. series Hersileoides, a two-species group composed of A. senecioides and A. fuscescens, and a six-species group including A. asteroides, should be elevated to generic level. With the Aster clade, they belong to the Australasian lineages. The generic status of Callistephus should be maintained. Whether Galatella (including Crinitina) and Tripolium should remain as genera or be merged into a single genus remains to be determined. In addition, the taxonomic status of A. auriculatus and the A. pycnophyllus–A. panduratus clade remains

  20. Co-existence of Paragonimus harinasutai and Paragonimus bangkokensis metacercariae in fresh water crab hosts in central Viet Nam with special emphasis on their close phylogenetic relationship.

    Science.gov (United States)

    Doanh, Pham Ngoc; Hien, Hoang Van; Nonaka, Nariaki; Horii, Yoichiro; Nawa, Yukifumi

    2012-09-01

    During our epidemiological surveys for Paragonimus species in central Viet Nam, we found four morphologically different Paragonimus metacercariae in mountainous crabs. They were identified as metacercariae of Paragonimus westermani, P. bangkokensis, P. proliferus, and P. harinasutai in the order of their prevalence in crab hosts. This is the first discovery of P. harinasutai in Viet Nam, co-inhabiting with P. bangkokensis and other species. Metacercariae of P. harinasutai were given orally to a cat to obtain adult worms. Then, ITS2 and CO1 sequences of metacercariae and adults of P. harinasutai, and metacercariae of P. bangkokensis collected from the same place were determined for analyses of phylogenetic relationships to other P. harinasutai and P. bangkokensis populations as well as related species. The results of molecular analyses showed that P. harinasutai from Quang Binh province of central Viet Nam was almost completely identical with those from Vientiane, Lao PDR; P. bangkokensis from Quang Binh, Viet Nam was also almost completely identical with those from Lao PDR and from Quang Ninh province, Viet Nam. Except for one P. harinasutai isolate from China, all populations of P. harinasutai and P. bangkokensis from Thailand, Lao and Viet Nam make a single clade in both ITS2 and CO1 trees. In ITS2 sequences, AT deletion and ATC insertion were observed in some isolates of both species, indicating recent gene flow between P. harinasutai and P. bangkokensis. Moreover, because of their extremely high genetic similarities and their co-inhabitation in the same crab hosts found in Thailand, Lao PDR and Viet Nam, they should be considered as the sister species at the early stage of divergence. In addition, P. microrchis previously described from Yunnan, China should be placed as the synonym of P. harinasutai, because of their morphological and molecular similarities. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  1. Amended diagnosis and redescription of Pristimantis marmoratus (Boulenger, 1900 (Amphibia: Craugastoridae, with a description of its advertisement call and notes on its breeding ecology and phylogenetic relationships

    Directory of Open Access Journals (Sweden)

    Philippe J.R. Kok

    2018-01-01

    Full Text Available The frog Pristimantis marmoratus was originally described as Hylodes marmoratus by George A. Boulenger in 1900 based on a single specimen reported to have been collected at the foot of Mount Roraima in Guyana in 1898. We herein discuss the exact location of the type locality of P. marmoratus and provide a redescription of the species based on new material from Kaieteur National Park and from the slopes of Maringma-tepui in Guyana. We also describe the previously unknown vocalization and breeding ecology of the species, and conducted an exploratory molecular analysis of the phylogenetic relationships within the genus Pristimantis represented by the members of the “unistrigatus species group” in the Guiana Shield. Pristimantis marmoratus is a small-sized species mainly distinguished from its known Guiana Shield congeners by the combination of F I < II, SVL ≤ 20.4 in males, presence of vocal slits in males, granular/pustulate dorsal skin with well-developed scapular ridges, basal webbing between fingers, fringes on fingers and toes, crossed iris, diffuse yellow or pale green wash on groin, and absence of flashy colour on axillary/pre-axillary region. The advertisement call consists of a single note repeated at a rate of ca 11 calls/min with a dominant frequency ranging from 2756 to 3101 Hz. Pristimantis marmoratus is primarily arboreal, exclusively active at dusk, and probably restricted to the pristine rainforests of the Pantepui uplands and highlands, east of the Gran Sabana between ca 600 and 1800 m above sea level. Preliminary molecular analyses recovered Pristimantis marmoratus as sister to an unnamed species from the Eastern Guiana Shield. On grounds of the newly established distributional extent we suggest maintaining the IUCN conservation status as Least Concern.

  2. Archigregarines of the English Channel revisited: New molecular data on Selenidium species including early described and new species and the uncertainties of phylogenetic relationships.

    Directory of Open Access Journals (Sweden)

    Sonja Rueckert

    Full Text Available Gregarines represent an important transition step from free-living predatory (colpodellids s.l. and/or photosynthetic (Chromera and Vitrella apicomplexan lineages to the most important pathogens, obligate intracellular parasites of humans and domestic animals such as coccidians and haemosporidians (Plasmodium, Toxoplasma, Eimeria, Babesia, etc.. While dozens of genomes of other apicomplexan groups are available, gregarines are barely entering the molecular age. Among the gregarines, archigregarines possess a unique mixture of ancestral (myzocytosis and derived (lack of apicoplast, presence of subpellicular microtubules features.In this study we revisited five of the early-described species of the genus Selenidium including the type species Selenidium pendula, with special focus on surface ultrastructure and molecular data. We were also able to describe three new species within this genus. All species were characterized at morphological (light and scanning electron microscopy data and molecular (SSU rDNA sequence data levels. Gregarine specimens were isolated from polychaete hosts collected from the English Channel near the Station Biologique de Roscoff, France: Selenidium pendula from Scolelepis squamata, S. hollandei and S. sabellariae from Sabellaria alveolata, S. sabellae from Sabella pavonina, Selenidium fallax from Cirriformia tentaculata, S. spiralis sp. n. and S. antevariabilis sp. n. from Amphitritides gracilis, and S. opheliae sp. n. from Ophelia roscoffensis. Molecular phylogenetic analyses of these data showed archigregarines clustering into five separate clades and support previous doubts about their monophyly.Our phylogenies using the extended gregarine sampling show that the archigregarines are indeed not monophyletic with one strongly supported clade of Selenidium sequences around the type species S. pendula. We suggest the revision of the whole archigregarine taxonomy with only the species within this clade remaining in the genus

  3. A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the 'true citrus fruit trees' group (Citrinae, Rutaceae) and the origin of cultivated species.

    Science.gov (United States)

    Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

    2013-01-01

    Despite differences in morphology, the genera representing 'true citrus fruit trees' are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial 'species' of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between 'true citrus fruit trees' were clarified. Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will help further works to analyse the molecular basis of the

  4. A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the ‘true citrus fruit trees’ group (Citrinae, Rutaceae) and the origin of cultivated species

    Science.gov (United States)

    Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

    2013-01-01

    Background and Aims Despite differences in morphology, the genera representing ‘true citrus fruit trees’ are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial ‘species’ of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between ‘true citrus fruit trees’ were clarified. Methods Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. Key Results A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Conclusions Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will

  5. Phylogenetic trees in bioinformatics

    Energy Technology Data Exchange (ETDEWEB)

    Burr, Tom L [Los Alamos National Laboratory

    2008-01-01

    Genetic data is often used to infer evolutionary relationships among a collection of viruses, bacteria, animal or plant species, or other operational taxonomic units (OTU). A phylogenetic tree depicts such relationships and provides a visual representation of the estimated branching order of the OTUs. Tree estimation is unique for several reasons, including: the types of data used to represent each OTU; the use ofprobabilistic nucleotide substitution models; the inference goals involving both tree topology and branch length, and the huge number of possible trees for a given sample of a very modest number of OTUs, which implies that fmding the best tree(s) to describe the genetic data for each OTU is computationally demanding. Bioinformatics is too large a field to review here. We focus on that aspect of bioinformatics that includes study of similarities in genetic data from multiple OTUs. Although research questions are diverse, a common underlying challenge is to estimate the evolutionary history of the OTUs. Therefore, this paper reviews the role of phylogenetic tree estimation in bioinformatics, available methods and software, and identifies areas for additional research and development.

  6. Undergraduate Students’ Difficulties in Reading and Constructing Phylogenetic Tree

    Science.gov (United States)

    Sa'adah, S.; Tapilouw, F. S.; Hidayat, T.

    2017-02-01

    Representation is a very important communication tool to communicate scientific concepts. Biologists produce phylogenetic representation to express their understanding of evolutionary relationships. The phylogenetic tree is visual representation depict a hypothesis about the evolutionary relationship and widely used in the biological sciences. Phylogenetic tree currently growing for many disciplines in biology. Consequently, learning about phylogenetic tree become an important part of biological education and an interesting area for biology education research. However, research showed many students often struggle with interpreting the information that phylogenetic trees depict. The purpose of this study was to investigate undergraduate students’ difficulties in reading and constructing a phylogenetic tree. The method of this study is a descriptive method. In this study, we used questionnaires, interviews, multiple choice and open-ended questions, reflective journals and observations. The findings showed students experiencing difficulties, especially in constructing a phylogenetic tree. The students’ responds indicated that main reasons for difficulties in constructing a phylogenetic tree are difficult to placing taxa in a phylogenetic tree based on the data provided so that the phylogenetic tree constructed does not describe the actual evolutionary relationship (incorrect relatedness). Students also have difficulties in determining the sister group, character synapomorphy, autapomorphy from data provided (character table) and comparing among phylogenetic tree. According to them building the phylogenetic tree is more difficult than reading the phylogenetic tree. Finding this studies provide information to undergraduate instructor and students to overcome learning difficulties of reading and constructing phylogenetic tree.

  7. The complete chloroplast genome sequence of Mahonia bealei (Berberidaceae) reveals a significant expansion of the inverted repeat and phylogenetic relationship with other angiosperms.

    Science.gov (United States)

    Ma, Ji; Yang, Bingxian; Zhu, Wei; Sun, Lianli; Tian, Jingkui; Wang, Xumin

    2013-10-10

    Mahonia bealei (Berberidaceae) is a frequently-used traditional Chinese medicinal plant with efficient anti-inflammatory ability. This plant is one of the sources of berberine, a new cholesterol-lowering drug with anti-diabetic activity. We have sequenced the complete nucleotide sequence of the chloroplast (cp) genome of M. bealei. The complete cp genome of M. bealei is 164,792 bp in length, and has a typical structure with large (LSC 73,052 bp) and small (SSC 18,591 bp) single-copy regions separated by a pair of inverted repeats (IRs 36,501 bp) of large size. The Mahonia cp genome contains 111 unique genes and 39 genes are duplicated in the IR regions. The gene order and content of M. bealei are almost unarranged which is consistent with the hypothesis that large IRs stabilize cp genome and reduce gene loss-and-gain probabilities during evolutionary process. A large IR expansion of over 12 kb has occurred in M. bealei, 15 genes (rps19, rpl22, rps3, rpl16, rpl14, rps8, infA, rpl36, rps11, petD, petB, psbH, psbN, psbT and psbB) have expanded to have an additional copy in the IRs. The IR expansion rearrangement occurred via a double-strand DNA break and subsequence repair, which is different from the ordinary gene conversion mechanism. Repeat analysis identified 39 direct/inverted repeats 30 bp or longer with a sequence identity ≥ 90%. Analysis also revealed 75 simple sequence repeat (SSR) loci and almost all are composed of A or T, contributing to a distinct bias in base composition. Comparison of protein-coding sequences with ESTs reveals 9 putative RNA edits and 5 of them resulted in non-synonymous modifications in rpoC1, rps2, rps19 and ycf1. Phylogenetic analysis using maximum parsimony (MP) and maximum likelihood (ML) was performed on a dataset composed of 65 protein-coding genes from 25 taxa, which yields an identical tree topology as previous plastid-based trees, and provides strong support for the sister relationship between Ranunculaceae and Berberidaceae

  8. Molecular Phylogenetics: Concepts for a Newcomer.

    Science.gov (United States)

    Ajawatanawong, Pravech

    Molecular phylogenetics is the study of evolutionary relationships among organisms using molecular sequence data. The aim of this review is to introduce the important terminology and general concepts of tree reconstruction to biologists who lack a strong background in the field of molecular evolution. Some modern phylogenetic programs are easy to use because of their user-friendly interfaces, but understanding the phylogenetic algorithms and substitution models, which are based on advanced statistics, is still important for the analysis and interpretation without a guide. Briefly, there are five general steps in carrying out a phylogenetic analysis: (1) sequence data preparation, (2) sequence alignment, (3) choosing a phylogenetic reconstruction method, (4) identification of the best tree, and (5) evaluating the tree. Concepts in this review enable biologists to grasp the basic ideas behind phylogenetic analysis and also help provide a sound basis for discussions with expert phylogeneticists.

  9. Phylogenetic inertia and Darwin's higher law.

    Science.gov (United States)

    Shanahan, Timothy

    2011-03-01

    The concept of 'phylogenetic inertia' is routinely deployed in evolutionary biology as an alternative to natural selection for explaining the persistence of characteristics that appear sub-optimal from an adaptationist perspective. However, in many of these contexts the precise meaning of 'phylogenetic inertia' and its relationship to selection are far from clear. After tracing the history of the concept of 'inertia' in evolutionary biology, I argue that treating phylogenetic inertia and natural selection as alternative explanations is mistaken because phylogenetic inertia is, from a Darwinian point of view, simply an expected effect of selection. Although Darwin did not discuss 'phylogenetic inertia,' he did assert the explanatory priority of selection over descent. An analysis of 'phylogenetic inertia' provides a perspective from which to assess Darwin's view. Copyright © 2010 Elsevier Ltd. All rights reserved.

  10. Unrealistic phylogenetic trees may improve phylogenetic footprinting.

    Science.gov (United States)

    Nettling, Martin; Treutler, Hendrik; Cerquides, Jesus; Grosse, Ivo

    2017-06-01

    The computational investigation of DNA binding motifs from binding sites is one of the classic tasks in bioinformatics and a prerequisite for understanding gene regulation as a whole. Due to the development of sequencing technologies and the increasing number of available genomes, approaches based on phylogenetic footprinting become increasingly attractive. Phylogenetic footprinting requires phylogenetic trees with attached substitution probabilities for quantifying the evolution of binding sites, but these trees and substitution probabilities are typically not known and cannot be estimated easily. Here, we investigate the influence of phylogenetic trees with different substitution probabilities on the classification performance of phylogenetic footprinting using synthetic and real data. For synthetic data we find that the classification performance is highest when the substitution probability used for phylogenetic footprinting is similar to that used for data generation. For real data, however, we typically find that the classification performance of phylogenetic footprinting surprisingly increases with increasing substitution probabilities and is often highest for unrealistically high substitution probabilities close to one. This finding suggests that choosing realistic model assumptions might not always yield optimal predictions in general and that choosing unrealistically high substitution probabilities close to one might actually improve the classification performance of phylogenetic footprinting. The proposed PF is implemented in JAVA and can be downloaded from https://github.com/mgledi/PhyFoo. : martin.nettling@informatik.uni-halle.de. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press.

  11. Revealing pancrustacean relationships: Phylogenetic analysis of ribosomal protein genes places Collembola (springtails) in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers.

    NARCIS (Netherlands)

    Timmermans, M.J.T.N.; Roelofs, D.; Mariën, A.G.H.; van Straalen, N.M.

    2008-01-01

    Background. In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an

  12. Revealing pancrustacean relationships : phylogenetic analysis of ribosomal protein genes places Collembola (springtails) in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers

    NARCIS (Netherlands)

    Timmermans, M J T N; Roelofs, D; Mariën, J; van Straalen, N M

    2008-01-01

    BACKGROUND: In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an

  13. Phylogenetic reconstruction methods: an overview.

    Science.gov (United States)

    De Bruyn, Alexandre; Martin, Darren P; Lefeuvre, Pierre

    2014-01-01

    Initially designed to infer evolutionary relationships based on morphological and physiological characters, phylogenetic reconstruction methods have greatly benefited from recent developments in molecular biology and sequencing technologies with a number of powerful methods having been developed specifically to infer phylogenies from macromolecular data. This chapter, while presenting an overview of basic concepts and methods used in phylogenetic reconstruction, is primarily intended as a simplified step-by-step guide to the construction of phylogenetic trees from nucleotide sequences using fairly up-to-date maximum likelihood methods implemented in freely available computer programs. While the analysis of chloroplast sequences from various Vanilla species is used as an illustrative example, the techniques covered here are relevant to the comparative analysis of homologous sequences datasets sampled from any group of organisms.

  14. The Drosophila bipectinata species complex: phylogenetic ...

    Indian Academy of Sciences (India)

    PARUL BANERJEE

    c Indian Academy of Sciences. RESEARCH ARTICLE. The Drosophila bipectinata species complex: phylogenetic relationship among different members based on chromosomal variations. PARUL BANERJEE and BASHISTH N. SINGH. ∗. Genetics Laboratory, Department of Zoology, Banaras Hindu University, Varanasi ...

  15. BioMatriX: Sequence analysis, structure visualization, phylogenetics ...

    African Journals Online (AJOL)

    bmx-biomatrix.blogspot.com) developed for biological science community to augment scientific research regarding genomics, proteomics, phylogenetics and linkage analysis in one platform. BioMatriX offers multi-functional services to perform ...

  16. Complete nucleotide sequence of Sida golden mosaic Florida virus and phylogenetic relationships with other begomoviruses infecting malvaceous weeds in the Caribbean.

    Science.gov (United States)

    Fiallo-Olivé, Elvira; Martínez-Zubiaur, Yamila; Moriones, Enrique; Navas-Castillo, Jesús

    2010-09-01

    The complete genome sequence of two isolates of the bipartite begomovirus (genus Begomovirus, family Geminiviridae) Sida golden mosaic Florida virus (SiGMFV) is presented. We propose that both isolates, found infecting Malvastrum coromandelianum (family Malvaceae) in Cuba, belong to a new strain of SiGMFV. Phylogenetic analysis showed that SiGMFV DNA-A is located in a monophyletic cluster that includes begomoviruses infecting malvaceous weeds from the Caribbean.

  17. Phylogenetic relationships of Hemiuridae (Digenea: Hemiuroidea) with new morphometric and molecular data of Aphanurus mugilis Tang, 1981 (Aphanurinae) from mullet fish of Vietnam.

    Science.gov (United States)

    Atopkin, D M; Besprozvannykh, V V; Yu Beloded, A; Ngo, H D; Ha, N V; Tang, N V

    2017-12-01

    Adult Aphanurus mugilis Tang, 1981 worms were detected in the intestine of Moolgarda engeli in the shallow waters off Cat Ba Island, Vietnam. Tang (1981) first described this species in Mugil cephalus off China. The worms in Vietnamese mullet were identical to Chinese specimens in a number of morphometric characteristics, with the exception of body and ovary size. In the present study, morphological characteristics, and the first molecular data for A. mugilis are provided. Additionally, molecular phylogenetic analysis of the family Hemiuridae was performed. The results of our molecular phylogenetic study indicate that the presence or absence of an ecsoma was not associated with molecular data for hemiurid subfamilies differentiation. The basal position of Bunocotylinae on the molecular-based phylogenetic tree indicated a primordial nature of ecsoma of hemiurid trematodes. Considerable molecular differentiation of Bunocotylinae from other hemiurids indicated the possibility of the recognition of the family Bunocotylidae Dollfus, 1950. Assuming that Machidatrema chilostoma is considered within the Bunocotylinae, the paraphyly of the Lecithasterinae was supported. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Reconstruction of phylogenetic relationships in dermatomycete genus Trichophyton Malmsten 1848 based on ribosomal internal transcribed spacer region, partial 28S rRNA and beta-tubulin genes sequences.

    Science.gov (United States)

    Pchelin, Ivan M; Zlatogursky, Vasily V; Rudneva, Mariya V; Chilina, Galina A; Rezaei-Matehkolaei, Ali; Lavnikevich, Dmitry M; Vasilyeva, Natalya V; Taraskina, Anastasia E

    2016-09-01

    Trichophyton spp. are important causative agents of superficial mycoses. The phylogeny of the genus and accurate strain identification, based on the ribosomal ITS region sequencing, are still under development. The present work is aimed at (i) inferring the genus phylogeny from partial ITS, LSU and BT2 sequences (ii) description of ribosomal ITS region polymorphism in 15 strains of Trichophyton interdigitale. We performed DNA sequence-based species identification and phylogenetic analysis on 48 strains belonging to the genus Trichophyton. Phylogenetic relationships were inferred by maximum likelihood and Bayesian methods on concatenated ITS, LSU and BT2 sequences. Ribosomal ITS region polymorphisms were assessed directly on the alignment. By phylogenetic reconstruction, we reveal major anthropophilic and zoophilic species clusters in the genus Trichophyton. We describe several sequences of the ITS region of T. interdigitale, which do not fit in the traditional polymorphism scheme and propose emendations in this scheme for discrimination between ITS sequence types in T. interdigitale. The new polymorphism scheme will allow inclusion of a wider spectrum of isolates while retaining its explanatory power. This scheme was also found to be partially congruent with NTS typing technique. © 2016 Blackwell Verlag GmbH.

  19. Phylogenetic relationships among members of the Fusarium solani species complex in human infections and the descriptions of F. keratoplasticum sp. nov. and F. petroliphilum stat. nov

    DEFF Research Database (Denmark)

    Short, Dylan P.G.; O’Donnell, Kerry; Thrane, Ulf

    2013-01-01

    Fusarium species are frequently associated with mycotic keratitis and, to a lesser extent, cases of localized and disseminated infections. The Fusarium solani species complex (FSSC) is the most common group of fusaria associated with human infectious diseases. Several studies to date have revealed...... dozens of strongly supported phylogenetic species within this important evolutionary clade, though little work has been done to improve the taxonomy and understanding of the reproductive mode and phenotypes of the predominant clinically relevant species. Here we described Fusarium keratoplasticum sp. nov...

  20. Phylogenetic relationships and the occurrence of interspecific recombination between beet chlorosis virus (BChV) and Beet mild yellowing virus (BMYV).

    Science.gov (United States)

    Kozlowska-Makulska, Anna; Hasiow-Jaroszewska, Beata; Szyndel, Marek S; Herrbach, Etienne; Bouzoubaa, Salah; Lemaire, Olivier; Beuve, Monique

    2015-02-01

    Samples containing two viruses belonging to the genus Polerovirus, beet chlorosis virus (BChV) and beet mild yellowing virus (BMYV), were collected from French and Polish sugar beet fields. The molecular properties of 24 isolates of BChV and BMYV were investigated, and their genetic diversity was examined in the coat protein (CP)- and P0-encoding genes. For the first time, we have demonstrated that beet polerovirus populations include recombinants between BChV and BMYV containing breakpoints within the CP gene. Moreover, a partial correlation between geographic origin and phylogenetic clustering was observed for BMYV isolates.

  1. Taxonomic revision and phylogenetic relationships of Dasyloricaria Isbrücker & Nijssen, 1979 (Siluriformes: Loricariidae, with description of a new species

    Directory of Open Access Journals (Sweden)

    Alejandro Londoño-Burbano

    Full Text Available ABSTRACT A taxonomic revision and phylogenetic analysis were completed for Dasyloricaria . The genus includes three valid species: D . filamentosa and D . latiura previously included in the genus, and a new species described herein. Dasyloricaria have a restricted trans-Andean distribution, with D . filamentosa occurring at the lower and middle Magdalena, lower Cauca, and Sinu in Colombia, and lago Maracaibo basin in Colombia and Venezuela; D . latiura in the Atrato and the Tuyra basins in Colombia and Panama, respectively; and the new species in the upper and middle Magdalena basin in Colombia. New synonyms for D . filamentosa and D . latiura are proposed, and a lectotype is designated for the latter. Dasyloricaria is herein recognized as monophyletic, with D . filamentosa as the sister group of D . latiura , and the new speciesas sister to that clade. Spatuloricaria is hypothesized to be the sister group of Dasyloricaria based on synapomorphies of the neurocranium, branchial arches and external morphology features. The subtribe Rineloricariina was partially corroborated through the phylogenetic analysis. An identification key for the species of Dasyloricaria is provided.

  2. Morphological and molecular characterization and phylogenetic relationships of a new species of trypanosome in Tapirus terrestris (lowland tapir), Trypanosoma terrestris sp. nov., from Atlantic Rainforest of southeastern Brazi.

