WorldWideScience

Sample records for plastid response element

  1. Plastid Located WHIRLY1 Enhances the Responsiveness of Arabidopsis Seedlings Toward Abscisic Acid

    Science.gov (United States)

    Isemer, Rena; Krause, Kirsten; Grabe, Nils; Kitahata, Nobutaka; Asami, Tadao; Krupinska, Karin

    2012-01-01

    WHIRLY1 is a protein that can be translocated from the plastids to the nucleus, making it an ideal candidate for communicating information between these two compartments. Mutants of Arabidopsis thaliana lacking WHIRLY1 (why1) were shown to have a reduced sensitivity toward salicylic acid (SA) and abscisic acid (ABA) during germination. Germination assays in the presence of abamine, an inhibitor of ABA biosynthesis, revealed that the effect of SA on germination was in fact caused by a concomitant stimulation of ABA biosynthesis. In order to distinguish whether the plastid or the nuclear isoform of WHIRLY1 is adjusting the responsiveness toward ABA, sequences encoding either the complete WHIRLY1 protein or a truncated form lacking the plastid transit peptide were overexpressed in the why1 mutant background. In plants overexpressing the full-length sequence, WHIRLY1 accumulated in both plastids and the nucleus, whereas in plants overexpressing the truncated sequence, WHIRLY1 accumulated exclusively in the nucleus. Seedlings containing recombinant WHIRLY1 in both compartments were hypersensitive toward ABA. In contrast, seedlings possessing only the nuclear form of WHIRLY1 were as insensitive toward ABA as the why1 mutants. ABA was furthermore shown to lower the rate of germination of wildtype seeds even in the presence of abamine which is known to inhibit the formation of xanthoxin, the plastid located precursor of ABA. From this we conclude that plastid located WHIRLY1 enhances the responsiveness of seeds toward ABA even when ABA is supplied exogenously. PMID:23269926

  2. Arabidopsis plastid AMOS1/EGY1 integrates abscisic acid signaling to regulate global gene expression response to ammonium stress

    KAUST Repository

    Li, Baohai

    2012-10-12

    Ammonium (NH4 +) is a ubiquitous intermediate of nitrogen metabolism but is notorious for its toxic effects on most organisms. Extensive studies of the underlying mechanisms of NH4 + toxicity have been reported in plants, but it is poorly understood how plants acclimate to high levels of NH4 +. Here, we identified an Arabidopsis (Arabidopsis thaliana) mutant, ammonium overly sensitive1 (amos1), that displays severe chlorosis under NH4 + stress. Map-based cloning shows amos1 to carry a mutation in EGY1 (for ethylene-dependent, gravitropism-deficient, and yellow-green-like protein1), which encodes a plastid metalloprotease. Transcriptomic analysis reveals that among the genes activated in response to NH4 +, 90% are regulated dependent on AMOS1/ EGY1. Furthermore, 63% of AMOS1/EGY1-dependent NH4 +-activated genes contain an ACGTG motif in their promoter region, a core motif of abscisic acid (ABA)-responsive elements. Consistent with this, our physiological, pharmacological, transcriptomic, and genetic data show that ABA signaling is a critical, but not the sole, downstream component of the AMOS1/EGY1-dependent pathway that regulates the expression of NH4 +-responsive genes and maintains chloroplast functionality under NH4 + stress. Importantly, abi4 mutants defective in ABA-dependent and retrograde signaling, but not ABA-deficient mutants, mimic leaf NH4 + hypersensitivity of amos1. In summary, our findings suggest that an NH4 +-responsive plastid retrograde pathway, which depends on AMOS1/EGY1 function and integrates with ABA signaling, is required for the regulation of expression of the presence of high NH4 + levels. © 2012 American Society of Plant Biologists. All Rights Reserved.

  3. Arabidopsis plastid AMOS1/EGY1 integrates abscisic acid signaling to regulate global gene expression response to ammonium stress

    KAUST Repository

    Li, Baohai; Li, Qing; Xiong, Liming; Kronzucker, Herbert J.; Krä mer, Ute; Shi, Weiming

    2012-01-01

    Ammonium (NH4 +) is a ubiquitous intermediate of nitrogen metabolism but is notorious for its toxic effects on most organisms. Extensive studies of the underlying mechanisms of NH4 + toxicity have been reported in plants, but it is poorly understood how plants acclimate to high levels of NH4 +. Here, we identified an Arabidopsis (Arabidopsis thaliana) mutant, ammonium overly sensitive1 (amos1), that displays severe chlorosis under NH4 + stress. Map-based cloning shows amos1 to carry a mutation in EGY1 (for ethylene-dependent, gravitropism-deficient, and yellow-green-like protein1), which encodes a plastid metalloprotease. Transcriptomic analysis reveals that among the genes activated in response to NH4 +, 90% are regulated dependent on AMOS1/ EGY1. Furthermore, 63% of AMOS1/EGY1-dependent NH4 +-activated genes contain an ACGTG motif in their promoter region, a core motif of abscisic acid (ABA)-responsive elements. Consistent with this, our physiological, pharmacological, transcriptomic, and genetic data show that ABA signaling is a critical, but not the sole, downstream component of the AMOS1/EGY1-dependent pathway that regulates the expression of NH4 +-responsive genes and maintains chloroplast functionality under NH4 + stress. Importantly, abi4 mutants defective in ABA-dependent and retrograde signaling, but not ABA-deficient mutants, mimic leaf NH4 + hypersensitivity of amos1. In summary, our findings suggest that an NH4 +-responsive plastid retrograde pathway, which depends on AMOS1/EGY1 function and integrates with ABA signaling, is required for the regulation of expression of the presence of high NH4 + levels. © 2012 American Society of Plant Biologists. All Rights Reserved.

  4. Does the mode of plastid inheritance influence plastid genome architecture?

    Directory of Open Access Journals (Sweden)

    Kate Crosby

    Full Text Available Plastid genomes show an impressive array of sizes and compactnesses, but the forces responsible for this variation are unknown. It has been argued that species with small effective genetic population sizes are less efficient at purging excess DNA from their genomes than those with large effective population sizes. If true, one may expect the primary mode of plastid inheritance to influence plastid DNA (ptDNA architecture. All else being equal, biparentally inherited ptDNAs should have a two-fold greater effective population size than those that are uniparentally inherited, and thus should also be more compact. Here, we explore the relationship between plastid inheritance pattern and ptDNA architecture, and consider the role of phylogeny in shaping our observations. Contrary to our expectations, we found no significant difference in plastid genome size or compactness between ptDNAs that are biparentally inherited relative to those that are uniparentally inherited. However, we also found that there was significant phylogenetic signal for the trait of mode of plastid inheritance. We also found that paternally inherited ptDNAs are significantly smaller (n = 19, p = 0.000001 than those that are maternally, uniparentally (when isogamous, or biparentally inherited. Potential explanations for this observation are discussed.

  5. Plastids and Carotenoid Accumulation.

    Science.gov (United States)

    Li, Li; Yuan, Hui; Zeng, Yunliu; Xu, Qiang

    Plastids are ubiquitously present in plants and are the organelles for carotenoid biosynthesis and storage. Based on their morphology and function, plastids are classified into various types, i.e. proplastids, etioplasts, chloroplasts, amyloplasts, and chromoplasts. All plastids, except proplastids, can synthesize carotenoids. However, plastid types have a profound effect on carotenoid accumulation and stability. In this chapter, we discuss carotenoid biosynthesis and regulation in various plastids with a focus on carotenoids in chromoplasts. Plastid transition related to carotenoid biosynthesis and the different capacity of various plastids to sequester carotenoids and the associated effect on carotenoid stability are described in light of carotenoid accumulation in plants.

  6. Efficient Plastid Transformation in Arabidopsis.

    Science.gov (United States)

    Yu, Qiguo; Lutz, Kerry Ann; Maliga, Pal

    2017-09-01

    Plastid transformation is routine in tobacco ( Nicotiana tabacum ) but 100-fold less frequent in Arabidopsis ( Arabidopsis thaliana ), preventing its use in plastid biology. A recent study revealed that null mutations in ACC2 , encoding a plastid-targeted acetyl-coenzyme A carboxylase, cause hypersensitivity to spectinomycin. We hypothesized that plastid transformation efficiency should increase in the acc2 background, because when ACC2 is absent, fatty acid biosynthesis becomes dependent on translation of the plastid-encoded ACC β-carboxylase subunit. We bombarded ACC2 -defective Arabidopsis leaves with a vector carrying a selectable spectinomycin resistance ( aadA ) gene and gfp , encoding the green fluorescence protein GFP. Spectinomycin-resistant clones were identified as green cell clusters on a spectinomycin medium. Plastid transformation was confirmed by GFP accumulation from the second open reading frame of a polycistronic messenger RNA, which would not be translated in the cytoplasm. We obtained one to two plastid transformation events per bombarded sample in spectinomycin-hypersensitive Slavice and Columbia acc2 knockout backgrounds, an approximately 100-fold enhanced plastid transformation frequency. Slavice and Columbia are accessions in which plant regeneration is uncharacterized or difficult to obtain. A practical system for Arabidopsis plastid transformation will be obtained by creating an ACC2 null background in a regenerable Arabidopsis accession. The recognition that the duplicated ACCase in Arabidopsis is an impediment to plastid transformation provides a rational template to implement plastid transformation in related recalcitrant crops. © 2017 American Society of Plant Biologists. All Rights Reserved.

  7. Plastid Proteomic Analysis in Tomato Fruit Development.

    Directory of Open Access Journals (Sweden)

    Miho Suzuki

    Full Text Available To better understand the mechanism of plastid differentiation from chloroplast to chromoplast, we examined proteome and plastid changes over four distinct developmental stages of 'Micro-Tom' fruit. Additionally, to discover more about the relationship between fruit color and plastid differentiation, we also analyzed and compared 'Micro-Tom' results with those from two other varieties, 'Black' and 'White Beauty'. We confirmed that proteins related to photosynthesis remain through the orange maturity stage of 'Micro-Tom', and also learned that thylakoids no longer exist at this stage. These results suggest that at a minimum there are changes in plastid morphology occurring before all related proteins change. We also compared 'Micro-Tom' fruits with 'Black' and 'White Beauty' using two-dimensional gel electrophoresis. We found a decrease of CHRC (plastid-lipid-associated protein and HrBP1 (harpin binding protein-1 in the 'Black' and 'White Beauty' varieties. CHRC is involved in carotenoid accumulation and stabilization. HrBP1 in Arabidopsis has a sequence similar to proteins in the PAP/fibrillin family. These proteins have characteristics and functions similar to lipocalin, an example of which is the transport of hydrophobic molecules. We detected spots of TIL (temperature-induced lipocalin in 2D-PAGE results, however the number of spots and their isoelectric points differed between 'Micro-Tom' and 'Black'/'White Beauty'. Lipocalin has various functions including those related to environmental stress response, apoptosis induction, membrane formation and fixation, regulation of immune response, cell growth, and metabolism adjustment. Lipocalin related proteins such as TIL and HrBP1 could be related to the accumulation of carotenoids, fruit color and the differentiation of chromoplast.

  8. Nuclear responses in INTOR plasma stabilization elements

    International Nuclear Information System (INIS)

    Gohar, Y.; Gilligan, J.; Jung, J.; Mattas, R.F.; Miley, G.H.; Wiffen, F.W.; Yang, S.

    1985-01-01

    Nuclear responses in the plasma stabilization elements were studied in a parametric fashion as a part of the transient electromagnetics critical issue C of ETR/INTOR activity. The main responses are neutron fluence and radiation dose in the insulator material, induced resistivity and atomic displacement in the conductor material, nuclear heating and life analysis for the elements. Copper and aluminum conductors with either MgAl 2 O 4 or MgO insulating material were investigated. Radiation damage and life analysis for these elements were also discussed

  9. The finite element response matrix method

    International Nuclear Information System (INIS)

    Nakata, H.; Martin, W.R.

    1983-02-01

    A new technique is developed with an alternative formulation of the response matrix method implemented with the finite element scheme. Two types of response matrices are generated from the Galerkin solution to the weak form of the diffusion equation subject to an arbitrary current and source. The piecewise polynomials are defined in two levels, the first for the local (assembly) calculations and the second for the global (core) response matrix calculations. This finite element response matrix technique was tested in two 2-dimensional test problems, 2D-IAEA benchmark problem and Biblis benchmark problem, with satisfatory results. The computational time, whereas the current code is not extensively optimized, is of the same order of the well estabilished coarse mesh codes. Furthermore, the application of the finite element technique in an alternative formulation of response matrix method permits the method to easily incorporate additional capabilities such as treatment of spatially dependent cross-sections, arbitrary geometrical configurations, and high heterogeneous assemblies. (Author) [pt

  10. Integrating Responsive Building Elements in Buildings

    DEFF Research Database (Denmark)

    Haase, Matthias; Amato, Alex; Heiselberg, Per

    2006-01-01

    energy strategies to develop guidelines and procedures for estimation of environmental performance of responsive building elements and integrated building concepts This paper introduces the ideas of this collaborative work and discusses its usefulness for Hong Kong and China. Special focus was put...

  11. The finite element response Matrix method

    International Nuclear Information System (INIS)

    Nakata, H.; Martin, W.R.

    1983-01-01

    A new method for global reactor core calculations is described. This method is based on a unique formulation of the response matrix method, implemented with a higher order finite element method. The unique aspects of this approach are twofold. First, there are two levels to the overall calculational scheme: the local or assembly level and the global or core level. Second, the response matrix scheme, which is formulated at both levels, consists of two separate response matrices rather than one response matrix as is generally the case. These separate response matrices are seen to be quite beneficial for the criticality eigenvalue calculation, because they are independent of k /SUB eff/. The response matrices are generated from a Galerkin finite element solution to the weak form of the diffusion equation, subject to an arbitrary incoming current and an arbitrary distributed source. Calculational results are reported for two test problems, the two-dimensional International Atomic Energy Agency benchmark problem and a two-dimensional pressurized water reactor test problem (Biblis reactor), and they compare well with standard coarse mesh methods with respect to accuracy and efficiency. Moreover, the accuracy (and capability) is comparable to fine mesh for a fraction of the computational cost. Extension of the method to treat heterogeneous assemblies and spatial depletion effects is discussed

  12. Quantitative proteomic analysis of intact plastids.

    Science.gov (United States)

    Shiraya, Takeshi; Kaneko, Kentaro; Mitsui, Toshiaki

    2014-01-01

    Plastids are specialized cell organelles in plant cells that are differentiated into various forms including chloroplasts, chromoplasts, and amyloplasts, and fulfill important functions in maintaining the overall cell metabolism and sensing environmental factors such as sunlight. It is therefore important to grasp the mechanisms of differentiation and functional changes of plastids in order to enhance the understanding of vegetality. In this chapter, details of a method for the extraction of intact plastids that makes analysis possible while maintaining the plastid functions are provided; in addition, a quantitative shotgun method for analyzing the composition and changes in the content of proteins in plastids as a result of environmental impacts is described.

  13. Contrasting responses of photosynthesis to salt stress in the glycophyte Arabidopsis and the halophyte thellungiella: role of the plastid terminal oxidase as an alternative electron sink.

    Science.gov (United States)

    Stepien, Piotr; Johnson, Giles N

    2009-02-01

    The effects of short-term salt stress on gas exchange and the regulation of photosynthetic electron transport were examined in Arabidopsis (Arabidopsis thaliana) and its salt-tolerant close relative Thellungiella (Thellungiella halophila). Plants cultivated on soil were challenged for 2 weeks with NaCl. Arabidopsis showed a much higher sensitivity to salt than Thellungiella; while Arabidopsis plants were unable to survive exposure to greater than 150 mM salt, Thellugiella could tolerate concentrations as high as 500 mM with only minimal effects on gas exchange. Exposure of Arabidopsis to sublethal salt concentrations resulted in stomatal closure and inhibition of CO2 fixation. This lead to an inhibition of electron transport though photosystem II (PSII), an increase in cyclic electron flow involving only PSI, and increased nonphotochemical quenching of chlorophyll fluorescence. In contrast, in Thellungiella, although gas exchange was marginally inhibited by high salt and PSI was unaffected, there was a large increase in electron flow involving PSII. This additional electron transport activity is oxygen dependent and sensitive to the alternative oxidase inhibitor n-propyl gallate. PSII electron transport in Thellungiella showed a reduced sensitivity to 2'-iodo-6-isopropyl-3-methyl-2',4,4'-trinitrodiphenylether, an inhibitor of the cytochrome b6f complex. At the same time, we observed a substantial up-regulation of a protein reacting with antibodies raised against the plastid terminal oxidase. No such up-regulation was seen in Arabidopsis. We conclude that in salt-stressed Thellungiella, plastid terminal oxidase acts as an alternative electron sink, accounting for up to 30% of total PSII electron flow.

  14. Mediated Plastid RNA Editing in Plant Immunity

    Science.gov (United States)

    García-Andrade, Javier; Ramírez, Vicente; López, Ana; Vera, Pablo

    2013-01-01

    Plant regulatory circuits coordinating nuclear and plastid gene expression have evolved in response to external stimuli. RNA editing is one of such control mechanisms. We determined the Arabidopsis nuclear-encoded homeodomain-containing protein OCP3 is incorporated into the chloroplast, and contributes to control over the extent of ndhB transcript editing. ndhB encodes the B subunit of the chloroplast NADH dehydrogenase-like complex (NDH) involved in cyclic electron flow (CEF) around photosystem I. In ocp3 mutant strains, ndhB editing efficiency decays, CEF is impaired and disease resistance to fungal pathogens substantially enhanced, a process recapitulated in plants defective in editing plastid RNAs encoding NDH complex subunits due to mutations in previously described nuclear-encoded pentatricopeptide-related proteins (i.e. CRR21, CRR2). Furthermore, we observed that following a pathogenic challenge, wild type plants respond with editing inhibition of ndhB transcript. In parallel, rapid destabilization of the plastidial NDH complex is also observed in the plant following perception of a pathogenic cue. Therefore, NDH complex activity and plant immunity appear as interlinked processes. PMID:24204264

  15. Integrating Environmentally Responsive Elements in Buildings

    DEFF Research Database (Denmark)

    Heiselberg, Per

    2006-01-01

    Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie with techno......Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie...

  16. Plastid-Nuclear Interaction and Accelerated Coevolution in Plastid Ribosomal Genes in Geraniaceae.

    Science.gov (United States)

    Weng, Mao-Lun; Ruhlman, Tracey A; Jansen, Robert K

    2016-06-27

    Plastids and mitochondria have many protein complexes that include subunits encoded by organelle and nuclear genomes. In animal cells, compensatory evolution between mitochondrial and nuclear-encoded subunits was identified and the high mitochondrial mutation rates were hypothesized to drive compensatory evolution in nuclear genomes. In plant cells, compensatory evolution between plastid and nucleus has rarely been investigated in a phylogenetic framework. To investigate plastid-nuclear coevolution, we focused on plastid ribosomal protein genes that are encoded by plastid and nuclear genomes from 27 Geraniales species. Substitution rates were compared for five sets of genes representing plastid- and nuclear-encoded ribosomal subunit proteins targeted to the cytosol or the plastid as well as nonribosomal protein controls. We found that nonsynonymous substitution rates (dN) and the ratios of nonsynonymous to synonymous substitution rates (ω) were accelerated in both plastid- (CpRP) and nuclear-encoded subunits (NuCpRP) of the plastid ribosome relative to control sequences. Our analyses revealed strong signals of cytonuclear coevolution between plastid- and nuclear-encoded subunits, in which nonsynonymous substitutions in CpRP and NuCpRP tend to occur along the same branches in the Geraniaceae phylogeny. This coevolution pattern cannot be explained by physical interaction between amino acid residues. The forces driving accelerated coevolution varied with cellular compartment of the sequence. Increased ω in CpRP was mainly due to intensified positive selection whereas increased ω in NuCpRP was caused by relaxed purifying selection. In addition, the many indels identified in plastid rRNA genes in Geraniaceae may have contributed to changes in plastid subunits. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  17. Plastid and Stromule Morphogenesis in Tomato

    Science.gov (United States)

    PYKE, KEVIN A.; HOWELLS, CAROLINE A.

    2002-01-01

    By using green fluorescent protein targeted to the plastid organelle in tomato (Lycopersicon esculentum Mill.), the morphology of plastids and their associated stromules in epidermal cells and trichomes from stems and petioles and in the chromoplasts of pericarp cells in the tomato fruit has been revealed. A novel characteristic of tomato stromules is the presence of extensive bead‐like structures along the stromules that are often observed as free vesicles, distinct from and apparently unconnected to the plastid body. Interconnections between the red pigmented chromoplast bodies are common in fruit pericarp cells suggesting that chromoplasts could form a complex network in this cell type. The potential implications for carotenoid biosynthesis in tomato fruit and for vesicles originating from beaded stromules as a secretory mechanism for plastids in glandular trichomes of tomato is discussed. PMID:12466096

  18. Phytochrome-dependent coordinate control of distinct aspects of nuclear and plastid gene expression during anterograde signalling and photomorphogenesis

    Directory of Open Access Journals (Sweden)

    Sookyung eOh

    2014-04-01

    Full Text Available Light perception by photoreceptors impacts plastid transcription, development, and differentiation. This photoreceptor-dependent activity suggests a mechanism for photoregulation of gene expression in the nucleus and plastid that serves to coordinate expression of critical genes of these two organelles. This coordinate expression is required for proper stoichiometric accumulation of components needed for assembly of plastids, photosynthetic light-harvesting complexes and components such as phytochromes. Chloroplast-targeted sigma factors, which function together with the plastid-encoded RNA polymerase to regulate expression of plastid-encoded genes, and nuclear-encoded plastid development factors, such as GLK1 and GLK2, are targets of phytochrome regulation. Such phytochrome-dependent functions are hypothesized to allow light-dependent regulation, and feasibly tuning, of plastid components and function in response to changes in the external environment, which directly affects photosynthesis and the potential for light-induced damage. When the size and protein composition of the light-harvesting complexes are not tuned to the external environment, imbalances in electron transport can impact the cellular redox state and cause cellular damage. We show that phytochromes specifically regulate the expression of multiple factors that function to modulate plastid transcription and, thus, provide a paradigm for coordinate expression of the nuclear and plastid genomes in response to changes in external light conditions. As phytochromes respond to changes in the prevalent wavelengths of light and light intensity, we propose that specific phytochrome-dependent molecular mechanisms are used during light-dependent signaling between the nucleus and chloroplast during photomorphogenesis to coordinate chloroplast development with plant developmental stage and the external environment.

  19. Efficient and stable transformation of Lactuca sativa L. cv. Cisco (lettuce) plastids.

    Science.gov (United States)

    Kanamoto, Hirosuke; Yamashita, Atsushi; Asao, Hiroshi; Okumura, Satoru; Takase, Hisabumi; Hattori, Masahira; Yokota, Akiho; Tomizawa, Ken-Ichi

    2006-04-01

    Transgenic plastids offer unique advantages in plant biotechnology, including high-level foreign protein expression. However, broad application of plastid genome engineering in biotechnology has been largely hampered by the lack of plastid transformation systems for major crops. Here we describe the development of a plastid transformation system for lettuce, Lactuca sativa L. cv. Cisco. The transforming DNA carries a spectinomycin-resistance gene (aadA) under the control of lettuce chloroplast regulatory expression elements, flanked by two adjacent lettuce plastid genome sequences allowing its targeted insertion between the rbcL and accD genes. On average, we obtained 1 transplastomic lettuce plant per bombardment. We show that lettuce leaf chloroplasts can express transgene-encoded GFP to approximately 36% of the total soluble protein. All transplastomic T0 plants were fertile and the T1 progeny uniformly showed stability of the transgene in the chloroplast genome. This system will open up new possibilities for the efficient production of edible vaccines, pharmaceuticals, and antibodies in plants.

  20. Parallel loss of plastid introns and their maturase in the genus Cuscuta.

    Science.gov (United States)

    McNeal, Joel R; Kuehl, Jennifer V; Boore, Jeffrey L; Leebens-Mack, Jim; dePamphilis, Claude W

    2009-06-19

    Plastid genome content and arrangement are highly conserved across most land plants and their closest relatives, streptophyte algae, with nearly all plastid introns having invaded the genome in their common ancestor at least 450 million years ago. One such intron, within the transfer RNA trnK-UUU, contains a large open reading frame that encodes a presumed intron maturase, matK. This gene is missing from the plastid genomes of two species in the parasitic plant genus Cuscuta but is found in all other published land plant and streptophyte algal plastid genomes, including that of the nonphotosynthetic angiosperm Epifagus virginiana and two other species of Cuscuta. By examining matK and plastid intron distribution in Cuscuta, we add support to the hypothesis that its normal role is in splicing seven of the eight group IIA introns in the genome. We also analyze matK nucleotide sequences from Cuscuta species and relatives that retain matK to test whether changes in selective pressure in the maturase are associated with intron deletion. Stepwise loss of most group IIA introns from the plastid genome results in substantial change in selective pressure within the hypothetical RNA-binding domain of matK in both Cuscuta and Epifagus, either through evolution from a generalist to a specialist intron splicer or due to loss of a particular intron responsible for most of the constraint on the binding region. The possibility of intron-specific specialization in the X-domain is implicated by evidence of positive selection on the lineage leading to C. nitida in association with the loss of six of seven introns putatively spliced by matK. Moreover, transfer RNA gene deletion facilitated by parasitism combined with an unusually high rate of intron loss from remaining functional plastid genes created a unique circumstance on the lineage leading to Cuscuta subgenus Grammica that allowed elimination of matK in the most species-rich lineage of Cuscuta.

  1. Parallel loss of plastid introns and their maturase in the genus Cuscuta.

    Directory of Open Access Journals (Sweden)

    Joel R McNeal

    2009-06-01

    Full Text Available Plastid genome content and arrangement are highly conserved across most land plants and their closest relatives, streptophyte algae, with nearly all plastid introns having invaded the genome in their common ancestor at least 450 million years ago. One such intron, within the transfer RNA trnK-UUU, contains a large open reading frame that encodes a presumed intron maturase, matK. This gene is missing from the plastid genomes of two species in the parasitic plant genus Cuscuta but is found in all other published land plant and streptophyte algal plastid genomes, including that of the nonphotosynthetic angiosperm Epifagus virginiana and two other species of Cuscuta. By examining matK and plastid intron distribution in Cuscuta, we add support to the hypothesis that its normal role is in splicing seven of the eight group IIA introns in the genome. We also analyze matK nucleotide sequences from Cuscuta species and relatives that retain matK to test whether changes in selective pressure in the maturase are associated with intron deletion. Stepwise loss of most group IIA introns from the plastid genome results in substantial change in selective pressure within the hypothetical RNA-binding domain of matK in both Cuscuta and Epifagus, either through evolution from a generalist to a specialist intron splicer or due to loss of a particular intron responsible for most of the constraint on the binding region. The possibility of intron-specific specialization in the X-domain is implicated by evidence of positive selection on the lineage leading to C. nitida in association with the loss of six of seven introns putatively spliced by matK. Moreover, transfer RNA gene deletion facilitated by parasitism combined with an unusually high rate of intron loss from remaining functional plastid genes created a unique circumstance on the lineage leading to Cuscuta subgenus Grammica that allowed elimination of matK in the most species-rich lineage of Cuscuta.

  2. Regulatory Shifts in Plastid Transcription Play a Key Role in Morphological Conversions of Plastids during Plant Development.

    Science.gov (United States)

    Liebers, Monique; Grübler, Björn; Chevalier, Fabien; Lerbs-Mache, Silva; Merendino, Livia; Blanvillain, Robert; Pfannschmidt, Thomas

    2017-01-01

    Plastids display a high morphological and functional diversity. Starting from an undifferentiated small proplastid, these plant cell organelles can develop into four major forms: etioplasts in the dark, chloroplasts in green tissues, chromoplasts in colored flowers and fruits and amyloplasts in roots. The various forms are interconvertible into each other depending on tissue context and respective environmental condition. Research of the last two decades uncovered that each plastid type contains its own specific proteome that can be highly different from that of the other types. Composition of these proteomes largely defines the enzymatic functionality of the respective plastid. The vast majority of plastid proteins is encoded in the nucleus and must be imported from the cytosol. However, a subset of proteins of the photosynthetic and gene expression machineries are encoded on the plastid genome and are transcribed by a complex transcriptional apparatus consisting of phage-type nuclear-encoded RNA polymerases and a bacterial-type plastid-encoded RNA polymerase. Both types recognize specific sets of promoters and transcribe partly over-lapping as well as specific sets of genes. Here we summarize the current knowledge about the sequential activity of these plastid RNA polymerases and their relative activities in different types of plastids. Based on published plastid gene expression profiles we hypothesize that each conversion from one plastid type into another is either accompanied or even preceded by significant changes in plastid transcription suggesting that these changes represent important determinants of plastid morphology and protein composition and, hence, the plastid type.

  3. Plastids: the Green Frontiers for Vaccine Production

    Directory of Open Access Journals (Sweden)

    Mohammad Tahir eWaheed

    2015-11-01

    Full Text Available Infectious diseases pose an increasing risk to health, especially in developing countries. Vaccines are available to either cure or prevent many of these diseases. However, there are certain limitations related to these vaccines, mainly the costs, which make these vaccines mostly unaffordable for people in resource poor countries. These costs are mainly related to production and purification of the products manufactured from fermenter-based systems. Plastid biotechnology has become an attractive platform to produce biopharmaceuticals in large amounts and cost-effectively. This is mainly due to high copy number of plastids DNA in mature chloroplasts, a characteristic particularly important for vaccine production in large amounts. An additional advantage lies in the maternal inheritance of plastids in most plant species, which addresses the regulatory concerns related to transgenic plants. These and many other aspects of plastids will be discussed in the present review, especially those that particularly make these green biofactories an attractive platform for vaccine production. A summary of recent vaccine antigens against different human diseases expressed in plastids will also be presented.

  4. Stable plastid transformation in Scoparia dulcis L.

    Science.gov (United States)

    Muralikrishna, Narra; Srinivas, Kota; Kumar, Kalva Bharath; Sadanandam, Abbagani

    2016-10-01

    In the present investigation we report stable plastid transformation in Scoparia dulcis L., a versatile medicinal herb via particle gun method. The vector KNTc, harbouring aadA as a selectable marker and egfp as a reporter gene which were under the control of synthetic promoter pNG1014a, targets inverted repeats, trnR / t rnN of the plastid genome. By use of this heterologous vector, recovery of transplastomic lines with suitable selection protocol have been successfully established with overall efficiency of two transgenic lines for 25 bombarded leaf explants. PCR and Southern blot analysis demonstrated stable integration of foreign gene into the target sequences. The results represent a significant advancement of the plastid transformation technology in medicinal plants, which relevantly implements a change over in enhancing and regulating of certain metabolic pathways.

  5. The plastid genomes of flowering plants.

    Science.gov (United States)

    Ruhlman, Tracey A; Jansen, Robert K

    2014-01-01

    The plastid genome (plastome) has proved a valuable source of data for evaluating evolutionary relationships among angiosperms. Through basic and applied approaches, plastid transformation technology offers the potential to understand and improve plant productivity, providing food, fiber, energy and medicines to meet the needs of a burgeoning global population. The growing genomic resources available to both phylogenetic and biotechnological investigations are allowing novel insights and expanding the scope of plastome research to encompass new species. In this chapter we present an overview of some of the seminal and contemporary research that has contributed to our current understanding of plastome evolution and attempt to highlight the relationship between evolutionary mechanisms and tools of plastid genetic engineering.

  6. Characteristic and analysis of structural elements of corporate social responsibility

    Directory of Open Access Journals (Sweden)

    J. S. Bilonog

    2015-04-01

    Full Text Available In this article attention is focused on social responsibility of business and on necessity to estimate its condition in Ukraine. Materials regarding elements and the principles of corporate social responsibility are structured. On this basis unification of quantitative elements of business social responsibility is offered according to which it is possible to carry out the analysis of the non­financial reporting. It is proposed to use not only quantitative techniques of data analysis but also refer to the qualitative ones. As a result of this, the analysis of social reports will be more productive and would minimize subjectivity of the researcher or representatives of the company which are responsible for presenting the information to the general public. The basic principles by which the companies can realize the strategy of corporate social responsibility are considered. Due to the empirical analysis of corporate reports expediency to use specified elements is proved. Reports of the companies in producing and non­productive sector are analyzed in more detail; features of displaying information on corporate social responsibility are defined. The attention to need of carrying out monitoring researches in the sphere of the corporate social reporting is updated.

  7. Elements of a national emergency response system for nuclear accidents

    International Nuclear Information System (INIS)

    Dickerson, M.H.

    1987-01-01

    The purpose of this paper is to suggest elements for a general emergency response system, employed at a national level, to detect, evaluate and assess the consequences of a radiological atmospheric release occurring within or outside of national boundaries. These elements are focused on the total aspect of emergency response ranging from providing an initial alarm to a total assessment of the environmental and health effects. Elements of the emergency response system are described in such a way that existing resources can be directly applied if appropriate; if not, newly developed or an expansion of existing resources can be employed. The major thrust of this paper is toward a philosophical discussion and general description of resources that would be required to implementation. If the major features of this proposal system are judged desirable for implementation, then the next level of detail can be added. The philosophy underlying this paper is preparedness - preparedness through planning, awareness and the application of technology. More specifically, it is establishment of reasonable guidelines including the definition of reference and protective action levels for public exposure to accidents involving nuclear material; education of the public, government officials and the news media; and the application of models and measurements coupled to computer systems to address a series of questions related to emergency planning, response and assessment. It is the role of a proven national emergency response system to provide reliable, quality-controlled information to decision makers for the management of environmental crises

  8. The myth of interconnected plastids and related phenomena.

    Science.gov (United States)

    Schattat, Martin H; Barton, Kiah A; Mathur, Jaideep

    2015-01-01

    Studies spread over nearly two and a half centuries have identified the primary plastid in autotrophic algae and plants as a pleomorphic, multifunctional organelle comprising of a double-membrane envelope enclosing an organization of internal membranes submerged in a watery stroma. All plastid units have been observed extending and retracting thin stroma-filled tubules named stromules sporadically. Observations on living plant cells often convey the impression that stromules connect two or more independent plastids with each other. When photo-bleaching techniques were used to suggest that macromolecules such as the green fluorescent protein could flow between already interconnected plastids, for many people this impression changed to conviction. However, it was noticed only recently that the concept of protein flow between plastids rests solely on the words "interconnected plastids" for which details have never been provided. We have critically reviewed botanical literature dating back to the 1880s for understanding this term and the phenomena that have become associated with it. We find that while meticulously detailed ontogenic studies spanning nearly 150 years have established the plastid as a singular unit organelle, there is no experimental support for the idea that interconnected plastids exist under normal conditions of growth and development. In this review, while we consider several possibilities that might allow a single elongated plastid to be misinterpreted as two or more interconnected plastids, our final conclusion is that the concept of direct protein flow between plastids is based on an unfounded assumption.

  9. Plastome-Genome Interactions Affect Plastid Transmission in Oenothera

    Science.gov (United States)

    Chiu, W. L.; Sears, B. B.

    1993-01-01

    Plastids of Oenothera, the evening primrose, can be transmitted to the progeny from both parents. In a constant nuclear background, the frequency of biparental plastid transmission is determined by the types of plastid genomes (plastomes) involved in the crosses. In this study, the impact of nuclear genomes on plastid inheritance was analyzed. In general, the transmission efficiency of each plastome correlated strongly with its compatibility with the nuclear genome of the progeny, suggesting that plastome-genome interactions can influence plastid transmission by affecting the efficiency of plastid multiplication after fertilization. Lower frequencies of plastid transmission from the paternal side were observed when the pollen had poor vigor due to an incompatible plastome-genome combination, indicating that plastome-genome interactions may also affect the input of plastids at fertilization. Parental traits that affect the process of fertilization can also have an impact on plastid transmission. Crosses using maternal parents with long styles or pollen with relatively low growth capacity resulted in reduced frequencies of paternal plastid transmission. These observations suggest that degeneration of pollen plastids may occur as the time interval between pollination and fertilization is lengthened. PMID:8462856

  10. Specificity determinants for the abscisic acid response element ?

    OpenAIRE

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interac...

  11. Why does biparental plastid inheritance revive in angiosperms?

    Science.gov (United States)

    Zhang, Quan; Sodmergen

    2010-03-01

    It is widely believed that plastid and mitochondrial genomes are inherited through the maternal parent. In plants, however, paternal transmission of these genomes is frequently observed, especially for the plastid genome. A male gametic trait, called potential biparental plastid inheritance (PBPI), occurs in up to 20% of angiosperm genera, implying a strong tendency for plastid transmission from the male lineage. Why do plants receive organelles from the male parents? Are there clues in plastids that will help to elucidate the evolution of plants? Reconstruction of the ancestral state of plastid inheritance patterns in a phylogenetic context provides insights into these questions. In particular, a recent report demonstrated the unilateral occurrence of PBPI in angiosperms. This result implies that nuclear cytoplasmic conflicts, a basic driving force for altering the mode of organelle inheritance, might have arisen specifically in angiosperms. Based on existing evidence, it is likely that biparental inheritance may have occurred to rescue angiosperm species with defective plastids.

  12. Hypothesis: Gene-rich plastid genomes in red algae may be an outcome of nuclear genome reduction.

    Science.gov (United States)

    Qiu, Huan; Lee, Jun Mo; Yoon, Hwan Su; Bhattacharya, Debashish

    2017-06-01

    Red algae (Rhodophyta) putatively diverged from the eukaryote tree of life >1.2 billion years ago and are the source of plastids in the ecologically important diatoms, haptophytes, and dinoflagellates. In general, red algae contain the largest plastid gene inventory among all such organelles derived from primary, secondary, or additional rounds of endosymbiosis. In contrast, their nuclear gene inventory is reduced when compared to their putative sister lineage, the Viridiplantae, and other photosynthetic lineages. The latter is thought to have resulted from a phase of genome reduction that occurred in the stem lineage of Rhodophyta. A recent comparative analysis of a taxonomically broad collection of red algal and Viridiplantae plastid genomes demonstrates that the red algal ancestor encoded ~1.5× more plastid genes than Viridiplantae. This difference is primarily explained by more extensive endosymbiotic gene transfer (EGT) in the stem lineage of Viridiplantae, when compared to red algae. We postulate that limited EGT in Rhodophytes resulted from the countervailing force of ancient, and likely recurrent, nuclear genome reduction. In other words, the propensity for nuclear gene loss led to the retention of red algal plastid genes that would otherwise have undergone intracellular gene transfer to the nucleus. This hypothesis recognizes the primacy of nuclear genome evolution over that of plastids, which have no inherent control of their gene inventory and can change dramatically (e.g., secondarily non-photosynthetic eukaryotes, dinoflagellates) in response to selection acting on the host lineage. © 2017 Phycological Society of America.

  13. RECG maintains plastid and mitochondrial genome stability by suppressing extensive recombination between short dispersed repeats.

    Directory of Open Access Journals (Sweden)

    Masaki Odahara

    2015-03-01

    Full Text Available Maintenance of plastid and mitochondrial genome stability is crucial for photosynthesis and respiration, respectively. Recently, we have reported that RECA1 maintains mitochondrial genome stability by suppressing gross rearrangements induced by aberrant recombination between short dispersed repeats in the moss Physcomitrella patens. In this study, we studied a newly identified P. patens homolog of bacterial RecG helicase, RECG, some of which is localized in both plastid and mitochondrial nucleoids. RECG partially complements recG deficiency in Escherichia coli cells. A knockout (KO mutation of RECG caused characteristic phenotypes including growth delay and developmental and mitochondrial defects, which are similar to those of the RECA1 KO mutant. The RECG KO cells showed heterogeneity in these phenotypes. Analyses of RECG KO plants showed that mitochondrial genome was destabilized due to a recombination between 8-79 bp repeats and the pattern of the recombination partly differed from that observed in the RECA1 KO mutants. The mitochondrial DNA (mtDNA instability was greater in severe phenotypic RECG KO cells than that in mild phenotypic ones. This result suggests that mitochondrial genomic instability is responsible for the defective phenotypes of RECG KO plants. Some of the induced recombination caused efficient genomic rearrangements in RECG KO mitochondria. Such loci were sometimes associated with a decrease in the levels of normal mtDNA and significant decrease in the number of transcripts derived from the loci. In addition, the RECG KO mutation caused remarkable plastid abnormalities and induced recombination between short repeats (12-63 bp in the plastid DNA. These results suggest that RECG plays a role in the maintenance of both plastid and mitochondrial genome stability by suppressing aberrant recombination between dispersed short repeats; this role is crucial for plastid and mitochondrial functions.

  14. ABFs, a family of ABA-responsive element binding factors.

    Science.gov (United States)

    Choi, H; Hong, J; Ha, J; Kang, J; Kim, S Y

    2000-01-21

    Abscisic acid (ABA) plays an important role in environmental stress responses of higher plants during vegetative growth. One of the ABA-mediated responses is the induced expression of a large number of genes, which is mediated by cis-regulatory elements known as abscisic acid-responsive elements (ABREs). Although a number of ABRE binding transcription factors have been known, they are not specifically from vegetative tissues under induced conditions. Considering the tissue specificity of ABA signaling pathways, factors mediating ABA-dependent stress responses during vegetative growth phase may thus have been unidentified so far. Here, we report a family of ABRE binding factors isolated from young Arabidopsis plants under stress conditions. The factors, isolated by a yeast one-hybrid system using a prototypical ABRE and named as ABFs (ABRE binding factors) belong to a distinct subfamily of bZIP proteins. Binding site selection assay performed with one ABF showed that its preferred binding site is the strong ABRE, CACGTGGC. ABFs can transactivate an ABRE-containing reporter gene in yeast. Expression of ABFs is induced by ABA and various stress treatments, whereas their induction patterns are different from one another. Thus, a new family of ABRE binding factors indeed exists that have the potential to activate a large number of ABA/stress-responsive genes in Arabidopsis.

  15. Stable Plastid Transformation for High-Level Recombinant Protein Expression: Promises and Challenges

    Directory of Open Access Journals (Sweden)

    Meili Gao

    2012-01-01

    Full Text Available Plants are a promising expression system for the production of recombinant proteins. However, low protein productivity remains a major obstacle that limits extensive commercialization of whole plant and plant cell bioproduction platform. Plastid genetic engineering offers several advantages, including high levels of transgenic expression, transgenic containment via maternal inheritance, and multigene expression in a single transformation event. In recent years, the development of optimized expression strategies has given a huge boost to the exploitation of plastids in molecular farming. The driving forces behind the high expression level of plastid bioreactors include codon optimization, promoters and UTRs, genotypic modifications, endogenous enhancer and regulatory elements, posttranslational modification, and proteolysis. Exciting progress of the high expression level has been made with the plastid-based production of two particularly important classes of pharmaceuticals: vaccine antigens, therapeutic proteins, and antibiotics and enzymes. Approaches to overcome and solve the associated challenges of this culture system that include low transformation frequencies, the formation of inclusion bodies, and purification of recombinant proteins will also be discussed.

  16. Spectral response of multi-element silicon detectors

    Energy Technology Data Exchange (ETDEWEB)

    Ludewigt, B.A.; Rossington, C.S.; Chapman, K. [Univ. of California, Berkeley, CA (United States)

    1997-04-01

    Multi-element silicon strip detectors, in conjunction with integrated circuit pulse-processing electronics, offer an attractive alternative to conventional lithium-drifted silicon Si(Li) and high purity germanium detectors (HPGe) for high count rate, low noise synchrotron x-ray fluorescence applications. One of the major differences between the segmented Si detectors and the commercially available single-element Si(Li) or HPGe detectors is that hundreds of elements can be fabricated on a single Si substrate using standard silicon processing technologies. The segmentation of the detector substrate into many small elements results in very low noise performance at or near, room temperature, and the count rate of the detector is increased many-fold due to the multiplication in the total number of detectors. Traditionally, a single channel of detector with electronics can handle {approximately}100 kHz count rates while maintaining good energy resolution; the segmented detectors can operate at greater than MHz count rates merely due to the multiplication in the number of channels. One of the most critical aspects in the development of the segmented detectors is characterizing the charge sharing and charge loss that occur between the individual detector strips, and determining how these affect the spectral response of the detectors.

  17. Finite element simulation of impact response of wire mesh screens

    Directory of Open Access Journals (Sweden)

    Wang Caizheng

    2015-01-01

    Full Text Available In this paper, the response of wire mesh screens to low velocity impact with blunt objects is investigated using finite element (FE simulation. The woven wire mesh is modelled with homogeneous shell elements with equivalent smeared mechanical properties. The mechanical behaviour of the woven wire mesh was determined experimentally with tensile tests on steel wire mesh coupons to generate the data for the smeared shell material used in the FE. The effects of impacts with a low mass (4 kg and a large mass (40 kg providing the same impact energy are studied. The joint between the wire mesh screen and the aluminium frame surrounding it is modelled using contact elements with friction between the corresponding elements. Damage to the screen of different types compromising its structural integrity, such as mesh separation and pulling out from the surrounding frame is modelled. The FE simulation is validated with results of impact tests conducted on woven steel wire screen meshes.

  18. Antioxidant response elements: Discovery, classes, regulation and potential applications

    Directory of Open Access Journals (Sweden)

    Azhwar Raghunath

    2018-07-01

    Full Text Available Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs, which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Keywords: Antioxidant response elements, Antioxidant genes, ARE-reporter constructs, ARE SNPs, Keap1/Nrf2/ARE pathway, Oxidative stress

  19. Carotenoid Metabolism in Plants: The Role of Plastids.

    Science.gov (United States)

    Sun, Tianhu; Yuan, Hui; Cao, Hongbo; Yazdani, Mohammad; Tadmor, Yaakov; Li, Li

    2018-01-08

    Carotenoids are indispensable to plants and critical in human diets. Plastids are the organelles for carotenoid biosynthesis and storage in plant cells. They exist in various types, which include proplastids, etioplasts, chloroplasts, amyloplasts, and chromoplasts. These plastids have dramatic differences in their capacity to synthesize and sequester carotenoids. Clearly, plastids play a central role in governing carotenogenic activity, carotenoid stability, and pigment diversity. Understanding of carotenoid metabolism and accumulation in various plastids expands our view on the multifaceted regulation of carotenogenesis and facilitates our efforts toward developing nutrient-enriched food crops. In this review, we provide a comprehensive overview of the impact of various types of plastids on carotenoid biosynthesis and accumulation, and discuss recent advances in our understanding of the regulatory control of carotenogenesis and metabolic engineering of carotenoids in light of plastid types in plants. Copyright © 2017 The Author. Published by Elsevier Inc. All rights reserved.

  20. The plastid genome of the red macroalga Grateloupia taiwanensis (Halymeniaceae.

    Directory of Open Access Journals (Sweden)

    Michael S DePriest

    Full Text Available The complete plastid genome sequence of the red macroalga Grateloupia taiwanensis S.-M.Lin & H.-Y.Liang (Halymeniaceae, Rhodophyta is presented here. Comprising 191,270 bp, the circular DNA contains 233 protein-coding genes and 29 tRNA sequences. In addition, several genes previously unknown to red algal plastids are present in the genome of G. taiwanensis. The plastid genomes from G. taiwanensis and another florideophyte, Gracilaria tenuistipitata var. liui, are very similar in sequence and share significant synteny. In contrast, less synteny is shared between G. taiwanensis and the plastid genome representatives of Bangiophyceae and Cyanidiophyceae. Nevertheless, the gene content of all six red algal plastid genomes here studied is highly conserved, and a large core repertoire of plastid genes can be discerned in Rhodophyta.

  1. The Plastid Genome of the Red Macroalga Grateloupia taiwanensis (Halymeniaceae)

    Science.gov (United States)

    DePriest, Michael S.; Bhattacharya, Debashish; López-Bautista, Juan M.

    2013-01-01

    The complete plastid genome sequence of the red macroalga Grateloupia taiwanensis S.-M.Lin & H.-Y.Liang (Halymeniaceae, Rhodophyta) is presented here. Comprising 191,270 bp, the circular DNA contains 233 protein-coding genes and 29 tRNA sequences. In addition, several genes previously unknown to red algal plastids are present in the genome of G. taiwanensis. The plastid genomes from G. taiwanensis and another florideophyte, Gracilaria tenuistipitata var. liui, are very similar in sequence and share significant synteny. In contrast, less synteny is shared between G. taiwanensis and the plastid genome representatives of Bangiophyceae and Cyanidiophyceae. Nevertheless, the gene content of all six red algal plastid genomes here studied is highly conserved, and a large core repertoire of plastid genes can be discerned in Rhodophyta. PMID:23894297

  2. Plastid transformation in potato: Solanum tuberosum.

    Science.gov (United States)

    Valkov, Vladimir T; Gargano, Daniela; Scotti, Nunzia; Cardi, Teodoro

    2014-01-01

    Although plastid transformation has attractive advantages and potential applications in plant biotechnology, for long time it has been highly efficient only in tobacco. The lack of efficient selection and regeneration protocols and, for some species, the inefficient recombination using heterologous flanking regions in transformation vectors prevented the extension of the technology to major crops. However, the availability of this technology for species other than tobacco could offer new possibilities in plant breeding, such as resistance management or improvement of nutritional value, with no or limited environmental concerns. Herein we describe an efficient plastid transformation protocol for potato (Solanum tuberosum subsp. tuberosum). By optimizing the tissue culture system and using transformation vectors carrying homologous potato flanking sequences, we obtained up to one transplastomic shoot per bombardment. Such efficiency is comparable to that usually achieved in tobacco. The method described in this chapter can be used to regenerate potato transplastomic plants expressing recombinant proteins in chloroplasts as well as in amyloplasts.

  3. Complete plastid genome sequence of Daucus carota: implications for biotechnology and phylogeny of angiosperms.

    Science.gov (United States)

    Ruhlman, Tracey; Lee, Seung-Bum; Jansen, Robert K; Hostetler, Jessica B; Tallon, Luke J; Town, Christopher D; Daniell, Henry

    2006-08-31

    results provide the best taxon sampling of complete chloroplast genomes and the strongest support yet for the sister relationship of Caryophyllales to the asterids. The availability of the complete plastid genome sequence should facilitate improved transformation efficiency and foreign gene expression in carrot through utilization of endogenous flanking sequences and regulatory elements.

  4. Complete plastid genome sequence of Daucus carota: Implications for biotechnology and phylogeny of angiosperms

    Directory of Open Access Journals (Sweden)

    Ruhlman Tracey

    2006-08-01

    Daucus with Panax in the euasterid II clade. These results provide the best taxon sampling of complete chloroplast genomes and the strongest support yet for the sister relationship of Caryophyllales to the asterids. The availability of the complete plastid genome sequence should facilitate improved transformation efficiency and foreign gene expression in carrot through utilization of endogenous flanking sequences and regulatory elements.

  5. Vesicles Are Persistent Features of Different Plastids.

    Science.gov (United States)

    Lindquist, Emelie; Solymosi, Katalin; Aronsson, Henrik

    2016-10-01

    Peripheral vesicles in plastids have been observed repeatedly, primarily in proplastids and developing chloroplasts, in which they are suggested to function in thylakoid biogenesis. Previous observations of vesicles in mature chloroplasts have mainly concerned low temperature pretreated plants occasionally treated with inhibitors blocking vesicle fusion. Here, we show that such vesicle-like structures occur not only in chloroplasts and proplastids, but also in etioplasts, etio-chloroplasts, leucoplasts, chromoplasts and even transforming desiccoplasts without any specific pretreatment. Observations are made both in C3 and C4 species, in different cell types (meristematic, epidermis, mesophyll, bundle sheath and secretory cells) and different organs (roots, stems, leaves, floral parts and fruits). Until recently not much focus has been given to the idea that vesicle transport in chloroplasts could be mediated by proteins, but recent data suggest that the vesicle system of chloroplasts has similarities with the cytosolic coat protein complex II system. All current data taken together support the idea of an ongoing, active and protein-mediated vesicle transport not only in chloroplasts but also in other plastids, obviously occurring regardless of chemical modifications, temperature and plastid developmental stage. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. Respiratory processes in non-photosynthetic plastids

    Science.gov (United States)

    Renato, Marta; Boronat, Albert; Azcón-Bieto, Joaquín

    2015-01-01

    Chlororespiration is a respiratory process located in chloroplast thylakoids which consists in an electron transport chain from NAD(P)H to oxygen. This respiratory chain involves the NAD(P)H dehydrogenase complex, the plastoquinone pool and the plastid terminal oxidase (PTOX), and it probably acts as a safety valve to prevent the over-reduction of the photosynthetic machinery in stress conditions. The existence of a similar respiratory activity in non-photosynthetic plastids has been less studied. Recently, it has been reported that tomato fruit chromoplasts present an oxygen consumption activity linked to ATP synthesis. Etioplasts and amyloplasts contain several electron carriers and some subunits of the ATP synthase, so they could harbor a similar respiratory process. This review provides an update on the study about respiratory processes in chromoplasts, identifying the major gaps that need to be addressed in future research. It also reviews the proteomic data of etioplasts and amyloplasts, which suggest the presence of a respiratory electron transport chain in these plastids. PMID:26236317

  7. Respiratory processes in non-photosynthetic plastids

    Directory of Open Access Journals (Sweden)

    Marta eRenato

    2015-07-01

    Full Text Available Chlororespiration is a respiratory process located in chloroplast thylakoids which consists in an electron transport chain from NAD(PH to oxygen. This respiratory chain involves the NAD(PH dehydrogenase complex, the plastoquinone pool and the plastid terminal oxidase (PTOX, and it probably acts as a safety valve to prevent the over-reduction of the photosynthetic machinery in stress conditions. The existence of a similar respiratory activity in non-photosynthetic plastids has been less studied. Recently, it has been reported that tomato fruit chromoplasts present an oxygen consumption activity linked to ATP synthesis. Etioplasts and amyloplasts contain several electron carriers and some subunits of the ATP synthase, so they could harbor a similar respiratory process. This review provides an update on the study about respiratory processes in chromoplasts, identifying the major gaps that need to be addressed in future research. It also reviews the proteomic data of etioplasts and amyloplasts, which suggest the presence of a respiratory electron transport chain in these plastids.

  8. Evolution of red algal plastid genomes: ancient architectures, introns, horizontal gene transfer, and taxonomic utility of plastid markers.

    Directory of Open Access Journals (Sweden)

    Jan Janouškovec

    Full Text Available Red algae have the most gene-rich plastid genomes known, but despite their evolutionary importance these genomes remain poorly sampled. Here we characterize three complete and one partial plastid genome from a diverse range of florideophytes. By unifying annotations across all available red algal plastid genomes we show they all share a highly compact and slowly-evolving architecture and uniquely rich gene complements. Both chromosome structure and gene content have changed very little during red algal diversification, and suggest that plastid-to nucleus gene transfers have been rare. Despite their ancient character, however, the red algal plastids also contain several unprecedented features, including a group II intron in a tRNA-Met gene that encodes the first example of red algal plastid intron maturase - a feature uniquely shared among florideophytes. We also identify a rare case of a horizontally-acquired proteobacterial operon, and propose this operon may have been recruited for plastid function and potentially replaced a nucleus-encoded plastid-targeted paralogue. Plastid genome phylogenies yield a fully resolved tree and suggest that plastid DNA is a useful tool for resolving red algal relationships. Lastly, we estimate the evolutionary rates among more than 200 plastid genes, and assess their usefulness for species and subspecies taxonomy by comparison to well-established barcoding markers such as cox1 and rbcL. Overall, these data demonstrates that red algal plastid genomes are easily obtainable using high-throughput sequencing of total genomic DNA, interesting from evolutionary perspectives, and promising in resolving red algal relationships at evolutionarily-deep and species/subspecies levels.

  9. Distinct pathways mediate the sorting of tail-anchored proteins to the plastid outer envelope.

    Directory of Open Access Journals (Sweden)

    Preetinder K Dhanoa

    Full Text Available BACKGROUND: Tail-anchored (TA proteins are a distinct class of membrane proteins that are sorted post-translationally to various organelles and function in a number of important cellular processes, including redox reactions, vesicular trafficking and protein translocation. While the molecular targeting signals and pathways responsible for sorting TA proteins to their correct intracellular destinations in yeasts and mammals have begun to be characterized, relatively little is known about TA protein biogenesis in plant cells, especially for those sorted to the plastid outer envelope. METHODOLOGY/PRINCIPAL FINDINGS: Here we investigated the biogenesis of three plastid TA proteins, including the 33-kDa and 34-kDa GTPases of the translocon at the outer envelope of chloroplasts (Toc33 and Toc34 and a novel 9-kDa protein of unknown function that we define here as an outer envelope TA protein (OEP9. Using a combination of in vivo and in vitro assays we show that OEP9 utilizes a different sorting pathway than that used by Toc33 and Toc34. For instance, while all three TA proteins interact with the cytosolic OEP chaperone/receptor, AKR2A, the plastid targeting information within OEP9 is distinct from that within Toc33 and Toc34. Toc33 and Toc34 also appear to differ from OEP9 in that their insertion is dependent on themselves and the unique lipid composition of the plastid outer envelope. By contrast, the insertion of OEP9 into the plastid outer envelope occurs in a proteinaceous-dependent, but Toc33/34-independent manner and membrane lipids appear to serve primarily to facilitate normal thermodynamic integration of this TA protein. CONCLUSIONS/SIGNIFICANCE: Collectively, the results provide evidence in support of at least two sorting pathways for plastid TA outer envelope proteins and shed light on not only the complex diversity of pathways involved in the targeting and insertion of proteins into plastids, but also the molecular mechanisms that underlie

  10. Antioxidant response elements: Discovery, classes, regulation and potential applications.

    Science.gov (United States)

    Raghunath, Azhwar; Sundarraj, Kiruthika; Nagarajan, Raju; Arfuso, Frank; Bian, Jinsong; Kumar, Alan P; Sethi, Gautam; Perumal, Ekambaram

    2018-07-01

    Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs), which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  11. Specificity determinants for the abscisic acid response element.

    Science.gov (United States)

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interaction with ACGT core motif-containing ABRE sequences. We have also examined the variation in the stability of the protein-DNA complex upon mutating ABRE sequences using the protein design algorithm FoldX. The high throughput free energy calculations successfully predicted the ability of ABF1 to bind to alternative core motifs like GCGT or AAGT and also rationalized the role of the flanking sequences in determining the specificity of the protein-DNA interaction.

  12. On being the right size as an animal with plastids

    NARCIS (Netherlands)

    C. Rauch (Cessa); P. Jahns (Peter); A.G.M. Tielens (Aloysius); D.B. Gould (Douglas ); W.F. Martin (William F.)

    2017-01-01

    textabstractPlastids typically reside in plant or algal cells—with one notable exception. There is one group of multicellular animals, sea slugs in the order Sacoglossa, members of which feed on siphonaceous algae. The slugs sequester the ingested plastids in the cytosol of cells in their digestive

  13. On Being the Right Size as an Animal with Plastids

    NARCIS (Netherlands)

    Rauch, Cessa; Jahns, Peter; Tielens, Aloysius G M; Gould, Sven B; Martin, William F

    2017-01-01

    Plastids typically reside in plant or algal cells-with one notable exception. There is one group of multicellular animals, sea slugs in the order Sacoglossa, members of which feed on siphonaceous algae. The slugs sequester the ingested plastids in the cytosol of cells in their digestive gland,

  14. The yeast genome may harbor hypoxia response elements (HRE).

    Science.gov (United States)

    Ferreira, Túlio César; Hertzberg, Libi; Gassmann, Max; Campos, Elida Geralda

    2007-01-01

    The hypoxia-inducible factor-1 (HIF-1) is a heterodimeric transcription factor activated when cells are submitted to hypoxia. The heterodimer is composed of two subunits, HIF-1alpha and the constitutively expressed HIF-1beta. During normoxia, HIF-1alpha is degraded by the 26S proteasome, but hypoxia causes HIF-1alpha to be stabilized, enter the nucleus and bind to HIF-1beta, thus forming the active complex. The complex then binds to the regulatory sequences of various genes involved in physiological and pathological processes. The specific regulatory sequence recognized by HIF-1 is the hypoxia response element (HRE) that has the consensus sequence 5'BRCGTGVBBB3'. Although the basic transcriptional regulation machinery is conserved between yeast and mammals, Saccharomyces cerevisiae does not express HIF-1 subunits. However, we hypothesized that baker's yeast has a protein analogous to HIF-1 which participates in the response to changes in oxygen levels by binding to HRE sequences. In this study we screened the yeast genome for HREs using probabilistic motif search tools. We described 24 yeast genes containing motifs with high probability of being HREs (p-value<0.1) and classified them according to biological function. Our results show that S. cerevisiae may harbor HREs and indicate that a transcription factor analogous to HIF-1 may exist in this organism.

  15. Plant cells without detectable plastids are generated in the crumpled leaf mutant of Arabidopsis thaliana.

    Science.gov (United States)

    Chen, Yuling; Asano, Tomoya; Fujiwara, Makoto T; Yoshida, Shigeo; Machida, Yasunori; Yoshioka, Yasushi

    2009-05-01

    Plastids are maintained in cells by proliferating prior to cell division and being partitioned to each daughter cell during cell division. It is unclear, however, whether cells without plastids are generated when plastid division is suppressed. The crumpled leaf (crl) mutant of Arabidopsis thaliana is a plastid division mutant that displays severe abnormalities in plastid division and plant development. We show that the crl mutant contains cells lacking detectable plastids; this situation probably results from an unequal partitioning of plastids to each daughter cell. Our results suggest that crl has a partial defect in plastid expansion, which is suggested to be important in the partitioning of plastids to daughter cells when plastid division is suppressed. The absence of cells without detectable plastids in the accumulation and replication of chloroplasts 6 (arc6) mutant, another plastid division mutant of A. thaliana having no significant defects in plant morphology, suggests that the generation of cells without detectable plastids is one of the causes of the developmental abnormalities seen in crl plants. We also demonstrate that plastids with trace or undetectable amounts of chlorophyll are generated from enlarged plastids by a non-binary fission mode of plastid replication in both crl and arc6.

  16. Fatty acid biosynthesis in pea root plastids

    International Nuclear Information System (INIS)

    Stahl, R.J.; Sparace, S.A.

    1989-01-01

    Fatty acid biosynthesis from [1- 14 C]acetate was optimized in plastids isolated from primary root tips of 7-day-old germinating pea seeds. Fatty acid synthesis was maximum at approximately 80 nmoles/hr/mg protein in the presence of 200 μM acetate, 0.5 mM each of NADH, NADPH and CoA, 6 mM each of ATP and MgCl 2 , 1 mM each of the MnCl 2 and glycerol-3-phosphate, 15 mM KHCO 3 , and 0.1M Bis-tris-propane, pH 8.0 incubated at 35C. At the standard incubation temperature of 25C, fatty acid synthesis was linear from up to 6 hours with 80 to 100 μg/mL plastid protein. ATP and CoA were absolute requirements, whereas KHCO 3 , divalent cations and reduced nucleotides all improved activity by 80 to 85%. Mg 2+ and NADH were the preferred cation and nucleotide, respectively. Dithiothreitol and detergents were generally inhibitory. The radioactive products of fatty acid biosynthesis were approximately 33% 16:0, 10% 18:0 and 56% 18:1 and generally did not vary with increasing concentrations of each cofactor

  17. Lichen Parmelia sulcata time response model to environmental elemental availability

    International Nuclear Information System (INIS)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Transplants of lichen Parmelia sulcata collected in an area previously identified as non polluted, were placed at six stations, five of which were near Power Plants and the other in an area expected to be a remote station. Together with the lichen transplants, two total deposition collection buckets and an aerosol sampler were installed. Lichens were recollected two every month from each station. At the same time the water collection buckets were replaced by new ones. The aerosol sampler filter was replaced every week, collection being effective only for 10 minutes out of every two hours; in the remote station aerosol filters were replaced only once a month, the collection rate being kept. Each station was run for a period of one year. Both lichens and aerosol filters were analysed by PIXE and INAA at ITN. Total deposition samples were dried under an infrared lamp, and afterwards acid digested and analysed by ICP-MS at the National Geological Survey of The Netherlands. Data for the three types of samples were then produced for a total of 16 elements. In this work we used the data set thus obtained to test a model for the time response of lichen Parmelia sulcata to a new environment. (author)

  18. Stable plastid transformation in lettuce (Lactuca sativa L.).

    Science.gov (United States)

    Lelivelt, Cilia L C; McCabe, Matthew S; Newell, Christine A; Desnoo, C Bastiaan; van Dun, Kees M P; Birch-Machin, Ian; Gray, John C; Mills, Kingston H G; Nugent, Jacqueline M

    2005-08-01

    Although plastid transformation in higher plants was first demonstrated in the early 1990s it is only recently that the technology is being extended to a broader range of species. To date, the production of fertile transplastomic plants has been reported for tobacco, tomato, petunia, soybean, cotton and Lesquerella fendleri (Brassicaceae). In this study we demonstrate a polyethylene glycol-mediated plastid transformation system for lettuce that generates fertile, homoplasmic, plastid-transformed lines. Transformation was achieved using a vector that targets genes to the trnA/trnI intergenic region of the lettuce plastid genome employing the aadA gene as a selectable marker against spectinomycin. Spectinomycin resistance and heterologous gene transcription were shown in T(1) plants derived from self-pollinated primary regenerants demonstrating transmission of the plastid-encoded transgene to the first seed generation. Crossing with male sterile wild-type lettuce showed that spectinomycin resistance was not transmitted via pollen. Constructs containing the gfp gene showed plastid-based expression of green fluorescent protein. The lettuce plastid could have potential both as a production and a delivery system for edible human therapeutic proteins.

  19. Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters.

    Science.gov (United States)

    Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

    2005-02-01

    cis-Acting regulatory elements are important molecular switches involved in the transcriptional regulation of a dynamic network of gene activities controlling various biological processes, including abiotic stress responses, hormone responses and developmental processes. In particular, understanding regulatory gene networks in stress response cascades depends on successful functional analyses of cis-acting elements. The ever-improving accuracy of transcriptome expression profiling has led to the identification of various combinations of cis-acting elements in the promoter regions of stress-inducible genes involved in stress and hormone responses. Here we discuss major cis-acting elements, such as the ABA-responsive element (ABRE) and the dehydration-responsive element/C-repeat (DRE/CRT), that are a vital part of ABA-dependent and ABA-independent gene expression in osmotic and cold stress responses.

  20. ACGT-containing abscisic acid response element (ABRE) and coupling element 3 (CE3) are functionally equivalent.

    Science.gov (United States)

    Hobo, T; Asada, M; Kowyama, Y; Hattori, T

    1999-09-01

    ACGT-containing ABA response elements (ABREs) have been functionally identified in the promoters of various genes. In addition, single copies of ABRE have been found to require a cis-acting, coupling element to achieve ABA induction. A coupling element 3 (CE3) sequence, originally identified as such in the barley HVA1 promoter, is found approximately 30 bp downstream of motif A (ACGT-containing ABRE) in the promoter of the Osem gene. The relationship between these two elements was further defined by linker-scan analyses of a 55 bp fragment of the Osem promoter, which is sufficient for ABA-responsiveness and VP1 activation. The analyses revealed that both motif A and CE3 sequence were required not only for ABA-responsiveness but also for VP1 activation. Since the sequences of motif A and CE3 were found to be similar, motif-exchange experiments were carried out. The experiments demonstrated that motif A and CE3 were interchangeable by each other with respect to both ABA and VP1 regulation. In addition, both sequences were shown to be recognized by a VP1-interacting, ABA-responsive bZIP factor TRAB1. These results indicate that ACGT-containing ABREs and CE3 are functionally equivalent cis-acting elements. Furthermore, TRAB1 was shown to bind two other non-ACGT ABREs. Based on these results, all these ABREs including CE3 are proposed to be categorized into a single class of cis-acting elements.

  1. 33 CFR Appendix C to Part 155 - Training Elements for Oil Spill Response Plans

    Science.gov (United States)

    2010-07-01

    .... 155, App. C Appendix C to Part 155—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is... included training as one of the sections required in a vessel or facility response plan. In reviewing...

