Synergistic Malaria Parasite Killing by Two Types of Plasmodial Surface Anion Channel Inhibitors.
Directory of Open Access Journals (Sweden)
Margaret Pain
Full Text Available Malaria parasites increase their host erythrocyte's permeability to a broad range of ions and organic solutes. The plasmodial surface anion channel (PSAC mediates this uptake and is an established drug target. Development of therapies targeting this channel is limited by several problems including interactions between known inhibitors and permeating solutes that lead to incomplete channel block. Here, we designed and executed a high-throughput screen to identify a novel class of PSAC inhibitors that overcome this solute-inhibitor interaction. These new inhibitors differ from existing blockers and have distinct effects on channel-mediated transport, supporting a model of two separate routes for solute permeation though PSAC. Combinations of inhibitors specific for the two routes had strong synergistic action against in vitro parasite propagation, whereas combinations acting on a single route produced only additive effects. The magnitude of synergism depended on external nutrient concentrations, consistent with an essential role of the channel in parasite nutrient acquisition. The identified inhibitors will enable a better understanding of the channel's structure-function and may be starting points for novel combination therapies that produce synergistic parasite killing.
Directory of Open Access Journals (Sweden)
Abdullah A. B. Bokhari
2014-01-01
Full Text Available Malaria parasites grow within vertebrate erythrocytes and increase host cell permeability to access nutrients from plasma. This increase is mediated by the plasmodial surface anion channel (PSAC, an unusual ion channel linked to the conserved clag gene family. Although PSAC recognizes and transports a broad range of uncharged and charged solutes, it must efficiently exclude the small Na+ ion to maintain infected cell osmotic stability. Here, we examine possible mechanisms for this remarkable solute selectivity. We identify guanidinium as an organic cation with high permeability into human erythrocytes infected with Plasmodium falciparum, but negligible uptake by uninfected cells. Transport characteristics and pharmacology indicate that this uptake is specifically mediated by PSAC. The rank order of organic and inorganic cation permeabilities suggests cation dehydration as the rate-limiting step in transport through the channel. The high guanidinium permeability of infected cells also allows rapid and stringent synchronization of parasite cultures, as required for molecular and cellular studies of this pathogen. These studies provide important insights into how nutrients and ions are transported via PSAC, an established target for antimalarial drug development.
Directory of Open Access Journals (Sweden)
C. T. Daniel-Ribeiro
1992-01-01
Full Text Available The present paper reviews our recent data concerning the use of immunological methods employing monoclonal antibodies and synthetic peptides to study malaria transmission and immunity and to diagnose plasmodial infection. As concerns malaria transmission, we studied the main vectors of human malaria and the plasmodial species transmitted in endemic areas of Rondônia state, Brazil. The natural infection on anopheline was evaluated by immunoradiometric assay (IRMA using monoclonal antibodies to an immunodominant sporozoite surface antigen (CS protein demonstrated to be species specific. Our results showed that among six species of Anopheles found infected, An. darlingi was the main vector transmitting Plasmodium falciparum and P. vivax malaria in the immediate vicinity of houses. In order to assess the level of anti-CS antibodies we studied, by IRMA using the synthetic peptide corresponding to the repetitive epitope of the sporozoite CS protein, sera of individuals living in the same areas where the entomological survey has been performed. In this assay the prevalence of anti-CS antibodies was very low and did not reflect the malaria transmission rate in the studied areas. In relation to malaria diagnosis, a monoclonal antibody specific to an epitope of a 50 kDa exoantigen, the major component of supernatant collected at the time of schizont rupture, was used as a probe for the detection of P. falciparum antigens. This assay seemed to be more sensitive than parasitological examination for malaria diagnosis since it was able to detect plasmodial antigens in both symptomatic and asymtomatic individuals with negative thick blood smear at different intervals after a last parasitologically confirmed confirmed attack of malaria.
Aljaž-Rožič Mateja; Hočevar Nežka
2004-01-01
The MELAMIN Chemical Factory in Kočevje manufactures synthetic resins and binders for the paper industry. Binders based on AKD (alkyl ketene dimer) are produced which are used for binding paper and cardboard in the range of neutral and partially basic pH. Cationic and, lately, anionic binders are mostly used for the bulk binding of paper and board. The possibility of using AKD binders on paper or board surfaces is presented. In this case partially cationic AKD binders may be applied. When opt...
Asymptomatic plasmodial infection in Colombian pregnant women.
Carmona-Fonseca, Jaime; Agudelo, Olga M; Arango, Eliana M
2017-08-01
Information about asymptomatic plasmodial infection is scarce in the world, and the current antimalarial program goals (control, elimination, and eradication) demand this evidence to be well documented in different populations and malaria transmission settings. This study aimed to measure the prevalence of API in Colombian pregnant women at delivery. A retrospective prevalence survey was used. Women were recruited at hospital obstetric facility in each of the municipalities of Turbo, Necoclí in Antioquia department, and Puerto Libertador in Córdoba department. Malaria infection was tested by thick blood smear (TBS) and real-time quantitative PCR (qPCR). Ninety-six pregnant women at delivery were studied: 95% were asymptomatic (91/96), 45% had asymptomatic plasmodial infection (API) by qPCR (41/91), and only 8% (7/91) had API by microscopy. The prevalence of submicroscopic infections (TBS negative and qPCR positive) was very high, 37% (34/91) in asymptomatic women and 41% (39/96) in total women studied (91 asymptomatic and 5 symptomatic). The prevalence of API in Colombian pregnant women is much higher than which is expected for a country that does not have the level of malaria transmission as Sub-Saharan African countries. Copyright © 2017 Elsevier B.V. All rights reserved.
2012-01-01
Background Natural products could play an important role in the challenge to discover new anti-malarial drugs. In a previous study, Dicoma tomentosa (Asteraceae) was selected for its promising anti-plasmodial activity after a preliminary screening of several plants traditionally used in Burkina Faso to treat malaria. The aim of the present study was to further investigate the anti-plasmodial properties of this plant and to isolate the active anti-plasmodial compounds. Methods Eight crude extracts obtained from D. tomentosa whole plant were tested in vitro against two Plasmodium falciparum strains (3D7 and W2) using the p-LDH assay (colorimetric method). The Peters’ four-days suppressive test model (Plasmodium berghei-infected mice) was used to evaluate the in vivo anti-plasmodial activity. An in vitro bioguided fractionation was undertaken on a dichloromethane extract, using preparative HPLC and TLC techniques. The identity of the pure compound was assessed using UV, MS and NMR spectroscopic analysis. In vitro cytotoxicity against WI38 human fibroblasts (WST-1 assay) and haemolytic activity were also evaluated for extracts and pure compounds in order to check selectivity. Results The best in vitro anti-plasmodial results were obtained with the dichloromethane, diethylether, ethylacetate and methanol extracts, which exhibited a high activity (IC50 ≤ 5 μg/ml). Hot water and hydroethanolic extracts also showed a good activity (IC50 ≤ 15 μg/ml), which confirmed the traditional use and the promising anti-malarial potential of the plant. The activity was also confirmed in vivo for all tested extracts. However, most of the active extracts also exhibited cytotoxic activity, but no extract was found to display any haemolytic activity. The bioguided fractionation process allowed to isolate and identify a sesquiterpene lactone (urospermal A-15-O-acetate) as the major anti-plasmodial compound of the plant (IC50 < 1 μg/ml against both 3D7 and W2 strains). This was also
Anti-plasmodial and antioxidant activities of methanol extract of the ...
African Journals Online (AJOL)
This study was aimed at investigating the anti-plasmodial and antioxidant activities of the extract of the leaf of Lophira lanceolata, a traditional medicine recipe. The methanol extract (ME) obtained by 72 h cold maceration was evaluated for acute toxicity test (LD50) and phytochemical constituents. The suppressive and ...
Navaee, Aso; Salimi, Abdollah
2018-05-01
Copper derivatives are the most prominent CO2 reduction electrocatalyst. Herein, the metallic copper has been electrochemically treated with some of common ionic salts such as N3bar, HPO2bar, S2bar, Fbar, Clbar, Brbar and Ibar based on the dissolution of a metallic working electrode in an aqueous solution to derive the surface roughness incorporated with nanostructures. Diverse surface morphology can be obtained when the ionic radii of anions are changed. Surface study reveals various roughness shapes based on the size and polarity of the anions, where the ions with higher ionic radii have higher impact on the Cu surface. In comparison, polyatomic oxyanion such as HPO2bar even with large ionic radii do not have enough strength to create the surface roughness than that of oxygen-free anions with large ionic radii. The photoelectrochemical behavior of the modified surfaces toward CO2 reduction is studied at a wide potential window in bicarbonate aqueous solution. Based on our investigations, treated surfaces by Ibar, Clbar and S2bargive a more surface roughness, while Ibar and N3bar offer higher catalytic activity toward CO2 reduction due to possible complexing ability of these anions with Cu cations, followed by formation of the co-catalyst semiconductor and facilitate electron transfer. This methodology can be applied to investigate the effect of ions on transition metals along with obtaining different surface morphologies tailored to different applications.
Directory of Open Access Journals (Sweden)
THOMAS EDISON E. DELA CRUZ
2010-10-01
Full Text Available Myxomycetes are ubiquitous in terrestrial forest ecosystems. Thus, this research study looks at the taxonomic diversity and distribution of plasmodial myxomycetes in La Mesa Ecopark in Quezon City, Philippines. A total of 240 moist chambers were prepared from four substrates (aerial and ground leaf litter, twigs and barks collected within this ecopark. Following incubation of moist chambers for eight weeks, a total of 28 species belonging to 10 genera were collected and identified: Arcyria (3, Diderma (2, Didymium (5, Lamproderma (2, Perichaena (3, Physarum (8, Macbrideola (1, Metatrichia (1, Trichia (1 and Stemonitis (2. Highest myxomycete yield (85% was observed in aerial leaf litter. In terms of taxonomic diversity, highest diversity was observed in bark microhabitats, although the lowest number of species was recorded in it. Assessment of their abundance and distribution showed similarities in species composition between aerial and ground leaf litter. This research study is the first report of plasmodial myxomycetes in La Mesa Ecopark in Quezon City, Philippines.
Surface modification of polystyrene with atomic oxygen radical anions-dissolved solution
International Nuclear Information System (INIS)
Wang Lian; Yan Lifeng; Zhao Peitao; Torimoto, Yoshifumi; Sadakata, Masayoshi; Li Quanxin
2008-01-01
A novel approach to surface modification of polystyrene (PS) polymer with atomic oxygen radical anions-dissolved solution (named as O - water) has been investigated. The O - water, generated by bubbling of the O - (atomic oxygen radical anion) flux into the deionized water, was characterized by UV-absorption spectroscopy and electron paramagnetic resonance (EPR) spectroscopy. The O - water treatments caused an obvious increase of the surface hydrophilicity, surface energy, surface roughness and also caused an alteration of the surface chemical composition for PS surfaces, which were indicated by the variety of contact angle and material characterization by atomic force microscope (AFM) imaging, field emission scanning electron microscopy (FESEM), X-ray photoelectron spectroscopy (XPS), and attenuated total-reflection Fourier transform infrared (ATR-FTIR) measurements. Particularly, it was found that some hydrophilic groups such as hydroxyl (OH) and carbonyl (C=O) groups were introduced onto the polystyrene surfaces via the O - water treatment, leading to the increases of surface hydrophilicity and surface energy. The active oxygen species would react with the aromatic ring molecules on the PS surfaces and decompose the aromatic compounds to produce hydrophilic hydroxyl and carbonyl compounds. In addition, the O - water is also considered as a 'clean solution' without adding any toxic chemicals and it is easy to be handled at room temperature. Present method may suit to the surface modification of polymers and other heat-sensitive materials potentially
Reimschuessel, R.; Gieseker, C.M.; Driscoll, C.; Baya, A.; Kane, A.S.; Blazer, V.S.; Evans, J.J.; Kent, M.L.; Moran, J.D.W.; Poynton, S.L.
2003-01-01
Ulcers in Atlantic menhaden Brevoortia tyrannus (Latrobe) (Clupeidae), observed along the USA east coast, have been attributed to diverse etiologies including bacterial, fungal and, recently, harmful algal blooms. To understand the early pathogenesis of these lesions, we examined juvenile Atlantic menhaden collected during their seasonal presence in Chesapeake Bay tributaries from April to October 1999 and from March to August 2000. We conducted histopathological examinations of young-of-the-year fish from the Pocomoke River tributary, which has a history of fish mortalities and high lesion prevalence. Kudoa clupeidae (Myxozoa: Myxosporea) spores were present in the muscles of fish collected in both years. Of the fish assessed by histology in April, 5 to 14% were infected, while in May 90 to 96% were infected. Infection rates remained high during the summer. Mature spores were primarily located within myomeres and caused little or no observable pathological changes. Ultrastructure showed spores with capsulogenic cells bearing filamentous projections, and a basal crescentic nucleus with mottled nucleoplasm containing cleaved, condensed chromatin. Also, a highly invasive plasmodial stage of a myxozoan was found in the lesions of juvenile Atlantic menhaden. The plasmodia were observed in fish collected between May and July, with the maximum occurrence in late June 1999 and late May 2000. Plasmodia penetrated and surrounded muscle bundles, causing grossly observable raised lesions in 73% of all fish infected with this invasive stage. Plasmodia were also detected in the visceral organs, branchial arches, and interocular muscles of some fish. Some of the invasive extrasporogonic plasmodial lesions were associated with ulcers and chronic inflammatory infiltrates. The plasmodial stage appeared to slough out of the tissue with subsequent evidence of wound healing. Ultrastructure showed plasmodia with an elaborate irregular surface, divided into distinct ectoplasm and
Probes for anionic cell surface detection
Smith, Bradley D.
2013-03-05
Embodiments of the present invention are generally directed to compositions comprising a class of molecular probes for detecting the presence of anionic cell surfaces. Embodiments include compositions that are enriched for these compositions and preparations, particularly preparations suitable for use as laboratory/clinical reagents and diagnostic indicators, either alone or as part of a kit. An embodiment of the invention provides for a highly selective agent useful in the discernment and identification of dead or dying cells, such as apoptotic cells, in a relatively calcium-free environment. An embodiment of the invention provides a selective agent for the identification of bacteria in a mixed population of bacterial cells and nonbacterial cells.
Heterologous expression of plasmodial proteins for structural studies and functional annotation
CSIR Research Space (South Africa)
Birkholtz, LM
2008-01-01
Full Text Available Malaria Journal Open AcceReview Heterologous expression of plasmodial proteins for structural studies and functional annotation Lyn-Marie Birkholtz1, Gregory Blatch2, Theresa L Coetzer3, Heinrich C Hoppe1,4, Esmaré Human1, Elizabeth J Morris1,5, Zoleka Ngcete..., Kwadlangezwa, South Africa Email: Lyn-Marie Birkholtz - lbirkholtz@up.ac.za; Gregory Blatch - G.Blatch@ru.ac.za; Theresa L Coetzer - theresa.coetzer@nhls.ac.za; Heinrich C Hoppe - hhoppe@csir.co.za; Esmaré Human - esmare.human@up.ac.za; Elizabeth J Morris...
Directory of Open Access Journals (Sweden)
Lucie Zarybnicka
2016-01-01
Full Text Available The present work deals with the surface modification of a commercial microfiltration poly(ethersulfone membrane by graft polymerization technique. Poly(styrene-co-divinylbenzene-co-4-vinylbenzylchloride surface layer was covalently attached onto the poly(ethersulfone support layer to improve the membrane electrochemical properties. Followed by amination, a two-layer anion-exchange membrane was prepared. The effect of surface layer treatment using the extraction in various solvents on membrane morphological and electrochemical characteristics was studied. The membranes were tested from the point of view of water content, ion-exchange capacity, specific resistance, permselectivity, FT-IR spectroscopy, and SEM analysis. It was found that the two-layer anion-exchange membranes after the extraction using tetrahydrofuran or toluene exhibited smooth and porous surface layer, which resulted in improved ion-exchange capacity, electrical resistance, and permselectivity of the membranes.
Anti-plasmodial activity of some Zulu medicinal plants and of some triterpenes isolated from them.
Simelane, Mthokozisi B C; Shonhai, Addmore; Shode, Francis O; Smith, Peter; Singh, Mogie; Opoku, Andy R
2013-10-08
Mimusops caffra E. Mey. ex A.DC and Mimusops obtusifolia Lam (both members of the Sapotaceae family), and Hypoxis colchicifolia Bak (family Hypoxidaceae) are used by traditional healers in Zululand to manage malaria. Anti-plasmodial investigation of the crude extracts and some triterpenes isolated from the plants showed activity against a chloroquine sensitive (CQS) strain of Plasmodium falciparum (D10). Among the crude extracts the leaves of M. caffra exhibited the highest activity, with an IC₅₀ of 2.14 μg/mL. The pentacyclic tritepenoid ursolic acid (1), isolated from the leaves of M. caffra was the most active compound (IC₅₀ 6.8 μg/mL) as compared to taraxerol (2) and sawamilletin (3) isolated from the stem bark of M. obtusifolia (IC₅₀ > 100). Chemical modification of the ursolic acid (1) to 3β-acetylursolic acid (4) greatly enhanced its anti-plasmodial activity. Compound 4 reduced parasitaemia against Plasmodium berghei by 94.01% in in vivo studies in mice. The cytotoxicity of 3β-acetylursolic acid (IC₅₀) to two human cell lines (HEK293 and HepG2) was 366.00 μg/mL and 566.09 μg/mL, respectively. The results validate the use of these plants in folk medicine.
Miros, François N; Zhao, Yingjie; Sargsyan, Gevorg; Pupier, Marion; Besnard, Céline; Beuchat, César; Mareda, Jiri; Sakai, Naomi; Matile, Stefan
2016-02-18
Of central importance in chemistry and biology, enolate chemistry is an attractive topic to elaborate on possible contributions of anion-π interactions to catalysis. To demonstrate the existence of such contributions, experimental evidence for the stabilization of not only anions but also anionic intermediates and transition states on π-acidic aromatic surfaces is decisive. To tackle this challenge for enolate chemistry with maximal precision and minimal uncertainty, malonate dilactones are covalently positioned on the π-acidic surface of naphthalenediimides (NDIs). Their presence is directly visible in the upfield shifts of the α-protons in the (1) H NMR spectra. The reactivity of these protons on π-acidic surfaces is measured by hydrogen-deuterium (H-D) exchange for 11 different examples, excluding controls. The velocity of H-D exchange increases with π acidity (NDI core substituents: SO2 R>SOR>H>OR>OR/NR2 >SR>NR2 ). The H-D exchange kinetics vary with the structure of the enolate (malonates>methylmalonates, dilactones>dithiolactones). Moreover, they depend on the distance to the π surface (bridge length: 11-13 atoms). Most importantly, H-D exchange depends strongly on the chirality of the π surface (chiral sulfoxides as core substituents; the crystal structure of the enantiopure (R,R,P)-macrocycle is reported). For maximal π acidity, transition-state stabilizations up to -18.8 kJ mol(-1) are obtained for H-D exchange. The Brønsted acidity of the enols increases strongly with π acidity of the aromatic surface, the lowest measured pKa =10.9 calculates to a ΔpKa =-5.5. Corresponding to the deprotonation of arginine residues in neutral water, considered as "impossible" in biology, the found enolate-π interactions are very important. The strong dependence of enolate stabilization on the unprecedented seven-component π-acidity gradient over almost 1 eV demonstrates quantitatively that such important anion-π activities can be expected only from
Anion-π Catalysts with Axial Chirality.
Wang, Chao; Matile, Stefan
2017-09-04
The idea of anion-π catalysis is to stabilize anionic transition states by anion-π interactions on aromatic surfaces. For asymmetric anion-π catalysis, π-acidic surfaces have been surrounded with stereogenic centers. This manuscript introduces the first anion-π catalysts that operate with axial chirality. Bifunctional catalysts with tertiary amine bases next to π-acidic naphthalenediimide planes are equipped with a bulky aromatic substituent in the imide position to produce separable atropisomers. The addition of malonic acid half thioesters to enolate acceptors is used for evaluation. In the presence of a chiral axis, the selective acceleration of the disfavored but relevant enolate addition was much better than with point chirality, and enantioselectivity could be observed for the first time for this reaction with small-molecule anion-π catalysts. Enantioselectivity increased with the π acidity of the π surface, whereas the addition of stereogenic centers around the aromatic plane did not cause further improvements. These results identify axial chirality of the active aromatic plane generated by atropisomerism as an attractive strategy for asymmetric anion-π catalysis. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Anti-plasmodial action of de novo-designed, cationic, lysine-branched, amphipathic, helical peptides
Directory of Open Access Journals (Sweden)
Kaushik Naveen K
2012-08-01
Full Text Available Abstract Background A lack of vaccine and rampant drug resistance demands new anti-malarials. Methods In vitro blood stage anti-plasmodial properties of several de novo-designed, chemically synthesized, cationic, amphipathic, helical, antibiotic peptides were examined against Plasmodium falciparum using SYBR Green assay. Mechanistic details of anti-plasmodial action were examined by optical/fluorescence microscopy and FACS analysis. Results Unlike the monomeric decapeptides {(Ac-GXRKXHKXWA-NH2 (X = F,ΔF (Fm, ΔFm IC50 >100 μM}, the lysine-branched,dimeric versions showed far greater potency {IC50 (μM Fd 1.5 , ΔFd 1.39}. The more helical and proteolytically stable ΔFd was studied for mechanistic details. ΔFq, a K-K2 dendrimer of ΔFm and (ΔFm2 a linear dimer of ΔFm showed IC50 (μM of 0.25 and 2.4 respectively. The healthy/infected red cell selectivity indices were >35 (ΔFd, >20 (ΔFm2 and 10 (ΔFq. FITC-ΔFd showed rapid and selective accumulation in parasitized red cells. Overlaying DAPI and FITC florescence suggested that ΔFd binds DNA. Trophozoites and schizonts incubated with ΔFd (2.5 μM egressed anomalously and Band-3 immunostaining revealed them not to be associated with RBC membrane. Prematurely egressed merozoites from peptide-treated cultures were found to be invasion incompetent. Conclusion Good selectivity (>35, good resistance index (1.1 and low cytotoxicity indicate the promise of ΔFd against malaria.
International Nuclear Information System (INIS)
Komatsu, Shojiro; Okada, Katsuyuki; Shimizu, Yoshiki; Moriyoshi, Yusuke
2001-01-01
The existence of CH 3 adsorbates on (111) surface of chemical vapor deposited diamond, which was observed by scanning tunneling microscopy, was explained by the following S N 2 (bimolecular, substitutional, and nucleophilic) type surface reaction; C(s) - +C 2 H 6 ->C(s)-CH 3 +CH 3 - , where C(s) denotes a surface carbon atom. The activation energy was estimated to be 36.78 kcal/mol and the reaction proved to be exothermic with the enthalpy change of -9.250 kcal/mol, according to ab initio molecular orbital calculations at MP2/3-21+G * //RHF/3-21G * level; this result is consistent with typical substrate temperatures, namely about 900 degree C, for chemical vapor deposition of diamond. Charge transfer from the highest occupied molecular orbital of the surface anionic site to the lowest unoccupied molecular orbital of ethane, that is antibonding at the CH 3 - CH 3 bond, has been clearly visualized. A characteristic configuration of an ethane molecule which is associated with an anionic vacant site C(s) - on hydrogenated (111) surface of diamond was also found. [copyright] 2001 American Institute of Physics
Constantino, Leonel Vinicius; Quirino, Juliana Nunes; Abrão, Taufik; Parreira, Paulo Sérgio; Urbano, Alexandre; Santos, Maria Josefa
2018-02-15
Calcined hydrotalcite can be applied to remove anionic contaminants from aqueous systems such as antimony species due to its great anion exchange capacity and high surface area. Hence, this study evaluated antimonite and antimonate sorption-desorption processes onto calcined hydrotalcite in the presence of nitrate, sulfate and phosphate. Sorption and desorption experiments of antimonite and antimonate were carried out in batch equilibrium and the post-sorption solids were analyzed by X-ray fluorescence (EDXRF). Sorption data were better fitted by dual-mode Langmuir-Freundlich model (R 2 >0.99) and desorption data by Langmuir model. High maximum sorption capacities were found for the calcined hydrotalcite, ranging from 617 to 790meqkg -1 . The competing anions strongly affected the antimony sorption. EDXRF analysis and mathematical modelling showed that sulfate and phosphate presented higher effect on antimonite and antimonate sorption, respectively. High values for sorption efficiency (SE=99%) and sorption capacity were attributed to the sorbent small particles and the large surface area. Positive hysteresis indexes and low mobilization factors (MF>3%) suggest very low desorption capacity to antimony species from LDH. These calcined hydrotalcite characteristics are desirable for sorption of antimony species from aqueous solutions. Copyright © 2017. Published by Elsevier B.V.
Selected anionic and cationic surface active agents: case study on the Kłodnica sediments
Directory of Open Access Journals (Sweden)
Olkowska Ewa
2017-03-01
Full Text Available Surface active agents (surfactants are a group of chemical compounds, which are used as ingredients of detergents, cleaning products, cosmetics and functional products. After use, wastes containing surfactants or their degradation products are discharged to wastewater treatment plants or directly into surface waters. Due to their specific properties of SAAs, compounds are able to migrate between different environmental compartments such as soil, sediment, water or even living organisms and accumulate there. Surfactants can have a harmful effect on living organisms. They can connect with bioactive molecules and modify their function. Additionally, they have the ability to migrate into cells and cause their damage or death. For these reasons investigation of individual surfactants should be conducted. The presented research has been undertaken to obtain information about SAA contamination of sediment from the River Kłodnica catchment caused by selected anionic (linear alkylbenzene sulfonates (LAS C10-C13 and cationic (alkylbenzyldimethylammonium (BDMA-C12-16, alkyl trimethyl ammonium (DTMA, hexadecyl piridinium chloride (HP chlorides surfactants. This river flows through an area of the Upper Silesia Industrial Region where various companies and other institutions (e.g. coal mining, power plants, metallurgy, hospitals are located. To determine their concentration the following analytical tools have been applied: accelerated solvent extraction– solid phase extraction – high performance liquid chromatography – UV-Vis (anionic SAAs and conductivity (cationic SAAs detectors. In all sediments anionic SAAs have been detected. The concentrations of HTMA and BDMA-C16 in tested samples were higher than other cationic analytes. Generally, levels of surfactants with longer alkyl chains were higher and this observation can confirm their higher susceptibility to sorption on solid surfaces.
Hydration of a Large Anionic Charge Distribution - Naphthalene-Water Cluster Anions
Weber, J. Mathias; Adams, Christopher L.
2010-06-01
We report the infrared spectra of anionic clusters of naphthalene with up to three water molecules. Comparison of the experimental infrared spectra with theoretically predicted spectra from quantum chemistry calculations allow conclusions regarding the structures of the clusters under study. The first water molecule forms two hydrogen bonds with the π electron system of the naphthalene moiety. Subsequent water ligands interact with both the naphthalene and the other water ligands to form hydrogen bonded networks, similar to other hydrated anion clusters. Naphthalene-water anion clusters illustrate how water interacts with negative charge delocalized over a large π electron system. The clusters are interesting model systems that are discussed in the context of wetting of graphene surfaces and polyaromatic hydrocarbons.
Zeng, Xianghui; de Groot, Anne Marit; Sijts, Alice J. A. M.; Broere, Femke; Oude Blenke, Erik; Colombo, Stefano; van Eden, Willem; Franzyk, Henrik; Nielsen, Hanne Mørck; Foged, Camilla
2015-11-01
Cationic vectors have demonstrated the potential to facilitate intracellular delivery of therapeutic oligonucleotides. However, enhanced transfection efficiency is usually associated with adverse effects, which also proves to be a challenge for vectors based on cationic peptides. In this study a series of proteolytically stable palmitoylated α-peptide/β-peptoid peptidomimetics with a systematically varied number of repeating lysine and homoarginine residues was shown to self-assemble with small interfering RNA (siRNA). The resulting well-defined nanocomplexes were coated with anionic lipids giving rise to net anionic liposomes. These complexes and the corresponding liposomes were optimized towards efficient gene silencing and low adverse effects. The optimal anionic liposomes mediated a high silencing effect, which was comparable to that of the control (cationic Lipofectamine 2000), and did not display any noticeable cytotoxicity and immunogenicity in vitro. In contrast, the corresponding nanocomplexes mediated a reduced silencing effect with a more narrow safety window. The surface coating with anionic lipid bilayers led to partial decomplexation of the siRNA-peptidomimetic nanocomplex core of the liposomes, which facilitated siRNA release. Additionally, the optimal anionic liposomes showed efficient intracellular uptake and endosomal escape. Therefore, these findings suggest that a more efficacious and safe formulation can be achieved by surface coating of the siRNA-peptidomimetic nano-self-assemblies with anionic lipid bilayers.Cationic vectors have demonstrated the potential to facilitate intracellular delivery of therapeutic oligonucleotides. However, enhanced transfection efficiency is usually associated with adverse effects, which also proves to be a challenge for vectors based on cationic peptides. In this study a series of proteolytically stable palmitoylated α-peptide/β-peptoid peptidomimetics with a systematically varied number of repeating lysine
Luque-Caballero, Germán; Martín-Molina, Alberto; Sánchez-Treviño, Alda Yadira; Rodríguez-Valverde, Miguel A; Cabrerizo-Vílchez, Miguel A; Maldonado-Valderrama, Julia
2014-04-28
Complexation of DNA with lipids is currently being developed as an alternative to classical vectors based on viruses. Most of the research to date focuses on cationic lipids owing to their spontaneous complexation with DNA. Nonetheless, recent investigations have revealed that cationic lipids induce a large number of adverse effects on DNA delivery. Precisely, the lower cytotoxicity of anionic lipids accounts for their use as a promising alternative. However, the complexation of DNA with anionic lipids (mediated by cations) is still in early stages and is not yet well understood. In order to explore the molecular mechanisms underlying the complexation of anionic lipids and DNA we proposed a combined methodology based on the surface pressure-area isotherms, Gibbs elasticity and Atomic Force Microscopy (AFM). These techniques allow elucidation of the role of the surface pressure in the complexation and visualization of the interfacial aggregates for the first time. We demonstrate that the DNA complexes with negatively charged model monolayers (DPPC/DPPS 4 : 1) only in the presence of Ca(2+), but is expelled at very high surface pressures. Also, according to the Gibbs elasticity plot, the complexation of lipids and DNA implies a whole fluidisation of the monolayer and a completely different phase transition map in the presence of DNA and Ca(2+). AFM imaging allows identification for the first time of specific morphologies associated with different packing densities. At low surface coverage, a branched net like structure is observed whereas at high surface pressure fibers formed of interfacial aggregates appear. In summary, Ca(2+) mediates the interaction between DNA and negatively charged lipids and also the conformation of the ternary system depends on the surface pressure. Such observations are important new generic features of the interaction between DNA and anionic lipids.
Cotelle, Yoann; Benz, Sebastian; Avestro, Alyssa-Jennifer; Ward, Thomas R; Sakai, Naomi; Matile, Stefan
2016-03-18
To integrate anion-π, cation-π, and ion pair-π interactions in catalysis, the fundamental challenge is to run reactions reliably on aromatic surfaces. Addressing a specific question concerning enolate addition to nitroolefins, this study elaborates on Leonard turns to tackle this problem in a general manner. Increasingly refined turns are constructed to position malonate half thioesters as close as possible on π-acidic surfaces. The resulting preorganization of reactive intermediates is shown to support the disfavored addition to enolate acceptors to an absolutely unexpected extent. This decisive impact on anion-π catalysis increases with the rigidity of the turns. The new, rigidified Leonard turns are most effective with weak anion-π interactions, whereas stronger interactions do not require such ideal substrate positioning to operate well. The stunning simplicity of the motif and its surprisingly strong relevance for function should render the introduced approach generally useful. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Pohlandt, C.
1981-01-01
Because pellicular anion-exchange resins suitable for the determination, by ion chromatography, of anions with alkaline eluents were unavailable in South Africa at the inception of this work, an attempt was made to prepare such resins. In this study it is shown that the pellicular resins produced are more efficient than the surface-aminated resins used previously. The simultaneous separation and determination of five common anions is demonstrated. The method was applied to the analysis of uranium leach liquors, effluent samples, and a solid sample of ferric oxide (goethite)
Pu Anion Exchange Process Intensification
International Nuclear Information System (INIS)
Taylor-Pashow, Kathryn M. L.
2017-01-01
This research is focused on improving the efficiency of the anion exchange process for purifying plutonium. While initially focused on plutonium, the technology could also be applied to other ion-exchange processes. Work in FY17 focused on the improvement and optimization of porous foam columns that were initially developed in FY16. These foam columns were surface functionalized with poly(4-vinylpyridine) (PVP) to provide the Pu specific anion-exchange sites. Two different polymerization methods were explored for maximizing the surface functionalization with the PVP. The open-celled polymeric foams have large open pores and large surface areas available for sorption. The fluid passes through the large open pores of this material, allowing convection to be the dominant mechanism by which mass transport takes place. These materials generally have very low densities, open-celled structures with high cell interconnectivity, small cell sizes, uniform cell size distributions, and high structural integrity. These porous foam columns provide advantages over the typical porous resin beads by eliminating the slow diffusion through resin beads, making the anion-exchange sites easily accessible on the foam surfaces. The best performing samples exceeded the Pu capacity of the commercially available resin, and also offered the advantage of sharper elution profiles, resulting in a more concentrated product, with less loss of material to the dilute heads and tails cuts. An alternate approach to improving the efficiency of this process was also explored through the development of a microchannel array system for performing the anion exchange.
Pu Anion Exchange Process Intensification
Energy Technology Data Exchange (ETDEWEB)
Taylor-Pashow, Kathryn M. L. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)
2017-10-06
This research is focused on improving the efficiency of the anion exchange process for purifying plutonium. While initially focused on plutonium, the technology could also be applied to other ion-exchange processes. Work in FY17 focused on the improvement and optimization of porous foam columns that were initially developed in FY16. These foam columns were surface functionalized with poly(4-vinylpyridine) (PVP) to provide the Pu specific anion-exchange sites. Two different polymerization methods were explored for maximizing the surface functionalization with the PVP. The open-celled polymeric foams have large open pores and large surface areas available for sorption. The fluid passes through the large open pores of this material, allowing convection to be the dominant mechanism by which mass transport takes place. These materials generally have very low densities, open-celled structures with high cell interconnectivity, small cell sizes, uniform cell size distributions, and high structural integrity. These porous foam columns provide advantages over the typical porous resin beads by eliminating the slow diffusion through resin beads, making the anion-exchange sites easily accessible on the foam surfaces. The best performing samples exceeded the Pu capacity of the commercially available resin, and also offered the advantage of sharper elution profiles, resulting in a more concentrated product, with less loss of material to the dilute heads and tails cuts. An alternate approach to improving the efficiency of this process was also explored through the development of a microchannel array system for performing the anion exchange.
Zeng, Jianxian; Dong, Zhihui; Zhang, Zhe; Liu, Yuan
2017-07-05
A surface-grafted imprinted ceramic membrane (IIP-PVI/CM) for recognizing molybdate (Mo(VI)) anion was prepared by surface-initiated graft-polymerization. Firstly, raw alumina ceramic membrane (CM) was deposited with SiO 2 active layer by situ hydrolysis deposition method. Subsequently, γ-methacryloxy propyl trimethoxyl silane (MPS) was used as a coupling agent to introduce double bonds onto the SiO 2 layer (MPS-CM). Then, 1-vinylimidazole (VI) was employed as a functional monomer to graft-polymerization onto the MPS-CM (PVI-CM). During the graft-polymerization, the influence factors of grafting degree of PVI were investigated in detail. Under optimum conditions (monomer concentration 20wt%, temperature 70°C, initiator amount 1.1wt% and reaction time 8h), the grafting degree of 20.39g/100g was obtained. Further, Mo(VI) anion was used as a template to imprint in the PVI-CM by employing 1,6-dibromohexane as a cross-linking agent, and then Mo(VI) was removed, obtaining the IIP-PVI/CM with many imprinted cavities for Mo(VI). Thereafter, static adsorption and dynamic separation properties of IIP-PVI/CM for Mo(VI) were studied. Results indicate that IIP-PVI/CM shows a specific selectivity for Mo(VI) with the adsorption capacity of 0.69mmol/100g, and the selectivity coefficient of IIP-PVI/CM is 7.48 for molybdate to tungstate anions. During the dynamic separation, IIP-PVI/CM has also good selectivity for separation of Mo(VI) and W(VI) anions. Copyright © 2017 Elsevier B.V. All rights reserved.
Yoshimura, Tomokazu; Bong, Miri; Matsuoka, Keisuke; Honda, Chikako; Endo, Kazutoyo
2009-11-01
Three anionic homologues of a novel partially fluorinated carboxylate-type anionic gemini surfactant, N,N'-di(3-perfluoroalkyl-2-hydroxypropyl)-N,N'-diacetic acid ethylenediamine (2C(n)(F) edda, where n represents the number of carbon atoms in the fluorocarbon chain (4, 6, and 8)) were synthesized. In these present gemini surfactants, the relatively small carboxylic acid moieties form hydrophilic head groups. The surface properties or structures of the aggregates of these surfactants are strongly influenced by the nonflexible fluorocarbons and small head groups; this is because these surfactants have a closely packed molecular structure. The equilibrium surface tension properties of these surfactants were measured at 298.2K for various fluorocarbon chain lengths. The plot of the logarithm of the critical micelle concentration (cmc) against the fluorocarbon chain lengths for 2C(n)(F) edda (n=4, 6, and 8) showed a minimum for n=6. Furthermore, the lowest surface tension of 2C(6)(F) edda at the cmc was 16.4mNm(-1). Such unique behavior has not been observed even in the other fluorinated surfactants. Changes in the shapes and sizes of these surfactant aggregate with concentration were investigated by dynamic light scattering and transmission electron microscopy (TEM). The TEM micrographs showed that in an aqueous alkali solution, 2C(n)(F) edda mainly formed aggregates with stringlike (n=4), cagelike (n=6), and distorted bilayer structures (n=8). The morphological changes in the aggregates were affected by the molecular structure composed of nonflexible fluorocarbon chains and flexible hydrocarbon chains.
International Nuclear Information System (INIS)
Qian, Xiaolei; Fan, Hua; Wang, Chaozhan; Wei, Yinmao
2013-01-01
Ion-exchange membrane is of importance for the development of membrane chromatography. In this work, a high-capacity anion-exchange membrane was prepared by grafting of glycidyl methacrylate (GMA) onto the surface of regenerated cellulose (RC) membranes via surface-initiated atom transfer radical polymerization (SI-ATRP) and subsequent derivatization with diethylamine. Attenuated total reflectance Fourier-transform infrared (ATR-FTIR), X-ray photoelectron spectroscopy (XPS) and scanning electron microscopy (SEM) were used to characterize changes in the chemical functionality, surface topography and pore morphology of the modified membranes. The static capacity of the prepared anion-exchange membrane was evaluated with bovine serum albumin (BSA) as a model protein. The results indicated that the anion-exchange membrane which could reach a maximum capacity of 96 mg/mL for static adsorption possesses a higher adsorption capacity, and the adsorption capacity increases with the polymerization time. The effect of pH and salt concentration confirmed that the adsorption of BSA followed ion-exchange mechanism. The established method would have potential application in the preparation of anion-exchange membrane.
Dong, Xiao; Gu, Huaimin; Liu, Fangfang
2012-03-01
The paper investigated the residual ions in hydroxylamine-reduced silver colloid (HRSC) and the relationship between the condition of HRSC and the enhanced mechanisms of this colloid. We also detected the SERS of MB and studied the effects of anions on the Raman signal. In the case of HRSC, the bands of residual ions diminish while the bands of Ag-anions increase gradually with increasing the concentrations of Cl(-) and NO(3)(-). It means the affinity of residual ions on the silver surface is weaker than that of Cl(-) and NO(3)(-) and the residual ions are replaced gradually by the added Cl(-) or NO(3)(-). The Raman signal of residual ions can be detected by treatment with anions that do not bind strongly to the silver surface, such as SO(4)(2-). The most intense band of Ag-anions bonds can be also observed when adding weakly binding anions to the colloid. However, the anions which make up the Ag-anions bonds are residual Cl(-) and the effect of weakly binding anions is only to aggregate the silver particles. Residual Cl(-) can be replaced by I(-) which has the highest affinity. From the detection of methylene blue (MB), the effects of anions on the enhancement of Raman signal are discussed in detail, and these findings could make the conditions suitable for detecting analytes in high efficiency. This study will have a profound implication to SERS users about their interpretation of SERS spectra when obtaining these anomalous bands. Copyright © 2011 Elsevier B.V. All rights reserved.
Zhu, Guifen; Gao, Xia; Wang, Xiaolong; Wang, Jianji; Fan, Jing
2018-01-12
To illuminate the influence mechanism of anionic structure of ionic liquids (ILs) on the adsorption performance of surface molecularly imprinted polymers (MIPs), in this work, six newly designed MIPs were prepared on the surface of amino-poly(styrene-divinylbenzene) particles by using imidazolium ILs with the same cation [C 4 mim] + but different anions (Cl, CH 3 SO 3 , PF 6 , BF 4 , C 4 F 7 O 2 , C 4 F 9 SO 3 ) as template molecules, methacrylic acid as functional monomer, and ethylene dimethacrylate as cross-linker. The resulting MIP materials were characterized by IR and SEM, and the influence of hydrogen bond accepting ability of anions on the adsorption performance of the MIPs for the ILs was investigated in acetonitrile. It was found that adsorption capacity of the MIPs towards the ILs decreased in the order MIP [C4mim][Cl] > MIP [C4mim][C4F7O2] ≥ MIP [C4mim][BF4] and MIP [C4mim][CH3SO3] > MIP [C4mim][C4F9SO3] > MIP [C4mim][PF6] , which is in good agreement with the ability of anions of the ILs to form hydrogen bonds. Ultraviolet, 1 H-NMR and 35 Cl-NMR spectroscopy was then used to study the interactions of anions of the ILs with the functional monomer. It was found that the hydrogen bond interaction between anions of the ILs and acidic proton of the functional monomer was the main driving force for the high adsorption selectivity of the imprinted polymers, and the stronger hydrogen bond interaction indicates higher binding capacity and higher selectivity of the polymers towards the ILs. It was also verified that the ILs with stronger hydrogen bond accepting ability of anions could be selectively extracted by the corresponding IL-MIPs. These results may provide new insight into the recognition mechanism of MIPs for ILs, and are also useful for the rational design of this new class of imprinting materials. Copyright © 2017 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Walter, Pauline; Hoffmann, Xenia-Katharina; Ebeling, Britta; Haas, Markus; Marwan, Wolfgang, E-mail: wolfgang.marwan@ovgu.de
2013-05-24
Highlights: •We investigate reprogramming of gene expression in multinucleate single cells. •Cells of two differentiation control mutants are fused. •Fused cells proceed to alternative gene expression patterns. •The population of nuclei damps stochastic fluctuations in gene expression. •Dynamic processes of cellular reprogramming can be observed by repeated sampling of a cell. -- Abstract: Nonlinear dynamic processes involving the differential regulation of transcription factors are considered to impact the reprogramming of stem cells, germ cells, and somatic cells. Here, we fused two multinucleate plasmodial cells of Physarum polycephalum mutants defective in different sporulation control genes while being in different physiological states. The resulting heterokaryons established one of two significantly different expression patterns of marker genes while the plasmodial halves that were fused to each other synchronized spontaneously. Spontaneous synchronization suggests that switch-like control mechanisms spread over and finally control the entire plasmodium as a result of cytoplasmic mixing. Regulatory molecules due to the large volume of the vigorously streaming cytoplasm will define concentrations in acting on the population of nuclei and in the global setting of switches. Mixing of a large cytoplasmic volume is expected to damp stochasticity when individual nuclei deliver certain RNAs at low copy number into the cytoplasm. We conclude that spontaneous synchronization, the damping of molecular noise in gene expression by the large cytoplasmic volume, and the option to take multiple macroscopic samples from the same plasmodium provide unique options for studying the dynamics of cellular reprogramming at the single cell level.
International Nuclear Information System (INIS)
Walter, Pauline; Hoffmann, Xenia-Katharina; Ebeling, Britta; Haas, Markus; Marwan, Wolfgang
2013-01-01
Highlights: •We investigate reprogramming of gene expression in multinucleate single cells. •Cells of two differentiation control mutants are fused. •Fused cells proceed to alternative gene expression patterns. •The population of nuclei damps stochastic fluctuations in gene expression. •Dynamic processes of cellular reprogramming can be observed by repeated sampling of a cell. -- Abstract: Nonlinear dynamic processes involving the differential regulation of transcription factors are considered to impact the reprogramming of stem cells, germ cells, and somatic cells. Here, we fused two multinucleate plasmodial cells of Physarum polycephalum mutants defective in different sporulation control genes while being in different physiological states. The resulting heterokaryons established one of two significantly different expression patterns of marker genes while the plasmodial halves that were fused to each other synchronized spontaneously. Spontaneous synchronization suggests that switch-like control mechanisms spread over and finally control the entire plasmodium as a result of cytoplasmic mixing. Regulatory molecules due to the large volume of the vigorously streaming cytoplasm will define concentrations in acting on the population of nuclei and in the global setting of switches. Mixing of a large cytoplasmic volume is expected to damp stochasticity when individual nuclei deliver certain RNAs at low copy number into the cytoplasm. We conclude that spontaneous synchronization, the damping of molecular noise in gene expression by the large cytoplasmic volume, and the option to take multiple macroscopic samples from the same plasmodium provide unique options for studying the dynamics of cellular reprogramming at the single cell level
International Nuclear Information System (INIS)
Schmitz, Andrew; Shaw, John; Chakraborty, Himadri S.; Thumm, Uwe
2010-01-01
The resonant charge transfer process in the collision of hydrogen anions with metal surfaces is described within a single-active-electron wave-packet propagation method. The ion-survival probability is found to be strongly enhanced at two different surface-specific perpendicular velocities of the ion. It is shown that, while the low-velocity enhancement is induced from a dynamical confinement of the ion level inside the band gap, the high-velocity enhancement is due to electron recapture from transiently populated image states. Results are presented for Li(110), Cu(111), and Pd(111) surfaces.
Koscher, Brent A; Bronstein, Noah D; Olshansky, Jacob H; Bekenstein, Yehonadav; Alivisatos, A Paul
2016-09-21
Ion-exchange transformations allow access to nanocrystalline materials with compositions that are inaccessible via direct synthetic routes. However, additional mechanistic insight into the processes that govern these reactions is needed. We present evidence for the presence of two distinct mechanisms of exchange during anion exchange in CsPbX3 nanocrystals (NCs), ranging in size from 6.5 to 11.5 nm, for transformations from CsPbBr3 to CsPbCl3 or CsPbI3. These NCs exhibit bright luminescence throughout the exchange, allowing their optical properties to be observed in real time, in situ. The iodine exchange presents surface-reaction-limited exchanges allowing all anionic sites within the NC to appear chemically identical, whereas the chlorine exchange presents diffusion-limited exchanges proceeding through a more complicated exchange mechanism. Our results represent the first steps toward developing a microkinetic description of the anion exchange, with implications not only for understanding the lead halide perovskites but also for nanoscale ion exchange in general.