    Science.gov (United States)

    Acosta, Igor da Cunha Lima; da Costa, Andrea Pereira; Nunes, Pablo Henrique; Gondim, Maria Fernanda Naegeli; Gatti, Andressa; Rossi, João Luiz; Gennari, Solange Maria; Marcili, Arlei

    2013-12-11

    The Lowland tapir (Tapirus terrestris) is the largest Brazilian mammal and despite being distributed in various Brazilian biomes, it is seriously endangered in the Atlantic Rainforest. These hosts were never evaluated for the presence of Trypanosoma parasites. The Lowland tapirs were captured in the Brazilian southeastern Atlantic Rainforest, Espírito Santo state. Trypanosomes were isolated by hemoculture, and the molecular phylogeny based on small subunit rDNA (SSU rDNA) and glycosomal-3-phosphate dehydrogenase (gGAPDH) gene sequences and the ultrastructural features seen via light microscopy and scanning and transmission electron microscopy are described. Phylogenetic trees using combined SSU rDNA and gGAPDH data sets clustered the trypanosomes of Lowland tapirs, which were highly divergent from other trypanosome species. The phylogenetic position and morphological discontinuities, mainly in epimastigote culture forms, made it possible to classify the trypanosomes from Lowland tapirs as a separate species. The isolated trypanosomes from Tapirus terrestris are a new species, Trypanosoma terrestris sp. n., and were positioned in a new Trypanosoma clade, named T. terrestris clade.

  3. Resolution of the enigmatic phylogenetic relationship of the critically endangered Western Swamp Tortoise Pseudemydura umbrina (Pleurodira: Chelidae) using a complete mitochondrial genome.

    Science.gov (United States)

    Zhang, Xiuwen; Unmack, Peter J; Kuchling, Gerald; Wang, Yinan; Georges, Arthur

    2017-10-01

    Pseudemydura umbrina is one of the most endangered turtle species in the world, and the imperative for its conservation is its distinctive morphology and relict status among the Chelidae. We use Illumina sequencing to obtain the complete mitogenome for resolving its uncertain phylogenetic position. A novel nuclear paralogue confounded the assembly, and resolution of the authentic mitogenome required further Sanger sequencing. The P. umbrina mitogenome is 16,414bp comprising 37 genes organized in a conserved pattern for other vertebrates. The nuclear paralogue is 547bp, 97.8% identity to the corresponding mitochondrial sequence. Particular features of the mitogenome include an nd3 174+1A frameshift, loss of DHC loop in tRNA Ser (AGN), and a light-strand replication initiation site in Wancy region that extends into an adjacent tRNA gene. Phylogenetic analysis showed that P. umbrina is the monotypic sister lineage to the remaining Australasian Chelidae, a lineage probably dating back to the Cretaceous. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Complete genome sequences of three tomato spotted wilt virus isolates from tomato and pepper plants in Korea and their phylogenetic relationship to other TSWV isolates.

    Science.gov (United States)

    Lee, Jong-Seung; Cho, Won Kyong; Kim, Mi-Kyeong; Kwak, Hae-Ryun; Choi, Hong-Soo; Kim, Kook-Hyung

    2011-04-01

    Tomato spotted wilt virus (TSWV) infects numerous host plants and has three genome segments, called L, M and S. Here, we report the complete genome sequences of three Korean TSWV isolates (TSWV-1 to -3) infecting tomato and pepper plants. Although the nucleotide sequence of TSWV-1 genome isolated from tomato is very different from those of TSWV-2 and TSWV-3 isolated from pepper, the deduced amino acid sequences of the five TSWV genes are highly conserved among all three TSWV isolates. In phylogenetic analysis, deduced RdRp protein sequences of TSWV-2 and TSWV-3 were clustered together with two previously reported isolates from Japan and Korea, while TSWV-1 grouped together with a Hawaiian isolate. A phylogenetic tree based on N protein sequences, however, revealed four distinct groups of TSWV isolates, and all three Korean isolates belonged to group II, together with many other isolates, mostly from Europe and Asia. Interestingly, most American isolates grouped together as group I. Together, these results suggested that these newly identified TSWV isolates might have originated from an Asian ancestor and undergone divergence upon infecting different host plants.

  5. Constructing phylogenetic trees using interacting pathways.

    Science.gov (United States)

    Wan, Peng; Che, Dongsheng

    2013-01-01

    Phylogenetic trees are used to represent evolutionary relationships among biological species or organisms. The construction of phylogenetic trees is based on the similarities or differences of their physical or genetic features. Traditional approaches of constructing phylogenetic trees mainly focus on physical features. The recent advancement of high-throughput technologies has led to accumulation of huge amounts of biological data, which in turn changed the way of biological studies in various aspects. In this paper, we report our approach of building phylogenetic trees using the information of interacting pathways. We have applied hierarchical clustering on two domains of organisms-eukaryotes and prokaryotes. Our preliminary results have shown the effectiveness of using the interacting pathways in revealing evolutionary relationships.

  6. Molecular Phylogenetics: Mathematical Framework and Unsolved Problems

    Science.gov (United States)

    Xia, Xuhua

    Phylogenetic relationship is essential in dating evolutionary events, reconstructing ancestral genes, predicting sites that are important to natural selection, and, ultimately, understanding genomic evolution. Three categories of phylogenetic methods are currently used: the distance-based, the maximum parsimony, and the maximum likelihood method. Here, I present the mathematical framework of these methods and their rationales, provide computational details for each of them, illustrate analytically and numerically the potential biases inherent in these methods, and outline computational challenges and unresolved problems. This is followed by a brief discussion of the Bayesian approach that has been recently used in molecular phylogenetics.

  7. Genetic characterization and phylogenetic relationships based on 18S rRNA and ITS1 region of small form of canine Babesia spp. from India.

    Science.gov (United States)

    Mandal, M; Banerjee, P S; Garg, Rajat; Ram, Hira; Kundu, K; Kumar, Saroj; Kumar, G V P P S Ravi

    2014-10-01

    Canine babesiosis is a vector borne disease caused by intra-erythrocytic apicomplexan parasites Babesia canis (large form) and Babesia gibsoni (small form), throughout the globe. Apart from few sporadic reports on the occurrence of B. gibsoni infection in dogs, no attempt has been made to characterize Babesia spp. of dogs in India. Fifteen canine blood samples, positive for small form of Babesia, collected from northern to eastern parts of India, were used for amplification of 18S rRNA gene (∼1665bp) of Babesia sp. and partial ITS1 region (∼254bp) of B. gibsoni Asian genotype. Cloning and sequencing of the amplified products of each sample was performed separately. Based on sequences and phylogenetic analysis of 18S rRNA and ITS1 sequences, 13 were considered to be B. gibsoni. These thirteen isolates shared high sequence identity with each other and with B. gibsoni Asian genotype. The other two isolates could not be assigned to any particular species because of the difference(s) in 18S rRNA sequence with B. gibsoni and closer identity with Babesiaoccultans and Babesiaorientalis. In the phylogenetic tree, all the isolates of B. gibsoni Asian genotype formed a separate major clade named as Babesia spp. sensu stricto clade with high bootstrap support. The two unnamed Babesia sp. (Malbazar and Ludhiana isolates) clustered close together with B. orientalis, Babesia sp. (Kashi 1 isolate) and B. occultans of bovines. It can be inferred from this study that 18S rRNA gene and ITS1 region are highly conserved among 13 B. gibsoni isolates from India. It is the maiden attempt of genetic characterization by sequencing of 18S rRNA gene and ITS1 region of B. gibsoni from India and is also the first record on the occurrence of an unknown Babesia sp. of dogs from south and south-east Asia. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Intraspecific Variation and Phylogenetic Relationships Are Revealed by ITS1 Secondary Structure Analysis and Single-Nucleotide Polymorphism in Ganoderma lucidum

    Science.gov (United States)

    Pei, Haisheng; Chen, Zhou; Tan, Xiaoyan; Hu, Jing; Yang, Bin; Sun, Junshe

    2017-01-01

    Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS) sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1–3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP) site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality control in the

  9. Intraspecific Variation and Phylogenetic Relationships Are Revealed by ITS1 Secondary Structure Analysis and Single-Nucleotide Polymorphism in Ganoderma lucidum.

    Directory of Open Access Journals (Sweden)

    Xiuqing Zhang

    Full Text Available Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1-3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality

  10. Phylogenetic molecular function annotation

    International Nuclear Information System (INIS)

    Engelhardt, Barbara E; Jordan, Michael I; Repo, Susanna T; Brenner, Steven E

    2009-01-01

    It is now easier to discover thousands of protein sequences in a new microbial genome than it is to biochemically characterize the specific activity of a single protein of unknown function. The molecular functions of protein sequences have typically been predicted using homology-based computational methods, which rely on the principle that homologous proteins share a similar function. However, some protein families include groups of proteins with different molecular functions. A phylogenetic approach for predicting molecular function (sometimes called 'phylogenomics') is an effective means to predict protein molecular function. These methods incorporate functional evidence from all members of a family that have functional characterizations using the evolutionary history of the protein family to make robust predictions for the uncharacterized proteins. However, they are often difficult to apply on a genome-wide scale because of the time-consuming step of reconstructing the phylogenies of each protein to be annotated. Our automated approach for function annotation using phylogeny, the SIFTER (Statistical Inference of Function Through Evolutionary Relationships) methodology, uses a statistical graphical model to compute the probabilities of molecular functions for unannotated proteins. Our benchmark tests showed that SIFTER provides accurate functional predictions on various protein families, outperforming other available methods.

  11. Functional & phylogenetic diversity of copepod communities

    Science.gov (United States)

    Benedetti, F.; Ayata, S. D.; Blanco-Bercial, L.; Cornils, A.; Guilhaumon, F.

    2016-02-01

    The diversity of natural communities is classically estimated through species identification (taxonomic diversity) but can also be estimated from the ecological functions performed by the species (functional diversity), or from the phylogenetic relationships among them (phylogenetic diversity). Estimating functional diversity requires the definition of specific functional traits, i.e., phenotypic characteristics that impact fitness and are relevant to ecosystem functioning. Estimating phylogenetic diversity requires the description of phylogenetic relationships, for instance by using molecular tools. In the present study, we focused on the functional and phylogenetic diversity of copepod surface communities in the Mediterranean Sea. First, we implemented a specific trait database for the most commonly-sampled and abundant copepod species of the Mediterranean Sea. Our database includes 191 species, described by seven traits encompassing diverse ecological functions: minimal and maximal body length, trophic group, feeding type, spawning strategy, diel vertical migration and vertical habitat. Clustering analysis in the functional trait space revealed that Mediterranean copepods can be gathered into groups that have different ecological roles. Second, we reconstructed a phylogenetic tree using the available sequences of 18S rRNA. Our tree included 154 of the analyzed Mediterranean copepod species. We used these two datasets to describe the functional and phylogenetic diversity of copepod surface communities in the Mediterranean Sea. The replacement component (turn-over) and the species richness difference component (nestedness) of the beta diversity indices were identified. Finally, by comparing various and complementary aspects of plankton diversity (taxonomic, functional, and phylogenetic diversity) we were able to gain a better understanding of the relationships among the zooplankton community, biodiversity, ecosystem function, and environmental forcing.

  12. Description and phylogenetic relationships of a new genus and two new species of lizards from Brazilian Amazonia, with nomenclatural comments on the taxonomy of Gymnophthalmidae (Reptilia: Squamata).

    Science.gov (United States)

    Colli, Guarino R; Hoogmoed, Marinus S; Cannatella, David C; Cassimiro, José; Gomes, Jerriane Oliveira; Ghellere, José Mário; Gomes, Jerriane Oliveira; Ghellere, José Mário; Nunes, Pedro M Sales; Pellegrino, Kátia C M; Salerno, Patricia; Souza, Sergio Marques De; Rodrigues, Miguel Trefaut

    2015-08-18

    We describe a new genus and two new species of gymnophthalmid lizards based on specimens collected from Brazilian Amazonia, mostly in the "arc of deforestation". The new genus is easily distinguished from other Gymnophthalmidae by having very wide, smooth, and imbricate nuchals, arranged in two longitudinal and 6-10 transverse rows from nape to brachium level, followed by much narrower, strongly keeled, lanceolate, and mucronate scales. It also differs from all other Gymnophthalmidae, except Iphisa, by the presence of two longitudinal rows of ventrals. The new genus differs from Iphisa by having two pairs of enlarged chinshields (one in Iphisa); posterior dorsal scales lanceolate, strongly keeled and not arranged in longitudinal rows (dorsals broad, smooth and forming two longitudinal rows), and lateral scales keeled (smooth). Maximum parsimony, maximum likelihood, and Bayesian phylogenetic analyses based on morphological and molecular data indicate the new species form a clade that is most closely related to Iphisa. We also address several nomenclatural issues and present a revised classification of Gymnophthalmidae.

  13. Phylogenetic relationships and biogeography of Ptilophora (Gelidiales, Rhodophyta) with descriptions of P. aureolusa, P. malagasya, and P. spongiophila from Madagascar.

    Science.gov (United States)

    Boo, Ga Hun; Gall, Line Le; Hwang, Il Ki; Miller, Kathy Ann; Boo, Sung Min

    2018-04-01

    The genus Ptilophora currently includes 16 species occurring mostly in subtidal habitats of the Indo-Pacific Ocean, but its global diversity and biogeography are poorly understood. We analyzed mitochondrial cox1, plastid rbcL and plastid psbA sequences from specimens collected in southern Madagascar during the 2010 Atimo Vatae expedition and studied their morphologies. Both morphological and molecular data sets demonstrated the presence of five species in southern Madagascar: Ptilophora hildebrandtii, P. pterocladioides, and three new species described here, P. aureolusa, P. malagasya, and P. spongiophila. Ptilophora aureolusa is distinguished by its compound pinnae with uniformly spaced pinnules. Ptilophora malagasya has an indistinct midrib and irregularly spaced pinnules. Ptilophora spongiophila, heavily coated with sponges, has cylindrical to flattened main axes, lateral and surface proliferations, and spatulate tetrasporangial sori. The species of Ptilophora found in Madagascar are endemic, except P. hildebrandtii, which also occurs in eastern Africa. Ptilophora comprises four phylogenetic groups that map to eastern Australia, Japan, western Australia/Southeast Asia/Madagascar/eastern Africa, and Madagascar/eastern Africa/Aegean Sea. Biogeographical analysis revealed that the ancestor of Ptilophora originated in Australia, but most of the species radiated from Madagascar. © 2018 Phycological Society of America.

  14. Forgotten in the taxonomic literature: Resurrection of the scleractinian coral genus Sclerophyllia (Scleractinia, Lobophylliidae) from the Arabian Peninsula and its phylogenetic relationships

    KAUST Repository

    Arrigoni, Roberto

    2014-11-21

    The monospecific scleractinian coral genus Sclerophyllia Klunzinger, 1879 was originally described from Al-Qusayr (Egypt) in the Red Sea based on a series of solitary specimens. Thenceforth, it has been considered a junior synonym of Symphyllia and Cynarina based on corallum macromorphology. In this study, several specimens of Sclerophyllia margariticola were collected on the coasts of Saudi Arabia in the northern and central Red Sea. Four molecular markers were sequenced, COI and the intergenic spacer between COI and l-rRNA from mitochondrial DNA and Histone H3 and ribosomal ITS2 from nuclear DNA. Phylogenetic trees and haplotype network analyses show that S. margariticola belongs to the family Lobophylliidae and that it is closely related to Acanthastrea maxima, an uncommon species from waters around the Arabian peninsula (the Gulf of Aden, Arabian Sea, Gulf of Oman and Persian Gulf). Sclerophyllia margariticola and A. maxima share several macro- and micromorphological characters, such as the presence of free septa, high elliptical septal teeth perpendicular to the septal margin, irregular lobate tips, very wide tooth spacing, a very strong granulation with granules scattered all along the septal sides, and a palisade interarea structure, and their micromorphology differs substantially from that of Acanthastrea echinata, the type species of Acanthastrea. Therefore, we formally resurrect Sclerophyllia, provide a revised diagnosis for the genus, and move A. maxima into Sclerophyllia.

  15. Suitability of Root and Rhizome Anatomy for Taxonomic Classification and Reconstruction of Phylogenetic Relationships in the Tribes Cardueae and Cichorieae (Asteraceae).

    Science.gov (United States)

    Ginko, Elisabeth; Dobeš, Christoph; Saukel, Johannes

    2016-05-27

    The value of root and rhizome anatomy for the taxonomic characterisation of 59 species classified into 34 genera and 12 subtribes from the Asteraceae tribes Cardueae and Cichorieae was assessed. In addition, the evolutionary history of anatomical characters was reconstructed using a nuclear ribosomal DNA sequence-based phylogeny of the Cichorieae. Taxa were selected with a focus on pharmaceutically relevant species. A binary decision tree was constructed and discriminant function analyses were performed to extract taxonomically relevant anatomical characters and to infer the separability of infratribal taxa, respectively. The binary decision tree distinguished 33 species and two subspecies, but only five of the genera (sampled for at least two species) by a unique combination of hierarchically arranged characters. Accessions were discriminated-except for one sample worthy of discussion-according to their subtribal affiliation in the discriminant function analyses (DFA). However, constantly expressed subtribe-specific characters were almost missing and even in combination, did not discriminate the subtribes. Most anatomical characters showed at least some degree of homoplasious evolution limiting their suitability as phylogenetically informative characters.

  16. Untangling hybrid phylogenetic signals: horizontal gene transfer and artifacts of phylogenetic reconstruction.

    Science.gov (United States)

    Beiko, Robert G; Ragan, Mark A

    2009-01-01

    Phylogenomic methods can be used to investigate the tangled evolutionary relationships among genomes. Building 'all the trees of all the genes' can potentially identify common pathways of horizontal gene transfer (HGT) among taxa at varying levels of phylogenetic depth. Phylogenetic affinities can be aggregated and merged with the information about genetic linkage and biochemical function to examine hypotheses of adaptive evolution via HGT. Additionally, the use of many genetic data sets increases the power of statistical tests for phylogenetic artifacts. However, large-scale phylogenetic analyses pose several challenges, including the necessary abandonment of manual validation techniques, the need to translate inferred phylogenetic discordance into inferred HGT events, and the challenges involved in aggregating results from search-based inference methods. In this chapter we describe a tree search procedure to recover the most parsimonious pathways of HGT, and examine some of the assumptions that are made by this method.

  17. Phylogenetic Trees From Sequences

    Science.gov (United States)

    Ryvkin, Paul; Wang, Li-San

    In this chapter, we review important concepts and approaches for phylogeny reconstruction from sequence data.We first cover some basic definitions and properties of phylogenetics, and briefly explain how scientists model sequence evolution and measure sequence divergence. We then discuss three major approaches for phylogenetic reconstruction: distance-based phylogenetic reconstruction, maximum parsimony, and maximum likelihood. In the third part of the chapter, we review how multiple phylogenies are compared by consensus methods and how to assess confidence using bootstrapping. At the end of the chapter are two sections that list popular software packages and additional reading.

  18. The phylogenetics of succession can guide restoration

    DEFF Research Database (Denmark)

    Shooner, Stephanie; Chisholm, Chelsea Lee; Davies, T. Jonathan

    2015-01-01

    Phylogenetic tools have increasingly been used in community ecology to describe the evolutionary relationships among co-occurring species. In studies of succession, such tools may allow us to identify the evolutionary lineages most suited for particular stages of succession and habitat...... rehabilitation. However, to date, these two applications have been largely separate. Here, we suggest that information on phylogenetic community structure might help to inform community restoration strategies following major disturbance. Our study examined phylogenetic patterns of succession based...... for species sorting along abiotic gradients (slope and aspect) on the mine sites that had been abandoned for the longest. Synthesis and applications. Understanding the trajectory of succession is critical for restoration efforts. Our results suggest that early colonizers represent a phylogenetically random...

  19. Relaciones filogenéticas del género Anomala (Coleoptera: Melolonthidae: Rutelinae Phylogenetic relationships of the genus Anomala (Coleoptera: Melolonthidae: Rutelinae

    Directory of Open Access Journals (Sweden)

    Andrés Ramírez-Ponce

    2009-08-01

    Full Text Available Se presenta un análisis filogenético basado en caracteres morfológicos de adultos de varios géneros de la tribu Anomalini para redefinir al género Anomala Samouelle, 1819 y evaluar su situación filogenética. El análisis de parsimonia, que incluyó 46 especies de 18 géneros procedentes de varias partes del mundo, permitió poner a prueba la monofilia de algunos géneros y evaluar su posición taxonómica, además de revelar que los límites de algunos géneros no son claros. Con base en el cladograma de consenso estricto existen evidencias suficientes para considerar las especies americanas hasta ahora incluidas en Anomala como un género diferente, al que corresponde nombrar Paranomala Casey, 1915, stat. rev. También se comprobó que algunas especies americanas incluidas en el género Callistethus Blanchard, 1851 deben incorporarse al género Paranomala, con excepción de C. viduus (Newman, la cual fundamenta la revalidación del género Pachystethus Blanchard, 1851, stat. rev. También se sinonimiza el género Anomalacra Casey, 1915 con Paranomala, y se transfiere Anomala carlsoni Hardy, 1976 a Leptohoplia Saylor, 1935. Se actualizan las descripciones y diagnosis de los géneros Anomala, Paranomala, Callistethus y Pachystethus y se incluye una clave de los géneros americanos de Anomalini que incorpora las definiciones y cambios nomenclaturales propuestos.A phylogenetic analysis based on adult morphology that includes some genera included in the tribe Anomalini is presented, to redefine the genus Anomala Samouelle, 1819, and evaluate its phylogenetic situation. The parsimony analysis, based on 46 species of 18 genera from several areas of the world, allowed us to test the monophyly of some genera and evaluate their taxonomic position, and to reveal that the generic limits are not clear. On the basis of the strict consensus cladogram there is reason to consider the American species heretofore included in Anomala as members of a

  20. A gene encoding starch branching enzyme I (SBEI) in apple (Malusxdomestica, Rosaceae) and its phylogenetic relationship to Sbe genes from other angiosperms.

    Science.gov (United States)

    Han, Yuepeng; Gasic, Ksenija; Sun, Fengjie; Xu, Mingliang; Korban, Schuyler S

    2007-06-01

    An apple starch-branching enzyme SbeI gene (GenBank Accession No. DQ115404) has been isolated, cloned, and sequenced. The SbeI is a single copy gene in the apple genome, consisting of 14 exons and 13 introns, and covering 6075bp. As detected by RT-PCR, the apple SbeI is expressed at very low levels during early stages of fruit development; while, the highest levels of mRNA transcripts are observed at approximately 44 days post-pollination. Besides fruits, the apple SbeI is also expressed in buds and flowers, and very weakly in leaves. The genomic structure of SbeI in apple is strikingly similar to those reported so far in grasses (Poaceae), with exons 4 through 13 being of identical lengths in both apple and grasses. Moreover, structure similarities in exon lengths have also been detected in SbeII genes of both grasses and eudicots. These findings prompted the investigation of the evolutionary process of the Sbe gene family in angiosperms. A total of 26 Sbe sequences, representing an array of monocots and eudicots, are investigated in this study. Phylogenetic analysis has suggested that Sbe genes have duplicated into SbeI and SbeII prior to the divergence of moncots from eudicots. The SbeII gene is further duplicated into SbeIIa and SbeIIb prior to the radiation of grasses; however, it is not yet clear whether this duplication event has occurred before or after the radiation of the eudicots.

  1. Phylogenetic relationships among Synallaxini spinetails (Aves: Furnariidae) reveal a new biogeographic pattern across the Amazon and Paraná river basins.

    Science.gov (United States)

    Claramunt, Santiago

    2014-09-01

    Relationships among genera in the tribe Synallaxini have proved difficult to resolve. In this study, I investigate relationships among Synallaxis, Certhiaxis and Schoeniophylax using DNA sequences from the mitochondrion and three nuclear regions. I implemented novel primers and protocols for amplifying and sequencing autosomal and sex-linked introns in Furnariidae that resolved basal relationships in the Synallaxini with strong support. Synallaxis propinqua is sister to Schoeniophylax phryganophilus, and together they form a clade with Certhiaxis. The results are robust to analytical approaches when all genomic regions are analyzed jointly (parsimony, maximum likelihood, and species-tree analysis) and the same basal relationships are recovered by most genomic regions when analyzed separately. A sister relationship between S. propinqua, an Amazonian river island specialist, and S. phryganophilus, from the Paraná River basin region, reveals a new biogeographic pattern shared by at least other four pairs of taxa with similar distributions and ecologies. Estimates of divergence times for these five pairs span from the late Miocene to the Pleistocene. Identification of the historical events that produced this pattern is difficult and further advances will require additional studies of the taxa involved and a better understanding of the recent environmental history of South America. A new classification is proposed for the Synallaxini, including the description of a new genus for S. propinqua. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Treelink: data integration, clustering and visualization of phylogenetic trees.