  2. The mitochondrial and plastid genomes of Volvox carteri: bloated molecules rich in repetitive DNA

    Directory of Open Access Journals (Sweden)

    Lee Robert W

    2009-03-01

    Full Text Available Abstract Background The magnitude of noncoding DNA in organelle genomes can vary significantly; it is argued that much of this variation is attributable to the dissemination of selfish DNA. The results of a previous study indicate that the mitochondrial DNA (mtDNA of the green alga Volvox carteri abounds with palindromic repeats, which appear to be selfish elements. We became interested in the evolution and distribution of these repeats when, during a cursory exploration of the V. carteri nuclear DNA (nucDNA and plastid DNA (ptDNA sequences, we found palindromic repeats with similar structural features to those of the mtDNA. Upon this discovery, we decided to investigate the diversity and evolutionary implications of these palindromic elements by sequencing and characterizing large portions of mtDNA and ptDNA and then comparing these data to the V. carteri draft nuclear genome sequence. Results We sequenced 30 and 420 kilobases (kb of the mitochondrial and plastid genomes of V. carteri, respectively – resulting in partial assemblies of these genomes. The mitochondrial genome is the most bloated green-algal mtDNA observed to date: ~61% of the sequence is noncoding, most of which is comprised of short palindromic repeats spread throughout the intergenic and intronic regions. The plastid genome is the largest (>420 kb and most expanded (>80% noncoding ptDNA sequence yet discovered, with a myriad of palindromic repeats in the noncoding regions, which have a similar size and secondary structure to those of the mtDNA. We found that 15 kb (~0.01% of the nuclear genome are homologous to the palindromic elements of the mtDNA, and 50 kb (~0.05% are homologous to those of the ptDNA. Conclusion Selfish elements in the form of short palindromic repeats have propagated in the V. carteri mtDNA and ptDNA, resulting in the distension of these genomes. Copies of these same repeats are also found in a small fraction of the nucDNA, but appear to be inert in this

  3. Rapid and accurate pyrosequencing of angiosperm plastid genomes

    Science.gov (United States)

    Moore, Michael J; Dhingra, Amit; Soltis, Pamela S; Shaw, Regina; Farmerie, William G; Folta, Kevin M; Soltis, Douglas E

    2006-01-01

    Background Plastid genome sequence information is vital to several disciplines in plant biology, including phylogenetics and molecular biology. The past five years have witnessed a dramatic increase in the number of completely sequenced plastid genomes, fuelled largely by advances in conventional Sanger sequencing technology. Here we report a further significant reduction in time and cost for plastid genome sequencing through the successful use of a newly available pyrosequencing platform, the Genome Sequencer 20 (GS 20) System (454 Life Sciences Corporation), to rapidly and accurately sequence the whole plastid genomes of the basal eudicot angiosperms Nandina domestica (Berberidaceae) and Platanus occidentalis (Platanaceae). Results More than 99.75% of each plastid genome was simultaneously obtained during two GS 20 sequence runs, to an average depth of coverage of 24.6× in Nandina and 17.3× in Platanus. The Nandina and Platanus plastid genomes shared essentially identical gene complements and possessed the typical angiosperm plastid structure and gene arrangement. To assess the accuracy of the GS 20 sequence, over 45 kilobases of sequence were generated for each genome using conventional sequencing. Overall error rates of 0.043% and 0.031% were observed in GS 20 sequence for Nandina and Platanus, respectively. More than 97% of all observed errors were associated with homopolymer runs, with ~60% of all errors associated with homopolymer runs of 5 or more nucleotides and ~50% of all errors associated with regions of extensive homopolymer runs. No substitution errors were present in either genome. Error rates were generally higher in the single-copy and noncoding regions of both plastid genomes relative to the inverted repeat and coding regions. Conclusion Highly accurate and essentially complete sequence information was obtained for the Nandina and Platanus plastid genomes using the GS 20 System. More importantly, the high accuracy observed in the GS 20 plastid

  4. Rapid and accurate pyrosequencing of angiosperm plastid genomes

    Directory of Open Access Journals (Sweden)

    Farmerie William G

    2006-08-01

    Full Text Available Abstract Background Plastid genome sequence information is vital to several disciplines in plant biology, including phylogenetics and molecular biology. The past five years have witnessed a dramatic increase in the number of completely sequenced plastid genomes, fuelled largely by advances in conventional Sanger sequencing technology. Here we report a further significant reduction in time and cost for plastid genome sequencing through the successful use of a newly available pyrosequencing platform, the Genome Sequencer 20 (GS 20 System (454 Life Sciences Corporation, to rapidly and accurately sequence the whole plastid genomes of the basal eudicot angiosperms Nandina domestica (Berberidaceae and Platanus occidentalis (Platanaceae. Results More than 99.75% of each plastid genome was simultaneously obtained during two GS 20 sequence runs, to an average depth of coverage of 24.6× in Nandina and 17.3× in Platanus. The Nandina and Platanus plastid genomes shared essentially identical gene complements and possessed the typical angiosperm plastid structure and gene arrangement. To assess the accuracy of the GS 20 sequence, over 45 kilobases of sequence were generated for each genome using conventional sequencing. Overall error rates of 0.043% and 0.031% were observed in GS 20 sequence for Nandina and Platanus, respectively. More than 97% of all observed errors were associated with homopolymer runs, with ~60% of all errors associated with homopolymer runs of 5 or more nucleotides and ~50% of all errors associated with regions of extensive homopolymer runs. No substitution errors were present in either genome. Error rates were generally higher in the single-copy and noncoding regions of both plastid genomes relative to the inverted repeat and coding regions. Conclusion Highly accurate and essentially complete sequence information was obtained for the Nandina and Platanus plastid genomes using the GS 20 System. More importantly, the high accuracy

  5. A plastome mutation affects processing of both chloroplast and nuclear DNA-encoded plastid proteins.

    Science.gov (United States)

    Johnson, E M; Schnabelrauch, L S; Sears, B B

    1991-01-01

    Immunoblotting of a chloroplast mutant (pm7) of Oenothera showed that three proteins, cytochrome f and the 23 kDa and 16 kDa subunits of the oxygen-evolving subcomplex of photosystem II, were larger than the corresponding mature proteins of the wild type and, thus, appear to be improperly processed in pm7. The mutant is also chlorotic and has little or no internal membrane development in the plastids. The improperly processed proteins, and other proteins that are completely missing, represent products of both the plastid and nuclear genomes. To test for linkage of these defects, a green revertant of pm7 was isolated from cultures in which the mutant plastids were maintained in a nuclear background homozygous for the plastome mutator (pm) gene. In this revertant, all proteins analyzed co-reverted to the wild-type condition, indicating that a single mutation in a plastome gene is responsible for the complex phenotype of pm7. These results suggest that the defect in pm7 lies in a gene that affects a processing protease encoded in the chloroplast genome.

  6. Non-photosynthetic plastids as hosts for metabolic engineering.

    Science.gov (United States)

    Mellor, Silas Busck; Behrendorff, James B Y H; Nielsen, Agnieszka Zygadlo; Jensen, Poul Erik; Pribil, Mathias

    2018-04-13

    Using plants as hosts for production of complex, high-value compounds and therapeutic proteins has gained increasing momentum over the past decade. Recent advances in metabolic engineering techniques using synthetic biology have set the stage for production yields to become economically attractive, but more refined design strategies are required to increase product yields without compromising development and growth of the host system. The ability of plant cells to differentiate into various tissues in combination with a high level of cellular compartmentalization represents so far the most unexploited plant-specific resource. Plant cells contain organelles called plastids that retain their own genome, harbour unique biosynthetic pathways and differentiate into distinct plastid types upon environmental and developmental cues. Chloroplasts, the plastid type hosting the photosynthetic processes in green tissues, have proven to be suitable for high yield protein and bio-compound production. Unfortunately, chloroplast manipulation often affects photosynthetic efficiency and therefore plant fitness. In this respect, plastids of non-photosynthetic tissues, which have focused metabolisms for synthesis and storage of particular classes of compounds, might prove more suitable for engineering the production and storage of non-native metabolites without affecting plant fitness. This review provides the current state of knowledge on the molecular mechanisms involved in plastid differentiation and focuses on non-photosynthetic plastids as alternative biotechnological platforms for metabolic engineering. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  7. 3-dimensional earthquake response analysis of embedded reactor building using hybrid model of boundary elements and finite elements

    International Nuclear Information System (INIS)

    Muto, K.; Motosaka, M.; Kamata, M.; Masuda, K.; Urao, K.; Mameda, T.

    1985-01-01

    In order to investigate the 3-dimensional earthquake response characteristics of an embedded structure with consideration for soil-structure interaction, the authors have developed an analytical method using 3-dimensional hybrid model of boundary elements (BEM) and finite elements (FEM) and have conducted a dynamic analysis of an actual nuclear reactor building. This paper describes a comparative study between two different embedment depths in soil as elastic half-space. As the results, it was found that the earthquake response intensity decreases with the increase of the embedment depth and that this method was confirmed to be effective for investigating the 3-D response characteristics of embedded structures such as deflection pattern of each floor level, floor response spectra in high frequency range. (orig.)

  8. The plastid genome of Eutreptiella provides a window into the process of secondary endosymbiosis of plastid in euglenids.

    Directory of Open Access Journals (Sweden)

    Štěpánka Hrdá

    Full Text Available Euglenids are a group of protists that comprises species with diverse feeding modes. One distinct and diversified clade of euglenids is photoautotrophic, and its members bear green secondary plastids. In this paper we present the plastid genome of the euglenid Eutreptiella, which we assembled from 454 sequencing of Eutreptiella gDNA. Comparison of this genome and the only other available plastid genomes of photosynthetic euglenid, Euglena gracilis, revealed that they contain a virtually identical set of 57 protein coding genes, 24 genes fewer than the genome of Pyramimonas parkeae, the closest extant algal relative of the euglenid plastid. Searching within the transcriptomes of Euglena and Eutreptiella showed that 6 of the missing genes were transferred to the nucleus of the euglenid host while 18 have been probably lost completely. Euglena and Eutreptiella represent the deepest bifurcation in the photosynthetic clade, and therefore all these gene transfers and losses must have happened before the last common ancestor of all known photosynthetic euglenids. After the split of Euglena and Eutreptiella only one additional gene loss took place. The conservation of gene content in the two lineages of euglenids is in contrast to the variability of gene order and intron counts, which diversified dramatically. Our results show that the early secondary plastid of euglenids was much more susceptible to gene losses and endosymbiotic gene transfers than the established plastid, which is surprisingly resistant to changes in gene content.

  9. Lichens (Parmelia sulcata) time response model to environmental elemental availability

    NARCIS (Netherlands)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.T.

    1999-01-01

    Parmelia sulcata transplants, collected in a non-polluted area, were exposed to new atmospheric conditions at six stations, of which five were located near power plants and one at an unpolluted area. Data were collected for a 1-year period, on rainfall, airborne particulates, elemental deposition

  10. 33 CFR Appendix D to Part 154 - Training Elements for Oil Spill Response Plans

    Science.gov (United States)

    2010-07-01

    ... Appendix D to Part 154—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is clearly expressed by... that the plans often do not provide sufficient information in the training section of the plan for...

  11. Plastid-to-Nucleus Retrograde Signals Are Essential for the Expression of Nuclear Starch Biosynthesis Genes during Amyloplast Differentiation in Tobacco BY-2 Cultured Cells1[W][OA

    Science.gov (United States)

    Enami, Kazuhiko; Ozawa, Tomoki; Motohashi, Noriko; Nakamura, Masayuki; Tanaka, Kan; Hanaoka, Mitsumasa

    2011-01-01

    Amyloplasts, a subtype of plastid, are found in nonphotosynthetic tissues responsible for starch synthesis and storage. When tobacco (Nicotiana tabacum) Bright Yellow-2 cells are cultured in the presence of cytokinin instead of auxin, their plastids differentiate from proplastids to amyloplasts. In this program, it is well known that the expression of nucleus-encoded starch biosynthesis genes, such as ADP-Glucose Pyrophosphorylase (AgpS) and Granule-Bound Starch Synthase (GBSS), is specifically induced. In this study, we investigated the roles of plastid gene expression in amyloplast differentiation. Microarray analysis of plastid genes revealed that no specific transcripts were induced in amyloplasts. Nevertheless, amyloplast development accompanied with starch biosynthesis was drastically inhibited in the presence of plastid transcription/translation inhibitors. Surprisingly, the expression of nuclear AgpS and GBSS was significantly repressed by the addition of these inhibitors, suggesting that a plastid-derived signal(s) that reflects normal plastid gene expression was essential for nuclear gene expression. A series of experiments was performed to examine the effects of intermediates and inhibitors of tetrapyrrole biosynthesis, since some of the intermediates have been characterized as candidates for plastid-to-nucleus retrograde signals. Addition of levulinic acid, an inhibitor of tetrapyrrole biosynthesis, resulted in the up-regulation of nuclear AgpS and GBSS gene expression as well as starch accumulation, while the addition of heme showed opposite effects. Thus, these results indicate that plastid transcription and/or translation are required for normal amyloplast differentiation, regulating the expression of specific nuclear genes by unknown signaling mechanisms that can be partly mediated by tetrapyrrole intermediates. PMID:21771917

  12. Plastid-like Seq in mt Genome - RMG | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available deletions in the plastid DNA sequence (Number of deletion sites is shown in parentheses) Insertion Number o...f nucleotide insertions in the plastid DNA sequence (Number of insertion sites is shown in parentheses) Homo

  13. Design Process for Integrated Concepts with Responsive Building Elements

    DEFF Research Database (Denmark)

    Aa, Van der A.; Heiselberg, Per

    2008-01-01

    An integrated building concept is a prerequisite to come to an energy efficient building with a good and healthy IAQ indoor comfort. A design process that defines the targets and boundary conditions in the very first stage of the design and guarantees them until the building is finished and used...... is needed. The hard question is however: how to make the right choice of the combination of individual measures from building components and building services elements. Within the framework of IEA-ECBCS Annex 44 research has been conducted about the design process for integrated building concepts...

  14. Plastid genomes of two brown algae, Ectocarpus siliculosus and Fucus vesiculosus: further insights on the evolution of red-algal derived plastids

    Directory of Open Access Journals (Sweden)

    Corre Erwan

    2009-10-01

    Full Text Available Abstract Background Heterokont algae, together with cryptophytes, haptophytes and some alveolates, possess red-algal derived plastids. The chromalveolate hypothesis proposes that the red-algal derived plastids of all four groups have a monophyletic origin resulting from a single secondary endosymbiotic event. However, due to incongruence between nuclear and plastid phylogenies, this controversial hypothesis remains under debate. Large-scale genomic analyses have shown to be a powerful tool for phylogenetic reconstruction but insufficient sequence data have been available for red-algal derived plastid genomes. Results The chloroplast genomes of two brown algae, Ectocarpus siliculosus and Fucus vesiculosus, have been fully sequenced. These species represent two distinct orders of the Phaeophyceae, which is a major group within the heterokont lineage. The sizes of the circular plastid genomes are 139,954 and 124,986 base pairs, respectively, the size difference being due principally to the presence of longer inverted repeat and intergenic regions in E. siliculosus. Gene contents of the two plastids are similar with 139-148 protein-coding genes, 28-31 tRNA genes, and 3 ribosomal RNA genes. The two genomes also exhibit very similar rearrangements compared to other sequenced plastid genomes. The tRNA-Leu gene of E. siliculosus lacks an intron, in contrast to the F. vesiculosus and other heterokont plastid homologues, suggesting its recent loss in the Ectocarpales. Most of the brown algal plastid genes are shared with other red-algal derived plastid genomes, but a few are absent from raphidophyte or diatom plastid genomes. One of these regions is most similar to an apicomplexan nuclear sequence. The phylogenetic relationship between heterokonts, cryptophytes and haptophytes (collectively referred to as chromists plastids was investigated using several datasets of concatenated proteins from two cyanobacterial genomes and 18 plastid genomes, including

  15. Design of responsive materials using topologically interlocked elements

    International Nuclear Information System (INIS)

    Molotnikov, A; Gerbrand, R; Qi, Y; Simon, G P; Estrin, Y

    2015-01-01

    In this work we present a novel approach to designing responsive structures by segmentation of monolithic plates into an assembly of topologically interlocked building blocks. The particular example considered is an assembly of interlocking osteomorphic blocks. The results of this study demonstrate that the constraining force, which is required to hold the blocks together, can be viewed as a design parameter that governs the bending stiffness and the load bearing capacity of the segmented structure. In the case where the constraining forces are provided laterally using an external frame, the maximum load the assembly can sustain and its stiffness increase linearly with the magnitude of the lateral load applied. Furthermore, we show that the segmented plate with integrated shape memory wires employed as tensioning cables can act as a smart structure that changes its flexural stiffness and load bearing capacity in response to external stimuli, such as heat generated by the switching on and off an electric current. (paper)

  16. State-of-the-art Review : Vol. 2A. Responsive Building Elements

    DEFF Research Database (Denmark)

    Blümel, Ernst; Haghighat, Fariborz; Li, Yuguo

    This report resumes and presents the activity done in Subtask A of IEA-ECBCS Annex 44 “Integrating Environmentally Responsive Elements in Buildings” concerning the state of the art review of Responsive Building Elements. It is based on the contributions from the participating countries...... at researchers in the field and gives an overview of how these elements work together with available performance data. It is hoped, that this report will be helpful for researchers in their search for new solutions to the problem of designing and constructing sustainable buildings....

  17. Hormone response element binding proteins: novel regulators of vitamin D and estrogen signaling.

    Science.gov (United States)

    Lisse, Thomas S; Hewison, Martin; Adams, John S

    2011-03-01

    Insights from vitamin D-resistant New World primates and their human homologues as models of natural and pathological insensitivity to sterol/steroid action have uncovered a family of novel intracellular vitamin D and estrogen regulatory proteins involved in hormone action. The proteins, known as "vitamin D or estrogen response element-binding proteins", behave as potent cis-acting, transdominant regulators to inhibit steroid receptor binding to DNA response elements and is responsible for vitamin D and estrogen resistances. This set of interactors belongs to the heterogeneous nuclear ribonucleoprotein (hnRNP) family of previously known pre-mRNA-interacting proteins. This review provides new insights into the mechanism by which these novel regulators of signaling and metabolism can act to regulate responses to vitamin D and estrogen. In addition the review also describes other molecules that are known to influence nuclear receptor signaling through interaction with hormone response elements. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. Intragenomic spread of plastid-targeting presequences in the coccolithophore Emiliania huxleyi.

    Science.gov (United States)

    Burki, Fabien; Hirakawa, Yoshihisa; Keeling, Patrick J

    2012-09-01

    Nucleus-encoded plastid-targeted proteins of photosynthetic organisms are generally equipped with an N-terminal presequence required for crossing the plastid membranes. The acquisition of these presequences played a fundamental role in the establishment of plastids. Here, we report a unique case of two non-homologous proteins possessing completely identical presequences consisting of a bipartite plastid-targeting signal in the coccolithophore Emiliania huxleyi. We further show that this presequence is highly conserved in five additional proteins that did not originally function in plastids, representing de novo plastid acquisitions. These are among the most recent cases of presequence spreading from gene to gene and shed light on important evolutionary processes that have been usually erased by the ancient history of plastid evolution. We propose a mechanism of acquisition involving genomic duplications and gene replacement through non-homologous recombination that may have played a more general role for equipping proteins with targeting information.

  19. Prediction of transcriptional regulatory elements for plant hormone responses based on microarray data

    Directory of Open Access Journals (Sweden)

    Yamaguchi-Shinozaki Kazuko

    2011-02-01

    Full Text Available Abstract Background Phytohormones organize plant development and environmental adaptation through cell-to-cell signal transduction, and their action involves transcriptional activation. Recent international efforts to establish and maintain public databases of Arabidopsis microarray data have enabled the utilization of this data in the analysis of various phytohormone responses, providing genome-wide identification of promoters targeted by phytohormones. Results We utilized such microarray data for prediction of cis-regulatory elements with an octamer-based approach. Our test prediction of a drought-responsive RD29A promoter with the aid of microarray data for response to drought, ABA and overexpression of DREB1A, a key regulator of cold and drought response, provided reasonable results that fit with the experimentally identified regulatory elements. With this succession, we expanded the prediction to various phytohormone responses, including those for abscisic acid, auxin, cytokinin, ethylene, brassinosteroid, jasmonic acid, and salicylic acid, as well as for hydrogen peroxide, drought and DREB1A overexpression. Totally 622 promoters that are activated by phytohormones were subjected to the prediction. In addition, we have assigned putative functions to 53 octamers of the Regulatory Element Group (REG that have been extracted as position-dependent cis-regulatory elements with the aid of their feature of preferential appearance in the promoter region. Conclusions Our prediction of Arabidopsis cis-regulatory elements for phytohormone responses provides guidance for experimental analysis of promoters to reveal the basis of the transcriptional network of phytohormone responses.

  20. Effect of Large Negative Phase of Blast Loading on Structural Response of RC Elements

    Directory of Open Access Journals (Sweden)

    Syed Zubair Iman

    2016-01-01

    Full Text Available Structural response of reinforced concrete (RC elements for analysis and design are often obtained using the positive phase of the blast pressure curve disregarding the negative phase assuming insignificant contribution from the negative phase of the loading. Although, some insight on the effect of negative phase of blast pressure based on elastic single-degree-of-freedom (SDOF analysis was presented before, the influence of negative phase on different types of resistance functions of SDOF models and on realistic finite element analysis has not been explored. In this study, the effects of inclusion of pulse negative phase on structural response of RC elements from SDOF analysis and from more detailed finite element analysis have been investigated. Investigation of SDOF part has been conducted using MATLAB code that utilizes non-linear resistance functions of SDOF model. Detailed numerical investigation using finite element code DIANA was conducted on the significance of the negative phase on structural response. In the FE model, different support stiffness was used to explore the effect of support stiffness on the structural response due to blast negative phase. Results from SDOF and FE analyses present specific situations where the effect of large negative phase was found to be significant on the structural response of RC elements.

  1. Gene expression in isolated plastids from fruits of capsicum annum

    International Nuclear Information System (INIS)

    Powell, D.S.; Pryke, J.A.

    1987-01-01

    Plastids were obtained from the ripening fruits of Capsicum annum, and incubated in vitro in the presence of [ 35 S]methionine(Met). There was polypeptide synthesis at all stages of pepper tissue studied in both chloroplasts and chromoplasts, dependent on the addition of nuclioside triphosphates and phosphoenolpyruvate and inhibited by D-threo-chloramphenicol. l8. refs. (author)

  2. Production Of Cellulase In Plastids Of Transgenic Plants

    Science.gov (United States)

    Lamppa, Gayle

    2002-08-06

    A genetic construct encoding a fusion protein including endogluconase E1 and a transit peptide is used to transform plants. The plants produce cellulase by expressing the genetic construct. The cellulase is targeted to plastids and can be collected and purified.

  3. Instability of plastid DNA in the nuclear genome.

    Directory of Open Access Journals (Sweden)

    Anna E Sheppard

    2009-01-01

    Full Text Available Functional gene transfer from the plastid (chloroplast and mitochondrial genomes to the nucleus has been an important driving force in eukaryotic evolution. Non-functional DNA transfer is far more frequent, and the frequency of such transfers from the plastid to the nucleus has been determined experimentally in tobacco using transplastomic lines containing, in their plastid genome, a kanamycin resistance gene (neo readymade for nuclear expression. Contrary to expectations, non-Mendelian segregation of the kanamycin resistance phenotype is seen in progeny of some lines in which neo has been transferred to the nuclear genome. Here, we provide a detailed analysis of the instability of kanamycin resistance in nine of these lines, and we show that it is due to deletion of neo. Four lines showed instability with variation between progeny derived from different areas of the same plant, suggesting a loss of neo during somatic cell division. One line showed a consistent reduction in the proportion of kanamycin-resistant progeny, suggesting a loss of neo during meiosis, and the remaining four lines were relatively stable. To avoid genomic enlargement, the high frequency of plastid DNA integration into the nuclear genome necessitates a counterbalancing removal process. This is the first demonstration of such loss involving a high proportion of recent nuclear integrants. We propose that insertion, deletion, and rearrangement of plastid sequences in the nuclear genome are important evolutionary processes in the generation of novel nuclear genes. This work is also relevant in the context of transgenic plant research and crop production, because similar processes to those described here may be involved in the loss of plant transgenes.

  4. The plastid genome of Eutreptiella provides a window into the process of secondary endosymbiosis of plastid in euglenids

    Czech Academy of Sciences Publication Activity Database

    Hrdá, Š.; Fousek, Jan; Szabová, J.; Vlček, Čestmír; Hampl, V.

    2012-01-01

    Roč. 7, č. 3 (2012), e33746 E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GAP506/11/1320 Institutional support: RVO:68378050 Keywords : euglenid plastid * Eutreptiella * phylogeny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.730, year: 2012

  5. Mutations in a plastid-localized elongation factor G alter early stages of plastid development in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Hangarter Roger P

    2007-07-01

    Full Text Available Abstract Background Proper development of plastids in embryo and seedling tissues is critical for plant development. During germination, plastids develop to perform many critical functions that are necessary to establish the seedling for further growth. A growing body of work has demonstrated that components of the plastid transcription and translation machinery must be present and functional to establish the organelle upon germination. Results We have identified Arabidopsis thaliana mutants in a gene that encodes a plastid-targeted elongation factor G (SCO1 that is essential for plastid development during embryogenesis since two T-DNA insertion mutations in the coding sequence (sco1-2 and sco1-3 result in an embryo-lethal phenotype. In addition, a point mutation allele (sco1-1 and an allele with a T-DNA insertion in the promoter (sco1-4 of SCO1 display conditional seedling-lethal phenotypes. Seedlings of these alleles exhibit cotyledon and hypocotyl albinism due to improper chloroplast development, and normally die shortly after germination. However, when germinated on media supplemented with sucrose, the mutant plants can produce photosynthetically-active green leaves from the apical meristem. Conclusion The developmental stage-specific phenotype of the conditional-lethal sco1 alleles reveals differences in chloroplast formation during seedling germination compared to chloroplast differentiation in cells derived from the shoot apical meristem. Our identification of embryo-lethal mutant alleles in the Arabidopsis elongation factor G indicates that SCO1 is essential for plant growth, consistent with its predicted role in chloroplast protein translation.

  6. Implementation of structural response sensitivity calculations in a large-scale finite-element analysis system

    Science.gov (United States)

    Giles, G. L.; Rogers, J. L., Jr.

    1982-01-01

    The implementation includes a generalized method for specifying element cross-sectional dimensions as design variables that can be used in analytically calculating derivatives of output quantities from static stress, vibration, and buckling analyses for both membrane and bending elements. Limited sample results for static displacements and stresses are presented to indicate the advantages of analytically calclating response derivatives compared to finite difference methods. Continuing developments to implement these procedures into an enhanced version of the system are also discussed.

  7. Effects of segregation of primary alloying elements on the creep response in magnesium alloys

    DEFF Research Database (Denmark)

    Huang, Y.D.; Dieringa, H.; Hort, N.

    2008-01-01

    The segregation of primary alloying elements deteriorates the high temperature creep resistance of magnesium alloys. Annealing at high temperatures alleviating their segregations can improve the creep resistance. Present investigation on the effect of segregation of primary alloying elements...... on the creep response may provide some useful information about how to improve the creep resistance of magnesium alloys in the future. (c) 2008 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved....

  8. Entire plastid phylogeny of the carrot genus (Daucus, Apiaceae): Concordance with nuclear data and mitochondrial and nuclear DNA insertions to the plastid.

    Science.gov (United States)

    Spooner, David M; Ruess, Holly; Iorizzo, Massimo; Senalik, Douglas; Simon, Philipp

    2017-02-01

    We explored the phylogenetic utility of entire plastid DNA sequences in Daucus and compared the results with prior phylogenetic results using plastid and nuclear DNA sequences. We used Illumina sequencing to obtain full plastid sequences of 37 accessions of 20 Daucus taxa and outgroups, analyzed the data with phylogenetic methods, and examined evidence for mitochondrial DNA transfer to the plastid ( Dc MP). Our phylogenetic trees of the entire data set were highly resolved, with 100% bootstrap support for most of the external and many of the internal clades, except for the clade of D. carota and its most closely related species D. syrticus . Subsets of the data, including regions traditionally used as phylogenetically informative regions, provide various degrees of soft congruence with the entire data set. There are areas of hard incongruence, however, with phylogenies using nuclear data. We extended knowledge of a mitochondrial to plastid DNA insertion sequence previously named Dc MP and identified the first instance in flowering plants of a sequence of potential nuclear genome origin inserted into the plastid genome. There is a relationship of inverted repeat junction classes and repeat DNA to phylogeny, but no such relationship with nonsynonymous mutations. Our data have allowed us to (1) produce a well-resolved plastid phylogeny of Daucus , (2) evaluate subsets of the entire plastid data for phylogeny, (3) examine evidence for plastid and nuclear DNA phylogenetic incongruence, and (4) examine mitochondrial and nuclear DNA insertion into the plastid. © 2017 Spooner et al. Published by the Botanical Society of America. This work is licensed under a Creative Commons public domain license (CC0 1.0).

  9. Molecular analysis of UAS(E), a cis element containing stress response elements responsible for ethanol induction of the KlADH4 gene of Kluyveromyces lactis.

    Science.gov (United States)

    Mazzoni, C; Santori, F; Saliola, M; Falcone, C

    2000-01-01

    KlADH4 is a gene of Kluyveromyces lactis encoding a mitochondrial alcohol dehydrogenase activity, which is specifically induced by ethanol and insensitive to glucose repression. In this work, we report the molecular analysis of UAS(E), an element of the KlADH4 promoter which is essential for the induction of KlADH4 in the presence of ethanol. UAS(E) contains five stress response elements (STREs), which have been found in many genes of Saccharomyces cerevisiae involved in the response of cells to conditions of stress. Whereas KlADH4 is not responsive to stress conditions, the STREs present in UAS(E) seem to play a key role in the induction of the gene by ethanol, a situation that has not been observed in the related yeast S. cerevisiae. Gel retardation experiments showed that STREs in the KlADH4 promoter can bind factor(s) under non-inducing conditions. Moreover, we observed that the RAP1 binding site present in UAS(E) binds KlRap1p.

  10. CyanoClust: comparative genome resources of cyanobacteria and plastids.

    Science.gov (United States)

    Sasaki, Naobumi V; Sato, Naoki

    2010-01-01

    Cyanobacteria, which perform oxygen-evolving photosynthesis as do chloroplasts of plants and algae, are one of the best-studied prokaryotic phyla and one from which many representative genomes have been sequenced. Lack of a suitable comparative genomic database has been a problem in cyanobacterial genomics because many proteins involved in physiological functions such as photosynthesis and nitrogen fixation are not catalogued in commonly used databases, such as Clusters of Orthologous Proteins (COG). CyanoClust is a database of homolog groups in cyanobacteria and plastids that are produced by the program Gclust. We have developed a web-server system for the protein homology database featuring cyanobacteria and plastids. Database URL: http://cyanoclust.c.u-tokyo.ac.jp/.

  11. Demonstration of paternal inheritance of plastids in Picea (Pinaceae)

    International Nuclear Information System (INIS)

    Stine, M.

    1988-01-01

    Chloroplast DNA (cpDNA) was purified from Picea glauca, P. pungens, P. engelmannii, and P. omorika, and was digested with several restriction endonucleases. Interspecific restriction fragment length polymorphisms (RFLPs) of cpDNA were identified. The RFLPs were identified as cpDNA by the hybridization of cloned, 32 -P labeled, petunia cpDNA to the polymorphic bands, and by the lack of hybridization of a cloned and labeled mtDNA probe from maize. Chloroplast DNA RFLPs that showed no intraspecific variation when examined across the natural range for each species, were used as markers to follow the inheritance of plastids in interspecific hybrids. The inheritance of plastids was determined for F 1 -hybrids from reciprocal crosses of P. glauca and P. pungens, P. glauca and P. omorika, and F 1 -hybrids of P. engelmannii x pungens. All 31 F 1 -hybrids examined showed the cpDNA genotypes of the pollen parent, or the paternal species

  12. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    OpenAIRE

    Lee, M O; Liu, Y; Zhang, X K

    1995-01-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid re...

  13. Application of ADINA fluid element for transient response analysis of fluid-structure system

    International Nuclear Information System (INIS)

    Sakurai, Y.; Kodama, T.; Shiraishi, T.

    1985-01-01

    Pressure propagation and Fluid-Structure Interaction (FSI) in 3D space were simulated by general purpose finite element program ADINA using the displacement-based fluid element which presumes inviscid and compressible fluid with no net flow. Numerical transient solution was compared with the measured data of an FSI experiment and was found to fairly agree with the measured. In the next step, post analysis was conducted for a blowdown experiment performed with a 1/7 scaled reactor pressure vessel and a flexible core barrel and the code performance was found to be satisfactory. It is concluded that the transient response of the core internal structure of a PWR during the initial stage of LOCA can be analyzed by the displacement-based finite fluid element and the structural element. (orig.)

  14. Divergence of RNA polymerase ? subunits in angiosperm plastid genomes is mediated by genomic rearrangement

    OpenAIRE

    Blazier, J. Chris; Ruhlman, Tracey A.; Weng, Mao-Lun; Rehman, Sumaiyah K.; Sabir, Jamal S. M.; Jansen, Robert K.

    2016-01-01

    Genes for the plastid-encoded RNA polymerase (PEP) persist in the plastid genomes of all photosynthetic angiosperms. However, three unrelated lineages (Annonaceae, Passifloraceae and Geraniaceae) have been identified with unusually divergent open reading frames (ORFs) in the conserved region of rpoA, the gene encoding the PEP ? subunit. We used sequence-based approaches to evaluate whether these genes retain function. Both gene sequences and complete plastid genome sequences were assembled an...

  15. Transcriptional regulation and DNA methylation in plastids during transitional conversion of chloroplasts to chromoplasts.

    OpenAIRE

    Kobayashi, H; Ngernprasirtsiri, J; Akazawa, T

    1990-01-01

    During transitional conversion of chloroplasts to chromoplasts in ripening tomato (Lycopersicon esculentum) fruits, transcripts for several plastid genes for photosynthesis decreased to undetectable levels. Run-on transcription of plastids indicated that transcriptional regulation operated as a predominant factor. We found that most of the genes in chloroplasts were actively transcribed in vitro by Escherichia coli and soluble plastid RNA polymerases, but some genes in chromoplasts seemed to ...

  16. Cuscuta europaea plastid apparatus in various developmental stages

    Science.gov (United States)

    Švubová, Renáta; Ovečka, Miroslav; Pavlovič, Andrej; Slováková, Ľudmila; Blehová, Alžbeta

    2013-01-01

    It was generally accepted that Cuscuta europaea is mostly adapted to a parasitic lifestyle with no detectable levels of chlorophylls. We found out relatively high level of chlorophylls (Chls a+b) in young developmental stages of dodder. Significant lowering of Chls (a+b) content and increase of carotenoid concentration was typical only for ontogenetically more developed stages. Lower content of photosynthesis-related proteins involved in Chls biosynthesis and in photosystem formation as well as low photochemical activity of PSII indicate that photosynthesis is not the main activity of C. europaea plastids. Previously, it has been shown in other species that the Thylakoid Formation Protein 1 (THF1) is involved in thylakoid membrane differentiation, plant-fungal and plant-bacterial interactions and in sugar signaling with its preferential localization to plastids. Our immunofluorescence localization studies and analyses of haustorial plasma membrane fractions revealed that in addition to plastids, the THF1 protein localizes also to the plasma membrane and plasmodesmata in developing C. europaea haustorium, most abundantly in the digitate cells of the endophyte primordium. These results are supported by western blot analysis, documenting the highest levels of the THF1 protein in “get together” tissues of dodder and tobacco. Based on the fact that photosynthesis is not a typical process in the C. europaea haustorium and on the extra-plastidial localization pattern of the THF1, our data support rather other functions of this protein in the complex relationship between C. europaea and its host. PMID:23438585

  17. Development of Finite Element Response Model for Mechanistic - Empirical Design of Flexible Pavement

    Directory of Open Access Journals (Sweden)

    Mujtaba A. AHMED

    2012-08-01

    Full Text Available The focus of this work is to present a finite element method (FEM-based program of the M-E design on MATLAB protocol. The response output generated at critical locations are presented. The results were then compared with those from a locally available program called ‘NEMPADS’ and a reasonable comparison were achieved.

  18. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    Science.gov (United States)

    Lee, M O; Liu, Y; Zhang, X K

    1995-08-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid receptor (RAR) heterodimers as well as chicken ovalbumin upstream promoter transcription factor (COUP-TF) orphan receptor. In CV-1 cells, the lactoferrin-RARE linked with a heterologous thymidine kinase promoter was strongly activated by RXR homodimers in response to 9-cis-retinoic acid (9-cis-RA) but not to all-trans-RA. When the COUP-TF orphan receptor was cotransfected, the 9-cis-RA-induced RXR homodimer activity was strongly repressed. A unique feature of the lactoferrin-RARE is that it has an AGGTCA-like motif in common with an estrogen-responsive element (ERE). The composite RARE/ERE contributes to the functional interaction between retinoid receptors and the estrogen receptor (ER) and their ligands. In CV-1 cells, cotransfection of the retinoid and estrogen receptors led to mutual inhibition of the other's activity, while an RA-dependent inhibition of ER activity was observed in breast cancer cells. Furthermore, the lactoferrin-RARE/ERE showed differential transactivation activity in different cell types. RAs could activate the lactoferrin-RARE/ERE in human leukemia HL-60 cells and U937 cells but not in human breast cancer cells. By gel retardation analyses, we demonstrated that strong binding of the endogenous COUP-TF in breast cancer cells to the composite element contributed to diminished RA response in these cells. Thus, the lactoferrin-RARE/ERE functions as a signaling switch module that mediates multihormonal responsiveness in the regulation of lactoferrin gene

  19. Functional analysis of the stress response element and its role in the multistress response of Saccharomyces cerevisiae.

    Science.gov (United States)

    Treger, J M; Magee, T R; McEntee, K

    1998-02-04

    The DDR2 gene of Saccharomyces cerevisiae is a multistress response gene whose transcription is rapidly and strongly induced by a diverse array of xenobiotic agents, and environmental and physiological conditions. The multistress response of this gene requires the pentanucleotide, 5' CCCCT, (C4T;STRE (STress Response Element)) and the zinc-finger transcription factors, Msn2p and Msn4p. A 51bp oligonucleotide (oligo 31/32) containing two STREs from the DDR2 promoter region was previously shown to direct heat shock activation of a lacZ reporter gene. In this work we demonstrate that the same element conferred a complete multistress response to an E. coli galK reporter gene introduced into yeast cells. A variant oligonucleotide in which both the STRE spacing and neighboring sequences were altered responded to the same spectrum of stresses, while substitution of nucleotides within the pentanucleotide completely abolished the multistress response. These results directly demonstrate that STREs are not only necessary but are sufficient for mediating a transcriptional response to a surprisingly diverse set of environmental and physiological conditions.

  20. Over-expression of Arabidopsis thaliana SFD1/GLY1, the gene encoding plastid localized glycerol-3-phosphate dehydrogenase, increases plastidic lipid content in transgenic rice plants.

    Science.gov (United States)

    Singh, Vijayata; Singh, Praveen Kumar; Siddiqui, Adnan; Singh, Subaran; Banday, Zeeshan Zahoor; Nandi, Ashis Kumar

    2016-03-01

    Lipids are the major constituents of all membranous structures in plants. Plants possess two pathways for lipid biosynthesis: the prokaryotic pathway (i.e., plastidic pathway) and the eukaryotic pathway (i.e., endoplasmic-reticulum (ER) pathway). Whereas some plants synthesize galactolipids from diacylglycerol assembled in the plastid, others, including rice, derive their galactolipids from diacylglycerols assembled by the eukaryotic pathway. Arabidopsis thaliana glycerol-3-phosphate dehydrogenase (G3pDH), coded by SUPPRESSOR OF FATTY ACID DESATURASE 1 (SFD1; alias GLY1) gene, catalyzes the formation of glycerol 3-phosphate (G3p), the backbone of many membrane lipids. Here SFD1 was introduced to rice as a transgene. Arabidopsis SFD1 localizes in rice plastids and its over-expression increases plastidic membrane lipid content in transgenic rice plants without any major impact on ER lipids. The results suggest that over-expression of plastidic G3pDH enhances biosynthesis of plastid-localized lipids in rice. Lipid composition in the transgenic plants is consistent with increased phosphatidylglycerol synthesis in the plastid and increased galactolipid synthesis from diacylglycerol produced via the ER pathway. The transgenic plants show a higher photosynthetic assimilation rate, suggesting a possible application of this finding in crop improvement.

  1. The effect of loading time on flexible pavement dynamic response: a finite element analysis

    Science.gov (United States)

    Yin, Hao; Solaimanian, Mansour; Kumar, Tanmay; Stoffels, Shelley

    2007-12-01

    Dynamic response of asphalt concrete (AC) pavements under moving load is a key component for accurate prediction of flexible pavement performance. The time and temperature dependency of AC materials calls for utilizing advanced material characterization and mechanistic theories, such as viscoelasticity and stress/strain analysis. In layered elastic analysis, as implemented in the new Mechanistic-Empirical Pavement Design Guide (MEPDG), the time dependency is accounted for by calculating the loading times at different AC layer depths. In this study, the time effect on pavement response was evaluated by means of the concept of “pseudo temperature.” With the pavement temperature measured from instrumented thermocouples, the time and temperature dependency of AC materials was integrated into one single factor, termed “effective temperature.” Via this effective temperature, pavement responses under a transient load were predicted through finite element analysis. In the finite element model, viscoelastic behavior of AC materials was characterized through relaxation moduli, while the layers with unbound granular material were assumed to be in an elastic mode. The analysis was conducted for two different AC mixtures in a simplified flexible pavement structure at two different seasons. Finite element analysis results reveal that the loading time has a more pronounced impact on pavement response in the summer for both asphalt types. The results indicate that for reasonable prediction of dynamic response in flexible pavements, the effect of the depth-dependent loading time on pavement temperature should be considered.

  2. HPV-16 L1 genes with inactivated negative RNA elements induce potent immune responses

    International Nuclear Information System (INIS)

    Rollman, Erik; Arnheim, Lisen; Collier, Brian; Oeberg, Daniel; Hall, Haakan; Klingstroem, Jonas; Dillner, Joakim; Pastrana, Diana V.; Buck, Chris B.; Hinkula, Jorma; Wahren, Britta; Schwartz, Stefan

    2004-01-01

    Introduction of point mutations in the 5' end of the human papillomavirus type 16 (HPV-16) L1 gene specifically inactivates negative regulatory RNA processing elements. DNA vaccination of C57Bl/6 mice with the mutated L1 gene resulted in improved immunogenicity for both neutralizing antibodies as well as for broad cellular immune responses. Previous reports on the activation of L1 by codon optimization may be explained by inactivation of the regulatory RNA elements. The modified HPV-16 L1 DNA that induced anti-HPV-16 immunity may be seen as a complementary approach to protein subunit immunization against papillomavirus

  3. Plastid–Nuclear Interaction and Accelerated Coevolution in Plastid Ribosomal Genes in Geraniaceae

    Science.gov (United States)

    Weng, Mao-Lun; Ruhlman, Tracey A.; Jansen, Robert K.

    2016-01-01

    Plastids and mitochondria have many protein complexes that include subunits encoded by organelle and nuclear genomes. In animal cells, compensatory evolution between mitochondrial and nuclear-encoded subunits was identified and the high mitochondrial mutation rates were hypothesized to drive compensatory evolution in nuclear genomes. In plant cells, compensatory evolution between plastid and nucleus has rarely been investigated in a phylogenetic framework. To investigate plastid–nuclear coevolution, we focused on plastid ribosomal protein genes that are encoded by plastid and nuclear genomes from 27 Geraniales species. Substitution rates were compared for five sets of genes representing plastid- and nuclear-encoded ribosomal subunit proteins targeted to the cytosol or the plastid as well as nonribosomal protein controls. We found that nonsynonymous substitution rates (dN) and the ratios of nonsynonymous to synonymous substitution rates (ω) were accelerated in both plastid- (CpRP) and nuclear-encoded subunits (NuCpRP) of the plastid ribosome relative to control sequences. Our analyses revealed strong signals of cytonuclear coevolution between plastid- and nuclear-encoded subunits, in which nonsynonymous substitutions in CpRP and NuCpRP tend to occur along the same branches in the Geraniaceae phylogeny. This coevolution pattern cannot be explained by physical interaction between amino acid residues. The forces driving accelerated coevolution varied with cellular compartment of the sequence. Increased ω in CpRP was mainly due to intensified positive selection whereas increased ω in NuCpRP was caused by relaxed purifying selection. In addition, the many indels identified in plastid rRNA genes in Geraniaceae may have contributed to changes in plastid subunits. PMID:27190001

  4. The complete plastid genomes of the two 'dinotoms' Durinskia baltica and Kryptoperidinium foliaceum.

    Directory of Open Access Journals (Sweden)

    Behzad Imanian

    2010-05-01

    Full Text Available In one small group of dinoflagellates, photosynthesis is carried out by a tertiary endosymbiont derived from a diatom, giving rise to a complex cell that we collectively refer to as a 'dinotom'. The endosymbiont is separated from its host by a single membrane and retains plastids, mitochondria, a large nucleus, and many other eukaryotic organelles and structures, a level of complexity suggesting an early stage of integration. Although the evolution of these endosymbionts has attracted considerable interest, the plastid genome has not been examined in detail, and indeed no tertiary plastid genome has yet been sequenced.Here we describe the complete plastid genomes of two closely related dinotoms, Durinskia baltica and Kryptoperidinium foliaceum. The D. baltica (116470 bp and K. foliaceum (140426 bp plastid genomes map as circular molecules featuring two large inverted repeats that separate distinct single copy regions. The organization and gene content of the D. baltica plastid closely resemble those of the pennate diatom Phaeodactylum tricornutum. The K. foliaceum plastid genome is much larger, has undergone more reorganization, and encodes a putative tyrosine recombinase (tyrC also found in the plastid genome of the heterokont Heterosigma akashiwo, and two putative serine recombinases (serC1 and serC2 homologous to recombinases encoded by plasmids pCf1 and pCf2 in another pennate diatom, Cylindrotheca fusiformis. The K. foliaceum plastid genome also contains an additional copy of serC1, two degenerate copies of another plasmid-encoded ORF, and two non-coding regions whose sequences closely resemble portions of the pCf1 and pCf2 plasmids.These results suggest that while the plastid genomes of two dinotoms share very similar gene content and genome organization with that of the free-living pennate diatom P. tricornutum, the K. folicaeum plastid genome has absorbed two exogenous plasmids. Whether this took place before or after the tertiary

  5. Phylogenetic Analysis of Nucleus-Encoded Acetyl-CoA Carboxylases Targeted at the Cytosol and Plastid of Algae.

    KAUST Repository

    Huerlimann, Roger; Zenger, Kyall R; Jerry, Dean R; Heimann, Kirsten

    2015-01-01

    as Chromalveolata, forming the red lineage. However, recent genetic evidence groups the Stramenopiles, Alveolata and green plastid containing Rhizaria as SAR, excluding Haptophyta and Cryptophyta. Sequences coding for plastid and cytosol targeted homomeric ACCases

  6. Dynamic Response of a Planetary Gear System Using a Finite Element/Contact Mechanics Model

    Science.gov (United States)

    Parker, Robert G.; Agashe, Vinayak; Vijayakar, Sandeep M.

    2000-01-01

    The dynamic response of a helicopter planetary gear system is examined over a wide range of operating speeds and torques. The analysis tool is a unique, semianalytical finite element formulation that admits precise representation of the tooth geometry and contact forces that are crucial in gear dynamics. Importantly, no a priori specification of static transmission error excitation or mesh frequency variation is required; the dynamic contact forces are evaluated internally at each time step. The calculated response shows classical resonances when a harmonic of mesh frequency coincides with a natural frequency. However, peculiar behavior occurs where resonances expected to be excited at a given speed are absent. This absence of particular modes is explained by analytical relationships that depend on the planetary configuration and mesh frequency harmonic. The torque sensitivity of the dynamic response is examined and compared to static analyses. Rotation mode response is shown to be more sensitive to input torque than translational mode response.

  7. Creating diversified response profiles from a single quenchometric sensor element by using phase-resolved luminescence.

    Science.gov (United States)

    Tehan, Elizabeth C; Bukowski, Rachel M; Chodavarapu, Vamsy P; Titus, Albert H; Cartwright, Alexander N; Bright, Frank V

    2015-01-05

    We report a new strategy for generating a continuum of response profiles from a single luminescence-based sensor element by using phase-resolved detection. This strategy yields reliable responses that depend in a predictable manner on changes in the luminescent reporter lifetime in the presence of the target analyte, the excitation modulation frequency, and the detector (lock-in amplifier) phase angle. In the traditional steady-state mode, the sensor that we evaluate exhibits a linear, positive going response to changes in the target analyte concentration. Under phase-resolved conditions the analyte-dependent response profiles: (i) can become highly non-linear; (ii) yield negative going responses; (iii) can be biphasic; and (iv) can exhibit super sensitivity (e.g., sensitivities up to 300 fold greater in comparison to steady-state conditions).

  8. Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element.

    Science.gov (United States)

    Watanabe, Kenneth A; Homayouni, Arielle; Gu, Lingkun; Huang, Kuan-Ying; Ho, Tuan-Hua David; Shen, Qingxi J

    2017-09-01

    Seeds serve as a great model to study plant responses to drought stress, which is largely mediated by abscisic acid (ABA). The ABA responsive element (ABRE) is a key cis-regulatory element in ABA signalling. However, its consensus sequence (ACGTG(G/T)C) is present in the promoters of only about 40% of ABA-induced genes in rice aleurone cells, suggesting other ABREs may exist. To identify novel ABREs, RNA sequencing was performed on aleurone cells of rice seeds treated with 20 μM ABA. Gibbs sampling was used to identify enriched elements, and particle bombardment-mediated transient expression studies were performed to verify the function. Gene ontology analysis was performed to predict the roles of genes containing the novel ABREs. This study revealed 2443 ABA-inducible genes and a novel ABRE, designated as ABREN, which was experimentally verified to mediate ABA signalling in rice aleurone cells. Many of the ABREN-containing genes are predicted to be involved in stress responses and transcription. Analysis of other species suggests that the ABREN may be monocot specific. This study also revealed interesting expression patterns of genes involved in ABA metabolism and signalling. Collectively, this study advanced our understanding of diverse cis-regulatory sequences and the transcriptomes underlying ABA responses in rice aleurone cells. © 2017 John Wiley & Sons Ltd.

  9. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Science.gov (United States)

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  10. Seismic response of three-dimensional rockfill dams using the Indirect Boundary Element Method

    International Nuclear Information System (INIS)

    Sanchez-Sesma, Francisco J; Arellano-Guzman, Mauricio; Perez-Gavilan, Juan J; Suarez, Martha; Marengo-Mogollon, Humberto; Chaillat, Stephanie; Jaramillo, Juan Diego; Gomez, Juan; Iturraran-Viveros, Ursula; Rodriguez-Castellanos, Alejandro

    2010-01-01

    The Indirect Boundary Element Method (IBEM) is used to compute the seismic response of a three-dimensional rockfill dam model. The IBEM is based on a single layer integral representation of elastic fields in terms of the full-space Green function, or fundamental solution of the equations of dynamic elasticity, and the associated force densities along the boundaries. The method has been applied to simulate the ground motion in several configurations of surface geology. Moreover, the IBEM has been used as benchmark to test other procedures. We compute the seismic response of a three-dimensional rockfill dam model placed within a canyon that constitutes an irregularity on the surface of an elastic half-space. The rockfill is also assumed elastic with hysteretic damping to account for energy dissipation. Various types of incident waves are considered to analyze the physical characteristics of the response: symmetries, amplifications, impulse response and the like. Computations are performed in the frequency domain and lead to time response using Fourier analysis. In the present implementation a symmetrical model is used to test symmetries. The boundaries of each region are discretized into boundary elements whose size depends on the shortest wavelength, typically, six boundary segments per wavelength. Usually, the seismic response of rockfill dams is simulated using either finite elements (FEM) or finite differences (FDM). In most applications, commercial tools that combine features of these methods are used to assess the seismic response of the system for a given motion at the base of model. However, in order to consider realistic excitation of seismic waves with different incidence angles and azimuth we explore the IBEM.

  11. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    Science.gov (United States)

    Bi, Rong; Ismar, Stefanie M. H.; Sommer, Ulrich; Zhao, Meixun

    2018-02-01

    Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs) in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C), three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1) and two pCO2 levels (560 and 2400 µatm). Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON) and low ratios of PON vs. particulate organic phosphorus (PON : POP) in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC) and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2) on elemental cellular contents and docosahexaenoic acid (DHA) proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2). Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  12. Verification of Advective Bar Elements Implemented in the Aria Thermal Response Code.

    Energy Technology Data Exchange (ETDEWEB)

    Mills, Brantley [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2016-01-01

    A verification effort was undertaken to evaluate the implementation of the new advective bar capability in the Aria thermal response code. Several approaches to the verification process were taken : a mesh refinement study to demonstrate solution convergence in the fluid and the solid, visually examining the mapping of the advective bar element nodes to the surrounding surfaces, and a comparison of solutions produced using the advective bars for simple geometries with solutions from commercial CFD software . The mesh refinement study has shown solution convergence for simple pipe flow in both temperature and velocity . Guidelines were provided to achieve appropriate meshes between the advective bar elements and the surrounding volume. Simulations of pipe flow using advective bars elements in Aria have been compared to simulations using the commercial CFD software ANSYS Fluent (r) and provided comparable solutions in temperature and velocity supporting proper implementation of the new capability. Verification of Advective Bar Elements iv Acknowledgements A special thanks goes to Dean Dobranich for his guidance and expertise through all stages of this effort . His advice and feedback was instrumental to its completion. Thanks also goes to Sam Subia and Tolu Okusanya for helping to plan many of the verification activities performed in this document. Thank you to Sam, Justin Lamb and Victor Brunini for their assistance in resolving issues encountered with running the advective bar element model. Finally, thanks goes to Dean, Sam, and Adam Hetzler for reviewing the document and providing very valuable comments.

  13. Frequency response analysis of cylindrical shells conveying fluid using finite element method

    International Nuclear Information System (INIS)

    Seo, Young Soo; Jeong, Weui Bong; Yoo, Wan Suk; Jeong, Ho Kyeong

    2005-01-01

    A finite element vibration analysis of thin-walled cylindrical shells conveying fluid with uniform velocity is presented. The dynamic behavior of thin-walled shell is based on the Sanders' theory and the fluid in cylindrical shell is considered as inviscid and incompressible so that it satisfies the Laplace's equation. A beam-like shell element is used to reduce the number of degree-of-freedom by restricting to the circumferential modes of cylindrical shell. An estimation of frequency response function of the pipe considering of the coupled effects of the internal fluid is presented. A dynamic coupling condition of the interface between the fluid and the structure is used. The effective thickness of fluid according to circumferential modes is also discussed. The influence of fluid velocity on the frequency response function is illustrated and discussed. The results by this method are compared with published results and those by commercial tools

  14. Prediction of elastic-plastic response of structural elements subjected to cyclic loading

    International Nuclear Information System (INIS)

    El Haddad, M.H.; Samaan, S.

    1985-01-01

    A simplified elastic-plastic analysis is developed to predict stress strain and force deformation response of structural metallic elements subjected to irregular cyclic loadings. In this analysis a simple elastic-plastic method for predicting the skeleton force deformation curve is developed. In this method, elastic and fully plastic solutions are first obtained for unknown quantities, such as deflection or local strains. Elastic and fully plastic contributions are then combined to obtain an elastic-plastic solution. The skeleton curve is doubled to establish the shape of the hysteresis loop. The complete force deformation response can therefore be simulated through reversal by reversal in accordance with hysteresis looping and material memory. Several examples of structural elements with various cross sections made from various materials and subjected to irregular cyclic loadings, are analysed. A close agreement is obtained between experimental results found in the literature and present predictions. (orig.)

  15. Complete Plastid Genome Sequencing of Four Tilia Species (Malvaceae: A Comparative Analysis and Phylogenetic Implications.

    Directory of Open Access Journals (Sweden)

    Jie Cai

    Full Text Available Tilia is an ecologically and economically important genus in the family Malvaceae. However, there is no complete plastid genome of Tilia sequenced to date, and the taxonomy of Tilia is difficult owing to frequent hybridization and polyploidization. A well-supported interspecific relationships of this genus is not available due to limited informative sites from the commonly used molecular markers. We report here the complete plastid genome sequences of four Tilia species determined by the Illumina technology. The Tilia plastid genome is 162,653 bp to 162,796 bp in length, encoding 113 unique genes and a total number of 130 genes. The gene order and organization of the Tilia plastid genome exhibits the general structure of angiosperms and is very similar to other published plastid genomes of Malvaceae. As other long-lived tree genera, the sequence divergence among the four Tilia plastid genomes is very low. And we analyzed the nucleotide substitution patterns and the evolution of insertions and deletions in the Tilia plastid genomes. Finally, we build a phylogeny of the four sampled Tilia species with high supports using plastid phylogenomics, suggesting that it is an efficient way to resolve the phylogenetic relationships of this genus.

  16. Endosymbiosis undone by stepwise elimination of the plastid in a parasitic dinoflagellate

    KAUST Repository

    Gornik, Sebastian G.; Febrimarsa,; Cassin, Andrew M.; MacRae, James I.; Ramaprasad, Abhinay; Rchiad, ‍ Zineb; McConville, Malcolm J.; Bacic, Antony; McFadden, Geoffrey I.; Pain, Arnab; Waller, Ross F.

    2015-01-01

    Organelle gain through endosymbiosis has been integral to the origin and diversification of eukaryotes, and, once gained, plastids and mitochondria seem seldom lost. Indeed, discovery of nonphotosynthetic plastids in many eukaryotes - notably, the apicoplast in apicomplexan parasites such as the malaria pathogen Plasmodium - highlights the essential metabolic functions performed by plastids beyond photosynthesis. Once a cell becomes reliant on these ancillary functions, organelle dependence is apparently difficult to overcome. Previous examples of endosymbiotic organelle loss (either mitochondria or plastids), which have been invoked to explain the origin of eukaryotic diversity, have subsequently been recognized as organelle reduction to cryptic forms, such as mitosomes and apicoplasts. Integration of these ancient symbionts with their hosts has been too well developed to reverse. Here, we provide evidence that the dinoflagellate Hematodinium sp., a marine parasite of crustaceans, represents a rare case of endosymbiotic organelle loss by the elimination of the plastid. Extensive RNA and genomic sequencing data provide no evidence for a plastid organelle, but, rather, reveal a metabolic decoupling from known plastid functions that typically impede organelle loss. This independence has been achieved through retention of ancestral anabolic pathways, enzyme relocation from the plastid to the cytosol, and metabolic scavenging from the parasite's host. Hematodinium sp. thus represents a further dimension of endosymbiosis-life after the organelle. © 2015, National Academy of Sciences. All rights reserved.

  17. Endosymbiosis undone by stepwise elimination of the plastid in a parasitic dinoflagellate

    KAUST Repository

    Gornik, Sebastian G.

    2015-04-20

    Organelle gain through endosymbiosis has been integral to the origin and diversification of eukaryotes, and, once gained, plastids and mitochondria seem seldom lost. Indeed, discovery of nonphotosynthetic plastids in many eukaryotes - notably, the apicoplast in apicomplexan parasites such as the malaria pathogen Plasmodium - highlights the essential metabolic functions performed by plastids beyond photosynthesis. Once a cell becomes reliant on these ancillary functions, organelle dependence is apparently difficult to overcome. Previous examples of endosymbiotic organelle loss (either mitochondria or plastids), which have been invoked to explain the origin of eukaryotic diversity, have subsequently been recognized as organelle reduction to cryptic forms, such as mitosomes and apicoplasts. Integration of these ancient symbionts with their hosts has been too well developed to reverse. Here, we provide evidence that the dinoflagellate Hematodinium sp., a marine parasite of crustaceans, represents a rare case of endosymbiotic organelle loss by the elimination of the plastid. Extensive RNA and genomic sequencing data provide no evidence for a plastid organelle, but, rather, reveal a metabolic decoupling from known plastid functions that typically impede organelle loss. This independence has been achieved through retention of ancestral anabolic pathways, enzyme relocation from the plastid to the cytosol, and metabolic scavenging from the parasite\\'s host. Hematodinium sp. thus represents a further dimension of endosymbiosis-life after the organelle. © 2015, National Academy of Sciences. All rights reserved.

  18. Reactor calculation in coarse mesh by finite element method applied to matrix response method

    International Nuclear Information System (INIS)

    Nakata, H.

    1982-01-01

    The finite element method is applied to the solution of the modified formulation of the matrix-response method aiming to do reactor calculations in coarse mesh. Good results are obtained with a short running time. The method is applicable to problems where the heterogeneity is predominant and to problems of evolution in coarse meshes where the burnup is variable in one same coarse mesh, making the cross section vary spatially with the evolution. (E.G.) [pt

  19. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    OpenAIRE

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by ...

  20. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Science.gov (United States)

    Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L

    2013-01-01

    The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.

  1. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Directory of Open Access Journals (Sweden)

    Linda J Savage

    Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles

  2. Plastid-bearing sea slugs fix CO2 in the light but do not require photosynthesis to survive

    NARCIS (Netherlands)

    Christa, Gregor; Zimorski, Verena; Woehle, Christian; Tielens, Aloysius G M; Wägele, Heike; Martin, William F; Gould, Sven B

    2014-01-01

    Several sacoglossan sea slugs (Plakobranchoidea) feed upon plastids of large unicellular algae. Four species--called long-term retention (LtR) species--are known to sequester ingested plastids within specialized cells of the digestive gland. There, the stolen plastids (kleptoplasts) remain

  3. Revisiting the Relationship between Transposable Elements and the Eukaryotic Stress Response.

    Science.gov (United States)

    Horváth, Vivien; Merenciano, Miriam; González, Josefa

    2017-11-01

    A relationship between transposable elements (TEs) and the eukaryotic stress response was suggested in the first publications describing TEs. Since then, it has often been assumed that TEs are activated by stress, and that this activation is often beneficial for the organism. In recent years, the availability of new high-throughput experimental techniques has allowed further interrogation of the relationship between TEs and stress. By reviewing the recent literature, we conclude that although there is evidence for a beneficial effect of TE activation under stress conditions, the relationship between TEs and the eukaryotic stress response is quite complex. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Effect of randomness on multi-frequency aeroelastic responses resolved by Unsteady Adaptive Stochastic Finite Elements

    International Nuclear Information System (INIS)

    Witteveen, Jeroen A.S.; Bijl, Hester

    2009-01-01

    The Unsteady Adaptive Stochastic Finite Elements (UASFE) method resolves the effect of randomness in numerical simulations of single-mode aeroelastic responses with a constant accuracy in time for a constant number of samples. In this paper, the UASFE framework is extended to multi-frequency responses and continuous structures by employing a wavelet decomposition pre-processing step to decompose the sampled multi-frequency signals into single-frequency components. The effect of the randomness on the multi-frequency response is then obtained by summing the results of the UASFE interpolation at constant phase for the different frequency components. Results for multi-frequency responses and continuous structures show a three orders of magnitude reduction of computational costs compared to crude Monte Carlo simulations in a harmonically forced oscillator, a flutter panel problem, and the three-dimensional transonic AGARD 445.6 wing aeroelastic benchmark subject to random fields and random parameters with various probability distributions.

  5. Identification and characterization of plastid-type proteins from sequence-attributed features using machine learning

    Science.gov (United States)

    2013-01-01

    Background Plastids are an important component of plant cells, being the site of manufacture and storage of chemical compounds used by the cell, and contain pigments such as those used in photosynthesis, starch synthesis/storage, cell color etc. They are essential organelles of the plant cell, also present in algae. Recent advances in genomic technology and sequencing efforts is generating a huge amount of DNA sequence data every day. The predicted proteome of these genomes needs annotation at a faster pace. In view of this, one such annotation need is to develop an automated system that can distinguish between plastid and non-plastid proteins accurately, and further classify plastid-types based on their functionality. We compared the amino acid compositions of plastid proteins with those of non-plastid ones and found significant differences, which were used as a basis to develop various feature-based prediction models using similarity-search and machine learning. Results In this study, we developed separate Support Vector Machine (SVM) trained classifiers for characterizing the plastids in two steps: first distinguishing the plastid vs. non-plastid proteins, and then classifying the identified plastids into their various types based on their function (chloroplast, chromoplast, etioplast, and amyloplast). Five diverse protein features: amino acid composition, dipeptide composition, the pseudo amino acid composition, Nterminal-Center-Cterminal composition and the protein physicochemical properties are used to develop SVM models. Overall, the dipeptide composition-based module shows the best performance with an accuracy of 86.80% and Matthews Correlation Coefficient (MCC) of 0.74 in phase-I and 78.60% with a MCC of 0.44 in phase-II. On independent test data, this model also performs better with an overall accuracy of 76.58% and 74.97% in phase-I and phase-II, respectively. The similarity-based PSI-BLAST module shows very low performance with about 50% prediction

  6. RNase P RNA from the Recently Evolved Plastid of Paulinella and from Algae

    Directory of Open Access Journals (Sweden)

    Pilar Bernal-Bayard

    2014-11-01

    Full Text Available The RNase P RNA catalytic subunit (RPR encoded in some plastids has been found to be functionally defective. The amoeba Paulinella chromatophora contains an organelle (chromatophore that is derived from the recent endosymbiotic acquisition of a cyanobacterium, and therefore represents a model of the early steps in the acquisition of plastids. In contrast with plastid RPRs the chromatophore RPR retains functionality similar to the cyanobacterial enzyme. The chromatophore RPR sequence deviates from consensus at some positions but those changes allow optimal activity compared with mutated chromatophore RPR with the consensus sequence. We have analyzed additional RPR sequences identifiable in plastids and have found that it is present in all red algae and in several prasinophyte green algae. We have assayed in vitro a subset of the plastid RPRs not previously analyzed and confirm that these organelle RPRs lack RNase P activity in vitro.

  7. Interdependency of formation and localisation of the Min complex controls symmetric plastid division.

    Science.gov (United States)

    Maple, Jodi; Møller, Simon G

    2007-10-01

    Plastid division represents a fundamental biological process essential for plant development; however, the molecular basis of symmetric plastid division is unclear. AtMinE1 plays a pivotal role in selection of the plastid division site in concert with AtMinD1. AtMinE1 localises to discrete foci in chloroplasts and interacts with AtMinD1, which shows a similar localisation pattern. Here, we investigate the importance of Min protein complex formation during the chloroplast division process. Dissection of the assembly of the Min protein complex and determination of the interdependency of complex assembly and localisation in planta allow us to present a model of the molecular basis of selection of the division site in plastids. Moreover, functional analysis of AtMinE1 in bacteria demonstrates the level of functional conservation and divergence of the plastidic MinE proteins.

  8. Complete plastid genome of Astragalus mongholicus var. nakaianus (Fabaceae).

    Science.gov (United States)

    Choi, In-Su; Kim, Joo-Hwan; Choi, Byoung-Hee

    2016-07-01

    The first complete plastid genome (plastome) of the largest angiosperm genus, Astragalus, was sequenced for the Korean endangered endemic species A. mongholicus var. nakaianus. Its genome is relatively short (123,633 bp) because it lacks an Inverted Repeat (IR) region. It comprises 110 genes, including four unique rRNAs, 30 tRNAs, and 76 protein-coding genes. Similar to other closely related plastomes, rpl22 and rps16 are absent. The putative pseudogene with abnormal stop codons is atpE. This plastome has no additional inversions when compared with highly variable plastomes from IRLC tribes Fabeae and Trifolieae. Our phylogenetic analysis confirms the non-monophyly of Galegeae.

  9. Development of a Rapidly Deployed Department of Energy Emergency Response Element

    International Nuclear Information System (INIS)

    Riland, C.A.; Hopkins, R.C.; Tighe, R.J.

    1999-01-01

    The Federal Radiological Emergency Response Plan (FRERP) directs the Department of Energy (DOE) to maintain a viable, timely, and fully documented response option capable of supporting the responsible Lead Federal Agency in the event of a radiological emergency impacting any state or US territory (e.g., CONUS). In addition, the DOE maintains a response option to support radiological emergencies outside the continental US (OCONUS). While the OCUNUS mission is not governed by the FREP, this response is operationally similar to that assigned to the DOE by the FREP. The DOE is prepared to alert, activate, and deploy radiological response teams to augment the Radiological Assistance Program and/or local responders. The Radiological Monitoring and Assessment Center (RMAC) is a phased response that integrates with the Federal Radiological Monitoring and Assessment Center (FRMAC) in CONUS environments and represents a stand-alone DOE response for OCONUS environments. The FRMAC/RMAC Phase I was formally ''stood up'' as an operational element in April 1999. The FRMAC/RMAC Phase II proposed ''stand-up'' date is midyear 2000

  10. Opposite roles of the Arabidopsis cytokinin receptors AHK2 and AHK3 in the expression of plastid genes and genes for the plastid transcriptional machinery during senescence.

    Science.gov (United States)

    Danilova, Maria N; Kudryakova, Natalia V; Doroshenko, Anastasia S; Zabrodin, Dmitry A; Rakhmankulova, Zulfira F; Oelmüller, Ralf; Kusnetsov, Victor V

    2017-03-01

    Cytokinin membrane receptors of the Arabidopsis thaliana AHK2 and AHK3 play opposite roles in the expression of plastid genes and genes for the plastid transcriptional machinery during leaf senescence Loss-of-function mutants of Arabidopsis thaliana were used to study the role of cytokinin receptors in the expression of chloroplast genes during leaf senescence. Accumulation of transcripts of several plastid-encoded genes is dependent on the АНК2/АНК3 receptor combination. АНК2 is particularly important at the final stage of plant development and, unlike АНК3, a positive regulator of leaf senescence. Cytokinin-dependent up-regulation of the nuclear encoded genes for chloroplast RNA polymerases RPOTp and RPOTmp suggests that the hormone controls plastid gene expression, at least in part, via the expression of nuclear genes for the plastid transcription machinery. This is further supported by cytokinin dependent regulation of genes for the nuclear encoded plastid σ-factors, SIG1-6, which code for components of the transcriptional apparatus in chloroplasts.

  11. Analysis of Resonance Response Performance of C-Band Antenna Using Parasitic Element

    Science.gov (United States)

    Islam, M. T.; Misran, N.; Mandeep, J. S.

