WorldWideScience

Sample records for plasmodial surface anion

  1. Synergistic Malaria Parasite Killing by Two Types of Plasmodial Surface Anion Channel Inhibitors.

    Directory of Open Access Journals (Sweden)

    Margaret Pain

    Full Text Available Malaria parasites increase their host erythrocyte's permeability to a broad range of ions and organic solutes. The plasmodial surface anion channel (PSAC mediates this uptake and is an established drug target. Development of therapies targeting this channel is limited by several problems including interactions between known inhibitors and permeating solutes that lead to incomplete channel block. Here, we designed and executed a high-throughput screen to identify a novel class of PSAC inhibitors that overcome this solute-inhibitor interaction. These new inhibitors differ from existing blockers and have distinct effects on channel-mediated transport, supporting a model of two separate routes for solute permeation though PSAC. Combinations of inhibitors specific for the two routes had strong synergistic action against in vitro parasite propagation, whereas combinations acting on a single route produced only additive effects. The magnitude of synergism depended on external nutrient concentrations, consistent with an essential role of the channel in parasite nutrient acquisition. The identified inhibitors will enable a better understanding of the channel's structure-function and may be starting points for novel combination therapies that produce synergistic parasite killing.

  2. High Guanidinium Permeability Reveals Dehydration-Dependent Ion Selectivity in the Plasmodial Surface Anion Channel

    Directory of Open Access Journals (Sweden)

    Abdullah A. B. Bokhari

    2014-01-01

    Full Text Available Malaria parasites grow within vertebrate erythrocytes and increase host cell permeability to access nutrients from plasma. This increase is mediated by the plasmodial surface anion channel (PSAC, an unusual ion channel linked to the conserved clag gene family. Although PSAC recognizes and transports a broad range of uncharged and charged solutes, it must efficiently exclude the small Na+ ion to maintain infected cell osmotic stability. Here, we examine possible mechanisms for this remarkable solute selectivity. We identify guanidinium as an organic cation with high permeability into human erythrocytes infected with Plasmodium falciparum, but negligible uptake by uninfected cells. Transport characteristics and pharmacology indicate that this uptake is specifically mediated by PSAC. The rank order of organic and inorganic cation permeabilities suggests cation dehydration as the rate-limiting step in transport through the channel. The high guanidinium permeability of infected cells also allows rapid and stringent synchronization of parasite cultures, as required for molecular and cellular studies of this pathogen. These studies provide important insights into how nutrients and ions are transported via PSAC, an established target for antimalarial drug development.

  3. Anionic surface binders

    OpenAIRE

    Aljaž-Rožič Mateja; Hočevar Nežka

    2004-01-01

    The MELAMIN Chemical Factory in Kočevje manufactures synthetic resins and binders for the paper industry. Binders based on AKD (alkyl ketene dimer) are produced which are used for binding paper and cardboard in the range of neutral and partially basic pH. Cationic and, lately, anionic binders are mostly used for the bulk binding of paper and board. The possibility of using AKD binders on paper or board surfaces is presented. In this case partially cationic AKD binders may be applied. When opt...

  4. Probes for anionic cell surface detection

    Science.gov (United States)

    Smith, Bradley D.

    2013-03-05

    Embodiments of the present invention are generally directed to compositions comprising a class of molecular probes for detecting the presence of anionic cell surfaces. Embodiments include compositions that are enriched for these compositions and preparations, particularly preparations suitable for use as laboratory/clinical reagents and diagnostic indicators, either alone or as part of a kit. An embodiment of the invention provides for a highly selective agent useful in the discernment and identification of dead or dying cells, such as apoptotic cells, in a relatively calcium-free environment. An embodiment of the invention provides a selective agent for the identification of bacteria in a mixed population of bacterial cells and nonbacterial cells.

  5. Asymptomatic plasmodial infection in Colombian pregnant women.

    Science.gov (United States)

    Carmona-Fonseca, Jaime; Agudelo, Olga M; Arango, Eliana M

    2017-08-01

    Information about asymptomatic plasmodial infection is scarce in the world, and the current antimalarial program goals (control, elimination, and eradication) demand this evidence to be well documented in different populations and malaria transmission settings. This study aimed to measure the prevalence of API in Colombian pregnant women at delivery. A retrospective prevalence survey was used. Women were recruited at hospital obstetric facility in each of the municipalities of Turbo, Necoclí in Antioquia department, and Puerto Libertador in Córdoba department. Malaria infection was tested by thick blood smear (TBS) and real-time quantitative PCR (qPCR). Ninety-six pregnant women at delivery were studied: 95% were asymptomatic (91/96), 45% had asymptomatic plasmodial infection (API) by qPCR (41/91), and only 8% (7/91) had API by microscopy. The prevalence of submicroscopic infections (TBS negative and qPCR positive) was very high, 37% (34/91) in asymptomatic women and 41% (39/96) in total women studied (91 asymptomatic and 5 symptomatic). The prevalence of API in Colombian pregnant women is much higher than which is expected for a country that does not have the level of malaria transmission as Sub-Saharan African countries. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Specific anion effects on copper surface through electrochemical treatment: Enhanced photoelectrochemical CO2 reduction activity of derived nanostructures induced by chaotropic anions

    Science.gov (United States)

    Navaee, Aso; Salimi, Abdollah

    2018-05-01

    Copper derivatives are the most prominent CO2 reduction electrocatalyst. Herein, the metallic copper has been electrochemically treated with some of common ionic salts such as N3bar, HPO2bar, S2bar, Fbar, Clbar, Brbar and Ibar based on the dissolution of a metallic working electrode in an aqueous solution to derive the surface roughness incorporated with nanostructures. Diverse surface morphology can be obtained when the ionic radii of anions are changed. Surface study reveals various roughness shapes based on the size and polarity of the anions, where the ions with higher ionic radii have higher impact on the Cu surface. In comparison, polyatomic oxyanion such as HPO2bar even with large ionic radii do not have enough strength to create the surface roughness than that of oxygen-free anions with large ionic radii. The photoelectrochemical behavior of the modified surfaces toward CO2 reduction is studied at a wide potential window in bicarbonate aqueous solution. Based on our investigations, treated surfaces by Ibar, Clbar and S2bargive a more surface roughness, while Ibar and N3bar offer higher catalytic activity toward CO2 reduction due to possible complexing ability of these anions with Cu cations, followed by formation of the co-catalyst semiconductor and facilitate electron transfer. This methodology can be applied to investigate the effect of ions on transition metals along with obtaining different surface morphologies tailored to different applications.

  7. Surface modification of polystyrene with atomic oxygen radical anions-dissolved solution

    International Nuclear Information System (INIS)

    Wang Lian; Yan Lifeng; Zhao Peitao; Torimoto, Yoshifumi; Sadakata, Masayoshi; Li Quanxin

    2008-01-01

    A novel approach to surface modification of polystyrene (PS) polymer with atomic oxygen radical anions-dissolved solution (named as O - water) has been investigated. The O - water, generated by bubbling of the O - (atomic oxygen radical anion) flux into the deionized water, was characterized by UV-absorption spectroscopy and electron paramagnetic resonance (EPR) spectroscopy. The O - water treatments caused an obvious increase of the surface hydrophilicity, surface energy, surface roughness and also caused an alteration of the surface chemical composition for PS surfaces, which were indicated by the variety of contact angle and material characterization by atomic force microscope (AFM) imaging, field emission scanning electron microscopy (FESEM), X-ray photoelectron spectroscopy (XPS), and attenuated total-reflection Fourier transform infrared (ATR-FTIR) measurements. Particularly, it was found that some hydrophilic groups such as hydroxyl (OH) and carbonyl (C=O) groups were introduced onto the polystyrene surfaces via the O - water treatment, leading to the increases of surface hydrophilicity and surface energy. The active oxygen species would react with the aromatic ring molecules on the PS surfaces and decompose the aromatic compounds to produce hydrophilic hydroxyl and carbonyl compounds. In addition, the O - water is also considered as a 'clean solution' without adding any toxic chemicals and it is easy to be handled at room temperature. Present method may suit to the surface modification of polymers and other heat-sensitive materials potentially

  8. Modern immunological approaches to assess malaria transmission and immunity and to diagnose plasmodial infection

    Directory of Open Access Journals (Sweden)

    C. T. Daniel-Ribeiro

    1992-01-01

    Full Text Available The present paper reviews our recent data concerning the use of immunological methods employing monoclonal antibodies and synthetic peptides to study malaria transmission and immunity and to diagnose plasmodial infection. As concerns malaria transmission, we studied the main vectors of human malaria and the plasmodial species transmitted in endemic areas of Rondônia state, Brazil. The natural infection on anopheline was evaluated by immunoradiometric assay (IRMA using monoclonal antibodies to an immunodominant sporozoite surface antigen (CS protein demonstrated to be species specific. Our results showed that among six species of Anopheles found infected, An. darlingi was the main vector transmitting Plasmodium falciparum and P. vivax malaria in the immediate vicinity of houses. In order to assess the level of anti-CS antibodies we studied, by IRMA using the synthetic peptide corresponding to the repetitive epitope of the sporozoite CS protein, sera of individuals living in the same areas where the entomological survey has been performed. In this assay the prevalence of anti-CS antibodies was very low and did not reflect the malaria transmission rate in the studied areas. In relation to malaria diagnosis, a monoclonal antibody specific to an epitope of a 50 kDa exoantigen, the major component of supernatant collected at the time of schizont rupture, was used as a probe for the detection of P. falciparum antigens. This assay seemed to be more sensitive than parasitological examination for malaria diagnosis since it was able to detect plasmodial antigens in both symptomatic and asymtomatic individuals with negative thick blood smear at different intervals after a last parasitologically confirmed confirmed attack of malaria.

  9. Sorption-desorption of antimony species onto calcined hydrotalcite: Surface structure and control of competitive anions.

    Science.gov (United States)

    Constantino, Leonel Vinicius; Quirino, Juliana Nunes; Abrão, Taufik; Parreira, Paulo Sérgio; Urbano, Alexandre; Santos, Maria Josefa

    2018-02-15

    Calcined hydrotalcite can be applied to remove anionic contaminants from aqueous systems such as antimony species due to its great anion exchange capacity and high surface area. Hence, this study evaluated antimonite and antimonate sorption-desorption processes onto calcined hydrotalcite in the presence of nitrate, sulfate and phosphate. Sorption and desorption experiments of antimonite and antimonate were carried out in batch equilibrium and the post-sorption solids were analyzed by X-ray fluorescence (EDXRF). Sorption data were better fitted by dual-mode Langmuir-Freundlich model (R 2 >0.99) and desorption data by Langmuir model. High maximum sorption capacities were found for the calcined hydrotalcite, ranging from 617 to 790meqkg -1 . The competing anions strongly affected the antimony sorption. EDXRF analysis and mathematical modelling showed that sulfate and phosphate presented higher effect on antimonite and antimonate sorption, respectively. High values for sorption efficiency (SE=99%) and sorption capacity were attributed to the sorbent small particles and the large surface area. Positive hysteresis indexes and low mobilization factors (MF>3%) suggest very low desorption capacity to antimony species from LDH. These calcined hydrotalcite characteristics are desirable for sorption of antimony species from aqueous solutions. Copyright © 2017. Published by Elsevier B.V.

  10. Selected anionic and cationic surface active agents: case study on the Kłodnica sediments

    Directory of Open Access Journals (Sweden)

    Olkowska Ewa

    2017-03-01

    Full Text Available Surface active agents (surfactants are a group of chemical compounds, which are used as ingredients of detergents, cleaning products, cosmetics and functional products. After use, wastes containing surfactants or their degradation products are discharged to wastewater treatment plants or directly into surface waters. Due to their specific properties of SAAs, compounds are able to migrate between different environmental compartments such as soil, sediment, water or even living organisms and accumulate there. Surfactants can have a harmful effect on living organisms. They can connect with bioactive molecules and modify their function. Additionally, they have the ability to migrate into cells and cause their damage or death. For these reasons investigation of individual surfactants should be conducted. The presented research has been undertaken to obtain information about SAA contamination of sediment from the River Kłodnica catchment caused by selected anionic (linear alkylbenzene sulfonates (LAS C10-C13 and cationic (alkylbenzyldimethylammonium (BDMA-C12-16, alkyl trimethyl ammonium (DTMA, hexadecyl piridinium chloride (HP chlorides surfactants. This river flows through an area of the Upper Silesia Industrial Region where various companies and other institutions (e.g. coal mining, power plants, metallurgy, hospitals are located. To determine their concentration the following analytical tools have been applied: accelerated solvent extraction– solid phase extraction – high performance liquid chromatography – UV-Vis (anionic SAAs and conductivity (cationic SAAs detectors. In all sediments anionic SAAs have been detected. The concentrations of HTMA and BDMA-C16 in tested samples were higher than other cationic analytes. Generally, levels of surfactants with longer alkyl chains were higher and this observation can confirm their higher susceptibility to sorption on solid surfaces.

  11. On the effect of image states on resonant neutralization of hydrogen anions near metal surfaces

    International Nuclear Information System (INIS)

    Chakraborty, Himadri S.; Niederhausen, Thomas; Thumm, Uwe

    2005-01-01

    We directly assess the role of image state electronic structures on the ion-survival by comparing the resonant charge transfer dynamics of hydrogen anions near Pd(1 1 1), Pd(1 0 0), and Ag(1 1 1) surfaces. Our simulations show that image states that are degenerate with the metal conduction band favor the recapture of electrons by outgoing ions. In sharp contrast, localized image states that occur inside the band gap hinder the recapture process and thus enhance the ion-neutralization probability

  12. Surface properties and aggregate morphology of partially fluorinated carboxylate-type anionic gemini surfactants.

    Science.gov (United States)

    Yoshimura, Tomokazu; Bong, Miri; Matsuoka, Keisuke; Honda, Chikako; Endo, Kazutoyo

    2009-11-01

    Three anionic homologues of a novel partially fluorinated carboxylate-type anionic gemini surfactant, N,N'-di(3-perfluoroalkyl-2-hydroxypropyl)-N,N'-diacetic acid ethylenediamine (2C(n)(F) edda, where n represents the number of carbon atoms in the fluorocarbon chain (4, 6, and 8)) were synthesized. In these present gemini surfactants, the relatively small carboxylic acid moieties form hydrophilic head groups. The surface properties or structures of the aggregates of these surfactants are strongly influenced by the nonflexible fluorocarbons and small head groups; this is because these surfactants have a closely packed molecular structure. The equilibrium surface tension properties of these surfactants were measured at 298.2K for various fluorocarbon chain lengths. The plot of the logarithm of the critical micelle concentration (cmc) against the fluorocarbon chain lengths for 2C(n)(F) edda (n=4, 6, and 8) showed a minimum for n=6. Furthermore, the lowest surface tension of 2C(6)(F) edda at the cmc was 16.4mNm(-1). Such unique behavior has not been observed even in the other fluorinated surfactants. Changes in the shapes and sizes of these surfactant aggregate with concentration were investigated by dynamic light scattering and transmission electron microscopy (TEM). The TEM micrographs showed that in an aqueous alkali solution, 2C(n)(F) edda mainly formed aggregates with stringlike (n=4), cagelike (n=6), and distorted bilayer structures (n=8). The morphological changes in the aggregates were affected by the molecular structure composed of nonflexible fluorocarbon chains and flexible hydrocarbon chains.

  13. Combined DFT and XPS investigation of iodine anions adsorption on the sulfur terminated (001) chalcopyrite surface

    Energy Technology Data Exchange (ETDEWEB)

    Li, Kui, E-mail: likui9606@stu.xjtu.edu.cn [School of Nuclear Science and Technology, Xi’an Jiaotong University, Xi’an 710049 (China); Zhao, Yaolin, E-mail: zhaoyaolin@mail.xjtu.edu.cn [School of Nuclear Science and Technology, Xi’an Jiaotong University, Xi’an 710049 (China); Zhang, Peng, E-mail: zp32@qq.com [Sino Shaanxi Nuclear Industry Group, Xi’an 710100 (China); He, Chaohui, E-mail: hechaohui@mail.xjtu.edu.cn [School of Nuclear Science and Technology, Xi’an Jiaotong University, Xi’an 710049 (China); Deng, Jia, E-mail: djkokocase@stu.xjtu.edu.cn [School of Nuclear Science and Technology, Xi’an Jiaotong University, Xi’an 710049 (China); Ding, Shujiang, E-mail: dingsj@mail.xjtu.edu.cn [Department of Applied Chemistry, School of Science, Xi’an Jiaotong University, Xi’an 710049 (China); Shi, Weiqun, E-mail: shiwq@ihep.ac.cn [Key Laboratory of Nuclear Radiation and Nuclear Energy Technology and Key Laboratory for Biomedical Effects of Nanomaterials and Nanosafety, Institute of High Energy Physics, Chinese Academy of Sciences, Beijing 100049 (China)

    2016-12-30

    Highlights: • Metal surface sites of (001)-S surface of chalcopyrite show significant chemical affinity to iodide and iodate. • The energetically favorable active site is copper for iodide adsorption and iron for iodate adsorption, respectively. • Iodate undergoes a dissociative adsorption on the copper site of chalcopyrite surface. - Abstract: The adsorption of iodine anions (iodide and iodate) on the sulfur terminated (001) chalcopyrite surface has been systematically investigated combining first-principles calculations based on density functional theory (DFT) with X-ray photoelectron spectroscopy (XPS) measurements. Based on the total energy calculations and geometric optimization, the thermodynamically preferred site was copper atom for iodide adsorption and iron atom for iodate adsorption, respectively. In the case of Cu site mode, the iodate underwent a dissociative adsorption, where one I−O bond of iodate ion was broken and the dissociative oxygen atom adsorbed on the adjacent sulphur site. Projected density of states (PDOS) analysis further clarified the interaction mechanism between active sites of chalcopyrite surface and adsorbates. In addition, full-range XPS spectra qualitatively revealed the presence of iodine on chalcopyrite surface. High resolution XPS spectra of the I 3d peaks after adsorption verified the chemical environment of iodine. The binding energies of 618.8 eV and 623.5 eV for I 3d{sub 5/2} peaks unveiled that the adsorption of iodide and iodate ions on copper-iron sulfide minerals was the result of formation of low solubility metal iodides precipitate. Also two I 3d peaks with low intensity around 618 eV and 630 eV might be related to the inorganic reduction of iodate to iodide by reducing S{sup 2−} ion of chalcopyrite.

  14. Preparation of Two-Layer Anion-Exchange Poly(ethersulfone Based Membrane: Effect of Surface Modification

    Directory of Open Access Journals (Sweden)

    Lucie Zarybnicka

    2016-01-01

    Full Text Available The present work deals with the surface modification of a commercial microfiltration poly(ethersulfone membrane by graft polymerization technique. Poly(styrene-co-divinylbenzene-co-4-vinylbenzylchloride surface layer was covalently attached onto the poly(ethersulfone support layer to improve the membrane electrochemical properties. Followed by amination, a two-layer anion-exchange membrane was prepared. The effect of surface layer treatment using the extraction in various solvents on membrane morphological and electrochemical characteristics was studied. The membranes were tested from the point of view of water content, ion-exchange capacity, specific resistance, permselectivity, FT-IR spectroscopy, and SEM analysis. It was found that the two-layer anion-exchange membranes after the extraction using tetrahydrofuran or toluene exhibited smooth and porous surface layer, which resulted in improved ion-exchange capacity, electrical resistance, and permselectivity of the membranes.

  15. Myxosporean plasmodial infection associated with ulcerative lesions in young-of-the-year Atlantic menhaden in a tributary of the Chesapeake Bay, and possible links to Kudoa clupeidae

    Science.gov (United States)

    Reimschuessel, R.; Gieseker, C.M.; Driscoll, C.; Baya, A.; Kane, A.S.; Blazer, V.S.; Evans, J.J.; Kent, M.L.; Moran, J.D.W.; Poynton, S.L.

    2003-01-01

    Ulcers in Atlantic menhaden Brevoortia tyrannus (Latrobe) (Clupeidae), observed along the USA east coast, have been attributed to diverse etiologies including bacterial, fungal and, recently, harmful algal blooms. To understand the early pathogenesis of these lesions, we examined juvenile Atlantic menhaden collected during their seasonal presence in Chesapeake Bay tributaries from April to October 1999 and from March to August 2000. We conducted histopathological examinations of young-of-the-year fish from the Pocomoke River tributary, which has a history of fish mortalities and high lesion prevalence. Kudoa clupeidae (Myxozoa: Myxosporea) spores were present in the muscles of fish collected in both years. Of the fish assessed by histology in April, 5 to 14% were infected, while in May 90 to 96% were infected. Infection rates remained high during the summer. Mature spores were primarily located within myomeres and caused little or no observable pathological changes. Ultrastructure showed spores with capsulogenic cells bearing filamentous projections, and a basal crescentic nucleus with mottled nucleoplasm containing cleaved, condensed chromatin. Also, a highly invasive plasmodial stage of a myxozoan was found in the lesions of juvenile Atlantic menhaden. The plasmodia were observed in fish collected between May and July, with the maximum occurrence in late June 1999 and late May 2000. Plasmodia penetrated and surrounded muscle bundles, causing grossly observable raised lesions in 73% of all fish infected with this invasive stage. Plasmodia were also detected in the visceral organs, branchial arches, and interocular muscles of some fish. Some of the invasive extrasporogonic plasmodial lesions were associated with ulcers and chronic inflammatory infiltrates. The plasmodial stage appeared to slough out of the tissue with subsequent evidence of wound healing. Ultrastructure showed plasmodia with an elaborate irregular surface, divided into distinct ectoplasm and

  16. Novel ion-molecular surface reaction to result in CH3 adsorbates on (111) surface of chemical vapor deposition diamond from ethane and surface anionic sites

    International Nuclear Information System (INIS)

    Komatsu, Shojiro; Okada, Katsuyuki; Shimizu, Yoshiki; Moriyoshi, Yusuke

    2001-01-01

    The existence of CH 3 adsorbates on (111) surface of chemical vapor deposited diamond, which was observed by scanning tunneling microscopy, was explained by the following S N 2 (bimolecular, substitutional, and nucleophilic) type surface reaction; C(s) - +C 2 H 6 ->C(s)-CH 3 +CH 3 - , where C(s) denotes a surface carbon atom. The activation energy was estimated to be 36.78 kcal/mol and the reaction proved to be exothermic with the enthalpy change of -9.250 kcal/mol, according to ab initio molecular orbital calculations at MP2/3-21+G * //RHF/3-21G * level; this result is consistent with typical substrate temperatures, namely about 900 degree C, for chemical vapor deposition of diamond. Charge transfer from the highest occupied molecular orbital of the surface anionic site to the lowest unoccupied molecular orbital of ethane, that is antibonding at the CH 3 - CH 3 bond, has been clearly visualized. A characteristic configuration of an ethane molecule which is associated with an anionic vacant site C(s) - on hydrogenated (111) surface of diamond was also found. [copyright] 2001 American Institute of Physics

  17. Using AFM to probe the complexation of DNA with anionic lipids mediated by Ca(2+): the role of surface pressure.

    Science.gov (United States)

    Luque-Caballero, Germán; Martín-Molina, Alberto; Sánchez-Treviño, Alda Yadira; Rodríguez-Valverde, Miguel A; Cabrerizo-Vílchez, Miguel A; Maldonado-Valderrama, Julia

    2014-04-28

    Complexation of DNA with lipids is currently being developed as an alternative to classical vectors based on viruses. Most of the research to date focuses on cationic lipids owing to their spontaneous complexation with DNA. Nonetheless, recent investigations have revealed that cationic lipids induce a large number of adverse effects on DNA delivery. Precisely, the lower cytotoxicity of anionic lipids accounts for their use as a promising alternative. However, the complexation of DNA with anionic lipids (mediated by cations) is still in early stages and is not yet well understood. In order to explore the molecular mechanisms underlying the complexation of anionic lipids and DNA we proposed a combined methodology based on the surface pressure-area isotherms, Gibbs elasticity and Atomic Force Microscopy (AFM). These techniques allow elucidation of the role of the surface pressure in the complexation and visualization of the interfacial aggregates for the first time. We demonstrate that the DNA complexes with negatively charged model monolayers (DPPC/DPPS 4 : 1) only in the presence of Ca(2+), but is expelled at very high surface pressures. Also, according to the Gibbs elasticity plot, the complexation of lipids and DNA implies a whole fluidisation of the monolayer and a completely different phase transition map in the presence of DNA and Ca(2+). AFM imaging allows identification for the first time of specific morphologies associated with different packing densities. At low surface coverage, a branched net like structure is observed whereas at high surface pressure fibers formed of interfacial aggregates appear. In summary, Ca(2+) mediates the interaction between DNA and negatively charged lipids and also the conformation of the ternary system depends on the surface pressure. Such observations are important new generic features of the interaction between DNA and anionic lipids.

  18. Influence of hydrogen bond accepting ability of anions on the adsorption performance of ionic liquid surface molecularly imprinted polymers.

    Science.gov (United States)

    Zhu, Guifen; Gao, Xia; Wang, Xiaolong; Wang, Jianji; Fan, Jing

    2018-01-12

    To illuminate the influence mechanism of anionic structure of ionic liquids (ILs) on the adsorption performance of surface molecularly imprinted polymers (MIPs), in this work, six newly designed MIPs were prepared on the surface of amino-poly(styrene-divinylbenzene) particles by using imidazolium ILs with the same cation [C 4 mim] + but different anions (Cl, CH 3 SO 3 , PF 6 , BF 4 , C 4 F 7 O 2 , C 4 F 9 SO 3 ) as template molecules, methacrylic acid as functional monomer, and ethylene dimethacrylate as cross-linker. The resulting MIP materials were characterized by IR and SEM, and the influence of hydrogen bond accepting ability of anions on the adsorption performance of the MIPs for the ILs was investigated in acetonitrile. It was found that adsorption capacity of the MIPs towards the ILs decreased in the order MIP [C4mim][Cl]  > MIP [C4mim][C4F7O2]  ≥ MIP [C4mim][BF4] and MIP [C4mim][CH3SO3]  > MIP [C4mim][C4F9SO3]  > MIP [C4mim][PF6] , which is in good agreement with the ability of anions of the ILs to form hydrogen bonds. Ultraviolet, 1 H-NMR and 35 Cl-NMR spectroscopy was then used to study the interactions of anions of the ILs with the functional monomer. It was found that the hydrogen bond interaction between anions of the ILs and acidic proton of the functional monomer was the main driving force for the high adsorption selectivity of the imprinted polymers, and the stronger hydrogen bond interaction indicates higher binding capacity and higher selectivity of the polymers towards the ILs. It was also verified that the ILs with stronger hydrogen bond accepting ability of anions could be selectively extracted by the corresponding IL-MIPs. These results may provide new insight into the recognition mechanism of MIPs for ILs, and are also useful for the rational design of this new class of imprinting materials. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Band-gap-confinement and image-state-recapture effects in the survival of anions scattered from metal surfaces

    International Nuclear Information System (INIS)

    Schmitz, Andrew; Shaw, John; Chakraborty, Himadri S.; Thumm, Uwe

    2010-01-01

    The resonant charge transfer process in the collision of hydrogen anions with metal surfaces is described within a single-active-electron wave-packet propagation method. The ion-survival probability is found to be strongly enhanced at two different surface-specific perpendicular velocities of the ion. It is shown that, while the low-velocity enhancement is induced from a dynamical confinement of the ion level inside the band gap, the high-velocity enhancement is due to electron recapture from transiently populated image states. Results are presented for Li(110), Cu(111), and Pd(111) surfaces.

  20. Anion-π Catalysis of Enolate Chemistry: Rigidified Leonard Turns as a General Motif to Run Reactions on Aromatic Surfaces.

    Science.gov (United States)

    Cotelle, Yoann; Benz, Sebastian; Avestro, Alyssa-Jennifer; Ward, Thomas R; Sakai, Naomi; Matile, Stefan

    2016-03-18

    To integrate anion-π, cation-π, and ion pair-π interactions in catalysis, the fundamental challenge is to run reactions reliably on aromatic surfaces. Addressing a specific question concerning enolate addition to nitroolefins, this study elaborates on Leonard turns to tackle this problem in a general manner. Increasingly refined turns are constructed to position malonate half thioesters as close as possible on π-acidic surfaces. The resulting preorganization of reactive intermediates is shown to support the disfavored addition to enolate acceptors to an absolutely unexpected extent. This decisive impact on anion-π catalysis increases with the rigidity of the turns. The new, rigidified Leonard turns are most effective with weak anion-π interactions, whereas stronger interactions do not require such ideal substrate positioning to operate well. The stunning simplicity of the motif and its surprisingly strong relevance for function should render the introduced approach generally useful. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Preparation of a surface-grafted imprinted ceramic membrane for selective separation of molybdate anion from water solutions.

    Science.gov (United States)

    Zeng, Jianxian; Dong, Zhihui; Zhang, Zhe; Liu, Yuan

    2017-07-05

    A surface-grafted imprinted ceramic membrane (IIP-PVI/CM) for recognizing molybdate (Mo(VI)) anion was prepared by surface-initiated graft-polymerization. Firstly, raw alumina ceramic membrane (CM) was deposited with SiO 2 active layer by situ hydrolysis deposition method. Subsequently, γ-methacryloxy propyl trimethoxyl silane (MPS) was used as a coupling agent to introduce double bonds onto the SiO 2 layer (MPS-CM). Then, 1-vinylimidazole (VI) was employed as a functional monomer to graft-polymerization onto the MPS-CM (PVI-CM). During the graft-polymerization, the influence factors of grafting degree of PVI were investigated in detail. Under optimum conditions (monomer concentration 20wt%, temperature 70°C, initiator amount 1.1wt% and reaction time 8h), the grafting degree of 20.39g/100g was obtained. Further, Mo(VI) anion was used as a template to imprint in the PVI-CM by employing 1,6-dibromohexane as a cross-linking agent, and then Mo(VI) was removed, obtaining the IIP-PVI/CM with many imprinted cavities for Mo(VI). Thereafter, static adsorption and dynamic separation properties of IIP-PVI/CM for Mo(VI) were studied. Results indicate that IIP-PVI/CM shows a specific selectivity for Mo(VI) with the adsorption capacity of 0.69mmol/100g, and the selectivity coefficient of IIP-PVI/CM is 7.48 for molybdate to tungstate anions. During the dynamic separation, IIP-PVI/CM has also good selectivity for separation of Mo(VI) and W(VI) anions. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Enolate Stabilization by Anion-π Interactions: Deuterium Exchange in Malonate Dilactones on π-Acidic Surfaces.

    Science.gov (United States)

    Miros, François N; Zhao, Yingjie; Sargsyan, Gevorg; Pupier, Marion; Besnard, Céline; Beuchat, César; Mareda, Jiri; Sakai, Naomi; Matile, Stefan

    2016-02-18

    Of central importance in chemistry and biology, enolate chemistry is an attractive topic to elaborate on possible contributions of anion-π interactions to catalysis. To demonstrate the existence of such contributions, experimental evidence for the stabilization of not only anions but also anionic intermediates and transition states on π-acidic aromatic surfaces is decisive. To tackle this challenge for enolate chemistry with maximal precision and minimal uncertainty, malonate dilactones are covalently positioned on the π-acidic surface of naphthalenediimides (NDIs). Their presence is directly visible in the upfield shifts of the α-protons in the (1) H NMR spectra. The reactivity of these protons on π-acidic surfaces is measured by hydrogen-deuterium (H-D) exchange for 11 different examples, excluding controls. The velocity of H-D exchange increases with π acidity (NDI core substituents: SO2 R>SOR>H>OR>OR/NR2 >SR>NR2 ). The H-D exchange kinetics vary with the structure of the enolate (malonates>methylmalonates, dilactones>dithiolactones). Moreover, they depend on the distance to the π surface (bridge length: 11-13 atoms). Most importantly, H-D exchange depends strongly on the chirality of the π surface (chiral sulfoxides as core substituents; the crystal structure of the enantiopure (R,R,P)-macrocycle is reported). For maximal π acidity, transition-state stabilizations up to -18.8 kJ mol(-1) are obtained for H-D exchange. The Brønsted acidity of the enols increases strongly with π acidity of the aromatic surface, the lowest measured pKa =10.9 calculates to a ΔpKa =-5.5. Corresponding to the deprotonation of arginine residues in neutral water, considered as "impossible" in biology, the found enolate-π interactions are very important. The strong dependence of enolate stabilization on the unprecedented seven-component π-acidity gradient over almost 1 eV demonstrates quantitatively that such important anion-π activities can be expected only from

  3. Hofmeister Effect on PNIPAM in Bulk and at an Interface: Surface Partitioning of Weakly Hydrated Anions

    DEFF Research Database (Denmark)

    Moghaddam, Saeed Zajforoushan; Thormann, Esben

    2017-01-01

    The effect of sodium fluoride, sodium trichloroacetate, and sodium thiocyanate on the stability and conformation of poly(N-isopropylacrylamide), in bulk solution and at the gold-aqueous interface, is investigated by differential scanning calorimetry, dynamic light scattering, quartz crystal...... for thiocyanate and trichloroacetate, a salting-out effect is found for sodium trichloroacetate. This apparent contradiction is explained by a combination of previously suggested mechanisms for the salting-out effect by weakly hydrated anions....

  4. Study of the surface-enhanced Raman spectroscopy of residual impurities in hydroxylamine-reduced silver colloid and the effects of anions on the colloid activity.

    Science.gov (United States)

    Dong, Xiao; Gu, Huaimin; Liu, Fangfang

    2012-03-01

    The paper investigated the residual ions in hydroxylamine-reduced silver colloid (HRSC) and the relationship between the condition of HRSC and the enhanced mechanisms of this colloid. We also detected the SERS of MB and studied the effects of anions on the Raman signal. In the case of HRSC, the bands of residual ions diminish while the bands of Ag-anions increase gradually with increasing the concentrations of Cl(-) and NO(3)(-). It means the affinity of residual ions on the silver surface is weaker than that of Cl(-) and NO(3)(-) and the residual ions are replaced gradually by the added Cl(-) or NO(3)(-). The Raman signal of residual ions can be detected by treatment with anions that do not bind strongly to the silver surface, such as SO(4)(2-). The most intense band of Ag-anions bonds can be also observed when adding weakly binding anions to the colloid. However, the anions which make up the Ag-anions bonds are residual Cl(-) and the effect of weakly binding anions is only to aggregate the silver particles. Residual Cl(-) can be replaced by I(-) which has the highest affinity. From the detection of methylene blue (MB), the effects of anions on the enhancement of Raman signal are discussed in detail, and these findings could make the conditions suitable for detecting analytes in high efficiency. This study will have a profound implication to SERS users about their interpretation of SERS spectra when obtaining these anomalous bands. Copyright © 2011 Elsevier B.V. All rights reserved.

  5. Acid/base bifunctional carbonaceous nanomaterial with large surface area: Preparation, characterization, and adsorption properties for cationic and anionic compounds

    Energy Technology Data Exchange (ETDEWEB)

    Li, Kai; Ma, Chun–Fang; Ling, Yuan; Li, Meng [Department of Chemistry, Faculty of Material Science and Chemistry, China University of Geosciences, Wuhan 430074 (China); Gao, Qiang, E-mail: gaoqiang@cug.edu.cn [Department of Chemistry, Faculty of Material Science and Chemistry, China University of Geosciences, Wuhan 430074 (China); Engineering Research Center of Nano-Geo Materials of Ministry of Education, China University of Geosciences, Wuhan 430074 (China); Luo, Wen–Jun, E-mail: heartnohome@yahoo.com.cn [Department of Chemistry, Faculty of Material Science and Chemistry, China University of Geosciences, Wuhan 430074 (China)

    2015-07-15

    Nanostructured carbonaceous materials are extremely important in the nano field, yet developing simple, mild, and “green” methods that can make such materials possess large surface area and rich functional groups on their surfaces still remains a considerable challenge. Herein, a one-pot and environment-friendly method, i.e., thermal treatment (180 °C; 18 h) of water mixed with glucose and chitosan (CTS), has been proposed. The resultant carbonaceous nanomaterials were characterized by field emitting scanning electron microscope, N{sub 2} adsorption/desorption, Fourier transform infrared spectroscope, X-ray photoelectron spectroscopy, and zeta-potential analysis. It was found that, in contrast to the conventional hydrothermally carbonized product from pure glucose, with low surface area (9.3 m{sup 2} g{sup −1}) and pore volume (0.016 cm{sup 3} g{sup −1}), the CTS-added carbonaceous products showed satisfactory textural parameters (surface area and pore volume up to 254 m{sup 2} g{sup −1} and 0.701 cm{sup 3} g{sup −1}, respectively). Moreover, it was also interestingly found that these CTS-added carbonaceous products possessed both acidic (–COOH) and basic (–NH{sub 2}) groups on their surfaces. Taking the advantages of large surface area and –COOH/–NH{sub 2} bifunctional surface, the carbonaceous nanomaterials exhibited excellent performance for adsorptions of cationic compound (i.e., methylene blue) at pH 10 and anionic compound (i.e., acid red 18) at pH 2, respectively. This work not only provides a simple and green route to prepare acid/base bifunctional carbonaceous nanomaterials with large surface area but also well demonstrates their potential for application in adsorption. - Highlights: • A simple and green method was proposed to prepare carbon nanomaterials. • The carbon product showed acid/base bifunctional surface with large surface area. • The carbon material could efficiently adsorb both cationic and anionic compounds.

  6. Anti-plasmodial and antioxidant activities of methanol extract of the ...

    African Journals Online (AJOL)

    This study was aimed at investigating the anti-plasmodial and antioxidant activities of the extract of the leaf of Lophira lanceolata, a traditional medicine recipe. The methanol extract (ME) obtained by 72 h cold maceration was evaluated for acute toxicity test (LD50) and phytochemical constituents. The suppressive and ...

  7. Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

    International Nuclear Information System (INIS)

    Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

    2005-01-01

    We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

  8. A combined chemical, spectroscopic and ab initio modelling approach to surface reactivity: application to the retention of anions by siderite

    International Nuclear Information System (INIS)

    Badaut, V.; Schlegel, M.; Zeller, Ph.; Moutiers, G.

    2010-01-01

    79 Selenium may be one of the few radioelements possibly migrating out of nuclear geological repositories. Selenium may yet be retain this Se, but the possible interactions between Se and siderite are yet poorly known. In this work, the interactions between selenium oxi-anions - selenate and selenite - and siderite were investigated. Solution experiments have showed that dissolved selenite (≤ 10 -3 M) is quantitatively immobilized by siderite (75 g/L) after 48 h of reaction time, when selenate is only partly immobilized after 10 days. In the selenite case, XAS showed that immobilized selenium is initially present as Se(IV) probably sorbed on siderite surface. After 10 days of reaction, selenite ions are quantitatively reduced and form poorly crystalline elementary selenium. On the other hand, selenate retained b y siderite does not appear to be significantly reduced over the probed timescale (10 days). To better understand the mechanism of selenite reduction by siderite, the properties of bulk and perfect surfaces of siderite were modelled using DFT. The properties of the valence electrons could be correctly described only if the symmetry of the fundamental state electronic density is lower than the experimental crystallographic symmetry. We we modelled the retention of simple molecules as O 2 or H 2 O on siderite and magnesite (10-14) perfect surfaces. Our results are in good agreement with the literature. Finally, the modelling of selenite surface complexes on magnesite is performed with and without hydration. (authors)

  9. Surface tensions of binary mixtures of ionic liquids with bis(trifluoromethylsulfonyl)imide as the common anion

    International Nuclear Information System (INIS)

    Oliveira, M.B.; Domínguez-Pérez, M.; Cabeza, O.; Lopes-da-Silva, J.A.; Freire, M.G.; Coutinho, J.A.P.

    2013-01-01

    Highlights: • Novel data for the surface tensions of mixtures [C 4 mim][NTf 2 ] + [C 4 C 1 mim]/[C 3 mpy]/[C 3 mpyr]/[C 3 mpip][NTf 2 ] are presented. • γ were determined at a fixed temperature, 298.2 K, and at atmospheric pressure, for the whole composition range. • Surface tension deviations showed the near ideal behavior of the selected mixtures. • Gibbs adsorption isotherms showed the surface preferential adsorption of one ionic liquid over the other. -- Abstract: While values for thermophysical properties of ionic liquids are becoming widely available, data for ionic liquid mixtures are still scarce. In an effort to overcome this limitation and understand the behavior of ionic liquid mixtures, novel data for the surface tension of mixtures composed of 1-butyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide, [C 4 mim][NTf 2 ], with other ionic liquids with a common anion, namely 1-butyl-2,3-dimethylimidazolium, [C 4 C 1 mim] + , 3-methyl-1-propylpyridinium, [C 3 mpy] + , 1-methyl-1-propylpyrrolidinium, [C 3 mpyr] + , and 1-methyl-1-propylpiperidinium, [C 3 mpip] + , were measured at T = 298.2 K and atmospheric pressure over the entire composition range. From the surface tension deviations derived from the experimental results, it was possible to infer that the cation alkyl chain length of the second ionic liquid constituting the mixture has a stronger influence in the ideal mixture behavior than the type of family the ionic liquid cation belongs to. The Gibbs adsorption isotherms, estimated from the experimental values, show that the composition of the vapor–liquid interface is not the same as that of the bulk and that the interface is richer in the ionic liquid with the lowest surface tension, [C 4 mim][NTf 2

  10. Electric and electrochemical properties of surface films formed on copper in the presence of bicarbonate anions

    International Nuclear Information System (INIS)

    Sirkiae, P.; Saario, T.; Maekelae, K.; Laitinen, T.; Bojinov, M.

    1999-01-01

    Copper is used as an outer shield of cast iron canisters planned for storage of spent nuclear fuel. The copper shield is responsible for the corrosion protection of the canister. The aim of the present work was to study the influence of bicarbonate (HCO 3 - ) anions on the stability of the copper oxide film. The work consists of a brief literature survey and an experimental part, in which voltammetry, electrochemical impedance spectroscopy and dc resistance measurements via the Contact Electric Resistance (CER) technique were used. The studies reported in the literature indicated that HCO 3 - ions increase the solubility of copper in the stability region of Cu(II). Thus they render the oxide film formed on copper susceptible to local damage and to localised corrosion at high potentials. Unfortunately, despite the great importance of bicarbonates in copper corrosion, most of the environments used in the electrochemical and corrosion studies are not comparable with repository conditions. In the existing studies either the bicarbonate concentrations or pH of the solutions were too high. In addition, no such studies were available, in which not only the effect of carbonate ions, but also possible synergetic effects of them with other aggressive ions would have been clarified. The voltammetric results of the experimental part of this work point to a bilayer structure of the anodic film on copper in neutral solutions containing HCO 3 - ions. The transport of ionic defects through a thin continuous p-type semiconductor layer was concluded to be the rate limiting step of the anodic oxidation of copper in the stability region of monovalent copper and in the mixed oxide (Cu(I)/Cu(II) oxide) region. Films formed in the divalent copper region did not show well-pronounced semiconductor behaviour. Substantial evidence was found in the voltammetric, CER and impedance results for the increased defectiveness of the anodic film in the Cu(II) region. The oxidation rate of copper in

  11. Electric and electrochemical properties of surface films formed on copper in the presence of bicarbonate anions

    Energy Technology Data Exchange (ETDEWEB)

    Sirkiae, P.; Saario, T.; Maekelae, K.; Laitinen, T.; Bojinov, M. [VTT Manufacturing Technology, Espoo (Finland)

    1999-11-01

    Copper is used as an outer shield of cast iron canisters planned for storage of spent nuclear fuel. The copper shield is responsible for the corrosion protection of the canister. The aim of the present work was to study the influence of bicarbonate (HCO{sub 3}{sup -}) anions on the stability of the copper oxide film. The work consists of a brief literature survey and an experimental part, in which voltammetry, electrochemical impedance spectroscopy and dc resistance measurements via the Contact Electric Resistance (CER) technique were used. The studies reported in the literature indicated that HCO{sub 3}{sup -} ions increase the solubility of copper in the stability region of Cu(II). Thus they render the oxide film formed on copper susceptible to local damage and to localised corrosion at high potentials. Unfortunately, despite the great importance of bicarbonates in copper corrosion, most of the environments used in the electrochemical and corrosion studies are not comparable with repository conditions. In the existing studies either the bicarbonate concentrations or pH of the solutions were too high. In addition, no such studies were available, in which not only the effect of carbonate ions, but also possible synergetic effects of them with other aggressive ions would have been clarified. The voltammetric results of the experimental part of this work point to a bilayer structure of the anodic film on copper in neutral solutions containing HCO{sub 3}{sup -}ions. The transport of ionic defects through a thin continuous p-type semiconductor layer was concluded to be the rate limiting step of the anodic oxidation of copper in the stability region of monovalent copper and in the mixed oxide (Cu(I)/Cu(II) oxide) region. Films formed in the divalent copper region did not show well-pronounced semiconductor behaviour. Substantial evidence was found in the voltammetric, CER and impedance results for the increased defectiveness of the anodic film in the Cu(II) region. The

  12. Topology of the Adiabatic Potential Energy Surfaces for theResonance States of the Water Anion

    Energy Technology Data Exchange (ETDEWEB)

    Haxton, Daniel J.; Rescigno, Thomas N.; McCurdy, C. William

    2005-04-15

    The potential energy surfaces corresponding to the long-lived fixed-nuclei electron scattering resonances of H{sub 2}O relevant to the dissociative electron attachment process are examined using a combination of ab initio scattering and bound-state calculations. These surfaces have a rich topology, characterized by three main features: a conical intersection between the {sup 2}A{sub 1} and {sup 2}B{sub 2} Feshbach resonance states; charge-transfer behavior in the OH ({sup 2}{Pi}) + H{sup -} asymptote of the {sup 2}B{sub 1} and {sup 2}A{sub 1} resonances; and an inherent double-valuedness of the surface for the {sup 2}B{sub 2} state the C{sub 2v} geometry, arising from a branch-point degeneracy with a {sup 2}B{sub 2} shape resonance. In total, eight individual seams of degeneracy among these resonances are located.

  13. Surface coating of siRNA-peptidomimetic nano-self-assemblies with anionic lipid bilayers: enhanced gene silencing and reduced adverse effects in vitro

    Science.gov (United States)

    Zeng, Xianghui; de Groot, Anne Marit; Sijts, Alice J. A. M.; Broere, Femke; Oude Blenke, Erik; Colombo, Stefano; van Eden, Willem; Franzyk, Henrik; Nielsen, Hanne Mørck; Foged, Camilla

    2015-11-01

    Cationic vectors have demonstrated the potential to facilitate intracellular delivery of therapeutic oligonucleotides. However, enhanced transfection efficiency is usually associated with adverse effects, which also proves to be a challenge for vectors based on cationic peptides. In this study a series of proteolytically stable palmitoylated α-peptide/β-peptoid peptidomimetics with a systematically varied number of repeating lysine and homoarginine residues was shown to self-assemble with small interfering RNA (siRNA). The resulting well-defined nanocomplexes were coated with anionic lipids giving rise to net anionic liposomes. These complexes and the corresponding liposomes were optimized towards efficient gene silencing and low adverse effects. The optimal anionic liposomes mediated a high silencing effect, which was comparable to that of the control (cationic Lipofectamine 2000), and did not display any noticeable cytotoxicity and immunogenicity in vitro. In contrast, the corresponding nanocomplexes mediated a reduced silencing effect with a more narrow safety window. The surface coating with anionic lipid bilayers led to partial decomplexation of the siRNA-peptidomimetic nanocomplex core of the liposomes, which facilitated siRNA release. Additionally, the optimal anionic liposomes showed efficient intracellular uptake and endosomal escape. Therefore, these findings suggest that a more efficacious and safe formulation can be achieved by surface coating of the siRNA-peptidomimetic nano-self-assemblies with anionic lipid bilayers.Cationic vectors have demonstrated the potential to facilitate intracellular delivery of therapeutic oligonucleotides. However, enhanced transfection efficiency is usually associated with adverse effects, which also proves to be a challenge for vectors based on cationic peptides. In this study a series of proteolytically stable palmitoylated α-peptide/β-peptoid peptidomimetics with a systematically varied number of repeating lysine

  14. Mechanical, dielectric and surface analysis of hydroxyapatite doped anions for implantations

    Science.gov (United States)

    Helen, S.; Kumar, A. Ruban

    2018-04-01

    Calcium Phosphate has broad applications in field of medicine and in tissue engineering. In that hydroxyapatite is one of the calcium phosphate similar to bone and teeth mineral phase. The aim of this paper is to improve mechanical property of hydroxyapatite which has less mechanical strength by doping of ions. The ions increase its strength which can be used in various medical applications. Surface property of hydroxyapatite and electrical property of ion doped hydroxyapatite analyzed and shown that it can be used in implantations, coatings.

  15. Preparation of high-capacity, weak anion-exchange membranes by surface-initiated atom transfer radical polymerization of poly(glycidyl methacrylate) and subsequent derivatization with diethylamine

    International Nuclear Information System (INIS)

    Qian, Xiaolei; Fan, Hua; Wang, Chaozhan; Wei, Yinmao

    2013-01-01

    Ion-exchange membrane is of importance for the development of membrane chromatography. In this work, a high-capacity anion-exchange membrane was prepared by grafting of glycidyl methacrylate (GMA) onto the surface of regenerated cellulose (RC) membranes via surface-initiated atom transfer radical polymerization (SI-ATRP) and subsequent derivatization with diethylamine. Attenuated total reflectance Fourier-transform infrared (ATR-FTIR), X-ray photoelectron spectroscopy (XPS) and scanning electron microscopy (SEM) were used to characterize changes in the chemical functionality, surface topography and pore morphology of the modified membranes. The static capacity of the prepared anion-exchange membrane was evaluated with bovine serum albumin (BSA) as a model protein. The results indicated that the anion-exchange membrane which could reach a maximum capacity of 96 mg/mL for static adsorption possesses a higher adsorption capacity, and the adsorption capacity increases with the polymerization time. The effect of pH and salt concentration confirmed that the adsorption of BSA followed ion-exchange mechanism. The established method would have potential application in the preparation of anion-exchange membrane.

  16. [Cell surface peroxidase--generator of superoxide anion in wheat root cells under wound stress].

    Science.gov (United States)

    Chasov, A V; Gordon, L Kh; Kolesnikov, O P; Minibaeva, F V

    2002-01-01

    Development of wound stress in excised wheat roots is known to be accompanied with an increase in reactive oxygen species (ROS) production, fall of membrane potential, release of K+ from cells, alkalization of extracellular solution, changes in respiration and metabolism of structural lipids. Dynamics of superoxide release correlates with changes in other physiological parameters, indicating the cross-reaction of these processes. Activity of peroxidase in extracellular solution after a 1 h incubation and removal of roots was shown to be stimulated by the range of organic acids, detergents, metals, and to be inhibited by cyanide. Superoxide production was sensitive to the addition of Mn2+ and H2O2. Increase in superoxide production correlates with the enhancement of peroxidase activity at the application of organic acids and detergents. The results obtained indicate that cell surface peroxidase is one of the main generators of superoxide in wounded wheat root cells. Different ways of stimulation of the ROS producing activity in root cells is supposed. By controlling superoxide and hydrogen peroxide formation, the cell surface peroxidase can control the adaptation processes in stressed plant cells.

  17. Enhancement of 6-pentyl-α-pyrone fermentation activity in an extractive liquid-surface immobilization (Ext-LSI) system by mixing anion-exchange resin microparticles.

    Science.gov (United States)

    Oda, Shinobu; Michihata, Sayumi; Sakamoto, Naoki; Horibe, Hideo; Kono, Akihiko; Ohashi, Shinichi

    2012-12-01

    The addition of anion-exchange resin microparticles into a polyacrylonitrile (PAN) ballooned microsphere layer drastically enhanced the fermentative activity of Trichoderma atroviride AG2755-5NM398 in an extractive liquid-surface immobilization (Ext-LSI) system. The production of 6-pentyl-α-pyrone (6PP), a fungicidal secondary metabolite, was 1.92-fold higher than the control (PAN alone). Copyright © 2012 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  18. Surface tension and density for members of four ionic liquid homologous series containing a pyridinium based-cation and the bis(trifluoromethylsulfonyl)imide anion

    Czech Academy of Sciences Publication Activity Database

    Klomfar, Jaroslav; Součková, Monika; Pátek, Jaroslav

    2017-01-01

    Roč. 431, January (2017), s. 24-33 ISSN 0378-3812 R&D Projects: GA ČR GA13-00145S Institutional support: RVO:61388998 Keywords : ionic liquid * pyridinium-based cation * bis(trifluoromethylsulfonyl)imide anion * density-temperature relation * surface tension-temperature relation * recommended property values Subject RIV: BJ - Thermodynamics OBOR OECD: Thermodynamics Impact factor: 2.473, year: 2016

  19. Heterologous expression of plasmodial proteins for structural studies and functional annotation

    CSIR Research Space (South Africa)

    Birkholtz, LM

    2008-01-01

    Full Text Available Malaria Journal Open AcceReview Heterologous expression of plasmodial proteins for structural studies and functional annotation Lyn-Marie Birkholtz1, Gregory Blatch2, Theresa L Coetzer3, Heinrich C Hoppe1,4, Esmaré Human1, Elizabeth J Morris1,5, Zoleka Ngcete..., Kwadlangezwa, South Africa Email: Lyn-Marie Birkholtz - lbirkholtz@up.ac.za; Gregory Blatch - G.Blatch@ru.ac.za; Theresa L Coetzer - theresa.coetzer@nhls.ac.za; Heinrich C Hoppe - hhoppe@csir.co.za; Esmaré Human - esmare.human@up.ac.za; Elizabeth J Morris...

  20. DIVERSITY AND DISTRIBUTION OF PLASMODIAL MYXOMYCETES (SLIME MOLDS FROM LA MESA ECOPARK, QUEZON CITY, PHILIPPINES

    Directory of Open Access Journals (Sweden)

    THOMAS EDISON E. DELA CRUZ

    2010-10-01

    Full Text Available Myxomycetes are ubiquitous in terrestrial forest ecosystems. Thus, this research study looks at the taxonomic diversity and distribution of plasmodial myxomycetes in La Mesa Ecopark in Quezon City, Philippines. A total of 240 moist chambers were prepared from four substrates (aerial and ground leaf litter, twigs and barks collected within this ecopark. Following incubation of moist chambers for eight weeks, a total of 28 species belonging to 10 genera were collected and identified: Arcyria (3, Diderma (2, Didymium (5, Lamproderma (2, Perichaena (3, Physarum (8, Macbrideola (1, Metatrichia (1, Trichia (1 and Stemonitis (2. Highest myxomycete yield (85% was observed in aerial leaf litter. In terms of taxonomic diversity, highest diversity was observed in bark microhabitats, although the lowest number of species was recorded in it. Assessment of their abundance and distribution showed similarities in species composition between aerial and ground leaf litter. This research study is the first report of plasmodial myxomycetes in La Mesa Ecopark in Quezon City, Philippines.

  1. Anti-plasmodial activity of some Zulu medicinal plants and of some triterpenes isolated from them.

    Science.gov (United States)

    Simelane, Mthokozisi B C; Shonhai, Addmore; Shode, Francis O; Smith, Peter; Singh, Mogie; Opoku, Andy R

    2013-10-08

    Mimusops caffra E. Mey. ex A.DC and Mimusops obtusifolia Lam (both members of the Sapotaceae family), and Hypoxis colchicifolia Bak (family Hypoxidaceae) are used by traditional healers in Zululand to manage malaria. Anti-plasmodial investigation of the crude extracts and some triterpenes isolated from the plants showed activity against a chloroquine sensitive (CQS) strain of Plasmodium falciparum (D10). Among the crude extracts the leaves of M. caffra exhibited the highest activity, with an IC₅₀ of 2.14 μg/mL. The pentacyclic tritepenoid ursolic acid (1), isolated from the leaves of M. caffra was the most active compound (IC₅₀ 6.8 μg/mL) as compared to taraxerol (2) and sawamilletin (3) isolated from the stem bark of M. obtusifolia (IC₅₀ > 100). Chemical modification of the ursolic acid (1) to 3β-acetylursolic acid (4) greatly enhanced its anti-plasmodial activity. Compound 4 reduced parasitaemia against Plasmodium berghei by 94.01% in in vivo studies in mice. The cytotoxicity of 3β-acetylursolic acid (IC₅₀) to two human cell lines (HEK293 and HepG2) was 366.00 μg/mL and 566.09 μg/mL, respectively. The results validate the use of these plants in folk medicine.

  2. Surface- vs Diffusion-Limited Mechanisms of Anion Exchange in CsPbBr3 Nanocrystal Cubes Revealed through Kinetic Studies.

    Science.gov (United States)

    Koscher, Brent A; Bronstein, Noah D; Olshansky, Jacob H; Bekenstein, Yehonadav; Alivisatos, A Paul

    2016-09-21

    Ion-exchange transformations allow access to nanocrystalline materials with compositions that are inaccessible via direct synthetic routes. However, additional mechanistic insight into the processes that govern these reactions is needed. We present evidence for the presence of two distinct mechanisms of exchange during anion exchange in CsPbX3 nanocrystals (NCs), ranging in size from 6.5 to 11.5 nm, for transformations from CsPbBr3 to CsPbCl3 or CsPbI3. These NCs exhibit bright luminescence throughout the exchange, allowing their optical properties to be observed in real time, in situ. The iodine exchange presents surface-reaction-limited exchanges allowing all anionic sites within the NC to appear chemically identical, whereas the chlorine exchange presents diffusion-limited exchanges proceeding through a more complicated exchange mechanism. Our results represent the first steps toward developing a microkinetic description of the anion exchange, with implications not only for understanding the lead halide perovskites but also for nanoscale ion exchange in general.

  3. Anti-plasmodial action of de novo-designed, cationic, lysine-branched, amphipathic, helical peptides

    Directory of Open Access Journals (Sweden)

    Kaushik Naveen K

    2012-08-01

    Full Text Available Abstract Background A lack of vaccine and rampant drug resistance demands new anti-malarials. Methods In vitro blood stage anti-plasmodial properties of several de novo-designed, chemically synthesized, cationic, amphipathic, helical, antibiotic peptides were examined against Plasmodium falciparum using SYBR Green assay. Mechanistic details of anti-plasmodial action were examined by optical/fluorescence microscopy and FACS analysis. Results Unlike the monomeric decapeptides {(Ac-GXRKXHKXWA-NH2 (X = F,ΔF (Fm, ΔFm IC50 >100 μM}, the lysine-branched,dimeric versions showed far greater potency {IC50 (μM Fd 1.5 , ΔFd 1.39}. The more helical and proteolytically stable ΔFd was studied for mechanistic details. ΔFq, a K-K2 dendrimer of ΔFm and (ΔFm2 a linear dimer of ΔFm showed IC50 (μM of 0.25 and 2.4 respectively. The healthy/infected red cell selectivity indices were >35 (ΔFd, >20 (ΔFm2 and 10 (ΔFq. FITC-ΔFd showed rapid and selective accumulation in parasitized red cells. Overlaying DAPI and FITC florescence suggested that ΔFd binds DNA. Trophozoites and schizonts incubated with ΔFd (2.5 μM egressed anomalously and Band-3 immunostaining revealed them not to be associated with RBC membrane. Prematurely egressed merozoites from peptide-treated cultures were found to be invasion incompetent. Conclusion Good selectivity (>35, good resistance index (1.1 and low cytotoxicity indicate the promise of ΔFd against malaria.

  4. Development physicochemical and catalytic characteristics of Mo-containing catalysts for hydrotreatment based on various supports. 1. Adsorption of molybdate anions on the support surface

    International Nuclear Information System (INIS)

    Lur'e, M.A.; Kurest, I.Z.; Krasnopol'skaya, S.M.; Reznikov, S.A.; Babikov, A.F.; Shmidt, F.K.

    1994-01-01

    The amounts of basic OH-groups were determined by means of exchange by F-ions and the adsorption of Mo from acid and alkali ammonium paramolybdate (APM) solutions was investigated on the surface of hydrated titanium dioxide, γ-Al 2 O 3 and palygorskite-montmorillonite clay. The process is adequately described by the exchange equation at pH value of APM solution in excess of the isoelectric point (IEP) of the surface. At opposite correlation between pH of the solution and IEP the Langmuir model is adaptable. They concluded, on experimental data, that in the latter case OH-groups replaced by molybdate-anion stage of synthesis of catalyst. 22 refs., 3 figs

  5. The role of electrolyte anions (ClO4-, NO3-, and Cl-) in divalent metal (M2+) adsorption on oxide and hydroxide surfaces in salt solutions

    International Nuclear Information System (INIS)

    Criscenti, L.J.; Sverjensky, D.A.

    1999-01-01

    Adsorption of divalent metal ions (M 2+ ) onto oxide and hydroxide surfaces from solutions of strong electrolytes has typically been inferred to take place without the involvement of the electrolyte anion. Only in situations where M 2+ forms a strong enough aqueous complex with the electrolyte anion (for example, CdCl + or PbCl + ) has it been frequently suggested that the metal and the electrolyte anion adsorb simultaneously. A review of experimental data for the adsorption of Cd 2+ , Pb 2+ , Co 2+ , UO 2 2+ , Zn 2+ , Cu 2+ , Ba 2+ , Sr 2+ , and Ca 2+ onto quartz, silica, goethite, hydrous ferric oxide, corundum, γ-alumina, anatase, birnessite, and magnetite, from NaNO 3 , KNO 3 , NaCl, and NaClO 4 solutions over a wide range of ionic strengths (0.0001 M-1.0 M), reveals that transition and heavy metal adsorption behavior with ionic strength is a function of the type of electrolyte. In NaNO 3 solutions, metal adsorption exhibits little or no dependence on the ionic strength of the solution. However, in NaCl solutions, transition and heavy metal adsorption decreases strongly with increasing ionic strength. In NaClO 4 solutions, metal adsorption decreases strongly with increasing ionic strength. In NaClO 4 solutions, metal adsorption exhibits little dependence on ionic strength but is often suggestive of an increase in metal adsorption with increasing ionic strength. Analysis of selected adsorption edges was carried out using the extended triple-layer model and aqueous speciation models that included metal-nitrate, metal-chloride, and metal-hydroxide complexes

  6. Diffusion of I{sup -}, Cs{sup +}, and Sr{sup 2+} in compacted bentonite - Anion exclusion and surface diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Eriksen, T.E.; Jansson, Mats [Royal Inst. of Tech., Stockholm (Sweden). Dept. of Nuclear Chemistry

    1996-11-01

    The diffusion of I, Cs and Sr ions in bentonite compacted to a dry density of 1.8 gr/cm{sup 3} and saturated with two groundwaters of different ionic strength have been studied experimentally using the through diffusion technique. The I{sup -} diffusivity and diffusion porosity were found to be concentration independent in the concentration range exp(-8) to exp(-2) mol/dm{sup 3}. The diffusion porosity, being only a fraction of the water porosity for normal groundwaters, is strongly ionic strength dependent due to anion exclusion. The dependence of the diffusion of Cs{sup +} and Sr{sup 2+} on the sorption intensity is accommodated by a model encompassing diffusion of the sorbed cations within the electrical double layer next to the mineral surface in addition to diffusion in the pore water. 18 refs, 12 figs.

  7. Enhancing recovery of recombinant hepatitis B surface antigen in lab-scale and large-scale anion-exchange chromatography by optimizing the conductivity of buffers.

    Science.gov (United States)

    Mojarrad Moghanloo, Gol Mohammad; Khatami, Maryam; Javidanbardan, Amin; Hosseini, Seyed Nezamedin

    2018-01-01

    In biopharmaceutical science, ion-exchange chromatography (IEC) is a well-known purification technique to separate the impurities such as host cell proteins from recombinant proteins. However, IEC is one of the limiting steps in the purification process of recombinant hepatitis B surface antigen (rHBsAg), due to its low recovery rate (rate of 82% in both lab-scale and large-scale weak anion-exchange chromatography without any harsh effect on the purity percentage of rHBsAg. The recovery enhancement via increasing the conductivity of Eq. and Wash. buffers can be explained by their roles in reducing the binding strength and aggregation of retained particles in the column. Moreover, further increase in the salt concentration of Elut. Buffer could substantially promote the ion exchange process and the elution of retained rHBsAg. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. On the role of the plasmodial cytoskeleton in facilitating intelligent behavior in slime mold Physarum polycephalum

    Science.gov (United States)

    Mayne, Richard; Adamatzky, Andrew; Jones, Jeff

    2015-01-01

    The plasmodium of slime mold Physarum polycephalum behaves as an amorphous reaction-diffusion computing substrate and is capable of apparently ‘intelligent’ behavior. But how does intelligence emerge in an acellular organism? Through a range of laboratory experiments, we visualize the plasmodial cytoskeleton—a ubiquitous cellular protein scaffold whose functions are manifold and essential to life—and discuss its putative role as a network for transducing, transmitting and structuring data streams within the plasmodium. Through a range of computer modeling techniques, we demonstrate how emergent behavior, and hence computational intelligence, may occur in cytoskeletal communications networks. Specifically, we model the topology of both the actin and tubulin cytoskeletal networks and discuss how computation may occur therein. Furthermore, we present bespoke cellular automata and particle swarm models for the computational process within the cytoskeleton and observe the incidence of emergent patterns in both. Our work grants unique insight into the origins of natural intelligence; the results presented here are therefore readily transferable to the fields of natural computation, cell biology and biomedical science. We conclude by discussing how our results may alter our biological, computational and philosophical understanding of intelligence and consciousness. PMID:26478782

  9. Surface tension and 0.1 MPa density for members of homologous series of ionic liquids composed of imidazolium-, pyridinium-, and pyrrolidinium-based cations and of cyano-groups containing anions

    Czech Academy of Sciences Publication Activity Database

    Součková, Monika; Klomfar, Jaroslav; Pátek, Jaroslav

    2015-01-01

    Roč. 406, November (2015), s. 181-193 ISSN 0378-3812 R&D Projects: GA ČR GA13-00145S Institutional support: RVO:61388998 Keywords : ionic liquid * surface tension-temperature relation * density -temperature relation * cyano-funcionalized anion Subject RIV: BJ - Thermodynamics Impact factor: 1.846, year: 2015

  10. Uniform and pitting corrosion events induced by SCN- anions on Al alloys surfaces and the effect of UV light

    International Nuclear Information System (INIS)

    Amin, Mohammed A.

    2011-01-01

    The influence of the alloying elements on the uniform and pitting corrosion processes of Al-6061, Al-4.5%Cu, Al-7.5%Cu, Al-6%Si and Al-12%Si alloys was studied in 0.50 M KSCN solution at 25 o C. Open-circuit potential, Tafel polarization, linear polarization resistance (LPR) and ICP-AES measurements were used to study the uniform corrosion process on the surfaces of the tested alloys. Cyclic polarization, potentiostatic current-time transients and impedance techniques were employed for pitting corrosion studies. Obtained results were compared with pure Al. Passivation kinetics of the tested Al samples were also studied as a function of applied potential, [SCN - ] and sample composition by means of potentiostatic current transients. The induction time, after which the growth of stable pits occurs, decreased with increasing applied potential and [SCN - ]. Regarding to uniform corrosion, alloyed Cu was found to enhance the corrosion rate, while alloyed Si suppressed it. Alloying elements of the tested samples diminished pitting attack to an extent depending on the percentage of the alloying element in the sample. Among the investigated materials, Al-Si alloys exhibited the highest corrosion resistance towards uniform and pitting corrosion processes in KSCN solutions. The passive and dissolution behaviour of Al was also studied under the conditions of continuous illumination (300-450 nm) based on cyclic polarization and potentiostatic techniques. The incident photons had a little influence on pit initiation and a marked effect on pit growth. These explained in terms of a photo-induced modification of the passive film formed on the anode surface, which render it more resistant to pitting. The effects of UV photons energy and period of illumination on the morphology of the pitted surfaces were also studied.

  11. Pu Anion Exchange Process Intensification

    International Nuclear Information System (INIS)

    Taylor-Pashow, Kathryn M. L.

    2017-01-01

    This research is focused on improving the efficiency of the anion exchange process for purifying plutonium. While initially focused on plutonium, the technology could also be applied to other ion-exchange processes. Work in FY17 focused on the improvement and optimization of porous foam columns that were initially developed in FY16. These foam columns were surface functionalized with poly(4-vinylpyridine) (PVP) to provide the Pu specific anion-exchange sites. Two different polymerization methods were explored for maximizing the surface functionalization with the PVP. The open-celled polymeric foams have large open pores and large surface areas available for sorption. The fluid passes through the large open pores of this material, allowing convection to be the dominant mechanism by which mass transport takes place. These materials generally have very low densities, open-celled structures with high cell interconnectivity, small cell sizes, uniform cell size distributions, and high structural integrity. These porous foam columns provide advantages over the typical porous resin beads by eliminating the slow diffusion through resin beads, making the anion-exchange sites easily accessible on the foam surfaces. The best performing samples exceeded the Pu capacity of the commercially available resin, and also offered the advantage of sharper elution profiles, resulting in a more concentrated product, with less loss of material to the dilute heads and tails cuts. An alternate approach to improving the efficiency of this process was also explored through the development of a microchannel array system for performing the anion exchange.

  12. Pu Anion Exchange Process Intensification

    Energy Technology Data Exchange (ETDEWEB)

    Taylor-Pashow, Kathryn M. L. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2017-10-06

    This research is focused on improving the efficiency of the anion exchange process for purifying plutonium. While initially focused on plutonium, the technology could also be applied to other ion-exchange processes. Work in FY17 focused on the improvement and optimization of porous foam columns that were initially developed in FY16. These foam columns were surface functionalized with poly(4-vinylpyridine) (PVP) to provide the Pu specific anion-exchange sites. Two different polymerization methods were explored for maximizing the surface functionalization with the PVP. The open-celled polymeric foams have large open pores and large surface areas available for sorption. The fluid passes through the large open pores of this material, allowing convection to be the dominant mechanism by which mass transport takes place. These materials generally have very low densities, open-celled structures with high cell interconnectivity, small cell sizes, uniform cell size distributions, and high structural integrity. These porous foam columns provide advantages over the typical porous resin beads by eliminating the slow diffusion through resin beads, making the anion-exchange sites easily accessible on the foam surfaces. The best performing samples exceeded the Pu capacity of the commercially available resin, and also offered the advantage of sharper elution profiles, resulting in a more concentrated product, with less loss of material to the dilute heads and tails cuts. An alternate approach to improving the efficiency of this process was also explored through the development of a microchannel array system for performing the anion exchange.

  13. Anion exchange membrane

    Science.gov (United States)

    Verkade, John G; Wadhwa, Kuldeep; Kong, Xueqian; Schmidt-Rohr, Klaus

    2013-05-07

    An anion exchange membrane and fuel cell incorporating the anion exchange membrane are detailed in which proazaphosphatrane and azaphosphatrane cations are covalently bonded to a sulfonated fluoropolymer support along with anionic counterions. A positive charge is dispersed in the aforementioned cations which are buried in the support to reduce the cation-anion interactions and increase the mobility of hydroxide ions, for example, across the membrane. The anion exchange membrane has the ability to operate at high temperatures and in highly alkaline environments with high conductivity and low resistance.

  14. Switch-like reprogramming of gene expression after fusion of multinucleate plasmodial cells of two Physarum polycephalum sporulation mutants

    Energy Technology Data Exchange (ETDEWEB)

    Walter, Pauline; Hoffmann, Xenia-Katharina; Ebeling, Britta; Haas, Markus; Marwan, Wolfgang, E-mail: wolfgang.marwan@ovgu.de

    2013-05-24

    Highlights: •We investigate reprogramming of gene expression in multinucleate single cells. •Cells of two differentiation control mutants are fused. •Fused cells proceed to alternative gene expression patterns. •The population of nuclei damps stochastic fluctuations in gene expression. •Dynamic processes of cellular reprogramming can be observed by repeated sampling of a cell. -- Abstract: Nonlinear dynamic processes involving the differential regulation of transcription factors are considered to impact the reprogramming of stem cells, germ cells, and somatic cells. Here, we fused two multinucleate plasmodial cells of Physarum polycephalum mutants defective in different sporulation control genes while being in different physiological states. The resulting heterokaryons established one of two significantly different expression patterns of marker genes while the plasmodial halves that were fused to each other synchronized spontaneously. Spontaneous synchronization suggests that switch-like control mechanisms spread over and finally control the entire plasmodium as a result of cytoplasmic mixing. Regulatory molecules due to the large volume of the vigorously streaming cytoplasm will define concentrations in acting on the population of nuclei and in the global setting of switches. Mixing of a large cytoplasmic volume is expected to damp stochasticity when individual nuclei deliver certain RNAs at low copy number into the cytoplasm. We conclude that spontaneous synchronization, the damping of molecular noise in gene expression by the large cytoplasmic volume, and the option to take multiple macroscopic samples from the same plasmodium provide unique options for studying the dynamics of cellular reprogramming at the single cell level.