    Science.gov (United States)

    Allende, Christian; Sohn, Erik; Little, Cedric

    2015-12-29

    Phylogenetic trees are central to a wide range of biological studies. In many of these studies, tree nodes need to be associated with a variety of attributes. For example, in studies concerned with viral relationships, tree nodes are associated with epidemiological information, such as location, age and subtype. Gene trees used in comparative genomics are usually linked with taxonomic information, such as functional annotations and events. A wide variety of tree visualization and annotation tools have been developed in the past, however none of them are intended for an integrative and comparative analysis. Treelink is a platform-independent software for linking datasets and sequence files to phylogenetic trees. The application allows an automated integration of datasets to trees for operations such as classifying a tree based on a field or showing the distribution of selected data attributes in branches and leafs. Genomic and proteonomic sequences can also be linked to the tree and extracted from internal and external nodes. A novel clustering algorithm to simplify trees and display the most divergent clades was also developed, where validation can be achieved using the data integration and classification function. Integrated geographical information allows ancestral character reconstruction for phylogeographic plotting based on parsimony and likelihood algorithms. Our software can successfully integrate phylogenetic trees with different data sources, and perform operations to differentiate and visualize those differences within a tree. File support includes the most popular formats such as newick and csv. Exporting visualizations as images, cluster outputs and genomic sequences is supported. Treelink is available as a web and desktop application at http://www.treelinkapp.com .

  3. Genetic Diversity and Phylogenetic Relationships of Coevolving Symbiont-Harboring Insect Trypanosomatids, and Their Neotropical Dispersal by Invader African Blowflies (Calliphoridae

    Directory of Open Access Journals (Sweden)

    Tarcilla C. Borghesan

    2018-02-01

    Full Text Available This study is about the inter- and intra-specific genetic diversity of trypanosomatids of the genus Angomonas, and their association with Calliphoridae (blowflies in Neotropical and Afrotropical regions. Microscopic examination of 3,900 flies of various families, mostly Calliphoridae, revealed that 31% of them harbored trypanosomatids. Small subunit rRNA (SSU rRNA barcoding showed that Angomonas predominated (46% over the other common trypanosomatids of blowflies of genera Herpetomonas and Wallacemonas. Among Angomonas spp., A. deanei was much more common than the two-other species, A. desouzai and A. ambiguus. Phylogenetic analyses based on SSU rRNA, glycosomal glyceraldehyde-3-phosphate dehydrogenase (gGAPDH and internal transcribed spacer rDNA (ITS rDNA sequences revealed a marked genetic diversity within A. deanei, which comprised four infraspecific genotypes (Dea1–Dea4, and four corresponding symbiont genotypes (Kcr1–Kcr4. Host and symbiont phylogenies were highly congruent corroborating their co-divergence, consistent with host-symbiont interdependent metabolism and symbiont reduced genomes shaped by a long coevolutionary history. We compared the diversity of Angomonas/symbionts from three genera of blowflies, Lucilia, Chrysomya and Cochliomyia. A. deanei, A. desouzai, and A. ambiguus were found in the three genera of blowflies in South America. In Africa, A. deanei and A. ambiguus were identified in Chrysomya. The absence of A. desouzai in Africa and its presence in Neotropical Cochliomyia and Lucilia suggests parasite spillback of A. desouzai into Chrysomya, which was most likely introduced four decades ago from Africa into the Neotropic. The absence of correlation between parasite diversity and geographic and genetic distances, with identical genotypes of A. deanei found in the Neotropic and Afrotropic, is consistent with disjunct distribution due to the recent human-mediated transoceanic dispersal of Angomonas by Chrysomya. This

  4. Phylogenetic relationship and virulence inference of Streptococcus Anginosus Group: curated annotation and whole-genome comparative analysis support distinct species designation

    Science.gov (United States)

    2013-01-01

    VNTR numbers that occurred over the course of one year. Conclusions The comparative genomic analysis of the SAG clarifies the phylogenetics of these bacteria and supports the distinct species classification. Numerous potential virulence determinants were identified and provide a foundation for further studies into SAG pathogenesis. Furthermore, the data may be used to enable the development of rapid diagnostic assays and therapeutics for these pathogens. PMID:24341328

  5. Phylogenetic community structure: temporal variation in fish assemblage

    OpenAIRE

    Santorelli, Sergio; Magnusson, William; Ferreira, Efrem; Caramaschi, Erica; Zuanon, Jansen; Amadio, Sidnéia

    2014-01-01

    Hypotheses about phylogenetic relationships among species allow inferences about the mechanisms that affect species coexistence. Nevertheless, most studies assume that phylogenetic patterns identified are stable over time. We used data on monthly samples of fish from a single lake over 10 years to show that the structure in phylogenetic assemblages varies over time and conclusions depend heavily on the time scale investigated. The data set was organized in guild structures and temporal scales...

  6. Phylogenetic system and zoogeography of the Plecoptera.

    Science.gov (United States)

    Zwick, P

    2000-01-01

    Information about the phylogenetic relationships of Plecoptera is summarized. The few characters supporting monophyly of the order are outlined. Several characters of possible significance for the search for the closest relatives of the stoneflies are discussed, but the sister-group of the order remains unknown. Numerous characters supporting the presently recognized phylogenetic system of Plecoptera are presented, alternative classifications are discussed, and suggestions for future studies are made. Notes on zoogeography are appended. The order as such is old (Permian fossils), but phylogenetic relationships and global distribution patterns suggest that evolution of the extant suborders started with the breakup of Pangaea. There is evidence of extensive recent speciation in all parts of the world.

  7. Relationship Between Final Performance and Block Times with the Traditional and the New Starting Platforms with A Back Plate in International Swimming Championship 50-M and 100-M Freestyle Events

    Science.gov (United States)

    Garcia-Hermoso, Antonio; Escalante, Yolanda; Arellano, Raul; Navarro, Fernando; Domínguez, Ana M.; Saavedra, Jose M.

    2013-01-01

    The purpose of this study was to investigate the association between block time and final performance for each sex in 50-m and 100-m individual freestyle, distinguishing between classification (1st to 3rd, 4th to 8th, 9th to 16th) and type of starting platform (old and new) in international competitions. Twenty-six international competitions covering a 13-year period (2000-2012) were analysed retrospectively. The data corresponded to a total of 1657 swimmers’ competition histories. A two-way ANOVA (sex x classification) was performed for each event and starting platform with the Bonferroni post-hoc test, and another two-way ANOVA for sex and starting platform (sex x starting platform). Pearson’s simple correlation coefficient was used to determine correlations between the block time and the final performance. Finally, a simple linear regression analysis was done between the final time and the block time for each sex and platform. The men had shorter starting block times than the women in both events and from both platforms. For 50-m event, medalists had shorter block times than semi- finalists with the old starting platforms. Block times were directly related to performance with the old starting platforms. With the new starting platforms, however, the relationship was inverse, notably in the women’s 50-m event. The block time was related for final performance in the men’s 50- m event with the old starting platform, but with the new platform it was critical only for the women’s 50-m event. Key Points The men had shorter block times than the women in both events and with both platforms. For both distances, the swimmers had shorter block times in their starts from the new starting platform with a back plate than with the old platform. For the 50-m event with the old starting platform, the medalists had shorter block times than the semi-finalists. The new starting platform block time was only determinant in the women’s 50-m event. In order to improve

  8. Phylogenetic Structure of Foliar Spectral Traits in Tropical Forest Canopies

    Directory of Open Access Journals (Sweden)

    Kelly M. McManus

    2016-02-01

    Full Text Available The Spectranomics approach to tropical forest remote sensing has established a link between foliar reflectance spectra and the phylogenetic composition of tropical canopy tree communities vis-à-vis the taxonomic organization of biochemical trait variation. However, a direct relationship between phylogenetic affiliation and foliar reflectance spectra of species has not been established. We sought to develop this relationship by quantifying the extent to which underlying patterns of phylogenetic structure drive interspecific variation among foliar reflectance spectra within three Neotropical canopy tree communities with varying levels of soil fertility. We interpreted the resulting spectral patterns of phylogenetic signal in the context of foliar biochemical traits that may contribute to the spectral-phylogenetic link. We utilized a multi-model ensemble to elucidate trait-spectral relationships, and quantified phylogenetic signal for spectral wavelengths and traits using Pagel’s lambda statistic. Foliar reflectance spectra showed evidence of phylogenetic influence primarily within the visible and shortwave infrared spectral regions. These regions were also selected by the multi-model ensemble as those most important to the quantitative prediction of several foliar biochemical traits. Patterns of phylogenetic organization of spectra and traits varied across sites and with soil fertility, indicative of the complex interactions between the environmental and phylogenetic controls underlying patterns of biodiversity.

  9. Disentangling the phylogenetic and ecological components of spider phenotypic variation.

    Science.gov (United States)

    Gonçalves-Souza, Thiago; Diniz-Filho, José Alexandre Felizola; Romero, Gustavo Quevedo

    2014-01-01

    An understanding of how the degree of phylogenetic relatedness influences the ecological similarity among species is crucial to inferring the mechanisms governing the assembly of communities. We evaluated the relative importance of spider phylogenetic relationships and ecological niche (plant morphological variables) to the variation in spider body size and shape by comparing spiders at different scales: (i) between bromeliads and dicot plants (i.e., habitat scale) and (ii) among bromeliads with distinct architectural features (i.e., microhabitat scale). We partitioned the interspecific variation in body size and shape into phylogenetic (that express trait values as expected by phylogenetic relationships among species) and ecological components (that express trait values independent of phylogenetic relationships). At the habitat scale, bromeliad spiders were larger and flatter than spiders associated with the surrounding dicots. At this scale, plant morphology sorted out close related spiders. Our results showed that spider flatness is phylogenetically clustered at the habitat scale, whereas it is phylogenetically overdispersed at the microhabitat scale, although phylogenic signal is present in both scales. Taken together, these results suggest that whereas at the habitat scale selective colonization affect spider body size and shape, at fine scales both selective colonization and adaptive evolution determine spider body shape. By partitioning the phylogenetic and ecological components of phenotypic variation, we were able to disentangle the evolutionary history of distinct spider traits and show that plant architecture plays a role in the evolution of spider body size and shape. We also discussed the relevance in considering multiple scales when studying phylogenetic community structure.

  10. The phylogenetic likelihood library.

    Science.gov (United States)

    Flouri, T; Izquierdo-Carrasco, F; Darriba, D; Aberer, A J; Nguyen, L-T; Minh, B Q; Von Haeseler, A; Stamatakis, A

    2015-03-01

    We introduce the Phylogenetic Likelihood Library (PLL), a highly optimized application programming interface for developing likelihood-based phylogenetic inference and postanalysis software. The PLL implements appropriate data structures and functions that allow users to quickly implement common, error-prone, and labor-intensive tasks, such as likelihood calculations, model parameter as well as branch length optimization, and tree space exploration. The highly optimized and parallelized implementation of the phylogenetic likelihood function and a thorough documentation provide a framework for rapid development of scalable parallel phylogenetic software. By example of two likelihood-based phylogenetic codes we show that the PLL improves the sequential performance of current software by a factor of 2-10 while requiring only 1 month of programming time for integration. We show that, when numerical scaling for preventing floating point underflow is enabled, the double precision likelihood calculations in the PLL are up to 1.9 times faster than those in BEAGLE. On an empirical DNA dataset with 2000 taxa the AVX version of PLL is 4 times faster than BEAGLE (scaling enabled and required). The PLL is available at http://www.libpll.org under the GNU General Public License (GPL). © The Author(s) 2014. Published by Oxford University Press, on behalf of the Society of Systematic Biologists.

  11. Phylogenetic relationships in Taxodiaceae and Cupressaceae sensu stricto based on matK gene, chlL gene, trnL-trnF IGS region, and trnL intron sequences.

    Science.gov (United States)

    Kusumi, J; Tsumura, Y; Yoshimaru, H; Tachida, H

    2000-10-01

    Nucleotide sequences from four chloroplast genes, the matK, chlL, intergenic spacer (IGS) region between trnL and trnF, and an intron of trnL, were determined from all species of Taxodiaceae and five species of Cupressaceae sensu stricto (s.s.). Phylogenetic trees were constructed using the maximum parsimony and the neighbor-joining methods with Cunninghamia as an outgroup. These analyses provided greater resolution of relationships among genera and higher bootstrap supports for clades compared to previous analyses. Results indicate that Taiwania diverged first, and then Athrotaxis diverged from the remaining genera. Metasequoia, Sequoia, and Sequoiadendron form a clade. Taxodium and Glyptostrobus form a clade, which is the sister to Cryptomeria. Cupressaceae s.s. are derived from within Taxodiaceae, being the most closely related to the Cryptomeria/Taxodium/Glyptostrobus clade. These relationships are consistent with previous morphological groupings and the analyses of molecular data. In addition, we found acceleration of evolutionary rates in Cupressaceae s.s. Possible causes for the acceleration are discussed.

  12. Mapping Phylogenetic Trees to Reveal Distinct Patterns of Evolution.

    Science.gov (United States)

    Kendall, Michelle; Colijn, Caroline

    2016-10-01

    Evolutionary relationships are frequently described by phylogenetic trees, but a central barrier in many fields is the difficulty of interpreting data containing conflicting phylogenetic signals. We present a metric-based method for comparing trees which extracts distinct alternative evolutionary relationships embedded in data. We demonstrate detection and resolution of phylogenetic uncertainty in a recent study of anole lizards, leading to alternate hypotheses about their evolutionary relationships. We use our approach to compare trees derived from different genes of Ebolavirus and find that the VP30 gene has a distinct phylogenetic signature composed of three alternatives that differ in the deep branching structure. phylogenetics, evolution, tree metrics, genetics, sequencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  13. The Drosophila bipectinata species complex: phylogenetic ...

    Indian Academy of Sciences (India)

    [Banerjee P. and Singh B. N. 2017 The Drosophila bipectinata species complex: phylogenetic relationship among different members based on chromosomal variations. J. Genet. 96, 97–107]. Introduction ..... loops touch the chromocenter and in our microphotograph. (depicting both the arms) too, the involvement of chromo-.

  14. Phylogenetic congruence between subtropical trees and their associated fungi

    NARCIS (Netherlands)

    Liu, Xubing; Liang, Minxia; Etienne, Rampal S.; Gilbert, Gregory S; Yu, Shixiao

    2016-01-01

    Recent studies have detected phylogenetic signals in pathogen-host networks for both soil-borne and leaf-infecting fungi, suggesting that pathogenic fungi may track or coevolve with their preferred hosts. However, a phylogenetically concordant relationship between multiple hosts and multiple fungi

  15. Evolution of the brain and phylogenetic development of Mrican ...

    African Journals Online (AJOL)

    Evolution of the brain and phylogenetic development of Mrican Bovidae. Henriette Oboussier. Zoological Institute and Museum, University of Hamburg. Evidence drawn from the study of 270 brains of 54 species and subspecies of African Bovidae makes it possible to base phylogenetic relationships on the similarities in the ...

  16. Phylogenetic relationships among the European and American bison and seven cattle breeds recon structed using the Bovine SNP50 Illumina Genotyping BeadChip

    DEFF Research Database (Denmark)

    Pertoldi, Cino; Wójcik, Jan M; Kawalko, Agata

    2010-01-01

    amongst bison subspecies and cattle, and (3) de tect loci under positive or stabilizing selection. A Bayesian clustering procedure (STRUCTURE) detected ten genetically distinct clusters, with separation among all seven cattle breeds and European and American bison, but no separation be tween plain......Here we present the first at tempt to use the BovineSNP50 Illumina genotyping BeadChip for genome-wide screening of European bison Bisonbonasus bonasus (EB), two subspecies of American bison: the plains bison (EB), two sub species of American bison: the plains bison Bison bison bison (PB), the wood...... bison Bi on bison athabascae (WB) and seven (PB), the wood bison (WB) and seven cattle Bostaurus breeds. Our aims were to (1) reconstruct their evolutionary relationships, (2) detect any genetic signature of past bottlenecks and to quantify the con sequences of bottle necks on the genetic distances...

  17. Phylogenetic relationships of click beetles (Coleoptera: Elateridae) inferred from 28S ribosomal DNA: insights into the evolution of bioluminescence in Elateridae.

    Science.gov (United States)

    Sagegami-Oba, Reiko; Oba, Yuichi; Ohira, Hitoo

    2007-02-01

    Although the taxonomy of click beetles (family Elateridae) has been studied extensively, inconsistencies remain. We examine here the relationships between species of Elateridae based on partial sequences of nuclear 28S ribosomal DNA. Specimens were collected primarily from Japan, while luminous click beetles were also sampled from Central and South America to investigate the origins of bioluminescence in Elateridae. Neighbor-joining, maximum-parsimony, and maximum-likelihood analyses produced a consistent basal topology with high statistical support that is partially congruent with the results of previous investigations based on the morphological characteristics of larvae and adults. The most parsimonious reconstruction of the "luminous" and "nonluminous" states, based on the present molecular phylogeny, indicates that the ancestral state of Elateridae was nonluminous. This suggests that the bioluminescence in click beetle evolved independent of that of other luminous beetles, such as Lampyridae, despite their common mechanisms of bioluminescence.

  18. Relationship Between Final Performance and Block Times with the Traditional and the New Starting Platforms with A Back Plate in International Swimming Championship 50-M and 100-M Freestyle Events

    Directory of Open Access Journals (Sweden)

    Antonio Garcia-Hermoso

    2013-12-01

    Full Text Available The purpose of this study was to investigate the association between block time and final performance for each sex in 50-m and 100-m individual freestyle, distinguishing between classification (1st to 3rd, 4th to 8th, 9th to 16th and type of starting platform (old and new in international competitions. Twenty-six international competitions covering a 13-year period (2000-2012 were analysed retrospectively. The data corresponded to a total of 1657 swimmers’ competition histories. A two-way ANOVA (sex x classification was performed for each event and starting platform with the Bonferroni post-hoc test, and another two-way ANOVA for sex and starting platform (sex x starting platform. Pearson’s simple correlation coefficient was used to determine correlations between the block time and the final performance. Finally, a simple linear regression analysis was done between the final time and the block time for each sex and platform. The men had shorter starting block times than the women in both events and from both platforms. For 50-m event, medalists had shorter block times than semi- finalists with the old starting platforms. Block times were directly related to performance with the old starting platforms. With the new starting platforms, however, the relationship was inverse, notably in the women’s 50-m event. The block time was related for final performance in the men’s 50- m event with the old starting platform, but with the new platform it was critical only for the women’s 50-m event.

  19. Extending the BEAGLE library to a multi-FPGA platform.

    Science.gov (United States)

    Jin, Zheming; Bakos, Jason D

    2013-01-19

    Maximum Likelihood (ML)-based phylogenetic inference using Felsenstein's pruning algorithm is a standard method for estimating the evolutionary relationships amongst a set of species based on DNA sequence data, and is used in popular applications such as RAxML, PHYLIP, GARLI, BEAST, and MrBayes. The Phylogenetic Likelihood Function (PLF) and its associated scaling and normalization steps comprise the computational kernel for these tools. These computations are data intensive but contain fine grain parallelism that can be exploited by coprocessor architectures such as FPGAs and GPUs. A general purpose API called BEAGLE has recently been developed that includes optimized implementations of Felsenstein's pruning algorithm for various data parallel architectures. In this paper, we extend the BEAGLE API to a multiple Field Programmable Gate Array (FPGA)-based platform called the Convey HC-1. The core calculation of our implementation, which includes both the phylogenetic likelihood function (PLF) and the tree likelihood calculation, has an arithmetic intensity of 130 floating-point operations per 64 bytes of I/O, or 2.03 ops/byte. Its performance can thus be calculated as a function of the host platform's peak memory bandwidth and the implementation's memory efficiency, as 2.03 × peak bandwidth × memory efficiency. Our FPGA-based platform has a peak bandwidth of 76.8 GB/s and our implementation achieves a memory efficiency of approximately 50%, which gives an average throughput of 78 Gflops. This represents a ~40X speedup when compared with BEAGLE's CPU implementation on a dual Xeon 5520 and 3X speedup versus BEAGLE's GPU implementation on a Tesla T10 GPU for very large data sizes. The power consumption is 92 W, yielding a power efficiency of 1.7 Gflops per Watt. The use of data parallel architectures to achieve high performance for likelihood-based phylogenetic inference requires high memory bandwidth and a design methodology that emphasizes high memory

  20. The relationship with the Other as a platform for discussion about conflicts. Comments on the Orzesze coal mine project

    Directory of Open Access Journals (Sweden)

    Belzyt Joanna Iza

    2017-06-01

    Full Text Available An analysis was made of comments in media reports on the selected case, the „Orzesze” mining project, posted by Internet users on news websites during the period July 2014 - December 2016 This article is an attempt to examine the relationship with the Other/Alien when thinking about conflicts around investment projects which will interfere with the surrounding social and natural environment. The article considers the theories on the sources of conflict and the development of the conflict process and its consequences and suggests possible courses of action to prevent the escalation of such conflicts particularly with respect to the “Orzesze” mining project in the Upper Silesia, Poland. Taking into account that the Data, Relationship, Value, and Interest conflicts can all be sources of conflict, it should be underlined that good social communication is extremely important in the prevention and resolution of conflicts and the mitigation of their destructive influence. In a cooperation/communication oriented environment it would be much easier to focus on finding solutions rather than finding the guilty party as this can lead to an escalation of the conflict as searching for the guilty party is inextricably linked with the desire to win or to take revenge.

  1. Intricate patterns of phylogenetic relationships in the olive family as inferred from multi-locus plastid and nuclear DNA sequence analyses: a close-up on Chionanthus and Noronhia (Oleaceae).

    Science.gov (United States)

    Hong-Wa, Cynthia; Besnard, Guillaume

    2013-05-01

    Noronhia represents the most successful radiation of the olive family (Oleaceae) in Madagascar with more than 40 named endemic species distributed in all ecoregions from sea level to high mountains. Its position within the subtribe Oleinae has, however, been largely unresolved and its evolutionary history has remained unexplored. In this study, we generated a dataset of plastid (trnL-F, trnT-L, trnS-G, trnK-matK) and nuclear (internal transcribed spacer [ITS]) DNA sequences to infer phylogenetic relationships within Oleinae and to examine evolutionary patterns within Noronhia. Our sample included most species of Noronhia and representatives of the ten other extant genera within the subtribe with an emphasis on Chionanthus. Bayesian inferences and maximum likelihood analyses of plastid and nuclear data indicated several instances of paraphyly and polyphyly within Oleinae, with some geographic signal. Both plastid and ITS data showed a polyphyletic Noronhia that included Indian Ocean species of Chionanthus. They also found close relationships between Noronhia and African Chionanthus. However, the plastid data showed little clear differentiation between Noronhia and the African Chionanthus whereas relationships suggested by the nuclear ITS data were more consistent with taxonomy and geography. We used molecular dating to discriminate between hybridization and lineage sorting/gene duplication as alternative explanations for these topological discordances and to infer the biogeographic history of Noronhia. Hybridization between African Chionanthus and Noronhia could not be ruled out. However, Noronhia has long been established in Madagascar after a likely Cenozoic dispersal from Africa, suggesting any hybridization between representatives of African and Malagasy taxa was ancient. In any case, the African and Indian Ocean Chionanthus and Noronhia together formed a strongly supported monophyletic clade distinct and distant from other Chionanthus, which calls for a revised

  2. Payment Platform

    DEFF Research Database (Denmark)

    Hjelholt, Morten; Damsgaard, Jan

    2012-01-01

    thoroughly and substitute current payment standards in the decades to come. This paper portrays how digital payment platforms evolve in socio-technical niches and how various technological platforms aim for institutional attention in their attempt to challenge earlier platforms and standards. The paper...... applies a co-evolutionary multilevel perspective to model the interplay and processes between technology and society wherein digital payment platforms potentially will substitute other payment platforms just like the credit card negated the check. On this basis this paper formulate a multilevel conceptual...

  3. PhyDesign: an online application for profiling phylogenetic informativeness

    Directory of Open Access Journals (Sweden)

    Townsend Jeffrey P

    2011-05-01

    Full Text Available Abstract Background The rapid increase in number of sequenced genomes for species across of the tree of life is revealing a diverse suite of orthologous genes that could potentially be employed to inform molecular phylogenetic studies that encompass broader taxonomic sampling. Optimal usage of this diversity of loci requires user-friendly tools to facilitate widespread cost-effective locus prioritization for phylogenetic sampling. The Townsend (2007 phylogenetic informativeness provides a unique empirical metric for guiding marker selection. However, no software or automated methodology to evaluate sequence alignments and estimate the phylogenetic informativeness metric has been available. Results Here, we present PhyDesign, a platform-independent online application that implements the Townsend (2007 phylogenetic informativeness analysis, providing a quantitative prediction of the utility of loci to solve specific phylogenetic questions. An easy-to-use interface facilitates uploading of alignments and ultrametric trees to calculate and depict profiles of informativeness over specified time ranges, and provides rankings of locus prioritization for epochs of interest. Conclusions By providing these profiles, PhyDesign facilitates locus prioritization increasing the efficiency of sequencing for phylogenetic purposes compared to traditional studies with more laborious and low capacity screening methods, as well as increasing the accuracy of phylogenetic studies. Together with a manual and sample files, the application is freely accessible at http://phydesign.townsend.yale.edu.