    2014-01-01

    Analysis of the resonance response improvement of a planar C-band (4–8 GHz) antenna is proposed using parasitic element method. This parasitic element based method is validated for change in the active and parasitic antenna elements. A novel dual-band antenna for C-band application covering 5.7 GHz and 7.6 GHz is designed and fabricated. The antenna is composed of circular parasitic element with unequal microstrip lines at both sides and a rectangular partial ground plane. A fractional bandwidth of 13.5% has been achieved from 5.5 GHz to 6.3 GHz (WLAN band) for the lower band. The upper band covers from 7.1 GHz to 8 GHz with a fractional bandwidth of 12%. A gain of 6.4 dBi is achieved at the lower frequency and 4 dBi is achieved at the upper frequency. The VSWR of the antenna is less than 2 at the resonance frequency. PMID:24895643

  12. Paired hormone response elements predict caveolin-1 as a glucocorticoid target gene.

    Directory of Open Access Journals (Sweden)

    Marinus F van Batenburg

    2010-01-01

    Full Text Available Glucocorticoids act in part via glucocorticoid receptor binding to hormone response elements (HREs, but their direct target genes in vivo are still largely unknown. We developed the criterion that genomic occurrence of paired HREs at an inter-HRE distance less than 200 bp predicts hormone responsiveness, based on synergy of multiple HREs, and HRE information from known target genes. This criterion predicts a substantial number of novel responsive genes, when applied to genomic regions 10 kb upstream of genes. Multiple-tissue in situ hybridization showed that mRNA expression of 6 out of 10 selected genes was induced in a tissue-specific manner in mice treated with a single dose of corticosterone, with the spleen being the most responsive organ. Caveolin-1 was strongly responsive in several organs, and the HRE pair in its upstream region showed increased occupancy by glucocorticoid receptor in response to corticosterone. Our approach allowed for discovery of novel tissue specific glucocorticoid target genes, which may exemplify responses underlying the permissive actions of glucocorticoids.

  13. Regulation of Cancer Cell Responsiveness to Ionizing Radiation Treatment by Cyclic AMP Response Element Binding Nuclear Transcription Factor

    Directory of Open Access Journals (Sweden)

    Francesca D’Auria

    2017-05-01

    Full Text Available Cyclic AMP response element binding (CREB protein is a member of the CREB/activating transcription factor (ATF family of transcription factors that play an important role in the cell response to different environmental stimuli leading to proliferation, differentiation, apoptosis, and survival. A number of studies highlight the involvement of CREB in the resistance to ionizing radiation (IR therapy, demonstrating a relationship between IR-induced CREB family members’ activation and cell survival. Consistent with these observations, we have recently demonstrated that CREB and ATF-1 are expressed in leukemia cell lines and that low-dose radiation treatment can trigger CREB activation, leading to survival of erythro-leukemia cells (K562. On the other hand, a number of evidences highlight a proapoptotic role of CREB following IR treatment of cancer cells. Since the development of multiple mechanisms of resistance is one key problem of most malignancies, including those of hematological origin, it is highly desirable to identify biological markers of responsiveness/unresponsiveness useful to follow-up the individual response and to adjust anticancer treatments. Taking into account all these considerations, this mini-review will be focused on the involvement of CREB/ATF family members in response to IR therapy, to deepen our knowledge of this topic, and to pave the way to translation into a therapeutic context.

  14. A sea slug’s guide to plastid symbiosis

    Directory of Open Access Journals (Sweden)

    Jan de Vries

    2014-12-01

    Full Text Available Some 140 years ago sea slugs that contained chlorophyll-pigmented granules similar to those of plants were described. While we now understand that these “green granules” are plastids the slugs sequester from siphonaceous algae upon which they feed, surprisingly little is really known about the molecular details that underlie this one of a kind animal-plastid symbiosis. Kleptoplasts are stored in the cytosol of epithelial cells that form the slug’s digestive tubules, and one would guess that the stolen organelles are acquired for their ability to fix carbon, but studies have never really been able to prove that. We also do not know how the organelles are distinguished from the remaining food particles the slugs incorporate with their meal and that include algal mitochondria and nuclei. We know that the ability to store kleptoplasts long-term has evolved only a few times independently among hundreds of sacoglossan species, but we have no idea on what basis. Here we take a closer look at the history of sacoglossan research and discuss recent developments. We argue that, in order to understand what makes this symbiosis work, we will need to focus on the animal’s physiology just as much as we need to commence a detailed analysis of the plastids’ photobiology. Understanding kleptoplasty in sacoglossan slugs requires an unbiased multidisciplinary approach.

  15. Codon adaptation and synonymous substitution rate in diatom plastid genes.

    Science.gov (United States)

    Morton, Brian R; Sorhannus, Ulf; Fox, Martin

    2002-07-01

    Diatom plastid genes are examined with respect to codon adaptation and rates of silent substitution (Ks). It is shown that diatom genes follow the same pattern of codon usage as other plastid genes studied previously. Highly expressed diatom genes display codon adaptation, or a bias toward specific major codons, and these major codons are the same as those in red algae, green algae, and land plants. It is also found that there is a strong correlation between Ks and variation in codon adaptation across diatom genes, providing the first evidence for such a relationship in the algae. It is argued that this finding supports the notion that the correlation arises from selective constraints, not from variation in mutation rate among genes. Finally, the diatom genes are examined with respect to variation in Ks among different synonymous groups. Diatom genes with strong codon adaptation do not show the same variation in synonymous substitution rate among codon groups as the flowering plant psbA gene which, previous studies have shown, has strong codon adaptation but unusually high rates of silent change in certain synonymous groups. The lack of a similar finding in diatoms supports the suggestion that the feature is unique to the flowering plant psbA due to recent relaxations in selective pressure in that lineage.

  16. Effects of rare earth elements and REE-binding proteins on physiological responses in plants.

    Science.gov (United States)

    Liu, Dongwu; Wang, Xue; Chen, Zhiwei

    2012-02-01

    Rare earth elements (REEs), which include 17 elements in the periodic table, share chemical properties related to a similar external electronic configuration. REEs enriched fertilizers have been used in China since the 1980s. REEs could enter the cell and cell organelles, influence plant growth, and mainly be bound with the biological macromolecules. REE-binding proteins have been found in some plants. In addition, the chlorophyll activities and photosynthetic rate can be regulated by REEs. REEs could promote the protective function of cell membrane and enhance the plant resistance capability to stress produced by environmental factors, and affect the plant physiological mechanism by regulating the Ca²⁺ level in the plant cells. The focus of present review is to describe how REEs and REE-binding proteins participate in the physiological responses in plants.

  17. An exceptional horizontal gene transfer in plastids: gene replacement by a distant bacterial paralog and evidence that haptophyte and cryptophyte plastids are sisters

    Directory of Open Access Journals (Sweden)

    Palmer Jeffrey D

    2006-09-01

    Full Text Available Abstract Background Horizontal gene transfer (HGT to the plant mitochondrial genome has recently been shown to occur at a surprisingly high rate; however, little evidence has been found for HGT to the plastid genome, despite extensive sequencing. In this study, we analyzed all genes from sequenced plastid genomes to unearth any neglected cases of HGT and to obtain a measure of the overall extent of HGT to the plastid. Results Although several genes gave strongly supported conflicting trees under certain conditions, we are confident of HGT in only a single case beyond the rubisco HGT already reported. Most of the conflicts involved near neighbors connected by long branches (e.g. red algae and their secondary hosts, where phylogenetic methods are prone to mislead. However, three genes – clpP, ycf2, and rpl36 – provided strong support for taxa moving far from their organismal position. Further taxon sampling of clpP and ycf2 resulted in rejection of HGT due to long-branch attraction and a serious error in the published plastid genome sequence of Oenothera elata, respectively. A single new case, a bacterial rpl36 gene transferred into the ancestor of the cryptophyte and haptophyte plastids, appears to be a true HGT event. Interestingly, this rpl36 gene is a distantly related paralog of the rpl36 type found in other plastids and most eubacteria. Moreover, the transferred gene has physically replaced the native rpl36 gene, yet flanking genes and intergenic regions show no sign of HGT. This suggests that gene replacement somehow occurred by recombination at the very ends of rpl36, without the level and length of similarity normally expected to support recombination. Conclusion The rpl36 HGT discovered in this study is of considerable interest in terms of both molecular mechanism and phylogeny. The plastid acquisition of a bacterial rpl36 gene via HGT provides the first strong evidence for a sister-group relationship between haptophyte and

  18. An exceptional horizontal gene transfer in plastids: gene replacement by a distant bacterial paralog and evidence that haptophyte and cryptophyte plastids are sisters

    Science.gov (United States)

    Rice, Danny W; Palmer, Jeffrey D

    2006-01-01

    Background Horizontal gene transfer (HGT) to the plant mitochondrial genome has recently been shown to occur at a surprisingly high rate; however, little evidence has been found for HGT to the plastid genome, despite extensive sequencing. In this study, we analyzed all genes from sequenced plastid genomes to unearth any neglected cases of HGT and to obtain a measure of the overall extent of HGT to the plastid. Results Although several genes gave strongly supported conflicting trees under certain conditions, we are confident of HGT in only a single case beyond the rubisco HGT already reported. Most of the conflicts involved near neighbors connected by long branches (e.g. red algae and their secondary hosts), where phylogenetic methods are prone to mislead. However, three genes – clpP, ycf2, and rpl36 – provided strong support for taxa moving far from their organismal position. Further taxon sampling of clpP and ycf2 resulted in rejection of HGT due to long-branch attraction and a serious error in the published plastid genome sequence of Oenothera elata, respectively. A single new case, a bacterial rpl36 gene transferred into the ancestor of the cryptophyte and haptophyte plastids, appears to be a true HGT event. Interestingly, this rpl36 gene is a distantly related paralog of the rpl36 type found in other plastids and most eubacteria. Moreover, the transferred gene has physically replaced the native rpl36 gene, yet flanking genes and intergenic regions show no sign of HGT. This suggests that gene replacement somehow occurred by recombination at the very ends of rpl36, without the level and length of similarity normally expected to support recombination. Conclusion The rpl36 HGT discovered in this study is of considerable interest in terms of both molecular mechanism and phylogeny. The plastid acquisition of a bacterial rpl36 gene via HGT provides the first strong evidence for a sister-group relationship between haptophyte and cryptophyte plastids to the

  19. Finite Element Based Response Surface Methodology to Optimize Segmental Tunnel Lining

    Directory of Open Access Journals (Sweden)

    A. Rastbood

    2017-04-01

    Full Text Available The main objective of this paper is to optimize the geometrical and engineering characteristics of concrete segments of tunnel lining using Finite Element (FE based Response Surface Methodology (RSM. Input data for RSM statistical analysis were obtained using FEM. In RSM analysis, thickness (t and elasticity modulus of concrete segments (E, tunnel height (H, horizontal to vertical stress ratio (K and position of key segment in tunnel lining ring (θ were considered as input independent variables. Maximum values of Mises and Tresca stresses and tunnel ring displacement (UMAX were set as responses. Analysis of variance (ANOVA was carried out to investigate the influence of each input variable on the responses. Second-order polynomial equations in terms of influencing input variables were obtained for each response. It was found that elasticity modulus and key segment position variables were not included in yield stresses and ring displacement equations, and only tunnel height and stress ratio variables were included in ring displacement equation. Finally optimization analysis of tunnel lining ring was performed. Due to absence of elasticity modulus and key segment position variables in equations, their values were kept to average level and other variables were floated in related ranges. Response parameters were set to minimum. It was concluded that to obtain optimum values for responses, ring thickness and tunnel height must be near to their maximum and minimum values, respectively and ground state must be similar to hydrostatic conditions.

  20. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    Directory of Open Access Journals (Sweden)

    R. Bi

    2018-02-01

    Full Text Available Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C, three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1 and two pCO2 levels (560 and 2400 µatm. Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON and low ratios of PON vs. particulate organic phosphorus (PON : POP in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2 on elemental cellular contents and docosahexaenoic acid (DHA proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2. Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  1. A novel radiation responsive cis-acting element regulates gene induction and mediates tissue injury

    International Nuclear Information System (INIS)

    Hallahan, Dennis E.; Virudachalam, Subbulakshmi; Kuchibahtla, Jaya

    1997-01-01

    containing binding domains for the transcription factors AP-1 and Ets. This DNA sequence (TGCCTCAGTTTCCC) is similar to antioxidant responsive element. X-ray- mediated transcriptional activation of the 5' regulatory region of ICAM-1 required the antioxidant responsive element (ARE). Electrophoretic mobility shift analysis of nuclear proteins from irradiated endothelial cells incubated with the ARE binding domain (5'-GCTGCTGCCTCAGTTTCCC-3') showed increased protein-DNA complexes at 60 and 120 minutes after irradiation. Conclusions: 1) ICAM induction in irradiated tissue occurs in the microvascular endothelium. 2) ICAM expression contributes to the pathogenesis of radiation-mediated tissue injury and the ICAM knockout serves as a model for the study of the pathogenesis of tissue injury. 3) ICAM expression is regulated by a novel radiation-inducible cis-acting element that has homology to previously identified antioxidant responsive elements

  2. Characterization of a hypoxia-response element in the Epo locus of the pufferfish, Takifugu rubripes.

    Science.gov (United States)

    Kulkarni, Rashmi P; Tohari, Sumanty; Ho, Adrian; Brenner, Sydney; Venkatesh, Byrappa

    2010-06-01

    Animals respond to hypoxia by increasing synthesis of the glycoprotein hormone erythropoietin (Epo) which in turn stimulates the production of red blood cells. The gene encoding Epo has been recently cloned in teleost fishes such as the pufferfish Takifugu rubripes (fugu) and zebrafish (Danio rerio). It has been shown that the transcription levels of Epo in teleost fishes increase in response to anemia or hypoxia in a manner similar to its human ortholog. However, the cis-regulatory element(s) mediating the hypoxia response of Epo gene in fishes has not been identified. In the present study, using the human hepatoma cell line (Hep3B), we have identified and characterized a hypoxia response element (HRE) in the fugu Epo locus. The sequence of the fugu HRE (ACGTGCTG) is identical to that of the HRE in the human EPO locus. However, unlike the HRE in the mammalian Epo locus, which is located in the 3' region of the gene, the fugu HRE is located in the 5' flanking region and on the opposite strand of DNA. This HRE is conserved in other teleosts such as Tetraodon and zebrafish in a similar location. A 365-bp fragment containing the fugu HRE was able to drive GFP expression in the liver of transgenic zebrafish. However, we could not ascertain if the expression of transgene is induced by hypoxia in vivo due to the low and variable levels of GFP expression in transgenic zebrafish. Our investigations also revealed that the Epo locus has experienced extensive rearrangements during vertebrate evolution. Copyright © 2010 Elsevier B.V. All rights reserved.

  3. ATP-dependent molecular chaperones in plastids--More complex than expected.

    Science.gov (United States)

    Trösch, Raphael; Mühlhaus, Timo; Schroda, Michael; Willmund, Felix

    2015-09-01

    Plastids are a class of essential plant cell organelles comprising photosynthetic chloroplasts of green tissues, starch-storing amyloplasts of roots and tubers or the colorful pigment-storing chromoplasts of petals and fruits. They express a few genes encoded on their organellar genome, called plastome, but import most of their proteins from the cytosol. The import into plastids, the folding of freshly-translated or imported proteins, the degradation or renaturation of denatured and entangled proteins, and the quality-control of newly folded proteins all require the action of molecular chaperones. Members of all four major families of ATP-dependent molecular chaperones (chaperonin/Cpn60, Hsp70, Hsp90 and Hsp100 families) have been identified in plastids from unicellular algae to higher plants. This review aims not only at giving an overview of the most current insights into the general and conserved functions of these plastid chaperones, but also into their specific plastid functions. Given that chloroplasts harbor an extreme environment that cycles between reduced and oxidized states, that has to deal with reactive oxygen species and is highly reactive to environmental and developmental signals, it can be presumed that plastid chaperones have evolved a plethora of specific functions some of which are just about to be discovered. Here, the most urgent questions that remain unsolved are discussed, and guidance for future research on plastid chaperones is given. This article is part of a Special Issue entitled: Chloroplast Biogenesis. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Spatially dependent burnup implementation into the nodal program based on the finite element response matrix method

    International Nuclear Information System (INIS)

    Yoriyaz, H.

    1986-01-01

    In this work a spatial burnup scheme and feedback effects has been implemented into the FERM ( 'Finite Element Response Matrix' )program. The spatially dependent neutronic parameters have been considered in three levels: zonewise calculation, assembly wise calculation and pointwise calculation. Flux and power distributions and the multiplication factor were calculated and compared with the results obtained by CITATIOn program. These comparisons showed that processing time in the Ferm code has been hundred of times shorter and no significant difference has been observed in the assembly average power distribution. (Author) [pt

  5. Altered response hierarchy and increased T-cell breadth upon HIV-1 conserved element DNA vaccination in macaques.

    Directory of Open Access Journals (Sweden)

    Viraj Kulkarni

    Full Text Available HIV sequence diversity and potential decoy epitopes are hurdles in the development of an effective AIDS vaccine. A DNA vaccine candidate comprising of highly conserved p24(gag elements (CE induced robust immunity in all 10 vaccinated macaques, whereas full-length gag DNA vaccination elicited responses to these conserved elements in only 5 of 11 animals, targeting fewer CE per animal. Importantly, boosting CE-primed macaques with DNA expressing full-length p55(gag increased both magnitude of CE responses and breadth of Gag immunity, demonstrating alteration of the hierarchy of epitope recognition in the presence of pre-existing CE-specific responses. Inclusion of a conserved element immunogen provides a novel and effective strategy to broaden responses against highly diverse pathogens by avoiding decoy epitopes, while focusing responses to critical viral elements for which few escape pathways exist.

  6. In vivo Assembly in Escherichia coli of Transformation Vectors for Plastid Genome Engineering

    Directory of Open Access Journals (Sweden)

    Yuyong Wu

    2017-08-01

    Full Text Available Plastid transformation for the expression of recombinant proteins and entire metabolic pathways has become a promising tool for plant biotechnology. However, large-scale application of this technology has been hindered by some technical bottlenecks, including lack of routine transformation protocols for agronomically important crop plants like rice or maize. Currently, there are no standard or commercial plastid transformation vectors available for the scientific community. Construction of a plastid transformation vector usually requires tedious and time-consuming cloning steps. In this study, we describe the adoption of an in vivo Escherichia coli cloning (iVEC technology to quickly assemble a plastid transformation vector. The method enables simple and seamless build-up of a complete plastid transformation vector from five DNA fragments in a single step. The vector assembled for demonstration purposes contains an enhanced green fluorescent protein (GFP expression cassette, in which the gfp transgene is driven by the tobacco plastid ribosomal RNA operon promoter fused to the 5′ untranslated region (UTR from gene10 of bacteriophage T7 and the transcript-stabilizing 3′UTR from the E. coli ribosomal RNA operon rrnB. Successful transformation of the tobacco plastid genome was verified by Southern blot analysis and seed assays. High-level expression of the GFP reporter in the transplastomic plants was visualized by confocal microscopy and Coomassie staining, and GFP accumulation was ~9% of the total soluble protein. The iVEC method represents a simple and efficient approach for construction of plastid transformation vector, and offers great potential for the assembly of increasingly complex vectors for synthetic biology applications in plastids.

  7. Integration of growth factor signals at the c-fos serum response element.

    Science.gov (United States)

    Price, M A; Hill, C; Treisman, R

    1996-04-29

    A transcription factor ternary complex composed of serum response factor (SRF) and a second factor, ternary complex factor (TCF), mediates the response of the c-fos Serum Response Element to growth factors and mitogens. In NIH3T3 fibroblasts, TCF binding is required for transcriptional activation by the SRE in response to activation of the Ras-Raf-ERK pathway. We compared the properties of three members of the TCF family, Elk-1, SAP-1 and SAP-2 (ERP/NET). Although all the proteins contain sequences required for ternary complex formation with SRF, only Elk-1 and SAP-1 appear to interact with the c-fos SRE efficiently in vivo. Each TCF contains a C-terminal activation domain capable of transcriptional activation in response to activation of the Ras-Raf-ERK pathway, and this is dependent on the integrity of S/T-P motifs conserved between all the TCF family members. In contrast, activation of the SRE by whole serum and the mitogenic phospholipid LPA requires SRF binding alone. Constitutively activated members of the Rho subfamily of Ras-like GTPases are also capable of inducing activation of the SRE in the absence of TCF; unlike activated Ras itself, these proteins do not activate the TCFs in NIH3T3 cells. At the SRE, SRF- and TCF-linked signalling pathways act synergistically to potentiate transcription.

  8. Mean annual response of lichen Parmelia sulcata to environmental elemental availability

    International Nuclear Information System (INIS)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Lichens collected in an area previously identified as unpolluted, were transplanted to six different places located in polluted areas near Power Plants (both fuel and coal powered). A total of 26 lichen transplants were made for each place, each transplant weighing about 2g. Two were analysed as zero or reference and the remain 24 were hanged in nylon net bags in order to be able to collect two transplants each month, out of every station during a one year period. Besides the 24 lichen samples, each station was provided with two total deposition collection 10 litter buckets (with 25 cm diameter funnels) and an aerosol sampler. Concentration in both lichens and aerosols were measured by PIXE and INAA at ITN. Total deposition residues were analysed by ICP-MS at the The Netherlands Geological Survey. On this work we present the results obtained by looking for correlation between lichens elemental concentrations and annual averages of elemental availability variables such as concentration in suspension in the atmosphere and concentration in total deposition samples, for a total of 40 elements. In order to access both the limitations and the reliability of the results a discussion on the details of handling this data set is presented. A mathematical function which tentatively represents the lichen up-take response to water availability is also proposed. (author)

  9. ZAP-70 and p72syk are signaling response elements through MHC class II molecules

    DEFF Research Database (Denmark)

    Kanner, S B; Grosmaire, L S; Blake, J

    1995-01-01

    Ligation of major histocompatibility complex (MHC) class II antigens expressed on antigen-activated human CD4+ T-lymphocytes induces early signal transduction events including the activation of tyrosine kinases, the tyrosine phosphorylation of phospholipase-C gamma 1 and the mobilization...... of intracellular calcium. Similar responses have been observed in B-cells following stimulation of MHC class II molecules, including the increased production of intracellular cAMP. In this report, we demonstrate that the ZAP-70 tyrosine kinase is a responsive signaling element following cross-linking of HLA...... by herbimycin A. MHC class II ligation on B-lymphocytes resulted in cell death, which was both qualitatively distinct from Fas-induced apoptosis and partially protected by herbimycin A pretreatment. Thus, ligation of MHC class II molecules expressed on human lymphocytes stimulates the ZAP-70/p72syk family...

  10. Improvement of dynamic response in an impact absorber by frictional elements

    International Nuclear Information System (INIS)

    Bedolla, Jorge; Szwedowicz, Dariusz; Cortes, Claudia; Gutierrezwing, Enrique S.; Jimenez, Juan; Majewski, Tadeusz

    2014-01-01

    A novel device that uses friction between one or more pairs of elastic conical rings to dissipate the energy from an impacting body is presented. The device consists of one moving and one stationary cylinders coupled to each other using two pairs of conical rings and a spring. The spring is used to restore the system to its original configuration after the impact. The dynamic response of the system to the impact forces during impact events is analysed numerically and experimentally. The effects of several governing parameters, such as the mass ratio between the cylinders, the duration of the transient response of the device, the magnitude of the rest zone of the moving element and the peak impact force are investigated. The proposed system is applicable in sequential impact scenarios, in which remarkable improvements were observed over traditional solid-rod impact absorbers. The present study may serve as a guide for the design of improved damping devices for impact applications.

  11. Calculation of foundation response to spatially varying ground motion by finite element method

    International Nuclear Information System (INIS)

    Wang, F.; Gantenbein, F.

    1995-01-01

    This paper presents a general method to compute the response of a rigid foundation of arbitrary shape resting on a homogeneous or multilayered elastic soil when subjected to a spatially varying ground motion. The foundation response is calculated from the free-field ground motion and the contact tractions between the foundation and the soil. The spatial variation of ground motion in this study is introduced by a coherence function and the contact tractions are obtained numerically using the Finite Element Method in the process of calculating the dynamic compliance of the foundation. Applications of this method to a massless rigid disc supported on an elastic half space and to that founded on an elastic medium consisting of a layer of constant thickness supported on an elastic half space are described. The numerical results obtained are in very good agreement with analytical solutions published in the literature. (authors). 5 refs., 8 figs

  12. Blast response of curved carbon/epoxy composite panels: Experimental study and finite-element analysis

    International Nuclear Information System (INIS)

    Phadnis, V A; Roy, A; Silberschmidt, V V; Kumar, P; Shukla, A

    2013-01-01

    Experimental and numerical studies were conducted to understand the effect of plate curvature on blast response of carbon/epoxy composite panels. A shock-tube system was utilized to impart controlled shock loading to quasi-isotropic composite panels with differing range of radii of curvatures. A 3D Digital Image Correlation (DIC) technique coupled with high-speed photography was used to obtain out-of-plane deflection and velocity, as well as in-plane strain on the back face of the panels. Macroscopic post-mortem analysis was performed to compare yielding and deformation in these panels. A dynamic computational simulation that integrates fluid-structure interaction was conducted to evaluate the panel response in general purpose finite-element software ABAQUS/Explicit. The obtained numerical results were compared to the experimental data and showed a good correlation

  13. Design of chimeric expression elements that confer high-level gene activity in chromoplasts.

    Science.gov (United States)

    Caroca, Rodrigo; Howell, Katharine A; Hasse, Claudia; Ruf, Stephanie; Bock, Ralph

    2013-02-01

    Non-green plastids, such as chromoplasts, generally have much lower activity of gene expression than chloroplasts in photosynthetically active tissues. Suppression of plastid genes in non-green tissues occurs through a complex interplay of transcriptional and translational control, with the contribution of regulation of transcript abundance versus translational activity being highly variable between genes. Here, we have investigated whether the low expression of the plastid genome in chromoplasts results from inherent limitations in gene expression capacity, or can be overcome by designing appropriate combinations of promoters and translation initiation signals in the 5' untranslated region (5'-UTR). We constructed chimeric expression elements that combine promoters and 5'-UTRs from plastid genes, which are suppressed during chloroplast-to-chromoplast conversion in Solanum lycopersicum (tomato) fruit ripening, either just at the translational level or just at the level of mRNA accumulation. These chimeric expression elements were introduced into the tomato plastid genome by stable chloroplast transformation. We report the identification of promoter-UTR combinations that confer high-level gene expression in chromoplasts of ripe tomato fruits, resulting in the accumulation of reporter protein GFP to up to 1% of total cellular protein. Our work demonstrates that non-green plastids are capable of expressing genes to high levels. Moreover, the chimeric cis-elements for chromoplasts developed here are widely applicable in basic and applied research using transplastomic methods. © 2012 The Authors The Plant Journal © 2012 Blackwell Publishing Ltd.

  14. A role for neuronal cAMP responsive-element binding (CREB)-1 in brain responses to calorie restriction

    Science.gov (United States)

    Fusco, Salvatore; Ripoli, Cristian; Podda, Maria Vittoria; Ranieri, Sofia Chiatamone; Leone, Lucia; Toietta, Gabriele; McBurney, Michael W.; Schütz, Günther; Riccio, Antonella; Grassi, Claudio; Galeotti, Tommaso; Pani, Giovambattista

    2012-01-01

    Calorie restriction delays brain senescence and prevents neurodegeneration, but critical regulators of these beneficial responses other than the NAD+-dependent histone deacetylase Sirtuin-1 (Sirt-1) are unknown. We report that effects of calorie restriction on neuronal plasticity, memory and social behavior are abolished in mice lacking cAMP responsive-element binding (CREB)-1 in the forebrain. Moreover, CREB deficiency drastically reduces the expression of Sirt-1 and the induction of genes relevant to neuronal metabolism and survival in the cortex and hippocampus of dietary-restricted animals. Biochemical studies reveal a complex interplay between CREB and Sirt-1: CREB directly regulates the transcription of the sirtuin in neuronal cells by binding to Sirt-1 chromatin; Sirt-1, in turn, is recruited by CREB to DNA and promotes CREB-dependent expression of target gene peroxisome proliferator-activated receptor-γ coactivator-1α and neuronal NO Synthase. Accordingly, expression of these CREB targets is markedly reduced in the brain of Sirt KO mice that are, like CREB-deficient mice, poorly responsive to calorie restriction. Thus, the above circuitry, modulated by nutrient availability, links energy metabolism with neurotrophin signaling, participates in brain adaptation to nutrient restriction, and is potentially relevant to accelerated brain aging by overnutrition and diabetes. PMID:22190495

  15. Finite element modelling of Plantar Fascia response during running on different surface types

    Science.gov (United States)

    Razak, A. H. A.; Basaruddin, K. S.; Salleh, A. F.; Rusli, W. M. R.; Hashim, M. S. M.; Daud, R.

    2017-10-01

    Plantar fascia is a ligament found in human foot structure located beneath the skin of human foot that functioning to stabilize longitudinal arch of human foot during standing and normal gait. To perform direct experiment on plantar fascia seems very difficult since the structure located underneath the soft tissue. The aim of this study is to develop a finite element (FE) model of foot with plantar fascia and investigate the effect of the surface hardness on biomechanical response of plantar fascia during running. The plantar fascia model was developed using Solidworks 2015 according to the bone structure of foot model that was obtained from Turbosquid database. Boundary conditions were set out based on the data obtained from experiment of ground reaction force response during running on different surface hardness. The finite element analysis was performed using Ansys 14. The results found that the peak of stress and strain distribution were occur on the insertion of plantar fascia to bone especially on calcaneal area. Plantar fascia became stiffer with increment of Young’s modulus value and was able to resist more loads. Strain of plantar fascia was decreased when Young’s modulus increased with the same amount of loading.

  16. Variability among the Most Rapidly Evolving Plastid Genomic Regions is Lineage-Specific: Implications of Pairwise Genome Comparisons in Pyrus (Rosaceae) and Other Angiosperms for Marker Choice

    Science.gov (United States)

    Ter-Voskanyan, Hasmik; Allgaier, Martin; Borsch, Thomas

    2014-01-01

    Plastid genomes exhibit different levels of variability in their sequences, depending on the respective kinds of genomic regions. Genes are usually more conserved while noncoding introns and spacers evolve at a faster pace. While a set of about thirty maximum variable noncoding genomic regions has been suggested to provide universally promising phylogenetic markers throughout angiosperms, applications often require several regions to be sequenced for many individuals. Our project aims to illuminate evolutionary relationships and species-limits in the genus Pyrus (Rosaceae)—a typical case with very low genetic distances between taxa. In this study, we have sequenced the plastid genome of Pyrus spinosa and aligned it to the already available P. pyrifolia sequence. The overall p-distance of the two Pyrus genomes was 0.00145. The intergenic spacers between ndhC–trnV, trnR–atpA, ndhF–rpl32, psbM–trnD, and trnQ–rps16 were the most variable regions, also comprising the highest total numbers of substitutions, indels and inversions (potentially informative characters). Our comparative analysis of further plastid genome pairs with similar low p-distances from Oenothera (representing another rosid), Olea (asterids) and Cymbidium (monocots) showed in each case a different ranking of genomic regions in terms of variability and potentially informative characters. Only two intergenic spacers (ndhF–rpl32 and trnK–rps16) were consistently found among the 30 top-ranked regions. We have mapped the occurrence of substitutions and microstructural mutations in the four genome pairs. High AT content in specific sequence elements seems to foster frequent mutations. We conclude that the variability among the fastest evolving plastid genomic regions is lineage-specific and thus cannot be precisely predicted across angiosperms. The often lineage-specific occurrence of stem-loop elements in the sequences of introns and spacers also governs lineage-specific mutations

  17. Variability among the most rapidly evolving plastid genomic regions is lineage-specific: implications of pairwise genome comparisons in Pyrus (Rosaceae and other angiosperms for marker choice.

    Directory of Open Access Journals (Sweden)

    Nadja Korotkova

    Full Text Available Plastid genomes exhibit different levels of variability in their sequences, depending on the respective kinds of genomic regions. Genes are usually more conserved while noncoding introns and spacers evolve at a faster pace. While a set of about thirty maximum variable noncoding genomic regions has been suggested to provide universally promising phylogenetic markers throughout angiosperms, applications often require several regions to be sequenced for many individuals. Our project aims to illuminate evolutionary relationships and species-limits in the genus Pyrus (Rosaceae-a typical case with very low genetic distances between taxa. In this study, we have sequenced the plastid genome of Pyrus spinosa and aligned it to the already available P. pyrifolia sequence. The overall p-distance of the two Pyrus genomes was 0.00145. The intergenic spacers between ndhC-trnV, trnR-atpA, ndhF-rpl32, psbM-trnD, and trnQ-rps16 were the most variable regions, also comprising the highest total numbers of substitutions, indels and inversions (potentially informative characters. Our comparative analysis of further plastid genome pairs with similar low p-distances from Oenothera (representing another rosid, Olea (asterids and Cymbidium (monocots showed in each case a different ranking of genomic regions in terms of variability and potentially informative characters. Only two intergenic spacers (ndhF-rpl32 and trnK-rps16 were consistently found among the 30 top-ranked regions. We have mapped the occurrence of substitutions and microstructural mutations in the four genome pairs. High AT content in specific sequence elements seems to foster frequent mutations. We conclude that the variability among the fastest evolving plastid genomic regions is lineage-specific and thus cannot be precisely predicted across angiosperms. The often lineage-specific occurrence of stem-loop elements in the sequences of introns and spacers also governs lineage-specific mutations. Sequencing

  18. Non-photosynthetic plastids as hosts for metabolic engineering

    DEFF Research Database (Denmark)

    Mellor, Silas Busck; Behrendorff, James Bruce Yarnton H; Nielsen, Agnieszka Janina Zygadlo

    2018-01-01

    Using plants as hosts for production of complex, high-value compounds and therapeutic proteins has gained increasing momentum over the past decade. Recent advances in metabolic engineering techniques using synthetic biology have set the stage for production yields to become economically attractive......, but more refined design strategies are required to increase product yields without compromising development and growth of the host system. The ability of plant cells to differentiate into various tissues in combination with a high level of cellular compartmentalization represents so far the most...... in green tissues, have proven to be suitable for high yield protein and bio-compound production. Unfortunately, chloroplast manipulation often affects photosynthetic efficiency and therefore plant fitness. In this respect, plastids of non-photosynthetic tissues, which have focused metabolisms for synthesis...

  19. Regulatory elements in vivo in the promoter of the abscisic acid responsive gene rab17 from maize.

    Science.gov (United States)

    Busk, P K; Jensen, A B; Pagès, M

    1997-06-01

    The rab17 gene from maize is transcribed in late embryonic development and is responsive to abscisic acid and water stress in embryo and vegetative tissues. In vivo footprinting and transient transformation of rab17 were performed in embryos and vegetative tissues to characterize the cis-elements involved in regulation of the gene. By in vivo footprinting, protein binding was observed to nine elements in the promoter, which correspond to five putative ABREs (abscisic acid responsive elements) and four other sequences. The footprints indicated that distinct proteins interact with these elements in the two developmental stages. In transient transformation, six of the elements were important for high level expression of the rab17 promoter in embryos, whereas only three elements were important in leaves. The cis-acting sequences can be divided in embryo-specific, ABA-specific and leaf-specific elements on the basis of protein binding and the ability to confer expression of rab17. We found one positive, new element, called GRA, with the sequence CACTGGCCGCCC. This element was important for transcription in leaves but not in embryos. Two other non-ABRE elements that stimulated transcription from the rab17 promoter resemble previously described abscisic acid and drought-inducible elements. There were differences in protein binding and function of the five ABREs in the rab17 promoter. The possible reasons for these differences are discussed. The in vivo data obtained suggest that an embryo-specific pathway regulates transcription of the rab genes during development, whereas another pathway is responsible for induction in response to ABA and drought in vegetative tissues.

  20. Contributions of individual domains to function of the HIV-1 Rev response element.

    Science.gov (United States)

    O'Carroll, Ina P; Thappeta, Yashna; Fan, Lixin; Ramirez-Valdez, Edric A; Smith, Sean; Wang, Yun-Xing; Rein, Alan

    2017-08-16

    The HIV-1 Rev response element (RRE) is a 351-base element in unspliced and partially spliced viral RNA; binding of the RRE by the viral Rev protein induces nuclear export of RRE-containing RNAs, as required for virus replication. It contains one long, imperfect double helix (domain I), one branched domain (domain II) containing a high-affinity Rev-binding site, and two or three additional domains. We previously reported that the RRE assumes an "A" shape in solution and suggested that the location of the Rev binding sites in domains I and II, opposite each other on the two legs of the A, is optimal for Rev binding and explains Rev's specificity for RRE-containing RNAs. Using SAXS and a quantitative functional assay, we have now analyzed a panel of RRE mutants. All the results support the essential role of the A shape for RRE function. Moreover, they suggest that the distal portion of domain I and the three crowning domains all contribute to the maintenance of the A shape. Domains I and II are necessary and sufficient for substantial RRE function, provided they are joined by a flexible linker that allows the two domains to face each other. IMPORTANCE Retroviral replication requires that some of the viral RNAs transcribed in the cell nucleus be exported to the cytoplasm without being spliced. To achieve this, HIV-1 encodes a protein, Rev, which binds to a complex, highly structured element within viral RNA, the Rev Response Element (RRE), and escorts RRE-containing RNAs from the nucleus. We previously reported that the RRE is "A"-shaped and suggested that this architecture, with the 2 legs opposite one another, can explain the specificity of Rev for the RRE. We have analyzed the functional contributions of individual RRE domains, and now report that several domains contribute, with some redundancy, to maintenance of the overall RRE shape. The data strongly support the hypothesis that the opposed placement of the 2 legs is essential for RRE function. Copyright © 2017

  1. A Multi-Element Approach to Location Inference of Twitter: A Case for Emergency Response

    Directory of Open Access Journals (Sweden)

    Farhad Laylavi

    2016-04-01

    Full Text Available Since its inception, Twitter has played a major role in real-world events—especially in the aftermath of disasters and catastrophic incidents, and has been increasingly becoming the first point of contact for users wishing to provide or seek information about such situations. The use of Twitter in emergency response and disaster management opens up avenues of research concerning different aspects of Twitter data quality, usefulness and credibility. A real challenge that has attracted substantial attention in the Twitter research community exists in the location inference of twitter data. Considering that less than 2% of tweets are geotagged, finding location inference methods that can go beyond the geotagging capability is undoubtedly the priority research area. This is especially true in terms of emergency response, where spatial aspects of information play an important role. This paper introduces a multi-elemental location inference method that puts the geotagging aside and tries to predict the location of tweets by exploiting the other inherently attached data elements. In this regard, textual content, users’ profile location and place labelling, as the main location-related elements, are taken into account. Location-name classes in three granularity levels are defined and employed to look up the location references from the location-associated elements. The inferred location of the finest granular level is assigned to a tweet, based on a novel location assignment rule. The location assigned by the location inference process is considered to be the inferred location of a tweet, and is compared with the geotagged coordinates as the ground truth of the study. The results show that this method is able to successfully infer the location of 87% of the tweets at the average distance error of 12.2 km and the median distance error of 4.5 km, which is a significant improvement compared with that of the current methods that can predict the location

  2. Comparative ultrastructure of fruit plastids in three genetically diverse genotypes of apple (Malus × domestica Borkh.) during development

    Science.gov (United States)

    Schaeffer, Scott M.; Christian, Ryan; Castro-Velasquez, Nohely; Hyden, Brennan; Lynch-Holm, Valerie

    2017-01-01

    Plastids are the defining organelle for a plant cell and are critical for myriad metabolic functions. The role of leaf plastid, chloroplast, is extensively documented; however, fruit plastids—chromoplasts—are poorly understood, especially in the context of the diverse metabolic processes operating in these diverse plant organs. Recently, in a comparative study of the predicted plastid-targeted proteomes across seven plant species, we reported that each plant species is predicted to harbor a unique set of plastid-targeted proteins. However, the temporal and developmental context of these processes remains unknown. In this study, an ultrastructural analysis approach was used to characterize fruit plastids in the epidermal and collenchymal cell layers at 11 developmental timepoints in three genotypes of apple (Malus × domestica Borkh.): chlorophyll-predominant ‘Granny Smith’, carotenoid-predominant ‘Golden Delicious’, and anthocyanin-predominant ‘Top Red Delicious’. Plastids transitioned from a proplastid-like plastid to a chromoplast-like plastid in epidermis cells, while in the collenchyma cells, they transitioned from a chloroplast-like plastid to a chloro-chromo-amyloplast plastid. Plastids in the collenchyma cells of the three genotypes demonstrated a diverse array of structures and features. This study enabled the identification of discrete developmental stages during which specific functions are most likely being performed by the plastids as indicated by accumulation of plastoglobuli, starch granules, and other sub-organeller structures. Information regarding the metabolically active developmental stages is expected to facilitate biologically relevant omics studies to unravel the complex biochemistry of plastids in perennial non-model systems. PMID:28698906

  3. The plastid and mitochondrial peptidase network and a comprehensive peptidase compendium for Arabidopsis thaliana

    Science.gov (United States)

    Plant plastids and mitochondria have dynamic proteomes. To maintain their protein homeostasis, a proteostasis network containing protein chaperones, peptidases and their substrate recognition factors exists, but many peptidases, their functional connections and substrates are poorly characterized. T...

  4. A contemplation on the secondary origin of green algal and plant plastids

    Directory of Open Access Journals (Sweden)

    Eunsoo Kim

    2014-12-01

    Full Text Available A single origin of plastids and the monophyly of three “primary” plastid-containing groups – the Chloroplastida (or Viridiplantae; green algae+land plants, Rhodophyta, and Glaucophyta – are widely accepted, mainstream hypotheses that form the basis for many comparative evolutionary studies. This “Archaeplastida” hypothesis, however, thus far has not been unambiguously confirmed by phylogenetic studies based on nucleocytoplasmic markers. In view of this as well as other lines of evidence, we suggest the testing of an alternate hypothesis that plastids of the Chloroplastida are of secondary origin. The new hypothesis is in agreement with, or perhaps better explains, existing data, including both the plastidal and nucleocytoplasmic characteristics of the Chloroplastida in comparison to those of other groups.

  5. The transient response for different types of erodable surface thermocouples using finite element analysis

    Directory of Open Access Journals (Sweden)

    Mohammed Hussein

    2007-01-01

    Full Text Available The transient response of erodable surface thermocouples has been numerically assessed by using a two dimensional finite element analysis. Four types of base metal erodable surface thermocouples have been examined in this study, included type-K (alumel-chromel, type-E (chromel-constantan, type-T (copper-constantan, and type-J (iron-constantan with 50 mm thick- ness for each. The practical importance of these types of thermocouples is to be used in internal combustion engine studies and aerodynamics experiments. The step heat flux was applied at the surface of the thermocouple model. The heat flux from the measurements of the surface temperature can be commonly identified by assuming that the heat transfer within these devices is one-dimensional. The surface temperature histories at different positions along the thermocouple are presented. The normalized surface temperature histories at the center of the thermocouple for different types at different response time are also depicted. The thermocouple response to different heat flux variations were considered by using a square heat flux with 2 ms width, a sinusoidal surface heat flux variation width 10 ms period and repeated heat flux variation with 2 ms width. The present results demonstrate that the two dimensional transient heat conduction effects have a significant influence on the surface temperature history measurements made with these devices. It was observed that the surface temperature history and the transient response for thermocouple type-E are higher than that for other types due to the thermal properties of this thermocouple. It was concluded that the thermal properties of the surrounding material do have an impact, but the properties of the thermocouple and the insulation materials also make an important contribution to the net response.

  6. Plastid Phylogenomic Analyses Resolve Tofieldiaceae as the Root of the Early Diverging Monocot Order Alismatales.

    Science.gov (United States)

    Luo, Yang; Ma, Peng-Fei; Li, Hong-Tao; Yang, Jun-Bo; Wang, Hong; Li, De-Zhu

    2016-04-06

    The predominantly aquatic order Alismatales, which includes approximately 4,500 species within Araceae, Tofieldiaceae, and the core alismatid families, is a key group in investigating the origin and early diversification of monocots. Despite their importance, phylogenetic ambiguity regarding the root of the Alismatales tree precludes answering questions about the early evolution of the order. Here, we sequenced the first complete plastid genomes from three key families in this order:Potamogeton perfoliatus(Potamogetonaceae),Sagittaria lichuanensis(Alismataceae), andTofieldia thibetica(Tofieldiaceae). Each family possesses the typical quadripartite structure, with plastid genome sizes of 156,226, 179,007, and 155,512 bp, respectively. Among them, the plastid genome ofS. lichuanensisis the largest in monocots and the second largest in angiosperms. Like other sequenced Alismatales plastid genomes, all three families generally encode the same 113 genes with similar structure and arrangement. However, we detected 2.4 and 6 kb inversions in the plastid genomes ofSagittariaandPotamogeton, respectively. Further, we assembled a 79 plastid protein-coding gene sequence data matrix of 22 taxa that included the three newly generated plastid genomes plus 19 previously reported ones, which together represent all primary lineages of monocots and outgroups. In plastid phylogenomic analyses using maximum likelihood and Bayesian inference, we show both strong support for Acorales as sister to the remaining monocots and monophyly of Alismatales. More importantly, Tofieldiaceae was resolved as the most basal lineage within Alismatales. These results provide new insights into the evolution of Alismatales as well as the early-diverging monocots as a whole. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  7. Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.

    Science.gov (United States)

    Dunn, Joshua G; Weissman, Jonathan S

    2016-11-22

    Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily

  8. Coordinated rates of evolution between interacting plastid and nuclear genes in Geraniaceae.

    Science.gov (United States)

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal; Blazier, J Chris; Jansen, Robert K

    2015-03-01

    Although gene coevolution has been widely observed within individuals and between different organisms, rarely has this phenomenon been investigated within a phylogenetic framework. The Geraniaceae is an attractive system in which to study plastid-nuclear genome coevolution due to the highly elevated evolutionary rates in plastid genomes. In plants, the plastid-encoded RNA polymerase (PEP) is a protein complex composed of subunits encoded by both plastid (rpoA, rpoB, rpoC1, and rpoC2) and nuclear genes (sig1-6). We used transcriptome and genomic data for 27 species of Geraniales in a systematic evaluation of coevolution between genes encoding subunits of the PEP holoenzyme. We detected strong correlations of dN (nonsynonymous substitutions) but not dS (synonymous substitutions) within rpoB/sig1 and rpoC2/sig2, but not for other plastid/nuclear gene pairs, and identified the correlation of dN/dS ratio between rpoB/C1/C2 and sig1/5/6, rpoC1/C2 and sig2, and rpoB/C2 and sig3 genes. Correlated rates between interacting plastid and nuclear sequences across the Geraniales could result from plastid-nuclear genome coevolution. Analyses of coevolved amino acid positions suggest that structurally mediated coevolution is not the major driver of plastid-nuclear coevolution. The detection of strong correlation of evolutionary rates between SIG and RNAP genes suggests a plausible explanation for plastome-genome incompatibility in Geraniaceae. © 2015 American Society of Plant Biologists. All rights reserved.

  9. The chloroplast min system functions differentially in two specific nongreen plastids in Arabidopsis thaliana.

    Science.gov (United States)

    Wang, Peng; Zhang, Jie; Su, Jianbin; Wang, Peng; Liu, Jun; Liu, Bing; Feng, Dongru; Wang, Jinfa; Wang, Hongbin

    2013-01-01

    The nongreen plastids, such as etioplasts, chromoplasts, etc., as well as chloroplasts, are all derived from proplastids in the meristem. To date, the Min system members in plants have been identified as regulators of FtsZ-ring placement, which are essential for the symmetrical division of chloroplasts. However, the regulation of FtsZ-ring placement in nongreen plastids is poorly understood. In this study, we investigated the division site placement of nongreen plastids by examining the etioplasts as representative in Arabidopsis Min system mutants. Surprisingly, the shape and number of etioplasts in cotyledons of arc3, arc11 and mcd1 mutants were similar to that observed in wild-type plants, whereas arc12 and parc6 mutants exhibited enlarged etioplasts that were reduced in number. In order to examine nongreen plastids in true leaves, we silenced the ALB3 gene in these Min system mutant backgrounds to produce immature chloroplasts without the thylakoidal network using virus induced gene silencing (VIGS). Interestingly, consistent with our observations in etioplasts, enlarged and fewer nongreen plastids were only detected in leaves of parc6 (VIGS-ALB3) and arc12 (VIGS-ALB3) plants. Further, the FtsZ-ring assembled properly at the midpoint in nongreen plastids of arc3, arc11 and mcd1 (VIGS-ALB3) plants, but organized into multiple rings in parc6 (VIGS-ALB3) and presented fragmented filaments in arc12 (VIGS-ALB3) plants, suggesting that division site placement in nongreen plastids requires fewer components of the plant Min system. Taken together, these results suggest that division site placement in nongreen plastids is different from that in chloroplasts.

  10. The chloroplast min system functions differentially in two specific nongreen plastids in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Peng Wang

    Full Text Available The nongreen plastids, such as etioplasts, chromoplasts, etc., as well as chloroplasts, are all derived from proplastids in the meristem. To date, the Min system members in plants have been identified as regulators of FtsZ-ring placement, which are essential for the symmetrical division of chloroplasts. However, the regulation of FtsZ-ring placement in nongreen plastids is poorly understood. In this study, we investigated the division site placement of nongreen plastids by examining the etioplasts as representative in Arabidopsis Min system mutants. Surprisingly, the shape and number of etioplasts in cotyledons of arc3, arc11 and mcd1 mutants were similar to that observed in wild-type plants, whereas arc12 and parc6 mutants exhibited enlarged etioplasts that were reduced in number. In order to examine nongreen plastids in true leaves, we silenced the ALB3 gene in these Min system mutant backgrounds to produce immature chloroplasts without the thylakoidal network using virus induced gene silencing (VIGS. Interestingly, consistent with our observations in etioplasts, enlarged and fewer nongreen plastids were only detected in leaves of parc6 (VIGS-ALB3 and arc12 (VIGS-ALB3 plants. Further, the FtsZ-ring assembled properly at the midpoint in nongreen plastids of arc3, arc11 and mcd1 (VIGS-ALB3 plants, but organized into multiple rings in parc6 (VIGS-ALB3 and presented fragmented filaments in arc12 (VIGS-ALB3 plants, suggesting that division site placement in nongreen plastids requires fewer components of the plant Min system. Taken together, these results suggest that division site placement in nongreen plastids is different from that in chloroplasts.

  11. Analysis of plastid number, size, and distribution in Arabidopsis plants by light and fluorescence microscopy.

    Science.gov (United States)

    Pyke, Kevin

    2011-01-01

    Methods are described which allow one to observe chloroplasts in mesophyll cells from leaves of Arabidopsis, determine their number per cell, measure their area, and determine a value for chloroplast coverage inside mesophyll cells. Non-green plastids can also be imaged either by using staining, or by exploiting fluorescent proteins targeted to the plastid in non-green parts of the plant, such as the roots, in transgenic Arabidopsis.

  12. Processes for producing polyhydroxybutyrate and related polyhydroxyalkanoates in the plastids of higher plants

    Science.gov (United States)

    Somerville, C.R.; Nawrath, C.; Poirier, Y.

    1997-03-11

    The present invention relates to a process for producing poly-D-(-)-3-hydroxybutyric acid (PHB) and related polyhydroxyalkanoates (PHA) in the plastids of plants. The production of PHB is accomplished by genetically transforming plants with modified genes from microorganisms. The genes encode the enzymes required to synthesize PHB from acetyl-CoA or related metabolites and are fused with additional plant sequences for targeting the enzymes to the plastid. 37 figs.

  13. Aeroelastic Response from Indicial Functions with a Finite Element Model of a Suspension Bridge

    Science.gov (United States)

    Mikkelsen, O.; Jakobsen, J. B.

    2017-12-01

    The present paper describes a comprehensive analysis of the aeroelastic bridge response in time-domain, with a finite element model of the structure. The main focus is on the analysis of flutter instability, accounting for the wind forces generated by the bridge motion, including twisting as well as vertical and horizontal translation, i.e. all three global degrees of freedom. The solution is obtained by direct integration of the equations of motion for the bridge-wind system, with motion-dependent forces approximated from flutter derivatives in terms of rational functions. For the streamlined bridge box-girder investigated, the motion dependent wind forces related to the along-wind response are found to have a limited influence on the flutter velocity. The flutter mode shapes in the time-domain and the frequency domain are consistent, and composed of the three lowest symmetrical vertical modes coupled with the first torsional symmetric mode. The method applied in this study provides detailed response estimates and contributes to an increased understanding of the complex aeroelastic behaviour of long-span bridges.

  14. Degradation by radiation of the response of a thermocouple of a fuel element

    International Nuclear Information System (INIS)

    Rodriguez V, A.

    1994-01-01

    In the TRIGA Mark III Reactor of the National Institute of Nuclear Research, is necessary to use an instrumented fuel element for measurement the fuel temperature during pulses of power. This fuel element is exposed to daily temperature gradient of order to 390 Centigrade degrees in normal condition of reactor operation at 1 MW. The experience which this instrumented fuel elements is that useful life of the thermocouples is less then the fuel, because they show important changes in their chemistry composition and electrical specifications, until the point they don't give any response. So is necessary to know the factors that influenced in the shortening of the thermocouples life. The change in composition affects the thermocouple calibration depends on where the changes take place relative to the temperature gradient. The change will be dependent on the neutron flux and so the value of the neutron flux may be used as a measure or the composition change. If there is no neutron flux within the temperature gradient, there will be no composition change, and so the thermocouple calibration will no change. If the neutron flux varies within the region in which a temperature gradients exists, the composition of the thermocouple will vary and the calibration will change. But the maximum change in calibration will occur if the neutron flux is high and constant within the region of the temperature gradient. In this case, a composition change takes place which is uniform throughout the gradient and so the emf output can be expected to change. In this reactor, the thermocouples are in the second case. Then, the relative position of the thermal and neutron flux gradients are the most important factor that explain the composition change after or 2,500 times of exposing the thermocouples to the temperature gradients of order to 390 Centigrade degrees. (Author)

  15. Finite Element Modelling for Static and Free Vibration Response of Functionally Graded Beam

    Directory of Open Access Journals (Sweden)

    Ateeb Ahmad Khan

    Full Text Available Abstract A 1D Finite Element model for static response and free vibration analysis of functionally graded material (FGM beam is presented in this work. The FE model is based on efficient zig-zag theory (ZIGT with two noded beam element having four degrees of freedom at each node. Linear interpolation is used for the axial displacement and cubic hermite interpolation is used for the deflection. Out of a large variety of FGM systems available, Al/SiC and Ni/Al2O3 metal/ceramic FGM system has been chosen. Modified rule of mixture (MROM is used to calculate the young's modulus and rule of mixture (ROM is used to calculate density and poisson's ratio of FGM beam at any point. The MATLAB code based on 1D FE zigzag theory for FGM elastic beams is developed. A 2D FE model for the same elastic FGM beam has been developed using ABAQUS software. An 8-node biquadratic plane stress quadrilateral type element is used for modeling in ABAQUS. Three different end conditions namely simply-supported, cantilever and clamped- clamped are considered. The deflection, normal stress and shear stress has been reported for various models used. Eigen Value problem using subspace iteration method is solved to obtain un-damped natural frequencies and the corresponding mode shapes. The results predicted by the 1D FE model have been compared with the 2D FE results and the results present in open literature. This proves the correctness of the model. Finally, mode shapes have also been plotted for various FGM systems.

  16. Plastome Evolution in the Sole Hemiparasitic Genus Laurel Dodder (Cassytha) and Insights into the Plastid Phylogenomics of Lauraceae.

    Science.gov (United States)

    Wu, Chung-Shien; Wang, Ting-Jen; Wu, Chia-Wen; Wang, Ya-Nan; Chaw, Shu-Miaw

    2017-10-01

    To date, little is known about the evolution of plastid genomes (plastomes) in Lauraceae. As one of the top five largest families in tropical forests, the Lauraceae contain many species that are important ecologically and economically. Lauraceous species also provide wonderful materials to study the evolutionary trajectory in response to parasitism because they contain both nonparasitic and parasitic species. This study compared the plastomes of nine Lauraceous species, including the sole hemiparasitic and herbaceous genus Cassytha (laurel dodder; here represented by Cassytha filiformis). We found differential contractions of the canonical inverted repeat (IR), resulting in two IR types present in Lauraceae. These two IR types reinforce Cryptocaryeae and Neocinnamomum-Perseeae-Laureae as two separate clades. Our data reveal several traits unique to Cas. filiformis, including loss of IRs, loss or pseudogenization of 11 ndh and rpl23 genes, richness of repeats, and accelerated rates of nucleotide substitutions in protein-coding genes. Although Cas. filiformis is low in chlorophyll content, our analysis based on dN/dS ratios suggests that both its plastid house-keeping and photosynthetic genes are under strong selective constraints. Hence, we propose that short generation time and herbaceous lifestyle rather than reduced photosynthetic ability drive the accelerated rates of nucleotide substitutions in Cas. filiformis. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  17. Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

    Science.gov (United States)

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

    2014-07-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. Finite element analysis of structural response of superconducting magnet for a fusion reactor

    International Nuclear Information System (INIS)

    Reich, M.; Powell, J.; Bezler, P.; Chang, T.Y.; Prachuktam, S.

    1975-01-01

    In the proposal Tokamak fusion reactor, the superconducting unit consists of an assembly of D-shaped magnets standing vertically and arranged in a toroidal configuration. Each magnet is a composite structure comprised of Nb-22%Ti and Nb-48%Ti, and stabilizing metals such as copper and aluminum or stainless steel held together by reinforced epoxies which also serve as insulators and spacers. The magnets are quite large, typically 15-20 meters in diameter with rectangular cross sections around 0.93x2m. Under static loading condition, the magnet is subjected to dead weight and large magnetic field forces, which may induce high stresses in the structure. Furthermore, additional stresses due to earthquake must also be considered for the design of the component. Both static and dynamic analyses of a typical field magnet have been performed by use of the finite element method. The magnet was assumed to be linearly elastic with equivalent homogeneous material properties. Various finite element models have been considered in order to better represent the structure for a particular loading case. For earthquake analysis, the magnet was assumed to be subjected to 50% of the El Centro 1940 earthquake and the dynamic response was obtained by the displacement spectrum analysis procedure. In the paper, numerical results are presented and the structure behavior of the magnet under static and dynamic loading conditions is discussed

  19. Tooth Fracture Detection in Spiral Bevel Gears System by Harmonic Response Based on Finite Element Method

    Directory of Open Access Journals (Sweden)

    Yuan Chen

    2017-01-01

    Full Text Available Spiral bevel gears occupy several advantages such as high contact ratio, strong carrying capacity, and smooth operation, which become one of the most widely used components in high-speed stage of the aeronautical transmission system. Its dynamic characteristics are addressed by many scholars. However, spiral bevel gears, especially tooth fracture occurrence and monitoring, are not to be investigated, according to the limited published issues. Therefore, this paper establishes a three-dimensional model and finite element model of the Gleason spiral bevel gear pair. The model considers the effect of tooth root fracture on the system due to fatigue. Finite element method is used to compute the mesh generation, set the boundary condition, and carry out the dynamic load. The harmonic response spectra of the base under tooth fracture are calculated and the influence of main parameters on monitoring failure is investigated as well. The results show that the change of torque affects insignificantly the determination of whether or not the system has tooth fracture. The intermediate frequency interval (200 Hz–1000 Hz is the best interval to judge tooth fracture occurrence. The best fault test region is located in the working area where the system is going through meshing. The simulation calculation provides a theoretical reference for spiral bevel gear system test and fault diagnosis.

  20. Participation of Water in the Binding of Estrogen Receptor with Estrogen Responsive Element in vitro.

    Science.gov (United States)

    Zhu, Guo-Zhang; Tang, Guo-Qing; Ruan, Kang-Cheng; Gong, Yue-Ting; Zhang, Yong-Lian

    1998-01-01

    Many reports have showed that bound water was involved in the interaction between/among the macromolecules. However, it has not been reported whether bound water is also involved in the binding of trans-factors and cis-elements in the regulation of the eukaryotic gene trans-cription or not. Preliminary studies have been made on the effect of bound water on the binding of estrogen receptor with estrogen responsive element in vitro. In the gel retardation assay using the cytosol extract of rat uterus as the supplier of estrogen receptor and 32 bp oligonucleotide containing a concensus vitellogenin A(2) ERE as the probe, various cosolvents, such as glycerol, sucrose, N-dimethylformamide and dimethylsulfoxide, were added respectively to the reaction mixture in varying concentrations to regulate the osmotic pressure. The results indicated that the binding of ER-ERE was enhanced with the increase in the final concentration of these individual cosolvents. On the other hand, when the reaction was carried out under an increasing hydrostatic pressure, the ER-ERE binding was decreased sharply. After decompression the binding of ER-ERE was gradually restored to the normal level with the lapse of time. These results suggested that bound water was directly involved in the binding of ER-ERE and may play an important role in the regulation of the eukaryotic gene transcription.

  1. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    Science.gov (United States)

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by itself but acts synergistically to form a strong enhancer which is active even in the very low level of AP-1 activity in F9 cells. Furthermore, we show that synthetic DNAs containing two perfect TREs in certain arrangements have strong transcriptional enhancing activities in F9 cells and the activity is greatly influenced by the relative orientation and the distance of two TREs. Images Fig. 1. Fig. 2. Fig. 3. PMID:2323334

  2. A comparative study of finite element methodologies for the prediction of torsional response of bladed rotors

    International Nuclear Information System (INIS)

    Scheepers, R.; Heyns, P. S.

    2016-01-01

    The prevention of torsional vibration-induced fatigue damage to turbo-generators requires determining natural frequencies by either field testing or mathematical modelling. Torsional excitation methods, measurement techniques and mathematical modelling are active fields of research. However, these aspects are mostly considered in isolation and often without experimental verification. The objective of this work is to compare one dimensional (1D), full three dimensional (3D) and 3D cyclic symmetric (3DCS) Finite element (FE) methodologies for torsional vibration response. Results are compared to experimental results for a small-scale test rotor. It is concluded that 3D approaches are feasible given the current computing technology and require less simplification with potentially increased accuracy. Accuracy of 1D models may be reduced due to simplifications but faster solution times are obtained. For high levels of accuracy model updating using field test results is recommended

  3. Proteomic amino-termini profiling reveals targeting information for protein import into complex plastids.

    Directory of Open Access Journals (Sweden)

    Pitter F Huesgen

    Full Text Available In organisms with complex plastids acquired by secondary endosymbiosis from a photosynthetic eukaryote, the majority of plastid proteins are nuclear-encoded, translated on cytoplasmic ribosomes, and guided across four membranes by a bipartite targeting sequence. In-depth understanding of this vital import process has been impeded by a lack of information about the transit peptide part of this sequence, which mediates transport across the inner three membranes. We determined the mature N-termini of hundreds of proteins from the model diatom Thalassiosira pseudonana, revealing extensive N-terminal modification by acetylation and proteolytic processing in both cytosol and plastid. We identified 63 mature N-termini of nucleus-encoded plastid proteins, deduced their complete transit peptide sequences, determined a consensus motif for their cleavage by the stromal processing peptidase, and found evidence for subsequent processing by a plastid methionine aminopeptidase. The cleavage motif differs from that of higher plants, but is shared with other eukaryotes with complex plastids.

  4. Photosynthetic and Heterotrophic Ferredoxin Isoproteins Are Colocalized in Fruit Plastids of Tomato1

    Science.gov (United States)

    Aoki, Koh; Yamamoto, Miyuki; Wada, Keishiro

    1998-01-01

    Fruit tissues of tomato (Lycopersicon esculentum Mill.) contain both photosynthetic and heterotrophic ferredoxin (FdA and FdE, respectively) isoproteins, irrespective of their photosynthetic competence, but we did not previously determine whether these proteins were colocalized in the same plastids. In isolated fruit chloroplasts and chromoplasts, both FdA and FdE were detected by immunoblotting. Colocalization of FdA and FdE in the same plastids was demonstrated using double-staining immunofluorescence microscopy. We also found that FdA and FdE were colocalized in fruit chloroplasts and chloroamyloplasts irrespective of sink status of the plastid. Immunoelectron microscopy demonstrated that FdA and FdE were randomly distributed within the plastid stroma. To investigate the significance of the heterotrophic Fd in fruit plastids, Glucose 6-phosphate dehydrogenase (G6PDH) activity was measured in isolated fruit and leaf plastids. Fruit chloroplasts and chromoplasts showed much higher G6PDH activity than did leaf chloroplasts, suggesting that high G6PDH activity is linked with FdE to maintain nonphotosynthetic production of reducing power. This result suggested that, despite their morphological resemblance, fruit chloroplasts are functionally different from their leaf counterparts. PMID:9765529

  5. Visualisation of plastid outgrowths in potato (Solanum tuberosum L.) tubers by carboxyfluorescein diacetate staining.

    Science.gov (United States)

    Borucki, Wojciech; Bederska, Magdalena; Sujkowska-Rybkowska, Marzena

    2015-05-01

    We describe two types of plastid outgrowths visualised in potato tubers after carboxyfluorescein diacetate staining. Probable esterase activity of the outgrowths has been demonstrated for the first time ever. Plastid outgrowths were observed in the phelloderm and storage parenchyma cells of red potato (S. tuberosum L. cv. Rosalinde) tubers after administration of carboxyfluorescein diacetate stain. Endogenous esterases cleaved off acetic groups to release membrane-unpermeable green fluorescing carboxyfluorescein which accumulated differentially in particular cell compartments. The intensive green fluorescence of carboxyfluorescein exhibited highly branched stromules (stroma-filled plastid tubular projections of the plastid envelope) and allowed distinguishing them within cytoplasmic strands of the phelloderm cells. Stromules (1) were directed towards the nucleus or (2) penetrated the whole cells through the cytoplasmic bands of highly vacuolated phelloderm cells. Those directed towards the nucleus were flattened and adhered to the nuclear envelope. Stromule-like interconnections between two parts of the same plastids (isthmuses) were also observed. We also documented the formation of another type of the stroma-filled plastid outgrowths, referred to here as protrusions, which differed from previously defined stromules in both morphology and esterase activity. Unlike stromules, the protrusions were found to be associated with developmental processes leading to starch accumulation in the storage parenchyma cells. These results strongly suggest that stromules and protrusions exhibit esterase activity. This has been demonstrated for the first time. Morphological and biochemical features as well as possible functions of stromules and protrusions are discussed below.

  6. Plastid transformation in the monocotyledonous cereal crop, rice (Oryza sativa) and transmission of transgenes to their progeny.

    Science.gov (United States)

    Lee, Sa Mi; Kang, Kyungsu; Chung, Hyungsup; Yoo, Soon Hee; Xu, Xiang Ming; Lee, Seung-Bum; Cheong, Jong-Joo; Daniell, Henry; Kim, Minkyun

    2006-06-30

    The plastid transformation approach offers a number of unique advantages, including high-level transgene expression, multi-gene engineering, transgene containment, and a lack of gene silencing and position effects. The extension of plastid transformation technology to monocotyledonous cereal crops, including rice, bears great promise for the improvement of agronomic traits, and the efficient production of pharmaceutical or nutritional enhancement. Here, we report a promising step towards stable plastid transformation in rice. We produced fertile transplastomic rice plants and demonstrated transmission of the plastid-expressed green fluorescent protein (GFP) and aminoglycoside 3'-adenylyltransferase genes to the progeny of these plants. Transgenic chloroplasts were determined to have stably expressed the GFP, which was confirmed by both confocal microscopy and Western blot analyses. Although the produced rice plastid transformants were found to be heteroplastomic, and the transformation efficiency requires further improvement, this study has established a variety of parameters for the use of plastid transformation technology in cereal crops.

  7. Meta-analysis of the effect of overexpression of C-repeat/dehydration-responsive element binding family genes on temperature stress tolerance and related responses

    Science.gov (United States)

    C-repeat/dehydration-responsive element binding proteins are transcription factors that play a critical role in plant response to temperature stress. Over-expression of CBF/DREB genes has been demonstrated to enhance temperature stress tolerance. A series of physiological and biochemical modificat...

  8. Assessment of hypoxia and TNF-alpha response by a vector with HRE and NF-kappaB response elements.

    Science.gov (United States)

    Chen, Zhilin; Eadie, Ashley L; Hall, Sean R; Ballantyne, Laurel; Ademidun, David; Tse, M Yat; Pang, Stephen C; Melo, Luis G; Ward, Christopher A; Brunt, Keith R

    2017-01-01

    Hypoxia and inflammatory cytokine activation (H&I) are common processes in many acute and chronic diseases. Thus, a single vector that responds to both hypoxia and inflammatory cytokines, such as TNF-alpha, is useful for assesing the severity of such diseases. Adaptation to hypoxia is regulated primarily by hypoxia inducible transcription factor (HIF alpha) nuclear proteins that engage genes containing a hypoxia response element (HRE). Inflammation activates a multitude of cytokines, including TNF-alpha, that invariably modulate activation of the nuclear factor kappa B (NF-kB) transcription factor. We constructed a vector that encompassed both a hypoxia response element (HRE), and a NF-kappaB responsive element. We show that this vector was functionally responsive to both hypoxia and TNF-alpha, in vitro and in vivo . Thus, this vector might be suitable for the detection and assessment of hypoxia or TNF-alpha.