  15. Switch-like reprogramming of gene expression after fusion of multinucleate plasmodial cells of two Physarum polycephalum sporulation mutants

    International Nuclear Information System (INIS)

    Walter, Pauline; Hoffmann, Xenia-Katharina; Ebeling, Britta; Haas, Markus; Marwan, Wolfgang

    2013-01-01

    Highlights: •We investigate reprogramming of gene expression in multinucleate single cells. •Cells of two differentiation control mutants are fused. •Fused cells proceed to alternative gene expression patterns. •The population of nuclei damps stochastic fluctuations in gene expression. •Dynamic processes of cellular reprogramming can be observed by repeated sampling of a cell. -- Abstract: Nonlinear dynamic processes involving the differential regulation of transcription factors are considered to impact the reprogramming of stem cells, germ cells, and somatic cells. Here, we fused two multinucleate plasmodial cells of Physarum polycephalum mutants defective in different sporulation control genes while being in different physiological states. The resulting heterokaryons established one of two significantly different expression patterns of marker genes while the plasmodial halves that were fused to each other synchronized spontaneously. Spontaneous synchronization suggests that switch-like control mechanisms spread over and finally control the entire plasmodium as a result of cytoplasmic mixing. Regulatory molecules due to the large volume of the vigorously streaming cytoplasm will define concentrations in acting on the population of nuclei and in the global setting of switches. Mixing of a large cytoplasmic volume is expected to damp stochasticity when individual nuclei deliver certain RNAs at low copy number into the cytoplasm. We conclude that spontaneous synchronization, the damping of molecular noise in gene expression by the large cytoplasmic volume, and the option to take multiple macroscopic samples from the same plasmodium provide unique options for studying the dynamics of cellular reprogramming at the single cell level

  16. Maximally asymmetric transbilayer distribution of anionic lipids alters the structure and interaction with lipids of an amyloidogenic protein dimer bound to the membrane surface.

    Science.gov (United States)

    Cheng, Sara Y; Chou, George; Buie, Creighton; Vaughn, Mark W; Compton, Campbell; Cheng, Kwan H

    2016-03-01

    We used molecular dynamics simulations to explore the effects of asymmetric transbilayer distribution of anionic phosphatidylserine (PS) lipids on the structure of a protein on the membrane surface and subsequent protein-lipid interactions. Our simulation systems consisted of an amyloidogenic, beta-sheet rich dimeric protein (D42) absorbed to the phosphatidylcholine (PC) leaflet, or protein-contact PC leaflet, of two membrane systems: a single-component PC bilayer and double PC/PS bilayers. The latter comprised of a stable but asymmetric transbilayer distribution of PS in the presence of counterions, with a 1-component PC leaflet coupled to a 1-component PS leaflet in each bilayer. The maximally asymmetric PC/PS bilayer had a non-zero transmembrane potential (TMP) difference and higher lipid order packing, whereas the symmetric PC bilayer had a zero TMP difference and lower lipid order packing under physiologically relevant conditions. Analysis of the adsorbed protein structures revealed weaker protein binding, more folding in the N-terminal domain, more aggregation of the N- and C-terminal domains and larger tilt angle of D42 on the PC leaflet surface of the PC/PS bilayer versus the PC bilayer. Also, analysis of protein-induced membrane structural disruption revealed more localized bilayer thinning in the PC/PS versus PC bilayer. Although the electric field profile in the non-protein-contact PS leaflet of the PC/PS bilayer differed significantly from that in the non-protein-contact PC leaflet of the PC bilayer, no significant difference in the electric field profile in the protein-contact PC leaflet of either bilayer was evident. We speculate that lipid packing has a larger effect on the surface adsorbed protein structure than the electric field for a maximally asymmetric PC/PS bilayer. Our results support the mechanism that the higher lipid packing in a lipid leaflet promotes stronger protein-protein but weaker protein-lipid interactions for a dimeric protein on

  17. Anions in Cometary Comae

    Science.gov (United States)

    Charnley, Steven B.

    2011-01-01

    The presence of negative ions (anions) in cometary comae is known from Giotto mass spectrometry of IP/Halley. The anions 0-, OH-, C-, CH- and CN- have been detected, as well as unidentified anions with masses 22-65 and 85-110 amu (Chaizy et al. 1991). Organic molecular anions are known to have a significant impact on the charge balance of interstellar clouds and circumstellar envelopes and have been shown to act as catalysts for the gas-phase synthesis of larger hydrocarbon molecules in the ISM, but their importance in cometary comae has not yet been explored. We present details of the first attempt to model the chemistry of anions in cometary comae. Based on the combined chemical and hydro dynamical model of Rodgers & Charnley (2002), we investigate the role of large carbon-chain anions in cometary coma chemistry. We calculate the effects of these anions on coma thermodynamics, charge balance and examine their impact on molecule formation.

  18. Alkyl chain interaction at the surface of room temperature ionic liquids: systematic variation of alkyl chain length (R = C(1)-C(4), C(8)) in both cation and anion of [RMIM][R-OSO(3)] by sum frequency generation and surface tension.

    Science.gov (United States)

    Santos, Cherry S; Baldelli, Steven

    2009-01-29

    The gas-liquid interface of halide-free 1,3-dialkylimidazolium alkyl sulfates [RMIM][R-OSO(3)] with R chain length from C(1)-C(4) and C(8) has been studied systematically using the surface-specific sum frequency generation (SFG) vibrational spectroscopy and surface tension measurements. From the SFG spectra, vibrational modes from the methyl group of both cation and anion are observed for all ionic liquid samples considered in the present study. These results suggest the presence of both ions at the gas-liquid interface, which is further supported by surface tension measurements. Surface tension data show a decreasing trend as the alkyl chain in the imidazolium cation is varied from methyl to butyl chain, with a specific anion. A similar trend is observed when the alkyl chain of the anion is modified and the cation is fixed.

  19. Photochemical transformation of anionic 2-nitro-4-chlorophenol in surface waters: Laboratory and model assessment of the degradation kinetics, and comparison with field data

    Energy Technology Data Exchange (ETDEWEB)

    Sur, Babita [Dipartimento di Chimica, Universita di Torino, Via P. Giuria 5, 10125 Torino (Italy); Department of Chemical Engineering, Calcutta University, 92 Acharya P. C. Road, Kolkata 700009 (India); De Laurentiis, Elisa; Minella, Marco; Maurino, Valter; Minero, Claudio [Dipartimento di Chimica, Universita di Torino, Via P. Giuria 5, 10125 Torino (Italy); Vione, Davide [Dipartimento di Chimica, Universita di Torino, Via P. Giuria 5, 10125 Torino (Italy); Centro Interdipartimentale NatRisk, Universita di Torino, Via Leonardo da Vinci 44, 10095 Grugliasco (Italy)

    2012-06-01

    Anionic 2-nitro-4-chlorophenol (NCP) may occur in surface waters as a nitroderivative of 4-chlorophenol, which is a transformation intermediate of the herbicide dichlorprop. Here we show that NCP would undergo efficient photochemical transformation in environmental waters, mainly by direct photolysis and reaction with {center_dot}OH. NCP has a polychromatic photolysis quantum yield {Phi}{sub NCP} = (1.27 {+-} 0.22) {center_dot} 10{sup -5}, a rate constant with {center_dot}OH k{sub NCP,}{center_dot}{sub OH} = (1.09 {+-} 0.09) {center_dot} 10{sup 10} M{sup -1} s{sup -1}, a rate constant with {sup 1}O{sub 2}k{sub NCP,1O2} = (2.15 {+-} 0.38) {center_dot} 10{sup 7} M{sup -1} s{sup -1}, a rate constant with the triplet state of anthraquinone-2-sulphonate k{sub NCP,3AQ2S*} = (5.90 {+-} 0.43) {center_dot} 10{sup 8} M{sup -1} s{sup -1}, and is poorly reactive toward CO{sub 3}{sup -}{center_dot}. The k{sub NCP,3AQ2S*} value is representative of reaction with the triplet states of chromophoric dissolved organic matter. The inclusion of photochemical reactivity data into a model of surface-water photochemistry allowed the NCP transformation kinetics to be predicted as a function of water chemical composition and column depth. Very good agreement between model predictions and field data was obtained for the shallow lagoons of the Rhone delta (Southern France). Highlights: Black-Right-Pointing-Pointer Phototransformation kinetics of 2-nitro-4-chlorophenol, relevant to surface waters. Black-Right-Pointing-Pointer Determination of photochemical reactivity data in the laboratory. Black-Right-Pointing-Pointer Model approach to combine photochemical reactivity with environmental variables. Black-Right-Pointing-Pointer Good agreement with field data in lagoon water (Rhone delta, Southern France). Black-Right-Pointing-Pointer Direct photolysis and reaction with {center_dot}OH as main photoprocesses in the environment.

  20. Anion-π Catalysts with Axial Chirality.

    Science.gov (United States)

    Wang, Chao; Matile, Stefan

    2017-09-04

    The idea of anion-π catalysis is to stabilize anionic transition states by anion-π interactions on aromatic surfaces. For asymmetric anion-π catalysis, π-acidic surfaces have been surrounded with stereogenic centers. This manuscript introduces the first anion-π catalysts that operate with axial chirality. Bifunctional catalysts with tertiary amine bases next to π-acidic naphthalenediimide planes are equipped with a bulky aromatic substituent in the imide position to produce separable atropisomers. The addition of malonic acid half thioesters to enolate acceptors is used for evaluation. In the presence of a chiral axis, the selective acceleration of the disfavored but relevant enolate addition was much better than with point chirality, and enantioselectivity could be observed for the first time for this reaction with small-molecule anion-π catalysts. Enantioselectivity increased with the π acidity of the π surface, whereas the addition of stereogenic centers around the aromatic plane did not cause further improvements. These results identify axial chirality of the active aromatic plane generated by atropisomerism as an attractive strategy for asymmetric anion-π catalysis. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Anti-plasmodial activity of Dicoma tomentosa (Asteraceae) and identification of urospermal A-15-O-acetate as the main active compound

    Science.gov (United States)

    2012-01-01

    Background Natural products could play an important role in the challenge to discover new anti-malarial drugs. In a previous study, Dicoma tomentosa (Asteraceae) was selected for its promising anti-plasmodial activity after a preliminary screening of several plants traditionally used in Burkina Faso to treat malaria. The aim of the present study was to further investigate the anti-plasmodial properties of this plant and to isolate the active anti-plasmodial compounds. Methods Eight crude extracts obtained from D. tomentosa whole plant were tested in vitro against two Plasmodium falciparum strains (3D7 and W2) using the p-LDH assay (colorimetric method). The Peters’ four-days suppressive test model (Plasmodium berghei-infected mice) was used to evaluate the in vivo anti-plasmodial activity. An in vitro bioguided fractionation was undertaken on a dichloromethane extract, using preparative HPLC and TLC techniques. The identity of the pure compound was assessed using UV, MS and NMR spectroscopic analysis. In vitro cytotoxicity against WI38 human fibroblasts (WST-1 assay) and haemolytic activity were also evaluated for extracts and pure compounds in order to check selectivity. Results The best in vitro anti-plasmodial results were obtained with the dichloromethane, diethylether, ethylacetate and methanol extracts, which exhibited a high activity (IC50 ≤ 5 μg/ml). Hot water and hydroethanolic extracts also showed a good activity (IC50 ≤ 15 μg/ml), which confirmed the traditional use and the promising anti-malarial potential of the plant. The activity was also confirmed in vivo for all tested extracts. However, most of the active extracts also exhibited cytotoxic activity, but no extract was found to display any haemolytic activity. The bioguided fractionation process allowed to isolate and identify a sesquiterpene lactone (urospermal A-15-O-acetate) as the major anti-plasmodial compound of the plant (IC50 < 1 μg/ml against both 3D7 and W2 strains). This was also

  2. Surface Solvation of Halogen Anions in Water Clusters: An ab initio Molecular Dynamics Study of the Cl-(H.sub.2./sub.O).sub.6./sub. Complex

    Czech Academy of Sciences Publication Activity Database

    Tobias, D. J.; Jungwirth, Pavel; Parrinello, M.

    2001-01-01

    Roč. 114, č. 16 (2001), s. 7036-7044 ISSN 0021-9606 R&D Projects: GA MŠk LN00A032 Grant - others:NATO Science Program(XE) CLG-974459 Institutional research plan: CEZ:AV0Z4040901 Keywords : cluster * ab initio molecular dynamics * anionic solvation Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.147, year: 2001

  3. Evaluation of the Anti-plasmodial Activity of the Methanolic Root Extracts of Anthocleista nobilis G. Don, Nauclea latifolia Smith and Napoleona imperialis P. Beauv

    OpenAIRE

    Ijeoma H. Ogbuehi; Omotayo O. Ebong; Eme O. Asuquo; Chijioke A. Nwauche

    2014-01-01

    The emergence of resistant strains of the malaria parasite has necessitated the continued search for other effective, safe and cheap plant-based anti-malarial agents. This study was carried out to evaluate in vivo the anti-plasmodial effect of the extract of a combination of three plants as used in traditional medicine in South-east, Nigeria. Dried and ground roots of the three plants: Anthocleista nobilis, Nauclea latifolia and Napoleona imperialis were extracted in 70% methanol as a combina...

  4. The assessment of pellicular anion-exchange resins for the determination of anions by ion chromatography

    International Nuclear Information System (INIS)

    Pohlandt, C.

    1981-01-01

    Because pellicular anion-exchange resins suitable for the determination, by ion chromatography, of anions with alkaline eluents were unavailable in South Africa at the inception of this work, an attempt was made to prepare such resins. In this study it is shown that the pellicular resins produced are more efficient than the surface-aminated resins used previously. The simultaneous separation and determination of five common anions is demonstrated. The method was applied to the analysis of uranium leach liquors, effluent samples, and a solid sample of ferric oxide (goethite)

  5. Patchy proteins, anions and the Hofmeister series

    Energy Technology Data Exchange (ETDEWEB)

    Lund, Mikael; Jungwirth, Pavel [Institute of Organic Chemistry and Biochemistry, Academy of Sciences of the Czech Republic, Flemingovo namesti 2, 16610 Prague 6 (Czech Republic); Center for Complex Molecular Systems and Biomolecules, Flemingovo namesti 2, 16610 Prague 6 (Czech Republic)], E-mail: mikael.lund@uochb.cas.cz

    2008-12-10

    We investigate specific anion binding to a range of patchy protein models and use our results to probe protein-protein interactions for aqueous lysozyme solutions. Our molecular simulation studies show that the ion-protein interaction mechanism and strength largely depend on the nature of the interfacial amino acid residues. Via direct ion pairing, small anions interact with charged side-chains while larger anions are attracted to non-polar residues due to several solvent assisted mechanisms. Incorporating ion and surface specificity into a mesoscopic model for protein-protein interactions we calculate the free energy of interaction between lysozyme molecules in aqueous solutions of sodium chloride and sodium iodide. In agreement with experiment, our finding is that 'salting out' follows the reverse Hofmeister series for pH below the iso-electric point and the direct series for pH above pI.

  6. Role of adaptor proteins and clathrin in the trafficking of human kidney anion exchanger 1 (kAE1) to the cell surface.

    Science.gov (United States)

    Junking, Mutita; Sawasdee, Nunghathai; Duangtum, Natapol; Cheunsuchon, Boonyarit; Limjindaporn, Thawornchai; Yenchitsomanus, Pa-thai

    2014-07-01

    Kidney anion exchanger 1 (kAE1) plays an important role in acid-base homeostasis by mediating chloride/bicarbornate (Cl-/HCO3-) exchange at the basolateral membrane of α-intercalated cells in the distal nephron. Impaired intracellular trafficking of kAE1 caused by mutations of SLC4A1 encoding kAE1 results in kidney disease - distal renal tubular acidosis (dRTA). However, it is not known how the intracellular sorting and trafficking of kAE1 from trans-Golgi network (TGN) to the basolateral membrane occurs. Here, we studied the role of basolateral-related sorting proteins, including the mu1 subunit of adaptor protein (AP) complexes, clathrin and protein kinase D, on kAE1 trafficking in polarized and non-polarized kidney cells. By using RNA interference, co-immunoprecipitation, yellow fluorescent protein-based protein fragment complementation assays and immunofluorescence staining, we demonstrated that AP-1 mu1A, AP-3 mu1, AP-4 mu1 and clathrin (but not AP-1 mu1B, PKD1 or PKD2) play crucial roles in intracellular sorting and trafficking of kAE1. We also demonstrated colocalization of kAE1 and basolateral-related sorting proteins in human kidney tissues by double immunofluorescence staining. These findings indicate that AP-1 mu1A, AP-3 mu1, AP-4 mu1 and clathrin are required for kAE1 sorting and trafficking from TGN to the basolateral membrane of acid-secreting α-intercalated cells. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. Quantum-chemical study of the geometric and electronic structure of the chromate anion CrO42- and a chromate group on the surface of finely divided silica by the CNDO/2 method

    International Nuclear Information System (INIS)

    Plyuto, I.V.; Shpak, A.P.; Plyuto, Yu.V.; Chuiko, A.A.

    1989-01-01

    A comparative study of the geometric and electronic structure of the chromate anion CrO 4 2- and a chromate group on the surface of finely divided silica (≡Si-O) 2 - CrO 2 , which was simulated by a CrO 9 Si 6 H 12 cluster, has been carried out by the SCF-MO-LCAO method in the all-valence-electron CNDO/2 approximation. The data obtained on the equilibrium geometry of the chromate group attest to the formation of a double bond between the Cr atom and each O atom (which is not bonded to Si). It has been shown that the support has a significant stabilizing in fluence on the energy of the MO's of the chromate group. The chromate group on an SiO 2 surface is characterized by partial delocalization of the frontier MO's among the skeletal bonds; however, the dominant contribution to the HOMO is made by the 2p AO of the oxygen atoms in the coordination shell of the Cr atom (∼70%), and the dominant contribution to the LUMO is made by the 3d AO of the chromium atom (∼50%). The positions and composition of the lowest unoccupied molecular orbitals point out the possibility of the display of electron-acceptor properties by a chromate group of an SiO 2 surface

  8. Properties of cationic monosubstituted tetraalkylammonium cyclodextrin derivatives – their stability, complexation ability in solution or when deposited on solid anionic surface

    Czech Academy of Sciences Publication Activity Database

    Popr, M.; Filippov, Sergey K.; Matushkin, Nikolai; Dian, J.; Jindřich, J.

    2015-01-01

    Roč. 11, February (2015), s. 192-199 ISSN 1860-5397 R&D Projects: GA ČR GAP108/12/0640 Institutional support: RVO:61389013 Keywords : cyclodextrins * inclusion properties * solid surface Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.697, year: 2015

  9. Acid-base properties and surface complexation modeling of phosphate anion adsorption by wasted low grade iron ore with high phosphorus.

    Science.gov (United States)

    Yuan, Xiaoli; Bai, Chenguang; Xia, Wentang; An, Juan

    2014-08-15

    The adsorption phenomena and specific reaction processes of phosphate onto wasted low grade iron ore with high phosphorus (WLGIOWHP) were studied in this work. Zeta potential and Fourier transform infrared spectroscopy (FTIR) analyses were used to elucidate the interaction mechanism between WLGIOWHP and aqueous solution. The results implied that the main adsorption mechanism was the replacement of surface hydroxyl groups by phosphate via the formation of inner-sphere complex. The adsorption process was characterized by chemical adsorption onto WLGIOWHP. The non-electrostatic model (NEM) was used to simulate the surface adsorption of phosphate onto WLGIOWHP. The total surface site density and protonation constants for NEM (N(T)=1.6×10(-4) mol/g, K(a1)=2.2×10(-4), K(a2)=6.82×10(-9)) were obtained by non-linear data fitting of acid-base titrations. In addition, the NEM was used to establish the surface adsorption complexation modeling of phosphate onto WLGIOWHP. The model successfully predicted the adsorption of phosphate onto WLGIOWHP from municipal wastewater. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Group contribution and parachor analysis of experimental data on densities and surface tension for six ionic liquids with the [PF6] anion

    Czech Academy of Sciences Publication Activity Database

    Klomfar, Jaroslav; Součková, Monika; Pátek, Jaroslav

    2015-01-01

    Roč. 385, January (2015), s. 62-71 ISSN 0378-3812 R&D Projects: GA ČR GA13-00145S Institutional support: RVO:61388998 Keywords : ionic liquid * density * surface tension * odd-even effect Subject RIV: BJ - Thermodynamics Impact factor: 1.846, year: 2015

  11. The Thermodynamics of Anion Complexation to Nonpolar Pockets.

    Science.gov (United States)

    Sullivan, Matthew R; Yao, Wei; Tang, Du; Ashbaugh, Henry S; Gibb, Bruce C

    2018-02-08

    The interactions between nonpolar surfaces and polarizable anions lie in a gray area between the hydrophobic and Hofmeister effects. To assess the affinity of these interactions, NMR and ITC were used to probe the thermodynamics of eight anions binding to four different hosts whose pockets each consist primarily of hydrocarbon. Two classes of host were examined: cavitands and cyclodextrins. For all hosts, anion affinity was found to follow the Hofmeister series, with associations ranging from 1.6-5.7 kcal mol -1 . Despite the fact that cavitand hosts 1 and 2 possess intrinsic negative electrostatic fields, it was determined that these more enveloping hosts generally bound anions more strongly. The observation that the four hosts each possess specific anion affinities that cannot be readily explained by their structures, points to the importance of counter cations and the solvation of the "empty" hosts, free guests, and host-guest complexes, in defining the affinity.

  12. Formation of interstellar anions

    Science.gov (United States)

    Senent, Maria Luisa

    2012-05-01

    Formation of interstellar anions: M.L. Senent. The recent detection of negative charged species in the ISM1 has instigated enthusiasm for anions in the astrophysical community2. Many of these species are new and entail characterization. How they are formed in astrophysical sources is a question of major relevance. The anion presence in ISM was first predicted theoretically on the basis of electron affinities and on the negative linear chain molecular stabilities. Although very early, they were considered in astrochemical models3-4, their discovery is so recent because their abundances seem to be relatively low. These have to be understood in terms of molecular stabilities, reaction probabilities and radiative and collisional excitations. Then, we present our theoretical work on even carbon chains type Cn and CnH (n=2,4,6) focused to the understanding of anion abundances. We use highly correlated ab initio methods. We performed spectroscopic studies of various isomers that can play important roles as intermediates5-8. In previous papers9-10, we compared C2H and C2H- collisional rates responsible for observed line intensities. Actually, we study hydrogen attachment (Cn +H → CnH and Cn- +H → CnH-) and associative detachment processes (Cn- +H → CnH +e-) for 2, 4 and 6 carbon atom chains11. [1] M.C.McCarthy, C.A.Gottlieb, H.Gupta, P.Thaddeus, Astrophys.J, 652, L141 (2006) [2] V.M.Bierbaum, J.Cernicharo, R.Bachiller, eds., 2011, pp 383-389. [3] A. Dalgarno, R.A. Mc Cray, Astrophys.J,, 181, 95 (1973) [4] E. Herbst E., Nature, 289, 656 (1981); [5] H.Massó, M.L.Senent, P.Rosmus, M.Hochlaf, J.Chem.Phys., 124, 234304 (2006) [6] M.L.Senent, M.Hochlaf, Astrophys. J. , 708, 1452(2010) [7] H.Massó, M.L.Senent, J.Phys.Chem.A, 113, 12404 (2009) [8] D. Hammoutene, M.Hochlaf, M.L.Senent, submitted. [9] A. Spielfiedel, N. Feautrier, F. Najar, D. ben Abdallah, F. Dayou, M.L. Senent, F. Lique, Mon.Not.R.Astron.Soc., 421, 1891 (2012) [10] F.Dumouchel, A, Spielfieldel , M

  13. Oxidation of Gas-Phase SO2 on the Surfaces of Acidic Microdroplets: Implications for Sulfate and Sulfate Radical Anion Formation in the Atmospheric Liquid Phase.

    Science.gov (United States)

    Hung, Hui-Ming; Hoffmann, Michael R

    2015-12-01

    The oxidation of SO2(g) on the interfacial layers of microdroplet surfaces was investigated using a spray-chamber reactor coupled to an electrospray ionization mass spectrometer. Four major ions, HSO3(-), SO3(•-), SO4(•-) and HSO4(-), were observed as the SO2(g)/N2(g) gas-mixture was passed through a suspended microdroplet flow, where the residence time in the dynamic reaction zone was limited to a few hundred microseconds. The relatively high signal intensities of SO3(•-), SO4(•-), and HSO4(-) compared to those of HSO3(-) as observed at pH SO2·H2O, which is also affected by the pH dependent uptake coefficient. When H2O2(g) was introduced into the spray chamber simultaneously with SO2(g), HSO3(-) is rapidly oxidized to form bisulfate in the pH range of 3 to 5. Conversion to sulfate was less at pH SO2(g) on the acidic microdroplets was estimated as 1.5 × 10(6) [S(IV)] (M s(-1)) at pH ≤ 3. In the presence of acidic aerosols, this oxidation rate is approximately 2 orders of magnitude higher than the rate of oxidation with H2O2(g) at a typical atmospheric H2O2(g) concentration of 1 ppb. This finding highlights the relative importance of the acidic surfaces for SO2 oxidation in the atmosphere. Surface chemical reactions on aquated aerosol surfaces, as observed in this study, are overlooked in most atmospheric chemistry models. These reaction pathways may contribute to the rapid production of sulfate aerosols that is often observed in regions impacted by acidic haze aerosol such as Beijing and other megacities around the world.

  14. Anti-plasmodial and insecticidal activities of the essential oils of aromatic plants growing in the Mediterranean area

    Directory of Open Access Journals (Sweden)

    Dell’Agli Mario

    2012-07-01

    Full Text Available Abstract Background Sardinia is a Mediterranean area endemic for malaria up to the last century. During a screening study to evaluate the anti-plasmodial activity of some aromatic plants traditionally used in Sardinia, Myrtus communis (myrtle, Myrtaceae, Satureja thymbra (savory, Lamiaceae, and Thymus herba-barona (caraway thyme, Lamiaceae were collected in three vegetative periods: before, during and after flowering. Methods The essential oils were obtained by steam distillation, fractionated by silica gel column chromatography and analysed by GC-FID-MS. Total oil and three main fractions were tested on D10 and W2 strains of Plasmodium falciparum in vitro. Larvicidal and adulticidal activities were tested on Anopheles gambiae susceptible strains. Results The essential oil of savory, rich in thymol, was the most effective against P. falciparum with an inhibitory activity independent from the time of collection (IC50 17–26 μg/ml on D10 and 9–11 μg/ml on W2. Upon fractionation, fraction 1 was enriched in mono-sesquiterpenoid hydrocarbons; fraction 2 in thymol (73-83%; and fraction 3 contained thymol, carvacrol and terpinen-4-ol, with a different composition depending on the time of collection. Thymol-enriched fractions were the most active on both strains (IC50 20–22 μg/ml on D10 and 8–10 μg/ml on W2 and thymol was confirmed as mainly responsible for this activity (IC50 19.7± 3.0 and 10.6 ± 2.0 μg/ml on D10 and W2, respectively. The essential oil of S. thymbra L. showed also larvicidal and adulticidal activities. The larvicidal activity, expressed as LC50, was 0.15 ± 0.002; 0.21 ± 0.13; and 0.15 ± 0.09 μg/ml (mean ± sd depending on the time of collection: before, during and after flowering, respectively. Conclusions This study provides evidence for the use of essential oils for treating malaria and fighting the vector at both the larval and adult stages. These findings open the possibility for further

  15. Hydration of a Large Anionic Charge Distribution - Naphthalene-Water Cluster Anions

    Science.gov (United States)

    Weber, J. Mathias; Adams, Christopher L.

    2010-06-01

    We report the infrared spectra of anionic clusters of naphthalene with up to three water molecules. Comparison of the experimental infrared spectra with theoretically predicted spectra from quantum chemistry calculations allow conclusions regarding the structures of the clusters under study. The first water molecule forms two hydrogen bonds with the π electron system of the naphthalene moiety. Subsequent water ligands interact with both the naphthalene and the other water ligands to form hydrogen bonded networks, similar to other hydrated anion clusters. Naphthalene-water anion clusters illustrate how water interacts with negative charge delocalized over a large π electron system. The clusters are interesting model systems that are discussed in the context of wetting of graphene surfaces and polyaromatic hydrocarbons.

  16. Selective adsorption of volatile hydrocarbons and gases in high surface area chalcogels containing [ES3]3- anions (E = As, Sb)

    KAUST Repository

    Ahmed, Ejaz; Khanderi, Jayaprakash; Anjum, Dalaver H.; Rothenberger, Alexander

    2014-01-01

    We describe the sol-gel synthesis of the two new chalcogels KFeSbS3 and NaFeAsS3, which demonstrate excellent adsorption selectivity for volatile hydrocarbons and gases. These predominantly mesoporous materials have been synthesized by reacting Fe(OAc)2 with K3SbS3 or Na3AsS3 in a formamide/water mixture at room temperature. Aerogels obtained after supercritical drying have BET surface areas of 636 m2/g and 505 m2/g for KFeSbS3 and NaFeAsS3, respectively, with pore sizes in the micro- (below 2 nm), meso- (2-50 nm), and macro- (above 50 nm) regions.

  17. Selective adsorption of volatile hydrocarbons and gases in high surface area chalcogels containing [ES3]3- anions (E = As, Sb)

    KAUST Repository

    Ahmed, Ejaz

    2014-11-25

    We describe the sol-gel synthesis of the two new chalcogels KFeSbS3 and NaFeAsS3, which demonstrate excellent adsorption selectivity for volatile hydrocarbons and gases. These predominantly mesoporous materials have been synthesized by reacting Fe(OAc)2 with K3SbS3 or Na3AsS3 in a formamide/water mixture at room temperature. Aerogels obtained after supercritical drying have BET surface areas of 636 m2/g and 505 m2/g for KFeSbS3 and NaFeAsS3, respectively, with pore sizes in the micro- (below 2 nm), meso- (2-50 nm), and macro- (above 50 nm) regions.

  18. The many ways of making anionic clays

    Indian Academy of Sciences (India)

    Together with hydrotalcite-like layered double hydroxides, bivalent and trivalent metal hydroxides and their hydroxy salts are actually anionic clays consisting of positively charged hydroxide layers with anions intercalated in the interlayer region. The anionic clays exhibit anion sorption, anion diffusion and exchange ...

  19. One pot synthesis of nanosized anion doped TiO{sub 2}: Effect of irradiation of sound waves on surface morphology and optical properties

    Energy Technology Data Exchange (ETDEWEB)

    Sharotri, Nidhi, E-mail: nidhisliet11@gmail.com; Sud, Dhiraj, E-mail: author-suddhiraj@yahoo.com [Department of Chemistry, Sant Longowal Institute of Engineering and Technology, (Deemed University), Longowal 148106, Sangrur, Punjab (India)

    2015-08-28

    Commercialization of AOP’s for remediation of pollutants from environmental matrix required the process to be operated by solar light. Semiconductor TiO{sub 2} has emerged as an effective and preferred photocatalyst in the field of environmental photocatalysis due to its; (i) biological and chemical inertness (ii) resistance to chemical and photo corrosion, (iii) can absorb natural UV light due to appropriate energetic separation between its valence and conduction band. However, unfortunately the optical band gap of TiO{sub 2} (3.0-3.23 eV) with absorption cut off ∼ 380 nm, enables it to harness only a small fraction (∼ 5%) of the entire solar spectrum. One of the current areas of research is modification of TiO{sub 2} photocatalyst. In present paper one pot greener synthesis from titanium isopropoxide and hydroxylamine hydrochloride has been used as titanium and nitrogen precursor under ultrasonic waves. The as synthesized TiO{sub 2} nanomaterials were dried at 100°C and further calcinated at different temperatures. The effect of reaction parameters such as ultrasonication time on the yield, surface morphology, spectroscopic data and optical properties was also investigated. The results confirm that the anatase phase is a main phase with a crystallite size of 35-77 nm and the calculated band gap of nanomaterials varies from 2.10-3.1 eV.

  20. Determination of nitrate by anion exchange with ultraviolet detection

    Energy Technology Data Exchange (ETDEWEB)

    McComas, J.G.

    1976-01-01

    A weak base anion exchange resin is synthesized by surface bonding 3-aminopropyltriethoxysilane to silica gel. This silylated silica gel is used to separate nitrate from interferences. The nitrate is then determined by measuring its absorbance at 220 nm. An interference study was performed and no anions commonly found in potable water interferes. A comparison of this method was made with the brucine method on real samples and satisfactory agreement was obtained between the two methods.

  1. A flow cytometry-based workflow for detection and quantification of anti-plasmodial antibodies in vaccinated and naturally exposed individuals

    DEFF Research Database (Denmark)

    Ajua, Anthony; Engleitner, Thomas; Esen, Meral

    2012-01-01

    information about natural exposure and vaccine immunogenicity. A novel, cytometry-based workflow for the quantitative detection of anti-plasmodial antibodies in human serum is presented. METHODS: Fixed red blood cells (RBCs), infected with late stages of P. falciparum were utilized to detect malaria...... vaccine trials in semiimmune adults and pre-school children residing in a malaria endemic area. RESULTS: Fixation, permeabilization, and staining of infected RBCs were adapted for best operation in flow cytometry. As asexual vaccine candidates are designed to induce antibody patterns similar to semi...... with those obtained by manual gating (r between 0.79 and 0.99) and outperformed other model-driven gating methods. Bland-Altman plots confirmed the agreement of manual gating and OSA derived results. A-1.33 fold increase (p=0.003) in the number of positive cells after vaccination in a subgroup of preschool...

  2. Phosphazene-promoted anionic polymerization

    KAUST Repository

    Zhao, Junpeng

    2014-01-01

    In the recent surge of metal-free polymerization techniques, phosphazene bases have shown their remarkable potential as organic promoters/catalysts for the anionic polymerization of various types of monomers. By complexation with the counterion (e.g. proton or lithium cation), phosphazene base significantly improve the nucleophilicity of the initiator/chain-end resulting in rapid and usually controlled anionic/quasi-anionic polymerization. In this review, we will introduce the general mechanism, i.e. in situ activation (of initiating sites) and polymerization, and summarize the applications of such a mechanism on macromolecular engineering toward functionalized polymers, block copolymers and complex macromolecular architectures.

  3. Simultaneous anionic and cationic redox

    Science.gov (United States)

    Jung, Sung-Kyun; Kang, Kisuk

    2017-12-01

    It is challenging to unlock anionic redox activity, accompanied by full utilization of available cationic redox process, to boost capacity of battery cathodes. Now, material design by tuning the metal-oxygen interaction is shown to be a promising solution.

  4. Schlenk Techniques for Anionic Polymerization

    KAUST Repository

    Ratkanthwar, Kedar; Zhao, Junpeng; Zhang, Hefeng; Hadjichristidis, Nikolaos; Mays, Jimmy

    2015-01-01

    Anionic polymerization-high vacuum techniques (HVTs) are doubtlessly the most prominent and reliable experimental tools to prepare polymer samples with well-defined and, in many cases, complex macromolecular architectures. Due to the high demands

  5. In vitro anti-plasmodial activity of Dicoma anomala subsp. gerrardii (Asteraceae): identification of its main active constituent, structure-activity relationship studies and gene expression profiling.

    Science.gov (United States)

    Becker, John V W; van der Merwe, Marina M; van Brummelen, Anna C; Pillay, Pamisha; Crampton, Bridget G; Mmutlane, Edwin M; Parkinson, Chris; van Heerden, Fanie R; Crouch, Neil R; Smith, Peter J; Mancama, Dalu T; Maharaj, Vinesh J

    2011-10-11

    Anti-malarial drug resistance threatens to undermine efforts to eliminate this deadly disease. The resulting omnipresent requirement for drugs with novel modes of action prompted a national consortium initiative to discover new anti-plasmodial agents from South African medicinal plants. One of the plants selected for investigation was Dicoma anomala subsp. gerrardii, based on its ethnomedicinal profile. Standard phytochemical analysis techniques, including solvent-solvent extraction, thin-layer- and column chromatography, were used to isolate the main active constituent of Dicoma anomala subsp. gerrardii. The crystallized pure compound was identified using nuclear magnetic resonance spectroscopy, mass spectrometry and X-ray crystallography. The compound was tested in vitro on Plasmodium falciparum cultures using the parasite lactate dehydrogenase (pLDH) assay and was found to have anti-malarial activity. To determine the functional groups responsible for the activity, a small collection of synthetic analogues was generated - the aim being to vary features proposed as likely to be related to the anti-malarial activity and to quantify the effect of the modifications in vitro using the pLDH assay. The effects of the pure compound on the P. falciparum transcriptome were subsequently investigated by treating ring-stage parasites (alongside untreated controls), followed by oligonucleotide microarray- and data analysis. The main active constituent was identified as dehydrobrachylaenolide, a eudesmanolide-type sesquiterpene lactone. The compound demonstrated an in vitro IC50 of 1.865 μM against a chloroquine-sensitive strain (D10) of P. falciparum. Synthetic analogues of the compound confirmed an absolute requirement that the α-methylene lactone be present in the eudesmanolide before significant anti-malarial activity was observed. This feature is absent in the artemisinins and suggests a different mode of action. Microarray data analysis identified 572 unique genes that

  6. In vitro anti-plasmodial activity of Dicoma anomala subsp. gerrardii (Asteraceae: identification of its main active constituent, structure-activity relationship studies and gene expression profiling

    Directory of Open Access Journals (Sweden)

    van Heerden Fanie R

    2011-10-01

    Full Text Available Abstract Background Anti-malarial drug resistance threatens to undermine efforts to eliminate this deadly disease. The resulting omnipresent requirement for drugs with novel modes of action prompted a national consortium initiative to discover new anti-plasmodial agents from South African medicinal plants. One of the plants selected for investigation was Dicoma anomala subsp. gerrardii, based on its ethnomedicinal profile. Methods Standard phytochemical analysis techniques, including solvent-solvent extraction, thin-layer- and column chromatography, were used to isolate the main active constituent of Dicoma anomala subsp. gerrardii. The crystallized pure compound was identified using nuclear magnetic resonance spectroscopy, mass spectrometry and X-ray crystallography. The compound was tested in vitro on Plasmodium falciparum cultures using the parasite lactate dehydrogenase (pLDH assay and was found to have anti-malarial activity. To determine the functional groups responsible for the activity, a small collection of synthetic analogues was generated - the aim being to vary features proposed as likely to be related to the anti-malarial activity and to quantify the effect of the modifications in vitro using the pLDH assay. The effects of the pure compound on the P. falciparum transcriptome were subsequently investigated by treating ring-stage parasites (alongside untreated controls, followed by oligonucleotide microarray- and data analysis. Results The main active constituent was identified as dehydrobrachylaenolide, a eudesmanolide-type sesquiterpene lactone. The compound demonstrated an in vitro IC50 of 1.865 μM against a chloroquine-sensitive strain (D10 of P. falciparum. Synthetic analogues of the compound confirmed an absolute requirement that the α-methylene lactone be present in the eudesmanolide before significant anti-malarial activity was observed. This feature is absent in the artemisinins and suggests a different mode of action

  7. Ionic liquids comprising heteraromatic anions

    Energy Technology Data Exchange (ETDEWEB)

    Schneider, William F.; Brennecke, Joan F.; Maginn, Edward J.; Mindrup, Elaine; Gurkan, Burcu; Price, Erica; Goodrich, Brett

    2018-04-24

    Some embodiments described herein relate to ionic liquids comprising an anion of a heteraromatic compound such as optionally substituted pyrrolide, optionally substituted pyrazolide, optionally substituted indolide, optionally substituted phospholide, or optionally substituted imidazolide. Methods and devices for gas separation or gas absorption related to these ionic liquids are also described herein.

  8. IMPROVING OF ANION EXCHANGERES REGENERATION

    Directory of Open Access Journals (Sweden)

    Muzher M. Ibrahim

    2013-05-01

    Full Text Available Inthis study, Different basis [NaOH and KOH] of variable concentration are usedto reactivate Anion exchangers employing different schemes .The Laboratoryresults showed large improvement in efficiency of these exchangers ( i.eoperating time was increased from 12 to 42 hours .The results of this work showed that the environmentalload (waste water can be reduced greatly when using the proposed regenerationscheme .

  9. Quantum mechanics of toroidal anions

    International Nuclear Information System (INIS)

    Afanas'ev, G.N.

    1990-01-01

    We consider a toroidal solenoid with an electric charge attached to it. It turns out that statistical properties of the wave function describing interacting toroidal anions depend on both their relative position and orientation. The influence of the particular gauge choice on the exchange properties of the wave function is studied. 30 refs.; 6 figs

  10. Anion binding in biological systems

    Energy Technology Data Exchange (ETDEWEB)

    Feiters, Martin C [Department of Organic Chemistry, Institute for Molecules and Materials, Faculty of Science, Radboud University Nijmegen, Heyendaalseweg 135, 6525 AJ Nijmegen (Netherlands); Meyer-Klaucke, Wolfram [EMBL Hamburg Outstation at DESY, Notkestrasse 85, D-22607 Hamburg (Germany); Kostenko, Alexander V; Soldatov, Alexander V [Faculty of Physics, Southern Federal University, Sorge 5, Rostov-na-Donu, 344090 (Russian Federation); Leblanc, Catherine; Michel, Gurvan; Potin, Philippe [Centre National de la Recherche Scientifique and Universite Pierre et Marie Curie Paris-VI, Station Biologique de Roscoff, Place Georges Teissier, BP 74, F-29682 Roscoff cedex, Bretagne (France); Kuepper, Frithjof C [Scottish Association for Marine Science, Dunstaffnage Marine Laboratory, Oban, Argyll PA37 1QA, Scotland (United Kingdom); Hollenstein, Kaspar; Locher, Kaspar P [Institute of Molecular Biology and Biophysics, ETH Zuerich, Schafmattstrasse 20, Zuerich, 8093 (Switzerland); Bevers, Loes E; Hagedoorn, Peter-Leon; Hagen, Wilfred R, E-mail: m.feiters@science.ru.n [Department of Biotechnology, Delft University of Technology, Julianalaan 67, 2628 BC Delft (Netherlands)

    2009-11-15

    We compare aspects of biological X-ray absorption spectroscopy (XAS) studies of cations and anions, and report on some examples of anion binding in biological systems. Brown algae such as Laminaria digitata (oarweed) are effective accumulators of I from seawater, with tissue concentrations exceeding 50 mM, and the vanadate-containing enzyme haloperoxidase is implicated in halide accumulation. We have studied the chemical state of iodine and its biological role in Laminaria at the I K edge, and bromoperoxidase from Ascophyllum nodosum (knotted wrack) at the Br K edge. Mo is essential for many forms of life; W only for certain archaea, such as Archaeoglobus fulgidus and the hyperthermophilic archaeon Pyrococcus furiosus, and some bacteria. The metals are bound and transported as their oxo-anions, molybdate and tungstate, which are similar in size. The transport protein WtpA from P. furiosus binds tungstate more strongly than molybdate, and is related in sequence to Archaeoglobus fulgidus ModA, of which a crystal structure is known. We have measured A. fulgidus ModA with tungstate at the W L{sub 3} (2p{sub 3/2}) edge, and compared the results with the refined crystal structure. XAS studies of anion binding are feasible even if only weak interactions are present, are biologically relevant, and give new insights in the spectroscopy.

  11. Anion binding in biological systems

    International Nuclear Information System (INIS)

    Feiters, Martin C; Meyer-Klaucke, Wolfram; Kostenko, Alexander V; Soldatov, Alexander V; Leblanc, Catherine; Michel, Gurvan; Potin, Philippe; Kuepper, Frithjof C; Hollenstein, Kaspar; Locher, Kaspar P; Bevers, Loes E; Hagedoorn, Peter-Leon; Hagen, Wilfred R

    2009-01-01

    We compare aspects of biological X-ray absorption spectroscopy (XAS) studies of cations and anions, and report on some examples of anion binding in biological systems. Brown algae such as Laminaria digitata (oarweed) are effective accumulators of I from seawater, with tissue concentrations exceeding 50 mM, and the vanadate-containing enzyme haloperoxidase is implicated in halide accumulation. We have studied the chemical state of iodine and its biological role in Laminaria at the I K edge, and bromoperoxidase from Ascophyllum nodosum (knotted wrack) at the Br K edge. Mo is essential for many forms of life; W only for certain archaea, such as Archaeoglobus fulgidus and the hyperthermophilic archaeon Pyrococcus furiosus, and some bacteria. The metals are bound and transported as their oxo-anions, molybdate and tungstate, which are similar in size. The transport protein WtpA from P. furiosus binds tungstate more strongly than molybdate, and is related in sequence to Archaeoglobus fulgidus ModA, of which a crystal structure is known. We have measured A. fulgidus ModA with tungstate at the W L 3 (2p 3/2 ) edge, and compared the results with the refined crystal structure. XAS studies of anion binding are feasible even if only weak interactions are present, are biologically relevant, and give new insights in the spectroscopy.

  12. Anion binding in biological systems

    Science.gov (United States)

    Feiters, Martin C.; Meyer-Klaucke, Wolfram; Kostenko, Alexander V.; Soldatov, Alexander V.; Leblanc, Catherine; Michel, Gurvan; Potin, Philippe; Küpper, Frithjof C.; Hollenstein, Kaspar; Locher, Kaspar P.; Bevers, Loes E.; Hagedoorn, Peter-Leon; Hagen, Wilfred R.

    2009-11-01

    We compare aspects of biological X-ray absorption spectroscopy (XAS) studies of cations and anions, and report on some examples of anion binding in biological systems. Brown algae such as Laminaria digitata (oarweed) are effective accumulators of I from seawater, with tissue concentrations exceeding 50 mM, and the vanadate-containing enzyme haloperoxidase is implicated in halide accumulation. We have studied the chemical state of iodine and its biological role in Laminaria at the I K edge, and bromoperoxidase from Ascophyllum nodosum (knotted wrack) at the Br K edge. Mo is essential for many forms of life; W only for certain archaea, such as Archaeoglobus fulgidus and the hyperthermophilic archaeon Pyrococcus furiosus, and some bacteria. The metals are bound and transported as their oxo-anions, molybdate and tungstate, which are similar in size. The transport protein WtpA from P. furiosus binds tungstate more strongly than molybdate, and is related in sequence to Archaeoglobus fulgidus ModA, of which a crystal structure is known. We have measured A. fulgidus ModA with tungstate at the W L3 (2p3/2) edge, and compared the results with the refined crystal structure. XAS studies of anion binding are feasible even if only weak interactions are present, are biologically relevant, and give new insights in the spectroscopy.

  13. Anionic solid lipid nanoparticles supported on protamine/DNA complexes

    International Nuclear Information System (INIS)

    Ye Jiesheng; Liu Chunxi; Chen Zhijin; Zhang Na; Wang Aihua

    2008-01-01

    The objective of this study was to design novel anionic ternary nanoparticles for gene delivery. These ternary nanoparticles were equipped with protamine/DNA binary complexes (150-200 nm) as the support, and the anionic formation was achieved by absorption of anionic solid lipid nanoparticles (≤20 nm) onto the surface of the binary complexes. The small solid lipid nanoparticles (SLNs) were prepared by a modified film dispersion-ultrasonication method, and adsorption of the anionic SLNs onto the binary complexes was typically carried out in water via electrostatic interaction. The formulated ternary nanoparticles were found to be relatively uniform in size (257.7 ± 10.6 nm) with a 'bumpy' surface, and the surface charge inversion from 19.28 ± 1.14 mV to -17.16 ± 1.92 mV could be considered as evidence of the formation of the ternary nanoparticles. The fluorescence intensity measurements from three batches of the ternary nanoparticles gave a mean adsorption efficiency of 96.75 ± 1.13%. Circular dichroism spectra analysis showed that the protamine/DNA complexes had been coated by small SLNs, and that the anionic ternary nanoparticles formed did not disturb the construction of the binary complexes. SYBR Green I analysis suggested that the ternary nanoparticles could protect the DNA from nuclease degradation, and cell viability assay results showed that they exhibit lower cytotoxicity to A549 cells compared with the binary complexes and lipofectamine. The transfection efficiency of the ternary nanoparticles was better than that of naked DNA and the binary complexes, and almost equal to that of lipofectamine/DNA complexes, as revealed by inversion fluorescence microscope observation. These results indicated that the anionic ternary nanoparticles could facilitate gene transfer in cultured cells, and might alleviate the drawbacks of the conventional cationic vector/DNA complexes for gene delivery in vivo

  14. Tripodal receptors for cation and anion sensors

    NARCIS (Netherlands)

    Kuswandi, Bambang; Nuriman, [Unknown; Verboom, Willem; Reinhoudt, David

    2006-01-01

    This review discusses different types of artificial tripodal receptors for the selectiverecognition and sensing of cations and anions. Examples on the relationship between structure andselectivity towards cations and anions are described. Furthermore, their applications as potentiometricion sensing

  15. Methods and systems for measuring anions

    KAUST Repository

    Masih, Dilshad; Mohammed, Omar F.; Aly, Shawkat M.; Alarousu, Erkki

    2016-01-01

    Embodiments of the present disclosure provide for methods for detecting the presence and/or concentration of anions in a solution, systems for detecting the presence and/or concentration of anions in a solution, anion sensor systems, and the like.

  16. Methods and systems for measuring anions

    KAUST Repository

    Masih, Dilshad

    2016-08-18

    Embodiments of the present disclosure provide for methods for detecting the presence and/or concentration of anions in a solution, systems for detecting the presence and/or concentration of anions in a solution, anion sensor systems, and the like.

  17. Preparation of Cationic MOFs with Mobile Anions by Anion Stripping to Remove 2,4-D from Water

    Directory of Open Access Journals (Sweden)

    Tao Chen

    2017-07-01

    Full Text Available A cationic porous framework with mobile anions (MIL-101(Cr-Cl was easily and successfully synthesized by utilizing the stronger affinity of F− to Al3+ than Cr3+ in the charge-balanced framework of MIL-101(Cr. The structure, morphology and porosity of MIL-101(Cr-Cl were characterized. The obtained new materials retain the high surface area, good thermostability, and structure topology of MIL-101(Cr. With the mobile Cl− anion, MIL-101(Cr-Cl can be used as an ion-exchange material for anionic organic pollutions. In this work, 2,4-dichlorophenoxyacetic acid (2,4-D was used as a model to test the absorption performance of this new material. This new material exhibited improved adsorbability compared to that of the original metal-organic frameworks (MOFs. At the same time, this material also shows high anti-interference performance with changing solution pH.

  18. A computational study of anion-modulated cation-π interactions.

    Science.gov (United States)

    Carrazana-García, Jorge A; Rodríguez-Otero, Jesús; Cabaleiro-Lago, Enrique M

    2012-05-24

    The interaction of anions with cation-π complexes formed by the guanidinium cation and benzene was thoroughly studied by means of computational methods. Potential energy surface scans were performed in order to evaluate the effect of the anion coming closer to the cation-π pair. Several structures of guanidinium-benzene complexes and anion approaching directions were examined. Supermolecule calculations were performed on ternary complexes formed by guanidinium, benzene, and one anion and the interaction energy was decomposed into its different two- and three-body contributions. The interaction energies were further dissected into their electrostatic, exchange, repulsion, polarization and dispersion contributions by means of local molecular orbital energy decomposition analysis. The results confirm that, besides the electrostatic cation-anion attraction, the effect of the anion over the cation-π interaction is mainly due to polarization and can be rationalized following the changes in the anion-π and the nonadditive (three-body) terms of the interaction. When the cation and the anion are on the same side of the π system, the three-body interaction is anticooperative, but when the anion and the cation are on opposite sides of the π system, the three-body interaction is cooperative. As far as we know, this is the first study where this kind of analysis is carried out with a structured cation as guanidinium with a significant biological interest.

  19. Simultaneous anion and cation mobility in polypyrrole

    DEFF Research Database (Denmark)

    Skaarup, Steen; Bay, Lasse; Vidanapathirana, K.

    2003-01-01

    and the expulsion of anions; a broad anodic peak centered at ca. - 0.5 V representing the expulsion of cations; and a second broad peak at +0.2 to +0.5 V corresponding to anions being inserted. Although the motion of cations is the most important, as expected, there is a significant anion contribution, thereby...... complicating reproducibility when employing PPy(DBS) polymers as actuators. When the cation is doubly charged, it enters the film less readily, and anions dominate the mobility. Using a large and bulky cation switches the mechanism to apparently total anion motion. The changes in area of the three peaks...

  20. Structure and dynamics of solvated hydrogenoxalate and oxalate anions: theoretical study

    Czech Academy of Sciences Publication Activity Database

    Kroutil, O.; Minofar, Babak; Kabeláč, M.

    2016-01-01

    Roč. 22, č. 9 (2016), s. 210 ISSN 1610-2940 Institutional support: RVO:61388971 Keywords : Ab initio molecular dynamics * oxalic acid anions * Potential energy surface Subject RIV: EE - Microbiology, Virology Impact factor: 1.425, year: 2016

  1. Supramolecular Chemistry of Environmentally Relevant Anions

    International Nuclear Information System (INIS)

    Bowman-James, Kristin; Moyer, B.A.; Sessler, Jonathan L.

    2003-01-01

    The goal of this project is the development of highly selective extractants for anions targeting important and timely problems of critical interest to the EMSP mission. In particular, sulfate poses a special problem in cleaning up the Hanford waste tanks in that it interferes with vitrification, but available technologies for sulfate removal are limited. The basic chemical aspects of anion receptor design of functional pH independent systems as well as design of separations strategies for selective and efficient removal of targeted anions have been probed. Key findings include: (1) some of the first synthetic sulfate-selective anion-binding agents; (2) simple, structure-based methods for modifying the intrinsic anion selectivity of a given class of anion receptors; and (3) the first system capable of extracting sulfate from acidic, nitrate-containing aqueous media. Receptor design, structural influences on anion binding affinities, and findings from liquid-liquid extraction studies will be discussed

  2. Use of a colorimetric (DELI) test for the evaluation of chemoresistance of Plasmodium falciparum and Plasmodium vivax to commonly used anti-plasmodial drugs in the Brazilian Amazon.

    Science.gov (United States)

    Pratt-Riccio, Lilian R; Chehuan, Yonne F; Siqueira, Maria José; das Graças Alecrim, Maria; Bianco-Junior, Cesare; Druilhe, Pierre; Brasseur, Philippe; de Fátima Ferreira-da-Cruz, Maria; Carvalho, Leonardo J M; Daniel-Ribeiro, Cláudio T

    2013-08-12

    The emergence and spread of Plasmodium falciparum and Plasmodium vivax resistance to available anti-malarial drugs represents a major drawback in the control of malaria and its associated morbidity and mortality. The aim of this study was to evaluate the chemoresistance profile of P. falciparum and P. vivax to commonly used anti-plasmodial drugs in a malaria-endemic area in the Brazilian Amazon. The study was carried out in Manaus (Amazonas state), in the Brazilian Amazon. A total of 88 P. falciparum and 178 P. vivax isolates was collected from 2004 to 2007. The sensitivity of P. falciparum isolates was determined to chloroquine, quinine, mefloquine and artesunate and the sensitivity of P. vivax isolates was determined to chloroquine and mefloquine, by using the colorimetric DELI test. As expected, a high prevalence of P. falciparum isolates resistant to chloroquine (78.1%) was observed. The prevalence of isolates with profile of resistance or decreased sensitivity for quinine, mefloquine and artesunate was 12.7, 21.2 and 11.7%, respectively. In the case of P. vivax, the prevalence of isolates with profile of resistance for chloroquine and mefloquine was 9.8 and 28%, respectively. No differences in the frequencies of isolates with profile of resistance or geometric mean IC50s were seen when comparing the data obtained in 2004, 2005, 2006 and 2007, for all tested anti-malarials. The great majority of P. falciparum isolates in the Brazilian malaria-endemic area remain resistant to chloroquine, and the decreased sensitivity to quinine, mefloquine and artesunate observed in 10-20% of the isolates must be taken with concern, especially for artesunate. Plasmodium vivax isolates also showed a significant proportion of isolates with decreased sensitivity to chloroquine (first-line drug) and mainly to mefloquine. The data presented here also confirm the usefulness of the DELI test to generate results able to impact on public health policies.

  3. Adsorption of an anionic dispersant on lignite

    Energy Technology Data Exchange (ETDEWEB)

    Yavuz, R.; Kucukbayrak, S. [Istanbul Technical University, Istanbul (Turkey). Dept. of Chemical Engineering, Chemical & Metallurgical Engineering Faculty

    2001-12-01

    Since coal is not a homogeneous substance but a mixture of carbonaceous materials and mineral matter, it has a variety of surface properties. Therefore, it is not easy to control the properties of coal suspensions by simply adjusting variables, such as pH and/or electrolyte. A chemical agent needs to be added to control the properties of the coal suspensions. The adsorption behavior of an anionic dispersant in the presence of a wetting agent using some Turkish lignite samples was investigated. The effects of dispersant concentration, temperature and pH on the dispersant adsorption were studied systematically, and the experimental results are presented. Pellupur B69 as a dispersant, commercial mixture of formaldehyde condensate sodium salt of naphthalene sulphonic acid, and Texapon N{sub 2}5 as a wetting agent, a sodium lauryl ether sulfate, have been used.

  4. Anion

    Directory of Open Access Journals (Sweden)

    A. Vadivel Murugan

    2003-01-01

    . Its characterization is investigated by Fourier Transform Infrared Spectroscopy (FT-IR and Scanning Electron Microscopy (SEM. The hybrid material presents predominantly high electronic conductivities of around 2.0 and 7.0 S cm-1 at 300 and 400K respectively.

  5. Environmental behavior of inorganic anions

    International Nuclear Information System (INIS)

    Garland, T.R.; Cataldo, D.A.; Fellows, R.J.; Wildung, R.E.

    1987-01-01

    Recent efforts have addressed two aspects of anion behavior in the soil/plant system. The first involves evaluation of the gaseous component of the terrestrial iodine cycle in soils and plants. Field analyses of 129 I in soils and vegetation adjacent to a fuels reprocessing facility, which was idle for 10 years prior to the study, indicated that there may be a significant gaseous component to the terrestrial iodine cycle. Soil substrates, including a silt-sand, organic forest soil, quartz sand, and a sterilized soil, were amended with radioiodide, and the rates and quality of the volatile components evaluated

  6. Schlenk Techniques for Anionic Polymerization

    KAUST Repository

    Ratkanthwar, Kedar

    2015-09-01

    Anionic polymerization-high vacuum techniques (HVTs) are doubtlessly the most prominent and reliable experimental tools to prepare polymer samples with well-defined and, in many cases, complex macromolecular architectures. Due to the high demands for time and skilled technical personnel, HVTs are currently used in only a few research laboratories worldwide. Instead, most researchers in this filed are attracted to more facile Schlenk techniques. The basic principle of this technique followed in all laboratories is substantially the same, i.e. the use of alternate vacuum and inert gas atmosphere in glass apparatus for the purification/charging of monomer, solvents, additives, and for the manipulation of air-sensitive compounds such as alkyl metal initiators, organometallic or organic catalysts. However, it is executed quite differently in each research group in terms of the structure of Schlenk apparatus (manifolds, connections, purification/storage flasks, reactors, etc.), the use of small supplementary devices (soft tubing, cannulas, stopcocks, etc.) and experimental procedures. The operational methods are partly purpose-oriented while also featured by a high flexibility, which makes it impossible to describe in detail each specific one. In this chapter we will briefly exemplify the application of Schlenk techniques for anionic polymerization by describing the performance of a few experiments from our own work.

  7. Anionic lipids and the maintenance of membrane electrostatics in eukaryotes.

    Science.gov (United States)

    Platre, Matthieu Pierre; Jaillais, Yvon

    2017-02-01

    A wide range of signaling processes occurs at the cell surface through the reversible association of proteins from the cytosol to the plasma membrane. Some low abundant lipids are enriched at the membrane of specific compartments and thereby contribute to the identity of cell organelles by acting as biochemical landmarks. Lipids also influence membrane biophysical properties, which emerge as an important feature in specifying cellular territories. Such parameters are crucial for signal transduction and include lipid packing, membrane curvature and electrostatics. In particular, membrane electrostatics specifies the identity of the plasma membrane inner leaflet. Membrane surface charges are carried by anionic phospholipids, however the exact nature of the lipid(s) that powers the plasma membrane electrostatic field varies among eukaryotes and has been hotly debated during the last decade. Herein, we discuss the role of anionic lipids in setting up plasma membrane electrostatics and we compare similarities and differences that were found in different eukaryotic cells.

  8. Intermolecular proton transfer in anionic complexes of uracil with alcohols

    International Nuclear Information System (INIS)

    Haranczyk, Maciej; Rak, Janusz; Gutowski, Maciej S.; Radisic, Dunja; Stokes, Sarah T.; Bowen, Kit H.

    2005-01-01

    A series of eighteen alcohols (ROH) has been designed with an enthalpy of deprotonation (H DP ) in a range of 13.8-16.3 eV. The effects of excess electron attachment to the binary alcohol-uracil (ROH...U) complexes have been studied at the density functional level with a B3LYP exchange-correlation functional and at the second order Moeller-Plesset perturbation theory level. The photoelectron spectra of anionic complexes of uracil with three alcohols (ethanol, 2,2,3,3,3-pentafluoroethanol and 1,1,1,3,3,3-hexafluoro-2-propanol) have been measured with 2.54 eV photons. For ROHs with deprotonation enthalpies larger than 14.8 eV only the ROH...U - minimum exists on the potential energy surface of the anionic complex. For alcohols with deprotonation enthalpies in a range of 14.3-14.8 eV two minima might exist on the anionic potential energy surface, which correspond to the RO - ...HU . and ROH...U - structures. For ROHs with deprotonation enthalpies smaller than 14.3 eV, the excess electron attachment to the ROH...U complex always induces a barrier-free proton transfer from the hydroxyl group of ROH to the O8 atom of U, with the product being RO - ...HU . . A driving force for the intermolecular proton transfer is to stabilize the excess negative charge localized on a orbital of uracil. Therefore, these complexes with proton transferred to the anionic uracil are characterized by larger values of electron vertical detachment energy (VDE). The values of VDE for anionic complexes span a range from 1.0 to 2.3 eV and roughly correlate with the acidity of alcohols. However, there is a gap of ∼0.5 eV in the values of VDE, which separates the two families, ROH...U - and RO - ...HU . , of anionic complexes. The energy of stabilization for the anionic complexes spans a range from 0.6 to 1.7 eV and roughly correlates with the acidity of alcohols. The measured photoelectron spectra are in good agreement with the theoretical predictions

  9. The anionic biosurfactant rhamnolipid does not denature industrial enzymes

    Directory of Open Access Journals (Sweden)

    Jens Kvist Madsen

    2015-04-01

    Full Text Available Biosurfactants (BS are surface-active molecules produced by microorganisms. Their combination of useful properties and sustainable production make them promising industrial alternatives to petrochemical and oleochemical surfactants. Here we compare the impact of the anionic BS rhamnolipid (RL and the conventional/synthetic anionic surfactant sodium dodecyl sulfate (SDS on the structure and stability of three different commercially used enzymes, namely the cellulase Carezyme® (CZ, the phospholipase Lecitase Ultra® (LT and the α-amylase Stainzyme® (SZ. Our data reveal a fundamental difference in their mode of interaction. SDS shows great diversity of interaction towards the different enzymes. It efficiently unfolds both LT and CZ, but LT is unfolded by SDS through formation of SDS clusters on the protein well below the cmc, while CZ is only unfolded by bulk micelles and on average binds significantly less SDS than LT. SDS binds with even lower stoichiometry to SZ and leads to an increase in thermal stability. In contrast, RL does not affect the tertiary or secondary structure of any enzyme at room temperature, has little impact on thermal stability and only binds detectably (but at low stoichiometries to SZ. Furthermore all enzymes maintain activity at both monomeric and micellar concentrations of RL. We conclude that RL, despite its anionic charge, is a surfactant that does not compromise the structural integrity of industrially relevant proteins. This makes RL a promising alternative to current synthetic anionic surfactants in a wide range of commercial applications.

  10. Test procedure for anion exchange chromatography

    International Nuclear Information System (INIS)

    Cooper, T.D.

    1994-01-01

    Plutonium from stored nitrate solutions will be sorbed onto anion exchange resins and converted to storable plutonium dioxide. Useful information will be simultaneously gained on the thermal stability and ion exchange capacity of four commercially available anion exchange resins over several years and under severe degradative conditions. This information will prove useful in predicting the safe and efficient lifetimes of these resins

  11. Tripodal Receptors for Cation and Anion Sensors

    Directory of Open Access Journals (Sweden)

    David N. Reinhoudt

    2006-08-01

    Full Text Available This review discusses different types of artificial tripodal receptors for the selectiverecognition and sensing of cations and anions. Examples on the relationship between structure andselectivity towards cations and anions are described. Furthermore, their applications as potentiometricion sensing are emphasised, along with their potential applications in optical sensors or optodes.

  12. Neutral anion receptors: design and application

    NARCIS (Netherlands)

    Antonisse, M.M.G.; Reinhoudt, David

    1998-01-01

    After the development of synthetic cation receptors in the late 1960s, only in the past decade has work started on the development of synthetic neutral anion receptors. Combination and preorganization of different anion binding groups, like amides, urea moieties, or Lewis acidic metal centers lead

  13. Creating molecular macrocycles for anion recognition

    Directory of Open Access Journals (Sweden)

    Amar H. Flood

    2016-03-01

    Full Text Available The creation and functionality of new classes of macrocycles that are shape persistent and can bind anions is described. The genesis of triazolophane macrocycles emerges out of activity surrounding 1,2,3-triazoles made using click chemistry; and the same triazoles are responsible for anion capture. Mistakes made and lessons learnt in anion recognition provide deeper understanding that, together with theory, now provides for computer-aided receptor design. The lessons are acted upon in the creation of two new macrocycles. First, cyanostars are larger and like to capture large anions. Second is tricarb, which also favors large anions but shows a propensity to self-assemble in an orderly and stable manner, laying a foundation for future designs of hierarchical nanostructures.

  14. Anion channels: master switches of stress responses.

    Science.gov (United States)

    Roelfsema, M Rob G; Hedrich, Rainer; Geiger, Dietmar

    2012-04-01

    During stress, plant cells activate anion channels and trigger the release of anions across the plasma membrane. Recently, two new gene families have been identified that encode major groups of anion channels. The SLAC/SLAH channels are characterized by slow voltage-dependent activation (S-type), whereas ALMT genes encode rapid-activating channels (R-type). Both S- and R-type channels are stimulated in guard cells by the stress hormone ABA, which leads to stomatal closure. Besides their role in ABA-dependent stomatal movement, anion channels are also activated by biotic stress factors such as microbe-associated molecular patterns (MAMPs). Given that anion channels occur throughout the plant kingdom, they are likely to serve a general function as master switches of stress responses. Copyright © 2012 Elsevier Ltd. All rights reserved.

  15. Anion Gap Blood Test: MedlinePlus Lab Test Information

    Science.gov (United States)

    ... https://medlineplus.gov/labtests/aniongapbloodtest.html Anion Gap Blood Test To use the sharing features on this page, please enable JavaScript. What is an Anion Gap Blood Test? An anion gap blood test is a way ...

  16. High Vacuum Techniques for Anionic Polymerization

    KAUST Repository

    Ratkanthwar, Kedar; Hadjichristidis, Nikolaos; Mays, Jimmy

    2015-01-01

    Anionic polymerization high vacuum techniques (HVTs) are the most suitable for the preparation of polymer samples with well-defined complex macromolecular architectures. Though HVTs require glassblowing skill for designing and making polymerization

  17. Photoelectron spectroscopy of the 6-azauracil anion.

    Science.gov (United States)

    Chen, Jing; Buonaugurio, Angela; Dolgounitcheva, Olga; Zakrzewski, V G; Bowen, Kit H; Ortiz, J V

    2013-02-14

    We report the photoelectron spectrum of the 6-azauracil anion. The spectrum is dominated by a broad band exhibiting a maximum at an electron binding energy (EBE) of 1.2 eV. This spectral pattern is indicative of a valence anion. Our calculations were carried out using ab initio electron propagator and other many-body methods. Comparison of the anion and corresponding neutral of 6-azauracil with those of uracil shows that substituting a nitrogen atom for C-H at the C6 position of uracil gives rise to significant changes in the electronic structure of 6-azauracil versus that of uracil. The adiabatic electron affinity (AEA) of the canonical 6-azauracil tautomer is substantially larger than that of canonical uracil. Among the five tautomeric, 6-azauracil anions studied computationally, the canonical structure was found to be the most stable. The vertical detachment energies (VDE) of the canonical, valence-bound anion of 6-azauracil and its closest "very-rare" tautomer have been calculated. Electron propagator calculations on the canonical anion yield a VDE value that is in close agreement with the experimentally determined VDE value of 1.2 eV. The AEA value of 6-azauracil, assessed at the CCSD(T) level of theory to be 0.5 eV, corresponds with the EBE value of the onset of the experimental spectrum.

  18. Lowest auto-detachment state of the water anion

    International Nuclear Information System (INIS)

    Houfek, K.; Cizek, M.

    2016-01-01

    Because of the abundance of water in living tissue the reactive low-energy electron collisions with the water molecule represent an important step in the radiation damage of cells. In this paper, the potential energy surface of the ground state of the water anion H_2O"- is carefully mapped using multireference configuration interaction (MRCI) calculations for a large range of molecular geometries. Particular attention is paid to a consistent description of both the O"-+H_2 and OH"-+H asymptotes and to a relative position of the anion energy to the ground state energy of the neutral molecule. The auto-detachment region, where the anion state crosses to the electronic continuum is identified. The local minimum in the direction of the O"- + H_2 channel previously reported by Werner et al. [J. Chem. Phys. 87, 2913 (1987)] is found to be slightly off the linear geometry and is separated by a saddle from the auto-detachment region. The auto-detachment region is directly accessible from the OH"-+H asymptote. For the molecular geometries in the auto-detachment region and in its vicinity we also performed fixed-nuclei electron-molecule scattering calculations using the R-matrix method. Tuning of consistency of a description of the correlation energy in both the multireference CI and R-matrix calculations is discussed. Two models of the correlation energy within the R-matrix method that are consistent with the quantum chemistry calculations are found. Both models yield scattering quantities in a close agreement. The results of this work will allow a consistent formulation of the nonlocal resonance model of the water anion in a future publication

  19. Mimicking the cell membrane: bio-inspired simultaneous functions with monovalent anion selectivity and antifouling properties of anion exchange membrane

    Science.gov (United States)

    Zhao, Yan; Liu, Huimin; Tang, Kaini; Jin, Yali; Pan, Jiefeng; der Bruggen, Bart Van; Shen, Jiangnan; Gao, Congjie

    2016-11-01

    A new bio-inspired method was applied in this study to simultaneously improve the monovalent anion selectivity and antifouling properties of anion exchange membranes (AEMs). Three-layer architecture was developed by deposition of polydopamine (PDA) and electro-deposition of N-O-sulfonic acid benzyl chitosan (NSBC). The innermost and outermost layers were PDA with different deposition time. The middle layer was prepared by NSBC. Fourier transform infrared spectroscopy and scanning electron microscopy confirmed that PDA and NSBC were successfully modified on the surfaces of AEMs. The contact angle of the membranes indicated an improved hydrophilicity of the modified membranes. A series of electrodialysis experiments in which Cl-/SO42- separation was studied, demonstrating the monovalent anion selectivity of the samples. The Cl-/SO42- permselectivity of the modified membranes can reach up to 2.20, higher than that of the commercial membrane (only 0.78) during 90 minutes in electrodialysis (ED). The increase value of the resistance of the membranes was also measured to evaluate the antifouling properties. Sodium dodecyl benzene sulfonate (SDBS) was used as the fouling material in the ED process and the membrane area resistance of modified membrane increase value of was only 0.08 Ωcm2 30 minutes later.