  4. Phylogenetic relationship of asam gelugur (Garcinia atroviridis Griff. ex T. Anders) based on morphological characters in Langkat and Serdang Berdagai, Sumatera Utara

    Science.gov (United States)

    Bayu, E. S.; Lestami, A.; Kardhinata, E. H.; Rosemary

    2018-02-01

    Garcinia atroviridis plant is a commodity that has the potential to become an export commodity in Sumatera Utara. Characterization is an activity in germplasm to determine the morphological properties that can be utilized in differentiating between accessions and assessing the magnitude of genetic diversity. The magnitude of genetic diversity based on morphological properties can support breeding programs. The research was conducted in several areas of G. atroviridis plant, i.e. Gebang, Bahorok, Padang Tualang, Pegajahan, Sei Rampah, Pantai Cermin, and Perbaungan sub-districts in September 2016 with direct observation method. The aim of this research is to explore and characterization between G. atroviridis plant in Langkat and Serdang Berdagai. Parameters morphology characters were observed based on IPGRI, and observation data were analyzed by using SPSS version 21 to obtain the dendogram. The dendogram results showed that there are four groups of kinship relationships on the scale of the spacing (euclidean distance scale) 17. The lowest unequal value (closest kinship) in accessions G3(Bahorok) and G7(Sei Rampah) is 16.328 while the highest value of inequality (farthest kinship) in G5( Padang Tualang) and G6 (Pegajahan) is equal to 54.187. It needs the conservation of G. atroviridis although must be done next observation.

  5. Molecular identification of Anaplasma marginale in two autochthonous South American wild species revealed an identical new genotype and its phylogenetic relationship with those of bovines.

    Science.gov (United States)

    Guillemi, Eliana C; de la Fourniere, Sofía; Orozco, Marcela; Peña Martinez, Jorge; Correa, Elena; Fernandez, Javier; Lopez Arias, Ludmila; Paoletta, Martina; Corona, Belkis; Pinarello, Valérie; Wilkowsky, Silvina E; Farber, Marisa D

    2016-05-26

    Anaplasma marginale is a well-known cattle pathogen of tropical and subtropical world regions. Even though, this obligate intracellular bacterium has been reported in other host species different than bovine, it has never been documented in Myrmecophaga tridactyla (giant anteater) or Hippocamelus antisense (taruca), which are two native endangered species. Samples from two sick wild animals: a Myrmecophaga tridactyla (blood) and a Hippocamelus antisense (blood and serum) were studied for the presence of A. marginale DNA through msp5 gene fragment amplification. Further characterization was done through MSP1a tandem repeats analysis and MLST scheme and the genetic relationship among previously characterized A. marginale sequences were studied by applying, eBURST algorithm and AMOVA analysis. Anaplasma marginale DNA was identified in the Myrmecophaga tridactyla and Hippocamelus antisense samples. Through molecular markers, we identified an identical genotype in both animals that was not previously reported in bovine host. The analysis through eBURST and AMOVA revealed no differentiation between the taruca/anteater isolate and the bovine group. In the present publication we report the identification of A. marginale DNA in a novel ruminant (Hippocamelus antisense) and non-ruminant (Myrmecophaga tridactyla) host species. Genotyping analysis of isolates demonstrated the close relatedness of the new isolate with the circulation population of A. marginale in livestock. Further analysis is needed to understand whether these two hosts contribute to the anaplasmosis epidemiology.

  6. Phylogenetic relationships of some spirurine nematodes (Nematoda: Chromadorea: Rhabditida: Spirurina) parasitic in fishes inferred from SSU rRNA gene sequences.

    Science.gov (United States)

    Cernotíková, Eva; Horák, Ales; Moravec, Frantisek

    2011-06-01

    Abstract: Small subunit rRNA sequences were obtained from 38 representatives mainly of the nematode orders Spirurida (Camallanidae, Cystidicolidae, Daniconematidae, Philometridae, Physalopteridae, Rhabdochonidae, Skrjabillanidae) and, in part, Ascaridida (Anisakidae, Cucullanidae, Quimperiidae). The examined nematodes are predominantly parasites of fishes. Their analyses provided well-supported trees allowing the study ofphylogenetic relationships among some spirurine nematodes. The present results support the placement of Cucullanidae at the base of the suborder Spirurina and, based on the position of the genus Philonema (subfamily Philoneminae) forming a sister group to Skrjabillanidae (thus Philoneminae should be elevated to Philonemidae), the paraphyly of the Philometridae. Comparison of a large number of sequences of representatives of the latter family supports the paraphyly of the genera Philometra, Philometroides and Dentiphilometra. The validity of the newly included genera Afrophilometra and Caranginema is not supported. These results indicate geographical isolation has not been the cause of speciation in this parasite group and no coevolution with fish hosts is apparent. On the contrary, the group of South-American species ofAlinema, Nilonema and Rumai is placed in an independent branch, thus markedly separated from other family members. Molecular data indicate that the skrjabillanid subfamily Esocineminae (represented by Esocinema bohemicum) should be either elevated to the rank of an independent family or Daniconematidae (Mexiconema africanum) should be decreased to Daniconematinae and transferred to the family Skrjabillanidae. Camallanid genera Camallanus and Procamallanus, as well as the subgenera Procamallanus and Spirocamallanus are confirmed to be paraphyletic. Paraphyly has also been found within Filarioidea, Habronematoidea and Thelazioidea and in Cystidicolidae, Physalopteridae and Thelaziidae. The results of the analyses also show that

  7. The Complete Mitochondrial Genome of the Longhorn Beetle Dorysthenes paradoxus (Coleoptera: Cerambycidae: Prionini) and the Implication for the Phylogenetic Relationships of the Cerambycidae Species

    Science.gov (United States)

    Chen, Dong-Bin; Liu, Huan-Huan; Hu, Hua-Lei; Bian, Hai-Xu; Zhang, Ru-Song; Yang, Rui-Sheng; Jiang, Xing-Fu; Shi, Sheng-Lin

    2018-01-01

    Abstract The longhorn beetle Dorysthenes paradoxus (Faldermann, 1833) (Coleoptera: Cerambycidae) is not only a serious agricultural pest but also a traditionally edible insect in China. However, no genetic information on this species has been acquired. In the present study, we report the mitochondrial genome (mitogenome) of Do. paradoxus, as the first complete mitogenome of Prioninae. The circular mitogenome of 15,922 bp encodes 13 protein-coding genes (PCGs), 22 transfer RNAs (tRNAs), and two ribosomal RNAs (rRNAs), and it contains an A+T-rich region. This mitogenome exhibits the lowest A+T content (71.13%) but harbors the largest AT skew (0.116) among the completely sequenced Cerambycidae species. Eleven of the 13 PCGs have a typical ATN start codon, whereas COI and ND1 are tentatively designated by AAT and TTG, respectively. Only 4 of the 13 PCGs harbor a complete termination codon, and the remaining 9 possess incomplete termination codons (T or TA). Apart from tRNASer(AGN), the other 21 tRNAs can fold into a typical clover-leaf secondary structures. The Do. paradoxus A+T-rich region contains two poly-T stretches and a tandem repeat that comprises two 47-bp-long copies. Both Bayesian inference and Maximum likelihood analyses confirmed the subfamily ranks of Cerambycidae ([Prioninae + Cerambycinae] + Lamiinae) and the close relationship between Philinae and Prioninae/Cerambycinae. However, the data did not support the monophyly of Prioninae and Cerambycinae. The mitogenome presented here provides basic genetic information for this economically important species. PMID:29718483

  8. Undergraduate Students’ Initial Ability in Understanding Phylogenetic Tree

    Science.gov (United States)

    Sa'adah, S.; Hidayat, T.; Sudargo, Fransisca

    2017-04-01

    The Phylogenetic tree is a visual representation depicts a hypothesis about the evolutionary relationship among taxa. Evolutionary experts use this representation to evaluate the evidence for evolution. The phylogenetic tree is currently growing for many disciplines in biology. Consequently, learning about the phylogenetic tree has become an important part of biological education and an interesting area of biology education research. Skill to understanding and reasoning of the phylogenetic tree, (called tree thinking) is an important skill for biology students. However, research showed many students have difficulty in interpreting, constructing, and comparing among the phylogenetic tree, as well as experiencing a misconception in the understanding of the phylogenetic tree. Students are often not taught how to reason about evolutionary relationship depicted in the diagram. Students are also not provided with information about the underlying theory and process of phylogenetic. This study aims to investigate the initial ability of undergraduate students in understanding and reasoning of the phylogenetic tree. The research method is the descriptive method. Students are given multiple choice questions and an essay that representative by tree thinking elements. Each correct answer made percentages. Each student is also given questionnaires. The results showed that the undergraduate students’ initial ability in understanding and reasoning phylogenetic tree is low. Many students are not able to answer questions about the phylogenetic tree. Only 19 % undergraduate student who answered correctly on indicator evaluate the evolutionary relationship among taxa, 25% undergraduate student who answered correctly on indicator applying concepts of the clade, 17% undergraduate student who answered correctly on indicator determines the character evolution, and only a few undergraduate student who can construct the phylogenetic tree.

  9. [Phylogenetic relationships of the species of Oxytropis DC. subg. Oxytropis and Phacoxytropis (Fabaceae) from Asian Russia inferred from the nucleotide sequence analysis of the intergenic spacers of the chloroplast genome].

    Science.gov (United States)

    Kholina, A B; Kozyrenko, M M; Artyukova, E V; Sandanov, D V; Andrianova, E A

    2016-08-01

    The nucleotide sequence analysis of trnH–psbA, trnL–trnF, and trnS–trnG intergenic spacer regions of chloroplast DNA performed in the representatives of the genus Oxytropis from Asian Russia provided clarification of the phylogenetic relationships of some species and sections in the subgenera Oxytropis and Phacoxytropis and in the genus Oxytropis as a whole. Only the section Mesogaea corresponds to the subgenus Phacoxytropis, while the section Janthina of the same subgenus groups together with the sections of the subgenus Oxytropis. The sections Chrysantha and Ortholoma of the subgenus Oxytropis are not only closely related to each other, but together with the section Mesogaea, they are grouped into the subgenus Phacoxytropis. It seems likely that the sections Chrysantha and Ortholoma should be assigned to the subgenus Phacoxytropis, and the section Janthina should be assigned to the subgenus Oxytropis. The molecular differences were identified between O. coerulea and O. mandshurica from the section Janthina that were indicative of considerable divergence of their chloroplast genomes and the species independence of the taxa. The species independence of O. czukotica belonging to the section Arctobia was also confirmed.

  10. Phylogenetic relationships among marine Alteromonas-like proteobacteria: emended description of the family Alteromonadaceae and proposal of Pseudoalteromonadaceae fam. nov., Colwelliaceae fam. nov., Shewanellaceae fam. nov., Moritellaceae fam. nov., Ferrimonadaceae fam. nov., Idiomarinaceae fam. nov. and Psychromonadaceae fam. nov.

    Science.gov (United States)

    Ivanova, Elena P; Flavier, Sébastien; Christen, Richard

    2004-09-01

    The phylogenetic relationships among marine Alteromonas-like bacteria of the genera Alteromonas, Pseudoalteromonas, Glaciecola, Thalassomonas, Colwellia, Idiomarina, Oceanimonas, Oceanisphaera, Shewanella, Moritella, Ferrimonas, Psychromonas and several other genera of the 'Gammaproteobacteria' were studied. Results of 16S rRNA gene sequence analyses revealed that some members of these genera formed several coherent groups at the family level. Characteristic signature oligonucleotides for studied taxa were defined. Signature positions are divided into three classes: (i) single compensatory mutations, (ii) double compensatory mutations and (iii) mutations affecting nucleotides not paired in the secondary structure. The 16S rRNA gene sequence similarity level within genera was 93 % or above. This value can be a useful additional criterion for genus discrimination. On the basis of this work and previous polyphasic taxonomic studies, the circumscription of the family Alteromonadaceae is limited to the genera Alteromonas and Glaciecola and the creation is proposed of the families Pseudoalteromonadaceae fam. nov. to accommodate bacteria of the genera Pseudoalteromonas and Algicola gen. nov. (formerly Pseudoalteromonas bacteriolytica) and Colwelliaceae fam. nov. to accommodate bacteria of the genera Colwellia and Thalassomonas. Bacteria of the genera Oceanimonas and Oceanisphaera formed a robust cluster and shared common signature oligonucleotides. Because of deep branching and lack of association with any other genus, the following families are proposed that include single genera: Idiomarinaceae fam. nov., Psychromonadaceae fam. nov., Moritellaceae fam. nov., Ferrimonadaceae fam. nov. and Shewanellaceae fam. nov. Finally, this study also revealed that [Hyphomicrobium] indicum should be reclassified as Photobacterium indicum comb. nov.

  11. Evaluation of haplotype diversity of Achatina fulica (Lissachatina) [Bowdich] from Indian sub-continent by means of 16S rDNA sequence and its phylogenetic relationships with other global populations.

    Science.gov (United States)

    Ayyagari, Vijaya Sai; Sreerama, Krupanidhi

    2017-08-01

    Achatina fulica (Lissachatina fulica) is one of the most invasive species found across the globe causing a significant damage to crops, vegetables, and horticultural plants. This terrestrial snail is native to east Africa and spread to different parts of the world by introductions. India, a hot spot for biodiversity of several endemic gastropods, has witnessed an outburst of this snail population in several parts of the country posing a serious threat to crop loss and also to human health. With an objective to evaluate the genetic diversity of this snail, we have sampled this snail from different parts of India and analyzed its haplotype diversity by means of 16S rDNA sequence information. Apart from this, we have studied the phylogenetic relationships of the isolates sequenced in the present study in relation with other global populations by Bayesian and Maximum-likelihood approaches. Of the isolates sequenced, haplotype 'C' is the predominant one. A new haplotype 'S' from the state of Odisha was observed. The isolates sequenced in the present study clustered with its conspecifics from the Indian sub-continent. Haplotype network analyses were also carried out for studying the evolution of different haplotypes. It was observed that haplotype 'S' was associated with a Mauritius haplotype 'H', indicating the possibility of multiple introductions of A. fulica to India.

  12. Folding and unfolding phylogenetic trees and networks.

    Science.gov (United States)

    Huber, Katharina T; Moulton, Vincent; Steel, Mike; Wu, Taoyang

    2016-12-01

    Phylogenetic networks are rooted, labelled directed acyclic graphswhich are commonly used to represent reticulate evolution. There is a close relationship between phylogenetic networks and multi-labelled trees (MUL-trees). Indeed, any phylogenetic network N can be "unfolded" to obtain a MUL-tree U(N) and, conversely, a MUL-tree T can in certain circumstances be "folded" to obtain aphylogenetic network F(T) that exhibits T. In this paper, we study properties of the operations U and F in more detail. In particular, we introduce the class of stable networks, phylogenetic networks N for which F(U(N)) is isomorphic to N, characterise such networks, and show that they are related to the well-known class of tree-sibling networks. We also explore how the concept of displaying a tree in a network N can be related to displaying the tree in the MUL-tree U(N). To do this, we develop aphylogenetic analogue of graph fibrations. This allows us to view U(N) as the analogue of the universal cover of a digraph, and to establish a close connection between displaying trees in U(N) and reconciling phylogenetic trees with networks.

  13. TREEFINDER: a powerful graphical analysis environment for molecular phylogenetics

    Directory of Open Access Journals (Sweden)

    von Haeseler Arndt

    2004-06-01

    Full Text Available Abstract Background Most analysis programs for inferring molecular phylogenies are difficult to use, in particular for researchers with little programming experience. Results TREEFINDER is an easy-to-use integrative platform-independent analysis environment for molecular phylogenetics. In this paper the main features of TREEFINDER (version of April 2004 are described. TREEFINDER is written in ANSI C and Java and implements powerful statistical approaches for inferring gene tree and related analyzes. In addition, it provides a user-friendly graphical interface and a phylogenetic programming language. Conclusions TREEFINDER is a versatile framework for analyzing phylogenetic data across different platforms that is suited both for exploratory as well as advanced studies.

  14. Platform Constellations

    DEFF Research Database (Denmark)

    Staykova, Kalina Stefanova; Damsgaard, Jan

    2016-01-01

    This research paper presents an initial attempt to introduce and explain the emergence of new phenomenon, which we refer to as platform constellations. Functioning as highly modular systems, the platform constellations are collections of highly connected platforms which co-exist in parallel and a......’ acquisition and users’ engagement rates as well as unlock new sources of value creation and diversify revenue streams....

  15. ["Long-branch Attraction" artifact in phylogenetic reconstruction].

    Science.gov (United States)

    Li, Yi-Wei; Yu, Li; Zhang, Ya-Ping

    2007-06-01

    Phylogenetic reconstruction among various organisms not only helps understand their evolutionary history but also reveal several fundamental evolutionary questions. Understanding of the evolutionary relationships among organisms establishes the foundation for the investigations of other biological disciplines. However, almost all the widely used phylogenetic methods have limitations which fail to eliminate systematic errors effectively, preventing the reconstruction of true organismal relationships. "Long-branch Attraction" (LBA) artifact is one of the most disturbing factors in phylogenetic reconstruction. In this review, the conception and analytic method as well as the avoidance strategy of LBA were summarized. In addition, several typical examples were provided. The approach to avoid and resolve LBA artifact has been discussed.

  16. treespace: Statistical exploration of landscapes of phylogenetic trees.

    Science.gov (United States)

    Jombart, Thibaut; Kendall, Michelle; Almagro-Garcia, Jacob; Colijn, Caroline

    2017-11-01

    The increasing availability of large genomic data sets as well as the advent of Bayesian phylogenetics facilitates the investigation of phylogenetic incongruence, which can result in the impossibility of representing phylogenetic relationships using a single tree. While sometimes considered as a nuisance, phylogenetic incongruence can also reflect meaningful biological processes as well as relevant statistical uncertainty, both of which can yield valuable insights in evolutionary studies. We introduce a new tool for investigating phylogenetic incongruence through the exploration of phylogenetic tree landscapes. Our approach, implemented in the R package treespace, combines tree metrics and multivariate analysis to provide low-dimensional representations of the topological variability in a set of trees, which can be used for identifying clusters of similar trees and group-specific consensus phylogenies. treespace also provides a user-friendly web interface for interactive data analysis and is integrated alongside existing standards for phylogenetics. It fills a gap in the current phylogenetics toolbox in R and will facilitate the investigation of phylogenetic results. © 2017 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.

  17. A program for verification of phylogenetic network models.

    Science.gov (United States)

    Gunawan, Andreas D M; Lu, Bingxin; Zhang, Louxin

    2016-09-01

    Genetic material is transferred in a non-reproductive manner across species more frequently than commonly thought, particularly in the bacteria kingdom. On one hand, extant genomes are thus more properly considered as a fusion product of both reproductive and non-reproductive genetic transfers. This has motivated researchers to adopt phylogenetic networks to study genome evolution. On the other hand, a gene's evolution is usually tree-like and has been studied for over half a century. Accordingly, the relationships between phylogenetic trees and networks are the basis for the reconstruction and verification of phylogenetic networks. One important problem in verifying a network model is determining whether or not certain existing phylogenetic trees are displayed in a phylogenetic network. This problem is formally called the tree containment problem. It is NP-complete even for binary phylogenetic networks. We design an exponential time but efficient method for determining whether or not a phylogenetic tree is displayed in an arbitrary phylogenetic network. It is developed on the basis of the so-called reticulation-visible property of phylogenetic networks. A C-program is available for download on http://www.math.nus.edu.sg/∼matzlx/tcp_package matzlx@nus.edu.sg Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  18. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    Navya

    1CSIR-National Botanical Research Institute, Rana Pratap Marg, Lucknow ... used to characterize and identify the cultivars; however, it is often difficult and even .... complete deletion of the missing/gap sites from all the sequences (table 2).

  19. Phylogenetic Relationships and Biogeographic History of Iriarteeae

    DEFF Research Database (Denmark)

    Bacon, Christine D.; Florez, Alexander; Balslev, Henrik

    Iriarteeae comprise five genera and 32 species and includes keystone species essential for forest structure and ecological assembly such as Iriartea deltoidea and Socratea exorrhiza. The tribe is found in lowland to mid-elevation forests from Nicaragua to Bolivia and from the Pacific coast of Sou...

  20. Phylogenetic relationships within indigenous Sudanese Cassia ...

    African Journals Online (AJOL)

    Random amplified polymorphic DNA (RAPD) markers were used to assess genetic diversity in Cassia senna (L.). RAPD technique was carried out in a set of 27 (C. senna (L.) genotypes collected from different regions of Sudan. A total of 27 polymorphisms (5.2 polymorphic markers per primer) out of 31 reproducible ...

  1. Relaciones filogenéticas de las serpientes del género Conopsis con base en la morfología Phylogenetic relationships of the snake genus Conopsis based on morphology

    Directory of Open Access Journals (Sweden)

    Irene Goyenechea

    2009-12-01

    Full Text Available El género Conopsis es endémico de México y se distribuye desde Chihuahua hasta Oaxaca. Recientemente se estudió su taxonomía, al modificarse su nomenclatura en los últimos años. Estas serpientes colúbridas de hábitos enterradores pueden reconocerse por diversas características, entre las que destaca un surco en por lo menos 1 de los 3 últimos dientes maxilares. El género cuenta con 6 especies reconocidas: C. acuta, C. amphisticha, C. biserialis, C. lineata, C. megalodon y C. nasus. Estudios previos intentaron resolver la filogenia del género con base en caracteres morfológicos, pero debido al polimorfismo encontrado en ellos no hubo resolución. En este estudio se reevaluaron los caracteres morfológicos de Conopsis usando el método de frecuencias generalizadas para obtener una filogenia de las especies que componen el género. Los resultados obtenidos indican que se pueden recobrar las relaciones al interior del género usando el programa Fastmorphology, y que C. nasus y C. megalodon son grupos hermanos que junto con C. biserialis y C. amphisticha forman un clado. Conopsis acuta resultó el taxón más basal del género. Las relaciones de los grupos externos no se resuelven del todo pero los análisis indican que el grupo de los Sonorini no se sustenta.The snake genus Conopsis is endemic to Mexico and is found from Chihuahua to Oaxaca. It has been subject of study on its taxonomy due to recent modifications on its nomenclature. Now, this burrowing snake genus is diagnosed by several characters, standing out a groove in at least 1 of the 3-rear maxillary teeth. It comprises 6 known species: Conopsis acuta, Conopsis amphisticha, Conopsis biserialis, Conopsis lineata, Conopsis megalodon and Conopsis nasus. Previous works using morphological characters tried to solve the phylogenetic relationships between species in the genus but failed due to polymorphisms found in almost all characters studied. In this work those morphological

  2. Phylogenetic Analysis of Petunia sensu Jussieu (Solanaceae) using Chloroplast DNA RFLP

    OpenAIRE

    ANDO, TOSHIO; KOKUBUN, HISASHI; WATANABE, HITOSHI; TANAKA, NORIO; YUKAWA, TOMOHISA; HASHIMOTO, GORO; MARCHESI, EDUARDO; SUÁREZ, ENRIQUE; BASUALDO, ISABEL L.

    2005-01-01

    • Background and Aims The phylogenetic relationships of Petunia sensu Jussieu (Petunia sensu Wijsman plus Calibrachoa) are unclear. This study aimed to resolve this uncertainty using molecular evidence.

  3. Diversity and phylogenetic relationships of hemosporidian parasites in birds of Socorro Island, México, and their role in the re-introduction of the Socorro dove (Zenaida graysoni).

    Science.gov (United States)

    Carlson, Jenny S; Martínez-Gómez, Juan E; Valkiūnas, Gediminas; Loiseau, Claire; Bell, Douglas A; Sehgal, Ravinder N M

    2013-04-01

    The Socorro dove Zenaida graysoni , endemic to Socorro Island, was last reported in the wild in 1972. Fortunately, the species has been propagated in zoos in Europe and the United States, and plans are under way to re-introduce it to its native habitat. This will be the first known attempt to return a bird species extinct in the wild to its ancestral island. In order to assess the disease threats the Socorro dove may face, the avifauna of Socorro Island, with a specific focus on Socorro ground doves Columbina passerina socorroensis and mourning doves Zenaida macroura , as well as Socorro doves in captivity, were screened for blood parasites of the genera Plasmodium , Haemoproteus, Leucocytozoon, and Trypanosoma spp. We found Haemoproteus spp. in 17 (74%) of 23 Socorro ground doves, 23 (92%) of 25 mourning doves, and 3 (14%) of 21 northern mockingbirds; none of the other bird species showed infections. Here, we report the phylogenetic analysis of 19 distinct lineages of Haemoproteus spp. detected in birds of Socorro Island and compare their evolutionary relationships to parasites detected in the avifauna of the Galápagos Islands, continental Latin America, and Europe. Microscopic examination revealed 1 mourning dove infected with Plasmodium ( Haemamoeba ), thus underscoring the importance of using both PCR and microscopy when analyzing avian blood samples for hemosporidian parasites. The study confirms that the Socorro dove will most likely be exposed to Haemoproteus spp. that currently infect mourning doves and Socorro ground doves of Socorro Island. A monitoring program for both birds and vectors should be implemented to establish the prevalence of Plasmodium sp. and as a necessary conservation measure for critically endangered birds on the island.