  9. Numerical Simulation of the Ground Response to the Tire Load Using Finite Element Method

    Science.gov (United States)

    Valaskova, Veronika; Vlcek, Jozef

    2017-10-01

    Response of the pavement to the excitation caused by the moving vehicle is one of the actual problems of the civil engineering practice. The load from the vehicle is transferred to the pavement structure through contact area of the tires. Experimental studies show nonuniform distribution of the pressure in the area. This non-uniformity is caused by the flexible nature and the shape of the tire and is influenced by the tire inflation. Several tire load patterns, including uniform distribution and point load, were involved in the numerical modelling using finite element method. Applied tire loads were based on the tire contact forces of the lorry Tatra 815. There were selected two procedures for the calculations. The first one was based on the simplification of the vehicle to the half-part model. The characteristics of the vehicle model were verified by the experiment and by the numerical model in the software ADINA, when vehicle behaviour during the ride was investigated. Second step involved application of the calculated contact forces for the front axle as the load on the multi-layered half space representing the pavement structure. This procedure was realized in the software Plaxis and considered various stress patterns for the load. The response of the ground to the vehicle load was then analyzed. Axisymmetric model was established for this procedure. The paper presents the results of the investigation of the contact pressure distribution and corresponding reaction of the pavement to various load distribution patterns. The results show differences in some calculated quantities for different load patterns, which need to be verified by the experimental way when also ground response should be observed.

  10. Rev and Rex proteins of human complex retroviruses function with the MMTV Rem-responsive element

    Directory of Open Access Journals (Sweden)

    Dudley Jaquelin P

    2009-02-01

    Full Text Available Abstract Background Mouse mammary tumor virus (MMTV encodes the Rem protein, an HIV Rev-like protein that enhances nuclear export of unspliced viral RNA in rodent cells. We have shown that Rem is expressed from a doubly spliced RNA, typical of complex retroviruses. Several recent reports indicate that MMTV can infect human cells, suggesting that MMTV might interact with human retroviruses, such as human immunodeficiency virus (HIV, human T-cell leukemia virus (HTLV, and human endogenous retrovirus type K (HERV-K. In this report, we test whether the export/regulatory proteins of human complex retroviruses will increase expression from vectors containing the Rem-responsive element (RmRE. Results MMTV Rem, HIV Rev, and HTLV Rex proteins, but not HERV-K Rec, enhanced expression from an MMTV-based reporter plasmid in human T cells, and this activity was dependent on the RmRE. No RmRE-dependent reporter gene expression was detectable using Rev, Rex, or Rec in HC11 mouse mammary cells. Cell fractionation and RNA quantitation experiments suggested that the regulatory proteins did not affect RNA stability or nuclear export in the MMTV reporter system. Rem had no demonstrable activity on export elements from HIV, HTLV, or HERV-K. Similar to the Rem-specific activity in rodent cells, the RmRE-dependent functions of Rem, Rev, or Rex in human cells were inhibited by a dominant-negative truncated nucleoporin that acts in the Crm1 pathway of RNA and protein export. Conclusion These data argue that many retroviral regulatory proteins recognize similar complex RNA structures, which may depend on the presence of cell-type specific proteins. Retroviral protein activity on the RmRE appears to affect a post-export function of the reporter RNA. Our results provide additional evidence that MMTV is a complex retrovirus with the potential for viral interactions in human cells.

  11. District element modelling of the rock mass response to glaciation at Finnsjoen, central Sweden

    International Nuclear Information System (INIS)

    Rosengren, L.; Stephansson, O.

    1990-12-01

    Six rock mechanics models of a cross section of the Finnsjoen test site have been simulated by means of distinct element analysis and the computer code UDEC. The rock mass response to glaciation, deglaciation, isostatic movements and water pressure from an ice lake have been simulated. Four of the models use a boundary condition with boundary elements at the bottom and sides of the model. This gives a state of stress inside the model which agrees well with the analytical solution where the horizontal and vertical stresses are almost similar. Roller boundaries were applied to two models. This boundary condition cause zero lateral displacement at the model boundaries and the horizontal stress are always less than the vertical stress. Isostatic movements were simulated in one model. Two different geometries of fracture Zone 2 were simulated. Results from modelling the two different geometries show minor changes in stresses, displacements and failure of fracture zones. Under normal pore pressure conditions in the rock mass the weight of the ice load increases the vertical stresses in the models differ depending on the boundary condition. An ice thickness of 3 km and 1 km and an ice wedge of 1 km thickness covering half the top surface of the model have been simulated. For each loading sequence of the six models a complete set of data about normal stress, stress profiles along selected sections, displacements and failure of fracture zones are presented. Based on the results of this study a protection zone of about 100 m width from the outer boundary of stress discontinuity to the repository location is suggested. This value is based on the result that the stress disturbance diminishes at this distance from the outer boundary of the discontinuity. (25 refs.) (authors)

  12. The Ubx Polycomb response element bypasses an unpaired Fab-8 insulator via cis transvection in Drosophila.

    Science.gov (United States)

    Lu, Danfeng; Li, Zhuoran; Li, Lingling; Yang, Liping; Chen, Guijun; Yang, Deying; Zhang, Yue; Singh, Vikrant; Smith, Sheryl; Xiao, Yu; Wang, Erlin; Ye, Yunshuang; Zhang, Wei; Zhou, Lei; Rong, Yikang; Zhou, Jumin

    2018-01-01

    Chromatin insulators or boundary elements protect genes from regulatory activities from neighboring genes or chromatin domains. In the Drosophila Abdominal-B (Abd-B) locus, the deletion of such elements, such as Frontabdominal-7 (Fab-7) or Fab-8 led to dominant gain of function phenotypes, presumably due to the loss of chromatin barriers. Homologous chromosomes are paired in Drosophila, creating a number of pairing dependent phenomena including transvection, and whether transvection may affect the function of Polycomb response elements (PREs) and thus contribute to the phenotypes are not known. Here, we studied the chromatin barrier activity of Fab-8 and how it is affected by the zygosity of the transgene, and found that Fab-8 is able to block the silencing effect of the Ubx PRE on the DsRed reporter gene in a CTCF binding sites dependent manner. However, the blocking also depends on the zygosity of the transgene in that the barrier activity is present when the transgene is homozygous, but absent when the transgene is heterozygous. To analyze this effect, we performed chromatin immunoprecipitation and quantitative PCR (ChIP-qPCR) experiments on homozygous transgenic embryos, and found that H3K27me3 and H3K9me3 marks are restricted by Fab-8, but they spread beyond Fab-8 into the DsRed gene when the two CTCF binding sites within Fab-8 were mutated. Consistent with this, the mutation reduced H3K4me3 and RNA Pol II binding to the DsRed gene, and consequently, DsRed expression. Importantly, in heterozygous embryos, Fab-8 is unable to prevent the spread of H3K27me3 and H3K9me3 marks from crossing Fab-8 into DsRed, suggesting an insulator bypass. These results suggest that in the Abd-B locus, deletion of the insulator in one copy of the chromosome could lead to the loss of insulator activity on the homologous chromosome, and in other loci where chromosomal deletion created hemizygous regions of the genome, the chromatin barrier could be compromised. This study highlights

  13. Predicting the response of high damping rubber bearings using simplified models and finite element analysis

    International Nuclear Information System (INIS)

    Fuller, K.N.G.; Gough, J.; Ahmadi, H.R.

    1993-01-01

    The International Atomic Energy Agency has initiated a co-ordinated research programme on implementation of base-isolation for nuclear structures. This paper discusses two areas relevant to modelling elastomeric base-isolators. These are the use of simplified models to predict the response of isolated structures to earthquake inputs and finite element analysis for calculating the stress distributions within the isolators. In the former, a curvilinear hysteretic model of the high damping natural rubber able to accommodate the stiffening of the rubber at large shear deflections is presented. Its predictions of structural accelerations and bearing displacement produced by design earthquakes and those above the design level are compared with those using a linear spring and dashpot model. A comparison has been made between two finite element analyses using MARC and ABAQUS of the force-deformation behaviour of a single disc of rubber bonded on both sides. The disc was loaded both in compression and shear. Two forms of strain energy functions were used namely Mooney-RivIin and Ogden. The agreement between MARC and ABAQUS for the Mooney-Rivlin model for the material was very good. This was not however the case for the Ogden model and a difference of 25% in the maximum vertical deflection of the disc under 200kN load was observed. The need for a 'benchmark' problem is identified. This could be used to establish the accuracy of the finite element solvers. A problem based on the work of Rivlin on the force-deformation behaviour of cylinder of rubber under torsion is nominated. An appraisal of strain energy functions based on Mooney-RivIin formulations is carried out. It is shown that even for a five term series the strain energy function is incapable of catering for the rapid change of modulus at small strains both for simple and pure shear modes of deformation. This function models tension/compression data much better. The work identifies the need for evaluating other forms

  14. Co-suppression of sterol-regulatory element binding protein ...

    African Journals Online (AJOL)

    Administrator

    2011-06-22

    Jun 22, 2011 ... In Arabidopsis,. At5g35220 gene being sterol regulatory element-binding protein site 2, protease and metalloendopeptidase activity were required for chloroplast development and play a role in regulation of endodermal plastid size and number that are involved in ethylene-dependent gravitropism of light-.

  15. Identification of a peroxisome proliferator responsive element (PPRE)-like cis-element in mouse plasminogen activator inhibitor-1 gene promoter

    International Nuclear Information System (INIS)

    Chen Jiegen; Li Xi; Huang Haiyan; Liu Honglei; Liu Deguo; Song Tanjing; Ma Chungu; Ma Duan; Song Houyan; Tang Qiqun

    2006-01-01

    PAI-1 is expressed and secreted by adipose tissue which may mediate the pathogenesis of obesity-associated cardiovascular complications. Evidence is presented in this report that PAI-1 is not expressed by preadipocyte, but significantly induced during 3T3-L1 adipocyte differentiation and the PAI-1 expression correlates with the induction of peroxisome proliferator-activated receptor γ (PPARγ). A peroxisome proliferator responsive element (PPRE)-like cis-element (-206TCCCCCATGCCCT-194) is identified in the mouse PAI-1 gene promoter by electrophoretic mobility shift assay (EMSA) combined with transient transfection experiments; the PPRE-like cis-element forms a specific DNA-protein complex only with adipocyte nuclear extracts, not with preadipocyte nuclear extracts; the DNA-protein complex can be totally competed away by non-labeled consensus PPRE, and can be supershifted with PPARγ antibody. Mutation of this PPRE-like cis-element can abolish the transactivation of mouse PAI-1 promoter mediated by PPARγ. Specific PPARγ ligand Pioglitazone can significantly induce the PAI-1 expression, and stimulate the secretion of PAI-1 into medium

  16. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

    Science.gov (United States)

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

    2016-02-17

    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  17. Gene expression and stress response mediated by the epigenetic regulation of a transposable element small RNA.

    Directory of Open Access Journals (Sweden)

    Andrea D McCue

    2012-02-01

    Full Text Available The epigenetic activity of transposable elements (TEs can influence the regulation of genes; though, this regulation is confined to the genes, promoters, and enhancers that neighbor the TE. This local cis regulation of genes therefore limits the influence of the TE's epigenetic regulation on the genome. TE activity is suppressed by small RNAs, which also inhibit viruses and regulate the expression of genes. The production of TE heterochromatin-associated endogenous small interfering RNAs (siRNAs in the reference plant Arabidopsis thaliana is mechanistically distinct from gene-regulating small RNAs, such as microRNAs or trans-acting siRNAs (tasiRNAs. Previous research identified a TE small RNA that potentially regulates the UBP1b mRNA, which encodes an RNA-binding protein involved in stress granule formation. We demonstrate that this siRNA, siRNA854, is under the same trans-generational epigenetic control as the Athila family LTR retrotransposons from which it is produced. The epigenetic activation of Athila elements results in a shift in small RNA processing pathways, and new 21-22 nucleotide versions of Athila siRNAs are produced by protein components normally not responsible for processing TE siRNAs. This processing results in siRNA854's incorporation into ARGONAUTE1 protein complexes in a similar fashion to gene-regulating tasiRNAs. We have used reporter transgenes to demonstrate that the UPB1b 3' untranslated region directly responds to the epigenetic status of Athila TEs and the accumulation of siRNA854. The regulation of the UPB1b 3' untranslated region occurs both on the post-transcriptional and translational levels when Athila TEs are epigenetically activated, and this regulation results in the phenocopy of the ubp1b mutant stress-sensitive phenotype. This demonstrates that a TE's epigenetic activity can modulate the host organism's stress response. In addition, the ability of this TE siRNA to regulate a gene's expression in trans blurs

  18. DNA maintenance in plastids and mitochondria of plants

    Directory of Open Access Journals (Sweden)

    Delene J Oldenburg

    2015-10-01

    Full Text Available The DNA molecules in plastids and mitochondria of plants have been studied for over 40 years. Here, we review the data on the circular or linear form, replication, repair, and persistence of the organellar DNA (orgDNA in plants. The bacterial origin of orgDNA appears to have profoundly influenced ideas about the properties of chromosomal DNA molecules in these organelles to the point of dismissing data inconsistent with ideas from the 1970s. When found at all, circular genome-sized molecules comprise a few percent of orgDNA. In cells active in orgDNA replication, most orgDNA is found as linear and branched-linear forms larger than the size of the genome, likely a consequence of a virus-like DNA replication mechanism. In contrast to the stable chromosomal DNA molecules in bacteria and the plant nucleus, the molecular integrity of orgDNA declines during leaf development at a rate that varies among plant species. This decline is attributed to degradation of damaged-but-not-repaired molecules, with a proposed repair cost-saving benefit most evident in grasses. All orgDNA maintenance activities are proposed to occur on the nucleoid tethered to organellar membranes by developmentally-regulated proteins.

  19. Isoniazid suppresses antioxidant response element activities and impairs adipogenesis in mouse and human preadipocytes

    International Nuclear Information System (INIS)

    Chen, Yanyan; Xue, Peng; Hou, Yongyong; Zhang, Hao; Zheng, Hongzhi; Zhou, Tong; Qu, Weidong; Teng, Weiping; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2013-01-01

    Transcriptional signaling through the antioxidant response element (ARE), orchestrated by the Nuclear factor E2-related factor 2 (Nrf2), is a major cellular defense mechanism against oxidative or electrophilic stress. Here, we reported that isoniazid (INH), a widely used antitubercular drug, displays a substantial inhibitory property against ARE activities in diverse mouse and human cells. In 3T3-L1 preadipocytes, INH concentration-dependently suppressed the ARE-luciferase reporter activity and mRNA expression of various ARE-dependent antioxidant genes under basal and oxidative stressed conditions. In keeping with our previous findings that Nrf2-ARE plays a critical role in adipogenesis by regulating expression of CCAAT/enhancer-binding protein β (C/EBPβ) and peroxisome proliferator-activated receptor γ (PPARγ), suppression of ARE signaling by INH hampered adipogenic differentiation of 3T3-L1 cells and human adipose-derived stem cells (ADSCs). Following adipogenesis induced by hormonal cocktails, INH-treated 3T3-L1 cells and ADSCs displayed significantly reduced levels of lipid accumulation and attenuated expression of C/EBPα and PPARγ. Time-course studies in 3T3-L1 cells revealed that inhibition of adipogenesis by INH occurred in the early stage of terminal adipogenic differentiation, where reduced expression of C/EBPβ and C/EBPδ was observed. To our knowledge, the present study is the first to demonstrate that INH suppresses ARE signaling and interrupts with the transcriptional network of adipogenesis, leading to impaired adipogenic differentiation. The inhibition of ARE signaling may be a potential underlying mechanism by which INH attenuates cellular antioxidant response contributing to various complications. - Highlights: • Isoniazid suppresses ARE-mediated transcriptional activity. • Isoniazid inhibits adipogenesis in preadipocytes. • Isoniazid suppresses adipogenic gene expression during adipogenesis

  20. The French national inventory of radioactive waste. Elements of openness and responsibility

    International Nuclear Information System (INIS)

    Faussat, A.; Fernique, J.C.

    1995-01-01

    Article 13 of the Waste Act of 30 December 1991 calls for the Agence nationale pour la gestion des dechets radioactifs (ANDRA) ''to register the condition and location of all radioactive waste on national territory''. The establishment of a national inventory of radioactive waste and the broad distribution of inventory report to ensure that it becomes a matter of public record constitute a new approach to public information and an effective means of fulfilling the responsibility of the present generation vis-a-vis posterity. The National Waste Register goes beyond the low level radioactive waste disposal facilities to encompass 'all' waste, wherever it may be, including waste in storage at sites where waste is produced. As a result, the Register is multi-faceted, containing information on a variety of elements, from highly radioactive waste to hospital waste collected by ANDRA and to repositories with very low level radioactive material. Information must be provided about all of these widely divergent components. ANDRA has already published two inventories, which demonstrates the durability of its new mission. The Register now contains the inventory of radioactive waste generated by some activities connected with the defence programme. Data collection for the Register involves contacting the generators of waste and working with these entities, whether they are nuclear industry companies, defence organizations, non-nuclear industries, or the 25 Regional Directorates of Industry, Research and Environment, the control institutions or the environmental protection organizations. The yearly exchange of information among all partners involved in radioactive waste management is one of the basic tools of ANDRA, allowing it to be recognized as open and responsible, and to be more credible, fulfilling in this way one of the essential criteria for acceptability. (author). 4 refs

  1. The key elements for genetic response in Finnish dairy cattle breeding

    Directory of Open Access Journals (Sweden)

    Jarmo Juga

    1998-01-01

    Full Text Available This paper reviews some key elements of Finnish animal breeding research contributing to the Finnish dairy cattle breeding programme and discusses the possibilities and problems in collecting data for genetic evaluation, prediction of breeding values both within and across countries, estimation of the economic value of important traits, and selection of bulls and cows. Economic values are calculated for fertility, udder health and production traits when one genetic standard deviation unit (gen. sd. is changed in each trait independently and the financial returns from selection response in the Finnish dairy cattle breeding programme are estimated. The following components were used to calculate the economic value of mastitis treatments: 1 cost of mastitis including discarded milk and treatment costs, 2 reduction in milk price due to higher somatic cell count, 3 replacement costs and 4 lower production level of the herd due to involuntary culling of cows because of udder problems. A high somatic cell count lowers the price of milk and eventually leads to involuntary culling. For treatments for fertility disorders the following costs were included: 1 treatment costs 2 higher replacement costs and 3 decreased milk production in the herd. Days open included the following costs: 1 extra insemination, 2 reduced annual milk yield and 3 fewer calves born. Animal breeding was found to be a very cost effective investment, yielding returns of FIM 876.9 per cow from one round of selection when the gene flow was followed for over 25 years in the Finnish dairy cattle breeding programme.

  2. An Evolutionary Conserved Epigenetic Mark of Polycomb Response Elements Implemented by Trx/MLL/COMPASS.

    Science.gov (United States)

    Rickels, Ryan; Hu, Deqing; Collings, Clayton K; Woodfin, Ashley R; Piunti, Andrea; Mohan, Man; Herz, Hans-Martin; Kvon, Evgeny; Shilatifard, Ali

    2016-07-21

    Polycomb response elements (PREs) are specific DNA sequences that stably maintain the developmental pattern of gene expression. Drosophila PREs are well characterized, whereas the existence of PREs in mammals remains debated. Accumulating evidence supports a model in which CpG islands recruit Polycomb group (PcG) complexes; however, which subset of CGIs is selected to serve as PREs is unclear. Trithorax (Trx) positively regulates gene expression in Drosophila and co-occupies PREs to antagonize Polycomb-dependent silencing. Here we demonstrate that Trx-dependent H3K4 dimethylation (H3K4me2) marks Drosophila PREs and maintains the developmental expression pattern of nearby genes. Similarly, the mammalian Trx homolog, MLL1, deposits H3K4me2 at CpG-dense regions that could serve as PREs. In the absence of MLL1 and H3K4me2, H3K27me3 levels, a mark of Polycomb repressive complex 2 (PRC2), increase at these loci. By inhibiting PRC2-dependent H3K27me3 in the absence of MLL1, we can rescue expression of these loci, demonstrating a functional balance between MLL1 and PRC2 activities at these sites. Thus, our study provides rules for identifying cell-type-specific functional mammalian PREs within the human genome. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Hybrid finite element method for describing the electrical response of biological cells to applied fields.

    Science.gov (United States)

    Ying, Wenjun; Henriquez, Craig S

    2007-04-01

    A novel hybrid finite element method (FEM) for modeling the response of passive and active biological membranes to external stimuli is presented. The method is based on the differential equations that describe the conservation of electric flux and membrane currents. By introducing the electric flux through the cell membrane as an additional variable, the algorithm decouples the linear partial differential equation part from the nonlinear ordinary differential equation part that defines the membrane dynamics of interest. This conveniently results in two subproblems: a linear interface problem and a nonlinear initial value problem. The linear interface problem is solved with a hybrid FEM. The initial value problem is integrated by a standard ordinary differential equation solver such as the Euler and Runge-Kutta methods. During time integration, these two subproblems are solved alternatively. The algorithm can be used to model the interaction of stimuli with multiple cells of almost arbitrary geometries and complex ion-channel gating at the plasma membrane. Numerical experiments are presented demonstrating the uses of the method for modeling field stimulation and action potential propagation.

  4. Killing of Brain Tumor Cells by Hypoxia-Responsive Element Mediated Expression of BAX

    Directory of Open Access Journals (Sweden)

    Hangjun Ruan

    1999-11-01

    Full Text Available The presence of radioresistant hypoxic cells in human brain tumors limits the overall effectiveness of conventional fractionated radiation therapy. Tumor-specific therapies that target hypoxic cells are clearly needed. We have investigated the expression of suicide genes under hypoxia by a hypoxia-responsive element (HRE, which can be activated through hypoxia-inducible factor-1 (HIF-1. We transfected plasmids containing multiple copies of HIRE into U-87 MG and U-251 MG-NCI human brain tumor cells and tested their ability to induce LacZ gene expression under anoxia. Gene expression under anoxia versus oxia was increased about 12-fold for U-87 MG cells and about fourfold for U-251 MG-NCI cells. At intermediate hypoxic conditions, increased LacZ gene expression in U-87 MG cells was induced by the plasmid that contained three HREs, but not by the plasmid with two HREs. Lastly, when we placed a suicide gene BAX under the control of HREs, cells transfected with the BAX plasmids were preferentially killed through apoptosis under anoxia. Our studies demonstrate that HRE-regulated gene expression is active in brain tumor cells, and that the amount of increased gene expression obtained is dependent on the cell line, the HIRE copy number, and the degree of hypoxia.

  5. cAMP-response-element-binding protein positively regulates breast cancer metastasis and subsequent bone destruction

    Energy Technology Data Exchange (ETDEWEB)

    Son, Jieun; Lee, Jong-Ho; Kim, Ha-Neui; Ha, Hyunil, E-mail: hyunil74@hotmail.com; Lee, Zang Hee, E-mail: zang1959@snu.ac.kr

    2010-07-23

    Research highlights: {yields} CREB is highly expressed in advanced breast cancer cells. {yields} Tumor-related factors such as TGF-{beta} further elevate CREB expression. {yields} CREB upregulation stimulates metastatic potential of breast cancer cells. {yields} CREB signaling is required for breast cancer-induced bone destruction. -- Abstract: cAMP-response-element-binding protein (CREB) signaling has been reported to be associated with cancer development and poor clinical outcome in various types of cancer. However, it remains to be elucidated whether CREB is involved in breast cancer development and osteotropism. Here, we found that metastatic MDA-MB-231 breast cancer cells exhibited higher CREB expression than did non-metastatic MCF-7 cells and that CREB expression was further increased by several soluble factors linked to cancer progression, such as IL-1, IGF-1, and TGF-{beta}. Using wild-type CREB and a dominant-negative form (K-CREB), we found that CREB signaling positively regulated the proliferation, migration, and invasion of MDA-MB-231 cells. In addition, K-CREB prevented MDA-MB-231 cell-induced osteolytic lesions in a mouse model of cancer metastasis. Furthermore, CREB signaling in cancer cells regulated the gene expression of PTHrP, MMPs, and OPG, which are closely involved in cancer metastasis and bone destruction. These results indicate that breast cancer cells acquire CREB overexpression during their development and that this CREB upregulation plays an important role in multiple steps of breast cancer bone metastasis.

  6. Domain- and nucleotide-specific Rev response element regulation of feline immunodeficiency virus production

    Science.gov (United States)

    Na, Hong; Huisman, Willem; Ellestad, Kristofor K.; Phillips, Tom R.; Power, Christopher

    2010-01-01

    Computational analysis of feline immunodeficiency virus (FIV) RNA sequences indicated that common FIV strains contain a rev response element (RRE) defined by a long unbranched hairpin with 6 stem-loop sub-domains, termed stem-loop A (SLA). To examine the role of the RNA secondary structure of the RRE, mutational analyses were performed in both an infectious FIV molecular clone and a FIV CAT-RRE reporter system. These studies disclosed that the stems within SLA (SA1, 2, 3, 4, and 5) of the RRE were critical but SA6 was not essential for FIV replication and CAT expression. These studies also revealed that the secondary structure rather than an antisense protein (ASP) mediates virus expression and replication in vitro. In addition, a single synonymous mutation within the FIV-RRE, SA3/45, reduced viral reverse transcriptase activity and p24 expression after transfection but in addition also showed a marked reduction in viral expression and production following infection. PMID:20570310

  7. The Role of Carbohydrate Response Element Binding Protein in Intestinal and Hepatic Fructose Metabolism

    Directory of Open Access Journals (Sweden)

    Katsumi Iizuka

    2017-02-01

    Full Text Available Many articles have discussed the relationship between fructose consumption and the incidence of obesity and related diseases. Fructose is absorbed in the intestine and metabolized in the liver to glucose, lactate, glycogen, and, to a lesser extent, lipids. Unabsorbed fructose causes bacterial fermentation, resulting in irritable bowl syndrome. Therefore, understanding the mechanisms underlying intestinal and hepatic fructose metabolism is important for the treatment of metabolic syndrome and fructose malabsorption. Carbohydrate response element binding protein (ChREBP is a glucose-activated transcription factor that controls approximately 50% of de novo lipogenesis in the liver. ChREBP target genes are involved in glycolysis (Glut2, liver pyruvate kinase, fructolysis (Glut5, ketohexokinase, and lipogenesis (acetyl CoA carboxylase, fatty acid synthase. ChREBP gene deletion protects against high sucrose diet-induced and leptin-deficient obesity, because Chrebp−/− mice cannot consume fructose or sucrose. Moreover, ChREBP contributes to some of the physiological effects of fructose on sweet taste preference and glucose production through regulation of ChREBP target genes, such as fibroblast growth factor-21 and glucose-6-phosphatase catalytic subunits. Thus, ChREBP might play roles in fructose metabolism. Restriction of excess fructose intake will be beneficial for preventing not only metabolic syndrome but also irritable bowl syndrome.

  8. Ties that bind: the integration of plastid signalling pathways in plant cell metabolism.

    Science.gov (United States)

    Brunkard, Jacob O; Burch-Smith, Tessa M

    2018-04-13

    Plastids are critical organelles in plant cells that perform diverse functions and are central to many metabolic pathways. Beyond their major roles in primary metabolism, of which their role in photosynthesis is perhaps best known, plastids contribute to the biosynthesis of phytohormones and other secondary metabolites, store critical biomolecules, and sense a range of environmental stresses. Accordingly, plastid-derived signals coordinate a host of physiological and developmental processes, often by emitting signalling molecules that regulate the expression of nuclear genes. Several excellent recent reviews have provided broad perspectives on plastid signalling pathways. In this review, we will highlight recent advances in our understanding of chloroplast signalling pathways. Our discussion focuses on new discoveries illuminating how chloroplasts determine life and death decisions in cells and on studies elucidating tetrapyrrole biosynthesis signal transduction networks. We will also examine the role of a plastid RNA helicase, ISE2, in chloroplast signalling, and scrutinize intriguing results investigating the potential role of stromules in conducting signals from the chloroplast to other cellular locations. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  9. A Targeted Enrichment Strategy for Massively Parallel Sequencing of Angiosperm Plastid Genomes

    Directory of Open Access Journals (Sweden)

    Gregory W. Stull

    2013-02-01

    Full Text Available Premise of the study: We explored a targeted enrichment strategy to facilitate rapid and low-cost next-generation sequencing (NGS of numerous complete plastid genomes from across the phylogenetic breadth of angiosperms. Methods and Results: A custom RNA probe set including the complete sequences of 22 previously sequenced eudicot plastomes was designed to facilitate hybridization-based targeted enrichment of eudicot plastid genomes. Using this probe set and an Agilent SureSelect targeted enrichment kit, we conducted an enrichment experiment including 24 angiosperms (22 eudicots, two monocots, which were subsequently sequenced on a single lane of the Illumina GAIIx with single-end, 100-bp reads. This approach yielded nearly complete to complete plastid genomes with exceptionally high coverage (mean coverage: 717×, even for the two monocots. Conclusions: Our enrichment experiment was highly successful even though many aspects of the capture process employed were suboptimal. Hence, significant improvements to this methodology are feasible. With this general approach and probe set, it should be possible to sequence more than 300 essentially complete plastid genomes in a single Illumina GAIIx lane (achieving 50× mean coverage. However, given the complications of pooling numerous samples for multiplex sequencing and the limited number of barcodes (e.g., 96 available in commercial kits, we recommend 96 samples as a current practical maximum for multiplex plastome sequencing. This high-throughput approach should facilitate large-scale plastid genome sequencing at any level of phylogenetic diversity in angiosperms.

  10. Plastid genome structure and loss of photosynthetic ability in the parasitic genus Cuscuta.

    Science.gov (United States)

    Revill, Meredith J W; Stanley, Susan; Hibberd, Julian M

    2005-09-01

    The genus Cuscuta (dodder) is composed of parasitic plants, some species of which appear to be losing the ability to photosynthesize. A molecular phylogeny was constructed using 15 species of Cuscuta in order to assess whether changes in photosynthetic ability and alterations in structure of the plastid genome relate to phylogenetic position within the genus. The molecular phylogeny provides evidence for four major clades within Cuscuta. Although DNA blot analysis showed that Cuscuta species have smaller plastid genomes than tobacco, and that plastome size varied significantly even within one Cuscuta clade, dot blot analysis indicated that the dodders possess homologous sequence to 101 genes from the tobacco plastome. Evidence is provided for significant rates of DNA transfer from plastid to nucleus in Cuscuta. Size and structure of Cuscuta plastid genomes, as well as photosynthetic ability, appear to vary independently of position within the phylogeny, thus supporting the hypothesis that within Cuscuta photosynthetic ability and organization of the plastid genome are changing in an unco-ordinated manner.

  11. Metabolic pathway redundancy within the apicomplexan-dinoflagellate radiation argues against an ancient chromalveolate plastid

    KAUST Repository

    Waller, Ross F.; Gornik, Sebastian G.; Koreny, Ludek; Pain, Arnab

    2015-01-01

    The chromalveolate hypothesis presents an attractively simple explanation for the presence of red algal-derived secondary plastids in 5 major eukaryotic lineages: “chromista” phyla, cryptophytes, haptophytes and ochrophytes; and alveolate phyla, dinoflagellates and apicomplexans. It posits that a single secondary endosymbiotic event occurred in a common ancestor of these diverse groups, and that this ancient plastid has since been maintained by vertical inheritance only. Substantial testing of this hypothesis by molecular phylogenies has, however, consistently failed to provide support for the predicted monophyly of the host organisms that harbour these plastids—the “chromalveolates.” This lack of support does not disprove the chromalveolate hypothesis per se, but rather drives the proposed endosymbiosis deeper into the eukaryotic tree, and requires multiple plastid losses to have occurred within intervening aplastidic lineages. An alternative perspective on plastid evolution is offered by considering the metabolic partnership between the endosymbiont and its host cell. A recent analysis of metabolic pathways in a deep-branching dinoflagellate indicates a high level of pathway redundancy in the common ancestor of apicomplexans and dinoflagellates, and differential losses of these pathways soon after radiation of the major extant lineages. This suggests that vertical inheritance of an ancient plastid in alveolates is highly unlikely as it would necessitate maintenance of redundant pathways over very long evolutionary timescales.

  12. Membrane composition and physiological activity of plastids from an oenothera plastome mutator-induced chloroplast mutant.

    Science.gov (United States)

    Johnson, E M; Sears, B B

    1990-01-01

    Plastids were isolated from a plastome mutator-induced mutant (pm7) of Oenothera hookeri and were analyzed for various physiological and biochemical attributes. No photosynthetic electron transport activity was detected in the mutant plastids. This is consistent with previous ultrastructural analysis showing the absence of thylakoid membranes in the pm7 plastids and with the observation of aberrant processing and accumulation of chloroplast proteins in the mutant. In comparison to wild type, the mutant tissue lacks chlorophyll, and has significant differences in levels of four fatty acids. The analyses did not reveal any differences in carotenoid levels nor in the synthesis of several chloroplast lipids. The consequences of the altered composition of the chloroplast membrane are discussed in terms of their relation to the aberrant protein processing of the pm7 plastids. The pigment, fatty acid, and lipid measurements were also performed on two distinct nuclear genotypes (A/A and A/C) which differ in their compatibility with the plastid genome (type I) contained in these lines. In these cases, only chlorophyll concentrations differed significantly.

  13. Metabolic pathway redundancy within the apicomplexan-dinoflagellate radiation argues against an ancient chromalveolate plastid

    KAUST Repository

    Waller, Ross F.

    2015-12-08

    The chromalveolate hypothesis presents an attractively simple explanation for the presence of red algal-derived secondary plastids in 5 major eukaryotic lineages: “chromista” phyla, cryptophytes, haptophytes and ochrophytes; and alveolate phyla, dinoflagellates and apicomplexans. It posits that a single secondary endosymbiotic event occurred in a common ancestor of these diverse groups, and that this ancient plastid has since been maintained by vertical inheritance only. Substantial testing of this hypothesis by molecular phylogenies has, however, consistently failed to provide support for the predicted monophyly of the host organisms that harbour these plastids—the “chromalveolates.” This lack of support does not disprove the chromalveolate hypothesis per se, but rather drives the proposed endosymbiosis deeper into the eukaryotic tree, and requires multiple plastid losses to have occurred within intervening aplastidic lineages. An alternative perspective on plastid evolution is offered by considering the metabolic partnership between the endosymbiont and its host cell. A recent analysis of metabolic pathways in a deep-branching dinoflagellate indicates a high level of pathway redundancy in the common ancestor of apicomplexans and dinoflagellates, and differential losses of these pathways soon after radiation of the major extant lineages. This suggests that vertical inheritance of an ancient plastid in alveolates is highly unlikely as it would necessitate maintenance of redundant pathways over very long evolutionary timescales.

  14. Plastid and mitochondrial genomes of Coccophora langsdorfii (Fucales, Phaeophyceae and the utility of molecular markers.

    Directory of Open Access Journals (Sweden)

    Louis Graf

    Full Text Available Coccophora langsdorfii (Turner Greville (Fucales is an intertidal brown alga that is endemic to Northeast Asia and increasingly endangered by habitat loss and climate change. We sequenced the complete circular plastid and mitochondrial genomes of C. langsdorfii. The circular plastid genome is 124,450 bp and contains 139 protein-coding, 28 tRNA and 6 rRNA genes. The circular mitochondrial genome is 35,660 bp and contains 38 protein-coding, 25 tRNA and 3 rRNA genes. The structure and gene content of the C. langsdorfii plastid genome is similar to those of other species in the Fucales. The plastid genomes of brown algae in other orders share similar gene content but exhibit large structural recombination. The large in-frame insert in the cox2 gene in the mitochondrial genome of C. langsdorfii is typical of other brown algae. We explored the effect of this insertion on the structure and function of the cox2 protein. We estimated the usefulness of 135 plastid genes and 35 mitochondrial genes for developing molecular markers. This study shows that 29 organellar genes will prove efficient for resolving brown algal phylogeny. In addition, we propose a new molecular marker suitable for the study of intraspecific genetic diversity that should be tested in a large survey of populations of C. langsdorfii.

  15. Third-generation Ah receptor-responsive luciferase reporter plasmids: amplification of dioxin-responsive elements dramatically increases CALUX bioassay sensitivity and responsiveness.

    Science.gov (United States)

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S

    2011-10-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene-based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts.

  16. The Indirect Boundary Element Method (IBEM) for Seismic Response of Topographical Irregularities in Layered Media

    Science.gov (United States)

    Contreras Zazueta, M. A.; Perton, M.; Sanchez-Sesma, F. J.; Sánchez-Alvaro, E.

    2013-12-01

    The seismic hazard assessment of extended developments, such as a dam, a bridge or a pipeline, needs the strong ground motion simulation taking into account the effects of surface geology. In many cases the incoming wave field can be obtained from attenuation relations or simulations for layered media using Discrete Wave Number (DWN). Sometimes there is a need to include in simulations the seismic source as well. A number of methods to solve these problems have been developed. Among them the Finite Element and Finite Difference Methods (FEM and FDM) are generally preferred because of the facility of use. Nevertheless, the analysis of realistic dynamic loading induced by earthquakes requires a thinner mesh of the entire domain to consider high frequencies. Consequently this may imply a high computational cost. The Indirect Boundary Element Method (IBEM) can also be employed. Here it is used to study the response of a site to historical seismic activity. This method is particularly suited to model wave propagation through wide areas as it requires only the meshing of boundaries. Moreover, it is well suited to represent finely the diffraction that can occur on a fault. However, the IBEM has been applied mainly to simple geometrical configurations. In this communication significant refinements of the formulation are presented. Using IBEM we can simulate wave propagation in complex geometrical configurations such as a stratified medium crossed by thin faults or having a complex topography. Two main developments are here described; one integrates the DWN method inside the IBEM in order to represent the Green's functions of stratified media with relatively low computational cost but assuming unbounded parallel flat layers, and the other is the extension of IBEM to deal with multi-regions in contact which allows more versatility with a higher computational cost compared to the first one but still minor to an equivalent FEM formulation. The two approaches are fully

  17. Trace elements in the sea surface microlayer: rapid responses to changes in aerosol deposition

    Directory of Open Access Journals (Sweden)

    Alina M. Ebling

    2017-08-01

    Full Text Available Natural and anthropogenic aerosols are a significant source of trace elements to oligotrophic ocean surface waters, where they provide episodic pulses of limiting micronutrients for the microbial community. However, little is known about the fate of trace elements at the air-sea interface, i.e. the sea surface microlayer. In this study, samples of aerosols, sea surface microlayer, and underlying water column were collected in the Florida Keys during a dusty season (July 2014 and non-dusty season (May 2015 and analyzed for the dissolved and particulate elements Al, Fe, Ni, Cu, Zn, and Pb. Microlayer samples were collected using a cylinder of ultra-pure SiO2 (quartz glass, a novel adaptation of the glass plate technique. A significant dust deposition event occurred during the 2014 sampling period which resulted in elevated concentrations of trace elements in the microlayer. Residence times in the microlayer from this event ranged from 12 to 94 minutes for dissolved trace elements and from 1.3 to 3.4 minutes for particulate trace elements. These residence times are potentially long enough for the atmospherically derived trace elements to undergo chemical and biological alterations within the microlayer. Characterizing the trace element distributions within the three regimes is an important step towards our overall goals of understanding the rates and mechanisms of the solubilization of trace elements following aeolian dust deposition and how this might affect microorganisms in surface waters.

  18. Comparative ultrastructure of fruit plastids in three genetically diverse genotypes of apple (Malus × domestica Borkh.) during development.

    Science.gov (United States)

    Schaeffer, Scott M; Christian, Ryan; Castro-Velasquez, Nohely; Hyden, Brennan; Lynch-Holm, Valerie; Dhingra, Amit

    2017-10-01

    Comparative ultrastructural developmental time-course analysis has identified discrete stages at which the fruit plastids undergo structural and consequently functional transitions to facilitate subsequent development-guided understanding of the complex plastid biology. Plastids are the defining organelle for a plant cell and are critical for myriad metabolic functions. The role of leaf plastid, chloroplast, is extensively documented; however, fruit plastids-chromoplasts-are poorly understood, especially in the context of the diverse metabolic processes operating in these diverse plant organs. Recently, in a comparative study of the predicted plastid-targeted proteomes across seven plant species, we reported that each plant species is predicted to harbor a unique set of plastid-targeted proteins. However, the temporal and developmental context of these processes remains unknown. In this study, an ultrastructural analysis approach was used to characterize fruit plastids in the epidermal and collenchymal cell layers at 11 developmental timepoints in three genotypes of apple (Malus × domestica Borkh.): chlorophyll-predominant 'Granny Smith', carotenoid-predominant 'Golden Delicious', and anthocyanin-predominant 'Top Red Delicious'. Plastids transitioned from a proplastid-like plastid to a chromoplast-like plastid in epidermis cells, while in the collenchyma cells, they transitioned from a chloroplast-like plastid to a chloro-chromo-amyloplast plastid. Plastids in the collenchyma cells of the three genotypes demonstrated a diverse array of structures and features. This study enabled the identification of discrete developmental stages during which specific functions are most likely being performed by the plastids as indicated by accumulation of plastoglobuli, starch granules, and other sub-organeller structures. Information regarding the metabolically active developmental stages is expected to facilitate biologically relevant omics studies to unravel the complex

  19. 1ST-ORDER NONADIABATIC COUPLING MATRIX-ELEMENTS FROM MULTICONFIGURATIONAL SELF-CONSISTENT-FIELD RESPONSE THEORY

    DEFF Research Database (Denmark)

    Bak, Keld L.; Jørgensen, Poul; Jensen, H.J.A.

    1992-01-01

    A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response of a ref......A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response...... to the full configuration interaction limit. Comparisons are made with state-averaged MCSCF results for MgH2 and finite-difference configuration interaction by perturbation with multiconfigurational zeroth-order wave function reflected by interactive process (CIPSI) results for BH....

  20. Horizontal transfer of DNA from the mitochondrial to the plastid genome and its subsequent evolution in milkweeds (Apocynaceae)

    Science.gov (United States)

    Shannon C.K. Straub; Richard C. Cronn; Christopher Edwards; Mark Fishbein; Aaron. Liston

    2013-01-01

    Horizontal gene transfer (HGT) of DNA from the plastid to the nuclear and mitochondrial genomes of higher plants is a common phenomenon; however, plastid genomes (plastomes) are highly conserved and have generally been regarded as impervious to HGT. We sequenced the 158 kb plastome and the 690 kb mitochondrial genome of common milkweed (Asclepias syriaca [Apocynaceae...

  1. Plastid ribosomal protein S5 plays a critical role in photosynthesis, plant development, and cold stress tolerance in arabidopsis

    Science.gov (United States)

    Plastid ribosomal proteins (RPs) are essential components for protein synthesis machinery and exert diverse roles in plant growth and development. Mutations in plastid RPs lead to a range of developmental phenotypes in plants. However, how they regulate these processes is not fully understood and th...

  2. A complete plastid phylogeny of Daucus – concordance to nuclear results, and markers necessary for phylogenetic resolution

    Science.gov (United States)

    Premise of study: Our purposes were to (1) obtain a well-resolved plastid counterpart to the 94 gene nuclear ortholog gene phylogeny of Arbizu et al. (2014, Amer. J. Bot. 101:1666-1685; and Syst. Bot., in press), and (2) to investigate various classes and numbers of plastid markers necessary for a c...

  3. Essential role for cyclic-AMP responsive element binding protein 1 (CREB) in the survival of acute lymphoblastic leukemia

    NARCIS (Netherlands)

    van der Sligte, Naomi E.; Kampen, Kim R.; ter Elst, Arja; Scherpen, Frank J. G.; Meeuwsen-de Boer, Tiny G. J.; Guryev, Victor; van Leeuwen, Frank N.; Kornblau, Steven M.; de Bont, Eveline S. J. M.

    2015-01-01

    Acute lymphoblastic leukemia (ALL) relapse remains a leading cause of cancer related death in children, therefore, new therapeutic options are needed. Recently, we showed that a peptide derived from Cyclic-AMP Responsive Element Binding Protein (CREB) was highly phosphorylated in pediatric

  4. Soil solution chemistry and element fluxes in three European heathlands and their responses to warming and drought

    DEFF Research Database (Denmark)

    Schmidt, I.K.; Tietema, A.; Williams, D.

    2004-01-01

    Soil water chemistry and element budgets were studied at three northwestern European Calluna vulgaris heathland sites in Denmark (DK), The Netherlands (NL), and Wales (UK). Responses to experimental nighttime warming and early summer drought were followed during a two-year period. Soil solution...

  5. Plastid Transcriptomics and Translatomics of Tomato Fruit Development and Chloroplast-to-Chromoplast Differentiation: Chromoplast Gene Expression Largely Serves the Production of a Single Protein[W][OA

    Science.gov (United States)

    Kahlau, Sabine; Bock, Ralph

    2008-01-01

    Plastid genes are expressed at high levels in photosynthetically active chloroplasts but are generally believed to be drastically downregulated in nongreen plastids. The genome-wide changes in the expression patterns of plastid genes during the development of nongreen plastid types as well as the contributions of transcriptional versus translational regulation are largely unknown. We report here a systematic transcriptomics and translatomics analysis of the tomato (Solanum lycopersicum) plastid genome during fruit development and chloroplast-to-chromoplast conversion. At the level of RNA accumulation, most but not all plastid genes are strongly downregulated in fruits compared with leaves. By contrast, chloroplast-to-chromoplast differentiation during fruit ripening is surprisingly not accompanied by large changes in plastid RNA accumulation. However, most plastid genes are translationally downregulated during chromoplast development. Both transcriptional and translational downregulation are more pronounced for photosynthesis-related genes than for genes involved in gene expression, indicating that some low-level plastid gene expression must be sustained in chromoplasts. High-level expression during chromoplast development identifies accD, the only plastid-encoded gene involved in fatty acid biosynthesis, as the target gene for which gene expression activity in chromoplasts is maintained. In addition, we have determined the developmental patterns of plastid RNA polymerase activities, intron splicing, and RNA editing and report specific developmental changes in the splicing and editing patterns of plastid transcripts. PMID:18441214

  6. Elemental cycling response of an Adirondack subalpine spruce-fir forest to atmospheric and environmental change

    Science.gov (United States)

    Andrew J. Friedland; Eric K. Miller

    1996-01-01

    Patterns and trends in forest elemental cycling can become more apparent in the presence of atmospheric perturbations. High-elevation forests of the northeastern United States have received large amounts of atmospheric deposition of pollutants, which have altered natural elemental cycling and retention rates in a variety of ways. This study examined atmospheric...

  7. Plant-soil distribution of potentially toxic elements in response to elevated atmospheric CO2.

    Science.gov (United States)

    Duval, Benjamin D; Dijkstra, Paul; Natali, Susan M; Megonigal, J Patrick; Ketterer, Michael E; Drake, Bert G; Lerdau, Manuel T; Gordon, Gwyneth; Anbar, Ariel D; Hungate, Bruce A

    2011-04-01

    The distribution of contaminant elements within ecosystems is an environmental concern because of these elements' potential toxicity to animals and plants and their ability to hinder microbial ecosystem services. As with nutrients, contaminants are cycled within and through ecosystems. Elevated atmospheric CO2 generally increases plant productivity and alters nutrient element cycling, but whether CO2 causes similar effects on the cycling of contaminant elements is unknown. Here we show that 11 years of experimental CO2 enrichment in a sandy soil with low organic matter content causes plants to accumulate contaminants in plant biomass, with declines in the extractable contaminant element pools in surface soils. These results indicate that CO2 alters the distribution of contaminant elements in ecosystems, with plant element accumulation and declining soil availability both likely explained by the CO2 stimulation of plant biomass. Our results highlight the interdependence of element cycles and the importance of taking a broad view of the periodic table when the effects of global environmental change on ecosystem biogeochemistry are considered.

  8. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    International Nuclear Information System (INIS)

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun; Chan, King Ming

    2010-01-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn 2+ -induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  9. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    Energy Technology Data Exchange (ETDEWEB)

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong); Chan, King Ming, E-mail: kingchan@cuhk.edu.hk [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong)

    2010-08-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn{sup 2+}-induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  10. Detailed assessment of gene activation levels by multiple hypoxia-responsive elements under various hypoxic conditions.

    Science.gov (United States)

    Takeuchi, Yasuto; Inubushi, Masayuki; Jin, Yong-Nan; Murai, Chika; Tsuji, Atsushi B; Hata, Hironobu; Kitagawa, Yoshimasa; Saga, Tsuneo

    2014-12-01

    HIF-1/HRE pathway is a promising target for the imaging and the treatment of intractable malignancy (HIF-1; hypoxia-inducible factor 1, HRE; hypoxia-responsive element). The purposes of our study are: (1) to assess the gene activation levels resulting from various numbers of HREs under various hypoxic conditions, (2) to evaluate the bidirectional activity of multiple HREs, and (3) to confirm whether multiple HREs can induce gene expression in vivo. Human colon carcinoma HCT116 cells were transiently transfected by the constructs containing a firefly luciferase reporter gene and various numbers (2, 4, 6, 8, 10, and 12) of HREs (nHRE+, nHRE-). The relative luciferase activities were measured under various durations of hypoxia (6, 12, 18, and 24 h), O2 concentrations (1, 2, 4, 8, and 16 %), and various concentrations of deferoxamine mesylate (20, 40, 80, 160, and 320 µg/mL growth medium). The bidirectional gene activation levels by HREs were examined in the constructs (dual-luc-nHREs) containing firefly and Renilla luciferase reporter genes at each side of nHREs. Finally, to test whether the construct containing 12HRE and the NIS reporter gene (12HRE-NIS) can induce gene expression in vivo, SPECT imaging was performed in a mouse xenograft model. (1) gene activation levels by HREs tended to increase with increasing HRE copy number, but a saturation effect was observed in constructs with more than 6 or 8 copies of an HRE, (2) gene activation levels by HREs increased remarkably during 6-12 h of hypoxia, but not beyond 12 h, (3) gene activation levels by HREs decreased with increasing O2 concentrations, but could be detected even under mild hypoxia at 16 % O2, (4) the bidirectionally proportional activity of the HRE was confirmed regardless of the hypoxic severity, and (5) NIS expression driven by 12 tandem copies of an HRE in response to hypoxia could be visualized on in vivo SPECT imaging. The results of this study will help in the understanding and assessment of

  11. Complete DNA sequences of the plastid genomes of two parasitic flowering plant species, Cuscuta reflexa and Cuscuta gronovii.

    Science.gov (United States)

    Funk, Helena T; Berg, Sabine; Krupinska, Karin; Maier, Uwe G; Krause, Kirsten

    2007-08-22

    The holoparasitic plant genus Cuscuta comprises species with photosynthetic capacity and functional chloroplasts as well as achlorophyllous and intermediate forms with restricted photosynthetic activity and degenerated chloroplasts. Previous data indicated significant differences with respect to the plastid genome coding capacity in different Cuscuta species that could correlate with their photosynthetic activity. In order to shed light on the molecular changes accompanying the parasitic lifestyle, we sequenced the plastid chromosomes of the two species Cuscuta reflexa and Cuscuta gronovii. Both species are capable of performing photosynthesis, albeit with varying efficiencies. Together with the plastid genome of Epifagus virginiana, an achlorophyllous parasitic plant whose plastid genome has been sequenced, these species represent a series of progression towards total dependency on the host plant, ranging from reduced levels of photosynthesis in C. reflexa to a restricted photosynthetic activity and degenerated chloroplasts in C. gronovii to an achlorophyllous state in E. virginiana. The newly sequenced plastid genomes of C. reflexa and C. gronovii reveal that the chromosome structures are generally very similar to that of non-parasitic plants, although a number of species-specific insertions, deletions (indels) and sequence inversions were identified. However, we observed a gradual adaptation of the plastid genome to the different degrees of parasitism. The changes are particularly evident in C. gronovii and include (a) the parallel losses of genes for the subunits of the plastid-encoded RNA polymerase and the corresponding promoters from the plastid genome, (b) the first documented loss of the gene for a putative splicing factor, MatK, from the plastid genome and (c) a significant reduction of RNA editing. Overall, the comparative genomic analysis of plastid DNA from parasitic plants indicates a bias towards a simplification of the plastid gene expression

  12. Complete DNA sequences of the plastid genomes of two parasitic flowering plant species, Cuscuta reflexa and Cuscuta gronovii

    Directory of Open Access Journals (Sweden)

    Maier Uwe G

    2007-08-01

    Full Text Available Abstract Background The holoparasitic plant genus Cuscuta comprises species with photosynthetic capacity and functional chloroplasts as well as achlorophyllous and intermediate forms with restricted photosynthetic activity and degenerated chloroplasts. Previous data indicated significant differences with respect to the plastid genome coding capacity in different Cuscuta species that could correlate with their photosynthetic activity. In order to shed light on the molecular changes accompanying the parasitic lifestyle, we sequenced the plastid chromosomes of the two species Cuscuta reflexa and Cuscuta gronovii. Both species are capable of performing photosynthesis, albeit with varying efficiencies. Together with the plastid genome of Epifagus virginiana, an achlorophyllous parasitic plant whose plastid genome has been sequenced, these species represent a series of progression towards total dependency on the host plant, ranging from reduced levels of photosynthesis in C. reflexa to a restricted photosynthetic activity and degenerated chloroplasts in C. gronovii to an achlorophyllous state in E. virginiana. Results The newly sequenced plastid genomes of C. reflexa and C. gronovii reveal that the chromosome structures are generally very similar to that of non-parasitic plants, although a number of species-specific insertions, deletions (indels and sequence inversions were identified. However, we observed a gradual adaptation of the plastid genome to the different degrees of parasitism. The changes are particularly evident in C. gronovii and include (a the parallel losses of genes for the subunits of the plastid-encoded RNA polymerase and the corresponding promoters from the plastid genome, (b the first documented loss of the gene for a putative splicing factor, MatK, from the plastid genome and (c a significant reduction of RNA editing. Conclusion Overall, the comparative genomic analysis of plastid DNA from parasitic plants indicates a bias towards

  13. Hepatic overexpression of cAMP-responsive element modulator α induces a regulatory T-cell response in a murine model of chronic liver disease

    NARCIS (Netherlands)

    Kuttkat, Nadine; Mohs, Antje; Ohl, Kim; Hooiveld, Guido; Longerich, Thomas; Tenbrock, Klaus; Cubero, Francisco Javier; Trautwein, Christian

    2016-01-01


    Objective Th17 cells are a subset of CD4+ T-helper cells characterised by interleukin 17 (IL-17) production, a cytokine that plays a crucial role in inflammation-associated diseases. The cyclic AMP-responsive element modulator-α (CREMα) is a central mediator of T-cell pathogenesis, which

  14. HIV-1 p24(gag derived conserved element DNA vaccine increases the breadth of immune response in mice.

    Directory of Open Access Journals (Sweden)

    Viraj Kulkarni

    Full Text Available Viral diversity is considered a major impediment to the development of an effective HIV-1 vaccine. Despite this diversity, certain protein segments are nearly invariant across the known HIV-1 Group M sequences. We developed immunogens based on the highly conserved elements from the p24(gag region according to two principles: the immunogen must (i include strictly conserved elements of the virus that cannot mutate readily, and (ii exclude both HIV regions capable of mutating without limiting virus viability, and also immunodominant epitopes located in variable regions. We engineered two HIV-1 p24(gag DNA immunogens that express 7 highly Conserved Elements (CE of 12-24 amino acids in length and differ by only 1 amino acid in each CE ('toggle site', together covering >99% of the HIV-1 Group M sequences. Altering intracellular trafficking of the immunogens changed protein localization, stability, and also the nature of elicited immune responses. Immunization of C57BL/6 mice with p55(gag DNA induced poor, CD4(+ mediated cellular responses, to only 2 of the 7 CE; in contrast, vaccination with p24CE DNA induced cross-clade reactive, robust T cell responses to 4 of the 7 CE. The responses were multifunctional and composed of both CD4(+ and CD8(+ T cells with mature cytotoxic phenotype. These findings provide a method to increase immune response to universally conserved Gag epitopes, using the p24CE immunogen. p24CE DNA vaccination induced humoral immune responses similar in magnitude to those induced by p55(gag, which recognize the virus encoded p24(gag protein. The inclusion of DNA immunogens composed of conserved elements is a promising vaccine strategy to induce broader immunity by CD4(+ and CD8(+ T cells to additional regions of Gag compared to vaccination with p55(gag DNA, achieving maximal cross-clade reactive cellular and humoral responses.

  15. Complete sequence and analysis of plastid genomes of two economically important red algae: Pyropia haitanensis and Pyropia yezoensis.

    Directory of Open Access Journals (Sweden)

    Li Wang

    Full Text Available Pyropia haitanensis and P. yezoensis are two economically important marine crops that are also considered to be research models to study the physiological ecology of intertidal seaweed communities, evolutionary biology of plastids, and the origins of sexual reproduction. This plastid genome information will facilitate study of breeding, population genetics and phylogenetics.We have fully sequenced using next-generation sequencing the circular plastid genomes of P. hatanensis (195,597 bp and P. yezoensis (191,975 bp, the largest of all the plastid genomes of the red lineage sequenced to date. Organization and gene contents of the two plastids were similar, with 211-213 protein-coding genes (including 29-31 unknown-function ORFs, 37 tRNA genes, and 6 ribosomal RNA genes, suggesting a largest coding capacity in the red lineage. In each genome, 14 protein genes overlapped and no interrupted genes were found, indicating a high degree of genomic condensation. Pyropia maintain an ancient gene content and conserved gene clusters in their plastid genomes, containing nearly complete repertoires of the plastid genes known in photosynthetic eukaryotes. Similarity analysis based on the whole plastid genome sequences showed the distance between P. haitanensis and P. yezoensis (0.146 was much smaller than that of Porphyra purpurea and P. haitanensis (0.250, and P. yezoensis (0.251; this supports re-grouping the two species in a resurrected genus Pyropia while maintaining P. purpurea in genus Porphyra. Phylogenetic analysis supports a sister relationship between Bangiophyceae and Florideophyceae, though precise phylogenetic relationships between multicellular red alage and chromists were not fully resolved.These results indicate that Pyropia have compact plastid genomes. Large coding capacity and long intergenic regions contribute to the size of the largest plastid genomes reported for the red lineage. Possessing the largest coding capacity and ancient gene

  16. Biomechanical Analysis of Human Abdominal Impact Responses and Injuries through Finite Element Simulations of a Full Human Body Model.

    Science.gov (United States)

    Ruan, Jesse S; El-Jawahri, Raed; Barbat, Saeed; Prasad, Priya

    2005-11-01

    Human abdominal response and injury in blunt impacts was investigated through finite element simulations of cadaver tests using a full human body model of an average-sized adult male. The model was validated at various impact speeds by comparing model responses with available experimental cadaver test data in pendulum side impacts and frontal rigid bar impacts from various sources. Results of various abdominal impact simulations are presented in this paper. Model-predicted abdominal dynamic responses such as force-time and force-deflection characteristics, and injury severities, measured by organ pressures, for the simulated impact conditions are presented. Quantitative results such as impact forces, abdominal deflections, internal organ stresses have shown that the abdomen responded differently to left and right side impacts, especially in low speed impact. Results also indicated that the model exhibited speed sensitive response characteristics and the compressibility of the abdomen significantly influenced the overall impact response in the simulated impact conditions. This study demonstrates that the development of a validated finite element human body model can be useful for abdominal injury assessment. Internal organ injuries, which are difficult to detect in experimental studies with human cadavers due to the difficulty of instrumentation, may be more easily identified with a validated finite element model through stress-strain analysis.

  17. An approach to unfold the response of a multi-element system using an artificial neural network

    International Nuclear Information System (INIS)

    Cordes, E.; Fehrenbacher, G.; Schuetz, R.; Sprunck, M.; Hahn, K.; Hofmann, R.; Wahl, W.

    1998-01-01

    An unfolding procedure is proposed which aims at obtaining spectral information of a neutron radiation field by the analysis of the response of a multi-element system consisting of converter type semiconductors. For the unfolding procedure an artificial neural network (feed forward network), trained by the back-propagation method, was used. The response functions of the single elements to neutron radiation were calculated by application of a computational model for an energy range from 10 -2 eV to 10 MeV. The training of the artificial neural network was based on the computation of responses of a six-element system for a set of 300 neutron spectra and the application of the back-propagation method. The validation was performed by the unfolding of 100 computed responses. Two unfolding examples were pointed out for the determination of the neutron spectra. The spectra resulting from the unfolding procedure agree well with the original spectra used for the response computation

  18. Third-Generation Ah Receptor–Responsive Luciferase Reporter Plasmids: Amplification of Dioxin-Responsive Elements Dramatically Increases CALUX Bioassay Sensitivity and Responsiveness

    Science.gov (United States)

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S.; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S.

    2011-01-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene–based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts. PMID:21775728

  19. Finite element modelling to assess the effect of surface mounted piezoelectric patch size on vibration response of a hybrid beam

    Science.gov (United States)

    Rahman, N.; Alam, M. N.

    2018-02-01

    Vibration response analysis of a hybrid beam with surface mounted patch piezoelectric layer is presented in this work. A one dimensional finite element (1D-FE) model based on efficient layerwise (zigzag) theory is used for the analysis. The beam element has eight mechanical and a variable number of electrical degrees of freedom. The beams are also modelled in 2D-FE (ABAQUS) using a plane stress piezoelectric quadrilateral element for piezo layers and a plane stress quadrilateral element for the elastic layers of hybrid beams. Results are presented to assess the effect of size of piezoelectric patch layer on the free and forced vibration responses of thin and moderately thick beams under clamped-free and clamped-clamped configurations. The beams are subjected to unit step loading and harmonic loading to obtain the forced vibration responses. The vibration control using in phase actuation potential on piezoelectric patches is also studied. The 1D-FE results are compared with the 2D-FE results.

  20. Characterization of an estrogen-responsive element implicated in regulation of the rainbow trout estrogen receptor gene.

    Science.gov (United States)

    Le Dréan, Y; Lazennec, G; Kern, L; Saligaut, D; Pakdel, F; Valotaire, Y

    1995-08-01

    We previously reported that the expression of the rainbow trout estrogen receptor (rtER) gene is markedly increased by estradiol (E2). In this paper, we have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyl transferase (CAT), linked to 5' flanking regions of the rtER gene promoter, to identify cis-elements responsible for E2 inducibility. Deletion analysis localized an estrogen-responsive element (ERE), at position +242, with one mutation on the first base compared with the consensus sequence. This element confers estrogen responsiveness to CAT reporter linked to both the herpes simplex virus thymidine kinase promoter and the homologous rtER promoter. Moreover, using a 0.2 kb fragment of the rtER promoter encompassing the ERE and the rtER DNA binding domain obtained from a bacterial expression system, DNase I footprinting experiments demonstrated a specific protection covering 20 bp (+240/+260) containing the ERE sequence. Based on these studies, we believe that this ERE sequence, identified in the rtER gene promoter, may be a major cis-acting element involved in the regulation of the gene by estrogen.

  1. Identification of an estrogen response element in the 3'-flanking region of the murine c-fos protooncogene.

    Science.gov (United States)

    Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S

    1992-09-05

    We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or

  2. SANTOS - a two-dimensional finite element program for the quasistatic, large deformation, inelastic response of solids

    Energy Technology Data Exchange (ETDEWEB)

    Stone, C.M.

    1997-07-01

    SANTOS is a finite element program designed to compute the quasistatic, large deformation, inelastic response of two-dimensional planar or axisymmetric solids. The code is derived from the transient dynamic code PRONTO 2D. The solution strategy used to compute the equilibrium states is based on a self-adaptive dynamic relaxation solution scheme, which is based on explicit central difference pseudo-time integration and artificial mass proportional damping. The element used in SANTOS is a uniform strain 4-node quadrilateral element with an hourglass control scheme to control the spurious deformation modes. Finite strain constitutive models for many common engineering materials are included. A robust master-slave contact algorithm for modeling sliding contact is implemented. An interface for coupling to an external code is also provided. 43 refs., 22 figs.

  3. A chromatin insulator driving three-dimensional Polycomb response element (PRE) contacts and Polycomb association with the chromatin fiber

    DEFF Research Database (Denmark)

    Comet, Itys; Schuettengruber, Bernd; Sexton, Tom

    2011-01-01

    to insulate genes from regulatory elements or to take part in long-distance interactions. Using a high-resolution chromatin conformation capture (H3C) method, we show that the Drosophila gypsy insulator behaves as a conformational chromatin border that is able to prohibit contacts between a Polycomb response...... element (PRE) and a distal promoter. On the other hand, two spaced gypsy elements form a chromatin loop that is able to bring an upstream PRE in contact with a downstream gene to mediate its repression. Chromatin immunoprecipitation (ChIP) profiles of the Polycomb protein and its associated H3K27me3...... histone mark reflect this insulator-dependent chromatin conformation, suggesting that Polycomb action at a distance can be organized by local chromatin topology....

  4. First-principles study on the effect of alloying elements on the elastic deformation response in β-titanium alloys

    International Nuclear Information System (INIS)

    Gouda, Mohammed K.; Gepreel, Mohamed A. H.; Nakamura, Koichi

    2015-01-01

    Theoretical deformation response of hypothetical β-titanium alloys was investigated using first-principles calculation technique under periodic boundary conditions. Simulation was carried out on hypothetical 54-atom supercell of Ti–X (X = Cr, Mn, Fe, Zr, Nb, Mo, Al, and Sn) binary alloys. The results showed that the strength of Ti increases by alloying, except for Cr. The most effective alloying elements are Nb, Zr, and Mo in the current simulation. The mechanism of bond breaking was revealed by studying the local structure around the alloying element atom with respect to volume change. Moreover, the effect of alloying elements on bulk modulus and admissible strain was investigated. It was found that Zr, Nb, and Mo have a significant effect to enhance the admissible strain of Ti without change in bulk modulus

  5. Implicit three-dimensional finite-element formulation for the nonlinear structural response of reactor components

    International Nuclear Information System (INIS)

    Kulak, R.F.; Belytschko, T.B.

    1975-09-01

    The formulation of a finite-element procedure for the implicit transient and static analysis of plate/shell type structures in three-dimensional space is described. The triangular plate/shell element can sustain both membrane and bending stresses. Both geometric and material nonlinearities can be treated, and an elastic-plastic material law has been incorporated. The formulation permits the element to undergo arbitrarily large rotations and translations; but, in its present form it is restricted to small strains. The discretized equations of motion are obtained by a stiffness method. An implicit integration algorithm based on trapezoidal integration formulas is used to integrate the discretized equations of motion in time. To ensure numerical stability, an iterative solution procedure with equilibrium checks is used

  6. cAMP response element binding protein (CREB activates transcription via two distinct genetic elements of the human glucose-6-phosphatase gene

    Directory of Open Access Journals (Sweden)

    Stefano Luisa

    2005-01-01

    Full Text Available Abstract Background The enzyme glucose-6-phosphatase catalyzes the dephosphorylation of glucose-6-phosphatase to glucose, the final step in the gluconeogenic and glycogenolytic pathways. Expression of the glucose-6-phosphatase gene is induced by glucocorticoids and elevated levels of intracellular cAMP. The effect of cAMP in regulating glucose-6-phosphatase gene transcription was corroborated by the identification of two genetic motifs CRE1 and CRE2 in the human and murine glucose-6-phosphatase gene promoter that resemble cAMP response elements (CRE. Results The cAMP response element is a point of convergence for many extracellular and intracellular signals, including cAMP, calcium, and neurotrophins. The major CRE binding protein CREB, a member of the basic region leucine zipper (bZIP family of transcription factors, requires phosphorylation to become a biologically active transcriptional activator. Since unphosphorylated CREB is transcriptionally silent simple overexpression studies cannot be performed to test the biological role of CRE-like sequences of the glucose-6-phosphatase gene. The use of a constitutively active CREB2/CREB fusion protein allowed us to uncouple the investigation of target genes of CREB from the variety of signaling pathways that lead to an activation of CREB. Here, we show that this constitutively active CREB2/CREB fusion protein strikingly enhanced reporter gene transcription mediated by either CRE1 or CRE2 derived from the glucose-6-phosphatase gene. Likewise, reporter gene transcription was enhanced following expression of the catalytic subunit of cAMP-dependent protein kinase (PKA in the nucleus of transfected cells. In contrast, activating transcription factor 2 (ATF2, known to compete with CREB for binding to the canonical CRE sequence 5'-TGACGTCA-3', did not transactivate reporter genes containing CRE1, CRE2, or both CREs derived from the glucose-6-phosphatase gene. Conclusions Using a constitutively active CREB2

  7. Metals and trace elements in feathers: A geochemical approach to avoid misinterpretation of analytical responses.

    Science.gov (United States)

    Borghesi, Fabrizio; Migani, Francesca; Andreotti, Alessandro; Baccetti, Nicola; Bianchi, Nicola; Birke, Manfred; Dinelli, Enrico

    2016-02-15

    Assessing trace metal pollution using feathers has long attracted the attention of ecotoxicologists as a cost-effective and non-invasive biomonitoring method. In order to interpret the concentrations in feathers considering the external contamination due to lithic residue particles, we adopted a novel geochemical approach. We analysed 58 element concentrations in feathers of wild Eurasian Greater Flamingo Phoenicopterus roseus fledglings, from 4 colonies in Western Europe (Spain, France, Sardinia, and North-eastern Italy) and one group of adults from zoo. In addition, 53 elements were assessed in soil collected close to the nesting islets. This enabled to compare a wide selection of metals among the colonies, highlighting environmental anomalies and tackling possible causes of misinterpretation of feather results. Most trace elements in feathers (Al, Ce, Co, Cs, Fe, Ga, Li, Mn, Nb, Pb, Rb, Ti, V, Zr, and REEs) were of external origin. Some elements could be constitutive (Cu, Zn) or significantly bioaccumulated (Hg, Se) in flamingos. For As, Cr, and to a lesser extent Pb, it seems that bioaccumulation potentially could be revealed by highly exposed birds, provided feathers are well cleaned. This comprehensive study provides a new dataset and confirms that Hg has been accumulated in feathers in all sites to some extent, with particular concern for the Sardinian colony, which should be studied further including Cr. The Spanish colony appears critical for As pollution and should be urgently investigated in depth. Feathers collected from North-eastern Italy were the hardest to clean, but our methods allowed biological interpretation of Cr and Pb. Our study highlights the importance of external contamination when analysing trace elements in feathers and advances methodological recommendations in order to reduce the presence of residual particles carrying elements of external origin. Geochemical data, when available, can represent a valuable tool for a correct

  8. Element uptake and physiological responses of Lactuca sativa upon co-exposures to tourmaline and dissolved humic acids.