  20. Mimicking the cell membrane: bio-inspired simultaneous functions with monovalent anion selectivity and antifouling properties of anion exchange membrane

    Science.gov (United States)

    Zhao, Yan; Liu, Huimin; Tang, Kaini; Jin, Yali; Pan, Jiefeng; der Bruggen, Bart Van; Shen, Jiangnan; Gao, Congjie

    2016-01-01

    A new bio-inspired method was applied in this study to simultaneously improve the monovalent anion selectivity and antifouling properties of anion exchange membranes (AEMs). Three-layer architecture was developed by deposition of polydopamine (PDA) and electro-deposition of N-O-sulfonic acid benzyl chitosan (NSBC). The innermost and outermost layers were PDA with different deposition time. The middle layer was prepared by NSBC. Fourier transform infrared spectroscopy and scanning electron microscopy confirmed that PDA and NSBC were successfully modified on the surfaces of AEMs. The contact angle of the membranes indicated an improved hydrophilicity of the modified membranes. A series of electrodialysis experiments in which Cl−/SO42− separation was studied, demonstrating the monovalent anion selectivity of the samples. The Cl−/SO42− permselectivity of the modified membranes can reach up to 2.20, higher than that of the commercial membrane (only 0.78) during 90 minutes in electrodialysis (ED). The increase value of the resistance of the membranes was also measured to evaluate the antifouling properties. Sodium dodecyl benzene sulfonate (SDBS) was used as the fouling material in the ED process and the membrane area resistance of modified membrane increase value of was only 0.08 Ωcm2 30 minutes later. PMID:27853255

  1. Assessing the reactivation efficacy of hydroxylamine anion towards VX-inhibited AChE: a computational study.

    Science.gov (United States)

    Khan, Md Abdul Shafeeuulla; Ganguly, Bishwajit

    2012-05-01

    Oximate anions are used as potential reactivating agents for OP-inhibited AChE because of they possess enhanced nucleophilic reactivity due to the α-effect. We have demonstrated the process of reactivating the VX-AChE adduct with formoximate and hydroxylamine anions by applying the DFT approach at the B3LYP/6-311 G(d,p) level of theory. The calculated results suggest that the hydroxylamine anion is more efficient than the formoximate anion at reactivating VX-inhibited AChE. The reaction of formoximate anion and the VX-AChE adduct is a three-step process, while the reaction of hydroxylamine anion with the VX-AChE adduct seems to be a two-step process. The rate-determining step in the process is the initial attack on the VX of the VX-AChE adduct by the nucleophile. The subsequent steps are exergonic in nature. The potential energy surface (PES) for the reaction of the VX-AChE adduct with hydroxylamine anion reveals that the reactivation process is facilitated by the lower free energy of activation (by a factor of 1.7 kcal mol(-1)) than that of the formoximate anion at the B3LYP/6-311 G(d,p) level of theory. The higher free energy of activation for the reverse reactivation reaction between hydroxylamine anion and the VX-serine adduct further suggests that the hydroxylamine anion is a very good antidote agent for the reactivation process. The activation barriers calculated in solvent using the polarizable continuum model (PCM) for the reactivation of the VX-AChE adduct with hydroxylamine anion were also found to be low. The calculated results suggest that V-series compounds can be more toxic than G-series compounds, which is in accord with earlier experimental observations.

  2. Metal-Anion Pairing at Oxide/Water Interfaces: Theoretical and Experimental Investigations from the Nanoscale to the Macroscale

    Energy Technology Data Exchange (ETDEWEB)

    Allen, Heather [The Ohio State Univ., Columbus, OH (United States)

    2016-11-14

    We combine the use of several techniques including bulk adsorption experiments, X-ray absorption, infrared, total internal reflection Raman, and vibrational sum frequencygeneration (XAS, IR, TIR-Raman, VSFG) spectroscopies, and molecular modeling to investigate ion adsorption at mineral surfaces. XAS and TIR-Raman provides data on how the metal binds to the surface (e.g., monodentate, bidentate), IR provides data on bulk anion adsorption at mineral surfaces from aqueous solutions, and VSFG provides surface specific data on anion adsorption at the mineral surface as well as impact of adsorbed metal-anion pairs on water structure at the mineral surface. Molecular modeling is used to guide spectroscopic data interpretation by providing information on water structure around ions in solution and the structure of metal-anion complexes in aqueous solutions. In addition, molecular modeling is used to provide insight into water structure at mineral surfaces, the surface sites involved in ion adsorption, and the distribution of ion pairs between aqueous solution and the mineral surface. Our studies have focused on systems involving alkaline earth metal (Mg2+, Ca2+, Sr2+, Ba2+) and heavy metal (Co2+, Cd2+) cations. The anions we have selected for studyinclude Cl-, NO3-, ClO4-, SO42-, SeO32-, and SeO42-. Ion adsorption and the potential formation ofternary complexes on silica (quartz, amorphous silica), alumina (corundum and gibbsite), and ferric iron oxides (goethite and hematite) are under investigation.

  3. DNA release from lipoplexes by anionic lipids: correlation with lipid mesomorphism, interfacial curvature, and membrane fusion

    Energy Technology Data Exchange (ETDEWEB)

    Tarahovsky, Yury S.; Koynova, Rumiana; MacDonald, Robert C. (Northwestern)

    2010-01-18

    DNA release from lipoplexes is an essential step during lipofection and is probably a result of charge neutralization by cellular anionic lipids. As a model system to test this possibility, fluorescence resonance energy transfer between DNA and lipid covalently labeled with Cy3 and BODIPY, respectively, was used to monitor the release of DNA from lipid surfaces induced by anionic liposomes. The separation of DNA from lipid measured this way was considerably slower and less complete than that estimated with noncovalently labeled DNA, and depends on the lipid composition of both lipoplexes and anionic liposomes. This result was confirmed by centrifugal separation of released DNA and lipid. X-ray diffraction revealed a clear correlation of the DNA release capacity of the anionic lipids with the interfacial curvature of the mesomorphic structures developed when the anionic and cationic liposomes were mixed. DNA release also correlated with the rate of fusion of anionic liposomes with lipoplexes. It is concluded that the tendency to fuse and the phase preference of the mixed lipid membranes are key factors for the rate and extent of DNA release. The approach presented emphasizes the importance of the lipid composition of both lipoplexes and target membranes and suggests optimal transfection may be obtained by tailoring lipoplex composition to the lipid composition of target cells.

  4. Acetate and phosphate anion adsorption linear sweep voltammograms simulated using density functional theory

    KAUST Repository

    Savizi, Iman Shahidi Pour

    2011-04-01

    Specific adsorption of anions to electrode surfaces may alter the rates of electrocatalytic reactions. Density functional theory (DFT) methods are used to predict the adsorption free energy of acetate and phosphate anions as a function of Pt(1 1 1) electrode potential. Four models of the electrode potential are used including a simple vacuum slab model, an applied electric field model with and without the inclusion of a solvating water bi-layer, and the double reference model. The linear sweep voltammogram (LSV) due to anion adsorption is simulated using the DFT results. The inclusion of solvation at the electrochemical interface is necessary for accurately predicting the adsorption peak position. The Langmuir model is sufficient for predicting the adsorption peak shape, indicating coverage effects are minor in altering the LSV for acetate and phosphate adsorption. Anion adsorption peak positions are determined for solution phase anion concentrations present in microbial fuel cells and microbial electrolysis cells and discussion is provided as to the impact of anion adsorption on oxygen reduction and hydrogen evolution reaction rates in these devices. © 2011 Elsevier Ltd. All rights reserved.

  5. Supramolecular Chemistry of Selective Anion Recognition for Anions of Environmental Relevance

    International Nuclear Information System (INIS)

    Bowman-James, K.; Wilson, G.; Moyer, B. A.

    2004-01-01

    This project involves the design and synthesis of receptors for oxoanions of environmental importance, including emphasis on high level and low activity waste. Target anions have included primarily oxoanions and a study of the basic concepts behind selective binding of target anions. A primary target has been sulfate because of its deleterious influence on the vitrification of tank wastes

  6. The effect of interlayer anion on the reactivity of Mg-Al layered double hydroxides: improving and extending the customization capacity of anionic clays.

    Science.gov (United States)

    Rojas, Ricardo; Bruna, Felipe; de Pauli, Carlos P; Ulibarri, M Ángeles; Giacomelli, Carla E

    2011-07-01

    Layered double hydroxides (LDHs) reactivity and interfacial behavior are closely interconnected and control particle properties relevant to the wide range of these solids' applications. Despite their importance, their relationship has been hardly described. In this work, chloride and dodecylsulfate (DDS(-)) intercalated LDHs are studied combining experimental data (electrophoretic mobility and contact angle measurements, hydroxyl and organic compounds uptake) and a simple mathematical model that includes anion-binding and acid-base reactions. This approach evidences the anion effect on LDHs interfacial behavior, reflected in the opposite particle charge and the different surface hydrophobic/hydrophilic character. LDHs reactivity are also determined by the interlayer composition, as demonstrated by the cation uptake capability of the DDS(-) intercalated sample. Consequently, the interlayer anion modifies the LDHs interfacial properties and reactivity, which in turn extends the customization capacity of these solids. Copyright © 2011 Elsevier Inc. All rights reserved.

  7. Infrared spectroscopy of anionic hydrated fluorobenzenes

    International Nuclear Information System (INIS)

    Schneider, Holger; Vogelhuber, Kristen M.; Weber, J. Mathias

    2007-01-01

    We investigate the structural motifs of anionic hydrated fluorobenzenes by infrared photodissociation spectroscopy and density functional theory. Our calculations show that all fluorobenzene anions under investigation are strongly distorted from the neutral planar molecular geometries. In the anions, different F atoms are no longer equivalent, providing structurally different binding sites for water molecules and giving rise to a multitude of low-lying isomers. The absorption bands for hexa- and pentafluorobenzene show that only one isomer for the respective monohydrate complexes is populated in our experiment. For C 6 F 6 - ·H 2 O, we can assign these bands to an isomer where water forms a weak double ionic hydrogen bond with two F atoms in the ion, in accord with the results of Bowen et al. [J. Chem. Phys. 127, 014312 (2007), following paper.] The spectroscopic motif of the binary complexes changes slightly with decreasing fluorination of the aromatic anion. For dihydrated hexafluorobenzene anions, several isomers are populated in our experiments, some of which may be due to hydrogen bonding between water molecules

  8. Cytotoxic mechanisms of hydrosulfide anion and cyanide anion in primary rat hepatocyte cultures

    International Nuclear Information System (INIS)

    Thompson, Rodney W.; Valentine, Holly L.; Valentine, William M.

    2003-01-01

    Hydrogen sulfide and hydrogen cyanide are known to compromise mitochondrial respiration through inhibition of cytochrome c oxidase and this is generally considered to be their primary mechanism of toxicity. Experimental studies and the efficiency of current treatment protocols suggest that H 2 S may exert adverse physiological effects through additional mechanisms. To evaluate the role of alternative mechanisms in H 2 S toxicity, the relative contributions of electron transport inhibition, uncoupling of mitochondrial respiration, and opening of the mitochondrial permeability transition pore (MPTP) to hydrosulfide and cyanide anion cytotoxicity in primary hepatocyte cultures were examined. Supplementation of hepatocytes with the glycolytic substrate, fructose, rescued hepatocytes from cyanide anion induced toxicity, whereas fructose supplementation increased hydrosulfide anion toxicity suggesting that hydrosulfide anion may compromise glycolysis in hepatocytes. Although inhibitors of the MPTP opening were protective for hydrosulfide anion, they had no effect on cyanide anion toxicity, consistent with an involvement of the permeability transition pore in hydrosulfide anion toxicity but not cyanide anion toxicity. Exposure of isolated rat liver mitochondria to hydrosulfide did not result in large amplitude swelling suggesting that if H 2 S induces the permeability transition it does so indirectly through a mechanism requiring other cellular components. Hydrosulfide anion did not appear to be an uncoupler of mitochondrial respiration in hepatocytes based upon the inability of oligomycin and fructose to protect hepatocytes from hydrosulfide anion toxicity. These findings support mechanisms additional to inhibition of cytochrome c oxidase in hydrogen sulfide toxicity. Further investigations are required to assess the role of the permeability transition in H 2 S toxicity, determine whether similar affects occur in other cell types or in vivo and evaluate whether this may

  9. Fundamental characteristics study of anion-exchange PVDF-SiO(2) membranes.

    Science.gov (United States)

    Zuo, Xingtao; Shi, Wenxin; Yu, Shuili; He, Jiajie

    2012-01-01

    A new type of poly(vinylidene fluoride)(PVDF)-SiO(2) hybrid anion-exchange membrane was prepared by blending method. The anion-exchange groups were introduced by the reaction of epoxy groups with trimethylamine (TMA). Contact angle between water and the membrane surface was measured to characterize the hydrophilicity change of the membrane surface. The effects of nano-sized SiO(2) particles in the membrane-forming materials on the membrane mechanical properties and conductivity were also investigated. The experimental results indicated that PVDF-SiO(2) anion-exchange membranes exhibited better water content, ion-exchange capacity, conductivity and mechanic properties, and so may find potential applications in alkaline membrane fuel cells and water treatment processes.

  10. Gas-Phase Reactivity of Microsolvated Anions

    DEFF Research Database (Denmark)

    Thomsen, Ditte Linde

    the gas-phase α-effect. The experimental studies are performed by means of the flowing after glow selected ion flow tube technique, and these are supplemented by electronic structure calculations. The α-nucleophile employed is the microsolvated hydrogen peroxide anion whose reactivity is compared......Gas-phase studies of ion-molecule reactions shed light on the intrinsic factors that govern reactivity; and even solvent effects can be examined in the gasphase environment by employing microsolvated ions. An area that has received considerable attention with regard to the interplay between...... to that of a series of microsolvated oxygen centered anions. The association of the nucleophiles with a single water or methanol molecule allows the α-effect to be observed in the SN2 reaction with methyl chloride; this effect was not apparent in the reactions of the unsolvated anions. The results suggest...

  11. New borohydride anion B6H7-

    International Nuclear Information System (INIS)

    Kuznetsov, I.Yu.; Vinitskij, D.M.; Solntsev, K.A.

    1985-01-01

    The [Ni(Bipy) 3 ] (B 6 H 7 ) 2 , (Ph 4 P)B 6 H 7 , [Ni(Phen) 3 ](B 6 H 7 ) 2 crystals (where Bipy = bipyridine, Phen = phenathroline, Ph = phenyl) are obtained via the exchange reaction with a subsequent recrystallization from aqua-acetonic and acetonic solutions. The structure is studied of a new borohydride anion B 6 H 7 - possessing a four-valence bond unique for polyhedral borohydride anions. A triangular face of boride skeleton coordinating a hydrogen atom is considerably larger than other faces, and the electron density on this hydrogen atom is evidently much higher than at the end hydride hydrogen atoms. The trend of B 6 H 7 - anion to form statistically disordered structurs testifies to a rather slight effect of the seventh hydrogen atom position on the structure pattern of the ionic crystal lattice

  12. Anion retention in soil: Possible application to reduce migration of buried technetium and iodine

    International Nuclear Information System (INIS)

    Gu, B.; Schulz, R.K.

    1991-10-01

    This report summarizes a literature review of our present knowledge of the anion exchange properties of a number of soils and minerals, which may potentially be used as anion exchangers to retard migration of such anions as iodide (I - ), iodate (IO 3 - ) and pertechnetate (TcO 4 - ) away from disposal site. The amorphous clays allophane and imogolite, are found to be among the most important soil components capable of developing appreciable amounts of positive charge for anion exchange even at about neutral pH. Decreases in the SiO 2 /Al 2 O 3 ratio and soil pH result in an increase in soil AEC. Allophane and imogolite rich soils have an AEC ranging from 1 to 18 meq/100g at pH about 6. Highly weathered soils dominated by Fe and Al oxides and kaolinite may develop a significant amount of AEC as soil pH falls. The retention of iodine (I) and technetium (T c ), by soils is associated with both soil organic matter, and Fe and Al oxides, whereas sorption on layer silicate minerals in negligible. Fe and Al oxides become more important in the retention of anionic I - , IO 3 - , and TcO 4 - as pH falls, since more positive charge is developed on the oxide surfaces. Although few studies, if any, have been conducted on I and T c sorption by soil allophane and imogolite, it is estimated that a surface plough soil (2 million pounds soil per acre) with 5 meq/100g AEC, as is commonly found in andisols, shall retain approximately 5900 kg I and 4500 kg T c . It is conceivable that an anion exchanger such as an andisol could be used to modify the near field environment of a radioactive waste disposal facility. This whole disposal system would then offer similar migration resistance to anions as is normally afforded to cations by usual and normal soils. 93 refs., 10 figs., 7 tabs

  13. The absorption of plutonium by anion resins

    Energy Technology Data Exchange (ETDEWEB)

    Durham, R. W.; Mills, R.

    1961-10-15

    Equilibrium experiments have shown Pu{sup +4} to be absorbed from nitric acid onto an anion resin as a complex anion Pu(NO{sub 3}){sub 6}{sup -2}. The amount of absorption is dependent on the plutonium and nitric acid concentrations in the equilibrium solution with a maximum at 7N to 8N HNO{sub 3}. A low cross-linked resin has a higher capacity and reaches equilibrium more rapidly than the normally supplied resin. Saturation capacity of one per cent cross-linked Nalcite SBR (Dowex 1), 50 -- 100 mesh, is 385 mg Pu/gram dry resin. (author)

  14. High Vacuum Techniques for Anionic Polymerization

    KAUST Repository

    Ratkanthwar, Kedar

    2015-09-01

    Anionic polymerization high vacuum techniques (HVTs) are the most suitable for the preparation of polymer samples with well-defined complex macromolecular architectures. Though HVTs require glassblowing skill for designing and making polymerization reactor, it is the best way to avoid any termination of living polymers during the number of steps for the synthesis of polymers with complex structure. In this chapter, we describe the different polymerization reactors and HVTs for the purification of monomers, solvents, and other reagents for anionic polymerization as well as few model reactions for the synthesis of polymers with simple to complex structure.

  15. Dibromine radical anion reactions with heme enzymes

    International Nuclear Information System (INIS)

    Gebicka, L.; Gebicki, J.L.

    1996-01-01

    Reactions of Br 2 radical anion with heme enzymes, catalase horseradish peroxidase, have been studied by pulse radiolysis. It has been found that Br 2 - does not react with the heme centre of investigated enzymes. Dibromine radical anion reacts with tryptophan residues of catalase without any influence on the activity of catalase. It is suggested that in pulse radiolysis studies, where horseradish peroxidase is at about tenfold excess toward Br 2 - , the enzyme is modified rather by Br 2 , than by Br 2 - . (author). 26 refs., 3 figs

  16. A two-year monitoring study on anionic detergent, phosphate and ...

    African Journals Online (AJOL)

    Anionic detergent, phosphate and chlorophyll-a concentrations were evaluated in Istanbul Strait between January 2013 and December 2014. Water samples were taken monthly at one station in the strait. The average concentrations of phosphate were 1.38 mg L-1 for surface water and 1.76 mg L -1 for bottom water in 2013 ...

  17. Efficient Removal of Cationic and Anionic Radioactive Pollutants from Water Using Hydrotalcite-Based Getters.

    Science.gov (United States)

    Bo, Arixin; Sarina, Sarina; Liu, Hongwei; Zheng, Zhanfeng; Xiao, Qi; Gu, Yuantong; Ayoko, Godwin A; Zhu, Huaiyong

    2016-06-29

    Hydrotalcite (HT)-based materials are usually applied to capture anionic pollutants in aqueous solutions. Generally considered anion exchangers, their ability to capture radioactive cations is rarely exploited. In the present work, we explored the ability of pristine and calcined HT getters to effectively capture radioactive cations (Sr(2+) and Ba(2+)) which can be securely stabilized at the getter surface. It is found that calcined HT outperforms its pristine counterpart in cation removal ability. Meanwhile, a novel anion removal mechanism targeting radioactive I(-) is demonstrated. This approach involves HT surface modification with silver species, namely, Ag2CO3 nanoparticles, which can attach firmly on HT surface by forming coherent interface. This HT-based anion getter can be further used to capture I(-) in aqueous solution. The observed I(-) uptake mechanism is distinctly different from the widely reported ion exchange mechanism of HT and much more efficient. As a result of the high local concentrations of precipitants on the getters, radioactive ions in water can be readily immobilized onto the getter surface by forming precipitates. The secured ionic pollutants can be subsequently removed from water by filtration or sedimentation for safe disposal. Overall, these stable, inexpensive getters are the materials of choice for removal of trace ionic pollutants from bulk radioactive liquids, especially during episodic environmental crisis.

  18. Interstellar dehydrogenated PAH anions: vibrational spectra

    Science.gov (United States)

    Buragohain, Mridusmita; Pathak, Amit; Sarre, Peter; Gour, Nand Kishor

    2018-03-01

    Interstellar polycyclic aromatic hydrocarbon (PAH) molecules exist in diverse forms depending on the local physical environment. Formation of ionized PAHs (anions and cations) is favourable in the extreme conditions of the interstellar medium (ISM). Besides in their pure form, PAHs are also likely to exist in substituted forms; for example, PAHs with functional groups, dehydrogenated PAHs etc. A dehydrogenated PAH molecule might subsequently form fullerenes in the ISM as a result of ongoing chemical processes. This work presents a density functional theory (DFT) calculation on dehydrogenated PAH anions to explore the infrared emission spectra of these molecules and discuss any possible contribution towards observed IR features in the ISM. The results suggest that dehydrogenated PAH anions might be significantly contributing to the 3.3 μm region. Spectroscopic features unique to dehydrogenated PAH anions are highlighted that may be used for their possible identification in the ISM. A comparison has also been made to see the size effect on spectra of these PAHs.

  19. Anion-conducting polymer, composition, and membrane

    Science.gov (United States)

    Pivovar, Bryan S [Los Alamos, NM; Thorn, David L [Los Alamos, NM

    2009-09-01

    Anion-conducing polymers and membranes with enhanced stability to aqueous alkali include a polymer backbone with attached sulfonium, phosphazenium, phosphazene, and guanidinium residues. Compositions also with enhanced stability to aqueous alkali include a support embedded with sulfonium, phosphazenium, and guanidinium salts.

  20. Synthesis of azaphenanthridines via anionic ring closure

    DEFF Research Database (Denmark)

    Hansen, Henriette Møller; Lysén, M.; Begtrup, M.

    2005-01-01

    A new and convergent synthesis of azaphenanthridines via an anionic ring closure is reported. Ortho-lithiation/in situ borylation of cyanopyridines produces the corresponding cyanopyridylboronic esters, which undergo a Suzuki-Miyaura cross-coupling to give the key intermediates. Addition of lithium...

  1. Modelling the transport of carbonic acid anions through anion-exchange membranes

    International Nuclear Information System (INIS)

    Nikonenko, V.; Lebedev, K.; Manzanares, J.A.; Pourcelly, G.

    2003-01-01

    Electrodiffusion of carbonate and bicarbonate anions through anion-exchange membranes (AEM) is described on the basis of the Nernst-Planck equations taking into account coupled hydrolysis reactions in the external diffusion boundary layers (DBLs) and internal pore solution. The model supposes local electroneutrality as well as chemical and thermodynamic equilibrium. The transport is considered in three layers being an anion exchange membrane and two adjoining diffusion layers. A mechanism of competitive transport of HCO 3 - and CO 3 2- anions through the membrane which takes into account Donnan exclusion of H + ions is proposed. It is predicted that the pH of the depleting solution decreases and that of the concentrating solution increases during electrodialysis (ED). Eventual deviations from local electroneutrality and local chemical equilibrium are discussed

  2. Nanotubular halloysite clay as efficient water filtration system for cationic and anionic dyes removal

    OpenAIRE

    Conference, Nanostruc; Yafei Zhao, Elshad Abdullayev and Yuri Lvov

    2014-01-01

    Halloysite clay has chemical structure similar to kaolinite but it is rolled in tubes with diameter of 50 nm and length of ca. 1000 nm. Halloysite exhibits higher adsorption capacity for both cationic and anionic dyes because it has negative SiO2 outermost and positive Al2O3 inner lumen surface. An adsorption study using cationicRhodamine 6G and anionic Chrome azurol S has shown pproximately two times better dye removal for halloysite as compared to kaolin. Halloysite filters have been effect...

  3. New magnetic organic-inorganic composites based on hydrotalcite-like anionic clays for drug delivery

    International Nuclear Information System (INIS)

    Carja, Gabriela; Chiriac, Horia; Lupu, Nicoleta

    2007-01-01

    The structural 'memory effect' of anionic clays was used to obtain layered double hydroxides (LDHs) with tailored magnetic properties, by loading iron oxides and/or spinel structures on iron partially substituted hydrotalcite-like materials. The obtained magnetic layered structures were further used as precursors for new hybrid nanostructures, such as aspirin-hydrotalcite-like anionic clays. Transmission electron microscopy (TEM) analysis shows that small iron oxide or spinel nanoparticles coexist with the fibrous drug particles on the surface of partially aggregated typical clay-like particles. The specific saturation magnetization of the loaded LDHs can be increased up to 70 emu/g by using specific post-synthesis treatments

  4. Regulation of organic anion transport in the liver

    NARCIS (Netherlands)

    Roelofsen, H; Jansen, PLM

    1997-01-01

    In several liver diseases the biliary transport is disturbed, resulting in, for example, jaundice and cholestasis. Many of these symptoms can be attributed to altered regulation of hepatic transporters. Organic anion transport, mediated by the canalicular multispecific organic anion transporter

  5. Changes in plasma osmolality and anion gap: potential predictors of ...

    African Journals Online (AJOL)

    Changes in plasma osmolality and anion gap: potential predictors of ... PROMOTING ACCESS TO AFRICAN RESEARCH ... Objective: To determine the relationship of mortality to plasma osmolality and anion gap inpatients on haemodialysis.

  6. Supramolecular Chemistry of Selective Anion Recognition for Anions of Environmental Relevance

    International Nuclear Information System (INIS)

    Sessler, Jonathan L.

    2007-01-01

    The major thrust of this project, led by the University of Kansas (Prof. Kristin Bowman-James), entails an exploration of the basic determinants of anion recognition and their application to the design, synthesis, and testing of novel sulfate extractants. A key scientific inspiration for the work comes from the need, codified in simple-to-appreciate terms by the Oak Ridge National Laboratory component of the team (viz. Dr. Bruce Moyer), for chemical entities that can help in the extractive removal of species that have low solubilities in borosilicate glass. Among such species, sulfate anion, has been identified as particularly insidious. Its presence interferes with the vitrification process, thus rendering the remediation of tank waste from, e.g., the Hanford site far more difficult and expensive. The availability of effective extractants, that would allow for the separation of separating sulfate from the major competing anions in the waste, especially nitrate, could allow for pre-vitrification removal of sulfate via liquid-liquid extraction. The efforts at The University of Texas, the subject of this report, have thus concentrated on the development of new sulfate receptors. These systems are designed to increase our basic understanding of anion recognition events and set the stage for the development of viable sulfate anion extractants. In conjunction with the Oak Ridge National Laboratory (ORNL) members of the research team, several of these new receptors were studied as putative extractants, with two of the systems being shown to act as promising synergists for anion exchange.

  7. Anion Effects on the Ion Exchange Process and the Deformation Property of Ionic Polymer Metal Composite Actuators

    Directory of Open Access Journals (Sweden)

    Wataru Aoyagi

    2016-06-01

    Full Text Available An ionic polymer-metal composite (IPMC actuator composed of a thin perfluorinated ionomer membrane with electrodes plated on both surfaces undergoes a large bending motion when a low electric field is applied across its thickness. Such actuators are soft, lightweight, and able to operate in solutions and thus show promise with regard to a wide range of applications, including MEMS sensors, artificial muscles, biomimetic systems, and medical devices. However, the variations induced by changing the type of anion on the device deformation properties are not well understood; therefore, the present study investigated the effects of different anions on the ion exchange process and the deformation behavior of IPMC actuators with palladium electrodes. Ion exchange was carried out in solutions incorporating various anions and the actuator tip displacement in deionized water was subsequently measured while applying a step voltage. In the step voltage response measurements, larger anions such as nitrate or sulfate led to a more pronounced tip displacement compared to that obtained with smaller anions such as hydroxide or chloride. In AC impedance measurements, larger anions generated greater ion conductivity and a larger double-layer capacitance at the cathode. Based on these mechanical and electrochemical measurements, it is concluded that the presence of larger anions in the ion exchange solution induces a greater degree of double-layer capacitance at the cathode and results in enhanced tip deformation of the IPMC actuators.

  8. Adsorption of anionic surfactant on porous and nonporous polyethylene terephthalate films

    International Nuclear Information System (INIS)

    Yamauchi, Yu.; Apel, P.Yu.

    2016-01-01

    We study the adsorption of anionic surfactant, sodium dodecyl diphenyloxide disulfonate (SDDD) on three types of polyethylene terephthalate (PET) substrates from aqueous solutions of SDDD of different concentrations. Neutral electrolyte (KCl) was added to the solutions to vary the ionic strength. Three types of substrates were used: 1) original PET film; 2) etched nonporous film, obtained from pristine film by chemical etching and bearing negative charge on the surface; 3) etched porous membranes, fabricated from pristine film by ion irradiation and subsequent chemical etching. The membranes have negative charge on the flat surface and on the inner pore walls. The comparison shows that the negative charge on the flat surface has weak effect on adsorption of the anionic surfactant, and the SDDD adsorption on the inner walls of pores is much weaker than on flat surface, even if the pore radius is significantly larger than the Debye length. This «exclusion» effect strongly depends on ionic strength of solution. [ru

  9. Diffusion of anions and cations in compacted sodium bentonite

    International Nuclear Information System (INIS)

    Muurinen, A.

    1994-02-01

    The thesis presents the results of studies on the diffusion mechanisms of anions and cations in compacted sodium bentonite, which is planned to be used as a buffer material in nuclear waste disposal in Finland. The diffusivities and sorption factors were determined by tracer experiments. The pore volume accessible to chloride, here defined as effective porosity, was determined as a function of bentonite density and electrolyte concentration in water, and the Stern-Gouy double-layer model was used to explain the observed anion exclusion. The sorption of Cs + and Sr 2+ was studied in loose and compacted bentonite samples as a function of the electrolyte concentration in solution. In order to obtain evidence of the diffusion of exchangeable cations, defined as surface diffusion, the diffusivities of Cs + and Sr 2+ in compacted bentonite were studied as a function of the sorption factor, which was varied by electrolyte concentration in solution. The measurements were performed both by a non-steady state method and by a through-diffusion method. (89 refs., 35 fig., 4 tab.)

  10. A study of sorption of pertechnetate anion on chitosan

    International Nuclear Information System (INIS)

    Pivarciova, L.; Rosskopfova, O.; Rajec, P.; Galambos, M.

    2015-01-01

    Chitosan is one of the natural materials of biological origin. The sorption of pertechnetate anions from aqueous solutions on chitosan was studied in a batch system. This work was aimed to study influence of the contact time, effect of pH and effect of different ions on sorption of pertechnetate anions on chitosan. This sorbent was characterized by BET-surface area and potentiometric titration. The point of zero charge (pH pzc ) was at pH=7.15. The highest percentage of technetium sorption on chitosan was near pH 3. The adsorption capacity of chitosan decreased with increase in pH value above 3. In the initial pH range of 4-10, final pHs are the same. The selectivity of chitosan for these cations with concentration above 1·10 -3 mol·dm -3 was in the order Na + > Ca 2+ > Fe 3+ > Fe 2+ . The competition effect of (SO 4 ) 2- towards TcO 4 - sorption was stronger than the competition effect (ClO 4 ) - of ions. (authors)

  11. Water permeation through anion exchange membranes

    Science.gov (United States)

    Luo, Xiaoyan; Wright, Andrew; Weissbach, Thomas; Holdcroft, Steven

    2018-01-01

    An understanding of water permeation through solid polymer electrolyte (SPE) membranes is crucial to offset the unbalanced water activity within SPE fuel cells. We examine water permeation through an emerging class of anion exchange membranes, hexamethyl-p-terphenyl poly (dimethylbenzimidazolium) (HMT-PMBI), and compare it against series of membrane thickness for a commercial anion exchange membrane (AEM), Fumapem® FAA-3, and a series of proton exchange membranes, Nafion®. The HMT-PMBI membrane is found to possess higher water permeabilities than Fumapem® FAA-3 and comparable permeability than Nafion (H+). By measuring water permeation through membranes of different thicknesses, we are able to decouple, for the first time, internal and interfacial water permeation resistances through anion exchange membranes. Permeation resistances on liquid/membrane interface is found to be negligible compared to that for vapor/membrane for both series of AEMs. Correspondingly, the resistance of liquid water permeation is found to be one order of magnitude smaller compared to that of vapor water permeation. HMT-PMBI possesses larger effective internal water permeation coefficient than both Fumapem® FAA-3 and Nafion® membranes (60 and 18% larger, respectively). In contrast, the effective interfacial permeation coefficient of HMT-PMBI is found to be similar to Fumapem® (±5%) but smaller than Nafion®(H+) (by 14%).

  12. Anionic 11-mercaptoundecanoic acid capped ZnO nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Šimšíková, Michaela, E-mail: michaela.simsikova@ceitec.vutbr.cz [CEITEC BUT, Brno University of Technology, Technická 10, 616 69 Brno (Czech Republic); Antalík, Marián [Department of Biochemistry, Faculty of Science, P.J. Šafárik University, Šrobárova 2, 041 54 Košice (Slovakia); Department of Biophysics, Institute of Experimental Physics, SAS, Watsonova 47, 040 01 Košice (Slovakia); Kaňuchová, Mária; Škvarla, Jiří [Institute of Montaneous Sciences and Environmental Protection, Faculty of Mining, Ecology, Process Control and Geotechnologies, Technical University of Košice, Park Komenského 19, 043 84 Košice (Slovakia)

    2013-10-01

    The anionic zinc oxide nanoparticles have been prepared at room temperature by a precipitation method using ZnCl{sub 2} and NaOH and surface modification with 11-mercaptoundecanoic acid (MUA). Atomic force microscopy (AFM) was used for definition of morphology and size of prepared nanoparticles which was proved by measurements of particle size distribution using Zetasizer. Successful coating with MUA as surfactant was acknowledged by X-ray photoelectron spectroscopy and ATR FT-IR spectroscopy. The isoelectric point (IEP) of ZnO–MUA nanoparticles was obtained by measurements of zeta potential and FT-IR dependence on pH; the obtained value was approximately 3.58. The value of exchanged protons was 2.88 which indicates a positive binding cooperativity of modified nanoparticles.

  13. Interaction of a potyviral VPg with anionic phospholipid vesicles

    International Nuclear Information System (INIS)

    Rantalainen, Kimmo I.; Christensen, Peter A.; Hafren, Anders; Otzen, Daniel E.; Kalkkinen, Nisse; Maekinen, Kristiina

    2009-01-01

    The viral genome-linked protein (VPg) of Potato virus A (PVA) is a multifunctional protein that belongs to a class of intrinsically disordered proteins. Typically, this type of protein gains a more stable structure upon interactions or posttranslational modifications. In a membrane lipid strip overlay binding assay, PVA VPg was found to bind phosphatidylserine (PS), but not phosphatidylcholine (PC). According to circular dichroism spectroscopy, the secondary structure of PVA VPg was stabilized upon interactions with PS and phosphatidylglycerol (PG), but not with PC vesicles. It is possible that this stabilization favored the formation of α-helical structures. Limited tryptic digestion showed that the interaction with anionic vesicles protected certain, otherwise accessible, trypsin cleavage sites. An electron microscopy study revealed that interaction with VPg substantially increased the vesicle diameter and caused the formation of pore or plaque-like electron dense spots on the vesicle surface, which gradually led to disruption of the vesicles.

  14. Graphene-coated polymeric anion exchangers for ion chromatography

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Kai; Cao, Minyi; Lou, Chaoyan [Department of Chemistry, Xixi Campus, Zhejiang University, Hangzhou 310028 (China); Wu, Shuchao, E-mail: wushch2002@163.com [Zhejiang Institute of Geology and Mineral Resources, Hangzhou 310007 (China); Zhang, Peimin [Department of Chemistry, Xixi Campus, Zhejiang University, Hangzhou 310028 (China); Zhi, Mingyu [Hangzhou Vocational & Technical College, Hangzhou, 310018 (China); Zhu, Yan, E-mail: zhuyan@zju.edu.cn [Department of Chemistry, Xixi Campus, Zhejiang University, Hangzhou 310028 (China)

    2017-06-01

    Carbonaceous stationary phases have gained much attention for their peculiar selectivity and robustness. Herein we report the fabrication and application of a graphene-coated polymeric stationary phase for anion exchange chromatography. The graphene-coated particles were fabricated by a facile evaporation-reduction method. These hydrophilic particles were proven appropriate substrates for grafting of hyperbranched condensation polymers (HBCPs) to make pellicular anion exchangers. The new phase was characterized by zeta potentials, Fourier transform infrared spectroscopy, thermogravimetry and scanning electron microscope. Frontal displacement chromatography showed that the capacities of the anion exchangers were tuned by both graphene amount and HBCPs layer count. The chromatographic performance of graphene-coated anion exchangers was demonstrated with separation of inorganic anions, organic acids, carbohydrates and amino acids. Good reproducibility was obtained by consecutive injections, indicating high chemical stability of the coating. - Highlights: • Graphene-coated polymeric particles were fabricated by a facile method. • Hyperbranched condensation polymers (HBCPs) were grafted from graphene-coated particles to make anion exchangers. • Graphene amount and HBCPs layer count had significant effects on the anion exchange capacities. • Separation of diverse anionic analytes on the anion exchangers was demonstrated. • The prepared anion exchangers exhibited high stability.

  15. Infrared Spectroscopy of Discrete Uranyl Anion Complexes

    International Nuclear Information System (INIS)

    Groenewold, G. S.; Gianotto, Anita K.; McIIwain, Michael E.; Van Stipdonk, Michael J.; Kullman, Michael; Moore, David T.; Polfer, Nick; Oomens, Jos; Infante, Ivan A.; Visscher, Lucas; Siboulet, Bertrand; De Jong, Wibe A.

    2008-01-01

    The Free-Electron Laser for Infrared Experiments (FELIX) w 1 as used to study the wavelength-resolved multiple photon photodissociation of discrete, gas phase uranyl (UO2 2 2+) complexes containing a single anionic ligand (A), with or without ligated solvent molecules (S). The uranyl antisymmetric and symmetric stretching frequencies were measured for complexes with general formula [UO2A(S)n]+, where A was either hydroxide, methoxide, or acetate; S was water, ammonia, acetone, or acetonitrile; and n = 0-3. The values for the antisymmetric stretching frequency for uranyl ligated with only an anion ([UO2A]+) were as low or lower than measurements for [UO2]2+ ligated with as many as five strong neutral donor ligands, and are comparable to solution phase values. This result was surprising because initial DFT calculations predicted values that were 30-40 cm-1 higher, consistent with intuition but not with the data. Modification of the basis sets and use of alternative functionals improved computational accuracy for the methoxide and acetate complexes, but calculated values for the hydroxide were greater than the measurement regardless of the computational method used. Attachment of a neutral donor ligand S to [UO2A]+ produced [UO2AS]+, which produced only very modest changes to the uranyl antisymmetric stretch frequency, and did not universally shift the frequency to lower values. DFT calculations for [UO2AS]+ were in accord with trends in the data, and showed that attachment of the solvent was accommodated by weakening of the U-anion bond as well as the uranyl. When uranyl frequencies were compared for [UO2AS]+ species having different solvent neutrals, values decreased with increasing neutral nucleophilicity

  16. Low-energy electron-induced dissociation in condensed-phase L-cysteine I: Desorption of anions from chemisorbed films

    International Nuclear Information System (INIS)

    Alizadeh, E; Rowntree, P A; Massey, S; Sanche, L

    2015-01-01

    Among amino acids, cysteine has been widely studied, becoming a standard for molecular self-assembly experiments, because its mercapto group (-SH) allows the formation of self-assembled monolayers (SAMs) on metal surfaces. Dissociative electron attachment (DEA) on L-cysteine SAMs is investigated utilizing a time-of-flight mass spectrometer coupled with a low-energy electron gun. The results show that electrons with kinetic energies of 3 to 15 eV attach to L-cysteine producing anionic fragments of different masses (e.g., H - , O - , OH - , S - , SH - ) via dissociation of intermediate transient anions. The anion yield functions exhibited purely resonant behaviour with electron energies below 15 eV, indicating that the formation of transient anions is the predominant mechanism of production of anionic fragments from L-cysteine dissociation. (paper)

  17. Improvement of calcium mineral separation contrast using anionic reagents: electrokinetics properties and flotation

    Science.gov (United States)

    Lafhaj, Z.; Filippov, L. O.; Filippova, I. V.

    2017-07-01

    The flotation separation of salt type calcium minerals is problematic, due to the similarities in their same active Ca2+ related site for interaction with anionic collectors and similar physicochemical characteristics such as solubility, zero-point charge, surface speciation and Ca-site density. The work was performed to achieve effective and selective separation of the calcium-minerals using pure minerals samples: orange calcite with Mg impurities, optic calcite with impurities level and an apatite. The pure samples surface was examined using techniques sensitive near-surface like infrared spectroscopy (FTIR) and chemical composition was obtained by ICPMS. The isoelectric point (IEP) and point of zero charge (PZC) in electrolyte were recorded using electrophoresis method at different ionic strengths of the solution. Mechanisms of charge development at the mineral-water interface are discussed. The time of contact as important parameter for the charge equilibrium was deduced from kinetics study and fixed to 30 minutes. The difference in the values obtained between IEP and PZSE can be explained by the presence of a specific adsorption of cations and anions on the surface. The effect of pure anionic collectors such as oleic and linoleic acid were studied. At low pH, both collectors lead to a good recovery for the calcites. The flotation recovery of optic calcite at pH 9 with sodium oleate is higher than with sodium linoleate. At alkaline pH, apatite showed a better recovery with sodium linoleate.

  18. Perspective: Electrospray photoelectron spectroscopy: From multiply-charged anions to ultracold anions

    International Nuclear Information System (INIS)

    Wang, Lai-Sheng

    2015-01-01

    Electrospray ionization (ESI) has become an essential tool in chemical physics and physical chemistry for the production of novel molecular ions from solution samples for a variety of spectroscopic experiments. ESI was used to produce free multiply-charged anions (MCAs) for photoelectron spectroscopy (PES) in the late 1990 s, allowing many interesting properties of this class of exotic species to be investigated. Free MCAs are characterized by strong intramolecular Coulomb repulsions, which create a repulsive Coulomb barrier (RCB) for electron emission. The RCB endows many fascinating properties to MCAs, giving rise to meta-stable anions with negative electron binding energies. Recent development in the PES of MCAs includes photoelectron imaging to examine the influence of the RCB on the electron emission dynamics, pump-probe experiments to examine electron tunneling through the RCB, and isomer-specific experiments by coupling PES with ion mobility for biological MCAs. The development of a cryogenically cooled Paul trap has led to much better resolved PE spectra for MCAs by creating vibrationally cold anions from the room temperature ESI source. Recent advances in coupling the cryogenic Paul trap with PE imaging have allowed high-resolution PE spectra to be obtained for singly charged anions produced by ESI. In particular, the observation of dipole-bound excited states has made it possible to conduct vibrational autodetachment spectroscopy and resonant PES, which yield much richer vibrational spectroscopic information for dipolar free radicals than traditional PES

  19. Zero-point energy effects in anion solvation shells.

    Science.gov (United States)

    Habershon, Scott

    2014-05-21

    By comparing classical and quantum-mechanical (path-integral-based) molecular simulations of solvated halide anions X(-) [X = F, Cl, Br and I], we identify an ion-specific quantum contribution to anion-water hydrogen-bond dynamics; this effect has not been identified in previous simulation studies. For anions such as fluoride, which strongly bind water molecules in the first solvation shell, quantum simulations exhibit hydrogen-bond dynamics nearly 40% faster than the corresponding classical results, whereas those anions which form a weakly bound solvation shell, such as iodide, exhibit a quantum effect of around 10%. This observation can be rationalized by considering the different zero-point energy (ZPE) of the water vibrational modes in the first solvation shell; for strongly binding anions, the ZPE of bound water molecules is larger, giving rise to faster dynamics in quantum simulations. These results are consistent with experimental investigations of anion-bound water vibrational and reorientational motion.

  20. Process for removing sulfate anions from waste water

    Science.gov (United States)

    Nilsen, David N.; Galvan, Gloria J.; Hundley, Gary L.; Wright, John B.

    1997-01-01

    A liquid emulsion membrane process for removing sulfate anions from waste water is disclosed. The liquid emulsion membrane process includes the steps of: (a) providing a liquid emulsion formed from an aqueous strip solution and an organic phase that contains an extractant capable of removing sulfate anions from waste water; (b) dispersing the liquid emulsion in globule form into a quantity of waste water containing sulfate anions to allow the organic phase in each globule of the emulsion to extract and absorb sulfate anions from the waste water and (c) separating the emulsion including its organic phase and absorbed sulfate anions from the waste water to provide waste water containing substantially no sulfate anions.

  1. The chemistry of molecular anions in circumstellar sources

    Energy Technology Data Exchange (ETDEWEB)

    Agúndez, Marcelino [LUTH, Observatoire de Paris-Meudon, 5 Place Jules Janssen, 92190 Meudon (France); Cernicharo, José [Departamento de Astrofísica, CAB, CSIC-INTA, Ctra. de Torrejón a Ajalvir km 4, 28850 Madrid (Spain); Guélin, Michel [Institut de Radioastronomie Millimétrique, 300 rue de la Piscine, 38406 Saint Martin d' Héres (France)

    2015-01-22

    The detection of negatively charged molecules in the interstellar and circumstellar medium in the past four years has been one of the most impacting surprises in the area of molecular astrophysics. It has motivated the interest of astronomers, physicists, and chemists on the study of the spectroscopy, chemical kinetics, and prevalence of molecular anions in the different astronomical regions. Up to six different molecular anions have been discovered in space to date, the last one being the small ion CN{sup −}, which has been observed in the envelope of the carbon star IRC +10216 and which contrary to the other larger anions is not formed by electron attachment to CN, but through reactions of large carbon anions with nitrogen atoms. Here we briefly review the current status of our knowledge of the chemistry of molecular anions in space, with particular emphasis on the circumstellar source IRC +10216, which to date is the astronomical source harboring the largest variety of anions.

  2. Anion photoelectron spectroscopy of radicals and clusters

    Energy Technology Data Exchange (ETDEWEB)

    Travis, Taylor R. [Univ. of California, Berkeley, CA (United States)

    1999-12-01

    Anion photoelectron spectroscopy is used to study free radicals and clusters. The low-lying 2Σ and 2π states of C2nH (n = 1--4) have been studied. The anion photoelectron spectra yielded electron affinities, term values, and vibrational frequencies for these combustion and astrophysically relevant species. Photoelectron angular distributions allowed the author to correctly assign the electronic symmetry of the ground and first excited states and to assess the degree of vibronic coupling in C2H and C4H. Other radicals studied include NCN and I3. The author was able to observe the low-lying singlet and triplet states of NCN for the first time. Measurement of the electron affinity of I3 revealed that it has a bound ground state and attachment of an argon atom to this moiety enabled him to resolve the symmetric stretching progression.

  3. Anion concurrence and anion selectivity in the sorption of radionuclides by organotones

    International Nuclear Information System (INIS)

    Behnsen, Julia G.

    2007-01-01

    Some long-lived and radiologically important nuclear fission products, such as I-129 (half-life t 1/2 = 1,6 . 10 7 a), Tc-99 (t 1/2 = 2,1 . 10 5 a), and Se-79 (t 1/2 = 6,5 . 10 4 a) are anionic in aqueous environments. This study focuses on the adsorption of such anions to organoclays and the understanding of the selectivity of the process. The organoclays used in this study were prepared from a bentonite (MX-80) and a vermiculite clay, and the cationic surfactants hexadcylpyridium, hexadecyltrimethylammonium, and benzethonium. Surfactant adsorption to the bentonite exceeds the cation exchange capacity of the clay, with the surplus positive charge being balanced by the co-adsorption of chloride. The interlayer distance of the bentonites is increased sufficiently to contain bi- and pseudotrimolecular structures of the surfactants. Adsorption experiments were carried out using the batch technique. Anion adsorption of iodide, perrhenate, selenite, nitrate, and sulphate is mainly due to ion exchange with chloride. As an additional adsorption mechanism, the incorporation of inorganic ion pairs into the interlayer space of the clay is proposed as a result of experiments showing differences in the adsorption levels of sodium and potassium iodide. Anion adsorption results show a clear selectivity of the organoclays, with the affinity sequence being: ReO - 4 > I - > NO - 3 > Cl - > SO 2- 4 > SeO 2- 3 . This sequence corresponds to the sequence of increasing hydration energies of the anions, thus selectivity could be due to the process of minimization of free energy of the system. (orig.)

  4. Anionic magnetite nanoparticle conjugated with pyrrolidinyl peptide nucleic acid for DNA base discrimination

    Energy Technology Data Exchange (ETDEWEB)

    Khadsai, Sudarat; Rutnakornpituk, Boonjira [Naresuan University, Department of Chemistry and Center of Excellence in Biomaterials, Faculty of Science (Thailand); Vilaivan, Tirayut [Chulalongkorn University, Department of Chemistry, Organic Synthesis Research Unit, Faculty of Science (Thailand); Nakkuntod, Maliwan [Naresuan University, Department of Biology, Faculty of Science (Thailand); Rutnakornpituk, Metha, E-mail: methar@nu.ac.th [Naresuan University, Department of Chemistry and Center of Excellence in Biomaterials, Faculty of Science (Thailand)

    2016-09-15

    Magnetite nanoparticles (MNPs) were surface modified with anionic poly(N-acryloyl glycine) (PNAG) and streptavidin for specific interaction with biotin-conjugated pyrrolidinyl peptide nucleic acid (PNA). Hydrodynamic size (D{sub h}) of PNAG-grafted MNPs varied from 334 to 496 nm depending on the loading ratio of the MNP to NAG in the reaction. UV–visible and fluorescence spectrophotometries were used to confirm the successful immobilization of streptavidin and PNA on the MNPs. About 291 pmol of the PNA/mg MNP was immobilized on the particle surface. The PNA-functionalized MNPs were effectively used as solid supports to differentiate between fully complementary and non-complementary/single-base mismatch DNA using the PNA probe. These novel anionic MNPs can be efficiently applicable for use as a magnetically guidable support for DNA base discrimination.Graphical Abstract.

  5. Anionic magnetite nanoparticle conjugated with pyrrolidinyl peptide nucleic acid for DNA base discrimination

    International Nuclear Information System (INIS)

    Khadsai, Sudarat; Rutnakornpituk, Boonjira; Vilaivan, Tirayut; Nakkuntod, Maliwan; Rutnakornpituk, Metha

    2016-01-01

    Magnetite nanoparticles (MNPs) were surface modified with anionic poly(N-acryloyl glycine) (PNAG) and streptavidin for specific interaction with biotin-conjugated pyrrolidinyl peptide nucleic acid (PNA). Hydrodynamic size (D h ) of PNAG-grafted MNPs varied from 334 to 496 nm depending on the loading ratio of the MNP to NAG in the reaction. UV–visible and fluorescence spectrophotometries were used to confirm the successful immobilization of streptavidin and PNA on the MNPs. About 291 pmol of the PNA/mg MNP was immobilized on the particle surface. The PNA-functionalized MNPs were effectively used as solid supports to differentiate between fully complementary and non-complementary/single-base mismatch DNA using the PNA probe. These novel anionic MNPs can be efficiently applicable for use as a magnetically guidable support for DNA base discrimination.Graphical Abstract

  6. Anion retention in soil: Possible application to reduce migration of buried technetium and iodine

    Energy Technology Data Exchange (ETDEWEB)

    Gu, B.; Schulz, R.K. (California Univ., Berkeley, CA (United States). Dept. of Soil Science)

    1991-10-01

    This report summarizes a literature review of our present knowledge of the anion exchange properties of a number of soils and minerals, which may potentially be used as anion exchangers to retard migration of such anions as iodide (I{sup {minus}}), iodate (IO{sub 3}{sup {minus}}) and pertechnetate (TcO{sub 4}{sup {minus}}) away from disposal site. The amorphous clays allophane and imogolite, are found to be among the most important soil components capable of developing appreciable amounts of positive charge for anion exchange even at about neutral pH. Decreases in the SiO{sub 2}/Al{sub 2}O{sub 3} ratio and soil pH result in an increase in soil AEC. Allophane and imogolite rich soils have an AEC ranging from 1 to 18 meq/100g at pH about 6. Highly weathered soils dominated by Fe and Al oxides and kaolinite may develop a significant amount of AEC as soil pH falls. The retention of iodine (I) and technetium ({Tc}), by soils is associated with both soil organic matter, and Fe and Al oxides, whereas sorption on layer silicate minerals in negligible. Fe and Al oxides become more important in the retention of anionic I{sup {minus}}, IO{sub 3}{sup {minus}}, and TcO{sub 4}{sup {minus}} as pH falls, since more positive charge is developed on the oxide surfaces. Although few studies, if any, have been conducted on I and {Tc} sorption by soil allophane and imogolite, it is estimated that a surface plough soil (2 million pounds soil per acre) with 5 meq/100g AEC, as is commonly found in andisols, shall retain approximately 5900 kg I and 4500 kg {Tc}. It is conceivable that an anion exchanger such as an andisol could be used to modify the near field environment of a radioactive waste disposal facility. This whole disposal system would then offer similar migration resistance to anions as is normally afforded to cations by usual and normal soils. 93 refs., 10 figs., 7 tabs.

  7. Chemical Hydrogen Storage Using Polyhedral Borane Anions and Aluminum-Ammonia-Borane Complexes

    Energy Technology Data Exchange (ETDEWEB)

    Hawthorne, M. Frederick; Jalisatgi, Satish S.; Safronov, Alexander V.; Lee, Han Beak; Wu, Jianguo

    2010-10-01

    Phase 1. Hydrolysis of borohydride compounds offer the potential for significant hydrogen storage capacity, but most work to date has focused on one particular anion, BH4-, which requires high pH for stability. Other borohydride compounds, in particular polyhedral borane anions offer comparable hydrogen storage capacity without requiring high pH media and their long term thermal and hydrolytic stability coupled with non-toxic nature make them a very attractive alternative to NaBH4. The University of Missouri project provided the overall program focal point for the investigation of catalytic hydrolysis of polyhedral borane anions for hydrogen release. Due to their inherent stability, a transition metal catalyst was necessary for the hydrolysis of polyhedral borane anions. Transition metal ions such as cobalt, nickel, palladium and rhodium were investigated for their catalytic activity in the hydrolysis of nido-KB11H14, closo-K2B10H10, and closo-K2B12H12. The rate of hydrolysis follows first-order kinetics with respect to the concentration of the polyhedral borane anion and surface area of the rhodium catalyst. The rate of hydrolysis depends upon a) choice of polyhedral borane anion, c) concentration of polyhedral borane anion, d) surface area of the rhodium catalyst and e) temperature of the reaction. In all cases the yield of hydrogen was 100% which corresponds to ~7 wt% of hydrogen (based on material wt%). Phase 2. The phase 2 of program at the University of Missouri was focused upon developing aluminum ammonia-boranes (Al-AB) as chemical hydrogen storage materials, specifically their synthesis and studies of their dehydrogenation. The ammonia borane molecule (AB) is a demonstrated source of chemically stored hydrogen (19.6 wt%) which meets DOE performance parameters except for its regeneration from spent AB and elemental hydrogen. The presence of an aluminum center bonded to multiple AB residues might combine the efficiency of AB dehydrogenation with an aluminum

  8. Selective Interaction of a Cationic Polyfluorene with Model Lipid Membranes: Anionic versus Zwitterionic Lipids

    Directory of Open Access Journals (Sweden)

    Zehra Kahveci

    2014-03-01

    Full Text Available This paper explores the interaction mechanism between the conjugated polyelectrolyte {[9,9-bis(6'-N,N,N-trimethylammoniumhexyl]fluorene-phenylene}bromide (HTMA-PFP and model lipid membranes. The study was carried out using different biophysical techniques, mainly fluorescence spectroscopy and microscopy. Results show that despite the preferential interaction of HTMA-PFP with anionic lipids, HTMA-PFP shows affinity for zwitterionic lipids; although the interaction mechanism is different as well as HTMA-PFP’s final membrane location. Whilst the polyelectrolyte is embedded within the lipid bilayer in the anionic membrane, it remains close to the surface, forming aggregates that are sensitive to the physical state of the lipid bilayer in the zwitterionic system. The different interaction mechanism is reflected in the polyelectrolyte fluorescence spectrum, since the maximum shifts to longer wavelengths in the zwitterionic system. The intrinsic fluorescence of HTMA-PFP was used to visualize the interaction between polymer and vesicles via fluorescence microscopy, thanks to its high quantum yield and photostability. This technique allows the selectivity of the polyelectrolyte and higher affinity for anionic membranes to be observed. The results confirmed the appropriateness of using HTMA-PFP as a membrane fluorescent marker and suggest that, given its different behaviour towards anionic and zwitterionic membranes, HTMA-PFP could be used for selective recognition and imaging of bacteria over mammalian cells.

  9. A novel anion exchange membrane from polystyrene (ethylene butylene) polystyrene: Synthesis and characterization

    International Nuclear Information System (INIS)

    Vinodh, Rajangam; Ilakkiya, Arjunan; Elamathi, Swaminathan; Sangeetha, Dharmalingam

    2010-01-01

    We look forward for an eco-friendly hydrocarbon polymer with higher molecular weight for the preparation of an anion exchange membrane. Polystyrene ethylene butylene polystyrene (PSEBS) was chosen as the polymer matrix. The anion exchange membrane was prepared from PSEBS tri-block co-polymer and then the properties were characterized for alkaline fuel cell application. The preparation of anion exchange polymer involved two steps namely chloromethylation and quaternization. The anion exchange membrane with high conductivity has been prepared by introducing quaternary ammonium groups in to the polymer. Finally, the membrane was prepared using solution casting method. The solution casting method yields highly hydrophilic membranes with uniform structure that were suitable for electrochemical applications. The efficiency of the entrapment was monitored by swelling ratio, chemical stability and ion exchange measurement. The characteristic structural properties of the membrane were investigated by FT-IR spectroscopy and 1 H NMR spectroscopy. The thermal stability of the membrane was characterized by TGA, DSC and DMA (dynamic mechanical analysis). The prepared uniform electrolyte membrane in this study has high thermal and chemical stability. The surface morphology and elemental composition of the quaternized PSEBS was determined by SEM-EDXA techniques, respectively. The measured hydroxyl ion conductivity of the synthesized alkaline PSEBS polymer electrolyte membrane showed ionic conductivity in the range of 10 -3 S/cm in deionized water at room temperature. It was found that the substitution provided a flexible, chemically and thermally stable membrane. Hence, the membrane will have potential application in the alkaline fuel cell.

  10. Inhibition of nuclear waste solutions containing multiple aggressive anions

    International Nuclear Information System (INIS)

    Congdon, J.W.

    1987-01-01

    The inhibition of localized corrosion of carbon steel in caustic, high-level radioactive waste solutions was studied using cyclic potentiodynamic polarization scans, supplemented by partially immersed coupon tests. The electrochemical tests provided a rapid and accurate means of determining the relationship between the minimum inhibitor requirements and the concentration of the aggressive anions in this system. Nitrate, sulfate, chloride, and fluoride were identified as aggressive anions, however, no synergistic effects were observed between these anions. This observation may have important theoretical implications because it tends to contradict the behavior of aggressive anions as predicted by existing theories for localized corrosion. 10 refs., 5 figs., 2 tabs

  11. Predicting competitive adsorption behavior of major toxic anionic elements onto activated alumina: A speciation-based approach

    International Nuclear Information System (INIS)

    Su Tingzhi; Guan Xiaohong; Tang Yulin; Gu Guowei; Wang Jianmin

    2010-01-01

    Toxic anionic elements such as arsenic, selenium, and vanadium often co-exist in groundwater. These elements may impact each other when adsorption methods are used to remove them. In this study, we investigated the competitive adsorption behavior of As(V), Se(IV), and V(V) onto activated alumina under different pH and surface loading conditions. Results indicated that these anionic elements interfered with each other during adsorption. A speciation-based model was developed to quantify the competitive adsorption behavior of these elements. This model could predict the adsorption data well over the pH range of 1.5-12 for various surface loading conditions, using the same set of adsorption constants obtained from single-sorbate systems. This model has great implications in accurately predicting the field capacity of activated alumina under various local water quality conditions when multiple competitive anionic elements are present.

  12. Layered double hydroxides as the next generation inorganic anion exchangers: Synthetic methods versus applicability.

    Science.gov (United States)

    Chubar, Natalia; Gilmour, Robert; Gerda, Vasyl; Mičušík, Matej; Omastova, Maria; Heister, Katja; Man, Pascal; Fraissard, Jacques; Zaitsev, Vladimir

    2017-07-01

    considered in association with the synthetic methods by which the LDHs were produced. Special attention is paid to the LDH properties that are particularly relevant to water treatment, such as exchangeability ease of the interlayer anions and the LDH stability at the solid-water interface. Notably, the LDH properties (e.g., rich speciation, hydration, and the exchangeability ease of the interlayer anions with aqueous anions) are considered in the synthetic strategy context applied to the material preparation. One such promising synthetic method has been developed by the authors who supported their opinions by the unpublished data in addition to reviewing the literature. The reviewing approach allowed for establishing regularities between the parameters: the LDH synthetic method-structure/surface/interlayer-removal-suitability for water treatment. Specifically, this approach allowed for a conclusion about either the unsuitability or promising potential of some synthetic methods (or the removal approaches) used for the preparation of LDHs for water purification at larger scales. The overall reviewing approach undertaken by the authors in this work mainly complements the other reviews on LDHs (published over the past seven to eight years) and for the first time compares the properties of these materials beyond the nanoscale. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Fluorescence anisotropy of tyrosinate anion using one-, two- and three-photon excitation: tyrosinate anion fluorescence.

    Science.gov (United States)

    Kierdaszuk, Borys

    2013-03-01

    We examined the emission spectra and steady-state anisotropy of tyrosinate anion fluorescence with one-photon (250-310 nm), two-photon (570-620 nm) and three-photon (750-930 nm) excitation. Similar emission spectra of the neutral (pH 7.2) and anionic (pH 13) forms of N-acetyl-L-tyrosinamide (NATyrA) (pKa 10.6) were observed for all modes of excitation, with the maxima at 302 and 352 nm, respectively. Two-photon excitation (2PE) and three-photon excitation (3PE) spectra of the anionic form were the same as that for one-photon excitation (1PE). In contrast, 2PE spectrum from the neutral form showed ~30-nm shift to shorter wavelengths relative to 1PE spectrum (λmax 275 nm) at two-photon energy (550 nm), the latter being overlapped with 3PE spectrum, both at two-photon energy (550 nm). Two-photon cross-sections for NATyrA anion at 565-580 nm were 10 % of that for N-acetyl-L-tryptophanamide (NATrpA), and increased to 90 % at 610 nm, while for the neutral form of NATyrA decreased from 2 % of that for NATrpA at 570 nm to near zero at 585 nm. Surprisingly, the fundamental anisotropy of NATyrA anion in vitrified solution at -60 °C was ~0.05 for 2PE at 610 nm as compared to near 0.3 for 1PE at 305 nm, and wavelength-dependence appears to be a basic feature of its anisotropy. In contrast, the 3PE anisotropy at 900 nm was about 0.5, and 3PE and 1PE anisotropy values appear to be related by the cos(6) θ to cos(2) θ photoselection factor (approx. 10/6) independently of excitation wavelength. Attention is drawn to the possible effect of tyrosinate anions in proteins on their multi-photon induced fluorescence emission and excitation spectra as well as excitation anisotropy spectra.

  14. Once upon Anion: A Tale of Photodetachment

    Science.gov (United States)

    Lineberger, W. Carl

    2013-04-01

    This contribution is very much a personal history of a journey through the wonderful world of anion chemistry, and a tale of how advances in laser technologies, theoretical methods, and computational capabilities continuously enabled advances in our understanding. It is a story of the excitement and joy that come from the opportunity to add to the fabric of science, and to do so by working as a group of excited explorers with common goals. The participants in this journey include me, my students and postdoctoral associates, my collaborators, and our many generous colleagues. It all happened, in the words of the Beatles, “with a little help from my friends.” Actually, it was so much more than a little help!

  15. Structures and properties of anionic clay minerals

    International Nuclear Information System (INIS)

    Koch, Chr. Bender

    1998-01-01

    The Moessbauer spectra of pyroaurite-sjoegrenite-type compounds (PTC) (layered anion exchangers) are discussed with reference to the crystal structure, cation order, and crystallite morphology. It is shown that cation-ordered layers are produced in the synthesis of carbonate and sulphate types of green rust. In contrast, synthetic and natural pyroaurite only occurs as disordered types. The redox chemistry of Fe(III) within the metal hydroxide layer is illustrated with examples of electrochemical oxidation and reversible reduction by boiling glycerol. The chemistry of iron in the interlayer is exemplified by the intercalation of Fe-cyanide complexes in hydrotalcite. This reaction may be used as a probe for the charge distribution in the interlayer

  16. Advanced polymer chemistry of organometallic anions

    International Nuclear Information System (INIS)

    Chamberlin, R.M.; Abney, K.D.; Balaich, G.J.; Fino, S.A.

    1997-01-01

    This is the final report of a one-year, Laboratory Directed Research and Development (LDRD) project at the Los Alamos National Laboratory (LANL). The objective of the project was to prepare and characterize new polymers incorporating cobalt dicarbollide. Specific goals were to prepare polymerizable cobalt dicarbollide monomers using the nucleophilic substitution route discovered in laboratories and to establish the reaction conditions required to form polymers from these complexes. This one-year project resulted in two publications (in press), and provided the foundation for further investigations into polymer synthesis and characterization using cobalt dicarbollide and other metallocarboranes. Interest in synthesizing organometallic polymers containing the cobalt bis(dicarbollide) anion is motivated by their possible application as cation exchange materials for the remediation of cesium-137 and strontium-90 from nuclear wastes

  17. Anion binding by biotin[6]uril in water

    DEFF Research Database (Denmark)

    Lisbjerg, Micke; Nielsen, Bjarne Enrico; Milhøj, Birgitte Olai

    2015-01-01

    In this contribution we show that the newly discovered 6 + 6 biotin-formaldehyde macrocycle Biotin[6]uril binds a variety of anionic guest molecules in water. We discuss how and why the anions are bound based on data obtained using NMR spectroscopy, mass spectrometry, isothermal titration...

  18. A colorimetric tetrathiafulvalene-calix 4 pyrrole anion sensor

    DEFF Research Database (Denmark)

    Nielsen, K. A.

    2012-01-01

    The interaction and colorimetric sensing properties of a tetrathiafulvalene substituted calix[4]pyrrole sensor with anions were investigated using H-1 NMR and absorption spectroscopic techniques. Visual color changes were observed upon addition of different anions (Cl-, Br-, CN-, and Ac......O-) to a solution of the sensor. (C) 2012 Elsevier Ltd. All rights reserved....

  19. Diffuse neutron scattering from anion-excess strontium chloride

    DEFF Research Database (Denmark)

    Goff, J.P.; Clausen, K.N.; Fåk, B.

    1992-01-01

    The defect structure and diffusional processes have been studied in the anion-excess fluorite (Sr, Y)Cl2.03 by diffuse neutron scattering techniques. Static cuboctahedral clusters found at ambient temperature break up at temperatures below 1050 K, where the anion disorder is highly dynamic. The a...

  20. Protonation Reaction of Benzonitrile Radical Anion and Absorption of Product

    DEFF Research Database (Denmark)

    Holcman, Jerzy; Sehested, Knud

    1975-01-01

    The rate constant for the protonation of benzonitrile radical anions formed in pulse radiolysis of aqueous benzonitrile solutions is (3.5 ± 0.5)× 1010 dm3 mol–1 s–1. A new 270 nm absorption band is attributed to the protonated benzonitrile anion. The pK of the protonation reaction is determined t...

  1. Influence of the type of oxidant on anion exchange properties of fibrous Cladophora cellulose/polypyrrole composites.

    Science.gov (United States)

    Razaq, Aamir; Mihranyan, Albert; Welch, Ken; Nyholm, Leif; Strømme, Maria

    2009-01-15

    The electrochemically controlled anion absorption properties of a novel large surface area composite paper material composed of polypyrrole (PPy) and cellulose derived from Cladophora sp. algae, synthesized with two oxidizing agents, iron(III) chloride and phosphomolybdic acid (PMo), were analyzed in four different electrolytes containing anions (i.e., chloride, aspartate, glutamate, and p-toluenesulfonate) of varying size.The composites were characterized with scanning and transmission electron microscopy, N2 gas adsorption,and conductivity measurements. The potential-controlled ion exchange properties of the materials were studied by cyclic voltammetry and chronoamperometry at varying potentials. The surface area and conductivity of the iron(III) chloride synthesized sample were 58.8 m2/g and 0.65 S/cm, respectively, while the corresponding values for the PMo synthesized sample were 31.3 m2/g and 0.12 S/cm. The number of absorbed ions per sample mass was found to be larger for the iron(III) chloride synthesized sample than for the PMo synthesized one in all four electrolytes. Although the largest extraction yields were obtained in the presence of the smallest anion (i.e., chloride) for both samples, the relative degree of extraction for the largest ions (i.e., glutamate and p-toluenesulfonate) was higher for the PMo sample. This clearly shows that it is possible to increase the extraction yield of large anions by carrying out the PPy polymerization in the presence of large anions. The results likewise show that high ion exchange capacities, as well as extraction and desorption rates, can be obtained for large anions with high surface area composites coated with relatively thin layers of PPy.

  2. Supramolecular Chemistry of Selective Anion Recognition for Anions of Environmental Relevance

    International Nuclear Information System (INIS)

    Moyer, Bruce a.; Bostick, Debra A.; Fowler, Christopher J.; Kang, Hyun-Ah; Ruas, Alexandre; Delmau, Laetitia H.; Haverlock, Tamara J.; Llinares, Jose M.; Hossain, Alamgir; Kang, S. O.; Bowman-James, Kristin; Shriver, James A.; Marquez, Manuel; Sessler, Jonathan L.

    2005-01-01

    The major thrust of this project led by the University of Kansas (Prof. Kristin Bowman-Jones) entails the exploration of the principles of recognition and separation of sulfate by the design, synthesis, and testing of novel sulfate extractants. A key science need for the cleanup of tank wastes at Hanford has been identified in developing methods to separate those bulk waste components that have low solubilities in borosilicate glass. Sulfate has been identified as a particularly difficult and expensive problem in that its concentration in the waste is relatively high, its solubility in glass is especially low, and it interferes with the performance of both vitrification equipment and the glass waste form. The new extractants will be synthesized by the University of Kansas and the University of Texas, Austin. Oak Ridge National Laboratory (ORNL) is subjecting the new extractants to experiments that will determine their properties and effectiveness in separating sulfate from the major competing anions in the waste, especially nitrate. Such experiments will entail primarily liquid-liquid extraction. Current efforts focus on exciting new systems in which the anion receptors act as synergists for anion exchange

  3. AT Base Pair Anions vs. (9-methyl-A)(1-methyl-T) Base Pair Anions

    International Nuclear Information System (INIS)

    Radisic, Dunja; Bowen, Kit H.; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej S.

    2005-01-01

    The anionic base pairs of adenine and thymine, (AT)-, and 9-methyladenine and 1-methylthymine, (MAMT)-, have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)- found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration that was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)- was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)- and a resulting (MAMT)- configuration that wa s either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)- occurred at a completely different electron binding energy than had (AT)-. Moreover, the VDE value of (MAMT)- was in agreement with that predicted by theory. The configuration of (MAMT)- and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced damage, BFPT in the WC/HS configurations of (AT)- is not feasible

  4. AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions.

    Science.gov (United States)

    Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej

    2005-05-04

    The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.

  5. Superoxide anion production by human neutrophils activated by Trichomonas vaginalis.

    Science.gov (United States)

    Song, Hyun-Ouk; Ryu, Jae-Sook

    2013-08-01

    Neutrophils are the predominant inflammatory cells found in vaginal discharges of patients infected with Trichomonas vaginalis. In this study, we examined superoxide anion (O2 (.-)) production by neutrophils activated by T. vaginalis. Human neutrophils produced superoxide anions when stimulated with either a lysate of T. vaginalis, its membrane component (MC), or excretory-secretory product (ESP). To assess the role of trichomonad protease in production of superoxide anions by neutrophils, T. vaginalis lysate, ESP, and MC were each pretreated with a protease inhibitor cocktail before incubation with neutrophils. Superoxide anion production was significantly decreased by this treatment. Trichomonad growth was inhibited by preincubation with supernatants of neutrophils incubated for 3 hr with T. vaginalis lysate. Furthermore, myeloperoxidase (MPO) production by neutrophils was stimulated by live trichomonads. These results indicate that the production of superoxide anions and MPO by neutrophils stimulated with T. vaginalis may be a part of defense mechanisms of neutrophils in trichomoniasis.

  6. Coumarin amide derivatives as fluorescence chemosensors for cyanide anions

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Qianqian [School of Material Science and Engineering, Shandong Provincial Key Laboratory of Preparation and Measurement of Building Materials, University of Jinan, Jinan 250022, Shandong (China); Liu, Zhiqiang [State Key Laboratory of Crystal Materials, Shandong University, Jinan 250100, Shandong (China); Cao, Duxia, E-mail: duxiacao@ujn.edu.cn [School of Material Science and Engineering, Shandong Provincial Key Laboratory of Preparation and Measurement of Building Materials, University of Jinan, Jinan 250022, Shandong (China); Guan, Ruifang, E-mail: mse_guanrf@ujn.edu.cn [School of Material Science and Engineering, Shandong Provincial Key Laboratory of Preparation and Measurement of Building Materials, University of Jinan, Jinan 250022, Shandong (China); Wang, Kangnan; Shan, Yanyan; Xu, Yongxiao; Ma, Lin [School of Material Science and Engineering, Shandong Provincial Key Laboratory of Preparation and Measurement of Building Materials, University of Jinan, Jinan 250022, Shandong (China)

    2015-07-01

    Four coumarin amide derivatives with 4-methyl coumarin or pyrene as terminal group have been synthesized. Their photophysical properties and recognition properties for cyanide anions have been examined. The results indicate that the compounds can recognize cyanide anions with obvious absorption and fluorescence spectra change, at the same time, obvious color and fluorescence change can be observed by naked eye. The in situ hydrogen nuclear magnetic resonance spectra and photophysical properties change confirm that Michael additions between the chemosensors and cyanide anions take place at the 4-position of coumarin. - Highlights: • Four coumarin amide derivatives with 4-methyl coumarin or pyrene as terminal group were synthesized. • The compounds can recognize cyanide anions with obvious absorption and fluorescence spectra change. • Michael additions between the chemosensors and cyanide anions take place at the 4-position of coumarin.