Santos, Cherry S; Baldelli, Steven
2009-01-29
The gas-liquid interface of halide-free 1,3-dialkylimidazolium alkyl sulfates [RMIM][R-OSO(3)] with R chain length from C(1)-C(4) and C(8) has been studied systematically using the surface-specific sum frequency generation (SFG) vibrational spectroscopy and surface tension measurements. From the SFG spectra, vibrational modes from the methyl group of both cation and anion are observed for all ionic liquid samples considered in the present study. These results suggest the presence of both ions at the gas-liquid interface, which is further supported by surface tension measurements. Surface tension data show a decreasing trend as the alkyl chain in the imidazolium cation is varied from methyl to butyl chain, with a specific anion. A similar trend is observed when the alkyl chain of the anion is modified and the cation is fixed.
On the effect of image states on resonant neutralization of hydrogen anions near metal surfaces
International Nuclear Information System (INIS)
Chakraborty, Himadri S.; Niederhausen, Thomas; Thumm, Uwe
2005-01-01
We directly assess the role of image state electronic structures on the ion-survival by comparing the resonant charge transfer dynamics of hydrogen anions near Pd(1 1 1), Pd(1 0 0), and Ag(1 1 1) surfaces. Our simulations show that image states that are degenerate with the metal conduction band favor the recapture of electrons by outgoing ions. In sharp contrast, localized image states that occur inside the band gap hinder the recapture process and thus enhance the ion-neutralization probability
Ijeoma H. Ogbuehi; Omotayo O. Ebong; Eme O. Asuquo; Chijioke A. Nwauche
2014-01-01
The emergence of resistant strains of the malaria parasite has necessitated the continued search for other effective, safe and cheap plant-based anti-malarial agents. This study was carried out to evaluate in vivo the anti-plasmodial effect of the extract of a combination of three plants as used in traditional medicine in South-east, Nigeria. Dried and ground roots of the three plants: Anthocleista nobilis, Nauclea latifolia and Napoleona imperialis were extracted in 70% methanol as a combina...
Anionic solid lipid nanoparticles supported on protamine/DNA complexes
International Nuclear Information System (INIS)
Ye Jiesheng; Liu Chunxi; Chen Zhijin; Zhang Na; Wang Aihua
2008-01-01
The objective of this study was to design novel anionic ternary nanoparticles for gene delivery. These ternary nanoparticles were equipped with protamine/DNA binary complexes (150-200 nm) as the support, and the anionic formation was achieved by absorption of anionic solid lipid nanoparticles (≤20 nm) onto the surface of the binary complexes. The small solid lipid nanoparticles (SLNs) were prepared by a modified film dispersion-ultrasonication method, and adsorption of the anionic SLNs onto the binary complexes was typically carried out in water via electrostatic interaction. The formulated ternary nanoparticles were found to be relatively uniform in size (257.7 ± 10.6 nm) with a 'bumpy' surface, and the surface charge inversion from 19.28 ± 1.14 mV to -17.16 ± 1.92 mV could be considered as evidence of the formation of the ternary nanoparticles. The fluorescence intensity measurements from three batches of the ternary nanoparticles gave a mean adsorption efficiency of 96.75 ± 1.13%. Circular dichroism spectra analysis showed that the protamine/DNA complexes had been coated by small SLNs, and that the anionic ternary nanoparticles formed did not disturb the construction of the binary complexes. SYBR Green I analysis suggested that the ternary nanoparticles could protect the DNA from nuclease degradation, and cell viability assay results showed that they exhibit lower cytotoxicity to A549 cells compared with the binary complexes and lipofectamine. The transfection efficiency of the ternary nanoparticles was better than that of naked DNA and the binary complexes, and almost equal to that of lipofectamine/DNA complexes, as revealed by inversion fluorescence microscope observation. These results indicated that the anionic ternary nanoparticles could facilitate gene transfer in cultured cells, and might alleviate the drawbacks of the conventional cationic vector/DNA complexes for gene delivery in vivo
The Thermodynamics of Anion Complexation to Nonpolar Pockets.
Sullivan, Matthew R; Yao, Wei; Tang, Du; Ashbaugh, Henry S; Gibb, Bruce C
2018-02-08
The interactions between nonpolar surfaces and polarizable anions lie in a gray area between the hydrophobic and Hofmeister effects. To assess the affinity of these interactions, NMR and ITC were used to probe the thermodynamics of eight anions binding to four different hosts whose pockets each consist primarily of hydrocarbon. Two classes of host were examined: cavitands and cyclodextrins. For all hosts, anion affinity was found to follow the Hofmeister series, with associations ranging from 1.6-5.7 kcal mol -1 . Despite the fact that cavitand hosts 1 and 2 possess intrinsic negative electrostatic fields, it was determined that these more enveloping hosts generally bound anions more strongly. The observation that the four hosts each possess specific anion affinities that cannot be readily explained by their structures, points to the importance of counter cations and the solvation of the "empty" hosts, free guests, and host-guest complexes, in defining the affinity.
A computational study of anion-modulated cation-π interactions.
Carrazana-García, Jorge A; Rodríguez-Otero, Jesús; Cabaleiro-Lago, Enrique M
2012-05-24
The interaction of anions with cation-π complexes formed by the guanidinium cation and benzene was thoroughly studied by means of computational methods. Potential energy surface scans were performed in order to evaluate the effect of the anion coming closer to the cation-π pair. Several structures of guanidinium-benzene complexes and anion approaching directions were examined. Supermolecule calculations were performed on ternary complexes formed by guanidinium, benzene, and one anion and the interaction energy was decomposed into its different two- and three-body contributions. The interaction energies were further dissected into their electrostatic, exchange, repulsion, polarization and dispersion contributions by means of local molecular orbital energy decomposition analysis. The results confirm that, besides the electrostatic cation-anion attraction, the effect of the anion over the cation-π interaction is mainly due to polarization and can be rationalized following the changes in the anion-π and the nonadditive (three-body) terms of the interaction. When the cation and the anion are on the same side of the π system, the three-body interaction is anticooperative, but when the anion and the cation are on opposite sides of the π system, the three-body interaction is cooperative. As far as we know, this is the first study where this kind of analysis is carried out with a structured cation as guanidinium with a significant biological interest.
Fundamental characteristics study of anion-exchange PVDF-SiO(2) membranes.
Zuo, Xingtao; Shi, Wenxin; Yu, Shuili; He, Jiajie
2012-01-01
A new type of poly(vinylidene fluoride)(PVDF)-SiO(2) hybrid anion-exchange membrane was prepared by blending method. The anion-exchange groups were introduced by the reaction of epoxy groups with trimethylamine (TMA). Contact angle between water and the membrane surface was measured to characterize the hydrophilicity change of the membrane surface. The effects of nano-sized SiO(2) particles in the membrane-forming materials on the membrane mechanical properties and conductivity were also investigated. The experimental results indicated that PVDF-SiO(2) anion-exchange membranes exhibited better water content, ion-exchange capacity, conductivity and mechanic properties, and so may find potential applications in alkaline membrane fuel cells and water treatment processes.
Energy Technology Data Exchange (ETDEWEB)
Li, Kai; Ma, Chun–Fang; Ling, Yuan; Li, Meng [Department of Chemistry, Faculty of Material Science and Chemistry, China University of Geosciences, Wuhan 430074 (China); Gao, Qiang, E-mail: gaoqiang@cug.edu.cn [Department of Chemistry, Faculty of Material Science and Chemistry, China University of Geosciences, Wuhan 430074 (China); Engineering Research Center of Nano-Geo Materials of Ministry of Education, China University of Geosciences, Wuhan 430074 (China); Luo, Wen–Jun, E-mail: heartnohome@yahoo.com.cn [Department of Chemistry, Faculty of Material Science and Chemistry, China University of Geosciences, Wuhan 430074 (China)
2015-07-15
Nanostructured carbonaceous materials are extremely important in the nano field, yet developing simple, mild, and “green” methods that can make such materials possess large surface area and rich functional groups on their surfaces still remains a considerable challenge. Herein, a one-pot and environment-friendly method, i.e., thermal treatment (180 °C; 18 h) of water mixed with glucose and chitosan (CTS), has been proposed. The resultant carbonaceous nanomaterials were characterized by field emitting scanning electron microscope, N{sub 2} adsorption/desorption, Fourier transform infrared spectroscope, X-ray photoelectron spectroscopy, and zeta-potential analysis. It was found that, in contrast to the conventional hydrothermally carbonized product from pure glucose, with low surface area (9.3 m{sup 2} g{sup −1}) and pore volume (0.016 cm{sup 3} g{sup −1}), the CTS-added carbonaceous products showed satisfactory textural parameters (surface area and pore volume up to 254 m{sup 2} g{sup −1} and 0.701 cm{sup 3} g{sup −1}, respectively). Moreover, it was also interestingly found that these CTS-added carbonaceous products possessed both acidic (–COOH) and basic (–NH{sub 2}) groups on their surfaces. Taking the advantages of large surface area and –COOH/–NH{sub 2} bifunctional surface, the carbonaceous nanomaterials exhibited excellent performance for adsorptions of cationic compound (i.e., methylene blue) at pH 10 and anionic compound (i.e., acid red 18) at pH 2, respectively. This work not only provides a simple and green route to prepare acid/base bifunctional carbonaceous nanomaterials with large surface area but also well demonstrates their potential for application in adsorption. - Highlights: • A simple and green method was proposed to prepare carbon nanomaterials. • The carbon product showed acid/base bifunctional surface with large surface area. • The carbon material could efficiently adsorb both cationic and anionic compounds.
Preparation of Cationic MOFs with Mobile Anions by Anion Stripping to Remove 2,4-D from Water
Directory of Open Access Journals (Sweden)
Tao Chen
2017-07-01
Full Text Available A cationic porous framework with mobile anions (MIL-101(Cr-Cl was easily and successfully synthesized by utilizing the stronger affinity of F− to Al3+ than Cr3+ in the charge-balanced framework of MIL-101(Cr. The structure, morphology and porosity of MIL-101(Cr-Cl were characterized. The obtained new materials retain the high surface area, good thermostability, and structure topology of MIL-101(Cr. With the mobile Cl− anion, MIL-101(Cr-Cl can be used as an ion-exchange material for anionic organic pollutions. In this work, 2,4-dichlorophenoxyacetic acid (2,4-D was used as a model to test the absorption performance of this new material. This new material exhibited improved adsorbability compared to that of the original metal-organic frameworks (MOFs. At the same time, this material also shows high anti-interference performance with changing solution pH.
Verkade, John G; Wadhwa, Kuldeep; Kong, Xueqian; Schmidt-Rohr, Klaus
2013-05-07
An anion exchange membrane and fuel cell incorporating the anion exchange membrane are detailed in which proazaphosphatrane and azaphosphatrane cations are covalently bonded to a sulfonated fluoropolymer support along with anionic counterions. A positive charge is dispersed in the aforementioned cations which are buried in the support to reduce the cation-anion interactions and increase the mobility of hydroxide ions, for example, across the membrane. The anion exchange membrane has the ability to operate at high temperatures and in highly alkaline environments with high conductivity and low resistance.
Patchy proteins, anions and the Hofmeister series
Energy Technology Data Exchange (ETDEWEB)
Lund, Mikael; Jungwirth, Pavel [Institute of Organic Chemistry and Biochemistry, Academy of Sciences of the Czech Republic, Flemingovo namesti 2, 16610 Prague 6 (Czech Republic); Center for Complex Molecular Systems and Biomolecules, Flemingovo namesti 2, 16610 Prague 6 (Czech Republic)], E-mail: mikael.lund@uochb.cas.cz
2008-12-10
We investigate specific anion binding to a range of patchy protein models and use our results to probe protein-protein interactions for aqueous lysozyme solutions. Our molecular simulation studies show that the ion-protein interaction mechanism and strength largely depend on the nature of the interfacial amino acid residues. Via direct ion pairing, small anions interact with charged side-chains while larger anions are attracted to non-polar residues due to several solvent assisted mechanisms. Incorporating ion and surface specificity into a mesoscopic model for protein-protein interactions we calculate the free energy of interaction between lysozyme molecules in aqueous solutions of sodium chloride and sodium iodide. In agreement with experiment, our finding is that 'salting out' follows the reverse Hofmeister series for pH below the iso-electric point and the direct series for pH above pI.
Energy Technology Data Exchange (ETDEWEB)
Allen, Heather [The Ohio State Univ., Columbus, OH (United States)
2016-11-14
We combine the use of several techniques including bulk adsorption experiments, X-ray absorption, infrared, total internal reflection Raman, and vibrational sum frequencygeneration (XAS, IR, TIR-Raman, VSFG) spectroscopies, and molecular modeling to investigate ion adsorption at mineral surfaces. XAS and TIR-Raman provides data on how the metal binds to the surface (e.g., monodentate, bidentate), IR provides data on bulk anion adsorption at mineral surfaces from aqueous solutions, and VSFG provides surface specific data on anion adsorption at the mineral surface as well as impact of adsorbed metal-anion pairs on water structure at the mineral surface. Molecular modeling is used to guide spectroscopic data interpretation by providing information on water structure around ions in solution and the structure of metal-anion complexes in aqueous solutions. In addition, molecular modeling is used to provide insight into water structure at mineral surfaces, the surface sites involved in ion adsorption, and the distribution of ion pairs between aqueous solution and the mineral surface. Our studies have focused on systems involving alkaline earth metal (Mg2+, Ca2+, Sr2+, Ba2+) and heavy metal (Co2+, Cd2+) cations. The anions we have selected for studyinclude Cl-, NO3-, ClO4-, SO42-, SeO32-, and SeO42-. Ion adsorption and the potential formation ofternary complexes on silica (quartz, amorphous silica), alumina (corundum and gibbsite), and ferric iron oxides (goethite and hematite) are under investigation.
Determination of nitrate by anion exchange with ultraviolet detection
Energy Technology Data Exchange (ETDEWEB)
McComas, J.G.
1976-01-01
A weak base anion exchange resin is synthesized by surface bonding 3-aminopropyltriethoxysilane to silica gel. This silylated silica gel is used to separate nitrate from interferences. The nitrate is then determined by measuring its absorbance at 220 nm. An interference study was performed and no anions commonly found in potable water interferes. A comparison of this method was made with the brucine method on real samples and satisfactory agreement was obtained between the two methods.
DEFF Research Database (Denmark)
Ajua, Anthony; Engleitner, Thomas; Esen, Meral
2012-01-01
information about natural exposure and vaccine immunogenicity. A novel, cytometry-based workflow for the quantitative detection of anti-plasmodial antibodies in human serum is presented. METHODS: Fixed red blood cells (RBCs), infected with late stages of P. falciparum were utilized to detect malaria...... vaccine trials in semiimmune adults and pre-school children residing in a malaria endemic area. RESULTS: Fixation, permeabilization, and staining of infected RBCs were adapted for best operation in flow cytometry. As asexual vaccine candidates are designed to induce antibody patterns similar to semi...... with those obtained by manual gating (r between 0.79 and 0.99) and outperformed other model-driven gating methods. Bland-Altman plots confirmed the agreement of manual gating and OSA derived results. A-1.33 fold increase (p=0.003) in the number of positive cells after vaccination in a subgroup of preschool...
Charnley, Steven B.
2011-01-01
The presence of negative ions (anions) in cometary comae is known from Giotto mass spectrometry of IP/Halley. The anions 0-, OH-, C-, CH- and CN- have been detected, as well as unidentified anions with masses 22-65 and 85-110 amu (Chaizy et al. 1991). Organic molecular anions are known to have a significant impact on the charge balance of interstellar clouds and circumstellar envelopes and have been shown to act as catalysts for the gas-phase synthesis of larger hydrocarbon molecules in the ISM, but their importance in cometary comae has not yet been explored. We present details of the first attempt to model the chemistry of anions in cometary comae. Based on the combined chemical and hydro dynamical model of Rodgers & Charnley (2002), we investigate the role of large carbon-chain anions in cometary coma chemistry. We calculate the effects of these anions on coma thermodynamics, charge balance and examine their impact on molecule formation.
Czech Academy of Sciences Publication Activity Database
Klomfar, Jaroslav; Součková, Monika; Pátek, Jaroslav
2017-01-01
Roč. 431, January (2017), s. 24-33 ISSN 0378-3812 R&D Projects: GA ČR GA13-00145S Institutional support: RVO:61388998 Keywords : ionic liquid * pyridinium-based cation * bis(trifluoromethylsulfonyl)imide anion * density-temperature relation * surface tension-temperature relation * recommended property values Subject RIV: BJ - Thermodynamics OBOR OECD: Thermodynamics Impact factor: 2.473, year: 2016
Bo, Arixin; Sarina, Sarina; Liu, Hongwei; Zheng, Zhanfeng; Xiao, Qi; Gu, Yuantong; Ayoko, Godwin A; Zhu, Huaiyong
2016-06-29
Hydrotalcite (HT)-based materials are usually applied to capture anionic pollutants in aqueous solutions. Generally considered anion exchangers, their ability to capture radioactive cations is rarely exploited. In the present work, we explored the ability of pristine and calcined HT getters to effectively capture radioactive cations (Sr(2+) and Ba(2+)) which can be securely stabilized at the getter surface. It is found that calcined HT outperforms its pristine counterpart in cation removal ability. Meanwhile, a novel anion removal mechanism targeting radioactive I(-) is demonstrated. This approach involves HT surface modification with silver species, namely, Ag2CO3 nanoparticles, which can attach firmly on HT surface by forming coherent interface. This HT-based anion getter can be further used to capture I(-) in aqueous solution. The observed I(-) uptake mechanism is distinctly different from the widely reported ion exchange mechanism of HT and much more efficient. As a result of the high local concentrations of precipitants on the getters, radioactive ions in water can be readily immobilized onto the getter surface by forming precipitates. The secured ionic pollutants can be subsequently removed from water by filtration or sedimentation for safe disposal. Overall, these stable, inexpensive getters are the materials of choice for removal of trace ionic pollutants from bulk radioactive liquids, especially during episodic environmental crisis.
Cytotoxic mechanisms of hydrosulfide anion and cyanide anion in primary rat hepatocyte cultures
International Nuclear Information System (INIS)
Thompson, Rodney W.; Valentine, Holly L.; Valentine, William M.
2003-01-01
Hydrogen sulfide and hydrogen cyanide are known to compromise mitochondrial respiration through inhibition of cytochrome c oxidase and this is generally considered to be their primary mechanism of toxicity. Experimental studies and the efficiency of current treatment protocols suggest that H 2 S may exert adverse physiological effects through additional mechanisms. To evaluate the role of alternative mechanisms in H 2 S toxicity, the relative contributions of electron transport inhibition, uncoupling of mitochondrial respiration, and opening of the mitochondrial permeability transition pore (MPTP) to hydrosulfide and cyanide anion cytotoxicity in primary hepatocyte cultures were examined. Supplementation of hepatocytes with the glycolytic substrate, fructose, rescued hepatocytes from cyanide anion induced toxicity, whereas fructose supplementation increased hydrosulfide anion toxicity suggesting that hydrosulfide anion may compromise glycolysis in hepatocytes. Although inhibitors of the MPTP opening were protective for hydrosulfide anion, they had no effect on cyanide anion toxicity, consistent with an involvement of the permeability transition pore in hydrosulfide anion toxicity but not cyanide anion toxicity. Exposure of isolated rat liver mitochondria to hydrosulfide did not result in large amplitude swelling suggesting that if H 2 S induces the permeability transition it does so indirectly through a mechanism requiring other cellular components. Hydrosulfide anion did not appear to be an uncoupler of mitochondrial respiration in hepatocytes based upon the inability of oligomycin and fructose to protect hepatocytes from hydrosulfide anion toxicity. These findings support mechanisms additional to inhibition of cytochrome c oxidase in hydrogen sulfide toxicity. Further investigations are required to assess the role of the permeability transition in H 2 S toxicity, determine whether similar affects occur in other cell types or in vivo and evaluate whether this may
Modelling the transport of carbonic acid anions through anion-exchange membranes
International Nuclear Information System (INIS)
Nikonenko, V.; Lebedev, K.; Manzanares, J.A.; Pourcelly, G.
2003-01-01
Electrodiffusion of carbonate and bicarbonate anions through anion-exchange membranes (AEM) is described on the basis of the Nernst-Planck equations taking into account coupled hydrolysis reactions in the external diffusion boundary layers (DBLs) and internal pore solution. The model supposes local electroneutrality as well as chemical and thermodynamic equilibrium. The transport is considered in three layers being an anion exchange membrane and two adjoining diffusion layers. A mechanism of competitive transport of HCO 3 - and CO 3 2- anions through the membrane which takes into account Donnan exclusion of H + ions is proposed. It is predicted that the pH of the depleting solution decreases and that of the concentrating solution increases during electrodialysis (ED). Eventual deviations from local electroneutrality and local chemical equilibrium are discussed
Intermolecular proton transfer in anionic complexes of uracil with alcohols
International Nuclear Information System (INIS)
Haranczyk, Maciej; Rak, Janusz; Gutowski, Maciej S.; Radisic, Dunja; Stokes, Sarah T.; Bowen, Kit H.
2005-01-01
A series of eighteen alcohols (ROH) has been designed with an enthalpy of deprotonation (H DP ) in a range of 13.8-16.3 eV. The effects of excess electron attachment to the binary alcohol-uracil (ROH...U) complexes have been studied at the density functional level with a B3LYP exchange-correlation functional and at the second order Moeller-Plesset perturbation theory level. The photoelectron spectra of anionic complexes of uracil with three alcohols (ethanol, 2,2,3,3,3-pentafluoroethanol and 1,1,1,3,3,3-hexafluoro-2-propanol) have been measured with 2.54 eV photons. For ROHs with deprotonation enthalpies larger than 14.8 eV only the ROH...U - minimum exists on the potential energy surface of the anionic complex. For alcohols with deprotonation enthalpies in a range of 14.3-14.8 eV two minima might exist on the anionic potential energy surface, which correspond to the RO - ...HU . and ROH...U - structures. For ROHs with deprotonation enthalpies smaller than 14.3 eV, the excess electron attachment to the ROH...U complex always induces a barrier-free proton transfer from the hydroxyl group of ROH to the O8 atom of U, with the product being RO - ...HU . . A driving force for the intermolecular proton transfer is to stabilize the excess negative charge localized on a orbital of uracil. Therefore, these complexes with proton transferred to the anionic uracil are characterized by larger values of electron vertical detachment energy (VDE). The values of VDE for anionic complexes span a range from 1.0 to 2.3 eV and roughly correlate with the acidity of alcohols. However, there is a gap of ∼0.5 eV in the values of VDE, which separates the two families, ROH...U - and RO - ...HU . , of anionic complexes. The energy of stabilization for the anionic complexes spans a range from 0.6 to 1.7 eV and roughly correlates with the acidity of alcohols. The measured photoelectron spectra are in good agreement with the theoretical predictions
Adsorption of anionic surfactant on porous and nonporous polyethylene terephthalate films
International Nuclear Information System (INIS)
Yamauchi, Yu.; Apel, P.Yu.
2016-01-01
We study the adsorption of anionic surfactant, sodium dodecyl diphenyloxide disulfonate (SDDD) on three types of polyethylene terephthalate (PET) substrates from aqueous solutions of SDDD of different concentrations. Neutral electrolyte (KCl) was added to the solutions to vary the ionic strength. Three types of substrates were used: 1) original PET film; 2) etched nonporous film, obtained from pristine film by chemical etching and bearing negative charge on the surface; 3) etched porous membranes, fabricated from pristine film by ion irradiation and subsequent chemical etching. The membranes have negative charge on the flat surface and on the inner pore walls. The comparison shows that the negative charge on the flat surface has weak effect on adsorption of the anionic surfactant, and the SDDD adsorption on the inner walls of pores is much weaker than on flat surface, even if the pore radius is significantly larger than the Debye length. This «exclusion» effect strongly depends on ionic strength of solution. [ru
Mayne, Richard; Adamatzky, Andrew; Jones, Jeff
2015-01-01
The plasmodium of slime mold Physarum polycephalum behaves as an amorphous reaction-diffusion computing substrate and is capable of apparently ‘intelligent’ behavior. But how does intelligence emerge in an acellular organism? Through a range of laboratory experiments, we visualize the plasmodial cytoskeleton—a ubiquitous cellular protein scaffold whose functions are manifold and essential to life—and discuss its putative role as a network for transducing, transmitting and structuring data streams within the plasmodium. Through a range of computer modeling techniques, we demonstrate how emergent behavior, and hence computational intelligence, may occur in cytoskeletal communications networks. Specifically, we model the topology of both the actin and tubulin cytoskeletal networks and discuss how computation may occur therein. Furthermore, we present bespoke cellular automata and particle swarm models for the computational process within the cytoskeleton and observe the incidence of emergent patterns in both. Our work grants unique insight into the origins of natural intelligence; the results presented here are therefore readily transferable to the fields of natural computation, cell biology and biomedical science. We conclude by discussing how our results may alter our biological, computational and philosophical understanding of intelligence and consciousness. PMID:26478782
Savizi, Iman Shahidi Pour
2011-04-01
Specific adsorption of anions to electrode surfaces may alter the rates of electrocatalytic reactions. Density functional theory (DFT) methods are used to predict the adsorption free energy of acetate and phosphate anions as a function of Pt(1 1 1) electrode potential. Four models of the electrode potential are used including a simple vacuum slab model, an applied electric field model with and without the inclusion of a solvating water bi-layer, and the double reference model. The linear sweep voltammogram (LSV) due to anion adsorption is simulated using the DFT results. The inclusion of solvation at the electrochemical interface is necessary for accurately predicting the adsorption peak position. The Langmuir model is sufficient for predicting the adsorption peak shape, indicating coverage effects are minor in altering the LSV for acetate and phosphate adsorption. Anion adsorption peak positions are determined for solution phase anion concentrations present in microbial fuel cells and microbial electrolysis cells and discussion is provided as to the impact of anion adsorption on oxygen reduction and hydrogen evolution reaction rates in these devices. © 2011 Elsevier Ltd. All rights reserved.
Rojas, Ricardo; Bruna, Felipe; de Pauli, Carlos P; Ulibarri, M Ángeles; Giacomelli, Carla E
2011-07-01
Layered double hydroxides (LDHs) reactivity and interfacial behavior are closely interconnected and control particle properties relevant to the wide range of these solids' applications. Despite their importance, their relationship has been hardly described. In this work, chloride and dodecylsulfate (DDS(-)) intercalated LDHs are studied combining experimental data (electrophoretic mobility and contact angle measurements, hydroxyl and organic compounds uptake) and a simple mathematical model that includes anion-binding and acid-base reactions. This approach evidences the anion effect on LDHs interfacial behavior, reflected in the opposite particle charge and the different surface hydrophobic/hydrophilic character. LDHs reactivity are also determined by the interlayer composition, as demonstrated by the cation uptake capability of the DDS(-) intercalated sample. Consequently, the interlayer anion modifies the LDHs interfacial properties and reactivity, which in turn extends the customization capacity of these solids. Copyright © 2011 Elsevier Inc. All rights reserved.
Supramolecular Chemistry of Selective Anion Recognition for Anions of Environmental Relevance
International Nuclear Information System (INIS)
Sessler, Jonathan L.
2007-01-01
The major thrust of this project, led by the University of Kansas (Prof. Kristin Bowman-James), entails an exploration of the basic determinants of anion recognition and their application to the design, synthesis, and testing of novel sulfate extractants. A key scientific inspiration for the work comes from the need, codified in simple-to-appreciate terms by the Oak Ridge National Laboratory component of the team (viz. Dr. Bruce Moyer), for chemical entities that can help in the extractive removal of species that have low solubilities in borosilicate glass. Among such species, sulfate anion, has been identified as particularly insidious. Its presence interferes with the vitrification process, thus rendering the remediation of tank waste from, e.g., the Hanford site far more difficult and expensive. The availability of effective extractants, that would allow for the separation of separating sulfate from the major competing anions in the waste, especially nitrate, could allow for pre-vitrification removal of sulfate via liquid-liquid extraction. The efforts at The University of Texas, the subject of this report, have thus concentrated on the development of new sulfate receptors. These systems are designed to increase our basic understanding of anion recognition events and set the stage for the development of viable sulfate anion extractants. In conjunction with the Oak Ridge National Laboratory (ORNL) members of the research team, several of these new receptors were studied as putative extractants, with two of the systems being shown to act as promising synergists for anion exchange.
Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO
International Nuclear Information System (INIS)
Pal, Subrata; Maiti, Prabal K; Bagchi, Biman
2005-01-01
We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics
Razaq, Aamir; Mihranyan, Albert; Welch, Ken; Nyholm, Leif; Strømme, Maria
2009-01-15
The electrochemically controlled anion absorption properties of a novel large surface area composite paper material composed of polypyrrole (PPy) and cellulose derived from Cladophora sp. algae, synthesized with two oxidizing agents, iron(III) chloride and phosphomolybdic acid (PMo), were analyzed in four different electrolytes containing anions (i.e., chloride, aspartate, glutamate, and p-toluenesulfonate) of varying size.The composites were characterized with scanning and transmission electron microscopy, N2 gas adsorption,and conductivity measurements. The potential-controlled ion exchange properties of the materials were studied by cyclic voltammetry and chronoamperometry at varying potentials. The surface area and conductivity of the iron(III) chloride synthesized sample were 58.8 m2/g and 0.65 S/cm, respectively, while the corresponding values for the PMo synthesized sample were 31.3 m2/g and 0.12 S/cm. The number of absorbed ions per sample mass was found to be larger for the iron(III) chloride synthesized sample than for the PMo synthesized one in all four electrolytes. Although the largest extraction yields were obtained in the presence of the smallest anion (i.e., chloride) for both samples, the relative degree of extraction for the largest ions (i.e., glutamate and p-toluenesulfonate) was higher for the PMo sample. This clearly shows that it is possible to increase the extraction yield of large anions by carrying out the PPy polymerization in the presence of large anions. The results likewise show that high ion exchange capacities, as well as extraction and desorption rates, can be obtained for large anions with high surface area composites coated with relatively thin layers of PPy.
The many ways of making anionic clays
Indian Academy of Sciences (India)
Together with hydrotalcite-like layered double hydroxides, bivalent and trivalent metal hydroxides and their hydroxy salts are actually anionic clays consisting of positively charged hydroxide layers with anions intercalated in the interlayer region. The anionic clays exhibit anion sorption, anion diffusion and exchange ...
Oda, Shinobu; Michihata, Sayumi; Sakamoto, Naoki; Horibe, Hideo; Kono, Akihiko; Ohashi, Shinichi
2012-12-01
The addition of anion-exchange resin microparticles into a polyacrylonitrile (PAN) ballooned microsphere layer drastically enhanced the fermentative activity of Trichoderma atroviride AG2755-5NM398 in an extractive liquid-surface immobilization (Ext-LSI) system. The production of 6-pentyl-α-pyrone (6PP), a fungicidal secondary metabolite, was 1.92-fold higher than the control (PAN alone). Copyright © 2012 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Supramolecular Chemistry of Environmentally Relevant Anions
International Nuclear Information System (INIS)
Bowman-James, Kristin; Moyer, B.A.; Sessler, Jonathan L.
2003-01-01
The goal of this project is the development of highly selective extractants for anions targeting important and timely problems of critical interest to the EMSP mission. In particular, sulfate poses a special problem in cleaning up the Hanford waste tanks in that it interferes with vitrification, but available technologies for sulfate removal are limited. The basic chemical aspects of anion receptor design of functional pH independent systems as well as design of separations strategies for selective and efficient removal of targeted anions have been probed. Key findings include: (1) some of the first synthetic sulfate-selective anion-binding agents; (2) simple, structure-based methods for modifying the intrinsic anion selectivity of a given class of anion receptors; and (3) the first system capable of extracting sulfate from acidic, nitrate-containing aqueous media. Receptor design, structural influences on anion binding affinities, and findings from liquid-liquid extraction studies will be discussed
International Nuclear Information System (INIS)
Oliveira, M.B.; Domínguez-Pérez, M.; Cabeza, O.; Lopes-da-Silva, J.A.; Freire, M.G.; Coutinho, J.A.P.
2013-01-01
Highlights: • Novel data for the surface tensions of mixtures [C 4 mim][NTf 2 ] + [C 4 C 1 mim]/[C 3 mpy]/[C 3 mpyr]/[C 3 mpip][NTf 2 ] are presented. • γ were determined at a fixed temperature, 298.2 K, and at atmospheric pressure, for the whole composition range. • Surface tension deviations showed the near ideal behavior of the selected mixtures. • Gibbs adsorption isotherms showed the surface preferential adsorption of one ionic liquid over the other. -- Abstract: While values for thermophysical properties of ionic liquids are becoming widely available, data for ionic liquid mixtures are still scarce. In an effort to overcome this limitation and understand the behavior of ionic liquid mixtures, novel data for the surface tension of mixtures composed of 1-butyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide, [C 4 mim][NTf 2 ], with other ionic liquids with a common anion, namely 1-butyl-2,3-dimethylimidazolium, [C 4 C 1 mim] + , 3-methyl-1-propylpyridinium, [C 3 mpy] + , 1-methyl-1-propylpyrrolidinium, [C 3 mpyr] + , and 1-methyl-1-propylpiperidinium, [C 3 mpip] + , were measured at T = 298.2 K and atmospheric pressure over the entire composition range. From the surface tension deviations derived from the experimental results, it was possible to infer that the cation alkyl chain length of the second ionic liquid constituting the mixture has a stronger influence in the ideal mixture behavior than the type of family the ionic liquid cation belongs to. The Gibbs adsorption isotherms, estimated from the experimental values, show that the composition of the vapor–liquid interface is not the same as that of the bulk and that the interface is richer in the ionic liquid with the lowest surface tension, [C 4 mim][NTf 2
Energy Technology Data Exchange (ETDEWEB)
Li, Kui, E-mail: likui9606@stu.xjtu.edu.cn [School of Nuclear Science and Technology, Xi’an Jiaotong University, Xi’an 710049 (China); Zhao, Yaolin, E-mail: zhaoyaolin@mail.xjtu.edu.cn [School of Nuclear Science and Technology, Xi’an Jiaotong University, Xi’an 710049 (China); Zhang, Peng, E-mail: zp32@qq.com [Sino Shaanxi Nuclear Industry Group, Xi’an 710100 (China); He, Chaohui, E-mail: hechaohui@mail.xjtu.edu.cn [School of Nuclear Science and Technology, Xi’an Jiaotong University, Xi’an 710049 (China); Deng, Jia, E-mail: djkokocase@stu.xjtu.edu.cn [School of Nuclear Science and Technology, Xi’an Jiaotong University, Xi’an 710049 (China); Ding, Shujiang, E-mail: dingsj@mail.xjtu.edu.cn [Department of Applied Chemistry, School of Science, Xi’an Jiaotong University, Xi’an 710049 (China); Shi, Weiqun, E-mail: shiwq@ihep.ac.cn [Key Laboratory of Nuclear Radiation and Nuclear Energy Technology and Key Laboratory for Biomedical Effects of Nanomaterials and Nanosafety, Institute of High Energy Physics, Chinese Academy of Sciences, Beijing 100049 (China)
2016-12-30
Highlights: • Metal surface sites of (001)-S surface of chalcopyrite show significant chemical affinity to iodide and iodate. • The energetically favorable active site is copper for iodide adsorption and iron for iodate adsorption, respectively. • Iodate undergoes a dissociative adsorption on the copper site of chalcopyrite surface. - Abstract: The adsorption of iodine anions (iodide and iodate) on the sulfur terminated (001) chalcopyrite surface has been systematically investigated combining first-principles calculations based on density functional theory (DFT) with X-ray photoelectron spectroscopy (XPS) measurements. Based on the total energy calculations and geometric optimization, the thermodynamically preferred site was copper atom for iodide adsorption and iron atom for iodate adsorption, respectively. In the case of Cu site mode, the iodate underwent a dissociative adsorption, where one I−O bond of iodate ion was broken and the dissociative oxygen atom adsorbed on the adjacent sulphur site. Projected density of states (PDOS) analysis further clarified the interaction mechanism between active sites of chalcopyrite surface and adsorbates. In addition, full-range XPS spectra qualitatively revealed the presence of iodine on chalcopyrite surface. High resolution XPS spectra of the I 3d peaks after adsorption verified the chemical environment of iodine. The binding energies of 618.8 eV and 623.5 eV for I 3d{sub 5/2} peaks unveiled that the adsorption of iodide and iodate ions on copper-iron sulfide minerals was the result of formation of low solubility metal iodides precipitate. Also two I 3d peaks with low intensity around 618 eV and 630 eV might be related to the inorganic reduction of iodate to iodide by reducing S{sup 2−} ion of chalcopyrite.
Zhao, Yan; Liu, Huimin; Tang, Kaini; Jin, Yali; Pan, Jiefeng; der Bruggen, Bart Van; Shen, Jiangnan; Gao, Congjie
2016-01-01
A new bio-inspired method was applied in this study to simultaneously improve the monovalent anion selectivity and antifouling properties of anion exchange membranes (AEMs). Three-layer architecture was developed by deposition of polydopamine (PDA) and electro-deposition of N-O-sulfonic acid benzyl chitosan (NSBC). The innermost and outermost layers were PDA with different deposition time. The middle layer was prepared by NSBC. Fourier transform infrared spectroscopy and scanning electron microscopy confirmed that PDA and NSBC were successfully modified on the surfaces of AEMs. The contact angle of the membranes indicated an improved hydrophilicity of the modified membranes. A series of electrodialysis experiments in which Cl−/SO42− separation was studied, demonstrating the monovalent anion selectivity of the samples. The Cl−/SO42− permselectivity of the modified membranes can reach up to 2.20, higher than that of the commercial membrane (only 0.78) during 90 minutes in electrodialysis (ED). The increase value of the resistance of the membranes was also measured to evaluate the antifouling properties. Sodium dodecyl benzene sulfonate (SDBS) was used as the fouling material in the ED process and the membrane area resistance of modified membrane increase value of was only 0.08 Ωcm2 30 minutes later. PMID:27853255
Zhao, Yan; Liu, Huimin; Tang, Kaini; Jin, Yali; Pan, Jiefeng; der Bruggen, Bart Van; Shen, Jiangnan; Gao, Congjie
2016-11-01
A new bio-inspired method was applied in this study to simultaneously improve the monovalent anion selectivity and antifouling properties of anion exchange membranes (AEMs). Three-layer architecture was developed by deposition of polydopamine (PDA) and electro-deposition of N-O-sulfonic acid benzyl chitosan (NSBC). The innermost and outermost layers were PDA with different deposition time. The middle layer was prepared by NSBC. Fourier transform infrared spectroscopy and scanning electron microscopy confirmed that PDA and NSBC were successfully modified on the surfaces of AEMs. The contact angle of the membranes indicated an improved hydrophilicity of the modified membranes. A series of electrodialysis experiments in which Cl-/SO42- separation was studied, demonstrating the monovalent anion selectivity of the samples. The Cl-/SO42- permselectivity of the modified membranes can reach up to 2.20, higher than that of the commercial membrane (only 0.78) during 90 minutes in electrodialysis (ED). The increase value of the resistance of the membranes was also measured to evaluate the antifouling properties. Sodium dodecyl benzene sulfonate (SDBS) was used as the fouling material in the ED process and the membrane area resistance of modified membrane increase value of was only 0.08 Ωcm2 30 minutes later.
Structure and dynamics of solvated hydrogenoxalate and oxalate anions: theoretical study
Czech Academy of Sciences Publication Activity Database
Kroutil, O.; Minofar, Babak; Kabeláč, M.
2016-01-01
Roč. 22, č. 9 (2016), s. 210 ISSN 1610-2940 Institutional support: RVO:61388971 Keywords : Ab initio molecular dynamics * oxalic acid anions * Potential energy surface Subject RIV: EE - Microbiology, Virology Impact factor: 1.425, year: 2016
Supramolecular Chemistry of Selective Anion Recognition for Anions of Environmental Relevance
International Nuclear Information System (INIS)
Bowman-James, K.; Wilson, G.; Moyer, B. A.
2004-01-01
This project involves the design and synthesis of receptors for oxoanions of environmental importance, including emphasis on high level and low activity waste. Target anions have included primarily oxoanions and a study of the basic concepts behind selective binding of target anions. A primary target has been sulfate because of its deleterious influence on the vitrification of tank wastes
Chemical Hydrogen Storage Using Polyhedral Borane Anions and Aluminum-Ammonia-Borane Complexes
Energy Technology Data Exchange (ETDEWEB)
Hawthorne, M. Frederick; Jalisatgi, Satish S.; Safronov, Alexander V.; Lee, Han Beak; Wu, Jianguo
2010-10-01
Phase 1. Hydrolysis of borohydride compounds offer the potential for significant hydrogen storage capacity, but most work to date has focused on one particular anion, BH4-, which requires high pH for stability. Other borohydride compounds, in particular polyhedral borane anions offer comparable hydrogen storage capacity without requiring high pH media and their long term thermal and hydrolytic stability coupled with non-toxic nature make them a very attractive alternative to NaBH4. The University of Missouri project provided the overall program focal point for the investigation of catalytic hydrolysis of polyhedral borane anions for hydrogen release. Due to their inherent stability, a transition metal catalyst was necessary for the hydrolysis of polyhedral borane anions. Transition metal ions such as cobalt, nickel, palladium and rhodium were investigated for their catalytic activity in the hydrolysis of nido-KB11H14, closo-K2B10H10, and closo-K2B12H12. The rate of hydrolysis follows first-order kinetics with respect to the concentration of the polyhedral borane anion and surface area of the rhodium catalyst. The rate of hydrolysis depends upon a) choice of polyhedral borane anion, c) concentration of polyhedral borane anion, d) surface area of the rhodium catalyst and e) temperature of the reaction. In all cases the yield of hydrogen was 100% which corresponds to ~7 wt% of hydrogen (based on material wt%). Phase 2. The phase 2 of program at the University of Missouri was focused upon developing aluminum ammonia-boranes (Al-AB) as chemical hydrogen storage materials, specifically their synthesis and studies of their dehydrogenation. The ammonia borane molecule (AB) is a demonstrated source of chemically stored hydrogen (19.6 wt%) which meets DOE performance parameters except for its regeneration from spent AB and elemental hydrogen. The presence of an aluminum center bonded to multiple AB residues might combine the efficiency of AB dehydrogenation with an aluminum
Hydrothermal carbon nanosphere-based agglomerated anion exchanger for ion chromatography.
Zhao, Qiming; Wu, Shuchao; Zhang, Kai; Lou, Chaoyan; Zhang, Peiming; Zhu, Yan
2016-10-14
This work reports the application of hydrothermal carbon nanospheres (HCNSs) as stationary phases in ion chromatography. HCNSs were facilely quaternized through polycondensation of methylamine and 1,4-butanediol diglycidyl ether. The quaternization was confirmed by Fourier transform infrared spectroscopy and X-ray photoelectron spectroscopy. Owing to the electrostatic interaction, quaternized HCNSs were equably attached onto the surface of sulfonated polystyrene-divinylbenzene (PS-DVB) beads to construct the anion exchangers. The aggregation was verified by scanning electron microscopy and elemental analysis. Common anions, aliphatic monocarboxylic acids, polarizable anions, and aromatic acids were well separated on the stationary phases with good stability and symmetry. The prepared column was further applied to detect phosphate content in Cola drink samples. The limit of detection (S/N=3) was 0.09mg/L, and the relative standard deviation (n=10) of retention time was 0.31%. The average recovery was 99.58%. Copyright © 2016 Elsevier B.V. All rights reserved.
Anionic lipids and the maintenance of membrane electrostatics in eukaryotes.
Platre, Matthieu Pierre; Jaillais, Yvon
2017-02-01
A wide range of signaling processes occurs at the cell surface through the reversible association of proteins from the cytosol to the plasma membrane. Some low abundant lipids are enriched at the membrane of specific compartments and thereby contribute to the identity of cell organelles by acting as biochemical landmarks. Lipids also influence membrane biophysical properties, which emerge as an important feature in specifying cellular territories. Such parameters are crucial for signal transduction and include lipid packing, membrane curvature and electrostatics. In particular, membrane electrostatics specifies the identity of the plasma membrane inner leaflet. Membrane surface charges are carried by anionic phospholipids, however the exact nature of the lipid(s) that powers the plasma membrane electrostatic field varies among eukaryotes and has been hotly debated during the last decade. Herein, we discuss the role of anionic lipids in setting up plasma membrane electrostatics and we compare similarities and differences that were found in different eukaryotic cells.
Methods and systems for measuring anions
Masih, Dilshad; Mohammed, Omar F.; Aly, Shawkat M.; Alarousu, Erkki
2016-01-01
Embodiments of the present disclosure provide for methods for detecting the presence and/or concentration of anions in a solution, systems for detecting the presence and/or concentration of anions in a solution, anion sensor systems, and the like.
Methods and systems for measuring anions
Masih, Dilshad
2016-08-18
Embodiments of the present disclosure provide for methods for detecting the presence and/or concentration of anions in a solution, systems for detecting the presence and/or concentration of anions in a solution, anion sensor systems, and the like.
Lafhaj, Z.; Filippov, L. O.; Filippova, I. V.
2017-07-01
The flotation separation of salt type calcium minerals is problematic, due to the similarities in their same active Ca2+ related site for interaction with anionic collectors and similar physicochemical characteristics such as solubility, zero-point charge, surface speciation and Ca-site density. The work was performed to achieve effective and selective separation of the calcium-minerals using pure minerals samples: orange calcite with Mg impurities, optic calcite with impurities level and an apatite. The pure samples surface was examined using techniques sensitive near-surface like infrared spectroscopy (FTIR) and chemical composition was obtained by ICPMS. The isoelectric point (IEP) and point of zero charge (PZC) in electrolyte were recorded using electrophoresis method at different ionic strengths of the solution. Mechanisms of charge development at the mineral-water interface are discussed. The time of contact as important parameter for the charge equilibrium was deduced from kinetics study and fixed to 30 minutes. The difference in the values obtained between IEP and PZSE can be explained by the presence of a specific adsorption of cations and anions on the surface. The effect of pure anionic collectors such as oleic and linoleic acid were studied. At low pH, both collectors lead to a good recovery for the calcites. The flotation recovery of optic calcite at pH 9 with sodium oleate is higher than with sodium linoleate. At alkaline pH, apatite showed a better recovery with sodium linoleate.