  4. Fast phylogenetic DNA barcoding

    DEFF Research Database (Denmark)

    Terkelsen, Kasper Munch; Boomsma, Wouter Krogh; Willerslev, Eske

    2008-01-01

    We present a heuristic approach to the DNA assignment problem based on phylogenetic inferences using constrained neighbour joining and non-parametric bootstrapping. We show that this method performs as well as the more computationally intensive full Bayesian approach in an analysis of 500 insect...... DNA sequences obtained from GenBank. We also analyse a previously published dataset of environmental DNA sequences from soil from New Zealand and Siberia, and use these data to illustrate the fact that statistical approaches to the DNA assignment problem allow for more appropriate criteria...... for determining the taxonomic level at which a particular DNA sequence can be assigned....

  5. A Consistent Phylogenetic Backbone for the Fungi

    Science.gov (United States)

    Ebersberger, Ingo; de Matos Simoes, Ricardo; Kupczok, Anne; Gube, Matthias; Kothe, Erika; Voigt, Kerstin; von Haeseler, Arndt

    2012-01-01

    The kingdom of fungi provides model organisms for biotechnology, cell biology, genetics, and life sciences in general. Only when their phylogenetic relationships are stably resolved, can individual results from fungal research be integrated into a holistic picture of biology. However, and despite recent progress, many deep relationships within the fungi remain unclear. Here, we present the first phylogenomic study of an entire eukaryotic kingdom that uses a consistency criterion to strengthen phylogenetic conclusions. We reason that branches (splits) recovered with independent data and different tree reconstruction methods are likely to reflect true evolutionary relationships. Two complementary phylogenomic data sets based on 99 fungal genomes and 109 fungal expressed sequence tag (EST) sets analyzed with four different tree reconstruction methods shed light from different angles on the fungal tree of life. Eleven additional data sets address specifically the phylogenetic position of Blastocladiomycota, Ustilaginomycotina, and Dothideomycetes, respectively. The combined evidence from the resulting trees supports the deep-level stability of the fungal groups toward a comprehensive natural system of the fungi. In addition, our analysis reveals methodologically interesting aspects. Enrichment for EST encoded data—a common practice in phylogenomic analyses—introduces a strong bias toward slowly evolving and functionally correlated genes. Consequently, the generalization of phylogenomic data sets as collections of randomly selected genes cannot be taken for granted. A thorough characterization of the data to assess possible influences on the tree reconstruction should therefore become a standard in phylogenomic analyses. PMID:22114356

  6. Phylogenetic Inference of HIV Transmission Clusters

    Directory of Open Access Journals (Sweden)

    Vlad Novitsky

    2017-10-01

    Full Text Available Better understanding the structure and dynamics of HIV transmission networks is essential for designing the most efficient interventions to prevent new HIV transmissions, and ultimately for gaining control of the HIV epidemic. The inference of phylogenetic relationships and the interpretation of results rely on the definition of the HIV transmission cluster. The definition of the HIV cluster is complex and dependent on multiple factors, including the design of sampling, accuracy of sequencing, precision of sequence alignment, evolutionary models, the phylogenetic method of inference, and specified thresholds for cluster support. While the majority of studies focus on clusters, non-clustered cases could also be highly informative. A new dimension in the analysis of the global and local HIV epidemics is the concept of phylogenetically distinct HIV sub-epidemics. The identification of active HIV sub-epidemics reveals spreading viral lineages and may help in the design of targeted interventions.HIVclustering can also be affected by sampling density. Obtaining a proper sampling density may increase statistical power and reduce sampling bias, so sampling density should be taken into account in study design and in interpretation of phylogenetic results. Finally, recent advances in long-range genotyping may enable more accurate inference of HIV transmission networks. If performed in real time, it could both inform public-health strategies and be clinically relevant (e.g., drug-resistance testing.

  7. On the information content of discrete phylogenetic characters.

    Science.gov (United States)

    Bordewich, Magnus; Deutschmann, Ina Maria; Fischer, Mareike; Kasbohm, Elisa; Semple, Charles; Steel, Mike

    2017-12-16

    Phylogenetic inference aims to reconstruct the evolutionary relationships of different species based on genetic (or other) data. Discrete characters are a particular type of data, which contain information on how the species should be grouped together. However, it has long been known that some characters contain more information than others. For instance, a character that assigns the same state to each species groups all of them together and so provides no insight into the relationships of the species considered. At the other extreme, a character that assigns a different state to each species also conveys no phylogenetic signal. In this manuscript, we study a natural combinatorial measure of the information content of an individual character and analyse properties of characters that provide the maximum phylogenetic information, particularly, the number of states such a character uses and how the different states have to be distributed among the species or taxa of the phylogenetic tree.

  8. Transforming phylogenetic networks: Moving beyond tree space

    OpenAIRE

    Huber, Katharina T.; Moulton, Vincent; Wu, Taoyang

    2016-01-01

    Phylogenetic networks are a generalization of phylogenetic trees that are used to represent reticulate evolution. Unrooted phylogenetic networks form a special class of such networks, which naturally generalize unrooted phylogenetic trees. In this paper we define two operations on unrooted phylogenetic networks, one of which is a generalization of the well-known nearest-neighbor interchange (NNI) operation on phylogenetic trees. We show that any unrooted phylogenetic network can be transforme...

  9. Ant-Based Phylogenetic Reconstruction (ABPR: A new distance algorithm for phylogenetic estimation based on ant colony optimization

    Directory of Open Access Journals (Sweden)

    Karla Vittori

    2008-12-01

    Full Text Available We propose a new distance algorithm for phylogenetic estimation based on Ant Colony Optimization (ACO, named Ant-Based Phylogenetic Reconstruction (ABPR. ABPR joins two taxa iteratively based on evolutionary distance among sequences, while also accounting for the quality of the phylogenetic tree built according to the total length of the tree. Similar to optimization algorithms for phylogenetic estimation, the algorithm allows exploration of a larger set of nearly optimal solutions. We applied the algorithm to four empirical data sets of mitochondrial DNA ranging from 12 to 186 sequences, and from 898 to 16,608 base pairs, and covering taxonomic levels from populations to orders. We show that ABPR performs better than the commonly used Neighbor-Joining algorithm, except when sequences are too closely related (e.g., population-level sequences. The phylogenetic relationships recovered at and above species level by ABPR agree with conventional views. However, like other algorithms of phylogenetic estimation, the proposed algorithm failed to recover expected relationships when distances are too similar or when rates of evolution are very variable, leading to the problem of long-branch attraction. ABPR, as well as other ACO-based algorithms, is emerging as a fast and accurate alternative method of phylogenetic estimation for large data sets.

  10. Trophic phylogenetics: evolutionary influences on body size, feeding, and species associations in grassland arthropods.

    Science.gov (United States)

    Lind, Eric M; Vincent, John B; Weiblen, George D; Cavender-Bares, Jeannine; Borer, Elizabeth T

    2015-04-01

    Contemporary animal-plant interactions such as herbivory are widely understood to be shaped by evolutionary history. Yet questions remain about the role of plant phylogenetic diversity in generating and maintaining herbivore diversity, and whether evolutionary relatedness of producers might predict the composition of consumer communities. We tested for evidence of evolutionary associations among arthropods and the plants on which they were found, using phylogenetic analysis of naturally occurring arthropod assemblages sampled from a plant-diversity manipulation experiment. Considering phylogenetic relationships among more than 900 arthropod consumer taxa and 29 plant species in the experiment, we addressed several interrelated questions. First, our results support the hypothesis that arthropod functional traits such as body size and trophic role are phylogenetically conserved in community ecological samples. Second, herbivores tended to cooccur with closer phylogenetic relatives than would be expected at random, whereas predators and parasitoids did not show phylogenetic association patterns. Consumer specialization, as measured by association through time with monocultures of particular host plant species, showed significant phylogenetic signal, although the. strength of this association varied among plant species. Polycultures of phylogenetically dissimilar plant species supported more phylogenetically dissimilar consumer communities than did phylogenetically similar polycultures. Finally, we separated the effects of plant species richness and relatedness in predicting the phylogenetic distribution of the arthropod assemblages in this experiment. The phylogenetic diversity of plant communities predicted the phylogenetic diversity of herbivore communities even after accounting for plant species richness. The phylogenetic diversity of secondary consumers differed by guild, with predator phylogenetic diversity responding to herbivore relatedness, while parasitoid

  11. Ultrafast Approximation for Phylogenetic Bootstrap

    NARCIS (Netherlands)

    Bui Quang Minh, [No Value; Nguyen, Thi; von Haeseler, Arndt

    Nonparametric bootstrap has been a widely used tool in phylogenetic analysis to assess the clade support of phylogenetic trees. However, with the rapidly growing amount of data, this task remains a computational bottleneck. Recently, approximation methods such as the RAxML rapid bootstrap (RBS) and

  12. Marine turtle mitogenome phylogenetics and evolution

    DEFF Research Database (Denmark)

    Duchene, Sebastián; Frey, Amy; Alfaro-Núñez, Luis Alonso

    2012-01-01

    The sea turtles are a group of cretaceous origin containing seven recognized living species: leatherback, hawksbill, Kemp's ridley, olive ridley, loggerhead, green, and flatback. The leatherback is the single member of the Dermochelidae family, whereas all other sea turtles belong in Cheloniidae...... distributions, shedding light on complex migration patterns and possible geographic or climatic events as driving forces of sea-turtle distribution. We have sequenced complete mitogenomes for all sea-turtle species, including samples from their geographic range extremes, and performed phylogenetic analyses...... to assess sea-turtle evolution with a large molecular dataset. We found variation in the length of the ATP8 gene and a highly variable site in ND4 near a proton translocation channel in the resulting protein. Complete mitogenomes show strong support and resolution for phylogenetic relationships among all...

  13. Molecular phylogenetics of mastodon and Tyrannosaurus rex.

    Science.gov (United States)

    Organ, Chris L; Schweitzer, Mary H; Zheng, Wenxia; Freimark, Lisa M; Cantley, Lewis C; Asara, John M

    2008-04-25

    We report a molecular phylogeny for a nonavian dinosaur, extending our knowledge of trait evolution within nonavian dinosaurs into the macromolecular level of biological organization. Fragments of collagen alpha1(I) and alpha2(I) proteins extracted from fossil bones of Tyrannosaurus rex and Mammut americanum (mastodon) were analyzed with a variety of phylogenetic methods. Despite missing sequence data, the mastodon groups with elephant and the T. rex groups with birds, consistent with predictions based on genetic and morphological data for mastodon and on morphological data for T. rex. Our findings suggest that molecular data from long-extinct organisms may have the potential for resolving relationships at critical areas in the vertebrate evolutionary tree that have, so far, been phylogenetically intractable.

  14. Phylogenetic paleobiogeography of Late Ordovician Laurentian brachiopods

    Directory of Open Access Journals (Sweden)

    Jennifer E. Bauer

    2014-12-01

    Full Text Available Phylogenetic biogeographic analysis of four brachiopod genera was used to uncover large-scale geologic drivers of Late Ordovician biogeographic differentiation in Laurentia. Previously generated phylogenetic hypotheses were converted into area cladograms, ancestral geographic ranges were optimized and speciation events characterized as via dispersal or vicariance, when possible. Area relationships were reconstructed using Lieberman-modified Brooks Parsimony Analysis. The resulting area cladograms indicate tectonic and oceanographic changes were the primary geologic drivers of biogeographic patterns within the focal taxa. The Taconic tectophase contributed to the separation of the Appalachian and Central basins as well as the two midcontinent basins, whereas sea level rise following the Boda Event promoted interbasinal dispersal. Three migration pathways into the Cincinnati Basin were recognized, which supports the multiple pathway hypothesis for the Richmondian Invasion.

  15. A format for phylogenetic placements.

    Directory of Open Access Journals (Sweden)

    Frederick A Matsen

    Full Text Available We have developed a unified format for phylogenetic placements, that is, mappings of environmental sequence data (e.g., short reads into a phylogenetic tree. We are motivated to do so by the growing number of tools for computing and post-processing phylogenetic placements, and the lack of an established standard for storing them. The format is lightweight, versatile, extensible, and is based on the JSON format, which can be parsed by most modern programming languages. Our format is already implemented in several tools for computing and post-processing parsimony- and likelihood-based phylogenetic placements and has worked well in practice. We believe that establishing a standard format for analyzing read placements at this early stage will lead to a more efficient development of powerful and portable post-analysis tools for the growing applications of phylogenetic placement.

  16. Platform computing

    CERN Multimedia

    2002-01-01

    "Platform Computing releases first grid-enabled workload management solution for IBM eServer Intel and UNIX high performance computing clusters. This Out-of-the-box solution maximizes the performance and capability of applications on IBM HPC clusters" (1/2 page) .

  17. Enumerating all maximal frequent subtrees in collections of phylogenetic trees.

    Science.gov (United States)

    Deepak, Akshay; Fernández-Baca, David

    2014-01-01

    A common problem in phylogenetic analysis is to identify frequent patterns in a collection of phylogenetic trees. The goal is, roughly, to find a subset of the species (taxa) on which all or some significant subset of the trees agree. One popular method to do so is through maximum agreement subtrees (MASTs). MASTs are also used, among other things, as a metric for comparing phylogenetic trees, computing congruence indices and to identify horizontal gene transfer events. We give algorithms and experimental results for two approaches to identify common patterns in a collection of phylogenetic trees, one based on agreement subtrees, called maximal agreement subtrees, the other on frequent subtrees, called maximal frequent subtrees. These approaches can return subtrees on larger sets of taxa than MASTs, and can reveal new common phylogenetic relationships not present in either MASTs or the majority rule tree (a popular consensus method). Our current implementation is available on the web at https://code.google.com/p/mfst-miner/. Our computational results confirm that maximal agreement subtrees and all maximal frequent subtrees can reveal a more complete phylogenetic picture of the common patterns in collections of phylogenetic trees than maximum agreement subtrees; they are also often more resolved than the majority rule tree. Further, our experiments show that enumerating maximal frequent subtrees is considerably more practical than enumerating ordinary (not necessarily maximal) frequent subtrees.

  18. Enumerating all maximal frequent subtrees in collections of phylogenetic trees

    Science.gov (United States)

    2014-01-01

    Background A common problem in phylogenetic analysis is to identify frequent patterns in a collection of phylogenetic trees. The goal is, roughly, to find a subset of the species (taxa) on which all or some significant subset of the trees agree. One popular method to do so is through maximum agreement subtrees (MASTs). MASTs are also used, among other things, as a metric for comparing phylogenetic trees, computing congruence indices and to identify horizontal gene transfer events. Results We give algorithms and experimental results for two approaches to identify common patterns in a collection of phylogenetic trees, one based on agreement subtrees, called maximal agreement subtrees, the other on frequent subtrees, called maximal frequent subtrees. These approaches can return subtrees on larger sets of taxa than MASTs, and can reveal new common phylogenetic relationships not present in either MASTs or the majority rule tree (a popular consensus method). Our current implementation is available on the web at https://code.google.com/p/mfst-miner/. Conclusions Our computational results confirm that maximal agreement subtrees and all maximal frequent subtrees can reveal a more complete phylogenetic picture of the common patterns in collections of phylogenetic trees than maximum agreement subtrees; they are also often more resolved than the majority rule tree. Further, our experiments show that enumerating maximal frequent subtrees is considerably more practical than enumerating ordinary (not necessarily maximal) frequent subtrees. PMID:25061474

  19. TreeCluster: Massively scalable transmission clustering using phylogenetic trees

    OpenAIRE

    Moshiri, Alexander

    2018-01-01

    Background: The ability to infer transmission clusters from molecular data is critical to designing and evaluating viral control strategies. Viral sequencing datasets are growing rapidly, but standard methods of transmission cluster inference do not scale well beyond thousands of sequences. Results: I present TreeCluster, a cross-platform tool that performs transmission cluster inference on a given phylogenetic tree orders of magnitude faster than existing inference methods and supports multi...

  20. Efficient FPT Algorithms for (Strict) Compatibility of Unrooted Phylogenetic Trees.

    Science.gov (United States)

    Baste, Julien; Paul, Christophe; Sau, Ignasi; Scornavacca, Celine

    2017-04-01

    In phylogenetics, a central problem is to infer the evolutionary relationships between a set of species X; these relationships are often depicted via a phylogenetic tree-a tree having its leaves labeled bijectively by elements of X and without degree-2 nodes-called the "species tree." One common approach for reconstructing a species tree consists in first constructing several phylogenetic trees from primary data (e.g., DNA sequences originating from some species in X), and then constructing a single phylogenetic tree maximizing the "concordance" with the input trees. The obtained tree is our estimation of the species tree and, when the input trees are defined on overlapping-but not identical-sets of labels, is called "supertree." In this paper, we focus on two problems that are central when combining phylogenetic trees into a supertree: the compatibility and the strict compatibility problems for unrooted phylogenetic trees. These problems are strongly related, respectively, to the notions of "containing as a minor" and "containing as a topological minor" in the graph community. Both problems are known to be fixed parameter tractable in the number of input trees k, by using their expressibility in monadic second-order logic and a reduction to graphs of bounded treewidth. Motivated by the fact that the dependency on k of these algorithms is prohibitively large, we give the first explicit dynamic programming algorithms for solving these problems, both running in time [Formula: see text], where n is the total size of the input.

  1. phangorn: phylogenetic analysis in R.

    Science.gov (United States)

    Schliep, Klaus Peter

    2011-02-15

    phangorn is a package for phylogenetic reconstruction and analysis in the R language. Previously it was only possible to estimate phylogenetic trees with distance methods in R. phangorn, now offers the possibility of reconstructing phylogenies with distance based methods, maximum parsimony or maximum likelihood (ML) and performing Hadamard conjugation. Extending the general ML framework, this package provides the possibility of estimating mixture and partition models. Furthermore, phangorn offers several functions for comparing trees, phylogenetic models or splits, simulating character data and performing congruence analyses. phangorn can be obtained through the CRAN homepage http://cran.r-project.org/web/packages/phangorn/index.html. phangorn is licensed under GPL 2.

  2. Phylogenetic comparative methods complement discriminant function analysis in ecomorphology.

    Science.gov (United States)

    Barr, W Andrew; Scott, Robert S

    2014-04-01

    In ecomorphology, Discriminant Function Analysis (DFA) has been used as evidence for the presence of functional links between morphometric variables and ecological categories. Here we conduct simulations of characters containing phylogenetic signal to explore the performance of DFA under a variety of conditions. Characters were simulated using a phylogeny of extant antelope species from known habitats. Characters were modeled with no biomechanical relationship to the habitat category; the only sources of variation were body mass, phylogenetic signal, or random "noise." DFA on the discriminability of habitat categories was performed using subsets of the simulated characters, and Phylogenetic Generalized Least Squares (PGLS) was performed for each character. Analyses were repeated with randomized habitat assignments. When simulated characters lacked phylogenetic signal and/or habitat assignments were random, ecomorphology. Copyright © 2013 Wiley Periodicals, Inc.

  3. On Nakhleh's metric for reduced phylogenetic networks

    OpenAIRE

    Cardona, Gabriel; Llabrés, Mercè; Rosselló, Francesc; Valiente Feruglio, Gabriel Alejandro

    2009-01-01

    We prove that Nakhleh’s metric for reduced phylogenetic networks is also a metric on the classes of tree-child phylogenetic networks, semibinary tree-sibling time consistent phylogenetic networks, and multilabeled phylogenetic trees. We also prove that it separates distinguishable phylogenetic networks. In this way, it becomes the strongest dissimilarity measure for phylogenetic networks available so far. Furthermore, we propose a generalization of that metric that separates arbitrary phyl...

  4. Phylogenetic comparative methods on phylogenetic networks with reticulations.

    Science.gov (United States)

    Bastide, Paul; Solís-Lemus, Claudia; Kriebel, Ricardo; Sparks, K William; Ané, Cécile

    2018-04-25

    The goal of Phylogenetic Comparative Methods (PCMs) is to study the distribution of quantitative traits among related species. The observed traits are often seen as the result of a Brownian Motion (BM) along the branches of a phylogenetic tree. Reticulation events such as hybridization, gene flow or horizontal gene transfer, can substantially affect a species' traits, but are not modeled by a tree. Phylogenetic networks have been designed to represent reticulate evolution. As they become available for downstream analyses, new models of trait evolution are needed, applicable to networks. One natural extension of the BM is to use a weighted average model for the trait of a hybrid, at a reticulation point. We develop here an efficient recursive algorithm to compute the phylogenetic variance matrix of a trait on a network, in only one preorder traversal of the network. We then extend the standard PCM tools to this new framework, including phylogenetic regression with covariates (or phylogenetic ANOVA), ancestral trait reconstruction, and Pagel's λ test of phylogenetic signal. The trait of a hybrid is sometimes outside of the range of its two parents, for instance because of hybrid vigor or hybrid depression. These two phenomena are rather commonly observed in present-day hybrids. Transgressive evolution can be modeled as a shift in the trait value following a reticulation point. We develop a general framework to handle such shifts, and take advantage of the phylogenetic regression view of the problem to design statistical tests for ancestral transgressive evolution in the evolutionary history of a group of species. We study the power of these tests in several scenarios, and show that recent events have indeed the strongest impact on the trait distribution of present-day taxa. We apply those methods to a dataset of Xiphophorus fishes, to confirm and complete previous analysis in this group. All the methods developed here are available in the Julia package PhyloNetworks.

  5. [Orange Platform].

    Science.gov (United States)

    Toba, Kenji

    2017-07-01

    The Organized Registration for the Assessment of dementia on Nationwide General consortium toward Effective treatment in Japan (ORANGE platform) is a recently established nationwide clinical registry for dementia. This platform consists of multiple registries of patients with dementia stratified by the following clinical stages: preclinical, mild cognitive impairment, early-stage, and advanced-stage dementia. Patients will be examined in a super-longitudinal fashion, and their lifestyle, social background, genetic risk factors, and required care process will be assessed. This project is also notable because the care registry includes information on the successful, comprehensive management of patients with dementia. Therefore, this multicenter prospective cohort study will contribute participants to all clinical trials for Alzheimer's disease as well as improve the understanding of individuals with dementia.