  7. Control of calcium carbonate crystallization by using anionic polymethylsiloxanes as templates

    Energy Technology Data Exchange (ETDEWEB)

    Neira-Carrillo, Andronico, E-mail: aneira@uchile.cl [Faculty of Veterinary and Animal Sciences, University of Chile, Santa Rosa 11735, PO Box 2-15, Santiago (Chile); Vasquez-Quitral, Patricio; Paz Diaz, Maria; Soledad Fernandez, Maria; Luis Arias, Jose [Faculty of Veterinary and Animal Sciences, University of Chile, Santa Rosa 11735, PO Box 2-15, Santiago (Chile); Yazdani-Pedram, Mehrdad [Faculty of Chemical and Pharmaceutical Science, University of Chile, S. Livingstone 1007, PO Box 233, Santiago (Chile)

    2012-10-15

    Sulfonated (SO{sub 3}H-PMS) and carboxylated (CO{sub 2}H-PMS) polymethylsiloxanes were synthesized and their effects as anionic template modifier on the CaCO{sub 3} crystal morphologies were evaluated. In vitro crystallization assays of CaCO{sub 3} were performed at room temperature by using gas diffusion method at different concentration, pH and time. SEM images of CaCO{sub 3} showed well-defined short calcite piles (ca. 5 {mu}m) and elongated calcite (ca. 20 {mu}m) when SO{sub 3}H-PMS was used. When CO{sub 2}H-PMS was used, the morphology of CaCO{sub 3} crystals was single-truncated at pH 7-9 and aggregated-modified calcite at pH 10-11. However, at pH 12 the least stable donut-shaped vaterite crystals were formed. EDS and XRD confirmed the presence of Si from anionic PMS templates on the CaCO{sub 3} surfaces and its polymorphism, respectively. Results showed that the selective morphologies of CaCO{sub 3} reflect the electrostatic interaction of anionic groups of functionalized PMS with Ca{sup 2+} adsorbed on CaCO{sub 3} crystals. Rounded and truncated-modified fluorescent CaCO{sub 3} was also produced by the inclusion of functionalized PMS into the lattice of CaCO{sub 3} matrix. We demonstrated that the anionic PMS offer a good modifier for polymer-controlled crystallization and a convenient approach for understanding the biomineralization field. - Graphical abstract: Optical photographs of rounded and truncated-modified fluorescent CaCO{sub 3} produced by the inclusion of sulfonated (SO{sub 3}H-PMS) polymethylsiloxanes into the lattice of CaCO{sub 3} matrix. Insert represents the simulation of modified and fluorescent CaCO{sub 3} crystals using Software JCrystal, (2008). Highlights: Black-Right-Pointing-Pointer We prepared two anionic polymethylsiloxanes (PMS) as templates. Black-Right-Pointing-Pointer Their modifier capacity on the CaCO{sub 3} crystal morphologies was demonstrated. Black-Right-Pointing-Pointer At pH 12, the least stable donut-shaped vaterite

  8. New magnetic organic-inorganic composites based on hydrotalcite-like anionic clays for drug delivery

    Energy Technology Data Exchange (ETDEWEB)

    Carja, Gabriela [Department of Physical Chemistry, Faculty of Industrial Chemistry, Technical University of Iasi, 71 Mangeron Boulevard, 700050 Iasi (Romania); Chiriac, Horia [National Institute of Research and Development for Technical Physics, 47 Mangeron Boulevard, 700050 Iasi (Romania)]. E-mail: hchiriac@phys-iasi.ro; Lupu, Nicoleta [National Institute of Research and Development for Technical Physics, 47 Mangeron Boulevard, 700050 Iasi (Romania)

    2007-04-15

    The structural 'memory effect' of anionic clays was used to obtain layered double hydroxides (LDHs) with tailored magnetic properties, by loading iron oxides and/or spinel structures on iron partially substituted hydrotalcite-like materials. The obtained magnetic layered structures were further used as precursors for new hybrid nanostructures, such as aspirin-hydrotalcite-like anionic clays. Transmission electron microscopy (TEM) analysis shows that small iron oxide or spinel nanoparticles coexist with the fibrous drug particles on the surface of partially aggregated typical clay-like particles. The specific saturation magnetization of the loaded LDHs can be increased up to 70 emu/g by using specific post-synthesis treatments.

  9. Verification of the sputter-generated 32SFn- (n = 1-6) anions by accelerator mass spectrometry

    Science.gov (United States)

    Mane, R. G.; Surendran, P.; Kumar, Sanjay; Nair, J. P.; Yadav, M. L.; Hemalatha, M.; Thomas, R. G.; Mahata, K.; Kailas, S.; Gupta, A. K.

    2016-01-01

    Recently, we have performed systematic Secondary Ion Mass Spectrometry (SIMS) measurements at our ion source test set up and have demonstrated that gas phase 32SFn- (n = 1-6) anions for all size 'n' can be readily generated from a variety of surfaces undergoing Cs+ ion sputtering in the presence of high purity SF6 gas by employing the gas spray-cesium sputter technique. In our SIMS measurements, the isotopic yield ratio 34SFn-/32SFn- (n = 1-6) was found to be close to its natural abundance but not for all size 'n'. In order to gain further insight into the constituents of these molecular anions, ultra sensitive Accelerator Mass Spectrometry (AMS) measurements were conducted with the most abundant 32SFn- (n = 1-6) anions, at BARC-TIFR 14 UD Pelletron accelerator. The results from these measurements are discussed in this paper.

  10. Anionic silicate organic frameworks constructed from hexacoordinate silicon centres

    Science.gov (United States)

    Roeser, Jérôme; Prill, Dragica; Bojdys, Michael J.; Fayon, Pierre; Trewin, Abbie; Fitch, Andrew N.; Schmidt, Martin U.; Thomas, Arne

    2017-10-01

    Crystalline frameworks composed of hexacoordinate silicon species have thus far only been observed in a few high pressure silicate phases. By implementing reversible Si-O chemistry for the crystallization of covalent organic frameworks, we demonstrate the simple one-pot synthesis of silicate organic frameworks based on octahedral dianionic SiO6 building units. Clear evidence of the hexacoordinate environment around the silicon atoms is given by 29Si nuclear magnetic resonance analysis. Characterization by high-resolution powder X-ray diffraction, density functional theory calculation and analysis of the pair-distribution function showed that those anionic frameworks—M2[Si(C16H10O4)1.5], where M = Li, Na, K and C16H10O4 is 9,10-dimethylanthracene-2,3,6,7-tetraolate—crystallize as two-dimensional hexagonal layers stabilized in a fully eclipsed stacking arrangement with pronounced disorder in the stacking direction. Permanent microporosity with high surface area (up to 1,276 m2 g-1) was evidenced by gas-sorption measurements. The negatively charged backbone balanced with extra-framework cations and the permanent microporosity are characteristics that are shared with zeolites.

  11. Simultaneous determination of inorganic and organic anions by ion chromatography

    International Nuclear Information System (INIS)

    Park, Yang Soon; Joe, Ki Soo; Han, Sun Ho; Park, Soon Dal; Choi, Kwang Soon

    1999-06-01

    Four methods were investigated for the simultaneous determination of several inorganic and organic anions in aqueous solution by ion chromatography. The first is two columns coupled system. The second is the gradient elution system with an anion exchange column. The third is the system with a mixed-mode stationary phase. The fourth is the system with an anion exchange column and the eluant of low conductivity without ion suppressor. The advantages and disadvantages of individual systems were discussed. The suitable methods were proposed for the application to the samples of the nuclear power industry and the environment. (author)

  12. Unusual structures of MgF5- superhalogen anion

    Science.gov (United States)

    Anusiewicz, Iwona; Skurski, Piotr

    2007-05-01

    The vertical electron detachment energies (VDE) of three MgF5- anions were calculated at the outer valence Green function level with the 6-311 + G(3df) basis sets. This species was found to form unusual geometrical structures each of which corresponds to an anionic state exhibiting superhalogen nature. The global minimum structure was described as a system in which two central magnesium atoms are linked via symmetrical triangle formed by three fluorine atoms. Extremely large electron binding energies of these anions (exceeding 8.5 eV in all cases) were predicted and discussed.

  13. Nitrate Anion Exchange in Pu-238 Aqueous Scrap Recovery Operations

    International Nuclear Information System (INIS)

    Pansoy-Hjelvik, M.E.; Silver, G.L.; Reimus, M.A.H.; Ramsey, K.B.

    1999-01-01

    Strong base, nitrate anion exchange (IX) is crucial to the purification of 238 Pu solution feedstocks with gross levels of impurities. This paper discusses the work involved in bench scale experiments to optimize the nitrate anion exchange process. In particular, results are presented of experiments conducted to (a) demonstrate that high levels of impurities can be separated from 238 Pu solutions via nitrate anion exchange and, (b) work out chemical pretreatment methodology to adjust and maintain 238 Pu in the IV oxidation state to optimize the Pu(IV)-hexanitrato anionic complex sorption to Reillex-HPQ resin. Additional experiments performed to determine the best chemical treatment methodology to enhance recovery of sorbed Pu from the resin, and VIS-NIR absorption studies to determine the steady state equilibrium of Pu(IV), Pu(III), and Pu(VI) in nitric acid are discussed

  14. Dehydroabiethylamine acetate as metal-containing anion precipitant

    International Nuclear Information System (INIS)

    Skrylev, L.D.; Borisov, V.A.

    1979-01-01

    The precipitation is studied of vanadate, tungstate-, molybdate- and chromate-ions by dehydroabiethylamine acetate. The degree of precipitation of metal-bearing anions is a function of the anion and of pH of the treated solutions. There exists a predetermined value of pH for each anion, at which the content of metal-bearing anion in the ultra-filtrate is at a minimum. For vanadate-ions, this pH is 5.0; for tungstate-ions, 3.0; for molybdate-ions, 4.0; for chrommate-ions, 8.0. The heats of solution of methavanadate, paratungstate, paramolybdate and dehydroabiethylamine chromate, calculated in accordance with the Vant-Hoff equation, range between 3.5 and 8.3 kJ/mole; free energy varies between 45.8 and 137.5 kJ/mole; and entropy varies between 110 and 371 J/degree mole

  15. Detection of cyanide anion by zinc porphyrin-spiropyran dyad

    International Nuclear Information System (INIS)

    Kho, Young Min; Hur, Dae Young; Shin, Eun Ju

    2016-01-01

    Versatile methods of the sensitive and selective detection for cyanide anion to monitor toxic cyanide have been developed. These include colorimetric, colorimetric, chromatographic, and electrochemical analyses. Among those methods for cyanide detection, optical methods based on absorption and fluorescence spectroscopy are relatively simple, inexpensive, and sensitive. A number of organic sensors for cyanide anion have been designed and synthesized. Absorption and/or fluorescence spectra of these sensors are changed by forming coordination complex or bonding covalently with cyanide. Compared with other anions, cyanide anion has some characteristic properties, such as its strong nucleophilicity and high binding affinity toward metal ions, and is superior and useful for the development of the sensors. Both covalent bond-based sensors and coordination complex-based sensors have been developed for cyanide detection. The results indicate that ZnP-SP plays a role as a CN"- selective, colorimetric sensor either without or with UV irradiation

  16. Electronic spectra of anions intercalated in layered double hydroxides

    Indian Academy of Sciences (India)

    groups of the layers and interlayer water through the termi- nal atom symmetry ... results in a reaction with the metal hydroxide layers lead- ing to the ..... List of band positions observed for potassium salts of anion and LDH samples. Salts.

  17. Detection of cyanide anion by zinc porphyrin-spiropyran dyad

    Energy Technology Data Exchange (ETDEWEB)

    Kho, Young Min; Hur, Dae Young; Shin, Eun Ju [Dept. of Chemistry, Sunchon National University, Suncheon (Korea, Republic of)

    2016-10-15

    Versatile methods of the sensitive and selective detection for cyanide anion to monitor toxic cyanide have been developed. These include colorimetric, colorimetric, chromatographic, and electrochemical analyses. Among those methods for cyanide detection, optical methods based on absorption and fluorescence spectroscopy are relatively simple, inexpensive, and sensitive. A number of organic sensors for cyanide anion have been designed and synthesized. Absorption and/or fluorescence spectra of these sensors are changed by forming coordination complex or bonding covalently with cyanide. Compared with other anions, cyanide anion has some characteristic properties, such as its strong nucleophilicity and high binding affinity toward metal ions, and is superior and useful for the development of the sensors. Both covalent bond-based sensors and coordination complex-based sensors have been developed for cyanide detection. The results indicate that ZnP-SP plays a role as a CN{sup -} selective, colorimetric sensor either without or with UV irradiation.

  18. Two independent anion transport systems in rabbit mandibular salivary glands

    DEFF Research Database (Denmark)

    Novak, I; Young, J A

    1986-01-01

    Cholinergically stimulated Cl and HCO3 transport in perfused rabbit mandibular glands has been studied with extracellular anion substitution and administration of transport inhibitors. In glands perfused with HCO3-free solutions, replacement of Cl with other anions supported secretion in the foll......Cholinergically stimulated Cl and HCO3 transport in perfused rabbit mandibular glands has been studied with extracellular anion substitution and administration of transport inhibitors. In glands perfused with HCO3-free solutions, replacement of Cl with other anions supported secretion...... stimulated secretion by about 30%, but when infused in addition to furosemide (0.1 mmol/l), it inhibited by about 20%. Amiloride (1.0 mmol/l) caused no inhibition. The results suggest that there are at least three distinct carriers in the rabbit mandibular gland. One is a furosemide-sensitive Na-coupled Cl...

  19. Mechanism of protection of adenosine from sulphate radical anion ...

    Indian Academy of Sciences (India)

    Unknown

    Keywords. Repair by caffeic acid; repair of adenosine radicals; oxidation by sulphate radical anions. ... known that hydroxycinnamic acids are natural anti- oxidants ... acid. 2. Experimental ..... ously and independently under kinetic conditions at.

  20. New anion-exchange polymers for improved separations

    International Nuclear Information System (INIS)

    Jarvinen, G.D.; Barr, M.E.; Marsh, S.F.

    1997-01-01

    Objective is to improve the understanding of how the structure of a new class of anion-exchange polymers controls the binding of anionic actinide complexes from solution. This is needed to develop practical separation systems that will reduce the cost of actinide processing operations within the DOE complex. In addition anion exchange is widely used in industry. Several new series of bifunctional anion- exchange polymers have been designed, synthesized, and tested for removing Pu(IV), Am(III), and U(VI) from nitric acid. The polymers contain a pyridinium site derived from the host poly(4-vinylpyridine) and a second cationic site attached through a chain of 2 to 6 methylene groups. The new polymers removed Pu four to ten times more efficiently than the best commercial materials

  1. Intestinal transporters for endogenic and pharmaceutical organic anions

    DEFF Research Database (Denmark)

    Grandvuinet, Anne Sophie; Vestergaard, Henrik Tang; Rapin, Nicolas

    2012-01-01

    This review provides an overview of intestinal human transporters for organic anions and stresses the need for standardization of the various in-vitro methods presently employed in drug-drug interaction (DDI) investigations....

  2. Expanding frontiers in materials chemistry and physics with multiple anions.

    Science.gov (United States)

    Kageyama, Hiroshi; Hayashi, Katsuro; Maeda, Kazuhiko; Attfield, J Paul; Hiroi, Zenji; Rondinelli, James M; Poeppelmeier, Kenneth R

    2018-02-22

    During the last century, inorganic oxide compounds laid foundations for materials synthesis, characterization, and technology translation by adding new functions into devices previously dominated by main-group element semiconductor compounds. Today, compounds with multiple anions beyond the single-oxide ion, such as oxyhalides and oxyhydrides, offer a new materials platform from which superior functionality may arise. Here we review the recent progress, status, and future prospects and challenges facing the development and deployment of mixed-anion compounds, focusing mainly on oxide-derived materials. We devote attention to the crucial roles that multiple anions play during synthesis, characterization, and in the physical properties of these materials. We discuss the opportunities enabled by recent advances in synthetic approaches for design of both local and overall structure, state-of-the-art characterization techniques to distinguish unique structural and chemical states, and chemical/physical properties emerging from the synergy of multiple anions for catalysis, energy conversion, and electronic materials.

  3. Adsorption and desorption dynamics of citric acid anions in soil

    KAUST Repository

    Oburger, E.; Leitner, D.; Jones, D. L.; Zygalakis, K. C.; Schnepf, A.; Roose, T.

    2011-01-01

    The functional role of organic acid anions in soil has been intensively investigated, with special focus on (i) microbial respiration and soil carbon dynamics, (ii) nutrient solubilization or (iii) metal detoxification and reduction of plant metal

  4. Synthesis and anion binding properties of porphyrins and related compounds

    KAUST Repository

    Figueira, Flá vio; Rodrigues, Joã o M M; Farinha, Andreia; Cavaleiro, José A S; Tomé , Joã o P C

    2016-01-01

    promising. In this review, we summarize the most recent developments in anion binding studies while outlining the strategies that may be used to synthesize and functionalize these type of macrocycles. © 2016 World Scientific Publishing Company.

  5. Changing certain dietary cationic and anionic minerals: Impact on ...

    African Journals Online (AJOL)

    Changing certain dietary cationic and anionic minerals: Impact on blood chemistry, milk ... Increased blood pH and serum HCO3 were noticed in buffaloes fed with LC ... Serum calcium and chloride increased with decreased DCAD level while ...

  6. Ion-exchange concentration of inorganic anions from aqueous solution

    Directory of Open Access Journals (Sweden)

    L. P. Bondareva

    2016-01-01

    Full Text Available Monitoring of natural waters in the present time - consuming process, the accuracy of which is influenced by many factors: the composition of water, the presence of impurities and "interfering" components. The water sample preparation process includes the step of concentration and separation of ions determined. The most versatile, efficient, and frequently used method is the concentration of inorganic anions from aqueous solutions by ion exchanger, which can optimize the composition of water to the optimal for identification and quantitative determination of anions. The characteristics of sorption chloride, nitrate and sulfate ions of basic anion exchange resin AВ-17 and Purolite A430 were compared in the article. The constants of protolysis of ion exchangers both AB 17 and Purolite A430 are the same and equal 0.037 ± 0,002. The value of total capacity (POE Purolite A430 was 4.3 mmol/g, AB 17 – 3.4 mmol/g. The studied ion exchangers have the same type of ionic groups – quaternary ammonium, but their number and denotes differ. The number of quaternary ammonium groups is higher in Purolite A430, respectively the number of absorbed anions of these ion exchanger is higher. The values of dynamic exchange capacity (DOE of ion exchanger Purolite A430 is higher than these values of AB-17 and equal to 1.48 ± 0.03 mmol / dm3 for chloride ion, 1.50 ± 0.03 mmol / dm3 for nitrate ion, 1.62 ± 0.03 mmol / dm3 for sulfate ion. The values of the POE and DOE of anion-exchange resins Purolite A430 and AV-17 and the characteristics of the individual sorption of chloride, nitrate, sulfate ions showed an advantage of the Purolite for the concentrationing of anions. It is found that times of anions sorption from triple-anion solutions by Purolite A430 are significantly different for different anions, and these times are close for anion-exchanger AV-17. It proves the possibility of quantitative separation and concentration by anion-exchanger Purolite A430.

  7. (100) faceted anion voids in electron irradiated fluorite

    International Nuclear Information System (INIS)

    Johnson, E.

    1979-01-01

    High fluence electron irradiation of fluorite crystals in the temperature range 150 to 320 K results in formation of a simple cubic anion void superlattice. Above 320 K the damage structure changes to a random distribution of large [001] faceted anion voids. This voidage behaviour, similar to that observed in a range of irradiated metals, is discussed in terms points defect rather than conventional colour centre terminology. (Auth.)

  8. Gas-Grain Models for Interstellar Anion Chemistry

    Science.gov (United States)

    Cordiner, M. A.; Charnely, S. B.

    2012-01-01

    Long-chain hydrocarbon anions C(sub n) H(-) (n = 4, 6, 8) have recently been found to be abundant in a variety of interstellar clouds. In order to explain their large abundances in the denser (prestellar/protostellar) environments, new chemical models are constructed that include gas-grain interactions. Models including accretion of gas-phase species onto dust grains and cosmic-ray-induced desorption of atoms are able to reproduce the observed anion-to-neutral ratios, as well as the absolute abundances of anionic and neutral carbon chains, with a reasonable degree of accuracy. Due to their destructive effects, the depletion of oxygen atoms onto dust results in substantially greater polyyne and anion abundances in high-density gas (with n(sub H2) approx > / cubic cm). The large abundances of carbon-chain-bearing species observed in the envelopes of protostars such as L1527 can thus be explained without the need for warm carbon-chain chemistry. The C6H(-) anion-to-neutral ratio is found to be most sensitive to the atomic O and H abundances and the electron density. Therefore, as a core evolves, falling atomic abundances and rising electron densities are found to result in increasing anion-to-neutral ratios. Inclusion of cosmic-ray desorption of atoms in high-density models delays freeze-out, which results in a more temporally stable anion-to-neutral ratio, in better agreement with observations. Our models include reactions between oxygen atoms and carbon-chain anions to produce carbon-chain-oxide species C6O, C7O, HC6O, and HC7O, the abundances of which depend on the assumed branching ratios for associative electron detachment

  9. Luminescent Surface Quaternized Carbon Dots

    KAUST Repository

    Bourlinos, Athanasios B.; Zbořil, Radek; Petr, Jan; Bakandritsos, Aristides; Krysmann, Marta; Giannelis, Emmanuel P.

    2012-01-01

    Thermal oxidation of a salt precursor made from the acid base combination of tris(hydroxymethyl)aminomethane and betaine hydrochloride results in light-emitting surface quaternized carbon dots that are water-dispersible, display anion exchange properties, and exhibit uniform size/surface charge. © 2011 American Chemical Society.

  10. Luminescent Surface Quaternized Carbon Dots

    KAUST Repository

    Bourlinos, Athanasios B.

    2012-01-10

    Thermal oxidation of a salt precursor made from the acid base combination of tris(hydroxymethyl)aminomethane and betaine hydrochloride results in light-emitting surface quaternized carbon dots that are water-dispersible, display anion exchange properties, and exhibit uniform size/surface charge. © 2011 American Chemical Society.

  11. Nanotubular Halloysite Clay as Efficient Water Filtration System for Removal of Cationic and Anionic Dyes

    International Nuclear Information System (INIS)

    Zhao, Yafei; Abdullayev, Elshad; Lvov, Yuri

    2014-01-01

    Halloysite nanotubes, chemically similar to kaolinite, are formed by rolling of kaolinite layers in tubes with diameter of 50 nm and length of ca. 1 μm. Halloysite has negative SiO 2 outermost and positive Al 2 O 3 inner lumen surface, which enables it to be used as potential absorbent for both cationic and anionic dyes due to the efficient bivalent adsorbancy. An adsorption study using cationic Rhodamine 6G and anionic Chrome azurol S has shown approximately two times better dye removal for halloysite as compared to kaolinite. Halloysite filters have been effectively regenerated up to 50 times by burning the adsorbed dyes. Overall removal efficiency of anionic Chrome azurol S exceeded 99.9% for 5th regeneration cycle of halloysite. Chrome azurol S adsorption capacity decreases with the increase of ionic strength, temperature and pH. For cationic Rhodamine 6G, higher ionic strength, temperature and initial solution concentration were favorable to enhanced adsorption with optimal pH 8. These results indicate a potential to utilize halloysite for the removal of ionic dyes from environmental waters

  12. Anion-Regulated Selective Generation of Cobalt Sites in Carbon: Toward Superior Bifunctional Electrocatalysis

    Energy Technology Data Exchange (ETDEWEB)

    Wan, Gang [State Key Laboratory of High Performance Ceramics and Superfine Microstructures, Shanghai Institute of Ceramics, Chinese Academy of Sciences, 1295 Ding-xi Road Shanghai 200050 P. R. China; University of Chinese Academy of Sciences, Beijing 100049 P. R. China; Yang, Ce [Chemical Science and Engineering Division, Argonne National Laboratory, 9700 Cass Avenue Lemont IL 60439 USA; Zhao, Wanpeng [State Key Laboratory of High Performance Ceramics and Superfine Microstructures, Shanghai Institute of Ceramics, Chinese Academy of Sciences, 1295 Ding-xi Road Shanghai 200050 P. R. China; University of Chinese Academy of Sciences, Beijing 100049 P. R. China; Li, Qianru [State Key Laboratory of High Performance Ceramics and Superfine Microstructures, Shanghai Institute of Ceramics, Chinese Academy of Sciences, 1295 Ding-xi Road Shanghai 200050 P. R. China; University of Chinese Academy of Sciences, Beijing 100049 P. R. China; Wang, Ning [State Key Laboratory of High Performance Ceramics and Superfine Microstructures, Shanghai Institute of Ceramics, Chinese Academy of Sciences, 1295 Ding-xi Road Shanghai 200050 P. R. China; University of Chinese Academy of Sciences, Beijing 100049 P. R. China; Li, Tao [X-ray Science Division, Advanced Photon Source, Argonne National Laboratory, 9700 Cass Avenue Lemont IL 60439 USA; Zhou, Hua [X-ray Science Division, Advanced Photon Source, Argonne National Laboratory, 9700 Cass Avenue Lemont IL 60439 USA; Chen, Hangrong [State Key Laboratory of High Performance Ceramics and Superfine Microstructures, Shanghai Institute of Ceramics, Chinese Academy of Sciences, 1295 Ding-xi Road Shanghai 200050 P. R. China; Shi, Jianlin [State Key Laboratory of High Performance Ceramics and Superfine Microstructures, Shanghai Institute of Ceramics, Chinese Academy of Sciences, 1295 Ding-xi Road Shanghai 200050 P. R. China

    2017-11-06

    The introduction of active transition metal sites (TMSs) in carbon enables the synthesis of noble-metal-free electrocatalysts for clean energy conversion applications, however, there are often multiple existing forms of TMSs, which are of different natures and catalytic models. Regulating the evolution of distinctive TMSs is highly desirable but remains challenging to date. Anions, as essential elements involved in the synthesis, have been totally neglected previously in the construction of TMSs. Herein, the effects of anions on the creation of different types of TMSs is investigated for the first time. It is found that the active cobalt-nitrogen sites tend to be selectively constructed on the surface of N-doped carbon by using chloride, while metallic cobalt nanoparticles encased in protective graphite layers are the dominant forms of cobalt species with nitrate ions. The obtained catalysts demonstrate cobalt-sites-dependent activity for ORR and HER in acidic media. And the remarkably enhanced catalytic activities approaching that of benchmark Pt/C in acidic medium has been obtained on the catalyst dominated with cobalt-nitrogen sites, confirmed by the advanced spectroscopic . Our finding demonstrates a general paradigm of anion-regulated evolution of distinctive TMSs, providing a new pathway for enhancing performances of various targeted reactions related with TMSs.

  13. Hydrothermal carbon nanosphere-based agglomerated anion exchanger for ion chromatography.

    Science.gov (United States)

    Zhao, Qiming; Wu, Shuchao; Zhang, Kai; Lou, Chaoyan; Zhang, Peiming; Zhu, Yan

    2016-10-14

    This work reports the application of hydrothermal carbon nanospheres (HCNSs) as stationary phases in ion chromatography. HCNSs were facilely quaternized through polycondensation of methylamine and 1,4-butanediol diglycidyl ether. The quaternization was confirmed by Fourier transform infrared spectroscopy and X-ray photoelectron spectroscopy. Owing to the electrostatic interaction, quaternized HCNSs were equably attached onto the surface of sulfonated polystyrene-divinylbenzene (PS-DVB) beads to construct the anion exchangers. The aggregation was verified by scanning electron microscopy and elemental analysis. Common anions, aliphatic monocarboxylic acids, polarizable anions, and aromatic acids were well separated on the stationary phases with good stability and symmetry. The prepared column was further applied to detect phosphate content in Cola drink samples. The limit of detection (S/N=3) was 0.09mg/L, and the relative standard deviation (n=10) of retention time was 0.31%. The average recovery was 99.58%. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Study of Synthesis Polyethylene glycol oleate Sulfonated as an Anionic Surfactant for Enhanced Oil Recovery (EOR)

    Science.gov (United States)

    Sampora, Yulianti; Juwono, Ariadne L.; Haryono, Agus; Irawan, Yan

    2017-11-01

    Mechanical Enhanced Oil Recovery (EOR) through chemical injection is using an anionic surfactant to improve the recovery of oil residues, particularly in a reservoir area that has certain characteristics. This case led the authors to conduct research on the synthesis of an anionic surfactant based on oleic acid and polyethylene glycol 400 that could be applied as a chemical injection. In this work, we investigate the sulfonation of Polyethylene glycol oleate (PDO) in a sulfuric acid agent. PDO in this experiment was derived from Indonesian palm oil. Variation of mole reactant and reaction time have been studied. The surfactant has been characterized by measuring the interfacial tension, acid value, ester value, saponification value, iodine value, Fourier Transform Infrared (FTIR), and particle size analyzer. There is a new peak at 1170-1178 cm-1 indicating that S=O bond has formed. PDO sulfonate exhibits good surface activity due to interfacial tension of 0,003 mN/m. Thus, polyethylene glycol oleate sulfonate was successfully synthesized and it could be useful as a novel an anionic surfactant.

  15. Effect of the alkyl chain length of the ionic liquid anion on polymer electrolytes properties

    International Nuclear Information System (INIS)

    Leones, Rita; Sentanin, Franciani; Nunes, Sílvia Cristina; Esperança, José M.S.S.; Gonçalves, Maria Cristina

    2015-01-01

    New polymer electrolytes (PEs) based on chitosan and three ionic liquid (IL) families ([C 2 mim][C n SO 3 ], [C 2 mim][C n SO 4 ] and [C 2 mim][diC n PO 4 ]) were synthesized by the solvent casting method. The effect of the length of the alkyl chain of the IL anion on the thermal, morphological and electrochemical properties of the PEs was studied. The solid polymer electrolytes SPE membranes were analyzed by differential scanning calorimetry (DSC), thermogravimetric analysis (TGA), X-ray diffraction (XRD), scanning electron microscopy (SEM), energy dispersive X-ray (EDX), polarized optical microscopy (POM), atomic force microscopy (AFM), complex impedance spectroscopy (ionic conductivity) and cyclic voltammetry (CV). The obtained results evidenced an influence of the alkyl chain length of the IL anion on the temperature of degradation, birefringence, surface roughness and ionic conductivity of the membranes. The DSC, XRD and CV results showed independency from the length of the IL-anion-alkyl chain. The PEs displayed an predominantly amorphous morphology, a minimum temperature of degradation of 135 °C, a room temperature (T = 25 °C) ionic conductivity of 7.78 × 10 −4 S cm −1 and a wide electrochemical window of ∼ 4.0 V.

  16. The gecko visual pigment: the anion hypsochromic effect.

    Science.gov (United States)

    Crescitelli, F; Karvaly, B

    1991-01-01

    The 521-pigment in the retina of the Tokay gecko (Gekko gekko) readily responds to particular physical and chemical changes in its environment. When solubilized in chloride deficient state the addition of Class I anions (Cl-, Br-) induces a bathochromic shift of the absorption spectrum. Class II anions (NO3-, IO3-, N3-, OCN-, SCN-, SeCN-, N(CN)2-), which exhibit ambidental properties, cause an hypsochromic shift. Class III anions (F-, I-, NO2-, CN-, AsO3-, SO2(4-), S2O2(3-) have no spectral effect on the 521-pigment. Cations appear to have no influence on the pigment absorption and Class I anions prevent or reverse the hypsochromic shift caused by Class II anions. It is suggested that the spectral displacements reflect specific changes in the opsin conformation, which alter the immediate (dipolar) environment of the retinal chromophore. The protein conformation seems to promote excited-state processes most in the native 521-pigment state and least in the presence of Class II anions. This in turn suggests that the photosensitivity of the 521-pigment is controlled by the excited rather than by the ground-state properties of the pigment.

  17. A novel anion exchange membrane from polystyrene (ethylene butylene) polystyrene: Synthesis and characterization

    Energy Technology Data Exchange (ETDEWEB)

    Vinodh, Rajangam; Ilakkiya, Arjunan; Elamathi, Swaminathan [Department of Chemistry, Anna University Chennai, Sardar Patel Road, Chennai 600025, Tamil Nadu (India); Sangeetha, Dharmalingam, E-mail: sangeetha@annauniv.ed [Department of Chemistry, Anna University Chennai, Sardar Patel Road, Chennai 600025, Tamil Nadu (India)

    2010-02-25

    We look forward for an eco-friendly hydrocarbon polymer with higher molecular weight for the preparation of an anion exchange membrane. Polystyrene ethylene butylene polystyrene (PSEBS) was chosen as the polymer matrix. The anion exchange membrane was prepared from PSEBS tri-block co-polymer and then the properties were characterized for alkaline fuel cell application. The preparation of anion exchange polymer involved two steps namely chloromethylation and quaternization. The anion exchange membrane with high conductivity has been prepared by introducing quaternary ammonium groups in to the polymer. Finally, the membrane was prepared using solution casting method. The solution casting method yields highly hydrophilic membranes with uniform structure that were suitable for electrochemical applications. The efficiency of the entrapment was monitored by swelling ratio, chemical stability and ion exchange measurement. The characteristic structural properties of the membrane were investigated by FT-IR spectroscopy and {sup 1}H NMR spectroscopy. The thermal stability of the membrane was characterized by TGA, DSC and DMA (dynamic mechanical analysis). The prepared uniform electrolyte membrane in this study has high thermal and chemical stability. The surface morphology and elemental composition of the quaternized PSEBS was determined by SEM-EDXA techniques, respectively. The measured hydroxyl ion conductivity of the synthesized alkaline PSEBS polymer electrolyte membrane showed ionic conductivity in the range of 10{sup -3} S/cm in deionized water at room temperature. It was found that the substitution provided a flexible, chemically and thermally stable membrane. Hence, the membrane will have potential application in the alkaline fuel cell.

  18. Vibrational Spectroscopy of Cation and Anion Channelrhodopsins

    Science.gov (United States)

    Yi, Adrian S.

    Optogenetics is a technique to control and monitor cell activity with light by expression of specific microbial rhodopsins. Cation channelrhodopsins (CCRs) and anion channelrhodopsins (ACRs) have been demonstrated to activate and silence cell activity, respectively. In this dissertation, the molecular mechanisms of two channelrhodopsins are studied: a CCR from Chlamydomonas augustae (CaChR1) and an ACR from Guillardia theta (GtACR1). The recently discovered GtACR1is especially interesting, as it achieves neural silencing with 1/1000th of the light intensity compared to previous microbial rhodopsin silencing ion pumps. Static and time-resolved resonance Raman, FTIR difference, and UV-visible spectroscopies were utilized in addition to various biochemical and genetic techniques to explore the molecular mechanisms of these channelrhodopsins. In CaChR1, Glu169 and Asp299 residues are located nearby the Schiff base (SB) similar to the homologous residues Asp85 and Asp212, which exist in an ionized state in unphotolyzed bacteriorhodopsin (BR) and play a key role in proton pumping. We observe significant changes in the protonation states of the SB, Glu169, and Asp299 of CaChR1 leading up to the open-channel P2 state, where all three groups exist in a charge neutral state. This unusual charge neutrality along with the position of these groups in the CaChR1 ion channel suggests that charge neutrality plays an important role in cation gating and selectivity in these low efficiency CCRs. Significant differences exist in the photocycle and protonation/hydrogen bonding states of key residues inGtACR1compared to BR and CaChR1. Resonance Raman studies reveal that in the unphotolyzed state of GtACR1, residues Glu68, Ser97 (BR Asp85 homolog), and Asp234 (BR Asp212 homolog) located near the SB exist in charge neutral states. Furthermore, upon K formation, these residues do not change their protonation states. At room temperature, a slow decay of the red-shifted K intermediate is

  19. Ab initio theoretical study of dipole-bound anions of molecular complexes: (HF)3- and (HF)4- anions

    Science.gov (United States)

    Ramaekers, Riet; Smith, Dayle M. A.; Smets, Johan; Adamowicz, Ludwik

    1997-12-01

    Ab initio calculations have been performed to determine structures and vertical electron detachment energy (VDE) of the hydrogen fluoride trimer and tetramer anions, (HF)3- and (HF)4-. In these systems the excess electron is bound by the dipole field of the complex. It was determined that, unlike the neutral complexes which prefer the cyclic structures, the equilibrium geometries of the anions have "zig-zag" shapes. For both complexes the predicted VDEs are positive [210 meV and 363 meV for (HF)3- and (HF)4-, respectively], indicating that the anions are stable systems with respect to the vertical electron detachment. These results were obtained at the coupled-cluster level of theory with single, double and triple excitations [CCSD(T) method; the triple-excitation contribution in this method is calculated approximately using the perturbation approach] with the anion geometries obtained using the second-order Møller-Plesset perturbation theory (MP2) method. The same approach was also used to determine the adiabatic electron affinities (AEA) of (HF)3 and (HF)4. In addition to the electronic contribution, we also calculated the contributions (using the harmonic approximation) resulting from different zero-point vibration energies of the neutral and anionic clusters. The calculations predicted that while the AEA of (HF)3 is positive (44 meV), the AEA for (HF)4 is marginally negative (-16 meV). This suggests that the (HF)3- anion should be a stable system, while the (HF)4- is probably metastable.

  20. Dowex anion exchanger-loaded-baker's yeast as bi-functionalized biosorbents for selective extraction of anionic and cationic mercury(II) species

    International Nuclear Information System (INIS)

    Mahmoud, Mohamed E.; Yakout, Amr A.; Osman, Maher M.

    2009-01-01

    Dowex anion exchanger-immobilized-baker's yeast [Dae-yeast] were synthesized and potentially applied as environmental friendly biosorbents to evaluate the up-take process of anionic and cationic mercury(II) species as well as other metal ions. Optimization of mass ratio of Dowex anion exchanger versus yeast (1:1-1:10) in presence of various interacting buffer solutions (pH 4.0-9.0) was performed and evaluated. Surface modification of [Dae-yeast] was characterized by scanning electron microscopy (SEM) and infrared spectroscopy. The maximum metal biosorption capacity values of [Dae-yeast] towards mercury(II) were found in the range of 0.800-0.960, 0.840-0.950 and 0.730-0.900 mmol g -1 in presence of buffer solutions pH 2.0, 4.0 and 7.0, respectively. Three possible and different mechanisms are proposed to account for the biosorption of mercury and mercuric species under these three buffering conditions based on ion exchange, ion pair and chelation interaction processes. Factors affecting biosorption of mercury from aqueous medium including the pH effect of aqueous solutions (1.0-7.0), shaking time (1-30 min) and interfering ions were searched. The potential applications of modified biosorbents for selective biosorption and extraction of mercury from different real matrices including dental filling waste materials, industrial waste water samples and mercury lamp waste materials were also explored. The results denote to excellent percentage extraction values, from nitric acid as the dissolution solvent with a pH 2.0, as determined in the range of 90.77-97.91 ± 3.00-5.00%, 90.00-93.40 ± 4.00-5.00% and 92.31-100.00 ± 3.00-4.00% for the three tested samples, respectively.

  1. Full-dimensional characterization of photoelectron spectra of HOCO− and DOCO− and tunneling facilitated decay of HOCO prepared by anion photodetachment

    International Nuclear Information System (INIS)

    Wang, Jun; Li, Jun; Guo, Hua; Ma, Jianyi

    2014-01-01

    The photodetachment of both the HOCO − and DOCO − anions is investigated using full-dimensional quantum wave packets on new ab initio based global potential energy surfaces for both the neutral and anionic species. The calculated electron affinities and neutral fundamental vibrational frequencies of both isotopomers are in good agreement with available experimental data. The measured photoelectron spectra are also accurately reproduced, further validating the accuracy of the potential energy surfaces. In addition, strong mode specificity is found in the lifetimes of the HOCO vibrational features and the tunneling facilitated predissociation rates to H + CO 2 are rationalized using the recently proposed sudden vector projection model

  2. Benzonitrile: Electron affinity, excited states, and anion solvation

    Science.gov (United States)

    Dixon, Andrew R.; Khuseynov, Dmitry; Sanov, Andrei

    2015-10-01

    We report a negative-ion photoelectron imaging study of benzonitrile and several of its hydrated, oxygenated, and homo-molecularly solvated cluster anions. The photodetachment from the unsolvated benzonitrile anion to the X ˜ 1 A 1 state of the neutral peaks at 58 ± 5 meV. This value is assigned as the vertical detachment energy (VDE) of the valence anion and the upper bound of adiabatic electron affinity (EA) of benzonitrile. The EA of the lowest excited electronic state of benzonitrile, a ˜ 3 A 1 , is determined as 3.41 ± 0.01 eV, corresponding to a 3.35 eV lower bound for the singlet-triplet splitting. The next excited state, the open-shell singlet A ˜ 1 A 1 , is found about an electron-volt above the triplet, with a VDE of 4.45 ± 0.01 eV. These results are in good agreement with ab initio calculations for neutral benzonitrile and its valence anion but do not preclude the existence of a dipole-bound state of similar energy and geometry. The step-wise and cumulative solvation energies of benzonitrile anions by several types of species were determined, including homo-molecular solvation by benzonitrile, hydration by 1-3 waters, oxygenation by 1-3 oxygen molecules, and mixed solvation by various combinations of O2, H2O, and benzonitrile. The plausible structures of the dimer anion of benzonitrile were examined using density functional theory and compared to the experimental observations. It is predicted that the dimer anion favors a stacked geometry capitalizing on the π-π interactions between the two partially charged benzonitrile moieties.

  3. Anion bridges drive salting out of a simple amphiphile from aqueous solution

    International Nuclear Information System (INIS)

    Bowron, D.T.; Finney, J.L.

    2002-01-01

    Neutron diffraction with isotope substitution has been used to determine the structural changes that occur on the addition of a simple salting-out agent to a dilute aqueous alcohol solution. The striking results obtained demonstrate a relatively simple process occurs in which interamphiphile anionic salt bridges are formed between the polar groups of the alcohol molecules. These ion bridges drive an increase in the exposure of the alcohol molecule nonpolar surface to the solvent water and hence point the way to their eventual salting out by the hydrophobic effect

  4. Monohydrocalcite: a promising remediation material for hazardous anions

    International Nuclear Information System (INIS)

    Fukushi, Keisuke; Munemoto, Takashi; Sakai, Minoru; Yagi, Shintaro

    2011-01-01

    The formation conditions, solubility and stability of monohydrocalcite (MHC, CaCO 3 ·H 2 O), as well as sorption behaviors of toxic anions on MHC, are reviewed to evaluate MHC as a remediation material for hazardous oxyanions. MHC is a rare mineral in geological settings that occurs in recent sediments in saline lakes. Water temperature does not seem to be an important factor for MHC formation. The pH of lake water is usually higher than 8 and the Mg/Ca ratio exceeds 4. MHC synthesis experiments as a function of time indicate that MHC is formed from amorphous calcium carbonate and transforms to calcite and/or aragonite. Most studies show that MHC forms from solutions containing Mg, which inhibits the formation of stable calcium carbonates. The solubility of MHC is higher than those of calcite, aragonite and vaterite, but lower than those of ikaite and amorphous calcium carbonate at ambient temperature. The solubility of MHC decreases with temperature. MHC is unstable and readily transforms to calcite or aragonite. The transformation consists of the dissolution of MHC and the subsequent formation of stable phases from the solution. The rate-limiting steps of the transformation of MHC are the nucleation and growth of stable crystalline phases. Natural occurrences indicate that certain additives, particularly PO 4 and Mg, stabilize MHC. Laboratory studies confirm that a small amount of PO 4 in solution (>30 μM) can significantly inhibit the transformation of MHC. MHC has a higher sorption capacity for PO 4 than calcite and aragonite. The modes of PO 4 uptake are adsorption on the MHC surface at moderate phosphate concentrations and precipitation of secondary calcium phosphate minerals at higher concentrations. Arsenate is most likely removed from the solution during the transformation of MHC. The proposed sorption mechanism of arsenate is coprecipitation during crystallization of aragonite. The arsenic sorption capacity by MHC is significantly higher than simple

  5. Monohydrocalcite: a promising remediation material for hazardous anions

    Science.gov (United States)

    Fukushi, Keisuke; Munemoto, Takashi; Sakai, Minoru; Yagi, Shintaro

    2011-12-01

    The formation conditions, solubility and stability of monohydrocalcite (MHC, CaCO3·H2O), as well as sorption behaviors of toxic anions on MHC, are reviewed to evaluate MHC as a remediation material for hazardous oxyanions. MHC is a rare mineral in geological settings that occurs in recent sediments in saline lakes. Water temperature does not seem to be an important factor for MHC formation. The pH of lake water is usually higher than 8 and the Mg/Ca ratio exceeds 4. MHC synthesis experiments as a function of time indicate that MHC is formed from amorphous calcium carbonate and transforms to calcite and/or aragonite. Most studies show that MHC forms from solutions containing Mg, which inhibits the formation of stable calcium carbonates. The solubility of MHC is higher than those of calcite, aragonite and vaterite, but lower than those of ikaite and amorphous calcium carbonate at ambient temperature. The solubility of MHC decreases with temperature. MHC is unstable and readily transforms to calcite or aragonite. The transformation consists of the dissolution of MHC and the subsequent formation of stable phases from the solution. The rate-limiting steps of the transformation of MHC are the nucleation and growth of stable crystalline phases. Natural occurrences indicate that certain additives, particularly PO4 and Mg, stabilize MHC. Laboratory studies confirm that a small amount of PO4 in solution (>30 μM) can significantly inhibit the transformation of MHC. MHC has a higher sorption capacity for PO4 than calcite and aragonite. The modes of PO4 uptake are adsorption on the MHC surface at moderate phosphate concentrations and precipitation of secondary calcium phosphate minerals at higher concentrations. Arsenate is most likely removed from the solution during the transformation of MHC. The proposed sorption mechanism of arsenate is coprecipitation during crystallization of aragonite. The arsenic sorption capacity by MHC is significantly higher than simple adsorption

  6. Monohydrocalcite: a promising remediation material for hazardous anions

    Directory of Open Access Journals (Sweden)

    Keisuke Fukushi, Takashi Munemoto, Minoru Sakai and Shintaro Yagi

    2011-01-01

    Full Text Available The formation conditions, solubility and stability of monohydrocalcite (MHC, CaCO3centerdotH2O, as well as sorption behaviors of toxic anions on MHC, are reviewed to evaluate MHC as a remediation material for hazardous oxyanions. MHC is a rare mineral in geological settings that occurs in recent sediments in saline lakes. Water temperature does not seem to be an important factor for MHC formation. The pH of lake water is usually higher than 8 and the Mg/Ca ratio exceeds 4. MHC synthesis experiments as a function of time indicate that MHC is formed from amorphous calcium carbonate and transforms to calcite and/or aragonite. Most studies show that MHC forms from solutions containing Mg, which inhibits the formation of stable calcium carbonates. The solubility of MHC is higher than those of calcite, aragonite and vaterite, but lower than those of ikaite and amorphous calcium carbonate at ambient temperature. The solubility of MHC decreases with temperature. MHC is unstable and readily transforms to calcite or aragonite. The transformation consists of the dissolution of MHC and the subsequent formation of stable phases from the solution. The rate-limiting steps of the transformation of MHC are the nucleation and growth of stable crystalline phases. Natural occurrences indicate that certain additives, particularly PO4 and Mg, stabilize MHC. Laboratory studies confirm that a small amount of PO4 in solution (>30 μM can significantly inhibit the transformation of MHC. MHC has a higher sorption capacity for PO4 than calcite and aragonite. The modes of PO4 uptake are adsorption on the MHC surface at moderate phosphate concentrations and precipitation of secondary calcium phosphate minerals at higher concentrations. Arsenate is most likely removed from the solution during the transformation of MHC. The proposed sorption mechanism of arsenate is coprecipitation during crystallization of aragonite. The arsenic sorption capacity by MHC is significantly

  7. Matrix diffusion in crystalline rocks: coupling of anion exclusion, surface diffusion and surface complexation

    International Nuclear Information System (INIS)

    Olin, M.; Valkiainen, M.; Aalto, H.

    1997-12-01

    This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments

  8. Matrix diffusion in crystalline rocks: coupling of anion exclusion, surface diffusion and surface complexation

    Energy Technology Data Exchange (ETDEWEB)

    Olin, M.; Valkiainen, M.; Aalto, H. [VTT Chemical Technology, Espoo (Finland)

    1997-12-01

    This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments. 21 refs.

  9. Metal-Oxide Film Conversions Involving Large Anions

    International Nuclear Information System (INIS)

    Pretty, S.; Zhang, X.; Shoesmith, D.W.; Wren, J.C.

    2008-01-01

    The main objective of my research is to establish the mechanism and kinetics of metal-oxide film conversions involving large anions (I - , Br - , S 2- ). Within a given group, the anions will provide insight on the effect of anion size on the film conversion, while comparison of Group 6 and Group 7 anions will provide insight on the effect of anion charge. This research has a range of industrial applications, for example, hazardous radioiodine can be immobilized by reaction with Ag to yield AgI. From the perspective of public safety, radioiodine is one of the most important fission products from the uranium fuel because of its large fuel inventory, high volatility, and radiological hazard. Additionally, because of its mobility, the gaseous iodine concentration is a critical parameter for safety assessment and post-accident management. A full kinetic analysis using electrochemical techniques has been performed on the conversion of Ag 2 O to (1) AgI and (2) AgBr. (authors)

  10. Metal-Oxide Film Conversions Involving Large Anions

    Energy Technology Data Exchange (ETDEWEB)

    Pretty, S.; Zhang, X.; Shoesmith, D.W.; Wren, J.C. [The University of Western Ontario, Chemistry Department, 1151 Richmond St., N6A 5B7, London, Ontario (Canada)

    2008-07-01

    The main objective of my research is to establish the mechanism and kinetics of metal-oxide film conversions involving large anions (I{sup -}, Br{sup -}, S{sup 2-}). Within a given group, the anions will provide insight on the effect of anion size on the film conversion, while comparison of Group 6 and Group 7 anions will provide insight on the effect of anion charge. This research has a range of industrial applications, for example, hazardous radioiodine can be immobilized by reaction with Ag to yield AgI. From the perspective of public safety, radioiodine is one of the most important fission products from the uranium fuel because of its large fuel inventory, high volatility, and radiological hazard. Additionally, because of its mobility, the gaseous iodine concentration is a critical parameter for safety assessment and post-accident management. A full kinetic analysis using electrochemical techniques has been performed on the conversion of Ag{sub 2}O to (1) AgI and (2) AgBr. (authors)

  11. Anion analysis in uranium more concentrates by ion chromatography

    International Nuclear Information System (INIS)

    Badaut, V.

    2009-01-01

    In the present exploratory study, the applicability of anionic impurities or attributing nuclear material to a certain chemical process or origin has been investigated. Anions (e.g., nitrate, sulphate, fluoride, chloride) originate from acids or salt solutions that are used for processing of solutions containing uranium or plutonium. The study focuses on uranium ore concentrates ('yellow cakes') originating from different mines. Uranium is mined from different types of ore body and depending on the type of rock, different chemical processes for leaching, dissolving and precipitating the uranium need to be applied. Consequently, the anionic patterns observed in he products of these processes (the 'ore concentrates') are different. The concentrations of different anionic species were measured by ion chromatography using conductivity detection. The results show clear differences of anion concentrations and patterns between samples from different uranium mines. Besides this, differences between sampling campaigns n a same mine were also observed indicating that the uranium ore is not homogeneous in a mine. These within-mine variations, however, were smaller than the between-mine variations. (author)

  12. Vertical detachment energies of anionic thymidine: Microhydration effects.

    Science.gov (United States)

    Kim, Sunghwan; Schaefer, Henry F

    2010-10-14

    Density functional theory has been employed to investigate microhydration effects on the vertical detachment energy (VDE) of the thymidine anion by considering the various structures of its monohydrates. Structures were located using a random searching procedure. Among 14 distinct structures of the anionic thymidine monohydrate, the low-energy structures, in general, have the water molecule bound to the thymine base unit. The negative charge developed on the thymine moiety increases the strength of the intermolecular hydrogen bonding between the water and base units. The computed VDE values of the thymidine monohydrate anions are predicted to range from 0.67 to 1.60 eV and the lowest-energy structure has a VDE of 1.32 eV. The VDEs of the monohydrates of the thymidine anion, where the N(1)[Single Bond]H hydrogen of thymine has been replaced by a 2(')-deoxyribose ring, are greater by ∼0.30 eV, compared to those of the monohydrates of the thymine anion. The results of the present study are in excellent agreement with the accompanying experimental results of Bowen and co-workers [J. Chem. Phys. 133, 144304 (2010)].

  13. Identification of inorganic anions by gas chromatography/mass spectrometry.

    Science.gov (United States)

    Sakayanagi, Masataka; Yamada, Yaeko; Sakabe, Chikako; Watanabe, Kunio; Harigaya, Yoshihiro

    2006-03-10

    Inorganic anions were identified by using gas chromatography/mass spectrometry (GC/MS). Derivatization of the anions was achieved with pentafluorobenzyl p-toluenesulphonate (PFB-Tos) as the reaction reagent and a crown ether as a phase transfer catalyst. When PFB-Br was used as the reaction reagent, the retention time of it was close to those of the derivatized inorganic anions and interfered with the analysis. In contrast, the retention time of PFB-Tos differed greatly from the PFB derivatives of the inorganic anions and the compounds of interest could be detected without interference. Although the PFB derivatives of SO4, S2O3, CO3, ClO4, and ClO3 could not be detected, the derivatives of F, Cl, Br, I, CN, OCN, SCN, N3, NO3, and NO2 were detected using PFB-Tos as the derivatizing reagent. The inorganic anions were detectable within 30 ng approximately, which is of sufficient sensitivity for use in forensic chemistry. Accurate mass number was measured for each PFB derivative by high-resolution mass spectrometry (HRMS) within a measurement error of 2 millimass units (mmu), which allowed determination of the compositional formula from the mass number. In addition, actual analysis was performed successively by our method using trial samples of matrix.

  14. Separation of transfer ribonucleic acids on polystyrene anion exchangers

    Energy Technology Data Exchange (ETDEWEB)

    Singhal, R.P.; Griffin, G.D.; Novelli, G.D.

    1976-11-16

    The transfer RNA separation by chromatography on strong-base-polystyrene exchange materials is examined and compared with the widely used reversed-phase chromatography. Results indicate important differences in some transfer RNA (tRNA) elution patterns by the anion-exchange chromatography, as compared with the reversed-phase chromatography. Transfer RNAs containing hydrophobic groups are adsorbed more strongly. The anion exchanger has twice the number of theoretical plates. Single peaks of tRNA/sub 2//sup Glu/ and tRNA/sub 1//sup Phe/ obtained from the reversed-phase column give multiple peaks on polystyrene anion-exchange chromatography. All six leucine tRNAs (Escherichia coli) and differences in tRNA populations synthesized during early and late stages of the dividing lymphocytes from normal human blood can be characterized by the anion-exchange chromatography. Different separation profiles are obtained by two separation systems for tyrosine tRNAs from mouse liver and mouse-plasma-cell tumor. The results indicate that, in contrast to the reversed-phase chromatography, strong-base-polystyrene anion-exchange chromatography is capable of separating tRNAs with minor structural differences.

  15. REACTIVITY OF ANIONS IN INTERSTELLAR MEDIA: DETECTABILITY AND APPLICATIONS

    Energy Technology Data Exchange (ETDEWEB)

    Senent, M. L. [Departamento de Quimica y Fisica Teoricas, Instituto de Estructura de la Materia, IEM-C.S.I.C., Serrano 121, Madrid E-28006 (Spain); Hochlaf, M., E-mail: senent@iem.cfmac.csic.es, E-mail: hochlaf@univ-mlv.fr [Laboratoire de Modelisation et Simulation Multi Echelle, Universite Paris-Est, MSME UMR 8208 CNRS, 5 boulevard Descartes, F-77454 Marne-la-Vallee (France)

    2013-05-01

    We propose a general rule to distinguish between detectable and undetectable astronomical anions. We believe that only few anions live long enough in the interstellar medium and thus can be detected. Our method is based on quantum mechanical calculations capable of describing accurately the evolution of electronic states during chemical processes. The still not fully understood reactivity at low temperatures is discussed considering non-adiabatic effects. The role of excited states has usually been neglected in previous works which basically focused on the ground electronic state for interpretations of experimental observations. Here, we deal with unsaturated carbon chains (e.g., C{sub n} H{sup -}), which show a high density of electronic states close to their corresponding ground electronic states, complex molecular dynamics, and non-adiabatic phenomena. Our general rule shows that it is not sufficient that anions exist in the gas phase (in the laboratory) to be present in media such as astrophysical media, since formation and decomposition reactions of these anions may allow the population of anionic electronic states to autodetach, forming neutrals. For C{sub n} H, reactivity depends strongly on n, where long and short chains behave differently. Formation of linear chains is relevant.

  16. Characteristics of resin floc dispersion of anion and cation exchange resin in precoat filter using powdered ion exchange resin

    Energy Technology Data Exchange (ETDEWEB)

    Adachi, Tetsurou (Nitto Denko Corp., Ibaraki, Osaka (Japan)); Sawa, Toshio; Shindoh, Toshikazu

    1989-09-01

    The filtration performance of mixed filter aid consisting of powdered anion and cation exchange resins used in the precoat filter is closely related to the characteristics of resin floc dispersion. The factors related to resin floc dispersion of anion and cation exchange resin were investigated by measuring the specific settle volume of resin floc as an evaluating index in addition to the measurement of physical, chemical and electrochemical properties of powdered ion exchange resin. The effect of adsorption of iron oxide and polymer electrolyte and of ion exchange were determined. In addition, considered floc dispersion with adsorbing iron oxide, it was assumed that the amount and filling ratio of resin floc were related to summation and multiplication of surface electric charge respectively. An experimental expression was obtained for simulation of the change of specific settle volume of resin floc by particle size, surface area, ion exchange capacity and degree of ionization of the powdered ion exchange resin. (author).

  17. Characteristics of resin floc dispersion of anion and cation exchange resin in precoat filter using powdered ion exchange resin

    International Nuclear Information System (INIS)

    Adachi, Tetsurou; Sawa, Toshio; Shindoh, Toshikazu.

    1989-01-01

    The filtration performance of mixed filter aid consisting of powdered anion and cation exchange resins used in the precoat filter is closely related to the characteristics of resin floc dispersion. The factors related to resin floc dispersion of anion and cation exchange resin were investigated by measuring the specific settle volume of resin floc as an evaluating index in addition to the measurement of physical, chemical and electrochemical properties of powdered ion exchange resin. The effect of adsorption of iron oxide and polymer electrolyte and of ion exchange were determined. In addition, considered floc dispersion with adsorbing iron oxide, it was assumed that the amount and filling ratio of resin floc were related to summation and multiplication of surface electric charge respectively. An experimental expression was obtained for simulation of the change of specific settle volume of resin floc by particle size, surface area, ion exchange capacity and degree of ionization of the powdered ion exchange resin. (author)

  18. Electrochemical solid-phase microextraction of anions and cations using polypyrrole coatings and an integrated three-electrode device.

    Science.gov (United States)

    Liljegren, Gustav; Pettersson, Jean; Markides, Karin E; Nyholm, Leif

    2002-05-01

    A method for the extraction, transfer and desorption of anions and cations under controlled potential conditions employing a new integrated three-electrode device is described. The device, containing working, reference and counter electrodes, was prepared from tubes that could be moved vertically with respect to each other. In this way, a small amount of solvent, held by capillary force, remained between the electrodes when the device was lifted out of a solution after an extraction. This design allowed the potential control to be maintained at all times. With the new integrated device, it was possible to perform potential controlled desorption into vials containing as little as 200 microl of solution. The required ion exchange capacity was obtained by electrodeposition of a polypyrrole coating on the surface of the glassy carbon working electrode. Solid-phase microextractions of several cations or anions were performed simultaneously under potentiostatic control by doping the polypyrrole coating with different anions such as perchlorate and p-toluenesulfonate. The efficiency of the extractions, which could be altered by varying the potential of the working electrode, could be increased by 150 to 200% compared to extractions using normal solid-phase microextraction conditions under open circuit conditions. A constant potential of +1.0 V and -0.5 V with respect to the silver pseudo reference electrode, was found to be well-suited for the extraction of samples containing ppm concentrations of anions (chloride, nitrite, bromide, nitrate, sulfate and phosphate) and cations (cadmium, cobalt and zinc), respectively.

  19. Evaluation of chitosan–anionic polymers based tablets for extended-release of highly water-soluble drugs

    Directory of Open Access Journals (Sweden)

    Yang Shao

    2015-02-01

    Full Text Available The objective of this study is to develop chitosan–anionic polymers based extended-release tablets and test the feasibility of using this system for the sustained release of highly water-soluble drugs with high drug loading. Here, the combination of sodium valproate (VPS and valproic acid (VPA were chosen as the model drugs. Anionic polymers studied include xanthan gum (XG, carrageenan (CG, sodium carboxymethyl cellulose (CMC-Na and sodium alginate (SA. The tablets were prepared by wet granulation method. In vitro drug release was carried out under simulated gastrointestinal condition. Drug release mechanism was studied. Compared with single polymers, chitosan–anionic polymers based system caused a further slowdown of drug release rate. Among them, CS–xanthan gum matrix system exhibited the best extended-release behavior and could extend drug release for up to 24 h. Differential scanning calorimetry (DSC and Fourier transform infrared spectroscopy (FTIR studies demonstrated that polyelectrolyte complexes (PECs were formed on the tablet surface, which played an important role on retarding erosion and swelling of the matrix in the later stage. In conclusion, this study demonstrated that it is possible to develop highly water-soluble drugs loaded extended-release tablets using chitosan–anionic polymers based system.

  20. Silver oxide nanocrystals anchored on titanate nanotubes and nanofibers: promising candidates for entrapment of radioactive iodine anions.

    Science.gov (United States)

    Yang, Dongjiang; Liu, Hongwei; Liu, Long; Sarina, Sarina; Zheng, Zhanfeng; Zhu, Huaiyong

    2013-11-21

    Iodine radioisotopes are released into the environment by the nuclear industry and medical research institutions using radioactive materials. The (129)I(-) anion is one of the more mobile radioactive species due to a long half-life, and it is a great challenge to design long-term management solutions for such radioactive waste. In this study, a new adsorbent structure with the potential to efficiently remove radioactive iodine anions (I(-)) from water is devised: silver oxide (Ag2O) nanocrystals firmly anchored on the surface of titanate nanotubes and nanofibers via coherent interfaces between Ag2O and titanate phases. I(-) anions in fluids can easily access the Ag2O nanocrystals and be efficiently trapped by forming AgI precipitate that firmly attaches to the adsorbent. Due to their one-dimensional morphology, the new adsorbents can be readily dispersed in liquids and easily separated after purification; and the adsorption beds loaded with the adsorbents can permit high flux. This significantly enhances the adsorption efficiency and reduces the separation costs. The proposed structure reveals a new direction in developing efficient adsorbents for the removal of radioactive anions from wastewater.

  1. An Anthracene-Based Tripodal Chemosensor for Anion Sensing

    Directory of Open Access Journals (Sweden)

    Whitney A. Quinn

    2010-05-01

    Full Text Available An anthracene-based tripodal ligand was synthesized from the condensation of tren with 9-anthraldehyde, and the subsequent reduction with sodium borohydride. The neutral ligand was protonated from the reaction with p-toluenesulfonic acid to give a triply charged chemosensor that was examined for its anion binding ability toward fluoride, chloride, bromide, sulfate and nitrate by the fluorescence spectroscopy in DMSO. The addition of an anion to the ligand resulted in an enhancement in fluorescence intensity at the excitation of 310 nm. Analysis of the spectral changes suggested that the ligand formed a 1:1 complex with each of the anions, showing strong affinity for fluoride and sulfate in DMSO. The unsubstituted tren was reacted with sulfuric acid to form a sulfate complex and the structure was determined by the X-ray crystallography. Analysis of the complex revealed that three sulfates are held between two ligands by multiple hydrogen bonding interactions with protonated amines.

  2. Copper(I) coordination compounds with closododecaborate anion

    International Nuclear Information System (INIS)

    Malinina, E.A.; Drozdova, V.V.; Mustyatsa, V.N.; Goeva, L.V.; Polyakova, I.N.; Votinova, N.A.; Zhizhin, K.Yu.; Kuznetsov, N.T.

    2006-01-01

    Cu(I) Complexes with closo-dodecaborate anion Cat[CuB 12 H 12 ], where Cat= Cs + , Ph 4 P + , Ph 4 As + , R x NH 4-x + (R=Me, Et, Pr, Bu, X=3-4) are synthesized. Synthesis of complexes was conducted in the copper(II) salt-salt of dodecaborate anion-sulfur dioxide (sodium sulfite) system. Structure of the complex [Cu 2 (NCCH 3 ) 4 B 12 H 12 ] assigned by X-ray structural analysis discloses that B 12 H 12 2- anion enters into the inner sphere of metal-complexing agent, and connection of closo-borate ligand with the metal is caused by the formation of three-centric metal-hydrogen-boron bonds [ru

  3. Cell wall bound anionic peroxidases from asparagus byproducts.

    Science.gov (United States)

    Jaramillo-Carmona, Sara; López, Sergio; Vazquez-Castilla, Sara; Jimenez-Araujo, Ana; Rodriguez-Arcos, Rocio; Guillen-Bejarano, Rafael

    2014-10-08

    Asparagus byproducts are a good source of cationic soluble peroxidases (CAP) useful for the bioremediation of phenol-contaminated wastewaters. In this study, cell wall bound peroxidases (POD) from the same byproducts have been purified and characterized. The covalent forms of POD represent >90% of the total cell wall bound POD. Isoelectric focusing showed that whereas the covalent fraction is constituted primarily by anionic isoenzymes, the ionic fraction is a mixture of anionic, neutral, and cationic isoenzymes. Covalently bound peroxidases were purified by means of ion exchange chromatography and affinity chromatography. In vitro detoxification studies showed that although CAP are more effective for the removal of 4-CP and 2,4-DCP, anionic asparagus peroxidase (AAP) is a better option for the removal of hydroxytyrosol (HT), the main phenol present in olive mill wastewaters.

  4. Reactivity of niobium cluster anions with nitrogen and carbon monoxide

    Science.gov (United States)

    Mwakapumba, Joseph; Ervin, Kent M.

    1997-02-01

    Reactions of small niobium cluster anions, Nbn-(n = 2-7), with CO and N2 are investigated using a flow tube reactor (flowing afterglow) apparatus. Carbon monoxide chemisorption on niobium cluster anions occurs with faster reaction rates than nitrogen chemisorption on corresponding cluster sizes. N2 addition to niobium cluster anions is much more size-selective than is CO addition. These general trends follow those reported in the literature for reactions of neutral and cationic niobium clusters with CO and N2. Extensive fragmentation of the clusters is observed upon chemisorption. A small fraction of the larger clusters survive and sequentially add multiple CO or N2 units without fragmentation. However, chemisorption saturation is not reached at the experimentally accessible pressure and reagent concentration ranges. The thermochemistry of the adsorption processes and the nature of the adsorbed species, molecular or dissociated, are discussed.

  5. Synthesis and anion binding properties of porphyrins and related compounds

    KAUST Repository

    Figueira, Flávio

    2016-12-02

    Over the last two decades the preparation of pyrrole-based receptors for anion recognition has attracted considerable attention. In this regard porphyrins, phthalocyanines and expanded porphyrins have been used as strong and selective receptors while the combination of those with different techniques and materials can boost their applicability in different applications as chemosensors and extracting systems. Improvements in the field, including the synthesis of this kind of compounds, can contribute to the development of efficient, cheap, and easy-to-prepare anion receptors. Extensive efforts have been made to improve the affinity and selectivity of these compounds and the continuous expansion of related research makes this chemistry even more promising. In this review, we summarize the most recent developments in anion binding studies while outlining the strategies that may be used to synthesize and functionalize these type of macrocycles. © 2016 World Scientific Publishing Company.

  6. Determination of arsenate in water by anion selective membrane electrode using polyurethane–silica gel fibrous anion exchanger composite

    Energy Technology Data Exchange (ETDEWEB)

    Khan, Asif Ali, E-mail: asifkhan42003@yahoo.com; Shaheen, Shakeeba, E-mail: shakeebashaheen@ymail.com

    2014-01-15

    Highlights: • PU–Si gel is new anion exchanger material synthesized and characterized. • This material used as anion exchange membrane is applied for electroanalytical studies. • The method for detection and determination of AsO{sub 4}{sup 3−} in traces amounts discussed. • The results are also verified from arsenic analyzer. -- Abstract: Polyurethane (PU)–silica (Si gel) based fibrous anion exchanger composites were prepared by solid–gel polymerization of polyurethane in the presence of different amounts of silica gel. The formation of PU–Si gel fibrous anion exchanger composite was characterized by Fourier transform infra-red spectroscopy (FTIR), X-ray diffraction (XRD), thermogravimetric analysis (TGA-DTA), scanning electron microscopy (SEM) and elemental analysis. The membrane having a composition of 5:3 (PU:Si gel) shows best results for water content, porosity, thickness and swelling. Our studies show that the present ion selective membrane electrode is selective for arsenic, having detection limit (1 × 10{sup −8} M to 1 × 10{sup −1} M), response time (45 s) and working pH range (5–8). The selectivity coefficient values for interfering ions indicate good selectivity for arsenate (AsO{sub 4}{sup 3−}) over interfering anions. The accuracy of the detection limit results was compared by PCA-Arsenomat.

  7. Anion effect on the retention of recoil atom of coordination crystalline compounds

    International Nuclear Information System (INIS)

    Dimotakis, P.N.; Papadopoulos, B.P.

    1980-01-01

    The anion effect of various cobaltic crystalline compounds - having the same cation and differing in anion -on the retention of neutron activated central cobalt atom has been studied. The cation was trans-dichloro(bis)ethylenediamine cobalt(III) and the anions were simple spherical anions (Cl - , Br - , I - ), planar anions (NO 3 - ), trigonal pyramidal anions (ClO 3 - , BrO 3 - ), tetrahedral anions (SO 4 2- , CrO 4 2- , MnO 4 - ) and linear anions (SCN - ). The cobalt-60 activity after reactor irradiation either in simple Co 2+ cation or in cobaltic complex cation determined the retention values. In all irradiations at ordinary temperature and at liquid nitrogen temperature the results showed an effect of the different anions, depending on the geometry, volume and charge, on the recombination of the recoil cobalt with the ligands in the coordination sphere. (author)

  8. Electrokinetic remediation of anionic contaminants from unsaturated soils

    International Nuclear Information System (INIS)

    Lindgren, E.R.; Kozak, M.W.; Mattson, E.D.

    1992-01-01

    Heavy-metal contamination of soil and groundwater is a widespread problem in the DOE weapons complex, and for the nation as a whole. Electrokinetic remediation is one possible technique for in situ removal of such contaminants from unsaturated soils. In previous studies at Sandia National Laboratories, the electromigration of chromate ions and anionic dye ions have been demonstrated. This paper reports on a series of experiments that were conducted to study the effect of moisture content on the electromigration rate of anionic contaminants in unsaturated soil and determine the limiting moisture content for which electromigration occurs

  9. A study of model systems in anionic exchange

    International Nuclear Information System (INIS)

    Haegele, R.; Boeyens, J.C.A.

    1977-01-01

    Preliminary experiments are reported on the preparation and characterization of anionic sulphate and chloride complexes of UO 2+ 2 and iron(III), benzyl-trimethylammonium cation being used as a model substance for the simulation of positive sites in an anionic-exchange resin. The structure of (BTMA) 4 [UO 2 CL 3 -O 2 -CL 3 UO 2 ], a binuclear uranyl-peroxocomplex that has not been reported in the literature, was elucidated by single-crystal x-ray examination, and is described and discussed [af

  10. Procedure for reducing hydrogen ion concentration in acidic anion eluate

    International Nuclear Information System (INIS)

    Parobek, P.; Baloun, S.; Plevac, S.