    Science.gov (United States)

    Jia, Weili; Wang, Cuiping; Ma, Chuanxin; Wang, Jicheng; Sun, Hongwen

    2018-03-27

    Element migration and physiological response in Lactuca sativa upon co-exposure to tourmaline (T) and dissolved humic acids (DHAs) were investigated. Different fractions of DHA 1 and DHA 4 and three different doses of T were introduced into Hoagland's solution. The results indicated that T enhanced the contents of elements such as N and C, Si and Al in the roots and shoots. The correlation between TF values of Si and Al (R 2  = 0.7387) was higher than that of Si and Mn (R 2  = 0.4961) without the presence of DHAs. However, both DHA 1 and DHA 4 increased the correlation between Si and Mn, but decreased the one between Si and Al. CAT activities in T treatments were positively correlated to the contents of N and Al in the shoots, whose R 2 was 0.9994 and 0.9897, respectively. In the co-exposure of DHAs and tourmaline, DHA 4 exhibited more impacts on element uptake, CAT activities, as well as ABA contents in comparison with the presence of DHA 1 , regardless of the T exposure doses. These results suggested that DHAs have effects on mineral element behaviors and physiological response in Lactuca sativa upon exposure to tourmaline for the first time, which had great use in guiding soil remediation.

  9. Capacity for cooperative binding of thyroid hormone (T3) receptor dimers defines wild type T3 response elements.

    Science.gov (United States)

    Brent, G A; Williams, G R; Harney, J W; Forman, B M; Samuels, H H; Moore, D D; Larsen, P R

    1992-04-01

    Thyroid hormone response elements (T3REs) have been identified in a variety of promoters including those directing expression of rat GH (rGH), alpha-myosin heavy chain (rMHC), and malic enzyme (rME). A detailed biochemical and genetic analysis of the rGH element has shown that it consists of three hexamers related to the consensus [(A/G)GGT(C/A)A]. We have extended this analysis to the rMHC and rME elements. Binding of highly purified thyroid hormone receptor (T3R) to T3REs was determined using the gel shift assay, and thyroid hormone (T3) induction was measured in transient tranfections. We show that the wild type version of each of the three elements binds T3R dimers cooperatively. Mutational analysis of the rMHC and rME elements identified domains important for binding T3R dimers and allowed a direct determination of the relationship between T3R binding and function. In each element two hexamers are required for dimer binding, and mutations that interfere with dimer formation significantly reduce T3 induction. Similar to the rGH element, the rMHC T3RE contains three hexameric domains arranged as a direct repeat followed by an inverted copy, although the third domain is weaker than in rGH. All three are required for full function and T3R binding. The rME T3RE is a two-hexamer direct repeat T3RE, which also binds T3R monomer and dimer. Across a series of mutant elements, there was a strong correlation between dimer binding in vitro and function in vivo for rMHC (r = 0.99, P less than 0.01) and rME (r = 0.67, P less than 0.05) T3REs. Our results demonstrate a similar pattern of T3R dimer binding to a diverse array of hexameric sequences and arrangements in three wild type T3REs. Addition of nuclear protein enhanced T3R binding but did not alter the specificity of binding to wild type or mutant elements. Binding of purified T3R to T3REs was highly correlated with function, both with and without the addition of nuclear protein. T3R dimer formation is the common

  10. A common red algal origin of the apicomplexan, dinoflagellate, and heterokont plastids

    Czech Academy of Sciences Publication Activity Database

    Janouškovec, J.; Horák, A.; Oborník, Miroslav; Lukeš, Julius; Keeling, P. J.

    2010-01-01

    Roč. 107, č. 24 (2010), s. 10949-10954 ISSN 0027-8424 R&D Projects: GA AV ČR IAA601410907 Institutional research plan: CEZ:AV0Z60220518 Keywords : Apicomplexa * Chromera velia * CCMP3155 * plastid evolution * chloroplast genome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.771, year: 2010

  11. Cytosolic monoterpene biosynthesis is supported by plastid-generated geranyl diphosphate substrate in transgenic tomato fruits.

    Science.gov (United States)

    Gutensohn, Michael; Orlova, Irina; Nguyen, Thuong T H; Davidovich-Rikanati, Rachel; Ferruzzi, Mario G; Sitrit, Yaron; Lewinsohn, Efraim; Pichersky, Eran; Dudareva, Natalia

    2013-08-01

    Geranyl diphosphate (GPP), the precursor of most monoterpenes, is synthesized in plastids from dimethylallyl diphosphate and isopentenyl diphosphate by GPP synthases (GPPSs). In heterodimeric GPPSs, a non-catalytic small subunit (GPPS-SSU) interacts with a catalytic large subunit, such as geranylgeranyl diphosphate synthase, and determines its product specificity. Here, snapdragon (Antirrhinum majus) GPPS-SSU was over-expressed in tomato fruits under the control of the fruit ripening-specific polygalacturonase promoter to divert the metabolic flux from carotenoid formation towards GPP and monoterpene biosynthesis. Transgenic tomato fruits produced monoterpenes, including geraniol, geranial, neral, citronellol and citronellal, while exhibiting reduced carotenoid content. Co-expression of the Ocimum basilicum geraniol synthase (GES) gene with snapdragon GPPS-SSU led to a more than threefold increase in monoterpene formation in tomato fruits relative to the parental GES line, indicating that the produced GPP can be used by plastidic monoterpene synthases. Co-expression of snapdragon GPPS-SSU with the O. basilicum α-zingiberene synthase (ZIS) gene encoding a cytosolic terpene synthase that has been shown to possess both sesqui- and monoterpene synthase activities resulted in increased levels of ZIS-derived monoterpene products compared to fruits expressing ZIS alone. These results suggest that re-direction of the metabolic flux towards GPP in plastids also increases the cytosolic pool of GPP available for monoterpene synthesis in this compartment via GPP export from plastids. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  12. YCF45 protein, usually associated with plastids, is targeted into the mitochondrion of Trypanosoma brucei

    Czech Academy of Sciences Publication Activity Database

    Týč, Jiří; Long, Shaojun; Jirků, Milan; Lukeš, Julius

    2010-01-01

    Roč. 173, č. 1 (2010), s. 43-47 ISSN 0166-6851 R&D Projects: GA ČR GA204/09/1667 Institutional research plan: CEZ:AV0Z60220518 Keywords : Trypanosoma * Plastid * Mitochondrion * Targeting * YCF45 * Horizontal gene transfer Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.875, year: 2010

  13. Divergence of RNA polymerase α subunits in angiosperm plastid genomes is mediated by genomic rearrangement.

    Science.gov (United States)

    Blazier, J Chris; Ruhlman, Tracey A; Weng, Mao-Lun; Rehman, Sumaiyah K; Sabir, Jamal S M; Jansen, Robert K

    2016-04-18

    Genes for the plastid-encoded RNA polymerase (PEP) persist in the plastid genomes of all photosynthetic angiosperms. However, three unrelated lineages (Annonaceae, Passifloraceae and Geraniaceae) have been identified with unusually divergent open reading frames (ORFs) in the conserved region of rpoA, the gene encoding the PEP α subunit. We used sequence-based approaches to evaluate whether these genes retain function. Both gene sequences and complete plastid genome sequences were assembled and analyzed from each of the three angiosperm families. Multiple lines of evidence indicated that the rpoA sequences are likely functional despite retaining as low as 30% nucleotide sequence identity with rpoA genes from outgroups in the same angiosperm order. The ratio of non-synonymous to synonymous substitutions indicated that these genes are under purifying selection, and bioinformatic prediction of conserved domains indicated that functional domains are preserved. One of the lineages (Pelargonium, Geraniaceae) contains species with multiple rpoA-like ORFs that show evidence of ongoing inter-paralog gene conversion. The plastid genomes containing these divergent rpoA genes have experienced extensive structural rearrangement, including large expansions of the inverted repeat. We propose that illegitimate recombination, not positive selection, has driven the divergence of rpoA.

  14. Transcriptional regulation and DNA methylation in plastids during transitional conversion of chloroplasts to chromoplasts.

    Science.gov (United States)

    Kobayashi, H; Ngernprasirtsiri, J; Akazawa, T

    1990-01-01

    During transitional conversion of chloroplasts to chromoplasts in ripening tomato (Lycopersicon esculentum) fruits, transcripts for several plastid genes for photosynthesis decreased to undetectable levels. Run-on transcription of plastids indicated that transcriptional regulation operated as a predominant factor. We found that most of the genes in chloroplasts were actively transcribed in vitro by Escherichia coli and soluble plastid RNA polymerases, but some genes in chromoplasts seemed to be silent when assayed by the in vitro systems. The regulatory step, therefore, was ascribed to DNA templates. The analysis of modified base composition revealed the presence of methylated bases in chromoplast DNA, in which 5-methylcytosine was most abundant. The presence of 5-methylcytosine detected by isoschizomeric endonucleases and Southern hybridization was correlated with the undetectable transcription activity of each gene in the run-on assay and in vitro transcription experiments. It is thus concluded that the suppression of transcription mediated by DNA methylation is one of the mechanisms governing gene expression in plastids converting from chloroplasts to chromoplasts. Images Fig. 1 Fig. 2 Fig. 3. Fig. 4. Fig. 5. PMID:2303026

  15. Ultrastructural study on dynamics of lipid bodies and plastids during ripening of chili pepper fruits.

    Science.gov (United States)

    Liu, Lin

    2013-03-01

    Dynamics of lipid bodies and plastids in chili pepper fruits during ripening were investigated by means of transmission electron microscopy. Mesocarp of chili pepper fruits consists of collenchyma, normal parenchyma, and huge celled parenchyma. In mature green fruits, plastids contain numerous thylakoids that are well organized into grana in collenchyma, a strikingly huge amount of starch and irregularly organized thylakoids in normal parenchyma, and simple tubes rather than thylakoids in huge celled parenchyma. These morphological features suggest that plastids are chloroplasts in collenchyma, chloroamyloplasts in normal parenchyma, proplastids in huge celled parenchyma. As fruits ripen to red, plastids in all cell types convert to chromoplasts and, concomitantly, lipid bodies accumulate in both cytoplasm and chromoplasts. Cytosolic lipid bodies are lined up in a regular layer adjacent to plasma membrane. The cytosolic lipid body consists of a core surrounded by a membrane. The core is comprised of a more electron-dense central part enclosed by a slightly less electron-dense peripheral layer. Plastidial lipid bodies in collenchyma, normal parenchyma, and endodermis initiate as plastoglobuli, which in turn convert to rod-like structures. Therefore, plastidial lipid bodies are more dynamic than cytosolic lipid bodies. Both cytosolic and plastidial lipid bodies contain rich unsaturated lipids. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. New advances in the forced response computation of periodic structures using the wave finite element (WFE) method

    OpenAIRE

    Mencik , Jean-Mathieu

    2014-01-01

    International audience; The wave finite element (WFE) method is investigated to describe the harmonic forced response of onedimensional periodic structures like those composed of complex substructures and encountered in engineering applications. The dynamic behavior of these periodic structures is analyzed over wide frequency bands where complex spatial dynamics, inside the substructures, are likely to occur.Within theWFE framework, the dynamic behavior of periodic structures is described in ...

  17. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Czech Academy of Sciences Publication Activity Database

    Štísová, Viktorie; Goffinont, S.; Maurizot, M. S.; Davídková, Marie

    2010-01-01

    Roč. 79, č. 8 (2010), s. 880-889 ISSN 0969-806X R&D Projects: GA MŠk 1P05OC085; GA MŠk OC09012 Institutional research plan: CEZ:AV0Z10480505 Keywords : DNA-protein complex * estrogen response element * estrogen receptor * ionizing radiation Subject RIV: BO - Biophysics Impact factor: 1.132, year: 2010

  18. Dielectric response of arbitrary-shaped clusters studied by the finite element method

    Czech Academy of Sciences Publication Activity Database

    Rychetský, Ivan; Klíč, Antonín

    2012-01-01

    Roč. 427, č. 1 (2012), s. 143-147 ISSN 0015-0193 R&D Projects: GA ČR GA202/09/0430 Institutional research plan: CEZ:AV0Z10100520 Keywords : effective permittivity * two-component composite * integral representation * finite element analysis Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.415, year: 2012

  19. Program for responsible and safe disposal of spent fuel elements and radioactive wastes (National disposal program)

    International Nuclear Information System (INIS)

    2015-01-01

    The contribution covers the following topics: fundamentals of the disposal policy; amount of radioactive wastes and prognosis; disposal of radioactive wastes - spent fuel elements and wastes from waste processing, radioactive wastes with low heat production; legal framework of the nuclear waste disposal in Germany; public participation, cost and financing.

  20. Phylogenetic Analysis of Nucleus-Encoded Acetyl-CoA Carboxylases Targeted at the Cytosol and Plastid of Algae.

    KAUST Repository

    Huerlimann, Roger

    2015-07-01

    The understanding of algal phylogeny is being impeded by an unknown number of events of horizontal gene transfer (HGT), and primary and secondary/tertiary endosymbiosis. Through these events, previously heterotrophic eukaryotes developed photosynthesis and acquired new biochemical pathways. Acetyl-CoA carboxylase (ACCase) is a key enzyme in the fatty acid synthesis and elongation pathways in algae, where ACCase exists in two locations (cytosol and plastid) and in two forms (homomeric and heteromeric). All algae contain nucleus-encoded homomeric ACCase in the cytosol, independent of the origin of the plastid. Nucleus-encoded homomeric ACCase is also found in plastids of algae that arose from a secondary/tertiary endosymbiotic event. In contrast, plastids of algae that arose from a primary endosymbiotic event contain heteromeric ACCase, which consists of three nucleus-encoded and one plastid-encoded subunits. These properties of ACCase provide the potential to inform on the phylogenetic relationships of hosts and their plastids, allowing different hypothesis of endosymbiotic events to be tested. Alveolata (Dinoflagellata and Apicomplexa) and Chromista (Stramenopiles, Haptophyta and Cryptophyta) have traditionally been grouped together as Chromalveolata, forming the red lineage. However, recent genetic evidence groups the Stramenopiles, Alveolata and green plastid containing Rhizaria as SAR, excluding Haptophyta and Cryptophyta. Sequences coding for plastid and cytosol targeted homomeric ACCases were isolated from Isochrysis aff. galbana (TISO), Chromera velia and Nannochloropsis oculata, representing three taxonomic groups for which sequences were lacking. Phylogenetic analyses show that cytosolic ACCase strongly supports the SAR grouping. Conversely, plastidial ACCase groups the SAR with the Haptophyta, Cryptophyta and Prasinophyceae (Chlorophyta). These two ACCase based, phylogenetic relationships suggest that the plastidial homomeric ACCase was acquired by the

  1. Complete plastid genome sequences suggest strong selection for retention of photosynthetic genes in the parasitic plant genus Cuscuta.

    Science.gov (United States)

    McNeal, Joel R; Kuehl, Jennifer V; Boore, Jeffrey L; de Pamphilis, Claude W

    2007-10-24

    Plastid genome content and protein sequence are highly conserved across land plants and their closest algal relatives. Parasitic plants, which obtain some or all of their nutrition through an attachment to a host plant, are often a striking exception. Heterotrophy can lead to relaxed constraint on some plastid genes or even total gene loss. We sequenced plastid genomes of two species in the parasitic genus Cuscuta along with a non-parasitic relative, Ipomoea purpurea, to investigate changes in the plastid genome that may result from transition to the parasitic lifestyle. Aside from loss of all ndh genes, Cuscuta exaltata retains photosynthetic and photorespiratory genes that evolve under strong selective constraint. Cuscuta obtusiflora has incurred substantially more change to its plastid genome, including loss of all genes for the plastid-encoded RNA polymerase. Despite extensive change in gene content and greatly increased rate of overall nucleotide substitution, C. obtusiflora also retains all photosynthetic and photorespiratory genes with only one minor exception. Although Epifagus virginiana, the only other parasitic plant with its plastid genome sequenced to date, has lost a largely overlapping set of transfer-RNA and ribosomal genes as Cuscuta, it has lost all genes related to photosynthesis and maintains a set of genes which are among the most divergent in Cuscuta. Analyses demonstrate photosynthetic genes are under the highest constraint of any genes within the plastid genomes of Cuscuta, indicating a function involving RuBisCo and electron transport through photosystems is still the primary reason for retention of the plastid genome in these species.

  2. Complete plastid genome sequences suggest strong selection for retention of photosynthetic genes in the parasitic plant genus Cuscuta

    Directory of Open Access Journals (Sweden)

    Kuehl Jennifer V

    2007-10-01

    Full Text Available Abstract Background Plastid genome content and protein sequence are highly conserved across land plants and their closest algal relatives. Parasitic plants, which obtain some or all of their nutrition through an attachment to a host plant, are often a striking exception. Heterotrophy can lead to relaxed constraint on some plastid genes or even total gene loss. We sequenced plastid genomes of two species in the parasitic genus Cuscuta along with a non-parasitic relative, Ipomoea purpurea, to investigate changes in the plastid genome that may result from transition to the parasitic lifestyle. Results Aside from loss of all ndh genes, Cuscuta exaltata retains photosynthetic and photorespiratory genes that evolve under strong selective constraint. Cuscuta obtusiflora has incurred substantially more change to its plastid genome, including loss of all genes for the plastid-encoded RNA polymerase. Despite extensive change in gene content and greatly increased rate of overall nucleotide substitution, C. obtusiflora also retains all photosynthetic and photorespiratory genes with only one minor exception. Conclusion Although Epifagus virginiana, the only other parasitic plant with its plastid genome sequenced to date, has lost a largely overlapping set of transfer-RNA and ribosomal genes as Cuscuta, it has lost all genes related to photosynthesis and maintains a set of genes which are among the most divergent in Cuscuta. Analyses demonstrate photosynthetic genes are under the highest constraint of any genes within the plastid genomes of Cuscuta, indicating a function involving RuBisCo and electron transport through photosystems is still the primary reason for retention of the plastid genome in these species.

  3. Dis3- and exosome subunit-responsive 3′ mRNA instability elements

    International Nuclear Information System (INIS)

    Kiss, Daniel L.; Hou, Dezhi; Gross, Robert H.; Andrulis, Erik D.

    2012-01-01

    Highlights: ► Successful use of a novel RNA-specific bioinformatic tool, RNA SCOPE. ► Identified novel 3′ UTR cis-acting element that destabilizes a reporter mRNA. ► Show exosome subunits are required for cis-acting element-mediated mRNA instability. ► Define precise sequence requirements of novel cis-acting element. ► Show that microarray-defined exosome subunit-regulated mRNAs have novel element. -- Abstract: Eukaryotic RNA turnover is regulated in part by the exosome, a nuclear and cytoplasmic complex of ribonucleases (RNases) and RNA-binding proteins. The major RNase of the complex is thought to be Dis3, a multi-functional 3′–5′ exoribonuclease and endoribonuclease. Although it is known that Dis3 and core exosome subunits are recruited to transcriptionally active genes and to messenger RNA (mRNA) substrates, this recruitment is thought to occur indirectly. We sought to discover cis-acting elements that recruit Dis3 or other exosome subunits. Using a bioinformatic tool called RNA SCOPE to screen the 3′ untranslated regions of up-regulated transcripts from our published Dis3 depletion-derived transcriptomic data set, we identified several motifs as candidate instability elements. Secondary screening using a luciferase reporter system revealed that one cassette—harboring four elements—destabilized the reporter transcript. RNAi-based depletion of Dis3, Rrp6, Rrp4, Rrp40, or Rrp46 diminished the efficacy of cassette-mediated destabilization. Truncation analysis of the cassette showed that two exosome subunit-sensitive elements (ESSEs) destabilized the reporter. Point-directed mutagenesis of ESSE abrogated the destabilization effect. An examination of the transcriptomic data from exosome subunit depletion-based microarrays revealed that mRNAs with ESSEs are found in every up-regulated mRNA data set but are underrepresented or missing from the down-regulated data sets. Taken together, our findings imply a potentially novel mechanism of m

  4. Ultraviolet B (UVB) induction of the c-fos promoter is mediated by phospho-cAMP response element binding protein (CREB) binding to CRE and c-fos activator protein 1 site (FAP1) cis elements.

    Science.gov (United States)

    Gonzales, Melissa; Bowden, G Tim

    2002-06-26

    The ultraviolet B (UVB) portion (280-320 nm) of the ultraviolet spectrum has been shown to contribute to the development of non-melanoma skin cancer in humans. Research in the human keratinocyte cell line, HaCaT, revealed that UVB irradiation caused the upregulation of the transcription factor activator protein-1 (AP-1). The AP-1 complex formed in UVB-irradiated HaCaT cells is specifically composed of c-fos and Jun D. c-Fos expression was induced in a manner that correlated with the UVB-induced activation of AP-1. To investigate how c-fos expression is regulated by UVB irradiation, the role of each of four cis elements within the c-fos promoter was evaluated. Clustered point mutations at the sis inducible element (SIE), serum response element (SRE), c-fos AP-1 site (FAP1), or cyclic AMP response elements (CRE) significantly inhibited UVB induction of the c-fos promoter. This indicated that all four cis elements are required for maximum promoter activity. The CRE and FAP1 elements were the two most active cis elements that mediate the UVB transactivation of c-fos. Homodimers of phosphorylated cAMP response element binding protein (CREB) were induced by UVB irradiation to bind to each of these elements. Therefore, CREB may function as an important regulatory protein in the UVB-induced expression of c-fos.

  5. Engineering plastid fatty acid biosynthesis to improve food quality and biofuel production in higher plants.

    Science.gov (United States)

    Rogalski, Marcelo; Carrer, Helaine

    2011-06-01

    The ability to manipulate plant fatty acid biosynthesis by using new biotechnological approaches has allowed the production of transgenic plants with unusual fatty acid profile and increased oil content. This review focuses on the production of very long chain polyunsaturated fatty acids (VLCPUFAs) and the increase in oil content in plants using molecular biology tools. Evidences suggest that regular consumption of food rich in VLCPUFAs has multiple positive health benefits. Alternative sources of these nutritional fatty acids are found in cold-water fishes. However, fish stocks are in severe decline because of decades of overfishing, and also fish oils can be contaminated by the accumulation of toxic compounds. Recently, there is also an increase in oilseed use for the production of biofuels. This tendency is partly associated with the rapidly rising costs of petroleum, increased concern about the environmental impact of fossil oil and the attractive need to develop renewable sources of fuel. In contrast to this scenario, oil derived from crop plants is normally contaminant free and less environmentally aggressive. Genetic engineering of the plastid genome (plastome) offers a number of attractive advantages, including high-level foreign protein expression, marker-gene excision and transgene containment because of maternal inheritance of plastid genome in most crops. Here, we describe the possibility to improve fatty acid biosynthesis in plastids, production of new fatty acids and increase their content in plants by genetic engineering of plastid fatty acid biosynthesis via plastid transformation. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

  6. Are algal genes in nonphotosynthetic protists evidence of historical plastid endosymbioses?

    Directory of Open Access Journals (Sweden)

    Tian Jing

    2009-10-01

    Full Text Available Abstract Background How photosynthetic organelles, or plastids, were acquired by diverse eukaryotes is among the most hotly debated topics in broad scale eukaryotic evolution. The history of plastid endosymbioses commonly is interpreted under the "chromalveolate" hypothesis, which requires numerous plastid losses from certain heterotrophic groups that now are entirely aplastidic. In this context, discoveries of putatively algal genes in plastid-lacking protists have been cited as evidence of gene transfer from a photosynthetic endosymbiont that subsequently was lost completely. Here we examine this evidence, as it pertains to the chromalveolate hypothesis, through genome-level statistical analyses of similarity scores from queries with two diatoms, Phaeodactylum tricornutum and Thalassiosira pseudonana, and two aplastidic sister taxa, Phytophthora ramorum and P. sojae. Results Contingency tests of specific predictions of the chromalveolate model find no evidence for an unusual red algal contribution to Phytophthora genomes, nor that putative cyanobacterial sequences that are present entered these genomes through a red algal endosymbiosis. Examination of genes unrelated to plastid function provide extraordinarily significant support for both of these predictions in diatoms, the control group where a red endosymbiosis is known to have occurred, but none of that support is present in genes specifically conserved between diatoms and oomycetes. In addition, we uncovered a strong association between overall sequence similarities among taxa and relative sizes of genomic data sets in numbers of genes. Conclusion Signal from "algal" genes in oomycete genomes is inconsistent with the chromalveolate hypothesis, and better explained by alternative models of sequence and genome evolution. Combined with the numerous sources of intragenomic phylogenetic conflict characterized previously, our results underscore the potential to be mislead by a posteriori

  7. Functional consequences of inducible genetic elements from the p53 SOS response in a mammalian organ system.

    Science.gov (United States)

    Guthrie, O'neil W

    2017-10-01

    In response to DNA damage from ultraviolet (UV) radiation, bacteria deploy the SOS response in order to limit cell death. This bacterial SOS response is characterized by an increase in the recA gene that transactivates expression of multiple DNA repair genes. The current series of experiments demonstrate that a mammalian organ system (the cochlea) that is not evolutionarily conditioned to UV radiation can elicit SOS responses that are reminiscent of that of bacteria. This mammalian SOS response is characterized by an increase in the p53 gene with activation of multiple DNA repair genes that harbor p53 response elements in their promoters. Furthermore, the experimental results provide support for the notion of a convergent trigger paradox, where independent SOS triggers facilitate disparate physiologic sequelae (loss vs. recovery of function). Therefore, it is proposed that the mammalian SOS response is multifunctional and manipulation of this endogenous response could be exploited in future biomedical interventions. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice

    Directory of Open Access Journals (Sweden)

    Riaño-Pachón Diego

    2007-08-01

    Full Text Available Abstract Background In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs, ABRE and CE3, in thale cress (Arabidopsis thaliana and rice (Oryza sativa. Results Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Conclusion Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of

  9. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice.

    Science.gov (United States)

    Gómez-Porras, Judith L; Riaño-Pachón, Diego Mauricio; Dreyer, Ingo; Mayer, Jorge E; Mueller-Roeber, Bernd

    2007-08-01

    In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs), ABRE and CE3, in thale cress (Arabidopsis thaliana) and rice (Oryza sativa). Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE) associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs) in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of interacting with transcription factors. Further studies will be

  10. Interactions between the cytomegalovirus promoter and the estrogen response element: implications for design of estrogen-responsive reporter plasmids.

    Science.gov (United States)

    Derecka, K; Wang, C K; Flint, A P F

    2006-07-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)ERE) was not estrogen responsive. Inhibition of ERE function was not due to an effect in trans or due to lack of estrogen receptor. It was not due to an interaction between the cmv promoter and the SeAP gene. cmv promoter function was dependent on NF-kappaB, and mutagenesis in the NF-kappaB sites reduced basal reporter expression without imparting responsiveness to estrogen. A mutation in the TATA box also failed to impart estrogen responsiveness. Modeling of DNA accessibility indicated the ERE was inserted at a site accessible to transcription factors. We conclude that the cmv promoter inhibits ERE function in cis when the two sequences are located in the same construct, and that this effect does not involve an interaction between cmv and reporter gene, NF-kappaB sites or the TATA box, or DNA inaccessibility.

  11. Modeling and assessment of the response of super-light elements to fire

    DEFF Research Database (Denmark)

    Hertz, Kristian Dahl; Campeanu, B.M.; Giraudo, M.

    2013-01-01

    Due to the significant weight of the elements, which raise the construction and transportation costs and the CO2 production, concrete buildings may not meet the requirements for sustainable constructions. Furthermore, concrete is quite vulnerable to fire, as it undergoes a permanent degradation...... of its mechanical properties at temperatures commonly reached by structural elements during a fire in a building. As a consequence, several multi-story concrete buildings have collapsed or suffered major structural damages because of fire, and caused injuries and casualties among the occupants. Even...... in those cases, where a safe evacuation of the building is ensured, the high costs associated with the downtime and reparation of the building can be very high and not acceptable in the view of a safe and sustainable design of structures. In this respect, the newly patented building technology...

  12. Study of the Internal Mechanical response of an asphalt mixture by 3-D Discrete Element Modeling

    DEFF Research Database (Denmark)

    Feng, Huan; Pettinari, Matteo; Hofko, Bernhard

    2015-01-01

    and the reliability of which have been validated. The dynamic modulus of asphalt mixtures were predicted by conducting Discrete Element simulation under dynamic strain control loading. In order to reduce the calculation time, a method based on frequency–temperature superposition principle has been implemented......In this paper the viscoelastic behavior of asphalt mixture was investigated by employing a three-dimensional Discrete Element Method (DEM). The cylinder model was filled with cubic array of spheres with a specified radius, and was considered as a whole mixture with uniform contact properties....... The ball density effect on the internal stress distribution of the asphalt mixture model has been studied when using this method. Furthermore, the internal stresses under dynamic loading have been studied. The agreement between the predicted and the laboratory test results of the complex modulus shows...

  13. Interactions Between the Cytomegalovirus Promoter and the Estrogen Response Element: Implications for Design of Estrogen-Responsive Reporter Plasmids

    OpenAIRE

    Derecka, K.; Wang, C.K.; Flint, A.P.F.

    2006-01-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)...

  14. Transport of rare earth element-tagged soil particles in response to thunderstorm runoff.

    Science.gov (United States)

    Matisoff, G; Ketterer, M E; Wilson, C G; Layman, R; Whiting, P J

    2001-08-15

    The downslope transport of rare earth element-tagged soil particles remobilized during a spring thunderstorm was studied on both a natural prairie and an agricultural field in southwestern Iowa (U.S.A.). A technique was developed for tagging natural soils with the rare earth elements Eu, Tb, and Ho to approximately 1,000 ppm via coprecipitation with MnO2. Tagged material was replaced in target locations; surficial soil samples were collected following precipitation and runoff; and rare earth element concentrations were determined by inductively coupled plasma mass spectrometry. Diffusion and exponential models were applied to the concentration-distance data to determine particle transport distances. The results indicate that the concentration-distance data are well described by the diffusion model, butthe exponential model does not simulate the rapid drop-off in concentrations near the tagged source. Using the diffusion model, calculated particle transport distances at all hillside locations and at both the cultivated and natural prairie sites were short, ranging from 3 to 73 cm during this single runoff event. This study successfully demonstrates a new tool for studying soil erosion.

  15. The Arabidopsis arc5 and arc6 mutations differentially affect plastid morphology in pavement and guard cells in the leaf epidermis.

    Science.gov (United States)

    Fujiwara, Makoto T; Yasuzawa, Mana; Kojo, Kei H; Niwa, Yasuo; Abe, Tomoko; Yoshida, Shigeo; Nakano, Takeshi; Itoh, Ryuuichi D

    2018-01-01

    Chloroplasts, or photosynthetic plastids, multiply by binary fission, forming a homogeneous population in plant cells. In Arabidopsis thaliana, the division apparatus (or division ring) of mesophyll chloroplasts includes an inner envelope transmembrane protein ARC6, a cytoplasmic dynamin-related protein ARC5 (DRP5B), and members of the FtsZ1 and FtsZ2 families of proteins, which co-assemble in the stromal mid-plastid division ring (FtsZ ring). FtsZ ring placement is controlled by several proteins, including a stromal factor MinE (AtMinE1). During leaf mesophyll development, ARC6 and AtMinE1 are necessary for FtsZ ring formation and thus plastid division initiation, while ARC5 is essential for a later stage of plastid division. Here, we examined plastid morphology in leaf epidermal pavement cells (PCs) and stomatal guard cells (GCs) in the arc5 and arc6 mutants using stroma-targeted fluorescent proteins. The arc5 PC plastids were generally a bit larger than those of the wild type, but most had normal shapes and were division-competent, unlike mutant mesophyll chloroplasts. The arc6 PC plastids were heterogeneous in size and shape, including the formation of giant and mini-plastids, plastids with highly developed stromules, and grape-like plastid clusters, which varied on a cell-by-cell basis. Moreover, unique plastid phenotypes for stomatal GCs were observed in both mutants. The arc5 GCs rarely lacked chlorophyll-bearing plastids (chloroplasts), while they accumulated minute chlorophyll-less plastids, whereas most GCs developed wild type-like chloroplasts. The arc6 GCs produced large chloroplasts and/or chlorophyll-less plastids, as previously observed, but unexpectedly, their chloroplasts/plastids exhibited marked morphological variations. We quantitatively analyzed plastid morphology and partitioning in paired GCs from wild-type, arc5, arc6, and atminE1 plants. Collectively, our results support the notion that ARC5 is dispensable in the process of equal division

  16. Geological occurrence response to trace elemental migration in coal liquefaction based on SPSS: take no. 11 coalbed in Antaibao mine for example

    Science.gov (United States)

    Xia, Xiaohong; Qin, Yong; Yang, Weifeng

    2013-03-01

    Coal liquefaction is an adoptable method to transfer the solid fossil energy into liquid oil in large scale, but the dirty material in which will migrate to different step of liquefaction. The migration rule of some trace elements is response to the react activity of macerals in coal and the geological occurrence of the element nature of itself. In this paper, from the SPSS data correlation analysis and hierarchical clustering dendrogram about the trace elements with macerals respond to coal liquefaction yield, it shows the trace elements in No.11 Antaibao coal seam originated from some of lithophile and sulphophle elements. Correlation coefficient between liquefaction yield of three organic macerals and migration of the elements in liquefaction residue indicated that the lithophile are easy to transfer to residue, while sulphophle are apt to in the liquid products. The activated macerals are response to sulphophle trace elements. The conclusion is useful to the coal blending and environmental effects on coal direct liquefaction.

  17. MYC cis-Elements in PsMPT Promoter Is Involved in Chilling Response of Paeonia suffruticosa.

    Directory of Open Access Journals (Sweden)

    Yuxi Zhang

    Full Text Available The MPT transports Pi to synthesize ATP. PsMPT, a chilling-induced gene, was previously reported to promote energy metabolism during bud dormancy release in tree peony. In this study, the regulatory elements of PsMPT promoter involved in chilling response were further analyzed. The PsMPT transcript was detected in different tree peony tissues and was highly expressed in the flower organs, including petal, stigma and stamen. An 1174 bp of the PsMPT promoter was isolated by TAIL-PCR, and the PsMPT promoter::GUS transgenic Arabidopsis was generated and analyzed. GUS staining and qPCR showed that the promoter was active in mainly the flower stigma and stamen. Moreover, it was found that the promoter activity was enhanced by chilling, NaCl, GA, ACC and NAA, but inhibited by ABA, mannitol and PEG. In transgenic plants harboring 421 bp of the PsMPT promoter, the GUS gene expression and the activity were significantly increased by chilling treatment. When the fragment from -421 to -408 containing a MYC cis-element was deleted, the chilling response could not be observed. Further mutation analysis confirmed that the MYC element was one of the key motifs responding to chilling in the PsMPT promoter. The present study provides useful information for further investigation of the regulatory mechanism of PsMPT during the endo-dormancy release.

  18. Adaptive response of arbuscular mycorrhizal symbiosis to accumulation of elements and translocation in Phragmites australis affected by cadmium stress.

    Science.gov (United States)

    Huang, Xiaochen; Ho, Shih-Hsin; Zhu, Shishu; Ma, Fang; Wu, Jieting; Yang, Jixian; Wang, Li

    2017-07-15

    Arbuscular mycorrhizal (AM) fungi have been reported to play a central role in improving plant tolerance to cadmium (Cd)-contaminated sites. This is achieved by enhancing both the growth of host plants and the nutritive elements in plants. This study assessed potential regulatory effects of AM symbiosis with regard to nutrient uptake and transport, and revealed different response strategies to various Cd concentrations. Phragmites australis was inoculated with Rhizophagus irregularis in the greenhouse cultivation system, where it was treated with 0-20 mg L -1 of Cd for 21days to investigate growth parameters, as well as Cd and nutritive element distribution in response to AM fungus inoculation. Mycorrhizal plants showed a higher tolerance, particularly under high Cd-level stress in the substrate. Moreover, our results determined the roots as dominant Cd reservoirs in plants. The AM fungus improved Cd accumulation and saturated concentration in the roots, thus inhibiting Cd uptake to shoots. The observed distributions of nutritive elements and the interactions among these indicated the highest microelement contribution to roots, Ca contributed maximally in leaves, and K and P contributed similarly under Cd stress. In addition, AM fungus inoculation effectively impacted Mn and P uptake and accumulation while coping with Cd toxicity. This study also demonstrated translocation factor from metal concentration (TF) could be a good parameter to evaluate different transportation strategies induced by various Cd stresses in contrast to the bioconcentration factor (BCF) and translocation factor from metal accumulation (TF'). Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. ETHYLENE RESPONSE FACTOR 96 positively regulates Arabidopsis resistance to necrotrophic pathogens by direct binding to GCC elements of jasmonate - and ethylene-responsive defence genes.

    Science.gov (United States)

    Catinot, Jérémy; Huang, Jing-Bo; Huang, Pin-Yao; Tseng, Min-Yuan; Chen, Ying-Lan; Gu, Shin-Yuan; Lo, Wan-Sheng; Wang, Long-Chi; Chen, Yet-Ran; Zimmerli, Laurent

    2015-12-01

    The ERF (ethylene responsive factor) family is composed of transcription factors (TFs) that are critical for appropriate Arabidopsis thaliana responses to biotic and abiotic stresses. Here we identified and characterized a member of the ERF TF group IX, namely ERF96, that when overexpressed enhances Arabidopsis resistance to necrotrophic pathogens such as the fungus Botrytis cinerea and the bacterium Pectobacterium carotovorum. ERF96 is jasmonate (JA) and ethylene (ET) responsive and ERF96 transcripts accumulation was abolished in JA-insensitive coi1-16 and in ET-insensitive ein2-1 mutants. Protoplast transactivation and electrophoresis mobility shift analyses revealed that ERF96 is an activator of transcription that binds to GCC elements. In addition, ERF96 mainly localized to the nucleus. Microarray analysis coupled to chromatin immunoprecipitation-PCR of Arabidopsis overexpressing ERF96 revealed that ERF96 enhances the expression of the JA/ET defence genes PDF1.2a, PR-3 and PR-4 as well as the TF ORA59 by direct binding to GCC elements present in their promoters. While ERF96-RNAi plants demonstrated wild-type resistance to necrotrophic pathogens, basal PDF1.2 expression levels were reduced in ERF96-silenced plants. This work revealed ERF96 as a key player of the ERF network that positively regulates the Arabidopsis resistance response to necrotrophic pathogens. © 2015 John Wiley & Sons Ltd.

  20. A phylogenetic analysis of the genus Psathyrostachys (Poaceae) based on one nuclear gene, three plastid genes, and morphology

    DEFF Research Database (Denmark)

    Petersen, Gitte; Seberg, Ole; Baden, Claus

    2004-01-01

    A phylogenetic analysis of the small, Central Asian genus Psathyrostachys Nevski is presented. The analysis is based on morphological characters and nucleotide sequence data from one nuclear gene, DMC1, and three plastid genes, rbcL, rpoA, and rpoC2. Separate analyses of the three data partitions...... (morphology, nuclear sequences, and plastid sequences) result in mostly congruent trees. The plastid and nuclear sequences produce completely congruent trees, and only the trees based on plastid sequences and morphological characters are incongruent. Combined analysis of all data results in a fairly well......-resolved strict consensus tree: Ps. rupestris is the sister to the remaining species, which are divided into two clades: one including Ps. fragilis and Ps. caduca, the other including Ps. juncea, Ps. huashanica, Ps. lanuginosa, Ps. stoloniformis, and Ps. kronenburgii. Pubescent culms and more than 20 mm long...

  1. Activation of the carbohydrate response element binding protein (ChREBP) in response to anoxia in the turtle Trachemys scripta elegans.

    Science.gov (United States)

    Krivoruchko, Anastasia; Storey, Kenneth B

    2014-10-01

    ChREBP (carbohydrate response element binding protein) is a glucose-responsive transcription factor that is known to be an important regulator of glycolytic and lipogenic genes in response to glucose. We hypothesized that activation of ChREBP could be relevant to anoxia survival by the anoxia-tolerant turtle, Trachemys scripta elegans. Expression of ChREBP in response to 5 and 20h of anoxia was examined using RT-PCR and Western immunoblotting. In addition, subcellular localization and DNA-binding activity of ChREBP protein were assessed and transcript levels of liver pyruvate kinase (LPK), a downstream gene under ChREBP control were quantified using RT-PCR. ChREBP was anoxia-responsive in kidney and liver, with transcript levels increasing by 1.2-1.8 fold in response to anoxia and protein levels increasing by 1.8-1.9 fold. Enhanced nuclear presence under anoxia was also observed in both tissues by 2.2-2.8 fold. A 4.2 fold increase in DNA binding activity of ChREBP was also observed in liver in response to 5h of anoxia. In addition, transcript levels of LPK increased by 2.1 fold in response to 5h of anoxia in the liver. The results suggest that activation of ChREBP in response to anoxia might be a crucial factor for anoxia survival in turtle liver by contributing to elevated glycolytic flux in the initial phases of oxygen limitation. This study provides the first demonstration of activation of ChREBP in response to anoxia in a natural model of anoxia tolerance, further improving our understanding of the molecular nature of anoxia tolerance. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Seismic response of three-dimensional topographies using a time-domain boundary element method

    Science.gov (United States)

    Janod, François; Coutant, Olivier

    2000-08-01

    We present a time-domain implementation for a boundary element method (BEM) to compute the diffraction of seismic waves by 3-D topographies overlying a homogeneous half-space. This implementation is chosen to overcome the memory limitations arising when solving the boundary conditions with a frequency-domain approach. This formulation is flexible because it allows one to make an adaptive use of the Green's function time translation properties: the boundary conditions solving scheme can be chosen as a trade-off between memory and cpu requirements. We explore here an explicit method of solution that requires little memory but a high cpu cost in order to run on a workstation computer. We obtain good results with four points per minimum wavelength discretization for various topographies and plane wave excitations. This implementation can be used for two different aims: the time-domain approach allows an easier implementation of the BEM in hybrid methods (e.g. coupling with finite differences), and it also allows one to run simple BEM models with reasonable computer requirements. In order to keep reasonable computation times, we do not introduce any interface and we only consider homogeneous models. Results are shown for different configurations: an explosion near a flat free surface, a plane wave vertically incident on a Gaussian hill and on a hemispherical cavity, and an explosion point below the surface of a Gaussian hill. Comparison is made with other numerical methods, such as finite difference methods (FDMs) and spectral elements.

  3. Quantitative analysis of polycomb response elements (PREs at identical genomic locations distinguishes contributions of PRE sequence and genomic environment

    Directory of Open Access Journals (Sweden)

    Okulski Helena

    2011-03-01

    Full Text Available Abstract Background Polycomb/Trithorax response elements (PREs are cis-regulatory elements essential for the regulation of several hundred developmentally important genes. However, the precise sequence requirements for PRE function are not fully understood, and it is also unclear whether these elements all function in a similar manner. Drosophila PRE reporter assays typically rely on random integration by P-element insertion, but PREs are extremely sensitive to genomic position. Results We adapted the ΦC31 site-specific integration tool to enable systematic quantitative comparison of PREs and sequence variants at identical genomic locations. In this adaptation, a miniwhite (mw reporter in combination with eye-pigment analysis gives a quantitative readout of PRE function. We compared the Hox PRE Frontabdominal-7 (Fab-7 with a PRE from the vestigial (vg gene at four landing sites. The analysis revealed that the Fab-7 and vg PREs have fundamentally different properties, both in terms of their interaction with the genomic environment at each site and their inherent silencing abilities. Furthermore, we used the ΦC31 tool to examine the effect of deletions and mutations in the vg PRE, identifying a 106 bp region containing a previously predicted motif (GTGT that is essential for silencing. Conclusions This analysis showed that different PREs have quantifiably different properties, and that changes in as few as four base pairs have profound effects on PRE function, thus illustrating the power and sensitivity of ΦC31 site-specific integration as a tool for the rapid and quantitative dissection of elements of PRE design.

  4. Quality assessment of structure and language elements of written responses given by seven Scandinavian drug information centres

    DEFF Research Database (Denmark)

    Reppe, Linda Amundstuen; Spigset, Olav; Kampmann, Jens Peter

    2017-01-01

    PURPOSE: The aim of this study was to identify structure and language elements affecting the quality of responses from Scandinavian drug information centres (DICs). METHODS: Six different fictitious drug-related queries were sent to each of seven Scandinavian DICs. The centres were blinded for wh...... on drug-related queries with respect to language and text structure. Giving specific advice and precise conclusions and avoiding too compressed language and non-standard abbreviations may aid to reach this goal....... of responses was generally judged as satisfactory to good. Presenting specific advice and conclusions were considered to improve the quality of the responses. However, small nuances in language formulations could affect the individual judgments of the experts, e.g. on whether or not advice was given. Some...... and explaining pharmacological terms to ensure that enquirers understand the response as intended. In addition, more use of active voice and less compressed text structure would be desirable. CONCLUSIONS: This evaluation of responses to DIC queries may give some indications on how to improve written responses...

  5. Enrichment of conserved synaptic activity-responsive element in neuronal genes predicts a coordinated response of MEF2, CREB and SRF.

    Directory of Open Access Journals (Sweden)

    Fernanda M Rodríguez-Tornos

    Full Text Available A unique synaptic activity-responsive element (SARE sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity. We hypothesize that this sequence is a broad mechanism that regulates gene expression in response to synaptic activation and during plasticity; and that analysis of SARE-containing genes could identify molecular mechanisms involved in brain disorders. To search for conserved SARE sequences in the mammalian genome, we used the SynoR in silico tool, and found the SARE cluster predominantly in the regulatory regions of genes expressed specifically in the nervous system; most were related to neural development and homeostatic maintenance. Two of these SARE sequences were tested in luciferase assays and proved to promote transcription in response to neuronal activation. Supporting the predictive capacity of our candidate list, up-regulation of several SARE containing genes in response to neuronal activity was validated using external data and also experimentally using primary cortical neurons and quantitative real time RT-PCR. The list of SARE-containing genes includes several linked to mental retardation and cognitive disorders, and is significantly enriched in genes that encode mRNA targeted by FMRP (fragile X mental retardation protein. Our study thus supports the idea that SARE sequences are relevant transcriptional regulatory elements that participate in plasticity. In addition, it offers a comprehensive view of how activity-responsive transcription factors coordinate their actions and increase the selectivity of their targets. Our data suggest that analysis of SARE-containing genes will reveal yet-undescribed pathways of synaptic plasticity and additional candidate genes disrupted in mental disease.

  6. Differential regulation of the human progesterone receptor gene through an estrogen response element half site and Sp1 sites.

    Science.gov (United States)

    Petz, Larry N; Ziegler, Yvonne S; Schultz, Jennifer R; Kim, Hwajin; Kemper, J Kim; Nardulli, Ann M

    2004-02-01

    The progesterone receptor (PR) gene is regulated by estrogen in normal reproductive tissues and in MCF-7 human breast cancer cells. Although it is generally thought that estrogen responsiveness is mediated by interaction of the ligand-occupied estrogen receptor (ER) with estrogen response elements (EREs) in target genes, the human progesterone receptor (PR) gene lacks a palindromic ERE. Promoter A of the PR gene does, however, contain an ERE half site upstream of two adjacent Sp1 sites from +571 to +595, the +571 ERE/Sp1 site. We have examined the individual contributions of the ERE half site and the two Sp1 sites in regulating estrogen responsiveness. Transient transfection assays demonstrated that both Sp1 sites were critical for estrogen-mediated activation of the PR gene. Interestingly, rather than decreasing transcription, mutations in the ERE half site increased transcription substantially suggesting that this site plays a role in limiting transcription. Chromatin immunoprecipitation assays demonstrated that Sp1 was associated with the +571 ERE/Sp1 site in the endogenous PR gene in the absence and in the presence of estrogen, but that ERalpha was only associated with this region of the PR gene after MCF-7 cells had been treated with estrogen. Our studies provide evidence that effective regulation of transcription through the +571 ERE/Sp1 site requires the binding of ERalpha and Sp1 to their respective cis elements and the appropriate interaction of ERalpha and Sp1 with other coregulatory proteins and transcription factors.

  7. Plastid Transformation in the Monocotyledonous Cereal Crop, Rice (Oryza sativa) and Transmission of Transgenes to Their Progeny

    OpenAIRE

    Lee, Sa Mi; Kang, Kyungsu; Chung, Hyunsup; Yoo, Soon Hee; Xu, Xiang Ming; Lee, Seung-Bum; Cheong, Jong-Joo; Daniell, Henry; Kim, Minkyun

    2006-01-01

    The plastid transformation approach offers a number of unique advantages, including high-level transgene expression, multi-gene engineering, transgene containment, and a lack of gene silencing and position effects. The extension of plastid transformation technology to monocotyledonous cereal crops, including rice, bears great promise for the improvement of agronomic traits, and the efficient production of pharmaceutical or nutritional enhancement. Here, we report a promising step towards stab...

  8. Contrasting Patterns of Nucleotide Substitution Rates Provide Insight into Dynamic Evolution of Plastid and Mitochondrial Genomes of Geranium

    OpenAIRE

    Park, Seongjun; Ruhlman, Tracey A.; Weng, Mao-Lun; Hajrah, Nahid H.; Sabir, Jamal S.M.; Jansen, Robert K.

    2017-01-01

    Abstract Geraniaceae have emerged as a model system for investigating the causes and consequences of variation in plastid and mitochondrial genomes. Incredible structural variation in plastid genomes (plastomes) and highly accelerated evolutionary rates have been reported in selected lineages and functional groups of genes in both plastomes and mitochondrial genomes (mitogenomes), and these phenomena have been implicated in cytonuclear incompatibility. Previous organelle genome studies have i...

  9. Cell-specific CO2 fixation rates of two distinct groups of plastidic protists in the Atlantic Ocean remain unchanged after nutrient addition.

    Science.gov (United States)

    Grob, Carolina; Jardillier, Ludwig; Hartmann, Manuela; Ostrowski, Martin; Zubkov, Mikhail V; Scanlan, David J

    2015-04-01

    To assess the role of open-ocean ecosystems in global CO2 fixation, we investigated how picophytoplankton, which dominate primary production, responded to episodic increases in nutrient availability. Previous experiments have shown nitrogen alone, or in combination with phosphorus or iron, to be the proximate limiting nutrient(s) for total phytoplankton grown over several days. Much less is known about how nutrient upshift affects picophytoplankton CO2 fixation over the duration of the light period. To address this issue, we performed a series of small volume (8-60 ml) - short term (10-11 h) nutrient addition experiments in different regions of the Atlantic Ocean using NH4 Cl, FeCl3 , K medium, dust and nutrient-rich water from 300 m depth. We found no significant nutrient stimulation of group-specific CO2 fixation rates of two taxonomically and size-distinct groups of plastidic protists. The above was true regardless of the region sampled or nutrient added, suggesting that this is a generic phenomenon. Our findings show that at least in the short term (i.e. daylight period), nutrient availability does not limit CO2 fixation by the smallest plastidic protists, while their taxonomic composition does not determine their response to nutrient addition. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  10. RING E3 ligases: key regulatory elements are involved in abiotic stress responses in plants.

    Science.gov (United States)

    Cho, Seok Keun; Ryu, Moon Young; Kim, Jong Hum; Hong, Jeong Soo; Oh, Tae Rin; Kim, Woo Taek; Yang, Seong Wook

    2017-08-01

    Plants are constantly exposed to a variety of abiotic stresses, such as drought, heat, cold, flood, and salinity. To survive under such unfavorable conditions, plants have evolutionarily developed their own resistant-mechanisms. For several decades, many studies have clarified specific stress response pathways of plants through various molecular and genetic studies. In particular, it was recently discovered that ubiquitin proteasome system (UPS), a regulatory mechanism for protein turn over, is greatly involved in the stress responsive pathways. In the UPS, many E3 ligases play key roles in recognizing and tethering poly-ubiquitins on target proteins for subsequent degradation by the 26S proteasome. Here we discuss the roles of RING ligases that have been defined in related to abiotic stress responses in plants. [BMB Reports 2017; 50(8): 393-400].

  11. Development of electrochemical reporter assay using HeLa cells transfected with vector plasmids encoding various responsive elements

    Energy Technology Data Exchange (ETDEWEB)

    Shiku, Hitoshi, E-mail: shiku@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Takeda, Michiaki; Murata, Tatsuya [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Akiba, Uichi; Hamada, Fumio [Graduate School of Engineering and Resource Science, Akita University, 1-1 Tegata gakuen-machi, Akita 010-8502 (Japan); Matsue, Tomokazu, E-mail: matsue@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan)

    2009-04-27

    Electrochemical assay using HeLa cell lines transfected with various plasmid vectors encoding SEAP (secreted alkaline phosphatase) as the reporter has been performed by using SECM (scanning electrochemical microscopy). The plasmid vector contains different responsive elements that include GRE (glucocorticoid response elements), CRE (cAMP responsive elements), or {kappa}B (binding site for NF{kappa}B (nuclear factor kappa B)) upstream of the SEAP sequence. The transfected HeLa cells were patterned on a culture dish in a 4 x 4 array of circles of diameter 300 {mu}m by using the PDMS (poly(dimethylsiloxane)) stencil technique. The cellular array was first exposed to 100 ng mL{sup -1} dexamethasone, 10 ng mL{sup -1} forskolin, or 100 ng mL{sup -1} TNF-{alpha} (tumor necrosis factor {alpha}) after which it was further cultured in an RPMI culture medium for 6 h. After incubation, the cellular array was soaked in a measuring solution containing 4.7 mM PAPP (p-aminophenylphosphate) at pH 9.5, following which electrochemical measurements were performed immediately within 40 min. The SECM method allows parallel evaluation of different cell lines transfected with pGRE-SEAP, pCRE-SEAP, and pNF{kappa}B-SEAP patterned on the same solid support for detection of the oxidation current of PAP (p-aminophenol) flux produced from only 300 HeLa cells in each stencil pattern. The results of the SECM method were highly sensitive as compared to those obtained from the conventional CL (chemiluminescence) protocol with at least 5 x 10{sup 4} cells per well.

  12. Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

    Science.gov (United States)

    Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

    2012-05-01

    To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.

  13. Regulation of CYP3A4 by pregnane X receptor: The role of nuclear receptors competing for response element binding

    Energy Technology Data Exchange (ETDEWEB)

    Istrate, Monica A., E-mail: monicai@scripps.edu [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Nussler, Andreas K., E-mail: nuessler@uchir.me.tum.de [Department of Traumatology, Technical University Munich, Ismaningerstr. 22, 81675 Munich (Germany); Eichelbaum, Michel, E-mail: michel.eichelbaum@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Burk, Oliver, E-mail: oliver.burk@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany)

    2010-03-19

    Induction of the major drug metabolizing enzyme CYP3A4 by xenobiotics contributes to the pronounced interindividual variability of its expression and often results in clinically relevant drug-drug interactions. It is mainly mediated by PXR, which regulates CYP3A4 expression by binding to several specific elements in the 5' upstream regulatory region of the gene. Induction itself shows a marked interindividual variability, whose underlying determinants are only partly understood. In this study, we investigated the role of nuclear receptor binding to PXR response elements in CYP3A4, as a potential non-genetic mechanism contributing to interindividual variability of induction. By in vitro DNA binding experiments, we showed that several nuclear receptors bind efficiently to the proximal promoter ER6 and distal xenobiotic-responsive enhancer module DR3 motifs. TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII further demonstrated dose-dependent repression of PXR-mediated CYP3A4 enhancer/promoter reporter activity in transient transfection in the presence and absence of the PXR inducer rifampin, while VDR showed this effect only in the absence of treatment. By combining functional in vitro characterization with hepatic expression analysis, we predict that TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII show a strong potential for the repression of PXR-mediated activation of CYP3A4 in vivo. In summary, our results demonstrate that nuclear receptor binding to PXR response elements interferes with PXR-mediated expression and induction of CYP3A4 and thereby contributes to the interindividual variability of induction.

  14. Non-linear finite element analysis for prediction of seismic response of buildings considering soil-structure interaction

    Directory of Open Access Journals (Sweden)

    E. Çelebi

    2012-11-01

    Full Text Available The objective of this paper focuses primarily on the numerical approach based on two-dimensional (2-D finite element method for analysis of the seismic response of infinite soil-structure interaction (SSI system. This study is performed by a series of different scenarios that involved comprehensive parametric analyses including the effects of realistic material properties of the underlying soil on the structural response quantities. Viscous artificial boundaries, simulating the process of wave transmission along the truncated interface of the semi-infinite space, are adopted in the non-linear finite element formulation in the time domain along with Newmark's integration. The slenderness ratio of the superstructure and the local soil conditions as well as the characteristics of input excitations are important parameters for the numerical simulation in this research. The mechanical behavior of the underlying soil medium considered in this prediction model is simulated by an undrained elasto-plastic Mohr-Coulomb model under plane-strain conditions. To emphasize the important findings of this type of problems to civil engineers, systematic calculations with different controlling parameters are accomplished to evaluate directly the structural response of the vibrating soil-structure system. When the underlying soil becomes stiffer, the frequency content of the seismic motion has a major role in altering the seismic response. The sudden increase of the dynamic response is more pronounced for resonance case, when the frequency content of the seismic ground motion is close to that of the SSI system. The SSI effects under different seismic inputs are different for all considered soil conditions and structural types.

  15. Hedysarum L. (Fabaceae: Hedysareae) Is Not Monophyletic - Evidence from Phylogenetic Analyses Based on Five Nuclear and Five Plastid Sequences.

    Science.gov (United States)

    Liu, Pei-Liang; Wen, Jun; Duan, Lei; Arslan, Emine; Ertuğrul, Kuddisi; Chang, Zhao-Yang

    2017-01-01

    The legume family (Fabaceae) exhibits a high level of species diversity and evolutionary success worldwide. Previous phylogenetic studies of the genus Hedysarum L. (Fabaceae: Hedysareae) showed that the nuclear and the plastid topologies might be incongruent, and the systematic position of the Hedysarum sect. Stracheya clade was uncertain. In this study, phylogenetic relationships of Hedysarum were investigated based on the nuclear ITS, ETS, PGDH, SQD1, TRPT and the plastid psbA-trnH, trnC-petN, trnL-trnF, trnS-trnG, petN-psbM sequences. Both nuclear and plastid data support two major lineages in Hedysarum: the Hedysarum s.s. clade and the Sartoria clade. In the nuclear tree, Hedysarum is biphyletic with the Hedysarum s.s. clade sister to the Corethrodendron + Eversmannia + Greuteria + Onobrychis clade (the CEGO clade), whereas the Sartoria clade is sister to the genus Taverniera DC. In the plastid tree, Hedysarum is monophyletic and sister to Taverniera. The incongruent position of the Hedysarum s.s. clade between the nuclear and plastid trees may be best explained by a chloroplast capture hypothesis via introgression. The Hedysarum sect. Stracheya clade is resolved as sister to the H. sect. Hedysarum clade in both nuclear and plastid trees, and our analyses support merging Stracheya into Hedysarum. Based on our new evidence from multiple sequences, Hedysarum is not monophyletic, and its generic delimitation needs to be reconsidered.

  16. Hedysarum L. (Fabaceae: Hedysareae) Is Not Monophyletic – Evidence from Phylogenetic Analyses Based on Five Nuclear and Five Plastid Sequences

    Science.gov (United States)

    Liu, Pei-Liang; Wen, Jun; Duan, Lei; Arslan, Emine; Ertuğrul, Kuddisi; Chang, Zhao-Yang

    2017-01-01

    The legume family (Fabaceae) exhibits a high level of species diversity and evolutionary success worldwide. Previous phylogenetic studies of the genus Hedysarum L. (Fabaceae: Hedysareae) showed that the nuclear and the plastid topologies might be incongruent, and the systematic position of the Hedysarum sect. Stracheya clade was uncertain. In this study, phylogenetic relationships of Hedysarum were investigated based on the nuclear ITS, ETS, PGDH, SQD1, TRPT and the plastid psbA-trnH, trnC-petN, trnL-trnF, trnS-trnG, petN-psbM sequences. Both nuclear and plastid data support two major lineages in Hedysarum: the Hedysarum s.s. clade and the Sartoria clade. In the nuclear tree, Hedysarum is biphyletic with the Hedysarum s.s. clade sister to the Corethrodendron + Eversmannia + Greuteria + Onobrychis clade (the CEGO clade), whereas the Sartoria clade is sister to the genus Taverniera DC. In the plastid tree, Hedysarum is monophyletic and sister to Taverniera. The incongruent position of the Hedysarum s.s. clade between the nuclear and plastid trees may be best explained by a chloroplast capture hypothesis via introgression. The Hedysarum sect. Stracheya clade is resolved as sister to the H. sect. Hedysarum clade in both nuclear and plastid trees, and our analyses support merging Stracheya into Hedysarum. Based on our new evidence from multiple sequences, Hedysarum is not monophyletic, and its generic delimitation needs to be reconsidered. PMID:28122062

  17. Identification of hookworm DAF-16/FOXO response elements and direct gene targets.

    Directory of Open Access Journals (Sweden)

    Xin Gao

    2010-08-01

    Full Text Available The infective stage of the parasitic nematode hookworm is developmentally arrested in the environment and needs to infect a specific host to complete its life cycle. The canine hookworm (Ancylostoma caninum is an excellent model for investigating human hookworm infections. The transcription factor of A. caninum, Ac-DAF-16, which has a characteristic fork head or "winged helix" DNA binding domain (DBD, has been implicated in the resumption of hookworm development in the host. However, the precise roles of Ac-DAF-16 in hookworm parasitism and its downstream targets are unknown. In the present study, we combined molecular techniques and bioinformatics to identify a group of Ac-DAF-16 binding sites and target genes.The DNA binding domain of Ac-DAF-16 was used to select genomic fragments by in vitro genomic selection. Twenty four bound genomic fragments were analyzed for the presence of the DAF-16 family binding element (DBE and possible alternative Ac-DAF-16 bind motifs. The 22 genes linked to these genomic fragments were identified using bioinformatics tools and defined as candidate direct gene targets of Ac-DAF-16. Their developmental stage-specific expression patterns were examined. Also, a new putative DAF-16 binding element was identified.Our results show that Ac-DAF-16 is involved in diverse biological processes throughout hookworm development. Further investigation of these target genes will provide insights into the molecular basis by which Ac-DAF-16 regulates its downstream gene network in hookworm infection.

  18. Skeletal response to maxillary protraction with and without maxillary expansion: a finite element study.

    Science.gov (United States)

    Gautam, Pawan; Valiathan, Ashima; Adhikari, Raviraj

    2009-06-01

    The purpose of this finite element study was to evaluate biomechanically 2 treatment modalities-maxillary protraction alone and in combination with maxillary expansion-by comparing the displacement of various craniofacial structures. Two 3-dimensional analytical models were developed from sequential computed tomography scan images taken at 2.5-mm intervals of a dry young skull. AutoCAD software (2004 version, Autodesk, San Rafael, Calif) and ANSYS software (version 10, Belcan Engineering Group, Cincinnati, Ohio) were used. The model consisted of 108,799 solid 10 node 92 elements, 193,633 nodes, and 580,899 degrees of freedom. In the first model, maxillary protraction forces were simulated by applying 1 kg of anterior force 30 degrees downward to the palatal plane. In the second model, a 4-mm midpalatal suture opening and maxillary protraction were simulated. Forward displacement of the nasomaxillary complex with upward and forward rotation was observed with maxillary protraction alone. No rotational tendency was noted when protraction was carried out with 4 mm of transverse expansion. A tendency for anterior maxillary constriction after maxillary protraction was evident. The amounts of displacement in the frontal, vertical, and lateral directions with midpalatal suture opening were greater compared with no opening of the midpalatal suture. The forward and downward displacements of the nasomaxillary complex with maxillary protraction and maxillary expansion more closely approximated the natural growth direction of the maxilla. Displacements of craniofacial structures were more favorable for the treatment of skeletal Class III maxillary retrognathia when maxillary protraction was used with maxillary expansion. Hence, biomechanically, maxillary protraction combined with maxillary expansion appears to be a superior treatment modality for the treatment of maxillary retrognathia than maxillary protraction alone.

  19. Assisting the development of innovative responsive façade elements using building performance simulation

    NARCIS (Netherlands)

    de Klijn-Chevalerias, M.L.; Loonen, R.C.G.M.; Zarzycka, A.; de Witte, D.; Sarakinioti, M.V.; Hensen, JLM; Turrin, Michela; Peters, Brady; O'Brien, William; Stouffs, Rudi; Dogan, Timur

    2017-01-01

    Thermal mass is usually positively associated with energy efficiency and thermal comfort in buildings. However, the slow response of heavyweight constructions is not beneficial at all times, as these dynamic effects may actually also increase heating and cooling energy demand during intermittent

  20. The effect of tibia element on the tibia response due to impact loading

    CSIR Research Space (South Africa)

    Pandelani, T

    2014-10-01

    Full Text Available , specifically for anti-vehicular mine blast scenarios. The aim of this study was to assess under impact loading to ensure that it represents the natural lower leg response. Axial impact loads were applied to the MIL-Lx at impact velocities of 2.7 to 10.2 m...

  1. The Specificity of Innate Immune Responses Is Enforced by Repression of Interferon Response Elements by NF-κB p50

    Science.gov (United States)

    Cheng, Christine S.; Feldman, Kristyn E.; Lee, James; Verma, Shilpi; Huang, De-Bin; Huynh, Kim; Chang, Mikyoung; Ponomarenko, Julia V.; Sun, Shao-Cong; Benedict, Chris A.; Ghosh, Gourisankar; Hoffmann, Alexander

    2011-01-01

    The specific binding of transcription factors to cognate sequence elements is thought to be critical for the generation of specific gene expression programs. Members of the nuclear factor κB (NF-κB) and interferon (IFN) regulatory factor (IRF) transcription factor families bind to the κB site and the IFN response element (IRE), respectively, of target genes, and they are activated in macrophages after exposure to pathogens. However, how these factors produce pathogen-specific inflammatory and immune responses remains poorly understood. Combining top-down and bottom-up systems biology approaches, we have identified the NF-κB p50 homodimer as a regulator of IRF responses. Unbiased genome-wide expression and biochemical and structural analyses revealed that the p50 homodimer repressed a subset of IFN-inducible genes through a previously uncharacterized subclass of guanine-rich IRE (G-IRE) sequences. Mathematical modeling predicted that the p50 homodimer might enforce the stimulus specificity of composite promoters. Indeed, the production of the antiviral regulator IFN-β was rendered stimulus-specific by the binding of the p50 homodimer to the G-IRE–containing IFNβ enhancer to suppress cytotoxic IFN signaling. Specifically, a deficiency in p50 resulted in the inappropriate production of IFN-β in response to bacterial DNA sensed by Toll-like receptor 9. This role for the NF-κB p50 homodimer in enforcing the specificity of the cellular response to pathogens by binding to a subset of IRE sequences alters our understanding of how the NF-κB and IRF signaling systems cooperate to regulate antimicrobial immunity. PMID:21343618

  2. Reactor elements properties response during a postulated loss-of-coolant accident (LOCA)

    International Nuclear Information System (INIS)

    Ahmed, E.E.; Rahman, F.A.

    1985-01-01

    Four computer algorithms have been introduced to solve for the reactor different materials response subjected to LOCA conditions, they were developed with the intent of producing a simple, accurate and efficient prediction schemes. A general overview of the solution procedures design and working of each of four algorithms are presented, followed by short description of the nature of solution and calculated results. These algorithms are: 1. ZIRCP to give the cladding material properties response under normal and transient conditions. 2. FCGAPP to give the fuel- cladding gas-gap conductivity. 3. NFUEIP to solve the temperature dependent of nuclear fuel properties during normal and transient conditions. 4. TSDATP has been developed to solve for the thermodynamic and transport properties of water and steam over a large range of temperature and pressure. 14 fig

  3. Distinctly different dynamics and kinetics of two steroid receptors at the same response elements in living cells.

    Directory of Open Access Journals (Sweden)

    Hatice Z Nenseth

    Full Text Available Closely related transcription factors (TFs can bind to the same response elements (REs with similar affinities and activate transcription. However, it is unknown whether transcription is similarly orchestrated by different TFs bound at the same RE. Here we have compared the recovery half time (t1/2, binding site occupancy and the resulting temporal changes in transcription upon binding of two closely related steroid receptors, the androgen and glucocorticoid receptors (AR and GR, to their common hormone REs (HREs. We show that there are significant differences at all of these levels between AR and GR at the MMTV HRE when activated by their ligands. These data show that two TFs bound at the same RE can have significantly different modes of action that can affect their responses to environmental cues.