  6. BLAST-EXPLORER helps you building datasets for phylogenetic analysis

    Directory of Open Access Journals (Sweden)

    Claverie Jean-Michel

    2010-01-01

    Full Text Available Abstract Background The right sampling of homologous sequences for phylogenetic or molecular evolution analyses is a crucial step, the quality of which can have a significant impact on the final interpretation of the study. There is no single way for constructing datasets suitable for phylogenetic analysis, because this task intimately depends on the scientific question we want to address, Moreover, database mining softwares such as BLAST which are routinely used for searching homologous sequences are not specifically optimized for this task. Results To fill this gap, we designed BLAST-Explorer, an original and friendly web-based application that combines a BLAST search with a suite of tools that allows interactive, phylogenetic-oriented exploration of the BLAST results and flexible selection of homologous sequences among the BLAST hits. Once the selection of the BLAST hits is done using BLAST-Explorer, the corresponding sequence can be imported locally for external analysis or passed to the phylogenetic tree reconstruction pipelines available on the Phylogeny.fr platform. Conclusions BLAST-Explorer provides a simple, intuitive and interactive graphical representation of the BLAST results and allows selection and retrieving of the BLAST hit sequences based a wide range of criterions. Although BLAST-Explorer primarily aims at helping the construction of sequence datasets for further phylogenetic study, it can also be used as a standard BLAST server with enriched output. BLAST-Explorer is available at http://www.phylogeny.fr

  7. Osteología, taxonomía y relaciones filogenéticas de las ranas del género Telmatobufo (Leptodactylidae Osteology, taxonomy and phylogenetic relationships of the frog genus Telmatobufo (Leptodactylidae

    Directory of Open Access Journals (Sweden)

    J. RAMÓN FORMAS

    2001-06-01

    distance and Rogers' genetic distance were employed to assess the morphological and the genetical similarities among the three Telmatobufo species. Employing mtRNA12S sequences, in combination with polarized allelic frequencies of structural genes, and morphological (external and osteological characters, a hypothesis on the phylogenetic relationships of the Telmatobufo species is proposed, worked on principles of maximum parsimony and maximum likelihood. Finally, a reconstruction of the evolutionary history and speciation process of this group of endemic frogs of the temperate central southern Chilean forests is proposed

  8. Phylogenetic and biogeographic analysis of sphaerexochine trilobites.

    Directory of Open Access Journals (Sweden)

    Curtis R Congreve

    Full Text Available BACKGROUND: Sphaerexochinae is a speciose and widely distributed group of cheirurid trilobites. Their temporal range extends from the earliest Ordovician through the Silurian, and they survived the end Ordovician mass extinction event (the second largest mass extinction in Earth history. Prior to this study, the individual evolutionary relationships within the group had yet to be determined utilizing rigorous phylogenetic methods. Understanding these evolutionary relationships is important for producing a stable classification of the group, and will be useful in elucidating the effects the end Ordovician mass extinction had on the evolutionary and biogeographic history of the group. METHODOLOGY/PRINCIPAL FINDINGS: Cladistic parsimony analysis of cheirurid trilobites assigned to the subfamily Sphaerexochinae was conducted to evaluate phylogenetic patterns and produce a hypothesis of relationship for the group. This study utilized the program TNT, and the analysis included thirty-one taxa and thirty-nine characters. The results of this analysis were then used in a Lieberman-modified Brooks Parsimony Analysis to analyze biogeographic patterns during the Ordovician-Silurian. CONCLUSIONS/SIGNIFICANCE: The genus Sphaerexochus was found to be monophyletic, consisting of two smaller clades (one composed entirely of Ordovician species and another composed of Silurian and Ordovician species. By contrast, the genus Kawina was found to be paraphyletic. It is a basal grade that also contains taxa formerly assigned to Cydonocephalus. Phylogenetic patterns suggest Sphaerexochinae is a relatively distinctive trilobite clade because it appears to have been largely unaffected by the end Ordovician mass extinction. Finally, the biogeographic analysis yields two major conclusions about Sphaerexochus biogeography: Bohemia and Avalonia were close enough during the Silurian to exchange taxa; and during the Ordovician there was dispersal between Eastern Laurentia and

  9. Polytomy identification in microbial phylogenetic reconstruction

    Directory of Open Access Journals (Sweden)

    Lin Guan

    2011-12-01

    Full Text Available Abstract Background A phylogenetic tree, showing ancestral relations among organisms, is commonly represented as a rooted tree with sets of bifurcating branches (dichotomies for simplicity, although polytomies (multifurcating branches may reflect more accurate evolutionary relationships. To represent the true evolutionary relationships, it is important to systematically identify the polytomies from a bifurcating tree and generate a taxonomy-compatible multifurcating tree. For this purpose we propose a novel approach, "PolyPhy", which would classify a set of bifurcating branches of a phylogenetic tree into a set of branches with dichotomies and polytomies by considering genome distances among genomes and tree topological properties. Results PolyPhy employs a machine learning technique, BLR (Bayesian logistic regression classifier, to identify possible bifurcating subtrees as polytomies from the trees resulted from ComPhy. Other than considering genome-scale distances between all pairs of species, PolyPhy also takes into account different properties of tree topology between dichotomy and polytomy, such as long-branch retraction and short-branch contraction, and quantifies these properties into comparable rates among different sub-branches. We extract three tree topological features, 'LR' (Leaf rate, 'IntraR' (Intra-subset branch rate and 'InterR' (Inter-subset branch rate, all of which are calculated from bifurcating tree branch sets for classification. We have achieved F-measure (balanced measure between precision and recall of 81% with about 0.9 area under the curve (AUC of ROC. Conclusions PolyPhy is a fast and robust method to identify polytomies from phylogenetic trees based on genome-wide inference of evolutionary relationships among genomes. The software package and test data can be downloaded from http://digbio.missouri.edu/ComPhy/phyloTreeBiNonBi-1.0.zip.

  10. Bayesian phylogenetic estimation of fossil ages.

    Science.gov (United States)

    Drummond, Alexei J; Stadler, Tanja

    2016-07-19

    Recent advances have allowed for both morphological fossil evidence and molecular sequences to be integrated into a single combined inference of divergence dates under the rule of Bayesian probability. In particular, the fossilized birth-death tree prior and the Lewis-Mk model of discrete morphological evolution allow for the estimation of both divergence times and phylogenetic relationships between fossil and extant taxa. We exploit this statistical framework to investigate the internal consistency of these models by producing phylogenetic estimates of the age of each fossil in turn, within two rich and well-characterized datasets of fossil and extant species (penguins and canids). We find that the estimation accuracy of fossil ages is generally high with credible intervals seldom excluding the true age and median relative error in the two datasets of 5.7% and 13.2%, respectively. The median relative standard error (RSD) was 9.2% and 7.2%, respectively, suggesting good precision, although with some outliers. In fact, in the two datasets we analyse, the phylogenetic estimate of fossil age is on average less than 2 Myr from the mid-point age of the geological strata from which it was excavated. The high level of internal consistency found in our analyses suggests that the Bayesian statistical model employed is an adequate fit for both the geological and morphological data, and provides evidence from real data that the framework used can accurately model the evolution of discrete morphological traits coded from fossil and extant taxa. We anticipate that this approach will have diverse applications beyond divergence time dating, including dating fossils that are temporally unconstrained, testing of the 'morphological clock', and for uncovering potential model misspecification and/or data errors when controversial phylogenetic hypotheses are obtained based on combined divergence dating analyses.This article is part of the themed issue 'Dating species divergences using

  11. Constructing level-2 phylogenetic networks from triplets

    OpenAIRE

    Iersel, Leo; Keijsper, J.C.M.; Kelk, Steven; Stougie, Leen; Hagen, F.; Boekhout, T.; Vingron, M.; Wong, L.

    2009-01-01

    htmlabstractJansson and Sung showed that, given a dense set of input triplets T (representing hypotheses about the local evolutionary relationships of triplets of taxa), it is possible to determine in polynomial time whether there exists a level-1 network consistent with T, and if so to construct such a network (Inferring a Level-1 Phylogenetic Network from a Dense Set of Rooted Triplets, Theoretical Computer Science, 363, pp. 60-68 (2006)). Here we extend this work by showing that this probl...

  12. Point estimates in phylogenetic reconstructions

    OpenAIRE

    Benner, Philipp; Bacak, Miroslav; Bourguignon, Pierre-Yves

    2013-01-01

    Motivation: The construction of statistics for summarizing posterior samples returned by a Bayesian phylogenetic study has so far been hindered by the poor geometric insights available into the space of phylogenetic trees, and ad hoc methods such as the derivation of a consensus tree makeup for the ill-definition of the usual concepts of posterior mean, while bootstrap methods mitigate the absence of a sound concept of variance. Yielding satisfactory results with sufficiently concentrated pos...

  13. Phylogenetic lineages in Pseudocercospora.

    Science.gov (United States)

    Crous, P W; Braun, U; Hunter, G C; Wingfield, M J; Verkley, G J M; Shin, H-D; Nakashima, C; Groenewald, J Z

    2013-06-30

    Pseudocercospora is a large cosmopolitan genus of plant pathogenic fungi that are commonly associated with leaf and fruit spots as well as blights on a wide range of plant hosts. They occur in arid as well as wet environments and in a wide range of climates including cool temperate, sub-tropical and tropical regions. Pseudocercospora is now treated as a genus in its own right, although formerly recognised as either an anamorphic state of Mycosphaerella or having mycosphaerella-like teleomorphs. The aim of this study was to sequence the partial 28S nuclear ribosomal RNA gene of a selected set of isolates to resolve phylogenetic generic limits within the Pseudocercospora complex. From these data, 14 clades are recognised, six of which cluster in Mycosphaerellaceae. Pseudocercospora s. str. represents a distinct clade, sister to Passalora eucalypti, and a clade representing the genera Scolecostigmina, Trochophora and Pallidocercospora gen. nov., taxa formerly accommodated in the Mycosphaerella heimii complex and characterised by smooth, pale brown conidia, as well as the formation of red crystals in agar media. Other clades in Mycosphaerellaceae include Sonderhenia, Microcyclosporella, and Paracercospora. Pseudocercosporella resides in a large clade along with Phloeospora, Miuraea, Cercospora and Septoria. Additional clades represent Dissoconiaceae, Teratosphaeriaceae, Cladosporiaceae, and the genera Xenostigmina, Strelitziana, Cyphellophora and Thedgonia. The genus Phaeomycocentrospora is introduced to accommodate Mycocentrospora cantuariensis, primarily distinguished from Pseudocercospora based on its hyaline hyphae, broad conidiogenous loci and hila. Host specificity was considered for 146 species of Pseudocercospora occurring on 115 host genera from 33 countries. Partial nucleotide sequence data for three gene loci, ITS, EF-1α, and ACT suggest that the majority of these species are host specific. Species identified on the basis of host, symptomatology and general

  14. A program to compute the soft Robinson-Foulds distance between phylogenetic networks.

    Science.gov (United States)

    Lu, Bingxin; Zhang, Louxin; Leong, Hon Wai

    2017-03-14

    Over the past two decades, phylogenetic networks have been studied to model reticulate evolutionary events. The relationships among phylogenetic networks, phylogenetic trees and clusters serve as the basis for reconstruction and comparison of phylogenetic networks. To understand these relationships, two problems are raised: the tree containment problem, which asks whether a phylogenetic tree is displayed in a phylogenetic network, and the cluster containment problem, which asks whether a cluster is represented at a node in a phylogenetic network. Both the problems are NP-complete. A fast exponential-time algorithm for the cluster containment problem on arbitrary networks is developed and implemented in C. The resulting program is further extended into a computer program for fast computation of the Soft Robinson-Foulds distance between phylogenetic networks. Two computer programs are developed for facilitating reconstruction and validation of phylogenetic network models in evolutionary and comparative genomics. Our simulation tests indicated that they are fast enough for use in practice. Additionally, the distribution of the Soft Robinson-Foulds distance between phylogenetic networks is demonstrated to be unlikely normal by our simulation data.

  15. On the Quirks of Maximum Parsimony and Likelihood on Phylogenetic Networks

    OpenAIRE

    Bryant, Christopher; Fischer, Mareike; Linz, Simone; Semple, Charles

    2015-01-01

    Maximum parsimony is one of the most frequently-discussed tree reconstruction methods in phylogenetic estimation. However, in recent years it has become more and more apparent that phylogenetic trees are often not sufficient to describe evolution accurately. For instance, processes like hybridization or lateral gene transfer that are commonplace in many groups of organisms and result in mosaic patterns of relationships cannot be represented by a single phylogenetic tree. This is why phylogene...

  16. Genetic connectivity in scleractinian corals across the Northern Gulf of Mexico: oil/gas platforms, and relationship to the Flower Garden Banks.

    Directory of Open Access Journals (Sweden)

    Paul W Sammarco

    Full Text Available The 3,000 oil/gas structures currently deployed in the northern Gulf of Mexico (GOM provide hard substratum for marine organisms in a region where such has been rare since the Holocene. The major exception to this are the Flower Garden Banks (FGB. Corals are known to have colonized oil/gas platforms around the FGB, facilitating biogeographic expansion. We ask the question, what are the patterns of genetic affinity in these coral populations. We sampled coral tissue from populations of two species occurring on oil and gas platforms: Madracis decactis (hermatype and Tubastraea coccinea (invasive ahermatype. We sampled 28 platforms along four transects from 20 km offshore to the continental shelf edge off 1 Matagorda Island, TX; 2 Lake Sabine, TX; 3 Terrebonne Bay, LA; and 4 Mobile, AL. The entire population of M. decactis was sampled between depths of 5 m and 37 m. T. coccinea populations were sub-sampled. Genetic variation was assessed using the PCR-based Amplified Fragment Length Polymorphisms (AFLPs. Data were analyzed via AFLPOP and STRUCTURE. Genetic connectivity among M. decactis platform populations was highest near the FGB and decreased to the east. Connectivity increased again in the eastern sector, indicating isolation between the populations from different sides of the Mississippi River (Transects 3 and 4. A point-drop in genetic affinity (relatedness at the shelf edge south of Terrebonne Bay, LA indicated a population differing from all others in the northern GOM. Genetic affinities among T. coccinea were highest in the west and decreased to the east. Very low genetic affinities off Mobile, AL indicated a dramatic difference between those populations and those west of the Mississippi River, apparently a formidable barrier to larval dispersal.

  17. Genetic connectivity in scleractinian corals across the Northern Gulf of Mexico: oil/gas platforms, and relationship to the Flower Garden Banks.

    Science.gov (United States)

    Sammarco, Paul W; Brazeau, Daniel A; Sinclair, James

    2012-01-01

    The 3,000 oil/gas structures currently deployed in the northern Gulf of Mexico (GOM) provide hard substratum for marine organisms in a region where such has been rare since the Holocene. The major exception to this are the Flower Garden Banks (FGB). Corals are known to have colonized oil/gas platforms around the FGB, facilitating biogeographic expansion. We ask the question, what are the patterns of genetic affinity in these coral populations. We sampled coral tissue from populations of two species occurring on oil and gas platforms: Madracis decactis (hermatype) and Tubastraea coccinea (invasive ahermatype). We sampled 28 platforms along four transects from 20 km offshore to the continental shelf edge off 1) Matagorda Island, TX; 2) Lake Sabine, TX; 3) Terrebonne Bay, LA; and 4) Mobile, AL. The entire population of M. decactis was sampled between depths of 5 m and 37 m. T. coccinea populations were sub-sampled. Genetic variation was assessed using the PCR-based Amplified Fragment Length Polymorphisms (AFLPs). Data were analyzed via AFLPOP and STRUCTURE. Genetic connectivity among M. decactis platform populations was highest near the FGB and decreased to the east. Connectivity increased again in the eastern sector, indicating isolation between the populations from different sides of the Mississippi River (Transects 3 and 4). A point-drop in genetic affinity (relatedness) at the shelf edge south of Terrebonne Bay, LA indicated a population differing from all others in the northern GOM. Genetic affinities among T. coccinea were highest in the west and decreased to the east. Very low genetic affinities off Mobile, AL indicated a dramatic difference between those populations and those west of the Mississippi River, apparently a formidable barrier to larval dispersal.

  18. Phylogenetic classification of bony fishes.

    Science.gov (United States)

    Betancur-R, Ricardo; Wiley, Edward O; Arratia, Gloria; Acero, Arturo; Bailly, Nicolas; Miya, Masaki; Lecointre, Guillaume; Ortí, Guillermo

    2017-07-06

    Fish classifications, as those of most other taxonomic groups, are being transformed drastically as new molecular phylogenies provide support for natural groups that were unanticipated by previous studies. A brief review of the main criteria used by ichthyologists to define their classifications during the last 50 years, however, reveals slow progress towards using an explicit phylogenetic framework. Instead, the trend has been to rely, in varying degrees, on deep-rooted anatomical concepts and authority, often mixing taxa with explicit phylogenetic support with arbitrary groupings. Two leading sources in ichthyology frequently used for fish classifications (JS Nelson's volumes of Fishes of the World and W. Eschmeyer's Catalog of Fishes) fail to adopt a global phylogenetic framework despite much recent progress made towards the resolution of the fish Tree of Life. The first explicit phylogenetic classification of bony fishes was published in 2013, based on a comprehensive molecular phylogeny ( www.deepfin.org ). We here update the first version of that classification by incorporating the most recent phylogenetic results. The updated classification presented here is based on phylogenies inferred using molecular and genomic data for nearly 2000 fishes. A total of 72 orders (and 79 suborders) are recognized in this version, compared with 66 orders in version 1. The phylogeny resolves placement of 410 families, or ~80% of the total of 514 families of bony fishes currently recognized. The ordinal status of 30 percomorph families included in this study, however, remains uncertain (incertae sedis in the series Carangaria, Ovalentaria, or Eupercaria). Comments to support taxonomic decisions and comparisons with conflicting taxonomic groups proposed by others are presented. We also highlight cases were morphological support exist for the groups being classified. This version of the phylogenetic classification of bony fishes is substantially improved, providing resolution

  19. Locating a tree in a phylogenetic network

    NARCIS (Netherlands)

    Iersel, van L.J.J.; Semple, C.; Steel, M.A.

    2010-01-01

    Phylogenetic trees and networks are leaf-labelled graphs that are used to describe evolutionary histories of species. The Tree Containment problem asks whether a given phylogenetic tree is embedded in a given phylogenetic network. Given a phylogenetic network and a cluster of species, the Cluster

  20. PhyLIS: A Simple GNU/Linux Distribution for Phylogenetics and Phyloinformatics

    Directory of Open Access Journals (Sweden)

    Robert C. Thomson

    2009-01-01

    Full Text Available PhyLIS is a free GNU/Linux distribution that is designed to provide a simple, standardized platform for phylogenetic and phyloinformatic analysis. The operating system incorporates most commonly used phylogenetic software, which has been pre-compiled and pre-configured, allowing for straightforward application of phylogenetic methods and development of phyloinformatic pipelines in a stable Linux environment. The software is distributed as a live CD and can be installed directly or run from the CD without making changes to the computer. PhyLIS is available for free at http://www.eve.ucdavis.edu/rcthomson/phylis/.

  1. PhyLIS: a simple GNU/Linux distribution for phylogenetics and phyloinformatics.

    Science.gov (United States)

    Thomson, Robert C

    2009-07-30

    PhyLIS is a free GNU/Linux distribution that is designed to provide a simple, standardized platform for phylogenetic and phyloinformatic analysis. The operating system incorporates most commonly used phylogenetic software, which has been pre-compiled and pre-configured, allowing for straightforward application of phylogenetic methods and development of phyloinformatic pipelines in a stable Linux environment. The software is distributed as a live CD and can be installed directly or run from the CD without making changes to the computer. PhyLIS is available for free at http://www.eve.ucdavis.edu/rcthomson/phylis/.

  2. Molecular Phylogenetic: Organism Taxonomy Method Based on Evolution History

    Directory of Open Access Journals (Sweden)

    N.L.P Indi Dharmayanti

    2011-03-01

    Full Text Available Phylogenetic is described as taxonomy classification of an organism based on its evolution history namely its phylogeny and as a part of systematic science that has objective to determine phylogeny of organism according to its characteristic. Phylogenetic analysis from amino acid and protein usually became important area in sequence analysis. Phylogenetic analysis can be used to follow the rapid change of a species such as virus. The phylogenetic evolution tree is a two dimensional of a species graphic that shows relationship among organisms or particularly among their gene sequences. The sequence separation are referred as taxa (singular taxon that is defined as phylogenetically distinct units on the tree. The tree consists of outer branches or leaves that represents taxa and nodes and branch represent correlation among taxa. When the nucleotide sequence from two different organism are similar, they were inferred to be descended from common ancestor. There were three methods which were used in phylogenetic, namely (1 Maximum parsimony, (2 Distance, and (3 Maximum likehoood. Those methods generally are applied to construct the evolutionary tree or the best tree for determine sequence variation in group. Every method is usually used for different analysis and data.

  3. Reconstruction of phylogenetic trees of prokaryotes using maximal common intervals.

    Science.gov (United States)

    Heydari, Mahdi; Marashi, Sayed-Amir; Tusserkani, Ruzbeh; Sadeghi, Mehdi

    2014-10-01

    One of the fundamental problems in bioinformatics is phylogenetic tree reconstruction, which can be used for classifying living organisms into different taxonomic clades. The classical approach to this problem is based on a marker such as 16S ribosomal RNA. Since evolutionary events like genomic rearrangements are not included in reconstructions of phylogenetic trees based on single genes, much effort has been made to find other characteristics for phylogenetic reconstruction in recent years. With the increasing availability of completely sequenced genomes, gene order can be considered as a new solution for this problem. In the present work, we applied maximal common intervals (MCIs) in two or more genomes to infer their distance and to reconstruct their evolutionary relationship. Additionally, measures based on uncommon segments (UCS's), i.e., those genomic segments which are not detected as part of any of the MCIs, are also used for phylogenetic tree reconstruction. We applied these two types of measures for reconstructing the phylogenetic tree of 63 prokaryotes with known COG (clusters of orthologous groups) families. Similarity between the MCI-based (resp. UCS-based) reconstructed phylogenetic trees and the phylogenetic tree obtained from NCBI taxonomy browser is as high as 93.1% (resp. 94.9%). We show that in the case of this diverse dataset of prokaryotes, tree reconstruction based on MCI and UCS outperforms most of the currently available methods based on gene orders, including breakpoint distance and DCJ. We additionally tested our new measures on a dataset of 13 closely-related bacteria from the genus Prochlorococcus. In this case, distances like rearrangement distance, breakpoint distance and DCJ proved to be useful, while our new measures are still appropriate for phylogenetic reconstruction. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  4. Locating a tree in a phylogenetic network

    OpenAIRE

    van Iersel, Leo; Semple, Charles; Steel, Mike

    2010-01-01

    Phylogenetic trees and networks are leaf-labelled graphs that are used to describe evolutionary histories of species. The Tree Containment problem asks whether a given phylogenetic tree is embedded in a given phylogenetic network. Given a phylogenetic network and a cluster of species, the Cluster Containment problem asks whether the given cluster is a cluster of some phylogenetic tree embedded in the network. Both problems are known to be NP-complete in general. In this article, we consider t...

  5. Trypanosoma (Megatrypanum) melophagium in the sheep ked Melophagus ovinus from organic farms in Croatia: phylogenetic inferences support restriction to sheep and sheep keds and close relationship with trypanosomes from other ruminant species.

    Science.gov (United States)

    Martinković, Franjo; Matanović, Krešimir; Rodrigues, Adriana C; Garcia, Herakles A; Teixeira, Marta M G

    2012-01-01

    Trypanosoma (Megatrypanum) melophagium is a parasite of sheep transmitted by sheep keds, the sheep-restricted ectoparasite Melophagus ovinus (Diptera: Hippoboscidae). Sheep keds were 100% prevalent in sheep from five organic farms in Croatia, Southeastern Europe, whereas trypanosomes morphologically compatible with T. melophagium were 86% prevalent in the guts of the sheep keds. Multilocus phylogenetic analyses using sequences of small subunit rRNA, glycosomal glyceraldehyde-3-phosphate dehydrogenase, spliced leader, and internal transcribed spacer 1 of the rDNA distinguished T. melophagium from all allied trypanosomes from other ruminant species and placed the trypanosome in the subgenus Megatrypanum. Trypanosomes from sheep keds from Croatia and Scotland, the only available isolates for comparison, shared identical sequences. All biologic and phylogenetic inferences support the restriction of T. melophagium to sheep and, especially, to the sheep keds. The comparison of trypanosomes from sheep, cattle, and deer from the same country, which was never achieved before this work, strongly supported the host-restricted specificity of trypanosomes of the subgenus Megatrypanum. Our findings indicate that with the expansion of organic farms, both sheep keds and T. melophagium may re-emerge as parasitic infections of sheep. © 2011 The Author(s) Journal of Eukaryotic Microbiology © 2011 International Society of Protistologists.

  6. Phylogenetic Analysis of the Bee Tribe Anthidiini | Combey | Journal ...

    African Journals Online (AJOL)

    The phylogenetic relationships among members of long tongue bee tribe Anthidiini (Megachilidae: Megachilinae) were investigated at the Department of Entomology and Wildlife, University of Cape Coast (Ghana) and the Agricultural Research Council, Pretoria (South Af-rica) from July, 2006 to May, 2007. Ten museums ...

  7. Genetic and phylogenetic analysis of ten Gobiidae species in China ...

    African Journals Online (AJOL)

    To study the genetic and phylogenetic relationship of gobioid fishes in China, the representatives of 10 gobioid fishes from 2 subfamilies in China were examined by amplified fragment length polymorphism (AFLP) analysis. We established 220 AFLP bands for 45 individuals from the 10 species, and the percentage of ...

  8. Phylogenetic analysis of the genus Hordeum using repetitive DNA sequences

    DEFF Research Database (Denmark)

    Svitashev, S.; Bryngelsson, T.; Vershinin, A.

    1994-01-01

    A set of six cloned barley (Hordeum vulgare) repetitive DNA sequences was used for the analysis of phylogenetic relationships among 31 species (46 taxa) of the genus Hordeum, using molecular hybridization techniques. In situ hybridization experiments showed dispersed organization of the sequences...

  9. Genetic Connectivity in Scleractinian Corals across the Northern Gulf of Mexico: Oil/Gas Platforms, and Relationship to the Flower Garden Banks

    OpenAIRE

    Sammarco, Paul W.; Brazeau, Daniel A.; Sinclair, James

    2012-01-01

    The 3,000 oil/gas structures currently deployed in the northern Gulf of Mexico (GOM) provide hard substratum for marine organisms in a region where such has been rare since the Holocene. The major exception to this are the Flower Garden Banks (FGB). Corals are known to have colonized oil/gas platforms around the FGB, facilitating biogeographic expansion. We ask the question, what are the patterns of genetic affinity in these coral populations. We sampled coral tissue from populations of two s...

  10. Patterns of forest phylogenetic community structure across the United States and their possible forest health implications

    Science.gov (United States)

    Kevin M. Potter; Frank H. Koch

    2014-01-01

    The analysis of phylogenetic relationships among co-occurring tree species offers insights into the ecological organization of forest communities from an evolutionary perspective and, when employed regionally across thousands of plots, can assist in forest health assessment. Phylogenetic clustering of species, when species are more closely related than expected by...