International Nuclear Information System (INIS)
Alizadeh, E; Rowntree, P A; Massey, S; Sanche, L
2015-01-01
Among amino acids, cysteine has been widely studied, becoming a standard for molecular self-assembly experiments, because its mercapto group (-SH) allows the formation of self-assembled monolayers (SAMs) on metal surfaces. Dissociative electron attachment (DEA) on L-cysteine SAMs is investigated utilizing a time-of-flight mass spectrometer coupled with a low-energy electron gun. The results show that electrons with kinetic energies of 3 to 15 eV attach to L-cysteine producing anionic fragments of different masses (e.g., H - , O - , OH - , S - , SH - ) via dissociation of intermediate transient anions. The anion yield functions exhibited purely resonant behaviour with electron energies below 15 eV, indicating that the formation of transient anions is the predominant mechanism of production of anionic fragments from L-cysteine dissociation. (paper)
Phosphazene-promoted anionic polymerization
Zhao, Junpeng
2014-01-01
In the recent surge of metal-free polymerization techniques, phosphazene bases have shown their remarkable potential as organic promoters/catalysts for the anionic polymerization of various types of monomers. By complexation with the counterion (e.g. proton or lithium cation), phosphazene base significantly improve the nucleophilicity of the initiator/chain-end resulting in rapid and usually controlled anionic/quasi-anionic polymerization. In this review, we will introduce the general mechanism, i.e. in situ activation (of initiating sites) and polymerization, and summarize the applications of such a mechanism on macromolecular engineering toward functionalized polymers, block copolymers and complex macromolecular architectures.
Anion retention in soil: Possible application to reduce migration of buried technetium and iodine
International Nuclear Information System (INIS)
Gu, B.; Schulz, R.K.
1991-10-01
This report summarizes a literature review of our present knowledge of the anion exchange properties of a number of soils and minerals, which may potentially be used as anion exchangers to retard migration of such anions as iodide (I - ), iodate (IO 3 - ) and pertechnetate (TcO 4 - ) away from disposal site. The amorphous clays allophane and imogolite, are found to be among the most important soil components capable of developing appreciable amounts of positive charge for anion exchange even at about neutral pH. Decreases in the SiO 2 /Al 2 O 3 ratio and soil pH result in an increase in soil AEC. Allophane and imogolite rich soils have an AEC ranging from 1 to 18 meq/100g at pH about 6. Highly weathered soils dominated by Fe and Al oxides and kaolinite may develop a significant amount of AEC as soil pH falls. The retention of iodine (I) and technetium (T c ), by soils is associated with both soil organic matter, and Fe and Al oxides, whereas sorption on layer silicate minerals in negligible. Fe and Al oxides become more important in the retention of anionic I - , IO 3 - , and TcO 4 - as pH falls, since more positive charge is developed on the oxide surfaces. Although few studies, if any, have been conducted on I and T c sorption by soil allophane and imogolite, it is estimated that a surface plough soil (2 million pounds soil per acre) with 5 meq/100g AEC, as is commonly found in andisols, shall retain approximately 5900 kg I and 4500 kg T c . It is conceivable that an anion exchanger such as an andisol could be used to modify the near field environment of a radioactive waste disposal facility. This whole disposal system would then offer similar migration resistance to anions as is normally afforded to cations by usual and normal soils. 93 refs., 10 figs., 7 tabs
Anion retention in soil: Possible application to reduce migration of buried technetium and iodine
Energy Technology Data Exchange (ETDEWEB)
Gu, B.; Schulz, R.K. (California Univ., Berkeley, CA (United States). Dept. of Soil Science)
1991-10-01
This report summarizes a literature review of our present knowledge of the anion exchange properties of a number of soils and minerals, which may potentially be used as anion exchangers to retard migration of such anions as iodide (I{sup {minus}}), iodate (IO{sub 3}{sup {minus}}) and pertechnetate (TcO{sub 4}{sup {minus}}) away from disposal site. The amorphous clays allophane and imogolite, are found to be among the most important soil components capable of developing appreciable amounts of positive charge for anion exchange even at about neutral pH. Decreases in the SiO{sub 2}/Al{sub 2}O{sub 3} ratio and soil pH result in an increase in soil AEC. Allophane and imogolite rich soils have an AEC ranging from 1 to 18 meq/100g at pH about 6. Highly weathered soils dominated by Fe and Al oxides and kaolinite may develop a significant amount of AEC as soil pH falls. The retention of iodine (I) and technetium ({Tc}), by soils is associated with both soil organic matter, and Fe and Al oxides, whereas sorption on layer silicate minerals in negligible. Fe and Al oxides become more important in the retention of anionic I{sup {minus}}, IO{sub 3}{sup {minus}}, and TcO{sub 4}{sup {minus}} as pH falls, since more positive charge is developed on the oxide surfaces. Although few studies, if any, have been conducted on I and {Tc} sorption by soil allophane and imogolite, it is estimated that a surface plough soil (2 million pounds soil per acre) with 5 meq/100g AEC, as is commonly found in andisols, shall retain approximately 5900 kg I and 4500 kg {Tc}. It is conceivable that an anion exchanger such as an andisol could be used to modify the near field environment of a radioactive waste disposal facility. This whole disposal system would then offer similar migration resistance to anions as is normally afforded to cations by usual and normal soils. 93 refs., 10 figs., 7 tabs.
Czech Academy of Sciences Publication Activity Database
Součková, Monika; Klomfar, Jaroslav; Pátek, Jaroslav
2015-01-01
Roč. 406, November (2015), s. 181-193 ISSN 0378-3812 R&D Projects: GA ČR GA13-00145S Institutional support: RVO:61388998 Keywords : ionic liquid * surface tension-temperature relation * density -temperature relation * cyano-funcionalized anion Subject RIV: BJ - Thermodynamics Impact factor: 1.846, year: 2015
Creating molecular macrocycles for anion recognition
Directory of Open Access Journals (Sweden)
Amar H. Flood
2016-03-01
Full Text Available The creation and functionality of new classes of macrocycles that are shape persistent and can bind anions is described. The genesis of triazolophane macrocycles emerges out of activity surrounding 1,2,3-triazoles made using click chemistry; and the same triazoles are responsible for anion capture. Mistakes made and lessons learnt in anion recognition provide deeper understanding that, together with theory, now provides for computer-aided receptor design. The lessons are acted upon in the creation of two new macrocycles. First, cyanostars are larger and like to capture large anions. Second is tricarb, which also favors large anions but shows a propensity to self-assemble in an orderly and stable manner, laying a foundation for future designs of hierarchical nanostructures.
International Nuclear Information System (INIS)
Su Tingzhi; Guan Xiaohong; Tang Yulin; Gu Guowei; Wang Jianmin
2010-01-01
Toxic anionic elements such as arsenic, selenium, and vanadium often co-exist in groundwater. These elements may impact each other when adsorption methods are used to remove them. In this study, we investigated the competitive adsorption behavior of As(V), Se(IV), and V(V) onto activated alumina under different pH and surface loading conditions. Results indicated that these anionic elements interfered with each other during adsorption. A speciation-based model was developed to quantify the competitive adsorption behavior of these elements. This model could predict the adsorption data well over the pH range of 1.5-12 for various surface loading conditions, using the same set of adsorption constants obtained from single-sorbate systems. This model has great implications in accurately predicting the field capacity of activated alumina under various local water quality conditions when multiple competitive anionic elements are present.
The anionic biosurfactant rhamnolipid does not denature industrial enzymes
Directory of Open Access Journals (Sweden)
Jens Kvist Madsen
2015-04-01
Full Text Available Biosurfactants (BS are surface-active molecules produced by microorganisms. Their combination of useful properties and sustainable production make them promising industrial alternatives to petrochemical and oleochemical surfactants. Here we compare the impact of the anionic BS rhamnolipid (RL and the conventional/synthetic anionic surfactant sodium dodecyl sulfate (SDS on the structure and stability of three different commercially used enzymes, namely the cellulase Carezyme® (CZ, the phospholipase Lecitase Ultra® (LT and the α-amylase Stainzyme® (SZ. Our data reveal a fundamental difference in their mode of interaction. SDS shows great diversity of interaction towards the different enzymes. It efficiently unfolds both LT and CZ, but LT is unfolded by SDS through formation of SDS clusters on the protein well below the cmc, while CZ is only unfolded by bulk micelles and on average binds significantly less SDS than LT. SDS binds with even lower stoichiometry to SZ and leads to an increase in thermal stability. In contrast, RL does not affect the tertiary or secondary structure of any enzyme at room temperature, has little impact on thermal stability and only binds detectably (but at low stoichiometries to SZ. Furthermore all enzymes maintain activity at both monomeric and micellar concentrations of RL. We conclude that RL, despite its anionic charge, is a surfactant that does not compromise the structural integrity of industrially relevant proteins. This makes RL a promising alternative to current synthetic anionic surfactants in a wide range of commercial applications.
Khan, Md Abdul Shafeeuulla; Ganguly, Bishwajit
2012-05-01
Oximate anions are used as potential reactivating agents for OP-inhibited AChE because of they possess enhanced nucleophilic reactivity due to the α-effect. We have demonstrated the process of reactivating the VX-AChE adduct with formoximate and hydroxylamine anions by applying the DFT approach at the B3LYP/6-311 G(d,p) level of theory. The calculated results suggest that the hydroxylamine anion is more efficient than the formoximate anion at reactivating VX-inhibited AChE. The reaction of formoximate anion and the VX-AChE adduct is a three-step process, while the reaction of hydroxylamine anion with the VX-AChE adduct seems to be a two-step process. The rate-determining step in the process is the initial attack on the VX of the VX-AChE adduct by the nucleophile. The subsequent steps are exergonic in nature. The potential energy surface (PES) for the reaction of the VX-AChE adduct with hydroxylamine anion reveals that the reactivation process is facilitated by the lower free energy of activation (by a factor of 1.7 kcal mol(-1)) than that of the formoximate anion at the B3LYP/6-311 G(d,p) level of theory. The higher free energy of activation for the reverse reactivation reaction between hydroxylamine anion and the VX-serine adduct further suggests that the hydroxylamine anion is a very good antidote agent for the reactivation process. The activation barriers calculated in solvent using the polarizable continuum model (PCM) for the reactivation of the VX-AChE adduct with hydroxylamine anion were also found to be low. The calculated results suggest that V-series compounds can be more toxic than G-series compounds, which is in accord with earlier experimental observations.
International Nuclear Information System (INIS)
Khadsai, Sudarat; Rutnakornpituk, Boonjira; Vilaivan, Tirayut; Nakkuntod, Maliwan; Rutnakornpituk, Metha
2016-01-01
Magnetite nanoparticles (MNPs) were surface modified with anionic poly(N-acryloyl glycine) (PNAG) and streptavidin for specific interaction with biotin-conjugated pyrrolidinyl peptide nucleic acid (PNA). Hydrodynamic size (D h ) of PNAG-grafted MNPs varied from 334 to 496 nm depending on the loading ratio of the MNP to NAG in the reaction. UV–visible and fluorescence spectrophotometries were used to confirm the successful immobilization of streptavidin and PNA on the MNPs. About 291 pmol of the PNA/mg MNP was immobilized on the particle surface. The PNA-functionalized MNPs were effectively used as solid supports to differentiate between fully complementary and non-complementary/single-base mismatch DNA using the PNA probe. These novel anionic MNPs can be efficiently applicable for use as a magnetically guidable support for DNA base discrimination.Graphical Abstract
Anion concurrence and anion selectivity in the sorption of radionuclides by organotones
International Nuclear Information System (INIS)
Behnsen, Julia G.
2007-01-01
Some long-lived and radiologically important nuclear fission products, such as I-129 (half-life t 1/2 = 1,6 . 10 7 a), Tc-99 (t 1/2 = 2,1 . 10 5 a), and Se-79 (t 1/2 = 6,5 . 10 4 a) are anionic in aqueous environments. This study focuses on the adsorption of such anions to organoclays and the understanding of the selectivity of the process. The organoclays used in this study were prepared from a bentonite (MX-80) and a vermiculite clay, and the cationic surfactants hexadcylpyridium, hexadecyltrimethylammonium, and benzethonium. Surfactant adsorption to the bentonite exceeds the cation exchange capacity of the clay, with the surplus positive charge being balanced by the co-adsorption of chloride. The interlayer distance of the bentonites is increased sufficiently to contain bi- and pseudotrimolecular structures of the surfactants. Adsorption experiments were carried out using the batch technique. Anion adsorption of iodide, perrhenate, selenite, nitrate, and sulphate is mainly due to ion exchange with chloride. As an additional adsorption mechanism, the incorporation of inorganic ion pairs into the interlayer space of the clay is proposed as a result of experiments showing differences in the adsorption levels of sodium and potassium iodide. Anion adsorption results show a clear selectivity of the organoclays, with the affinity sequence being: ReO - 4 > I - > NO - 3 > Cl - > SO 2- 4 > SeO 2- 3 . This sequence corresponds to the sequence of increasing hydration energies of the anions, thus selectivity could be due to the process of minimization of free energy of the system. (orig.)
A two-year monitoring study on anionic detergent, phosphate and ...
African Journals Online (AJOL)
Anionic detergent, phosphate and chlorophyll-a concentrations were evaluated in Istanbul Strait between January 2013 and December 2014. Water samples were taken monthly at one station in the strait. The average concentrations of phosphate were 1.38 mg L-1 for surface water and 1.76 mg L -1 for bottom water in 2013 ...
Lowest auto-detachment state of the water anion
International Nuclear Information System (INIS)
Houfek, K.; Cizek, M.
2016-01-01
Because of the abundance of water in living tissue the reactive low-energy electron collisions with the water molecule represent an important step in the radiation damage of cells. In this paper, the potential energy surface of the ground state of the water anion H_2O"- is carefully mapped using multireference configuration interaction (MRCI) calculations for a large range of molecular geometries. Particular attention is paid to a consistent description of both the O"-+H_2 and OH"-+H asymptotes and to a relative position of the anion energy to the ground state energy of the neutral molecule. The auto-detachment region, where the anion state crosses to the electronic continuum is identified. The local minimum in the direction of the O"- + H_2 channel previously reported by Werner et al. [J. Chem. Phys. 87, 2913 (1987)] is found to be slightly off the linear geometry and is separated by a saddle from the auto-detachment region. The auto-detachment region is directly accessible from the OH"-+H asymptote. For the molecular geometries in the auto-detachment region and in its vicinity we also performed fixed-nuclei electron-molecule scattering calculations using the R-matrix method. Tuning of consistency of a description of the correlation energy in both the multireference CI and R-matrix calculations is discussed. Two models of the correlation energy within the R-matrix method that are consistent with the quantum chemistry calculations are found. Both models yield scattering quantities in a close agreement. The results of this work will allow a consistent formulation of the nonlocal resonance model of the water anion in a future publication
International Nuclear Information System (INIS)
Lur'e, M.A.; Kurest, I.Z.; Krasnopol'skaya, S.M.; Reznikov, S.A.; Babikov, A.F.; Shmidt, F.K.
1994-01-01
The amounts of basic OH-groups were determined by means of exchange by F-ions and the adsorption of Mo from acid and alkali ammonium paramolybdate (APM) solutions was investigated on the surface of hydrated titanium dioxide, γ-Al 2 O 3 and palygorskite-montmorillonite clay. The process is adequately described by the exchange equation at pH value of APM solution in excess of the isoelectric point (IEP) of the surface. At opposite correlation between pH of the solution and IEP the Langmuir model is adaptable. They concluded, on experimental data, that in the latter case OH-groups replaced by molybdate-anion stage of synthesis of catalyst. 22 refs., 3 figs
Simultaneous anion and cation mobility in polypyrrole
DEFF Research Database (Denmark)
Skaarup, Steen; Bay, Lasse; Vidanapathirana, K.
2003-01-01
and the expulsion of anions; a broad anodic peak centered at ca. - 0.5 V representing the expulsion of cations; and a second broad peak at +0.2 to +0.5 V corresponding to anions being inserted. Although the motion of cations is the most important, as expected, there is a significant anion contribution, thereby...... complicating reproducibility when employing PPy(DBS) polymers as actuators. When the cation is doubly charged, it enters the film less readily, and anions dominate the mobility. Using a large and bulky cation switches the mechanism to apparently total anion motion. The changes in area of the three peaks...
Graphene-coated polymeric anion exchangers for ion chromatography
Energy Technology Data Exchange (ETDEWEB)
Zhang, Kai; Cao, Minyi; Lou, Chaoyan [Department of Chemistry, Xixi Campus, Zhejiang University, Hangzhou 310028 (China); Wu, Shuchao, E-mail: wushch2002@163.com [Zhejiang Institute of Geology and Mineral Resources, Hangzhou 310007 (China); Zhang, Peimin [Department of Chemistry, Xixi Campus, Zhejiang University, Hangzhou 310028 (China); Zhi, Mingyu [Hangzhou Vocational & Technical College, Hangzhou, 310018 (China); Zhu, Yan, E-mail: zhuyan@zju.edu.cn [Department of Chemistry, Xixi Campus, Zhejiang University, Hangzhou 310028 (China)
2017-06-01
Carbonaceous stationary phases have gained much attention for their peculiar selectivity and robustness. Herein we report the fabrication and application of a graphene-coated polymeric stationary phase for anion exchange chromatography. The graphene-coated particles were fabricated by a facile evaporation-reduction method. These hydrophilic particles were proven appropriate substrates for grafting of hyperbranched condensation polymers (HBCPs) to make pellicular anion exchangers. The new phase was characterized by zeta potentials, Fourier transform infrared spectroscopy, thermogravimetry and scanning electron microscope. Frontal displacement chromatography showed that the capacities of the anion exchangers were tuned by both graphene amount and HBCPs layer count. The chromatographic performance of graphene-coated anion exchangers was demonstrated with separation of inorganic anions, organic acids, carbohydrates and amino acids. Good reproducibility was obtained by consecutive injections, indicating high chemical stability of the coating. - Highlights: • Graphene-coated polymeric particles were fabricated by a facile method. • Hyperbranched condensation polymers (HBCPs) were grafted from graphene-coated particles to make anion exchangers. • Graphene amount and HBCPs layer count had significant effects on the anion exchange capacities. • Separation of diverse anionic analytes on the anion exchangers was demonstrated. • The prepared anion exchangers exhibited high stability.
Control of calcium carbonate crystallization by using anionic polymethylsiloxanes as templates
Energy Technology Data Exchange (ETDEWEB)
Neira-Carrillo, Andronico, E-mail: aneira@uchile.cl [Faculty of Veterinary and Animal Sciences, University of Chile, Santa Rosa 11735, PO Box 2-15, Santiago (Chile); Vasquez-Quitral, Patricio; Paz Diaz, Maria; Soledad Fernandez, Maria; Luis Arias, Jose [Faculty of Veterinary and Animal Sciences, University of Chile, Santa Rosa 11735, PO Box 2-15, Santiago (Chile); Yazdani-Pedram, Mehrdad [Faculty of Chemical and Pharmaceutical Science, University of Chile, S. Livingstone 1007, PO Box 233, Santiago (Chile)
2012-10-15
Sulfonated (SO{sub 3}H-PMS) and carboxylated (CO{sub 2}H-PMS) polymethylsiloxanes were synthesized and their effects as anionic template modifier on the CaCO{sub 3} crystal morphologies were evaluated. In vitro crystallization assays of CaCO{sub 3} were performed at room temperature by using gas diffusion method at different concentration, pH and time. SEM images of CaCO{sub 3} showed well-defined short calcite piles (ca. 5 {mu}m) and elongated calcite (ca. 20 {mu}m) when SO{sub 3}H-PMS was used. When CO{sub 2}H-PMS was used, the morphology of CaCO{sub 3} crystals was single-truncated at pH 7-9 and aggregated-modified calcite at pH 10-11. However, at pH 12 the least stable donut-shaped vaterite crystals were formed. EDS and XRD confirmed the presence of Si from anionic PMS templates on the CaCO{sub 3} surfaces and its polymorphism, respectively. Results showed that the selective morphologies of CaCO{sub 3} reflect the electrostatic interaction of anionic groups of functionalized PMS with Ca{sup 2+} adsorbed on CaCO{sub 3} crystals. Rounded and truncated-modified fluorescent CaCO{sub 3} was also produced by the inclusion of functionalized PMS into the lattice of CaCO{sub 3} matrix. We demonstrated that the anionic PMS offer a good modifier for polymer-controlled crystallization and a convenient approach for understanding the biomineralization field. - Graphical abstract: Optical photographs of rounded and truncated-modified fluorescent CaCO{sub 3} produced by the inclusion of sulfonated (SO{sub 3}H-PMS) polymethylsiloxanes into the lattice of CaCO{sub 3} matrix. Insert represents the simulation of modified and fluorescent CaCO{sub 3} crystals using Software JCrystal, (2008). Highlights: Black-Right-Pointing-Pointer We prepared two anionic polymethylsiloxanes (PMS) as templates. Black-Right-Pointing-Pointer Their modifier capacity on the CaCO{sub 3} crystal morphologies was demonstrated. Black-Right-Pointing-Pointer At pH 12, the least stable donut-shaped vaterite
Conference, Nanostruc; Yafei Zhao, Elshad Abdullayev and Yuri Lvov
2014-01-01
Halloysite clay has chemical structure similar to kaolinite but it is rolled in tubes with diameter of 50 nm and length of ca. 1000 nm. Halloysite exhibits higher adsorption capacity for both cationic and anionic dyes because it has negative SiO2 outermost and positive Al2O3 inner lumen surface. An adsorption study using cationicRhodamine 6G and anionic Chrome azurol S has shown pproximately two times better dye removal for halloysite as compared to kaolin. Halloysite filters have been effect...
Energy Technology Data Exchange (ETDEWEB)
Eriksen, T.E.; Jansson, Mats [Royal Inst. of Tech., Stockholm (Sweden). Dept. of Nuclear Chemistry
1996-11-01
The diffusion of I, Cs and Sr ions in bentonite compacted to a dry density of 1.8 gr/cm{sup 3} and saturated with two groundwaters of different ionic strength have been studied experimentally using the through diffusion technique. The I{sup -} diffusivity and diffusion porosity were found to be concentration independent in the concentration range exp(-8) to exp(-2) mol/dm{sup 3}. The diffusion porosity, being only a fraction of the water porosity for normal groundwaters, is strongly ionic strength dependent due to anion exclusion. The dependence of the diffusion of Cs{sup +} and Sr{sup 2+} on the sorption intensity is accommodated by a model encompassing diffusion of the sorbed cations within the electrical double layer next to the mineral surface in addition to diffusion in the pore water. 18 refs, 12 figs.
Energy Technology Data Exchange (ETDEWEB)
Khadsai, Sudarat; Rutnakornpituk, Boonjira [Naresuan University, Department of Chemistry and Center of Excellence in Biomaterials, Faculty of Science (Thailand); Vilaivan, Tirayut [Chulalongkorn University, Department of Chemistry, Organic Synthesis Research Unit, Faculty of Science (Thailand); Nakkuntod, Maliwan [Naresuan University, Department of Biology, Faculty of Science (Thailand); Rutnakornpituk, Metha, E-mail: methar@nu.ac.th [Naresuan University, Department of Chemistry and Center of Excellence in Biomaterials, Faculty of Science (Thailand)
2016-09-15
Magnetite nanoparticles (MNPs) were surface modified with anionic poly(N-acryloyl glycine) (PNAG) and streptavidin for specific interaction with biotin-conjugated pyrrolidinyl peptide nucleic acid (PNA). Hydrodynamic size (D{sub h}) of PNAG-grafted MNPs varied from 334 to 496 nm depending on the loading ratio of the MNP to NAG in the reaction. UV–visible and fluorescence spectrophotometries were used to confirm the successful immobilization of streptavidin and PNA on the MNPs. About 291 pmol of the PNA/mg MNP was immobilized on the particle surface. The PNA-functionalized MNPs were effectively used as solid supports to differentiate between fully complementary and non-complementary/single-base mismatch DNA using the PNA probe. These novel anionic MNPs can be efficiently applicable for use as a magnetically guidable support for DNA base discrimination.Graphical Abstract.
International Nuclear Information System (INIS)
Wang, Lai-Sheng
2015-01-01
Electrospray ionization (ESI) has become an essential tool in chemical physics and physical chemistry for the production of novel molecular ions from solution samples for a variety of spectroscopic experiments. ESI was used to produce free multiply-charged anions (MCAs) for photoelectron spectroscopy (PES) in the late 1990 s, allowing many interesting properties of this class of exotic species to be investigated. Free MCAs are characterized by strong intramolecular Coulomb repulsions, which create a repulsive Coulomb barrier (RCB) for electron emission. The RCB endows many fascinating properties to MCAs, giving rise to meta-stable anions with negative electron binding energies. Recent development in the PES of MCAs includes photoelectron imaging to examine the influence of the RCB on the electron emission dynamics, pump-probe experiments to examine electron tunneling through the RCB, and isomer-specific experiments by coupling PES with ion mobility for biological MCAs. The development of a cryogenically cooled Paul trap has led to much better resolved PE spectra for MCAs by creating vibrationally cold anions from the room temperature ESI source. Recent advances in coupling the cryogenic Paul trap with PE imaging have allowed high-resolution PE spectra to be obtained for singly charged anions produced by ESI. In particular, the observation of dipole-bound excited states has made it possible to conduct vibrational autodetachment spectroscopy and resonant PES, which yield much richer vibrational spectroscopic information for dipolar free radicals than traditional PES
Process for removing sulfate anions from waste water
Nilsen, David N.; Galvan, Gloria J.; Hundley, Gary L.; Wright, John B.
1997-01-01
A liquid emulsion membrane process for removing sulfate anions from waste water is disclosed. The liquid emulsion membrane process includes the steps of: (a) providing a liquid emulsion formed from an aqueous strip solution and an organic phase that contains an extractant capable of removing sulfate anions from waste water; (b) dispersing the liquid emulsion in globule form into a quantity of waste water containing sulfate anions to allow the organic phase in each globule of the emulsion to extract and absorb sulfate anions from the waste water and (c) separating the emulsion including its organic phase and absorbed sulfate anions from the waste water to provide waste water containing substantially no sulfate anions.
Becker, John V W; van der Merwe, Marina M; van Brummelen, Anna C; Pillay, Pamisha; Crampton, Bridget G; Mmutlane, Edwin M; Parkinson, Chris; van Heerden, Fanie R; Crouch, Neil R; Smith, Peter J; Mancama, Dalu T; Maharaj, Vinesh J
2011-10-11
Anti-malarial drug resistance threatens to undermine efforts to eliminate this deadly disease. The resulting omnipresent requirement for drugs with novel modes of action prompted a national consortium initiative to discover new anti-plasmodial agents from South African medicinal plants. One of the plants selected for investigation was Dicoma anomala subsp. gerrardii, based on its ethnomedicinal profile. Standard phytochemical analysis techniques, including solvent-solvent extraction, thin-layer- and column chromatography, were used to isolate the main active constituent of Dicoma anomala subsp. gerrardii. The crystallized pure compound was identified using nuclear magnetic resonance spectroscopy, mass spectrometry and X-ray crystallography. The compound was tested in vitro on Plasmodium falciparum cultures using the parasite lactate dehydrogenase (pLDH) assay and was found to have anti-malarial activity. To determine the functional groups responsible for the activity, a small collection of synthetic analogues was generated - the aim being to vary features proposed as likely to be related to the anti-malarial activity and to quantify the effect of the modifications in vitro using the pLDH assay. The effects of the pure compound on the P. falciparum transcriptome were subsequently investigated by treating ring-stage parasites (alongside untreated controls), followed by oligonucleotide microarray- and data analysis. The main active constituent was identified as dehydrobrachylaenolide, a eudesmanolide-type sesquiterpene lactone. The compound demonstrated an in vitro IC50 of 1.865 μM against a chloroquine-sensitive strain (D10) of P. falciparum. Synthetic analogues of the compound confirmed an absolute requirement that the α-methylene lactone be present in the eudesmanolide before significant anti-malarial activity was observed. This feature is absent in the artemisinins and suggests a different mode of action. Microarray data analysis identified 572 unique genes that
Perchlorate adsorption and desorption on activated carbon and anion exchange resin.
Yoon, In-Ho; Meng, Xiaoguang; Wang, Chao; Kim, Kyoung-Woong; Bang, Sunbaek; Choe, Eunyoung; Lippincott, Lee
2009-05-15
The mechanisms of perchlorate adsorption on activated carbon (AC) and anion exchange resin (SR-7 resin) were investigated using Raman, FTIR, and zeta potential analyses. Batch adsorption and desorption results demonstrated that the adsorption of perchlorate by AC and SR-7 resin was reversible. The reversibility of perchlorate adsorption by the resin was also proved by column regeneration test. Solution pH significantly affected perchlorate adsorption and the zeta potential of AC, while it did not influence perchlorate adsorption and the zeta potential of resin. Zeta potential measurements showed that perchlorate was adsorbed on the negatively charged AC surface. Raman spectra indicated the adsorption resulted in an obvious position shift of the perchlorate peak, suggesting that perchlorate was associated with functional groups on AC at neutral pH through interactions stronger than electrostatic interaction. The adsorbed perchlorate on the resin exhibited a Raman peak at similar position as the aqueous perchlorate, indicating that perchlorate was adsorbed on the resin through electrostatic attraction between the anion and positively charged surface sites.
Infrared spectroscopy of anionic hydrated fluorobenzenes
International Nuclear Information System (INIS)
Schneider, Holger; Vogelhuber, Kristen M.; Weber, J. Mathias
2007-01-01
We investigate the structural motifs of anionic hydrated fluorobenzenes by infrared photodissociation spectroscopy and density functional theory. Our calculations show that all fluorobenzene anions under investigation are strongly distorted from the neutral planar molecular geometries. In the anions, different F atoms are no longer equivalent, providing structurally different binding sites for water molecules and giving rise to a multitude of low-lying isomers. The absorption bands for hexa- and pentafluorobenzene show that only one isomer for the respective monohydrate complexes is populated in our experiment. For C 6 F 6 - ·H 2 O, we can assign these bands to an isomer where water forms a weak double ionic hydrogen bond with two F atoms in the ion, in accord with the results of Bowen et al. [J. Chem. Phys. 127, 014312 (2007), following paper.] The spectroscopic motif of the binary complexes changes slightly with decreasing fluorination of the aromatic anion. For dihydrated hexafluorobenzene anions, several isomers are populated in our experiments, some of which may be due to hydrogen bonding between water molecules
Anion channels: master switches of stress responses.
Roelfsema, M Rob G; Hedrich, Rainer; Geiger, Dietmar
2012-04-01
During stress, plant cells activate anion channels and trigger the release of anions across the plasma membrane. Recently, two new gene families have been identified that encode major groups of anion channels. The SLAC/SLAH channels are characterized by slow voltage-dependent activation (S-type), whereas ALMT genes encode rapid-activating channels (R-type). Both S- and R-type channels are stimulated in guard cells by the stress hormone ABA, which leads to stomatal closure. Besides their role in ABA-dependent stomatal movement, anion channels are also activated by biotic stress factors such as microbe-associated molecular patterns (MAMPs). Given that anion channels occur throughout the plant kingdom, they are likely to serve a general function as master switches of stress responses. Copyright © 2012 Elsevier Ltd. All rights reserved.
Suryanti, Venty; Bhadbhade, Mohan; Black, David StC; Kumar, Naresh
2017-10-01
N-Nitrophenylglyoxylic amides 1 and 2 in presence of tetrabutylammonium cation (TBA) act as receptors for anions HSO4-, Cl-, Br- and NO3- as investigated by NMR studies. The receptors formed 1:1 host-guest complexes in solution. X-ray structure of 1 along with TBA that bind a chloride anion is reported. Molecule 1 showed the highest selectivity for HSO4- anion over others measured. X-ray structure of the bound Cl- revealed a pocket containing the anion making strong (Nsbnd H⋯Cl) and weak hydrogen bonds (Csbnd H⋯Cl) that contribute to the recognition of the chloride anion. Nsbnd H and Csbnd H hydrogen bonds resulted in a relatively strong binding for chloride ions.
Supramolecular Chemistry of Selective Anion Recognition for Anions of Environmental Relevance
International Nuclear Information System (INIS)
Moyer, Bruce a.; Bostick, Debra A.; Fowler, Christopher J.; Kang, Hyun-Ah; Ruas, Alexandre; Delmau, Laetitia H.; Haverlock, Tamara J.; Llinares, Jose M.; Hossain, Alamgir; Kang, S. O.; Bowman-James, Kristin; Shriver, James A.; Marquez, Manuel; Sessler, Jonathan L.
2005-01-01
The major thrust of this project led by the University of Kansas (Prof. Kristin Bowman-Jones) entails the exploration of the principles of recognition and separation of sulfate by the design, synthesis, and testing of novel sulfate extractants. A key science need for the cleanup of tank wastes at Hanford has been identified in developing methods to separate those bulk waste components that have low solubilities in borosilicate glass. Sulfate has been identified as a particularly difficult and expensive problem in that its concentration in the waste is relatively high, its solubility in glass is especially low, and it interferes with the performance of both vitrification equipment and the glass waste form. The new extractants will be synthesized by the University of Kansas and the University of Texas, Austin. Oak Ridge National Laboratory (ORNL) is subjecting the new extractants to experiments that will determine their properties and effectiveness in separating sulfate from the major competing anions in the waste, especially nitrate. Such experiments will entail primarily liquid-liquid extraction. Current efforts focus on exciting new systems in which the anion receptors act as synergists for anion exchange
Influence of organic surface coatings on the sorption of anticonvulsants on mineral surfaces.
Qu, Shen; Cwiertny, David M
2013-10-01
Here, we explore the role that sorption to mineral surfaces plays in the fate of two commonly encountered effluent-derived pharmaceuticals, the anticonvulsants phenytoin and carbamazepine. Adsorption isotherms and pH-edge experiments are consistent with electrostatics governing anticonvulsant uptake on metal oxides typically found in soil and aquifer material (e.g., Si, Al, Fe, Mn, and Ti). Appreciable, albeit limited, adsorption was observed only for phenytoin, which is anionic above pH 8.3, on the iron oxides hematite and ferrihydrite. Adsorption increased substantially in the presence of cationic and anionic surfactants, species also commonly encountered in wastewater effluent. For carbamazepine, we propose the enhanced uptake results entirely from hydrophobic interactions with apolar tails of surfactant surface coatings. For phenytoin, adsorption also arises from the ability of surfactants to alter the net charge of the mineral surface and thereby further enhance favorable electrostatic interactions with its anionic form. Collectively, our results demonstrate that although pristine mineral surfaces are likely not major sinks for phenytoin and carbamazepine in the environment, their alteration with organic matter, particularly surfactants, can considerably increase their ability to retain these emerging pollutants in subsurface systems.
Gas-Grain Models for Interstellar Anion Chemistry
Cordiner, M. A.; Charnely, S. B.
2012-01-01
Long-chain hydrocarbon anions C(sub n) H(-) (n = 4, 6, 8) have recently been found to be abundant in a variety of interstellar clouds. In order to explain their large abundances in the denser (prestellar/protostellar) environments, new chemical models are constructed that include gas-grain interactions. Models including accretion of gas-phase species onto dust grains and cosmic-ray-induced desorption of atoms are able to reproduce the observed anion-to-neutral ratios, as well as the absolute abundances of anionic and neutral carbon chains, with a reasonable degree of accuracy. Due to their destructive effects, the depletion of oxygen atoms onto dust results in substantially greater polyyne and anion abundances in high-density gas (with n(sub H2) approx > / cubic cm). The large abundances of carbon-chain-bearing species observed in the envelopes of protostars such as L1527 can thus be explained without the need for warm carbon-chain chemistry. The C6H(-) anion-to-neutral ratio is found to be most sensitive to the atomic O and H abundances and the electron density. Therefore, as a core evolves, falling atomic abundances and rising electron densities are found to result in increasing anion-to-neutral ratios. Inclusion of cosmic-ray desorption of atoms in high-density models delays freeze-out, which results in a more temporally stable anion-to-neutral ratio, in better agreement with observations. Our models include reactions between oxygen atoms and carbon-chain anions to produce carbon-chain-oxide species C6O, C7O, HC6O, and HC7O, the abundances of which depend on the assumed branching ratios for associative electron detachment
Ab initio theoretical study of dipole-bound anions of molecular complexes: (HF)3- and (HF)4- anions
Ramaekers, Riet; Smith, Dayle M. A.; Smets, Johan; Adamowicz, Ludwik
1997-12-01
Ab initio calculations have been performed to determine structures and vertical electron detachment energy (VDE) of the hydrogen fluoride trimer and tetramer anions, (HF)3- and (HF)4-. In these systems the excess electron is bound by the dipole field of the complex. It was determined that, unlike the neutral complexes which prefer the cyclic structures, the equilibrium geometries of the anions have "zig-zag" shapes. For both complexes the predicted VDEs are positive [210 meV and 363 meV for (HF)3- and (HF)4-, respectively], indicating that the anions are stable systems with respect to the vertical electron detachment. These results were obtained at the coupled-cluster level of theory with single, double and triple excitations [CCSD(T) method; the triple-excitation contribution in this method is calculated approximately using the perturbation approach] with the anion geometries obtained using the second-order Møller-Plesset perturbation theory (MP2) method. The same approach was also used to determine the adiabatic electron affinities (AEA) of (HF)3 and (HF)4. In addition to the electronic contribution, we also calculated the contributions (using the harmonic approximation) resulting from different zero-point vibration energies of the neutral and anionic clusters. The calculations predicted that while the AEA of (HF)3 is positive (44 meV), the AEA for (HF)4 is marginally negative (-16 meV). This suggests that the (HF)3- anion should be a stable system, while the (HF)4- is probably metastable.
Energy Technology Data Exchange (ETDEWEB)
Tarahovsky, Yury S.; Koynova, Rumiana; MacDonald, Robert C. (Northwestern)
2010-01-18
DNA release from lipoplexes is an essential step during lipofection and is probably a result of charge neutralization by cellular anionic lipids. As a model system to test this possibility, fluorescence resonance energy transfer between DNA and lipid covalently labeled with Cy3 and BODIPY, respectively, was used to monitor the release of DNA from lipid surfaces induced by anionic liposomes. The separation of DNA from lipid measured this way was considerably slower and less complete than that estimated with noncovalently labeled DNA, and depends on the lipid composition of both lipoplexes and anionic liposomes. This result was confirmed by centrifugal separation of released DNA and lipid. X-ray diffraction revealed a clear correlation of the DNA release capacity of the anionic lipids with the interfacial curvature of the mesomorphic structures developed when the anionic and cationic liposomes were mixed. DNA release also correlated with the rate of fusion of anionic liposomes with lipoplexes. It is concluded that the tendency to fuse and the phase preference of the mixed lipid membranes are key factors for the rate and extent of DNA release. The approach presented emphasizes the importance of the lipid composition of both lipoplexes and target membranes and suggests optimal transfection may be obtained by tailoring lipoplex composition to the lipid composition of target cells.
Metal-Oxide Film Conversions Involving Large Anions
Energy Technology Data Exchange (ETDEWEB)
Pretty, S.; Zhang, X.; Shoesmith, D.W.; Wren, J.C. [The University of Western Ontario, Chemistry Department, 1151 Richmond St., N6A 5B7, London, Ontario (Canada)
2008-07-01
The main objective of my research is to establish the mechanism and kinetics of metal-oxide film conversions involving large anions (I{sup -}, Br{sup -}, S{sup 2-}). Within a given group, the anions will provide insight on the effect of anion size on the film conversion, while comparison of Group 6 and Group 7 anions will provide insight on the effect of anion charge. This research has a range of industrial applications, for example, hazardous radioiodine can be immobilized by reaction with Ag to yield AgI. From the perspective of public safety, radioiodine is one of the most important fission products from the uranium fuel because of its large fuel inventory, high volatility, and radiological hazard. Additionally, because of its mobility, the gaseous iodine concentration is a critical parameter for safety assessment and post-accident management. A full kinetic analysis using electrochemical techniques has been performed on the conversion of Ag{sub 2}O to (1) AgI and (2) AgBr. (authors)
Metal-Oxide Film Conversions Involving Large Anions
International Nuclear Information System (INIS)
Pretty, S.; Zhang, X.; Shoesmith, D.W.; Wren, J.C.
2008-01-01
The main objective of my research is to establish the mechanism and kinetics of metal-oxide film conversions involving large anions (I - , Br - , S 2- ). Within a given group, the anions will provide insight on the effect of anion size on the film conversion, while comparison of Group 6 and Group 7 anions will provide insight on the effect of anion charge. This research has a range of industrial applications, for example, hazardous radioiodine can be immobilized by reaction with Ag to yield AgI. From the perspective of public safety, radioiodine is one of the most important fission products from the uranium fuel because of its large fuel inventory, high volatility, and radiological hazard. Additionally, because of its mobility, the gaseous iodine concentration is a critical parameter for safety assessment and post-accident management. A full kinetic analysis using electrochemical techniques has been performed on the conversion of Ag 2 O to (1) AgI and (2) AgBr. (authors)
International Nuclear Information System (INIS)
Badaut, V.; Schlegel, M.; Zeller, Ph.; Moutiers, G.
2010-01-01
79 Selenium may be one of the few radioelements possibly migrating out of nuclear geological repositories. Selenium may yet be retain this Se, but the possible interactions between Se and siderite are yet poorly known. In this work, the interactions between selenium oxi-anions - selenate and selenite - and siderite were investigated. Solution experiments have showed that dissolved selenite (≤ 10 -3 M) is quantitatively immobilized by siderite (75 g/L) after 48 h of reaction time, when selenate is only partly immobilized after 10 days. In the selenite case, XAS showed that immobilized selenium is initially present as Se(IV) probably sorbed on siderite surface. After 10 days of reaction, selenite ions are quantitatively reduced and form poorly crystalline elementary selenium. On the other hand, selenate retained b y siderite does not appear to be significantly reduced over the probed timescale (10 days). To better understand the mechanism of selenite reduction by siderite, the properties of bulk and perfect surfaces of siderite were modelled using DFT. The properties of the valence electrons could be correctly described only if the symmetry of the fundamental state electronic density is lower than the experimental crystallographic symmetry. We we modelled the retention of simple molecules as O 2 or H 2 O on siderite and magnesite (10-14) perfect surfaces. Our results are in good agreement with the literature. Finally, the modelling of selenite surface complexes on magnesite is performed with and without hydration. (authors)
Specificity of anion-binding in the substrate-pocket ofbacteriorhodopsin
Energy Technology Data Exchange (ETDEWEB)
Facciotti, Marc T.; Cheung, Vincent S.; Lunde, Christopher S.; Rouhani, Shahab; Baliga, Nitin S.; Glaeser, Robert M.
2003-08-30
The structure of the D85S mutant of bacteriorhodopsin with a nitrate anion bound in the Schiff-base binding site, and the structure of the anion-free protein have been obtained in the same crystal form. Together with the previously solved structures of this anion pump, in both the anion-free state and bromide-bound state, these new structures provide insight into how this mutant of bacteriorhodopsin is able to bind a variety of different anions in the same binding pocket. The structural analysis reveals that the main structural change that accommodates different anions is the repositioning of the polar side-chain of S85. On the basis of these x-ray crystal structures, the prediction is then made that the D85S/D212N double mutant might bind similar anions and do so over a broader pH range than does the single mutant. Experimental comparison of the dissociation constants, K{sub d}, for a variety of anions confirms this prediction and demonstrates, in addition, that the binding affinity is dramatically improved by the D212N substitution.
Verification of the sputter-generated 32SFn- (n = 1-6) anions by accelerator mass spectrometry
Mane, R. G.; Surendran, P.; Kumar, Sanjay; Nair, J. P.; Yadav, M. L.; Hemalatha, M.; Thomas, R. G.; Mahata, K.; Kailas, S.; Gupta, A. K.
2016-01-01
Recently, we have performed systematic Secondary Ion Mass Spectrometry (SIMS) measurements at our ion source test set up and have demonstrated that gas phase 32SFn- (n = 1-6) anions for all size 'n' can be readily generated from a variety of surfaces undergoing Cs+ ion sputtering in the presence of high purity SF6 gas by employing the gas spray-cesium sputter technique. In our SIMS measurements, the isotopic yield ratio 34SFn-/32SFn- (n = 1-6) was found to be close to its natural abundance but not for all size 'n'. In order to gain further insight into the constituents of these molecular anions, ultra sensitive Accelerator Mass Spectrometry (AMS) measurements were conducted with the most abundant 32SFn- (n = 1-6) anions, at BARC-TIFR 14 UD Pelletron accelerator. The results from these measurements are discussed in this paper.
Qiu, J; Song, B; Li, X; Cozzolino, A F
2017-12-20
The solution and gas phase halide binding to a bis-antimony(iii) anion receptor was studied. This new class of anion receptors utilizes the strong Sb-centered secondary bonding interactions (SBIs) that are formed opposite to the polar Sb-O primary bond. 1 H NMR titration data were fitted statistically to binding models and solution-phase binding energetics were extracted, while the formation of anion-to-receptor complexes was observed using ESI-MS. Density functional theory calculations suggest that their affinity towards binding halide anions is mitigated by the strong explicit solvation effect in DMSO, which gives insights into future designs that circumvent direct solvent binding and are anticipated to yield tighter and perhaps more selectivity in anion binding.
Zero-point energy effects in anion solvation shells.
Habershon, Scott
2014-05-21
By comparing classical and quantum-mechanical (path-integral-based) molecular simulations of solvated halide anions X(-) [X = F, Cl, Br and I], we identify an ion-specific quantum contribution to anion-water hydrogen-bond dynamics; this effect has not been identified in previous simulation studies. For anions such as fluoride, which strongly bind water molecules in the first solvation shell, quantum simulations exhibit hydrogen-bond dynamics nearly 40% faster than the corresponding classical results, whereas those anions which form a weakly bound solvation shell, such as iodide, exhibit a quantum effect of around 10%. This observation can be rationalized by considering the different zero-point energy (ZPE) of the water vibrational modes in the first solvation shell; for strongly binding anions, the ZPE of bound water molecules is larger, giving rise to faster dynamics in quantum simulations. These results are consistent with experimental investigations of anion-bound water vibrational and reorientational motion.