  4. Growth and Tissue Elemental Composition Response of Butterhead Lettuce (Lactuca sativa, cv. Flandria to Hydroponic and Aquaponic Conditions

    Directory of Open Access Journals (Sweden)

    Tyler S. Anderson

    2017-07-01

    Full Text Available The primary objective of this research was to compare lettuce performance under conventional hydroponics at pH 5.8 (referred to as H5, hydroponics at pH 7.0 (referred to as H7, and recirculated aquaponic water at pH 7.0 (referred to as A7. Aquaponic nutrients were supplied by continuously recirculating water between a fish rearing system (recirculating aquaculture system or RAS and the lettuce growing system (with the sole addition being chelated iron. This paper builds upon our previous research where we found that H7 produced 26% less shoot fresh weight (FW growth than H5 and an 18% reduction in dry weight (DW. In this research, we also evaluated the inorganic hydroponics nutrient solution at pH 7.0 (H7 to provide continuity between experiments and to isolate the pH effect. The A7 plant biomass responses were not different from H5 in all biomass response categories. H7 was different from H5 in shoot FW, DW, and DW/FW, as well as root FW and DW. H7 was different from the A7 in shoot FW, DW/FW, and root DW. There were no tissue elemental differences between H5 and H7 except Cu. The Ca and Na contents differed between H5 and A7, while the microelements Mn, Mo, and Zn differed. Generally, the elemental tissue differences between treatments were proportional to the differences for the same elements in the nutrient solutions. Aquaponic systems are often viewed to be more complicated and more risky because two complex systems are being joined (hydroponics plus RAS. However, the aquaponics system proved to be surprisingly simple to manage in daily operations. Our data suggested that the aquaponics system (A7, which was operated at a higher pH 7.0, was able to offset any negative biomass and elemental effects that occurred in the inorganic hydroponic pH 7.0 treatment (H7 from its increased pH and less optimized nutrient solution elemental concentrations.

  5. Mechanism Profiling of Hepatotoxicity Caused by Oxidative Stress Using Antioxidant Response Element Reporter Gene Assay Models and Big Data.

    Science.gov (United States)

    Kim, Marlene Thai; Huang, Ruili; Sedykh, Alexander; Wang, Wenyi; Xia, Menghang; Zhu, Hao

    2016-05-01

    Hepatotoxicity accounts for a substantial number of drugs being withdrawn from the market. Using traditional animal models to detect hepatotoxicity is expensive and time-consuming. Alternative in vitro methods, in particular cell-based high-throughput screening (HTS) studies, have provided the research community with a large amount of data from toxicity assays. Among the various assays used to screen potential toxicants is the antioxidant response element beta lactamase reporter gene assay (ARE-bla), which identifies chemicals that have the potential to induce oxidative stress and was used to test > 10,000 compounds from the Tox21 program. The ARE-bla computational model and HTS data from a big data source (PubChem) were used to profile environmental and pharmaceutical compounds with hepatotoxicity data. Quantitative structure-activity relationship (QSAR) models were developed based on ARE-bla data. The models predicted the potential oxidative stress response for known liver toxicants when no ARE-bla data were available. Liver toxicants were used as probe compounds to search PubChem Bioassay and generate a response profile, which contained thousands of bioassays (> 10 million data points). By ranking the in vitro-in vivo correlations (IVIVCs), the most relevant bioassay(s) related to hepatotoxicity were identified. The liver toxicants profile contained the ARE-bla and relevant PubChem assays. Potential toxicophores for well-known toxicants were created by identifying chemical features that existed only in compounds with high IVIVCs. Profiling chemical IVIVCs created an opportunity to fully explore the source-to-outcome continuum of modern experimental toxicology using cheminformatics approaches and big data sources. Kim MT, Huang R, Sedykh A, Wang W, Xia M, Zhu H. 2016. Mechanism profiling of hepatotoxicity caused by oxidative stress using antioxidant response element reporter gene assay models and big data. Environ Health Perspect 124:634-641;

  6. Micoses superficiais e os elementos da resposta imune Superficial mycosis and the immune response elements

    Directory of Open Access Journals (Sweden)

    Paulo Ricardo Criado

    2011-08-01

    Full Text Available As micoses superficiais são prevalentes em todo o mundo, geralmente ocasionadas por dermatófitos e restritas à camada córnea. A resposta imunológica do hospedeiro às infecções dos fungos dermatófitos depende basicamente das defesas do hospedeiro a metabólitos do fungo, da virulência da cepa ou da espécie infectante e da localização anatômica da infecção. Serão revistos alguns dos fatores da defesa imunológica do hospedeiro que influenciam na eficácia da resposta imune. Em especial, a participação dos receptores de padrão de reconhecimento (PRRs, tais como os receptores toll-like ou os da família lectina (DC-SIGN e dectin-2, que participam da resposta imune inata, conferindo-lhe especificidade e definindo o padrão da resposta imune como um todo. O predomínio celular ou humoral da resposta imune definirá o quadro clínico e o prognóstico da infecção, levando à cura ou cronicidadeSuperficial mycoses are prevalent worldwide. They are often caused by dermatophytes and restricted to the stratum corneum. The host's immune response against infections caused by dermatophytes basically depends on the host's defense against metabolites of the fungi, virulence of the infecting strain or species and anatomical site of the infection. We will review some of the factors of the host's immune defense that influence the efficacy of the immune response. We will particularly review the role of pattern recognition receptors (PRRs, such as toll-like receptors or lectin receptors (DCSIGN and Dectin 2, which participate in the innate immune response, bringing specificity to the immune response and setting its pattern. The predominance of a cellular or humoral immune response determines the clinical manifestations and the prognosis of the infection, leading to healing or chronicity

  7. An Image-Based Finite Element Approach for Simulating Viscoelastic Response of Asphalt Mixture

    Directory of Open Access Journals (Sweden)

    Wenke Huang

    2016-01-01

    Full Text Available This paper presents an image-based micromechanical modeling approach to predict the viscoelastic behavior of asphalt mixture. An improved image analysis technique based on the OTSU thresholding operation was employed to reduce the beam hardening effect in X-ray CT images. We developed a voxel-based 3D digital reconstruction model of asphalt mixture with the CT images after being processed. In this 3D model, the aggregate phase and air void were considered as elastic materials while the asphalt mastic phase was considered as linear viscoelastic material. The viscoelastic constitutive model of asphalt mastic was implemented in a finite element code using the ABAQUS user material subroutine (UMAT. An experimental procedure for determining the parameters of the viscoelastic constitutive model at a given temperature was proposed. To examine the capability of the model and the accuracy of the parameter, comparisons between the numerical predictions and the observed laboratory results of bending and compression tests were conducted. Finally, the verified digital sample of asphalt mixture was used to predict the asphalt mixture viscoelastic behavior under dynamic loading and creep-recovery loading. Simulation results showed that the presented image-based digital sample may be appropriate for predicting the mechanical behavior of asphalt mixture when all the mechanical properties for different phases became available.

  8. Plastid transformation in lettuce (Lactuca sativa L.) by biolistic DNA delivery.

    Science.gov (United States)

    Ruhlman, Tracey A

    2014-01-01

    The interest in producing pharmaceutical proteins in a nontoxic plant host has led to the development of an approach to express such proteins in transplastomic lettuce (Lactuca sativa L.). A number of therapeutic proteins and vaccine antigen candidates have been stably integrated into the lettuce plastid genome using biolistic DNA delivery. High levels of accumulation and retention of biological activity suggest that lettuce may provide an ideal platform for the production of biopharmaceuticals.

  9. Cuscuta europaea plastid apparatus in various developmental stages: localization of THF1 protein.

    Science.gov (United States)

    Švubová, Renáta; Ovečka, Miroslav; Pavlovič, Andrej; Slováková, L'udmila; Blehová, Alžbeta

    2013-05-01

    It was generally accepted that Cuscuta europaea is mostly adapted to a parasitic lifestyle with no detectable levels of chlorophylls. We found out relatively high level of chlorophylls (Chls a+b) in young developmental stages of dodder. Significant lowering of Chls (a+b) content and increase of carotenoid concentration was typical only for ontogenetically more developed stages. Lower content of photosynthesis-related proteins involved in Chls biosynthesis and in photosystem formation as well as low photochemical activity of PSII indicate that photosynthesis is not the main activity of C. europaea plastids. Previously, it has been shown in other species that the Thylakoid Formation Protein 1 (THF1) is involved in thylakoid membrane differentiation, plant-fungal and plant-bacterial interactions and in sugar signaling with its preferential localization to plastids. Our immunofluorescence localization studies and analyses of haustorial plasma membrane fractions revealed that in addition to plastids, the THF1 protein localizes also to the plasma membrane and plasmodesmata in developing C. europaea haustorium, most abundantly in the digitate cells of the endophyte primordium. These results are supported by western blot analysis, documenting the highest levels of the THF1 protein in "get together" tissues of dodder and tobacco. Based on the fact that photosynthesis is not a typical process in the C. europaea haustorium and on the extra-plastidial localization pattern of the THF1, our data support rather other functions of this protein in the complex relationship between C. europaea and its host.

  10. Plastid Genome Evolution in the Early-Diverging Legume Subfamily Cercidoideae (Fabaceae

    Directory of Open Access Journals (Sweden)

    Yin-Huan Wang

    2018-02-01

    Full Text Available The subfamily Cercidoideae is an early-branching legume lineage, which consists of 13 genera distributed in the tropical and warm temperate Northern Hemisphere. A previous study detected two plastid genomic variations in this subfamily, but the limited taxon sampling left the overall plastid genome (plastome diversification across the subfamily unaddressed, and phylogenetic relationships within this clade remained unresolved. Here, we assembled eight plastomes from seven Cercidoideae genera and conducted phylogenomic-comparative analyses in a broad evolutionary framework across legumes. The plastomes of Cercidoideae all exhibited a typical quadripartite structure with a conserved gene content typical of most angiosperm plastomes. Plastome size ranged from 151,705 to 165,416 bp, mainly due to the expansion and contraction of inverted repeat (IR regions. The order of genes varied due to the occurrence of several inversions. In Tylosema species, a plastome with a 29-bp IR-mediated inversion was found to coexist with a canonical-type plastome, and the abundance of the two arrangements of isomeric molecules differed between individuals. Complete plastome data were much more efficient at resolving intergeneric relationships of Cercidoideae than the previously used selection of only a few plastid or nuclear loci. In sum, our study revealed novel insights into the structural diversification of plastomes in an early-branching legume lineage, and, thus, into the evolutionary trajectories of legume plastomes in general.

  11. Expansion of inverted repeat does not decrease substitution rates in Pelargonium plastid genomes.

    Science.gov (United States)

    Weng, Mao-Lun; Ruhlman, Tracey A; Jansen, Robert K

    2017-04-01

    For species with minor inverted repeat (IR) boundary changes in the plastid genome (plastome), nucleotide substitution rates were previously shown to be lower in the IR than the single copy regions (SC). However, the impact of large-scale IR expansion/contraction on plastid nucleotide substitution rates among closely related species remains unclear. We included plastomes from 22 Pelargonium species, including eight newly sequenced genomes, and used both pairwise and model-based comparisons to investigate the impact of the IR on sequence evolution in plastids. Ten types of plastome organization with different inversions or IR boundary changes were identified in Pelargonium. Inclusion in the IR was not sufficient to explain the variation of nucleotide substitution rates. Instead, the rate heterogeneity in Pelargonium plastomes was a mixture of locus-specific, lineage-specific and IR-dependent effects. Our study of Pelargonium plastomes that vary in IR length and gene content demonstrates that the evolutionary consequences of retaining these repeats are more complicated than previously suggested. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  12. A plastid gene phylogeny of the non-photosynthetic parasitic Orobanche (Orobanchaceae) and related genera.

    Science.gov (United States)

    Park, Jeong-Mi; Manen, Jean-François; Colwell, Alison E; Schneeweiss, Gerald M

    2008-07-01

    The phylogenetic relationships of the non-photosynthetic Orobanche sensu lato (Orobanchaceae), which includes some of the economically most important parasitic weeds, remain insufficiently understood and controversial. This concerns both the phylogenetic relationships within the genus, in particular its monophyly or lack thereof, and the relationships to other holoparasitic genera such as Cistanche or Conopholis. Here we present the first comprehensive phylogenetic study of this group based on a region from the plastid genome (rps2 gene). Although substitution rates appear to be elevated compared to the photosynthetic members of Orobanchaceae, relationships among the major lineages Cistanche, Conopholis plus Epifagus, Boschniakia rossica (Cham. & Schltdl.) B. Fedtsch., B. himalaica Hook. f. & Thomson, B. hookeri Walp. plus B. strobilacea A. Gray, and Orobanche s. l. remain unresolved. Resolution within Orobanche, however, is much better. In agreement with morphological, cytological and other molecular phylogenetic evidence, five lineages, corresponding to the four traditionally recognised sections (Gymnocaulis, Myzorrhiza, Orobanche, Trionychon) and O. latisquama Reut. ex Boiss. (of sect. Orobanche), can be distinguished. A combined analysis of plastid rps2 and nuclear ITS sequences of the holoparasitic genera results in more resolved and better supported trees, although the relationships among Orobanche s. l., Cistanche, and the clade including the remaining genera is unresolved. Therefore, rps2 is a marker from the plastid genome that is well-suited to be used in combination with other already established nuclear markers for resolving generic relationships of Orobanche and related genera.

  13. A plastid gene phylogeny of the non-photosynthetic parasitic Orobanche (Orobanchaceae) and related genera

    Science.gov (United States)

    Park, J.-M.; Manen, J.-F.; Colwell, A.E.; Schneeweiss, G.M.

    2008-01-01

    The phylogenetic relationships of the non-photosynthetic Orobanche sensu lato (Orobanchaceae), which includes some of the economically most important parasitic weeds, remain insufficiently understood and controversial. This concerns both the phylogenetic relationships within the genus, in particular its monophyly or lack thereof, and the relationships to other holoparasitic genera such as Cistanche or Conopholis. Here we present the first comprehensive phylogenetic study of this group based on a region from the plastid genome (rps2 gene). Although substitution rates appear to be elevated compared to the photosynthetic members of Orobanchaceae, relationships among the major lineages Cistanche, Conopholis plus Epifagus, Boschniakia rossica (Cham. & Schltdl.) B. Fedtsch., B. himalaica Hook. f. & Thomson, B. hookeri Walp. plus B. strobilacea A. Gray, and Orobanche s. l. remain unresolved. Resolution within Orobanche, however, is much better. In agreement with morphological, cytological and other molecular phylogenetic evidence, five lineages, corresponding to the four traditionally recognised sections (Gymnocaulis, Myzorrhiza, Orobanche, Trionychon) and O. latisquama Reut. ex Boiss. (of sect. Orobanche), can be distinguished. A combined analysis of plastid rps2 and nuclear ITS sequences of the holoparasitic genera results in more resolved and better supported trees, although the relationships among Orobanche s. l., Cistanche, and the clade including the remaining genera is unresolved. Therefore, rps2 is a marker from the plastid genome that is well-suited to be used in combination with other already established nuclear markers for resolving generic relationships of Orobanche and related genera. ?? 2008 The Botanical Society of Japan and Springer.

  14. Historical landscape elements in preserving steppic species - vegetation responses on micro-topography and human disturbances

    Science.gov (United States)

    Deák, Balázs; Valkó, Orsolya; Török, Péter; Tóthmérész, Béla

    2017-04-01

    Land use changes of past centuries resulted in a considerable loss and isolation of grassland habitats worldwide which also led to a serious loss in ecosystem functions. In intensively used agricultural landscapes remnants of natural flora persisted only in small habitat islands embedded in a hostile matrix, which are inadequate for arable farming or construction. In the steppe zone of Eurasia burial mounds, so-called kurgans, have a great potential to preserve the natural flora and habitats and act as local biodiversity hotspots. Their special micro-topography and historical origin makes kurgans characteristic landscape elements of the steppe region. These features also result in a specific soil development and micro-climate, which makes kurgans especially adequate habitats for several steppe specialist plant species. Furthermore, they are proper objects for studying the effects of present and past human disturbances on the vegetation of semi-natural habitats. Exploration of the main factors driving biodiversity in isolated habitat fragments is crucial for understanding the ecological processes shaping their vegetation and for designing effective strategies for their protection. We surveyed the vegetation of 44 isolated kurgans in East-Hungary and studied the effects of habitat area, slope, recent disturbance, past destruction and the level of woody encroachment on the species richness and cover of grassland specialist and weedy species. We used model selection techniques and linear models for testing relevant factors affecting specialist species in grassland fragments. We found that the biodiversity conservation potential of kurgans is supported by their steep slopes, which provide adequate habitat conditions and micro-climate for steppic specialist plant species. By harbouring several grassland specialist species, kurgans have a great potential for preserving the natural species pool of even considerably altered agricultural landscapes, and can mitigate the

  15. The effect of precrash velocity reduction on occupant response using a human body finite element model.

    Science.gov (United States)

    Guleyupoglu, B; Schap, J; Kusano, K D; Gayzik, F S

    2017-07-04

    The objective of this study is to use a validated finite element model of the human body and a certified model of an anthropomorphic test dummy (ATD) to evaluate the effect of simulated precrash braking on driver kinematics, restraint loads, body loads, and computed injury criteria in 4 commonly injured body regions. The Global Human Body Models Consortium (GHBMC) 50th percentile male occupant (M50-O) and the Humanetics Hybrid III 50th percentile models were gravity settled in the driver position of a generic interior equipped with an advanced 3-point belt and driver airbag. Fifteen simulations per model (30 total) were conducted, including 4 scenarios at 3 severity levels: median, severe, and the U.S. New Car Assessment Program (U.S.-NCAP) and 3 extra per model with high-intensity braking. The 4 scenarios were no precollision system (no PCS), forward collision warning (FCW), FCW with prebraking assist (FCW+PBA), and FCW and PBA with autonomous precrash braking (FCW + PBA + PB). The baseline ΔV was 17, 34, and 56.4 kph for median, severe, and U.S.-NCAP scenarios, respectively, and were based on crash reconstructions from NASS/CDS. Pulses were then developed based on the assumed precrash systems equipped. Restraint properties and the generic pulse used were based on literature. In median crash severity cases, little to no risk (braking cases (1.0-1.4 g), head injury criterion (HIC), brain injury criterion (BrIC), and chest deflection injury measures increased with increased braking intensity. All other measures for these cases tended to decrease. The ATD also predicted and trended similar to the human body models predictions for both the median, severe, and NCAP cases. Forward excursion for both models decreased across median, severe, and NCAP cases and diverged from each other in cases above 1.0 g of braking intensity. The addition of precrash systems simulated through reduced precrash speeds caused reductions in some injury criteria, whereas others (chest

  16. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Directory of Open Access Journals (Sweden)

    Cheng Wang

    Full Text Available The proliferating cell nuclear antigen (PCNA is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2 enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2.Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays.We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  17. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Science.gov (United States)

    Wang, Cheng; Yu, Jie; Kallen, Caleb B

    2008-01-01

    The proliferating cell nuclear antigen (PCNA) is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE) sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2) enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  18. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  19. Genomic Regulation of the Response of an Agroecosystem to Elements of Global Change

    Energy Technology Data Exchange (ETDEWEB)

    DeLucia, Evan, H.

    2011-06-03

    This document outlines some of the major accomplishments from this project: (1) New tools for analyzing and visualizing microarray data from soybean gene expression experiments; (2) Physiological, biochemical, and gene array evidence that acclimation of carbon metabolism to elevated CO{sub 2} is governed in significant part by changes in gene expression associated with respiratory metabolism; (3) Increased carbon assimilation in soybeans grown at elevated CO{sub 2} altered pools of carbohydrates and transcripts that control growth and expansion of young leaves; (4) Growth at elevated CO{sub 2} increases the abundance of transcripts controlling cell wall polysaccharide synthesis but not transcripts controlling lignin synthesis; (5) The total antioxidant capacity of soybeans varies among cultivars and in response to atmospheric change; (6) Accelerated leaf senescence at elevated O{sub 3} coincides with reduced abundance of transcripts controlling protein synthesis; (7) Growth under elevated CO{sub 2} increases the susceptibility of soybean to insect herbivores by increasing insect lifespan and fecundity through altered leaf chemistry and by defeating molecular induction of plant defenses; (8) Exposure to elevated CO{sub 2} and O{sub 3} alters flavonoid metabolism in soybean; (9) Exposure to elevated CO{sub 2} or O{sub 3} conferred resistance to soybean mosaic virus by cross inducing defense- and stress-related signaling pathways; and (10) Exposure to elevated CO{sub 2} accelerates decomposition by changing chemical and biotic properties of the soil.

  20. Evidence for some signal transduction elements involved in UV-light-dependent responses in parsley protoplasts

    International Nuclear Information System (INIS)

    Frohnmeyer, H.; Bowler, C.; Schäfer, E.

    1997-01-01

    The signalling pathways used by UV-light are largely unknown. Using protoplasts from a heterotrophic parsley (Petroselinum crispum L.) cell culture that exclusively respond to UV-B light between 300 and 350 nm with a fast induction of genes encoding flavonoid biosynthetic enzymes, information was obtained about the UV-light signal transduction pathway for chalcone synthase (CHS) and phenylalanine ammonia-lyase (PAL) gene expression. Pharmacological effectors which influence intracellular calcium levels, calmodulin and the activity of serine/threonine kinases also changed the UV-light-dependent expression of these genes. This evaluation indicated the participation of these components on the UV-B-mediated signal transduction cascade to CHS. In contrast, neither membrane-permeable cyclic GMP nor the tyrosine kinase inhibitor genistein affected CHS or PAL expression. Similar results were obtained in protoplasts, which have been transiently transformed with CHS-promoter/GUS (β-glucuronidase) reporter fusion constructs. The involvement of calcium and calmodulin was further indicated in a cell-free light-responsive in vitro transcription system from evacuolated parsley protoplasts. In conclusion, there is evidence now that components of the UV-light-dependent pathway leading to the CHS-promoter are different from the previously characterized cGMP-dependent pathway to CHS utilized by phytochrome in soybean (Glycine max) and tomato seedlings (Lycopersicon esculentum). (author)

  1. Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana.

    Science.gov (United States)

    Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S

    2005-07-15

    A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.

  2. The Dynamic Response of an Euler-Bernoulli Beam on an Elastic Foundation by Finite Element Analysis using the Exact Stiffness Matrix

    International Nuclear Information System (INIS)

    Kim, Jeong Soo; Kim, Moon Kyum

    2012-01-01

    In this study, finite element analysis of beam on elastic foundation, which received great attention of researchers due to its wide applications in engineering, is performed for estimating dynamic responses of shallow foundation using exact stiffness matrix. First, element stiffness matrix based on the closed solution of beam on elastic foundation is derived. Then, we performed static finite element analysis included exact stiffness matrix numerically, comparing results from the analysis with some exact analysis solutions well known for verification. Finally, dynamic finite element analysis is performed for a shallow foundation structure under rectangular pulse loading using trapezoidal method. The dynamic analysis results exist in the reasonable range comparing solution of single degree of freedom problem under a similar condition. The results show that finite element analysis using exact stiffness matrix is evaluated as a good tool of estimating the dynamic response of structures on elastic foundation.

  3. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    Energy Technology Data Exchange (ETDEWEB)

    Park, Serk In, E-mail: serkin@korea.edu [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); The BK21 Plus Program for Biomedical Sciences, Korea University College of Medicine, Seoul (Korea, Republic of); Department of Medicine and Center for Bone Biology, Vanderbilt University School of Medicine, Nashville, TN (United States); Park, Sung-Jun [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Laboratory of Obesity and Aging Research, National Heart, Lung and Blood Institute, National Institutes of Health, Bethesda, MD (United States); Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Park, Yun Gyu, E-mail: parkyg@korea.ac.kr [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of)

    2016-01-15

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  4. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    International Nuclear Information System (INIS)

    Park, Serk In; Park, Sung-Jun; Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won; Park, Yun Gyu

    2016-01-01

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  5. The human tartrate-resistant acid phosphatase (TRAP): involvement of the hemin responsive elements (HRE) in transcriptional regulation.

    Science.gov (United States)

    Fleckenstein, E C; Dirks, W G; Drexler, H G

    2000-02-01

    The biochemical properties and protein structure of the tartrate-resistant acid phosphatase (TRAP), an iron-containing lysosomal glycoprotein in cells of the mononuclear phagocyte system, are well known. In contrast, little is known about the physiology and genic structure of this unique enzyme. In some diseases, like hairy cell leukemia, Gaucher's disease and osteoclastoma, cytochemically detected TRAP expression is used as a disease-associated marker. In order to begin to elucidate the regulation of this gene we generated different deletion constructs of the TRAP 5'-flanking region, placed them upstream of the luciferase reporter gene and assayed them for their ability to direct luciferase expression in human 293 cells. Treatment of these cells with the iron-modulating reagents transferrin and hemin causes opposite effects on the TRAP promoter activity. Two regulatory GAGGC tandem repeat sequences (the hemin responsive elements, HRE) within the 5'-flanking region of the human TRAP gene were identified. Studies with specific HRE-deletion constructs of the human TRAP 5'-flanking region upstream of the luciferase reporter gene document the functionality of these HRE-sequences which are apparently responsible for mediating transcriptional inhibition upon exposure to hemin. In addition to the previously published functional characterization of the murine TRAP HRE motifs, these results provide the first description of a new iron/hemin-responsive transcriptional regulation in the human TRAP gene.

  6. The Plant Immunity Regulating F-Box Protein CPR1 Supports Plastid Function in Absence of Pathogens

    Directory of Open Access Journals (Sweden)

    Christiane Hedtmann

    2017-09-01

    Full Text Available The redox imbalanced 6 mutant (rimb6 of Arabidopsis thaliana was isolated in a genetic screening approach for mutants with defects in chloroplast-to-nucleus redox signaling. It has an atypically low activation status of the 2-Cys peroxiredoxin-A promoter in the seedling stage. rimb6 shows wildtype-like germination, seedling development and greening, but slower growth and reduced biomass in the rosette stage. Mapping of the casual mutation revealed that rimb6 carries a single nucleotide polymorphism in the gene encoding CONSTITUTIVE EXPRESSER OF PATHOGENESIS RELATED (PR GENES 1, CPR1 (At4g12560, leading to a premature stop codon. CPR1 is known as a repressor of pathogen signaling and regulator of microtubule organization. Allelism of rimb6 and cpr1 revealed a function of CPR1 in chloroplast stress protection. Expression studies in pathogen signaling mutants demonstrated that CPR1-mediated activation of genes for photosynthesis and chloroplast antioxidant protection is, in contrast to activation of pathogen responses, regulated independently from PAD4-controlled salicylic acid (SA accumulation. We conclude that the support of plastid function is a basic, SA-independent function of CPR1.

  7. Growth responses of selected freshwater algae to trace elements and scrubber ash slurry generated by coal-fired power plants

    Energy Technology Data Exchange (ETDEWEB)

    Vocke, R.W.

    1979-01-01

    The development and implementation of standard toxicity tests is a necessity if consistent and reliable data are to be obtained for water quality criteria. The adapted EPA AAPBT is an ideal static algal toxicity test system. The algal test medium has a chemical composition similar to natural unpolluted waters of low ionic strength. It is appropriate to use MATC water quality criteria when assessing the potential impact of pollutants generated by coal-fired power stations because these energy-generated pollutants typically enter aquatic systems in small quantities over long periods. The MATC water quality criteria are estimates of trace element and SASE levels, based on the most sensitive alga investigated, that will not cause significant changes in naturally-functioning algal populations. These levels are 0.016f mg L/sup -1/ As(V), 0.001 mg L/sup -1/ Cd(II), 0.004 mg L/sup -1/ Hg(II), 0.006 mg L/sup -1/ Se(VI), and 0.344% SASE. To provide viable working water quality criteria, an extrapolation from the laboratory to the natural environment must be made. Therefore, those oxidation states of the trace elements were selected which are the dominant states occurring in natural, unpolluted, slightly alkaline freshwaters. It must be pointed out that these MATC values are based on algal responses to single toxicants and no allowance is made for synergistic, additive, or antagonistic relationships which could occur in natural aquatic systems. Additionally, natural chelation may influence toxicity. The highly toxic nature of potential pollutants from coal-fired generating plants emphasizes the need for minimizing stack effluent pollutants and retaining scrubber ash slurry for proper disposal in an effort to maintain trace elements in concentration ranges compatible with naturally-functioning ecosystems.

  8. Global and Local Mechanical Responses for Necking of Rectangular Bars Using Updated and Total Lagrangian Finite Element Formulations

    Directory of Open Access Journals (Sweden)

    Claudio A. Careglio

    2016-01-01

    Full Text Available In simulations of forged and stamping processes using the finite element method, load displacement paths and three-dimensional stress and strains states should be well and reliably represented. The simple tension test is a suitable and economical tool to calibrate constitutive equations with finite strains and plasticity for those simulations. A complex three-dimensional stress and strain states are developed when this test is done on rectangular bars and the necking phenomenon appears. In this work, global and local numerical results of the mechanical response of rectangular bars subjected to simple tension test obtained from two different finite element formulations are compared and discussed. To this end, Updated and Total Lagrangian formulations are used in order to get the three-dimensional stress and strain states. Geometric changes together with strain and stress distributions at the cross section where necking occurs are assessed. In particular, a detailed analysis of the effective plastic strain, stress components in axial and transverse directions and pressure, and deviatoric stress components is presented. Specific numerical results are also validated with experimental measurements comparing, in turn, the performance of the two numerical approaches used in this study.

  9. Microstructure Optimization of Dual-Phase Steels Using a Representative Volume Element and a Response Surface Method: Parametric Study

    Science.gov (United States)

    Belgasam, Tarek M.; Zbib, Hussein M.

    2017-12-01

    Dual-phase (DP) steels have received widespread attention for their low density and high strength. This low density is of value to the automotive industry for the weight reduction it offers and the attendant fuel savings and emission reductions. Recent studies on developing DP steels showed that the combination of strength/ductility could be significantly improved when changing the volume fraction and grain size of phases in the microstructure depending on microstructure properties. Consequently, DP steel manufacturers are interested in predicting microstructure properties and in optimizing microstructure design. In this work, a microstructure-based approach using representative volume elements (RVEs) was developed. The approach examined the flow behavior of DP steels using virtual tension tests with an RVE to identify specific mechanical properties. Microstructures with varied martensite and ferrite grain sizes, martensite volume fractions, carbon content, and morphologies were studied in 3D RVE approaches. The effect of these microstructure parameters on a combination of strength/ductility of DP steels was examined numerically using the finite element method by implementing a dislocation density-based elastic-plastic constitutive model, and a Response surface methodology to determine the optimum conditions for a required combination of strength/ductility. The results from the numerical simulations are compared with experimental results found in the literature. The developed methodology proves to be a powerful tool for studying the effect and interaction of key microstructural parameters on strength and ductility and thus can be used to identify optimum microstructural conditions.

  10. Contributions of vitamin D response elements and HLA promoters to multiple sclerosis risk.

    Science.gov (United States)

    Nolan, David; Castley, Alison; Tschochner, Monika; James, Ian; Qiu, Wei; Sayer, David; Christiansen, Frank T; Witt, Campbell; Mastaglia, Frank; Carroll, William; Kermode, Allan

    2012-08-07

    The identification of a vitamin D-responsive (VDRE) motif within the HLA-DRB1*15:01 promoter region provides an attractive explanation for the combined effects of HLA-DR inheritance and vitamin D exposure on multiple sclerosis (MS) risk. We therefore sought to incorporate HLA-DRB1 promoter variation, including the VDRE motif, in an assessment of HLA-DRB1-associated MS risk. We utilized 32 homozygous HLA cell lines (covering 17 DRB1 alleles) and 53 heterozygote MS samples (20 DRB1 alleles) for HLA-DRB1 promoter sequencing. The influence of HLA-DRB1 variation on MS risk was then assessed among 466 MS cases and 498 controls. The majority of HLA*DRB1 alleles (including HLA-DRB1*15:01) express the functional VDRE motif, apart from HLA-DRB1*04, *07, and *09 alleles that comprise the HLA-DR53 serologic group. Allele-specific variation within functional X-box and Y-box motifs was also associated with serologically defined HLA-DR haplotypes. Incorporating these results in an analysis of MS risk, we identified a strong protective effect of HLA-DRB1*04, *07, and *09 (DR53) alleles (p = 10(-12)) and elevated risk associated with DRB1*15 and *16 (DR51) and *08 (DR8) alleles (p < 10(-18)). HLA-DRB1 groups corresponding to serologic HLA-DR profiles as well as promoter polymorphism haplotypes effectively stratified MS risk over an 11-fold range, suggesting functional relationships between risk-modifying HLA-DRB1 alleles. An independent contribution of VDRE motif variation to increase MS risk was not discernible, although vitamin D-dependent regulation of HLA-DR expression may still play an important role given that HLA-DRB1*04/*07/*09 (DR53) alleles that express the "nonresponsive" VDRE motif were associated with significantly reduced risk of MS.

  11. Development of a Finite Element Model of the Human Shoulder to Investigate the Mechanical Responses and Injuries in Side Impact

    Science.gov (United States)

    Iwamoto, Masami; Miki, Kazuo; Yang, King H.

    Previous studies in both fields of automotive safety and orthopedic surgery have hypothesized that immobilization of the shoulder caused by the shoulder injury could be related to multiple rib fractures, which are frequently life threatening. Therefore, for more effective occupant protection, it is important to understand the relationship between shoulder injury and multiple rib fractures in side impact. The purpose of this study is to develop a finite element model of the human shoulder in order to understand this relationship. The shoulder model included three bones (the humerus, scapula and clavicle) and major ligaments and muscles around the shoulder. The model also included approaches to represent bone fractures and joint dislocations. The relationships between shoulder injury and immobilization of the shoulder are discussed using model responses for lateral shoulder impact. It is also discussed how the injury can be related to multiple rib fractures.

  12. Activation of estrogen response elements is mediated both via estrogen and muscle contractions in rat skeletal muscle myotubes

    DEFF Research Database (Denmark)

    Wiik, A.; Hellsten, Ylva; Berthelson, P.

    2009-01-01

    is ER independent. The muscle contraction-induced transactivation of ERE and increase in ERbeta mRNA were instead found to be MAP kinase (MAPK) dependent. This study demonstrates for the first time that muscle contractions have a similar functional effect as estrogen in skeletal muscle myotubes, causing......The aim of the present study was to investigate the activation of estrogen response elements (EREs) by estrogen and muscle contractions in rat myotubes in culture and to assess whether the activation is dependent on the estrogen receptors (ERs). In addition, the effect of estrogen and contraction...... on the mRNA levels of ERalpha and ERbeta was studied to determine the functional consequence of the transactivation. Myoblasts were isolated from rat skeletal muscle and transfected with a vector consisting of sequences of EREs coupled to the gene for luciferase. The transfected myoblasts were...

  13. A 'Swinging Cradle' model for in vitro classification of different types of response elements of a nuclear receptor

    International Nuclear Information System (INIS)

    Malo, Madhu S.; Pushpakaran, Premraj; Hodin, Richard A.

    2005-01-01

    Nuclear receptors are hormone-activated transcription factors that bind to specific target sequences termed hormone-response element (HRE). A HRE usually consists of two half-sites (5'-AGGTCA-3' consensus sequence) arranged as a direct, everted or inverted repeat with variable spacer region. Assignment of a HRE as a direct, everted or inverted repeat is based on its homology to the consensus half-site, but minor variations can make such an assignment confusing. We hypothesize a 'Swinging Cradle' model for HRE classification, whereby the core HRE functions as the 'sitting platform' for the NR, and the extra nucleotides at either end act as the 'sling' of the Cradle. We show that in vitro binding of the thyroid hormone receptor and 9-cis retinoic acid receptor heterodimer to an everted repeat TRE follows the 'Swinging Cradle' model, whereas the other TREs do not. We also show that among these TREs, the everted repeat mediates the highest biological activity

  14. Four New Acylated Iridoid Glycosides from the Aerial Part of Veronicastrum sibiricum and Their Antioxidant Response Element-Inducing Activity.

    Science.gov (United States)

    Kim, Myeong Il; Kim, Chul Young

    2018-01-01

    Four new (1 - 4) and one known (5) acylated iridoid glycosides were isolated from the aerial parts of Veronicastrum sibiricum (L.) Pennell. The chemical structures of the isolated compounds were determined to be 3″,4″-dicinnamoyl-6-O-rhamnopyranosyl-10-O-bergaptol-5,7-bisdeoxycynanchoside (1), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylpaulownioside (2), 2″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (3), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylaucubin (4), and 3″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (5) using spectroscopic techniques. Among these compounds, compound 5 increased antioxidant response element (ARE) luciferase activity. © 2018 Wiley-VHCA AG, Zurich, Switzerland.

  15. On the residual stress modeling of shot-peened AISI 4340 steel: finite element and response surface methods

    Science.gov (United States)

    Asgari, Ali; Dehestani, Pouya; Poruraminaie, Iman

    2018-02-01

    Shot peening is a well-known process in applying the residual stress on the surface of industrial parts. The induced residual stress improves fatigue life. In this study, the effects of shot peening parameters such as shot diameter, shot speed, friction coefficient, and the number of impacts on the applied residual stress will be evaluated. To assess these parameters effect, firstly the shot peening process has been simulated by finite element method. Then, effects of the process parameters on the residual stress have been evaluated by response surface method as a statistical approach. Finally, a strong model is presented to predict the maximum residual stress induced by shot peening process in AISI 4340 steel. Also, the optimum parameters for the maximum residual stress are achieved. The results indicate that effect of shot diameter on the induced residual stress is increased by increasing the shot speed. Also, enhancing the friction coefficient magnitude always cannot lead to increase in the residual stress.

  16. Isolation of an X-ray-responsive element in the promoter region of tissue-type plasminogen activator: Potential uses of X-ray-responsive elements for gene therapy

    International Nuclear Information System (INIS)

    Boothman, D.A.; Lee, I.W.; Sahijdak, W.M.

    1994-01-01

    Tissue-type plasminogen activator (t-PA) was induced over 50-fold after X irradiation in radioresistant human melanoma cells. Activities of t-PA were induced 14-fold in ataxia telangiectasia, 9-fold in Bloom's syndrome and 6-fold in Fanconi's anemia cells, compared to normal human fibroblasts. X-ray-inducible synthesis of the protease, t-PA, may play a role(s) in damage-inducible repair processes in mammalian cells, similar to the SOS repair systems in lower eukaryotes and prokaryotes. DNA band shift and DNase I footprinting assays were used to determine binding if transcription factors to a previously unknown X-ray-responsive element (XRE) in the t-PA promoter. The major goals of our research with XREs are to understand (a) which transcription factor(s) regulates to-PA induction after X-rays, and (b) the role(s) of t-PA in DNA repair, apoptosis or other responses to X rays. The purpose of this paper is to discuss the potential use of an XRE, such as the one in the t-PA promoter, for gene radiotherapy. Several gene therapy strategies are proposed. 22 refs., 3 figs

  17. Reconstruction of molecular phylogeny of closely related Amorphophallus species of India using plastid DNA marker and fingerprinting approaches.

    Science.gov (United States)

    Gholave, Avinash R; Pawar, Kiran D; Yadav, Shrirang R; Bapat, Vishwas A; Jadhav, Jyoti P

    2017-01-01

    Plastid DNA markers sequencing and DNA fingerprinting approaches were used and compared for resolving molecular phylogeny of closely related, previously unexplored Amorphophallus species of India. The utility of individual plastid markers namely rbcL , matK , trnH - psbA , trnLC - trnLD , their combined dataset and two fingerprinting techniques viz. RAPD and ISSR were tested for their efficacy to resolves Amorphophallus species into three sections specific clades namely Rhaphiophallus , Conophallus and Amorphophallus . In the present study, sequences of these four plastid DNA regions as well as RAPD and ISSR profiles of 16 Amorphophallus species together with six varieties of two species were generated and analyzed. Maximum likelihood and Bayesian Inference based construction of phylogenetic trees indicated that among the four plastid DNA regions tested individually and their combined dataset, rbcL was found best suited for resolving closely related Amorphophallus species into section specific clades. When analyzed individually, rbcL exhibited better discrimination ability than matK , trnH - psbA , trnLC - trnLD and combination of all four tested plastid markers. Among two fingerprinting techniques used, the resolution of Amorphophallus species using RAPD was better than ISSR and combination of RAPD +ISSR and in congruence with resolution based on rbcL .

  18. Horizontal Transfer of DNA from the Mitochondrial to the Plastid Genome and Its Subsequent Evolution in Milkweeds (Apocynaceae)

    Science.gov (United States)

    Straub, Shannon C.K.; Cronn, Richard C.; Edwards, Christopher; Fishbein, Mark; Liston, Aaron

    2013-01-01

    Horizontal gene transfer (HGT) of DNA from the plastid to the nuclear and mitochondrial genomes of higher plants is a common phenomenon; however, plastid genomes (plastomes) are highly conserved and have generally been regarded as impervious to HGT. We sequenced the 158 kb plastome and the 690 kb mitochondrial genome of common milkweed (Asclepias syriaca [Apocynaceae]) and found evidence of intracellular HGT for a 2.4-kb segment of mitochondrial DNA to the rps2–rpoC2 intergenic spacer of the plastome. The transferred region contains an rpl2 pseudogene and is flanked by plastid sequence in the mitochondrial genome, including an rpoC2 pseudogene, which likely provided the mechanism for HGT back to the plastome through double-strand break repair involving homologous recombination. The plastome insertion is restricted to tribe Asclepiadeae of subfamily Asclepiadoideae, whereas the mitochondrial rpoC2 pseudogene is present throughout the subfamily, which confirms that the plastid to mitochondrial HGT event preceded the HGT to the plastome. Although the plastome insertion has been maintained in all lineages of Asclepiadoideae, it shows minimal evidence of transcription in A. syriaca and is likely nonfunctional. Furthermore, we found recent gene conversion of the mitochondrial rpoC2 pseudogene in Asclepias by the plastid gene, which reflects continued interaction of these genomes. PMID:24029811

  19. Membrane Composition and Physiological Activity of Plastids from an Oenothera Plastome Mutator-Induced Chloroplast Mutant 1

    Science.gov (United States)

    Johnson, Ellen M.; Sears, Barbara B.

    1990-01-01

    Plastids were isolated from a plastome mutator-induced mutant (pm7) of Oenothera hookeri and were analyzed for various physiological and biochemical attributes. No photosynthetic electron transport activity was detected in the mutant plastids. This is consistent with previous ultrastructural analysis showing the absence of thylakoid membranes in the pm7 plastids and with the observation of aberrant processing and accumulation of chloroplast proteins in the mutant. In comparison to wild type, the mutant tissue lacks chlorophyll, and has significant differences in levels of four fatty acids. The analyses did not reveal any differences in carotenoid levels nor in the synthesis of several chloroplast lipids. The consequences of the altered composition of the chloroplast membrane are discussed in terms of their relation to the aberrant protein processing of the pm7 plastids. The pigment, fatty acid, and lipid measurements were also performed on two distinct nuclear genotypes (A/A and A/C) which differ in their compatibility with the plastid genome (type I) contained in these lines. In these cases, only chlorophyll concentrations differed significantly. PMID:16667256

  20. Split photosystem protein, linear-mapping topology, and growth of structural complexity in the plastid genome of chromera velia

    KAUST Repository

    Janouškovec, Jan

    2013-08-22

    The canonical photosynthetic plastid genomes consist of a single circular-mapping chromosome that encodes a highly conserved protein core, involved in photosynthesis and ATP generation. Here, we demonstrate that the plastid genome of the photosynthetic relative of apicomplexans, Chromera velia, departs from this view in several unique ways. Core photosynthesis proteins PsaA and AtpB have been broken into two fragments, which we show are independently transcribed, oligoU-tailed, translated, and assembled into functional photosystem I and ATP synthase complexes. Genome-wide transcription profiles support expression of many other highly modified proteins, including several that contain extensions amounting to hundreds of amino acids in length. Canonical gene clusters and operons have been fragmented and reshuffled into novel putative transcriptional units. Massive genomic coverage by paired-end reads, coupled with pulsed-field gel electrophoresis and polymerase chain reaction, consistently indicate that the C. velia plastid genome is linear-mapping, a unique state among all plastids. Abundant intragenomic duplication probably mediated by recombination can explain protein splits, extensions, and genome linearization and is perhaps the key driving force behind the many features that defy the conventional ways of plastid genome architecture and function. © The Author 2013.

  1. Constitutive Transcription and Stable RNA Accumulation in Plastids during the Conversion of Chloroplasts to Chromoplasts in Ripening Tomato Fruits 1

    Science.gov (United States)

    Marano, María Rosa; Carrillo, Néstor

    1992-01-01

    The size distribution of plastid transcripts during chromoplast differentiation in ripening tomato (Lycopersicon esculentum L.) fruits was determined using northern blot analysis. Hybridization of total cellular RNA from leaves and fruits with several tobacco chloroplast DNA probes showed distinct transcript patterns in chloroplasts and chromoplasts. We also compared transcriptional rates by probing immobilized DNA fragments of small size (representing about 85% of the plastid genome) with run-on transcripts from tomato plastids. The relative rates of transcription of the various DNA regions were very similar in chloro- and chromoplasts. Parallel determination of the steady-state levels of plastid RNA showed no strict correlation between synthesis rate and RNA accumulation. Differences in the relative abundance of transcripts between chloro- and chromoplasts were not very pronounced and were limited to a small number of genes. The results indicate that the conversion of chloroplasts to chromoplasts at the onset of tomato fruit ripening proceeds with no important variations in the relative transcription rates and with only moderate changes in the relative stability of plastid-encoded transcripts. Images Figure 1 Figure 4 PMID:16653091

  2. P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

    Directory of Open Access Journals (Sweden)

    Ivan Raimondi

    Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

  3. Alcohol dysregulates corticotropin-releasing-hormone (CRH promoter activity by interfering with the negative glucocorticoid response element (nGRE.

    Directory of Open Access Journals (Sweden)

    Magdalena M Przybycien-Szymanska

    Full Text Available EtOH exposure in male rats increases corticotropin-releasing hormone (CRH mRNA in the paraventricular nucleus of the hypothalamus (PVN, a brain region responsible for coordinating stress and anxiety responses. In this study we identified the molecular mechanisms involved in mediating these effects by examining the direct effects of EtOH on CRH promoter activity in a neuronal cell line derived from the PVN (IVB. In addition, we investigated the potential interactions of EtOH and glucocorticoids on the CRH promoter by concomitantly treating cells with EtOH and the glucocorticoid receptor (GR antagonist RU486, and by sequentially deleting GR binding sites within glucocorticoid response element (GRE on the CRH promoter. Cells were transiently transfected with a firefly luciferase reporter construct containing 2.5 kb of the rat wild type (WT or mutated CRH promoter. Our results showed that EtOH treatment induced a biphasic response in CRH promoter activity. EtOH exposure for 0.5 h significantly decreased promoter activity compared to vehicle treated controls, whereas promoter activity was significantly increased after 2.0 h of EtOH exposure. Treatment with RU486, or deletion of the GR binding sites 1 and 2 within the GRE, abolished the EtOH-induced increase in the promoter activity, however did not affect EtOH-induced decrease in CRH promoter activity at an earlier time point. Overall, our data suggest that alcohol exposure directly regulates CRH promoter activity by interfering with the normal feedback mechanisms of glucocorticoids mediated by GR signaling at the GRE site of the CRH promoter.

  4. Non-functional plastid ndh gene fragments are present in the nuclear genome of Norway spruce (Picea abies L. Karsch): insights from in silico analysis of nuclear and organellar genomes.

    Science.gov (United States)

    Ranade, Sonali Sachin; García-Gil, María Rosario; Rosselló, Josep A

    2016-04-01

    Many genes have been lost from the prokaryote plastidial genome during the early events of endosymbiosis in eukaryotes. Some of them were definitively lost, but others were relocated and functionally integrated to the host nuclear genomes through serial events of gene transfer during plant evolution. In gymnosperms, plastid genome sequencing has revealed the loss of ndh genes from several species of Gnetales and Pinaceae, including Norway spruce (Picea abies). This study aims to trace the ndh genes in the nuclear and organellar Norway spruce genomes. The plastid genomes of higher plants contain 11 ndh genes which are homologues of mitochondrial genes encoding subunits of the proton-pumping NADH-dehydrogenase (nicotinamide adenine dinucleotide dehydrogenase) or complex I (electron transport chain). Ndh genes encode 11 NDH polypeptides forming the Ndh complex (analogous to complex I) which seems to be primarily involved in chloro-respiration processes. We considered ndh genes from the plastidial genome of four gymnosperms (Cryptomeria japonica, Cycas revoluta, Ginkgo biloba, Podocarpus totara) and a single angiosperm species (Arabidopsis thaliana) to trace putative homologs in the nuclear and organellar Norway spruce genomes using tBLASTn to assess the evolutionary fate of ndh genes in Norway spruce and to address their genomic location(s), structure, integrity and functionality. The results obtained from tBLASTn were subsequently analyzed by performing homology search for finding ndh specific conserved domains using conserved domain search. We report the presence of non-functional plastid ndh gene fragments, excepting ndhE and ndhG genes, in the nuclear genome of Norway spruce. Regulatory transcriptional elements like promoters, TATA boxes and enhancers were detected in the upstream regions of some ndh fragments. We also found transposable elements in the flanking regions of few ndh fragments suggesting nuclear rearrangements in those regions. These evidences

  5. Physiological roles of plastid terminal oxidase in plant stress

    Indian Academy of Sciences (India)

    The absence of PTOX in plants usually results in photo-bleached variegated leaves and impaired adaptation to environment alteration. Although PTOX level and activity has been found to increase under a wide range of stress conditions, the functions of plant PTOX in stress responses are still disputed now. In this paper ...

  6. Expression of MUC17 is regulated by HIF1α-mediated hypoxic responses and requires a methylation-free hypoxia responsible element in pancreatic cancer.

    Directory of Open Access Journals (Sweden)

    Sho Kitamoto

    Full Text Available MUC17 is a type 1 membrane-bound glycoprotein that is mainly expressed in the digestive tract. Recent studies have demonstrated that the aberrant overexpression of MUC17 is correlated with the malignant potential of pancreatic ductal adenocarcinomas (PDACs; however, the exact regulatory mechanism of MUC17 expression has yet to be identified. Here, we provide the first report of the MUC17 regulatory mechanism under hypoxia, an essential feature of the tumor microenvironment and a driving force of cancer progression. Our data revealed that MUC17 was significantly induced by hypoxic stimulation through a hypoxia-inducible factor 1α (HIF1α-dependent pathway in some pancreatic cancer cells (e.g., AsPC1, whereas other pancreatic cancer cells (e.g., BxPC3 exhibited little response to hypoxia. Interestingly, these low-responsive cells have highly methylated CpG motifs within the hypoxia responsive element (HRE, 5'-RCGTG-3', a binding site for HIF1α. Thus, we investigated the demethylation effects of CpG at HRE on the hypoxic induction of MUC17. Treatment of low-responsive cells with 5-aza-2'-deoxycytidine followed by additional hypoxic incubation resulted in the restoration of hypoxic MUC17 induction. Furthermore, DNA methylation of HRE in pancreatic tissues from patients with PDACs showed higher hypomethylation status as compared to those from non-cancerous tissues, and hypomethylation was also correlated with MUC17 mRNA expression. Taken together, these findings suggested that the HIF1α-mediated hypoxic signal pathway contributes to MUC17 expression, and DNA methylation of HRE could be a determinant of the hypoxic inducibility of MUC17 in pancreatic cancer cells.

  7. Hydroponics: A Versatile System to Study Nutrient Allocation and Plant Responses to Nutrient Availability and Exposure to Toxic Elements.

    Science.gov (United States)

    Nguyen, Nga T; McInturf, Samuel A; Mendoza-Cózatl, David G

    2016-07-13

    Hydroponic systems have been utilized as one of the standard methods for plant biology research and are also used in commercial production for several crops, including lettuce and tomato. Within the plant research community, numerous hydroponic systems have been designed to study plant responses to biotic and abiotic stresses. Here we present a hydroponic protocol that can be easily implemented in laboratories interested in pursuing studies on plant mineral nutrition. This protocol describes the hydroponic system set up in detail and the preparation of plant material for successful experiments. Most of the materials described in this protocol can be found outside scientific supply companies, making the set up for hydroponic experiments less expensive and convenient. The use of a hydroponic growth system is most advantageous in situations where the nutrient media need to be well controlled and when intact roots need to be harvested for downstream applications. We also demonstrate how nutrient concentrations can be modified to induce plant responses to both essential nutrients and toxic non-essential elements.

  8. Finite Element Modeling and Analysis of Nonlinear Impact and Frictional Motion Responses Including Fluid—Structure Coupling Effects

    Directory of Open Access Journals (Sweden)

    Yong Zhao

    1997-01-01

    Full Text Available A nonlinear three dimensional (3D single rack model and a nonlinear 3D whole pool multi-rack model are developed for the spent fuel storage racks of a nuclear power plant (NPP to determine impacts and frictional motion responses when subjected to 3D excitations from the supporting building floor. The submerged free standing rack system and surrounding water are coupled due to hydrodynamic fluid-structure interaction (FSI using potential theory. The models developed have features that allow consideration of geometric and material nonlinearities including (1 the impacts of fuel assemblies to rack cells, a rack to adjacent racks or pool walls, and rack support legs to the pool floor; (2 the hydrodynamic coupling of fuel assemblies with their storing racks, and of a rack with adjacent racks, pool walls, and the pool floor; and (3 the dynamic motion behavior of rocking, twisting, and frictional sliding of rack modules. Using these models 3D nonlinear time history dynamic analyses are performed per the U.S. Nuclear Regulatory Commission (USNRC criteria. Since few such modeling, analyses, and results using both the 3D single and whole pool multiple rack models are available in the literature, this paper emphasizes description of modeling and analysis techniques using the SOLVIA general purpose nonlinear finite element code. Typical response results with different Coulomb friction coefficients are presented and discussed.

  9. Regulation of Cox-2 by Cyclic AMP Response Element Binding Protein in Prostate Cancer: Potential Role for Nexrutine

    Directory of Open Access Journals (Sweden)

    Rita Ghosh

    2007-11-01

    Full Text Available We recently showed that NexrutineR, a Phellodendron amurense bark extract, suppresses proliferation of prostate cancer cell lines and tumor development in the transgenic adenocarcinoma of mouse prostate (TRAMP model. Our data also indicate that the antiproliferative effects of NexrutineR are mediated in part by Akt and Cyclic AMP response element binding protein (CREB. Cyclooxygenase (Cox-2, a pro-inflammatory mediator, is a CREB target that induces prostaglandin E2 (PGE2 and suppresses apoptosis. Treatment of LNCaP cells with NexrutineR reduced tumor necrosis factor α-induced enzymatic as well as promoter activities of Cox-2. NexrutineR also reduced the expression and promoter activity of Cox-2 in PC-3 cells that express high constitutive levels of Cox-2. Deletion analysis coupled with mutational analysis of the Cox-2 promoter identified CRE as being sufficient for mediating NexrutineR response. Immunohistochemical analysis of human prostate tumors show increased expression of CREB and DNA binding activity in high-grade tumors (three-fold higher in human prostate tumors compared to normal prostate; P = .01. We have identified CREB-mediated activation of Cox-2 as a potential signaling pathway in prostate cancer which can be blocked with a nontoxic, cost-effective dietary supplement like NexrutineR, demonstrating a prospective for development of NexrutineR for prostate cancer management.

  10. Enhanced phosphorylation of cyclic AMP response element binding protein in Brain of mice following repetitive hypoxic exposure

    International Nuclear Information System (INIS)

    Gao Yanan; Gao Ge; Long Caixia; Han Song; Zu Pengyu; Fang Li; Li Junfa

    2006-01-01

    Cerebral ischemic/hypoxic preconditioning (I/HPC) is a phenomenon of endogenous protection that renders Brain tolerant to sustained ischemia/hypoxia. This profound protection induced by I/HPC makes it an attractive target for developing potential clinical therapeutic approaches. However, the molecular mechanism of I/HPC is unclear. Cyclic AMP (cAMP) response element binding protein (CREB), a selective nuclear transcriptional factor, plays a key role in the neuronal functions. Phosphorylation of CREB on Ser-133 may facilitate its transcriptional activity in response to various stresses. In the current study, we observed the changes in CREB phosphorylation (Ser-133) and protein expression in Brain of auto-hypoxia-induced HPC mice by using Western blot analysis. We found that the levels of phosphorylated CREB (Ser-133), but not protein expression of CREB, increased significantly (p < 0.05) in the hippocampus and the frontal cortex of mice after repetitive hypoxic exposure (H2-H4, n = 6 for each group), when compared to that of the normoxic (H0, n = 6) or hypoxic exposure once group (H1, n = 6). In addition, a significant enhancement (p < 0.05) of CREB phosphorylation (Ser-133) could also be found in the nuclear extracts from the whole hippocampus of hypoxic preconditioned mice (H2-H4, n = 6 for each group). These results suggest that the phosphorylation of CREB might be involved in the development of cerebral hypoxic preconditioning

  11. Comparison of Six DNA Extraction Procedures and the Application of Plastid DNA Enrichment Methods in Selected Non-photosynthetic Plants

    Directory of Open Access Journals (Sweden)

    Shin-Yi Shyu

    2013-12-01

    Full Text Available Genomic DNA was isolated using three DNA extraction commercial kits and three CTAB-based methods for two non-photosynthetic plants, Balanophora japonica and Mitrastemon kanehirai. The quality of the isolated DNA was evaluated and subjected to following restriction enzyme digestions. All six procedures yielded DNA of sufficient quality for PCR, and the method described by Barnwell et al. (1998 performed well in isolating DNA from both species for restriction enzyme digestion. In addition, we succeeded to enrich plastid DNA content by using the methods depending on a high salt buffer to deplete nuclear material. The ‘high salt’ methods based on protocol presented by Milligan (1989 were able to increase plastid DNA effectively and significantly reduce nuclear DNA from M. kanehirai. The plastid DNA enrichment protocols are inexpensive and not time-consuming, and may be applicable to other non-photosynthetic plants.

  12. Selective Gene Delivery for Integrating Exogenous DNA into Plastid and Mitochondrial Genomes Using Peptide-DNA Complexes.

    Science.gov (United States)

    Yoshizumi, Takeshi; Oikawa, Kazusato; Chuah, Jo-Ann; Kodama, Yutaka; Numata, Keiji

    2018-05-14

    Selective gene delivery into organellar genomes (mitochondrial and plastid genomes) has been limited because of a lack of appropriate platform technology, even though these organelles are essential for metabolite and energy production. Techniques for selective organellar modification are needed to functionally improve organelles and produce transplastomic/transmitochondrial plants. However, no method for mitochondrial genome modification has yet been established for multicellular organisms including plants. Likewise, modification of plastid genomes has been limited to a few plant species and algae. In the present study, we developed ionic complexes of fusion peptides containing organellar targeting signal and plasmid DNA for selective delivery of exogenous DNA into the plastid and mitochondrial genomes of intact plants. This is the first report of exogenous DNA being integrated into the mitochondrial genomes of not only plants, but also multicellular organisms in general. This fusion peptide-mediated gene delivery system is a breakthrough platform for both plant organellar biotechnology and gene therapy for mitochondrial diseases in animals.

  13. Comparison of phosphate uptake rates by the smallest plastidic and aplastidic protists in the North Atlantic subtropical gyre.

    Science.gov (United States)

    Hartmann, Manuela; Grob, Carolina; Scanlan, David J; Martin, Adrian P; Burkill, Peter H; Zubkov, Mikhail V

    2011-11-01

    The smallest phototrophic protists (protists meet their inorganic nutrient requirements, we compared the phosphate uptake rates of plastidic and aplastidic protists in the phosphate-depleted subtropical and tropical North Atlantic (4-29°N) using a combination of radiotracers and flow cytometric sorting on two Atlantic Meridional Transect cruises. Plastidic protists were divided into two groups according to their size (protists showed higher phosphate uptake rates per cell than the aplastidic protists. Although the phosphate uptake rates of protist cells were on average seven times (Pprotists were one fourth to one twentieth of an average bacterioplankton cell. The unsustainably low biomass-specific phosphate uptake by both plastidic and aplastidic protists suggests the existence of a common alternative means of phosphorus acquisition - predation on phosphorus-rich bacterioplankton cells. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  14. Complete nucleotide sequence of the Oenothera elata plastid chromosome, representing plastome I of the five distinguishable euoenothera plastomes.

    Science.gov (United States)

    Hupfer, H; Swiatek, M; Hornung, S; Herrmann, R G; Maier, R M; Chiu, W L; Sears, B

    2000-05-01

    We describe the 159,443-bp [corrected] sequence of the plastid chromosome of Oenothera elata (evening primrose). The Oe. elata plastid chromosome represents type I of the five genetically distinguishable basic plastomes found in the subsection Euoenothera. The genus Oenothera provides an ideal system in which to address fundamental questions regarding the functional integration of the compartmentalised genetic system characteristic of the eukaryotic cell. Its highly developed taxonomy and genetics, together with a favourable combination of features in its genetic structure (interspecific fertility, stable heterozygous progeny, biparental transmission of organelles, and the phenomenon of complex heterozygosity), allow facile exchanges of nuclei, plastids and mitochondria, as well as individual chromosome pairs, between species. The resulting hybrids or cybrids are usually viable and fertile, but can display various forms of developmental disturbance.

  15. Sequencing of whole plastid genomes and nuclear ribosomal DNA of Diospyros species (Ebenaceae) endemic to New Caledonia: many species, little divergence.

    Science.gov (United States)

    Turner, Barbara; Paun, Ovidiu; Munzinger, Jérôme; Chase, Mark W; Samuel, Rosabelle

    2016-06-01

    Some plant groups, especially on islands, have been shaped by strong ancestral bottlenecks and rapid, recent radiation of phenotypic characters. Single molecular markers are often not informative enough for phylogenetic reconstruction in such plant groups. Whole plastid genomes and nuclear ribosomal DNA (nrDNA) are viewed by many researchers as sources of information for phylogenetic reconstruction of groups in which expected levels of divergence in standard markers are low. Here we evaluate the usefulness of these data types to resolve phylogenetic relationships among closely related Diospyros species. Twenty-two closely related Diospyros species from New Caledonia were investigated using whole plastid genomes and nrDNA data from low-coverage next-generation sequencing (NGS). Phylogenetic trees were inferred using maximum parsimony, maximum likelihood and Bayesian inference on separate plastid and nrDNA and combined matrices. The plastid and nrDNA sequences were, singly and together, unable to provide well supported phylogenetic relationships among the closely related New Caledonian Diospyros species. In the nrDNA, a 6-fold greater percentage of parsimony-informative characters compared with plastid DNA was found, but the total number of informative sites was greater for the much larger plastid DNA genomes. Combining the plastid and nuclear data improved resolution. Plastid results showed a trend towards geographical clustering of accessions rather than following taxonomic species. In plant groups in which multiple plastid markers are not sufficiently informative, an investigation at the level of the entire plastid genome may also not be sufficient for detailed phylogenetic reconstruction. Sequencing of complete plastid genomes and nrDNA repeats seems to clarify some relationships among the New Caledonian Diospyros species, but the higher percentage of parsimony-informative characters in nrDNA compared with plastid DNA did not help to resolve the phylogenetic tree

  16. Systematics and plastid genome evolution of the cryptically photosynthetic parasitic plant genus Cuscuta (Convolvulaceae

    Directory of Open Access Journals (Sweden)

    Kuehl Jennifer V

    2007-12-01

    Full Text Available Abstract Background The genus Cuscuta L. (Convolvulaceae, commonly known as dodders, are epiphytic vines that invade the stems of their host with haustorial feeding structures at the points of contact. Although they lack expanded leaves, some species are noticeably chlorophyllous, especially as seedlings and in maturing fruits. Some species are reported as crop pests of worldwide distribution, whereas others are extremely rare and have local distributions and apparent niche specificity. A strong phylogenetic framework for this large genus is essential to understand the interesting ecological, morphological and molecular phenomena that occur within these parasites in an evolutionary context. Results Here we present a well-supported phylogeny of Cuscuta using sequences of the nuclear ribosomal internal transcribed spacer and plastid rps2, rbcL and matK from representatives across most of the taxonomic diversity of the genus. We use the phylogeny to interpret morphological and plastid genome evolution within the genus. At least three currently recognized taxonomic sections are not monophyletic and subgenus Cuscuta is unequivocally paraphyletic. Plastid genes are extremely variable with regards to evolutionary constraint, with rbcL exhibiting even higher levels of purifying selection in Cuscuta than photosynthetic relatives. Nuclear genome size is highly variable within Cuscuta, particularly within subgenus Grammica, and in some cases may indicate the existence of cryptic species in this large clade of morphologically similar species. Conclusion Some morphological characters traditionally used to define major taxonomic splits within Cuscuta are homoplastic and are of limited use in defining true evolutionary groups. Chloroplast genome evolution seems to have evolved in a punctuated fashion, with episodes of loss involving suites of genes or tRNAs followed by stabilization of gene content in major clades. Nearly all species of Cuscuta retain some

  17. Systematics and plastid genome evolution of the cryptically photosynthetic parasitic plant genus Cuscuta (Convolvulaceae).

    Science.gov (United States)

    McNeal, Joel R; Arumugunathan, Kathiravetpilla; Kuehl, Jennifer V; Boore, Jeffrey L; Depamphilis, Claude W

    2007-12-13

    The genus Cuscuta L. (Convolvulaceae), commonly known as dodders, are epiphytic vines that invade the stems of their host with haustorial feeding structures at the points of contact. Although they lack expanded leaves, some species are noticeably chlorophyllous, especially as seedlings and in maturing fruits. Some species are reported as crop pests of worldwide distribution, whereas others are extremely rare and have local distributions and apparent niche specificity. A strong phylogenetic framework for this large genus is essential to understand the interesting ecological, morphological and molecular phenomena that occur within these parasites in an evolutionary context. Here we present a well-supported phylogeny of Cuscuta using sequences of the nuclear ribosomal internal transcribed spacer and plastid rps2, rbcL and matK from representatives across most of the taxonomic diversity of the genus. We use the phylogeny to interpret morphological and plastid genome evolution within the genus. At least three currently recognized taxonomic sections are not monophyletic and subgenus Cuscuta is unequivocally paraphyletic. Plastid genes are extremely variable with regards to evolutionary constraint, with rbcL exhibiting even higher levels of purifying selection in Cuscuta than photosynthetic relatives. Nuclear genome size is highly variable within Cuscuta, particularly within subgenus Grammica, and in some cases may indicate the existence of cryptic species in this large clade of morphologically similar species. Some morphological characters traditionally used to define major taxonomic splits within Cuscuta are homoplastic and are of limited use in defining true evolutionary groups. Chloroplast genome evolution seems to have evolved in a punctuated fashion, with episodes of loss involving suites of genes or tRNAs followed by stabilization of gene content in major clades. Nearly all species of Cuscuta retain some photosynthetic ability, most likely for nutrient

  18. Horizontal transfer of a eukaryotic plastid-targeted protein gene to cyanobacteria

    Directory of Open Access Journals (Sweden)

    Keeling Patrick J

    2007-06-01

    Full Text Available Abstract Background Horizontal or lateral transfer of genetic material between distantly related prokaryotes has been shown to play a major role in the evolution of bacterial and archaeal genomes, but exchange of genes between prokaryotes and eukaryotes is not as well understood. In particular, gene flow from eukaryotes to prokaryotes is rarely documented with strong support, which is unusual since prokaryotic genomes appear to readily accept foreign genes. Results Here, we show that abundant marine cyanobacteria in the related genera Synechococcus and Prochlorococcus acquired a key Calvin cycle/glycolytic enzyme from a eukaryote. Two non-homologous forms of fructose bisphosphate aldolase (FBA are characteristic of eukaryotes and prokaryotes respectively. However, a eukaryotic gene has been inserted immediately upstream of the ancestral prokaryotic gene in several strains (ecotypes of Synechococcus and Prochlorococcus. In one lineage this new gene has replaced the ancestral gene altogether. The eukaryotic gene is most closely related to the plastid-targeted FBA from red algae. This eukaryotic-type FBA once replaced the plastid/cyanobacterial type in photosynthetic eukaryotes, hinting at a possible functional advantage in Calvin cycle reactions. The strains that now possess this eukaryotic FBA are scattered across the tree of Synechococcus and Prochlorococcus, perhaps because the gene has been transferred multiple times among cyanobacteria, or more likely because it has been selectively retained only in certain lineages. Conclusion A gene for plastid-targeted FBA has been transferred from red algae to cyanobacteria, where it has inserted itself beside its non-homologous, functional analogue. Its current distribution in Prochlorococcus and Synechococcus is punctate, suggesting a complex history since its introduction to this group.

  19. Rate variation in parasitic plants: correlated and uncorrelated patterns among plastid genes of different function

    Directory of Open Access Journals (Sweden)

    dePamphilis Claude W

    2005-02-01

    Full Text Available Abstract Background The analysis of synonymous and nonsynonymous rates of DNA change can help in the choice among competing explanations for rate variation, such as differences in constraint, mutation rate, or the strength of genetic drift. Nonphotosynthetic plants of the Orobanchaceae have increased rates of DNA change. In this study 38 taxa of Orobanchaceae and relatives were used and 3 plastid genes were sequenced for each taxon. Results Phylogenetic reconstructions of relative rates of sequence evolution for three plastid genes (rbcL, matK and rps2 show significant rate heterogeneity among lineages and among genes. Many of the non-photosynthetic plants have increases in both synonymous and nonsynonymous rates, indicating that both (1 selection is relaxed, and (2 there has been a change in the rate at which mutations are entering the population in these species. However, rate increases are not always immediate upon loss of photosynthesis. Overall there is a poor correlation of synonymous and nonsynonymous rates. There is, however, a strong correlation of synonymous rates across the 3 genes studied and the lineage-speccific pattern for each gene is strikingly similar. This indicates that the causes of synonymous rate variation are affecting the whole plastid genome in a similar way. There is a weaker correlation across genes for nonsynonymous rates. Here the picture is more complex, as could be expected if there are many causes of variation, differing from taxon to taxon and gene to gene. Conclusions The distinctive pattern of rate increases in Orobanchaceae has at least two causes. It is clear that there is a relaxation of constraint in many (though not all non-photosynthetic lineages. However, there is also some force affecting synonymous sites as well. At this point, it is not possible to tell whether it is generation time, speciation rate, mutation rate, DNA repair efficiency or some combination of these factors.