    1992-01-01

    A procedure is suggested for reducing the concentration of hydrogen ions in the acidic anionic eluate formed during the separation of uranium. The procedure involves anex elution, precipitation, filtration, precipitate rinsing, and anex rinsing. The procedure is included in the uranium elution process and requires at least one ion exchanger column and at least one tank in the continuous or discontinuous mode. Sparing the neutralizing agent by reducing the hydrogen ion concentration in the acidic anionic eluate is a major asset of this procedure. (Z.S.). 1 fig

  11. Derivatives of Dodecahalo-Closo-Dodecaborate Di-Anion

    OpenAIRE

    Avelar, Amy Cindy

    2009-01-01

    ABSTRACT OF THE DISSERTATIONDerivatives of the Dodecahalo-Closo-Dodecaborate Di-AnionbyAmy AvelarDoctor of Philosophy, Graduate Program in ChemistryUniversity of California, Riverside, December 2009Dr. Christopher A. Reed, ChairpersonThe di-anion, dodecahalo-closo-dodecaborate, B12X122-, where the X = Cl or Br, has been determined to be a useful weakly coordinating anion, WCA. Despite the di- negative charge, several elusive and reactive cationic species were stabilized with B12X122- as the c...

  12. Introducing various ligands into superhalogen anions reduces their electronic stabilities

    Science.gov (United States)

    Smuczyńska, Sylwia; Skurski, Piotr

    2008-02-01

    The vertical electron detachment energies (VDE) of six NaX2- anions (where X = F, Cl, Br) were calculated at the OVGF level with the 6-311++G(3df) basis sets. In all the cases studied the VDE exceeds the electron affinity of chlorine atom and thus those species were classified as superhalogen anions. The largest vertical binding energy was found for the NaF2- system (6.644 eV). The strong VDE dependence on the ligand type, ligand-central atom distance, and the character of the highest occupied molecular orbital (HOMO) was observed and discussed.

  13. Uranium extraction from sulfuric acid solution using anion exchange resin

    International Nuclear Information System (INIS)

    Sheta, M. E.; Abdel Aal, M. M.; Kandil, A. T.

    2012-12-01

    Uranium is currently recovered from sulfuric acid leach liquor using anion exchange resin as Amberlite IRA 402 (CT). This technology is based on fact that, uranium exists as anionic complexes. This takes place by controlling the pH of the solution, agitation time, temperature and resin to solution ratio (R/S). In this work, batch stirrer tank used for uranium extraction from sulfate medium and after extraction, elution process was done using 1M NaCl solution. After extraction and elution process, the resin was separated from the system and uranium was determined in the solution. (Author)

  14. Uranium isotopic effect studies on cation and anion exchange resins

    International Nuclear Information System (INIS)

    Sarpal, S.K.; Gupta, A.R.

    1975-01-01

    Uranium isotope effects in exchange reactions involving hexavalent and tetravalent uranium, on ion exchange resins, have been re-examined. The earlier work on uranium isotope effects in electron exchange reactions involving hexavalent and tetravalent uranium, has been critically reviewed. New experimental data on these systems in hydrochloric acid medium, has been obtained, using break-through technique on anion-exchange columns. The isotope effects in these break-through experiments have been reinterpreted in a way which is consistent with the anion exchange behaviour of the various uranium species in these systems. (author)

  15. Perchlorate adsorption and desorption on activated carbon and anion exchange resin.

    Science.gov (United States)

    Yoon, In-Ho; Meng, Xiaoguang; Wang, Chao; Kim, Kyoung-Woong; Bang, Sunbaek; Choe, Eunyoung; Lippincott, Lee

    2009-05-15

    The mechanisms of perchlorate adsorption on activated carbon (AC) and anion exchange resin (SR-7 resin) were investigated using Raman, FTIR, and zeta potential analyses. Batch adsorption and desorption results demonstrated that the adsorption of perchlorate by AC and SR-7 resin was reversible. The reversibility of perchlorate adsorption by the resin was also proved by column regeneration test. Solution pH significantly affected perchlorate adsorption and the zeta potential of AC, while it did not influence perchlorate adsorption and the zeta potential of resin. Zeta potential measurements showed that perchlorate was adsorbed on the negatively charged AC surface. Raman spectra indicated the adsorption resulted in an obvious position shift of the perchlorate peak, suggesting that perchlorate was associated with functional groups on AC at neutral pH through interactions stronger than electrostatic interaction. The adsorbed perchlorate on the resin exhibited a Raman peak at similar position as the aqueous perchlorate, indicating that perchlorate was adsorbed on the resin through electrostatic attraction between the anion and positively charged surface sites.

  16. The Influence of Salt Anions on Heavy Metal Ion Adsorption on the Example of Nickel

    Science.gov (United States)

    Mende, Mandy; Schwarz, Dana; Steinbach, Christine; Schwarz, Simona

    2018-01-01

    The biodegradable polysaccharide chitosan possesses protonated and natural amino groups at medium pH values and has therefore been used as an adsorbing material for nickel salts in water treatment. Nickel is a problematic heavy metal ion which can cause various diseases and disorders in living organisms. Here, we show the influence of oxyanions (e.g., nitrate and sulfate) to the adsorption of nickel ions. Hence, simultaneously we are addressing the increasing global problem of nitrate and sulfate ion pollution in groundwater and surface water. A series of adsorption experiments was carried out in order to determine (i) the adsorption equilibrium, (ii) the adsorption capacity in dependence on the initial nickel ion concentration, and (iii) the influence of the anion presented in solution for the adsorption capacity. Surface morphology of chitosan flakes before and after the adsorption process has been studied with SEM-EDX analysis. The chitosan flakes exhibited promising adsorption capacities of 81.9 mg·g−1 and 21.2 mg·g−1 for nickel (sulfate) and nickel (nitrate), respectively. The calculated values of Gibbs free energy change ΔG0 confirm the higher adsorption of nickel ions in presence of sulfate ions. Hence, higher anion valence leads to a higher adsorption capacity. PMID:29510485

  17. Removal of Reactive Anionic Dyes from Binary Solutions by Adsorption onto Quaternized Kenaf Core Fiber

    Directory of Open Access Journals (Sweden)

    Intidhar Jabir Idan

    2017-01-01

    Full Text Available The most challenging mission in wastewater treatment plants is the removal of anionic dyes, because they are water-soluble and produce very shining colours in the water. In this regard, kenaf core fiber (KCF was chemically modified by the quaternized agent (3-chloro-2-hydroxypropyltrimethylammonium chloride to increase surface area and change the surface properties in order to improve the removing reactive anionic dyes from binary aqueous solution. The influencing operating factors like dye concentration, pH, adsorbent dosage, and contact time were examined in a batch mode. The results indicate that the percentage of removal of Reactive Red-RB (RR-RB and Reactive Black-5 (RB-5 dyes from binary solution was increased with increasing dyes concentrations and the maximum percentage of removal reached up to 98.4% and 99.9% for RR-RB and RB-5, respectively. Studies on effect of pH showed that the adsorption was not significantly influenced by pH. The equilibrium analyses explain that, in spite of the extended Langmuir model failure to describe the data in the binary system, it is better than the Jain and Snoeyink model in describing the adsorption behavior of binary dyes onto QKCF. Also, the pseudo-second-order model was better to represent the adsorption kinetics for RR-RB and RB-5 dyes on QKCF.

  18. Equilibrium and Thermodynamic Studies of Anionic Dyes Removal by an Anionic Clay-Layered Double Hydroxide

    International Nuclear Information System (INIS)

    Kantasamy, N.; Siti Mariam Sumari

    2016-01-01

    Adsorption isotherm describes the interaction of adsorbates with adsorbent in equilibrium. Equilibrium data was examined using Langmuir and Freundlich isotherm models. Thermodynamic studies were used to evaluate the thermodynamic parameters; heat of enthalpy change (ΔH degree), Gibbs free energy change (ΔG degree) and heat of entropy change (ΔSdegree) in order to gain information regarding the nature of adsorption (exothermic or endothermic). Four reactive dyes of anionic type, Acid Blue 29 (AB29), Reactive Black 5 (RB5), Reactive Orange 16 (RO16) and Reactive Red 120 (RR120) were used to obtain equilibrium isotherms at 25, 35, 45 and 55 degree Celsius. Based on Giles' classification, the isotherm produced were of L2-type, indicating strong dye affinity towards the adsorbent, and with weak competition with the solvent molecules for active adsorption sites. Equilibrium data fitted both Langmuir and Freundlich isotherm models with high correlation coefficient (R"2 > 0.91) indicating the possibility of both homogeneity and heterogeneous nature of adsorption. The negative values of ΔGdegree indicate the adsorption processes were spontaneous and feasible. The negative values of ΔHdegree lie between -20 to -75 kJ/ mol, suggesting these processes were exothermic and physical in nature. The negative values of ΔSdegree are indication of decreased disorder and randomness of spontaneous adsorption of reactive dyes on layered double hydroxide as adsorbent. (author)

  19. Fine tuning the ionic liquid-vacuum outer atomic surface using ion mixtures.

    Science.gov (United States)

    Villar-Garcia, Ignacio J; Fearn, Sarah; Ismail, Nur L; McIntosh, Alastair J S; Lovelock, Kevin R J

    2015-03-28

    Ionic liquid-vacuum outer atomic surfaces can be created that are remarkably different from the bulk composition. In this communication we demonstrate, using low-energy ion scattering (LEIS), that for ionic liquid mixtures the outer atomic surface shows significantly more atoms from anions with weaker cation-anion interactions (and vice versa).

  20. Femtosecond photoelectron spectroscopy: a new tool for the study of anion dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Greenblatt, Benjamin J. [Univ. of California, Berkeley, CA (United States)

    1999-02-01

    A new experimental technique for the time-resolved study of anion reactions is presented. Using femtosecond laser pulses, which provide extremely fast (~100 fs) time resolution, in conjunction with photoelectron spectroscopy, which reveals differences between anion and neutral potential energy surfaces, a complex anion reaction can be followed from its inception through the formation of asymptotic products. Experimental data can be modeled quantitatively using established theoretical approaches, allowing for the refinement of potential energy surfaces as well as dynamical models. After a brief overview, a detailed account of the construction of the experimental apparatus is presented. Documentation of the data acquisition program is contained in the Appendix. The first experimental demonstration of the technique is then presented for I2- photodissociation, modeled using a simulation program which is also detailed in the Appendix. The investigation of I2- photodissociation in several size-selected I2-(Ar)n (n = 6-20) and I2-(CO2)n (n = 4-16) clusters forms the heart of the dissertation. In a series of chapters, the numerous effects of solvation on this fundamental bond-breaking reaction are explored, the most notable of which is the recombination of I2- on the ground $\\tilde{X}$(2Σu+) state in sufficiently large clusters. Recombination and trapping of I2- on the excited $\\tilde{A}$(2π3/2,g) state is also observed in both types of clusters. The studies have revealed electronic state transitions, the first step in recombination, on a ~500 fs to ~10 ps timescale. Accompanying the changes in electronic state is solvent reorganization, which occurs on a similar timescale. Over longer periods (~1 ps to >200 ps), energy is transferred from vibrationally

  1. Role of sulfate, chloride, and nitrate anions on the degradation of fluoroquinolone antibiotics by photoelectro-Fenton.

    Science.gov (United States)

    Villegas-Guzman, Paola; Hofer, Florian; Silva-Agredo, Javier; Torres-Palma, Ricardo A

    2017-12-01

    Taking ciprofloxacin (CIP) as a fluoroquinolone antibiotic model, this work explores the role of common anions (sulfate, nitrate, and chloride) during the application of photoelectro-Fenton (PEF) at natural pH to degrade this type of compound in water. The system was composed of an IrO 2 anode, Ti, or gas diffusion electrode (GDE) as cathode, Fe 2+ , and UV (254 nm). To determine the implications of these anions, the degradation pathway and efficiency of the PEF sub-processes (UV photolysis, anodic oxidation, and electro-Fenton at natural pH) were studied in the individual presence of the anions. The results highlight that degradation routes and kinetics are strongly dependent on electrolytes. When chloride and nitrate ions were present, indirect electro-chemical oxidation was identified by electro-generated HOCl and nitrogenated oxidative species, respectively. Additionally, direct photolysis and direct oxidation at the anode surface were identified as degradation routes. As a consequence of the different pathways, six primary CIP by-products were identified. Therefore, a scheme was proposed representing the pathways involved in the degradation of CIP when submitted to PEF in water with chloride, nitrate, and sulfate ions, showing the complexity of this process. Promoted by individual and synergistic actions of this process, the PEF system leads to a complete elimination of CIP with total removal of antibiotic activity against Staphylococcus aureus and Escherichia coli, and significant mineralization. Finally, the role of the anions was tested in seawater containing CIP, in which the positive contributions of the anions were partially suppressed by its OH radical scavenger action. The findings are of interest for the understanding of the degradation of antibiotics via the PEF process in different matrices containing sulfate, nitrate, and chloride ions.

  2. Effect of the pore water composition on the diffusive anion transport in argillaceous, low permeability sedimentary rocks.

    Science.gov (United States)

    Wigger, Cornelia; Van Loon, Luc R

    2018-06-01

    The effect of the pore water composition on the diffusive anion transport was studied for two different argillaceous, low permeability sedimentary rocks, Opalinus Clay (OPA) and Helvetic Marl (HM). The samples were saturated with different solutions with varying molar concentration and different main cations in the solution: NaCl based pore solutions and CaCl 2 based pore solutions. The total porosity was measured by through-diffusion experiments with the neutral tracer HTO. Experiments performed in NaCl solutions resulted in a porosity of 0.12 for OPA and 0.03 for HM, and are consistent with results of the experiments in CaCl 2 solutions. The total porosity was independent of the molar concentration, in contrast to the measured anion porosity, which increased with increasing molar concentration. It could further be observed that the pore solution based on the bivalent cation calcium shielded the negative surface charge stronger than the monovalent cation sodium, resulting in a larger measureable anion-accessible porosity in the case of CaCl 2 solutions. The data was modelled based on an adapted Donnan approach of Birgersson and Karnland (2009). The model had to be adjusted with a permanent free, uncharged porosity, as well as with structural information on the permanent anion exclusion because of so-called bottleneck pores. Both parameters can only be evaluated from experiments. Nevertheless, taking these two adaptions into account, the effect of varying pore water compositions on the anion-accessible porosity of the investigated argillaceous rocks could be satisfactorily described. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. Effect of the pore water composition on the diffusive anion transport in argillaceous, low permeability sedimentary rocks

    Science.gov (United States)

    Wigger, Cornelia; Van Loon, Luc R.

    2018-06-01

    The effect of the pore water composition on the diffusive anion transport was studied for two different argillaceous, low permeability sedimentary rocks, Opalinus Clay (OPA) and Helvetic Marl (HM). The samples were saturated with different solutions with varying molar concentration and different main cations in the solution: NaCl based pore solutions and CaCl2 based pore solutions. The total porosity was measured by through-diffusion experiments with the neutral tracer HTO. Experiments performed in NaCl solutions resulted in a porosity of 0.12 for OPA and 0.03 for HM, and are consistent with results of the experiments in CaCl2 solutions. The total porosity was independent of the molar concentration, in contrast to the measured anion porosity, which increased with increasing molar concentration. It could further be observed that the pore solution based on the bivalent cation calcium shielded the negative surface charge stronger than the monovalent cation sodium, resulting in a larger measureable anion-accessible porosity in the case of CaCl2 solutions. The data was modelled based on an adapted Donnan approach of Birgersson and Karnland (2009). The model had to be adjusted with a permanent free, uncharged porosity, as well as with structural information on the permanent anion exclusion because of so-called bottleneck pores. Both parameters can only be evaluated from experiments. Nevertheless, taking these two adaptions into account, the effect of varying pore water compositions on the anion-accessible porosity of the investigated argillaceous rocks could be satisfactorily described.

  4. Influence of processes of structure formation in mixed solvent and anion nature on cadmium ions discharge kinetics from water-dimethylformamide electrolyte

    International Nuclear Information System (INIS)

    Kuznetsov, V.V.; Bozhenko, L.G.; Kucherenko, S.S.; Fedorova, O.V.

    1986-01-01

    Electrochemical reaction of cadmium ion discharge in water-dimethylformamide (DMF) solutions is studied. The influence of DMF concentration in the presence of different anions (ClO 4 - , F - , I - ) on both reaction kinetics and mechanism is discussed on the basis of structural transformations in the mixed solvent and near the surface electrode processes

  5. Anion-based approaches to tunable functionality in oxide heterostructures

    Science.gov (United States)

    May, Steven

    2014-03-01

    The ability to control the position and composition of the anion site is emerging as a promising route to tune properties in epitaxial perovskites. This talk will focus on recent and ongoing efforts aimed at developing anion-based approaches to tailor electronic and magnetic properties in oxide films. First, I will discuss how the position of the oxygen anions can be tailored to stabilize non-bulk-like bond angles and lengths, thereby altering electronic bandwidth. Recent work on La2/3Sr1/3MnO3 will be presented in which ultrathin films under the same strain state exhibit dramatically different electronic and magnetic properties when grown on substrates with different symmetries. In the second half of the talk, I will describe efforts focused on altering the composition of the anion site. In La1/3Sr2/3FeO3-δ films, a reversible change in oxygen content leads to dramatic changes in electrical, optical, and structural properties. Finally, the synthesis of oxyfluoride ferrite and nickelate perovskite films via topotactic reactions carried out following thin film deposition will be described. This work is supported by the Office of Naval Research (N00014-11-1-0664) and the U. S. Army Research Office (W911NF-12-1-0132).

  6. Anionic construction of the SLq,s(2) algebra

    International Nuclear Information System (INIS)

    Matheus-Valle, J.L.; Monteiro, M.R.

    1993-01-01

    Considering anionic oscillators in a two-dimensional lattice, the quantum semi-group sl (q,s ) (2) is realized by means of a generalized Schwinger construction. It is found that the parameter q of the algebra is connected to the statistical parameter, whereas the s parameter is related to a s-deformed oscillator introduced at each point of the lattice. (author)

  7. Effect of biocides and anionic homopolymeric inhibitors on the ...

    African Journals Online (AJOL)

    This paper describes the effect of biocides and of the anionic homopolymeric inhibitors on the precipitation behavior of calcium fluoride (CaF2).The efficiency of inhibitors in the presence and absence of biocides was calculated using the half-life (t1/2) approach, where 50% of the concentration has been precipitated.

  8. Adsorption and intercalation of anionic surfactants onto layered ...

    Indian Academy of Sciences (India)

    Unknown

    Department of Polymer Technology, Kamaraj College of Engineering and Technology, Virudhunagar 626 ... Layered double hydroxides (LDH) with brucite like structure was modified with various anionic ... Recently the application of layered double hydroxides ..... Yuan Q, Wei M, Wang Z and Duan X 2004 Clays Clay Miner.

  9. Contribution of attendant anions on cadmium toxicity to soil enzymes.

    Science.gov (United States)

    Tian, Haixia; Kong, Long; Megharaj, Mallavarapu; He, Wenxiang

    2017-11-01

    Sorption and desorption are critical processes to control the mobility and biotoxicity of cadmium (Cd) in soils. It is known that attendant anion species of heavy metals could affect metal adsorption on soils and might further alter their biotoxicity. However, for Cd, the influence of attendant anions on its sorption in soils and subsequent toxicity on soil enzymes are still unknown. In this work, four Cd compounds with different salt anions (SO 4 2- , NO 3 - , Cl - , and Ac - ) were selected to investigate their impact of on the sorption, soil dehydrogenase activity (DHA) and alkaline phosphatase activity (ALP). Thus, a series of simulated Cd pollution batch experiments including measuring adsorption-desorption behavior of Cd on soils and soil enzyme activities were carried out. Results showed that CdSO 4 exhibited highest sorption capacity among the tested soils except in Hunan soil. The Cd sorption with NO 3 - displayed a similar behavior with Cl - on all tested soils. Compared with soil properties, all four kinds of anions on Cd sorption played a more significant role affecting Cd ecological toxicity to soil DHA and ALP. Cd in acetate or nitrate form appears more sensitive towards DHA than sulphate and chloride, while the later pair is more toxic towards ALP than the former. These results have important implications for evaluation of Cd contamination using soil enzyme as bioindicator. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Efficiency of superoxide anions in the inactivation of selected dehydrogenases

    International Nuclear Information System (INIS)

    Rodacka, Aleksandra; Serafin, Eligiusz; Puchala, Mieczyslaw

    2010-01-01

    The most ubiquitous of the primary reactive oxygen species, formed in all aerobes, is the superoxide free radical. It is believed that the superoxide anion radical shows low reactivity and in oxidative stress it is regarded mainly as an initiator of more reactive species such as · OH and ONOO - . In this paper, the effectiveness of inactivation of selected enzymes by radiation-generated superoxide radicals in comparison with the effectiveness of the other products of water radiolysis is examined. We investigate three enzymes: glyceraldehyde-3-phosphate dehydrogenase (GAPDH), alcohol dehydrogenase (ADH) and lactate dehydrogenase (LDH). We show that the direct contribution of the superoxide anion radical to GAPDH and ADH inactivation is significant. The effectiveness of the superoxide anion in the inactivation of GAPDH and ADG was only 2.4 and 2.8 times smaller, respectively, in comparison with hydroxyl radical. LDH was practically not inactivated by the superoxide anion. Despite the fact that the studied dehydrogenases belong to the same class of enzymes (oxidoreductases), all have a similar molecular weight and are tetramers, their susceptibility to free-radical damage varies. The differences in the radiosensitivity of the enzymes are not determined by the basic structural parameters analyzed. A significant role in inactivation susceptibility is played by the type of amino acid residues and their localization within enzyme molecules.

  11. Efficiency of superoxide anions in the inactivation of selected dehydrogenases

    Energy Technology Data Exchange (ETDEWEB)

    Rodacka, Aleksandra, E-mail: olakow@biol.uni.lodz.p [Department of Molecular Biophysics, University of Lodz, Banacha 12/16, 90-237 Lodz (Poland); Serafin, Eligiusz, E-mail: serafin@biol.uni.lodz.p [Laboratory of Computer and Analytical Techniques, University of Lodz, Banacha 12/16, 90-237 Lodz (Poland); Puchala, Mieczyslaw, E-mail: puchala@biol.uni.lodz.p [Department of Molecular Biophysics, University of Lodz, Banacha 12/16, 90-237 Lodz (Poland)

    2010-09-15

    The most ubiquitous of the primary reactive oxygen species, formed in all aerobes, is the superoxide free radical. It is believed that the superoxide anion radical shows low reactivity and in oxidative stress it is regarded mainly as an initiator of more reactive species such as {sup {center_dot}}OH and ONOO{sup -}. In this paper, the effectiveness of inactivation of selected enzymes by radiation-generated superoxide radicals in comparison with the effectiveness of the other products of water radiolysis is examined. We investigate three enzymes: glyceraldehyde-3-phosphate dehydrogenase (GAPDH), alcohol dehydrogenase (ADH) and lactate dehydrogenase (LDH). We show that the direct contribution of the superoxide anion radical to GAPDH and ADH inactivation is significant. The effectiveness of the superoxide anion in the inactivation of GAPDH and ADG was only 2.4 and 2.8 times smaller, respectively, in comparison with hydroxyl radical. LDH was practically not inactivated by the superoxide anion. Despite the fact that the studied dehydrogenases belong to the same class of enzymes (oxidoreductases), all have a similar molecular weight and are tetramers, their susceptibility to free-radical damage varies. The differences in the radiosensitivity of the enzymes are not determined by the basic structural parameters analyzed. A significant role in inactivation susceptibility is played by the type of amino acid residues and their localization within enzyme molecules.

  12. based anion exchange membrane for alkaline polymer electrolyte

    Indian Academy of Sciences (India)

    Administrator

    Abstract. Hydroxyl ion (OH–) conducting anion exchange membranes based on modified poly (phenylene oxide) are fabricated for their application in alkaline polymer electrolyte fuel cells (APEFCs). In the present study, chloromethylation of poly(phenylene oxide) (PPO) is performed by aryl substitution rather than benzyl.

  13. Anion-exchange membranes in electrochemical energy systems

    NARCIS (Netherlands)

    Varcoe, J.R.; Atanassov, P.; Dekel, D.R.; Herring, A.M.; Hickner, M.A.; Kohl, P.A.; Kucernak, A. R.; Mustain, W.E.; Nijmeijer, K.; Scott, Keith; Xu, Tongwen; Zhuang, Lin

    2014-01-01

    This article provides an up-to-date perspective on the use of anion-exchange membranes in fuel cells, electrolysers, redox flow batteries, reverse electrodialysis cells, and bioelectrochemical systems (e.g. microbial fuel cells). The aim is to highlight key concepts, misconceptions, the current

  14. Anion complexation by calix[4]arene–TTF conjugates

    Czech Academy of Sciences Publication Activity Database

    Flídrová, K.; Tkadlecová, M.; Lang, Kamil; Lhoták, P.

    2012-01-01

    Roč. 92, č. 1 (2012), s. 668-673 ISSN 0143-7208 R&D Projects: GA ČR GA203/09/0691 Institutional research plan: CEZ:AV0Z40320502 Keywords : calix[4]arene * tetrathiafulvalene * anion recognition * receptor * NMR titration * UV/vis spectroscopy Subject RIV: CA - Inorganic Chemistry Impact factor: 3.532, year: 2012

  15. Novel Biscalix[4]arene-based Anion Receptors

    Czech Academy of Sciences Publication Activity Database

    Šťastný, V.; Lhoták, P.; Michlová, V.; Stibor, I.; Sýkora, Jan

    2002-01-01

    Roč. 58, č. 36 (2002), s. 7207-7211 ISSN 0040-4020 R&D Projects: GA ČR GA104/00/1722; GA ČR GA203/00/1011 Keywords : calixarenes * anion receptors * NMR titration Subject RIV: CI - Industrial Chemistry, Chemical Engineering Impact factor: 2.420, year: 2002

  16. Physicochemical treatments of anionic surfactants wastewater: Effect on aerobic biodegradability.

    Science.gov (United States)

    Aloui, Fathi; Kchaou, Sonia; Sayadi, Sami

    2009-05-15

    The effect of different physicochemical treatments on the aerobic biodegradability of an industrial wastewater resulting from a cosmetic industry has been investigated. This industrial wastewater contains 11423 and 3148mgL(-1) of chemical oxygen demand (COD) and anionic surfactants, respectively. The concentration of COD and anionic surfactants were followed throughout the diverse physicochemical treatments and biodegradation experiments. Different pretreatments of this industrial wastewater using chemical flocculation process with lime and aluminium sulphate (alum), and also advanced oxidation process (electro-coagulation (Fe and Al) and electro-Fenton) led to important COD and anionic surfactants removals. The best results were obtained using electro-Fenton process, exceeding 98 and 80% of anionic surfactants and COD removals, respectively. The biological treatment by an isolated strain Citrobacter braakii of the surfactant wastewater, as well as the pretreated wastewater by the various physicochemical processes used in this study showed that the best results were obtained with electro-Fenton pretreated wastewater. The characterization of the treated surfactant wastewater by the integrated process (electro-coagulation or electro-Fenton)-biological showed that it respects Tunisian discharge standards.

  17. The effect of membrane diffusion potential change on anionic drugs ...

    African Journals Online (AJOL)

    The effect of membrane potential change on anionic drugs Indomethacin and barbitone induced human erythrocyte shape change and red cell uptake of drug has been studied using microscopy and spectrophotometry techniques respectively. The membrane potential was changed by reducing the extracellular chloride ...

  18. The alkylation of imine anions formation of enamines

    NARCIS (Netherlands)

    Heiszwolf, G.J.; Kloosterziel, H.

    1970-01-01

    The ambident anions derived from imines were alkylated using a variety of solvents and alkylating agents. Under reactive conditions enamines (N-alkylation) are formed as the main products instead of the usually obsd. homologous imines (C-alkylation). The influence of the type of imine, solvent, and

  19. Alkylation of enolate anions formation of enol ethers

    NARCIS (Netherlands)

    Heiszwolf, G.J.; Kloosterziel, H.

    1970-01-01

    The alkylation of ambident enolate anions-obtained from aliphatic ketones (and one particular type of aldehyde)-was studied using various solvents, bases, alkylating agents and substrates. Alkylation with a reactive alkylating agent (dialkyl sulfates, triethyloxonium fluoroborate) in an aprotic

  20. Synthesis of Terpyridine-Terminated Polymers by Anionic Polymerization

    NARCIS (Netherlands)

    Guerrero-Sanchez, C.A.; Lohmeijer, B.G.G.; Meier, M.A.R.; Schubert, U.S.

    2005-01-01

    The synthesis of terpyridine-functionalized polystyrene was achieved by reacting 4‘-chloro-2,2‘:6‘,2‘ ‘-terpyridine (terminating agent) with "living" polymeric carbanions synthesized by anionic polymerization. The obtained polymers were characterized by gel permeation chromatography, nuclear

  1. Anionic Redox Chemistry in Polysulfide Electrode Materials for Rechargeable Batteries.

    Science.gov (United States)

    Grayfer, Ekaterina D; Pazhetnov, Egor M; Kozlova, Mariia N; Artemkina, Sofya B; Fedorov, Vladimir E

    2017-12-22

    Classical Li-ion battery technology is based on the insertion of lithium ions into cathode materials involving metal (cationic) redox reactions. However, this vision is now being reconsidered, as many new-generation electrode materials with enhanced reversible capacities operate through combined cationic and anionic (non-metal) reversible redox processes or even exclusively through anionic redox transformations. Anionic participation in the redox reactions is observed in materials with more pronounced covalency, which is less typical for oxides, but quite common for phosphides or chalcogenides. In this Concept, we would like to draw the reader's attention to this new idea, especially, as it applies to transition-metal polychalcogenides, such as FeS 2 , VS 4 , TiS 3 , NbS 3 , TiS 4 , MoS 3 , etc., in which the key role is played by the (S-S) 2- /2 S 2- redox reaction. The exploration and better understanding of the anion-driven chemistry is important for designing advanced materials for battery and other energy-related applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. The Determination of Anionic Surfactants in Natural and Waste Waters.

    Science.gov (United States)

    Crisp, P. T.; And Others

    1983-01-01

    Background information, procedures, and results of an experiment suitable for measuring subpart per million concentrations of anionic surfactants in natural waters and waste effluents are provided. The experiment required only a spectrophotometer or filter photometer and has been successfully performed by students in an undergraduate environmental…

  3. Rejuvenation processes applied to 'poisoned' anion exchangers in uranium processing

    International Nuclear Information System (INIS)

    Gilmore, A.J.

    1979-11-01

    The removal of 'poisons' from anion exchangers in uranium processing of Canadian radioactive ores is commonly called rejuvenation or regeneration. The cost of the ion exchange recovery of uranium is adversely affected by a decrease in the capacity and efficiency of the anion exchangers, due to their being 'poisoned' by silica, elemental sulphur, molybdenum and tetrathionates. These 'poisons' have a high affinity for the anion exchangers, are adsorbed in preference to the uranyl complex, and do not desorb with the reagents used normally in the uranyl desorption phase. The frequency of rejuvenation and the reagents required for rejuvenation are determined by the severity of the 'poisoning' accumulated by the exchanger in contact with the uranium leach liquor. Caustic soda (NaOH) at approximately equal to 18 cents/lb is commonly used to remove uranium anion exchangers of tetrathionate ((S 4 0 6 )/-/-) 'poisons'. A potential saving in operating cost would be of consequence if other reagents, e.g. sodium carbonate (Na 2 CO 3 ) at approximately equal to 3.6 cents/lb or calcium hydroxide (Ca(OH) 2 ) at approximately equal to 1.9 cents/lb, were effective in removing (S 4 0 6 )/-/-) from a 'poisoned' exchanger. A rejuvenation process for a test program was adopted after a perusal of the literature

  4. Adsorption and intercalation of anionic surfactants onto layered ...

    Indian Academy of Sciences (India)

    Layered double hydroxides (LDH) with brucite like structure was modified with various anionic surfactants containing sulfonate, carboxyl, phosphonate and sulfate end group through ion-exchange method. XRD reports indicated that the sulfonate group containing surfactants led to an adsorption process whereas the sulfate ...

  5. Evaluation of indigenous anion exchange resins for plutonium purification

    International Nuclear Information System (INIS)

    Kumaresan, R.; Sabharwal, K.N.; Srinivasan, T.G.; Vasudeva Rao, P.R.; Thite, B.S.; Ajithlal, R.T.; Sinalkar, Nitin; Dharampurikar, G.R.; Janardhanan, C.; Michael, K.M.; Vijayan, K.; Jambunathan, U.; Dey, P.K.

    2004-01-01

    Preliminary data with pure plutonium nitrate solution indicate that indigenous anion exchange resin can be used for the purification and concentration of plutonium. However, further studies are required to be conducted on larger scale with actual plant feed solutions before arriving to final conclusions. This includes repeated loading and elution cycles studies with the same bed and evaluation of the performance after each cycle

  6. Materials chemistry approach to anion-sensor design

    Czech Academy of Sciences Publication Activity Database

    Anzenbacher Jr., P.; Jursiková, K.; Aldakov, D.; Marquez, M.; Pohl, Radek

    2004-01-01

    Roč. 60, č. 49 (2004), s. 11163-11168 ISSN 0040-4020 Institutional research plan: CEZ:AV0Z4055905 Keywords : conductive polymer * anion sensing * polythiophene Subject RIV: CC - Organic Chemistry Impact factor: 2.643, year: 2004

  7. Mitochondrial respiration scavenges extramitochondrial superoxide anion via a nonenzymatic mechanism.

    OpenAIRE

    Guidot, D M; Repine, J E; Kitlowski, A D; Flores, S C; Nelson, S K; Wright, R M; McCord, J M

    1995-01-01

    We determined that mitochondrial respiration reduced cytosolic oxidant stress in vivo and scavenged extramitochondrial superoxide anion (O2-.) in vitro. First, Saccharomyces cerevisiae deficient in both the cytosolic antioxidant cupro-zinc superoxide dismutase (Cu,Zn-SOD) and electron transport (Rho0 state) grew poorly (P 0.05) in all yeast. Seco...

  8. Preparation of Acrylamide-based Anionic Polyelectrolytes for Soil Establishment

    Directory of Open Access Journals (Sweden)

    Ahmad Rabiee

    2012-12-01

    Full Text Available Synthetic water soluble acrylamide-based polymers have wide range of ap-plications  in  the  feld  of  soil  establishment  and  non-desertifcation.  In  this research, the acrylamide-based anionic polyelectrolytes were prepared by  solution polymerization. The polymerization was carried out using AIBN as a radical initiator and at different degrees of anionic charges ranging between 10% and 30% using sodium hydroxide as hydrolyzing agents. The chemical structure of the  synthetic polymers was studied and confrmed by FTIR technique. The charge density on polymer backbone was determined by titration method. The rheological behavior of polymer solutions was evaluated by Brookfeld viscometer. The results show that the viscosity decreases with increasing the shear rate of solutions. Molecular weights of samples were measured by laser light scattering analyzer. The morphology of the polymer was studied by SEM and the EDX was used for elemental analysis determination. The anionic polymers with 10-30% negative charges were mixed with clay in order to evaluate the soil establishment. The results show that an anionic polyelectro-lyte can make soil particles more cohesive and improve soil physical properties.

  9. Spectral modulation through controlling anions in nanocaged phosphors

    NARCIS (Netherlands)

    Bian, H.; Liu, Y.; Yan, D.; Zhu, H.; Liu, C.; Xu, C.S.; Liu, Y.; Zhang, H.; Wang, X.

    2013-01-01

    A new approach has been proposed and validated to modulate the emission spectra of europium-doped 12CaO center dot 7Al(2)O(3) phosphors by tuning the nonradiative and radiative transition rates, realized by controlling the sort and amount of the encaged anions. A single wavelength at 255 nm can

  10. Nickel group cluster anion reactions with carbon monoxide: Rate coefficients and chemisorption efficiency

    Science.gov (United States)

    Hintz, Paul A.; Ervin, Kent M.

    1994-04-01

    Reactions of Ni-n(n=3-10), Pd-n(n=3-8), and Pt-n(n=3-7) with CO are studied in a flow tube reactor. Bimolecular rate coefficients are measured for the association reaction of CO adsorbing on the cluster surface. The rate coefficients range from about 10% of the collision rate for the trimer anions to near the collision rate for clusters larger than four atoms. The maximum number of CO molecules that bind to each cluster is determined. Whereas the saturation limits for nickel are typical for an 18 electron transition metal, the limits for platinum are lower, reflecting the electron deficient structures observed in condensed phase chemistry. The CO saturated palladium clusters represent the first examples of saturated binary palladium carbonyl compounds. Comparisons are made to similar studies on metal cation and neutral clusters and also to surface scattering studies of nickel group metals.

  11. Monohydrocalcite: a promising remediation material for hazardous anions

    Energy Technology Data Exchange (ETDEWEB)

    Fukushi, Keisuke [Institute of Nature and Environmental Technology, Kanazawa University, Kakuma-machi, Kanazawa, Ishikawa 920-1192 (Japan); Munemoto, Takashi [Graduate School of Science, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan); Sakai, Minoru [Department of Earth and Planetary Sciences, Faculty of Science, Kanazawa University, Kakuma-machi, Kanazawa, Ishikawa 920-1192 (Japan); Yagi, Shintaro [Graduate School of Natural Science and Technology, Kanazawa University, Kakuma-machi, Kanazawa, Ishikawa 920-1192 (Japan)

    2011-12-15

    The formation conditions, solubility and stability of monohydrocalcite (MHC, CaCO{sub 3}{center_dot}H{sub 2}O), as well as sorption behaviors of toxic anions on MHC, are reviewed to evaluate MHC as a remediation material for hazardous oxyanions. MHC is a rare mineral in geological settings that occurs in recent sediments in saline lakes. Water temperature does not seem to be an important factor for MHC formation. The pH of lake water is usually higher than 8 and the Mg/Ca ratio exceeds 4. MHC synthesis experiments as a function of time indicate that MHC is formed from amorphous calcium carbonate and transforms to calcite and/or aragonite. Most studies show that MHC forms from solutions containing Mg, which inhibits the formation of stable calcium carbonates. The solubility of MHC is higher than those of calcite, aragonite and vaterite, but lower than those of ikaite and amorphous calcium carbonate at ambient temperature. The solubility of MHC decreases with temperature. MHC is unstable and readily transforms to calcite or aragonite. The transformation consists of the dissolution of MHC and the subsequent formation of stable phases from the solution. The rate-limiting steps of the transformation of MHC are the nucleation and growth of stable crystalline phases. Natural occurrences indicate that certain additives, particularly PO{sub 4} and Mg, stabilize MHC. Laboratory studies confirm that a small amount of PO{sub 4} in solution (>30 {mu}M) can significantly inhibit the transformation of MHC. MHC has a higher sorption capacity for PO{sub 4} than calcite and aragonite. The modes of PO{sub 4} uptake are adsorption on the MHC surface at moderate phosphate concentrations and precipitation of secondary calcium phosphate minerals at higher concentrations. Arsenate is most likely removed from the solution during the transformation of MHC. The proposed sorption mechanism of arsenate is coprecipitation during crystallization of aragonite. The arsenic sorption capacity by MHC

  12. Separation of anionic oligosaccharides by high-performance liquid chromatography

    International Nuclear Information System (INIS)

    Green, E.D.; Baenziger, J.U.

    1986-01-01

    The authors have developed methods for rapid fractionation of anionic oligosaccharides containing sulfate and/or sialic acid moieties by high-performance liquid chromatography (HPLC). Ion-exchange HPLC on amine-bearing columns (Micropak AX-10 and AX-5) at pH 4.0 is utilized to separate anionic oligosaccharides bearing zero, one, two, three, or four charges, independent of the identity of the anionic moieties (sulfate and/or sialic acid). Ion-exchange HPLC at pH 1.7 allows separation of neutral, mono-, di-, and tetrasialylated, monosulfated, and disulfated oligosaccharides. Oligosaccharides containing three sialic acid residues and those bearing one each of sulfate and sialic acid, however, coelute at pH 1.7. Since the latter two oligosaccharide species separate at pH 4.0, analysis at pH 4.0 followed by analysis at pH 1.7 can be utilized to completely fractionate complex mixtures of sulfated and sialylated oligosaccharides. Ion-suppression amine adsorption HPLC has previously been shown to separate anionic oligosaccharides on the basis of net carbohydrate content (size). In this study they demonstrate the utility of ion-suppression amine adsorption HPLC for resolving sialylated oligosaccharide isomers which differ only in the linkages of sialic acid residues (α2,3 vs α2,6) and/or location of α2,3- and α2,6-linked sialic acid moieties on the peripheral branches of oligosaccharides. These two methods can be used in tandem to separate oligosaccharides, both analytically and preparatively, based on their number, types, and linkages of anionic moieties

  13. The effects of anionic and cationic surfactants on the ion flotation of Cd2+

    International Nuclear Information System (INIS)

    Kobayashi, Koichi

    1975-01-01

    The ion flotation of Cd 2+ ions has been investigated from the surface chemical point of view in comparison with the case of Cu 2+ ions reported previously. The effects of the change in the pH, the anionic and cationic surfactants, and bentonite on the flotation rate have also been studied. Sodium α-sulfolaurate proved to be one of the best surfactants among the anionic surfactants used for removing Cd 2+ ions, showing as high as a 97% removal. About 97% of the Cd 2+ ions could be floated in the region of pH 11.3 when a cationic surfactant was used with bentonite, regardless of the exact surfactant used. The addition of bentonite reduced the foam formation and liquid hold-up, resulting in effective bubble flotation. This behavior was as a whole similar to that of Cu 2+ ions. However, in all the flotation systems tested, the flotation rate increased sharply at about pH 8, and the flotation rate vs. pH curve for Cd 2+ shifted towards a more alkaline region than that for Cu 2+ , because of the stronger basic nature of the former. Also, the flotation rate of Cd 2+ ions for the Cd 2+ -anionic surfactant systems attained a steady value after about 7 min, longer than the 2-min gas flow required in the case of Cu 2+ ion flotation. The adjustment of the pH using ammonia gave a lower rate of flotation than in the case of flotation using sodium hydroxide. (auth.)

  14. Anion and cation diffusion in barium titanate and strontium titanate

    International Nuclear Information System (INIS)

    Kessel, Markus Franz

    2012-01-01

    Perovskite oxides show various interesting properties providing several technical applications. In many cases the defect chemistry is the key to understand and influence the material's properties. In this work the defect chemistry of barium titanate and strontium titanate is analysed by anion and cation diffusion experiments and subsequent time-of-flight secondary ion mass spectrometry (ToF-SIMS). The reoxidation equation for barium titanate used in multi-layer ceramic capacitors (MLCCs) is found out by a combination of different isotope exchange experiments and the analysis of the resulting tracer diffusion profiles. It is shown that the incorporation of oxygen from water vapour is faster by orders of magnitude than from molecular oxygen. Chemical analysis shows the samples contain various dopants leading to a complex defect chemistry. Dysprosium is the most important dopant, acting partially as a donor and partially as an acceptor in this effectively acceptor-doped material. TEM and EELS analysis show the inhomogeneous distribution of Dy in a core-shell microstructure. The oxygen partial pressure and temperature dependence of the oxygen tracer diffusion coefficients is analysed and explained by the complex defect chemistry of Dy-doped barium titanate. Additional fast diffusion profiles are attributed to fast diffusion along grain boundaries. In addition to the barium titanate ceramics from an important technical application, oxygen diffusion in cubic, nominally undoped BaTiO 3 single crystals has been studied by means of 18 O 2 / 16 O 2 isotope exchange annealing and subsequent determination of the isotope profiles in the solid by ToF-SIMS. It is shown that a correct description of the diffusion profiles requires the analysis of the diffusion through the surface space-charge into the material's bulk. Surface exchange coefficients, space-charge potentials and bulk diffusion coefficients are analysed as a function of oxygen partial pressure and temperature. The

  15. Reducing nitrogen crossover in microbial reverse-electrodialysis cells by using adjacent anion exchange membranes and anion exchange resin

    KAUST Repository

    Wallack, Maxwell J.; Geise, Geoffrey M.; Hatzell, Marta C.; Hickner, Michael A.; Logan, Bruce E.

    2015-01-01

    Microbial reverse electrodialysis cells (MRECs) combine power generation from salinity gradient energy using reverse electrodialysis (RED), with power generation from organic matter using a microbial fuel cell. Waste heat can be used to distill ammonium bicarbonate into high (HC) and low salt concentration (LC) solutions for use in the RED stack, but nitrogen crossover into the anode chamber must be minimized to avoid ammonia loses, and foster a healthy microbial community. To reduce nitrogen crossover, an additional low concentration (LC) chamber was inserted before the anode using an additional anion exchange membrane (AEM) next to another AEM, and filled with different amounts of anion or cation ion exchange resins. Addition of the extra AEM increased the ohmic resistance of the test RED stack from 103 Ω cm2 (1 AEM) to 295 Ω cm2 (2 AEMs). However, the use of the anion exchange resin decreased the solution resistance of the LC chamber by 74% (637 Ω cm2, no resin; 166 Ω cm2 with resin). Nitrogen crossover into the anode chamber was reduced by up to 97% using 50% of the chamber filled with an anion exchange resin compared to the control (no additional chamber). The added resistance contributed by the use of the additional LC chamber could be compensated for by using additional LC and HC membrane pairs in the RED stack.

  16. Polyvinyl alcohol (PVA) and sulfonated polyetheretherketone (SPEEK) anion exchange membrane for fuel cell

    CSIR Research Space (South Africa)

    Luo, H

    2010-08-31

    Full Text Available less than proton exchange membrane systems using alcohol as fuel. Many anion exchange membranes based on quaternised polymers have been developed and studied for AMFC3-5. The quaternary ammonium functional groups are the anion conductors...

  17. Anionic polymerization and polyhomologation: An ideal combination to synthesize polyethylene-based block copolymers

    KAUST Repository

    Zhang, H.; Alkayal, N.; Gnanou, Yves; Hadjichristidis, Nikolaos

    2013-01-01

    A novel one-pot methodology combining anionic polymerization and polyhomologation, through a "bridge" molecule (BF3OEt 2), was developed for the synthesis of polyethylene (PE)-based block copolymers. The anionically synthesized macroanion reacts

  18. Effect of sodium aromatic sulfonate group in anionic polymer dispersant on the viscosity of coal-water mixtures

    Energy Technology Data Exchange (ETDEWEB)

    Toshio Kakui; Hidehiro Kamiya [Lion Corporation, Tokyo (Japan). Chemicals Research Laboratories, Chemicals Division

    2004-06-01

    This paper focused on the effect of sodium aromatic sulfonate in anionic polymer dispersants on the viscosity of coal-water mixtures (CWMs) with a Tatung coal powder. To determine the optimum molecular structure of a polymer dispersant for the minimum viscosity of a CWM, various anionic co-polymers with different hydrophilic and hydrophobic groups or different molecular weights were prepared, using various types of monomers. Anionic co-polymers with sodium aromatic sulfonate, such as sodium styrene-sulfonate and sodium naphthalene-sulfonate, reduced the viscosity of dense CWMs. In particular, a co-polymer of sodium styrene-sulfonate and sodium acrylate with a molar ratio of 70:30 and a molecular weight of {approximately} 10 000 gave the minimum viscosity of a 70 wt % CWM. To obtain a low viscosity for a CWM, a large electrostatic repulsive force with an absolute value of the zeta potential of the coal particles of {gt} 70 mV and {gt} 6.5 mg/g of adsorbed polymer on the coal surface were needed. The mixture of sodium polystyrene-sulfonate and sodium polyacrylate with a weight ratio of 50:50 also gave a low viscosity of 70 wt % CWM. On the basis of the results, the adsorption behavior of polymer dispersants on the coal surface is examined by measuring the wettability of coal powder pellets. 27 refs., 8 figs., 3 tabs.

  19. Ab initio studies of O2-(H2O)n and O3-(H2O)n anionic molecular clusters, n≤12

    DEFF Research Database (Denmark)

    Bork, Nicolai Christian; Kurtén, T.; Enghoff, Martin Andreas Bødker

    2011-01-01

    that anionic O2−(H2O)n and O3−(H2O)n clusters are thermally stabilized at typical atmospheric conditions for at least n = 5. The first 4 water molecules are strongly bound to the anion due to delocalization of the excess charge while stabilization of more than 4 H2O is due to normal hydrogen bonding. Although...... clustering up to 12 H2O, we find that the O2 and O3 anions retain at least ca. 80 % of the charge and are located at the surface of the cluster. The O2− and O3− speicies are thus accessible for further reactions. Finally, the thermodynamics of a few relevant cluster reactions are considered....

  20. Ab initio studies of O-2(-) (H2O)(n) and O-3(-) (H2O)(n) anionic molecular clusters, n

    DEFF Research Database (Denmark)

    Bork, Nicolai Christian; Kurten, T.; Enghoff, Martin Andreas Bødker

    2011-01-01

    that anionic O-2(-)(H2O)n and O-3(-)(H2O)n clusters are thermally stabilized at typical atmospheric conditions for at least n = 5. The first 4 water molecules are strongly bound to the anion due to delocalization of the excess charge while stabilization of more than 4 H2O is due to normal hydrogen bonding....... Although clustering up to 12 H2O, we find that the O-2 and O-3 anions retain at least ca. 80 % of the charge and are located at the surface of the cluster. The O-2(-) and O-3(-) speicies are thus accessible for further reactions. We consider the distributions of cluster sizes as function of altitude before...

  1. Reactions of laser-ablated Co, Rh, and Ir with CO: Infrared spectra and density functional calculations of the metal carbonyl molecules, cations and anions in solid neon

    International Nuclear Information System (INIS)

    Zhou, M.; Andrews, L.

    1999-01-01

    Laser ablation produces metal atoms, cations, and electrons for reaction with CO during condensation in excess neon at 4 K. Infrared spectra are observed for the metal carbonyls, cations, and anions, which are identified from isotopic shifts ( 13 CO, C 18 O) and splittings using mixed isotopic precursors. Density functional calculations with pseudopotentials for Rh and Ir predict the observed carbonyl stretching frequencies within 1--2%. This characterization of the simple RhCO + , RhCO, and RhCO - (and Ir) species over a 350 cm -1 range provides a scale for comparison of larger catalytically active Rh and Ir carbonyl complexes in solution and on surfaces to estimate charge on the metal center. This work provides the first spectroscopic characterization of Rh and Ir carbonyl cations and anions except for the stable tetracarbonyl anions in solution

  2. Recent Advances in Solid Catalysts Obtained by Metalloporphyrins Immobilization on Layered Anionic Exchangers: A Short Review and Some New Catalytic Results

    Directory of Open Access Journals (Sweden)

    Shirley Nakagaki

    2016-02-01

    Full Text Available Layered materials are a very interesting class of compounds obtained by stacking of two-dimensional layers along the basal axis. A remarkable property of these materials is their capacity to interact with a variety of chemical species, irrespective of their charge (neutral, cationic or anionic. These species can be grafted onto the surface of the layered materials or intercalated between the layers, to expand or contract the interlayer distance. Metalloporphyrins, which are typically soluble oxidation catalysts, are examples of molecules that can interact with layered materials. This work presents a short review of the studies involving metalloporphyrin immobilization on two different anionic exchangers, Layered Double Hydroxides (LDHs and Layered Hydroxide Salts (LHSs, published over the past year. After immobilization of anionic porphyrins, the resulting solids behave as reusable catalysts for heterogeneous oxidation processes. Although a large number of publications involving metalloporphyrin immobilization on LDHs exist, only a few papers have dealt with LHSs as supports, so metalloporphyrins immobilized on LHSs represent a new and promising research field. This work also describes new results on an anionic manganese porphyrin (MnP immobilized on Mg/Al-LDH solids with different nominal Mg/Al molar ratios (2:1, 3:1 and 4:1 and intercalated with different anions (CO32− or NO3−. The influence of the support composition on the MnP immobilization rates and the catalytic performance of the resulting solid in cyclooctene oxidation reactions will be reported.

  3. Carbon-dot-based fluorescent turn-on sensor for selectively detecting sulfide anions in totally aqueous media and imaging inside live cells.

    Science.gov (United States)

    Hou, Xianfeng; Zeng, Fang; Du, Fangkai; Wu, Shuizhu

    2013-08-23

    Sulfide anions are generated not only as a byproduct from industrial processes but also in biosystems. Hence, robust fluorescent sensors for detecting sulfide anions which are fast-responding, water soluble and biocompatible are highly desirable. Herein, we report a carbon-dot-based fluorescent sensor, which features excellent water solubility, low cytotoxicity and a short response time. This sensor is based on the ligand/Cu(II) approach so as to achieve fast sensing of sulfide anions. The carbon dot (CD) serves as the fluorophore as well as the anchoring site for the ligands which bind with copper ions. For this CD-based system, as copper ions bind with the ligands which reside on the surface of the CD, the paramagnetic copper ions efficiently quench the fluorescence of the CD, affording the system a turn-off sensor for copper ions. More importantly, the subsequently added sulfide anions can extract Cu(2+) from the system and form very stable CuS with Cu(2+), resulting in fluorescence enhancement and affording the system a turn-on sensor for sulfide anions. This fast-responding and selective sensor can operate in totally aqueous solution or in physiological milieu with a low detection limit of 0.78 μM. It displays good biocompatibility, and excellent cell membrane permeability, and can be used to monitor S(2-) levels in running water and living cells.

  4. Recent Advances in Solid Catalysts Obtained by Metalloporphyrins Immobilization on Layered Anionic Exchangers: A Short Review and Some New Catalytic Results.

    Science.gov (United States)

    Nakagaki, Shirley; Mantovani, Karen Mary; Machado, Guilherme Sippel; Castro, Kelly Aparecida Dias de Freitas; Wypych, Fernando

    2016-02-29

    Layered materials are a very interesting class of compounds obtained by stacking of two-dimensional layers along the basal axis. A remarkable property of these materials is their capacity to interact with a variety of chemical species, irrespective of their charge (neutral, cationic or anionic). These species can be grafted onto the surface of the layered materials or intercalated between the layers, to expand or contract the interlayer distance. Metalloporphyrins, which are typically soluble oxidation catalysts, are examples of molecules that can interact with layered materials. This work presents a short review of the studies involving metalloporphyrin immobilization on two different anionic exchangers, Layered Double Hydroxides (LDHs) and Layered Hydroxide Salts (LHSs), published over the past year. After immobilization of anionic porphyrins, the resulting solids behave as reusable catalysts for heterogeneous oxidation processes. Although a large number of publications involving metalloporphyrin immobilization on LDHs exist, only a few papers have dealt with LHSs as supports, so metalloporphyrins immobilized on LHSs represent a new and promising research field. This work also describes new results on an anionic manganese porphyrin (MnP) immobilized on Mg/Al-LDH solids with different nominal Mg/Al molar ratios (2:1, 3:1 and 4:1) and intercalated with different anions (CO₃(2-) or NO₃(-)). The influence of the support composition on the MnP immobilization rates and the catalytic performance of the resulting solid in cyclooctene oxidation reactions will be reported.

  5. Importance of poly(ethylene oxide)-modification and chloride anion for the electron transfer reaction of cytochrome c in 1-ethyl-3-methylimidazolium bis(trifluoromethanesulfonyl)imide

    International Nuclear Information System (INIS)

    Ohno, Hiroyuki; Suzuki, Chiiko; Fujita, Kyoko

    2006-01-01

    Horse heart cytochrome c (cyt c) was chemically modified with poly(ethylene oxide) (PEO) to dissolve it in room temperature ionic liquid 1-ethyl-3-methylimidazolium bis(trifluoromethanesulfonyl)imide ([emim][TFSI]). The redox response of the modified cyt c, hereafter PEO-cyt c, was analyzed in [emim][TFSI]. PEO modification to the surface of cyt c, which exceeded 60% of the total mass of the PEO-cyt c, was an effective method to solubilize the cyt c. In spite of the high ion density and sufficient ionic conductivity of [emim][TFSI], no redox response of pure PEO-cyt c was detected. However, a reversible redox response of PEO-cyt c was observed after adding a simple electrolyte such as KCl to [emim][TFSI]. The redox response of PEO-cyt c was sensitive to the anion radius of the added salt, and the chloride anion was found to be the best anion species to produce a redox response of PEO-cyt c in [emim][TFSI]. However, above a certain salt concentration, the resulting increase in solution viscosity would suppress the redox reaction. The results strongly indicate that the chloride anions, because of their mobility in the polypeptide matrix, compensate the charge change of heme during the electron transfer reaction. Larger anions did not show such an effect due to sterical restrictions on the migration through the protein shell to the heme pocket of cyt c

  6. Contribution of various metabolites to the "unmeasured" anions in critically ill patients with metabolic acidosis.

    NARCIS (Netherlands)

    Moviat, M.; Terpstra, A.M.; Ruitenbeek, W.; Kluijtmans, L.A.J.; Pickkers, P.; Hoeven, J.G. van der

    2008-01-01

    OBJECTIVE: The physicochemical approach, described by Stewart to investigate the acid-base balance, includes the strong ion gap (SIG), a quantitative measure of "unmeasured" anions, which strongly correlates to the corrected anion gap. The chemical nature of these anions is for the most part

  7. Using remote substituents to control solution structure and anion binding in lanthanide complexes

    DEFF Research Database (Denmark)

    Tropiano, Manuel; Blackburn, Octavia A.; Tilney, James A.

    2013-01-01

    A study of the anion-binding properties of three structurally related lanthanide complexes, which all contain chemically identical anion-binding motifs, has revealed dramatic differences in their anion affinity. These arise as a consequence of changes in the substitution pattern on the periphery ...

  8. A Supramolecular Sensing Platform for Phosphate Anions and an Anthrax Biomarker in a Microfluidic Device

    Directory of Open Access Journals (Sweden)

    Jurriaan Huskens

    2011-10-01

    Full Text Available A supramolecular platform based on self-assembled monolayers (SAMs has been implemented in a microfluidic device. The system has been applied for the sensing of two different analyte types: biologically relevant phosphate anions and aromatic carboxylic acids, which are important for anthrax detection. A Eu(III-EDTA complex was bound to β-cyclodextrin monolayers via orthogonal supramolecular host-guest interactions. The self-assembly of the Eu(III-EDTA conjugate and naphthalene β-diketone as an antenna resulted in the formation of a highly luminescent lanthanide complex on the microchannel surface. Detection of different phosphate anions and aromatic carboxylic acids was demonstrated by monitoring the decrease in red emission following displacement of the antenna by the analyte. Among these analytes, adenosine triphosphate (ATP and pyrophosphate, as well as dipicolinic acid (DPA which is a biomarker for anthrax, showed a strong response. Parallel fabrication of five sensing SAMs in a single multichannel chip was performed, as a first demonstration of phosphate and carboxylic acid screening in a multiplexed format that allows a general detection platform for both analyte systems in a single test run with µM and nM detection sensitivity for ATP and DPA, respectively.

  9. Investigation of Electrochemical and Morphological Properties of Mixed Matrix Polysulfone-Silica Anion Exchange Membrane

    Directory of Open Access Journals (Sweden)

    Khoiruddin

    2016-02-01

    Full Text Available Mixed matrix anion exchange membranes (AEMs were synthesized using dry-wet phase inversion. The casting solutions were prepared by dispersing finely ground anion-exchange resin particles in N,N-dimethylacetamide (DMAc solutions of polysulfone (PSf. Subsequently, nanosilica particles were introduced into the membranes. The results show that evaporation time (tev and solution composition contributed to membrane properties formation. A longer tev produces membranes with reduced void fraction inside the membranes, thus the amount of water adsorbed and membrane conductivity are reduced. Meanwhile, the permselectivity was improved by increasing tev, since a longer tev produces membranes with a narrower channel for ion migration and more effective Donnan exclusion. The incorporation of 0.5 %-wt nanosilica particles into the polymer matrix led to conductivity improvement (from 2.27 to 3.41 mS.cm-1. This may be associated with additional pathway formation by hydroxyl groups on the silica surface that entraps water and assists ion migration. However, at further silica loading (1.0 and 1.5 %-wt, these properties decreased (to 1.9 and 1.4 mS.cm-1 respectively, which attributed to inaccessibility of ion-exchange functional groups due to membrane compactness. It was found from the results that nanosilica contributes to membrane formation (increases casting solution viscosity then reduces void fraction and membrane functional group addition (provides hydroxyl groups.

  10. Temperature and anion responsive self-assembly of ionic liquid block copolymers coating gold nanoparticles

    Science.gov (United States)

    Li, Junbo; Zhao, Jianlong; Wu, Wenlan; Liang, Ju; Guo, Jinwu; Zhou, Huiyun; Liang, Lijuan

    2016-06-01

    In this paper, double hydrophilic ionic liquid block copolymers (ILBCs), poly poly[1-methyl-3-(2-methacryloyloxy propylimidazolium bromine)]- block-(N-isopropylacrylamide) (PMMPImB- b-PNIPAAm) was first synthesized by reversible additionfragmentation chain transfer (RAFT) and then attached on the surface of gold nanoparticles (Au NPs) via a strong gold-sulfur bonding for preparing hybrid nanoparticles (PMMPImB- b-PNIPAAm-@-Au NPs). The hybrid NPs had a three layers micelle-like structure, including a gold core, thermo-responsive inner shell and anion responsive outer corona. The self-assembling behavior of thermal- and anion-response from shell and corona were respectively investigated by change of temperature and addition of (CF3SO2)2N-. The results showed the hybrid NPs retained a stable dispersion beyond the lower critical solution temperature (LCST) because of the space or electrostatic protecting by outer PMMPImB. However, with increasing concentration of (CF3SO2)2N-, the micellization of self-assembling PMMPImB- b-PNIPAAm-@-Au NPs was induced to form micellar structure containing the core with hydrophobic PMMPImB-(CF3SO2)2N- surrounded by composite shell of Au NPs-PNIPAAm via the anionresponsive properties of ILBCs. These results indicated that the block copolymers protected plasmonic nanoparticles remain self-assembling properties of block copolymers when phase transition from outer corona polymer.

  11. Surface tension of compositions of polyhexametyleneguanidine hydrochloride - surfactants

    Directory of Open Access Journals (Sweden)

    S. Kumargaliyeva

    2012-12-01

    Full Text Available We made up songs bactericidal polyhexamethyleneguanidine hydrochloride (metacyde with the surface-active substances - anionic sodium dodecylsulfate, cationic cetylpyridinium bromide, and nonionic Tween-80 and measured the surface tension of water solutions. The study showed that the composition metacyde with surface-active agents have a greater surface activity than the individual components.

  12. Supramolecular Chemistry of Selective Anion Recognition for Anions of Environmental Relevance. Final Report

    International Nuclear Information System (INIS)

    Bowman-James, Kristin

    2008-01-01

    increased understanding of the chemical rules that govern the selective sequestration of anions.

  13. Tunable cytotoxicity of rhodamine 6G via anion variations.

    Science.gov (United States)

    Magut, Paul K S; Das, Susmita; Fernand, Vivian E; Losso, Jack; McDonough, Karen; Naylor, Brittni M; Aggarwal, Sita; Warner, Isiah M

    2013-10-23

    Chemotherapeutic agents with low toxicity to normal tissues are a major goal in cancer research. In this regard, the therapeutic activities of cationic dyes, such as rhodamine 6G, toward cancer cells have been studied for decades with observed toxicities toward normal and cancer cells. Herein, we report rhodamine 6G-based organic salts with varying counteranions that are stable under physiological conditions, display excellent fluorescence photostability, and more importantly have tunable chemotherapeutic properties. Our in vitro studies indicate that the hydrophobic compounds of this series allow production of nanoparticles which are nontoxic to normal cells and toxic to cancer cells. Furthermore, the anions, in combination with cations such as sodium, were observed to be nontoxic to both normal and cancer cells. To the best of our knowledge, this is the first demonstration that both the cation and anion play an extremely important and cooperative role in the antitumor properties of these compounds.

  14. Macrocyclic bis(ureas as ligands for anion complexation

    Directory of Open Access Journals (Sweden)

    Claudia Kretschmer

    2014-08-01

    Full Text Available Two macrocyclic bis(ureas 1 and 2, both based on diphenylurea, have been synthesized. Compound 1 represents the smaller ring with two ethynylene groups as linkers and 2 the larger ring with two butadiynylene groups. On thermal treatment to 130 °C molecule 1 splits up into two dihydroindoloquinolinone (3 molecules. Both compounds 1 and 2 form adducts with polar molecules such as dimethyl sulfoxide (DMSO and dimethylformamide (DMF and act as complexing agents towards a series of anions (Cl−, Br−, I−, NO3−, HSO4−. The crystal structures of 3, 2·2DMSO, 2·2DMF, and of the complex NEt4[Br·2] have been determined. Quantitative investigations of the complexation equilibria were performed via 1H NMR titrations. While 1 is a rather weak complexing agent, the large ring of 2 binds anions with association constants up to log K = 7.93 for chloride ions.

  15. Effect of indifferent anions on reactions of cadmium ferrocyanide precipitation

    Energy Technology Data Exchange (ETDEWEB)

    Gyunner, Eh A; Mel' nichenko, L M; Vel' mozhnyj, I S [Simferopol' skij Gosudarstvennyj Univ. (Ukrainian SSR)

    1982-08-01

    To clarify the effect of indifferent anions on the processes of cadmium ferrocyanide precipitation the interaction in six systems of the type CdXsub(m)-Msub(4)R-Hsub(2)O (X-Cl/sup -/, CH/sub 3/COO/sup -/, SO/sub 4//sup 2 -/; M-K/sup +/, NH/sub 4//sup +/; R-(Fe(CN)/sub 6/)/sup 4 -/) is studied using the methods of physicochemical analysis (the method of residual concentrations, refractometry). Composition and formation regions of low-soluble interaction products are determined. Effect of anion X nature on interaction character is stated in the series Cl/sup -/, CH/sub 3/COO/sup -/, SO/sub 4//sup 2 -/ in mixtures with incomplete Cd/sup 2 +/ precipitation a tendency for the increase of Cd/sup 2 +/:R/sup 4 -/ ratios in precipitates formed is observed.

  16. Thermal Properties of Anionic Polyurethane Composition for Leather Finishing

    Directory of Open Access Journals (Sweden)

    Olga KOVTUNENKO

    2016-09-01

    Full Text Available Thermal properties of anionic polyurethane composition mixed with collagen product and hydrophilic sodium form of montmorillonite for use in the finishing of leather were studied by thermogravimetric method. The thermal indices of processes of thermal and thermo-oxidative destruction depending on the polyurethane composition were determined. The influence of anionic polyurethane composition on thermal behavior of chromium tanned gelatin films that imitate the leather were studied. APU composition with natural compounds increases their thermal stability both in air and in nitrogen atmosphere due to the formation of additional bonds between active groups of APU, protein and chrome tanning agent as the result of chemical reactions between organic and inorganic parts with the new structure formation.DOI: http://dx.doi.org/10.5755/j01.ms.22.3.10043

  17. The immobilization of anion exchange resins in polymer modified cements

    International Nuclear Information System (INIS)

    Dyer, A.; Morgan, P.D.

    1991-09-01

    Organic anion exchange resins, loaded with 99-Tc as the pertechnate ion, were incorporated into polymer modified cements (Flexocrete Ltd, Preston). BFS/OPC (9:1 mix) also was modified by three polymers from the same source (styrene acrylic (2) styrene butadiene) and loaded with anion exchanger containing the pertechnate. Composites were tested for initial compressive strengths, under water and radiation stability and leach rate. IAEA standard leach testing was with simulated sea and ground waters. Ground water leaching also was carried out on composites subjected to 1.10 9 rads (γ). Leach testing correlated well with compressive strength. Modified composites performed better than the BFS/OPC mix under all conditions studied and were able to encapsulate higher resin loadings. (author)

  18. Rejuvenation of the anion exchanger used for uranium recovery

    International Nuclear Information System (INIS)

    Yan, T.-Y.; Espenscheid, W.F.

    1986-01-01

    The present invention is directed to improving the performance of strong base anionic exchange resins used in uranium recovery that exhibit an undesirable decrease in loading capacity and in total exchange capacity. The invention comprises treating an anionic exchange resin to remove physically adsorbed and occluded fouling agents and to remove poisons which may be chemically bound to active ion groups on the resin. The process involves treating the resin, after the uranium ion exchange stage, with an alkaline carbonate solution, preferably treating the resin with an acid eluant first. The acid treatment dissolves insoluble fouling agents which are physically occluded or adsorbed by the resin and that the weak base treatment augments that result and probably removes poisons which are physically or chemically bound to the resin

  19. Synthesis of Randomly Substituted Anionic Cyclodextrins in Ball Milling

    Directory of Open Access Journals (Sweden)

    László Jicsinszky

    2017-03-01

    Full Text Available A number of influencing factors mean that the random substitution of cyclodextrins (CD in solution is difficult to reproduce. Reaction assembly in mechanochemistry reduces the number of these factors. However, lack of water can improve the reaction outcomes by minimizing the reagent’s hydrolysis. High-energy ball milling is an efficient, green and simple method for one-step reactions and usually reduces degradation and byproduct formation. Anionic CD derivatives have successfully been synthesized in the solid state, using a planetary ball mill. Comparison with solution reactions, the solvent-free conditions strongly reduced the reagent hydrolysis and resulted in products of higher degree of substitution (DS with more homogeneous DS distribution. The synthesis of anionic CD derivatives can be effectively performed under mechanochemical activation without significant changes to the substitution pattern but the DS distributions were considerably different from the products of solution syntheses.

  20. Organic anion transporting polypeptide 1B transporters modulate hydroxyurea pharmacokinetics

    OpenAIRE

    Walker, Aisha L.; Lancaster, Cynthia S.; Finkelstein, David; Ware, Russell E.; Sparreboom, Alex

    2013-01-01

    Hydroxyurea is currently the only FDA-approved drug that ameliorates the pathophysiology of sickle cell anemia. Unfortunately, substantial interpatient variability in the pharmacokinetics (PK) of hydroxyurea may result in variation of the drug's efficacy. However, little is known about mechanisms that modulate hydroxyurea PK. Recent in vitro studies identifying hydroxyurea as a substrate for organic anion transporting polypeptide (OATP1B) transporters prompted the current investigation assess...

  1. Salts of alkali metal anions and process of preparing same

    Science.gov (United States)

    Dye, James L.; Ceraso, Joseph M.; Tehan, Frederick J.; Lok, Mei Tak

    1978-01-01

    Compounds of alkali metal anion salts of alkali metal cations in bicyclic polyoxadiamines are disclosed. The salts are prepared by contacting an excess of alkali metal with an alkali metal dissolving solution consisting of a bicyclic polyoxadiamine in a suitable solvent, and recovered by precipitation. The salts have a gold-color crystalline appearance and are stable in a vacuum at -10.degree. C. and below.

  2. Inorganic anion exchangers for the treatment of radioactive wastes

    International Nuclear Information System (INIS)

    Dyer, A.; Jamil, M.A.

    1987-07-01

    Inorganic anion exchangers are evaluated for Tc, I and S isotope removal from aqueous nuclear waste streams. Chemical, thermal, and radiation stabilities were examined. Selected exchangers were examined in detail for their selectivities, kinetics and mechanism of the sorption process (especially in NO 3 - , OH - and BO 3 - environments). Cement encapsulation and leaching experiments were made on the exchangers showing most promise for 'radwaste' treatment. (author)

  3. Organic resin anion exchangers for the treatment of radioactive wastes

    International Nuclear Information System (INIS)

    Dyer, A.; McGinnes, D.F.

    1988-07-01

    Organic anion exchange resins are evaluated for 99-TcO 4 - (pertechnate) removed from aqueous nuclear waste streams. Chemical, thermal and radiation stabilities were studied. Selected resins were examined in detail for their selectivities in the presence of I - , NO 3 - , SO 4 = , CO 3 = , Cl - and OH - . Ion exchange equilibria and kinetic mechanisms were determined. Preliminary investigations of cement encapsulation in polymer modified form were made and some leach studies carried out. (author)

  4. Closing anion gap without insulin in euglycaemic diabetic ketoacidosis

    Directory of Open Access Journals (Sweden)

    Resham Raj Poudel

    2017-01-01

    Full Text Available Euglycaemic diabetic ketoacidosis (euDKA occurs in patients with poor carbohydrate intake who continue to take insulin. For these patients are not truly in the insulin-deficient state, intravenous fluid resuscitation alone can correct the ketoacidosis without any risk of hypoglycaemia. Diagnosis of euDKA can be missed in inexperienced settings; therefore, calculating anion gap and measuring ketone levels should be practiced in every sick diabetic patient regardless of glucose levels.