The chemistry of molecular anions in circumstellar sources
Energy Technology Data Exchange (ETDEWEB)
Agúndez, Marcelino [LUTH, Observatoire de Paris-Meudon, 5 Place Jules Janssen, 92190 Meudon (France); Cernicharo, José [Departamento de Astrofísica, CAB, CSIC-INTA, Ctra. de Torrejón a Ajalvir km 4, 28850 Madrid (Spain); Guélin, Michel [Institut de Radioastronomie Millimétrique, 300 rue de la Piscine, 38406 Saint Martin d' Héres (France)
2015-01-22
The detection of negatively charged molecules in the interstellar and circumstellar medium in the past four years has been one of the most impacting surprises in the area of molecular astrophysics. It has motivated the interest of astronomers, physicists, and chemists on the study of the spectroscopy, chemical kinetics, and prevalence of molecular anions in the different astronomical regions. Up to six different molecular anions have been discovered in space to date, the last one being the small ion CN{sup −}, which has been observed in the envelope of the carbon star IRC +10216 and which contrary to the other larger anions is not formed by electron attachment to CN, but through reactions of large carbon anions with nitrogen atoms. Here we briefly review the current status of our knowledge of the chemistry of molecular anions in space, with particular emphasis on the circumstellar source IRC +10216, which to date is the astronomical source harboring the largest variety of anions.
Kaur, Balwinder; Erdmann, Cristiane Andreia; Daniëls, Mathias; Dehaen, Wim; Rafiński, Zbigniew; Radecka, Hanna; Radecki, Jerzy
2017-12-05
In the present work, gold electrodes were modified using a redox-active layer based on dipyrromethene complexes with Cu(II) or Co(II) and a dipodal anion receptor functionalized with dipyrromethene. These modified gold electrodes were then applied for the electrochemical detection of anions (Cl - , SO 4 2- , and Br - ) in a highly diluted water solution (in the picomolar range). The results showed that both systems, incorporating Cu(II) as well as Co(II) redox centers, exhibited highest sensitivity toward Cl - . The selectivity sequence found for both systems was Cl - > SO 4 2- > Br - . The high selectivity of Cl - anions can be attributed to the higher binding constant of Cl - with the anion receptor and the stronger electronic effect between the central metal and anion in the complex. The detection limit for the determination of Cl - was found at the 1.0 pM level for both sensing systems. The electrodes based on Co(II) redox centers displayed better selectivity toward Cl - anion detection than those based on Cu(II) centers which can be attributed to the stronger electronic interaction between the receptor-target anion complex and the Co(II)/Co(III) redox centers in comparison to the Cu(II)/Cu(I) system. Applicability of gold electrodes modified with DPM-Co(II)-DPM-AR for the electrochemical determination of Cl - anions was demonstrated using the artificial matrix mimicking human serum.
Neutral anion receptors: design and application
Antonisse, M.M.G.; Reinhoudt, David
1998-01-01
After the development of synthetic cation receptors in the late 1960s, only in the past decade has work started on the development of synthetic neutral anion receptors. Combination and preorganization of different anion binding groups, like amides, urea moieties, or Lewis acidic metal centers lead
Directory of Open Access Journals (Sweden)
Wataru Aoyagi
2016-06-01
Full Text Available An ionic polymer-metal composite (IPMC actuator composed of a thin perfluorinated ionomer membrane with electrodes plated on both surfaces undergoes a large bending motion when a low electric field is applied across its thickness. Such actuators are soft, lightweight, and able to operate in solutions and thus show promise with regard to a wide range of applications, including MEMS sensors, artificial muscles, biomimetic systems, and medical devices. However, the variations induced by changing the type of anion on the device deformation properties are not well understood; therefore, the present study investigated the effects of different anions on the ion exchange process and the deformation behavior of IPMC actuators with palladium electrodes. Ion exchange was carried out in solutions incorporating various anions and the actuator tip displacement in deionized water was subsequently measured while applying a step voltage. In the step voltage response measurements, larger anions such as nitrate or sulfate led to a more pronounced tip displacement compared to that obtained with smaller anions such as hydroxide or chloride. In AC impedance measurements, larger anions generated greater ion conductivity and a larger double-layer capacitance at the cathode. Based on these mechanical and electrochemical measurements, it is concluded that the presence of larger anions in the ion exchange solution induces a greater degree of double-layer capacitance at the cathode and results in enhanced tip deformation of the IPMC actuators.
Interstellar dehydrogenated PAH anions: vibrational spectra
Buragohain, Mridusmita; Pathak, Amit; Sarre, Peter; Gour, Nand Kishor
2018-03-01
Interstellar polycyclic aromatic hydrocarbon (PAH) molecules exist in diverse forms depending on the local physical environment. Formation of ionized PAHs (anions and cations) is favourable in the extreme conditions of the interstellar medium (ISM). Besides in their pure form, PAHs are also likely to exist in substituted forms; for example, PAHs with functional groups, dehydrogenated PAHs etc. A dehydrogenated PAH molecule might subsequently form fullerenes in the ISM as a result of ongoing chemical processes. This work presents a density functional theory (DFT) calculation on dehydrogenated PAH anions to explore the infrared emission spectra of these molecules and discuss any possible contribution towards observed IR features in the ISM. The results suggest that dehydrogenated PAH anions might be significantly contributing to the 3.3 μm region. Spectroscopic features unique to dehydrogenated PAH anions are highlighted that may be used for their possible identification in the ISM. A comparison has also been made to see the size effect on spectra of these PAHs.
New magnetic organic-inorganic composites based on hydrotalcite-like anionic clays for drug delivery
Energy Technology Data Exchange (ETDEWEB)
Carja, Gabriela [Department of Physical Chemistry, Faculty of Industrial Chemistry, Technical University of Iasi, 71 Mangeron Boulevard, 700050 Iasi (Romania); Chiriac, Horia [National Institute of Research and Development for Technical Physics, 47 Mangeron Boulevard, 700050 Iasi (Romania)]. E-mail: hchiriac@phys-iasi.ro; Lupu, Nicoleta [National Institute of Research and Development for Technical Physics, 47 Mangeron Boulevard, 700050 Iasi (Romania)
2007-04-15
The structural 'memory effect' of anionic clays was used to obtain layered double hydroxides (LDHs) with tailored magnetic properties, by loading iron oxides and/or spinel structures on iron partially substituted hydrotalcite-like materials. The obtained magnetic layered structures were further used as precursors for new hybrid nanostructures, such as aspirin-hydrotalcite-like anionic clays. Transmission electron microscopy (TEM) analysis shows that small iron oxide or spinel nanoparticles coexist with the fibrous drug particles on the surface of partially aggregated typical clay-like particles. The specific saturation magnetization of the loaded LDHs can be increased up to 70 emu/g by using specific post-synthesis treatments.
New magnetic organic-inorganic composites based on hydrotalcite-like anionic clays for drug delivery
International Nuclear Information System (INIS)
Carja, Gabriela; Chiriac, Horia; Lupu, Nicoleta
2007-01-01
The structural 'memory effect' of anionic clays was used to obtain layered double hydroxides (LDHs) with tailored magnetic properties, by loading iron oxides and/or spinel structures on iron partially substituted hydrotalcite-like materials. The obtained magnetic layered structures were further used as precursors for new hybrid nanostructures, such as aspirin-hydrotalcite-like anionic clays. Transmission electron microscopy (TEM) analysis shows that small iron oxide or spinel nanoparticles coexist with the fibrous drug particles on the surface of partially aggregated typical clay-like particles. The specific saturation magnetization of the loaded LDHs can be increased up to 70 emu/g by using specific post-synthesis treatments
Kierdaszuk, Borys
2013-03-01
We examined the emission spectra and steady-state anisotropy of tyrosinate anion fluorescence with one-photon (250-310 nm), two-photon (570-620 nm) and three-photon (750-930 nm) excitation. Similar emission spectra of the neutral (pH 7.2) and anionic (pH 13) forms of N-acetyl-L-tyrosinamide (NATyrA) (pKa 10.6) were observed for all modes of excitation, with the maxima at 302 and 352 nm, respectively. Two-photon excitation (2PE) and three-photon excitation (3PE) spectra of the anionic form were the same as that for one-photon excitation (1PE). In contrast, 2PE spectrum from the neutral form showed ~30-nm shift to shorter wavelengths relative to 1PE spectrum (λmax 275 nm) at two-photon energy (550 nm), the latter being overlapped with 3PE spectrum, both at two-photon energy (550 nm). Two-photon cross-sections for NATyrA anion at 565-580 nm were 10 % of that for N-acetyl-L-tryptophanamide (NATrpA), and increased to 90 % at 610 nm, while for the neutral form of NATyrA decreased from 2 % of that for NATrpA at 570 nm to near zero at 585 nm. Surprisingly, the fundamental anisotropy of NATyrA anion in vitrified solution at -60 °C was ~0.05 for 2PE at 610 nm as compared to near 0.3 for 1PE at 305 nm, and wavelength-dependence appears to be a basic feature of its anisotropy. In contrast, the 3PE anisotropy at 900 nm was about 0.5, and 3PE and 1PE anisotropy values appear to be related by the cos(6) θ to cos(2) θ photoselection factor (approx. 10/6) independently of excitation wavelength. Attention is drawn to the possible effect of tyrosinate anions in proteins on their multi-photon induced fluorescence emission and excitation spectra as well as excitation anisotropy spectra.
New anion-exchange polymers for improved separations
International Nuclear Information System (INIS)
Jarvinen, G.D.; Barr, M.E.; Marsh, S.F.
1997-01-01
Objective is to improve the understanding of how the structure of a new class of anion-exchange polymers controls the binding of anionic actinide complexes from solution. This is needed to develop practical separation systems that will reduce the cost of actinide processing operations within the DOE complex. In addition anion exchange is widely used in industry. Several new series of bifunctional anion- exchange polymers have been designed, synthesized, and tested for removing Pu(IV), Am(III), and U(VI) from nitric acid. The polymers contain a pyridinium site derived from the host poly(4-vinylpyridine) and a second cationic site attached through a chain of 2 to 6 methylene groups. The new polymers removed Pu four to ten times more efficiently than the best commercial materials
Gao, Yan; Zhang, Liqun; Wang, Yong; Li, Haoran
2010-03-04
Attenuated total reflection infrared spectroscopy and density functional theory calculation have been employed to study the spectral properties of imidazolium-based ionic liquids (ILs) with different anions. ILs based on 1-butyl-3-methylimidazolium cation with different anions, OH(-), CF(3)CO(2)(-), HSO(4)(-), H(2)PO(4)(-), Cl(-), PF(6)(-), and BF(4)(-), are investigated in the present work. It has been shown that the C(2)-H stretching vibration of the imidazolium ring is closely related to the electron density of H-bonding between the two closest cations and anions for pure ILs. The electron density of H-bonding between cation and anion with different anions decreases in the order [OH](-) > [H(2)PO(4)](-) > [HSO(4)](-) > [CF(3)CO(2)](-) > [Cl](-) > [BF(4)](-) > [PF(6)](-). For aqueous ILs, with increasing water content, the aromatic C-H stretching vibration of the imidazolium cation showed systematic blue-shifts. Especially for BmimOH, the nu(C(2))(-H) undergoes a drastic blue-shift by 58 cm(-1), suggesting that the formation of the strong hydrogen bonds O-H...O may greatly weaken the electron density of H-bonding between the cation and anion of ILs.
Photoelectron spectroscopy of the 6-azauracil anion.
Chen, Jing; Buonaugurio, Angela; Dolgounitcheva, Olga; Zakrzewski, V G; Bowen, Kit H; Ortiz, J V
2013-02-14
We report the photoelectron spectrum of the 6-azauracil anion. The spectrum is dominated by a broad band exhibiting a maximum at an electron binding energy (EBE) of 1.2 eV. This spectral pattern is indicative of a valence anion. Our calculations were carried out using ab initio electron propagator and other many-body methods. Comparison of the anion and corresponding neutral of 6-azauracil with those of uracil shows that substituting a nitrogen atom for C-H at the C6 position of uracil gives rise to significant changes in the electronic structure of 6-azauracil versus that of uracil. The adiabatic electron affinity (AEA) of the canonical 6-azauracil tautomer is substantially larger than that of canonical uracil. Among the five tautomeric, 6-azauracil anions studied computationally, the canonical structure was found to be the most stable. The vertical detachment energies (VDE) of the canonical, valence-bound anion of 6-azauracil and its closest "very-rare" tautomer have been calculated. Electron propagator calculations on the canonical anion yield a VDE value that is in close agreement with the experimentally determined VDE value of 1.2 eV. The AEA value of 6-azauracil, assessed at the CCSD(T) level of theory to be 0.5 eV, corresponds with the EBE value of the onset of the experimental spectrum.
Adaptive self-assembly and induced-fit transformations of anion-binding metal-organic macrocycles
Zhang, Ting; Zhou, Li-Peng; Guo, Xiao-Qing; Cai, Li-Xuan; Sun, Qing-Fu
2017-06-01
Container-molecules are attractive to chemists due to their unique structural characteristics comparable to enzymes and receptors in nature. We report here a family of artificial self-assembled macrocyclic containers that feature induced-fit transformations in response to different anionic guests. Five metal-organic macrocycles with empirical formula of MnL2n (M=Metal L=Ligand n=3, 4, 5, 6, 7) are selectively obtained starting from one simple benzimidazole-based ligand and square-planar palladium(II) ions, either by direct anion-adaptive self-assembly or induced-fit transformations. Hydrogen-bonding interactions between the inner surface of the macrocycles and the anionic guests dictate the shape and size of the product. A comprehensive induced-fit transformation map across all the MnL2n species is drawn, with a representative reconstitution process from Pd7L14 to Pd3L6 traced in detail, revealing a gradual ring-shrinking mechanism. We envisage that these macrocyclic molecules with adjustable well-defined hydrogen-bonding pockets will find wide applications in molecular sensing or catalysis.
Directory of Open Access Journals (Sweden)
van Heerden Fanie R
2011-10-01
Full Text Available Abstract Background Anti-malarial drug resistance threatens to undermine efforts to eliminate this deadly disease. The resulting omnipresent requirement for drugs with novel modes of action prompted a national consortium initiative to discover new anti-plasmodial agents from South African medicinal plants. One of the plants selected for investigation was Dicoma anomala subsp. gerrardii, based on its ethnomedicinal profile. Methods Standard phytochemical analysis techniques, including solvent-solvent extraction, thin-layer- and column chromatography, were used to isolate the main active constituent of Dicoma anomala subsp. gerrardii. The crystallized pure compound was identified using nuclear magnetic resonance spectroscopy, mass spectrometry and X-ray crystallography. The compound was tested in vitro on Plasmodium falciparum cultures using the parasite lactate dehydrogenase (pLDH assay and was found to have anti-malarial activity. To determine the functional groups responsible for the activity, a small collection of synthetic analogues was generated - the aim being to vary features proposed as likely to be related to the anti-malarial activity and to quantify the effect of the modifications in vitro using the pLDH assay. The effects of the pure compound on the P. falciparum transcriptome were subsequently investigated by treating ring-stage parasites (alongside untreated controls, followed by oligonucleotide microarray- and data analysis. Results The main active constituent was identified as dehydrobrachylaenolide, a eudesmanolide-type sesquiterpene lactone. The compound demonstrated an in vitro IC50 of 1.865 μM against a chloroquine-sensitive strain (D10 of P. falciparum. Synthetic analogues of the compound confirmed an absolute requirement that the α-methylene lactone be present in the eudesmanolide before significant anti-malarial activity was observed. This feature is absent in the artemisinins and suggests a different mode of action
Anion Gap Blood Test: MedlinePlus Lab Test Information
... https://medlineplus.gov/labtests/aniongapbloodtest.html Anion Gap Blood Test To use the sharing features on this page, please enable JavaScript. What is an Anion Gap Blood Test? An anion gap blood test is a way ...
International Nuclear Information System (INIS)
Criscenti, L.J.; Sverjensky, D.A.
1999-01-01
Adsorption of divalent metal ions (M 2+ ) onto oxide and hydroxide surfaces from solutions of strong electrolytes has typically been inferred to take place without the involvement of the electrolyte anion. Only in situations where M 2+ forms a strong enough aqueous complex with the electrolyte anion (for example, CdCl + or PbCl + ) has it been frequently suggested that the metal and the electrolyte anion adsorb simultaneously. A review of experimental data for the adsorption of Cd 2+ , Pb 2+ , Co 2+ , UO 2 2+ , Zn 2+ , Cu 2+ , Ba 2+ , Sr 2+ , and Ca 2+ onto quartz, silica, goethite, hydrous ferric oxide, corundum, γ-alumina, anatase, birnessite, and magnetite, from NaNO 3 , KNO 3 , NaCl, and NaClO 4 solutions over a wide range of ionic strengths (0.0001 M-1.0 M), reveals that transition and heavy metal adsorption behavior with ionic strength is a function of the type of electrolyte. In NaNO 3 solutions, metal adsorption exhibits little or no dependence on the ionic strength of the solution. However, in NaCl solutions, transition and heavy metal adsorption decreases strongly with increasing ionic strength. In NaClO 4 solutions, metal adsorption decreases strongly with increasing ionic strength. In NaClO 4 solutions, metal adsorption exhibits little dependence on ionic strength but is often suggestive of an increase in metal adsorption with increasing ionic strength. Analysis of selected adsorption edges was carried out using the extended triple-layer model and aqueous speciation models that included metal-nitrate, metal-chloride, and metal-hydroxide complexes
Diffusion of anions and cations in compacted sodium bentonite
International Nuclear Information System (INIS)
Muurinen, A.
1994-02-01
The thesis presents the results of studies on the diffusion mechanisms of anions and cations in compacted sodium bentonite, which is planned to be used as a buffer material in nuclear waste disposal in Finland. The diffusivities and sorption factors were determined by tracer experiments. The pore volume accessible to chloride, here defined as effective porosity, was determined as a function of bentonite density and electrolyte concentration in water, and the Stern-Gouy double-layer model was used to explain the observed anion exclusion. The sorption of Cs + and Sr 2+ was studied in loose and compacted bentonite samples as a function of the electrolyte concentration in solution. In order to obtain evidence of the diffusion of exchangeable cations, defined as surface diffusion, the diffusivities of Cs + and Sr 2+ in compacted bentonite were studied as a function of the sorption factor, which was varied by electrolyte concentration in solution. The measurements were performed both by a non-steady state method and by a through-diffusion method. (89 refs., 35 fig., 4 tab.)
A study of sorption of pertechnetate anion on chitosan
International Nuclear Information System (INIS)
Pivarciova, L.; Rosskopfova, O.; Rajec, P.; Galambos, M.
2015-01-01
Chitosan is one of the natural materials of biological origin. The sorption of pertechnetate anions from aqueous solutions on chitosan was studied in a batch system. This work was aimed to study influence of the contact time, effect of pH and effect of different ions on sorption of pertechnetate anions on chitosan. This sorbent was characterized by BET-surface area and potentiometric titration. The point of zero charge (pH pzc ) was at pH=7.15. The highest percentage of technetium sorption on chitosan was near pH 3. The adsorption capacity of chitosan decreased with increase in pH value above 3. In the initial pH range of 4-10, final pHs are the same. The selectivity of chitosan for these cations with concentration above 1·10 -3 mol·dm -3 was in the order Na + > Ca 2+ > Fe 3+ > Fe 2+ . The competition effect of (SO 4 ) 2- towards TcO 4 - sorption was stronger than the competition effect (ClO 4 ) - of ions. (authors)
Tripodal receptors for cation and anion sensors
Kuswandi, Bambang; Nuriman, [Unknown; Verboom, Willem; Reinhoudt, David
2006-01-01
This review discusses different types of artificial tripodal receptors for the selectiverecognition and sensing of cations and anions. Examples on the relationship between structure andselectivity towards cations and anions are described. Furthermore, their applications as potentiometricion sensing
International Nuclear Information System (INIS)
Wang, Jun; Li, Jun; Guo, Hua; Ma, Jianyi
2014-01-01
The photodetachment of both the HOCO − and DOCO − anions is investigated using full-dimensional quantum wave packets on new ab initio based global potential energy surfaces for both the neutral and anionic species. The calculated electron affinities and neutral fundamental vibrational frequencies of both isotopomers are in good agreement with available experimental data. The measured photoelectron spectra are also accurately reproduced, further validating the accuracy of the potential energy surfaces. In addition, strong mode specificity is found in the lifetimes of the HOCO vibrational features and the tunneling facilitated predissociation rates to H + CO 2 are rationalized using the recently proposed sudden vector projection model
The gecko visual pigment: the anion hypsochromic effect.
Crescitelli, F; Karvaly, B
1991-01-01
The 521-pigment in the retina of the Tokay gecko (Gekko gekko) readily responds to particular physical and chemical changes in its environment. When solubilized in chloride deficient state the addition of Class I anions (Cl-, Br-) induces a bathochromic shift of the absorption spectrum. Class II anions (NO3-, IO3-, N3-, OCN-, SCN-, SeCN-, N(CN)2-), which exhibit ambidental properties, cause an hypsochromic shift. Class III anions (F-, I-, NO2-, CN-, AsO3-, SO2(4-), S2O2(3-) have no spectral effect on the 521-pigment. Cations appear to have no influence on the pigment absorption and Class I anions prevent or reverse the hypsochromic shift caused by Class II anions. It is suggested that the spectral displacements reflect specific changes in the opsin conformation, which alter the immediate (dipolar) environment of the retinal chromophore. The protein conformation seems to promote excited-state processes most in the native 521-pigment state and least in the presence of Class II anions. This in turn suggests that the photosensitivity of the 521-pigment is controlled by the excited rather than by the ground-state properties of the pigment.
Ion-exchange concentration of inorganic anions from aqueous solution
Directory of Open Access Journals (Sweden)
L. P. Bondareva
2016-01-01
Full Text Available Monitoring of natural waters in the present time - consuming process, the accuracy of which is influenced by many factors: the composition of water, the presence of impurities and "interfering" components. The water sample preparation process includes the step of concentration and separation of ions determined. The most versatile, efficient, and frequently used method is the concentration of inorganic anions from aqueous solutions by ion exchanger, which can optimize the composition of water to the optimal for identification and quantitative determination of anions. The characteristics of sorption chloride, nitrate and sulfate ions of basic anion exchange resin AВ-17 and Purolite A430 were compared in the article. The constants of protolysis of ion exchangers both AB 17 and Purolite A430 are the same and equal 0.037 ± 0,002. The value of total capacity (POE Purolite A430 was 4.3 mmol/g, AB 17 – 3.4 mmol/g. The studied ion exchangers have the same type of ionic groups – quaternary ammonium, but their number and denotes differ. The number of quaternary ammonium groups is higher in Purolite A430, respectively the number of absorbed anions of these ion exchanger is higher. The values of dynamic exchange capacity (DOE of ion exchanger Purolite A430 is higher than these values of AB-17 and equal to 1.48 ± 0.03 mmol / dm3 for chloride ion, 1.50 ± 0.03 mmol / dm3 for nitrate ion, 1.62 ± 0.03 mmol / dm3 for sulfate ion. The values of the POE and DOE of anion-exchange resins Purolite A430 and AV-17 and the characteristics of the individual sorption of chloride, nitrate, sulfate ions showed an advantage of the Purolite for the concentrationing of anions. It is found that times of anions sorption from triple-anion solutions by Purolite A430 are significantly different for different anions, and these times are close for anion-exchanger AV-17. It proves the possibility of quantitative separation and concentration by anion-exchanger Purolite A430.
Dehydroabiethylamine acetate as metal-containing anion precipitant
International Nuclear Information System (INIS)
Skrylev, L.D.; Borisov, V.A.
1979-01-01
The precipitation is studied of vanadate, tungstate-, molybdate- and chromate-ions by dehydroabiethylamine acetate. The degree of precipitation of metal-bearing anions is a function of the anion and of pH of the treated solutions. There exists a predetermined value of pH for each anion, at which the content of metal-bearing anion in the ultra-filtrate is at a minimum. For vanadate-ions, this pH is 5.0; for tungstate-ions, 3.0; for molybdate-ions, 4.0; for chrommate-ions, 8.0. The heats of solution of methavanadate, paratungstate, paramolybdate and dehydroabiethylamine chromate, calculated in accordance with the Vant-Hoff equation, range between 3.5 and 8.3 kJ/mole; free energy varies between 45.8 and 137.5 kJ/mole; and entropy varies between 110 and 371 J/degree mole
Anion binding in biological systems
Energy Technology Data Exchange (ETDEWEB)
Feiters, Martin C [Department of Organic Chemistry, Institute for Molecules and Materials, Faculty of Science, Radboud University Nijmegen, Heyendaalseweg 135, 6525 AJ Nijmegen (Netherlands); Meyer-Klaucke, Wolfram [EMBL Hamburg Outstation at DESY, Notkestrasse 85, D-22607 Hamburg (Germany); Kostenko, Alexander V; Soldatov, Alexander V [Faculty of Physics, Southern Federal University, Sorge 5, Rostov-na-Donu, 344090 (Russian Federation); Leblanc, Catherine; Michel, Gurvan; Potin, Philippe [Centre National de la Recherche Scientifique and Universite Pierre et Marie Curie Paris-VI, Station Biologique de Roscoff, Place Georges Teissier, BP 74, F-29682 Roscoff cedex, Bretagne (France); Kuepper, Frithjof C [Scottish Association for Marine Science, Dunstaffnage Marine Laboratory, Oban, Argyll PA37 1QA, Scotland (United Kingdom); Hollenstein, Kaspar; Locher, Kaspar P [Institute of Molecular Biology and Biophysics, ETH Zuerich, Schafmattstrasse 20, Zuerich, 8093 (Switzerland); Bevers, Loes E; Hagedoorn, Peter-Leon; Hagen, Wilfred R, E-mail: m.feiters@science.ru.n [Department of Biotechnology, Delft University of Technology, Julianalaan 67, 2628 BC Delft (Netherlands)
2009-11-15
We compare aspects of biological X-ray absorption spectroscopy (XAS) studies of cations and anions, and report on some examples of anion binding in biological systems. Brown algae such as Laminaria digitata (oarweed) are effective accumulators of I from seawater, with tissue concentrations exceeding 50 mM, and the vanadate-containing enzyme haloperoxidase is implicated in halide accumulation. We have studied the chemical state of iodine and its biological role in Laminaria at the I K edge, and bromoperoxidase from Ascophyllum nodosum (knotted wrack) at the Br K edge. Mo is essential for many forms of life; W only for certain archaea, such as Archaeoglobus fulgidus and the hyperthermophilic archaeon Pyrococcus furiosus, and some bacteria. The metals are bound and transported as their oxo-anions, molybdate and tungstate, which are similar in size. The transport protein WtpA from P. furiosus binds tungstate more strongly than molybdate, and is related in sequence to Archaeoglobus fulgidus ModA, of which a crystal structure is known. We have measured A. fulgidus ModA with tungstate at the W L{sub 3} (2p{sub 3/2}) edge, and compared the results with the refined crystal structure. XAS studies of anion binding are feasible even if only weak interactions are present, are biologically relevant, and give new insights in the spectroscopy.
Anion binding in biological systems
International Nuclear Information System (INIS)
Feiters, Martin C; Meyer-Klaucke, Wolfram; Kostenko, Alexander V; Soldatov, Alexander V; Leblanc, Catherine; Michel, Gurvan; Potin, Philippe; Kuepper, Frithjof C; Hollenstein, Kaspar; Locher, Kaspar P; Bevers, Loes E; Hagedoorn, Peter-Leon; Hagen, Wilfred R
2009-01-01
We compare aspects of biological X-ray absorption spectroscopy (XAS) studies of cations and anions, and report on some examples of anion binding in biological systems. Brown algae such as Laminaria digitata (oarweed) are effective accumulators of I from seawater, with tissue concentrations exceeding 50 mM, and the vanadate-containing enzyme haloperoxidase is implicated in halide accumulation. We have studied the chemical state of iodine and its biological role in Laminaria at the I K edge, and bromoperoxidase from Ascophyllum nodosum (knotted wrack) at the Br K edge. Mo is essential for many forms of life; W only for certain archaea, such as Archaeoglobus fulgidus and the hyperthermophilic archaeon Pyrococcus furiosus, and some bacteria. The metals are bound and transported as their oxo-anions, molybdate and tungstate, which are similar in size. The transport protein WtpA from P. furiosus binds tungstate more strongly than molybdate, and is related in sequence to Archaeoglobus fulgidus ModA, of which a crystal structure is known. We have measured A. fulgidus ModA with tungstate at the W L 3 (2p 3/2 ) edge, and compared the results with the refined crystal structure. XAS studies of anion binding are feasible even if only weak interactions are present, are biologically relevant, and give new insights in the spectroscopy.
Anion binding in biological systems
Feiters, Martin C.; Meyer-Klaucke, Wolfram; Kostenko, Alexander V.; Soldatov, Alexander V.; Leblanc, Catherine; Michel, Gurvan; Potin, Philippe; Küpper, Frithjof C.; Hollenstein, Kaspar; Locher, Kaspar P.; Bevers, Loes E.; Hagedoorn, Peter-Leon; Hagen, Wilfred R.
2009-11-01
We compare aspects of biological X-ray absorption spectroscopy (XAS) studies of cations and anions, and report on some examples of anion binding in biological systems. Brown algae such as Laminaria digitata (oarweed) are effective accumulators of I from seawater, with tissue concentrations exceeding 50 mM, and the vanadate-containing enzyme haloperoxidase is implicated in halide accumulation. We have studied the chemical state of iodine and its biological role in Laminaria at the I K edge, and bromoperoxidase from Ascophyllum nodosum (knotted wrack) at the Br K edge. Mo is essential for many forms of life; W only for certain archaea, such as Archaeoglobus fulgidus and the hyperthermophilic archaeon Pyrococcus furiosus, and some bacteria. The metals are bound and transported as their oxo-anions, molybdate and tungstate, which are similar in size. The transport protein WtpA from P. furiosus binds tungstate more strongly than molybdate, and is related in sequence to Archaeoglobus fulgidus ModA, of which a crystal structure is known. We have measured A. fulgidus ModA with tungstate at the W L3 (2p3/2) edge, and compared the results with the refined crystal structure. XAS studies of anion binding are feasible even if only weak interactions are present, are biologically relevant, and give new insights in the spectroscopy.
Test procedure for anion exchange chromatography
International Nuclear Information System (INIS)
Cooper, T.D.
1994-01-01
Plutonium from stored nitrate solutions will be sorbed onto anion exchange resins and converted to storable plutonium dioxide. Useful information will be simultaneously gained on the thermal stability and ion exchange capacity of four commercially available anion exchange resins over several years and under severe degradative conditions. This information will prove useful in predicting the safe and efficient lifetimes of these resins
International Nuclear Information System (INIS)
Mahmoud, Mohamed E.; Yakout, Amr A.; Osman, Maher M.
2009-01-01
Dowex anion exchanger-immobilized-baker's yeast [Dae-yeast] were synthesized and potentially applied as environmental friendly biosorbents to evaluate the up-take process of anionic and cationic mercury(II) species as well as other metal ions. Optimization of mass ratio of Dowex anion exchanger versus yeast (1:1-1:10) in presence of various interacting buffer solutions (pH 4.0-9.0) was performed and evaluated. Surface modification of [Dae-yeast] was characterized by scanning electron microscopy (SEM) and infrared spectroscopy. The maximum metal biosorption capacity values of [Dae-yeast] towards mercury(II) were found in the range of 0.800-0.960, 0.840-0.950 and 0.730-0.900 mmol g -1 in presence of buffer solutions pH 2.0, 4.0 and 7.0, respectively. Three possible and different mechanisms are proposed to account for the biosorption of mercury and mercuric species under these three buffering conditions based on ion exchange, ion pair and chelation interaction processes. Factors affecting biosorption of mercury from aqueous medium including the pH effect of aqueous solutions (1.0-7.0), shaking time (1-30 min) and interfering ions were searched. The potential applications of modified biosorbents for selective biosorption and extraction of mercury from different real matrices including dental filling waste materials, industrial waste water samples and mercury lamp waste materials were also explored. The results denote to excellent percentage extraction values, from nitric acid as the dissolution solvent with a pH 2.0, as determined in the range of 90.77-97.91 ± 3.00-5.00%, 90.00-93.40 ± 4.00-5.00% and 92.31-100.00 ± 3.00-4.00% for the three tested samples, respectively.
Energy Technology Data Exchange (ETDEWEB)
Khan, Asif Ali, E-mail: asifkhan42003@yahoo.com; Shaheen, Shakeeba, E-mail: shakeebashaheen@ymail.com
2014-01-15
Highlights: • PU–Si gel is new anion exchanger material synthesized and characterized. • This material used as anion exchange membrane is applied for electroanalytical studies. • The method for detection and determination of AsO{sub 4}{sup 3−} in traces amounts discussed. • The results are also verified from arsenic analyzer. -- Abstract: Polyurethane (PU)–silica (Si gel) based fibrous anion exchanger composites were prepared by solid–gel polymerization of polyurethane in the presence of different amounts of silica gel. The formation of PU–Si gel fibrous anion exchanger composite was characterized by Fourier transform infra-red spectroscopy (FTIR), X-ray diffraction (XRD), thermogravimetric analysis (TGA-DTA), scanning electron microscopy (SEM) and elemental analysis. The membrane having a composition of 5:3 (PU:Si gel) shows best results for water content, porosity, thickness and swelling. Our studies show that the present ion selective membrane electrode is selective for arsenic, having detection limit (1 × 10{sup −8} M to 1 × 10{sup −1} M), response time (45 s) and working pH range (5–8). The selectivity coefficient values for interfering ions indicate good selectivity for arsenate (AsO{sub 4}{sup 3−}) over interfering anions. The accuracy of the detection limit results was compared by PCA-Arsenomat.
Fine tuning the ionic liquid-vacuum outer atomic surface using ion mixtures.
Villar-Garcia, Ignacio J; Fearn, Sarah; Ismail, Nur L; McIntosh, Alastair J S; Lovelock, Kevin R J
2015-03-28
Ionic liquid-vacuum outer atomic surfaces can be created that are remarkably different from the bulk composition. In this communication we demonstrate, using low-energy ion scattering (LEIS), that for ionic liquid mixtures the outer atomic surface shows significantly more atoms from anions with weaker cation-anion interactions (and vice versa).
Directory of Open Access Journals (Sweden)
Yang Shao
2015-02-01
Full Text Available The objective of this study is to develop chitosan–anionic polymers based extended-release tablets and test the feasibility of using this system for the sustained release of highly water-soluble drugs with high drug loading. Here, the combination of sodium valproate (VPS and valproic acid (VPA were chosen as the model drugs. Anionic polymers studied include xanthan gum (XG, carrageenan (CG, sodium carboxymethyl cellulose (CMC-Na and sodium alginate (SA. The tablets were prepared by wet granulation method. In vitro drug release was carried out under simulated gastrointestinal condition. Drug release mechanism was studied. Compared with single polymers, chitosan–anionic polymers based system caused a further slowdown of drug release rate. Among them, CS–xanthan gum matrix system exhibited the best extended-release behavior and could extend drug release for up to 24 h. Differential scanning calorimetry (DSC and Fourier transform infrared spectroscopy (FTIR studies demonstrated that polyelectrolyte complexes (PECs were formed on the tablet surface, which played an important role on retarding erosion and swelling of the matrix in the later stage. In conclusion, this study demonstrated that it is possible to develop highly water-soluble drugs loaded extended-release tablets using chitosan–anionic polymers based system.
Directory of Open Access Journals (Sweden)
Zehra Kahveci
2014-03-01
Full Text Available This paper explores the interaction mechanism between the conjugated polyelectrolyte {[9,9-bis(6'-N,N,N-trimethylammoniumhexyl]fluorene-phenylene}bromide (HTMA-PFP and model lipid membranes. The study was carried out using different biophysical techniques, mainly fluorescence spectroscopy and microscopy. Results show that despite the preferential interaction of HTMA-PFP with anionic lipids, HTMA-PFP shows affinity for zwitterionic lipids; although the interaction mechanism is different as well as HTMA-PFP’s final membrane location. Whilst the polyelectrolyte is embedded within the lipid bilayer in the anionic membrane, it remains close to the surface, forming aggregates that are sensitive to the physical state of the lipid bilayer in the zwitterionic system. The different interaction mechanism is reflected in the polyelectrolyte fluorescence spectrum, since the maximum shifts to longer wavelengths in the zwitterionic system. The intrinsic fluorescence of HTMA-PFP was used to visualize the interaction between polymer and vesicles via fluorescence microscopy, thanks to its high quantum yield and photostability. This technique allows the selectivity of the polyelectrolyte and higher affinity for anionic membranes to be observed. The results confirmed the appropriateness of using HTMA-PFP as a membrane fluorescent marker and suggest that, given its different behaviour towards anionic and zwitterionic membranes, HTMA-PFP could be used for selective recognition and imaging of bacteria over mammalian cells.
Hasegawa, Takuya; Umemura, Tomonari; Koide, Akira; Chiba, Koichi; Ueki, Yuji; Tsunoda, Kin-ichi; Haraguchi, Hiroki
2005-08-01
An octadecylsilica (ODS) column modified with zwitterionic/nonionic mixed surfactants was evaluated for the direct injection determination of inorganic anions in biological fluids by ion chromatography. A zwitterionic surfactant (sulfobetaine-type) and a nonionic surfactant (polyoxyethylene-type) were used for a stationary-phase modification. When aqueous electrolyte solutions with concentrations of sub-mM to several mM were used as a mobile phase, the zwitterionic surfactant coated on the ODS surface exhibited unique separation selectivity for ionic species, while the nonionic surfactant coated on the ODS might have formed a hydrophilic network over the ODS surface and restricted matrix proteins from adsorbing on the stationary phase. Consequently, the mixed surfactant-modified column system allowed an efficient ion chromatographic separation of inorganic anions as well as a size-exclusive removal of column-fouling proteins. This separation system was applied to the direct injection determination of UV-absorbing anions in human saliva. The detection limits for nitrite, nitrate, iodide and thiocyanate were 3.1, 2.7, 4.5 and 25 microM, respectively, with UV detection at 210 nm (injection volume; 20 microl), and their relative standard deviations for 5 replicate measurements of saliva samples spiked with 100 microM each of those anions were 1.4, 0.9, 2.2 and 5.5%, respectively.
Anion effect on the retention of recoil atom of coordination crystalline compounds
International Nuclear Information System (INIS)
Dimotakis, P.N.; Papadopoulos, B.P.
1980-01-01
The anion effect of various cobaltic crystalline compounds - having the same cation and differing in anion -on the retention of neutron activated central cobalt atom has been studied. The cation was trans-dichloro(bis)ethylenediamine cobalt(III) and the anions were simple spherical anions (Cl - , Br - , I - ), planar anions (NO 3 - ), trigonal pyramidal anions (ClO 3 - , BrO 3 - ), tetrahedral anions (SO 4 2- , CrO 4 2- , MnO 4 - ) and linear anions (SCN - ). The cobalt-60 activity after reactor irradiation either in simple Co 2+ cation or in cobaltic complex cation determined the retention values. In all irradiations at ordinary temperature and at liquid nitrogen temperature the results showed an effect of the different anions, depending on the geometry, volume and charge, on the recombination of the recoil cobalt with the ligands in the coordination sphere. (author)
Benzonitrile: Electron affinity, excited states, and anion solvation
Dixon, Andrew R.; Khuseynov, Dmitry; Sanov, Andrei
2015-10-01
We report a negative-ion photoelectron imaging study of benzonitrile and several of its hydrated, oxygenated, and homo-molecularly solvated cluster anions. The photodetachment from the unsolvated benzonitrile anion to the X ˜ 1 A 1 state of the neutral peaks at 58 ± 5 meV. This value is assigned as the vertical detachment energy (VDE) of the valence anion and the upper bound of adiabatic electron affinity (EA) of benzonitrile. The EA of the lowest excited electronic state of benzonitrile, a ˜ 3 A 1 , is determined as 3.41 ± 0.01 eV, corresponding to a 3.35 eV lower bound for the singlet-triplet splitting. The next excited state, the open-shell singlet A ˜ 1 A 1 , is found about an electron-volt above the triplet, with a VDE of 4.45 ± 0.01 eV. These results are in good agreement with ab initio calculations for neutral benzonitrile and its valence anion but do not preclude the existence of a dipole-bound state of similar energy and geometry. The step-wise and cumulative solvation energies of benzonitrile anions by several types of species were determined, including homo-molecular solvation by benzonitrile, hydration by 1-3 waters, oxygenation by 1-3 oxygen molecules, and mixed solvation by various combinations of O2, H2O, and benzonitrile. The plausible structures of the dimer anion of benzonitrile were examined using density functional theory and compared to the experimental observations. It is predicted that the dimer anion favors a stacked geometry capitalizing on the π-π interactions between the two partially charged benzonitrile moieties.
Coumarin amide derivatives as fluorescence chemosensors for cyanide anions
Energy Technology Data Exchange (ETDEWEB)
Wu, Qianqian [School of Material Science and Engineering, Shandong Provincial Key Laboratory of Preparation and Measurement of Building Materials, University of Jinan, Jinan 250022, Shandong (China); Liu, Zhiqiang [State Key Laboratory of Crystal Materials, Shandong University, Jinan 250100, Shandong (China); Cao, Duxia, E-mail: duxiacao@ujn.edu.cn [School of Material Science and Engineering, Shandong Provincial Key Laboratory of Preparation and Measurement of Building Materials, University of Jinan, Jinan 250022, Shandong (China); Guan, Ruifang, E-mail: mse_guanrf@ujn.edu.cn [School of Material Science and Engineering, Shandong Provincial Key Laboratory of Preparation and Measurement of Building Materials, University of Jinan, Jinan 250022, Shandong (China); Wang, Kangnan; Shan, Yanyan; Xu, Yongxiao; Ma, Lin [School of Material Science and Engineering, Shandong Provincial Key Laboratory of Preparation and Measurement of Building Materials, University of Jinan, Jinan 250022, Shandong (China)
2015-07-01
Four coumarin amide derivatives with 4-methyl coumarin or pyrene as terminal group have been synthesized. Their photophysical properties and recognition properties for cyanide anions have been examined. The results indicate that the compounds can recognize cyanide anions with obvious absorption and fluorescence spectra change, at the same time, obvious color and fluorescence change can be observed by naked eye. The in situ hydrogen nuclear magnetic resonance spectra and photophysical properties change confirm that Michael additions between the chemosensors and cyanide anions take place at the 4-position of coumarin. - Highlights: • Four coumarin amide derivatives with 4-methyl coumarin or pyrene as terminal group were synthesized. • The compounds can recognize cyanide anions with obvious absorption and fluorescence spectra change. • Michael additions between the chemosensors and cyanide anions take place at the 4-position of coumarin.
Blagojević, S. M.; Pejić, N. D.; Blagojević, S. N.
2017-12-01
The physicochemical properties of initial formulation, that is anionic/amphoteric surfactants mixture SLES/AOS/CAB (sodium lauryl ether sulfate (SLES), α-olefin sulfonates (AOS) and cocamidopropyl betaine (CAB) at ratio 80 : 15 : 5) with nonionic surfactant of amine oxide type (lauramine oxide (AO)) in various concentration (1-5%) were studied. To characterize the surfactants mixture, the critical micelle concentration (CMC), surface tension (γ), foam volume, biodegradability and irritability were determined. This study showed that adding of AO in those mixtures lowered both γ and CMC as well as enhanced SLES/AOS/CAB foaming properties, but did not significantly affect biodegradability and irritability of initial formulation. Moreover, an increase in AO concentration has a meaningful synergistic effect on the initial formulation properties. All those results indicates that a nonionic surfactant of amine oxide type significantly improves the performance of anionic/amphoteric mixed micelle systems, and because of that anionic/amphoteric/nonionic mixture can be used in considerably lower concentrations as a cleaning formulation.
Gas-Phase Reactivity of Microsolvated Anions
DEFF Research Database (Denmark)
Thomsen, Ditte Linde
the gas-phase α-effect. The experimental studies are performed by means of the flowing after glow selected ion flow tube technique, and these are supplemented by electronic structure calculations. The α-nucleophile employed is the microsolvated hydrogen peroxide anion whose reactivity is compared......Gas-phase studies of ion-molecule reactions shed light on the intrinsic factors that govern reactivity; and even solvent effects can be examined in the gasphase environment by employing microsolvated ions. An area that has received considerable attention with regard to the interplay between...... to that of a series of microsolvated oxygen centered anions. The association of the nucleophiles with a single water or methanol molecule allows the α-effect to be observed in the SN2 reaction with methyl chloride; this effect was not apparent in the reactions of the unsolvated anions. The results suggest...
Tripodal Receptors for Cation and Anion Sensors
Directory of Open Access Journals (Sweden)
David N. Reinhoudt
2006-08-01
Full Text Available This review discusses different types of artificial tripodal receptors for the selectiverecognition and sensing of cations and anions. Examples on the relationship between structure andselectivity towards cations and anions are described. Furthermore, their applications as potentiometricion sensing are emphasised, along with their potential applications in optical sensors or optodes.
Chubar, Natalia; Gilmour, Robert; Gerda, Vasyl; Mičušík, Matej; Omastova, Maria; Heister, Katja; Man, Pascal; Fraissard, Jacques; Zaitsev, Vladimir
2017-07-01
considered in association with the synthetic methods by which the LDHs were produced. Special attention is paid to the LDH properties that are particularly relevant to water treatment, such as exchangeability ease of the interlayer anions and the LDH stability at the solid-water interface. Notably, the LDH properties (e.g., rich speciation, hydration, and the exchangeability ease of the interlayer anions with aqueous anions) are considered in the synthetic strategy context applied to the material preparation. One such promising synthetic method has been developed by the authors who supported their opinions by the unpublished data in addition to reviewing the literature. The reviewing approach allowed for establishing regularities between the parameters: the LDH synthetic method-structure/surface/interlayer-removal-suitability for water treatment. Specifically, this approach allowed for a conclusion about either the unsuitability or promising potential of some synthetic methods (or the removal approaches) used for the preparation of LDHs for water purification at larger scales. The overall reviewing approach undertaken by the authors in this work mainly complements the other reviews on LDHs (published over the past seven to eight years) and for the first time compares the properties of these materials beyond the nanoscale. Copyright © 2017 Elsevier B.V. All rights reserved.
Zn-Al LAYERED DOUBLE HYDROXIDE PILLARED BY DIFFERENT DICARBOXYLATE ANIONS
Directory of Open Access Journals (Sweden)
S. Gago
2004-12-01
Full Text Available Zn-Al layered double hydroxides (LDHs intercalated by terephthalate (TPH and biphenyl-4,4'-dicarboxylate (BPH anions have been synthesized by direct co-precipitation from aqueous solution. The Zn/Al ratio in the final materials was 1.8. The products were characterized by powder X-ray diffraction, thermogravimetric analysis, FTIR and FT Raman spectroscopy, and MAS NMR spectroscopy. The basal spacing for the TPH-LDH intercalate was 14.62 Å, indicating that the guest anions stack to form a monolayer with the aromatic rings perpendicular to the host layers. For the LDH intercalate containing BPH anions, a basal spacing of at least 19.2 Å would be expected if the anions adopted an arrangement similar to that for the TPH anions. The observed spacing was 18.24 Å, suggesting that the anions are tilted slightly with respect to the host layers.