  20. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Directory of Open Access Journals (Sweden)

    Marquez Rodolfo

    2004-09-01

    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  1. Novel nuclear-encoded proteins interacting with a plastid sigma factor, Sig1, in Arabidopsis thaliana.

    Science.gov (United States)

    Morikawa, Kazuya; Shiina, Takashi; Murakami, Shinya; Toyoshima, Yoshinori

    2002-03-13

    Sigma factor binding proteins are involved in modifying the promoter preferences of the RNA polymerase in bacteria. We found the nuclear encoded protein (SibI) that is transported into chloroplasts and interacts specifically with the region 4 of Sig1 in Arabidopsis. SibI and its homologue, T3K9.5 are novel proteins, which are not homologous to any protein of known function. The expression of sibI was tissue specific, light dependent, and developmentally timed. We suggest the transcriptional regulation by sigma factor binding proteins to function in the plastids of higher plant.

  2. Genome BLAST distance phylogenies inferred from whole plastid and whole mitochondrion genome sequences

    Directory of Open Access Journals (Sweden)

    Holland Barbara R

    2006-07-01

    Full Text Available Abstract Background Phylogenetic methods which do not rely on multiple sequence alignments are important tools in inferring trees directly from completely sequenced genomes. Here, we extend the recently described Genome BLAST Distance Phylogeny (GBDP strategy to compute phylogenetic trees from all completely sequenced plastid genomes currently available and from a selection of mitochondrial genomes representing the major eukaryotic lineages. BLASTN, TBLASTX, or combinations of both are used to locate high-scoring segment pairs (HSPs between two sequences from which pairwise similarities and distances are computed in different ways resulting in a total of 96 GBDP variants. The suitability of these distance formulae for phylogeny reconstruction is directly estimated by computing a recently described measure of "treelikeness", the so-called δ value, from the respective distance matrices. Additionally, we compare the trees inferred from these matrices using UPGMA, NJ, BIONJ, FastME, or STC, respectively, with the NCBI taxonomy tree of the taxa under study. Results Our results indicate that, at this taxonomic level, plastid genomes are much more valuable for inferring phylogenies than are mitochondrial genomes, and that distances based on breakpoints are of little use. Distances based on the proportion of "matched" HSP length to average genome length were best for tree estimation. Additionally we found that using TBLASTX instead of BLASTN and, particularly, combining TBLASTX and BLASTN leads to a small but significant increase in accuracy. Other factors do not significantly affect the phylogenetic outcome. The BIONJ algorithm results in phylogenies most in accordance with the current NCBI taxonomy, with NJ and FastME performing insignificantly worse, and STC performing as well if applied to high quality distance matrices. δ values are found to be a reliable predictor of phylogenetic accuracy. Conclusion Using the most treelike distance matrices, as

  3. Plastid genome evolution across the genus Cuscuta (Convolvulaceae): two clades within subgenus Grammica exhibit extensive gene loss.

    Science.gov (United States)

    Braukmann, Thomas; Kuzmina, Maria; Stefanovic, Sasa

    2013-02-01

    The genus Cuscuta (Convolvulaceae, the morning glory family) is one of the most intensely studied lineages of parasitic plants. Whole plastome sequencing of four Cuscuta species has demonstrated changes to both plastid gene content and structure. The presence of photosynthetic genes under purifying selection indicates that Cuscuta is cryptically photosynthetic. However, the tempo and mode of plastid genome evolution across the diversity of this group (~200 species) remain largely unknown. A comparative investigation of plastid genome content, grounded within a phylogenetic framework, was conducted using a slot-blot Southern hybridization approach. Cuscuta was extensively sampled (~56% of species), including groups previously suggested to possess more altered plastomes compared with other members of this genus. A total of 56 probes derived from all categories of protein-coding genes, typically found within the plastomes of flowering plants, were used. The results indicate that two clades within subgenus Grammica (clades 'O' and 'K') exhibit substantially more plastid gene loss relative to other members of Cuscuta. All surveyed members of the 'O' clade show extensive losses of plastid genes from every category of genes typically found in the plastome, including otherwise highly conserved small and large ribosomal subunits. The extent of plastid gene losses within this clade is similar in magnitude to that observed previously in some non-asterid holoparasites, in which the very presence of a plastome has been questioned. The 'K' clade also exhibits considerable loss of plastid genes. Unlike in the 'O' clade, in which all species seem to be affected, the losses in clade 'K' progress phylogenetically, following a pattern consistent with the Evolutionary Transition Series hypothesis. This clade presents an ideal opportunity to study the reduction of the plastome of parasites 'in action'. The widespread plastid gene loss in these two clades is hypothesized to be a

  4. Protein synthesis during the initial phase of the temperature-induced bleaching response in Euglena gracilis

    International Nuclear Information System (INIS)

    Ortiz, W.

    1990-01-01

    Growing cultures of photoheterotrophic Euglena gracilis experience an increase in chlorophyll accumulation during the initial phase of the temperature-induced bleaching response suggesting an increase in the synthesis of plastid components at the bleaching temperature of 33 degree C. A primary goal of this work was to establish whether an increase in the synthesis of plastid proteins accompanies the observed increase in chlorophyll accumulation. In vivo pulse-labeling experiments with [ 35 S]sodium sulfate were carried out with cells grown at room temperature or at 33 degree C. The synthesis of a number of plastid polypeptides of nucleocytoplasmic origin, including some presumably novel polypeptides, increased in cultures treated for 15 hours at 33 degree C. In contrast, while synthesis of thylakoid proteins by the plastid protein synthesis machinery decreased modestly, synthesis of the large subunit of the enzyme ribulosebisphosphate carboxylase was strongly affected at the elevated temperature. Synthesis of novel plastid-encoded polypeptides was not induced at the bleaching temperature. It is concluded that protein synthesis in plastids declines during the initial phase of the temperature response in Euglena despite an overall increase in cellular protein synthesis and an increase in chlorophyll accumulation per cell

  5. Brain response to primary blast wave using validated finite element models of human head and advanced combat helmet

    Directory of Open Access Journals (Sweden)

    Liying eZhang

    2013-08-01

    Full Text Available Blast-induced traumatic brain injury has emerged as a signature injury in combat casualty care. Present combat helmets are designed primarily to protect against ballistic and blunt impacts, but the current issue with helmets is protection concerning blasts. In order to delineate the blast wave attenuating capability of the Advanced Combat Helmet (ACH, a finite element (FE study was undertaken to evaluate the head response against blast loadings with and without helmet using a partially validated FE model of the human head and ACH. Four levels of overpressures (0.27-0.66 MPa from the Bowen’s lung iso-damage threshold curves were used to simulate blast insults. Effectiveness of the helmet with respect to head orientation was also investigated. The resulting biomechanical responses of the brain to blast threats were compared for human head with and without the helmet. For all Bowen’s cases, the peak intracranial pressures (ICP in the head ranged from 0.68-1.8 MPa in the coup cortical region. ACH was found to mitigate ICP in the head by 10-35%. Helmeted head resulted in 30% lower average peak brain strains and product of strain and strain rate. Among three blast loading directions with ACH, highest reduction in peak ICP (44% was due to backward blasts whereas the lowest reduction in peak ICP and brain strains was due to forward blast (27%. The biomechanical responses of a human head to primary blast insult exhibited directional sensitivity owing to the different geometry contours and coverage of the helmet construction and asymmetric anatomy of the head. Thus, direction-specific tolerances are needed in helmet design in order to offer omni-directional protection for the human head. The blasts of varying peak overpressures and durations that are believed to produce the same level of lung injury produce different levels of mechanical responses in the brain, and hence "iso-damage" curves for brain injury are likely different than the Bowen curves

  6. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing.

    Science.gov (United States)

    Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong

    2016-05-01

    Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  7. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Energy Technology Data Exchange (ETDEWEB)

    Stisova, Viktorie [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic); Goffinont, Stephane; Spotheim-Maurizot, Melanie [Centre de Biophysique Moleculaire CNRS, rue Charles Sadron, 45071 Orleans Cedex 2 (France); Davidkova, Marie, E-mail: davidkova@ujf.cas.c [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic)

    2010-08-15

    Signaling by estrogens, risk factors in breast cancer, is mediated through their binding to the estrogen receptor protein (ER), followed by the formation of a complex between ER and a DNA sequence, called estrogen response element (ERE). Anti-estrogens act as competitive inhibitors by blocking the signal transduction. We have studied in vitro the radiosensitivity of the complex between ERalpha, a subtype of this receptor, and a DNA fragment bearing ERE, as well as the influence of an estrogen (estradiol) or an anti-estrogen (tamoxifen) on this radiosensitivity. We observe that the complex is destabilized upon irradiation with gamma rays in aerated aqueous solution. The analysis of the decrease of binding abilities of the two partners shows that destabilization is mainly due to the damage to the protein. The destabilization is reduced when irradiating in presence of tamoxifen and is increased in presence of estradiol. These effects are due to opposite influences of the ligands on the loss of binding ability of ER. The mechanism that can account for our results is: binding of estradiol or tamoxifen induces distinct structural changes of the ER ligand-binding domain that can trigger (by allostery) distinct structural changes of the ER DNA-binding domains and thus, can differently affect ER-ERE interaction.

  8. A two-dimensional, finite-element methods for calculating TF coil response to out-of-plane Lorentz forces

    International Nuclear Information System (INIS)

    Witt, R.J.

    1989-01-01

    Toroidal field (TF) coils in fusion systems are routinely operated at very high magnetic fields. While obtaining the response of the coil to in-plane loads is relatively straightforward, the same is not true for the out-of-plane loads. Previous treatments of the out-of-plane problem have involved large, three-dimensional finite element idealizations. A new treatment of the out-of-plane problem is presented here; the model is two-dimensional in nature, and consumes far less CPU-time than three-dimensional methods. The approach assumes there exists a region of torsional deformation in the inboard leg and a bending region in the outboard leg. It also assumes the outboard part of the coil is attached to a torque frame/cylinder, which experiences primarily torsional deformation. Three-dimensional transition regions exist between the inboard and outboard legs and between the outboard leg and the torque frame. By considering several idealized problems of cylindrical shells subjected to moment distributions, it is shown that the size of these three-dimensional regions is quite small, and that the interaction between the torsional and bending regions can be treated in an equivalent two-dimensional fashion. Equivalent stiffnesses are derived to model penetration into and twist along the cylinders. These stiffnesses are then used in a special substructuring analysis to couple the three regions together. Results from the new method are compared to results from a 3D continuum model. (orig.)

  9. Response and binding elements for ligand-dependent positive transcription factors integrate positive and negative regulation of gene expression

    International Nuclear Information System (INIS)

    Rosenfeld, M.G.; Glass, C.K.; Adler, S.; Crenshaw, E.B. III; He, X.; Lira, S.A.; Elsholtz, H.P.; Mangalam, H.J.; Holloway, J.M.; Nelson, C.; Albert, V.R.; Ingraham, H.A.

    1988-01-01

    Accurate, regulated initiation of mRNA transcription by RNA polymerase II is dependent on the actions of a variety of positive and negative trans-acting factors that bind cis-acting promoter and enhancer elements. These transcription factors may exert their actions in a tissue-specific manner or function under control of plasma membrane or intracellular ligand-dependent receptors. A major goal in the authors' laboratory has been to identify the molecular mechanisms responsible for the serial activation of hormone-encoding genes in the pituitary during development and the positive and negative regulation of their transcription. The anterior pituitary gland contains phenotypically distinct cell types, each of which expresses unique trophic hormones: adrenocorticotropic hormone, thyroid-stimulating hormone, prolactin, growth hormone, and follicle-stimulating hormone/luteinizing hormone. The structurally related prolactin and growth hormone genes are expressed in lactotrophs and somatotrophs, respectively, with their expression virtually limited to the pituitary gland. The reported transient coexpression of these two structurally related neuroendocrine genes raises the possibility that the prolactin and growth hormone genes are developmentally controlled by a common factor(s)

  10. Cannabinoid exposure during zebra finch sensorimotor vocal learning persistently alters expression of endocannabinoid signaling elements and acute agonist responsiveness

    Directory of Open Access Journals (Sweden)

    Lichtman Aron H

    2011-01-01

    Full Text Available Abstract Background Previously we have found that cannabinoid treatment of zebra finches during sensorimotor stages of vocal development alters song patterns produced in adulthood. Such persistently altered behavior must be attributable to changes in physiological substrates responsible for song. We are currently working to identify the nature of such physiological changes, and to understand how they contribute to altered vocal learning. One possibility is that developmental agonist exposure results in altered expression of elements of endocannabinoid signaling systems. To test this hypothesis we have studied effects of the potent cannabinoid receptor agonist WIN55212-2 (WIN on endocannabinoid levels and densities of CB1 immunostaining in zebra finch brain. Results We found that late postnatal WIN treatment caused a long-term global disregulation of both levels of the endocannabinoid, 2-arachidonyl glycerol (2-AG and densities of CB1 immunostaining across brain regions, while repeated cannabinoid treatment in adults produced few long-term changes in the endogenous cannabinoid system. Conclusions Our findings indicate that the zebra finch endocannabinoid system is particularly sensitive to exogenous agonist exposure during the critical period of song learning and provide insight into susceptible brain areas.

  11. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia

    Directory of Open Access Journals (Sweden)

    C.B. Sacramento

    2010-08-01

    Full Text Available The main objective of the present study was to find suitable DNA-targeting sequences (DTS for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS and hypoxia-responsive element (HRE sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF. The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2 and hypoxia (less than 5% O2 were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  12. Hypoxia-induced oxidative base modifications in the VEGF hypoxia-response element are associated with transcriptionally active nucleosomes.

    Science.gov (United States)

    Ruchko, Mykhaylo V; Gorodnya, Olena M; Pastukh, Viktor M; Swiger, Brad M; Middleton, Natavia S; Wilson, Glenn L; Gillespie, Mark N

    2009-02-01

    Reactive oxygen species (ROS) generated in hypoxic pulmonary artery endothelial cells cause transient oxidative base modifications in the hypoxia-response element (HRE) of the VEGF gene that bear a conspicuous relationship to induction of VEGF mRNA expression (K.A. Ziel et al., FASEB J. 19, 387-394, 2005). If such base modifications are indeed linked to transcriptional regulation, then they should be detected in HRE sequences associated with transcriptionally active nucleosomes. Southern blot analysis of the VEGF HRE associated with nucleosome fractions prepared by micrococcal nuclease digestion indicated that hypoxia redistributed some HRE sequences from multinucleosomes to transcriptionally active mono- and dinucleosome fractions. A simple PCR method revealed that VEGF HRE sequences harboring oxidative base modifications were found exclusively in mononucleosomes. Inhibition of hypoxia-induced ROS generation with myxathiozol prevented formation of oxidative base modifications but not the redistribution of HRE sequences into mono- and dinucleosome fractions. The histone deacetylase inhibitor trichostatin A caused retention of HRE sequences in compacted nucleosome fractions and prevented formation of oxidative base modifications. These findings suggest that the hypoxia-induced oxidant stress directed at the VEGF HRE requires the sequence to be repositioned into mononucleosomes and support the prospect that oxidative modifications in this sequence are an important step in transcriptional activation.

  13. Platelet-released growth factors can accelerate tenocyte proliferation and activate the anti-oxidant response element.

    Science.gov (United States)

    Tohidnezhad, M; Varoga, D; Wruck, C J; Brandenburg, L O; Seekamp, A; Shakibaei, M; Sönmez, T T; Pufe, Thomas; Lippross, S

    2011-05-01

    Little is know about the pathophysiology of acute and degenerative tendon injuries. Although most lesions are uncomplicated, treatment is long and unsatisfactory in a considerable number of cases. Besides the common growth factors that were shown to be relevant for tendon integrity more recently protection against oxidative stress was shown to promote tendon healing. To improve tendon regeneration, many have advocated the use of platelet-rich plasma (PRP), a thrombocyte concentrate that can serve as an autologous source of growth factors. In this study, we investigated the effect of platelet-released growth factors (PRGF) on tenocytes. Tenocytes were isolated from the Achilles tendon of postnatal rats. Tenocyte cell cultures were stimulated with PRGF. We used a CyQuant assay and WST assay to analyse tendon cell growth and viability in different concentrations of PRGF. Migration and proliferation of cells grown in PRGF were assessed by a scratch test. A dual-luciferase assay was used to demonstrate the activation of the anti-oxidant response element (ARE) in tenocytes. A positive effect of PRGF could be shown on tendon cell growth and migratory capacity. PRGF activated the Nrf2-ARE pathway in a dose-dependent manner. Here, we provide evidence of a biological effect of PRGF on tenocytes by the promotion of tenocyte growth and activation of the Nrf2-ARE pathway. This is a novel aspect of the action of platelet concentrates on tendon growth.

  14. APOBEC3G inhibits HIV-1 RNA elongation by inactivating the viral trans-activation response element.

    Science.gov (United States)

    Nowarski, Roni; Prabhu, Ponnandy; Kenig, Edan; Smith, Yoav; Britan-Rosich, Elena; Kotler, Moshe

    2014-07-29

    Deamination of cytidine residues in viral DNA is a major mechanism by which APOBEC3G (A3G) inhibits vif-deficient human immunodeficiency virus type 1 (HIV-1) replication. dC-to-dU transition following RNase-H activity leads to viral cDNA degradation, production of non-functional proteins, formation of undesired stop codons and decreased viral protein synthesis. Here, we demonstrate that A3G provides an additional layer of defense against HIV-1 infection dependent on inhibition of proviral transcription. HIV-1 transcription elongation is regulated by the trans-activation response (TAR) element, a short stem-loop RNA structure required for elongation factors binding. Vif-deficient HIV-1-infected cells accumulate short viral transcripts and produce lower amounts of full-length HIV-1 transcripts due to A3G deamination of the TAR apical loop cytidine, highlighting the requirement for TAR loop integrity in HIV-1 transcription. We further show that free single-stranded DNA (ssDNA) termini are not essential for A3G activity and a gap of CCC motif blocked with juxtaposed DNA or RNA on either or 3'+5' ends is sufficient for A3G deamination. These results identify A3G as an efficient mutator and that deamination of (-)SSDNA results in an early block of HIV-1 transcription. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Groundwater response under an electronuclear plant to a river flood wave analyzed by a nonlinear finite element model

    International Nuclear Information System (INIS)

    Gambolati, G.; Toffolo, F.; Uliana, F.

    1984-01-01

    A nonlinear finite element model based on the Dupuit-Boussinesq equation of flow in an unconfined aquifer has been developed and applied to simulate the water table fluctuation under the electronuclear plant of the test site of Trino Vercellese (northwestern Italy) in response to the flood event that occurred in the Po River from March 30 to April 4, 1981. The nonlinearity has been overcome by the aid of an efficient iterative linearization technique wherein the model equations are solved by symbolic factorization, numerical factorization, and backward-forward substitution after an optimal preliminary reordering. The model was run for uniform values of aquifer permeability and specific yield within the typical range evidenced for the Trino sands by the early data in our possession. The results show that the maximum water level elevation below the reactor is almost 3 m lower than the corresponding river flood peak even in the most unfavorable conditions, i.e., with the hydraulic conductivity in the upper range, and is rather insensitive to the specific yield values within the plausible interval. The model allowed for an easy evaluation of the effectiveness of the impermeable protection walls and of a possible secondary aquifer recharge from a minor channel. The modeling approach for the analysis of the water table behavior appears to be a very promising tool to help in the structural design of future electronuclear plants

  16. Hypoxia-response element (HRE)-directed transcriptional regulation of the rat lysyl oxidase gene in response to cobalt and cadmium.

    Science.gov (United States)

    Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande

    2013-04-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.

  17. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    Science.gov (United States)

    Li, Wande

    2013-01-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  18. Nuclear and plastid DNAs from the binucleate dinoflagellates Glenodinium (Peridinium) foliaceum and Peridinium balticum.

    Science.gov (United States)

    Kite, G C; Rothschild, L J; Dodge, J D

    1988-01-01

    The binucleate dinoflagellates Glenodinium (Peridinium) foliaceum Stein and Peridinium balticum (Levander) Lemmermann were found to contain two major buoyant density classes of DNA. The heavier peak (1.730 g/cm3) was derived from the "dinokaryotic" nucleus and the lighter peak (1.706 g/cm3) from the "endosymbiont" nucleus and this allowed for the fractionation of G. foliaceum DNA in CsCl/EtBr density gradients. An initial CsCl/Hoechst Dye gradient removed a minor A-T rich satellite species which was identified as plastid DNA with a size of about 100-106 kb. Analysis of the nuclear DNA by agarose gel electrophoresis and renaturation studies showed that the endosymbiont nucleus lacked amplified gene-sized DNA molecules, however, this nucleus did have a comparatively high level of DNA. The total amount of DNA per cell and the relative contributions of the two nuclei appeared to vary between two strains of G. foliaceum (75 pg/cell in CCAP strain and 58 pg in UTEX strain). The only strain of P. balticum examined contained 73 pg cell. These results are discussed in relation to the status and possible functioning of the endosymbiont nucleus and the idea that these dinoflagellates provide model systems with which to study the evolution of plastids.

  19. Chaperone-like properties of tobacco plastid thioredoxins f and m

    Science.gov (United States)

    Sanz-Barrio, Ruth; Fernández-San Millán, Alicia; Carballeda, Jon; Corral-Martínez, Patricia; Seguí-Simarro, José M.; Farran, Inmaculada

    2012-01-01

    Thioredoxins (Trxs) are ubiquitous disulphide reductases that play important roles in the redox regulation of many cellular processes. However, some redox-independent functions, such as chaperone activity, have also been attributed to Trxs in recent years. The focus of our study is on the putative chaperone function of the well-described plastid Trxs f and m. To that end, the cDNA of both Trxs, designated as NtTrxf and NtTrxm, was isolated from Nicotiana tabacum plants. It was found that bacterially expressed tobacco Trx f and Trx m, in addition to their disulphide reductase activity, possessed chaperone-like properties. In vitro, Trx f and Trx m could both facilitate the reactivation of the cysteine-free form of chemically denatured glucose-6 phosphate dehydrogenase (foldase chaperone activity) and prevent heat-induced malate dehydrogenase aggregation (holdase chaperone activity). Our results led us to infer that the disulphide reductase and foldase chaperone functions prevail when the proteins occur as monomers and the well-conserved non-active cysteine present in Trx f is critical for both functions. By contrast, the holdase chaperone activity of both Trxs depended on their oligomeric status: the proteins were functional only when they were associated with high molecular mass protein complexes. Because the oligomeric status of both Trxs was induced by salt and temperature, our data suggest that plastid Trxs could operate as molecular holdase chaperones upon oxidative stress, acting as a type of small stress protein. PMID:21948853

  20. Higher level phylogenetic relationships within the bamboos (Poaceae: Bambusoideae) based on five plastid markers.

    Science.gov (United States)

    Kelchner, Scot A

    2013-05-01

    Bamboos are large perennial grasses of temperate and tropical forests worldwide. Two general growth forms exist: the economically and ecologically important woody bamboos (tribes Arundinarieae and Bambuseae), and the understory herbaceous bamboos (tribe Olyreae). Evolutionary relationships among the 1400+described species have been difficult to resolve with confidence. Comparative analysis of bamboo plastid (chloroplast) DNA has revealed three to five major lineages that show distinct biogeographic distributions. Taxon sampling across tribes and subtribes has been incomplete and most published data sets include a relatively small number of nucleotide characters. Branching order among lineages is often poorly supported, and in more than one study herbaceous bamboos form a clade within the woody bamboos. In this paper, the Bamboo Phylogeny Group presents the most complete phylogeny estimation to date of bamboo tribes and subtribes using 6.7 kb of coding and noncoding sequence data and 37 microstructural characters from the chloroplast genome. Quality of data is assessed, as is the possibility of long branch attraction, the degree of character conflict at key nodes in the tree, and the legitimacy of three alternative hypotheses of relationship. Four major plastid lineages are recognized: temperate woody, paleotropical woody, neotropical woody, and herbaceous bamboos. Woody bamboos are resolved as paraphyletic with respect to Olyreae but SH tests cannot reject monophyly of woody species (Arundinarieae+Bambuseae). Published by Elsevier Inc.

  1. Diversification of Rosaceae since the Late Cretaceous based on plastid phylogenomics.

    Science.gov (United States)

    Zhang, Shu-Dong; Jin, Jian-Jun; Chen, Si-Yun; Chase, Mark W; Soltis, Douglas E; Li, Hong-Tao; Yang, Jun-Bo; Li, De-Zhu; Yi, Ting-Shuang

    2017-05-01

    Phylogenetic relationships in Rosaceae have long been problematic because of frequent hybridisation, apomixis and presumed rapid radiation, and their historical diversification has not been clarified. With 87 genera representing all subfamilies and tribes of Rosaceae and six of the other eight families of Rosales (outgroups), we analysed 130 newly sequenced plastomes together with 12 from GenBank in an attempt to reconstruct deep relationships and reveal temporal diversification of this family. Our results highlight the importance of improving sequence alignment and the use of appropriate substitution models in plastid phylogenomics. Three subfamilies and 16 tribes (as previously delimited) were strongly supported as monophyletic, and their relationships were fully resolved and strongly supported at most nodes. Rosaceae were estimated to have originated during the Late Cretaceous with evidence for rapid diversification events during several geological periods. The major lineages rapidly diversified in warm and wet habits during the Late Cretaceous, and the rapid diversification of genera from the early Oligocene onwards occurred in colder and drier environments. Plastid phylogenomics offers new and important insights into deep phylogenetic relationships and the diversification history of Rosaceae. The robust phylogenetic backbone and time estimates we provide establish a framework for future comparative studies on rosaceous evolution. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  2. Citrus plastid-related gene profiling based on expressed sequence tag analyses

    Directory of Open Access Journals (Sweden)

    Tercilio Calsa Jr.

    2007-01-01

    Full Text Available Plastid-related sequences, derived from putative nuclear or plastome genes, were searched in a large collection of expressed sequence tags (ESTs and genomic sequences from the Citrus Biotechnology initiative in Brazil. The identified putative Citrus chloroplast gene sequences were compared to those from Arabidopsis, Eucalyptus and Pinus. Differential expression profiling for plastid-directed nuclear-encoded proteins and photosynthesis-related gene expression variation between Citrus sinensis and Citrus reticulata, when inoculated or not with Xylella fastidiosa, were also analyzed. Presumed Citrus plastome regions were more similar to Eucalyptus. Some putative genes appeared to be preferentially expressed in vegetative tissues (leaves and bark or in reproductive organs (flowers and fruits. Genes preferentially expressed in fruit and flower may be associated with hypothetical physiological functions. Expression pattern clustering analysis suggested that photosynthesis- and carbon fixation-related genes appeared to be up- or down-regulated in a resistant or susceptible Citrus species after Xylella inoculation in comparison to non-infected controls, generating novel information which may be helpful to develop novel genetic manipulation strategies to control Citrus variegated chlorosis (CVC.

  3. Structural changes in plastids of developing Splachnum ampullaceum sporophytes and relationship to odour production.

    Science.gov (United States)

    McCuaig, B; Dufour, S C; Raguso, R A; Bhatt, A P; Marino, P

    2015-03-01

    Many mosses of the family Splachnaceae are entomophilous and rely on flies for spore dispersal. Splachnum ampullaceum produces a yellow- or pink-coloured hypophysis that releases volatile compounds, attracting flies to the mature moss. The biosynthetic sources of the visual and aromatic cues within the hypophysis have not been identified, and may be either symbiotic cyanobacteria or chromoplasts that break down lipids into volatile compounds. Here, we used transmission electron microscopy and gas chromatography-mass spectrometry (GC-MS) to investigate the sources of these attractants, focusing on different tissues and stages of maturation. Microscopy revealed an abundance of plastids within the hypophysis, while no symbiotic bacteria were observed. During plant maturation, plastids differentiated from amyloplasts with large starch granules to photosynthetic chloroplasts and finally to chromoplasts with lipid accumulations. We used GC-MS to identify over 50 volatile organic compounds from mature sporophytes including short-chain oxygenated compounds, unsaturated irregular terpenoids, fatty acid-derived 6- and 8-carbon alcohols and ketones, and the aromatic compounds acetophenone and p-cresol. The hypophysis showed localised production of pungent volatiles, mainly short-chain fermentation compounds and p-cresol. Some of these volatiles have been shown to be produced from lipid oxidase degradation of linolenic acid within chromoplasts. However, other compounds (such as cyclohexanecarboxylic acid esters) may have a microbial origin. Further investigation is necessary to identify the origin of fly attractants in these mosses. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

  4. Biosynthesis of digalactosyldiacylglycerol in plastids from 16:3 and 18:3 plants

    Energy Technology Data Exchange (ETDEWEB)

    Heemskerk, J.W.M.; Heinz, E. (Univ. of Hamburg (West Germany)); Storz, T.; Schmidt, R.R. (Univ. of Konstanz (West Germany))

    1990-08-01

    Intact chloroplasts isolated from leaves of eight species of 16:3 and 18:3 plants and chromoplasts isolated from Narcissus pseudonarcissus L. flowers synthesize galactose-labeled mono-, di-, and trigalactosyldiacylglycerol (MGDG, DGDG, and TGDG) when incubated with UDP-(6-{sup 3}H)galactose. In all plastids, galactolipid synthesis, and especially synthesis of DGDG and TGDG, is reduced by treatment of the organelles with the nonpenetrating protease thermolysin. Envelope membranes isolated from thermolysin-treated chloroplasts of Spinacia oleracea L. (16:3 plant) and Pisum sativum L. (18:3 plant) or membranes isolated from thermolysin-treated chromoplasts are strongly reduced in galactolipid:galactolipid galactosyltransferase activity, but not with regard to UDP-Gal:diacylglycerol galactosyltransferase. For the intact plastids, this indicates that thermolysin treatment specifically blocks DGDG (and TGDG) synthesis, whereas MGDG synthesis is not affected. Neither in chloroplast nor in chromoplast membranes is DGDG synthesis stimulated by UDP-Gal. DGDG synthesis in S. oleracea chloroplasts is not stimulated by nucleoside 5{prime}-diphospho digalactosides. Therefore, galactolipid:galactolipid galactosyltransferase is so far the only detectable enzyme synthesizing DGDG.

  5. A Plastid Terminal Oxidase Associated with Carotenoid Desaturation during Chromoplast Differentiation1

    Science.gov (United States)

    Josse, Eve-Marie; Simkin, Andrew J.; Gaffé, Joël; Labouré, Anne-Marie; Kuntz, Marcel; Carol, Pierre

    2000-01-01

    The Arabidopsis IMMUTANS gene encodes a plastid homolog of the mitochondrial alternative oxidase, which is associated with phytoene desaturation. Upon expression in Escherichia coli, this protein confers a detectable cyanide-resistant electron transport to isolated membranes. In this assay this activity is sensitive to n-propyl-gallate, an inhibitor of the alternative oxidase. This protein appears to be a plastid terminal oxidase (PTOX) that is functionally equivalent to a quinol:oxygen oxidoreductase. This protein was immunodetected in achlorophyllous pepper (Capsicum annuum) chromoplast membranes, and a corresponding cDNA was cloned from pepper and tomato (Lycopersicum esculentum) fruits. Genomic analysis suggests the presence of a single gene in these organisms, the expression of which parallels phytoene desaturase and ζ-carotene desaturase gene expression during fruit ripening. Furthermore, this PTOX gene is impaired in the tomato ghost mutant, which accumulates phytoene in leaves and fruits. These data show that PTOX also participates in carotenoid desaturation in chromoplasts in addition to its role during early chloroplast development. PMID:10938359

  6. Structural changes in plastids of developing Splachnum ampullaceum sporophytes and relationship to odour production

    Science.gov (United States)

    McCuaig, B.; Dufour, S. C.; Raguso, R. A.; Bhatt, A. P.; Marino, P.

    2014-01-01

    Many mosses of the family Splachnaceae are entomophilous and rely on flies for spore dispersal. Splachnum ampullaceum produces a yellow- or pink-coloured hypophysis that releases volatile compounds, attracting flies to the mature moss. The biosynthetic sources of the visual and aromatic cues within the hypophysis have not been identified, and may be either symbiotic cyanobacteria or chromoplasts that break down lipids into volatile compounds. Here, we used transmission electron microscopy and gas chromatography-mass spectrometry (GC-MS) to investigate the sources of these attractants, focusing on different tissues and stages of maturation. Microscopy revealed an abundance of plastids within the hypophysis, while no symbiotic bacteria were observed. During plant maturation, plastids differentiated from amyloplasts with large starch granules to photosynthetic chloroplasts and finally to chromoplasts with lipid accumulations. We used GC-MS to identify over 50 volatile organic compounds from mature sporophytes including short-chain oxygenated compounds, unsaturated irregular terpenoids, fatty acid-derived 6- and 8-carbon alcohols and ketones, and the aromatic compounds acetophenone and p-cresol. The hypophysis showed localised production of pungent volatiles, mainly short-chain fermentation compounds and p-cresol. Some of these volatiles have been shown to be produced from lipid oxidase degradation of linolenic acid within chromoplasts. However, other compounds (such as cyclohexanecarboxylic acid esters) may have a microbial origin. Further investigation is necessary to identify the origin of fly attractants in these mosses. PMID:25213550

  7. Plant hormone cytokinins control cell cycle progression and plastid replication in apicomplexan parasites.

    Science.gov (United States)

    Andrabi, Syed Bilal Ahmad; Tahara, Michiru; Matsubara, Ryuma; Toyama, Tomoko; Aonuma, Hiroka; Sakakibara, Hitoshi; Suematsu, Makoto; Tanabe, Kazuyuki; Nozaki, Tomoyoshi; Nagamune, Kisaburo

    2018-02-01

    Cytokinins are plant hormones that are involved in regulation of cell proliferation, cell cycle progression, and cell and plastid development. Here, we show that the apicomplexan parasites Toxoplasma gondii and Plasmodium berghei, an opportunistic human pathogen and a rodent malaria agent, respectively, produce cytokinins via a biosynthetic pathway similar to that in plants. Cytokinins regulate the growth and cell cycle progression of T. gondii by mediating expression of the cyclin gene TgCYC4. A natural form of cytokinin, trans-zeatin (t-zeatin), upregulated expression of this cyclin, while a synthetic cytokinin, thidiazuron, downregulated its expression. Immunofluorescence microscopy and quantitative PCR analysis showed that t-zeatin increased the genome-copy number of apicoplast, which are non-photosynthetic plastid, in the parasite, while thidiazuron led to their disappearance. Thidiazuron inhibited growth of T. gondii and Plasmodium falciparum, a human malaria parasite, suggesting that thidiazuron has therapeutic potential as an inhibitor of apicomplexan parasites. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  8. Biosynthesis of digalactosyldiacylglycerol in plastids from 16:3 and 18:3 plants

    International Nuclear Information System (INIS)

    Heemskerk, J.W.M.; Heinz, E.; Storz, T.; Schmidt, R.R.

    1990-01-01

    Intact chloroplasts isolated from leaves of eight species of 16:3 and 18:3 plants and chromoplasts isolated from Narcissus pseudonarcissus L. flowers synthesize galactose-labeled mono-, di-, and trigalactosyldiacylglycerol (MGDG, DGDG, and TGDG) when incubated with UDP-[6- 3 H]galactose. In all plastids, galactolipid synthesis, and especially synthesis of DGDG and TGDG, is reduced by treatment of the organelles with the nonpenetrating protease thermolysin. Envelope membranes isolated from thermolysin-treated chloroplasts of Spinacia oleracea L. (16:3 plant) and Pisum sativum L. (18:3 plant) or membranes isolated from thermolysin-treated chromoplasts are strongly reduced in galactolipid:galactolipid galactosyltransferase activity, but not with regard to UDP-Gal:diacylglycerol galactosyltransferase. For the intact plastids, this indicates that thermolysin treatment specifically blocks DGDG (and TGDG) synthesis, whereas MGDG synthesis is not affected. Neither in chloroplast nor in chromoplast membranes is DGDG synthesis stimulated by UDP-Gal. DGDG synthesis in S. oleracea chloroplasts is not stimulated by nucleoside 5'-diphospho digalactosides. Therefore, galactolipid:galactolipid galactosyltransferase is so far the only detectable enzyme synthesizing DGDG

  9. Phylogeny of Gracilariaceae (Rhodophyta): evidence from plastid and mitochondrial nucleotide sequences.

    Science.gov (United States)

    Lyra, Goia de M; Costa, Emmanuelle da S; de Jesus, Priscila B; de Matos, João Carlos G; Caires, Taiara A; Oliveira, Mariana C; Oliveira, Eurico C; Xi, Zhenxiang; Nunes, José Marcos de C; Davis, Charles C

    2015-04-01

    Gracilariaceae are mostly pantropical red algae and include ~230 species in seven genera. Infrafamilial classification of the group has long been based on reproductive characters, but previous phylogenies have shown that traditionally circumscribed groups are not monophyletic. We performed phylogenetic analyses using two plastid (universal plastid amplicon and rbcL) and one mitochondrial (cox1) loci from a greatly expanded number of taxa to better assess generic relationships and understand patterns of character distributions. Our analyses produce the most well-supported phylogeny of the family to date, and indicate that key characteristics of spermatangia and cystocarp type do not delineate genera as commonly suggested. Our results further indicate that Hydropuntia is not monophyletic. Given their morphological overlap with closely related members of Gracilaria, we propose that Hydropuntia be synonymized with the former. Our results additionally expand the known ranges of several Gracilariaceae species to include Brazil. Lastly, we demonstrate that the recently described Gracilaria yoneshigueana should be synonymized as G. domingensis based on morphological and molecular characters. These results demonstrate the utility of DNA barcoding for understanding poorly known and fragmentary materials of cryptic red algae. © 2015 Phycological Society of America.

  10. The Use of Sparse Direct Solver in Vector Finite Element Modeling for Calculating Two Dimensional (2-D) Magnetotelluric Responses in Transverse Electric (TE) Mode

    Science.gov (United States)

    Yihaa Roodhiyah, Lisa’; Tjong, Tiffany; Nurhasan; Sutarno, D.

    2018-04-01

    The late research, linear matrices of vector finite element in two dimensional(2-D) magnetotelluric (MT) responses modeling was solved by non-sparse direct solver in TE mode. Nevertheless, there is some weakness which have to be improved especially accuracy in the low frequency (10-3 Hz-10-5 Hz) which is not achieved yet and high cost computation in dense mesh. In this work, the solver which is used is sparse direct solver instead of non-sparse direct solverto overcome the weaknesses of solving linear matrices of vector finite element metod using non-sparse direct solver. Sparse direct solver will be advantageous in solving linear matrices of vector finite element method because of the matrix properties which is symmetrical and sparse. The validation of sparse direct solver in solving linear matrices of vector finite element has been done for a homogen half-space model and vertical contact model by analytical solution. Thevalidation result of sparse direct solver in solving linear matrices of vector finite element shows that sparse direct solver is more stable than non-sparse direct solver in computing linear problem of vector finite element method especially in low frequency. In the end, the accuracy of 2D MT responses modelling in low frequency (10-3 Hz-10-5 Hz) has been reached out under the efficient allocation memory of array and less computational time consuming.

  11. Investigation into the Physiological Significance of the Phytohormone Abscisic Acid in Perkinsus marinus, an Oyster Parasite Harboring a Nonphotosynthetic Plastid.

    Science.gov (United States)

    Sakamoto, Hirokazu; Suzuki, Shigeo; Nagamune, Kisaburo; Kita, Kiyoshi; Matsuzaki, Motomichi

    2017-07-01

    Some organisms have retained plastids even after they have lost the ability to photosynthesize. Several studies of nonphotosynthetic plastids in apicomplexan parasites have shown that the isopentenyl pyrophosphate biosynthesis pathway in the organelle is essential for their survival. A phytohormone, abscisic acid, one of several compounds biosynthesized from isopentenyl pyrophosphate, regulates the parasite cell cycle. Thus, it is possible that the phytohormone is universally crucial, even in nonphotosynthetic plastids. Here, we examined this possibility using the oyster parasite Perkinsus marinus, which is a plastid-harboring cousin of apicomplexan parasites and has independently lost photosynthetic ability. Fluridone, an inhibitor of abscisic acid biosynthesis, blocked parasite growth and induced cell clustering. Nevertheless, abscisic acid and its intermediate carotenoids did not affect parasite growth or rescue the parasite from inhibition. Moreover, abscisic acid was not detected from the parasite using liquid chromatography mass spectrometry. Our findings show that abscisic acid does not play any significant roles in P. marinus. © 2016 The Authors. Journal of Eukaryotic Microbiology published by Wiley Periodicals, Inc. on behalf of International Society of Protistologists.

  12. Shine-dalgarno sequences play an essential role in the translation of plastid mRNAs in tobacco

    DEFF Research Database (Denmark)

    Scharff, Lars; Ehrnthaler, Miriam; Janowski, Marcin

    2017-01-01

    SD]). Although many chloroplast mRNAs harbor putative SDs in their 5' untranslated regions and the aSD displays strong conservation, the functional relevance of SD-aSD interactions in plastid translation is unclear. Here, by generating transplastomic tobacco (Nicotiana tabacum) mutants with point mutations...

  13. A robust and well-resolved phylogeny of Bactridinae (Arecaceae) based on plastid and nuclear DNA sequences

    DEFF Research Database (Denmark)

    Eiserhardt, Wolf L.; Pintaud, Jean-Christophe; Asmussen-Lange, Conny

    as well as most of the currently accepted infrageneric taxa and recently proposed informal groups. Analyses are based on five plastid DNA regions (matK, trnQ-rps16, rps16 intron, trnD-trnT, trnL-trnF) and three nuclear markers (PRK, RPB2, ITS). A combined dataset was analysed with likelihood and parsimony...

  14. Molecular and biochemical analysis of the plastidic ADP-glucose transporter (ZmBT1) from Zea mays.

    NARCIS (Netherlands)

    Kirchberger, S.; Leroch, M.; Huynen, M.A.; Wahl, M.; Neuhaus, H.E.; Tjaden, J.

    2007-01-01

    Physiological studies on the Brittle1 maize mutant have provided circumstantial evidence that ZmBT1 (Zea mays Brittle1 protein) is involved in the ADP-Glc transport into maize endosperm plastids, but up to now, no direct ADP-Glc transport mediated by ZmBT1 has ever been shown. The heterologous

  15. Molecular and biochemical analysis of the plastidic ADP-glucose transporter (ZmBT1) from Zea mays

    NARCIS (Netherlands)

    Kirchberger, S.; Leroch, M.; Huynen, M.A.; Wahl, M.; Neuhaus, H.E.; Tjaden, J.

    2007-01-01

    Physiological studies on the Brittle1 maize mutant have provided circumstantial evidence that ZmBT1 (Zea mays Brittle1 protein) is involved in the ADP-Glc transport into maize endosperm plastids, but up to now, no direct ADP-Glc transport mediated by ZmBT1 has ever been shown. The heterologous

  16. Horizontal gene transfer of a plastid gene in the non-photosynthetic flowering plants Orobanche and Phelipanche (Orobanchaceae).

    Science.gov (United States)

    Park, Jeong-Mi; Manen, Jean-François; Schneeweiss, Gerald M

    2007-06-01

    Plastid sequences are among the most widely used in phylogenetic and phylogeographic studies in flowering plants, where they are usually assumed to evolve like non-recombining, uniparentally transmitted, single-copy genes. Among others, this assumption can be violated by intracellular gene transfer (IGT) within cells or by the exchange of genes across mating barriers (horizontal gene transfer, HGT). We report on HGT of a plastid region including rps2, trnL-F, and rbcL in a group of non-photosynthetic flowering plants. Species of the parasitic broomrape genus Phelipanche harbor two copies of rps2, a plastid ribosomal gene, one corresponding to the phylogenetic position of the respective species, the other being horizontally acquired from the related broomrape genus Orobanche. While the vertically transmitted copies probably reside within the plastid genome, the localization of the horizontally acquired copies is not known. With both donor and recipient being parasitic plants, a possible pathway for the exchange of genetic material is via a commonly attacked host.

  17. Re-evaluating the green versus red signal in eukaryotes with secondary plastid of red algal origin

    Czech Academy of Sciences Publication Activity Database

    Burki, F.; Flegontov, Pavel; Oborník, Miroslav; Cihlář, Jaromír; Pain, A.; Lukeš, Julius; Keeling, P. J.

    2012-01-01

    Roč. 4, č. 6 (2012), s. 738-747 ISSN 1759-6653 R&D Projects: GA ČR GAP506/12/1522; GA ČR GBP501/12/G055 Institutional support: RVO:60077344 Keywords : Endosymbiotic gene transfer * plastid evolution * protist * algae * chromera Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.759, year: 2012

  18. Dissection of cis-regulatory element architecture of the rice oleosin gene promoters to assess abscisic acid responsiveness in suspension-cultured rice cells.

    Science.gov (United States)

    Kim, Sol; Lee, Soo-Bin; Han, Chae-Seong; Lim, Mi-Na; Lee, Sung-Eun; Yoon, In Sun; Hwang, Yong-Sic

    2017-08-01

    Oleosins are the most abundant proteins in the monolipid layer surrounding neutral storage lipids that form oil bodies in plants. Several lines of evidence indicate that they are physiologically important for the maintenance of oil body structure and for mobilization of the lipids stored inside. Rice has six oleosin genes in its genome, the expression of all of which was found to be responsive to abscisic acid (ABA) in our examination of mature embryo and aleurone tissues. The 5'-flanking region of OsOle5 was initially characterized for its responsiveness to ABA through a transient expression assay system using the protoplasts from suspension-cultured rice cells. A series of successive deletions and site-directed mutations identified five regions critical for the hormonal induction of its promoter activity. A search for cis-acting elements in these regions deposited in a public database revealed that they contain various promoter elements previously reported to be involved in the ABA response of various genes. A gain-of-function experiment indicated that multiple copies of all five regions were sufficient to provide the minimal promoter with a distinct ABA responsiveness. Comparative sequence analysis of the short, but still ABA-responsive, promoters of OsOle genes revealed no common modular architecture shared by them, indicating that various distinct promoter elements and independent trans-acting factors are involved in the ABA responsiveness of rice oleosin multigenes. Copyright © 2017 Elsevier GmbH. All rights reserved.

  19. Novel 9-cis/all-trans β-carotene isomerases from plastidic oil bodies in Dunaliella bardawil catalyze the conversion of all-trans to 9-cis β-carotene.

    Science.gov (United States)

    Davidi, Lital; Pick, Uri

    2017-06-01

    We identified and demonstrated the function of 9-cis/all-trans β-carotene isomerases in plastidic globules of Dunaliella bardawil, the species accumulating the highest levels of 9-cis β-carotene that is essential for humans. The halotolerant alga Dunaliella bardawil is unique in that it accumulates under light stress high levels of β-carotene in plastidic lipid globules. The pigment is composed of two major isomers: all-trans β-carotene, the common natural form of this pigment, and 9-cis β-carotene. The biosynthetic pathway of β-carotene is known, but it is not clear how the 9-cis isomer is formed. We identified in plastidic lipid globules that were isolated from D. bardawil two proteins with high sequence homology to the D27 protein-a 9-cis/all-trans β-carotene isomerase from rice (Alder et al. Science 335:1348-1351, 2012). The proteins are enriched in the oil globules by 6- to 17-fold compared to chloroplast proteins. The expression of the corresponding genes, 9-cis-βC-iso1 and 9-cis-βC-iso2, is enhanced under light stress. The synthetic proteins catalyze in vitro conversion of all-trans to 9-cis β-carotene. Expression of the 9-cis-βC-iso1 or of 9-cis-βC-iso2 genes in an E. coli mutant line that harbors β-carotene biosynthesis genes enhanced the conversion of all-trans into 9-cis β-carotene. These results suggest that 9-cis-βC-ISO1 and 9-cis-βC-ISO2 proteins are responsible for the formation of 9-cis β-carotene in D. bardawil under stress conditions.

  20. Newly constructed stable reporter cell lines for mechanistic studies on electrophile-responsive element-mediated gene expression reveal a role for flavonoid planarity.

    NARCIS (Netherlands)

    Boerboom, A.M.A.; Vermeulen, M.; Woude, H. van der; Bremer, B.I.; Lee-Hilz, Y.Y.; Kampman, E.; Bladeren, P.J. van; Rietjens, I.M.C.M.; Aarts, J.

    2006-01-01

    The electrophile-responsive element (EpRE) is a transcriptional enhancer involved in cancer-chemoprotective gene expression modulation by certain food components. Two stably transfected luciferase reporter cell lines were developed, EpRE(hNQO1)-LUX and EpRE(mGST-Ya)-LUX, based on EpRE sequences from

  1. Newly constructed stable reporter cell lines for mechanistic studies on electrophile-responsive element-mediated gene expression reveal a role for flavonoid planarity

    NARCIS (Netherlands)

    Boerboom, A.M.J.F.; Vermeulen, M.; Woude, H. van der; Bremer, B.I.; Lee-Hilz, Y.Y.; Kampman, E.; Bladeren, P.J. van; Rietjens, I.M.C.M.; Aarts, J.M.M.J.G.

    2006-01-01

    The electrophile-responsive element (EpRE) is a transcriptional enhancer involved in cancer-chemoprotective gene expression modulation by certain food components. Two stably transfected luciferase reporter cell lines were developed, EpRE(hNQO1)-LUX and EpRE(mGST-Ya)-LUX, based on EpRE sequences from

  2. Enhanced efficacy of radiation-induced gene therapy in mice bearing lung adenocarcinoma xenografts using hypoxia responsive elements

    International Nuclear Information System (INIS)

    Wang Wei-dong; Chen Zheng-tang; Li De-zhi; Duan Yu-zhong; Cao Zheng-huai; Li Rong

    2005-01-01

    The aim of the present study was to investigate whether the hypoxia responsive element (HRE) could be used to enhance suicide gene (HSV-tk) expression and tumoricidal activity in radiation-controlled gene therapy of human lung adenocarcinoma xenografts. A chimeric promoter, HRE-Egr, was generated by directly linking a 0.3-kb fragment of HRE to a 0.6-kb human Egr-1 promoter. Retroviral vectors containing luciferase or the HSV-tk gene driven by Egr-1 or HRE-Egr were constructed. A human adenocarcinoma cell line (A549) was stably transfected with the above vectors using the lipofectamine method. The sensitivity of transfected cells to prodrug ganciclovir (GCV) and cell survival rates were analyzed after exposure to a dose of 2 Gy radiation and hypoxia (1%). In vivo, tumor xenografts in BALB/c mice were transfected with the constructed retroviruses and irradiated to a total dose of 6 Gy, followed by GCV treatment (20 mg/kg for 14 days). When the HSV-tk gene controlled by the HRE-Egr promoter was introduced into A549 cells by a retroviral vector, the exposure to 1% O 2 and 2 Gy radiation induced significant enhancement of GCV cytotoxicity to the cells. Moreover, in nude mice bearing solid tumor xenografts, only the tumors infected with the hybrid promoter-containing virus gradually disappeared after GCV administration and radiation. These results indicate that HRE can enhance transgene expression and tumoricidal activity in HSV-tk gene therapy controlled by ionizing radiation in hypoxic human lung adenocarcinoma. (author)

  3. Polybutylcyanoacrylate nanoparticles for delivering hormone response element-conjugated neurotrophin-3 to the brain of intracerebral hemorrhagic rats.

    Science.gov (United States)

    Chung, Chiu-Yen; Yang, Jen-Tsung; Kuo, Yung-Chih

    2013-12-01

    Hypertensive intracerebral hemorrhage (ICH) is a rapidly evolutional pathology, inducing necrotic cell death followed by apoptosis, and alters gene expression levels in surrounding tissue of an injured brain. For ICH therapy by controlled gene release, the development of intravenously administrable delivery vectors to promote the penetration across the blood-brain barrier (BBB) is a critical challenge. To enhance transfer efficiency of genetic materials under hypoxic conditions, polybutylcyanoacrylate (PBCA) nanoparticles (NPs) were used to mediate the intracellular transport of plasmid neurotrophin-3 (NT-3) containing hormone response element (HRE) with a cytomegalovirus (cmv) promoter and to differentiate induced pluripotent stem cells (iPSCs). The differentiation ability of iPSCs to neurons was justified by various immunological stains for protein fluorescence. The effect of PBCA NP/cmvNT-3-HRE complexes on treating ICH rats was studied by immunostaining, western blotting and Nissl staining. We found that the treatments with PBCA NP/cmvNT-3-HRE complexes increased the capability of differentiating iPSCs to express NT-3, TrkC and MAP-2. Moreover, PBCA NPs could protect cmvNT-3-HRE against degradation with EcoRI/PstI and DNase I in vitro and raise the delivery across the BBB in vivo. The administration of PBCA NP/cmvNT-3-HRE complexes increased the expression of NT-3, inhibited the expression of apoptosis-inducing factor, cleaved caspase-3 and DNA fragmentation, and reduced the cell death rate after ICH in vivo. PBCA NPs are demonstrated as an appropriate delivery system for carrying cmvNT-3-HRE to the brain for ICH therapy. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Transrepression of the estrogen receptor promoter by calcitriol in human breast cancer cells via two negative vitamin D response elements.

    Science.gov (United States)

    Swami, Srilatha; Krishnan, Aruna V; Peng, Lihong; Lundqvist, Johan; Feldman, David

    2013-08-01

    Calcitriol (1,25-dihydroxyvitamin D3), the hormonally active metabolite of vitamin D, exerts its anti-proliferative activity in breast cancer (BCa) cells by multiple mechanisms including the downregulation of the expression of estrogen receptor α (ER). We analyzed an ∼3.5 kb ER promoter sequence and demonstrated the presence of two potential negative vitamin D response elements (nVDREs), a newly identified putative nVDRE upstream at -2488 to -2473 bp (distal nVDRE) and a previously published sequence (proximal nVDRE) at -94 to -70 bp proximal to the P1 start site. Transactivation analysis using ER promoter deletion constructs and heterologous promoter-reporter constructs revealed that both nVDREs functioned to mediate calcitriol transrepression. In the electrophoretic mobility shift assay, the vitamin D receptor (VDR) showed strong binding to both nVDREs in the presence of calcitriol, and the chromatin immunoprecipitation assay demonstrated the recruitment of the VDR to the distal nVDRE site. Mutations in the 5' hexameric DNA sequence of the distal nVDRE resulted in the loss of calcitriol-mediated transrepression and the inhibition of protein-DNA complex formation, demonstrating the importance of these nucleotides in VDR DNA binding and transrepression. A putative nuclear factor-Y (NFY) binding site, identified within the distal nVDRE, led to the findings that NFY bound to the distal nVDRE site interfered with the binding of the VDR at the site and reduced calcitriol-mediated transrepression. In conclusion, the ER promoter region contains two negative VDREs that act in concert to bind to the VDR and both nVDREs are required for the maximal inhibition of ER expression by calcitriol. The suppression of ER expression and estrogen-mediated signaling by calcitriol in BCa cells suggests that vitamin D may be useful in the treatment of ER+ BCa.

  5. Perturbations of carotenoid and tetrapyrrole biosynthetic pathways result in differential alterations in chloroplast function and plastid signaling

    International Nuclear Information System (INIS)

    Park, Joon-Heum; Jung, Sunyo

    2017-01-01

    In this study, we used the biosynthetic inhibitors of carotenoid and tetrapyrrole biosynthetic pathways, norflurazon (NF) and oxyfluorfen (OF), as tools to gain insight into mechanisms of photooxidation in rice plants. NF resulted in bleaching symptom on leaves of the treated plants, whereas OF treatment developed a fast symptom of an apparent necrotic phenotype. Both plants exhibited decreases in photosynthetic efficiency, as indicated by F v /F m . NF caused severe disruption in thylakoid membranes, whereas OF-treated plants exhibited disruption of chloroplast envelope and plasma membrane. Levels of Lhca and Lhcb proteins in photosystem I (PSI) and PSII were reduced by photooxidative stress in NF- and OF-treated plants, with a greater decrease in NF plants. The down-regulation of nuclear-encoded photosynthesis genes Lhcb and rbcS was also found in both NF- and OF-treated plants, whereas plastid-encoded photosynthetic genes including RbcL, PsaC, and PsbD accumulated normally in NF plants but decreased drastically in OF plants. This proposes that the plastids in NF plants retain their potential to develop thylakoid membranes and that photobleaching is mainly controlled by nuclear genes. Distinct photooxidation patterns between NF- and OF-treated plants developed differential signaling, which might enable the plant to coordinate the expression of photosynthetic genes from the nuclear and plastidic genomes. - Highlights: • Two modes of photooxidation by carotenoid and tetrapyrrole biosynthetic inhibitors. • We examine differential alterations in chloroplast function and plastid signaling. • NF and OF cause differential alterations in chloroplast ultrastructure and function. • Photooxidation coordinates photosynthetic gene expression from nucleus and plastid.

  6. Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

    Directory of Open Access Journals (Sweden)

    Seabra Ana R

    2010-08-01

    Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

  7. Plastid and mitochondrion genomic sequences from Arctic Chlorella sp. ArM0029B

    Science.gov (United States)

    2014-01-01

    Background Chorella is the representative taxon of Chlorellales in Trebouxiophyceae, and its chloroplast (cp) genomic information has been thought to depend only on studies concerning Chlorella vulgaris and GenBank information of C. variablis. Mitochondrial (mt) genomic information regarding Chlorella is currently unavailable. To elucidate the evolution of organelle genomes and genetic information of Chlorella, we have sequenced and characterized the cp and mt genomes of Arctic Chlorella sp. ArM0029B. Results The 119,989-bp cp genome lacking inverted repeats and 65,049-bp mt genome were sequenced. The ArM0029B cp genome contains 114 conserved genes, including 32 tRNA genes, 3 rRNA genes, and 79 genes encoding proteins. Chlorella cp genomes are highly rearranged except for a Chlorella-specific six-gene cluster, and the ArM0029B plastid resembles that of Chlorella variabilis except for a 15-kb gene cluster inversion. In the mt genome, 62 conserved genes, including 27 tRNA genes, 3 rRNA genes, and 32 genes encoding proteins were determined. The mt genome of ArM0029B is similar to that of the non-photosynthetic species Prototheca and Heicosporidium. The ArM0029B mt genome contains a group I intron, with an ORF containing two LAGLIDADG motifs, in cox1. The intronic ORF is shared by C. vulgaris and Prototheca. The phylogeny of the plastid genome reveals that ArM0029B showed a close relationship of Chlorella to Parachlorella and Oocystis within Chlorellales. The distribution of the cox1 intron at 721 support membership in the order Chlorellales. Mitochondrial phylogenomic analyses, however, indicated that ArM0029B shows a greater affinity to MX-AZ01 and Coccomyxa than to the Helicosporidium-Prototheca clade, although the detailed phylogenetic relationships among the three taxa remain to be resolved. Conclusions The plastid genome of ArM0029B is similar to that of C. variabilis. The mt sequence of ArM0029B is the first genome to be reported for Chlorella. Chloroplast

  8. Plastid structure and carotenogenic gene expression in red- and white-fleshed loquat (Eriobotrya japonica) fruits

    Science.gov (United States)

    Fu, Xiumin; Kong, Wenbin; Peng, Gang; Zhou, Jingyi; Azam, Muhammad; Xu, Changjie; Grierson, Don; Chen, Kunsong

    2012-01-01

    Loquat (Eriobotrya japonica Lindl.) can be sorted into red- and white-fleshed cultivars. The flesh of Luoyangqing (LYQ, red-fleshed) appears red-orange because of a high content of carotenoids while the flesh of Baisha (BS, white-fleshed) appears ivory white due to a lack of carotenoid accumulation. The carotenoid content in the peel and flesh of LYQ was approximately 68 μg g−1 and 13 μg g−1 fresh weight (FW), respectively, and for BS 19 μg g−1 and 0.27 μg g−1 FW. The mRNA levels of 15 carotenogenesis-related genes were analysed during fruit development and ripening. After the breaker stage (S4), the mRNA levels of phytoene synthase 1 (PSY1) and chromoplast-specific lycopene β-cyclase (CYCB) were higher in the peel, and CYCB and β-carotene hydroxylase (BCH) mRNAs were higher in the flesh of LYQ, compared with BS. Plastid morphogenesis during fruit ripening was also studied. The ultrastructure of plastids in the peel of BS changed less than in LYQ during fruit development. Two different chromoplast shapes were observed in the cells of LYQ peel and flesh at the fully ripe stage. Carotenoids were incorporated in the globules in chromoplasts of LYQ and BS peel but were in a crystalline form in the chromoplasts of LYQ flesh. However, no chromoplast structure was found in the cells of fully ripe BS fruit flesh. The mRNA level of plastid lipid-associated protein (PAP) in the peel and flesh of LYQ was over five times higher than in BS peel and flesh. In conclusion, the lower carotenoid content in BS fruit was associated with the lower mRNA levels of PSY1, CYCB, and BCH; however, the failure to develop normal chromoplasts in BS flesh is the most convincing explanation for the lack of carotenoid accumulation. The expression of PAP was well correlated with chromoplast numbers and carotenoid accumulation, suggesting its possible role in chromoplast biogenesis or interconversion of loquat fruit. PMID:21994170

  9. A 20 bp cis-acting element is both necessary and sufficient to mediate elicitor response of a maize PRms gene.

    Science.gov (United States)

    Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B

    1995-01-01

    Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.

  10. Tree ferns: monophyletic groups and their relationships as revealed by four protein-coding plastid loci.

    Science.gov (United States)

    Korall, Petra; Pryer, Kathleen M; Metzgar, Jordan S; Schneider, Harald; Conant, David S

    2006-06-01

    Tree ferns are a well-established clade within leptosporangiate ferns. Most of the 600 species (in seven families and 13 genera) are arborescent, but considerable morphological variability exists, spanning the giant scaly tree ferns (Cyatheaceae), the low, erect plants (Plagiogyriaceae), and the diminutive endemics of the Guayana Highlands (Hymenophyllopsidaceae). In this study, we investigate phylogenetic relationships within tree ferns based on analyses of four protein-coding, plastid loci (atpA, atpB, rbcL, and rps4). Our results reveal four well-supported clades, with genera of Dicksoniaceae (sensu ) interspersed among them: (A) (Loxomataceae, (Culcita, Plagiogyriaceae)), (B) (Calochlaena, (Dicksonia, Lophosoriaceae)), (C) Cibotium, and (D) Cyatheaceae, with Hymenophyllopsidaceae nested within. How these four groups are related to one other, to Thyrsopteris, or to Metaxyaceae is weakly supported. Our results show that Dicksoniaceae and Cyatheaceae, as currently recognised, are not monophyletic and new circumscriptions for these families are needed.

  11. Authentication of Botanical Origin in Herbal Teas by Plastid Noncoding DNA Length Polymorphisms.

    Science.gov (United States)

    Uncu, Ali Tevfik; Uncu, Ayse Ozgur; Frary, Anne; Doganlar, Sami

    2015-07-01

    The aim of this study was to develop a DNA barcode assay to authenticate the botanical origin of herbal teas. To reach this aim, we tested the efficiency of a PCR-capillary electrophoresis (PCR-CE) approach on commercial herbal tea samples using two noncoding plastid barcodes, the trnL intron and the intergenic spacer between trnL and trnF. Barcode DNA length polymorphisms proved successful in authenticating the species origin of herbal teas. We verified the validity of our approach by sequencing species-specific barcode amplicons from herbal tea samples. Moreover, we displayed the utility of PCR-CE assays coupled with sequencing to identify the origin of undeclared plant material in herbal tea samples. The PCR-CE assays proposed in this work can be applied as routine tests for the verification of botanical origin in herbal teas and can be extended to authenticate all types of herbal foodstuffs.

  12. Plastids features and transfer cells occurrence in the phloem of Portulaca mucronata and P. hirsutissima (Portulacaceae

    Directory of Open Access Journals (Sweden)

    Maria E. Maranhão Estelita

    2014-01-01

    Full Text Available The species of the Portulacaceae of the Serra do Cipó, State of Minas Gerais, Brasil, were studied. In Portulaca mucronata and P. hirsutissima transfer cells are companion and phloem parenchyma cells; they have the same secondary cell wall features, that is, short papillate protuberances which are uniformly distributed around the primary cell wall. These features are similar in both species but they are very distinct from others referred in the literature; this could be useful in Taxonomy. The phloem plastids have a globular protein crystalloid, surrounded by proteinaceous filaments. In P. hirsutissima few starch grains may also be present, and this occurrence is considered primitive in the phylogenetic scale. These features agree with presumptive evolution of those of leaf structure: P. hirsutissima has C3 photosynthesis structure, and P. mucronata C4 or Kranz anatomy.

  13. Expression of chloroperoxidase from Pseudomonas pyrrocinia in tobacco plastids for fungal resistance.

    Science.gov (United States)

    Ruhlman, Tracey A; Rajasekaran, Kanniah; Cary, Jeffrey W

    2014-11-01

    The chloroperoxidase (cpo) gene from Pseudomonas pyrrocinia was transformed into the plastid genome (plastome) of Nicotiana tabacum var. Petit Havana and transplastomic lines were compared with a nuclear transformant for the same gene. Southern analysis confirmed integration in the plastome and western blotting confirmed the presence of the chloroperoxidase protein (CPO) in higher abundance in transplastomic plants than in cpo nuclear transformants. Northern analysis of primary plastome transformants for cpo showed 15-fold higher transcript abundance than in the nuclear transformant, yet this extent of enhancement was not observed in western blot, enzyme or bioassay, indicating a bottleneck at the post-transcriptional level. Representative plants from the two transplastomic lines showed resistance to fungal pathogens in vitro (Aspergillus flavus, Fusarium verticillioides, and Verticillium dahliae) and in planta (Alternaria alternata). Published by Elsevier Ireland Ltd.

  14. Minimally destructive sampling of type specimens of Pyropia (Bangiales, Rhodophyta) recovers complete plastid and mitochondrial genomes.

    Science.gov (United States)

    Hughey, Jeffery R; Gabrielson, Paul W; Rohmer, Laurence; Tortolani, Jacquie; Silva, Mayra; Miller, Kathy Ann; Young, Joel D; Martell, Craig; Ruediger, Erik

    2014-06-04

    Plant species, including algae and fungi, are based on type specimens to which the name of a taxon is permanently attached. Applying a scientific name to any specimen therefore requires demonstrating correspondence between the type and that specimen. Traditionally, identifications are based on morpho-anatomical characters, but recently systematists are using DNA sequence data. These studies are flawed if the DNA is isolated from misidentified modern specimens. We propose a genome-based solution. Using 4 × 4 mm(2) of material from type specimens, we assembled 14 plastid and 15 mitochondrial genomes attributed to the red algae Pyropia perforata, Py. fucicola, and Py. kanakaensis. The chloroplast genomes were fairly conserved, but the mitochondrial genomes differed significantly among populations in content and length. Complete genomes are attainable from 19(th) and early 20(th) century type specimens; this validates the effort and cost of their curation as well as supports the practice of the type method.

  15. Minimally destructive sampling of type specimens of Pyropia (Bangiales, Rhodophyta) recovers complete plastid and mitochondrial genomes

    Science.gov (United States)

    Hughey, Jeffery R.; Gabrielson, Paul W.; Rohmer, Laurence; Tortolani, Jacquie; Silva, Mayra; Miller, Kathy Ann; Young, Joel D.; Martell, Craig; Ruediger, Erik

    2014-01-01

    Plant species, including algae and fungi, are based on type specimens to which the name of a taxon is permanently attached. Applying a scientific name to any specimen therefore requires demonstrating correspondence between the type and that specimen. Traditionally, identifications are based on morpho-anatomical characters, but recently systematists are using DNA sequence data. These studies are flawed if the DNA is isolated from misidentified modern specimens. We propose a genome-based solution. Using 4 × 4 mm2 of material from type specimens, we assembled 14 plastid and 15 mitochondrial genomes attributed to the red algae Pyropia perforata, Py. fucicola, and Py. kanakaensis. The chloroplast genomes were fairly conserved, but the mitochondrial genomes differed significantly among populations in content and length. Complete genomes are attainable from 19th and early 20th century type specimens; this validates the effort and cost of their curation as well as supports the practice of the type method. PMID:24894641

  16. Molecular phylogeny of Gavilea (Chloraeinae: Orchidaceae) using plastid and nuclear markers.

    Science.gov (United States)

    Chemisquy, M Amelia; Morrone, Osvaldo

    2012-03-01

    A phylogenetic analysis is provided for 70% of the representatives of genus Gavilea, as well as for several species of the remaining genera of subtribe Chloraeinae: Bipinnula, Chloraea and Geoblasta. Sequences from the plastid markers rpoC1, matK-trnK and atpB-rbcL and the nuclear marker ITS, were analyzed using Maximum Parsimony and Bayesian Inference. Monophyly of subtribe Chloraeinae was confirmed, as well as its position inside tribe Cranichideae. Neither Chloraea nor Bipinnula were recovered as monophyletic. Gavilea turned out polyphyletic, with Chloraeachica embedded in the genus while Gavilea supralabellata was related to Chloraea and might be a hybrid between both genera. None of the two sections of Gavilea were monophyletic, and the topologies obtained do not suggest a new division of the genus. Copyright © 2011 Elsevier Inc. All rights reserved.