  5. Indirect photometric detection of boron cluster anions electrophoretically separated in methanol.

    Science.gov (United States)

    Vítová, Lada; Fojt, Lukáš; Vespalec, Radim

    2014-04-18

    3,5-Dinitrobenzoate and picrate are light absorbing anions pertinent to indirect photometric detection of boron cluster anions in buffered methanolic background electrolytes (BGEs). Tris(hydroxymethyl)aminomethane and morpholine have been used as buffering bases, which eliminated baseline steps, and minimized the baseline noise. In methanolic BGEs, mobilities of boron cluster anions depend on both ionic constituents of the BGE buffer. This dependence can be explained by ion pair interaction of detected anions with BGE cations, which are not bonded into ion pairs with the BGE anions. The former ion pair interaction decreases sensitivity of the indirect photometric detection. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Coumarin benzothiazole derivatives as chemosensors for cyanide anions

    Science.gov (United States)

    Wang, Kangnan; Liu, Zhiqiang; Guan, Ruifang; Cao, Duxia; Chen, Hongyu; Shan, Yanyan; Wu, Qianqian; Xu, Yongxiao

    2015-06-01

    Four coumarin benzothiazole derivatives, N-(benzo[d]thiazol-2-yl)-2-oxo-2H-chromene-3-carboxamide (1), (Z)-N-(3-methylbenzo[d]thiazol-2(3H)-ylidene)-2-oxo-2H-chromene-3-carboxamide (2), 7-(diethylamino)-N-(benzo[d]thiazol-2-yl)-2-oxo-2H-chromene-3-carboxamide (3) and (Z)-7-(diethylamino)-N-(3-methylbenzo[d]thiazol-2(3H)-ylidene)-2-oxo-2H-chromene-3-carboxamide) (4), have been synthesized. Their crystal structures, photophysical properties in acetonitrile and recognition properties for cyanide anions have been investigated. All the compounds are generally planar, especially compound 1 exhibits perfect planarity with dihedral angle between benzothiazolyl group and coumarin group being only 3.63°. Coumarin benzothiazole compounds 1 and 3 can recognize cyanide anions by Michael addition reaction and compound 3 exhibits color change from yellow to colorless and green fluorescence was quenched completely, which can be observed by naked eye. Coumarin benzothiazolyliden compound 4 can recognize cyanide anions with fluorescence turn-on response based on the copper complex ensemble displacement mechanism.

  7. Preparation and physicochemical characterization of anionic uranyl. beta. -ketoenolates

    Energy Technology Data Exchange (ETDEWEB)

    Marangoni, G; Paolucci, G [Consiglio Nazionale delle Ricerche, Padua (Italy). Lab. di Chimica e Tecnologia dei Radioelementi; Graziani, R; Celon, E

    1978-01-01

    New classes of anionic uranyl ..beta..-ketoenolates of formula (UO/sub 2/L/sub 2/X)/sup -/ (where L = 1,3-diphenylpropane-1,3-dionate (dppd), 4,4,4-trifluoro-1-phenylbutane-1,3-dionate (tfpbd), or 1-phenylbutane-1,3-dionate (pbd); X = Cl/sup -/, Br/sup -/, I/sup -/, (NO/sub 3/)/sup -/, (O/sub 2/CMe)/sup -/, or (NCS)/sup -/) and (L/sub 2/O/sub 2/U(..mu..-X) UO/sub 2/L/sub 2/)/sup -/ (where X = F/sup -/, and also Cl/sup -/ only in the case of L = dppd) have been synthesized and characterized by a number of physical measurements. The different ability of the various anionic ligands to enter into the co-ordination sphere of the uranyl ion, their potentially different bonding modes, and the possible correlations between physical parameters and the nature of either the chelate substituents or the anionic ligand are discussed.

  8. Demonstrate use of capillary electrophoresis low level transient of anions

    International Nuclear Information System (INIS)

    Moum, Kari-Lye; Solheim, Torill; McElrath, Joel; Frattini, Paul

    2012-09-01

    Capillary Electrophoresis (CE) is a well-known analytical method capable of rapid detection of very low concentration of cations and anionic species such as chloride, sulfate and nitrate. These anions are of crucial importance in reducing the potential of stainless steel components to undergo stress corrosion cracking. Currently, Nuclear Power Plants (NPPs) use Ion Chromatography (IC) as the analytical technique to achieve the required detection levels of ionic species. At the Halden Reactor Project (HRP) IC was replaced by CE in 1996, and since then HRP has gained nearly 20 years of operational experience. During the last 15 years, EPRI has done research on the CE technique and has achieved extensive experience in this area. EPRI has demonstrated detection levels at ppt and sub-ppb levels. This paper presents the ability of the CE technique to follow low level transients of anions in Boiling Water Reactor (BWR) coolant. A transient caused by approx. 10 ppb chloride and sulfate was simulated in an experimental circuit simulating BWR conditions. A series of grab samples were taken and analysed using HRPs CE (Agilent G1600). (authors)

  9. A Simple Halide-to-Anion Exchange Method for Heteroaromatic Salts and Ionic Liquids

    Directory of Open Access Journals (Sweden)

    Neus Mesquida

    2012-04-01

    Full Text Available A broad and simple method permitted halide ions in quaternary heteroaromatic and ammonium salts to be exchanged for a variety of anions using an anion exchange resin (A− form in non-aqueous media. The anion loading of the AER (OH− form was examined using two different anion sources, acids or ammonium salts, and changing the polarity of the solvents. The AER (A− form method in organic solvents was then applied to several quaternary heteroaromatic salts and ILs, and the anion exchange proceeded in excellent to quantitative yields, concomitantly removing halide impurities. Relying on the hydrophobicity of the targeted ion pair for the counteranion swap, organic solvents with variable polarity were used, such as CH3OH, CH3CN and the dipolar nonhydroxylic solvent mixture CH3CN:CH2Cl2 (3:7 and the anion exchange was equally successful with both lipophilic cations and anions.

  10. Anion induced conformational preference of Cα NN motif residues in functional proteins.

    Science.gov (United States)

    Patra, Piya; Ghosh, Mahua; Banerjee, Raja; Chakrabarti, Jaydeb

    2017-12-01

    Among different ligand binding motifs, anion binding C α NN motif consisting of peptide backbone atoms of three consecutive residues are observed to be important for recognition of free anions, like sulphate or biphosphate and participate in different key functions. Here we study the interaction of sulphate and biphosphate with C α NN motif present in different proteins. Instead of total protein, a peptide fragment has been studied keeping C α NN motif flanked in between other residues. We use classical force field based molecular dynamics simulations to understand the stability of this motif. Our data indicate fluctuations in conformational preferences of the motif residues in absence of the anion. The anion gives stability to one of these conformations. However, the anion induced conformational preferences are highly sequence dependent and specific to the type of anion. In particular, the polar residues are more favourable compared to the other residues for recognising the anion. © 2017 Wiley Periodicals, Inc.

  11. Environmental Conditions Influencing Sorption of Inorganic Anions to Multiwalled Carbon Nanotubes Studied by Column Chromatography.

    Science.gov (United States)

    Metzelder, Florian; Schmidt, Torsten C

    2017-05-02

    Sorption to carbon-based nanomaterials is typically studied in batch experiments. An alternative method offering advantages to study sorption is column chromatography. Sorbent packed columns are used and sorption data are determined by relating sorbate retention to that of a nonretarded tracer. We have now for the first time applied this technique to study the influence of environmental conditions on sorption of inorganic anions (bromide, nitrite, nitrate, and iodide) to multiwalled carbon nanotubes. Deuterium oxide was used as nonretarded tracer. Sorption isotherms were best described by the Freundlich model. Sorption increased in the order bromide 4.5 the surface charge was negative, but sorption was still detectable at pH 6 and 9. Consequently, other forces than electrostatic attraction contributed to sorption. These forces may include H-bonding as indicated by sorption enthalpy determined by variation of column temperature. Overall, column chromatography represents a promising alternative in sorption studies to reveal sorbent properties.

  12. Determination of carbohydrates using pulsed amperometric detection combined with anion exchange separations

    Energy Technology Data Exchange (ETDEWEB)

    Edwards, W.T.; Pohl, C.A.; Rubin, R.

    1987-06-01

    Carbohydrates, including the monosaccharides commonly found in wood and wood pulp hydrolyzates, are separated by anion exchange chromatography using hydroxide and acetate eluants and are determined using pulsed amperometric detection. The detection method is based on oxidizing the sugars in a flow-through electrochemical cell equipped with a gold working electrode. A repeating cycle of three potentials is used: the first to oxidize the carbohydrates and measure the current generated, and two subsequent pulses to clean the electrode surface of oxidation products. The method is fast, sensitive, and requires no pre-column derivatization. It is applied to a sample of hydrolyzed wood pulp, which can be analyzed after minimal sample preparation. Detection limits are of the order of 1 mg/kg for monosaccharides in a 50 micro L injection. (Refs. 8).

  13. Cobalt sulfide aerogel prepared by anion exchange method with enhanced pseudocapacitive and water oxidation performances

    Science.gov (United States)

    Gao, Qiuyue; Shi, Zhenyu; Xue, Kaiming; Ye, Ziran; Hong, Zhanglian; Yu, Xinyao; Zhi, Mingjia

    2018-05-01

    This work introduces the anion exchange method into the sol-gel process for the first time to prepare a metal sulfide aerogel. A porous Co9S8 aerogel with a high surface area (274.2 m2 g‑1) and large pore volume (0.87 cm3 g‑1) has been successfully prepared by exchanging cobalt citrate wet gel in thioacetamide and subsequently drying in supercritical ethanol. Such a Co9S8 aerogel shows enhanced supercapacitive performance and catalytic activity toward oxygen evolution reaction (OER) compared to its oxide aerogel counterpart. High specific capacitance (950 F g‑1 at 1 A g‑1), good rate capability (74.3% capacitance retention from 1 to 20 A g‑1) and low onset overpotential for OER (220 mV) were observed. The results demonstrated here have implications in preparing various sulfide chalcogels.

  14. Anionic Surfactant as a Corrosion Inhibitor for Synthesized Ferrous Alloy in Acidic Solution

    Directory of Open Access Journals (Sweden)

    Farida Kellou-Kerkouche

    2013-01-01

    Full Text Available The effect of temperature on the corrosion behaviour of a synthesized iron-based alloy in 1 N sulphuric acid solution has been examined by means of three electrochemical techniques. Thereafter, we studied the influence of an anionic surfactant (sodium dodecyl benzene sulfonate at various concentrations on the electrochemical behaviour of the ferrous alloy. The obtained results show that the temperature increase reduced the performance of the used alloy, in the acidic environment. Otherwise, the surfactant inhibits the alloy dissolution in the sulphuric acid, through its adsorption on the metal surface without modifying the mechanism of corrosion process. We also noticed that the highest inhibition effect is obtained at a concentration above its critical micelle concentration (CMC. Langmuir adsorption isotherm fits well with the experimental data.

  15. Effect of the counter anion of cesium on foliar uptake and translocation

    Energy Technology Data Exchange (ETDEWEB)

    Hasegawa, Hidenao [Department of Radioecology, Institute for Environmental Sciences, 1-7, Ienomae, Obuchi, Rokkasho, Kamikita-gun, Aomori 039-3212 (Japan)], E-mail: hhidenao@ies.or.jp; Tsukada, Hirofumi; Kawabata, Hitoshi [Department of Radioecology, Institute for Environmental Sciences, 1-7, Ienomae, Obuchi, Rokkasho, Kamikita-gun, Aomori 039-3212 (Japan); Chikuchi, Yuki [JGC Plantech Aomori Co. Ltd., Rokkasho, Aomori 039-3212 (Japan); Takaku, Yuichi; Hisamatsu, Shun' ichi [Department of Radioecology, Institute for Environmental Sciences, 1-7, Ienomae, Obuchi, Rokkasho, Kamikita-gun, Aomori 039-3212 (Japan)

    2009-01-15

    Direct deposition of radioactive material onto crops is one important pathway for safety assessment of radionuclides released from nuclear facilities. Foliar uptake of Cs by radish (Raphanus sativus L. cv. Redchim) was studied by applying droplets of Cs solution (CsCl or CsNO{sub 3}) on an upper leaf surface. The uptake of Cs was strongly affected by counter anions of Cs in the applied solution. Approximately 80% of Cs was absorbed for CsCl solution, while only 20% was absorbed for CsNO{sub 3}. The partition of absorbed Cs between leaf and root tuber was quite similar for both Cs compounds, which indicated that behavior of the absorbed Cs in radish was the same for both.

  16. Anion influence on thermophysical properties of ionic liquids: 1-butylpyridinium tetrafluoroborate and 1-butylpyridinium triflate.

    Science.gov (United States)

    Bandrés, Isabel; Royo, Félix M; Gascón, Ignacio; Castro, Miguel; Lafuente, Carlos

    2010-03-18

    The thermophysical properties of two pyridinium-based ionic liquids, 1-butylpyridinium tetrafluoroborate and 1-butylpyridinium triflate, have been measured. Thus, densities, refractive indices, speeds of sound, viscosities, surface tensions, isobaric molar heat capacities, and thermal properties have been experimentally determined over a wide range of temperatures. The comparison of the properties of the two ionic liquids has allowed us to analyze in detail the anion influence. Moreover, useful derived properties have been calculated from the results. On the other hand, the influence of the lack of a substituent in the cation has been evaluated when properties of 1-butylpyridinium tetrafluoroborate have been contrasted to those of 1-butyl-n-methylpyridinium tetrafluoroborate, (n = 2, 3, or 4). The study has been carried out paying special attention to interactions between ions in order to elucidate the desired relationship between properties and structural characteristics of ionic liquids.

  17. Adaptive self-assembly and induced-fit transformations of anion-binding metal-organic macrocycles

    Science.gov (United States)

    Zhang, Ting; Zhou, Li-Peng; Guo, Xiao-Qing; Cai, Li-Xuan; Sun, Qing-Fu

    2017-06-01

    Container-molecules are attractive to chemists due to their unique structural characteristics comparable to enzymes and receptors in nature. We report here a family of artificial self-assembled macrocyclic containers that feature induced-fit transformations in response to different anionic guests. Five metal-organic macrocycles with empirical formula of MnL2n (M=Metal L=Ligand n=3, 4, 5, 6, 7) are selectively obtained starting from one simple benzimidazole-based ligand and square-planar palladium(II) ions, either by direct anion-adaptive self-assembly or induced-fit transformations. Hydrogen-bonding interactions between the inner surface of the macrocycles and the anionic guests dictate the shape and size of the product. A comprehensive induced-fit transformation map across all the MnL2n species is drawn, with a representative reconstitution process from Pd7L14 to Pd3L6 traced in detail, revealing a gradual ring-shrinking mechanism. We envisage that these macrocyclic molecules with adjustable well-defined hydrogen-bonding pockets will find wide applications in molecular sensing or catalysis.

  18. Comparing and Optimizing Nitrate Adsorption from Aqueous Solution Using Fe/Pt Bimetallic Nanoparticles and Anion Exchange Resins

    Directory of Open Access Journals (Sweden)

    Muhammad Daud

    2015-01-01

    Full Text Available This research work was carried out for the removal of nitrate from raw water for a drinking water supply. Nitrate is a widespread ground water contaminant. Methodology employed in this study included adsorption on metal based nanoparticles and ion exchange using anionic resins. Fe/Pt bimetallic nanoparticles were prepared in the laboratory, by the reduction of their respective salts using sodium borohydride. Scanning electron microscope, X-ray diffraction, energy dispersive spectrometry, and X-ray florescence techniques were utilized for characterization of bimetallic Fe/Pt nanoparticles. Optimum dose, pH, temperature, and contact time were determined for NO3- removal through batch tests, both for metal based nanoparticles and anionic exchange resin. Adsorption data fitted well the Langmuir isotherm and conformed to the pseudofirst-order kinetic model. Results indicated 97% reduction in nitrate by 0.25 mg/L of Fe/Pt nanoparticles at pH 7 and 83% reduction in nitrate was observed using 0.50 mg/L anionic exchange resins at pH 4 and contact time of one hour. Overall, Fe/Pt bimetallic nanoparticles demonstrated greater NO3- removal efficiency due to the small particle size, extremely large surface area (627 m2/g, and high adsorption capacity.

  19. Comparing and Optimizing Nitrate Adsorption from Aqueous Solution Using Fe/Pt Bimetallic Nanoparticles and Anion Exchange Resins

    International Nuclear Information System (INIS)

    Daud, M.; Khan, Z.; Ashgar, A.; Danish, M. I.; Qazi, I. A.

    2015-01-01

    This research work was carried out for the removal of nitrate from raw water for a drinking water supply. Nitrate is a widespread ground water contaminant. Methodology employed in this study included adsorption on metal based nanoparticles and ion exchange using anionic resins. Fe/Pt bimetallic nanoparticles were prepared in the laboratory, by the reduction of their respective salts using sodium borohydride. Scanning electron microscope, X-ray diffraction, energy dispersive spectrometry, and X-ray florescence techniques were utilized for characterization of bimetallic Fe/Pt nanoparticles. Optimum dose, ph, temperature, and contact time were determined for removal through batch tests, both for metal based nanoparticles and anionic exchange resin. Adsorption data fitted well the Langmuir isotherm and conformed to the pseudo first-order kinetic model. Results indicated 97% reduction in nitrate by 0.25 mg/L of Fe/Pt nanoparticles at ph 7 and 83% reduction in nitrate was observed using 0.50 mg/L anionic exchange resins at ph 4 and contact time of one hour. Overall, Fe/Pt bimetallic nanoparticles demonstrated greater removal efficiency due to the small particle size, extremely large surface area (627 m 2 /g), and high adsorption capacity.

  20. Synergism and Physicochemical Properties of Anionic/Amphoteric Surfactant Mixtures with Nonionic Surfactant of Amine Oxide Type

    Science.gov (United States)

    Blagojević, S. M.; Pejić, N. D.; Blagojević, S. N.

    2017-12-01

    The physicochemical properties of initial formulation, that is anionic/amphoteric surfactants mixture SLES/AOS/CAB (sodium lauryl ether sulfate (SLES), α-olefin sulfonates (AOS) and cocamidopropyl betaine (CAB) at ratio 80 : 15 : 5) with nonionic surfactant of amine oxide type (lauramine oxide (AO)) in various concentration (1-5%) were studied. To characterize the surfactants mixture, the critical micelle concentration (CMC), surface tension (γ), foam volume, biodegradability and irritability were determined. This study showed that adding of AO in those mixtures lowered both γ and CMC as well as enhanced SLES/AOS/CAB foaming properties, but did not significantly affect biodegradability and irritability of initial formulation. Moreover, an increase in AO concentration has a meaningful synergistic effect on the initial formulation properties. All those results indicates that a nonionic surfactant of amine oxide type significantly improves the performance of anionic/amphoteric mixed micelle systems, and because of that anionic/amphoteric/nonionic mixture can be used in considerably lower concentrations as a cleaning formulation.

  1. Effect of the chemical structure of anion exchange resin on the adsorption of humic acid: behavior and mechanism.

    Science.gov (United States)

    Shuang, Chendong; Wang, Jun; Li, Haibo; Li, Aimin; Zhou, Qing

    2015-01-01

    Polystyrenic (PS) anion-exchange resin and polyacrylic (PA) anion-exchange resin were used to investigate the effect of resin chemical structure on the adsorption of humic acid (HA). Due to the rearrangement of HA to form layers that function as barricades to further HA diffusion, PS resin exhibited 12.4 times slower kinetics for the initial adsorption rate and 8.4 times for the diffusion constant in comparison to that of the PA resin. An HA layer and a spherical cluster of HA can be observed on the surface of the PS and PA resins after adsorption, respectively. The considerable difference in HA adsorption between the PS and PA resins was due to the difference in molecule shape for interaction with different resin structures, which can essentially be explained by the hydrophobicity and various interactions of the PS resin. A given amount of HA occupies more positively charged sites and hydrophobic sites on the PS resin than were occupied by the same amount of HA on the PA resin. Increased pH resulted in an increase of HA adsorption onto the PA resin but a decrease in adsorption onto PS resin, as the non-electrostatic adsorption led to electrostatic repulsion between the HA attached to the resin and the HA dissolved in solution. These results suggest higher rates of adsorption and higher regeneration efficiency for interaction of HA with more hydrophilic anion exchange materials. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Thermodynamic solution properties of pefloxacin mesylate and its interactions with organized assemblies of anionic surfactant, sodium dodecyl sulphate

    International Nuclear Information System (INIS)

    Usman, Muhammad; Rashid, Muhammad Abid; Mansha, Asim; Siddiq, Mohammad

    2013-01-01

    Graphical abstract: - Highlights: • Free energy of adsorption is more negative than free energy of micellization. • Micellization becomes more spontaneous at high temperature. • There is strong interaction between PFM and SDS. - Abstract: This manuscript reports the physicochemical behavior of antibiotic amphiphilic drug pefloxacin mesylate (PFM) and its interaction with anionic surfactant, sodium dodecyl sulfate (SDS). The data of surface tension and electrical conductivity are helpful to detect the CMC as well as to calculate surface parameters, i.e. surface pressure, π, surface excess concentration, Γ, area per molecule of drug and standard Gibbs free energy of adsorption, ΔG ads and thermodynamic parameters like standard free energy of micellization, ΔG m , standard enthalpy of micellization, ΔH m and standard entropy of micellization, ΔS m . The interaction of this drug with anionic surfactant, sodium dodecyl sulfate (SDS) was studied by electrical conductivity and UV/visible spectroscopy. This enabled us to compute the values of partition coefficient (K x ), free energy of partition, ΔG p , binding constant, K b , free energy of binding, ΔG b , number of drug molecules per micelle, n, and thermodynamic parameters of drug–surfactant interaction

  3. Low-energy electron-induced dissociation in condensed-phase L-cysteine II: a comparative study on anion desorption from chemisorbed and physisorbed films

    Science.gov (United States)

    Alizadeh, Elahe; Massey, Sylvain; Sanche, Léon; Rowntree, Paul A.

    2016-04-01

    Due to its multifunctional structure, cysteine is becoming an ideal model molecule for investigating the complex interactions of proteins with metallic surfaces such as gold nanoparticles. We report herein the results of low-energy electron induced degradation of L-cysteine films, chemisorbed on a gold substrate via the thiol group or physisorbed into a clean gold surface. The data were recorded under ultra-high vacuum conditions at room temperature. Anion yields desorbed from these films by the impact of 0.5 to 19 eV electrons provide clear evidence of the efficient decomposition of this amino acid via dissociative electron attachment (i.e., from dissociation of intermediate transient anions located between 5 and 14 eV). The peaks in the desorbed-anion yield functions, associated with DEA, are superimposed on a continuously rising signal attributed to dipolar dissociation. Similar to the results previously observed from physisorbed films, light anionic species, with masses lower than 35 amu, have been detected. In addition, we measured for first time fragments at 14 amu (CH2-) and 15 amu (CH3-) desorbing from physisorbed films, as well as heavier fragments of mass 45 and 46 amu desorbing from chemisorbed films. Contribution to the Topical Issue "Low-Energy Interactions related to Atmospheric and Extreme Conditions", edited by S. Ptasinska, M. Smialek-Telega, A. Milosavljevic, B. Sivaraman.

  4. Low-energy electron-induced dissociation in condensed-phase L-cysteine II: a comparative study on anion desorption from chemisorbed and physisorbed films

    International Nuclear Information System (INIS)

    Alizadeh, E.; Rowntree, P.A.; Massey, S.; Sanche, L.

    2016-01-01

    In recent years it has become apparent that dissociative attachment of low energy electrons (DEA) is important for the description of radiation damage to biologically relevant molecules and living cells. Due to its multifunctional structure, cysteine is becoming an ideal model molecule for investigating the complex interactions of proteins with metallic surfaces such as gold nanoparticles. We report herein the results of low-energy electron induced degradation of L-cysteine films, chemisorbed on a gold substrate via the thiol group or physisorbed into a clean gold surface. The data were recorded under ultra-high vacuum conditions at room temperature. Anion yields desorbed from these films by the impact of 0.5 to 19 eV electrons provide clear evidence of the efficient decomposition of this amino acid via dissociative electron attachment (i.e., from dissociation of intermediate transient anions located between 5 and 14 eV). The peaks in the desorbed-anion yield functions, associated with DEA, are superimposed on a continuously rising signal attributed to dipolar dissociation. Similar to the results previously observed from physisorbed films, light anionic species, with masses lower than 35 amu, have been detected. In addition, we measured for first time fragments at 14 amu (CH_2"-) and 15 amu (CH_3"-) desorbing from physisorbed films, as well as heavier fragments of mass 45 and 46 amu desorbing from chemisorbed films

  5. Evaluation of an ODS column modified with zwitterionic/nonionic mixed surfactants and its application to direct injection determination of inorganic anions.

    Science.gov (United States)

    Hasegawa, Takuya; Umemura, Tomonari; Koide, Akira; Chiba, Koichi; Ueki, Yuji; Tsunoda, Kin-ichi; Haraguchi, Hiroki

    2005-08-01

    An octadecylsilica (ODS) column modified with zwitterionic/nonionic mixed surfactants was evaluated for the direct injection determination of inorganic anions in biological fluids by ion chromatography. A zwitterionic surfactant (sulfobetaine-type) and a nonionic surfactant (polyoxyethylene-type) were used for a stationary-phase modification. When aqueous electrolyte solutions with concentrations of sub-mM to several mM were used as a mobile phase, the zwitterionic surfactant coated on the ODS surface exhibited unique separation selectivity for ionic species, while the nonionic surfactant coated on the ODS might have formed a hydrophilic network over the ODS surface and restricted matrix proteins from adsorbing on the stationary phase. Consequently, the mixed surfactant-modified column system allowed an efficient ion chromatographic separation of inorganic anions as well as a size-exclusive removal of column-fouling proteins. This separation system was applied to the direct injection determination of UV-absorbing anions in human saliva. The detection limits for nitrite, nitrate, iodide and thiocyanate were 3.1, 2.7, 4.5 and 25 microM, respectively, with UV detection at 210 nm (injection volume; 20 microl), and their relative standard deviations for 5 replicate measurements of saliva samples spiked with 100 microM each of those anions were 1.4, 0.9, 2.2 and 5.5%, respectively.

  6. Synergistic effect of dicarbollide anions in liquid-liquid extraction: a molecular dynamics study at the octanol-water interface.

    Science.gov (United States)

    Chevrot, G; Schurhammer, R; Wipff, G

    2007-04-28

    We report a molecular dynamics study of chlorinated cobalt bis(dicarbollide) anions [(B(9)C(2)H(8)Cl(3))(2)Co](-)"CCD(-)" in octanol and at the octanol-water interface, with the main aim to understand why these hydrophobic species act as strong synergists in assisted liquid-liquid cation extraction. Neat octanol is quite heterogeneous and is found to display dual solvation properties, allowing to well solubilize CCD(-), Cs(+) salts in the form of diluted pairs or oligomers, without displaying aggregation. At the aqueous interface, octanol behaves as an amphiphile, forming either monolayers or bilayers, depending on the initial state and confinement conditions. In biphasic octanol-water systems, CCD(-) anions are found to mainly partition to the organic phase, thus attracting Cs(+) or even more hydrophilic counterions like Eu(3+) into that phase. The remaining CCD(-) anions adsorb at the interface, but are less surface active than at the chloroform interface. Finally, we compare the interfacial behavior of the Eu(BTP)(3)(3+) complex in the absence and in the presence of CCD(-) anions and extractant molecules. It is found that when the CCD(-)'s are concentrated enough, the complex is extracted to the octanol phase. Otherwise, it is trapped at the interface, attracted by water. These results are compared to those obtained with chloroform as organic phase and discussed in the context of synergistic effect of CCD(-) in liquid-liquid extraction, pointing to the importance of dual solvation properties of octanol and of the hydrophobic character of CCD(-) for synergistic extraction of cations.

  7. Highly Sensitive Electrochemical Sensor for the Detection of Anions in Water Based on a Redox-Active Monolayer Incorporating an Anion Receptor.

    Science.gov (United States)

    Kaur, Balwinder; Erdmann, Cristiane Andreia; Daniëls, Mathias; Dehaen, Wim; Rafiński, Zbigniew; Radecka, Hanna; Radecki, Jerzy

    2017-12-05

    In the present work, gold electrodes were modified using a redox-active layer based on dipyrromethene complexes with Cu(II) or Co(II) and a dipodal anion receptor functionalized with dipyrromethene. These modified gold electrodes were then applied for the electrochemical detection of anions (Cl - , SO 4 2- , and Br - ) in a highly diluted water solution (in the picomolar range). The results showed that both systems, incorporating Cu(II) as well as Co(II) redox centers, exhibited highest sensitivity toward Cl - . The selectivity sequence found for both systems was Cl - > SO 4 2- > Br - . The high selectivity of Cl - anions can be attributed to the higher binding constant of Cl - with the anion receptor and the stronger electronic effect between the central metal and anion in the complex. The detection limit for the determination of Cl - was found at the 1.0 pM level for both sensing systems. The electrodes based on Co(II) redox centers displayed better selectivity toward Cl - anion detection than those based on Cu(II) centers which can be attributed to the stronger electronic interaction between the receptor-target anion complex and the Co(II)/Co(III) redox centers in comparison to the Cu(II)/Cu(I) system. Applicability of gold electrodes modified with DPM-Co(II)-DPM-AR for the electrochemical determination of Cl - anions was demonstrated using the artificial matrix mimicking human serum.

  8. Transport behaviors of anionic azo dyes at interface between surfactant-modified flax shives and aqueous solution: Synchrotron infrared and adsorption studies

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Wenxia [MOE Key Laboratory of Resources and Environmental Systems Optimization, Institute for Energy, Environment and Sustainability Research, UR-NCEPU, North China Electric Power University, Beijing, 102206 (China); Huang, Guohe, E-mail: huang@iseis.org [MOE Key Laboratory of Resources and Environmental Systems Optimization, Institute for Energy, Environment and Sustainability Research, UR-NCEPU, North China Electric Power University, Beijing, 102206 (China); An, Chunjiang; Xin, Xiaying [Institute for Energy, Environment and Sustainable Communities, University of Regina, Regina, S4S 0A2 (Canada); Zhang, Yan [MOE Key Laboratory of Resources and Environmental Systems Optimization, Institute for Energy, Environment and Sustainability Research, UR-NCEPU, North China Electric Power University, Beijing, 102206 (China); Liu, Xia [Canadian Light Source, Saskatoon, S7N 2V3 (Canada)

    2017-05-31

    Highlights: • Surfactant modified flax shives for removing anionic azo dyes. • The equilibrium and kinetic studies for the adsorption of anionic azo dyes. • The migration patterns of dye pollutants at flax shive-water interface. • New insights from synchrotron infrared-assisted characterization. • Potential as biomass adsorbent for the removal of dyes from wastewater. - Abstract: From the viewpoint of sustainability, biomass adsorbent has a high potential in pollution control and there is an emerging interest to investigate the behaviors of pollutants at the interface between biomass adsorbent and solution. This study investigated the performance of cetyltrimethylammonium bromide surfactant-modified flax shives (MFS) for removal of anionic azo dyes from aqueous solution. The equilibrium and kinetic analysis for the adsorption of Acid Orange 7 (AO-7), Acid Red 18 (AR-18) and Acid Black 1 (AB-1) on MFS were conducted. The surface of MFS was characterized by synchrotron infrared and SEM analysis. The absorbed amount of three anionic azo dyes varied with the change of adsorbent dosage, pH and ionic strength. The adsorption isotherm data well fit to the Langmuir model. The adsorption process followed the pseudo-second-order kinetics and the liquid film diffusion models. Thermodynamic studies indicated that the adsorption of three anionic azo dyes was spontaneous. The adsorption of AR-18 and AB-1 onto MFS was endothermic while the adsorption of AO-7 was exothermic. The results can help better understand the behaviors of organic pollutants at biomass adsorbent-water interface. They also present the potential of using MFS as a suitable adsorbent for the removal of anionic azo dyes from wastewater.

  9. Transport behaviors of anionic azo dyes at interface between surfactant-modified flax shives and aqueous solution: Synchrotron infrared and adsorption studies

    International Nuclear Information System (INIS)

    Wang, Wenxia; Huang, Guohe; An, Chunjiang; Xin, Xiaying; Zhang, Yan; Liu, Xia

    2017-01-01

    Highlights: • Surfactant modified flax shives for removing anionic azo dyes. • The equilibrium and kinetic studies for the adsorption of anionic azo dyes. • The migration patterns of dye pollutants at flax shive-water interface. • New insights from synchrotron infrared-assisted characterization. • Potential as biomass adsorbent for the removal of dyes from wastewater. - Abstract: From the viewpoint of sustainability, biomass adsorbent has a high potential in pollution control and there is an emerging interest to investigate the behaviors of pollutants at the interface between biomass adsorbent and solution. This study investigated the performance of cetyltrimethylammonium bromide surfactant-modified flax shives (MFS) for removal of anionic azo dyes from aqueous solution. The equilibrium and kinetic analysis for the adsorption of Acid Orange 7 (AO-7), Acid Red 18 (AR-18) and Acid Black 1 (AB-1) on MFS were conducted. The surface of MFS was characterized by synchrotron infrared and SEM analysis. The absorbed amount of three anionic azo dyes varied with the change of adsorbent dosage, pH and ionic strength. The adsorption isotherm data well fit to the Langmuir model. The adsorption process followed the pseudo-second-order kinetics and the liquid film diffusion models. Thermodynamic studies indicated that the adsorption of three anionic azo dyes was spontaneous. The adsorption of AR-18 and AB-1 onto MFS was endothermic while the adsorption of AO-7 was exothermic. The results can help better understand the behaviors of organic pollutants at biomass adsorbent-water interface. They also present the potential of using MFS as a suitable adsorbent for the removal of anionic azo dyes from wastewater.

  10. Solution and gas phase evidence of anion binding through the secondary bonding interactions of a bidentate bis-antimony(iii) anion receptor.

    Science.gov (United States)

    Qiu, J; Song, B; Li, X; Cozzolino, A F

    2017-12-20

    The solution and gas phase halide binding to a bis-antimony(iii) anion receptor was studied. This new class of anion receptors utilizes the strong Sb-centered secondary bonding interactions (SBIs) that are formed opposite to the polar Sb-O primary bond. 1 H NMR titration data were fitted statistically to binding models and solution-phase binding energetics were extracted, while the formation of anion-to-receptor complexes was observed using ESI-MS. Density functional theory calculations suggest that their affinity towards binding halide anions is mitigated by the strong explicit solvation effect in DMSO, which gives insights into future designs that circumvent direct solvent binding and are anticipated to yield tighter and perhaps more selectivity in anion binding.

  11. N-acetylglyoxylic amide bearing a nitrophenyl group as anion receptors: NMR and X-ray investigations on anion binding and selectivity

    Science.gov (United States)

    Suryanti, Venty; Bhadbhade, Mohan; Black, David StC; Kumar, Naresh

    2017-10-01

    N-Nitrophenylglyoxylic amides 1 and 2 in presence of tetrabutylammonium cation (TBA) act as receptors for anions HSO4-, Cl-, Br- and NO3- as investigated by NMR studies. The receptors formed 1:1 host-guest complexes in solution. X-ray structure of 1 along with TBA that bind a chloride anion is reported. Molecule 1 showed the highest selectivity for HSO4- anion over others measured. X-ray structure of the bound Cl- revealed a pocket containing the anion making strong (Nsbnd H⋯Cl) and weak hydrogen bonds (Csbnd H⋯Cl) that contribute to the recognition of the chloride anion. Nsbnd H and Csbnd H hydrogen bonds resulted in a relatively strong binding for chloride ions.

  12. Adsorption and desorption dynamics of citric acid anions in soil

    KAUST Repository

    Oburger, E.

    2011-07-26

    The functional role of organic acid anions in soil has been intensively investigated, with special focus on (i) microbial respiration and soil carbon dynamics, (ii) nutrient solubilization or (iii) metal detoxification and reduction of plant metal uptake. Little is known about the interaction dynamics of organic acid anions with the soil matrix and the potential impact of adsorption and desorption processes on the functional significance of these effects. The aim of this study was to characterize experimentally the adsorption and desorption dynamics of organic acid anions in five agricultural soils differing in iron and aluminium oxide contents and using citrate as a model carboxylate. Results showed that both adsorption and desorption processes were fast in all soils, reaching a steady state within approximately 1 hour. However, for a given total soil citrate concentration (ct) the steady state was critically dependent on the starting conditions of the experiment, whether most of the citrate was initially present in solution (cl) or held on the solid phase (cs). Specifically, desorption-led processes resulted in significantly smaller steady-state solution concentrations than adsorption-led processes, indicating that hysteresis occurred. As it is not possible to distinguish between different adsorption and desorption pools in soil experimentally, a new dynamic hysteresis model that relies only on measured soil solution concentrations was developed. The model satisfactorily explained experimental data and was able to predict dynamic adsorption and desorption behaviour. To demonstrate its use, we applied the model to two relevant situations involving exudation and microbial degradation. The study highlighted the complex nature of citrate adsorption and desorption dynamics in soil. We conclude that existing models need to incorporate both temporal and hysteresis components to describe realistically the role and fate of organic acids in soil processes. © 2011 The

  13. Natural minerals and synthetic materials for sorption of radioactive anions

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Mun Ja; Chun, Kwan Sik; Kim, Seung Soo

    1998-07-01

    Technetium-99 and iodine-129 are fission products with long half-lives, and exist as highly soluble anionic species. Studies on natural and synthetic materials sorbing TcO{sub 4} and/or I have been performed by several researchers. The application of these materials as an additive in the high-level waste disposal has been considered. The iron- or sulfide-containing minerals such as metal iron, iron powder, stibnite and pyrrhotite show a high capacity for TcO{sub 4} sorption. And the small amounts of activated carbon are reported to have high distribution coefficients recently. In the iodine sorption studies, sulfide-, copper-, lead- or mercury-containing minerals can be a candidate. Pyrite, chalcopyrite, galena, Cu{sub 2}S and CuS reveal a high capacity for I sorption. The synthetic materials were found to have high sorption capacity and compensate the defects of natural minerals, which contain hydrous oxides such as zirconium oxide, aluminium oxide and mercarbide. The mercarbide has the high distribution coefficients for the sorption of TcO{sub 4} and I. Recently it was proposed that the synthetic clay, hydrotalcite, could be useful for the fixation of anion. However, to determine the applicability of those natural and synthetic materials as an additive to a buffer or backfill material for sorption of TcO{sub 4} and/or I, the sorption behavior of the anions on those materials under the repository conditions should be identified. (author). 32 refs., 21 tabs., 10 figs

  14. REMOVAL OF ANIONIC SURFACTANTS FROM WASTEWATER BY MAGNETIC MINERAL SORBENTS

    Directory of Open Access Journals (Sweden)

    Oksana Vladimirova Makarchuk

    2016-07-01

    Full Text Available The simplest and most effective method of removing low concentrations of anionic surfactants such as sodium dodecyl benzenesulfonate (SDBS and sodium lauryl sulfate (SLS is adsorption. Among adsorbents the natural clays are cheap and promising for these purposes. However, there are significant difficulties in removal of spent sorbent after the adsorption process. So, the creation of magnetic sorbents that can be effectively removed from water after sorption by magnetic separation will be a successful decision. The aim of this investigation is the creation of cheap and efficient magnetic sorbents based on natural clays and magnetite for anionic surfactant removal from wastewater. We have synthesized a series of magnetic sorbents from different natural clays with a content of magnetite from 2 to 10 wt%. The ability of magnetic sorbents to remove SDBS and SLS from aqueous solutions has been studied for different adsorbate concentrations by varying the amount of adsorbent, temperature and shaking time. Thermodynamic parameters were calculated from the slope and intercept of the linear plots of ln K against 1/T. Analysis of adsorption results obtained at different temperatures showed that the adsorption pattern on magnetic sorbents correspond to the Langmuir isotherm. It is shown that with increasing the content of magnetite in the magnetic sorbents improves not only their separation from water by magnetic separation, but adsorption capacity to SDBS and SLS. Thus, we obtained of cheap magnetic sorbents based on natural clays and magnetite by the easy way, which not only quickly separated from the solution by magnetic separation, but effectively remove anionic surfactants.

  15. Fixation of metallic sulfosalicylate complexes on an anionic exchange resin

    International Nuclear Information System (INIS)

    Cahuzac, S.

    1969-06-01

    Since sulfosalicylate ions have acid-base properties, sulfosalicylate complexes have an apparent stability which varies with the ph. As a result, the fixation of sulfo-salicylates on an anionic exchange resin depends on the ph of the solution in equilibrium with the resin. This research has been aimed at studying the influence of the ph on the fixation on an anionic exchange resin (Dowex 1 x 4) of sulfosalicylate anions on the one hand, and of metallic sulfosalicylate complexes on the other hand. In the first part of this work, a determination has been made, by frontal analysis of the distribution of sulfosalicylate ions in the resin according to the total sulfosalicylate I concentration in the aqueous solution in equilibrium with the resin. The exchange constants of these ions between the resin and the solution have been calculated. In the second part, a study has been made of the fixation of anionic sulfosalicylate complexes of Fe(III), Al(III), Cr(III), Cu(II), Ni(II), Co(II), Zn(II), Mn(II), Cd(II), Fe(II) and UO 2 2+ . By measuring the partition coefficients of these different elements between the resin and the solution it has been possible to give interpretation for the modes of fixation of the metallic ions, and to calculate their exchange constant between the resin and the solution. The relationship has been established for each metallic element studied, between its partition coefficient, the ph and the total concentration of the complexing agent in solution. Such a relationship makes it possible to predict, for given conditions, the nature of the species in solution and in the resin, as well as the partition coefficient of a metallic, element. Finally, in the third part of the work, use has been made of results obtained previously, to carry out some separations (Ni 2+ - Co 2+ ; Ni 2+ - Co 2+ - Cu 2+ ; UO 2 2+ - Fe 3+ ; UO 2 2+ - Cr 3+ ; UO 2 2+ - Cu 2+ ; UO 2 2+ - Ni 2+ ; UO 2 2+ - Co 2+ ; UO 2 2+ - Mn 2+ and UO 2 2+ - Cd 2+ ), as well as the purification

  16. On the Adsorption of Some Anionic Collectors on Fluoride Minerals

    DEFF Research Database (Denmark)

    Sørensen, Emil

    1973-01-01

    Test flotations have been carried out in a small apparatus under standardized conditions in order to determine the dependence of the flotation yield on the reagent concentration for certain minerals and anionic collectors. The results suggest that a special adsorption mechanism is operating...... in the case of fluoride minerals, and a theory is presented which involves the joint action of ionic and hydrogen bonds. A precondition is the compatibility of the crystal geometry with the configuration of the polar group of the collector molecules....

  17. Review: equipment for anionic surfactant manufacture from oil palm

    Directory of Open Access Journals (Sweden)

    Jesús Alfonso Torres Ortega

    2010-05-01

    Full Text Available In the present study is performed a review of the current processes of sulfonation of various raw materials for determine the process conditions in order to present the state of the art of sulfonation processes for the manufacture of anionic surfactants. There has been a scientific literature with emphasis on several aspects: Technology, sulfonation reactors and operating conditions in the process, analytical techniques for monitoring the reaction degree, the mathematical models proposed in the literature for the sulfonation/sulfation in tubular absorbers, patenting and specialized industry publications in this area.

  18. Quenching of p-Cyanophenylalanine Fluorescence by Various Anions.

    Science.gov (United States)

    Pazos, Ileana M; Roesch, Rachel M; Gai, Feng

    2013-03-20

    To expand the spectroscopic utility of the non-natural amino acid p -cyanophenylalanine (Phe CN ), we examine the quenching efficiencies of a series of commonly encountered anions toward its fluorescence. We find that iodide exhibits an unusually large Stern-Volmer quenching constant, making it a convenient choice in Phe CN fluorescence quenching studies. Indeed, using the villin headpiece subdomain as a testbed we demonstrate that iodide quenching of Phe CN fluorescence offers a convenient means to reveal protein conformational heterogeneity. Furthermore, we show that the amino group of Phe CN strongly quenches its fluorescence, suggesting that Phe CN could be used as a local pH sensor.

  19. Minority anion substitution by Ni in ZnO

    CERN Document Server

    Pereira, Lino Miguel da Costa; Correia, João Guilherme; Amorim, Lígia Marina; Silva, Daniel José; David-Bosne, Eric; Decoster, Stefan; da Silva, Manuel Ribeiro; Temst, Kristiaan; Vantomme, André

    2013-01-01

    We report on the lattice location of implanted Ni in ZnO using the $\\beta$− emission channeling technique. In addition to the majority substituting for the cation (Zn), a significant fraction of the Ni atoms occupy anion (O) sites. Since Ni is chemically more similar to Zn than it is to O, the observed O substitution is rather puzzling. We discuss these findings with respect to the general understanding of lattice location of dopants in compound semiconductors. In particular, we discuss potential implications on the magnetic behavior of transition metal doped dilute magnetic semiconductors.

  20. Molecular Recognition: Preparation and Characterization of Two Tripodal Anion Receptors

    Energy Technology Data Exchange (ETDEWEB)

    Shokri, Alireza; Deng, Shihu; Wang, Xue B.; Kass, Steven R.

    2014-03-01

    Two new tripodal hydroxyl-based anion receptors (1 and 2) are reported and their molecular complexes with Cl–, H2PO4 –, and OAc– along with the (M–1)– ion of 1 were characterized by negative ion photoelectron spectroscopy in the gas phase and by binding constant determinations in four solvents (i.e., CDCl3, CD2Cl2, CD3COCD3, and CD3CN). An intramolecular hydrogen bond network (HBN) in hexaol 1 was found to diminish its binding whereas the triol 2 is the strongest aliphatic hydroxyl-based receptor to date.

  1. Registration of interstitial anions in irradiated MgO crystals

    International Nuclear Information System (INIS)

    Surzhikov, A.P.; Pogrebnyak, A.D.

    1985-01-01

    Possibility of application of positron annihilation for detection in oxides of rare earth metals with interstitial component of Frenkel anion defects is revealed. Magnesium oxide monocrystals with Ca, Si, Fe, Al impurity contents of 0.1 wt.% were investigated. These crystals were irradiated by X-rays (45 kV, 20 μA) and protons (10 MeV). It is shown that heating of magnesium oxide crystals irradiated by protons up to 700 K completely anneals F + -centers. In this case the component disappears inth the pulse distributon at xi=5.0; the subsequent crystal irradiation with X-ray does not lead to its reduction

  2. Separation of boron isotopes using NMG type anion exchange resin

    International Nuclear Information System (INIS)

    Itagaki, Takaharu; Kosuge, Masao; Fukuda, Junji; Fujii, Yasuhiko.

    1992-01-01

    Ion exchange separation of boron isotopes (B-10 and B-11) has been studied by using a special boron selective ion exchange resin; NMG (n-methyl glucamine)-type anion exchange resin. The resin has shown a large isotope separation coefficient of 1.02 at the experimental conditions of temperature, 80degC, and boric acid concentration, 0.2 M (mole/dm 3 ). Enriched B-10 (92%) was obtained after the migration of 1149 m by a recyclic operation of ion exchange columns in a merry-go-round method. (author)

  3. Signal amplification in electrochemical detection of buckwheat allergenic protein using field effect transistor biosensor by introduction of anionic surfactant

    Directory of Open Access Journals (Sweden)

    Sho Hideshima

    2016-03-01

    Full Text Available Food allergens, especially buckwheat proteins, sometimes induce anaphylactic shock in patients after ingestion. Development of a simple and rapid screening method based on a field effect transistor (FET biosensor for food allergens in food facilities or products is in demand. In this study, we achieved the FET detection of a buckwheat allergenic protein (BWp16, which is not charged enough to be electrically detected by FET biosensors, by introducing additional negative charges from anionic surfactants to the target proteins. A change in the FET characteristics reflecting surface potential caused by the adsorption of target charged proteins was observed when the target sample was coupled with the anionic surfactant (sodium dodecyl sulfate; SDS, while no significant response was detected without any surfactant treatment. It was suggested that the surfactant conjugated with the protein could be useful for the charge amplification of the target proteins. The surface plasmon resonance analysis revealed that the SDS-coupled proteins were successfully captured by the receptors immobilized on the sensing surface. Additionally, we obtained the FET responses at various concentrations of BWp16 ranging from 1 ng/mL to 10 μg/mL. These results suggest that a signal amplification method for FET biosensing is useful for allergen detection in the food industry. Keywords: Field effect transistor biosensor, Food allergen, Signal amplification, Ionic surfactant, Intrinsic charge

  4. Diffusion, sorption, and retardation processes of anions in bentonite and organo-bentonites for multibarrier systems

    Science.gov (United States)

    Schampera, Birgit; Dultz, Stefan

    2013-04-01

    The low permeability, high cation exchange capacity (CEC) and plasticity of bentonites favor their use in multibarrier systems of waste deposits [1]. Bentonites have a high CEC but their ability to sorb anions is very low. There is, however, need for retardation of anions and organic pollutants in many applications. Bentonites, modified with certain organic cations, have the capacity to sorb anions and non-polar organic compounds in addition to cations. Investigations on organically modified clays address a wide variety of applications including immobilization of pollutants in contaminated soils, waste water treatment and in situ placement for the protection of ground water [2]. Many experiments on anion and cation sorption of organo-clays were conducted in the batch mode which does not reflect solid-liquid ratios and material densities in barrier systems. Diffusion experiments on compacted clays allow the evaluation of transport processes and sorption of pollutants at conditions relevant for repositories. For organo-clays only few diffusion studies are published e.g. [3] measured the diffusion of tritium and [4] the diffusion of H2O in bentonite and organo-bentonites. The organic cation hexadecylpyridinium (HDPy) was added to Wyoming bentonite (MX-80) in amounts corresponding to 2-400 % of the CEC. The uptake of organic cations was determined by the C-content, XRD and IR-spectroscopy. Wettability was analyzed by the contact angle. Physical, chemical and mineralogical properties of clays were characterized. Diffusion experiments were carried out in situ in a cell attached to the ATR-unit of a FTIR-spectrometer. For H2O-diffusion the compacted organo-clays are saturated first with D2O, afterwards H2O is supplied to the surface at the top of the clay platelet. Anion-diffusion was conducted with NO3--solution instead of H2O only having characteristic IR band positions at 1350 cm-1. Three different concentrations (0.25M, 0.5M and 1M) were used. Additional batch

  5. Formation of hydrotalcite in aqueous solutions and intercalation of ATP by anion exchange.

    Science.gov (United States)

    Tamura, Hiroki; Chiba, Jun; Ito, Masahiro; Takeda, Takashi; Kikkawa, Shinichi; Mawatari, Yasuteru; Tabata, Masayoshi

    2006-08-15

    The formation reaction and the intercalation of adenosine triphosphate (ATP) were studied for hydrotalcite (HT), a layered double hydroxide (LDH) of magnesium and aluminum. Hydrotalcite with nitrate ions in the interlayer (HT-NO(3)) was formed (A) by dropwise addition of a solution of magnesium and aluminum nitrates (pH ca. 3) to a sodium hydroxide solution (pH ca. 14) until the pH decreased from 14 to 10 and (B) by dropwise addition of the NaOH solution to the solution of magnesium and aluminum nitrates with pH increasing from 3 to 10. The precipitate obtained with method B was contaminated with aluminum hydroxide and the crystallinity of the product was low, possibly because aluminum hydroxide precipitates at pH 4 or 5 and remains even after HT-NO(3) forms at pH above 8. With method A, however, the precipitate was pure HT-NO(3) with increased crystallinity, since the solubility of aluminum hydroxide at pH above and around 10 is high as dissolved aluminate anions are stable in this high pH region, and there was no aluminum hydroxide contamination. The formed HT-NO(3) had a composition of [Mg(0.71)Al(0.29)(OH)(2)](NO(3))(0.29).0.58H(2)O. To intercalate ATP anions into the HT-NO(3), HT-NO(3) was dispersed in an ATP solution at pH 7. It was found that the interlayer nitrate ions were completely exchanged with ATP anions by ion exchange, and the interlayer distance expanded almost twice with a free space distance of 1.2 nm. The composition of HT-ATP was established as [Mg(0.68)Al(0.32)(OH)(2)](ATP)(0.080)0.88H(2)O. The increased distance could be explained with a calculated molecular configuration of the ATP as follows: An ATP molecule is bound to an interlayer surface with the triphosphate group, the adenosine group bends owing to its bond angles and projects into the interlayer to a height of 1 nm, and the adenosine groups aligned in the interlayer support the interlayer distance.

  6. Zn-Al LAYERED DOUBLE HYDROXIDE PILLARED BY DIFFERENT DICARBOXYLATE ANIONS

    Directory of Open Access Journals (Sweden)

    S. Gago

    2004-12-01

    Full Text Available Zn-Al layered double hydroxides (LDHs intercalated by terephthalate (TPH and biphenyl-4,4'-dicarboxylate (BPH anions have been synthesized by direct co-precipitation from aqueous solution. The Zn/Al ratio in the final materials was 1.8. The products were characterized by powder X-ray diffraction, thermogravimetric analysis, FTIR and FT Raman spectroscopy, and MAS NMR spectroscopy. The basal spacing for the TPH-LDH intercalate was 14.62 Å, indicating that the guest anions stack to form a monolayer with the aromatic rings perpendicular to the host layers. For the LDH intercalate containing BPH anions, a basal spacing of at least 19.2 Å would be expected if the anions adopted an arrangement similar to that for the TPH anions. The observed spacing was 18.24 Å, suggesting that the anions are tilted slightly with respect to the host layers.

  7. Review of cell performance in anion exchange membrane fuel cells

    Science.gov (United States)

    Dekel, Dario R.

    2018-01-01

    Anion exchange membrane fuel cells (AEMFCs) have recently received increasing attention since in principle they allow for the use of non-precious metal catalysts, which dramatically reduces the cost per kilowatt of power in fuel cell devices. Until not long ago, the main barrier in the development of AEMFCs was the availability of highly conductive anion exchange membranes (AEMs); however, improvements on this front in the past decade show that newly developed AEMs have already reached high levels of conductivity, leading to satisfactory cell performance. In recent years, a growing number of research studies have reported AEMFC performance results. In the last three years, new records in performance were achieved. Most of the literature reporting cell performance is based on hydrogen-AEMFCs, although an increasing number of studies have also reported the use of fuels others than hydrogen - such as alcohols, non-alcohol C-based fuels, as well as N-based fuels. This article reviews the cell performance and performance stability achieved in AEMFCs through the years since the first reports in the early 2000s.

  8. Dynamics of anion-molecule reactions at low energy

    International Nuclear Information System (INIS)

    Mikosch, J.

    2007-11-01

    Anion-molecule reactions must find their way through deeply bound entrance and exit channel complexes separated by a central barrier. This results in low reaction rates and rich dynamics since direct pathways compete with the formation of transient intermediates. In this thesis we examine the probability of proton transfer to a small anion and transient lifetimes of a thermoneutral bimolecular nucleophilic substitution (S N 2) reaction at well defined variable temperature down to 8 Kelvin in a multipole trap. The observed strong inverse temperature dependence is attributed to the deficit of available quantum states in the entrance channel at decreasing temperature. Furthermore we investigate scattering dynamics of S N 2 reactions at defined relative energy between 0.4 and 10 eV by crossed beam slice imaging. A weakly exothermic reaction with high central barrier proceeds via an indirect, complex-mediated mechanism at low relative energies featuring high internal product excitation in excellent quantitative agreement with a statistical model. In contrast, direct backward scattering prevails for higher energies with product velocities close to the kinematical cutoff. For a strongly exothermic reaction, competing S N 2-, dihalide- and proton transfer-channels are explored which proceed by complex mediation for low energy and various rebound-, grazing- and collision induced bond rupture-mechanisms at higher energy. From our data and a collaboration with theory we identify a new indirect roundabout S N 2 mechanism involving CH 3 -rotation. (orig.)

  9. Improved Performance of Ionic Liquid Supercapacitors by using Tetracyanoborate Anions.

    Science.gov (United States)

    Martins, Vitor L; Rennie, Anthony J R; Sanchez-Ramirez, Nedher; Torresi, Roberto M; Hall, Peter J

    2018-02-01

    Supercapacitors are energy storage devices designed to operate at higher power densities than conventional batteries, but their energy density is still too low for many applications. Efforts are made to design new electrolytes with wider electrochemical windows than aqueous or conventional organic electrolytes in order to increase energy density. Ionic liquids (ILs) with wide electrochemical stability windows are excellent candidates to be employed as supercapacitor electrolytes. ILs containing tetracyanoborate anions [B(CN) 4 ] offer wider electrochemical stability than conventional electrolytes and maintain a high ionic conductivity (6.9 mS cm -1 ). Herein, we report the use of ILs containing the [B(CN) 4 ] anion for such an application. They presented a high maximum operating voltage of 3.7 V, and two-electrode devices demonstrate high specific capacitances even when operating at relatively high rates (ca. 20 F g -1 @ 15 A g -1 ). This supercapacitor stored more energy and operated at a higher power at all rates studied when compared with cells using a commonly studied ILs.

  10. Absorption spectrum of the firefly luciferin anion isolated in vacuo.

    Science.gov (United States)

    Støchkel, Kristian; Milne, Bruce F; Brøndsted Nielsen, Steen

    2011-03-24

    The excited-state physics of the firefly luciferin anion depends on its chemical environment, and it is therefore important to establish the intrinsic behavior of the bare ion. Here we report electronic absorption spectra of the anion isolated in vacuo obtained at an electrostatic ion storage ring and an accelerator mass spectrometer where ionic dissociation is monitored on a long time scale (from 33 μs and up to 3 ms) and on a short time scale (0-3 μs), respectively. In the ring experiment the yield of all neutrals (mainly CO(2)) as a function of wavelength was measured whereas in the single pass experiment, the abundance of daughter ions formed after loss of CO(2) was recorded to provide action spectra. We find maxima at 535 and 265 nm, and that the band shape is largely determined by the sampling time interval, which is due to the kinetics of the dissociation process. Calculations at the TD-B3LYP/TZVPP++ level predict maximum absorption at 533 and 275 nm for the carboxylate isomer in excellent agreement with the experimental findings. The phenolate isomer lies higher in energy by 0.22 eV, and also its absorption maximum is calculated to be at 463 nm, which is far away from the experimental value. Our data serve to benchmark future theoretical models for bioluminescence from fireflies.

  11. Cation-enhanced capillary electrophoresis separation of atropoisomer anions.

    Science.gov (United States)

    Na, Yun-Cheol; Berthod, Alain; Armstrong, Daniel W

    2015-12-01

    CE was used to study the separation of the atropoisomers of four phosphoric acids and two sulfonic acids and the enantiomers of two phosphoric acids. All solutes are in their anionic forms in aqueous electrolytes. The chiral additives were two hydroxypropyl cyclodextrins (CDs) and cyclofructan 6 (CF6). The CDs were able to separate four solutes and the CF6 additive could separate only one: 1,1'-binaphthyl-2,2'-diyl hydrogenphosphate (BHP). Since CF6 is able to bind with cations, nitrate of alkaline metals, Ba(2+) , and Pb(2+) were added, greatly improving the BHP separation at the expense of longer migration times. There seems to be a link between CF6-cation-binding constants and BHP resolution factors. Cation additions were also performed with CD selectors that are less prone to form complexes with cations. Significant improvements of enantiomer or atropoisomer separations were observed also associated with longer migration times. It is speculated that the anionic solutes associate with the added cations forming larger entities better differentiated by CDs. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Synthetic cation-selective nanotube: permeant cations chaperoned by anions.

    Science.gov (United States)

    Hilder, Tamsyn A; Gordon, Dan; Chung, Shin-Ho

    2011-01-28

    The ability to design ion-selective, synthetic nanotubes which mimic biological ion channels may have significant implications for the future treatment of bacteria, diseases, and as ultrasensitive biosensors. We present the design of a synthetic nanotube made from carbon atoms that selectively allows monovalent cations to move across and rejects all anions. The cation-selective nanotube mimics some of the salient properties of biological ion channels. Before practical nanodevices are successfully fabricated it is vital that proof-of-concept computational studies are performed. With this in mind we use molecular and stochastic dynamics simulations to characterize the dynamics of ion permeation across a single-walled (10, 10), 36 Å long, carbon nanotube terminated with carboxylic acid with an effective radius of 5.08 Å. Although cations encounter a high energy barrier of 7 kT, its height is drastically reduced by a chloride ion in the nanotube. The presence of a chloride ion near the pore entrance thus enables a cation to enter the pore and, once in the pore, it is chaperoned by the resident counterion across the narrow pore. The moment the chaperoned cation transits the pore, the counterion moves back to the entrance to ferry another ion. The synthetic nanotube has a high sodium conductance of 124 pS and shows linear current-voltage and current-concentration profiles. The cation-anion selectivity ratio ranges from 8 to 25, depending on the ionic concentrations in the reservoirs.

  13. Dynamics of anion-molecule reactions at low energy

    Energy Technology Data Exchange (ETDEWEB)

    Mikosch, J.

    2007-11-15

    Anion-molecule reactions must find their way through deeply bound entrance and exit channel complexes separated by a central barrier. This results in low reaction rates and rich dynamics since direct pathways compete with the formation of transient intermediates. In this thesis we examine the probability of proton transfer to a small anion and transient lifetimes of a thermoneutral bimolecular nucleophilic substitution (S{sub N}2) reaction at well defined variable temperature down to 8 Kelvin in a multipole trap. The observed strong inverse temperature dependence is attributed to the deficit of available quantum states in the entrance channel at decreasing temperature. Furthermore we investigate scattering dynamics of S{sub N}2 reactions at defined relative energy between 0.4 and 10 eV by crossed beam slice imaging. A weakly exothermic reaction with high central barrier proceeds via an indirect, complex-mediated mechanism at low relative energies featuring high internal product excitation in excellent quantitative agreement with a statistical model. In contrast, direct backward scattering prevails for higher energies with product velocities close to the kinematical cutoff. For a strongly exothermic reaction, competing S{sub N}2-, dihalide- and proton transfer-channels are explored which proceed by complex mediation for low energy and various rebound-, grazing- and collision induced bond rupture-mechanisms at higher energy. From our data and a collaboration with theory we identify a new indirect roundabout S{sub N}2 mechanism involving CH{sub 3}-rotation. (orig.)

  14. Ultracold Anions for High-Precision Antihydrogen Experiments.

    Science.gov (United States)

    Cerchiari, G; Kellerbauer, A; Safronova, M S; Safronova, U I; Yzombard, P

    2018-03-30

    Experiments with antihydrogen (H[over ¯]) for a study of matter-antimatter symmetry and antimatter gravity require ultracold H[over ¯] to reach ultimate precision. A promising path towards antiatoms much colder than a few kelvin involves the precooling of antiprotons by laser-cooled anions. Because of the weak binding of the valence electron in anions-dominated by polarization and correlation effects-only few candidate systems with suitable transitions exist. We report on a combination of experimental and theoretical studies to fully determine the relevant binding energies, transition rates, and branching ratios of the most promising candidate La^{-}. Using combined transverse and collinear laser spectroscopy, we determined the resonant frequency of the laser cooling transition to be ν=96.592 713(91)  THz and its transition rate to be A=4.90(50)×10^{4}  s^{-1}. Using a novel high-precision theoretical treatment of La^{-} we calculated yet unmeasured energy levels, transition rates, branching ratios, and lifetimes to complement experimental information on the laser cooling cycle of La^{-}. The new data establish the suitability of La^{-} for laser cooling and show that the cooling transition is significantly stronger than suggested by a previous theoretical study.

  15. Novel Fragmentation Pathways of Anionic Adducts of Steroids Formed by Electrospray Anion Attachment Involving Regioselective Attachment, Regiospecific Decompositions, Charge-Induced Pathways, and Ion-Dipole Complex Intermediates

    Science.gov (United States)

    Rannulu, Nalaka S.; Cole, Richard B.

    2012-09-01

    The analysis of several bifunctional neutral steroids, 5-α-pregnane diol (5-α-pregnane-3α-20βdiol), estradiol (3,17α-dihydroxy-1,3,5(10)-estratriene), progesterone (4-pregnene-3,20-dione), lupeol (3β-hydroxy-20(29)-lupene), pregnenolone (5-pregnen-3β-ol-20-one), and pregnenolone acetate (5-pregnen-3β-ol-20-one acetate) was accomplished by negative ion electrospray mass spectrometry (ESI-MS) employing adduct formation with various anions: fluoride, bicarbonate, acetate, and chloride. Fluoride yielded higher abundances of anionic adducts and more substantial abundances of deprotonated molecules compared with other investigated anions. Collision-induced dissociation (CID) of precursor [M + anion]- adducts of these steroids revealed that fluoride adduct [M + F]- precursors first lose HF to produce [M - H]- and then undergo consecutive decompositions to yield higher abundances of structurally-informative product ions than the other tested anions. In addition to charge-remote fragmentations, the majority of CID pathways of estradiol are deduced to occur via charge-induced fragmentation. Most interestingly, certain anions exhibit preferential attachment to a specific site on these bifunctional steroid molecules, which we are calling "regioselective anion attachment." Regioselective anion attachment is evidenced by subsequent regiospecific decomposition. Regioselective attachment of fluoride (and acetate) anions to low (and moderate) acidity functional groups of pregnenolone, respectively, is demonstrated using deuterated compounds. Moreover, the formation of unique intermediate ion-dipole complexes leading to novel fragmentation pathways of fluoride adducts of pregnenolone acetate, and bicarbonate adducts of d4-pregnenolone, are also discussed.

  16. Biogeochemical behaviour of anionic radionuclides in soil: evidence for biotic interactions

    International Nuclear Information System (INIS)

    Fevrier, L.; Martin-Garin, A.

    2004-01-01

    Among studies on radionuclides, very few have been devoted to the behaviour of long-lived anionic radionuclides as 99 Tc and 79 Se in soils. Yet these two species are supposed to be highly mobile in soils, because of their anionic forms. The understanding of their biogeochemical behaviour in soils will improve both the ecological and health risk assessment. Very often the interactions between the radionuclides and the different components of soil are considered only from a physico-chemical point of view. However in surface horizons and more specially in the rhizosphere, the micro-organisms can not be ignored as they can affect either directly or indirectly the speciation of most of the chemical species, and particularly these of Se and Tc. This study demonstrates the role of the microbial compartment in the retention of Se and Tc in soil by comparing experiments with a sterilized soil (no microbial activity) to experiments with a soil more or less amended with organic carbon and / or nitrate, to stimulate its microbial activity. Kd coefficients for Se and Tc were determined in batch experiments, whereas transport of Se and Tc was investigated through column leaching experiments. Kd for Se was enhanced for the natural soil without amendment compared to the value obtained for the sterilized soil. The retention of Se was higher again in the natural soil amended with glucose and nitrate together. In addition, these amendments facilitated the development of a biofilm at the entrance of the column, which can directly retain Se. This effect was less obvious for Tc in batch experiments, but was revealed by leaching experiments where a high quantity of Tc was retained in the soil column when added with glucose and nitrate. These results give evidence that micro-organisms are responsible for a greater retention of Se and Tc in soil. (author)

  17. A combined experimental and computational study of the molecular interactions between anionic ibuprofen and water

    Energy Technology Data Exchange (ETDEWEB)

    Zapata-Escobar, Andy; Manrique-Moreno, Marcela; Guerra, Doris; Hadad, C. Z.; Restrepo, Albeiro, E-mail: albeiro@exactas.udea.edu.co [Instituto de Química, Universidad de Antioquia UdeA, Calle 70 No. 52–21, Medellín (Colombia)

    2014-05-14

    In this work, we report a detailed study of the microsolvation of anionic ibuprofen, Ibu{sup −}. Stochastic explorations of the configurational spaces for the interactions of Ibu{sup −} with up to three water molecules at the DFT level lead to very rich and complex potential energy surfaces. Our results suggest that instead of only one preponderant structure, a collection of isomers with very similar energies would have significant contributions to the properties of the solvated drug. One of these properties is the shift on the vibrational frequencies of the asymmetric stretching band of the carboxylate group in hydrated Ibu{sup −} with respect to the anhydrous drug, whose experimental values are nicely reproduced using the weighted contribution of the structures. We found at least three types of stabilizing interactions, including conventional CO {sub 2}{sup −}⋯H{sub 2}O, H{sub 2}O⋯H{sub 2}O charge assisted hydrogen bonds (HBs), and less common H{sub 2}O⋯H–C and H{sub 2}O⋯π interactions. Biological water molecules, those in direct contact with Ibu{sup −}, prefer to cluster around the carboxylate oxygen atoms via cyclic or bridged charge assisted hydrogen bonds. Many of those interactions are strongly affected by the formal carboxylate charge, resulting in “enhanced” HBs with increased strengths and degree of covalency. We found striking similarities between this case and the microsolvation of dymethylphosphate, which lead us to hypothesize that since microsolvation of phosphatidylcholine depends mainly on the formal charge of its ionic PO {sub 2}{sup −} group in the polar head, then microsolvation of anionic ibuprofen and interactions of water molecules with eukaryotic cell membranes are governed by the same types of physical interactions.

  18. A combined experimental and computational study of the molecular interactions between anionic ibuprofen and water

    International Nuclear Information System (INIS)

    Zapata-Escobar, Andy; Manrique-Moreno, Marcela; Guerra, Doris; Hadad, C. Z.; Restrepo, Albeiro

    2014-01-01

    In this work, we report a detailed study of the microsolvation of anionic ibuprofen, Ibu − . Stochastic explorations of the configurational spaces for the interactions of Ibu − with up to three water molecules at the DFT level lead to very rich and complex potential energy surfaces. Our results suggest that instead of only one preponderant structure, a collection of isomers with very similar energies would have significant contributions to the properties of the solvated drug. One of these properties is the shift on the vibrational frequencies of the asymmetric stretching band of the carboxylate group in hydrated Ibu − with respect to the anhydrous drug, whose experimental values are nicely reproduced using the weighted contribution of the structures. We found at least three types of stabilizing interactions, including conventional CO 2 − ⋯H 2 O, H 2 O⋯H 2 O charge assisted hydrogen bonds (HBs), and less common H 2 O⋯H–C and H 2 O⋯π interactions. Biological water molecules, those in direct contact with Ibu − , prefer to cluster around the carboxylate oxygen atoms via cyclic or bridged charge assisted hydrogen bonds. Many of those interactions are strongly affected by the formal carboxylate charge, resulting in “enhanced” HBs with increased strengths and degree of covalency. We found striking similarities between this case and the microsolvation of dymethylphosphate, which lead us to hypothesize that since microsolvation of phosphatidylcholine depends mainly on the formal charge of its ionic PO 2 − group in the polar head, then microsolvation of anionic ibuprofen and interactions of water molecules with eukaryotic cell membranes are governed by the same types of physical interactions

  19. The anionic basis of fluid secretion by the rabbit mandibular salivary gland

    DEFF Research Database (Denmark)

    Case, R M; Hunter, M; Novak, I

    1984-01-01

    The role played by anions in salivary secretion has been studied in experiments on the isolated, perfused mandibular gland of the rabbit, in which perfusate Cl- and/or HCO3- were replaced by other anions. Replacement of Cl- with Br- had no significant effect on salivary secretion rate, but replac......The role played by anions in salivary secretion has been studied in experiments on the isolated, perfused mandibular gland of the rabbit, in which perfusate Cl- and/or HCO3- were replaced by other anions. Replacement of Cl- with Br- had no significant effect on salivary secretion rate...

  20. Removal of 125I from radioactive experimental waste with an anion exchange paper membrane

    International Nuclear Information System (INIS)

    Inoue, Hiroyoshi; Kagoshima, Mayumi

    2000-01-01

    The behavior of radioactive iodide and chloride ions through an anion exchange paper membrane to remove 125 I from radioactive experimental waste has been studied with nonequilibrium thermodynamic analyses. Anion exchange paper membrane was found to be electroconductively more permeable to iodide ion than to chloride ion. The iodide ion bound more strongly to the anion exchange site within a membrane phase than the chloride ion by more than twice. The results suggested that an anion exchange paper membrane was appropriate for the filtration removal system

  1. Role of Anions Associated with the Formation and Properties of Silver Clusters.

    Science.gov (United States)

    Wang, Quan-Ming; Lin, Yu-Mei; Liu, Kuan-Guan

    2015-06-16

    Metal clusters have been very attractive due to their aesthetic structures and fascinating properties. Different from nanoparticles, each cluster of a macroscopic sample has a well-defined structure with identical composition, size, and shape. As the disadvantages of polydispersity are ruled out, informative structure-property relationships of metal clusters can be established. The formation of a high-nuclearity metal cluster involves the organization of metal ions into a complex entity in an ordered way. To achieve controllable preparation of metal clusters, it is helpful to introduce a directing agent in the formation process of a cluster. To this end, anion templates have been used to direct the formation of high nuclearity clusters. In this Account, the role of anions played in the formation of a variety of silver clusters has been reviewed. Silver ions are positively charged, so anionic species could be utilized to control the formation of silver clusters on the basis of electrostatic interactions, and the size and shape of the resulted clusters can be dictated by the templating anions. In addition, since the anion is an integral component in the silver clusters described, the physical properties of the clusters can be modulated by functional anions. The templating effects of simple inorganic anions and polyoxometales are shown in silver alkynyl clusters and silver thiolate clusters. Intercluster compounds are also described regarding the importance of anions in determining the packing of the ion pairs and making contribution to electron communications between the positive and negative counterparts. The role of the anions is threefold: (a) an anion is advantageous in stabilizing a cluster via balancing local positive charges of the metal cations; (b) an anion template could help control the size and shape of a cluster product; (c) an anion can be a key factor in influencing the function of a cluster through bringing in its intrinsic properties. Properties

  2. Migratory Insertion of Hydrogen Isocyanide in the Pentacyano(methyl)cobaltate(III) Anion

    DEFF Research Database (Denmark)

    Kofod, Pauli; Harris, Pernille Hanne; Larsen, Sine

    2003-01-01

    The preparation of the pentacyano(iminiumacetyl)cobaltate(III) anion and its N-methyl and N,N-dimethyl derivatives is reported. The iminiumacetyl group is formed by migratory insertion of cis hydrogen isocyanide in the pentacyano(methyl)cobaltate(III) anion. The new compounds have been spectrosco......The preparation of the pentacyano(iminiumacetyl)cobaltate(III) anion and its N-methyl and N,N-dimethyl derivatives is reported. The iminiumacetyl group is formed by migratory insertion of cis hydrogen isocyanide in the pentacyano(methyl)cobaltate(III) anion. The new compounds have been...