Yang, Dongjiang; Liu, Hongwei; Liu, Long; Sarina, Sarina; Zheng, Zhanfeng; Zhu, Huaiyong
2013-11-21
Iodine radioisotopes are released into the environment by the nuclear industry and medical research institutions using radioactive materials. The (129)I(-) anion is one of the more mobile radioactive species due to a long half-life, and it is a great challenge to design long-term management solutions for such radioactive waste. In this study, a new adsorbent structure with the potential to efficiently remove radioactive iodine anions (I(-)) from water is devised: silver oxide (Ag2O) nanocrystals firmly anchored on the surface of titanate nanotubes and nanofibers via coherent interfaces between Ag2O and titanate phases. I(-) anions in fluids can easily access the Ag2O nanocrystals and be efficiently trapped by forming AgI precipitate that firmly attaches to the adsorbent. Due to their one-dimensional morphology, the new adsorbents can be readily dispersed in liquids and easily separated after purification; and the adsorption beds loaded with the adsorbents can permit high flux. This significantly enhances the adsorption efficiency and reduces the separation costs. The proposed structure reveals a new direction in developing efficient adsorbents for the removal of radioactive anions from wastewater.
Inhibition of nuclear waste solutions containing multiple aggressive anions
International Nuclear Information System (INIS)
Congdon, J.W.
1987-01-01
The inhibition of localized corrosion of carbon steel in caustic, high-level radioactive waste solutions was studied using cyclic potentiodynamic polarization scans, supplemented by partially immersed coupon tests. The electrochemical tests provided a rapid and accurate means of determining the relationship between the minimum inhibitor requirements and the concentration of the aggressive anions in this system. Nitrate, sulfate, chloride, and fluoride were identified as aggressive anions, however, no synergistic effects were observed between these anions. This observation may have important theoretical implications because it tends to contradict the behavior of aggressive anions as predicted by existing theories for localized corrosion. 10 refs., 5 figs., 2 tabs
Vertical detachment energies of anionic thymidine: Microhydration effects.
Kim, Sunghwan; Schaefer, Henry F
2010-10-14
Density functional theory has been employed to investigate microhydration effects on the vertical detachment energy (VDE) of the thymidine anion by considering the various structures of its monohydrates. Structures were located using a random searching procedure. Among 14 distinct structures of the anionic thymidine monohydrate, the low-energy structures, in general, have the water molecule bound to the thymine base unit. The negative charge developed on the thymine moiety increases the strength of the intermolecular hydrogen bonding between the water and base units. The computed VDE values of the thymidine monohydrate anions are predicted to range from 0.67 to 1.60 eV and the lowest-energy structure has a VDE of 1.32 eV. The VDEs of the monohydrates of the thymidine anion, where the N(1)[Single Bond]H hydrogen of thymine has been replaced by a 2(')-deoxyribose ring, are greater by ∼0.30 eV, compared to those of the monohydrates of the thymine anion. The results of the present study are in excellent agreement with the accompanying experimental results of Bowen and co-workers [J. Chem. Phys. 133, 144304 (2010)].
Copper(I) coordination compounds with closododecaborate anion
International Nuclear Information System (INIS)
Malinina, E.A.; Drozdova, V.V.; Mustyatsa, V.N.; Goeva, L.V.; Polyakova, I.N.; Votinova, N.A.; Zhizhin, K.Yu.; Kuznetsov, N.T.
2006-01-01
Cu(I) Complexes with closo-dodecaborate anion Cat[CuB 12 H 12 ], where Cat= Cs + , Ph 4 P + , Ph 4 As + , R x NH 4-x + (R=Me, Et, Pr, Bu, X=3-4) are synthesized. Synthesis of complexes was conducted in the copper(II) salt-salt of dodecaborate anion-sulfur dioxide (sodium sulfite) system. Structure of the complex [Cu 2 (NCCH 3 ) 4 B 12 H 12 ] assigned by X-ray structural analysis discloses that B 12 H 12 2- anion enters into the inner sphere of metal-complexing agent, and connection of closo-borate ligand with the metal is caused by the formation of three-centric metal-hydrogen-boron bonds [ru
International Nuclear Information System (INIS)
Zhao, Yafei; Abdullayev, Elshad; Lvov, Yuri
2014-01-01
Halloysite nanotubes, chemically similar to kaolinite, are formed by rolling of kaolinite layers in tubes with diameter of 50 nm and length of ca. 1 μm. Halloysite has negative SiO 2 outermost and positive Al 2 O 3 inner lumen surface, which enables it to be used as potential absorbent for both cationic and anionic dyes due to the efficient bivalent adsorbancy. An adsorption study using cationic Rhodamine 6G and anionic Chrome azurol S has shown approximately two times better dye removal for halloysite as compared to kaolinite. Halloysite filters have been effectively regenerated up to 50 times by burning the adsorbed dyes. Overall removal efficiency of anionic Chrome azurol S exceeded 99.9% for 5th regeneration cycle of halloysite. Chrome azurol S adsorption capacity decreases with the increase of ionic strength, temperature and pH. For cationic Rhodamine 6G, higher ionic strength, temperature and initial solution concentration were favorable to enhanced adsorption with optimal pH 8. These results indicate a potential to utilize halloysite for the removal of ionic dyes from environmental waters
Unusual structures of MgF5- superhalogen anion
Anusiewicz, Iwona; Skurski, Piotr
2007-05-01
The vertical electron detachment energies (VDE) of three MgF5- anions were calculated at the outer valence Green function level with the 6-311 + G(3df) basis sets. This species was found to form unusual geometrical structures each of which corresponds to an anionic state exhibiting superhalogen nature. The global minimum structure was described as a system in which two central magnesium atoms are linked via symmetrical triangle formed by three fluorine atoms. Extremely large electron binding energies of these anions (exceeding 8.5 eV in all cases) were predicted and discussed.
Regulation of organic anion transport in the liver
Roelofsen, H; Jansen, PLM
1997-01-01
In several liver diseases the biliary transport is disturbed, resulting in, for example, jaundice and cholestasis. Many of these symptoms can be attributed to altered regulation of hepatic transporters. Organic anion transport, mediated by the canalicular multispecific organic anion transporter
Energy Technology Data Exchange (ETDEWEB)
Vinodh, Rajangam; Ilakkiya, Arjunan; Elamathi, Swaminathan [Department of Chemistry, Anna University Chennai, Sardar Patel Road, Chennai 600025, Tamil Nadu (India); Sangeetha, Dharmalingam, E-mail: sangeetha@annauniv.ed [Department of Chemistry, Anna University Chennai, Sardar Patel Road, Chennai 600025, Tamil Nadu (India)
2010-02-25
We look forward for an eco-friendly hydrocarbon polymer with higher molecular weight for the preparation of an anion exchange membrane. Polystyrene ethylene butylene polystyrene (PSEBS) was chosen as the polymer matrix. The anion exchange membrane was prepared from PSEBS tri-block co-polymer and then the properties were characterized for alkaline fuel cell application. The preparation of anion exchange polymer involved two steps namely chloromethylation and quaternization. The anion exchange membrane with high conductivity has been prepared by introducing quaternary ammonium groups in to the polymer. Finally, the membrane was prepared using solution casting method. The solution casting method yields highly hydrophilic membranes with uniform structure that were suitable for electrochemical applications. The efficiency of the entrapment was monitored by swelling ratio, chemical stability and ion exchange measurement. The characteristic structural properties of the membrane were investigated by FT-IR spectroscopy and {sup 1}H NMR spectroscopy. The thermal stability of the membrane was characterized by TGA, DSC and DMA (dynamic mechanical analysis). The prepared uniform electrolyte membrane in this study has high thermal and chemical stability. The surface morphology and elemental composition of the quaternized PSEBS was determined by SEM-EDXA techniques, respectively. The measured hydroxyl ion conductivity of the synthesized alkaline PSEBS polymer electrolyte membrane showed ionic conductivity in the range of 10{sup -3} S/cm in deionized water at room temperature. It was found that the substitution provided a flexible, chemically and thermally stable membrane. Hence, the membrane will have potential application in the alkaline fuel cell.
International Nuclear Information System (INIS)
Vinodh, Rajangam; Ilakkiya, Arjunan; Elamathi, Swaminathan; Sangeetha, Dharmalingam
2010-01-01
We look forward for an eco-friendly hydrocarbon polymer with higher molecular weight for the preparation of an anion exchange membrane. Polystyrene ethylene butylene polystyrene (PSEBS) was chosen as the polymer matrix. The anion exchange membrane was prepared from PSEBS tri-block co-polymer and then the properties were characterized for alkaline fuel cell application. The preparation of anion exchange polymer involved two steps namely chloromethylation and quaternization. The anion exchange membrane with high conductivity has been prepared by introducing quaternary ammonium groups in to the polymer. Finally, the membrane was prepared using solution casting method. The solution casting method yields highly hydrophilic membranes with uniform structure that were suitable for electrochemical applications. The efficiency of the entrapment was monitored by swelling ratio, chemical stability and ion exchange measurement. The characteristic structural properties of the membrane were investigated by FT-IR spectroscopy and 1 H NMR spectroscopy. The thermal stability of the membrane was characterized by TGA, DSC and DMA (dynamic mechanical analysis). The prepared uniform electrolyte membrane in this study has high thermal and chemical stability. The surface morphology and elemental composition of the quaternized PSEBS was determined by SEM-EDXA techniques, respectively. The measured hydroxyl ion conductivity of the synthesized alkaline PSEBS polymer electrolyte membrane showed ionic conductivity in the range of 10 -3 S/cm in deionized water at room temperature. It was found that the substitution provided a flexible, chemically and thermally stable membrane. Hence, the membrane will have potential application in the alkaline fuel cell.
International Nuclear Information System (INIS)
Usman, Muhammad; Rashid, Muhammad Abid; Mansha, Asim; Siddiq, Mohammad
2013-01-01
Graphical abstract: - Highlights: • Free energy of adsorption is more negative than free energy of micellization. • Micellization becomes more spontaneous at high temperature. • There is strong interaction between PFM and SDS. - Abstract: This manuscript reports the physicochemical behavior of antibiotic amphiphilic drug pefloxacin mesylate (PFM) and its interaction with anionic surfactant, sodium dodecyl sulfate (SDS). The data of surface tension and electrical conductivity are helpful to detect the CMC as well as to calculate surface parameters, i.e. surface pressure, π, surface excess concentration, Γ, area per molecule of drug and standard Gibbs free energy of adsorption, ΔG ads and thermodynamic parameters like standard free energy of micellization, ΔG m , standard enthalpy of micellization, ΔH m and standard entropy of micellization, ΔS m . The interaction of this drug with anionic surfactant, sodium dodecyl sulfate (SDS) was studied by electrical conductivity and UV/visible spectroscopy. This enabled us to compute the values of partition coefficient (K x ), free energy of partition, ΔG p , binding constant, K b , free energy of binding, ΔG b , number of drug molecules per micelle, n, and thermodynamic parameters of drug–surfactant interaction
Experimental evidence for interactions between anions and electron-deficient aromatic rings.
Berryman, Orion B; Johnson, Darren W
2009-06-14
This feature article summarizes our research aimed at using electron-deficient aromatic rings to bind anions in the context of complementary research in this active field. Particular attention is paid to the different types of interactions exhibited between anions and electron-deficient arenes in solution. The 120+ references cited in this article underscore the flurry of recent activity by numerous researchers in this field, which was relatively nascent when our efforts began in 2005. While the interaction of anions with electron-deficient aromatic rings has recently garnered much attention by supramolecular chemists, the observation of these interactions is not a recent discovery. Therefore, we begin with a historical perspective on early examples of anions interacting with electron-deficient arenes. An introduction to recent (and not so recent) computational investigations concerning anions and electron-deficient aromatic rings as well as a brief structural survey of crystalline examples of this interaction are provided. Finally, the limited solution-based observations of anions interacting with electron-deficient aromatic rings are summarized to introduce our current investigations in this area. We highlight three different systems from our lab where anion-arene interactions have been investigated. First, we show that tandem hydrogen bonds and anion-arene interactions augment halide binding in solution. Second, a crystallographic and computational study highlights the multiple types of interactions possible between anions and electron-deficient arenes. Third, we summarize the first example of a class of designed receptors that emphasize the different types of anion-arene interactions possible in solution.
Luminescent Surface Quaternized Carbon Dots
Bourlinos, Athanasios B.
2012-01-10
Thermal oxidation of a salt precursor made from the acid base combination of tris(hydroxymethyl)aminomethane and betaine hydrochloride results in light-emitting surface quaternized carbon dots that are water-dispersible, display anion exchange properties, and exhibit uniform size/surface charge. © 2011 American Chemical Society.
Luminescent Surface Quaternized Carbon Dots
Bourlinos, Athanasios B.; Zbořil, Radek; Petr, Jan; Bakandritsos, Aristides; Krysmann, Marta; Giannelis, Emmanuel P.
2012-01-01
Thermal oxidation of a salt precursor made from the acid base combination of tris(hydroxymethyl)aminomethane and betaine hydrochloride results in light-emitting surface quaternized carbon dots that are water-dispersible, display anion exchange properties, and exhibit uniform size/surface charge. © 2011 American Chemical Society.
Energy Technology Data Exchange (ETDEWEB)
Wan, Gang [State Key Laboratory of High Performance Ceramics and Superfine Microstructures, Shanghai Institute of Ceramics, Chinese Academy of Sciences, 1295 Ding-xi Road Shanghai 200050 P. R. China; University of Chinese Academy of Sciences, Beijing 100049 P. R. China; Yang, Ce [Chemical Science and Engineering Division, Argonne National Laboratory, 9700 Cass Avenue Lemont IL 60439 USA; Zhao, Wanpeng [State Key Laboratory of High Performance Ceramics and Superfine Microstructures, Shanghai Institute of Ceramics, Chinese Academy of Sciences, 1295 Ding-xi Road Shanghai 200050 P. R. China; University of Chinese Academy of Sciences, Beijing 100049 P. R. China; Li, Qianru [State Key Laboratory of High Performance Ceramics and Superfine Microstructures, Shanghai Institute of Ceramics, Chinese Academy of Sciences, 1295 Ding-xi Road Shanghai 200050 P. R. China; University of Chinese Academy of Sciences, Beijing 100049 P. R. China; Wang, Ning [State Key Laboratory of High Performance Ceramics and Superfine Microstructures, Shanghai Institute of Ceramics, Chinese Academy of Sciences, 1295 Ding-xi Road Shanghai 200050 P. R. China; University of Chinese Academy of Sciences, Beijing 100049 P. R. China; Li, Tao [X-ray Science Division, Advanced Photon Source, Argonne National Laboratory, 9700 Cass Avenue Lemont IL 60439 USA; Zhou, Hua [X-ray Science Division, Advanced Photon Source, Argonne National Laboratory, 9700 Cass Avenue Lemont IL 60439 USA; Chen, Hangrong [State Key Laboratory of High Performance Ceramics and Superfine Microstructures, Shanghai Institute of Ceramics, Chinese Academy of Sciences, 1295 Ding-xi Road Shanghai 200050 P. R. China; Shi, Jianlin [State Key Laboratory of High Performance Ceramics and Superfine Microstructures, Shanghai Institute of Ceramics, Chinese Academy of Sciences, 1295 Ding-xi Road Shanghai 200050 P. R. China
2017-11-06
The introduction of active transition metal sites (TMSs) in carbon enables the synthesis of noble-metal-free electrocatalysts for clean energy conversion applications, however, there are often multiple existing forms of TMSs, which are of different natures and catalytic models. Regulating the evolution of distinctive TMSs is highly desirable but remains challenging to date. Anions, as essential elements involved in the synthesis, have been totally neglected previously in the construction of TMSs. Herein, the effects of anions on the creation of different types of TMSs is investigated for the first time. It is found that the active cobalt-nitrogen sites tend to be selectively constructed on the surface of N-doped carbon by using chloride, while metallic cobalt nanoparticles encased in protective graphite layers are the dominant forms of cobalt species with nitrate ions. The obtained catalysts demonstrate cobalt-sites-dependent activity for ORR and HER in acidic media. And the remarkably enhanced catalytic activities approaching that of benchmark Pt/C in acidic medium has been obtained on the catalyst dominated with cobalt-nitrogen sites, confirmed by the advanced spectroscopic . Our finding demonstrates a general paradigm of anion-regulated evolution of distinctive TMSs, providing a new pathway for enhancing performances of various targeted reactions related with TMSs.
Rannulu, Nalaka S.; Cole, Richard B.
2012-09-01
The analysis of several bifunctional neutral steroids, 5-α-pregnane diol (5-α-pregnane-3α-20βdiol), estradiol (3,17α-dihydroxy-1,3,5(10)-estratriene), progesterone (4-pregnene-3,20-dione), lupeol (3β-hydroxy-20(29)-lupene), pregnenolone (5-pregnen-3β-ol-20-one), and pregnenolone acetate (5-pregnen-3β-ol-20-one acetate) was accomplished by negative ion electrospray mass spectrometry (ESI-MS) employing adduct formation with various anions: fluoride, bicarbonate, acetate, and chloride. Fluoride yielded higher abundances of anionic adducts and more substantial abundances of deprotonated molecules compared with other investigated anions. Collision-induced dissociation (CID) of precursor [M + anion]- adducts of these steroids revealed that fluoride adduct [M + F]- precursors first lose HF to produce [M - H]- and then undergo consecutive decompositions to yield higher abundances of structurally-informative product ions than the other tested anions. In addition to charge-remote fragmentations, the majority of CID pathways of estradiol are deduced to occur via charge-induced fragmentation. Most interestingly, certain anions exhibit preferential attachment to a specific site on these bifunctional steroid molecules, which we are calling "regioselective anion attachment." Regioselective anion attachment is evidenced by subsequent regiospecific decomposition. Regioselective attachment of fluoride (and acetate) anions to low (and moderate) acidity functional groups of pregnenolone, respectively, is demonstrated using deuterated compounds. Moreover, the formation of unique intermediate ion-dipole complexes leading to novel fragmentation pathways of fluoride adducts of pregnenolone acetate, and bicarbonate adducts of d4-pregnenolone, are also discussed.
Ab initio studies of O-2(-) (H2O)(n) and O-3(-) (H2O)(n) anionic molecular clusters, n
DEFF Research Database (Denmark)
Bork, Nicolai Christian; Kurten, T.; Enghoff, Martin Andreas Bødker
2011-01-01
that anionic O-2(-)(H2O)n and O-3(-)(H2O)n clusters are thermally stabilized at typical atmospheric conditions for at least n = 5. The first 4 water molecules are strongly bound to the anion due to delocalization of the excess charge while stabilization of more than 4 H2O is due to normal hydrogen bonding....... Although clustering up to 12 H2O, we find that the O-2 and O-3 anions retain at least ca. 80 % of the charge and are located at the surface of the cluster. The O-2(-) and O-3(-) speicies are thus accessible for further reactions. We consider the distributions of cluster sizes as function of altitude before...
Interactions between kaolinite Al−OH surface and sodium hexametaphosphate
Energy Technology Data Exchange (ETDEWEB)
Han, Yonghua, E-mail: hyh19891102@163.com [School of Chemical and Environmental Engineering, China University of Mining and Technology, Beijing 100083 (China); Liu, Wenli; Zhou, Jia [School of Chemical and Environmental Engineering, China University of Mining and Technology, Beijing 100083 (China); Chen, Jianhua [College of Resources and Metallurgy, Guangxi University, Nanning 530004 (China)
2016-11-30
Highlights: • Sodium hexametaphosphate (NaHMP) can adsorb on kaolinite Al−OH terminated (001) surface easily. • The oxygen atoms of hexametaphosphate form strong hydrogen bonds with the hydrogen atoms of kaolinite Al−OH surface. • The electrostatic force is the main interaction between NaHMP and Al−OH surface. • The linear hexaphosphate −[PO{sub 3}]{sub m}− chains adsorb stably than −[HPO{sub 3}]{sub m}− chains. - Abstract: To investigate the dispersion mechanism of sodium hexametaphosphate on kaolinite particles, we simulated the interaction between linear polyphosphate chains and kaolinite Al−OH terminated surface by molecular dynamics, as well as the interaction between the [HPO{sub 4}]{sup 2−} anion and kaolinite Al−OH surface by density functional theory (DFT). The calculated results demonstrate that hexametaphosphate can be adsorbed by the kaolinite Al−OH surface. The oxygen atoms of hexametaphosphate anions may receive many electrons from the Al−OH surface and form hydrogen bonds with the hydrogen atoms of surface hydroxyl groups. Moreover, electrostatic force dominates the interactions between hexametaphosphate anions and kaolinite Al−OH surface. Therefore, after the adsorption of hexametaphosphate on kaolinite Al−OH surface, the kaolinite particles carry more negative charge and the electrostatic repulsion between particles increases. In addition, the adsorption of −[PO{sub 3}]{sub m}− species on the Al−OH surface should be more stable than the adsorption of −[HPO{sub 3}]{sub m}− species.
Energy Technology Data Exchange (ETDEWEB)
Toshio Kakui; Hidehiro Kamiya [Lion Corporation, Tokyo (Japan). Chemicals Research Laboratories, Chemicals Division
2004-06-01
This paper focused on the effect of sodium aromatic sulfonate in anionic polymer dispersants on the viscosity of coal-water mixtures (CWMs) with a Tatung coal powder. To determine the optimum molecular structure of a polymer dispersant for the minimum viscosity of a CWM, various anionic co-polymers with different hydrophilic and hydrophobic groups or different molecular weights were prepared, using various types of monomers. Anionic co-polymers with sodium aromatic sulfonate, such as sodium styrene-sulfonate and sodium naphthalene-sulfonate, reduced the viscosity of dense CWMs. In particular, a co-polymer of sodium styrene-sulfonate and sodium acrylate with a molar ratio of 70:30 and a molecular weight of {approximately} 10 000 gave the minimum viscosity of a 70 wt % CWM. To obtain a low viscosity for a CWM, a large electrostatic repulsive force with an absolute value of the zeta potential of the coal particles of {gt} 70 mV and {gt} 6.5 mg/g of adsorbed polymer on the coal surface were needed. The mixture of sodium polystyrene-sulfonate and sodium polyacrylate with a weight ratio of 50:50 also gave a low viscosity of 70 wt % CWM. On the basis of the results, the adsorption behavior of polymer dispersants on the coal surface is examined by measuring the wettability of coal powder pellets. 27 refs., 8 figs., 3 tabs.
Diffuse neutron scattering from anion-excess strontium chloride
DEFF Research Database (Denmark)
Goff, J.P.; Clausen, K.N.; Fåk, B.
1992-01-01
The defect structure and diffusional processes have been studied in the anion-excess fluorite (Sr, Y)Cl2.03 by diffuse neutron scattering techniques. Static cuboctahedral clusters found at ambient temperature break up at temperatures below 1050 K, where the anion disorder is highly dynamic. The a...
Anion binding by biotin[6]uril in water
DEFF Research Database (Denmark)
Lisbjerg, Micke; Nielsen, Bjarne Enrico; Milhøj, Birgitte Olai
2015-01-01
In this contribution we show that the newly discovered 6 + 6 biotin-formaldehyde macrocycle Biotin[6]uril binds a variety of anionic guest molecules in water. We discuss how and why the anions are bound based on data obtained using NMR spectroscopy, mass spectrometry, isothermal titration...
Role of Anions Associated with the Formation and Properties of Silver Clusters.
Wang, Quan-Ming; Lin, Yu-Mei; Liu, Kuan-Guan
2015-06-16
Metal clusters have been very attractive due to their aesthetic structures and fascinating properties. Different from nanoparticles, each cluster of a macroscopic sample has a well-defined structure with identical composition, size, and shape. As the disadvantages of polydispersity are ruled out, informative structure-property relationships of metal clusters can be established. The formation of a high-nuclearity metal cluster involves the organization of metal ions into a complex entity in an ordered way. To achieve controllable preparation of metal clusters, it is helpful to introduce a directing agent in the formation process of a cluster. To this end, anion templates have been used to direct the formation of high nuclearity clusters. In this Account, the role of anions played in the formation of a variety of silver clusters has been reviewed. Silver ions are positively charged, so anionic species could be utilized to control the formation of silver clusters on the basis of electrostatic interactions, and the size and shape of the resulted clusters can be dictated by the templating anions. In addition, since the anion is an integral component in the silver clusters described, the physical properties of the clusters can be modulated by functional anions. The templating effects of simple inorganic anions and polyoxometales are shown in silver alkynyl clusters and silver thiolate clusters. Intercluster compounds are also described regarding the importance of anions in determining the packing of the ion pairs and making contribution to electron communications between the positive and negative counterparts. The role of the anions is threefold: (a) an anion is advantageous in stabilizing a cluster via balancing local positive charges of the metal cations; (b) an anion template could help control the size and shape of a cluster product; (c) an anion can be a key factor in influencing the function of a cluster through bringing in its intrinsic properties. Properties
Indirect photometric detection of boron cluster anions electrophoretically separated in methanol.
Vítová, Lada; Fojt, Lukáš; Vespalec, Radim
2014-04-18
3,5-Dinitrobenzoate and picrate are light absorbing anions pertinent to indirect photometric detection of boron cluster anions in buffered methanolic background electrolytes (BGEs). Tris(hydroxymethyl)aminomethane and morpholine have been used as buffering bases, which eliminated baseline steps, and minimized the baseline noise. In methanolic BGEs, mobilities of boron cluster anions depend on both ionic constituents of the BGE buffer. This dependence can be explained by ion pair interaction of detected anions with BGE cations, which are not bonded into ion pairs with the BGE anions. The former ion pair interaction decreases sensitivity of the indirect photometric detection. Copyright © 2014 Elsevier B.V. All rights reserved.
Anion analysis in uranium more concentrates by ion chromatography
International Nuclear Information System (INIS)
Badaut, V.
2009-01-01
In the present exploratory study, the applicability of anionic impurities or attributing nuclear material to a certain chemical process or origin has been investigated. Anions (e.g., nitrate, sulphate, fluoride, chloride) originate from acids or salt solutions that are used for processing of solutions containing uranium or plutonium. The study focuses on uranium ore concentrates ('yellow cakes') originating from different mines. Uranium is mined from different types of ore body and depending on the type of rock, different chemical processes for leaching, dissolving and precipitating the uranium need to be applied. Consequently, the anionic patterns observed in he products of these processes (the 'ore concentrates') are different. The concentrations of different anionic species were measured by ion chromatography using conductivity detection. The results show clear differences of anion concentrations and patterns between samples from different uranium mines. Besides this, differences between sampling campaigns n a same mine were also observed indicating that the uranium ore is not homogeneous in a mine. These within-mine variations, however, were smaller than the between-mine variations. (author)
Separation of transfer ribonucleic acids on polystyrene anion exchangers
Energy Technology Data Exchange (ETDEWEB)
Singhal, R.P.; Griffin, G.D.; Novelli, G.D.
1976-11-16
The transfer RNA separation by chromatography on strong-base-polystyrene exchange materials is examined and compared with the widely used reversed-phase chromatography. Results indicate important differences in some transfer RNA (tRNA) elution patterns by the anion-exchange chromatography, as compared with the reversed-phase chromatography. Transfer RNAs containing hydrophobic groups are adsorbed more strongly. The anion exchanger has twice the number of theoretical plates. Single peaks of tRNA/sub 2//sup Glu/ and tRNA/sub 1//sup Phe/ obtained from the reversed-phase column give multiple peaks on polystyrene anion-exchange chromatography. All six leucine tRNAs (Escherichia coli) and differences in tRNA populations synthesized during early and late stages of the dividing lymphocytes from normal human blood can be characterized by the anion-exchange chromatography. Different separation profiles are obtained by two separation systems for tyrosine tRNAs from mouse liver and mouse-plasma-cell tumor. The results indicate that, in contrast to the reversed-phase chromatography, strong-base-polystyrene anion-exchange chromatography is capable of separating tRNAs with minor structural differences.
DEFF Research Database (Denmark)
Moghaddam, Saeed Zajforoushan; Thormann, Esben
2017-01-01
The effect of sodium fluoride, sodium trichloroacetate, and sodium thiocyanate on the stability and conformation of poly(N-isopropylacrylamide), in bulk solution and at the gold-aqueous interface, is investigated by differential scanning calorimetry, dynamic light scattering, quartz crystal...... for thiocyanate and trichloroacetate, a salting-out effect is found for sodium trichloroacetate. This apparent contradiction is explained by a combination of previously suggested mechanisms for the salting-out effect by weakly hydrated anions....
Sampora, Yulianti; Juwono, Ariadne L.; Haryono, Agus; Irawan, Yan
2017-11-01
Mechanical Enhanced Oil Recovery (EOR) through chemical injection is using an anionic surfactant to improve the recovery of oil residues, particularly in a reservoir area that has certain characteristics. This case led the authors to conduct research on the synthesis of an anionic surfactant based on oleic acid and polyethylene glycol 400 that could be applied as a chemical injection. In this work, we investigate the sulfonation of Polyethylene glycol oleate (PDO) in a sulfuric acid agent. PDO in this experiment was derived from Indonesian palm oil. Variation of mole reactant and reaction time have been studied. The surfactant has been characterized by measuring the interfacial tension, acid value, ester value, saponification value, iodine value, Fourier Transform Infrared (FTIR), and particle size analyzer. There is a new peak at 1170-1178 cm-1 indicating that S=O bond has formed. PDO sulfonate exhibits good surface activity due to interfacial tension of 0,003 mN/m. Thus, polyethylene glycol oleate sulfonate was successfully synthesized and it could be useful as a novel an anionic surfactant.
Hu, Linna; Wang, Guangxiu; Cao, Rong; Yang, Chun; Chen, Xi
2014-10-01
Hydrophobic barium sulfate aggregates were fabricated by the direction of cocoate anions. At 30 °C, when the weight ratio of sodium cocoate to BaSO4 particles was 2.0 wt.%, the active ratio of the product reached 99.43% and the contact angle was greater than 120°. This method could not only simplify the complex modification process, but reduce energy consumption. The surface morphology, chemical structure and composition of BaSO4 aggregates were characterized by SEM, XRD, and FTIR. The results indicated that the as-synthesized BaSO4 particles were almond-liked and were composed of many interconnected nanoballs and that their surfaces were affected by cocoate anions. The adsorption of cocoate anions reversed the charge and weakened the surface polarity of BaSO4 particles, driving the formation of aggregates. And cocoate anions induced a change of the BaSO4 particles surface from hydrophilic to hydrophobic by a self-assembly and transformation process. Due to the self-assembled structure and the surface hydrophobicity, when adding the hydrophobic BaSO4 into PVC, the mechanical properties of PVC composite materials were significantly improved.
Alizadeh, Elahe; Massey, Sylvain; Sanche, Léon; Rowntree, Paul A.
2016-04-01
Due to its multifunctional structure, cysteine is becoming an ideal model molecule for investigating the complex interactions of proteins with metallic surfaces such as gold nanoparticles. We report herein the results of low-energy electron induced degradation of L-cysteine films, chemisorbed on a gold substrate via the thiol group or physisorbed into a clean gold surface. The data were recorded under ultra-high vacuum conditions at room temperature. Anion yields desorbed from these films by the impact of 0.5 to 19 eV electrons provide clear evidence of the efficient decomposition of this amino acid via dissociative electron attachment (i.e., from dissociation of intermediate transient anions located between 5 and 14 eV). The peaks in the desorbed-anion yield functions, associated with DEA, are superimposed on a continuously rising signal attributed to dipolar dissociation. Similar to the results previously observed from physisorbed films, light anionic species, with masses lower than 35 amu, have been detected. In addition, we measured for first time fragments at 14 amu (CH2-) and 15 amu (CH3-) desorbing from physisorbed films, as well as heavier fragments of mass 45 and 46 amu desorbing from chemisorbed films. Contribution to the Topical Issue "Low-Energy Interactions related to Atmospheric and Extreme Conditions", edited by S. Ptasinska, M. Smialek-Telega, A. Milosavljevic, B. Sivaraman.
International Nuclear Information System (INIS)
Alizadeh, E.; Rowntree, P.A.; Massey, S.; Sanche, L.
2016-01-01
In recent years it has become apparent that dissociative attachment of low energy electrons (DEA) is important for the description of radiation damage to biologically relevant molecules and living cells. Due to its multifunctional structure, cysteine is becoming an ideal model molecule for investigating the complex interactions of proteins with metallic surfaces such as gold nanoparticles. We report herein the results of low-energy electron induced degradation of L-cysteine films, chemisorbed on a gold substrate via the thiol group or physisorbed into a clean gold surface. The data were recorded under ultra-high vacuum conditions at room temperature. Anion yields desorbed from these films by the impact of 0.5 to 19 eV electrons provide clear evidence of the efficient decomposition of this amino acid via dissociative electron attachment (i.e., from dissociation of intermediate transient anions located between 5 and 14 eV). The peaks in the desorbed-anion yield functions, associated with DEA, are superimposed on a continuously rising signal attributed to dipolar dissociation. Similar to the results previously observed from physisorbed films, light anionic species, with masses lower than 35 amu, have been detected. In addition, we measured for first time fragments at 14 amu (CH_2"-) and 15 amu (CH_3"-) desorbing from physisorbed films, as well as heavier fragments of mass 45 and 46 amu desorbing from chemisorbed films
Femtosecond photoelectron spectroscopy: a new tool for the study of anion dynamics
Energy Technology Data Exchange (ETDEWEB)
Greenblatt, Benjamin J. [Univ. of California, Berkeley, CA (United States)
1999-02-01
A new experimental technique for the time-resolved study of anion reactions is presented. Using femtosecond laser pulses, which provide extremely fast (~100 fs) time resolution, in conjunction with photoelectron spectroscopy, which reveals differences between anion and neutral potential energy surfaces, a complex anion reaction can be followed from its inception through the formation of asymptotic products. Experimental data can be modeled quantitatively using established theoretical approaches, allowing for the refinement of potential energy surfaces as well as dynamical models. After a brief overview, a detailed account of the construction of the experimental apparatus is presented. Documentation of the data acquisition program is contained in the Appendix. The first experimental demonstration of the technique is then presented for I2- photodissociation, modeled using a simulation program which is also detailed in the Appendix. The investigation of I2- photodissociation in several size-selected I2-(Ar)n (n = 6-20) and I2-(CO2)n (n = 4-16) clusters forms the heart of the dissertation. In a series of chapters, the numerous effects of solvation on this fundamental bond-breaking reaction are explored, the most notable of which is the recombination of I2- on the ground $\\tilde{X}$(2Σu+) state in sufficiently large clusters. Recombination and trapping of I2- on the excited $\\tilde{A}$(2π3/2,g) state is also observed in both types of clusters. The studies have revealed electronic state transitions, the first step in recombination, on a ~500 fs to ~10 ps timescale. Accompanying the changes in electronic state is solvent reorganization, which occurs on a similar timescale. Over longer periods (~1 ps to >200 ps), energy is transferred from vibrationally
Mojarrad Moghanloo, Gol Mohammad; Khatami, Maryam; Javidanbardan, Amin; Hosseini, Seyed Nezamedin
2018-01-01
In biopharmaceutical science, ion-exchange chromatography (IEC) is a well-known purification technique to separate the impurities such as host cell proteins from recombinant proteins. However, IEC is one of the limiting steps in the purification process of recombinant hepatitis B surface antigen (rHBsAg), due to its low recovery rate (rate of 82% in both lab-scale and large-scale weak anion-exchange chromatography without any harsh effect on the purity percentage of rHBsAg. The recovery enhancement via increasing the conductivity of Eq. and Wash. buffers can be explained by their roles in reducing the binding strength and aggregation of retained particles in the column. Moreover, further increase in the salt concentration of Elut. Buffer could substantially promote the ion exchange process and the elution of retained rHBsAg. Copyright © 2017 Elsevier Inc. All rights reserved.
Formation of interstellar anions
Senent, Maria Luisa
2012-05-01
Formation of interstellar anions: M.L. Senent. The recent detection of negative charged species in the ISM1 has instigated enthusiasm for anions in the astrophysical community2. Many of these species are new and entail characterization. How they are formed in astrophysical sources is a question of major relevance. The anion presence in ISM was first predicted theoretically on the basis of electron affinities and on the negative linear chain molecular stabilities. Although very early, they were considered in astrochemical models3-4, their discovery is so recent because their abundances seem to be relatively low. These have to be understood in terms of molecular stabilities, reaction probabilities and radiative and collisional excitations. Then, we present our theoretical work on even carbon chains type Cn and CnH (n=2,4,6) focused to the understanding of anion abundances. We use highly correlated ab initio methods. We performed spectroscopic studies of various isomers that can play important roles as intermediates5-8. In previous papers9-10, we compared C2H and C2H- collisional rates responsible for observed line intensities. Actually, we study hydrogen attachment (Cn +H → CnH and Cn- +H → CnH-) and associative detachment processes (Cn- +H → CnH +e-) for 2, 4 and 6 carbon atom chains11. [1] M.C.McCarthy, C.A.Gottlieb, H.Gupta, P.Thaddeus, Astrophys.J, 652, L141 (2006) [2] V.M.Bierbaum, J.Cernicharo, R.Bachiller, eds., 2011, pp 383-389. [3] A. Dalgarno, R.A. Mc Cray, Astrophys.J,, 181, 95 (1973) [4] E. Herbst E., Nature, 289, 656 (1981); [5] H.Massó, M.L.Senent, P.Rosmus, M.Hochlaf, J.Chem.Phys., 124, 234304 (2006) [6] M.L.Senent, M.Hochlaf, Astrophys. J. , 708, 1452(2010) [7] H.Massó, M.L.Senent, J.Phys.Chem.A, 113, 12404 (2009) [8] D. Hammoutene, M.Hochlaf, M.L.Senent, submitted. [9] A. Spielfiedel, N. Feautrier, F. Najar, D. ben Abdallah, F. Dayou, M.L. Senent, F. Lique, Mon.Not.R.Astron.Soc., 421, 1891 (2012) [10] F.Dumouchel, A, Spielfieldel , M
The triel bond: a potential force for tuning anion-π interactions
Esrafili, Mehdi D.; Mousavian, Parisasadat
2018-02-01
Using ab-initio calculations, the mutual influence between anion-π and B···N or B···C triel bond interactions is investigated in some model complexes. The properties of these complexes are studied by molecular electrostatic potential, noncovalent interaction index, quantum theory of atoms in molecules (QTAIM) and natural bond orbital (NBO) analyses. According to the results, the formation of B···N or B···C triel bond interactions in the multi-component systems makes a significant shortening of anion-π distance. Such remarkable variation in the anion-π distances has not been reported previously. The strengthening of the anion-π bonding in the multi-component systems depend significantly on the nature of the anion, and it becomes larger in the order Br- > Cl- > F-. The parameters derived from the QTAIM and NBO methodologies are used to study the mechanism of the cooperativity between the anion-π and triel bond interactions in the multi-component complexes.
International Nuclear Information System (INIS)
Kuznetsov, I.Yu.; Vinitskij, D.M.; Solntsev, K.A.
1985-01-01
The [Ni(Bipy) 3 ] (B 6 H 7 ) 2 , (Ph 4 P)B 6 H 7 , [Ni(Phen) 3 ](B 6 H 7 ) 2 crystals (where Bipy = bipyridine, Phen = phenathroline, Ph = phenyl) are obtained via the exchange reaction with a subsequent recrystallization from aqua-acetonic and acetonic solutions. The structure is studied of a new borohydride anion B 6 H 7 - possessing a four-valence bond unique for polyhedral borohydride anions. A triangular face of boride skeleton coordinating a hydrogen atom is considerably larger than other faces, and the electron density on this hydrogen atom is evidently much higher than at the end hydride hydrogen atoms. The trend of B 6 H 7 - anion to form statistically disordered structurs testifies to a rather slight effect of the seventh hydrogen atom position on the structure pattern of the ionic crystal lattice
Ab initio studies of O2-(H2O)n and O3-(H2O)n anionic molecular clusters, n≤12
DEFF Research Database (Denmark)
Bork, Nicolai Christian; Kurtén, T.; Enghoff, Martin Andreas Bødker
2011-01-01
that anionic O2−(H2O)n and O3−(H2O)n clusters are thermally stabilized at typical atmospheric conditions for at least n = 5. The first 4 water molecules are strongly bound to the anion due to delocalization of the excess charge while stabilization of more than 4 H2O is due to normal hydrogen bonding. Although...... clustering up to 12 H2O, we find that the O2 and O3 anions retain at least ca. 80 % of the charge and are located at the surface of the cluster. The O2− and O3− speicies are thus accessible for further reactions. Finally, the thermodynamics of a few relevant cluster reactions are considered....
Wallack, Maxwell J.; Geise, Geoffrey M.; Hatzell, Marta C.; Hickner, Michael A.; Logan, Bruce E.
2015-01-01
Microbial reverse electrodialysis cells (MRECs) combine power generation from salinity gradient energy using reverse electrodialysis (RED), with power generation from organic matter using a microbial fuel cell. Waste heat can be used to distill ammonium bicarbonate into high (HC) and low salt concentration (LC) solutions for use in the RED stack, but nitrogen crossover into the anode chamber must be minimized to avoid ammonia loses, and foster a healthy microbial community. To reduce nitrogen crossover, an additional low concentration (LC) chamber was inserted before the anode using an additional anion exchange membrane (AEM) next to another AEM, and filled with different amounts of anion or cation ion exchange resins. Addition of the extra AEM increased the ohmic resistance of the test RED stack from 103 Ω cm2 (1 AEM) to 295 Ω cm2 (2 AEMs). However, the use of the anion exchange resin decreased the solution resistance of the LC chamber by 74% (637 Ω cm2, no resin; 166 Ω cm2 with resin). Nitrogen crossover into the anode chamber was reduced by up to 97% using 50% of the chamber filled with an anion exchange resin compared to the control (no additional chamber). The added resistance contributed by the use of the additional LC chamber could be compensated for by using additional LC and HC membrane pairs in the RED stack.
Anion induced conformational preference of Cα NN motif residues in functional proteins.
Patra, Piya; Ghosh, Mahua; Banerjee, Raja; Chakrabarti, Jaydeb
2017-12-01
Among different ligand binding motifs, anion binding C α NN motif consisting of peptide backbone atoms of three consecutive residues are observed to be important for recognition of free anions, like sulphate or biphosphate and participate in different key functions. Here we study the interaction of sulphate and biphosphate with C α NN motif present in different proteins. Instead of total protein, a peptide fragment has been studied keeping C α NN motif flanked in between other residues. We use classical force field based molecular dynamics simulations to understand the stability of this motif. Our data indicate fluctuations in conformational preferences of the motif residues in absence of the anion. The anion gives stability to one of these conformations. However, the anion induced conformational preferences are highly sequence dependent and specific to the type of anion. In particular, the polar residues are more favourable compared to the other residues for recognising the anion. © 2017 Wiley Periodicals, Inc.
REACTIVITY OF ANIONS IN INTERSTELLAR MEDIA: DETECTABILITY AND APPLICATIONS
Energy Technology Data Exchange (ETDEWEB)
Senent, M. L. [Departamento de Quimica y Fisica Teoricas, Instituto de Estructura de la Materia, IEM-C.S.I.C., Serrano 121, Madrid E-28006 (Spain); Hochlaf, M., E-mail: senent@iem.cfmac.csic.es, E-mail: hochlaf@univ-mlv.fr [Laboratoire de Modelisation et Simulation Multi Echelle, Universite Paris-Est, MSME UMR 8208 CNRS, 5 boulevard Descartes, F-77454 Marne-la-Vallee (France)
2013-05-01
We propose a general rule to distinguish between detectable and undetectable astronomical anions. We believe that only few anions live long enough in the interstellar medium and thus can be detected. Our method is based on quantum mechanical calculations capable of describing accurately the evolution of electronic states during chemical processes. The still not fully understood reactivity at low temperatures is discussed considering non-adiabatic effects. The role of excited states has usually been neglected in previous works which basically focused on the ground electronic state for interpretations of experimental observations. Here, we deal with unsaturated carbon chains (e.g., C{sub n} H{sup -}), which show a high density of electronic states close to their corresponding ground electronic states, complex molecular dynamics, and non-adiabatic phenomena. Our general rule shows that it is not sufficient that anions exist in the gas phase (in the laboratory) to be present in media such as astrophysical media, since formation and decomposition reactions of these anions may allow the population of anionic electronic states to autodetach, forming neutrals. For C{sub n} H, reactivity depends strongly on n, where long and short chains behave differently. Formation of linear chains is relevant.
A colorimetric tetrathiafulvalene-calix 4 pyrrole anion sensor
DEFF Research Database (Denmark)
Nielsen, K. A.
2012-01-01
The interaction and colorimetric sensing properties of a tetrathiafulvalene substituted calix[4]pyrrole sensor with anions were investigated using H-1 NMR and absorption spectroscopic techniques. Visual color changes were observed upon addition of different anions (Cl-, Br-, CN-, and Ac......O-) to a solution of the sensor. (C) 2012 Elsevier Ltd. All rights reserved....
Superoxide anion production by human neutrophils activated by Trichomonas vaginalis.
Song, Hyun-Ouk; Ryu, Jae-Sook
2013-08-01
Neutrophils are the predominant inflammatory cells found in vaginal discharges of patients infected with Trichomonas vaginalis. In this study, we examined superoxide anion (O2 (.-)) production by neutrophils activated by T. vaginalis. Human neutrophils produced superoxide anions when stimulated with either a lysate of T. vaginalis, its membrane component (MC), or excretory-secretory product (ESP). To assess the role of trichomonad protease in production of superoxide anions by neutrophils, T. vaginalis lysate, ESP, and MC were each pretreated with a protease inhibitor cocktail before incubation with neutrophils. Superoxide anion production was significantly decreased by this treatment. Trichomonad growth was inhibited by preincubation with supernatants of neutrophils incubated for 3 hr with T. vaginalis lysate. Furthermore, myeloperoxidase (MPO) production by neutrophils was stimulated by live trichomonads. These results indicate that the production of superoxide anions and MPO by neutrophils stimulated with T. vaginalis may be a part of defense mechanisms of neutrophils in trichomoniasis.
Anionic 11-mercaptoundecanoic acid capped ZnO nanoparticles
Energy Technology Data Exchange (ETDEWEB)
Šimšíková, Michaela, E-mail: michaela.simsikova@ceitec.vutbr.cz [CEITEC BUT, Brno University of Technology, Technická 10, 616 69 Brno (Czech Republic); Antalík, Marián [Department of Biochemistry, Faculty of Science, P.J. Šafárik University, Šrobárova 2, 041 54 Košice (Slovakia); Department of Biophysics, Institute of Experimental Physics, SAS, Watsonova 47, 040 01 Košice (Slovakia); Kaňuchová, Mária; Škvarla, Jiří [Institute of Montaneous Sciences and Environmental Protection, Faculty of Mining, Ecology, Process Control and Geotechnologies, Technical University of Košice, Park Komenského 19, 043 84 Košice (Slovakia)
2013-10-01
The anionic zinc oxide nanoparticles have been prepared at room temperature by a precipitation method using ZnCl{sub 2} and NaOH and surface modification with 11-mercaptoundecanoic acid (MUA). Atomic force microscopy (AFM) was used for definition of morphology and size of prepared nanoparticles which was proved by measurements of particle size distribution using Zetasizer. Successful coating with MUA as surfactant was acknowledged by X-ray photoelectron spectroscopy and ATR FT-IR spectroscopy. The isoelectric point (IEP) of ZnO–MUA nanoparticles was obtained by measurements of zeta potential and FT-IR dependence on pH; the obtained value was approximately 3.58. The value of exchanged protons was 2.88 which indicates a positive binding cooperativity of modified nanoparticles.