  17. Identification of an ICP27-responsive element in the coding region of a herpes simplex virus type 1 late gene.

    Science.gov (United States)

    Sedlackova, Lenka; Perkins, Keith D; Meyer, Julia; Strain, Anna K; Goldman, Oksana; Rice, Stephen A

    2010-03-01

    During productive herpes simplex virus type 1 (HSV-1) infection, a subset of viral delayed-early (DE) and late (L) genes require the immediate-early (IE) protein ICP27 for their expression. However, the cis-acting regulatory sequences in DE and L genes that mediate their specific induction by ICP27 are unknown. One viral L gene that is highly dependent on ICP27 is that encoding glycoprotein C (gC). We previously demonstrated that this gene is posttranscriptionally transactivated by ICP27 in a plasmid cotransfection assay. Based on our past results, we hypothesized that the gC gene possesses a cis-acting inhibitory sequence and that ICP27 overcomes the effects of this sequence to enable efficient gC expression. To test this model, we systematically deleted sequences from the body of the gC gene and tested the resulting constructs for expression. In so doing, we identified a 258-bp "silencing element" (SE) in the 5' portion of the gC coding region. When present, the SE inhibits gC mRNA accumulation from a transiently transfected gC gene, unless ICP27 is present. Moreover, the SE can be transferred to another HSV-1 gene, where it inhibits mRNA accumulation in the absence of ICP27 and confers high-level expression in the presence of ICP27. Thus, for the first time, an ICP27-responsive sequence has been identified in a physiologically relevant ICP27 target gene. To see if the SE functions during viral infection, we engineered HSV-1 recombinants that lack the SE, either in a wild-type (WT) or ICP27-null genetic background. In an ICP27-null background, deletion of the SE led to ICP27-independent expression of the gC gene, demonstrating that the SE functions during viral infection. Surprisingly, the ICP27-independent gC expression seen with the mutant occurred even in the absence of viral DNA synthesis, indicating that the SE helps to regulate the tight DNA replication-dependent expression of gC.

  18. Phylogeny and intraspecific variability of holoparasitic Orobanche (Orobanchaceae) inferred from plastid rbcL sequences.

    Science.gov (United States)

    Manen, Jean-François; Habashi, Christine; Jeanmonod, Daniel; Park, Jeong-Mi; Schneeweiss, Gerald M

    2004-11-01

    The rbcL sequences of 106 specimens representing 28 species of the four recognized sections of Orobanche were analyzed and compared. Most sequences represent pseudogenes with premature stop codons. This study confirms that the American lineage (sects. Gymnocaulis and Myzorrhiza) contains potentially functional rbcL-copies with intact open reading frames and low rates of non-synonymous substitutions. For the first time, this is also shown for a member of the Eurasian lineage, O. coerulescens of sect. Orobanche, while all other investigated species of sects. Orobanche and Trionychon contain pseudogenes with distorted reading frames and significantly higher rates of non-synonymous substitutions. Phylogenetic analyses of the rbcL sequences give equivocal results concerning the monophyly of Orobanche, and the American lineage might be more closely related to Boschniakia and Cistanche than to the other sections of Orobanche. Additionally, species of sect. Trionychon phylogenetically nest in sect. Orobanche. This is in concordance with results from other plastid markers (rps2 and matK), but in disagreement with other molecular (nuclear ITS), morphological, and karyological data. This might indicate that the ancestor of sect. Trionychon has captured the plastid genome, or parts of it, of a member of sect. Orobanche. Apart from the phylogenetically problematic position of sect. Trionychon, the phylogenetic relationships within sect. Orobanche are similar to those inferred from nuclear ITS data and are close to the traditional groupings traditionally recognized based on morphology. The intraspecific variation of rbcL is low and is neither correlated with intraspecific morphological variability nor with host range. Ancestral character reconstruction using parsimony suggests that the ancestor of O. sect. Orobanche had a narrow host range.

  19. Production of high levels of poly-3-hydroxybutyrate in plastids of Camelina sativa seeds.

    Science.gov (United States)

    Malik, Meghna R; Yang, Wenyu; Patterson, Nii; Tang, Jihong; Wellinghoff, Rachel L; Preuss, Mary L; Burkitt, Claire; Sharma, Nirmala; Ji, Yuanyuan; Jez, Joseph M; Peoples, Oliver P; Jaworski, Jan G; Cahoon, Edgar B; Snell, Kristi D

    2015-06-01

    Poly-3-hydroxybutyrate (PHB) production in plastids of Camelina sativa seeds was investigated by comparing levels of polymer produced upon transformation of plants with five different binary vectors containing combinations of five seed-specific promoters for expression of transgenes. Genes encoding PHB biosynthetic enzymes were modified at the N-terminus to encode a plastid targeting signal. PHB levels of up to 15% of the mature seed weight were measured in single sacrificed T1 seeds with a genetic construct containing the oleosin and glycinin promoters. A more detailed analysis of the PHB production potential of two of the best performing binary vectors in a Camelina line bred for larger seed size yielded lines containing up to 15% polymer in mature T2 seeds. Transmission electron microscopy showed the presence of distinct granules of PHB in the seeds. PHB production had varying effects on germination, emergence and survival of seedlings. Once true leaves formed, plants grew normally and were able to set seeds. PHB synthesis lowered the total oil but not the protein content of engineered seeds. A change in the oil fatty acid profile was also observed. High molecular weight polymer was produced with weight-averaged molecular weights varying between 600 000 and 1 500 000, depending on the line. Select lines were advanced to later generations yielding a line with 13.7% PHB in T4 seeds. The levels of polymer produced in this study are the highest reported to date in a seed and are an important step forward for commercializing an oilseed-based platform for PHB production. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  20. Pervasive, Genome-Wide Transcription in the Organelle Genomes of Diverse Plastid-Bearing Protists

    Directory of Open Access Journals (Sweden)

    Matheus Sanitá Lima

    2017-11-01

    Full Text Available Organelle genomes are among the most sequenced kinds of chromosome. This is largely because they are small and widely used in molecular studies, but also because next-generation sequencing technologies made sequencing easier, faster, and cheaper. However, studies of organelle RNA have not kept pace with those of DNA, despite huge amounts of freely available eukaryotic RNA-sequencing (RNA-seq data. Little is known about organelle transcription in nonmodel species, and most of the available eukaryotic RNA-seq data have not been mined for organelle transcripts. Here, we use publicly available RNA-seq experiments to investigate organelle transcription in 30 diverse plastid-bearing protists with varying organelle genomic architectures. Mapping RNA-seq data to organelle genomes revealed pervasive, genome-wide transcription, regardless of the taxonomic grouping, gene organization, or noncoding content. For every species analyzed, transcripts covered ≥85% of the mitochondrial and/or plastid genomes (all of which were ≤105 kb, indicating that most of the organelle DNA—coding and noncoding—is transcriptionally active. These results follow earlier studies of model species showing that organellar transcription is coupled and ubiquitous across the genome, requiring significant downstream processing of polycistronic transcripts. Our findings suggest that noncoding organelle DNA can be transcriptionally active, raising questions about the underlying function of these transcripts and underscoring the utility of publicly available RNA-seq data for recovering complete genome sequences. If pervasive transcription is also found in bigger organelle genomes (>105 kb and across a broader range of eukaryotes, this could indicate that noncoding organelle RNAs are regulating fundamental processes within eukaryotic cells.

  1. Pervasive, Genome-Wide Transcription in the Organelle Genomes of Diverse Plastid-Bearing Protists.

    Science.gov (United States)

    Sanitá Lima, Matheus; Smith, David Roy

    2017-11-06

    Organelle genomes are among the most sequenced kinds of chromosome. This is largely because they are small and widely used in molecular studies, but also because next-generation sequencing technologies made sequencing easier, faster, and cheaper. However, studies of organelle RNA have not kept pace with those of DNA, despite huge amounts of freely available eukaryotic RNA-sequencing (RNA-seq) data. Little is known about organelle transcription in nonmodel species, and most of the available eukaryotic RNA-seq data have not been mined for organelle transcripts. Here, we use publicly available RNA-seq experiments to investigate organelle transcription in 30 diverse plastid-bearing protists with varying organelle genomic architectures. Mapping RNA-seq data to organelle genomes revealed pervasive, genome-wide transcription, regardless of the taxonomic grouping, gene organization, or noncoding content. For every species analyzed, transcripts covered ≥85% of the mitochondrial and/or plastid genomes (all of which were ≤105 kb), indicating that most of the organelle DNA-coding and noncoding-is transcriptionally active. These results follow earlier studies of model species showing that organellar transcription is coupled and ubiquitous across the genome, requiring significant downstream processing of polycistronic transcripts. Our findings suggest that noncoding organelle DNA can be transcriptionally active, raising questions about the underlying function of these transcripts and underscoring the utility of publicly available RNA-seq data for recovering complete genome sequences. If pervasive transcription is also found in bigger organelle genomes (>105 kb) and across a broader range of eukaryotes, this could indicate that noncoding organelle RNAs are regulating fundamental processes within eukaryotic cells. Copyright © 2017 Sanitá Lima and Smith.

  2. Comparative analyses of plastid genomes from fourteen Cornales species: inferences for phylogenetic relationships and genome evolution.

    Science.gov (United States)

    Fu, Chao-Nan; Li, Hong-Tao; Milne, Richard; Zhang, Ting; Ma, Peng-Fei; Yang, Jing; Li, De-Zhu; Gao, Lian-Ming

    2017-12-08

    The Cornales is the basal lineage of the asterids, the largest angiosperm clade. Phylogenetic relationships within the order were previously not fully resolved. Fifteen plastid genomes representing 14 species, ten genera and seven families of Cornales were newly sequenced for comparative analyses of genome features, evolution, and phylogenomics based on different partitioning schemes and filtering strategies. All plastomes of the 14 Cornales species had the typical quadripartite structure with a genome size ranging from 156,567 bp to 158,715 bp, which included two inverted repeats (25,859-26,451 bp) separated by a large single-copy region (86,089-87,835 bp) and a small single-copy region (18,250-18,856 bp) region. These plastomes encoded the same set of 114 unique genes including 31 transfer RNA, 4 ribosomal RNA and 79 coding genes, with an identical gene order across all examined Cornales species. Two genes (rpl22 and ycf15) contained premature stop codons in seven and five species respectively. The phylogenetic relationships among all sampled species were fully resolved with maximum support. Different filtering strategies (none, light and strict) of sequence alignment did not have an effect on these relationships. The topology recovered from coding and noncoding data sets was the same as for the whole plastome, regardless of filtering strategy. Moreover, mutational hotspots and highly informative regions were identified. Phylogenetic relationships among families and intergeneric relationships within family of Cornales were well resolved. Different filtering strategies and partitioning schemes do not influence the relationships. Plastid genomes have great potential to resolve deep phylogenetic relationships of plants.

  3. An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

    Science.gov (United States)

    Itzhaki, H; Maxson, J M; Woodson, W R

    1994-09-13

    The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.

  4. Nuclear toxicology file: cell response to the steady or radioactive chemical elements exposure; Dossier toxicologie nucleaire: reponse cellulaire a l'exposition aux elements chimiques stables ou radioactifs

    Energy Technology Data Exchange (ETDEWEB)

    Lopez, B.S.; Saintigny, Y. [Centre National de la Recherche Scientifique (CNRS), Sciences du Vivant, UMR 217, 92 - Fontenay aux Roses (France); CEA Fontenay aux Roses, IRCM, UMR 217, 92 (France); Adam, Ch. [Institut de Radioprotection et de Surete Nucleaire (IRSN:DEI/SECRE), Lab. de Radioecologie et d' Ecotoxicologie, 13 - Saint-Paul-lez-Durance (France)

    2008-09-15

    The cellular response to an exposure in a toxic element is made at different levels. The first level is the agent detoxication by its elimination or its neutralization. The second level is the repair of the damages caused by this agent (for example the DNA repair). The third level is the control of the cellular death programmed to eliminate the irreparably damaged cells.Finally, the hurt cell can inform the nearby cells by producing molecular effectors inducing an abscopal or bystander effect. (N.C.)

  5. The Complete Plastid Genome Sequence of Madagascar Periwinkle Catharanthus roseus (L.) G. Don: Plastid Genome Evolution, Molecular Marker Identification, and Phylogenetic Implications in Asterids

    Science.gov (United States)

    Ku, Chuan; Chung, Wan-Chia; Chen, Ling-Ling; Kuo, Chih-Horng

    2013-01-01

    The Madagascar periwinkle ( Catharanthus roseus in the family Apocynaceae) is an important medicinal plant and is the source of several widely marketed chemotherapeutic drugs. It is also commonly grown for its ornamental values and, due to ease of infection and distinctiveness of symptoms, is often used as the host for studies on phytoplasmas, an important group of uncultivated plant pathogens. To gain insights into the characteristics of apocynaceous plastid genomes (plastomes), we used a reference-assisted approach to assemble the complete plastome of C . roseus , which could be applied to other C . roseus -related studies. The C . roseus plastome is the second completely sequenced plastome in the asterid order Gentianales. We performed comparative analyses with two other representative sequences in the same order, including the complete plastome of Coffea arabica (from the basal Gentianales family Rubiaceae) and the nearly complete plastome of Asclepias syriaca (Apocynaceae). The results demonstrated considerable variations in gene content and plastome organization within Apocynaceae, including the presence/absence of three essential genes (i.e., accD, clpP, and ycf1) and large size changes in non-coding regions (e.g., rps2-rpoC2 and IRb-ndhF). To find plastome markers of potential utility for Catharanthus breeding and phylogenetic analyses, we identified 41 C . roseus -specific simple sequence repeats. Furthermore, five intergenic regions with high divergence between C . roseus and three other euasterids I taxa were identified as candidate markers. To resolve the euasterids I interordinal relationships, 82 plastome genes were used for phylogenetic inference. With the addition of representatives from Apocynaceae and sampling of most other asterid orders, a sister relationship between Gentianales and Solanales is supported. PMID:23825699

  6. A distal ABA responsive element in AtNCED3 promoter is required for positive feedback regulation of ABA biosynthesis in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Yan-Zhuo Yang

    Full Text Available The plant hormone abscisic acid (ABA plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3.

  7. A distal ABA responsive element in AtNCED3 promoter is required for positive feedback regulation of ABA biosynthesis in Arabidopsis.

    Science.gov (United States)

    Yang, Yan-Zhuo; Tan, Bao-Cai

    2014-01-01

    The plant hormone abscisic acid (ABA) plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp) is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3.

  8. Chloroplast to chromoplast transition in tomato fruit: spectral confocal microscopy analyses of carotenoids and chlorophylls in isolated plastids and time-lapse recording on intact live tissue.

    Science.gov (United States)

    Egea, Isabel; Bian, Wanping; Barsan, Cristina; Jauneau, Alain; Pech, Jean-Claude; Latché, Alain; Li, Zhengguo; Chervin, Christian

    2011-08-01

    There are several studies suggesting that tomato (Solanum lycopersicum) chromoplasts arise from chloroplasts, but there is still no report showing the fluorescence of both chlorophylls and carotenoids in an intermediate plastid, and no video showing this transition phase. Pigment fluorescence within individual plastids, isolated from tomato fruit using sucrose gradients, was observed at different ripening stages, and an in situ real-time recording of pigment fluorescence was performed on live tomato fruit slices. At the mature green and red stages, homogenous fractions of chloroplasts and chromoplasts were obtained, respectively. At the breaker stage, spectral confocal microscopy showed that intermediate plastids contained both chlorophylls and carotenoids. Furthermore, an in situ real-time recording (a) showed that the chloroplast to chromoplast transition was synchronous for all plastids of a single cell; and (b) confirmed that all chromoplasts derived from pre-existing chloroplasts. These results give details of the early steps of tomato chromoplast biogenesis from chloroplasts, with the formation of intermediate plastids containing both carotenoids and chlorophylls. They provide information at the sub-cellular level on the synchronism of plastid transition and pigment changes.

  9. The role of the glucose-sensing transcription factor carbohydrate-responsive element-binding protein pathway in termite queen fertility

    Czech Academy of Sciences Publication Activity Database

    Sillam-Dusses, D.; Hanus, Robert; Poulsen, M.; Roy, V.; Favier, M.; Vasseur-Cognet, M.

    2016-01-01

    Roč. 6, č. 5 (2016), č. článku 160080. ISSN 2046-2441 R&D Projects: GA ČR(CZ) GA14-12774S Institutional support: RVO:61388963 Keywords : reproduction * phenotypic plasticity * carbohydrate-responsive element-binding protein * transcription factor * social insects * lipogenesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.481, year: 2016 http://rsob.royalsocietypublishing.org/content/6/5/160080

  10. An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

    OpenAIRE

    Itzhaki, H; Maxson, J M; Woodson, W R

    1994-01-01

    The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define ...

  11. Bladder inflammatory transcriptome in response to tachykinins: Neurokinin 1 receptor-dependent genes and transcription regulatory elements

    Directory of Open Access Journals (Sweden)

    Dozmorov Igor

    2007-05-01

    Full Text Available Abstract Background Tachykinins (TK, such as substance P, and their neurokinin receptors which are ubiquitously expressed in the human urinary tract, represent an endogenous system regulating bladder inflammatory, immune responses, and visceral hypersensitivity. Increasing evidence correlates alterations in the TK system with urinary tract diseases such as neurogenic bladders, outflow obstruction, idiopathic detrusor instability, and interstitial cystitis. However, despite promising effects in animal models, there seems to be no published clinical study showing that NK-receptor antagonists are an effective treatment of pain in general or urinary tract disorders, such as detrusor overactivity. In order to search for therapeutic targets that could block the tachykinin system, we set forth to determine the regulatory network downstream of NK1 receptor activation. First, NK1R-dependent transcripts were determined and used to query known databases for their respective transcription regulatory elements (TREs. Methods An expression analysis was performed using urinary bladders isolated from sensitized wild type (WT and NK1R-/- mice that were stimulated with saline, LPS, or antigen to provoke inflammation. Based on cDNA array results, NK1R-dependent genes were selected. PAINT software was used to query TRANSFAC database and to retrieve upstream TREs that were confirmed by electrophoretic mobility shift assays. Results The regulatory network of TREs driving NK1R-dependent genes presented cRel in a central position driving 22% of all genes, followed by AP-1, NF-kappaB, v-Myb, CRE-BP1/c-Jun, USF, Pax-6, Efr-1, Egr-3, and AREB6. A comparison between NK1R-dependent and NK1R-independent genes revealed Nkx-2.5 as a unique discriminator. In the presence of NK1R, Nkx2-5 _01 was significantly correlated with 36 transcripts which included several candidates for mediating bladder development (FGF and inflammation (PAR-3, IL-1R, IL-6, α-NGF, TSP2. In the absence of

  12. Signatures of rare-earth elements in banded corals of Kalpeni atoll-Lakshadweep archipelago in response to monsoonal variations

    Digital Repository Service at National Institute of Oceanography (India)

    Naqvi, S.A.S.; Nath, B.N.; Balaram, V.

    Concentrations of rare-earth elements (REE) have been determined in seasonal bands of Porites species collected from the Lakshadweep lagoon. Total REE (REE) are very low (less than 3 ppm) in these corals. Seasonal variations in REE appear to have...

  13. Transcriptional activation of rat creatine kinase B by 17beta-estradiol in MCF-7 cells involves an estrogen responsive element and GC-rich sites.

    Science.gov (United States)

    Wang, F; Samudio, I; Safe, S

    2001-01-01

    The rat creatine kinase B (CKB) gene is induced by estrogen in the uterus, and constructs containing rat CKB gene promoter inserts are highly estrogen-responsive in cell culture. Analysis of the upstream -568 to -523 region of the promoter in HeLa cells has identified an imperfect palindromic estrogen response element (ERE) that is required for hormone inducibility. Analysis of the CKB gene promoter in MCF-7 breast cancer cells confirmed that pCKB7 (containing the -568 to -523 promoter insert) was estrogen-responsive in transient transfection studies. However, mutation and deletion analysis of this region of the promoter showed that two GC-rich sites and the concensus ERE were functional cis-elements that bound estrogen receptor alpha (ERalpha)/Sp1 and ERalpha proteins, respectively. The role of these elements was confirmed in gel mobility shift and chromatin immunoprecipitation assays and transfection studies in MDA-MB-231 and Schneider Drosophila SL-2 cells. These results show that transcriptional activation of CKB by estrogen is dependent, in part, on ERalpha/Sp1 action which is cell context-dependent. Copyright 2001 Wiley-Liss, Inc.

  14. An IFNG SNP with an estrogen-like response element selectively enhances promoter expression in peripheral but not lamina propria T cells.

    Science.gov (United States)

    Gonsky, R; Deem, R L; Bream, J H; Young, H A; Targan, S R

    2006-07-01

    This study examines mucosa-specific regulatory pathways involved in modulation of interferon-gamma (IFN-gamma) in lamina propria T cells. Previous studies identified mucosa-specific CD2 cis-elements within the -204 to -108 bp IFNG promoter. Within this region, a single-site nucleotide polymorphism, -179G/T, imparts tumor necrosis factor-alpha stimulation of IFNG in peripheral blood lymphocytes, and is linked with accelerated AIDS progression. We discovered a putative estrogen response element (ERE) introduced by the -179T, which displays selective activation in peripheral blood mononuclear cells (PBMC) vs lamina propria mononuclear cells (LPMC). Transfection of PBMC with constructs containing the -179G or -179T site revealed CD2-mediated enhancement of the -179T compared to -179G allele, although, in LPMC, a similar level of expression was detected. Electrophoretic mobility shift assay (EMSA) analysis demonstrated CD2-mediated nucleoprotein binding to the -179T but not the -179G in PBMC. In LPMC, binding is constitutive to both -179G and -179T regions. Sequence and EMSA analysis suggests that the -179T allele creates an ERE-like binding site capable of binding recombinant estrogen receptor. Estrogen response element transactivation is enhanced by CD2 signaling, but inhibited by estrogen in PBMC but not in LPMC, although expression of estrogen receptor was similar. This is the first report to describe a potential molecular mechanism responsible for selectively controlling IFN-gamma production in LPMC.

  15. Paternal inheritance of plastid-encoded transgenes in Petunia hybrida in the greenhouse and under field conditions.

    Science.gov (United States)

    Horn, Patricia; Nausch, Henrik; Baars, Susanne; Schmidtke, Jörg; Schmidt, Kerstin; Schneider, Anja; Leister, Dario; Broer, Inge

    2017-12-01

    As already demonstrated in greenhouse trials, outcrossing of transgenic plants can be drastically reduced via transgene integration into the plastid. We verified this result in the field with Petunia , for which the highest paternal leakage has been observed. The variety white 115 (W115) served as recipient and Pink Wave (PW) and the transplastomic variant PW T16, encoding the uid A reporter gene, as pollen donor. While manual pollination in the greenhouse led to over 90% hybrids for both crossings, the transgenic donor resulted only in 2% hybrids in the field. Nevertheless paternal leakage was detected in one case which proves that paternal inheritance of plastid-located transgenes is possible under artificial conditions. In the greenhouse, paternal leakage occurred in a frequency comparable to published results. As expected natural pollination reduced the hybrid formation in the field from 90 to 7.6% and the transgenic donor did not result in any hybrid.

  16. Plastid, nuclear and reverse transcriptase sequences in the mitochondrial genome of Oenothera: is genetic information transferred between organelles via RNA?

    Science.gov (United States)

    Schuster, W; Brennicke, A

    1987-01-01

    We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433

  17. Contrasting Patterns of Nucleotide Substitution Rates Provide Insight into Dynamic Evolution of Plastid and Mitochondrial Genomes of Geranium.

    Science.gov (United States)

    Park, Seongjun; Ruhlman, Tracey A; Weng, Mao-Lun; Hajrah, Nahid H; Sabir, Jamal S M; Jansen, Robert K

    2017-06-01

    Geraniaceae have emerged as a model system for investigating the causes and consequences of variation in plastid and mitochondrial genomes. Incredible structural variation in plastid genomes (plastomes) and highly accelerated evolutionary rates have been reported in selected lineages and functional groups of genes in both plastomes and mitochondrial genomes (mitogenomes), and these phenomena have been implicated in cytonuclear incompatibility. Previous organelle genome studies have included limited sampling of Geranium, the largest genus in the family with over 400 species. This study reports on rates and patterns of nucleotide substitutions in plastomes and mitogenomes of 17 species of Geranium and representatives of other Geraniaceae. As detected across other angiosperms, substitution rates in the plastome are 3.5 times higher than the mitogenome in most Geranium. However, in the branch leading to Geranium brycei/Geranium incanum mitochondrial genes experienced significantly higher dN and dS than plastid genes, a pattern that has only been detected in one other angiosperm. Furthermore, rate accelerations differ in the two organelle genomes with plastomes having increased dN and mitogenomes with increased dS. In the Geranium phaeum/Geranium reflexum clade, duplicate copies of clpP and rpoA genes that experienced asymmetric rate divergence were detected in the single copy region of the plastome. In the case of rpoA, the branch leading to G. phaeum/G. reflexum experienced positive selection or relaxation of purifying selection. Finally, the evolution of acetyl-CoA carboxylase is unusual in Geraniaceae because it is only the second angiosperm family where both prokaryotic and eukaryotic ACCases functionally coexist in the plastid. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  18. Light-dependent, plastome-wide association of the plastid-encoded RNA polymerase with chloroplast DNA.

    Science.gov (United States)

    Finster, Sabrina; Eggert, Erik; Zoschke, Reimo; Weihe, Andreas; Schmitz-Linneweber, Christian

    2013-12-01

    Plastid genes are transcribed by two types of RNA polymerases: a plastid-encoded eubacterial-type RNA polymerase (PEP) and nuclear-encoded phage-type RNA polymerases (NEPs). To investigate the spatio-temporal expression of PEP, we tagged its α-subunit with a hemagglutinin epitope (HA). Transplastomic tobacco plants were generated and analyzed for the distribution of the tagged polymerase in plastid sub-fractions, and associated genes were identified under various light conditions. RpoA:HA was detected as early as the 3rd day after imbibition, and was constitutively expressed in green tissue over 60 days of plant development. We found that the tagged polymerase subunit preferentially associated with the plastid membranes, and was less abundant in the soluble stroma fraction. Attachment of RpoA:HA to the membrane fraction during early seedling development was independent of DNA, but at later stages of development, DNA appears to facilitate attachment of the polymerase to membranes. To survey PEP-dependent transcription units, we probed for nucleic acids enriched in RpoA:HA precipitates using a tobacco chloroplast whole-genome tiling array. The most strongly co-enriched DNA fragments represent photosynthesis genes (e.g. psbA, psbC, psbD and rbcL), whose expression is known to be driven by PEP promoters, while NEP-dependent genes were less abundant in RpoA:HA precipitates. Additionally, we demonstrate that the association of PEP with photosynthesis-related genes was reduced during the dark period, indicating that plastome-wide PEP-DNA association is a light-dependent process. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  19. The effect of chromate on the synthesis of plastid pigments and lipoquinones in Zea mays L. seedlings

    Directory of Open Access Journals (Sweden)

    Zbigniew Krupa

    2014-01-01

    Full Text Available Maize plants cultivated on nutrient solutions containing increasing amounts of CrO42- (from 10-7 to 10-4 M showed growth inhibition, strong reduction of the root system and an increase of dry matter of leaves. The highest accumulation of chromium in plant organs appeared in the roots. Chromate taken up into leaves caused changes in the content of plastid pigments and lipoquinones similar, in general, to those in senescent plants.

  20. Identification of a growth hormone-responsive STAT5-binding element in the rat insulin 1 gene

    DEFF Research Database (Denmark)

    Galsgaard, E D; Gouilleux, F; Groner, B

    1996-01-01

    promoter activity 2-fold, and this stimulation was abolished by introduction of a block mutation in a gamma-interferon-activated sequence (GAS)-like element (GLE) with the sequence 5'-TTCTGGGAA-3' located in the rat insulin 1 enhancer at position -330 to -322. This element, termed Ins-GLE, was able...... transfected with STAT5 and GH receptor cDNAs, it was found that expression of STAT5 was necessary for GH induction of these two DNA-binding complexes. These results suggest that GH stimulates insulin 1 promoter activity by inducing the binding of STAT5 to Ins-GLE.......GH and PRL stimulate both proliferation and insulin production in pancreatic beta-cells as well as in the rat insulinoma cell line RIN-5AH, We report here that human GH increases insulin mRNA levels in RIN-5AH cells via both somatogenic and lactogenic receptors. GH stimulated the rat insulin 1...

  1. Signaling cross-talk between peroxisome proliferator-activated receptor/retinoid X receptor and estrogen receptor through estrogen response elements.

    Science.gov (United States)

    Keller, H; Givel, F; Perroud, M; Wahli, W

    1995-07-01

    Peroxisome proliferator-activated receptors (PPARs) and retinoid X receptors (RXRs) are nuclear hormone receptors that are activated by fatty acids and 9-cis-retinoic acid, respectively. PPARs and RXRs form heterodimers that activate transcription by binding to PPAR response elements (PPREs) in the promoter of target genes. The PPREs described thus far consist of a direct tandem repeat of the AGGTCA core element with one intervening nucleotide. We show here that the vitellogenin A2 estrogen response element (ERE) can also function as a PPRE and is bound by a PPAR/RXR heterodimer. Although this heterodimer can bind to several other ERE-related palindromic response elements containing AGGTCA half-sites, only the ERE is able to confer transactivation of test reporter plasmids, when the ERE is placed either close to or at a distance from the transcription initiation site. Examination of natural ERE-containing promoters, including the pS2, very-low-density apolipoprotein II and vitellogenin A2 genes, revealed considerable differences in the binding of PPAR/RXR heterodimers to these EREs. In their natural promoter context, these EREs did not allow transcriptional activation by PPARs/RXRs. Analysis of this lack of stimulation of the vitellogenin A2 promoter demonstrated that PPARs/RXRs bind to the ERE but cannot transactivate due to a nonpermissive promoter structure. As a consequence, PPARs/RXRs inhibit transactivation by the estrogen receptor through competition for ERE binding. This is the first example of signaling cross-talk between PPAR/RXR and estrogen receptor.

  2. Identification of Smad Response Elements in the Promoter of Goldfish FSHβ Gene and Evidence for Their Mediation of Activin and GnRH Stimulation of FSHβ Expression

    Directory of Open Access Journals (Sweden)

    Man-Tat eLau

    2012-03-01

    Full Text Available As an essential hormone regulating gonads in vertebrates, the biosynthesis and secretion of follicle-stimulating hormone (FSH is controlled by a variety of endocrine and paracrine factors in both mammalian and non-mammalian vertebrates. Activin was initially discovered in the ovary for its specific stimulation of FSH secretion by the pituitary cells. Our earlier studies in fish have shown that activin stimulates FSHβ but suppresses LHβ expression in both the goldfish and zebrafish. Further experiments showed that the regulation of FSHβ in fish occurred at the promoter level involving Smads, in particular Smad3. To further understand the mechanisms by which activin/Smad regulates FSHβ transcription, the present study was undertaken to analyze the promoter of goldfish FSHβ gene (fshb with the aim to identify potential cis-regulatory elements responsible for activin/Smad stimulation. Both serial deletion and site-directed mutagenesis were used, and the promoter activity was tested in the LβT2 cells, a murine gonadotroph cell line. The reporter constructs of goldfish FSHβ promoter-SEAP (secreted alkaline phosphatase were co-transfected with an expression plasmid for Smads (2 or 3 followed by measurement of SEAP activity in the medium. Two putative Smad responsive elements (SRE were identified in the promoter at distal and proximal regions, respectively. The distal site contained a consensus Smad binding element (SBE; AGAC, -1675/-1672 whereas the proximal site (GACCTTGA, -212/-205 was identical to an SF-1 binding site reported in humans, which was preceded by a sequence (AACACTGA highly conserved between fish and mammals. The proximal site also seemed to be involved in mediating stimulation of FSHβ expression by gonadotropin-releasing hormone (GnRH and its potential interaction with activin. In conclusion, we have identified two potential cis-regulatory elements in the promoter of goldfish FSHβ that are responsible for activin

  3. HIGH PERCENTAGE OF RARE EARTH ELEMENT CONNECTION WITH THE ACCUMULATION SEDIMENT AS RESPONSE LONGSHORE CURRENTS IN THE BELITUNG WATERS

    Directory of Open Access Journals (Sweden)

    Delyuzar Ilahude

    2017-07-01

    Full Text Available The study area is geographically located in the West coast of Belitung island at coordinates 105o48'00" - 106o06' 00" E and 06o46'00" - 06o50' 00" S. The beach and coastal area is influenced by wave energy from the West and North directions The purpose of this study is to analyze the relationship between the zone of sediment accumulation of empirical approaches on oceanography parameter containing rare earth elements. The approach used is to predict the shore wave energy using wave prediction curve deep waters to obtain the energy flux of the wave at each point of reference. Sediments containing rare earth elements tend to lead to the south as a result of the movement of longshore currents. Regional coastal area of the western part of the island of Belitung, especially in the southern part of the estuary of the river Tanjung Pandan is estimated to be a zone of sediment accumulation. The movement of sediment caused by wave energy from the north led to sedimentation evolved significantly in the south which is thought to contain rare earths minerals derived from land. This sedimentation process takes place on a seasonal basis, which allegedly took place in the west. The movement of sediment to the south of the mouth of the Cerucuk River it is predicted that rare earth elements were supplied from these rivers tend to settle in the southern part of the estuary Cerucuk throughout the year.

  4. Extended spectrum β-lactamases, carbapenemases and mobile genetic elements responsible for antibiotics resistance in Gram-negative bacteria.

    Science.gov (United States)

    El Salabi, Allaaeddin; Walsh, Timothey R; Chouchani, Chedly

    2013-05-01

    Infectious diseases due to Gram-negative bacteria are a leading cause of morbidity and mortality worldwide. Antimicrobial agents represent one major therapeutic tools implicated to treat these infections. The misuse of antimicrobial agents has resulted in the emergence of resistant strains of Gram-negatives in particular Enterobacteriaceae and non-fermenters; they have an effect not only on a human but on the public health when bacteria use the resistance mechanisms to spread in the hospital environment and to the community outside the hospitals by means of mobile genetic elements. Gram-negative bacteria have become increasingly resistant to antimicrobial agents. They have developed several mechanisms by which they can withstand to antimicrobials, these mechanisms include the production of Extended-spectrum β-lactamases (ESBLs) and carbapenemases, furthermore, Gram-negative bacteria are now capable of spreading such resistance between members of the family Enterobacteriaceae and non-fermenters using mobile genetic elements as vehicles for such resistance mechanisms rendering antibiotics useless. Therefore, addressing the issue of mechanisms of antimicrobial resistance is considered one of most urgent priorities. This review will help to illustrate different resistance mechanisms; ESBLs, carbapenemases encoded by genes carried by mobile genetic elements, which are used by Gram-negative bacteria to escape antimicrobial effect.

  5. Re-evaluating the green versus red signal in eukaryotes with secondary plastid of red algal origin

    KAUST Repository

    Burki, Fabien

    2012-05-16

    The transition from endosymbiont to organelle in eukaryotic cells involves the transfer of significant numbers of genes to the host genomes, a process known as endosymbiotic gene transfer (EGT). In the case of plastid organelles, EGTs have been shown to leave a footprint in the nuclear genome that can be indicative of ancient photosynthetic activity in present-day plastid-lacking organisms, or even hint at the existence of cryptic plastids. Here,we evaluated the impact of EGTon eukaryote genomes by reanalyzing the recently published EST dataset for Chromera velia, an interesting test case of a photosynthetic alga closely related to apicomplexan parasites. Previously, 513 genes were reported to originate from red and green algae in a 1:1 ratio. In contrast, by manually inspecting newly generated trees indicating putative algal ancestry, we recovered only 51 genes congruent with EGT, of which 23 and 9 were of red and green algal origin, respectively,whereas 19 were ambiguous regarding the algal provenance.Our approach also uncovered 109 genes that branched within a monocot angiosperm clade, most likely representing a contamination. We emphasize the lack of congruence and the subjectivity resulting from independent phylogenomic screens for EGT, which appear to call for extreme caution when drawing conclusions for major evolutionary events. 2012 The Author(s).

  6. Evolutionary and biotechnology implications of plastid genome variation in the inverted-repeat-lacking clade of legumes.

    Science.gov (United States)

    Sabir, Jamal; Schwarz, Erika; Ellison, Nicholas; Zhang, Jin; Baeshen, Nabih A; Mutwakil, Muhammed; Jansen, Robert; Ruhlman, Tracey

    2014-08-01

    Land plant plastid genomes (plastomes) provide a tractable model for evolutionary study in that they are relatively compact and gene dense. Among the groups that display an appropriate level of variation for structural features, the inverted-repeat-lacking clade (IRLC) of papilionoid legumes presents the potential to advance general understanding of the mechanisms of genomic evolution. Here, are presented six complete plastome sequences from economically important species of the IRLC, a lineage previously represented by only five completed plastomes. A number of characters are compared across the IRLC including gene retention and divergence, synteny, repeat structure and functional gene transfer to the nucleus. The loss of clpP intron 2 was identified in one newly sequenced member of IRLC, Glycyrrhiza glabra. Using deeply sequenced nuclear transcriptomes from two species helped clarify the nature of the functional transfer of accD to the nucleus in Trifolium, which likely occurred in the lineage leading to subgenus Trifolium. Legumes are second only to cereal crops in agricultural importance based on area harvested and total production. Genetic improvement via plastid transformation of IRLC crop species is an appealing proposition. Comparative analyses of intergenic spacer regions emphasize the need for complete genome sequences for developing transformation vectors for plastid genetic engineering of legume crops. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  7. Assembled Plastid and Mitochondrial Genomes, as well as Nuclear Genes, Place the Parasite Family Cynomoriaceae in the Saxifragales.

    Science.gov (United States)

    Bellot, Sidonie; Cusimano, Natalie; Luo, Shixiao; Sun, Guiling; Zarre, Shahin; Gröger, Andreas; Temsch, Eva; Renner, Susanne S

    2016-08-03

    Cynomoriaceae, one of the last unplaced families of flowering plants, comprise one or two species or subspecies of root parasites that occur from the Mediterranean to the Gobi Desert. Using Illumina sequencing, we assembled the mitochondrial and plastid genomes as well as some nuclear genes of a Cynomorium specimen from Italy. Selected genes were also obtained by Sanger sequencing from individuals collected in China and Iran, resulting in matrices of 33 mitochondrial, 6 nuclear, and 14 plastid genes and rDNAs enlarged to include a representative angiosperm taxon sampling based on data available in GenBank. We also compiled a new geographic map to discern possible discontinuities in the parasites' occurrence. Cynomorium has large genomes of 13.70-13.61 (Italy) to 13.95-13.76 pg (China). Its mitochondrial genome consists of up to 49 circular subgenomes and has an overall gene content similar to that of photosynthetic angiosperms, while its plastome retains only 27 of the normally 116 genes. Nuclear, plastid and mitochondrial phylogenies place Cynomoriaceae in Saxifragales, and we found evidence for several horizontal gene transfers from different hosts, as well as intracellular gene transfers. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  8. Perturbations of carotenoid and tetrapyrrole biosynthetic pathways result in differential alterations in chloroplast function and plastid signaling.

    Science.gov (United States)

    Park, Joon-Heum; Jung, Sunyo

    2017-01-22

    In this study, we used the biosynthetic inhibitors of carotenoid and tetrapyrrole biosynthetic pathways, norflurazon (NF) and oxyfluorfen (OF), as tools to gain insight into mechanisms of photooxidation in rice plants. NF resulted in bleaching symptom on leaves of the treated plants, whereas OF treatment developed a fast symptom of an apparent necrotic phenotype. Both plants exhibited decreases in photosynthetic efficiency, as indicated by F v /F m . NF caused severe disruption in thylakoid membranes, whereas OF-treated plants exhibited disruption of chloroplast envelope and plasma membrane. Levels of Lhca and Lhcb proteins in photosystem I (PSI) and PSII were reduced by photooxidative stress in NF- and OF-treated plants, with a greater decrease in NF plants. The down-regulation of nuclear-encoded photosynthesis genes Lhcb and rbcS was also found in both NF- and OF-treated plants, whereas plastid-encoded photosynthetic genes including RbcL, PsaC, and PsbD accumulated normally in NF plants but decreased drastically in OF plants. This proposes that the plastids in NF plants retain their potential to develop thylakoid membranes and that photobleaching is mainly controlled by nuclear genes. Distinct photooxidation patterns between NF- and OF-treated plants developed differential signaling, which might enable the plant to coordinate the expression of photosynthetic genes from the nuclear and plastidic genomes. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Paternal inheritance of plastid-encoded transgenes in Petunia hybrida in the greenhouse and under field conditions

    Directory of Open Access Journals (Sweden)

    Patricia Horn

    2017-12-01

    Full Text Available As already demonstrated in greenhouse trials, outcrossing of transgenic plants can be drastically reduced via transgene integration into the plastid. We verified this result in the field with Petunia, for which the highest paternal leakage has been observed. The variety white 115 (W115 served as recipient and Pink Wave (PW and the transplastomic variant PW T16, encoding the uidA reporter gene, as pollen donor. While manual pollination in the greenhouse led to over 90% hybrids for both crossings, the transgenic donor resulted only in 2% hybrids in the field. Nevertheless paternal leakage was detected in one case which proves that paternal inheritance of plastid-located transgenes is possible under artificial conditions. In the greenhouse, paternal leakage occurred in a frequency comparable to published results. As expected natural pollination reduced the hybrid formation in the field from 90 to 7.6% and the transgenic donor did not result in any hybrid. Keywords: Paternal plastid inheritance, Transgene confinement, Greenhouse, Field trial, Pollen mediated gene flow

  10. Phylogeny and systematics of the brake fern genus Pteris (Pteridaceae) based on molecular (plastid and nuclear) and morphological evidence.

    Science.gov (United States)

    Zhang, Liang; Zhang, Li-Bing

    2018-01-01

    The brake fern genus Pteris belongs to Pteridaceae subfamily Pteridoideae. It is one of the largest fern genera and has been estimated to contain 200-250 species distributed on all continents except Antarctica. Previous studies were either based on plastid data only or based on both plastid and nuclear data but the sampling was small. In addition, an infrageneric classification of Pteris based on morphological and molecular evidence has not been available yet. In the present study, based on molecular data of eight plastid markers and one nuclear marker (gapCp) of 256 accessions representing ca. 178 species of Pteris, we reconstruct a global phylogeny of Pteris. The 15 major clades identified earlier are recovered here and we further identified a new major clade. Our nuclear phylogeny recovered 11 of these 16 major clades, seven of which are strongly supported. The inclusion of Schizostege in Pteris is confirmed for the first time. Based on the newly reconstructed phylogeny and evidence from morphology, distribution and/or ecology, we classify Pteris into three subgenera: P. subg. Pteris, P. subg. Campteria, and P. subg. Platyzoma. The former two are further divided into three and 12 sections, respectively. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Use of a questionnaire design as an element of nuclear energy generating enterprises social responsibility public audit

    International Nuclear Information System (INIS)

    Gushchina, M.O.; Pryalyin, M.A.; Torganova, O.B.

    2006-01-01

    In the article we describe some issues concerning corporate social responsibility to a society from the point of view its influence on image of an enterprise. We present results of a social investigation regarding to evaluation of social responsibility of the 'South-Ukraine Nuclear Power Plant'

  12. Transcriptional activation of transforming growth factor alpha by estradiol: requirement for both a GC-rich site and an estrogen response element half-site.

    Science.gov (United States)

    Vyhlidal, C; Samudio, I; Kladde, M P; Safe, S

    2000-06-01

    17beta-Estradiol (E2) induces transforming growth factor alpha (TGFalpha) gene expression in MCF-7 cells and previous studies have identified a 53 bp (-252 to -200) sequence containing two imperfect estrogen responsive elements (EREs) that contribute to E2 responsiveness. Deletion analysis of the TGFalpha gene promoter in this study identified a second upstream region of the promoter (-623 to -549) that is also E2 responsive. This sequence contains three GC-rich sites and an imperfect ERE half-site, and the specific cis-elements and trans-acting factors were determined by promoter analysis in transient transfection experiments, gel mobility shift assays and in vitro DNA footprinting. The results are consistent with an estrogen receptor alpha (ERalpha)/Sp1 complex interacting with an Sp1(N)(30) ERE half-site ((1/2)) motif in which both ERalpha and Sp1 bind promoter DNA. The ER/Sp1-DNA complex is formed using nuclear extracts from MCF-7 cells but not with recombinant human ERalpha or Sp1 proteins, suggesting that other nuclear factor(s) are required for complex stabilization. The E2-responsive Sp1(N)(x)ERE(1/2) motif identified in the TGFalpha gene promoter has also been characterized in the cathepsin D and heat shock protein 27 gene promoters; however, in the latter two promoters the numbers of intervening nucleotides are 23 and 10 respectively.

  13. Maize DRE-binding proteins DBF1 and DBF2 are involved in rab17 regulation through the drought-responsive element in an ABA-dependent pathway.

    Science.gov (United States)

    Kizis, Dimosthenis; Pagès, Montserrat

    2002-06-01

    The abscisic acid-responsive gene rab17 of maize is expressed during late embryogenesis, and is induced by ABA and desiccation in embryo and vegetative tissues. ABRE and DRE cis-elements are involved in regulation of the gene by ABA and drought. Using yeast one-hybrid screening, we isolated two cDNAs encoding two new DRE-binding proteins, designated DBF1 and DBF2, that are members of the AP2/EREBP transcription factor family. Analysis of mRNA accumulation profiles showed that DBF1 is induced during maize embryogenesis and after desiccation, NaCl and ABA treatments in plant seedlings, whereas the DBF2 mRNA is not induced. DNA-binding preferences of DBFs were analysed by electrophoretic mobility shift assays, and showed that both DBF1 and DBF2 bound to the wild-type DRE2 element, but not to the DRE2 mutant or to the DRE1 element which differs only in a single nucleotide. Transactivation activity using particle bombardment showed that DBF1 functioned as activator of DRE2-dependent transcription of rab17 promoter by ABA, whereas DBF2 overexpression had a repression action downregulating not only the basal promoter activity, but also the ABA effect. These results show that ABA plays a role in the regulation of DBF activity, and suggests the existence of an ABA-dependent pathway for the regulation of genes through the C-repeat/DRE element.

  14. Radiographic element

    International Nuclear Information System (INIS)

    Abbott, T.I.; Jones, C.G.

    1984-01-01

    Radiographic elements are disclosed comprised of first and second silver halide emulsion layers separated by an interposed support capable of transmitting radiation to which the second image portion is responsive. At least the first imaging portion contains a silver halide emulsion in which thin tubular silver halide grains of intermediate aspect ratios (from 5:1 to 8:1) are present. Spectral sensitizing dye is adsorbed to the surface of the tubular grains. Increased photographic speeds can be realized at comparable levels of crossover. (author)

  15. The inter-relationship of ascorbate transport, metabolism and mitochondrial, plastidic respiration.

    Science.gov (United States)

    Szarka, András; Bánhegyi, Gábor; Asard, Han

    2013-09-20

    Ascorbate, this multifaceted small molecular weight carbohydrate derivative, plays important roles in a range of cellular processes in plant cells, from the regulation of cell cycle, through cell expansion and senescence. Beyond these physiological functions, ascorbate has a critical role in responses to abiotic stresses, such as high light, high salinity, or drought. The biosynthesis, recycling, and intracellular transport are important elements of the balancing of ascorbate level to the always-changing conditions and demands. A bidirectional tight relationship was described between ascorbate biosynthesis and the mitochondrial electron transfer chain (mETC), since L-galactono-1,4-lactone dehydrogenase (GLDH), the enzyme catalyzing the ultimate step of ascorbate biosynthesis, uses oxidized cytochrome c as the only electron acceptor and has a role in the assembly of Complex I. A similar bidirectional relationship was revealed between the photosynthetic apparatus and ascorbate biosynthesis since the electron flux through the photosynthetic ETC affects the biosynthesis of ascorbate and the level of ascorbate could affect photosynthesis. The details of this regulatory network of photosynthetic electron transfer, respiratory electron transfer, and ascorbate biosynthesis are still not clear, as are the potential regulatory role and the regulation of intracellular ascorbate transport and fluxes. The elucidation of the role of ascorbate as an important element of the network of photosynthetic, respiratory ETC and tricarboxylic acid cycle will contribute to understanding plant cell responses to different stress conditions.

  16. Prediction and analysis of human thoracic impact responses and injuries in cadaver impacts using a full human body finite element model.

    Science.gov (United States)

    Ruan, Jesse; El-Jawahri, Raed; Chai, Li; Barbat, Saeed; Prasad, Priya

    2003-10-01

    Human thoracic dynamic responses and injuries associated with frontal impact, side impact, and belt loading were investigated and predicted using a complete human body finite element model for an average adult male. The human body model was developed to study the impact biomechanics of a vehicular occupant. Its geometry was based on the Visible Human Project (National Library of Medicine) and the topographies from human body anatomical texts. The data was then scaled to an average adult male according to available biomechanical data from the literature. The model includes details of the head, neck, ribcage, abdomen, thoracic and lumbar spine, internal organs of the chest and abdomen, pelvis, and the upper and lower extremities. The present study is focused on the dynamic response and injuries of the thorax. The model was validated at various impact speeds by comparing predicted responses with available experimental cadaver data in frontal and side pendulum impacts, as well as belt loading. Model responses were compared with similar individual cadaver tests instead of using cadaver corridors because the large differences between the upper and lower bounds of the corridors may confound the model validation. The validated model was then used to study thorax dynamic responses and injuries in various simulated impact conditions. Parameters that could induce injuries such as force, deflection, and stress were computed from model simulations and were compared with previously proposed thoracic injury criteria to assess injury potential for the thorax. It has been shown that the model exhibited speed sensitive impact characteristics, and the compressibility of the internal organs significantly influenced the overall impact response in the simulated impact conditions. This study demonstrates that the development of a validated FE human body model could be useful for injury assessment in various cadaveric impacts reported in the literature. Internal organ injuries, which are

  17. The Seismic Response of High-Speed Railway Bridges Subjected to Near-Fault Forward Directivity Ground Motions Using a Vehicle-Track-Bridge Element

    Directory of Open Access Journals (Sweden)

    Chen Ling-kun

    2014-01-01

    Full Text Available Based on the Next Generation Attenuation (NGA project ground motion library, the finite element model of the high-speed railway vehicle-bridge system is established. The model was specifically developed for such system that is subjected to near-fault ground motions. In addition, it accounted for the influence of the rail irregularities. The vehicle-track-bridge (VTB element is presented to simulate the interaction between train and bridge, in which a train can be modeled as a series of sprung masses concentrated at the axle positions. For the short period railway bridge, the results from the case study demonstrate that directivity pulse effect tends to increase the seismic responses of the bridge compared with far-fault ground motions or nonpulse-like motions and the directivity pulse effect and high values of the vertical acceleration component can notably influence the hysteretic behaviour of piers.

  18. v-src induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element.

    Science.gov (United States)

    Xie, W; Fletcher, B S; Andersen, R D; Herschman, H R

    1994-10-01

    We recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factors and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5' of the TIS10/PGS2 transcription start site that mediates pp60v-src induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E-box (CACGTG) sequences. Gel shift-oligonucleotide competition experiments with nuclear extracts from cells stably transfected with a temperature-sensitive v-src gene demonstrate that the CGTCACGTG sequence can bind proteins at both the ATF/CRE and E-box sequences. Dominant-negative CREB and Myc proteins that bind DNA, but do not transactivate, block v-src induction of a luciferase reporter driven by the first 80 nucleotides of the TIS10/PGS2 promoter. Mutational analysis distinguishes which TIS10/PGS2 cis-acting element mediates pp60v-src induction. E-box mutation has no effect on the fold induction in response to pp60v-src. In contrast, ATF/CRE mutation attenuates the pp60v-src response. Antibody supershift and methylation interference experiments demonstrate that CREB and at least one other ATF transcription factor in these extracts bind to the TIS10/PGS2 ATF/CRE element. Expression of a dominant-negative ras gene also blocks TIS10/PGS2 induction by v-src. Our data suggest that Ras mediates pp60v-src activation of an ATF transcription factor, leading to induced TIS10/PGS2 expression via the ATF/CRE element of the TIS10/PGS2 promoter. This is the first description of v-src activation of gene expression via an ATF/CRE element.

  19. Standard elements; Elements standards

    Energy Technology Data Exchange (ETDEWEB)

    Blanc, B [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1958-07-01

    Following his own experience the author recalls the various advantages, especially in the laboratory, of having pre-fabricated vacuum-line components at his disposal. (author) [French] A la suite de sa propre experience, l'auteur veut rappeler les divers avantages que presente, tout particulierement en laboratoire, le fait d'avoir a sa disposition des elements pre-fabriques de canalisations a vide. (auteur)

  20. Human granulocyte colony-stimulating factor (hG-CSF) expression in plastids of Lactuca sativa.

    Science.gov (United States)

    Sharifi Tabar, Mehdi; Habashi, Ali Akbar; Rajabi Memari, Hamid

    2013-01-01

    Human granulocyte colony-stimulating factor (hG-CSF) can serve as valuable biopharmaceutical for research and treatment of the human blood cancer. Transplastomic plants have been emerged as a new and high potential candidate for production of recombinant biopharmaceutical proteins in comparison with transgenic plants due to extremely high level expression, biosafety and many other advantages. hG-CSF gene was cloned into pCL vector between prrn16S promoter and TpsbA terminator. The recombinant vector was coated on nanogold particles and transformed to lettuce chloroplasts through biolistic method. Callogenesis and regeneration of cotyledonary explants were obtained by Murashige and Skoog media containing 6-benzylaminopurine and 1-naphthaleneacetic acid hormones. The presence of hG-CSF gene in plastome was studied with four specific PCR primers and expression by Western immunoblotting. hG-CSF gene cloning was confirmed by digestion and sequencing. Transplastomic lettuce lines were regenerated and subjected to molecular analysis. The presence of hG-CSF in plastome was confirmed by PCR using specific primers designed from the plastid genome. Western immunoblotting of extracted protein from transplastomic plants showed a 20-kDa band, which verified the expression of recombinant protein in lettuce chloroplasts. This study is the first report that successfully express hG-CSF gene in lettuce chloroplast. The lettuce plastome can provide a cheap and safe expression platform for producing valuable biopharmaceuticals for research and treatment.

  1. Phylogeny, character evolution, and biogeography of Cuscuta (dodders; Convolvulaceae) inferred from coding plastid and nuclear sequences.

    Science.gov (United States)

    García, Miguel A; Costea, Mihai; Kuzmina, Maria; Stefanović, Saša

    2014-04-01

    The parasitic genus Cuscuta, containing some 200 species circumscribed traditionally in three subgenera, is nearly cosmopolitan, occurring in a wide range of habitats and hosts. Previous molecular studies, on subgenera Grammica and Cuscuta, delimited major clades within these groups. However, the sequences used were unalignable among subgenera, preventing the phylogenetic comparison across the genus. We conducted a broad phylogenetic study using rbcL and nrLSU sequences covering the morphological, physiological, and geographical diversity of Cuscuta. We used parsimony methods to reconstruct ancestral states for taxonomically important characters. Biogeographical inferences were obtained using statistical and Bayesian approaches. Four well-supported major clades are resolved. Two of them correspond to subgenera Monogynella and Grammica. Subgenus Cuscuta is paraphyletic, with section Pachystigma sister to subgenus Grammica. Previously described cases of strongly supported discordance between plastid and nuclear phylogenies, interpreted as reticulation events, are confirmed here and three new cases are detected. Dehiscent fruits and globose stigmas are inferred as ancestral character states, whereas the ancestral style number is ambiguous. Biogeographical reconstructions suggest an Old World origin for the genus and subsequent spread to the Americas as a consequence of one long-distance dispersal. Hybridization may play an important yet underestimated role in the evolution of Cuscuta. Our results disagree with scenarios of evolution (polarity) previously proposed for several taxonomically important morphological characters, and with their usage and significance. While several cases of long-distance dispersal are inferred, vicariance or dispersal to adjacent areas emerges as the dominant biogeographical pattern.

  2. A gene phylogeny of the red algae (Rhodophyta) based on plastid rbcL.

    Science.gov (United States)

    Freshwater, D W; Fredericq, S; Butler, B S; Hommersand, M H; Chase, M W

    1994-01-01

    A phylogeny for the Rhodophyta has been inferred by parsimony analysis of plastid rbcL sequences representing 81 species, 68 genera, 38 families, and 17 orders of red algae; rbcL encodes the large subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase. Levels of sequence divergence among species, genera, and families are high in red algae, typically much greater than those reported for flowering plants. The Rhodophyta traditionally consists of one class, Rhodophyceae, and two subclasses, Bangiophycidae and Florideophycidae. The Bangiophycidae with three orders (Porphyridiales, Compsopogonales, and Bangiales) appears to be polyphyletic, and the Florideophycidae with 17 orders is monophyletic in this study. The current classification of the Florideophycidae based on ultrastructure of pit connections is supported. With the exception of the Rhodogorgonales, which appears to be misplaced, orders with one or two pit-plug cap layers (Hildenbrandiales, Corallinales, Acrochaetiales, Palmanales, Batrachospermales, and Nemaliales) terminate long branches of basal position within Florideophycidae in the most parsimonious rbcL tree. Orders that lack typical cap layers but possess a cap membrane are resolved as a monophyletic clade sister to the Ahnfeltiales. The large order Gigartinales, which is distributed among five rbcL clades, is polyphyletic. Families that possess typical carrageenan in their cell walls are resolved as a terminal clade containing two family complexes centered around the Solieriaceae and Gigartinaceae. PMID:8041781

  3. Complete plastid genome sequence of goosegrass (Eleusine indica) and comparison with other Poaceae.

    Science.gov (United States)

    Zhang, Hui; Hall, Nathan; McElroy, J Scott; Lowe, Elijah K; Goertzen, Leslie R

    2017-02-05

    Eleusine indica, also known as goosegrass, is a serious weed in at least 42 countries. In this paper we report the complete plastid genome sequence of goosegrass obtained by de novo assembly of paired-end and mate-paired reads generated by Illumina sequencing of total genomic DNA. The goosegrass plastome is a circular molecule of 135,151bp in length, consisting of two single-copy regions separated by a pair of inverted repeats (IRs) of 20,919 bases. The large (LSC) and the small (SSC) single-copy regions span 80,667 bases and 12,646 bases, respectively. The plastome of goosegrass has 38.19% GC content and includes 108 unique genes, of which 76 are protein-coding, 28 are transfer RNA, and 4 are ribosomal RNA. The goosegrass plastome sequence was compared to eight other species of Poaceae. Although generally conserved with respect to Poaceae, this genomic resource will be useful for evolutionary studies within this weed species and the genus Eleusine. Copyright © 2016. Published by Elsevier B.V.

  4. Phylogeny of Celastrus L. (Celastraceae) inferred from two nuclear and three plastid markers.

    Science.gov (United States)

    Mu, Xian-Yun; Zhao, Liang-Cheng; Zhang, Zhi-Xiang

    2012-09-01

    This is the first comprehensive molecular investigation of the genus Celastrus L. Phylogenetic relationships within the genus were assessed based on sequences of two nuclear (ETS, ITS) and three plastid (psbA-trnH, rpl16 and trnL-F) regions using the Bayesian inference and the maximum parsimony methods. Our results show that Celastrus, together with Tripterygium, formed a maximal supported clade. Within the cluster, Celastrus is composed of a basal clade and a core Celastrus clade, and the latter is consisted of six subclades. Relationships among species are more influenced by latitude than continental distribution patterns. The cauline cyme and lunate seeds are distinct characters to one of the maximal supported subclades. Their close relationship, similar geographical pattern and habitat imply that C. flagellaris may be a potential invasive species threatening C. scandens in North America. Celastrus leiocarpus, C. oblanceifolius and C. rugosus are confirmed as synonyms of C. punctatus, C. aculeatus and C. glaucophyllus, respectively. Discordance between the molecular data and previous morphology-based subgeneric classifications are noted. More works are needed to clarify the relationship between Celastrus and Tripterygium and the species within Celastrus.

  5. A phylogenetic analysis of Diurideae (Orchidaceae) based on plastid DNA sequence data.

    Science.gov (United States)

    Kores, P J; Molvray, M; Weston, P H; Hopper, S D; Brown, A P; Cameron, K M; Chase, M W

    2001-10-01

    DNA sequence data from plastid matK and trnL-F regions were used in phylogenetic analyses of Diurideae, which indicate that Diurideae are not monophyletic as currently delimited. However, if Chloraeinae and Pterostylidinae are excluded from Diurideae, the remaining subtribes form a well-supported, monophyletic group that is sister to a "spiranthid" clade. Chloraea, Gavilea, and Megastylis pro parte (Chloraeinae) are all placed among the spiranthid orchids and form a grade with Pterostylis leading to a monophyletic Cranichideae. Codonorchis, previously included among Chloraeinae, is sister to Orchideae. Within the more narrowly delimited Diurideae two major lineages are apparent. One includes Diuridinae, Cryptostylidinae, Thelymitrinae, and an expanded Drakaeinae; the other includes Caladeniinae s.s., Prasophyllinae, and Acianthinae. The achlorophyllous subtribe Rhizanthellinae is a member of Diurideae, but its placement is otherwise uncertain. The sequence-based trees indicate that some morphological characters used in previous classifications, such as subterranean storage organs, anther position, growth habit, fungal symbionts, and pollination syndromes have more complex evolutionary histories than previously hypothesized. Treatments based upon these characters have produced conflicting classifications, and molecular data offer a tool for reevaluating these phylogenetic hypotheses.

  6. Phylogenetic relationships in Peniocereus (Cactaceae) inferred from plastid DNA sequence data.

    Science.gov (United States)

    Arias, Salvador; Terrazas, Teresa; Arreola-Nava, Hilda J; Vázquez-Sánchez, Monserrat; Cameron, Kenneth M

    2005-10-01

    The phylogenetic relationships of Peniocereus (Cactaceae) species were studied using parsimony analyses of DNA sequence data. The plastid rpl16 and trnL-F regions were sequenced for 98 taxa including 17 species of Peniocereus, representatives from all genera of tribe Pachycereeae, four genera of tribe Hylocereeae, as well as from three additional outgroup genera of tribes Calymmantheae, Notocacteae, and Trichocereeae. Phylogenetic analyses support neither the monophyly of Peniocereus as currently circumscribed, nor the monophyly of tribe Pachycereeae since species of Peniocereus subgenus Pseudoacanthocereus are embedded within tribe Hylocereeae. Furthermore, these results show that the eight species of Peniocereus subgenus Peniocereus (Peniocereus sensu stricto) form a well-supported clade within subtribe Pachycereinae; P. serpentinus is also a member of this subtribe, but is sister to Bergerocactus. Moreover, Nyctocereus should be resurrected as a monotypic genus. Species of Peniocereus subgenus Pseudoacanthocereus are positioned among species of Acanthocereus within tribe Hylocereeae, indicating that they may be better classified within that genus. A number of morphological and anatomical characters, especially related to the presence or absence of dimorphic branches, are discussed to support these relationships.

  7. The Arabidopsis TOR Kinase Specifically Regulates the Expression of Nuclear Genes Coding for Plastidic Ribosomal Proteins and the Phosphorylation of the Cytosolic Ribosomal Protein S6.

    Science.gov (United States)

    Dobrenel, Thomas; Mancera-Martínez, Eder; Forzani, Céline; Azzopardi, Marianne; Davanture, Marlène; Moreau, Manon; Schepetilnikov, Mikhail; Chicher, Johana; Langella, Olivier; Zivy, Michel; Robaglia, Christophe; Ryabova, Lyubov A; Hanson, Johannes; Meyer, Christian

    2016-01-01

    Protein translation is an energy consuming process that has to be fine-tuned at both the cell and organism levels to match the availability of resources. The target of rapamycin kinase (TOR) is a key regulator of a large range of biological processes in response to environmental cues. In this study, we have investigated the effects of TOR inactivation on the expression and regulation of Arabidopsis ribosomal proteins at different levels of analysis, namely from transcriptomic to phosphoproteomic. TOR inactivation resulted in a coordinated down-regulation of the transcription and translation of nuclear-encoded mRNAs coding for plastidic ribosomal proteins, which could explain the chlorotic phenotype of the TOR silenced plants. We have identified in the 5' untranslated regions (UTRs) of this set of genes a conserved sequence related to the 5' terminal oligopyrimidine motif, which is known to confer translational regulation by the TOR kinase in other eukaryotes. Furthermore, the phosphoproteomic analysis of the ribosomal fraction following TOR inactivation revealed a lower phosphorylation of the conserved Ser240 residue in the C-terminal region of the 40S ribosomal protein S6 (RPS6). These results were confirmed by Western blot analysis using an antibody that specifically recognizes phosphorylated Ser240 in RPS6. Finally, this antibody was used to follow TOR activity in plants. Our results thus uncover a multi-level regulation of plant ribosomal genes and proteins by the TOR kinase.

  8. Thyroid Hormone Receptor β (TRβ) and Liver X Receptor (LXR) Regulate Carbohydrate-response Element-binding Protein (ChREBP) Expression in a Tissue-selective Manner*

    Science.gov (United States)

    Gauthier, Karine; Billon, Cyrielle; Bissler, Marie; Beylot, Michel; Lobaccaro, Jean-Marc; Vanacker, Jean-Marc; Samarut, Jacques

    2010-01-01

    Thyroid hormone (TR) and liver X (LXR) receptors are transcription factors involved in lipogenesis. Both receptors recognize the same consensus DNA-response element in vitro. It was previously shown that their signaling pathways interact in the control of cholesterol elimination in the liver. In the present study, carbohydrate-response element-binding protein (ChREBP), a major transcription factor controlling the activation of glucose-induced lipogenesis in liver, is characterized as a direct target of thyroid hormones (TH) in liver and white adipose tissue (WAT), the two main lipogenic tissues in mice. Using genetic and molecular approaches, ChREBP is shown to be specifically regulated by TRβ but not by TRα in vivo, even in WAT where both TR isoforms are expressed. However, this isotype specificity is not found in vitro. This TRβ specific regulation correlates with the loss of TH-induced lipogenesis in TRβ−/− mice. Fasting/refeeding experiments show that TRβ is not required for the activation of ChREBP expression particularly marked in WAT following refeeding. However, TH can stimulate ChREBP expression in WAT even under fasting conditions, suggesting completely independent pathways. Because ChREBP has been described as an LXR target, the interaction of LXR and TRβ in ChREBP regulation was assayed both in vitro and in vivo. Each receptor recognizes a different response element on the ChREBP promoter, located only 8 bp apart. There is a cross-talk between LXR and TRβ signaling on the ChREBP promoter in liver but not in WAT where LXR does not regulate ChREBP expression. The molecular basis for this cross-talk has been determined in in vitro systems. PMID:20615868

  9. Abscisic acid-activated SNRK2 protein kinases function in the gene-regulation pathway of ABA signal transduction by phosphorylating ABA response element-binding factors.

    Science.gov (United States)

    Kobayashi, Yuhko; Murata, Michiharu; Minami, Hideyuki; Yamamoto, Shuhei; Kagaya, Yasuaki; Hobo, Tokunori; Yamamoto, Akiko; Hattori, Tsukaho

    2005-12-01

    The plant hormone abscisic acid (ABA) induces gene expression via the ABA-response element (ABRE) present in the promoters of ABA-regulated genes. A group of bZIP proteins have been identified as ABRE-binding factors (ABFs) that activate transcription through this cis element. A rice ABF, TRAB1, has been shown to be activated via ABA-dependent phosphorylation. While a large number of signalling factors have been identified that are involved in stomatal regulation by ABA, relatively less is known about the ABA-signalling pathway that leads to gene expression. We have shown recently that three members of the rice SnRK2 protein kinase family, SAPK8, SAPK9 and SAPK10, are activated by ABA signal as well as by hyperosmotic stress. Here we show that transient overexpression in cultured cell protoplasts of these ABA-activated SnRK2 protein kinases leads to the activation of an ABRE-regulated promoter, suggesting that these kinases are involved in the gene-regulation pathway of ABA signalling. We further show several lines of evidence that these ABA-activated SnRK2 protein kinases directly phosphorylate TRAB1 in response to ABA. Kinetic analysis of SAPK10 activation and TRAB1 phosphorylation indicated that the latter immediately followed the former. TRAB1 was found to be phosphorylated not only in response to ABA, but also in response to hyperosmotic stress, which was interpreted as the consequence of phosphorylation of TRAB1 by hyperosmotically activated SAPKs. Physical interaction between TRAB1 and SAPK10 in vivo was demonstrated by a co-immunoprecipitation experiment. Finally, TRAB1 was phosphorylated in vitro by the ABA-activated SnRK2 protein kinases at Ser102, which is phosphorylated in vivo in response to ABA and is critical for the activation function.

  10. Finite-element modelling of geomechanical and hydraulic responses to the room 209 heading extension excavation response experiment 2: post-excavation analysis of experimental results

    Energy Technology Data Exchange (ETDEWEB)

    Chan, T; Griffith, P; Nakka, B W; Khair, K R

    1993-07-01

    An in situ excavation response test was conducted at the 240 Level of the Underground Research Laboratory (URL) in conjunction with the excavation of a tunnel (Room 209) through a narrow, near-vertical, water-bearing fracture oriented almost perpendicular to the tunnel axis. This report presents a post-excavation analysis of the predicted mechanical response of the granitic rock mass to the tunnel excavation and the near-field hydraulic response of the fracture zone, compares the numerical modelling predictions with the actual measured response, provides information on the rock mass and fracture from back-analysis of the responses, and makes recommendations for future experiments. Results indicate that displacements and stress c