  3. The role of polymer nanolayer architecture on the separation performance of anion-exchange membrane adsorbers: I. Protein separations.

    Science.gov (United States)

    Bhut, Bharat V; Weaver, Justin; Carter, Andrew R; Wickramasinghe, S Ranil; Husson, Scott M

    2011-11-01

    This contribution describes the preparation of strong anion-exchange membranes with higher protein binding capacities than the best commercial resins. Quaternary amine (Q-type) anion-exchange membranes were prepared by grafting polyelectrolyte nanolayers from the surfaces of macroporous membrane supports. A focus of this study was to better understand the role of polymer nanolayer architecture on protein binding. Membranes were prepared with different polymer chain graft densities using a newly developed surface-initiated polymerization protocol designed to provide uniform and variable chain spacing. Bovine serum albumin and immunoglobulin G were used to measure binding capacities of proteins with different size. Dynamic binding capacities of IgG were measured to evaluate the impact of polymer chain density on the accessibility of large size protein to binding sites within the polyelectrolyte nanolayer under flow conditions. The dynamic binding capacity of IgG increased nearly linearly with increasing polymer chain density, which suggests that the spacing between polymer chains is sufficient for IgG to access binding sites all along the grafted polymer chains. Furthermore, the high dynamic binding capacity of IgG (>130 mg/mL) was independent of linear flow velocity, which suggests that the mass transfer of IgG molecules to the binding sites occurs primarily via convection. Overall, this research provides clear evidence that the dynamic binding capacities of large biologics can be higher for well-designed macroporous membrane adsorbers than commercial membrane or resin ion-exchange products. Specifically, using controlled polymerization leads to anion-exchange membrane adsorbers with high binding capacities that are independent of flow rate, enabling high throughput. Results of this work should help to accelerate the broader implementation of membrane adsorbers in bioprocess purification steps. Copyright © 2011 Wiley Periodicals, Inc.

  4. Study of the ion-channel behavior on glassy carbon electrode supported bilayer lipid membranes stimulated by perchlorate anion

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Zhiquan; Shi, Jun; Huang, Weimin, E-mail: huangwm@jlu.edu.cn

    2015-10-01

    In this paper, a kind of didodecyldimethylammonium bromide (DDAB) layer membranes was supported on a glassy carbon electrode (GCE). We studied the ion channel behavior of the supported bilayer lipid membrane by scanning electrochemical microscopy (SCEM) in tris(2,2′-bipyridine) ruthenium(II) solution. Perchlorate anion was used as a presence of stimulus and ruthenium(II) complex cations as the probing ions for the measurement of SECM, the lipid membrane channel was opened and exhibited the behavior of distinct SECM positive feedback curve. The channel was in a closed state in the absence of perchlorate anions while reflected the behavior of SECM negative feedback curve. The rates of electron transfer reaction in the lipid membranes surface were detected and it was dependant on the potential of SECM. - Highlights: • The rates of electron transfer reaction in the lipid membranes surface were detected. • Dynamic investigations of ion-channel behavior of supported bilayer lipid membranes by scanning electrochemical microscopy • A novel way to explore the interaction between molecules and supported bilayer lipid membranes.

  5. Characteristics of floc formation of anion and cation exchange resin in precoat filter using powdered ion exchange resin

    International Nuclear Information System (INIS)

    Adachi, Tetsurou; Sawa, Toshio; Shindoh, Toshikazu.

    1989-01-01

    The filtration performance of mixed filter aid consisting of powdered anion and cation exchange resins used in the precoat filter is closely related to the characteristics of floc formation. The physical, chemical and electrochemical properties of powdered ion exchange resin were measured and the factors related to floc formation of anion and cation exchange resin were investigated by measuring the specific settle volume of resin floc as an evaluating index. It was found that these factors were mixing ratio, nature of resins and particle size of resins. In addition, it was assumed on the bases of these results that the amount of resin floc was related to sum of the surface electric charges of both resins. The filling ratio of resin floc was related to their product by multiplication and an experimental expression was obtained. The specific settle volume of resin floc could then be simulated by particle size, surface area, ion exchange capacity and degree of ionization of the powdered ion exchange resin. (author)

  6. Characteristics of floc formation of anion and cation exchange resin in precoat filter using powdered ion exchange resin

    Energy Technology Data Exchange (ETDEWEB)

    Adachi, Tetsurou (Nitto Denko Corp., Ibaraki, Osaka (Japan)); Sawa, Toshio; Shindoh, Toshikazu

    1989-09-01

    The filtration performance of mixed filter aid consisting of powdered anion and cation exchange resins used in the precoat filter is closely related to the characteristics of floc formation. The physical, chemical and electrochemical properties of powdered ion exchange resin were measured and the factors related to floc formation of anion and cation exchange resin were investigated by measuring the specific settle volume of resin floc as an evaluating index. It was found that these factors were mixing ratio, nature of resins and particle size of resins. In addition, it was assumed on the bases of these results that the amount of resin floc was related to sum of the surface electric charges of both resins. The filling ratio of resin floc was related to their product by multiplication and an experimental expression was obtained. The specific settle volume of resin floc could then be simulated by particle size, surface area, ion exchange capacity and degree of ionization of the powdered ion exchange resin. (author).

  7. Design of Perovskite Oxides as Anion-Intercalation-Type Electrodes for Supercapacitors: Cation Leaching Effect.

    Science.gov (United States)

    Liu, Yu; Dinh, Jim; Tade, Moses O; Shao, Zongping

    2016-09-14

    Oxygen ions can be exploited as a charge carrier to effectively realize a new type of anion-intercalation supercapacitor. In this study, to get some useful guidelines for future materials development, we comparatively studied SrCoO3-δ (SC), Ba0.5Sr0.5Co0.8Fe0.2O3-δ (BSCF), and Co3O4 as electrodes in supercapacitors with aqueous alkaline electrolyte. The effect of interaction between the electrode materials with the alkaline solution was focused on the structure and specific surface area of the electrode material, and ultimately the electrochemical performance was emphasized. Both BSCF and SC were found to experience cation leaching in alkaline solution, resulting in an increase in the specific surface area of the material, but overleaching caused the damage of perovskite structure of BSCF. Barium leaching was more serious than strontium, and the cation leaching was component dependent. Although high initial capacitance was achieved for BSCF, it was not a good candidate as intercalation-type electrode for supercapacitor because of poor cycling stability from serious Ba(2+) and Sr(2+) leaching. Instead, SC was a favorable electrode candidate for practical use in supercapacitors due to its high capacity and proper cation leaching capacity, which brought beneficial effect on cycling stability. It is suggested that cation leaching effect should be seriously considered in the development of new perovskite materials as electrodes for supercapacitors.

  8. Anionic Palladium(0) and Palladium(II) Ate Complexes.

    Science.gov (United States)

    Kolter, Marlene; Böck, Katharina; Karaghiosoff, Konstantin; Koszinowski, Konrad

    2017-10-16

    Palladium ate complexes are frequently invoked as important intermediates in Heck and cross-coupling reactions, but so far have largely eluded characterization at the molecular level. Here, we use electrospray-ionization mass spectrometry, electrical conductivity measurements, and NMR spectroscopy to show that the electron-poor catalyst [L 3 Pd] (L=tris[3,5-bis(trifluoromethyl)phenyl]phosphine) readily reacts with Br - ions to afford the anionic, zero-valent ate complex [L 3 PdBr] - . In contrast, more-electron-rich Pd catalysts display lower tendencies toward the formation of ate complexes. Combining [L 3 Pd] with LiI and an aryl iodide substrate (ArI) results in the observation of the Pd II ate complex [L 2 Pd(Ar)I 2 ] - . © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Partial molar volume of anionic polyelectrolytes in aqueous solution.

    Science.gov (United States)

    Salamanca, Constain; Contreras, Martín; Gamboa, Consuelo

    2007-05-15

    In this work the partial molar volumes (V) of different anionic polyelectrolytes and hydrophobically modified polyelectrolytes (PHM) were measured. Polymers like polymaleic acid-co-styrene, polymaleic acid-co-1-olefin, polymaleic acid-co-vinyl-2-pyrrolidone, and polyacrylic acid (abbreviated as MAS-n, PA-n-K2, AMVP, and PAA, respectively) were employed. These materials were investigated by density measurements in highly dilute aqueous solutions. The molar volume results allow us to discuss the effect of the carboxylic groups and the contributions from the comonomeric principal chain. The PAA presents the smaller V, while the largest V value was for AMVP. The V of PHM shows a linear relationship with the number of methylene groups in the lateral chain. It is found that the magnitude of the contribution per methylene group decreases as the hydrophobic character of the environment increases.

  10. Radiation-induced decomposition of anion exchange resins

    International Nuclear Information System (INIS)

    Baidak, Aliaksandr; LaVerne, Jay A.

    2010-01-01

    Radiation-induced degradation of the strongly basic anion exchange resin Amberlite TM IRA400 in NO 3 - , Cl - and OH - forms has been studied. The research focused on the formation of molecular hydrogen in the gamma-radiolysis of water slurries of these quaternary ammonium resins with varying water content. Extended studies with various electron scavengers (NO 3 - , N 2 O and O 2 ) prove an important role of e solv - in the formation of H 2 from these resins. An excess production of H 2 in these systems at about 85% water weight fraction was found to be due to trimethylamine, dimethylamine and other compounds that leach from the resin to the aqueous phase. Irradiations with 5 MeV 4 He ions were performed to simulate the effects of α-particles.

  11. Using solvent extraction to process nitrate anion exchange column effluents

    International Nuclear Information System (INIS)

    Yarbro, S.L.

    1987-10-01

    Octyl(phenyl)-N,N-diisobutylcarbamoylmethylphosphine oxide (CMPO), a new organophosphorous extractant, and a new centrifugal mixer-settler both recently developed at Argonne were evaluated for their potential use in the recovery of actinides from nitrate anion exchange column effluents. The performance of the extractant was evaluated by measuring the extraction coefficient values as a function of acid and salt concentration. Additional performance parameters include extraction coefficient behavior as a function of the total metal concentration in the organic phase, and comparison of different stripping and organic scrubbing techniques. A simulated effluent stream was used to evaluate the performance of the centrifugal mixer-settlers by comparing experimental and calculated interstage concentration profiles. Both the CMPO extractant and the centrifugal mixer-settlers have potential for processing nitrate column effluents, particularly if the stripping behavior can be improved. Details of the proposed process are presented in the flowsheet and contactor design analyses

  12. Using solvent extraction to process nitrate anion exchange column effluents

    Energy Technology Data Exchange (ETDEWEB)

    Yarbro, S.L.

    1987-10-01

    Octyl(phenyl)-N,N-diisobutylcarbamoylmethylphosphine oxide (CMPO), a new organophosphorous extractant, and a new centrifugal mixer-settler both recently developed at Argonne were evaluated for their potential use in the recovery of actinides from nitrate anion exchange column effluents. The performance of the extractant was evaluated by measuring the extraction coefficient values as a function of acid and salt concentration. Additional performance parameters include extraction coefficient behavior as a function of the total metal concentration in the organic phase, and comparison of different stripping and organic scrubbing techniques. A simulated effluent stream was used to evaluate the performance of the centrifugal mixer-settlers by comparing experimental and calculated interstage concentration profiles. Both the CMPO extractant and the centrifugal mixer-settlers have potential for processing nitrate column effluents, particularly if the stripping behavior can be improved. Details of the proposed process are presented in the flowsheet and contactor design analyses.

  13. Reactivity of amino acid anions with nitrogen and oxygen atoms.

    Science.gov (United States)

    Wang, Zhe-Chen; Li, Ya-Ke; He, Sheng-Gui; Bierbaum, Veronica M

    2018-02-14

    For many decades, astronomers have searched for biological molecules, including amino acids, in the interstellar medium; this endeavor is important for investigating the hypothesis of the origin of life from space. The space environment is complex and atomic species, such as nitrogen and oxygen atoms, are widely distributed. In this work, the reactions of eight typical deprotonated amino acids (glycine, alanine, cysteine, proline, aspartic acid, histidine, tyrosine, and tryptophan) with ground state nitrogen and oxygen atoms are studied by experiment and theory. These amino acid anions do not react with nitrogen atoms. However, the reactions of these ions with oxygen atoms show an intriguing variety of ionic products and the reaction rate constants are of the order of 10 -10 cm 3 s -1 . Density functional calculations provide detailed mechanisms of the reactions, and demonstrate that spin conversion is essential for some processes. Our study provides important data and insights for understanding the kinetic and dynamic behavior of amino acids in space environments.

  14. Preliminary Testing For Anionic, Cationic and Non-ionic

    Directory of Open Access Journals (Sweden)

    Bokic, Lj.

    2007-11-01

    Full Text Available Detergents present a major environmental problem due to large quantities of surfactants released from laundries. For this reason, it is important to apply an appropriate analytical method for their determination. In this work, we propose two simple, fast and inexpensive analytical methods for anionic, cationic and non-ionic surfactant determination: thin layer chromatography (TLC separation for qualitative screening and quantitative potentiometric determination with ion-selective electrodes. These methods have been chosen because of their many advantages: rapidity, ease of operation, low cost of analysis and a wide variety of TLC application possibilities. The advantage of potentiometric titration is its very high degree of automation and very low detection limits obtained with different ion-selective electrodes applied for different surfactants.

  15. Common, yet elusive: a case of severe anion gap acidosis.

    Science.gov (United States)

    Agrawal, Akanksha; Kishlyansky, Marina; Biso, Sylvia; Patnaik, Soumya; Punjabi, Chitra

    2017-09-01

    Acid-base disturbances are common occurrence in hospitalized patients with life threatening complications. 5-oxoproline has been increasingly recognized as cause of high anion gap metabolic acidosis (AGMA) in association with chronic acetaminophen use. However, laboratory workup for it are not widely available. We report case of 56-year-old female with severe AGMA not attributable to ketoacidosis, lactic acidosis or toxic ingestion. History was significant for chronic acetaminophen use, and laboratory workup negative for all frequent causes of AGMA. Given history and clinical presentation, our suspicion for 5-oxoproline toxicity was high. Our patient required emergent hemodialysis and subsequently improved clinically. With an increasing awareness of the uncommon causes of high AGMA, tests should be more readily available to detect their presence. Physicians should be more vigilant of underdiagnosed causes of AGMA if the presentation and laboratory values do not reflect a common cause, as definitive treatment may vary based on the offending agent.

  16. Removal of both cationic and anionic contaminants by amphoteric starch.

    Science.gov (United States)

    Peng, Huanlong; Zhong, Songxiong; Lin, Qintie; Yao, Xiaosheng; Liang, Zhuoying; Yang, Muqun; Yin, Guangcai; Liu, Qianjun; He, Hongfei

    2016-03-15

    A novel amphoteric starch incorporating quaternary ammonium and phosphate groups was applied to investigate the efficiency and mechanism of cationic and anionic contaminant treatment. Its flocculation abilities for kaolin suspension and copper-containing wastewater were evaluated by turbidity reduction and copper removal efficiency, respectively. And the kinetics of formation, breakage and subsequent re-formation of aggregates were monitored using a Photometric Dispersion Analyzer (PDA) and characterized by flocculation index (FI). The results showed that amphoteric starch possessed the advantages of being lower-dosages-consuming and being stronger in shear resistance than cationic starch, and exhibited a good flocculation efficiency over a wide pH range from 3.0 to 11.0. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Enhanced DOC removal using anion and cation ion exchange resins.

    Science.gov (United States)

    Arias-Paic, Miguel; Cawley, Kaelin M; Byg, Steve; Rosario-Ortiz, Fernando L

    2016-01-01

    Hardness and DOC removal in a single ion exchange unit operation allows for less infrastructure, is advantageous for process operation and depending on the water source, could enhance anion exchange resin removal of dissolved organic carbon (DOC). Simultaneous application of cationic (Plus) and anionic (MIEX) ion exchange resin in a single contact vessel was tested at pilot and bench scales, under multiple regeneration cycles. Hardness removal correlated with theoretical predictions; where measured hardness was between 88 and 98% of the predicted value. Comparing bench scale DOC removal of solely treating water with MIEX compared to Plus and MIEX treated water showed an enhanced DOC removal, where removal was increased from 0.5 to 1.25 mg/L for the simultaneous resin application compared to solely applying MIEX resin. A full scale MIEX treatment plant (14.5 MGD) reduced raw water DOC from 13.7 mg/L to 4.90 mg/L in the treated effluent at a bed volume (BV) treatment rate of 800, where a parallel operation of a simultaneous MIEX and Plus resin pilot (10 gpm) measured effluent DOC concentrations of no greater than 3.4 mg/L, even at bed volumes of treatment 37.5% greater than the full scale plant. MIEX effluent compared to simultaneous Plus and MIEX effluent resulted in differences in fluorescence intensity that correlated to decreases in DOC concentration. The simultaneous treatment of Plus and MIEX resin produced water with predominantly microbial character, indicating the enhanced DOC removal was principally due to increased removal of terrestrially derived organic matter. The addition of Plus resin to a process train with MIEX resin allows for one treatment process to remove both DOC and hardness, where a single brine waste stream can be sent to sewer at a full-scale plant, completely removing lime chemical addition and sludge waste disposal for precipitative softening processes. Published by Elsevier Ltd.

  18. Probing electron density of H-bonding between cation-anion of imidazolium-based ionic liquids with different anions by vibrational spectroscopy.

    Science.gov (United States)

    Gao, Yan; Zhang, Liqun; Wang, Yong; Li, Haoran

    2010-03-04

    Attenuated total reflection infrared spectroscopy and density functional theory calculation have been employed to study the spectral properties of imidazolium-based ionic liquids (ILs) with different anions. ILs based on 1-butyl-3-methylimidazolium cation with different anions, OH(-), CF(3)CO(2)(-), HSO(4)(-), H(2)PO(4)(-), Cl(-), PF(6)(-), and BF(4)(-), are investigated in the present work. It has been shown that the C(2)-H stretching vibration of the imidazolium ring is closely related to the electron density of H-bonding between the two closest cations and anions for pure ILs. The electron density of H-bonding between cation and anion with different anions decreases in the order [OH](-) > [H(2)PO(4)](-) > [HSO(4)](-) > [CF(3)CO(2)](-) > [Cl](-) > [BF(4)](-) > [PF(6)](-). For aqueous ILs, with increasing water content, the aromatic C-H stretching vibration of the imidazolium cation showed systematic blue-shifts. Especially for BmimOH, the nu(C(2))(-H) undergoes a drastic blue-shift by 58 cm(-1), suggesting that the formation of the strong hydrogen bonds O-H...O may greatly weaken the electron density of H-bonding between the cation and anion of ILs.

  19. Specificity of anion-binding in the substrate-pocket ofbacteriorhodopsin

    Energy Technology Data Exchange (ETDEWEB)

    Facciotti, Marc T.; Cheung, Vincent S.; Lunde, Christopher S.; Rouhani, Shahab; Baliga, Nitin S.; Glaeser, Robert M.

    2003-08-30

    The structure of the D85S mutant of bacteriorhodopsin with a nitrate anion bound in the Schiff-base binding site, and the structure of the anion-free protein have been obtained in the same crystal form. Together with the previously solved structures of this anion pump, in both the anion-free state and bromide-bound state, these new structures provide insight into how this mutant of bacteriorhodopsin is able to bind a variety of different anions in the same binding pocket. The structural analysis reveals that the main structural change that accommodates different anions is the repositioning of the polar side-chain of S85. On the basis of these x-ray crystal structures, the prediction is then made that the D85S/D212N double mutant might bind similar anions and do so over a broader pH range than does the single mutant. Experimental comparison of the dissociation constants, K{sub d}, for a variety of anions confirms this prediction and demonstrates, in addition, that the binding affinity is dramatically improved by the D212N substitution.

  20. Infrared multiple photon dissociation spectroscopy of sodium and potassium chlorate anions

    NARCIS (Netherlands)

    Dain, R. P.; Leavitt, C. M.; Oomens, J.; Steill, J. D.; Groenewold, G. S.; van Stipdonk, M. J.

    2010-01-01

    The structures of gas-phase, metal chlorate anions with the formula [M(ClO3)(2)](-), M = Na and K, were determined using tandem mass spectrometry and infrared multiple photon dissociation (IRMPD) spectroscopy. Structural assignments for both anions are based on comparisons of the experimental

  1. Mechanism of action of anions on the electron transport chain in thylakoid membranes of higher plants.

    Science.gov (United States)

    Singh-Rawal, Pooja; Zsiros, Ottó; Bharti, Sudhakar; Garab, Gyozo; Jajoo, Anjana

    2011-04-01

    With an aim to improve our understanding of the mechanisms behind specific anion effects in biological membranes, we have studied the effects of sodium salts of anions of varying valency in thylakoid membranes. Rates of electron transport of PS II and PS I, 77K fluorescence emission and excitation spectra, cyclic electron flow around PS I and circular dichroism (CD) spectra were measured in thylakoid membranes in order to elucidate a general mechanism of action of inorganic anions on photosynthetic electron transport chain. Re-distribution of absorbed excitation energy has been observed as a signature effect of inorganic anions. In the presence of anions, such as nitrite, sulphate and phosphate, distribution of absorbed excitation energy was found to be more in favor of Photosystem I (PS I). The amount of energy distributed towards PS I depended on the valency of the anion. In this paper, we propose for the first time that energy re-distribution and its valence dependence may not be the effect of anions per se. The entry of negative charge (anion) is accompanied by influx of positive charge (protons) to maintain a balance of charge across the thylakoid membranes. As reflected by the CD spectra, the observed energy re-distribution could be a result of structural rearrangements of the protein complexes of PS II caused by changes in the ionic environment of the thylakoid lumen.

  2. Facilitated transport of hydrophilic salts by mixtures of anion and cation carriers and by ditopic carriers

    NARCIS (Netherlands)

    Chrisstoffels, L.A.J.; de Jong, Feike; Reinhoudt, David; Sivelli, Stefano; Gazzola, Licia; Casnati, Alessandro; Ungaro, Rocco

    1999-01-01

    Anion transfer to the membrane phase affects the extraction efficiency of salt transport by cation carriers 1 and 3. Addition of anion receptors 5 or 6 to cation carriers 1, 3, or 4 in the membrane phase enhances the transport of salts under conditions in which the cation carriers alone do not

  3. Effect of Structure on Charge Distribution in the Isatin Anions in Aprotic Environment: Spectral Study

    Directory of Open Access Journals (Sweden)

    Pavol Tisovský

    2017-11-01

    Full Text Available Five isatin anions were prepared by deprotonation of initial isatins in aprotic solvents using basic fluoride and acetate anions (F− and CH3COO−. The F− basicity is sufficient to deprotonate isatin NH hydrogen from all the studied compounds. This process is reversible. In the presence of proton donor solvents, the anions form the corresponding isatins. The isatin hydrogen acidity depends on the overall structure of the isatin derivatives. The anions were characterized by ultraviolet–visible (UV–Vis, Fourier transform infrared (FTIR and nuclear magnetic resonance (NMR spectroscopy. Interestingly, the anions form aggregates at concentrations above 10−3 mol·dm−3. Further, the effect of cations on the UV–Vis spectra of the studied anions was studied. Charge transfer and its distribution in the anion depends on the radius and the cation electron configuration. The alkali metal cations, tetrabutylammonium (TBA+, Mg2+ and Ag+, interact with the C-2 carbonyl oxygen of the isatin anion. The interaction has a coulombic character. On the other hand, Cd2+, Zn2+, Hg2+, Co2+, and Cu+ cations form a coordinate bond with the isatin nitrogen.

  4. Supramolecular binding and release of sulfide and hydrosulfide anions in water.

    Science.gov (United States)

    Vázquez, J; Sindelar, V

    2018-06-05

    Hydrogen sulfide (H2S) has become an important target for research due to its physiological properties as well as its potential applications in medicine. In this work, supramolecular binding of sulfide (S2-) and hydrosulfide (HS-) anions in water is presented for the first time. Bambusurils were used to slow down the release of these anions in water.

  5. Anionic polymerization and polyhomologation: An ideal combination to synthesize polyethylene-based block copolymers

    KAUST Repository

    Zhang, H.

    2013-08-07

    A novel one-pot methodology combining anionic polymerization and polyhomologation, through a "bridge" molecule (BF3OEt 2), was developed for the synthesis of polyethylene (PE)-based block copolymers. The anionically synthesized macroanion reacts with the "bridge" molecule to afford a 3-arm star (trimacromolecular borane) which serves as an initiator for the polyhomologation. 2013 The Royal Society of Chemistry.

  6. Sorption of Pu(IV) from nitric acid by bifunctional anion-exchange resins

    International Nuclear Information System (INIS)

    Bartsch, R.A.; Zhang, Z.Y.; Elshani, S.; Zhao, W.; Jarvinen, G.D.; Barr, M.E.; Marsh, S.F.; Chamberlin, R.M.

    1999-01-01

    Anion exchange is attractive for separating plutonium because the Pu(IV) nitrate complex is very strongly sorbed and few other metal ions form competing anionic nitrate complexes. The major disadvantage of this process has been the unusually slow rate at which the Pu(IV) nitrate complex is sorbed by the resin. The paper summarizes the concept of bifunctional anion-exchange resins, proposed mechanism for Pu(IV) sorption, synthesis of the alkylating agent, calculation of K d values from Pu(IV) sorption results, and conclusions from the study of Pu(IV) sorption from 7M nitric acid by macroporous anion-exchange resins including level of crosslinking, level of alkylation, length of spacer, and bifunctional vs. monofunctional anion-exchange resins

  7. Analysing destruction channels of interstellar hydrocarbon anions with a 22pol ion-trap

    Energy Technology Data Exchange (ETDEWEB)

    Endres, Eric; Lakhmanskaya, Olga; Best, Thorsten; Hauser, Daniel; Kumar, Sunil; Wester, Roland [Universitaet Innsbruck, Institut fuer Ionenphysik und Angewandte Physik (Austria)

    2014-07-01

    In the interstellar medium (ISM), ion-molecule reactions are considered to play a key role in the formation of complex molecules. The detection of the first interstellar anions, which happen to be carbon chain anions, has raised new interest in the quantitative composition of the ISM and the underlying reaction network. To understand the observed abundance of these carbon chain anions, a detailed analysis of the possible destruction channels is indispensable. A cryogenic 22-pol radio frequency ion trap is an ideal tool to observe reactions that take place slowly, such as carbon chain anions with molecular hydrogen. Furthermore, measurements over a large temperature scale are feasible. Longitudinal optical access to the trap also provides the possibility to make precise photodetachment measurements. Temperature dependent measurements of the reaction rates for the reaction between hydrocarbon chain anions and H{sub 2} are presented.

  8. A procedure for reducing the concentration of hydrogen ions in acid anionic eluate and equipment therefore

    International Nuclear Information System (INIS)

    Parobek, P.; Baloun, S.; Plevac, S.

    1989-01-01

    The method is described of reducing the concentration of hydrogen ions in acid anionic eluate produced in the separation of uranium or other metals, in which anion exchanger elution, precipitation, filtration and precipitate and anion exchanger washing are used. The technological line for such elution comprises at least one ion exchange column and at least one container. They together form the first and the second stages of preparation of the acid anion elution solution, the sorption-elution separation of hydrogen ions on an cation exchanger being inserted between them. The preparation of the solution is divide into two stages. In the first stage, the acid and part of the solution for the preparation of the acid anion elution solution are supplied. The resulting enriched acid elution solution is fe onto the cation exchanger where the hydrogen ion concentration i reduced. It is then carried into the second stage where it is mixed with the remaining part of the solution. (B.S.)

  9. Physical Removal of Anions from Aqueous Media by Means of a Macrocycle-Containing Polymeric Network

    KAUST Repository

    Ji, Xiaofan

    2018-02-13

    Reported here is a hydrogel-forming polymer network that contains a water-soluble tetracationic macrocycle. Upon immersion of this polymer network in aqueous solutions containing various inorganic and organic salts, changes in the physical properties are observed that are consistent with absorption of the constituent anions into the polymer network. This absorption is ascribed to host-guest interactions involving the tetracationic macrocyclic receptor. Removal of the anions may then be achieved by lifting the resulting hydrogels out of the aqueous phase. Treating the anion-containing hydrogels with dilute HCl leads to the protonation-induced release of the bound anions. This allows the hydrogels to be recycled for reuse. The present polymer network thus provides a potentially attractive approach to removing undesired anions from aqueous environments.

  10. Anion Photoelectron Spectroscopy of the Homogenous 2-Hydroxypyridine Dimer Electron Induced Proton Transfer System

    Science.gov (United States)

    Vlk, Alexandra; Stokes, Sarah; Wang, Yi; Hicks, Zachary; Zhang, Xinxing; Blando, Nicolas; Frock, Andrew; Marquez, Sara; Bowen, Kit; Bowen Lab JHU Team

    Anion photoelectron spectroscopic (PES) and density functional theory (DFT) studies on the dimer anion of (2-hydroxypyridine)2-are reported. The experimentally measured vertical detachment energy (VDE) of 1.21eV compares well with the theoretically predicted values. The 2-hydroxypyridine anionic dimer system was investigated because of its resemblance to the nitrogenous heterocyclic pyrimidine nucleobases. Experimental and theoretical results show electron induced proton transfer (EIPT) in both the lactim and lactam homogeneous dimers. Upon electron attachment, the anion can serve as the intermediate between the two neutral dimers. A possible double proton transfer process can occur from the neutral (2-hydroxypyridine)2 to (2-pyridone)2 through the dimer anion. This potentially suggests an electron catalyzed double proton transfer mechanism of tautomerization. Research supported by the NSF Grant No. CHE-1360692.

  11. Controlled Release Kinetics in Hydroxy Double Salts: Effect of Host Anion Structure

    Directory of Open Access Journals (Sweden)

    Stephen Majoni

    2014-01-01

    Full Text Available Nanodimensional layered metal hydroxides such as layered double hydroxides (LDHs and hydroxy double salts (HDSs can undergo anion exchange reactions releasing intercalated anions. Because of this, these metal hydroxides have found applications in controlled release delivery of bioactive species such as drugs and pesticides. In this work, isomers of hydroxycinnamate were used as model compounds to systematically explore the effects of anion structure on the rate and extent of anion release in HDSs. Following intercalation and subsequent release of the isomers, it has been demonstrated that the nature and position of substituent groups on intercalated anions have profound effects on the rate and extent of release. The extent of release was correlated with the magnitude of dipole moments while the rate of reaction showed strong dependence on the extent of hydrogen bonding within the layers. The orthoisomer showed a more sustained and complete release as compared to the other isomers.

  12. Ultra-small and anionic starch nanospheres: formation and vitro thrombolytic behavior study.

    Science.gov (United States)

    Huang, Yinjuan; Ding, Shenglong; Liu, Mingzhu; Gao, Chunmei; Yang, Jinlong; Zhang, Xinjie; Ding, Bin

    2013-07-25

    This paper is considered as the first report on the investigation of nattokinase (NK) release from anionic starch nanospheres. The ultra-small and anionic starch nanospheres were prepared by the method of reverse micro-emulsion crosslinking in this work. Starch nanospheres were characterized through Fourier transform infrared (FTIR) spectroscopy, scanning electron microscopy (SEM), transmission electron microscopy (TEM) and dynamic light scattering (DLS). Effects of preparation conditions on particle size were studied. The cytotoxicity, biodegradable and vitro thrombolytic behaviors of nattokinase (NK) loaded anionic starch nanospheres were also studied. The results showed that the anionic starch nanospheres are non-toxic, biocompatible and biodegradable. Moreover, the anionic starch nanospheres can protect NK from fast biodegradation hence prolongs the circulation in vivo and can reduce the risk of acute hemorrhage complication by decreasing the thrombolysis rate. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Photochemistry and infrared spectrum of single-bridged diborane(5) anion isolated in solid argon

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Meng-Chen; Chin, Chih-Hao; Chen, Sian-Cong; Huang, Tzu-Ping [National Synchrotron Radiation Research Center (NSRRC), 101 Hsin-Ann Road, Hsinchu Science Park, Hsinchu 30076, Taiwan (China); Chen, Hui-Fen; Huang, Wei-Jie [Department of Medicinal and Applied Chemistry, Kaohsiung Medical University, 100, Shih-Chuan 1st Road, Kaohsiung 80708, Taiwan (China); Wu, Yu-Jong, E-mail: yjw@nsrrc.org.tw [National Synchrotron Radiation Research Center (NSRRC), 101 Hsin-Ann Road, Hsinchu Science Park, Hsinchu 30076, Taiwan (China); Department of Applied Chemistry, National Chiao Tung University, 1001, Ta-Hsueh Road, Hsinchu 30010, Taiwan (China)

    2016-08-21

    Three-center two-electron bonds are important for understanding electron-deficient molecules. To examine such a molecule, we produced a diborane(5) anion with a single-bridged structure upon electron bombardment during matrix deposition of Ar containing a small proportion of diborane(6). The diborane(5) anion was destroyed upon photolysis at 180, 220, 385, and 450 nm, but not at 532 nm. Moreover, the possible formation of neutral diborane(5) was observed upon photolysis at 385 and 450 nm, whereas neutral diborane(3) was observed upon photolysis at 180 and 220 nm. The observed line wavenumbers, relative intensities, and isotopic ratios of the diborane(5) anion agreed satisfactorily with those predicted by density functional theory calculations at the B3LYP/aug-cc-pVTZ level of theory. Thus, this method produced the boron hydride anion of interest with few other fragments, which enabled us to clearly identify the IR spectrum of the diborane(5) anion.

  14. Determination of Anionic Detergent Concentration of Karasu Stream in Sinop (Turkey

    Directory of Open Access Journals (Sweden)

    Ayşe Gündoğdu

    2018-02-01

    Full Text Available The study was achieved between May 2014 and April 2015 at the Karasu Creek located in the province of Sinop. It was conducted to determine anionic detergent pollution and some physicochemical properties (pH, temperature, conductivity, salinity, dissolved oxygen, total hardness, chemical oxygen demand, phosphate PO4-3, total nitrogen. The anionic detergent concentration of the stations was determined on a monthly basis. Seasonally averaged values of the anionic detergent was measured as the highest value in the autumn season. The lowest values of anionic detergent were found in stations in winter and spring. The increase in the concentration of anionic detergent is caused by population growth in residential areas, increased agricultural activities and rains, and that chemicals move to riverbed from terrestrial areas with rain water.

  15. Catalytic hydrodechlorination of triclosan using a new class of anion-exchange-resin supported palladium catalysts.

    Science.gov (United States)

    Han, Bing; Liu, Wen; Li, Jingwen; Wang, Jin; Zhao, Dongye; Xu, Rui; Lin, Zhang

    2017-09-01

    We prepared a new class of anion-exchange-resin supported Pd catalysts for efficient hydrodechlorination of triclosan in water. The catalysts were prepared through an initial ion-exchange uptake of PdCl 4 2- and subsequent reduction of Pd(II) to Pd(0) nanoparticles at ambient temperature. Two standard strong-base anion exchange resins (IRA-900 and IRA-958) with different matrices (polystyrene and polyacrylic) were chosen as the supports. SEM and TEM images showed that Pd(0) nanoparticles were evenly attached on the resin surface with a mean size of 3-5 nm. The resin supported Pd catalysts (Pd@IRA-900 and Pd@IRA-958) were able to facilitate rapid and complete hydrodechlorination of triclosan. At a Pd loading of 2.0 wt.%, the observed pseudo first-order rate constant (k obs ) was 1.25 ± 0.06 and 1.6 ± 0.1 L/g/min for Pd@IRA-900 and Pd@IRA-958, respectively. The catalysts were more resistant to Cl - poisoning and natural organic matter fouling than other supported-Pd catalysts. The presence of 10 mM NaCl suppressed the k obs value by 31% and 23% for Pd@IRA-900 and Pd@IRA-958, whereas the presence of humic acid at 30 mg/L as TOC lowered the rates by 28% and 27%, respectively. The better performance of Pd@IRA-958 was attributed to the polymeric matrix properties (i.e., hydrophobicity, pore size, and surface area) as well as Pd particle size. GC/MS analyses indicated that very low concentrations of chlorinated intermediates were detected in the early stage of the hydrodechlorination process, with 2-phenoxyphenol being the main byproduct. The catalysts can be repeatedly used in multiple operations without significant bleeding. The catalysts eliminate the need for calcination in preparing conventional supported catalysts, and the resin supports conveniently facilitate control of Pd loading and material properties. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Experimental evidence for interactions between anions and electron-deficient aromatic rings.

    Science.gov (United States)

    Berryman, Orion B; Johnson, Darren W

    2009-06-14

    This feature article summarizes our research aimed at using electron-deficient aromatic rings to bind anions in the context of complementary research in this active field. Particular attention is paid to the different types of interactions exhibited between anions and electron-deficient arenes in solution. The 120+ references cited in this article underscore the flurry of recent activity by numerous researchers in this field, which was relatively nascent when our efforts began in 2005. While the interaction of anions with electron-deficient aromatic rings has recently garnered much attention by supramolecular chemists, the observation of these interactions is not a recent discovery. Therefore, we begin with a historical perspective on early examples of anions interacting with electron-deficient arenes. An introduction to recent (and not so recent) computational investigations concerning anions and electron-deficient aromatic rings as well as a brief structural survey of crystalline examples of this interaction are provided. Finally, the limited solution-based observations of anions interacting with electron-deficient aromatic rings are summarized to introduce our current investigations in this area. We highlight three different systems from our lab where anion-arene interactions have been investigated. First, we show that tandem hydrogen bonds and anion-arene interactions augment halide binding in solution. Second, a crystallographic and computational study highlights the multiple types of interactions possible between anions and electron-deficient arenes. Third, we summarize the first example of a class of designed receptors that emphasize the different types of anion-arene interactions possible in solution.

  17. Facts and views on the role of anionic impurities, crack tip chemistry and oxide films in environmentally assisted cracking

    International Nuclear Information System (INIS)

    Aaltonen, P.; Bojinov, M.; Helin, M.

    2002-01-01

    The aim of this literature study has been to evaluate the level of understanding of the role of anionic impurities in environmentally assisted cracking (EAC) of iron- and nickel-based alloys in the coolant conditions of a boiling water reactor (BWR) - type nuclear power plant, mainly under normal water chemistry (NWC). The study has been motivated by a need to find the most relevant experimental approaches that can be applied when looking for correlations between crack growth rate and measurable electrochemical and chemical parameters. Special crack tip chemistry conditions are established, when trace amounts are present in the BWR coolant and become enriched within a crack. Anions may influence both the conductivity and the pH of the coolant within the crack. In addition, they may influence the composition, structure and properties of the oxide films formed on crack walls either directly via adsorption or incorporation or indirectly via the effect of changes in pH within the crack. Based on the proposed mechanisms for EAC, oxide films formed on crack wall surfaces are likely to play a key role in determing the crack growth rate of structural materials. The prediction of the influence of anionic impurities is thus likely to be facilitated by means of understanding their effect on the films on crack walls. One of the most promising approaches to experimentally clarify this influence is based on investigating the electrochemical behaviour of oxide films Fe- and Ni-based materials in high-temperature conditions simulating the special chemistry within a stress corrosion crack. Results from such studies should be compared and combined with ex situ analytical results obtained using modern electron microscopic techniques. In addition to crack growth, currently available electro-chemical techniques should also be applied to find out whether crack initiation can be explained and modelled on the basis of the electrochemical behaviour of oxide films. (orig.)

  18. Adsorção e dessorção aniônicas individuais por gibbsita pedogenética Individual anionic adsorption and desorption by pedogenic gibbsite

    Directory of Open Access Journals (Sweden)

    Adélia A. A. Pozza

    2009-01-01

    Full Text Available Anion adsorption/desorption dynamics was studied as individual processes on surface of particles of a gibbsitic clay. The data suggest a remarkable gibbsite role as nitrate leaching retardant in soil. The opposite behavior of gibbsite towards adsorption/desorption of silicate and phosphate suggests the need of an adequate compromise solution regarding interval and rate applications of anions in cultivated gibbsitic soils. The high P adsorption verified in pH values lower than that reported for the point of zero charge of synthetic Al-hydroxides implies that this process takes place in pedogenic gibbsites through inner sphere complexation.

  19. Chemical stabilization of graphite surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Bistrika, Alexander A.; Lerner, Michael M.

    2018-04-03

    Embodiments of a device, or a component of a device, including a stabilized graphite surface, methods of stabilizing graphite surfaces, and uses for the devices or components are disclosed. The device or component includes a surface comprising graphite, and a plurality of haloaryl ions and/or haloalkyl ions bound to at least a portion of the graphite. The ions may be perhaloaryl ions and/or perhaloalkyl ions. In certain embodiments, the ions are perfluorobenzenesulfonate anions. Embodiments of the device or component including stabilized graphite surfaces may maintain a steady-state oxidation or reduction surface current density after being exposed to continuous oxidation conditions for a period of at least 1-100 hours. The device or component is prepared by exposing a graphite-containing surface to an acidic aqueous solution of the ions under oxidizing conditions. The device or component can be exposed in situ to the solution.

  20. Design and synthesis of a water-stable anionic uranium-based metal-organic framework (MOF) with ultra large pores

    Energy Technology Data Exchange (ETDEWEB)

    Li, Peng; Vermeulen, Nicolaas A.; Gong, Xirui; Malliakas, Christos D.; Stoddart, J. Fraser; Hupp, Joseph T. [Northwestern Univ., Evanston, IL (United States). Dept. of Chemistry; Farha, Omar K. [Northwestern Univ., Evanston, IL (United States). Dept. of Chemistry; King Abdulaziz Univ., Jeddah (Saudi Arabia). Dept. of Chemistry

    2016-08-22

    Ionic metal-organic frameworks (MOFs) are a subclass of porous materials that have the ability to incorporate different charged species in confined nanospace by ion-exchange. To date, however, very few examples combining mesoporosity and water stability have been realized in ionic MOF chemistry. Herein, we report the rational design and synthesis of a water-stable anionic mesoporous MOF based on uranium and featuring tbo-type topology. The resulting tbo MOF exhibits exceptionally large open cavities (3.9 nm) exceeding those of all known anionic MOFs. By supercritical CO{sub 2} activation, a record-high Brunauer-Emmett-Teller (BET) surface area (2100 m{sup 2} g{sup -1}) for actinide-based MOFs has been obtained. Most importantly, however, this new uranium-based MOF is water-stable and able to absorb positively charged ions selectively over negatively charged ones, enabling the efficient separation of organic dyes and biomolecules.

  1. Electrodeposition of ZnO from DMSO solution: influence of anion nature and its concentration in the nucleation and growth mechanisms

    Energy Technology Data Exchange (ETDEWEB)

    Riveros, Gonzalo; Ramirez, Daniel, E-mail: gonzalo.riveros@uv.cl [Departamento de Quimica y Bioquimica, Facultad de Ciencias, Universidad de Valparaiso, Valparaiso (Chile); Tello, Alejandra; Schrebler, Ricardo; Henriquez, Rodrigo; Gomez, Humberto [Instituto de Quimica, Pontificia Universidad Catolica de Valparaiso, Curauma, Valparaiso (Chile)

    2012-03-15

    The influence of the anion nature and its concentration in the electrodeposition of ZnO onto a gold electrode from dimethylsulfoxide (DMSO) solutions was studied. Voltammetric experiments revealed important changes in the zinc oxide electrodeposition process depending on the employed anion as electrolyte. From chronoamperometric experiments, the corresponding current-time curves were fitted with different nucleation and growth mechanism models. The analysis of these results showed changes from an instantaneous to a progressive growth when the solution composition was changed from ZnCl{sub 2} to ZnCl{sub 2} + LiCl. The change of the mechanism is associated to the adsorption of chloride ion on the active sites of the electrode surface when LiCl is present in the solution. (author)

  2. Formation of secondary minerals and uptake of various anions under naturally-occurring hyper-alkaline conditions in Oman - 16344

    International Nuclear Information System (INIS)

    Anraku, Sohtaro; Sato, Tsutomu; Yoneda, Tetsuro; Morimoto, Kazuya

    2009-01-01

    In Japanese transuranic (TRU) waste disposal facilities, 129 I is the most important key nuclide for the long-term safety assessment. Thus, the K d values of I to natural minerals are important factor in the safety assessment. However, the degradation of cement materials in the repositories can produce high pH pore fluid which can affect the anion transport behavior. Therefore, it is necessary to understand the behavior of anions such as I- under the hyper-alkaline conditions. The natural hyper-alkaline spring water (pH>11) in the Oman ophiolite is known to be generated from the partly serpentinized peridotites. The spring water is characteristically hyper-alkaline, reducing, low-Mg, Si and HCO 3 - , and high-Ca, while the river water is moderately alkaline, oxidizing, high-Mg and HCO 3 - . The mixing of these spring and river water resulted in the formation of secondary minerals. In the present study, the naturally occurring hyper-alkaline conditions near the springs in Oman were used as natural analogue for the interaction between cement pore fluid and natural Mg-HCO 3 - groundwater. The present aim of this paper is to examine the conditions of secondary mineral formation and the anion uptake capacity of these mineral in this system. Water and precipitate samples were collected from the different locations around the spring vent to identify the effect of mixing ratios between spring and river water on mineral composition and water-mineral distribution coefficient of various anions. On-site synthesis was also carried out to support these data quantitatively. Aragonite was observed in all precipitates, while calcite, brucite and Mg-Al hydrotalcite-like compounds (HTlc) were also determined in some samples. Calcite was observed only closed to the springs. At locations far from the springs, calcite formation was inhibited due to high-Mg fluid from river water. Brucite was observed from the springs with relatively low-Al concentration and HTlc was the opposite. During

  3. Synthesis and characterization of cobalt ferrocyanides loaded on organic anion exchanger

    Energy Technology Data Exchange (ETDEWEB)

    Valsala, T.P. [Waste Management Division, Bhabha Atomic Research Centre, Trombay 400 085 (India)], E-mail: tpvalsala@yahoo.co.in; Joseph, Annie [Waste Management Division, Bhabha Atomic Research Centre, Trombay 400 085 (India); Shah, J.G. [Back End Technology Division, Bhabha Atomic Research Centre, Trombay 400 085 (India); Raj, Kanwar [Waste Management Division, Bhabha Atomic Research Centre, Trombay 400 085 (India); Venugopal, V. [Radiochemistry and Isotope Group, Bhabha Atomic Research Centre, Trombay 400 085 (India)

    2009-02-15

    Transition metal ferrocyanides have important applications in the selective removal of radioactive caesium from low level and intermediate level radioactive liquid waste streams. The microcrystalline nature of these materials renders them useless for application in column mode operations. Special preparation procedures have been developed to prepare granular solids by in situ precipitation of metal ferrocyanides on organic anion exchangers, which is suitable for column mode operations. The elemental compositions of the metal ferrocyanides precipitated inside the pores of anion exchanger were determined by analysing the dissolved samples using ICP-AES system and flame photometer. From the XRD and EDX analyses and the elemental composition of the synthesized materials, the nature of the compound formed inside the anion exchanger was found to be cobalt ferrocyanide. From SEM analysis of the samples, the particle size of the cobalt ferrocyanide precipitated inside the anion exchanger was found to be much less than that of cobalt ferrocyanide precipitated outside. The efficiency of these materials for removal of Cs was evaluated by measuring the distribution coefficient (Kd), ion exchange capacity and kinetics of Cs uptake. The Kd of the materials loaded on anion exchanger was found to be of the order of 10{sup 5} ml/g. The Cs uptake kinetics of the materials loaded on anion exchanger was slower than that of precipitated materials. The ion exchange capacity of the cobalt ferrocyanide loaded on anion exchanger was found to be much higher than that of the precipitated cobalt ferrocyanide.

  4. Effect of chemical retention on anionic species diffusion in compacted clays

    International Nuclear Information System (INIS)

    Bazer-Bachi, Frederic

    2005-01-01

    Anionic radioisotopes are of particular importance within the framework of the calculated health risk associated with high-level and long-lived intermediate-level underground radioactive waste disposal. Therefore, the objective of this work is the construction of a transport model coupled with chemistry in order to quantify the behaviour of anionic solutes in the Callovo-Oxfordian (CO_x) argillite, the argillaceous host rock of the ANDRA Meuse/Haute-Marne underground laboratory. An experimental methodology was defined to characterize this migration, several experimental methods being implemented: batch experiments, laboratory columns and through-diffusion cells. The study of the diffusion of the non-sorbing anionic tracer "3"6Cl"- highlighted the fact that, due to anionic exclusion, anions only had access to a part of the porosity. The retention of "3"5SO_4"2"- and "1"2"5I- on CO_x argillite was then characterized, quantified by batch experiments and confirmed by other experimental methods. Nevertheless, their migration was less retarded than expected by a model based on batch experiments and on "3"6Cl"- diffusive data. This difference was explained by anion exclusion which reduced sorption site accessibility. Thus, the intensity of this phenomenon has to be considered to model anion migration in compacted clays. (author) [fr

  5. Carbon Chain Anions and the Growth of Complex Organic Molecules in Titan’s Ionosphere

    Science.gov (United States)

    Desai, R. T.; Coates, A. J.; Wellbrock, A.; Vuitton, V.; Crary, F. J.; González-Caniulef, D.; Shebanits, O.; Jones, G. H.; Lewis, G. R.; Waite, J. H.; Cordiner, M.; Taylor, S. A.; Kataria, D. O.; Wahlund, J.-E.; Edberg, N. J. T.; Sittler, E. C.

    2017-08-01

    Cassini discovered a plethora of neutral and ionized molecules in Titan’s ionosphere including, surprisingly, anions and negatively charged molecules extending up to 13,800 u q-1. In this Letter, we forward model the Cassini electron spectrometer response function to this unexpected ionospheric component to achieve an increased mass resolving capability for negatively charged species observed at Titan altitudes of 950-1300 km. We report on detections consistently centered between 25.8 and 26.0 u q-1 and between 49.0-50.1 u q-1 which are identified as belonging to the carbon chain anions, CN-/C3N- and/or C2H-/C4H-, in agreement with chemical model predictions. At higher ionospheric altitudes, detections at 73-74 u q-1 could be attributed to the further carbon chain anions C5N-/C6H- but at lower altitudes and during further encounters extend over a higher mass/charge range. This, as well as further intermediary anions detected at >100 u, provide the first evidence for efficient anion chemistry in space involving structures other than linear chains. Furthermore, at altitudes below environments where chain anions have been observed and shows that anion chemistry plays a role in the formation of complex organics within a planetary atmosphere as well as in the interstellar medium.

  6. Thermophysical properties of 1-hexyl-3-methyl imidazolium based ionic liquids with tetrafluoroborate, hexafluorophosphate and bis(trifluoromethylsulfonyl)imide anions

    International Nuclear Information System (INIS)

    Muhammad, Ayyaz; Abdul Mutalib, M.I.; Wilfred, C.D.; Murugesan, T.; Shafeeq, Amir

    2008-01-01

    The thermophysical properties of 1-hexyl-3-methyl imidazolium based hydrophobic room temperature ionic liquids (RTILs); with tetrafluoroborate (BF 4 ), hexafluorophosphate (PF 6 ), and bis(trifluoromethylsulfonyl)imide (Tf 2 N) anions, namely density ρ (298.15 to 348.15) K, dynamic viscosity η (288.2 to 348.2) K, surface tension σ (298.15 to 338) K, and refractive index n D (302.95 to 332.95) K have been measured. The coefficients of thermal expansion α p values were calculated from the experimental density data using an empirical correlation. The thermal stability of all ILs is also investigated at two different heating rates (10 and 20) deg. C . min -1 ) using thermogravimetric analyzer (TGA). The experimental results presented in this study reveal that the choice of anion type shows the most significant effect on the properties of ILs. The chloride and water contents of ILs (as impurities) are also investigated and reported in the present work

  7. The Position of Aβ22-40 and Aβ1-42 in Anionic Lipid Membranes Containing Cholesterol.

    Science.gov (United States)

    Barrett, Matthew A; Alsop, Richard J; Hauß, Thomas; Rheinstädter, Maikel C

    2015-11-30

    Amyloid-β peptides interact with cell membranes in the human brain and are associated with neurodegenerative diseases, such as Alzheimer's disease. An emerging explanation of the molecular mechanism, which results in neurodegeneration, places the cause of neurotoxicity of the amyloid- peptides on their potentially negative interaction with neuronal membranes. It is known that amyloid-β peptides interact with the membrane, modifying the membrane's structural and dynamic properties. We present a series of X-ray diffraction experiments on anionic model lipid membranes containing various amounts of cholesterol. These experiments provide experimental evidence for an interaction of both the full length amyloid-β1-42 peptide, and the peptide fragment amyloid-β22-40 with anionic bilayer containing cholesterol. The location of the amyloid-β peptides was determined from these experiments, with the full length peptide embedding into the membrane, and the peptide fragment occupying 2 positions-on the membrane surface and embedded into the membrane core.

  8. Gas-generated thermal oxidation of a coordination cluster for an anion-doped mesoporous metal oxide.

    Science.gov (United States)

    Hirai, Kenji; Isobe, Shigehito; Sada, Kazuki

    2015-12-18

    Central in material design of metal oxides is the increase of surface area and control of intrinsic electronic and optical properties, because of potential applications for energy storage, photocatalysis and photovoltaics. Here, we disclose a facile method, inspired by geochemical process, which gives rise to mesoporous anion-doped metal oxides. As a model system, we demonstrate that simple calcination of a multinuclear coordination cluster results in synchronic chemical reactions: thermal oxidation of Ti8O10(4-aminobenzoate)12 and generation of gases including amino-group fragments. The gas generation during the thermal oxidation of Ti8O10(4-aminobenzoate)12 creates mesoporosity in TiO2. Concurrently, nitrogen atoms contained in the gases are doped into TiO2, thus leading to the formation of mesoporous N-doped TiO2. The mesoporous N-doped TiO2 can be easily synthesized by calcination of the multinuclear coordination cluster, but shows better photocatalytic activity than the one prepared by a conventional sol-gel method. Owing to an intrinsic designability of coordination compounds, this facile synthetic will be applicable to a wide range of metal oxides and anion dopants.

  9. Carbon Chain Anions and the Growth of Complex Organic Molecules in Titan’s Ionosphere

    Energy Technology Data Exchange (ETDEWEB)

    Desai, R. T.; Coates, A. J.; Wellbrock, A.; González-Caniulef, D.; Jones, G. H.; Lewis, G. R.; Taylor, S. A.; Kataria, D. O. [Mullard Space Science Laboratory, University College London, Holmbury St. Mary, Surrey RH5 6NT (United Kingdom); Vuitton, V. [Université Grenoble Alpes, CNRS, IPAG, F-38000 Grenoble (France); Crary, F. J. [Laboratory for Atmospheric and Space Physics, University of Colorado, Innovation Drive, Boulder, CO 80303 (United States); Shebanits, O.; Wahlund, J.-E. [Department of Physics and Astronomy, Uppsala University, Box 516, SE-751 20 Uppsala (Sweden); Waite, J. H. [Space Science and Engineering Division, Southwest Research Institute (SWRI), 6220 Culebra Road, San Antonio, TX 78238 (United States); Cordiner, M.; Sittler, E. C. [NASA Goddard Space Flight Center, 8800 Greenbelt Road, Greenbelt, MD 20771 (United States); Edberg, N. J. T., E-mail: r.t.desai@ucl.ac.uk [Swedish Institute of Space Physics, Box 537, SE-751 21 Uppsala (Sweden)

    2017-08-01

    Cassini discovered a plethora of neutral and ionized molecules in Titan’s ionosphere including, surprisingly, anions and negatively charged molecules extending up to 13,800 u q{sup −1}. In this Letter, we forward model the Cassini electron spectrometer response function to this unexpected ionospheric component to achieve an increased mass resolving capability for negatively charged species observed at Titan altitudes of 950–1300 km. We report on detections consistently centered between 25.8 and 26.0 u q{sup −1} and between 49.0–50.1 u q{sup −1} which are identified as belonging to the carbon chain anions, CN{sup −}/C{sub 3}N{sup −} and/or C{sub 2}H{sup −}/C{sub 4}H{sup −}, in agreement with chemical model predictions. At higher ionospheric altitudes, detections at 73–74 u q{sup −1} could be attributed to the further carbon chain anions C{sub 5}N{sup −}/C{sub 6}H{sup −} but at lower altitudes and during further encounters extend over a higher mass/charge range. This, as well as further intermediary anions detected at >100 u, provide the first evidence for efficient anion chemistry in space involving structures other than linear chains. Furthermore, at altitudes below <1100 km, the low-mass anions (<150 u q{sup −1}) were found to deplete at a rate proportional to the growth of the larger molecules, a correlation that indicates the anions are tightly coupled to the growth process. This study adds Titan to an increasing list of astrophysical environments where chain anions have been observed and shows that anion chemistry plays a role in the formation of complex organics within a planetary atmosphere as well as in the interstellar medium.

  10. Carbon Chain Anions and the Growth of Complex Organic Molecules in Titan’s Ionosphere

    International Nuclear Information System (INIS)

    Desai, R. T.; Coates, A. J.; Wellbrock, A.; González-Caniulef, D.; Jones, G. H.; Lewis, G. R.; Taylor, S. A.; Kataria, D. O.; Vuitton, V.; Crary, F. J.; Shebanits, O.; Wahlund, J.-E.; Waite, J. H.; Cordiner, M.; Sittler, E. C.; Edberg, N. J. T.

    2017-01-01

    Cassini discovered a plethora of neutral and ionized molecules in Titan’s ionosphere including, surprisingly, anions and negatively charged molecules extending up to 13,800 u q"−"1. In this Letter, we forward model the Cassini electron spectrometer response function to this unexpected ionospheric component to achieve an increased mass resolving capability for negatively charged species observed at Titan altitudes of 950–1300 km. We report on detections consistently centered between 25.8 and 26.0 u q"−"1 and between 49.0–50.1 u q"−"1 which are identified as belonging to the carbon chain anions, CN"−/C_3N"− and/or C_2H"−/C_4H"−, in agreement with chemical model predictions. At higher ionospheric altitudes, detections at 73–74 u q"−"1 could be attributed to the further carbon chain anions C_5N"−/C_6H"− but at lower altitudes and during further encounters extend over a higher mass/charge range. This, as well as further intermediary anions detected at >100 u, provide the first evidence for efficient anion chemistry in space involving structures other than linear chains. Furthermore, at altitudes below <1100 km, the low-mass anions (<150 u q"−"1) were found to deplete at a rate proportional to the growth of the larger molecules, a correlation that indicates the anions are tightly coupled to the growth process. This study adds Titan to an increasing list of astrophysical environments where chain anions have been observed and shows that anion chemistry plays a role in the formation of complex organics within a planetary atmosphere as well as in the interstellar medium.

  11. Effect of Fe(II)/Ce(III) dosage ratio on the structure and anion adsorptive removal of hydrothermally precipitated composites: Insights from EXAFS/XANES, XRD and FTIR

    KAUST Repository

    Chubar, Natalia

    2016-10-24

    In this work, we present material chemistry in the hydrothermal synthesis of new complex structure materials based on various dosage ratios of Fe and Ce (1:0, 2:1, 1:1, 1:2, 0:1), characterize them by the relevant methods that allow characterization of both crystalline and amorphous phases and correlate their structure/surface properties with the adsorptive performance of the five toxic anions. The applied synthesis conditions resulted in the formation of different compounds of Fe and Ce components. The Fe-component was dominated by various phases of Fe hydrous oxides, whereas the Ce-component was composed of various phases of Ce carbonates. The presence of two metal salts in raw materials resulted in the formation of a mesoporous structure and averaged the surface area compared to one metal-based material. The surface of all Fe-Ce composites was abundant in Fe component phases. Two-metal systems showed stronger anion removal performance than one-metal materials. The best adsorption was demonstrated by Fe-Ce based materials that had low crystallinity, that were rich in phases and that exhibited surfaces were abundant in greater number of surface functional groups. Notably, Fe extended fine structures simulated by EXAFS in these better adsorbents were rich from oscillations from both heavy and light atoms. This work provides new insights on the structure of composite inorganic materials useful to develop their applications in adsorption and catalysis. It also presents new inorganic anion exchangers with very high removal potential to fluoride and arsenate.

  12. Effect of Fe(II)/Ce(III) dosage ratio on the structure and anion adsorptive removal of hydrothermally precipitated composites: Insights from EXAFS/XANES, XRD and FTIR

    KAUST Repository

    Chubar, Natalia; Gerda, Vasyl; Banerjee, Dipanjan; Yablokova, Ganna

    2016-01-01

    In this work, we present material chemistry in the hydrothermal synthesis of new complex structure materials based on various dosage ratios of Fe and Ce (1:0, 2:1, 1:1, 1:2, 0:1), characterize them by the relevant methods that allow characterization of both crystalline and amorphous phases and correlate their structure/surface properties with the adsorptive performance of the five toxic anions. The applied synthesis conditions resulted in the formation of different compounds of Fe and Ce components. The Fe-component was dominated by various phases of Fe hydrous oxides, whereas the Ce-component was composed of various phases of Ce carbonates. The presence of two metal salts in raw materials resulted in the formation of a mesoporous structure and averaged the surface area compared to one metal-based material. The surface of all Fe-Ce composites was abundant in Fe component phases. Two-metal systems showed stronger anion removal performance than one-metal materials. The best adsorption was demonstrated by Fe-Ce based materials that had low crystallinity, that were rich in phases and that exhibited surfaces were abundant in greater number of surface functional groups. Notably, Fe extended fine structures simulated by EXAFS in these better adsorbents were rich from oscillations from both heavy and light atoms. This work provides new insights on the structure of composite inorganic materials useful to develop their applications in adsorption and catalysis. It also presents new inorganic anion exchangers with very high removal potential to fluoride and arsenate.

  13. Adsorption behavior of 99Mo using AG1-X8 anionic resin

    International Nuclear Information System (INIS)

    Santos, Jacinete L. dos; Yamaura, Mitiko; Damasceno, Marcos O.; Forbicini, Christina A.L.G.O.

    2013-01-01

    The significant growth in demand of 99 Mo in developed and developing countries, like Brazil, requires large production capacity and availability of this radioisotope. With the global crisis on its supply to Brazil rethought the need to become independent in their production and the solution was to start the Brazilian Multipurpose Reactor (RMB) project, which aims to meet the national demand of 99 Mo for the medical field. This work aims to study the 99 Mo adsorption in AG1-X8 strong anion resin, which is one of the intermediate steps of separation and purification, retaining it in the form of molybdate ions. In process evaluated the resin properties with respect to pH and concentration of 99 Mo in the solution. The adsorbed amount of 99 Mo was determined indirectly by the amount in the supernatant after adsorption and the data fitted to the Langmuir and Freundlich isotherms. Among the models, the Langmuir showed a closer relationship with the experimentally obtained data. This suggests the occurrence of monolayer adsorption and heterogeneous conditions at the surface, where both phenomena can coexist in the experimental conditions tested. (author)

  14. Adsorption behavior of {sup 99}Mo using AG1-X8 anionic resin

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Jacinete L. dos; Yamaura, Mitiko; Damasceno, Marcos O.; Forbicini, Christina A.L.G.O., E-mail: jlsantos@ipen.br, E-mail: myamaura@ipen.br, E-mail: marcos956@bol.com.br, E-mail: cforbici@ipen.br [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)

    2013-07-01

    The significant growth in demand of {sup 99}Mo in developed and developing countries, like Brazil, requires large production capacity and availability of this radioisotope. With the global crisis on its supply to Brazil rethought the need to become independent in their production and the solution was to start the Brazilian Multipurpose Reactor (RMB) project, which aims to meet the national demand of {sup 99}Mo for the medical field. This work aims to study the {sup 99}Mo adsorption in AG1-X8 strong anion resin, which is one of the intermediate steps of separation and purification, retaining it in the form of molybdate ions. In process evaluated the resin properties with respect to pH and concentration of {sup 99}Mo in the solution. The adsorbed amount of {sup 99}Mo was determined indirectly by the amount in the supernatant after adsorption and the data fitted to the Langmuir and Freundlich isotherms. Among the models, the Langmuir showed a closer relationship with the experimentally obtained data. This suggests the occurrence of monolayer adsorption and heterogeneous conditions at the surface, where both phenomena can coexist in the experimental conditions tested. (author)

  15. Fabrication of Electrospun Polyamide-6/Chitosan Nanofibrous Membrane toward Anionic Dyes Removal

    Directory of Open Access Journals (Sweden)

    Mozhdeh Ghani

    2014-01-01

    Full Text Available Nanofibrous filter media of polyamide-6/chitosan were fabricated by electrospinning onto a satin fabric substrate and characterized by scanning electron microscopy (SEM, Fourier transform infrared spectroscopy (FTIR, and water contact angle (WCA. Anionic dye removal capability of the filter was investigated for Solophenyl Red 3BL and Polar Yellow GN, respectively, as acidic and direct dyes were investigated with respect to solution parameters (pH and initial dye concentration and membrane parameters (electrospinning time and chitosan ratio through filtration system. Experiments were designed using response surface methodology (RSM based on five-level central composite design (CCD with four parameters to maximize removal efficiency of the filter media. Moreover, the effect of parameters and their likely interactions on dye removal were investigated by mathematically developed models. The optimum values for solution pH, initial dye concentration, electrospinning time, and chitosan ratio were predicted to be 5, 50 mg/L, 4 hr, 30% and 5, 100 mg/L, 4 hr, 10%, respectively, for achieving 96% and 95% removal of Solophenyl Red 3BL and Polar Yellow GN. Evaluation of the estimation capability of applied models revealed that the models have a good agreement with experimental values. This study demonstrated that polyamide-6/chitosan nanofibrous membrane has an enormous applicable potential in dye removal from aqueous solutions.

  16. Porous anionic indium-organic framework with enhanced gas and vapor adsorption and separation ability.

    Science.gov (United States)

    Huang, Yuanbiao; Lin, Zujin; Fu, Hongru; Wang, Fei; Shen, Min; Wang, Xusheng; Cao, Rong

    2014-09-01

    A three-dimensional microporous anionic metal-organic framework (MOF) (Et4N)3[In3(TATB)4] (FJI-C1, H3TATB=4,4',4''-s-triazine-2,4,6-triyltribenzoic acid) with large unit cell volume has been synthesized. Assisted by the organic cation group Et4N in the pores of the compound, FJI-C1 not only shows high adsorption uptakes of C2 and C3 hydrocarbons, but also exhibits highly selective separation of propane, acetylene, ethane, and ethylene from methane at room temperature. Furthermore, it also exhibits high separation selectivity for propane over C2 hydrocarbons and acetylene can be readily separated from their C2 hydrocarbons mixtures at low pressure due to the high selectivity for C2H2 in comparison to C2H4 and C2H6. In addition, FJI-C1 with hydrophilic internal pores surfaces shows highly efficient adsorption separation of polar molecules from nonpolar molecules. Notably, it exhibits high separation selectivity for benzene over cyclohexane due to the π-π interactions between benzene molecules and s-triazine rings of the porous MOF. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. New TiO2/DSAT Immobilization System for Photodegradation of Anionic and Cationic Dyes

    Directory of Open Access Journals (Sweden)

    Wan Izhan Nawawi Wan Ismail

    2015-01-01

    Full Text Available A new immobilized TiO2 technique was prepared by coating TiO2 solution onto double-sided adhesive tape (DSAT as a thin layer binder without adding any organic additives. Glass plate was used as support material to immobilized TiO2/DSAT. Two different charges of dyes were applied, namely, anionic reactive red 4 (RR4 and cationic methylene blue (MB dyes. Photocatalytic degradation of RR4 and MB dyes was observed under immobilized TiO2/DSAT with the degradation rate slightly lower and higher, respectively, compared with TiO2 in suspension mode. It was observed that DSAT is able to provide a very strong intact between glass and TiO2 layers thus making the reusability of immobilized TiO2/DSAT be up to 30 cycles. In fact, a better photodegradation activity was observed by number of cycles due to increasing formation of pores on TiO2 surface observed by SEM analysis.

  18. Chloride Ion Adsorption Capacity of Anion Exchange Resin in Cement Mortar

    Directory of Open Access Journals (Sweden)

    Yunsu Lee

    2018-04-01

    Full Text Available This paper presents the effect of anion exchange resin (AER on the adsorption of chloride ions in cement mortar. The kinetic and equilibrium behaviors of AER were investigated in distilled water and Ca(OH2 saturated solutions, and then the adsorption of chloride ions by the AER in the mortar specimen was determined. The AER was used as a partial replacement for sand in the mortar specimen. The mortar specimen was coated with epoxy, except for an exposed surface, and then immersed in a NaCl solution for 140 days. The chloride content in the mortar specimen was characterized by energy dispersive X-ray fluorescence analysis and electron probe microanalysis. The results showed that the AER could adsorb the chloride ions from the solution rapidly but had a relatively low performance when the pH of its surrounding environment increased. When the AER was mixed in the cement mortar, its chloride content was higher than that of the cement matrix around it, which confirms the chloride ion adsorption capacity of the AER.

  19. Removal of chromium (VI) from electroplating wastewater using an anion exchanger derived from rice straw.

    Science.gov (United States)

    Cao, Wei; Dang, Zhi; Yia, Xiao-Yun; Yang, Chen; Lu, Gui-Ning; Liu, Yun-Feng; Huang, Se-Yan; Zheng, Liu-Chun

    2013-01-01

    An anion exchanger from rice straw was used to remove Cr (VI) from synthetic wastewater and electroplating effluent. The exchanger was characterized using Fourier transform infrared (FTIR) spectrum and scanning electron microscopy (SEM), and it was found that the quaternary amino group and hydroxyl group are the main functional groups on the fibrous surface of the exchanger. The effect of contact time, initial concentration and pH on the removal of Cr (VI), and adsorption isotherms at different temperature, was investigated. The results showed that the removal of Cr (VI) was very rapid and was significantly affected by the initial pH of the solution. Although acidic conditions (pH = 2-6) facilitated Cr (VI) adsorption, the exchanger was effective in neutral solution and even under weak base conditions. The equilibrium data fitted well with Langmuir adsorption model, and the maximum Cr (VI) adsorption capacities at pH 6.4 were 0.35, 0.36 and 0.38 mmol/g for 15, 25 and 35 degrees C, respectively. The exchanger was finally tested with real electroplating wastewater, and at sorbent dosage of 10 g/L, the removal efficiencies for Cr (VI) and total Cr were 99.4% and 97.8%, respectively. In addition, the positive relationship between adsorbed Cr (VI) and desorbed Cl- suggested that Cr (VI) was mainly removed by ion exchange with chlorine.

  20. Robust Multilayer Graphene-Organic Frameworks for Selective Separation of Monovalent Anions.

    Science.gov (United States)

    Zhao, Yan; Zhu, Jiajie; Li, Jian; Zhao, Zhijuan; Charchalac Ochoa, Sebastian Ignacio; Shen, Jiangnan; Gao, Congjie; Van der Bruggen, Bart

    2018-05-30

    The chemical and mechanical stability of graphene nanosheets was used in this work to design a multilayer architecture of graphene, grafted with sulfonated 4,4'-diaminodiphenyl sulfone (SDDS). Quaternized poly(phenylene oxide) (QPPO) was synthesized and mixed with SDDS (rGO-SDDS-rGO@QPPO), yielding a multilayer graphene-organic framework (MGOF) with positive as well as negative functional groups that can be applied as a versatile electrodriven membrane in electrodialysis (ED). Multilayer graphene-organic frameworks are a new class of multilayer structures, with an architecture having a tunable interlayer spacing connected by cationic polymer material. MGOF membranes were demonstrated to allow for an excellent selective separation of monovalent anions in aqueous solution. Furthermore, different types of rGO-SDDS-rGO@QPPO membranes were found to have a good mechanical strength, with a tensile strength up to 66.43 MPa. The membrane (rGO-SDDS-rGO@QPPO-2) also has a low surface electric resistance (2.79 Ω·cm 2 ) and a low water content (14.5%) and swelling rate (4.7%). In addition, the selective separation between Cl - and SO 4 2- of the MGOF membranes could be as high as 36.6%.

  1. Investigation of Removal Possibilities of Colloidal Alumina from Aqueous Solution by the Use of Anionic Polyacrylamide

    International Nuclear Information System (INIS)

    Wisniewska, M.; Chibowski, S.; Urban, T.