Wigger, Cornelia; Van Loon, Luc R
2018-06-01
The effect of the pore water composition on the diffusive anion transport was studied for two different argillaceous, low permeability sedimentary rocks, Opalinus Clay (OPA) and Helvetic Marl (HM). The samples were saturated with different solutions with varying molar concentration and different main cations in the solution: NaCl based pore solutions and CaCl 2 based pore solutions. The total porosity was measured by through-diffusion experiments with the neutral tracer HTO. Experiments performed in NaCl solutions resulted in a porosity of 0.12 for OPA and 0.03 for HM, and are consistent with results of the experiments in CaCl 2 solutions. The total porosity was independent of the molar concentration, in contrast to the measured anion porosity, which increased with increasing molar concentration. It could further be observed that the pore solution based on the bivalent cation calcium shielded the negative surface charge stronger than the monovalent cation sodium, resulting in a larger measureable anion-accessible porosity in the case of CaCl 2 solutions. The data was modelled based on an adapted Donnan approach of Birgersson and Karnland (2009). The model had to be adjusted with a permanent free, uncharged porosity, as well as with structural information on the permanent anion exclusion because of so-called bottleneck pores. Both parameters can only be evaluated from experiments. Nevertheless, taking these two adaptions into account, the effect of varying pore water compositions on the anion-accessible porosity of the investigated argillaceous rocks could be satisfactorily described. Copyright © 2018 Elsevier B.V. All rights reserved.
Wigger, Cornelia; Van Loon, Luc R.
2018-06-01
The effect of the pore water composition on the diffusive anion transport was studied for two different argillaceous, low permeability sedimentary rocks, Opalinus Clay (OPA) and Helvetic Marl (HM). The samples were saturated with different solutions with varying molar concentration and different main cations in the solution: NaCl based pore solutions and CaCl2 based pore solutions. The total porosity was measured by through-diffusion experiments with the neutral tracer HTO. Experiments performed in NaCl solutions resulted in a porosity of 0.12 for OPA and 0.03 for HM, and are consistent with results of the experiments in CaCl2 solutions. The total porosity was independent of the molar concentration, in contrast to the measured anion porosity, which increased with increasing molar concentration. It could further be observed that the pore solution based on the bivalent cation calcium shielded the negative surface charge stronger than the monovalent cation sodium, resulting in a larger measureable anion-accessible porosity in the case of CaCl2 solutions. The data was modelled based on an adapted Donnan approach of Birgersson and Karnland (2009). The model had to be adjusted with a permanent free, uncharged porosity, as well as with structural information on the permanent anion exclusion because of so-called bottleneck pores. Both parameters can only be evaluated from experiments. Nevertheless, taking these two adaptions into account, the effect of varying pore water compositions on the anion-accessible porosity of the investigated argillaceous rocks could be satisfactorily described.
International Nuclear Information System (INIS)
Adachi, Tetsurou; Sawa, Toshio; Shindoh, Toshikazu.
1989-01-01
The filtration performance of mixed filter aid consisting of powdered anion and cation exchange resins used in the precoat filter is closely related to the characteristics of floc formation. The physical, chemical and electrochemical properties of powdered ion exchange resin were measured and the factors related to floc formation of anion and cation exchange resin were investigated by measuring the specific settle volume of resin floc as an evaluating index. It was found that these factors were mixing ratio, nature of resins and particle size of resins. In addition, it was assumed on the bases of these results that the amount of resin floc was related to sum of the surface electric charges of both resins. The filling ratio of resin floc was related to their product by multiplication and an experimental expression was obtained. The specific settle volume of resin floc could then be simulated by particle size, surface area, ion exchange capacity and degree of ionization of the powdered ion exchange resin. (author)
Energy Technology Data Exchange (ETDEWEB)
Adachi, Tetsurou (Nitto Denko Corp., Ibaraki, Osaka (Japan)); Sawa, Toshio; Shindoh, Toshikazu
1989-09-01
The filtration performance of mixed filter aid consisting of powdered anion and cation exchange resins used in the precoat filter is closely related to the characteristics of floc formation. The physical, chemical and electrochemical properties of powdered ion exchange resin were measured and the factors related to floc formation of anion and cation exchange resin were investigated by measuring the specific settle volume of resin floc as an evaluating index. It was found that these factors were mixing ratio, nature of resins and particle size of resins. In addition, it was assumed on the bases of these results that the amount of resin floc was related to sum of the surface electric charges of both resins. The filling ratio of resin floc was related to their product by multiplication and an experimental expression was obtained. The specific settle volume of resin floc could then be simulated by particle size, surface area, ion exchange capacity and degree of ionization of the powdered ion exchange resin. (author).
High Vacuum Techniques for Anionic Polymerization
Ratkanthwar, Kedar
2015-09-01
Anionic polymerization high vacuum techniques (HVTs) are the most suitable for the preparation of polymer samples with well-defined complex macromolecular architectures. Though HVTs require glassblowing skill for designing and making polymerization reactor, it is the best way to avoid any termination of living polymers during the number of steps for the synthesis of polymers with complex structure. In this chapter, we describe the different polymerization reactors and HVTs for the purification of monomers, solvents, and other reagents for anionic polymerization as well as few model reactions for the synthesis of polymers with simple to complex structure.
Effect of chemical retention on anionic species diffusion in compacted clays
International Nuclear Information System (INIS)
Bazer-Bachi, Frederic
2005-01-01
Anionic radioisotopes are of particular importance within the framework of the calculated health risk associated with high-level and long-lived intermediate-level underground radioactive waste disposal. Therefore, the objective of this work is the construction of a transport model coupled with chemistry in order to quantify the behaviour of anionic solutes in the Callovo-Oxfordian (CO_x) argillite, the argillaceous host rock of the ANDRA Meuse/Haute-Marne underground laboratory. An experimental methodology was defined to characterize this migration, several experimental methods being implemented: batch experiments, laboratory columns and through-diffusion cells. The study of the diffusion of the non-sorbing anionic tracer "3"6Cl"- highlighted the fact that, due to anionic exclusion, anions only had access to a part of the porosity. The retention of "3"5SO_4"2"- and "1"2"5I- on CO_x argillite was then characterized, quantified by batch experiments and confirmed by other experimental methods. Nevertheless, their migration was less retarded than expected by a model based on batch experiments and on "3"6Cl"- diffusive data. This difference was explained by anion exclusion which reduced sorption site accessibility. Thus, the intensity of this phenomenon has to be considered to model anion migration in compacted clays. (author) [fr
Derivatives of Dodecahalo-Closo-Dodecaborate Di-Anion
Avelar, Amy Cindy
2009-01-01
ABSTRACT OF THE DISSERTATIONDerivatives of the Dodecahalo-Closo-Dodecaborate Di-AnionbyAmy AvelarDoctor of Philosophy, Graduate Program in ChemistryUniversity of California, Riverside, December 2009Dr. Christopher A. Reed, ChairpersonThe di-anion, dodecahalo-closo-dodecaborate, B12X122-, where the X = Cl or Br, has been determined to be a useful weakly coordinating anion, WCA. Despite the di- negative charge, several elusive and reactive cationic species were stabilized with B12X122- as the c...
Determination of Anionic Detergent Concentration of Karasu Stream in Sinop (Turkey
Directory of Open Access Journals (Sweden)
Ayşe Gündoğdu
2018-02-01
Full Text Available The study was achieved between May 2014 and April 2015 at the Karasu Creek located in the province of Sinop. It was conducted to determine anionic detergent pollution and some physicochemical properties (pH, temperature, conductivity, salinity, dissolved oxygen, total hardness, chemical oxygen demand, phosphate PO4-3, total nitrogen. The anionic detergent concentration of the stations was determined on a monthly basis. Seasonally averaged values of the anionic detergent was measured as the highest value in the autumn season. The lowest values of anionic detergent were found in stations in winter and spring. The increase in the concentration of anionic detergent is caused by population growth in residential areas, increased agricultural activities and rains, and that chemicals move to riverbed from terrestrial areas with rain water.
Detection of cyanide anion by zinc porphyrin-spiropyran dyad
Energy Technology Data Exchange (ETDEWEB)
Kho, Young Min; Hur, Dae Young; Shin, Eun Ju [Dept. of Chemistry, Sunchon National University, Suncheon (Korea, Republic of)
2016-10-15
Versatile methods of the sensitive and selective detection for cyanide anion to monitor toxic cyanide have been developed. These include colorimetric, colorimetric, chromatographic, and electrochemical analyses. Among those methods for cyanide detection, optical methods based on absorption and fluorescence spectroscopy are relatively simple, inexpensive, and sensitive. A number of organic sensors for cyanide anion have been designed and synthesized. Absorption and/or fluorescence spectra of these sensors are changed by forming coordination complex or bonding covalently with cyanide. Compared with other anions, cyanide anion has some characteristic properties, such as its strong nucleophilicity and high binding affinity toward metal ions, and is superior and useful for the development of the sensors. Both covalent bond-based sensors and coordination complex-based sensors have been developed for cyanide detection. The results indicate that ZnP-SP plays a role as a CN{sup -} selective, colorimetric sensor either without or with UV irradiation.
Detection of cyanide anion by zinc porphyrin-spiropyran dyad
International Nuclear Information System (INIS)
Kho, Young Min; Hur, Dae Young; Shin, Eun Ju
2016-01-01
Versatile methods of the sensitive and selective detection for cyanide anion to monitor toxic cyanide have been developed. These include colorimetric, colorimetric, chromatographic, and electrochemical analyses. Among those methods for cyanide detection, optical methods based on absorption and fluorescence spectroscopy are relatively simple, inexpensive, and sensitive. A number of organic sensors for cyanide anion have been designed and synthesized. Absorption and/or fluorescence spectra of these sensors are changed by forming coordination complex or bonding covalently with cyanide. Compared with other anions, cyanide anion has some characteristic properties, such as its strong nucleophilicity and high binding affinity toward metal ions, and is superior and useful for the development of the sensors. Both covalent bond-based sensors and coordination complex-based sensors have been developed for cyanide detection. The results indicate that ZnP-SP plays a role as a CN"- selective, colorimetric sensor either without or with UV irradiation
Adsorption of an anionic dispersant on lignite
Energy Technology Data Exchange (ETDEWEB)
Yavuz, R.; Kucukbayrak, S. [Istanbul Technical University, Istanbul (Turkey). Dept. of Chemical Engineering, Chemical & Metallurgical Engineering Faculty
2001-12-01
Since coal is not a homogeneous substance but a mixture of carbonaceous materials and mineral matter, it has a variety of surface properties. Therefore, it is not easy to control the properties of coal suspensions by simply adjusting variables, such as pH and/or electrolyte. A chemical agent needs to be added to control the properties of the coal suspensions. The adsorption behavior of an anionic dispersant in the presence of a wetting agent using some Turkish lignite samples was investigated. The effects of dispersant concentration, temperature and pH on the dispersant adsorption were studied systematically, and the experimental results are presented. Pellupur B69 as a dispersant, commercial mixture of formaldehyde condensate sodium salt of naphthalene sulphonic acid, and Texapon N{sub 2}5 as a wetting agent, a sodium lauryl ether sulfate, have been used.
AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions.
Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej
2005-05-04
The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.
AT Base Pair Anions vs. (9-methyl-A)(1-methyl-T) Base Pair Anions
International Nuclear Information System (INIS)
Radisic, Dunja; Bowen, Kit H.; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej S.
2005-01-01
The anionic base pairs of adenine and thymine, (AT)-, and 9-methyladenine and 1-methylthymine, (MAMT)-, have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)- found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration that was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)- was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)- and a resulting (MAMT)- configuration that wa s either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)- occurred at a completely different electron binding energy than had (AT)-. Moreover, the VDE value of (MAMT)- was in agreement with that predicted by theory. The configuration of (MAMT)- and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced damage, BFPT in the WC/HS configurations of (AT)- is not feasible
Identification of inorganic anions by gas chromatography/mass spectrometry.
Sakayanagi, Masataka; Yamada, Yaeko; Sakabe, Chikako; Watanabe, Kunio; Harigaya, Yoshihiro
2006-03-10
Inorganic anions were identified by using gas chromatography/mass spectrometry (GC/MS). Derivatization of the anions was achieved with pentafluorobenzyl p-toluenesulphonate (PFB-Tos) as the reaction reagent and a crown ether as a phase transfer catalyst. When PFB-Br was used as the reaction reagent, the retention time of it was close to those of the derivatized inorganic anions and interfered with the analysis. In contrast, the retention time of PFB-Tos differed greatly from the PFB derivatives of the inorganic anions and the compounds of interest could be detected without interference. Although the PFB derivatives of SO4, S2O3, CO3, ClO4, and ClO3 could not be detected, the derivatives of F, Cl, Br, I, CN, OCN, SCN, N3, NO3, and NO2 were detected using PFB-Tos as the derivatizing reagent. The inorganic anions were detectable within 30 ng approximately, which is of sufficient sensitivity for use in forensic chemistry. Accurate mass number was measured for each PFB derivative by high-resolution mass spectrometry (HRMS) within a measurement error of 2 millimass units (mmu), which allowed determination of the compositional formula from the mass number. In addition, actual analysis was performed successively by our method using trial samples of matrix.
Surface tension of compositions of polyhexametyleneguanidine hydrochloride - surfactants
Directory of Open Access Journals (Sweden)
S. Kumargaliyeva
2012-12-01
Full Text Available We made up songs bactericidal polyhexamethyleneguanidine hydrochloride (metacyde with the surface-active substances - anionic sodium dodecylsulfate, cationic cetylpyridinium bromide, and nonionic Tween-80 and measured the surface tension of water solutions. The study showed that the composition metacyde with surface-active agents have a greater surface activity than the individual components.
Adsorption of iodide and iodate on colloidal silver surface
International Nuclear Information System (INIS)
Zhang Aiping; Tie Xiaoyun; Zhang Jinzhi; An Yanwei; Li Lingjie
2008-01-01
'Chemically pure' silver colloids were prepared by laser ablated method to investigate their adsorption-induced spectral and morphologic changes, using UV-visible absorption, Raman and transmission electron microscopy (TEM) techniques, when nucleophilic different anions (IO 3 - and I - ) were added into sols. It reveals that the adsorption of nucleophiles on silver surfaces leads to an excess negative charge in the metal interior and modifies both surface charge density and the Fermi levels of metal, which is responsible for the colloidal aggregation, reconstruction and appearance of new resonance absorption bands or with wavelength shift. In addition, two models regarding different adsorption effects of these two anions on silver surfaces were proposed to explain their variant spectral and TEM phenomena.
Changes in plasma osmolality and anion gap: potential predictors of ...
African Journals Online (AJOL)
Changes in plasma osmolality and anion gap: potential predictors of ... PROMOTING ACCESS TO AFRICAN RESEARCH ... Objective: To determine the relationship of mortality to plasma osmolality and anion gap inpatients on haemodialysis.
Schlenk Techniques for Anionic Polymerization
Ratkanthwar, Kedar; Zhao, Junpeng; Zhang, Hefeng; Hadjichristidis, Nikolaos; Mays, Jimmy
2015-01-01
Anionic polymerization-high vacuum techniques (HVTs) are doubtlessly the most prominent and reliable experimental tools to prepare polymer samples with well-defined and, in many cases, complex macromolecular architectures. Due to the high demands
Urban Land: Study of Surface Run-off Composition and Its Dynamics
Palagin, E. D.; Gridneva, M. A.; Bykova, P. G.
2017-11-01
The qualitative composition of urban land surface run-off is liable to significant variations. To study surface run-off dynamics, to examine its behaviour and to discover reasons of these variations, it is relevant to use the mathematical apparatus technique of time series analysis. A seasonal decomposition procedure was applied to a temporary series of monthly dynamics with the annual frequency of seasonal variations in connection with a multiplicative model. The results of the quantitative chemical analysis of surface wastewater of the 22nd Partsjezd outlet in Samara for the period of 2004-2016 were used as basic data. As a result of the analysis, a seasonal pattern of variations in the composition of surface run-off in Samara was identified. Seasonal indices upon 15 waste-water quality indicators were defined. BOD (full), suspended materials, mineralization, chlorides, sulphates, ammonium-ion, nitrite-anion, nitrate-anion, phosphates (phosphorus), iron general, copper, zinc, aluminium, petroleum products, synthetic surfactants (anion-active). Based on the seasonal decomposition of the time series data, the contribution of trends, seasonal and accidental components of the variability of the surface run-off indicators was estimated.
A Simple Halide-to-Anion Exchange Method for Heteroaromatic Salts and Ionic Liquids
Directory of Open Access Journals (Sweden)
Neus Mesquida
2012-04-01
Full Text Available A broad and simple method permitted halide ions in quaternary heteroaromatic and ammonium salts to be exchanged for a variety of anions using an anion exchange resin (A− form in non-aqueous media. The anion loading of the AER (OH− form was examined using two different anion sources, acids or ammonium salts, and changing the polarity of the solvents. The AER (A− form method in organic solvents was then applied to several quaternary heteroaromatic salts and ILs, and the anion exchange proceeded in excellent to quantitative yields, concomitantly removing halide impurities. Relying on the hydrophobicity of the targeted ion pair for the counteranion swap, organic solvents with variable polarity were used, such as CH3OH, CH3CN and the dipolar nonhydroxylic solvent mixture CH3CN:CH2Cl2 (3:7 and the anion exchange was equally successful with both lipophilic cations and anions.
Sorption of Pu(IV) from nitric acid by bifunctional anion-exchange resins
International Nuclear Information System (INIS)
Bartsch, R.A.; Zhang, Z.Y.; Elshani, S.; Zhao, W.; Jarvinen, G.D.; Barr, M.E.; Marsh, S.F.; Chamberlin, R.M.
1999-01-01
Anion exchange is attractive for separating plutonium because the Pu(IV) nitrate complex is very strongly sorbed and few other metal ions form competing anionic nitrate complexes. The major disadvantage of this process has been the unusually slow rate at which the Pu(IV) nitrate complex is sorbed by the resin. The paper summarizes the concept of bifunctional anion-exchange resins, proposed mechanism for Pu(IV) sorption, synthesis of the alkylating agent, calculation of K d values from Pu(IV) sorption results, and conclusions from the study of Pu(IV) sorption from 7M nitric acid by macroporous anion-exchange resins including level of crosslinking, level of alkylation, length of spacer, and bifunctional vs. monofunctional anion-exchange resins
Density and surface tension of ionic liquids.
Kolbeck, C; Lehmann, J; Lovelock, K R J; Cremer, T; Paape, N; Wasserscheid, P; Fröba, A P; Maier, F; Steinrück, H-P
2010-12-30
We measured the density and surface tension of 9 bis[(trifluoromethyl)sulfonyl]imide ([Tf(2)N](-))-based and 12 1-methyl-3-octylimidazolium ([C(8)C(1)Im](+))-based ionic liquids (ILs) with the vibrating tube and the pendant drop method, respectively. This comprehensive set of ILs was chosen to probe the influence of the cations and anions on density and surface tension. When the alkyl chain length in the [C(n)C(1)Im][Tf(2)N] series (n = 1, 2, 4, 6, 8, 10, 12) is increased, a decrease in density is observed. The surface tension initially also decreases but reaches a plateau for alkyl chain lengths greater than n = 8. Functionalizing the alkyl chains with ethylene glycol groups results in a higher density as well as a higher surface tension. For the dependence of density and surface tension on the chemical nature of the anion, relations are only found for subgroups of the studied ILs. Density and surface tension values are discussed with respect to intermolecular interactions and surface composition as determined by angle-resolved X-ray photoelectron spectroscopy (ARXPS). The absence of nonvolatile surface-active contaminants was proven by ARXPS.
Villegas-Guzman, Paola; Hofer, Florian; Silva-Agredo, Javier; Torres-Palma, Ricardo A
2017-12-01
Taking ciprofloxacin (CIP) as a fluoroquinolone antibiotic model, this work explores the role of common anions (sulfate, nitrate, and chloride) during the application of photoelectro-Fenton (PEF) at natural pH to degrade this type of compound in water. The system was composed of an IrO 2 anode, Ti, or gas diffusion electrode (GDE) as cathode, Fe 2+ , and UV (254 nm). To determine the implications of these anions, the degradation pathway and efficiency of the PEF sub-processes (UV photolysis, anodic oxidation, and electro-Fenton at natural pH) were studied in the individual presence of the anions. The results highlight that degradation routes and kinetics are strongly dependent on electrolytes. When chloride and nitrate ions were present, indirect electro-chemical oxidation was identified by electro-generated HOCl and nitrogenated oxidative species, respectively. Additionally, direct photolysis and direct oxidation at the anode surface were identified as degradation routes. As a consequence of the different pathways, six primary CIP by-products were identified. Therefore, a scheme was proposed representing the pathways involved in the degradation of CIP when submitted to PEF in water with chloride, nitrate, and sulfate ions, showing the complexity of this process. Promoted by individual and synergistic actions of this process, the PEF system leads to a complete elimination of CIP with total removal of antibiotic activity against Staphylococcus aureus and Escherichia coli, and significant mineralization. Finally, the role of the anions was tested in seawater containing CIP, in which the positive contributions of the anions were partially suppressed by its OH radical scavenger action. The findings are of interest for the understanding of the degradation of antibiotics via the PEF process in different matrices containing sulfate, nitrate, and chloride ions.
Energy Technology Data Exchange (ETDEWEB)
Adachi, Tetsurou (Nitto Denko Corp., Ibaraki, Osaka (Japan)); Sawa, Toshio; Shindoh, Toshikazu
1989-09-01
The filtration performance of mixed filter aid consisting of powdered anion and cation exchange resins used in the precoat filter is closely related to the characteristics of resin floc dispersion. The factors related to resin floc dispersion of anion and cation exchange resin were investigated by measuring the specific settle volume of resin floc as an evaluating index in addition to the measurement of physical, chemical and electrochemical properties of powdered ion exchange resin. The effect of adsorption of iron oxide and polymer electrolyte and of ion exchange were determined. In addition, considered floc dispersion with adsorbing iron oxide, it was assumed that the amount and filling ratio of resin floc were related to summation and multiplication of surface electric charge respectively. An experimental expression was obtained for simulation of the change of specific settle volume of resin floc by particle size, surface area, ion exchange capacity and degree of ionization of the powdered ion exchange resin. (author).
International Nuclear Information System (INIS)
Adachi, Tetsurou; Sawa, Toshio; Shindoh, Toshikazu.
1989-01-01
The filtration performance of mixed filter aid consisting of powdered anion and cation exchange resins used in the precoat filter is closely related to the characteristics of resin floc dispersion. The factors related to resin floc dispersion of anion and cation exchange resin were investigated by measuring the specific settle volume of resin floc as an evaluating index in addition to the measurement of physical, chemical and electrochemical properties of powdered ion exchange resin. The effect of adsorption of iron oxide and polymer electrolyte and of ion exchange were determined. In addition, considered floc dispersion with adsorbing iron oxide, it was assumed that the amount and filling ratio of resin floc were related to summation and multiplication of surface electric charge respectively. An experimental expression was obtained for simulation of the change of specific settle volume of resin floc by particle size, surface area, ion exchange capacity and degree of ionization of the powdered ion exchange resin. (author)
Sorption of vanillin on highly basic anion exchanger under static conditions
Sholokhova, A. Yu.; Eliseeva, T. V.; Voronyuk, I. V.
2017-11-01
The kinetics of the sorption of vanillin by a granulated anion exchanger is studied under static conditions. A comparison of the kinetic curves of the uptake of hydroxybenzaldehyde by gel and macroporous anion exchanger shows that macroporous sorbent has better kinetic characteristics. The effect temperature has on the capacity of an anion exchanger and the time needed to establish sorption equilibrium is found, and the activation energy of vanillin uptake is determined. Studying the effect experimental factors have on the rate of sorption and using the formal kinetics approach, it is established that in the investigated range of concentrations, the limiting stage of the uptake of vanillin by an anion exchanger with the functional groups of a quaternary ammonium base is that of external diffusion. Vanillin sorption by a highly basic anion exchanger in hydroxyl form is characterized by polymolecular uptake best described by a BET isotherm; at the same time, the uptake of sorbate by a chloride form is of a monomolecular character and can be described by a Freindlich isotherm. Structural changes in the anion exchanger sorbed hydroxybenzaldehyde are identified via FTIR spectroscopy.
Cell wall bound anionic peroxidases from asparagus byproducts.
Jaramillo-Carmona, Sara; López, Sergio; Vazquez-Castilla, Sara; Jimenez-Araujo, Ana; Rodriguez-Arcos, Rocio; Guillen-Bejarano, Rafael
2014-10-08
Asparagus byproducts are a good source of cationic soluble peroxidases (CAP) useful for the bioremediation of phenol-contaminated wastewaters. In this study, cell wall bound peroxidases (POD) from the same byproducts have been purified and characterized. The covalent forms of POD represent >90% of the total cell wall bound POD. Isoelectric focusing showed that whereas the covalent fraction is constituted primarily by anionic isoenzymes, the ionic fraction is a mixture of anionic, neutral, and cationic isoenzymes. Covalently bound peroxidases were purified by means of ion exchange chromatography and affinity chromatography. In vitro detoxification studies showed that although CAP are more effective for the removal of 4-CP and 2,4-DCP, anionic asparagus peroxidase (AAP) is a better option for the removal of hydroxytyrosol (HT), the main phenol present in olive mill wastewaters.
Effect of the alkyl chain length of the ionic liquid anion on polymer electrolytes properties
International Nuclear Information System (INIS)
Leones, Rita; Sentanin, Franciani; Nunes, Sílvia Cristina; Esperança, José M.S.S.; Gonçalves, Maria Cristina
2015-01-01
New polymer electrolytes (PEs) based on chitosan and three ionic liquid (IL) families ([C 2 mim][C n SO 3 ], [C 2 mim][C n SO 4 ] and [C 2 mim][diC n PO 4 ]) were synthesized by the solvent casting method. The effect of the length of the alkyl chain of the IL anion on the thermal, morphological and electrochemical properties of the PEs was studied. The solid polymer electrolytes SPE membranes were analyzed by differential scanning calorimetry (DSC), thermogravimetric analysis (TGA), X-ray diffraction (XRD), scanning electron microscopy (SEM), energy dispersive X-ray (EDX), polarized optical microscopy (POM), atomic force microscopy (AFM), complex impedance spectroscopy (ionic conductivity) and cyclic voltammetry (CV). The obtained results evidenced an influence of the alkyl chain length of the IL anion on the temperature of degradation, birefringence, surface roughness and ionic conductivity of the membranes. The DSC, XRD and CV results showed independency from the length of the IL-anion-alkyl chain. The PEs displayed an predominantly amorphous morphology, a minimum temperature of degradation of 135 °C, a room temperature (T = 25 °C) ionic conductivity of 7.78 × 10 −4 S cm −1 and a wide electrochemical window of ∼ 4.0 V.
Anion bridges drive salting out of a simple amphiphile from aqueous solution
International Nuclear Information System (INIS)
Bowron, D.T.; Finney, J.L.
2002-01-01
Neutron diffraction with isotope substitution has been used to determine the structural changes that occur on the addition of a simple salting-out agent to a dilute aqueous alcohol solution. The striking results obtained demonstrate a relatively simple process occurs in which interamphiphile anionic salt bridges are formed between the polar groups of the alcohol molecules. These ion bridges drive an increase in the exposure of the alcohol molecule nonpolar surface to the solvent water and hence point the way to their eventual salting out by the hydrophobic effect
Synthesis and characterization of cobalt ferrocyanides loaded on organic anion exchanger
Energy Technology Data Exchange (ETDEWEB)
Valsala, T.P. [Waste Management Division, Bhabha Atomic Research Centre, Trombay 400 085 (India)], E-mail: tpvalsala@yahoo.co.in; Joseph, Annie [Waste Management Division, Bhabha Atomic Research Centre, Trombay 400 085 (India); Shah, J.G. [Back End Technology Division, Bhabha Atomic Research Centre, Trombay 400 085 (India); Raj, Kanwar [Waste Management Division, Bhabha Atomic Research Centre, Trombay 400 085 (India); Venugopal, V. [Radiochemistry and Isotope Group, Bhabha Atomic Research Centre, Trombay 400 085 (India)
2009-02-15
Transition metal ferrocyanides have important applications in the selective removal of radioactive caesium from low level and intermediate level radioactive liquid waste streams. The microcrystalline nature of these materials renders them useless for application in column mode operations. Special preparation procedures have been developed to prepare granular solids by in situ precipitation of metal ferrocyanides on organic anion exchangers, which is suitable for column mode operations. The elemental compositions of the metal ferrocyanides precipitated inside the pores of anion exchanger were determined by analysing the dissolved samples using ICP-AES system and flame photometer. From the XRD and EDX analyses and the elemental composition of the synthesized materials, the nature of the compound formed inside the anion exchanger was found to be cobalt ferrocyanide. From SEM analysis of the samples, the particle size of the cobalt ferrocyanide precipitated inside the anion exchanger was found to be much less than that of cobalt ferrocyanide precipitated outside. The efficiency of these materials for removal of Cs was evaluated by measuring the distribution coefficient (Kd), ion exchange capacity and kinetics of Cs uptake. The Kd of the materials loaded on anion exchanger was found to be of the order of 10{sup 5} ml/g. The Cs uptake kinetics of the materials loaded on anion exchanger was slower than that of precipitated materials. The ion exchange capacity of the cobalt ferrocyanide loaded on anion exchanger was found to be much higher than that of the precipitated cobalt ferrocyanide.
(100) faceted anion voids in electron irradiated fluorite
International Nuclear Information System (INIS)
Johnson, E.
1979-01-01
High fluence electron irradiation of fluorite crystals in the temperature range 150 to 320 K results in formation of a simple cubic anion void superlattice. Above 320 K the damage structure changes to a random distribution of large [001] faceted anion voids. This voidage behaviour, similar to that observed in a range of irradiated metals, is discussed in terms points defect rather than conventional colour centre terminology. (Auth.)
Dibromine radical anion reactions with heme enzymes
International Nuclear Information System (INIS)
Gebicka, L.; Gebicki, J.L.
1996-01-01
Reactions of Br 2 radical anion with heme enzymes, catalase horseradish peroxidase, have been studied by pulse radiolysis. It has been found that Br 2 - does not react with the heme centre of investigated enzymes. Dibromine radical anion reacts with tryptophan residues of catalase without any influence on the activity of catalase. It is suggested that in pulse radiolysis studies, where horseradish peroxidase is at about tenfold excess toward Br 2 - , the enzyme is modified rather by Br 2 , than by Br 2 - . (author). 26 refs., 3 figs
Nitrate Anion Exchange in Pu-238 Aqueous Scrap Recovery Operations
International Nuclear Information System (INIS)
Pansoy-Hjelvik, M.E.; Silver, G.L.; Reimus, M.A.H.; Ramsey, K.B.
1999-01-01
Strong base, nitrate anion exchange (IX) is crucial to the purification of 238 Pu solution feedstocks with gross levels of impurities. This paper discusses the work involved in bench scale experiments to optimize the nitrate anion exchange process. In particular, results are presented of experiments conducted to (a) demonstrate that high levels of impurities can be separated from 238 Pu solutions via nitrate anion exchange and, (b) work out chemical pretreatment methodology to adjust and maintain 238 Pu in the IV oxidation state to optimize the Pu(IV)-hexanitrato anionic complex sorption to Reillex-HPQ resin. Additional experiments performed to determine the best chemical treatment methodology to enhance recovery of sorbed Pu from the resin, and VIS-NIR absorption studies to determine the steady state equilibrium of Pu(IV), Pu(III), and Pu(VI) in nitric acid are discussed
Two independent anion transport systems in rabbit mandibular salivary glands
DEFF Research Database (Denmark)
Novak, I; Young, J A
1986-01-01
Cholinergically stimulated Cl and HCO3 transport in perfused rabbit mandibular glands has been studied with extracellular anion substitution and administration of transport inhibitors. In glands perfused with HCO3-free solutions, replacement of Cl with other anions supported secretion in the foll......Cholinergically stimulated Cl and HCO3 transport in perfused rabbit mandibular glands has been studied with extracellular anion substitution and administration of transport inhibitors. In glands perfused with HCO3-free solutions, replacement of Cl with other anions supported secretion...... stimulated secretion by about 30%, but when infused in addition to furosemide (0.1 mmol/l), it inhibited by about 20%. Amiloride (1.0 mmol/l) caused no inhibition. The results suggest that there are at least three distinct carriers in the rabbit mandibular gland. One is a furosemide-sensitive Na-coupled Cl...
Hou, Xianfeng; Zeng, Fang; Du, Fangkai; Wu, Shuizhu
2013-08-23
Sulfide anions are generated not only as a byproduct from industrial processes but also in biosystems. Hence, robust fluorescent sensors for detecting sulfide anions which are fast-responding, water soluble and biocompatible are highly desirable. Herein, we report a carbon-dot-based fluorescent sensor, which features excellent water solubility, low cytotoxicity and a short response time. This sensor is based on the ligand/Cu(II) approach so as to achieve fast sensing of sulfide anions. The carbon dot (CD) serves as the fluorophore as well as the anchoring site for the ligands which bind with copper ions. For this CD-based system, as copper ions bind with the ligands which reside on the surface of the CD, the paramagnetic copper ions efficiently quench the fluorescence of the CD, affording the system a turn-off sensor for copper ions. More importantly, the subsequently added sulfide anions can extract Cu(2+) from the system and form very stable CuS with Cu(2+), resulting in fluorescence enhancement and affording the system a turn-on sensor for sulfide anions. This fast-responding and selective sensor can operate in totally aqueous solution or in physiological milieu with a low detection limit of 0.78 μM. It displays good biocompatibility, and excellent cell membrane permeability, and can be used to monitor S(2-) levels in running water and living cells.
Simultaneous anionic and cationic redox
Jung, Sung-Kyun; Kang, Kisuk
2017-12-01
It is challenging to unlock anionic redox activity, accompanied by full utilization of available cationic redox process, to boost capacity of battery cathodes. Now, material design by tuning the metal-oxygen interaction is shown to be a promising solution.
Migratory Insertion of Hydrogen Isocyanide in the Pentacyano(methyl)cobaltate(III) Anion
DEFF Research Database (Denmark)
Kofod, Pauli; Harris, Pernille Hanne; Larsen, Sine
2003-01-01
The preparation of the pentacyano(iminiumacetyl)cobaltate(III) anion and its N-methyl and N,N-dimethyl derivatives is reported. The iminiumacetyl group is formed by migratory insertion of cis hydrogen isocyanide in the pentacyano(methyl)cobaltate(III) anion. The new compounds have been spectrosco......The preparation of the pentacyano(iminiumacetyl)cobaltate(III) anion and its N-methyl and N,N-dimethyl derivatives is reported. The iminiumacetyl group is formed by migratory insertion of cis hydrogen isocyanide in the pentacyano(methyl)cobaltate(III) anion. The new compounds have been...
Dynamics of anion exchange of lanthanides in aqueous-organic complexing media
International Nuclear Information System (INIS)
Sheveleva, I.V.; Bogatyrev, I.O.
1987-01-01
Effect of organic solvents (ethanol, acetone, acetonitrile) on change in kinetic parameters of the anion exchange process (anion-exchange column chromatography) of r.e.e. (europium and gadolinium) in complexing nitric acid media has been studied. It is established that complex LnA 4 anion is the only sorbing form of europium and gadolinium on anionite. When the organic component content of the solution being the same, the dynamic parameters of lanthanide exchange have higher values in aqueous-acetonitrile and aqueous-acetone media in comparison with aqueous-enthanol solutions of nitric acid. Lesser mobility of complex lanthanide anions in aqueous-alcoholic solutions can be explained by stronger solvation in the presence of solvents with higher acceptor properties
Energy Technology Data Exchange (ETDEWEB)
Zhang, Zhiquan; Shi, Jun; Huang, Weimin, E-mail: huangwm@jlu.edu.cn
2015-10-01
In this paper, a kind of didodecyldimethylammonium bromide (DDAB) layer membranes was supported on a glassy carbon electrode (GCE). We studied the ion channel behavior of the supported bilayer lipid membrane by scanning electrochemical microscopy (SCEM) in tris(2,2′-bipyridine) ruthenium(II) solution. Perchlorate anion was used as a presence of stimulus and ruthenium(II) complex cations as the probing ions for the measurement of SECM, the lipid membrane channel was opened and exhibited the behavior of distinct SECM positive feedback curve. The channel was in a closed state in the absence of perchlorate anions while reflected the behavior of SECM negative feedback curve. The rates of electron transfer reaction in the lipid membranes surface were detected and it was dependant on the potential of SECM. - Highlights: • The rates of electron transfer reaction in the lipid membranes surface were detected. • Dynamic investigations of ion-channel behavior of supported bilayer lipid membranes by scanning electrochemical microscopy • A novel way to explore the interaction between molecules and supported bilayer lipid membranes.
The Influence of Salt Anions on Heavy Metal Ion Adsorption on the Example of Nickel
Mende, Mandy; Schwarz, Dana; Steinbach, Christine; Schwarz, Simona
2018-01-01
The biodegradable polysaccharide chitosan possesses protonated and natural amino groups at medium pH values and has therefore been used as an adsorbing material for nickel salts in water treatment. Nickel is a problematic heavy metal ion which can cause various diseases and disorders in living organisms. Here, we show the influence of oxyanions (e.g., nitrate and sulfate) to the adsorption of nickel ions. Hence, simultaneously we are addressing the increasing global problem of nitrate and sulfate ion pollution in groundwater and surface water. A series of adsorption experiments was carried out in order to determine (i) the adsorption equilibrium, (ii) the adsorption capacity in dependence on the initial nickel ion concentration, and (iii) the influence of the anion presented in solution for the adsorption capacity. Surface morphology of chitosan flakes before and after the adsorption process has been studied with SEM-EDX analysis. The chitosan flakes exhibited promising adsorption capacities of 81.9 mg·g−1 and 21.2 mg·g−1 for nickel (sulfate) and nickel (nitrate), respectively. The calculated values of Gibbs free energy change ΔG0 confirm the higher adsorption of nickel ions in presence of sulfate ions. Hence, higher anion valence leads to a higher adsorption capacity. PMID:29510485
Research on the Microstructure and Property of an Anion Rubber Modified Asphalt
Directory of Open Access Journals (Sweden)
Wei Hong
2013-01-01
Full Text Available The anion rubber modified asphalt (ARMA mixture was first successfully developed with a unique process. In the development process, rubber and asphalt were mixed in the same proportion. Furthermore, the microstructure and modification mechanism of the material were characterized by SEM, FT-IR, TG, and XRD tests. The mechanical property of the mixture was also tested in accordance with the relevant standards. In the end, the material’s capacity of releasing anion was measured by DLY-6A232 atmospheric ion gauge. The results indicated that the addition of anion additive into the rubber modified asphalt (RMA was a mere physical mixture, and the anion additives and rubber particles uniformly dispersed in the ARMA. The addition of anion additive could improve the thermal stability of the RMA. Compared with the traditional asphalt pavement material, the ARMA material shows excellent mechanical properties as well as the ability of releasing anion. Moreover, the material has enormous economic and social benefits by taking full advantage of a large amount of waste tires, thus improving the road surrounding environment.
Liljegren, Gustav; Pettersson, Jean; Markides, Karin E; Nyholm, Leif
2002-05-01
A method for the extraction, transfer and desorption of anions and cations under controlled potential conditions employing a new integrated three-electrode device is described. The device, containing working, reference and counter electrodes, was prepared from tubes that could be moved vertically with respect to each other. In this way, a small amount of solvent, held by capillary force, remained between the electrodes when the device was lifted out of a solution after an extraction. This design allowed the potential control to be maintained at all times. With the new integrated device, it was possible to perform potential controlled desorption into vials containing as little as 200 microl of solution. The required ion exchange capacity was obtained by electrodeposition of a polypyrrole coating on the surface of the glassy carbon working electrode. Solid-phase microextractions of several cations or anions were performed simultaneously under potentiostatic control by doping the polypyrrole coating with different anions such as perchlorate and p-toluenesulfonate. The efficiency of the extractions, which could be altered by varying the potential of the working electrode, could be increased by 150 to 200% compared to extractions using normal solid-phase microextraction conditions under open circuit conditions. A constant potential of +1.0 V and -0.5 V with respect to the silver pseudo reference electrode, was found to be well-suited for the extraction of samples containing ppm concentrations of anions (chloride, nitrite, bromide, nitrate, sulfate and phosphate) and cations (cadmium, cobalt and zinc), respectively.
Deng, Shubo; Ting, Yen Peng
2005-11-01
Heavy metal pollution in the aqueous environment is a problem of global concern. Biosorption has been considered as a promising technology for the removal of low levels of toxic metals from industrial effluents and natural waters. A modified fungal biomass of Penicillium chrysogenum with positive surface charges was prepared by grafting polyethylenimine (PEI) onto the biomass surface in a two-step reaction. The presence of PEI on the biomass surface was verified by FTIR and X-ray photoelectron spectroscopy (XPS) analyses. Due to the high density of amine groups in the long chains of PEI molecules on the surface, the modified biomass was found to possess positive zeta potential at pH below 10.4 as well as high sorption capacity for anionic Cr(VI). Using the Langmuir adsorption isotherm, the maximum sorption capacity for Cr(VI) at a pH range of 4.3-5.5 was 5.37 mmol/g of biomass dry weight, the highest sorption capacity for Cr(VI) compared to other sorbents reported in the literature. Scanning electronic microscopy (SEM) provided evidence of chromium aggregates formed on the biomass surface. XPS results verified the presence of Cr(III) on the biomass surface in the pH range 2.5-10.5, suggesting that some Cr(VI) anions were reduced to Cr(III) during the sorption. The sorption kinetics indicated that redox reaction occurred on the biomass surface, and whether the converted Cr(III) ions were released to solution or adsorbed on the biomass depended on the solution pH. Sorption mechanisms including electrostatic interaction, chelation, and precipitation were found to be involved in the complex sorption of chromium on the PEI-modified biomass.
International Nuclear Information System (INIS)
Daud, M.; Khan, Z.; Ashgar, A.; Danish, M. I.; Qazi, I. A.
2015-01-01
This research work was carried out for the removal of nitrate from raw water for a drinking water supply. Nitrate is a widespread ground water contaminant. Methodology employed in this study included adsorption on metal based nanoparticles and ion exchange using anionic resins. Fe/Pt bimetallic nanoparticles were prepared in the laboratory, by the reduction of their respective salts using sodium borohydride. Scanning electron microscope, X-ray diffraction, energy dispersive spectrometry, and X-ray florescence techniques were utilized for characterization of bimetallic Fe/Pt nanoparticles. Optimum dose, ph, temperature, and contact time were determined for removal through batch tests, both for metal based nanoparticles and anionic exchange resin. Adsorption data fitted well the Langmuir isotherm and conformed to the pseudo first-order kinetic model. Results indicated 97% reduction in nitrate by 0.25 mg/L of Fe/Pt nanoparticles at ph 7 and 83% reduction in nitrate was observed using 0.50 mg/L anionic exchange resins at ph 4 and contact time of one hour. Overall, Fe/Pt bimetallic nanoparticles demonstrated greater removal efficiency due to the small particle size, extremely large surface area (627 m 2 /g), and high adsorption capacity.
Energy Technology Data Exchange (ETDEWEB)
Voitovich, A.P., E-mail: voitovich@imaph.bas-net.by; Kalinov, V.S.; Stupak, A.P.; Novikov, A.N.; Runets, L.P.
2015-01-15
Lithium fluoride nanocrystals are irradiated by gamma quanta at 77 K. The radiation color centers formed in a near-surface layer of nanocrystals are studied. Absorption, luminescence and luminescence excitation spectra of the surface defects have been measured. It has been found that the luminescence excitation spectra for aggregated surface centers consist of two or three bands with not very much different intensities. Reactions of the surface centers separately with electrons and with anion vacancies have been investigated. Numbers of anion vacancies and electrons entering into the centers composition have been established and it has been found that F{sub S1}, F{sub S1}{sup −}, F{sub S2}, F{sub S2}{sup −}, F{sub S3}{sup +} and F{sub S3} types of the surface centers are formed. The degree of luminescence polarization has been defined and it has been determined that the polarization degree for F{sub S2}{sup +} centers changes sign under transition from one excitation band to another. It has been shown that during irradiation at 77 K radiation-induced defects are formed more efficiently on the surface than in the bulk. - Highlights: • Radiative color centers were fabricated in lithium fluoride nanocrystals. • The unique absorption and luminescence characteristics are inherent in the centers. • The reactions of these centers with electrons and anion vacancies were studied. • The degree of luminescence polarization was defined. • Numbers of anion vacancies and electrons forming the centers were established.
In vitro and in vivo anti-malarial activity of Boerhavia elegans and Solanum surattense
Directory of Open Access Journals (Sweden)
Khodakarim Nastaran
2010-05-01
Full Text Available Abstract Background There is an urgent need to identify new anti-malarial drug targets for both prophylaxis and chemotherapy, due to the increasing problem of drug resistance to malaria parasites. In the present study, the aim was to discover novel, effective plant-based extracts for the activity against malaria. Methods Ten plants found in Iran were selected by ethnobotanical survey of medicinal plants. The crude ethanolic extracts were tested for in vitro anti-plasmodial activity against two strains of Plasmodium falciparum: K1 (chloroquine-resistant strain and CY27 (chloroquine-sensitive strain, using the parasite lactate dehydrogenase (pLDH assay. The anti-plasmodial activity of the extracts was also assessed in the 4-day suppressive anti-malarial assay in mice inoculated with Plasmodium berghei (ANKA strain. Crude ethanolic extracts showed good anti-plasmodial activity were further fractionated by partitioning in water and dichloromethane. Results Of 10 plant species assayed, three species: Boerhavia elegans (Choisy, Solanum surattense (Burm.f. and Prosopis juliflora (Sw. showed promising anti-plasmodial activity in vitro (IC50 ≤ 50 μg/ml and in vivo with no toxicity. The dichloromethane fraction of three extracts revealed stronger anti-plasmodial activity than the total extracts. Conclusion Anti-plasmodial activities of extracts of B. elegans and S. surattense are reported for the first time.