  11. Interpreting the universal phylogenetic tree

    Science.gov (United States)

    Woese, C. R.

    2000-01-01

    The universal phylogenetic tree not only spans all extant life, but its root and earliest branchings represent stages in the evolutionary process before modern cell types had come into being. The evolution of the cell is an interplay between vertically derived and horizontally acquired variation. Primitive cellular entities were necessarily simpler and more modular in design than are modern cells. Consequently, horizontal gene transfer early on was pervasive, dominating the evolutionary dynamic. The root of the universal phylogenetic tree represents the first stage in cellular evolution when the evolving cell became sufficiently integrated and stable to the erosive effects of horizontal gene transfer that true organismal lineages could exist.

  12. Phylogenetic Paleoecology: Tree-Thinking and Ecology in Deep Time.

    Science.gov (United States)

    Lamsdell, James C; Congreve, Curtis R; Hopkins, Melanie J; Krug, Andrew Z; Patzkowsky, Mark E

    2017-06-01

    The new and emerging field of phylogenetic paleoecology leverages the evolutionary relationships among species to explain temporal and spatial changes in species diversity, abundance, and distribution in deep time. This field is poised for rapid progress as knowledge of the evolutionary relationships among fossil species continues to expand. In particular, this approach will lend new insights to many of the longstanding questions in evolutionary biology, such as: the relationships among character change, ecology, and evolutionary rates; the processes that determine the evolutionary relationships among species within communities and along environmental gradients; and the phylogenetic signal underlying ecological selectivity in background and mass extinctions and in major evolutionary radiations. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. PhyloSift: phylogenetic analysis of genomes and metagenomes.

    Science.gov (United States)

    Darling, Aaron E; Jospin, Guillaume; Lowe, Eric; Matsen, Frederick A; Bik, Holly M; Eisen, Jonathan A

    2014-01-01

    Like all organisms on the planet, environmental microbes are subject to the forces of molecular evolution. Metagenomic sequencing provides a means to access the DNA sequence of uncultured microbes. By combining DNA sequencing of microbial communities with evolutionary modeling and phylogenetic analysis we might obtain new insights into microbiology and also provide a basis for practical tools such as forensic pathogen detection. In this work we present an approach to leverage phylogenetic analysis of metagenomic sequence data to conduct several types of analysis. First, we present a method to conduct phylogeny-driven Bayesian hypothesis tests for the presence of an organism in a sample. Second, we present a means to compare community structure across a collection of many samples and develop direct associations between the abundance of certain organisms and sample metadata. Third, we apply new tools to analyze the phylogenetic diversity of microbial communities and again demonstrate how this can be associated to sample metadata. These analyses are implemented in an open source software pipeline called PhyloSift. As a pipeline, PhyloSift incorporates several other programs including LAST, HMMER, and pplacer to automate phylogenetic analysis of protein coding and RNA sequences in metagenomic datasets generated by modern sequencing platforms (e.g., Illumina, 454).

  14. PhyloSift: phylogenetic analysis of genomes and metagenomes

    Directory of Open Access Journals (Sweden)

    Aaron E. Darling

    2014-01-01

    Full Text Available Like all organisms on the planet, environmental microbes are subject to the forces of molecular evolution. Metagenomic sequencing provides a means to access the DNA sequence of uncultured microbes. By combining DNA sequencing of microbial communities with evolutionary modeling and phylogenetic analysis we might obtain new insights into microbiology and also provide a basis for practical tools such as forensic pathogen detection.In this work we present an approach to leverage phylogenetic analysis of metagenomic sequence data to conduct several types of analysis. First, we present a method to conduct phylogeny-driven Bayesian hypothesis tests for the presence of an organism in a sample. Second, we present a means to compare community structure across a collection of many samples and develop direct associations between the abundance of certain organisms and sample metadata. Third, we apply new tools to analyze the phylogenetic diversity of microbial communities and again demonstrate how this can be associated to sample metadata.These analyses are implemented in an open source software pipeline called PhyloSift. As a pipeline, PhyloSift incorporates several other programs including LAST, HMMER, and pplacer to automate phylogenetic analysis of protein coding and RNA sequences in metagenomic datasets generated by modern sequencing platforms (e.g., Illumina, 454.

  15. DendroPy: a Python library for phylogenetic computing.

    Science.gov (United States)

    Sukumaran, Jeet; Holder, Mark T

    2010-06-15

    DendroPy is a cross-platform library for the Python programming language that provides for object-oriented reading, writing, simulation and manipulation of phylogenetic data, with an emphasis on phylogenetic tree operations. DendroPy uses a splits-hash mapping to perform rapid calculations of tree distances, similarities and shape under various metrics. It contains rich simulation routines to generate trees under a number of different phylogenetic and coalescent models. DendroPy's data simulation and manipulation facilities, in conjunction with its support of a broad range of phylogenetic data formats (NEXUS, Newick, PHYLIP, FASTA, NeXML, etc.), allow it to serve a useful role in various phyloinformatics and phylogeographic pipelines. The stable release of the library is available for download and automated installation through the Python Package Index site (http://pypi.python.org/pypi/DendroPy), while the active development source code repository is available to the public from GitHub (http://github.com/jeetsukumaran/DendroPy).

  16. Molecular phylogenetics and historical biogeography of Rhinolophus bats.

    Science.gov (United States)

    Stoffberg, Samantha; Jacobs, David S; Mackie, Iain J; Matthee, Conrad A

    2010-01-01

    The phylogenetic relationships within the horseshoe bats (genus Rhinolophus) are poorly resolved, particularly at deeper levels within the tree. We present a better-resolved phylogenetic hypothesis for 30 rhinolophid species based on parsimony and Bayesian analyses of the mitochondrial cytochrome b gene and three nuclear introns (TG, THY and PRKC1). Strong support was found for the existence of two geographic clades within the monophyletic Rhinolophidae: an African group and an Oriental assemblage. The relaxed Bayesian clock method indicated that the two rhinolophid clades diverged approximately 35 million years ago and results from Dispersal Vicariance (DIVA) analysis suggest that the horseshoe bats arose in Asia and subsequently dispersed into Europe and Africa.

  17. Using tree diversity to compare phylogenetic heuristics.

    Science.gov (United States)

    Sul, Seung-Jin; Matthews, Suzanne; Williams, Tiffani L

    2009-04-29

    Evolutionary trees are family trees that represent the relationships between a group of organisms. Phylogenetic heuristics are used to search stochastically for the best-scoring trees in tree space. Given that better tree scores are believed to be better approximations of the true phylogeny, traditional evaluation techniques have used tree scores to determine the heuristics that find the best scores in the fastest time. We develop new techniques to evaluate phylogenetic heuristics based on both tree scores and topologies to compare Pauprat and Rec-I-DCM3, two popular Maximum Parsimony search algorithms. Our results show that although Pauprat and Rec-I-DCM3 find the trees with the same best scores, topologically these trees are quite different. Furthermore, the Rec-I-DCM3 trees cluster distinctly from the Pauprat trees. In addition to our heatmap visualizations of using parsimony scores and the Robinson-Foulds distance to compare best-scoring trees found by the two heuristics, we also develop entropy-based methods to show the diversity of the trees found. Overall, Pauprat identifies more diverse trees than Rec-I-DCM3. Overall, our work shows that there is value to comparing heuristics beyond the parsimony scores that they find. Pauprat is a slower heuristic than Rec-I-DCM3. However, our work shows that there is tremendous value in using Pauprat to reconstruct trees-especially since it finds identical scoring but topologically distinct trees. Hence, instead of discounting Pauprat, effort should go in improving its implementation. Ultimately, improved performance measures lead to better phylogenetic heuristics and will result in better approximations of the true evolutionary history of the organisms of interest.

  18. High-resolution phylogenetic microbial community profiling

    Energy Technology Data Exchange (ETDEWEB)

    Singer, Esther; Coleman-Derr, Devin; Bowman, Brett; Schwientek, Patrick; Clum, Alicia; Copeland, Alex; Ciobanu, Doina; Cheng, Jan-Fang; Gies, Esther; Hallam, Steve; Tringe, Susannah; Woyke, Tanja

    2014-03-17

    The representation of bacterial and archaeal genome sequences is strongly biased towards cultivated organisms, which belong to merely four phylogenetic groups. Functional information and inter-phylum level relationships are still largely underexplored for candidate phyla, which are often referred to as microbial dark matter. Furthermore, a large portion of the 16S rRNA gene records in the GenBank database are labeled as environmental samples and unclassified, which is in part due to low read accuracy, potential chimeric sequences produced during PCR amplifications and the low resolution of short amplicons. In order to improve the phylogenetic classification of novel species and advance our knowledge of the ecosystem function of uncultivated microorganisms, high-throughput full length 16S rRNA gene sequencing methodologies with reduced biases are needed. We evaluated the performance of PacBio single-molecule real-time (SMRT) sequencing in high-resolution phylogenetic microbial community profiling. For this purpose, we compared PacBio and Illumina metagenomic shotgun and 16S rRNA gene sequencing of a mock community as well as of an environmental sample from Sakinaw Lake, British Columbia. Sakinaw Lake is known to contain a large age of microbial species from candidate phyla. Sequencing results show that community structure based on PacBio shotgun and 16S rRNA gene sequences is highly similar in both the mock and the environmental communities. Resolution power and community representation accuracy from SMRT sequencing data appeared to be independent of GC content of microbial genomes and was higher when compared to Illumina-based metagenome shotgun and 16S rRNA gene (iTag) sequences, e.g. full-length sequencing resolved all 23 OTUs in the mock community, while iTags did not resolve closely related species. SMRT sequencing hence offers various potential benefits when characterizing uncharted microbial communities.

  19. Phylogenetics of neotropical Platymiscium (Leguminosae

    DEFF Research Database (Denmark)

    Saslis-Lagoudakis, C. Haris; Chase, Mark W; Robinson, Daniel N

    2008-01-01

    Platymiscium is a neotropical legume genus of forest trees in the Pterocarpus clade of the pantropical "dalbergioid" clade. It comprises 19 species (29 taxa), distributed from Mexico to southern Brazil. This study presents a molecular phylogenetic analysis of Platymiscium and allies inferred from...

  20. Double-digest RAD sequencing using Ion Proton semiconductor platform (ddRADseq-ion) with nonmodel organisms.

    Science.gov (United States)

    Recknagel, Hans; Jacobs, Arne; Herzyk, Pawel; Elmer, Kathryn R

    2015-11-01

    Research in evolutionary biology involving nonmodel organisms is rapidly shifting from using traditional molecular markers such as mtDNA and microsatellites to higher throughput SNP genotyping methodologies to address questions in population genetics, phylogenetics and genetic mapping. Restriction site associated DNA sequencing (RAD sequencing or RADseq) has become an established method for SNP genotyping on Illumina sequencing platforms. Here, we developed a protocol and adapters for double-digest RAD sequencing for Ion Torrent (Life Technologies; Ion Proton, Ion PGM) semiconductor sequencing. We sequenced thirteen genomic libraries of three different nonmodel vertebrate species on Ion Proton with PI chips: Arctic charr Salvelinus alpinus, European whitefish Coregonus lavaretus and common lizard Zootoca vivipara. This resulted in ~962 million single-end reads overall and a mean of ~74 million reads per library. We filtered the genomic data using Stacks, a bioinformatic tool to process RAD sequencing data. On average, we obtained ~11,000 polymorphic loci per library of 6-30 individuals. We validate our new method by technical and biological replication, by reconstructing phylogenetic relationships, and using a hybrid genetic cross to track genomic variants. Finally, we discuss the differences between using the different sequencing platforms in the context of RAD sequencing, assessing possible advantages and disadvantages. We show that our protocol can be used for Ion semiconductor sequencing platforms for the rapid and cost-effective generation of variable and reproducible genetic markers. © 2015 John Wiley & Sons Ltd.

  1. Inferring phylogenetic trees from the knowledge of rare evolutionary events.

    Science.gov (United States)

    Hellmuth, Marc; Hernandez-Rosales, Maribel; Long, Yangjing; Stadler, Peter F

    2018-06-01

    Rare events have played an increasing role in molecular phylogenetics as potentially homoplasy-poor characters. In this contribution we analyze the phylogenetic information content from a combinatorial point of view by considering the binary relation on the set of taxa defined by the existence of a single event separating two taxa. We show that the graph-representation of this relation must be a tree. Moreover, we characterize completely the relationship between the tree of such relations and the underlying phylogenetic tree. With directed operations such as tandem-duplication-random-loss events in mind we demonstrate how non-symmetric information constrains the position of the root in the partially reconstructed phylogeny.

  2. A phylogenetic blueprint for a modern whale.

    Science.gov (United States)

    Gatesy, John; Geisler, Jonathan H; Chang, Joseph; Buell, Carl; Berta, Annalisa; Meredith, Robert W; Springer, Mark S; McGowen, Michael R

    2013-02-01

    The emergence of Cetacea in the Paleogene represents one of the most profound macroevolutionary transitions within Mammalia. The move from a terrestrial habitat to a committed aquatic lifestyle engendered wholesale changes in anatomy, physiology, and behavior. The results of this remarkable transformation are extant whales that include the largest, biggest brained, fastest swimming, loudest, deepest diving mammals, some of which can detect prey with a sophisticated echolocation system (Odontoceti - toothed whales), and others that batch feed using racks of baleen (Mysticeti - baleen whales). A broad-scale reconstruction of the evolutionary remodeling that culminated in extant cetaceans has not yet been based on integration of genomic and paleontological information. Here, we first place Cetacea relative to extant mammalian diversity, and assess the distribution of support among molecular datasets for relationships within Artiodactyla (even-toed ungulates, including Cetacea). We then merge trees derived from three large concatenations of molecular and fossil data to yield a composite hypothesis that encompasses many critical events in the evolutionary history of Cetacea. By combining diverse evidence, we infer a phylogenetic blueprint that outlines the stepwise evolutionary development of modern whales. This hypothesis represents a starting point for more detailed, comprehensive phylogenetic reconstructions in the future, and also highlights the synergistic interaction between modern (genomic) and traditional (morphological+paleontological) approaches that ultimately must be exploited to provide a rich understanding of evolutionary history across the entire tree of Life. Copyright © 2012 Elsevier Inc. All rights reserved.

  3. Work Engagement: A Double-Edged Sword? A Study of the Relationship between Work Engagement and the Work-Home Interaction Using the ARK Research Platform

    Directory of Open Access Journals (Sweden)

    Katrine Listau

    2017-07-01

    Full Text Available The aim of the present study was to investigate how being engaged at work affects academics’ work-home interaction. Using the Conservation of Resources theory as a theoretical framework, the study contributes to existing research by examining the relationship between the work engagement subscales (i.e. vigour, dedication, and absorption and both work-home facilitation and work-home conflict. In order to test the hypotheses, a Partial Least Squares-Structural Equation Modelling analysis was conducted using a large sample of academics from the Norwegian university sector (N = 4378. The results indicated that vigour and dedication had a positive relationship with work-home facilitation and a negative relationship with work-home conflict. In contrast, absorption was not significantly related to work-home facilitation, but was positively associated with work-home conflict. Thus, we conclude that work engagement seems to have the potential to create both positive and negative outcomes.

  4. Phylogenetic congruence between subtropical trees and their associated fungi.

    Science.gov (United States)

    Liu, Xubing; Liang, Minxia; Etienne, Rampal S; Gilbert, Gregory S; Yu, Shixiao

    2016-12-01

    Recent studies have detected phylogenetic signals in pathogen-host networks for both soil-borne and leaf-infecting fungi, suggesting that pathogenic fungi may track or coevolve with their preferred hosts. However, a phylogenetically concordant relationship between multiple hosts and multiple fungi in has rarely been investigated. Using next-generation high-throughput DNA sequencing techniques, we analyzed fungal taxa associated with diseased leaves, rotten seeds, and infected seedlings of subtropical trees. We compared the topologies of the phylogenetic trees of the soil and foliar fungi based on the internal transcribed spacer (ITS) region with the phylogeny of host tree species based on matK , rbcL , atpB, and 5.8S genes. We identified 37 foliar and 103 soil pathogenic fungi belonging to the Ascomycota and Basidiomycota phyla and detected significantly nonrandom host-fungus combinations, which clustered on both the fungus phylogeny and the host phylogeny. The explicit evidence of congruent phylogenies between tree hosts and their potential fungal pathogens suggests either diffuse coevolution among the plant-fungal interaction networks or that the distribution of fungal species tracked spatially associated hosts with phylogenetically conserved traits and habitat preferences. Phylogenetic conservatism in plant-fungal interactions within a local community promotes host and parasite specificity, which is integral to the important role of fungi in promoting species coexistence and maintaining biodiversity of forest communities.

  5. Predicting rates of interspecific interaction from phylogenetic trees.

    Science.gov (United States)

    Nuismer, Scott L; Harmon, Luke J

    2015-01-01

    Integrating phylogenetic information can potentially improve our ability to explain species' traits, patterns of community assembly, the network structure of communities, and ecosystem function. In this study, we use mathematical models to explore the ecological and evolutionary factors that modulate the explanatory power of phylogenetic information for communities of species that interact within a single trophic level. We find that phylogenetic relationships among species can influence trait evolution and rates of interaction among species, but only under particular models of species interaction. For example, when interactions within communities are mediated by a mechanism of phenotype matching, phylogenetic trees make specific predictions about trait evolution and rates of interaction. In contrast, if interactions within a community depend on a mechanism of phenotype differences, phylogenetic information has little, if any, predictive power for trait evolution and interaction rate. Together, these results make clear and testable predictions for when and how evolutionary history is expected to influence contemporary rates of species interaction. © 2014 John Wiley & Sons Ltd/CNRS.

  6. The power and pitfalls of HIV phylogenetics in public health.

    Science.gov (United States)

    Brooks, James I; Sandstrom, Paul A

    2013-07-25

    Phylogenetics is the application of comparative studies of genetic sequences in order to infer evolutionary relationships among organisms. This tool can be used as a form of molecular epidemiology to enhance traditional population-level communicable disease surveillance. Phylogenetic study has resulted in new paradigms being created in the field of communicable diseases and this commentary aims to provide the reader with an explanation of how phylogenetics can be used in tracking infectious diseases. Special emphasis will be placed upon the application of phylogenetics as a tool to help elucidate HIV transmission patterns and the limitations to these methods when applied to forensic analysis. Understanding infectious disease epidemiology in order to prevent new transmissions is the sine qua non of public health. However, with increasing epidemiological resolution, there may be an associated potential loss of privacy to the individual. It is within this context that we aim to promote the discussion on how to use phylogenetics to achieve important public health goals, while at the same time protecting the rights of the individual.

  7. Towards an integrated phylogenetic classification of the Tremellomycetes.

    Science.gov (United States)

    Liu, X-Z; Wang, Q-M; Göker, M; Groenewald, M; Kachalkin, A V; Lumbsch, H T; Millanes, A M; Wedin, M; Yurkov, A M; Boekhout, T; Bai, F-Y

    2015-06-01

    Families and genera assigned to Tremellomycetes have been mainly circumscribed by morphology and for the yeasts also by biochemical and physiological characteristics. This phenotype-based classification is largely in conflict with molecular phylogenetic analyses. Here a phylogenetic classification framework for the Tremellomycetes is proposed based on the results of phylogenetic analyses from a seven-genes dataset covering the majority of tremellomycetous yeasts and closely related filamentous taxa. Circumscriptions of the taxonomic units at the order, family and genus levels recognised were quantitatively assessed using the phylogenetic rank boundary optimisation (PRBO) and modified general mixed Yule coalescent (GMYC) tests. In addition, a comprehensive phylogenetic analysis on an expanded LSU rRNA (D1/D2 domains) gene sequence dataset covering as many as available teleomorphic and filamentous taxa within Tremellomycetes was performed to investigate the relationships between yeasts and filamentous taxa and to examine the stability of undersampled clades. Based on the results inferred from molecular data and morphological and physiochemical features, we propose an updated classification for the Tremellomycetes. We accept five orders, 17 families and 54 genera, including seven new families and 18 new genera. In addition, seven families and 17 genera are emended and one new species name and 185 new combinations are proposed. We propose to use the term pro tempore or pro tem. in abbreviation to indicate the species names that are temporarily maintained.

  8. Phylogenetic Signal in AFLP Data Sets

    NARCIS (Netherlands)

    Koopman, W.J.M.

    2005-01-01

    AFLP markers provide a potential source of phylogenetic information for molecular systematic studies. However, there are properties of restriction fragment data that limit phylogenetic interpretation of AFLPs. These are (a) possible nonindependence of fragments, (b) problems of homology assignment

  9. Phylogenetic Position of Barbus lacerta Heckel, 1843

    Directory of Open Access Journals (Sweden)

    Mustafa Korkmaz

    2015-11-01

    As a result, five clades come out from phylogenetic reconstruction and in phylogenetic tree Barbus lacerta determined to be sister group of Barbus macedonicus, Barbus oligolepis and Barbus plebejus complex.

  10. Evolutionary relationships among Astroviridae

    NARCIS (Netherlands)

    Lukashov, Vladimir V.; Goudsmit, Jaap

    2002-01-01

    To study the evolutionary relationships among astroviruses, all available sequences for members of the family Astroviridae were collected. Phylogenetic analysis distinguished two deep-rooted groups: one comprising mammalian astroviruses, with ovine astrovirus being an outlier, and the other

  11. The transposition distance for phylogenetic trees

    OpenAIRE

    Rossello, Francesc; Valiente, Gabriel

    2006-01-01

    The search for similarity and dissimilarity measures on phylogenetic trees has been motivated by the computation of consensus trees, the search by similarity in phylogenetic databases, and the assessment of clustering results in bioinformatics. The transposition distance for fully resolved phylogenetic trees is a recent addition to the extensive collection of available metrics for comparing phylogenetic trees. In this paper, we generalize the transposition distance from fully resolved to arbi...

  12. Phylogenetic perspectives on reef fish functional traits.

    Science.gov (United States)

    Floeter, Sergio R; Bender, Mariana G; Siqueira, Alexandre C; Cowman, Peter F

    2018-02-01

    Functional traits have been fundamental to the evolution and diversification of entire fish lineages on coral reefs. Yet their relationship with the processes promoting speciation, extinction and the filtering of local species pools remains unclear. We review the current literature exploring the evolution of diet, body size, water column use and geographic range size in reef-associated fishes. Using published and new data, we mapped functional traits on to published phylogenetic trees to uncover evolutionary patterns that have led to the current functional diversity of fishes on coral reefs. When examining reconstructed patterns for diet and feeding mode, we found examples of independent transitions to planktivory across different reef fish families. Such transitions and associated morphological alterations may represent cases in which ecological opportunity for the exploitation of different resources drives speciation and adaptation. In terms of body size, reconstructions showed that both large and small sizes appear multiple times within clades of mid-sized fishes and that extreme body sizes have arisen mostly in the last 10 million years (Myr). The reconstruction of range size revealed many cases of disparate range sizes among sister species. Such range size disparity highlights potential vicariant processes through isolation in peripheral locations. When accounting for peripheral speciation processes in sister pairs, we found a significant relationship between labrid range size and lineage age. The diversity and evolution of traits within lineages is influenced by trait-environment interactions as well as by species and trait-trait interactions, where the presence of a given trait may trigger the development of related traits or behaviours. Our effort to assess the evolution of functional diversity across reef fish clades adds to the burgeoning research focusing on the evolutionary and ecological roles of functional traits. We argue that the combination of a

  13. Phylogenetic footprints in organizational behavior

    OpenAIRE

    Witt, Ulrich; Schwesinger, Georg

    2012-01-01

    An evolutionary tool kit is applied in this paper to explain how innate social behavior traits evolved in early human groups. These traits were adapted to the particular production requirements of the group in human phylogeny. They shaped the group members' attitudes towards contributing to the group's goals and towards other group members. We argue that these attitudes are still present in modern humans and leave their phylogenetic footprints also in present-day organizational life. We discu...

  14. Linear programming model to construct phylogenetic network for 16S rRNA sequences of photosynthetic organisms and influenza viruses.

    Science.gov (United States)

    Mathur, Rinku; Adlakha, Neeru

    2014-06-01

    Phylogenetic trees give the information about the vertical relationships of ancestors and descendants but phylogenetic networks are used to visualize the horizontal relationships among the different organisms. In order to predict reticulate events there is a need to construct phylogenetic networks. Here, a Linear Programming (LP) model has been developed for the construction of phylogenetic network. The model is validated by using data sets of chloroplast of 16S rRNA sequences of photosynthetic organisms and Influenza A/H5N1 viruses. Results obtained are in agreement with those obtained by earlier researchers.