    2016-01-01

    Purification of drinking and industrial water required usage of high molecular weight polymer to cause flocculation process of dispersed suspension of contaminants. Poly electrolytes, including ionic polyacrylamide are especially appropriate for these purposes, because in this case the suspension stability can be controlled by both steric and electrostatic forces. Thus the influence of solution p H and hydrolysis degree (carboxyl groups content) of anionic polyacrylamide (PAM) on the alumina (Al_2O_3) suspension stability were studied. The turbidimetry was applied for determination of the examined systems stability. The mechanism of suspension stabilization or destabilization in the polymer presence was proposed on the basis of determined parameters: adsorbed amount of PAM, its adsorption layer thickness, linear dimensions of macromolecules in the solution and zeta potential of alumina particles covered with the polyacrylamide layer. The greatest decrease of the alumina suspension stability in the polymer presence in comparison to that without the polymer was obtained at p H 6 after the addition of PAMs with higher molecular weight (i.e. 14 000 0000) and hydrolysis degrees 20 and 30% (efficient neutralization of solid surface charge). In turn, the most unstable alumina system proved to be that prepared at p H 9 containing PAM with the highest molecular weight and the greatest hydrolysis degree (causing the most effective bridging flocculation).

  2. Effects of arginine on multimodal anion exchange chromatography.

    Science.gov (United States)

    Hirano, Atsushi; Arakawa, Tsutomu; Kameda, Tomoshi

    2015-12-01

    The effects of arginine on binding and elution properties of a multimodal anion exchanger, Capto adhere, were examined using bovine serum albumin (BSA) and a monoclonal antibody against interleukin-8 (mAb-IL8). Negatively charged BSA was bound to the positively charged Capto adhere and was readily eluted from the column with a stepwise or gradient elution using 1M NaCl at pH 7.0. For heat-treated BSA, small oligomers and remaining monomers were also eluted using a NaCl gradient, whereas larger oligomers required arginine for effective elution. The positively charged mAb-IL8 was bound to Capto adhere at pH 7.0. Arginine was also more effective for elution of the bound mAb-IL8 than was NaCl. The results imply that arginine interacts with the positively charged Capto adhere. The mechanism underlying the interactions of arginine with Capto adhere was examined by calculating the binding free energy between an arginine molecule and a Capto adhere ligand in water through molecular dynamics simulations. The overall affinity of arginine for Capto adhere is attributed to the hydrophobic and π-π interactions between an arginine side chain and the aromatic moiety of the ligand as well as hydrogen bonding between arginine and the ligand hydroxyl group, which may account for the characteristics of protein elution using arginine. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Americium Separations from High-Salt Solutions Using Anion Exchange

    International Nuclear Information System (INIS)

    Barr, Mary E.; Jarvinen, Gordon D.; Stark, Peter C.; Chamberlin, Rebecca M.; Bartsch, Richard A.; Zhang, Z.Y.; Zhao, W.

    2001-01-01

    The aging of the US nuclear stockpile presents a number of challenges, including the increasing radioactivity of plutonium residues due to the ingrowth of 241 Am from the β-decay of 241 Pu. We investigated parameters that affect the sorption of Am onto anion-exchange resins from concentrated effluents derived from nitric acid processing of plutonium residues. These postevaporator wastes are nearly saturated solutions of acidic nitrate salts, and americium removal is complicated by physical factors, such as solution viscosity and particulates, as well as by the presence of large quantities of competing metals and acid. Single- and double-contact batch distribution coefficients for americium and neodymium from simple and complex surrogate solutions are presented. Varied parameters include the nitrate salt concentration and composition and the nitric acid concentration. We find that under these extremely concentrated conditions, Am(III) removal efficiencies can surpass 50% per contact. Distribution coefficients for both neodymium and americium are insensitive to solution acidity and appear to be driven primarily by low water activities of the solutions

  4. Anionic carbonato and oxalato cobalt(III) nitrogen mustard complexes.

    Science.gov (United States)

    Craig, Peter R; Brothers, Penelope J; Clark, George R; Wilson, William R; Denny, William A; Ware, David C

    2004-02-21

    Synthetic approaches to cobalt(III) complexes [Co(L)(L')2] containing the bidentate dialkylating nitrogen mustard N,N-bis(2-chloroethyl)-1,2-ethanediamine (L = dce) together with anionic ancilliary ligands (L') which are either carbonato (CO3(2-)), oxalato (ox2-), bis(2-hydroxyethyl)dithiocarbamato (bhedtc-), 2-pyridine carboxylato (pico-) or 2-pyrazine carboxylato (pyzc-) were investigated. Synthetic routes were developed using the related amines N,N-diethyl-1,2-ethanediamine (dee) and 1,2-ethanediamine (en). The complexes [Co(CO3)2(L)]- (L = dee 1, dce 2), [Co(ox)2(L)]- (L = dee 3, dce 4), [Co(bhedtc)2(dee)]+ 5, [Co(bhedtc)2(en)]+ 6, mer-[Co(pico)3], mer-[Co(pyzc)]3 7 and [Co(pico)2(dee)]+ 8 were prepared and were characterised by IR, UV-Vis, 1H and 13C[1H] NMR spectroscopy, mass spectrometry and cyclic voltammetry. [Co(bhedtc)2(en)]BPh4 6b and trans(O)-[Co(pico)2(dee)]ClO4 8 were characterised by X-ray crystallography. In vitro biological tests were carried out on complexes 1-4 in order to assess the degree to which coordination of the mustard to cobalt attenuated its cytotoxicity, and the differential toxicity in air vs. nitrogen.

  5. Stability of anionic polymers in presence of multivalent cations

    International Nuclear Information System (INIS)

    Sabbagh, Imad

    1997-01-01

    This research thesis aimed at studying the stability of poly-electrolytes in saline environments, and the interactions between ions and poly-electrolytes of different charge densities. For this purpose, the author more particularly studied specific interactions between anionic poly-electrolytes and multivalent cations. After a recall of properties of neutral polymers and poly-electrolytes in solution, the author evokes interactions between poly-electrolytes and counter-ions, and briefly presents two models of stability of poly-electrolytes in saline solutions. The next part presents various experimental spectroscopic and electrochemical techniques and results of the characterization of the used products. Spectroscopic techniques allow ion-polymer interactions at the atomic scale to be studied, and electrochemical techniques allow the behaviour of small ions to be studied. The author then discusses the main differences of solubility between poly-electrolytes containing sulphonate or sulphate groups and those containing carboxylate groups. A model is then developed to generalise phase diagrams of a poly-electrolyte with respect to the chemical affinity of its functional group with ions of opposite sign. The author then addresses the behaviour of a non charged polyacrylic acid in various saline solutions, and presents a phase diagram model [fr

  6. Origin of negative resistance in anion migration controlled resistive memory

    Science.gov (United States)

    Banerjee, Writam; Wu, Facai; Hu, Yuan; Wu, Quantan; Wu, Zuheng; Liu, Qi; Liu, Ming

    2018-03-01

    Resistive random access memory (RRAM) is one of the most promising emerging nonvolatile technologies for the futuristic memory devices. Resistive switching behavior often shows negative resistance (NR), either voltage controlled or current controlled. In this work, the origin of a current compliance dependent voltage controlled NR effect during the resetting of anion migration based RRAM devices is discussed. The N-type voltage controlled NR is a high field driven phenomena. The current conduction within the range of a certain negative voltage is mostly dominated by space charge limited current. But with the higher negative voltage, a field induced tunneling effect is generated in the NR region. The voltage controlled NR is strongly dependent on the compliance current. The area independent behavior indicates the filamentary switching. The peak to valley ratio (PVR) is > 5. The variation of PVR as a function of the conduction band offset is achieved. Compared to other reported works, based on the PVR, it is possible to distinguish the RRAM types. Generally, due to the higher electric field effect on the metallic bridge during RESET, the electrochemical metallization type RRAM shows much higher PVR than the valance change type RRAM.

  7. Purification of degraded TBP solvent using macroreticular anion exchange resin

    International Nuclear Information System (INIS)

    Kartha, P.K.S.; Kutty, P.V.E.; Janaradanan, C.; Ramanujam, A.; Dhumwad, R.K.

    1989-01-01

    Tri-n-butyl phosphate (TBP) diluted with a suitable diluent is commonly used for solvent extraction in Purex process for the recovery of uranium and plutonium from irradiated nuclear fuels. This solvent gets degraded due to various factors, the main degradation product being dibutyl phosphoric acid (HDBP). A solvent cleanup step is generally incorporated in the process for removing the degradation products from the used solvent. A liquid-liquid cleanup system using sodium carbonate or sodium hydroxide solution is routinely used. Considering certain advantages, like the possibility of loading the resin almost to saturation capacity and the subsequent disposal of the spent resin by incineration and the feasibility of adopting it to the process, a liquid-solid system has been tried as an alternate method, employing various available macroreticular anion exchange resins in OH - form for the sorption of HDBP from TBP. After standardizing the various conditions for the satisfactory removal of HDBP from TBP using synthetic mixtures, resins were tested with process solvent in batch contacts. The parameters studied were (1) capacity of different resins for HDBP sorption (2) influence of acidity, uranium and HDBP on the sorption behaviour of the latter (3) removal of fission products from the solvent by the resin and (4) regeneration and recycling of the resin. (author). 2 figs., 13 tabs., 17 refs

  8. Highly conductive side chain block copolymer anion exchange membranes.

    Science.gov (United States)

    Wang, Lizhu; Hickner, Michael A

    2016-06-28

    Block copolymers based on poly(styrene) having pendent trimethyl styrenylbutyl ammonium (with four carbon ring-ionic group alkyl linkers) or benzyltrimethyl ammonium groups with a methylene bridge between the ring and ionic group were synthesized by reversible addition-fragmentation radical (RAFT) polymerization as anion exchange membranes (AEMs). The C4 side chain polymer showed a 17% increase in Cl(-) conductivity of 33.7 mS cm(-1) compared to the benzyltrimethyl ammonium sample (28.9 mS cm(-1)) under the same conditions (IEC = 3.20 meq. g(-1), hydration number, λ = ∼7.0, cast from DMF/1-propanol (v/v = 3 : 1), relative humidity = 95%). As confirmed by small angle X-ray scattering (SAXS), the side chain block copolymers with tethered ammonium cations showed well-defined lamellar morphologies and a significant reduction in interdomain spacing compared to benzyltrimethyl ammonium containing block copolymers. The chemical stabilities of the block copolymers were evaluated under severe, accelerated conditions, and degradation was observed by (1)H NMR. The block copolymer with C4 side chain trimethyl styrenylbutyl ammonium motifs displayed slightly improved stability compared to that of a benzyltrimethyl ammonium-based AEM at 80 °C in 1 M NaOD aqueous solution for 30 days.

  9. Cation and anion monitoring in a wastewater treatment pilot project

    Directory of Open Access Journals (Sweden)

    Magda de Almeida

    2015-01-01

    Full Text Available El propósito del tratamiento de aguas residuales es la reutilización del agua.Esta reduce el consumo de agua potable y previene la contaminación del agua de primeruso. La reutilización del agua ya se ha implementado con éxito en diferentes lugares. Lostratamientos que utilizan los humedales artifi ciales son ampliamente estudiados como unaalternativa más económica y ecológica para tratar las aguas residuales. En estos sistemas, elcontrol de especies inorgánicas también es importante. Este estudio ha monitoreado cationes (Na+, K+, Li+ y NH4+ y aniones (SO42-, NO3-, NO2-, Cl- y PO42- en un sistema de humedalesconstruido (CWs, en un sistema de captación de agua de lluvia, en el tratamiento de aguasresiduales y en agua reutilizable fi nal. El monitoreo se llevó a cabo utilizando el análisiscromatográfi co de iones. Los valores de remoción encontrados en CWs fueron: 99,9% K+,NH4+ y SO42-, 52,6% Na+, 89,8% NO3-, 98,2% NO2-, 63,6% Cl- y 96,8% PO42-. Los resultadostambién mostraron que el sistema CWs está adecuado para la eliminación de iones del aguaresidual.

  10. Gamma radiation effect on gas production in anion exchange resins

    Energy Technology Data Exchange (ETDEWEB)

    Traboulsi, A. [CEA Marcoule, DEN/DTCD/SPDE/LCFI, BP 17171, 30207 Bagnols-sur-Cèze Cedex (France); E.A. LISA – METICA, Aix Marseille Université, Pôle de l’Etoile, case 451, 13397 Marseille Cedex 20 (France); Labed, V., E-mail: veronique.labed@cea.fr [CEA Marcoule, DEN/DTCD/SPDE/LCFI, BP 17171, 30207 Bagnols-sur-Cèze Cedex (France); Dauvois, V. [CEA Saclay, DEN/DANS/DPC/SECR/LSRM, 91191 Gif sur Yvette Cedex (France); Dupuy, N.; Rebufa, C. [E.A. LISA – METICA, Aix Marseille Université, Pôle de l’Etoile, case 451, 13397 Marseille Cedex 20 (France)

    2013-10-01

    Radiation-induced decomposition of Amberlite IRA400 anion exchange resin in hydroxide form by gamma radiolysis has been studied at various doses in different atmospheres (anaerobic, anaerobic with liquid water, and aerobic). The effect of these parameters on the degradation of ion exchange resins is rarely investigated in the literature. We focused on the radiolysis gases produced by resin degradation. When the resin was irradiated under anaerobic conditions with liquid water, the liquid phase over the resin was also analyzed to identify any possible water-soluble products released by degradation of the resin. The main products released are trimethylamine (TMA), molecular hydrogen (H{sub 2g}) and carbon dioxide (CO{sub 2g}). TMA and H{sub 2g} are produced in all the irradiation atmospheres. However, TMA was in gaseous form under anaerobic and aerobic conditions and in aqueous form in presence of liquid water. In the latter conditions, TMA{sub aq} was associated with aqueous dimethylamine (DMA{sub aq}), monomethylamine (MMA{sub aq}) and ammonia (NH{sub 4}{sup +}{sub aq}). CO{sub 2g} is formed in the presence of oxygen due to oxidation of organic compounds present in the system, in particular the degradation products such as TMA{sub g}.

  11. Purification of bacteriophage M13 by anion exchange chromatography.

    Science.gov (United States)

    Monjezi, Razieh; Tey, Beng Ti; Sieo, Chin Chin; Tan, Wen Siang

    2010-07-01

    M13 is a non-lytic filamentous bacteriophage (phage). It has been used widely in phage display technology for displaying foreign peptides, and also for studying macromolecule structures and interactions. Traditionally, this phage has been purified by cesium chloride (CsCl) density gradient ultracentrifugation which is highly laborious and time consuming. In the present study, a simple, rapid and efficient method for the purification of M13 based on anion exchange chromatography was established. A pre-packed SepFast Super Q column connected to a fast protein liquid chromatography (FPLC) system was employed to capture released phages in clarified Escherichia coli fermented broth. An average yield of 74% was obtained from a packed bed mode elution using citrate buffer (pH 4), containing 1.5 M NaCl at 1 ml/min flow rate. The purification process was shortened substantially to less than 2 h from 18 h in the conventional ultracentrifugation method. SDS-PAGE revealed that the purity of particles was comparable to that of CsCl gradient density ultracentrifugation method. Plaque forming assay showed that the purified phages were still infectious. Copyright 2010 Elsevier B.V. All rights reserved.

  12. Development of Preparation Methods for Alkaline Anion Exchange Membranes by Radiation

    International Nuclear Information System (INIS)

    Shin, Jun Hwa; Nho, Young Chang; Sohn, Joon Yong

    2010-01-01

    The objective of this project is to contribute to the environmentally friendly fuel cell system by developing a radiation grafting method for the preparation of anion exchange membranes for alkaline fuel cell and finally to the radiation technology industry. In this project, the preparation methods for the VBC-grafted fluoropolymer films using radiation have been developed and anion exchange membranes have been prepared via the reaction between the VBC-grafted fluoropolymer films and amines. The prepared anion exchange membranes were characterized and the performance of the membranes were evaluated

  13. Ca2+ and Mg2+-enhanced reduction of arsenazo III to its anion free radical metabolite and generation of superoxide anion by an outer mitochondrial membrane azoreductase.

    Science.gov (United States)

    Moreno, S N; Mason, R P; Docampo, R

    1984-12-10

    At the concentrations usually employed as a Ca2+ indicator, arsenazo III underwent a one-electron reduction by rat liver mitochondria to produce an azo anion radical as demonstrated by electron-spin resonance spectroscopy. Either NADH or NADPH could serve as a source of reducing equivalents for the production of this free radical by intact rat liver mitochondria. Under aerobic conditions, addition of arsenazo III to rat liver mitochondria produced an increase in electron flow from NAD(P)H to molecular oxygen, generating superoxide anion. NAD(P)H generated from endogenous mitochondrial NAD(P)+ by intramitochondrial reactions could not be used for the NAD(P)H azoreductase reaction unless the mitochondria were solubilized by detergent or anaerobiosis. In addition, NAD(P)H azoreductase activity was higher in the crude outer mitochondrial membrane fraction than in mitoplasts and intact mitochondria. The steady-state concentration of the azo anion radical and the arsenazo III-stimulated cyanide-insensitive oxygen consumption were enhanced by calcium and magnesium, suggesting that, in addition to an enhanced azo anion radical-stabilization by complexation with the metal ions, enhanced reduction of arsenazo III also occurred. Accordingly, addition of cations to crude outer mitochondrial membrane preparations increased arsenazo III-stimulated cyanide-insensitive O2 consumption, H2O2 formation, and NAD(P)H oxidation. Antipyrylazo III was much less effective than arsenazo III in increasing superoxide anion formation by rat liver mitochondria and gave a much weaker electron spin resonance spectrum of an azo anion radical. These results provide direct evidence of an azoreductase activity associated with the outer mitochondrial membrane and of a stimulation of arsenazo III reduction by cations.

  14. Diffusion in the matrix of rocks from Olkiluoto. The effect of anion exclusion

    International Nuclear Information System (INIS)

    Valkiainen, M.; Aalto, H.; Olin, M.; Lindberg, A.; Siitari-Kauppi, M.

    1995-12-01

    Diffusion in the rock matrix is dependent on two basic factors: the effective diffusion conductivity of the rock and the rock-capacity factor. The aim of this ongoing research is to study both of these factors more closely by finding evidence and studying the significance of anion exclusion and surface diffusion. The material for the study was selected form the drill-core of the drill-hole OL-KR5 from Olkiluoto investigations site. Six rock-types were included in the study, three unaltered and three altered. The water-types selected can be divided to two groups: in one the ionic strength is varied, in the another the ionic type is varied. The diffusion measurements were carried out partly by the equilibration-leaching method, partly by the through-diffusion method. The measurements by the equilibration-leaching method were performed in the anaerobic cabinet and the through-diffusion measurement in laboratory room conditions. Radioactive isotopes 3 H, 35 S, 36 Cl and 22 Na were selected as tracers. This report contains results of the equilibration-leaching measurements and through- diffusion measurements using 3 H (HTO), 36 Cl (Cl-) and 35 S(SO 4 2- ) as tracers. The rock-types under study were also studied in the University of Helsinki, Department of Chemistry using polymethylmethacrylate labelled with 14 C revealing the pore structure. Also, results of specific surface area measurements made in BAM, Berlin are given. The comparison of results obtained by the gas diffusion method at the University of Jyvaeskylae to the results obtained by tritium are also appended. (12 refs., 20 figs., 10 tabs.)

  15. The Production of Polycyclic Aromatic Hydrocarbon Anions in Inert Gas Matrices Doped with Alkali Metals. Electronic Absorption Spectra of the Pentacene Anion (C22H14(-))

    Science.gov (United States)

    Halasinski, Thomas M.; Hudgins, Douglas M.; Salama, Farid; Allamandola, Louis J.; Mead, Susan (Technical Monitor)

    1999-01-01

    The absorption spectra of pentacene (C22H14) and its radical cation (C22H14(+)) and anion (C22H14(-)) isolated in inert-gas matrices of Ne, Ar, and Kr are reported from the ultraviolet to the near-infrared. The associated vibronic band systems and their spectroscopic assignments are discussed together with the physical and chemical conditions governing ion (and counterion) production in the solid matrix. In particular, the formation of isolated pentacene anions is found to be optimized in matrices doped with alkali metal (Na and K).

  16. Preparation of anion exchange membrane using polyvinyl chloride (PVC) for alkaline water electrolysis

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, Gab-Jin; Bong, Soo-Yeon; Ryu, Cheol-Hwi [Hoseo University, Asan (Korea, Republic of); Lim, Soo-Gon [Energy and Machinery Korea Co., Ltd., Changwon (Korea, Republic of); Choi, Ho-Sang [Kyungil University, Gyeongsan (Korea, Republic of)

    2015-09-15

    An anion exchange membrane was prepared by the chloromethylation and the amination of polyvinyl chloride (PVC), as the base polymer. The membrane properties of the prepared anion exchange membrane, including ionic conductivity, ion exchange capacity, and water content were measured. The ionic conductivity of the prepared anion exchange membrane was in the range of 0.098x10{sup -2} -7.0x10{sup -2}S cm{sup -1}. The ranges of ion exchange capacity and water content were 1.9-3.7meq./g-dry-membrane and 35.1-63.1%, respectively. The chemical stability of the prepared anion exchange membrane was tested by soaking in 30 wt% KOH solution to determine its availability as a separator in the alkaline water electrolysis. The ionic conductivity during the chemical stability test largely did not change.

  17. Dynamics of anion exchange of lanthanides in aqueous-organic complexing media

    International Nuclear Information System (INIS)

    Sheveleva, I.V.; Bogatyrev, I.O.

    1987-01-01

    Effect of organic solvents (ethanol, acetone, acetonitrile) on change in kinetic parameters of the anion exchange process (anion-exchange column chromatography) of r.e.e. (europium and gadolinium) in complexing nitric acid media has been studied. It is established that complex LnA 4 anion is the only sorbing form of europium and gadolinium on anionite. When the organic component content of the solution being the same, the dynamic parameters of lanthanide exchange have higher values in aqueous-acetonitrile and aqueous-acetone media in comparison with aqueous-enthanol solutions of nitric acid. Lesser mobility of complex lanthanide anions in aqueous-alcoholic solutions can be explained by stronger solvation in the presence of solvents with higher acceptor properties

  18. Induction of Apoptosis by Superoxide Anion and the Protective Effects of Selenium and Vitamin E

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Objective The purpose of this study is to investigate the effect of superoxide anion on the apoptosis of cultured fibroblasts and the protective role of selenium and Vitamin E. Methods Cultured fibroblasts (NIH3T3), with or without selenium or vitamin E in the medium, were treated by superoxide anion produced by xanthine/xanthine oxidase reaction system and changes in cell structure and DNA were observed microscopically and electrophoretically. Results Apoptosis was observed when superoxide anion at a concentration of 5 nmol/L or 10 nmol/L had acted on the fibroblasts for 5-10 h. Selenium and Vitamin E in the medium inhibited the apoptosis significantly when their concentrations reached 1.15 mol/L and 2.3 mol/L respectively. Conclusion Selenium and vitamin E have protective effect against the apoptosis induced by superoxide anion. The effect of selenium is more remarkable than that of vitamin E.

  19. Feasibility Study for the Reduction of Perchlorate, Iodide, and Other Aqueous Anions

    National Research Council Canada - National Science Library

    Clewell, Rebecca A; Tsui, David T; Mattie, David R

    1999-01-01

    Cyclic Voltammetry (CV) was used as a technique to determine the feasibility of the use of a coulometric detector in the determination of perchlorate, iodide, and various other anions commonly found in drinking water...

  20. Cellulose Anionic Hydrogels Based on Cellulose Nanofibers As Natural Stimulants for Seed Germination and Seedling Growth.

    Science.gov (United States)

    Zhang, Hao; Yang, Minmin; Luan, Qian; Tang, Hu; Huang, Fenghong; Xiang, Xia; Yang, Chen; Bao, Yuping

    2017-05-17

    Cellulose anionic hydrogels were successfully prepared by dissolving TEMPO-oxidized cellulose nanofibers in NaOH/urea aqueous solution and being cross-linked with epichlorohydrin. The hydrogels exhibited microporous structure and high hydrophilicity, which contribute to the excellent water absorption property. The growth indexes, including the germination rate, root length, shoot length, fresh weight, and dry weight of the seedlings, were investigated. The results showed that cellulose anionic hydrogels with suitable carboxylate contents as plant growth regulators could be beneficial for seed germination and growth. Moreover, they presented preferable antifungal activity during the breeding and growth of the sesame seed breeding. Thus, the cellulose anionic hydrogels with suitable carboxylate contents could be applied as soilless culture mediums for plant growth. This research provided a simple and effective method for the fabrication of cellulose anionic hydrogel and evaluated its application in agriculture.

  1. Ammonia-hydrogen bromide and ammonia-hydrogen iodide complexes: anion photoelectron and ab initio studies.

    Science.gov (United States)

    Eustis, S N; Whiteside, A; Wang, D; Gutowski, M; Bowen, K H

    2010-01-28

    The ammonia-hydrogen bromide and ammonia-hydrogen iodide, anionic heterodimers were studied by anion photoelectron spectroscopy. In complementary studies, these anions and their neutral counterparts were also investigated via ab initio theory at the coupled cluster level. In both systems, neutral NH(3)...HX dimers were predicted to be linear, hydrogen-bonded complexes, whereas their anionic dimers were found to be proton-transferred species of the form, (NH(4)(+)X(-))(-). Both experimentally measured and theoretically predicted vertical detachment energies (VDE) are in excellent agreement for both systems, with values for (NH(4)(+)Br(-))(-) being 0.65 and 0.67 eV, respectively, and values for (NH(4)(+)I(-))(-) being 0.77 and 0.81 eV, respectively. These systems are discussed in terms of our previous study of (NH(4)(+)Cl(-))(-).

  2. An ab initio study on BeX 3- superhalogen anions (X = F, Cl, Br)

    Science.gov (United States)

    Anusiewicz, Iwona; Skurski, Piotr

    2002-06-01

    The vertical electron detachment energies (VDE) of 10 BeX 3- (X = F, Cl, Br) anions were calculated at the outer valence Green function (OVGF) level with the 6-311++G(3df) basis sets. The largest vertical electron binding energy was found for BeF 3- system (7.63 eV). All negatively charged species possess the vertical electron detachment energies that are larger than 5.5 eV and thus may be termed superhalogen anions. The strong dependence of the VDE of the BeX 3- species on the ligand-central atom (Be-X) distance and on the partial atomic charge localized on Be was observed and discussed, as well as the other factors that may influence the electronic stability of such anions. In addition, the usefulness of the various theoretical treatments for estimating the VDEs of superhalogen anions was tested and analyzed.

  3. The complex compounds of manganese (II) with poly dental ligands and polyhedron borane anions

    International Nuclear Information System (INIS)

    Buranova, S.A.

    1996-01-01

    The purpose of the present work is synthesis of complex compounds of manganese with organic ligands. Their studying by spectroscopic methods purposely to determinate the influence of borane anions on composition and structure of coordinating sphere of manganese

  4. The Anion Paradox in Sodium Taste Reception: Resolution by Voltage-Clamp Studies

    Science.gov (United States)

    Ye, Qing; Heck, Gerard L.; Desimone, John A.

    1991-11-01

    Sodium salts are potent taste stimuli, but their effectiveness is markedly dependent on the anion, with chloride yielding the greatest response. The cellular mechanisms that mediate this phenomenon are not known. This "anion paradox" has been resolved by considering the field potential that is generated by restricted electrodiffusion of the anion through paracellular shunts between taste-bud cells. Neural responses to sodium chloride, sodium acetate, and sodium gluconate were studied while the field potential was voltage-clamped. Clamping at electronegative values eliminated the anion effect, whereas clamping at electropositive potentials exaggerated it. Thus, field potentials across the lingual epithelium modulate taste reception, indicating that the functional unit of taste reception includes the taste cell and its paracellular microenvironment.

  5. Cylindrical polymer brushes with dendritic side chains by iterative anionic reactions

    KAUST Repository

    Zhang, Hefeng; Qu, Chengke; He, Junpo

    2015-01-01

    We report in this paper an easy method for the synthesis of cylindrical polymer brushes with dendritic side chains through anionic reaction. The synthesis is accomplished by iteratively grafting a living block copolymer, polyisoprene-. b

  6. QUANTITATIVE ANALYSIS OF RELATIONSHIP STRUCTURE AND ANIONIC SURFACTANT MICELLE CONCENTRATION CRITIC WITH SEMIEMPIRIS AM1

    Directory of Open Access Journals (Sweden)

    Eva Vaulina Yulistia Delsy

    2017-05-01

    Full Text Available This research determines the mathematical equation which calculate the Concentration Micelle Critic theoretical anionic surfactant. The research was conducted the depiction of each surfactant anionic three-dimensional compound models, followed by optimizing the model structure anionic surfactant by using AM1 calculation method. Furthermore the calculation of descriptors (QSPR method, then it was analyzed statistically using Multiple Linear Regression (MLR. The results of statistical calculations showed that to calculate the theoretical CMC anionic surfactant can use the QSPR equation: log CMC = 4.157+0.118qC1+7.698qC2+0.425α–0.010µ-0.129RD–0.138 log P+0.021BM–0.034Avdw, n = 100 ; r = 0.927 ; r2 = 0.860 ; SE = 0.352 ; F= 30.888 ; PRESS = 23.506

  7. L-shaped benzimidazole fluorophores: synthesis, characterization and optical response to bases, acids and anions.

    Science.gov (United States)

    Lirag, Rio Carlo; Le, Ha T M; Miljanić, Ognjen Š

    2013-05-14

    Nine L-shaped benzimidazole fluorophores have been synthesized, computationally evaluated and spectroscopically characterized. These "half-cruciform" fluorophores respond to bases, acids and anions through changes in fluorescence that vary from moderate to dramatic.

  8. Organic anion transporting polypeptide 1B transporters modulate hydroxyurea pharmacokinetics.

    Science.gov (United States)

    Walker, Aisha L; Lancaster, Cynthia S; Finkelstein, David; Ware, Russell E; Sparreboom, Alex

    2013-12-15

    Hydroxyurea is currently the only FDA-approved drug that ameliorates the pathophysiology of sickle cell anemia. Unfortunately, substantial interpatient variability in the pharmacokinetics (PK) of hydroxyurea may result in variation of the drug's efficacy. However, little is known about mechanisms that modulate hydroxyurea PK. Recent in vitro studies identifying hydroxyurea as a substrate for organic anion transporting polypeptide (OATP1B) transporters prompted the current investigation assessing the role of OATP1B transporters in modulating hydroxyurea PK. Using wild-type and Oatp1b knockout (Oatp1b(-/-)) mice, hydroxyurea PK was analyzed in vivo by measuring [(14)C]hydroxyurea distribution in plasma, kidney, liver, urine, or the exhaled (14)CO2 metabolite. Plasma levels were significantly reduced by 20% in Oatp1b(-/-) mice compared with wild-type (area under the curve of 38.64 or 48.45 μg·h(-1)·ml(-1), respectively) after oral administration, whereas no difference was observed between groups following intravenous administration. Accumulation in the kidney was significantly decreased by twofold in Oatp1b(-/-) mice (356.9 vs. 748.1 pmol/g), which correlated with a significant decrease in urinary excretion. Hydroxyurea accumulation in the liver was also decreased (136.6 vs. 107.3 pmol/g in wild-type or Oatp1b(-/-) mice, respectively) correlating with a decrease in exhaled (14)CO2. These findings illustrate that deficiency of Oatp1b transporters alters the absorption, distribution, and elimination of hydroxyurea thus providing the first in vivo evidence that cell membrane transporters may play a significant role in modulating hydroxyurea PK. Future studies to investigate other transporters and their role in hydroxyurea disposition are warranted for understanding the sources of variation in hydroxyurea's PK.

  9. Ionic Resistance and Permselectivity Tradeoffs in Anion Exchange Membranes

    KAUST Repository

    Geise, Geoffrey M.

    2013-10-23

    Salinity gradient energy technologies, such as reverse electrodialysis (RED) and capacitive mixing based on Donnan potential (Capmix CDP), could help address the global need for noncarbon-based energy. Anion exchange membranes (AEMs) are a key component in these systems, and improved AEMs are needed in order to optimize and extend salinity gradient energy technologies. We measured ionic resistance and permselectivity properties of quaternary ammonium-functionalized AEMs based on poly(sulfone) and poly(phenylene oxide) polymer backbones and developed structure-property relationships between the transport properties and the water content and fixed charge concentration of the membranes. Ion transport and ion exclusion properties depend on the volume fraction of water in the polymer membrane, and the chemical nature of the polymer itself can influence fine-tuning of the transport properties to obtain membranes with other useful properties, such as chemical and dimensional stability. The ionic resistance of the AEMs considered in this study decreased by more than 3 orders of magnitude (i.e., from 3900 to 1.6 Ω m) and the permselectivity decreased by 6% (i.e., from 0.91 to 0.85) as the volume fraction of water in the polymer was varied by a factor of 3.8 (i.e., from 0.1 to 0.38). Water content was used to rationalize a tradeoff relationship between the permselectivity and ionic resistance of these AEMs whereby polymers with higher water content tend to have lower ionic resistance and lower permselectivity. The correlation of ion transport properties with water volume fraction and fixed charge concentration is discussed with emphasis on the importance of considering water volume fraction when interpreting ion transport data. © 2013 American Chemical Society.

  10. A C{sub 2}-symmetric ratiometric fluorescence and colorimetric anion sensor based on pyrrole derivative

    Energy Technology Data Exchange (ETDEWEB)

    Liu Ge [Department of Chemistry, Chifeng University, Chifeng 024000 (China); Shao Jie, E-mail: njshao@live.c [Department of Chemistry and Materials Science, Nanjing Forestry University, Nanjing 210037 (China)

    2011-07-15

    A C{sub 2}-symmetric fluorescence and colorimetric anion sensor (1) based on pyrrole derivative was designed and synthesized according to binding site-signaling subunit approach. The compound 1 was easily prepared by reaction of pyrrole-2,5-dicarboxaldehyde with 4-nitrophenylhydrazine in ethanol (yield=78%). In DMSO, the sensor 1 exhibited a visible color change from red to brown upon exposure to anions such as AcO{sup -} and F{sup -}; however, no obvious color changes were observed when the other tested anions (e. g. H{sub 2}PO{sub 4}{sup -}, Cl{sup -}, Br{sup -} and I{sup -}) were added. There was a significant redshift ({Delta}{lambda}{sub max}=160 nm) in UV-vis spectrum during UV-vis spectral titrations. In particular, the sensor 1 showed ratiometric fluorescence responses to anions. - Highlights: {yields} C{sub 2}-symmetric fluorescence and colorimetric anion sensor based on pyrrole derivative was designed and synthesized according to binding site-signaling subunit approach. {yields} The sensor was easily prepared by reaction of pyrrole-2,5-dicarboxaldehyde with 4-nitrophenylhydrazine in ethanol (yield=78%). {yields} In DMSO, the sensor exhibited a visible color change from red to brown upon exposure to anions such as AcO{sup -} and F{sup -}, however, no obvious color changes were observed when the other anions tested (e. g. H{sub 2}PO{sub 4}{sup -}, Cl{sup -}, Br{sup -} and I{sup -}) were added. {yields} The sensor showed ratiometric fluorescence responses to anions.

  11. ESR study of the anion radicals of 5-nitropyrimidines: conversion to iminoxy radicals

    International Nuclear Information System (INIS)

    Sevilla, M.D.; Clark, C.; Failor, R.

    1976-01-01

    The anion radicals of a number of 5-nitropyrimidines have been investigated by ESR spectroscopy. The anions are formed by electrolysis in dimethylformamide and by electron attachment in aqueous glasses, 12 M LiCl--D 2 O and 8 M NaOD. The electrolysis of 5-nitrouracil and 5-nitro-6-methyluracil results in relatively stable anion radicals. The results for 5-nitrouracil give evidence for two or perhaps three anions which differ only by the degree of ring nitrogen protonation. The results for 5-nitro-6-methyluracil suggest that the nitro group of the anion is twisted so that it is coupled only weakly to the ring π-electron system. The anions of 5-nitrouracil, 5-nitroorotic acid, 5-nitrobarbituric acid, and 5-nitro-6-methyluracil have been produced in the alkaline and neutral aqueous glasses. The anisotropic spectra found have been analyzed with the aid of computer simulations which assume axial symmetry. For example, the analysis of the spectrum of 5-nitrouracil anion in 12 M LiCl yields A/sub parallel//sup N/ = 33; A/sub perpendicular to//sup N/ = 5, a 6 /sup H/ = 5.5 G, g/sub parallel/ = 2.0016, and g/sub perpendicular to/ = 2.0059. A concentration dependence in the splittings is noted and discussed. Ultraviolet photolysis of the anions of 5-nitro-6-methyluracil and 5-nitrobarbituric acid results in the formation of iminoxy radicals. Mechanisms of formation of the iminoxy radicals are discussed and results found in this work are compared to results found in single crystals and aqueous solution

  12. Removal of plutonium from nitric acid-oxalic acid solutions using anion exchange method

    International Nuclear Information System (INIS)

    Kasar, U.M.; Pawar, S.M.; Joshi, A.R.

    1999-01-01

    An anion exchange method using Amberlyst A-26 (MP) resin was developed for removal of Pu from nitric acid-oxalic acid solutions without destroying oxalate. The method consists of sorption of Pu(IV) on Amberlyst A-26, a macroporous anion exchange resin, from nitric acid-oxalic acid medium in the presence of Al(NO 3 ) 3 . Pu(IV) breakthrough capacity of Amberlyst A-26 using synthetic feed solution was determined. (author)

  13. Sensitization of microorganisms and enzymes by radiation-induced selective inorganic radical anions

    International Nuclear Information System (INIS)

    Schubert, J.; Stegeman, H.

    1981-01-01

    Bacterial survival and enzymatic inactivation were examined following exposure to radiolytically-generated radical anions, X - 2 , where X=Cl, Br, I or CNS - . Depending on pH, radical anions react selectively or specifically with cysteine, tryptophan, tyrosine and histidine. Consequently, when one or more of these amino acids is crucial for enzymatic activity or bacterial survival and is attacked by a radical anion, a high degree or radiosensitization may be realized. Halide radical anions can form free chlorine, bromine or iodine. However, these bactericidal halogens are destroyed by reaction with the hydrated electron, e - sub(aq), or at pHs>9, as occurs, for example, when a medium saturated with nitrous oxide, N 2 O, and e - sub(aq) scavenger, is replaced by nitrogen or oxygen. Increasing concentration of other e - sub(aq) scavengers, such as phosphate buffer, promotes formation of halogen from halides. The conditions producing formation and elimination of halogens in irradiated media must be appreciated to avoid confusing radiosensitization by X 2 to X - 2 . Radiosensitization by radical anions of several microorganisms: S. faecalis, S. typhimurium, E. coli, and M. radiodurens is described. A crucial amino acid for survival of S. faecalis appears to be tyrosine, while both tyrosine and tryptophan seem essential for recovery of S. typhimurium from effects of ionizing radiation. It is postulated that the radiosensitizing action of radical anions involves inhibition of DNA repair of strand-breaks by depriving the cells of energy. In view of the high OH scavenging power of foods, it is concluded that the radiosensitization of bacteria and enzymes in foods by radical anions, except for special cases, is not practical. Rather, radical anions serve to identify crucial amino acids to radiosensitization mechanisms in model systems, and possibly in radiotherapy. (author)

  14. Hybrid capacitive deionization with anion-exchange membranes for lithium extraction

    OpenAIRE

    Siekierka Anna; Bryjak Marek

    2017-01-01

    Lithium is considered to be a critical material for various industrial fields. We present our studies on extraction lithium from diluted aqueous solution by novel hybrid system based on a membrane capacitive deionization and batteries desalination. Hybrid CDI is comprised by a lithium selective adsorbent, activated carbon electrode and anion-exchange membranes. Here, we demonstrated implication of various type of anion-exchange membranes and influence their properties on effective capacity an...

  15. Cation–Anion Interactions within the Nucleic Acid Ion Atmosphere Revealed by Ion Counting

    Science.gov (United States)

    Gebala, Magdalena; Giambasu, George M.; Lipfert, Jan; Bisaria, Namita; Bonilla, Steve; Li, Guangchao; York, Darrin M.; Herschlag, Daniel

    2016-01-01

    The ion atmosphere is a critical structural, dynamic, and energetic component of nucleic acids that profoundly affects their interactions with proteins and ligands. Experimental methods that “count” the number of ions thermodynamically associated with the ion atmosphere allow dissection of energetic properties of the ion atmosphere, and thus provide direct comparison to theoretical results. Previous experiments have focused primarily on the cations that are attracted to nucleic acid polyanions, but have also showed that anions are excluded from the ion atmosphere. Herein, we have systematically explored the properties of anion exclusion, testing the zeroth-order model that anions of different identity are equally excluded due to electrostatic repulsion. Using a series of monovalent salts, we find, surprisingly, that the extent of anion exclusion and cation inclusion significantly depends on salt identity. The differences are prominent at higher concentrations and mirror trends in mean activity coefficients of the electrolyte solutions. Salts with lower activity coefficients exhibit greater accumulation of both cations and anions within the ion atmosphere, strongly suggesting that cation–anion correlation effects are present in the ion atmosphere and need to be accounted for to understand electrostatic interactions of nucleic acids. To test whether the effects of cation–anion correlations extend to nucleic acid kinetics and thermodynamics, we followed the folding of P4–P6, a domain of the Tetrahymena group I ribozyme, via single-molecule fluorescence resonance energy transfer in solutions with different salts. Solutions of identical concentration but lower activity gave slower and less favorable folding. Our results reveal hitherto unknown properties of the ion atmosphere and suggest possible roles of oriented ion pairs or anion-bridged cations in the ion atmosphere for electrolyte solutions of salts with reduced activity. Consideration of these new

  16. Vibrational Fano resonances in the photodetachment of dipole-bound anions

    International Nuclear Information System (INIS)

    Edwards, Stephen T; Tully, John C; Johnson, Mark A

    2012-01-01

    A simple model for the photodetachment of dipole-bound anions is proposed where non-adiabatic coupling of vibrational states leads to a Fano resonance in the spectrum. It is found that the shape of the photodetachment spectrum depends significantly on the parameter representing molecular polarizability. The model is also applied to a Fano profile observed in the photodetachment of small water cluster anions.

  17. Acute and chronic influence of temperature on red blood cell anion exchange.

    Science.gov (United States)

    Jensen, F B; Wang, T; Brahm, J

    2001-01-01

    Unidirectional (36)Cl(-) efflux via the red blood cell anion exchanger was measured under Cl(-) self-exchange conditions (i.e. no net flow of anions) in rainbow trout Oncorhynchus mykiss and red-eared freshwater turtle Trachemys scripta to examine the effects of acute temperature changes and acclimation temperature on this process. We also evaluated the possible adaptation of anion exchange to different temperature regimes by including our previously published data on other animals. An acute temperature increase caused a significant increase in the rate constant (k) for unidirectional Cl(-) efflux in rainbow trout and freshwater turtle. After 3 weeks of temperature acclimation, 5 degrees C-acclimated rainbow trout showed only marginally higher Cl(-) transport rates than 15 degrees C-acclimated trout when compared at the same temperature. Apparent activation energies for red blood cell Cl(-) exchange in trout and turtle were lower than values reported in endothermic animals. The Q(10) for red blood cell anion exchange was 2.0 in trout and 2.3 in turtle, values close to those for CO(2) excretion, suggesting that, in ectothermic animals, the temperature sensitivity of band-3-mediated anion exchange matches the temperature sensitivity of CO(2) transport (where red blood cell Cl(-)/HCO(3)(-) exchange is a rate-limiting step). In endotherms, such as man and chicken, Q(10) values for red blood cell anion exchange are considerably higher but are no obstacle to CO(2) transport, because body temperature is normally kept constant at values at which anion exchange rates are high. When compared at constant temperature, red blood cell Cl(-) permeability shows large differences among species (trout, carp, eel, cod, turtle, alligator, chicken and man). Cl(-) permeabilities are, however, remarkable similar when compared at preferred body temperatures, suggesting an appropriate evolutionary adaptation of red blood cell anion exchange function to the different thermal niches occupied

  18. Rearrangements under confinement lead to increased binding energy of Synaptotagmin-1 with anionic membranes in Mg2+ and Ca2.

    Science.gov (United States)

    Gruget, Clémence; Coleman, Jeff; Bello, Oscar; Krishnakumar, Shyam S; Perez, Eric; Rothman, James E; Pincet, Frederic; Donaldson, Stephen H

    2018-05-01

    Synaptotagmin-1 (Syt1) is the primary calcium sensor (Ca 2+ ) that mediates neurotransmitter release at the synapse. The tandem C2 domains (C2A and C2B) of Syt1 exhibit functionally critical, Ca 2+ -dependent interactions with the plasma membrane. With the surface forces apparatus, we directly measure the binding energy of membrane-anchored Syt1 to an anionic membrane and find that Syt1 binds with ~6 k B T in EGTA, ~10 k B T in Mg 2+ and ~18 k B T in Ca 2+ . Molecular rearrangements measured during confinement are more prevalent in Ca 2+ and Mg 2+ and suggest that Syt1 initially binds through C2B, then reorients the C2 domains into the preferred binding configuration. These results provide energetic and mechanistic details of the Syt1 Ca 2+ -activation process in synaptic transmission. © 2018 Federation of European Biochemical Societies.

  19. Kinetics of Corrosion Inhibition of Aluminum in Acidic Media by Water-Soluble Natural Polymeric Pectates as Anionic Polyelectrolyte Inhibitors.

    Science.gov (United States)

    Hassan, Refat M; Zaafarany, Ishaq A

    2013-06-17

    Corrosion inhibition of aluminum (Al) in hydrochloric acid by anionic polyeletrolyte pectates (PEC) as a water-soluble natural polymer polysaccharide has been studied using both gasometric and weight loss techniques. The results drawn from these two techniques are comparable and exhibit negligible differences. The inhibition efficiency was found to increase with increasing inhibitor concentration and decrease with increasing temperature. The inhibition action of PEC on Al metal surface was found to obey the Freundlich isotherm. Factors such as the concentration and geometrical structure of the inhibitor, concentration of the corrosive medium, and temperature affecting the corrosion rates were examined. The kinetic parameters were evaluated and a suitable corrosion mechanism consistent with the kinetic results is discussed in the paper.

  20. Kinetics of Corrosion Inhibition of Aluminum in Acidic Media by Water-Soluble Natural Polymeric Pectates as Anionic Polyelectrolyte Inhibitors

    Directory of Open Access Journals (Sweden)

    Refat M. Hassan

    2013-06-01

    Full Text Available Corrosion inhibition of aluminum (Al in hydrochloric acid by anionic polyeletrolyte pectates (PEC as a water-soluble natural polymer polysaccharide has been studied using both gasometric and weight loss techniques. The results drawn from these two techniques are comparable and exhibit negligible differences. The inhibition efficiency was found to increase with increasing inhibitor concentration and decrease with increasing temperature. The inhibition action of PEC on Al metal surface was found to obey the Freundlich isotherm. Factors such as the concentration and geometrical structure of the inhibitor, concentration of the corrosive medium, and temperature affecting the corrosion rates were examined. The kinetic parameters were evaluated and a suitable corrosion mechanism consistent with the kinetic results is discussed in the paper.

  1. Verification of the sputter-generated {sup 32}SF{sub n}{sup −} (n = 1–6) anions by accelerator mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Mane, R.G.; Surendran, P. [Nuclear Physics Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Kumar, Sanjay [Physics Department, Agra College Agra, Agra 282002 (India); Nair, J.P.; Yadav, M.L. [Nuclear Physics Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Hemalatha, M. [UM-DAE Centre for Excellence in Basic Sciences, Mumbai 400098 (India); Thomas, R.G.; Mahata, K. [Nuclear Physics Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Kailas, S. [UM-DAE Centre for Excellence in Basic Sciences, Mumbai 400098 (India); Bhabha Atomic Research Centre, Trombay, Mumbai 400 085 (India); Gupta, A.K., E-mail: anit@tifr.res.in [Nuclear Physics Division, Bhabha Atomic Research Centre, Mumbai 400085 (India)

    2016-01-01

    Recently, we have performed systematic Secondary Ion Mass Spectrometry (SIMS) measurements at our ion source test set up and have demonstrated that gas phase {sup 32}SF{sub n}{sup −} (n = 1–6) anions for all size ‘n’ can be readily generated from a variety of surfaces undergoing Cs{sup +} ion sputtering in the presence of high purity SF{sub 6} gas by employing the gas spray-cesium sputter technique. In our SIMS measurements, the isotopic yield ratio {sup 34}SF{sub n}{sup −}/{sup 32}SF{sub n}{sup −} (n = 1–6) was found to be close to its natural abundance but not for all size ‘n’. In order to gain further insight into the constituents of these molecular anions, ultra sensitive Accelerator Mass Spectrometry (AMS) measurements were conducted with the most abundant {sup 32}SF{sub n}{sup −} (n = 1–6) anions, at BARC-TIFR 14 UD Pelletron accelerator. The results from these measurements are discussed in this paper.

  2. New inorganic (an)ion exchangers with a higher affinity for arsenate and a competitive removal capacity towards fluoride, bromate, bromide, selenate, selenite, arsenite and borate

    KAUST Repository

    Chubar, Natalia

    2011-12-01

    Highly selective materials and effective technologies are needed to meet the increasingly stronger drinking water standards for targeted ionic species. Inorganic ion exchangers based on individual and mixed-metal hydrous oxides (or mixed adsorbents that contain inorganic ion exchangers in their composition) are adsorptive materials that are capable of lowering the concentrations of anionic contaminants, such as H 2AsO 4 -, H 3AsO 3, F -, Br -, BrO 3 -, HSeO 4 -, HSeO 3 - and H 3BO 3, to 10 μg/L or less. To achieve a higher selectivity towards arsenate, a new ion exchanger based on Mg-Al hydrous oxides was developed by a novel, cost-effective and environmentally friendly synthesis method via a non-traditional (alkoxide-free) sol-gel approach. The exceptional adsorptive capacity of the Mg-Al hydrous oxides towards H 2AsO 4 - (up to 200 mg[As]/gdw) is due to the high affinity of this sorbent towards arsenate (steep equilibrium isotherms) and its fast adsorption kinetics. Because of the mesoporous (as determined by N 2 adsorption and SEM) and layered (as determined by XRD and FTIR) structure of the ion-exchange material as well as the abundance of anion exchange sites (as determined by XPS and potentiometric titration) on its surface the material demonstrated very competitive (or very high) removal capacity towards other targeted anions, including fluoride, bromide, bromate, selenate, selenite, and borate. © 2011 IWA Publishing.

  3. Research on the Microstructure and Property of an Anion Rubber Modified Asphalt

    Directory of Open Access Journals (Sweden)

    Wei Hong

    2013-01-01

    Full Text Available The anion rubber modified asphalt (ARMA mixture was first successfully developed with a unique process. In the development process, rubber and asphalt were mixed in the same proportion. Furthermore, the microstructure and modification mechanism of the material were characterized by SEM, FT-IR, TG, and XRD tests. The mechanical property of the mixture was also tested in accordance with the relevant standards. In the end, the material’s capacity of releasing anion was measured by DLY-6A232 atmospheric ion gauge. The results indicated that the addition of anion additive into the rubber modified asphalt (RMA was a mere physical mixture, and the anion additives and rubber particles uniformly dispersed in the ARMA. The addition of anion additive could improve the thermal stability of the RMA. Compared with the traditional asphalt pavement material, the ARMA material shows excellent mechanical properties as well as the ability of releasing anion. Moreover, the material has enormous economic and social benefits by taking full advantage of a large amount of waste tires, thus improving the road surrounding environment.

  4. Sorption of vanillin on highly basic anion exchanger under static conditions

    Science.gov (United States)

    Sholokhova, A. Yu.; Eliseeva, T. V.; Voronyuk, I. V.

    2017-11-01

    The kinetics of the sorption of vanillin by a granulated anion exchanger is studied under static conditions. A comparison of the kinetic curves of the uptake of hydroxybenzaldehyde by gel and macroporous anion exchanger shows that macroporous sorbent has better kinetic characteristics. The effect temperature has on the capacity of an anion exchanger and the time needed to establish sorption equilibrium is found, and the activation energy of vanillin uptake is determined. Studying the effect experimental factors have on the rate of sorption and using the formal kinetics approach, it is established that in the investigated range of concentrations, the limiting stage of the uptake of vanillin by an anion exchanger with the functional groups of a quaternary ammonium base is that of external diffusion. Vanillin sorption by a highly basic anion exchanger in hydroxyl form is characterized by polymolecular uptake best described by a BET isotherm; at the same time, the uptake of sorbate by a chloride form is of a monomolecular character and can be described by a Freindlich isotherm. Structural changes in the anion exchanger sorbed hydroxybenzaldehyde are identified via FTIR spectroscopy.

  5. Organic anion transporter (Slc22a) family members as mediators of toxicity

    International Nuclear Information System (INIS)

    Sweet, Douglas H.

    2005-01-01

    Exposure of the body to toxic organic anions is unavoidable and occurs from both intentional and unintentional sources. Many hormones, neurotransmitters, and waste products of cellular metabolism, or their metabolites, are organic anions. The same is true for a wide variety of medications, herbicides, pesticides, plant and animal toxins, and industrial chemicals and solvents. Rapid and efficient elimination of these substances is often the body's best defense for limiting both systemic exposure and the duration of their pharmacological or toxicological effects. For organic anions, active transepithelial transport across the renal proximal tubule followed by elimination via the urine is a major pathway in this detoxification process. Accordingly, a large number of organic anion transport proteins belonging to several different gene families have been identified and found to be expressed in the proximal nephron. The function of these transporters, in combination with the high volume of renal blood flow, predisposes the kidney to increased toxic susceptibility. Understanding how the kidney mediates the transport of organic anions is integral to achieving desired therapeutic outcomes in response to drug interactions and chemical exposures, to understanding the progression of some disease states, and to predicting the influence of genetic variation upon these processes. This review will focus on the organic anion transporter (OAT) family and discuss the known members, their mechanisms of action, subcellular localization, and current evidence implicating their function as a determinant of the toxicity of certain endogenous and xenobiotic agents

  6. The triel bond: a potential force for tuning anion-π interactions

    Science.gov (United States)

    Esrafili, Mehdi D.; Mousavian, Parisasadat

    2018-02-01

    Using ab-initio calculations, the mutual influence between anion-π and B···N or B···C triel bond interactions is investigated in some model complexes. The properties of these complexes are studied by molecular electrostatic potential, noncovalent interaction index, quantum theory of atoms in molecules (QTAIM) and natural bond orbital (NBO) analyses. According to the results, the formation of B···N or B···C triel bond interactions in the multi-component systems makes a significant shortening of anion-π distance. Such remarkable variation in the anion-π distances has not been reported previously. The strengthening of the anion-π bonding in the multi-component systems depend significantly on the nature of the anion, and it becomes larger in the order Br- > Cl- > F-. The parameters derived from the QTAIM and NBO methodologies are used to study the mechanism of the cooperativity between the anion-π and triel bond interactions in the multi-component complexes.

  7. Anion dynamics in the first 10 milliseconds of an argon-acetylene radio-frequency plasma

    International Nuclear Information System (INIS)

    Van de Wetering, F M J H; Beckers, J; Kroesen, G M W

    2012-01-01

    The time evolution of the smallest anions (C 2 H - and H 2 CC - ), just after plasma ignition, is studied by means of microwave cavity resonance spectroscopy (MCRS) in concert with laser-induced photodetachment under varying gas pressure and temperature in an argon-acetylene radio-frequency (13.56 MHz) plasma. These anions act as an initiator for spontaneous dust particle formation in these plasmas. With an intense 355 nm Nd:YAG laser pulse directed through the discharge, electrons are detached only from these anions present in the laser path. This results in a sudden increase in the electron density in the plasma, which can accurately and with sub-microsecond time resolution be measured with MCRS. By adjusting the time after plasma ignition at which the laser is fired through the discharge, the time evolution of the anion density can be studied. We have operated in the linear regime: the photodetachment signal is proportional to the laser intensity. This allowed us to study the trends of the photodetachment signal as a function of the operational parameters of the plasma. The density of the smallest anions steadily increases in the first few milliseconds after plasma ignition, after which it reaches a steady state. While keeping the gas density constant, increasing the gas temperature in the range 30-120 °C limits the number of smallest anions and saturates at a temperature of about 90 °C. A reaction pathway is proposed to explain the observed trends.

  8. Influence of alkyl chain length and anion species on ionic liquid structure at the graphite interface as a function of applied potential

    International Nuclear Information System (INIS)

    Li, Hua; Wood, Ross J; Atkin, Rob; Endres, Frank

    2014-01-01

    Atomic force microscopy (AFM) force measurements elucidate the effect of cation alkyl chain length and the anion species on ionic liquid (IL) interfacial structure at highly ordered pyrolytic graphite (HOPG) surfaces as a function of potential. Three ILs are examined: 1-hexyl-3-methylimidazolium tris(pentafluoroethyl)trifluorophosphate ([HMIM] FAP), 1-ethyl-3-methylimidazolium tris(pentafluoroethyl)trifluorophosphate ([EMIM] FAP), and 1-ethyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide ([EMIM] TFSA). The step-wise force-distance profiles indicate the ILs adopt a multilayered morphology near the surface. When the surface is biased positively or negatively versus Pt quasireference electrode, both the number of steps, and the force required to rupture each step increase, indicating stronger interfacial structure. At all potentials, push-through forces for [HMIM] FAP are the highest, because the long alkyl chain results in strong cohesive interactions between cations, leading to well-formed layers that resist the AFM tip. The most layers are observed for [EMIM] FAP, because the C 2 chains are relatively rigid and the dimensions of the cation and anion are similar, facilitating neat packing. [EMIM] TFSA has the smallest push-through forces and fewest layers, and thus the weakest interfacial structure. Surface-tip attractive forces are measured for all ILs. At the same potential, the attractions are the strongest for [EMIM] TFSA and the weakest for [HMIM] FAP because the interfacial layers are better formed for the longer alkyl chain cation. This means interfacial forces are stronger, which masks the weak attractive forces. (paper)

  9. Characteristics of competitive uptake between Microcystin-LR and natural organic matter (NOM) fractions using strongly basic anion exchange resins.

    Science.gov (United States)

    Dixit, Fuhar; Barbeau, Benoit; Mohseni, Madjid

    2018-03-29

    Microcystins are the most commonly occurring cyanotoxins, and have been extensively studied across the globe. In the present study, a strongly basic anion exchange resin was employed to investigate the removal of Microcystin-LR (MCLR), one of the most toxic microcystin variants. Factors influencing the uptake behavior included the MCLR and resin concentrations, resin dosage, and natural organic matter (NOM) characteristics, specifically, the charge density and molecular weight distribution of source water NOM. Equivalent background concentration (EBC) was employed to evaluate the competitive uptake between NOM and MCLR. The experimental data were compared with different mathematical and physical models and pore diffusion was determined as the rate-limiting step. The resin dose/solute concentration ratio played a key role in the MCLR uptake process and MCLR removal was attributed primarily to electrostatic attractions. Charge density and molecular weight distribution of the background NOM fractions played a major role in MCLR removal at lower resin dosages (200 mg/L ∼ 1 mL/L and below), where a competitive uptake was observed due to the limited exchange sites. Further, evidences of pore blockage and site reduction were also observed in the presence of humics and larger molecular weight organic fractions, where a four-fold reduction in the MCLR uptake was observed. Comparable results were obtained for laboratory studies on synthetic laboratory water and surface water under similar conditions. Given their excellent performance and low cost, anion exchange resins are expected to present promising potentials for applications involving the removal of removal of algal toxins and NOM from surface waters. Copyright © 2018 Elsevier Ltd. All rights reserved.

  10. Organic anion transporter 3- and organic anion transporting polypeptides 1B1- and 1B3-mediated transport of catalposide

    Directory of Open Access Journals (Sweden)

    Jeong HU

    2015-01-01

    Full Text Available Hyeon-Uk Jeong,1 Mihwa Kwon,2 Yongnam Lee,3 Ji Seok Yoo,3 Dae Hee Shin,3 Im-Sook Song,2 Hye Suk Lee1 1College of Pharmacy, The Catholic University of Korea, Bucheon 420-743, Korea; 2College of Pharmacy and Research Institute of Pharmaceutical Sciences, Kyungpook National University, Daegu 702-701, Korea; 3Central R&D Institute, Yungjin Pharm Co., Ltd., Suwon 443-270, Korea Abstract: We investigated the in vitro transport characteristics of catalposide in HEK293 cells overexpressing organic anion transporter 1 (OAT1, OAT3, organic anion transporting polypeptide 1B1 (OATP1B1, OATP1B3, organic cation transporter 1 (OCT1, OCT2, P-glycoprotein (P-gp, and breast cancer resistance protein (BCRP. The transport mechanism of catalposide was investigated in HEK293 and LLC-PK1 cells overexpressing the relevant transporters. The uptake of catalposide was 319-, 13.6-, and 9.3-fold greater in HEK293 cells overexpressing OAT3, OATP1B1, and OATP1B3 transporters, respectively, than in HEK293 control cells. The increased uptake of catalposide via the OAT3, OATP1B1, and OATP1B3 transporters was decreased to basal levels in the presence of representative inhibitors such as probenecid, furosemide, and cimetidine (for OAT3 and cyclosporin A, gemfibrozil, and rifampin (for OATP1B1 and OATP1B3. The concentration-dependent OAT3-mediated uptake of catalposide revealed the following kinetic parameters: Michaelis constant (Km =41.5 µM, maximum uptake rate (Vmax =46.2 pmol/minute, and intrinsic clearance (CLint =1.11 µL/minute. OATP1B1- and OATP1B3-mediated catalposide uptake also showed concentration dependency, with low CLint values of 0.035 and 0.034 µL/minute, respectively. However, the OCT1, OCT2, OAT1, P-gp, and BCRP transporters were apparently not involved in the uptake of catalposide into cells. In addition, catalposide inhibited the transport activities of OAT3, OATP1B1, and OATP1B3 with half-maximal inhibitory concentration values of 83, 200, and 235 µ

  11. Surface Water & Surface Drainage

    Data.gov (United States)

    Earth Data Analysis Center, University of New Mexico — This data set contains boundaries for all surface water and surface drainage for the state of New Mexico. It is in a vector digital data structure digitized from a...

  12. Anion exchanger and the resistance against thermal haemolysis.

    Science.gov (United States)

    Ivanov, I T; Zheleva, A; Zlatanov, I

    2011-01-01

    4,4'-Diiso-thiocyanato stilbene-2,2'-disulphonic acid (DIDS) is a membrane-impermeable, highly specific covalent inhibitor and powerful thermal stabiliser of the anion exchanger (AE1), the major integral protein of erythrocyte membrane (EM). Suspensions of control and DIDS-treated (15 µM, pH 8.2) human erythrocytes were heated from 20° to 70°C using various but constant heating rates (1-8°C/min). The cellular electrolyte leakage exhibited a sigmoidal response to temperature as detected by conductometry. The critical midpoint temperature of leakage, T(mo), extrapolated to low heating rate (0.5°C/min) was used as a measure for EM thermostability. T(mo) was greater for DIDS-treated erythrocytes, 63.2° ± 0.3°C, than for intact erythrocytes, 60.7° ± 0.2°C. The time, t(1/2), for 50% haemolysis of erythrocytes, exposed to 53°C was used as a measure for the resistance of erythrocytes against thermal haemolysis. The t(1/2) was also greater for DIDS-treated erythrocytes, 63 ± 3 min, than for intact erythrocytes, 38 ± 2 min. The fluorescent label N-(3-pyrenyl)maleimide and EPR spin label 3-maleimido-proxyl, covalently bound to sulphydryl groups of major EM proteins, were used to monitor the changes in molecular motions during transient heating. Both labels reported an intensification of the motional dynamics at the denaturation temperatures of spectrin (50°C) and AE1 (67°C), and, surprisingly, immobilisation of a major EM protein, presumably the AE1, at T(mo). The above results are interpreted in favour of the possible involvement of a predenaturational rearrangement of AE1 copies in the EM thermostability and the resistance against thermal haemolysis.

  13. Electronic structure of incident carbon ions on a graphite surface

    International Nuclear Information System (INIS)

    Kiuchi, Masato; Takeuchi, Takae; Yamamoto, Masao.

    1997-01-01

    The electronic structure of an incident carbon ion on a graphite surface is discussed on the basis of ab initio molecular orbital calculations. A carbon cation forms a covalent bond with the graphite, and a carbon nonion is attracted to the graphite surface through van der Waals interaction. A carbon anion has no stable state on a graphite surface. The charge effects of incident ions become clear upon detailed examination of the electronic structure. (author)

  14. Probing Intermolecular Electron Delocalization in Dimer Radical Anions by Vibrational Spectroscopy

    International Nuclear Information System (INIS)

    Mani, Tomoyasu; Brookhaven National Laboratory; Grills, David C.

    2017-01-01

    Delocalization of charges is one of the factors controlling charge transport in conjugated molecules. It is considered to play an important role in the performance of a wide range of molecular technologies, including organic solar cells and organic electronics. Dimerization reactions are well-suited as a model to investigate intermolecular spatial delocalization of charges. And while dimerization reactions of radical cations are well investigated, studies on radical anions are still scarce. Upon dimerization of radical anions with neutral counterparts, an electron is considered to delocalize over the two molecules. By using time-resolved infrared (TRIR) detection coupled with pulse radiolysis, we show that radical anions of 4-n-hexyl-4'-cyanobiphenyl (6CB) undergo such dimerization reactions, with an electron equally delocalized over the two molecules. We have recently demonstrated that nitrile ν(C≡N) vibrations respond to the degree of electron localization of nitrile-substituted anions: we can quantify the changes in the electronic charges from the neutral to the anion states in the nitriles by monitoring the ν(C≡N) IR shifts. In the first part of this article, we show that the sensitivity of the ν(C≡N) IR shifts does not depend on solvent polarity. In the second part, we describe how probing the shifts of the nitrile IR vibrational band unambiguously confirms the formation of dimer radical anions, with K dim = 3 × 10 4 M –1 . IR findings are corroborated by electronic absorption spectroscopy and electronic structure calculations. We find that the presence of a hexyl chain and the formation of π–π interactions are both crucial for dimerization of radical anions of 6CB with neutral 6CB. Our study provides clear evidence of spatial delocalization of electrons over two molecular fragments.

  15. Cytosolic nucleotides block and regulate the Arabidopsis vacuolar anion channel AtALMT9.

    Science.gov (United States)

    Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis

    2014-09-12

    The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al(3+) to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Cytosolic Nucleotides Block and Regulate the Arabidopsis Vacuolar Anion Channel AtALMT9*

    Science.gov (United States)

    Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis

    2014-01-01

    The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al3+ to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. PMID:25028514

  17. Kosmotropic anions promote conversion of recombinant prion protein into a PrPSc-like misfolded form.

    Directory of Open Access Journals (Sweden)

    Rodrigo Diaz-Espinoza

    Full Text Available Prions are self-propagating proteins involved in transmissible spongiform encephalopaties in mammals. An aberrant conformation with amyloid-like features of a cell surface protein, termed prion protein (PrP, is thought to be the essential component of the infectious particle, though accessory co-factor molecules such as lipids and nucleotides may be involved. The cellular co-factors and environmental conditions implicated in PrP misfolding are not completely understood. To address this issue, several studies have been done inducing misfolding of recombinant PrP (recPrP into classical amyloid structures using partially denaturing conditions. In this work, we report that misfolding of recPrP into PrP(Sc-like aggregates can be induced by simply incubating the protein in the presence of kosmotropic salts at concentrations that are known to retain or increase the stability of the protein. We used a simple experimental reaction (protein, buffer and salts submitted to agitation/incubation cycles at physiological temperature and pH. The formation of protease resistant-recPrP was time and salt-concentration dependent and required the presence of kosmotropic anions such as F(- or SO(4(-2. The molecular weights of the protease resistant recPrP fragments are reminiscent of those found in degradation assays of bona fide PrP(Sc. The aggregates also exhibited PrP(Sc-like ultrastructural features including rod-shape morphology under electron microscope, high beta-sheet content and thioflavin-T positive signal. The formation of recPrP aggregates with PrP(Sc biochemical features under conditions closer to physiological in the absence of organic co-factor molecules provides a simple setup that may prove helpful to understand the molecular mechanism of PrP misfolding.

  18. Reactive processing of textile-natural fiber reinforced anionic polyamide-6 composites

    International Nuclear Information System (INIS)

    Kan, Ze; Chen, Peng; Liu, Zhengying; Feng, Jianmin; Yang, Mingbo

    2015-01-01

    Nowadays natural fiber, used in reinforced composites, is widely concerned. However, no natural fiber reinforced reactive thermoplastic polymer grades had been prepared so far. Through our studies, it was demonstrated that there was a severe retardation and discoloration occurred in the reactive processing between anionic polyamide-6 (APA-6) and natural fiber, which result in incomplete polymerization when put together. In order to solve the problem, two methods were adopted in this paper, which are fiber pretreatment and usage of a new-style initiator called caprolactam magnesium bromide. The former is to remove sizing agent and impurities on the surface of fiber, and the latter is to weaken the side reactions between APA-6 and natural fiber by the nature of its lower reactivity and weaker alkaline. In cooperation with both methods, the severe retardation and discoloration had been improved significantly, so that the polymerization of APA-6 in natural fiber was occurred smoothly. Following textile-natural fiber reinforced APA-6 composites with an average thickness of 2.5 mm and a fiber volume content of 50% was prepared by vacuum assisted resin transfer molding (VARTM). The soxhlet extraction, dilute solution viscometry and differential scanning calorimeter (DSC) measurements respectively suggested the degree of conversion, viscosity-average molar mass and crystallization of composites was up to 94%, 11.3×104 and 50%. Remarkable improvement of mechanical properties were achieved through dynamic mechanical analysis (DMA), tensile and three-point bending test. Favorable interfacial adhesion and wettability were revealed by scanning electron microscopy (SEM) observation. Therefore, all of the above good performance make this new-style and environmentally friendly composites have broad application prospects

  19. Reactive processing of textile-natural fiber reinforced anionic polyamide-6 composites

    Science.gov (United States)

    Kan, Ze; Chen, Peng; Liu, Zhengying; Feng, Jianmin; Yang, Mingbo

    2015-05-01

    Nowadays natural fiber, used in reinforced composites, is widely concerned. However, no natural fiber reinforced reactive thermoplastic polymer grades had been prepared so far. Through our studies, it was demonstrated that there was a severe retardation and discoloration occurred in the reactive processing between anionic polyamide-6 (APA-6) and natural fiber, which result in incomplete polymerization when put together. In order to solve the problem, two methods were adopted in this paper, which are fiber pretreatment and usage of a new-style initiator called caprolactam magnesium bromide. The former is to remove sizing agent and impurities on the surface of fiber, and the latter is to weaken the side reactions between APA-6 and natural fiber by the nature of its lower reactivity and weaker alkaline. In cooperation with both methods, the severe retardation and discoloration had been improved significantly, so that the polymerization of APA-6 in natural fiber was occurred smoothly. Following textile-natural fiber reinforced APA-6 composites with an average thickness of 2.5 mm and a fiber volume content of 50% was prepared by vacuum assisted resin transfer molding (VARTM). The soxhlet extraction, dilute solution viscometry and differential scanning calorimeter (DSC) measurements respectively suggested the degree of conversion, viscosity-average molar mass and crystallization of composites was up to 94%, 11.3×104 and 50%. Remarkable improvement of mechanical properties were achieved through dynamic mechanical analysis (DMA), tensile and three-point bending test. Favorable interfacial adhesion and wettability were revealed by scanning electron microscopy (SEM) observation. Therefore, all of the above good performance make this new-style and environmentally friendly composites have broad application prospects.

  20. Polyethylenimine-modified fungal biomass as a high-capacity biosorbent for Cr(VI) anions: sorption capacity and uptake mechanisms.

    Science.gov (United States)

    Deng, Shubo; Ting, Yen Peng

    2005-11-01

    Heavy metal pollution in the aqueous environment is a problem of global concern. Biosorption has been considered as a promising technology for the removal of low levels of toxic metals from industrial effluents and natural waters. A modified fungal biomass of Penicillium chrysogenum with positive surface charges was prepared by grafting polyethylenimine (PEI) onto the biomass surface in a two-step reaction. The presence of PEI on the biomass surface was verified by FTIR and X-ray photoelectron spectroscopy (XPS) analyses. Due to the high density of amine groups in the long chains of PEI molecules on the surface, the modified biomass was found to possess positive zeta potential at pH below 10.4 as well as high sorption capacity for anionic Cr(VI). Using the Langmuir adsorption isotherm, the maximum sorption capacity for Cr(VI) at a pH range of 4.3-5.5 was 5.37 mmol/g of biomass dry weight, the highest sorption capacity for Cr(VI) compared to other sorbents reported in the literature. Scanning electronic microscopy (SEM) provided evidence of chromium aggregates formed on the biomass surface. XPS results verified the presence of Cr(III) on the biomass surface in the pH range 2.5-10.5, suggesting that some Cr(VI) anions were reduced to Cr(III) during the sorption. The sorption kinetics indicated that redox reaction occurred on the biomass surface, and whether the converted Cr(III) ions were released to solution or adsorbed on the biomass depended on the solution pH. Sorption mechanisms including electrostatic interaction, chelation, and precipitation were found to be involved in the complex sorption of chromium on the PEI-modified biomass.