In vitro and in vivo anti-malarial activity of Boerhavia elegans and Solanum surattense
2010-01-01
Background There is an urgent need to identify new anti-malarial drug targets for both prophylaxis and chemotherapy, due to the increasing problem of drug resistance to malaria parasites. In the present study, the aim was to discover novel, effective plant-based extracts for the activity against malaria. Methods Ten plants found in Iran were selected by ethnobotanical survey of medicinal plants. The crude ethanolic extracts were tested for in vitro anti-plasmodial activity against two strains of Plasmodium falciparum: K1 (chloroquine-resistant strain) and CY27 (chloroquine-sensitive strain), using the parasite lactate dehydrogenase (pLDH) assay. The anti-plasmodial activity of the extracts was also assessed in the 4-day suppressive anti-malarial assay in mice inoculated with Plasmodium berghei (ANKA strain). Crude ethanolic extracts showed good anti-plasmodial activity were further fractionated by partitioning in water and dichloromethane. Results Of 10 plant species assayed, three species: Boerhavia elegans (Choisy), Solanum surattense (Burm.f.) and Prosopis juliflora (Sw.) showed promising anti-plasmodial activity in vitro (IC50 ≤ 50 μg/ml) and in vivo with no toxicity. The dichloromethane fraction of three extracts revealed stronger anti-plasmodial activity than the total extracts. Conclusion Anti-plasmodial activities of extracts of B. elegans and S. surattense are reported for the first time. PMID:20462416
The anionic basis of fluid secretion by the rabbit mandibular salivary gland
DEFF Research Database (Denmark)
Case, R M; Hunter, M; Novak, I
1984-01-01
The role played by anions in salivary secretion has been studied in experiments on the isolated, perfused mandibular gland of the rabbit, in which perfusate Cl- and/or HCO3- were replaced by other anions. Replacement of Cl- with Br- had no significant effect on salivary secretion rate, but replac......The role played by anions in salivary secretion has been studied in experiments on the isolated, perfused mandibular gland of the rabbit, in which perfusate Cl- and/or HCO3- were replaced by other anions. Replacement of Cl- with Br- had no significant effect on salivary secretion rate...
Using remote substituents to control solution structure and anion binding in lanthanide complexes
DEFF Research Database (Denmark)
Tropiano, Manuel; Blackburn, Octavia A.; Tilney, James A.
2013-01-01
A study of the anion-binding properties of three structurally related lanthanide complexes, which all contain chemically identical anion-binding motifs, has revealed dramatic differences in their anion affinity. These arise as a consequence of changes in the substitution pattern on the periphery ...
Ultra-small and anionic starch nanospheres: formation and vitro thrombolytic behavior study.
Huang, Yinjuan; Ding, Shenglong; Liu, Mingzhu; Gao, Chunmei; Yang, Jinlong; Zhang, Xinjie; Ding, Bin
2013-07-25
This paper is considered as the first report on the investigation of nattokinase (NK) release from anionic starch nanospheres. The ultra-small and anionic starch nanospheres were prepared by the method of reverse micro-emulsion crosslinking in this work. Starch nanospheres were characterized through Fourier transform infrared (FTIR) spectroscopy, scanning electron microscopy (SEM), transmission electron microscopy (TEM) and dynamic light scattering (DLS). Effects of preparation conditions on particle size were studied. The cytotoxicity, biodegradable and vitro thrombolytic behaviors of nattokinase (NK) loaded anionic starch nanospheres were also studied. The results showed that the anionic starch nanospheres are non-toxic, biocompatible and biodegradable. Moreover, the anionic starch nanospheres can protect NK from fast biodegradation hence prolongs the circulation in vivo and can reduce the risk of acute hemorrhage complication by decreasing the thrombolysis rate. Copyright © 2013 Elsevier Ltd. All rights reserved.
Simultaneous determination of inorganic and organic anions by ion chromatography
International Nuclear Information System (INIS)
Park, Yang Soon; Joe, Ki Soo; Han, Sun Ho; Park, Soon Dal; Choi, Kwang Soon
1999-06-01
Four methods were investigated for the simultaneous determination of several inorganic and organic anions in aqueous solution by ion chromatography. The first is two columns coupled system. The second is the gradient elution system with an anion exchange column. The third is the system with a mixed-mode stationary phase. The fourth is the system with an anion exchange column and the eluant of low conductivity without ion suppressor. The advantages and disadvantages of individual systems were discussed. The suitable methods were proposed for the application to the samples of the nuclear power industry and the environment. (author)
The absorption of plutonium by anion resins
Energy Technology Data Exchange (ETDEWEB)
Durham, R. W.; Mills, R.
1961-10-15
Equilibrium experiments have shown Pu{sup +4} to be absorbed from nitric acid onto an anion resin as a complex anion Pu(NO{sub 3}){sub 6}{sup -2}. The amount of absorption is dependent on the plutonium and nitric acid concentrations in the equilibrium solution with a maximum at 7N to 8N HNO{sub 3}. A low cross-linked resin has a higher capacity and reaches equilibrium more rapidly than the normally supplied resin. Saturation capacity of one per cent cross-linked Nalcite SBR (Dowex 1), 50 -- 100 mesh, is 385 mg Pu/gram dry resin. (author)
Partitioning of hydrophobic pesticides within a soil-water-anionic surfactant system.
Wang, Peng; Keller, Arturo A
2009-02-01
Surfactants can be added to pesticide-contaminated soils to enhance the treatment efficiency of soil washing. Our results showed that pesticide (atrazine and diuron) partitioning and desorbability within a soil-water-anionic surfactant system is soil particle-size dependent and is significantly influenced by the presence of anionic surfactant. Anionic surfactant (linear alkylbenzene sulphonate, LAS) sorption was influenced by its complexation with both the soluble and exchangeable divalent cations in soils (e.g. Ca2+, Mg2+). In this study, we propose a new concept: soil system hardness which defines the total amount of soluble and exchangeable divalent cations associated with a soil. Our results showed that anionic surfactant works better with soils having lower soil system hardness. It was also found that the hydrophobic organic compounds (HOCs) sorbed onto the LAS-divalent cation precipitate, resulting in a significant decrease in the aqueous concentration of HOC. Our results showed that the effect of exchangeable cations and sorption of HOC onto the surfactant precipitates needs to be considered to accurately predict HOC behavior within soil-water-anionic surfactant systems.
Preparation and characterization of novel anion phase change heat storage materials.
Hong, Wei; Lil, Qingshan; Sun, Jing; Di, Youbo; Zhao, Zhou; Yu, Wei'an; Qu, Yuan; Jiao, TiFeng; Wang, Guowei; Xing, Guangzhong
2013-10-01
In this paper, polyurethane phase change material was successfully prepared with TDI with BDO for hard segments and PEG for soft segments. Moreover, based on this the solid-solid phase change material, A-PCM1030 which can release anions was prepared with the successful addition of anion additives A1030 for the first time. Then the test of the above material was conducted utilizing FT-IR, DSC, TEM, WAXD and Air Ion Detector. The Results indicated that the polyurethane phase change material possesses excellent thermal stability since there was no appearance of liquid leakage and phase separation after 50 times warming-cooling thermal cycles. It also presented reversibility on absorbing and releasing heat. In addition, adding a little A1030 can increase the thermal stability and reduce phase transition temperatures, as well as reduce the undercooling of the polyurethane phase change material. In addition, the anion test results suggested that the supreme amount of anion released by A-PCM1030 could reach 2510 anions/cm3 under dynamic conditions, which is beneficial for human health.
Chubar, Natalia; Gerda, Vasyl; Banerjee, Dipanjan; Yablokova, Ganna
2016-01-01
In this work, we present material chemistry in the hydrothermal synthesis of new complex structure materials based on various dosage ratios of Fe and Ce (1:0, 2:1, 1:1, 1:2, 0:1), characterize them by the relevant methods that allow characterization of both crystalline and amorphous phases and correlate their structure/surface properties with the adsorptive performance of the five toxic anions. The applied synthesis conditions resulted in the formation of different compounds of Fe and Ce components. The Fe-component was dominated by various phases of Fe hydrous oxides, whereas the Ce-component was composed of various phases of Ce carbonates. The presence of two metal salts in raw materials resulted in the formation of a mesoporous structure and averaged the surface area compared to one metal-based material. The surface of all Fe-Ce composites was abundant in Fe component phases. Two-metal systems showed stronger anion removal performance than one-metal materials. The best adsorption was demonstrated by Fe-Ce based materials that had low crystallinity, that were rich in phases and that exhibited surfaces were abundant in greater number of surface functional groups. Notably, Fe extended fine structures simulated by EXAFS in these better adsorbents were rich from oscillations from both heavy and light atoms. This work provides new insights on the structure of composite inorganic materials useful to develop their applications in adsorption and catalysis. It also presents new inorganic anion exchangers with very high removal potential to fluoride and arsenate.
Chubar, Natalia
2016-10-24
In this work, we present material chemistry in the hydrothermal synthesis of new complex structure materials based on various dosage ratios of Fe and Ce (1:0, 2:1, 1:1, 1:2, 0:1), characterize them by the relevant methods that allow characterization of both crystalline and amorphous phases and correlate their structure/surface properties with the adsorptive performance of the five toxic anions. The applied synthesis conditions resulted in the formation of different compounds of Fe and Ce components. The Fe-component was dominated by various phases of Fe hydrous oxides, whereas the Ce-component was composed of various phases of Ce carbonates. The presence of two metal salts in raw materials resulted in the formation of a mesoporous structure and averaged the surface area compared to one metal-based material. The surface of all Fe-Ce composites was abundant in Fe component phases. Two-metal systems showed stronger anion removal performance than one-metal materials. The best adsorption was demonstrated by Fe-Ce based materials that had low crystallinity, that were rich in phases and that exhibited surfaces were abundant in greater number of surface functional groups. Notably, Fe extended fine structures simulated by EXAFS in these better adsorbents were rich from oscillations from both heavy and light atoms. This work provides new insights on the structure of composite inorganic materials useful to develop their applications in adsorption and catalysis. It also presents new inorganic anion exchangers with very high removal potential to fluoride and arsenate.
Expanding frontiers in materials chemistry and physics with multiple anions.
Kageyama, Hiroshi; Hayashi, Katsuro; Maeda, Kazuhiko; Attfield, J Paul; Hiroi, Zenji; Rondinelli, James M; Poeppelmeier, Kenneth R
2018-02-22
During the last century, inorganic oxide compounds laid foundations for materials synthesis, characterization, and technology translation by adding new functions into devices previously dominated by main-group element semiconductor compounds. Today, compounds with multiple anions beyond the single-oxide ion, such as oxyhalides and oxyhydrides, offer a new materials platform from which superior functionality may arise. Here we review the recent progress, status, and future prospects and challenges facing the development and deployment of mixed-anion compounds, focusing mainly on oxide-derived materials. We devote attention to the crucial roles that multiple anions play during synthesis, characterization, and in the physical properties of these materials. We discuss the opportunities enabled by recent advances in synthetic approaches for design of both local and overall structure, state-of-the-art characterization techniques to distinguish unique structural and chemical states, and chemical/physical properties emerging from the synergy of multiple anions for catalysis, energy conversion, and electronic materials.
International Nuclear Information System (INIS)
Ghasemian, Ensieh; Najafi, Mojgan; Rafati, Amir Abbas; Felegari, Zahra
2010-01-01
Surface and bulk properties of 1-hexyl-3-methylimidazolium chloride [C 6 mim][Cl] as an ionic liquid (IL) have been investigated by surface tension and electrical conductivity techniques at various temperatures. Results reveal that the ionic liquid behaves as surfactant-like and aggregates in aqueous solution. Critical aggregation concentration (cac) values obtained by conductivity and surface tension measurements are in good agreement with values found in the literature. A series of important and useful adsorption parameters including cac, surface excess concentration (Γ), and minimum surface area per molecule (A min ) at the air + water interface were estimated from surface tension in the presence and absence of different electrolytes. Obtained data show that the surface tension as well as the cac of [C 6 mim][Cl] is reduced by electrolytes. Also, values of surface excess concentration (Γ) show that the IL ions in the presence of electrolyte have much larger affinity to adsorption at the surface and this affinity increased in aqueous electrolyte solution in the order of I - > Br - > Cl - for counter ion of salts that was explained in terms of a larger repulsion of chloride anions from interface to the bromide and iodide anion as well as difference in their excess polarizability.
Preparation of Acrylamide-based Anionic Polyelectrolytes for Soil Establishment
Directory of Open Access Journals (Sweden)
Ahmad Rabiee
2012-12-01
Full Text Available Synthetic water soluble acrylamide-based polymers have wide range of ap-plications in the feld of soil establishment and non-desertifcation. In this research, the acrylamide-based anionic polyelectrolytes were prepared by solution polymerization. The polymerization was carried out using AIBN as a radical initiator and at different degrees of anionic charges ranging between 10% and 30% using sodium hydroxide as hydrolyzing agents. The chemical structure of the synthetic polymers was studied and confrmed by FTIR technique. The charge density on polymer backbone was determined by titration method. The rheological behavior of polymer solutions was evaluated by Brookfeld viscometer. The results show that the viscosity decreases with increasing the shear rate of solutions. Molecular weights of samples were measured by laser light scattering analyzer. The morphology of the polymer was studied by SEM and the EDX was used for elemental analysis determination. The anionic polymers with 10-30% negative charges were mixed with clay in order to evaluate the soil establishment. The results show that an anionic polyelectro-lyte can make soil particles more cohesive and improve soil physical properties.
A study of model systems in anionic exchange
International Nuclear Information System (INIS)
Haegele, R.; Boeyens, J.C.A.
1977-01-01
Preliminary experiments are reported on the preparation and characterization of anionic sulphate and chloride complexes of UO 2+ 2 and iron(III), benzyl-trimethylammonium cation being used as a model substance for the simulation of positive sites in an anionic-exchange resin. The structure of (BTMA) 4 [UO 2 CL 3 -O 2 -CL 3 UO 2 ], a binuclear uranyl-peroxocomplex that has not been reported in the literature, was elucidated by single-crystal x-ray examination, and is described and discussed [af
High Vacuum Techniques for Anionic Polymerization
Ratkanthwar, Kedar; Hadjichristidis, Nikolaos; Mays, Jimmy
2015-01-01
Anionic polymerization high vacuum techniques (HVTs) are the most suitable for the preparation of polymer samples with well-defined complex macromolecular architectures. Though HVTs require glassblowing skill for designing and making polymerization
Energy Technology Data Exchange (ETDEWEB)
Wang, Wenxia [MOE Key Laboratory of Resources and Environmental Systems Optimization, Institute for Energy, Environment and Sustainability Research, UR-NCEPU, North China Electric Power University, Beijing, 102206 (China); Huang, Guohe, E-mail: huang@iseis.org [MOE Key Laboratory of Resources and Environmental Systems Optimization, Institute for Energy, Environment and Sustainability Research, UR-NCEPU, North China Electric Power University, Beijing, 102206 (China); An, Chunjiang; Xin, Xiaying [Institute for Energy, Environment and Sustainable Communities, University of Regina, Regina, S4S 0A2 (Canada); Zhang, Yan [MOE Key Laboratory of Resources and Environmental Systems Optimization, Institute for Energy, Environment and Sustainability Research, UR-NCEPU, North China Electric Power University, Beijing, 102206 (China); Liu, Xia [Canadian Light Source, Saskatoon, S7N 2V3 (Canada)
2017-05-31
Highlights: • Surfactant modified flax shives for removing anionic azo dyes. • The equilibrium and kinetic studies for the adsorption of anionic azo dyes. • The migration patterns of dye pollutants at flax shive-water interface. • New insights from synchrotron infrared-assisted characterization. • Potential as biomass adsorbent for the removal of dyes from wastewater. - Abstract: From the viewpoint of sustainability, biomass adsorbent has a high potential in pollution control and there is an emerging interest to investigate the behaviors of pollutants at the interface between biomass adsorbent and solution. This study investigated the performance of cetyltrimethylammonium bromide surfactant-modified flax shives (MFS) for removal of anionic azo dyes from aqueous solution. The equilibrium and kinetic analysis for the adsorption of Acid Orange 7 (AO-7), Acid Red 18 (AR-18) and Acid Black 1 (AB-1) on MFS were conducted. The surface of MFS was characterized by synchrotron infrared and SEM analysis. The absorbed amount of three anionic azo dyes varied with the change of adsorbent dosage, pH and ionic strength. The adsorption isotherm data well fit to the Langmuir model. The adsorption process followed the pseudo-second-order kinetics and the liquid film diffusion models. Thermodynamic studies indicated that the adsorption of three anionic azo dyes was spontaneous. The adsorption of AR-18 and AB-1 onto MFS was endothermic while the adsorption of AO-7 was exothermic. The results can help better understand the behaviors of organic pollutants at biomass adsorbent-water interface. They also present the potential of using MFS as a suitable adsorbent for the removal of anionic azo dyes from wastewater.
International Nuclear Information System (INIS)
Wang, Wenxia; Huang, Guohe; An, Chunjiang; Xin, Xiaying; Zhang, Yan; Liu, Xia
2017-01-01
Highlights: • Surfactant modified flax shives for removing anionic azo dyes. • The equilibrium and kinetic studies for the adsorption of anionic azo dyes. • The migration patterns of dye pollutants at flax shive-water interface. • New insights from synchrotron infrared-assisted characterization. • Potential as biomass adsorbent for the removal of dyes from wastewater. - Abstract: From the viewpoint of sustainability, biomass adsorbent has a high potential in pollution control and there is an emerging interest to investigate the behaviors of pollutants at the interface between biomass adsorbent and solution. This study investigated the performance of cetyltrimethylammonium bromide surfactant-modified flax shives (MFS) for removal of anionic azo dyes from aqueous solution. The equilibrium and kinetic analysis for the adsorption of Acid Orange 7 (AO-7), Acid Red 18 (AR-18) and Acid Black 1 (AB-1) on MFS were conducted. The surface of MFS was characterized by synchrotron infrared and SEM analysis. The absorbed amount of three anionic azo dyes varied with the change of adsorbent dosage, pH and ionic strength. The adsorption isotherm data well fit to the Langmuir model. The adsorption process followed the pseudo-second-order kinetics and the liquid film diffusion models. Thermodynamic studies indicated that the adsorption of three anionic azo dyes was spontaneous. The adsorption of AR-18 and AB-1 onto MFS was endothermic while the adsorption of AO-7 was exothermic. The results can help better understand the behaviors of organic pollutants at biomass adsorbent-water interface. They also present the potential of using MFS as a suitable adsorbent for the removal of anionic azo dyes from wastewater.
Separation of anionic oligosaccharides by high-performance liquid chromatography
International Nuclear Information System (INIS)
Green, E.D.; Baenziger, J.U.
1986-01-01
The authors have developed methods for rapid fractionation of anionic oligosaccharides containing sulfate and/or sialic acid moieties by high-performance liquid chromatography (HPLC). Ion-exchange HPLC on amine-bearing columns (Micropak AX-10 and AX-5) at pH 4.0 is utilized to separate anionic oligosaccharides bearing zero, one, two, three, or four charges, independent of the identity of the anionic moieties (sulfate and/or sialic acid). Ion-exchange HPLC at pH 1.7 allows separation of neutral, mono-, di-, and tetrasialylated, monosulfated, and disulfated oligosaccharides. Oligosaccharides containing three sialic acid residues and those bearing one each of sulfate and sialic acid, however, coelute at pH 1.7. Since the latter two oligosaccharide species separate at pH 4.0, analysis at pH 4.0 followed by analysis at pH 1.7 can be utilized to completely fractionate complex mixtures of sulfated and sialylated oligosaccharides. Ion-suppression amine adsorption HPLC has previously been shown to separate anionic oligosaccharides on the basis of net carbohydrate content (size). In this study they demonstrate the utility of ion-suppression amine adsorption HPLC for resolving sialylated oligosaccharide isomers which differ only in the linkages of sialic acid residues (α2,3 vs α2,6) and/or location of α2,3- and α2,6-linked sialic acid moieties on the peripheral branches of oligosaccharides. These two methods can be used in tandem to separate oligosaccharides, both analytically and preparatively, based on their number, types, and linkages of anionic moieties
Water permeation through anion exchange membranes
Luo, Xiaoyan; Wright, Andrew; Weissbach, Thomas; Holdcroft, Steven
2018-01-01
An understanding of water permeation through solid polymer electrolyte (SPE) membranes is crucial to offset the unbalanced water activity within SPE fuel cells. We examine water permeation through an emerging class of anion exchange membranes, hexamethyl-p-terphenyl poly (dimethylbenzimidazolium) (HMT-PMBI), and compare it against series of membrane thickness for a commercial anion exchange membrane (AEM), Fumapem® FAA-3, and a series of proton exchange membranes, Nafion®. The HMT-PMBI membrane is found to possess higher water permeabilities than Fumapem® FAA-3 and comparable permeability than Nafion (H+). By measuring water permeation through membranes of different thicknesses, we are able to decouple, for the first time, internal and interfacial water permeation resistances through anion exchange membranes. Permeation resistances on liquid/membrane interface is found to be negligible compared to that for vapor/membrane for both series of AEMs. Correspondingly, the resistance of liquid water permeation is found to be one order of magnitude smaller compared to that of vapor water permeation. HMT-PMBI possesses larger effective internal water permeation coefficient than both Fumapem® FAA-3 and Nafion® membranes (60 and 18% larger, respectively). In contrast, the effective interfacial permeation coefficient of HMT-PMBI is found to be similar to Fumapem® (±5%) but smaller than Nafion®(H+) (by 14%).
Directory of Open Access Journals (Sweden)
Shirley Nakagaki
2016-02-01
Full Text Available Layered materials are a very interesting class of compounds obtained by stacking of two-dimensional layers along the basal axis. A remarkable property of these materials is their capacity to interact with a variety of chemical species, irrespective of their charge (neutral, cationic or anionic. These species can be grafted onto the surface of the layered materials or intercalated between the layers, to expand or contract the interlayer distance. Metalloporphyrins, which are typically soluble oxidation catalysts, are examples of molecules that can interact with layered materials. This work presents a short review of the studies involving metalloporphyrin immobilization on two different anionic exchangers, Layered Double Hydroxides (LDHs and Layered Hydroxide Salts (LHSs, published over the past year. After immobilization of anionic porphyrins, the resulting solids behave as reusable catalysts for heterogeneous oxidation processes. Although a large number of publications involving metalloporphyrin immobilization on LDHs exist, only a few papers have dealt with LHSs as supports, so metalloporphyrins immobilized on LHSs represent a new and promising research field. This work also describes new results on an anionic manganese porphyrin (MnP immobilized on Mg/Al-LDH solids with different nominal Mg/Al molar ratios (2:1, 3:1 and 4:1 and intercalated with different anions (CO32− or NO3−. The influence of the support composition on the MnP immobilization rates and the catalytic performance of the resulting solid in cyclooctene oxidation reactions will be reported.
Nakagaki, Shirley; Mantovani, Karen Mary; Machado, Guilherme Sippel; Castro, Kelly Aparecida Dias de Freitas; Wypych, Fernando
2016-02-29
Layered materials are a very interesting class of compounds obtained by stacking of two-dimensional layers along the basal axis. A remarkable property of these materials is their capacity to interact with a variety of chemical species, irrespective of their charge (neutral, cationic or anionic). These species can be grafted onto the surface of the layered materials or intercalated between the layers, to expand or contract the interlayer distance. Metalloporphyrins, which are typically soluble oxidation catalysts, are examples of molecules that can interact with layered materials. This work presents a short review of the studies involving metalloporphyrin immobilization on two different anionic exchangers, Layered Double Hydroxides (LDHs) and Layered Hydroxide Salts (LHSs), published over the past year. After immobilization of anionic porphyrins, the resulting solids behave as reusable catalysts for heterogeneous oxidation processes. Although a large number of publications involving metalloporphyrin immobilization on LDHs exist, only a few papers have dealt with LHSs as supports, so metalloporphyrins immobilized on LHSs represent a new and promising research field. This work also describes new results on an anionic manganese porphyrin (MnP) immobilized on Mg/Al-LDH solids with different nominal Mg/Al molar ratios (2:1, 3:1 and 4:1) and intercalated with different anions (CO₃(2-) or NO₃(-)). The influence of the support composition on the MnP immobilization rates and the catalytic performance of the resulting solid in cyclooctene oxidation reactions will be reported.
An Anthracene-Based Tripodal Chemosensor for Anion Sensing
Directory of Open Access Journals (Sweden)
Whitney A. Quinn
2010-05-01
Full Text Available An anthracene-based tripodal ligand was synthesized from the condensation of tren with 9-anthraldehyde, and the subsequent reduction with sodium borohydride. The neutral ligand was protonated from the reaction with p-toluenesulfonic acid to give a triply charged chemosensor that was examined for its anion binding ability toward fluoride, chloride, bromide, sulfate and nitrate by the fluorescence spectroscopy in DMSO. The addition of an anion to the ligand resulted in an enhancement in fluorescence intensity at the excitation of 310 nm. Analysis of the spectral changes suggested that the ligand formed a 1:1 complex with each of the anions, showing strong affinity for fluoride and sulfate in DMSO. The unsubstituted tren was reacted with sulfuric acid to form a sulfate complex and the structure was determined by the X-ray crystallography. Analysis of the complex revealed that three sulfates are held between two ligands by multiple hydrogen bonding interactions with protonated amines.
Controlled Release Kinetics in Hydroxy Double Salts: Effect of Host Anion Structure
Directory of Open Access Journals (Sweden)
Stephen Majoni
2014-01-01
Full Text Available Nanodimensional layered metal hydroxides such as layered double hydroxides (LDHs and hydroxy double salts (HDSs can undergo anion exchange reactions releasing intercalated anions. Because of this, these metal hydroxides have found applications in controlled release delivery of bioactive species such as drugs and pesticides. In this work, isomers of hydroxycinnamate were used as model compounds to systematically explore the effects of anion structure on the rate and extent of anion release in HDSs. Following intercalation and subsequent release of the isomers, it has been demonstrated that the nature and position of substituent groups on intercalated anions have profound effects on the rate and extent of release. The extent of release was correlated with the magnitude of dipole moments while the rate of reaction showed strong dependence on the extent of hydrogen bonding within the layers. The orthoisomer showed a more sustained and complete release as compared to the other isomers.
A photoelectron imaging and quantum chemistry study of the deprotonated indole anion.
Parkes, Michael A; Crellin, Jonathan; Henley, Alice; Fielding, Helen H
2018-05-29
Indole is an important molecular motif in many biological molecules and exists in its deprotonated anionic form in the cyan fluorescent protein, an analogue of green fluorescent protein. However, the electronic structure of the deprotonated indole anion has been relatively unexplored. Here, we use a combination of anion photoelectron velocity-map imaging measurements and quantum chemistry calculations to probe the electronic structure of the deprotonated indole anion. We report vertical detachment energies (VDEs) of 2.45 ± 0.05 eV and 3.20 ± 0.05 eV, respectively. The value for D0 is in agreement with recent high-resolution measurements whereas the value for D1 is a new measurement. We find that the first electronically excited singlet state of the anion, S1(ππ*), lies above the VDE and has shape resonance character with respect to the D0 detachment continuum and Feshbach resonance character with respect to the D1 continuum.
Probing Intermolecular Electron Delocalization in Dimer Radical Anions by Vibrational Spectroscopy
International Nuclear Information System (INIS)
Mani, Tomoyasu; Brookhaven National Laboratory; Grills, David C.
2017-01-01
Delocalization of charges is one of the factors controlling charge transport in conjugated molecules. It is considered to play an important role in the performance of a wide range of molecular technologies, including organic solar cells and organic electronics. Dimerization reactions are well-suited as a model to investigate intermolecular spatial delocalization of charges. And while dimerization reactions of radical cations are well investigated, studies on radical anions are still scarce. Upon dimerization of radical anions with neutral counterparts, an electron is considered to delocalize over the two molecules. By using time-resolved infrared (TRIR) detection coupled with pulse radiolysis, we show that radical anions of 4-n-hexyl-4'-cyanobiphenyl (6CB) undergo such dimerization reactions, with an electron equally delocalized over the two molecules. We have recently demonstrated that nitrile ν(C≡N) vibrations respond to the degree of electron localization of nitrile-substituted anions: we can quantify the changes in the electronic charges from the neutral to the anion states in the nitriles by monitoring the ν(C≡N) IR shifts. In the first part of this article, we show that the sensitivity of the ν(C≡N) IR shifts does not depend on solvent polarity. In the second part, we describe how probing the shifts of the nitrile IR vibrational band unambiguously confirms the formation of dimer radical anions, with K dim = 3 × 10 4 M –1 . IR findings are corroborated by electronic absorption spectroscopy and electronic structure calculations. We find that the presence of a hexyl chain and the formation of π–π interactions are both crucial for dimerization of radical anions of 6CB with neutral 6CB. Our study provides clear evidence of spatial delocalization of electrons over two molecular fragments.
Sensitization of microorganisms and enzymes by radiation-induced selective inorganic radical anions
International Nuclear Information System (INIS)
Schubert, J.; Stegeman, H.
1981-01-01
Bacterial survival and enzymatic inactivation were examined following exposure to radiolytically-generated radical anions, X - 2 , where X=Cl, Br, I or CNS - . Depending on pH, radical anions react selectively or specifically with cysteine, tryptophan, tyrosine and histidine. Consequently, when one or more of these amino acids is crucial for enzymatic activity or bacterial survival and is attacked by a radical anion, a high degree or radiosensitization may be realized. Halide radical anions can form free chlorine, bromine or iodine. However, these bactericidal halogens are destroyed by reaction with the hydrated electron, e - sub(aq), or at pHs>9, as occurs, for example, when a medium saturated with nitrous oxide, N 2 O, and e - sub(aq) scavenger, is replaced by nitrogen or oxygen. Increasing concentration of other e - sub(aq) scavengers, such as phosphate buffer, promotes formation of halogen from halides. The conditions producing formation and elimination of halogens in irradiated media must be appreciated to avoid confusing radiosensitization by X 2 to X - 2 . Radiosensitization by radical anions of several microorganisms: S. faecalis, S. typhimurium, E. coli, and M. radiodurens is described. A crucial amino acid for survival of S. faecalis appears to be tyrosine, while both tyrosine and tryptophan seem essential for recovery of S. typhimurium from effects of ionizing radiation. It is postulated that the radiosensitizing action of radical anions involves inhibition of DNA repair of strand-breaks by depriving the cells of energy. In view of the high OH scavenging power of foods, it is concluded that the radiosensitization of bacteria and enzymes in foods by radical anions, except for special cases, is not practical. Rather, radical anions serve to identify crucial amino acids to radiosensitization mechanisms in model systems, and possibly in radiotherapy. (author)
Acute and chronic influence of temperature on red blood cell anion exchange.
Jensen, F B; Wang, T; Brahm, J
2001-01-01
Unidirectional (36)Cl(-) efflux via the red blood cell anion exchanger was measured under Cl(-) self-exchange conditions (i.e. no net flow of anions) in rainbow trout Oncorhynchus mykiss and red-eared freshwater turtle Trachemys scripta to examine the effects of acute temperature changes and acclimation temperature on this process. We also evaluated the possible adaptation of anion exchange to different temperature regimes by including our previously published data on other animals. An acute temperature increase caused a significant increase in the rate constant (k) for unidirectional Cl(-) efflux in rainbow trout and freshwater turtle. After 3 weeks of temperature acclimation, 5 degrees C-acclimated rainbow trout showed only marginally higher Cl(-) transport rates than 15 degrees C-acclimated trout when compared at the same temperature. Apparent activation energies for red blood cell Cl(-) exchange in trout and turtle were lower than values reported in endothermic animals. The Q(10) for red blood cell anion exchange was 2.0 in trout and 2.3 in turtle, values close to those for CO(2) excretion, suggesting that, in ectothermic animals, the temperature sensitivity of band-3-mediated anion exchange matches the temperature sensitivity of CO(2) transport (where red blood cell Cl(-)/HCO(3)(-) exchange is a rate-limiting step). In endotherms, such as man and chicken, Q(10) values for red blood cell anion exchange are considerably higher but are no obstacle to CO(2) transport, because body temperature is normally kept constant at values at which anion exchange rates are high. When compared at constant temperature, red blood cell Cl(-) permeability shows large differences among species (trout, carp, eel, cod, turtle, alligator, chicken and man). Cl(-) permeabilities are, however, remarkable similar when compared at preferred body temperatures, suggesting an appropriate evolutionary adaptation of red blood cell anion exchange function to the different thermal niches occupied
Sensing mechanism for a fluorescent off–on chemosensor for cyanide anion
International Nuclear Information System (INIS)
Li, Yang; Chen, Junsheng; Chu, Tian-Shu
2016-01-01
In this article, the sensing mechanism of cyanide anion chemosensor 2-((2-phenyl-2H-1,2,3-triazol-4-yl)methylene)malononitrile (M1) has been investigated through the density functional theory (DFT) and time-dependent density functional theory (TDDFT) methods. The theoretical results demonstrate that the reaction barrier of 13.02 kcal/mol means a favorable response speed of the chemosensor M1 for cyanide anion. Cyanide anion attacks C=C double bond and hinders the ICT process from the malononitrile moiety to the fluorophore phenyl ring. The high viscosity of DMSO restrains the twisting of the group, inhibits the formation of the ICT state in the first excited state. Due to weak ICT character, the nucleophilic addition product shows the dramatic “off–on” fluorescence enhancement. Meanwhile, intramolecular charge transfer (ICT) mechanism accounts for how different solvents influence the fluorescence spectra. That is, more obvious ICT character of product in EtOH causes fluorescence quenching. The “reaction-based” recognition mode and large bond energy between M1 and cyanide anion minimize the interference by other anions, such as F − , AcO − . Thus, the chemosensor M1 has a high selectivity for cyanide.
The Anion Paradox in Sodium Taste Reception: Resolution by Voltage-Clamp Studies
Ye, Qing; Heck, Gerard L.; Desimone, John A.
1991-11-01
Sodium salts are potent taste stimuli, but their effectiveness is markedly dependent on the anion, with chloride yielding the greatest response. The cellular mechanisms that mediate this phenomenon are not known. This "anion paradox" has been resolved by considering the field potential that is generated by restricted electrodiffusion of the anion through paracellular shunts between taste-bud cells. Neural responses to sodium chloride, sodium acetate, and sodium gluconate were studied while the field potential was voltage-clamped. Clamping at electronegative values eliminated the anion effect, whereas clamping at electropositive potentials exaggerated it. Thus, field potentials across the lingual epithelium modulate taste reception, indicating that the functional unit of taste reception includes the taste cell and its paracellular microenvironment.
Development of Preparation Methods for Alkaline Anion Exchange Membranes by Radiation
International Nuclear Information System (INIS)
Shin, Jun Hwa; Nho, Young Chang; Sohn, Joon Yong
2010-01-01
The objective of this project is to contribute to the environmentally friendly fuel cell system by developing a radiation grafting method for the preparation of anion exchange membranes for alkaline fuel cell and finally to the radiation technology industry. In this project, the preparation methods for the VBC-grafted fluoropolymer films using radiation have been developed and anion exchange membranes have been prepared via the reaction between the VBC-grafted fluoropolymer films and amines. The prepared anion exchange membranes were characterized and the performance of the membranes were evaluated
Basic Surface Properties of Mononuclear Cells from Didelphis marsupialis
Directory of Open Access Journals (Sweden)
Nacife Valéria Pereira
1998-01-01
Full Text Available The electrostatic surface charge and surface tension of mononuclear cells/monocytes obtained from young and adult marsupials (Didelphis marsupialis were investigated by using cationized ferritin and colloidal iron hydroxyde, whole cell electrophoresis, and measurements of contact angles. Anionic sites were found distributed throughout the entire investigated cell surfaces. The results revealed that the anionic character of the cells is given by electrostatic charges corresponding to -18.8 mV (cells from young animals and -29.3 mV (cells from adult animals. The surface electrostatic charge decreased from 10 to 65.2% after treatment of the cells with each one of trypsin, neuraminidase and phospholipase C. The hydrophobic nature of the mononuclear cell surfaces studied by using the contact angle method revealed that both young and adult cells possess cell surfaces of high hidrofilicity since the angles formed with drops of saline water were 42.5°and 40.8°, respectively. Treatment of the cells with trypsin or neuraminidase rendered their surfaces more hydrophobic, suggesting that sialic acid-containing glycoproteins are responsible for most of the hydrophilicity observed in the mononuclear cell surfaces from D. marsupialis.
African Journals Online (AJOL)
Items 201 - 250 of 263 ... Vol 6, No 2 (2007), Prevalence of Plasmodial Parasiteamia among ... Vol 5, No 2 (2006), Profile of menarche among school children in ... Non-paretic Lower Limbs of Patients with Post-stroke Hemiplegia, Abstract ... Vol 6, No 2 (2007), Root Surface Caries Occurence in Relation to Social and Dental ...
Ionic liquids comprising heteraromatic anions
Energy Technology Data Exchange (ETDEWEB)
Schneider, William F.; Brennecke, Joan F.; Maginn, Edward J.; Mindrup, Elaine; Gurkan, Burcu; Price, Erica; Goodrich, Brett
2018-04-24
Some embodiments described herein relate to ionic liquids comprising an anion of a heteraromatic compound such as optionally substituted pyrrolide, optionally substituted pyrazolide, optionally substituted indolide, optionally substituted phospholide, or optionally substituted imidazolide. Methods and devices for gas separation or gas absorption related to these ionic liquids are also described herein.
Protonation Reaction of Benzonitrile Radical Anion and Absorption of Product
DEFF Research Database (Denmark)
Holcman, Jerzy; Sehested, Knud
1975-01-01
The rate constant for the protonation of benzonitrile radical anions formed in pulse radiolysis of aqueous benzonitrile solutions is (3.5 ± 0.5)× 1010 dm3 mol–1 s–1. A new 270 nm absorption band is attributed to the protonated benzonitrile anion. The pK of the protonation reaction is determined t...
Physicochemical treatments of anionic surfactants wastewater: Effect on aerobic biodegradability.
Aloui, Fathi; Kchaou, Sonia; Sayadi, Sami
2009-05-15
The effect of different physicochemical treatments on the aerobic biodegradability of an industrial wastewater resulting from a cosmetic industry has been investigated. This industrial wastewater contains 11423 and 3148mgL(-1) of chemical oxygen demand (COD) and anionic surfactants, respectively. The concentration of COD and anionic surfactants were followed throughout the diverse physicochemical treatments and biodegradation experiments. Different pretreatments of this industrial wastewater using chemical flocculation process with lime and aluminium sulphate (alum), and also advanced oxidation process (electro-coagulation (Fe and Al) and electro-Fenton) led to important COD and anionic surfactants removals. The best results were obtained using electro-Fenton process, exceeding 98 and 80% of anionic surfactants and COD removals, respectively. The biological treatment by an isolated strain Citrobacter braakii of the surfactant wastewater, as well as the pretreated wastewater by the various physicochemical processes used in this study showed that the best results were obtained with electro-Fenton pretreated wastewater. The characterization of the treated surfactant wastewater by the integrated process (electro-coagulation or electro-Fenton)-biological showed that it respects Tunisian discharge standards.
Anionic Redox Chemistry in Polysulfide Electrode Materials for Rechargeable Batteries.
Grayfer, Ekaterina D; Pazhetnov, Egor M; Kozlova, Mariia N; Artemkina, Sofya B; Fedorov, Vladimir E
2017-12-22
Classical Li-ion battery technology is based on the insertion of lithium ions into cathode materials involving metal (cationic) redox reactions. However, this vision is now being reconsidered, as many new-generation electrode materials with enhanced reversible capacities operate through combined cationic and anionic (non-metal) reversible redox processes or even exclusively through anionic redox transformations. Anionic participation in the redox reactions is observed in materials with more pronounced covalency, which is less typical for oxides, but quite common for phosphides or chalcogenides. In this Concept, we would like to draw the reader's attention to this new idea, especially, as it applies to transition-metal polychalcogenides, such as FeS 2 , VS 4 , TiS 3 , NbS 3 , TiS 4 , MoS 3 , etc., in which the key role is played by the (S-S) 2- /2 S 2- redox reaction. The exploration and better understanding of the anion-driven chemistry is important for designing advanced materials for battery and other energy-related applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Energy Technology Data Exchange (ETDEWEB)
Hishida, Mafumi; Kaneko, Yohei; Okuno, Masanari; Yamamura, Yasuhisa; Ishibashi, Taka-aki; Saito, Kazuya, E-mail: kazuya@chem.tsukuba.ac.jp [Department of Chemistry, Faculty of Pure and Applied Sciences, University of Tsukuba, Tsukuba, Ibaraki 305-8571 (Japan)
2015-05-07
The behavior of water molecules at the surface of nonionic surfactant (monomyristolein) and effects of monovalent ions on the behavior are investigated using the heterodyne-detected vibrational sum frequency generation spectroscopy. It is found that water molecules at the surface are oriented with their hydrogen atoms pointing to the bulk, and that the degree of orientation depends on the anion strongly but weakly on the cation. With measured surface potentials in those saline solutions, it is concluded that the heterogeneous distribution of anions and cations in combination with the nonionic surfactant causes the water orientation. This heterogeneous distribution well explains the contrasting order of anions and cations with respect to the ion size in the Hofmeister series.
International Nuclear Information System (INIS)
Hishida, Mafumi; Kaneko, Yohei; Okuno, Masanari; Yamamura, Yasuhisa; Ishibashi, Taka-aki; Saito, Kazuya
2015-01-01
The behavior of water molecules at the surface of nonionic surfactant (monomyristolein) and effects of monovalent ions on the behavior are investigated using the heterodyne-detected vibrational sum frequency generation spectroscopy. It is found that water molecules at the surface are oriented with their hydrogen atoms pointing to the bulk, and that the degree of orientation depends on the anion strongly but weakly on the cation. With measured surface potentials in those saline solutions, it is concluded that the heterogeneous distribution of anions and cations in combination with the nonionic surfactant causes the water orientation. This heterogeneous distribution well explains the contrasting order of anions and cations with respect to the ion size in the Hofmeister series
ESR study of the anion radicals of 5-nitropyrimidines: conversion to iminoxy radicals
International Nuclear Information System (INIS)
Sevilla, M.D.; Clark, C.; Failor, R.
1976-01-01
The anion radicals of a number of 5-nitropyrimidines have been investigated by ESR spectroscopy. The anions are formed by electrolysis in dimethylformamide and by electron attachment in aqueous glasses, 12 M LiCl--D 2 O and 8 M NaOD. The electrolysis of 5-nitrouracil and 5-nitro-6-methyluracil results in relatively stable anion radicals. The results for 5-nitrouracil give evidence for two or perhaps three anions which differ only by the degree of ring nitrogen protonation. The results for 5-nitro-6-methyluracil suggest that the nitro group of the anion is twisted so that it is coupled only weakly to the ring π-electron system. The anions of 5-nitrouracil, 5-nitroorotic acid, 5-nitrobarbituric acid, and 5-nitro-6-methyluracil have been produced in the alkaline and neutral aqueous glasses. The anisotropic spectra found have been analyzed with the aid of computer simulations which assume axial symmetry. For example, the analysis of the spectrum of 5-nitrouracil anion in 12 M LiCl yields A/sub parallel//sup N/ = 33; A/sub perpendicular to//sup N/ = 5, a 6 /sup H/ = 5.5 G, g/sub parallel/ = 2.0016, and g/sub perpendicular to/ = 2.0059. A concentration dependence in the splittings is noted and discussed. Ultraviolet photolysis of the anions of 5-nitro-6-methyluracil and 5-nitrobarbituric acid results in the formation of iminoxy radicals. Mechanisms of formation of the iminoxy radicals are discussed and results found in this work are compared to results found in single crystals and aqueous solution
Anion-based approaches to tunable functionality in oxide heterostructures
May, Steven
2014-03-01
The ability to control the position and composition of the anion site is emerging as a promising route to tune properties in epitaxial perovskites. This talk will focus on recent and ongoing efforts aimed at developing anion-based approaches to tailor electronic and magnetic properties in oxide films. First, I will discuss how the position of the oxygen anions can be tailored to stabilize non-bulk-like bond angles and lengths, thereby altering electronic bandwidth. Recent work on La2/3Sr1/3MnO3 will be presented in which ultrathin films under the same strain state exhibit dramatically different electronic and magnetic properties when grown on substrates with different symmetries. In the second half of the talk, I will describe efforts focused on altering the composition of the anion site. In La1/3Sr2/3FeO3-δ films, a reversible change in oxygen content leads to dramatic changes in electrical, optical, and structural properties. Finally, the synthesis of oxyfluoride ferrite and nickelate perovskite films via topotactic reactions carried out following thin film deposition will be described. This work is supported by the Office of Naval Research (N00014-11-1-0664) and the U. S. Army Research Office (W911NF-12-1-0132).
Directory of Open Access Journals (Sweden)
Intidhar Jabir Idan
2017-01-01
Full Text Available The most challenging mission in wastewater treatment plants is the removal of anionic dyes, because they are water-soluble and produce very shining colours in the water. In this regard, kenaf core fiber (KCF was chemically modified by the quaternized agent (3-chloro-2-hydroxypropyltrimethylammonium chloride to increase surface area and change the surface properties in order to improve the removing reactive anionic dyes from binary aqueous solution. The influencing operating factors like dye concentration, pH, adsorbent dosage, and contact time were examined in a batch mode. The results indicate that the percentage of removal of Reactive Red-RB (RR-RB and Reactive Black-5 (RB-5 dyes from binary solution was increased with increasing dyes concentrations and the maximum percentage of removal reached up to 98.4% and 99.9% for RR-RB and RB-5, respectively. Studies on effect of pH showed that the adsorption was not significantly influenced by pH. The equilibrium analyses explain that, in spite of the extended Langmuir model failure to describe the data in the binary system, it is better than the Jain and Snoeyink model in describing the adsorption behavior of binary dyes onto QKCF. Also, the pseudo-second-order model was better to represent the adsorption kinetics for RR-RB and RB-5 dyes on QKCF.
Hybrid capacitive deionization with anion-exchange membranes for lithium extraction
Directory of Open Access Journals (Sweden)
Siekierka Anna
2017-01-01
Full Text Available Lithium is considered to be a critical material for various industrial fields. We present our studies on extraction lithium from diluted aqueous solution by novel hybrid system based on a membrane capacitive deionization and batteries desalination. Hybrid CDI is comprised by a lithium selective adsorbent, activated carbon electrode and anion-exchange membranes. Here, we demonstrated implication of various type of anion-exchange membranes and influence their properties on effective capacity and energy requirements in charge/discharge steps. We described a configuration with anion-exchange membrane characterized by adsorption capacity of 35 mg/g of Li+ with 0.08Wh/g and removal efficiency of 60 % of lithium ions, using novel selective desalination technique.