  15. Snap: an integrated SNP annotation platform

    DEFF Research Database (Denmark)

    Li, Shengting; Ma, Lijia; Li, Heng

    2007-01-01

    Snap (Single Nucleotide Polymorphism Annotation Platform) is a server designed to comprehensively analyze single genes and relationships between genes basing on SNPs in the human genome. The aim of the platform is to facilitate the study of SNP finding and analysis within the framework of medical...

  16. A New Perspective on Polyploid Fragaria (Strawberry) Genome Composition Based on Large-Scale, Multi-Locus Phylogenetic Analysis.

    Science.gov (United States)

    Yang, Yilong; Davis, Thomas M

    2017-12-01

    The subgenomic compositions of the octoploid (2n = 8× = 56) strawberry (Fragaria) species, including the economically important cultivated species Fragaria x ananassa, have been a topic of long-standing interest. Phylogenomic approaches utilizing next-generation sequencing technologies offer a new window into species relationships and the subgenomic compositions of polyploids. We have conducted a large-scale phylogenetic analysis of Fragaria (strawberry) species using the Fluidigm Access Array system and 454 sequencing platform. About 24 single-copy or low-copy nuclear genes distributed across the genome were amplified and sequenced from 96 genomic DNA samples representing 16 Fragaria species from diploid (2×) to decaploid (10×), including the most extensive sampling of octoploid taxa yet reported. Individual gene trees were constructed by different tree-building methods. Mosaic genomic structures of diploid Fragaria species consisting of sequences at different phylogenetic positions were observed. Our findings support the presence in octoploid species of genetic signatures from at least five diploid ancestors (F. vesca, F. iinumae, F. bucharica, F. viridis, and at least one additional allele contributor of unknown identity), and questions the extent to which distinct subgenomes are preserved over evolutionary time in the allopolyploid Fragaria species. In addition, our data support divergence between the two wild octoploid species, F. virginiana and F. chiloensis. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  17. Maximum Parsimony on Phylogenetic networks

    Science.gov (United States)

    2012-01-01

    Background Phylogenetic networks are generalizations of phylogenetic trees, that are used to model evolutionary events in various contexts. Several different methods and criteria have been introduced for reconstructing phylogenetic trees. Maximum Parsimony is a character-based approach that infers a phylogenetic tree by minimizing the total number of evolutionary steps required to explain a given set of data assigned on the leaves. Exact solutions for optimizing parsimony scores on phylogenetic trees have been introduced in the past. Results In this paper, we define the parsimony score on networks as the sum of the substitution costs along all the edges of the network; and show that certain well-known algorithms that calculate the optimum parsimony score on trees, such as Sankoff and Fitch algorithms extend naturally for networks, barring conflicting assignments at the reticulate vertices. We provide heuristics for finding the optimum parsimony scores on networks. Our algorithms can be applied for any cost matrix that may contain unequal substitution costs of transforming between different characters along different edges of the network. We analyzed this for experimental data on 10 leaves or fewer with at most 2 reticulations and found that for almost all networks, the bounds returned by the heuristics matched with the exhaustively determined optimum parsimony scores. Conclusion The parsimony score we define here does not directly reflect the cost of the best tree in the network that displays the evolution of the character. However, when searching for the most parsimonious network that describes a collection of characters, it becomes necessary to add additional cost considerations to prefer simpler structures, such as trees over networks. The parsimony score on a network that we describe here takes into account the substitution costs along the additional edges incident on each reticulate vertex, in addition to the substitution costs along the other edges which are

  18. One tree to link them all: a phylogenetic dataset for the European tetrapoda.

    Science.gov (United States)

    Roquet, Cristina; Lavergne, Sébastien; Thuiller, Wilfried

    2014-08-08

    Since the ever-increasing availability of phylogenetic informative data, the last decade has seen an upsurge of ecological studies incorporating information on evolutionary relationships among species. However, detailed species-level phylogenies are still lacking for many large groups and regions, which are necessary for comprehensive large-scale eco-phylogenetic analyses. Here, we provide a dataset of 100 dated phylogenetic trees for all European tetrapods based on a mixture of supermatrix and supertree approaches. Phylogenetic inference was performed separately for each of the main Tetrapoda groups of Europe except mammals (i.e. amphibians, birds, squamates and turtles) by means of maximum likelihood (ML) analyses of supermatrix applying a tree constraint at the family (amphibians and squamates) or order (birds and turtles) levels based on consensus knowledge. For each group, we inferred 100 ML trees to be able to provide a phylogenetic dataset that accounts for phylogenetic uncertainty, and assessed node support with bootstrap analyses. Each tree was dated using penalized-likelihood and fossil calibration. The trees obtained were well-supported by existing knowledge and previous phylogenetic studies. For mammals, we modified the most complete supertree dataset available on the literature to include a recent update of the Carnivora clade. As a final step, we merged the phylogenetic trees of all groups to obtain a set of 100 phylogenetic trees for all European Tetrapoda species for which data was available (91%). We provide this phylogenetic dataset (100 chronograms) for the purpose of comparative analyses, macro-ecological or community ecology studies aiming to incorporate phylogenetic information while accounting for phylogenetic uncertainty.

  19. Hypopomus Gill: nova apomorfia e notas sobre suas relações filogenéticas (Teleostei, Gymnotiformes, Rhamphichthyoidea Hypopomus Gill: new apomorphy and notes on its phylogenetic relationships (Teleostei, Gymnotioformes, Rhamphichthoidea

    Directory of Open Access Journals (Sweden)

    Mauro L. Triques

    2007-01-01

    Full Text Available O monofiletismo de Hypopomus Gill, 1864 é corroborado pela presença de canto da boca curvo para cima, homoplasticamente também em Steatogenys Boulenger, 1898. Sua sinonímia com Parupygus Hoedeman, 1962 é corroborada. Três de sete apomorfias previamente atribuídas para definir o monofiletismo de Hypopomidae são refutadas (região posterior do paresfenóide estreita, depressão na face dorsal do basi-hial e opérculo trapezoidal e outras quatro são propostas para unir Hypopomus a Rhamphichthyidae (mandíbula incluída; alongamento anterior do dentário; cartilagem palatina alongada e processo ascendente do mesopterigóide curvo para trás. Assim, estudos mais elaborados são necessários para avaliar a posição filogenética do gênero.The monophyly of Hypopomus Gill, 1864 is corroborated, on the basis of the presence of mouth corner upturned, homoplastically also in Steatogenys Boulenger, 1898. Its synonymy with Parupygus Hoedeman, 1962 is corroborated. Three of seven synapomorphies attributed to the monophyly of Hypopomidae are refuted (posterior region of parasphenoid narrow, depression on the dorsal surface of bashyal and trapezoidal opercle and four other are presented to unite Hypopomus to Rhamphichthyidae (lower jaw included; anterior elongation of dentary; elongation of palatine cartilage and ascending process of mesopterygoid backward curved. Thus, further studies are necessary to assess the phylogenetic position of the genus.

  20. Transforming phylogenetic networks: Moving beyond tree space.

    Science.gov (United States)

    Huber, Katharina T; Moulton, Vincent; Wu, Taoyang

    2016-09-07

    Phylogenetic networks are a generalization of phylogenetic trees that are used to represent reticulate evolution. Unrooted phylogenetic networks form a special class of such networks, which naturally generalize unrooted phylogenetic trees. In this paper we define two operations on unrooted phylogenetic networks, one of which is a generalization of the well-known nearest-neighbor interchange (NNI) operation on phylogenetic trees. We show that any unrooted phylogenetic network can be transformed into any other such network using only these operations. This generalizes the well-known fact that any phylogenetic tree can be transformed into any other such tree using only NNI operations. It also allows us to define a generalization of tree space and to define some new metrics on unrooted phylogenetic networks. To prove our main results, we employ some fascinating new connections between phylogenetic networks and cubic graphs that we have recently discovered. Our results should be useful in developing new strategies to search for optimal phylogenetic networks, a topic that has recently generated some interest in the literature, as well as for providing new ways to compare networks. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Nonbinary Tree-Based Phylogenetic Networks.

    Science.gov (United States)

    Jetten, Laura; van Iersel, Leo

    2018-01-01

    Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can, for example, represent gene transfer events. Such phylogenetic networks are called tree-based. Here, we consider two possible generalizations of this concept to nonbinary networks, which we call tree-based and strictly-tree-based nonbinary phylogenetic networks. We give simple graph-theoretic characterizations of tree-based and strictly-tree-based nonbinary phylogenetic networks. Moreover, we show for each of these two classes that it can be decided in polynomial time whether a given network is contained in the class. Our approach also provides a new view on tree-based binary phylogenetic networks. Finally, we discuss two examples of nonbinary phylogenetic networks in biology and show how our results can be applied to them.

  2. Functional and phylogenetic ecology in R

    CERN Document Server

    Swenson, Nathan G

    2014-01-01

    Functional and Phylogenetic Ecology in R is designed to teach readers to use R for phylogenetic and functional trait analyses. Over the past decade, a dizzying array of tools and methods were generated to incorporate phylogenetic and functional information into traditional ecological analyses. Increasingly these tools are implemented in R, thus greatly expanding their impact. Researchers getting started in R can use this volume as a step-by-step entryway into phylogenetic and functional analyses for ecology in R. More advanced users will be able to use this volume as a quick reference to understand particular analyses. The volume begins with an introduction to the R environment and handling relevant data in R. Chapters then cover phylogenetic and functional metrics of biodiversity; null modeling and randomizations for phylogenetic and functional trait analyses; integrating phylogenetic and functional trait information; and interfacing the R environment with a popular C-based program. This book presents a uni...

  3. Phylogenetic relationships of Chilean leptodactylids: a molecular approach based on mitochondrial genes 12S and 16S Relaciones filogenéticas de los leptodactílidos chilenos: una aproximación molecular basada en los genes mitocondriales 12S y 16S

    Directory of Open Access Journals (Sweden)

    CLAUDIO CORREA

    2006-12-01

    Full Text Available Most Chilean amphibians belong to the subfamily Telmatobiinae (Anura, Leptodactylidae. Several phylogenetic studies of Leptodactylidae and Telmatobiinae, based principally on morphological characters, have implicitly suggested closer relationships of some species of the Telmatobiinae with members of other subfamilies of leptodactylids, including the leptodactyline genus Pleurodema which is present in Chile. Furthermore, a growing number of molecular studies suggest a non monophyletic status for Telmatobiinae, although none of these studies have investigated the phylogenetic relationships of this subfamily. We compared partial sequences of the ribosomal mitochondrial genes 12S and 16S to determine the phylogenetic relationships of Chilean leptodactylids and its position within the modern anurans (Neobatrachia. We included 22 species from nine of the 10 genera of telmatobiines present in Chile (Alsodes, Atelognathus, Batrachyla, Caudiverbera, Eupsophus, Hylorina, Insuetophrynus, Telmatobufo and Telmatobius, two species of the genus Pleurodema, and one species of Rhinodermatidae, which is considered a leptodactylid derivative family by some authors. We also included 51 species representing most of the families that compose Neobatrachia. Phylogenetic reconstructions were performed using the methods of maximum parsimony, maximum likelihood and Bayesian inference. The topologies obtained in all the analyses indicate that Telmatobiinae is a polyphyletic assemblage, composed by species belonging to Hyloidea (most of the genera and species more related to Australasian taxa (the clade Caudiverbera + Telmatobufo, defined as the tribe Calyptocephalellini. These molecular data support groups based on other kinds of evidence (Caudiverbera + Telmatobufo, Alsodes + Eupsophus and Batrachyla + Hylorina and raise new phylogenetic hypotheses for several genera of telmatobiines (Atelognathus with Batrachyla and Hylorina, Insuetophrynus + Rhinoderma. The phylogenetic

  4. Phylogenetic trees and Euclidean embeddings.

    Science.gov (United States)

    Layer, Mark; Rhodes, John A

    2017-01-01

    It was recently observed by de Vienne et al. (Syst Biol 60(6):826-832, 2011) that a simple square root transformation of distances between taxa on a phylogenetic tree allowed for an embedding of the taxa into Euclidean space. While the justification for this was based on a diffusion model of continuous character evolution along the tree, here we give a direct and elementary explanation for it that provides substantial additional insight. We use this embedding to reinterpret the differences between the NJ and BIONJ tree building algorithms, providing one illustration of how this embedding reflects tree structures in data.

  5. Pareto-optimal phylogenetic tree reconciliation.

    Science.gov (United States)

    Libeskind-Hadas, Ran; Wu, Yi-Chieh; Bansal, Mukul S; Kellis, Manolis

    2014-06-15

    Phylogenetic tree reconciliation is a widely used method for reconstructing the evolutionary histories of gene families and species, hosts and parasites and other dependent pairs of entities. Reconciliation is typically performed using maximum parsimony, in which each evolutionary event type is assigned a cost and the objective is to find a reconciliation of minimum total cost. It is generally understood that reconciliations are sensitive to event costs, but little is understood about the relationship between event costs and solutions. Moreover, choosing appropriate event costs is a notoriously difficult problem. We address this problem by giving an efficient algorithm for computing Pareto-optimal sets of reconciliations, thus providing the first systematic method for understanding the relationship between event costs and reconciliations. This, in turn, results in new techniques for computing event support values and, for cophylogenetic analyses, performing robust statistical tests. We provide new software tools and demonstrate their use on a number of datasets from evolutionary genomic and cophylogenetic studies. Our Python tools are freely available at www.cs.hmc.edu/∼hadas/xscape. . © The Author 2014. Published by Oxford University Press.

  6. Phylogenetic Conservatism in Plant Phenology

    Science.gov (United States)

    Davies, T. Jonathan; Wolkovich, Elizabeth M.; Kraft, Nathan J. B.; Salamin, Nicolas; Allen, Jenica M.; Ault, Toby R.; Betancourt, Julio L.; Bolmgren, Kjell; Cleland, Elsa E.; Cook, Benjamin I.; hide

    2013-01-01

    Phenological events defined points in the life cycle of a plant or animal have been regarded as highly plastic traits, reflecting flexible responses to various environmental cues. The ability of a species to track, via shifts in phenological events, the abiotic environment through time might dictate its vulnerability to future climate change. Understanding the predictors and drivers of phenological change is therefore critical. Here, we evaluated evidence for phylogenetic conservatism the tendency for closely related species to share similar ecological and biological attributes in phenological traits across flowering plants. We aggregated published and unpublished data on timing of first flower and first leaf, encompassing 4000 species at 23 sites across the Northern Hemisphere. We reconstructed the phylogeny for the set of included species, first, using the software program Phylomatic, and second, from DNA data. We then quantified phylogenetic conservatism in plant phenology within and across sites. We show that more closely related species tend to flower and leaf at similar times. By contrasting mean flowering times within and across sites, however, we illustrate that it is not the time of year that is conserved, but rather the phenological responses to a common set of abiotic cues. Our findings suggest that species cannot be treated as statistically independent when modelling phenological responses.Closely related species tend to resemble each other in the timing of their life-history events, a likely product of evolutionarily conserved responses to environmental cues. The search for the underlying drivers of phenology must therefore account for species' shared evolutionary histories.

  7. Phylogenetic Origins of Brain Organisers

    Directory of Open Access Journals (Sweden)

    Ellen Robertshaw

    2012-01-01

    Full Text Available The regionalisation of the nervous system begins early in embryogenesis, concomitant with the establishment of the anteroposterior (AP and dorsoventral (DV body axes. The molecular mechanisms that drive axis induction appear to be conserved throughout the animal kingdom and may be phylogenetically older than the emergence of bilateral symmetry. As a result of this process, groups of patterning genes that are equally well conserved are expressed at specific AP and DV coordinates of the embryo. In the emerging nervous system of vertebrate embryos, this initial pattern is refined by local signalling centres, secondary organisers, that regulate patterning, proliferation, and axonal pathfinding in adjacent neuroepithelium. The main secondary organisers for the AP neuraxis are the midbrain-hindbrain boundary, zona limitans intrathalamica, and anterior neural ridge and for the DV neuraxis the notochord, floor plate, and roof plate. A search for homologous secondary organisers in nonvertebrate lineages has led to controversy over their phylogenetic origins. Based on a recent study in hemichordates, it has been suggested that the AP secondary organisers evolved at the base of the deuterostome superphylum, earlier than previously thought. According to this view, the lack of signalling centres in some deuterostome lineages is likely to reflect a secondary loss due to adaptive processes. We propose that the relative evolutionary flexibility of secondary organisers has contributed to a broader morphological complexity of nervous systems in different clades.

  8. Taxonomic colouring of phylogenetic trees of protein sequences

    Directory of Open Access Journals (Sweden)

    Andrade-Navarro Miguel A

    2006-02-01

    Full Text Available Abstract Background Phylogenetic analyses of protein families are used to define the evolutionary relationships between homologous proteins. The interpretation of protein-sequence phylogenetic trees requires the examination of the taxonomic properties of the species associated to those sequences. However, there is no online tool to facilitate this interpretation, for example, by automatically attaching taxonomic information to the nodes of a tree, or by interactively colouring the branches of a tree according to any combination of taxonomic divisions. This is especially problematic if the tree contains on the order of hundreds of sequences, which, given the accelerated increase in the size of the protein sequence databases, is a situation that is becoming common. Results We have developed PhyloView, a web based tool for colouring phylogenetic trees upon arbitrary taxonomic properties of the species represented in a protein sequence phylogenetic tree. Provided that the tree contains SwissProt, SpTrembl, or GenBank protein identifiers, the tool retrieves the taxonomic information from the corresponding database. A colour picker displays a summary of the findings and allows the user to associate colours to the leaves of the tree according to any number of taxonomic partitions. Then, the colours are propagated to the branches of the tree. Conclusion PhyloView can be used at http://www.ogic.ca/projects/phyloview/. A tutorial, the software with documentation, and GPL licensed source code, can be accessed at the same web address.

  9. Inferring 'weak spots' in phylogenetic trees: application to mosasauroid nomenclature.

    Science.gov (United States)

    Madzia, Daniel; Cau, Andrea

    2017-01-01

    Mosasauroid squamates represented the apex predators within the Late Cretaceous marine and occasionally also freshwater ecosystems. Proper understanding of the origin of their ecological adaptations or paleobiogeographic dispersals requires adequate knowledge of their phylogeny. The studies assessing the position of mosasauroids on the squamate evolutionary tree and their origins have long given conflicting results. The phylogenetic relationships within Mosasauroidea, however, have experienced only little changes throughout the last decades. Considering the substantial improvements in the development of phylogenetic methodology that have undergone in recent years, resulting, among others, in numerous alterations in the phylogenetic hypotheses of other fossil amniotes, we test the robustness in our understanding of mosasauroid beginnings and their evolutionary history. We re-examined a data set that results from modifications assembled in the course of the last 20 years and performed multiple parsimony analyses and Bayesian tip-dating analysis. Following the inferred topologies and the 'weak spots' in the phylogeny of mosasauroids, we revise the nomenclature of the 'traditionally' recognized mosasauroid clades, to acknowledge the overall weakness among branches and the alternative topologies suggested previously, and discuss several factors that might have an impact on the differing phylogenetic hypotheses and their statistical support.

  10. Phylogenetic constrains on mycorrhizal specificity in eight Dendrobium (Orchidaceae) species.

    Science.gov (United States)

    Xing, Xiaoke; Ma, Xueting; Men, Jinxin; Chen, Yanhong; Guo, Shunxing

    2017-05-01

    Plant phylogeny constrains orchid mycorrhizal (OrM) fungal community composition in some orchids. Here, we investigated the structures of the OrM fungal communities of eight Dendrobium species in one niche to determine whether similarities in the OrM fungal communities correlated with the phylogeny of the host plants and whether the Dendrobium-OrM fungal interactions are phylogenetically conserved. A phylogeny based on DNA data was constructed for the eight coexisting Dendrobium species, and the OrM fungal communities were characterized by their roots. There were 31 different fungal lineages associated with the eight Dendrobium species. In total, 82.98% of the identified associations belonging to Tulasnellaceae, and a smaller proportion involved members of the unknown Basidiomycota (9.67%). Community analyses revealed that phylogenetically related Dendrobium tended to interact with a similar set of Tulasnellaceae fungi. The interactions between Dendrobium and Tulasnellaceae fungi were significantly influenced by the phylogenetic relationships among the Dendrobium species. Our results provide evidence that the mycorrhizal specificity in the eight coexisting Dendrobium species was phylogenetically conserved.

  11. Phylogenetic Analysis Using Protein Mass Spectrometry.

    Science.gov (United States)

    Ma, Shiyong; Downard, Kevin M; Wong, Jason W H

    2017-01-01

    Through advances in molecular biology, comparative analysis of DNA sequences is currently the cornerstone in the study of molecular evolution and phylogenetics. Nevertheless, protein mass spectrometry offers some unique opportunities to enable phylogenetic analyses in organisms where DNA may be difficult or costly to obtain. To date, the methods of phylogenetic analysis using protein mass spectrometry can be classified into three categories: (1) de novo protein sequencing followed by classical phylogenetic reconstruction, (2) direct phylogenetic reconstruction using proteolytic peptide mass maps, and (3) mapping of mass spectral data onto classical phylogenetic trees. In this chapter, we provide a brief description of the three methods and the protocol for each method along with relevant tools and algorithms.

  12. On the quirks of maximum parsimony and likelihood on phylogenetic networks.

    Science.gov (United States)

    Bryant, Christopher; Fischer, Mareike; Linz, Simone; Semple, Charles

    2017-03-21

    Maximum parsimony is one of the most frequently-discussed tree reconstruction methods in phylogenetic estimation. However, in recent years it has become more and more apparent that phylogenetic trees are often not sufficient to describe evolution accurately. For instance, processes like hybridization or lateral gene transfer that are commonplace in many groups of organisms and result in mosaic patterns of relationships cannot be represented by a single phylogenetic tree. This is why phylogenetic networks, which can display such events, are becoming of more and more interest in phylogenetic research. It is therefore necessary to extend concepts like maximum parsimony from phylogenetic trees to networks. Several suggestions for possible extensions can be found in recent literature, for instance the softwired and the hardwired parsimony concepts. In this paper, we analyze the so-called big parsimony problem under these two concepts, i.e. we investigate maximum parsimonious networks and analyze their properties. In particular, we show that finding a softwired maximum parsimony network is possible in polynomial time. We also show that the set of maximum parsimony networks for the hardwired definition always contains at least one phylogenetic tree. Lastly, we investigate some parallels of parsimony to different likelihood concepts on phylogenetic networks. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Nonbinary tree-based phylogenetic networks

    OpenAIRE

    Jetten, Laura; van Iersel, Leo

    2016-01-01

    Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can for example represent gene transfer events. Such phylogenetic networks are called tree-based. Here, we consider two possible generalizations of this concept to nonbinary networks, which we call tree-based and st...

  14. Phylogenetic affinity of tree shrews to Glires is attributed to fast evolution rate.

    Science.gov (United States)

    Lin, Jiannan; Chen, Guangfeng; Gu, Liang; Shen, Yuefeng; Zheng, Meizhu; Zheng, Weisheng; Hu, Xinjie; Zhang, Xiaobai; Qiu, Yu; Liu, Xiaoqing; Jiang, Cizhong

    2014-02-01

    Previous phylogenetic analyses have led to incongruent evolutionary relationships between tree shrews and other suborders of Euarchontoglires. What caused the incongruence remains elusive. In this study, we identified 6845 orthologous genes between seventeen placental mammals. Tree shrews and Primates were monophyletic in the phylogenetic trees derived from the first or/and second codon positions whereas tree shrews and Glires formed a monophyly in the trees derived from the third or all codon positions. The same topology was obtained in the phylogeny inference using the slowly and fast evolving genes, respectively. This incongruence was likely attributed to the fast substitution rate in tree shrews and Glires. Notably, sequence GC content only was not informative to resolve the controversial phylogenetic relationships between tree shrews, Glires, and Primates. Finally, estimation in the confidence of the tree selection strongly supported the phylogenetic affiliation of tree shrews to Primates as a monophyly. Copyright © 2013 Elsevier Inc. All rights reserved.

  15. Improved Maximum Parsimony Models for Phylogenetic Networks.

    Science.gov (United States)

    Van Iersel, Leo; Jones, Mark; Scornavacca, Celine

    2018-05-01

    Phylogenetic networks are well suited to represent evolutionary histories comprising reticulate evolution. Several methods aiming at reconstructing explicit phylogenetic networks have been developed in the last two decades. In this article, we propose a new definition of maximum parsimony for phylogenetic networks that permits to model biological scenarios that cannot be modeled by the definitions currently present in the literature (namely, the "hardwired" and "softwired" parsimony). Building on this new definition, we provide several algorithmic results that lay the foundations for new parsimony-based methods for phylogenetic network reconstruction.

  16. Efficient parsimony-based methods for phylogenetic network reconstruction.

    Science.gov (United States)

    Jin, Guohua; Nakhleh, Luay; Snir, Sagi; Tuller, Tamir

    2007-01-15

    Phylogenies--the evolutionary histories of groups of organisms-play a major role in representing relationships among biological entities. Although many biol