Hybrid capacitive deionization with anion-exchange membranes for lithium extraction
Siekierka, Anna; Bryjak, Marek
2017-11-01
Lithium is considered to be a critical material for various industrial fields. We present our studies on extraction lithium from diluted aqueous solution by novel hybrid system based on a membrane capacitive deionization and batteries desalination. Hybrid CDI is comprised by a lithium selective adsorbent, activated carbon electrode and anion-exchange membranes. Here, we demonstrated implication of various type of anion-exchange membranes and influence their properties on effective capacity and energy requirements in charge/discharge steps. We described a configuration with anion-exchange membrane characterized by adsorption capacity of 35 mg/g of Li+ with 0.08Wh/g and removal efficiency of 60 % of lithium ions, using novel selective desalination technique.
Directory of Open Access Journals (Sweden)
Muhammad Daud
2015-01-01
Full Text Available This research work was carried out for the removal of nitrate from raw water for a drinking water supply. Nitrate is a widespread ground water contaminant. Methodology employed in this study included adsorption on metal based nanoparticles and ion exchange using anionic resins. Fe/Pt bimetallic nanoparticles were prepared in the laboratory, by the reduction of their respective salts using sodium borohydride. Scanning electron microscope, X-ray diffraction, energy dispersive spectrometry, and X-ray florescence techniques were utilized for characterization of bimetallic Fe/Pt nanoparticles. Optimum dose, pH, temperature, and contact time were determined for NO3- removal through batch tests, both for metal based nanoparticles and anionic exchange resin. Adsorption data fitted well the Langmuir isotherm and conformed to the pseudofirst-order kinetic model. Results indicated 97% reduction in nitrate by 0.25 mg/L of Fe/Pt nanoparticles at pH 7 and 83% reduction in nitrate was observed using 0.50 mg/L anionic exchange resins at pH 4 and contact time of one hour. Overall, Fe/Pt bimetallic nanoparticles demonstrated greater NO3- removal efficiency due to the small particle size, extremely large surface area (627 m2/g, and high adsorption capacity.
Analysing destruction channels of interstellar hydrocarbon anions with a 22pol ion-trap
Energy Technology Data Exchange (ETDEWEB)
Endres, Eric; Lakhmanskaya, Olga; Best, Thorsten; Hauser, Daniel; Kumar, Sunil; Wester, Roland [Universitaet Innsbruck, Institut fuer Ionenphysik und Angewandte Physik (Austria)
2014-07-01
In the interstellar medium (ISM), ion-molecule reactions are considered to play a key role in the formation of complex molecules. The detection of the first interstellar anions, which happen to be carbon chain anions, has raised new interest in the quantitative composition of the ISM and the underlying reaction network. To understand the observed abundance of these carbon chain anions, a detailed analysis of the possible destruction channels is indispensable. A cryogenic 22-pol radio frequency ion trap is an ideal tool to observe reactions that take place slowly, such as carbon chain anions with molecular hydrogen. Furthermore, measurements over a large temperature scale are feasible. Longitudinal optical access to the trap also provides the possibility to make precise photodetachment measurements. Temperature dependent measurements of the reaction rates for the reaction between hydrocarbon chain anions and H{sub 2} are presented.
Infrared multiple photon dissociation spectroscopy of sodium and potassium chlorate anions
Dain, R. P.; Leavitt, C. M.; Oomens, J.; Steill, J. D.; Groenewold, G. S.; van Stipdonk, M. J.
2010-01-01
The structures of gas-phase, metal chlorate anions with the formula [M(ClO3)(2)](-), M = Na and K, were determined using tandem mass spectrometry and infrared multiple photon dissociation (IRMPD) spectroscopy. Structural assignments for both anions are based on comparisons of the experimental
The Position of Aβ22-40 and Aβ1-42 in Anionic Lipid Membranes Containing Cholesterol.
Barrett, Matthew A; Alsop, Richard J; Hauß, Thomas; Rheinstädter, Maikel C
2015-11-30
Amyloid-β peptides interact with cell membranes in the human brain and are associated with neurodegenerative diseases, such as Alzheimer's disease. An emerging explanation of the molecular mechanism, which results in neurodegeneration, places the cause of neurotoxicity of the amyloid- peptides on their potentially negative interaction with neuronal membranes. It is known that amyloid-β peptides interact with the membrane, modifying the membrane's structural and dynamic properties. We present a series of X-ray diffraction experiments on anionic model lipid membranes containing various amounts of cholesterol. These experiments provide experimental evidence for an interaction of both the full length amyloid-β1-42 peptide, and the peptide fragment amyloid-β22-40 with anionic bilayer containing cholesterol. The location of the amyloid-β peptides was determined from these experiments, with the full length peptide embedding into the membrane, and the peptide fragment occupying 2 positions-on the membrane surface and embedded into the membrane core.
Energy Technology Data Exchange (ETDEWEB)
Riveros, Gonzalo; Ramirez, Daniel, E-mail: gonzalo.riveros@uv.cl [Departamento de Quimica y Bioquimica, Facultad de Ciencias, Universidad de Valparaiso, Valparaiso (Chile); Tello, Alejandra; Schrebler, Ricardo; Henriquez, Rodrigo; Gomez, Humberto [Instituto de Quimica, Pontificia Universidad Catolica de Valparaiso, Curauma, Valparaiso (Chile)
2012-03-15
The influence of the anion nature and its concentration in the electrodeposition of ZnO onto a gold electrode from dimethylsulfoxide (DMSO) solutions was studied. Voltammetric experiments revealed important changes in the zinc oxide electrodeposition process depending on the employed anion as electrolyte. From chronoamperometric experiments, the corresponding current-time curves were fitted with different nucleation and growth mechanism models. The analysis of these results showed changes from an instantaneous to a progressive growth when the solution composition was changed from ZnCl{sub 2} to ZnCl{sub 2} + LiCl. The change of the mechanism is associated to the adsorption of chloride ion on the active sites of the electrode surface when LiCl is present in the solution. (author)
Coumarin benzothiazole derivatives as chemosensors for cyanide anions
Wang, Kangnan; Liu, Zhiqiang; Guan, Ruifang; Cao, Duxia; Chen, Hongyu; Shan, Yanyan; Wu, Qianqian; Xu, Yongxiao
2015-06-01
Four coumarin benzothiazole derivatives, N-(benzo[d]thiazol-2-yl)-2-oxo-2H-chromene-3-carboxamide (1), (Z)-N-(3-methylbenzo[d]thiazol-2(3H)-ylidene)-2-oxo-2H-chromene-3-carboxamide (2), 7-(diethylamino)-N-(benzo[d]thiazol-2-yl)-2-oxo-2H-chromene-3-carboxamide (3) and (Z)-7-(diethylamino)-N-(3-methylbenzo[d]thiazol-2(3H)-ylidene)-2-oxo-2H-chromene-3-carboxamide) (4), have been synthesized. Their crystal structures, photophysical properties in acetonitrile and recognition properties for cyanide anions have been investigated. All the compounds are generally planar, especially compound 1 exhibits perfect planarity with dihedral angle between benzothiazolyl group and coumarin group being only 3.63°. Coumarin benzothiazole compounds 1 and 3 can recognize cyanide anions by Michael addition reaction and compound 3 exhibits color change from yellow to colorless and green fluorescence was quenched completely, which can be observed by naked eye. Coumarin benzothiazolyliden compound 4 can recognize cyanide anions with fluorescence turn-on response based on the copper complex ensemble displacement mechanism.
Directory of Open Access Journals (Sweden)
Pavol Tisovský
2017-11-01
Full Text Available Five isatin anions were prepared by deprotonation of initial isatins in aprotic solvents using basic fluoride and acetate anions (F− and CH3COO−. The F− basicity is sufficient to deprotonate isatin NH hydrogen from all the studied compounds. This process is reversible. In the presence of proton donor solvents, the anions form the corresponding isatins. The isatin hydrogen acidity depends on the overall structure of the isatin derivatives. The anions were characterized by ultraviolet–visible (UV–Vis, Fourier transform infrared (FTIR and nuclear magnetic resonance (NMR spectroscopy. Interestingly, the anions form aggregates at concentrations above 10−3 mol·dm−3. Further, the effect of cations on the UV–Vis spectra of the studied anions was studied. Charge transfer and its distribution in the anion depends on the radius and the cation electron configuration. The alkali metal cations, tetrabutylammonium (TBA+, Mg2+ and Ag+, interact with the C-2 carbonyl oxygen of the isatin anion. The interaction has a coulombic character. On the other hand, Cd2+, Zn2+, Hg2+, Co2+, and Cu+ cations form a coordinate bond with the isatin nitrogen.
Sensing mechanism for a fluorescent off–on chemosensor for cyanide anion
Energy Technology Data Exchange (ETDEWEB)
Li, Yang [State Key Laboratory of Molecular Reaction Dynamics, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, Dalian 116023 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Chen, Junsheng [State Key Laboratory of Molecular Reaction Dynamics, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, Dalian 116023 (China); Chu, Tian-Shu, E-mail: tschu@dicp.ac.cn [State Key Laboratory of Molecular Reaction Dynamics, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, Dalian 116023 (China); Institute for Computational Sciences and Engineering, Laboratory of New Fiber, Materials and Modern Textile, the Growing Base for State Key Laboratory, Qingdao University, Qingdao 266071 (China)
2016-11-15
In this article, the sensing mechanism of cyanide anion chemosensor 2-((2-phenyl-2H-1,2,3-triazol-4-yl)methylene)malononitrile (M1) has been investigated through the density functional theory (DFT) and time-dependent density functional theory (TDDFT) methods. The theoretical results demonstrate that the reaction barrier of 13.02 kcal/mol means a favorable response speed of the chemosensor M1 for cyanide anion. Cyanide anion attacks C=C double bond and hinders the ICT process from the malononitrile moiety to the fluorophore phenyl ring. The high viscosity of DMSO restrains the twisting of the group, inhibits the formation of the ICT state in the first excited state. Due to weak ICT character, the nucleophilic addition product shows the dramatic “off–on” fluorescence enhancement. Meanwhile, intramolecular charge transfer (ICT) mechanism accounts for how different solvents influence the fluorescence spectra. That is, more obvious ICT character of product in EtOH causes fluorescence quenching. The “reaction-based” recognition mode and large bond energy between M1 and cyanide anion minimize the interference by other anions, such as F{sup −}, AcO{sup −}. Thus, the chemosensor M1 has a high selectivity for cyanide.
Refeeding syndrome as an unusual cause of anion gap metabolic acidosis.
Singla, Manish; Perry, Alexandra; Lavery, Eric
2012-11-01
Refeeding syndrome is characterized by hypophosphatemia in the setting of malnutrition. It is commonly seen in patients with anorexia, alcoholism, or malignancy, and it is often a missed diagnosis. Because of the potential morbidity associated with missing the diagnosis of refeeding syndrome, it is important to monitor for this disease in any malnourished patient. We present a case of a 49-year-old male with chronic alcohol abuse who presented for alcohol detoxification and was found to have low phosphate, potassium, and magnesium on presentation, in addition to an elevated anion gap of unclear etiology. After extensive workup to evaluate the cause of his elevated anion gap and worsening of his electrolyte abnormalities despite replenishment, it was felt his symptoms were a result of refeeding syndrome. After oral intake was held and aggressive electrolyte replenishment was performed for 24 hours, the patient's anion gap closed and his electrolyte levels stabilized. This case demonstrates a unique presentation of refeeding syndrome given the patient's profound metabolic acidosis that provided a clue toward his eventual diagnosis. The standard workup for an anion gap metabolic acidosis was negative, and it was not until his refeeding syndrome had been treated that the anion gap closed.
Quantum mechanics of toroidal anions
International Nuclear Information System (INIS)
Afanas'ev, G.N.
1990-01-01
We consider a toroidal solenoid with an electric charge attached to it. It turns out that statistical properties of the wave function describing interacting toroidal anions depend on both their relative position and orientation. The influence of the particular gauge choice on the exchange properties of the wave function is studied. 30 refs.; 6 figs
International Nuclear Information System (INIS)
Pradanawati, Sylvia Ayu; Wang, Fu-Ming; Rick, John
2014-01-01
Highlights: • A new pentafluorophosphate benzimidazole anion was formed by Lewis acid-base reaction. • This pentafluorophosphate benzimidazole anion is fabricated with the benzimidazole anion and PF 5 . • This pentafluorophosphate benzimidazole anion avoids the ominous side reactions that PF 5 reacts SEI to form LiF and HF at high temperature. • The additional pentafluorophosphate benzimidazole anion formation well maintains the battery performance at 60 °C measurement compares to the electrolyte only with contains the salt, LiPF 6 . - Abstract: Lithium salts play a critical role in initiating electrochemical reactions in Li-ion batteries. Single Li ions dissociate from bulk-salt and associate with carbonates to form a solid electrolyte interface (SEI) during the first charge-discharge of the battery. SEI formation and the chemical stability of salt must both be controlled and optimized to minimize irreversible reactions in SEI formation and to suppress the decomposition of the salt at high temperatures. This study synthesizes a new benzimidazole-based anion in the electrolyte. This anion, pentafluorophosphate benzimidazole, results from a Lewis acid-base reaction between the benzimidazole anion and PF 5 . The new pentafluorophosphate benzimidazole anion inhibits the decomposition of LiPF 6 by inhibiting PF 5 side reactions, which degrade the SEI, and lead to the formation of LiF and HF at high temperatures. In addition, the use of the pentafluorophosphate benzimidazole anion results in the formation of a modified SEI that is able to modify the battery's performance. Cyclic voltammetry, scanning electron microscopy, differential scanning calorimetry, electrochemical impedance spectroscopy, as well as charge-discharge and X-ray photoelectron spectroscopy measurements have been used to characterize the materials in this study. The formation of the pentafluorophosphate benzimidazole anion in the electrolyte caused a 14% decrease in the activation energy
Anion-conducting polymer, composition, and membrane
Pivovar, Bryan S [Los Alamos, NM; Thorn, David L [Los Alamos, NM
2009-09-01
Anion-conducing polymers and membranes with enhanced stability to aqueous alkali include a polymer backbone with attached sulfonium, phosphazenium, phosphazene, and guanidinium residues. Compositions also with enhanced stability to aqueous alkali include a support embedded with sulfonium, phosphazenium, and guanidinium salts.
Vibrational Fano resonances in the photodetachment of dipole-bound anions
International Nuclear Information System (INIS)
Edwards, Stephen T; Tully, John C; Johnson, Mark A
2012-01-01
A simple model for the photodetachment of dipole-bound anions is proposed where non-adiabatic coupling of vibrational states leads to a Fano resonance in the spectrum. It is found that the shape of the photodetachment spectrum depends significantly on the parameter representing molecular polarizability. The model is also applied to a Fano profile observed in the photodetachment of small water cluster anions.
Effect of superoxide anion scavenger on rat hearts with chronic intermittent hypoxia.
Pai, Peiying; Lai, Ching Jung; Lin, Ching-Yuang; Liou, Yi-Fan; Huang, Chih-Yang; Lee, Shin-Da
2016-04-15
Only very limited information regarding the protective effects of the superoxide anion scavenger on chronic intermittent hypoxia-induced cardiac apoptosis is available. The purpose of this study is to evaluate the effects of the superoxide anion scavenger on cardiac apoptotic and prosurvival pathways in rats with sleep apnea. Forty-two Sprague-Dawley rats were divided into three groups, rats with normoxic exposure (Control, 21% O2, 1 mo), rats with chronic intermittent hypoxia exposure (Hypoxia, 3-7% O2vs. 21% O2per 40 s cycle, 8 h per day, 1 mo), and rats with pretreatment of the superoxide anion scavenger and chronic intermittent hypoxia exposure (Hypoxia-O2 (-)-Scavenger, MnTMPyP pentachloride, 1 mg/kg ip per day; 3-7% O2vs. 21% O2per 40 s cycle, 8 h per day, 1 mo) at 5-6 mo of age. After 1 mo, the protein levels and apoptotic cells of excised hearts from three groups were measured by Western blotting and terminal deoxynucleotide transferase-mediated dUTP nick end labeling (TUNEL) assay. The superoxide anion scavenger decreased hypoxia-induced myocardial architecture abnormalities, left ventricular hypertrophy, and TUNEL-positive apoptosis. The superoxide anion scavenger decreased hypoxia-induced Fas ligand, Fas death receptors, Fas-associated death domain (FADD), activated caspase-8, and activated caspase-3 (Fas-dependent apoptotic pathway) as well as Bad, activated caspase-9 and activated caspase-3 (mitochondria-dependent apoptotic pathway), endonuclease G (EndoG), apoptosis-inducing factor (AIF), and TUNEL-positive apoptosis. The superoxide anion scavenger increased IGF-1, IGF-1R, p-PI3k, p-Akt, p-Bad, Bcl-2, and Bcl-xL (survival pathway). Our findings imply that the superoxide anion scavenger might prevent cardiac Fas-mediated and mitochondrial-mediated apoptosis and enhance the IGF-1-related survival pathway in chronic intermittent hypoxia. The superoxide anion scavenger may prevent chronic sleep apnea-enhanced cardiac apoptotic pathways and enhances
Anion embedded sol-gel films on Al for corrosion protection
International Nuclear Information System (INIS)
Sheffer, Mari; Groysman, Alec; Starosvetsky, David; Savchenko, Natali; Mandler, Daniel
2004-01-01
We report here on the successful incorporation of organic anions into a sol-gel film on Al as a means of enhancing the protection against corrosion. Following our previous study where we showed that hydrophobic sol-gel films provided pronounced corrosion inhibition, we studied the corrosion inhibition that phenylphosphonic acid (PPA) has when embedded inside a thin sol-gel coating on Al. The anion of this organic anion tends to stay inside a phenyltrimethoxysilane (PTMOS) based sol-gel film due to π-interactions. Our findings, which are derived primarily from potentiodynamic polarization measurements, electrochemical noise, scanning electron microscopy measurements and Auger electron spectroscopy (AES), clearly show that the organic phosphonate adds to the protection efficiency of the sol-gel film
Preparation and physicochemical characterization of anionic uranyl. beta. -ketoenolates
Energy Technology Data Exchange (ETDEWEB)
Marangoni, G; Paolucci, G [Consiglio Nazionale delle Ricerche, Padua (Italy). Lab. di Chimica e Tecnologia dei Radioelementi; Graziani, R; Celon, E
1978-01-01
New classes of anionic uranyl ..beta..-ketoenolates of formula (UO/sub 2/L/sub 2/X)/sup -/ (where L = 1,3-diphenylpropane-1,3-dionate (dppd), 4,4,4-trifluoro-1-phenylbutane-1,3-dionate (tfpbd), or 1-phenylbutane-1,3-dionate (pbd); X = Cl/sup -/, Br/sup -/, I/sup -/, (NO/sub 3/)/sup -/, (O/sub 2/CMe)/sup -/, or (NCS)/sup -/) and (L/sub 2/O/sub 2/U(..mu..-X) UO/sub 2/L/sub 2/)/sup -/ (where X = F/sup -/, and also Cl/sup -/ only in the case of L = dppd) have been synthesized and characterized by a number of physical measurements. The different ability of the various anionic ligands to enter into the co-ordination sphere of the uranyl ion, their potentially different bonding modes, and the possible correlations between physical parameters and the nature of either the chelate substituents or the anionic ligand are discussed.
Removal of 125I from radioactive experimental waste with an anion exchange paper membrane
International Nuclear Information System (INIS)
Inoue, Hiroyoshi; Kagoshima, Mayumi
2000-01-01
The behavior of radioactive iodide and chloride ions through an anion exchange paper membrane to remove 125 I from radioactive experimental waste has been studied with nonequilibrium thermodynamic analyses. Anion exchange paper membrane was found to be electroconductively more permeable to iodide ion than to chloride ion. The iodide ion bound more strongly to the anion exchange site within a membrane phase than the chloride ion by more than twice. The results suggested that an anion exchange paper membrane was appropriate for the filtration removal system
The effects of anionic and cationic surfactants on the ion flotation of Cd2+
International Nuclear Information System (INIS)
Kobayashi, Koichi
1975-01-01
The ion flotation of Cd 2+ ions has been investigated from the surface chemical point of view in comparison with the case of Cu 2+ ions reported previously. The effects of the change in the pH, the anionic and cationic surfactants, and bentonite on the flotation rate have also been studied. Sodium α-sulfolaurate proved to be one of the best surfactants among the anionic surfactants used for removing Cd 2+ ions, showing as high as a 97% removal. About 97% of the Cd 2+ ions could be floated in the region of pH 11.3 when a cationic surfactant was used with bentonite, regardless of the exact surfactant used. The addition of bentonite reduced the foam formation and liquid hold-up, resulting in effective bubble flotation. This behavior was as a whole similar to that of Cu 2+ ions. However, in all the flotation systems tested, the flotation rate increased sharply at about pH 8, and the flotation rate vs. pH curve for Cd 2+ shifted towards a more alkaline region than that for Cu 2+ , because of the stronger basic nature of the former. Also, the flotation rate of Cd 2+ ions for the Cd 2+ -anionic surfactant systems attained a steady value after about 7 min, longer than the 2-min gas flow required in the case of Cu 2+ ion flotation. The adjustment of the pH using ammonia gave a lower rate of flotation than in the case of flotation using sodium hydroxide. (auth.)
Directory of Open Access Journals (Sweden)
Dell’Agli Mario
2012-07-01
Full Text Available Abstract Background Sardinia is a Mediterranean area endemic for malaria up to the last century. During a screening study to evaluate the anti-plasmodial activity of some aromatic plants traditionally used in Sardinia, Myrtus communis (myrtle, Myrtaceae, Satureja thymbra (savory, Lamiaceae, and Thymus herba-barona (caraway thyme, Lamiaceae were collected in three vegetative periods: before, during and after flowering. Methods The essential oils were obtained by steam distillation, fractionated by silica gel column chromatography and analysed by GC-FID-MS. Total oil and three main fractions were tested on D10 and W2 strains of Plasmodium falciparum in vitro. Larvicidal and adulticidal activities were tested on Anopheles gambiae susceptible strains. Results The essential oil of savory, rich in thymol, was the most effective against P. falciparum with an inhibitory activity independent from the time of collection (IC50 17–26 μg/ml on D10 and 9–11 μg/ml on W2. Upon fractionation, fraction 1 was enriched in mono-sesquiterpenoid hydrocarbons; fraction 2 in thymol (73-83%; and fraction 3 contained thymol, carvacrol and terpinen-4-ol, with a different composition depending on the time of collection. Thymol-enriched fractions were the most active on both strains (IC50 20–22 μg/ml on D10 and 8–10 μg/ml on W2 and thymol was confirmed as mainly responsible for this activity (IC50 19.7± 3.0 and 10.6 ± 2.0 μg/ml on D10 and W2, respectively. The essential oil of S. thymbra L. showed also larvicidal and adulticidal activities. The larvicidal activity, expressed as LC50, was 0.15 ± 0.002; 0.21 ± 0.13; and 0.15 ± 0.09 μg/ml (mean ± sd depending on the time of collection: before, during and after flowering, respectively. Conclusions This study provides evidence for the use of essential oils for treating malaria and fighting the vector at both the larval and adult stages. These findings open the possibility for further
Chevrot, G; Schurhammer, R; Wipff, G
2007-04-28
We report a molecular dynamics study of chlorinated cobalt bis(dicarbollide) anions [(B(9)C(2)H(8)Cl(3))(2)Co](-)"CCD(-)" in octanol and at the octanol-water interface, with the main aim to understand why these hydrophobic species act as strong synergists in assisted liquid-liquid cation extraction. Neat octanol is quite heterogeneous and is found to display dual solvation properties, allowing to well solubilize CCD(-), Cs(+) salts in the form of diluted pairs or oligomers, without displaying aggregation. At the aqueous interface, octanol behaves as an amphiphile, forming either monolayers or bilayers, depending on the initial state and confinement conditions. In biphasic octanol-water systems, CCD(-) anions are found to mainly partition to the organic phase, thus attracting Cs(+) or even more hydrophilic counterions like Eu(3+) into that phase. The remaining CCD(-) anions adsorb at the interface, but are less surface active than at the chloroform interface. Finally, we compare the interfacial behavior of the Eu(BTP)(3)(3+) complex in the absence and in the presence of CCD(-) anions and extractant molecules. It is found that when the CCD(-)'s are concentrated enough, the complex is extracted to the octanol phase. Otherwise, it is trapped at the interface, attracted by water. These results are compared to those obtained with chloroform as organic phase and discussed in the context of synergistic effect of CCD(-) in liquid-liquid extraction, pointing to the importance of dual solvation properties of octanol and of the hydrophobic character of CCD(-) for synergistic extraction of cations.
Electrokinetic remediation of anionic contaminants from unsaturated soils
International Nuclear Information System (INIS)
Lindgren, E.R.; Kozak, M.W.; Mattson, E.D.
1992-01-01
Heavy-metal contamination of soil and groundwater is a widespread problem in the DOE weapons complex, and for the nation as a whole. Electrokinetic remediation is one possible technique for in situ removal of such contaminants from unsaturated soils. In previous studies at Sandia National Laboratories, the electromigration of chromate ions and anionic dye ions have been demonstrated. This paper reports on a series of experiments that were conducted to study the effect of moisture content on the electromigration rate of anionic contaminants in unsaturated soil and determine the limiting moisture content for which electromigration occurs
International Nuclear Information System (INIS)
Kuznetsov, V.V.; Bozhenko, L.G.; Kucherenko, S.S.; Fedorova, O.V.
1986-01-01
Electrochemical reaction of cadmium ion discharge in water-dimethylformamide (DMF) solutions is studied. The influence of DMF concentration in the presence of different anions (ClO 4 - , F - , I - ) on both reaction kinetics and mechanism is discussed on the basis of structural transformations in the mixed solvent and near the surface electrode processes
Energy Technology Data Exchange (ETDEWEB)
Mane, R.G.; Surendran, P. [Nuclear Physics Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Kumar, Sanjay [Physics Department, Agra College Agra, Agra 282002 (India); Nair, J.P.; Yadav, M.L. [Nuclear Physics Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Hemalatha, M. [UM-DAE Centre for Excellence in Basic Sciences, Mumbai 400098 (India); Thomas, R.G.; Mahata, K. [Nuclear Physics Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Kailas, S. [UM-DAE Centre for Excellence in Basic Sciences, Mumbai 400098 (India); Bhabha Atomic Research Centre, Trombay, Mumbai 400 085 (India); Gupta, A.K., E-mail: anit@tifr.res.in [Nuclear Physics Division, Bhabha Atomic Research Centre, Mumbai 400085 (India)
2016-01-01
Recently, we have performed systematic Secondary Ion Mass Spectrometry (SIMS) measurements at our ion source test set up and have demonstrated that gas phase {sup 32}SF{sub n}{sup −} (n = 1–6) anions for all size ‘n’ can be readily generated from a variety of surfaces undergoing Cs{sup +} ion sputtering in the presence of high purity SF{sub 6} gas by employing the gas spray-cesium sputter technique. In our SIMS measurements, the isotopic yield ratio {sup 34}SF{sub n}{sup −}/{sup 32}SF{sub n}{sup −} (n = 1–6) was found to be close to its natural abundance but not for all size ‘n’. In order to gain further insight into the constituents of these molecular anions, ultra sensitive Accelerator Mass Spectrometry (AMS) measurements were conducted with the most abundant {sup 32}SF{sub n}{sup −} (n = 1–6) anions, at BARC-TIFR 14 UD Pelletron accelerator. The results from these measurements are discussed in this paper.
Bismuth-induced restructuring of the GaSb(110) surface
DEFF Research Database (Denmark)
Gemmeren, T. van; Lottermoser, L.; Falkenberg, G.
1998-01-01
The structure of the GaSb(110)(1 x 2)-Bi reconstruction has been solved using surface x-ray diffraction, scanning tunneling microscopy, and photoelectron spectroscopy. The ideal GaSb(110) surface is terminated with zigzag chains of anions and cations running in the [1 (1) over bar 0] direction...
Czech Academy of Sciences Publication Activity Database
Lehchili, F.; Setifi, F.; Liu, X.; Saneei, A.; Kučeráková, Monika; Setifi, Z.; Dušek, Michal; Poupon, Morgane; Pourayoubi, M.; Reedijk, J.
2017-01-01
Roč. 131, Jul (2017), s. 27-33 ISSN 0277-5387 R&D Projects: GA MŠk LO1603; GA ČR GA15-12719S EU Projects: European Commission(XE) CZ.2.16/3.1.00/24510 Institutional support: RVO:68378271 Keywords : polynitrile * crystal structure * anion-pi interaction * luminescence * Hirshfeld surface Subject RIV: BM - Solid Matter Physics ; Magnetism OBOR OECD: Condensed matter physics (including formerly solid state physics, supercond.) Impact factor: 1.926, year: 2016
Chubar, Natalia; Gerda, Vasyl; Banerjee, Dipanjan
2016-01-01
In this work, we report atomic-scale reconstruction processes in Fe-Ce oxide-based composites (hydrothermally precipitated at Fe-to-Ce dosage ratios of 1:0, 2:1, 1:1, 1:2, and 0:1), upon treatment at 300 °C. The structural changes are correlated with the adsorptive removal of arsenate, phosphate, fluoride, bromide, and bromate. The presence of the carbonate-based Ce-component and surface sulfate in precursor samples creates favorable conditions for phase transformation, resulting in the formation of novel (unknown) layered compounds of Fe and Ce. These compounds are of the layered double hydroxide type, with sulfate in the interlayer space. In spite of general awareness of the importance of surface area in adsorptive removal, the increase in surface area upon thermal treatment did not increase adsorption of the studied anions. However, EXAFS simulations and the adsorption tests provided evidence of regularities between local structures of Fe in composites obtained at 80 and 300 °C and adsorption performance of most studied anions. The best adsorption of tetrahedral anions was demonstrated by samples whose simulated outer Fe shells resulted from oscillations from both O and Fe atoms. In contrast, the loss of extended x-ray absorption fine structure was correlated with the decrease of adsorptive removal. Both Fe K-edge and Ce L3 -edge EXAFS suggested the formation of solid solutions. For the first time, the utilization of extended x-ray absorption fine structure is suggested as a methodological approach (first expressed in the companion paper) to estimate the surface reactivity of inorganic materials intended for use as anion exchange adsorbents.
Chubar, Natalia
2016-12-07
In this work, we report atomic-scale reconstruction processes in Fe-Ce oxide-based composites (hydrothermally precipitated at Fe-to-Ce dosage ratios of 1:0, 2:1, 1:1, 1:2, and 0:1), upon treatment at 300 °C. The structural changes are correlated with the adsorptive removal of arsenate, phosphate, fluoride, bromide, and bromate. The presence of the carbonate-based Ce-component and surface sulfate in precursor samples creates favorable conditions for phase transformation, resulting in the formation of novel (unknown) layered compounds of Fe and Ce. These compounds are of the layered double hydroxide type, with sulfate in the interlayer space. In spite of general awareness of the importance of surface area in adsorptive removal, the increase in surface area upon thermal treatment did not increase adsorption of the studied anions. However, EXAFS simulations and the adsorption tests provided evidence of regularities between local structures of Fe in composites obtained at 80 and 300 °C and adsorption performance of most studied anions. The best adsorption of tetrahedral anions was demonstrated by samples whose simulated outer Fe shells resulted from oscillations from both O and Fe atoms. In contrast, the loss of extended x-ray absorption fine structure was correlated with the decrease of adsorptive removal. Both Fe K-edge and Ce L3 -edge EXAFS suggested the formation of solid solutions. For the first time, the utilization of extended x-ray absorption fine structure is suggested as a methodological approach (first expressed in the companion paper) to estimate the surface reactivity of inorganic materials intended for use as anion exchange adsorbents.
Vlk, Alexandra; Stokes, Sarah; Wang, Yi; Hicks, Zachary; Zhang, Xinxing; Blando, Nicolas; Frock, Andrew; Marquez, Sara; Bowen, Kit; Bowen Lab JHU Team
Anion photoelectron spectroscopic (PES) and density functional theory (DFT) studies on the dimer anion of (2-hydroxypyridine)2-are reported. The experimentally measured vertical detachment energy (VDE) of 1.21eV compares well with the theoretically predicted values. The 2-hydroxypyridine anionic dimer system was investigated because of its resemblance to the nitrogenous heterocyclic pyrimidine nucleobases. Experimental and theoretical results show electron induced proton transfer (EIPT) in both the lactim and lactam homogeneous dimers. Upon electron attachment, the anion can serve as the intermediate between the two neutral dimers. A possible double proton transfer process can occur from the neutral (2-hydroxypyridine)2 to (2-pyridone)2 through the dimer anion. This potentially suggests an electron catalyzed double proton transfer mechanism of tautomerization. Research supported by the NSF Grant No. CHE-1360692.
Moreno, S N; Mason, R P; Docampo, R
1984-12-10
At the concentrations usually employed as a Ca2+ indicator, arsenazo III underwent a one-electron reduction by rat liver mitochondria to produce an azo anion radical as demonstrated by electron-spin resonance spectroscopy. Either NADH or NADPH could serve as a source of reducing equivalents for the production of this free radical by intact rat liver mitochondria. Under aerobic conditions, addition of arsenazo III to rat liver mitochondria produced an increase in electron flow from NAD(P)H to molecular oxygen, generating superoxide anion. NAD(P)H generated from endogenous mitochondrial NAD(P)+ by intramitochondrial reactions could not be used for the NAD(P)H azoreductase reaction unless the mitochondria were solubilized by detergent or anaerobiosis. In addition, NAD(P)H azoreductase activity was higher in the crude outer mitochondrial membrane fraction than in mitoplasts and intact mitochondria. The steady-state concentration of the azo anion radical and the arsenazo III-stimulated cyanide-insensitive oxygen consumption were enhanced by calcium and magnesium, suggesting that, in addition to an enhanced azo anion radical-stabilization by complexation with the metal ions, enhanced reduction of arsenazo III also occurred. Accordingly, addition of cations to crude outer mitochondrial membrane preparations increased arsenazo III-stimulated cyanide-insensitive O2 consumption, H2O2 formation, and NAD(P)H oxidation. Antipyrylazo III was much less effective than arsenazo III in increasing superoxide anion formation by rat liver mitochondria and gave a much weaker electron spin resonance spectrum of an azo anion radical. These results provide direct evidence of an azoreductase activity associated with the outer mitochondrial membrane and of a stimulation of arsenazo III reduction by cations.
Directory of Open Access Journals (Sweden)
Sho Hideshima
2016-03-01
Full Text Available Food allergens, especially buckwheat proteins, sometimes induce anaphylactic shock in patients after ingestion. Development of a simple and rapid screening method based on a field effect transistor (FET biosensor for food allergens in food facilities or products is in demand. In this study, we achieved the FET detection of a buckwheat allergenic protein (BWp16, which is not charged enough to be electrically detected by FET biosensors, by introducing additional negative charges from anionic surfactants to the target proteins. A change in the FET characteristics reflecting surface potential caused by the adsorption of target charged proteins was observed when the target sample was coupled with the anionic surfactant (sodium dodecyl sulfate; SDS, while no significant response was detected without any surfactant treatment. It was suggested that the surfactant conjugated with the protein could be useful for the charge amplification of the target proteins. The surface plasmon resonance analysis revealed that the SDS-coupled proteins were successfully captured by the receptors immobilized on the sensing surface. Additionally, we obtained the FET responses at various concentrations of BWp16 ranging from 1 ng/mL to 10 μg/mL. These results suggest that a signal amplification method for FET biosensing is useful for allergen detection in the food industry. Keywords: Field effect transistor biosensor, Food allergen, Signal amplification, Ionic surfactant, Intrinsic charge
Organic anion transporter (Slc22a) family members as mediators of toxicity
International Nuclear Information System (INIS)
Sweet, Douglas H.
2005-01-01
Exposure of the body to toxic organic anions is unavoidable and occurs from both intentional and unintentional sources. Many hormones, neurotransmitters, and waste products of cellular metabolism, or their metabolites, are organic anions. The same is true for a wide variety of medications, herbicides, pesticides, plant and animal toxins, and industrial chemicals and solvents. Rapid and efficient elimination of these substances is often the body's best defense for limiting both systemic exposure and the duration of their pharmacological or toxicological effects. For organic anions, active transepithelial transport across the renal proximal tubule followed by elimination via the urine is a major pathway in this detoxification process. Accordingly, a large number of organic anion transport proteins belonging to several different gene families have been identified and found to be expressed in the proximal nephron. The function of these transporters, in combination with the high volume of renal blood flow, predisposes the kidney to increased toxic susceptibility. Understanding how the kidney mediates the transport of organic anions is integral to achieving desired therapeutic outcomes in response to drug interactions and chemical exposures, to understanding the progression of some disease states, and to predicting the influence of genetic variation upon these processes. This review will focus on the organic anion transporter (OAT) family and discuss the known members, their mechanisms of action, subcellular localization, and current evidence implicating their function as a determinant of the toxicity of certain endogenous and xenobiotic agents
Carbon Chain Anions and the Growth of Complex Organic Molecules in Titan’s Ionosphere
Energy Technology Data Exchange (ETDEWEB)
Desai, R. T.; Coates, A. J.; Wellbrock, A.; González-Caniulef, D.; Jones, G. H.; Lewis, G. R.; Taylor, S. A.; Kataria, D. O. [Mullard Space Science Laboratory, University College London, Holmbury St. Mary, Surrey RH5 6NT (United Kingdom); Vuitton, V. [Université Grenoble Alpes, CNRS, IPAG, F-38000 Grenoble (France); Crary, F. J. [Laboratory for Atmospheric and Space Physics, University of Colorado, Innovation Drive, Boulder, CO 80303 (United States); Shebanits, O.; Wahlund, J.-E. [Department of Physics and Astronomy, Uppsala University, Box 516, SE-751 20 Uppsala (Sweden); Waite, J. H. [Space Science and Engineering Division, Southwest Research Institute (SWRI), 6220 Culebra Road, San Antonio, TX 78238 (United States); Cordiner, M.; Sittler, E. C. [NASA Goddard Space Flight Center, 8800 Greenbelt Road, Greenbelt, MD 20771 (United States); Edberg, N. J. T., E-mail: r.t.desai@ucl.ac.uk [Swedish Institute of Space Physics, Box 537, SE-751 21 Uppsala (Sweden)
2017-08-01
Cassini discovered a plethora of neutral and ionized molecules in Titan’s ionosphere including, surprisingly, anions and negatively charged molecules extending up to 13,800 u q{sup −1}. In this Letter, we forward model the Cassini electron spectrometer response function to this unexpected ionospheric component to achieve an increased mass resolving capability for negatively charged species observed at Titan altitudes of 950–1300 km. We report on detections consistently centered between 25.8 and 26.0 u q{sup −1} and between 49.0–50.1 u q{sup −1} which are identified as belonging to the carbon chain anions, CN{sup −}/C{sub 3}N{sup −} and/or C{sub 2}H{sup −}/C{sub 4}H{sup −}, in agreement with chemical model predictions. At higher ionospheric altitudes, detections at 73–74 u q{sup −1} could be attributed to the further carbon chain anions C{sub 5}N{sup −}/C{sub 6}H{sup −} but at lower altitudes and during further encounters extend over a higher mass/charge range. This, as well as further intermediary anions detected at >100 u, provide the first evidence for efficient anion chemistry in space involving structures other than linear chains. Furthermore, at altitudes below <1100 km, the low-mass anions (<150 u q{sup −1}) were found to deplete at a rate proportional to the growth of the larger molecules, a correlation that indicates the anions are tightly coupled to the growth process. This study adds Titan to an increasing list of astrophysical environments where chain anions have been observed and shows that anion chemistry plays a role in the formation of complex organics within a planetary atmosphere as well as in the interstellar medium.
Carbon Chain Anions and the Growth of Complex Organic Molecules in Titan’s Ionosphere
International Nuclear Information System (INIS)
Desai, R. T.; Coates, A. J.; Wellbrock, A.; González-Caniulef, D.; Jones, G. H.; Lewis, G. R.; Taylor, S. A.; Kataria, D. O.; Vuitton, V.; Crary, F. J.; Shebanits, O.; Wahlund, J.-E.; Waite, J. H.; Cordiner, M.; Sittler, E. C.; Edberg, N. J. T.
2017-01-01
Cassini discovered a plethora of neutral and ionized molecules in Titan’s ionosphere including, surprisingly, anions and negatively charged molecules extending up to 13,800 u q"−"1. In this Letter, we forward model the Cassini electron spectrometer response function to this unexpected ionospheric component to achieve an increased mass resolving capability for negatively charged species observed at Titan altitudes of 950–1300 km. We report on detections consistently centered between 25.8 and 26.0 u q"−"1 and between 49.0–50.1 u q"−"1 which are identified as belonging to the carbon chain anions, CN"−/C_3N"− and/or C_2H"−/C_4H"−, in agreement with chemical model predictions. At higher ionospheric altitudes, detections at 73–74 u q"−"1 could be attributed to the further carbon chain anions C_5N"−/C_6H"− but at lower altitudes and during further encounters extend over a higher mass/charge range. This, as well as further intermediary anions detected at >100 u, provide the first evidence for efficient anion chemistry in space involving structures other than linear chains. Furthermore, at altitudes below <1100 km, the low-mass anions (<150 u q"−"1) were found to deplete at a rate proportional to the growth of the larger molecules, a correlation that indicates the anions are tightly coupled to the growth process. This study adds Titan to an increasing list of astrophysical environments where chain anions have been observed and shows that anion chemistry plays a role in the formation of complex organics within a planetary atmosphere as well as in the interstellar medium.
Schampera, Birgit; Dultz, Stefan
2013-04-01
The low permeability, high cation exchange capacity (CEC) and plasticity of bentonites favor their use in multibarrier systems of waste deposits [1]. Bentonites have a high CEC but their ability to sorb anions is very low. There is, however, need for retardation of anions and organic pollutants in many applications. Bentonites, modified with certain organic cations, have the capacity to sorb anions and non-polar organic compounds in addition to cations. Investigations on organically modified clays address a wide variety of applications including immobilization of pollutants in contaminated soils, waste water treatment and in situ placement for the protection of ground water [2]. Many experiments on anion and cation sorption of organo-clays were conducted in the batch mode which does not reflect solid-liquid ratios and material densities in barrier systems. Diffusion experiments on compacted clays allow the evaluation of transport processes and sorption of pollutants at conditions relevant for repositories. For organo-clays only few diffusion studies are published e.g. [3] measured the diffusion of tritium and [4] the diffusion of H2O in bentonite and organo-bentonites. The organic cation hexadecylpyridinium (HDPy) was added to Wyoming bentonite (MX-80) in amounts corresponding to 2-400 % of the CEC. The uptake of organic cations was determined by the C-content, XRD and IR-spectroscopy. Wettability was analyzed by the contact angle. Physical, chemical and mineralogical properties of clays were characterized. Diffusion experiments were carried out in situ in a cell attached to the ATR-unit of a FTIR-spectrometer. For H2O-diffusion the compacted organo-clays are saturated first with D2O, afterwards H2O is supplied to the surface at the top of the clay platelet. Anion-diffusion was conducted with NO3--solution instead of H2O only having characteristic IR band positions at 1350 cm-1. Three different concentrations (0.25M, 0.5M and 1M) were used. Additional batch
Roles of Organic Acid Anion Secretion in Aluminium Tolerance of Higher Plants
Yang, Lin-Tong; Qi, Yi-Ping; Jiang, Huan-Xin; Chen, Li-Song
2013-01-01
Approximately 30% of the world's total land area and over 50% of the world's potential arable lands are acidic. Furthermore, the acidity of the soils is gradually increasing as a result of the environmental problems including some farming practices and acid rain. At mildly acidic or neutral soils, aluminium(Al) occurs primarily as insoluble deposits and is essentially biologically inactive. However, in many acidic soils throughout the tropics and subtropics, Al toxicity is a major factor limiting crop productivity. The Al-induced secretion of organic acid (OA) anions, mainly citrate, oxalate, and malate, from roots is the best documented mechanism of Al tolerance in higher plants. Increasing evidence shows that the Al-induced secretion of OA anions may be related to the following several factors, including (a) anion channels or transporters, (b) internal concentrations of OA anions in plant tissues, (d) temperature, (e) root plasma membrane (PM) H+-ATPase, (f) magnesium (Mg), and (e) phosphorus (P). Genetically modified plants and cells with higher Al tolerance by overexpressing genes for the secretion and the biosynthesis of OA anions have been obtained. In addition, some aspects needed to be further studied are also discussed. PMID:23509687
Marangoni, Rafael; Ramos, Luiz Pereira; Wypych, Fernando
2009-02-15
Different anionic blue and orange dyes have been immobilized on a zinc hydroxide nitrate (Zn(5)(OH)(8)(NO(3))(2)nH(2)O--Zn-OH-NO(3)) by anion exchange with interlayer and/or outer surface nitrate ions of the layered matrix. Orange G (OG) was totally intercalated, orange II (OII) was partially intercalated, while Niagara blue 3B (NB) and Evans blue (EV) were only adsorbed at the outer surface. Several composite films of poly(vinyl alcohol)--PVA were prepared by casting through the dispersion of the hybrid material (Zn-OH-OG) into a PVA aqueous solution and evaporation of water in a vacuum oven. The obtained composite films were transparent, colored, and capable of absorbing UV radiation. Improved mechanical properties were also obtained in relation to the nonfilled PVA films. These results demonstrate the onset of a new range of potential applications for layered hydroxide salts in the preparation of polymer composite multifunctional materials.
IMPROVING OF ANION EXCHANGERES REGENERATION
Directory of Open Access Journals (Sweden)
Muzher M. Ibrahim
2013-05-01
Full Text Available Inthis study, Different basis [NaOH and KOH] of variable concentration are usedto reactivate Anion exchangers employing different schemes .The Laboratoryresults showed large improvement in efficiency of these exchangers ( i.eoperating time was increased from 12 to 42 hours .The results of this work showed that the environmentalload (waste water can be reduced greatly when using the proposed regenerationscheme .
Cytosolic nucleotides block and regulate the Arabidopsis vacuolar anion channel AtALMT9.
Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis
2014-09-12
The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al(3+) to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Cytosolic Nucleotides Block and Regulate the Arabidopsis Vacuolar Anion Channel AtALMT9*
Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis
2014-01-01
The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al3+ to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. PMID:25028514
Hybrid capacitive deionization with anion-exchange membranes for lithium extraction
Siekierka Anna; Bryjak Marek
2017-01-01
Lithium is considered to be a critical material for various industrial fields. We present our studies on extraction lithium from diluted aqueous solution by novel hybrid system based on a membrane capacitive deionization and batteries desalination. Hybrid CDI is comprised by a lithium selective adsorbent, activated carbon electrode and anion-exchange membranes. Here, we demonstrated implication of various type of anion-exchange membranes and influence their properties on effective capacity an...
Moviat, M.; Terpstra, A.M.; Ruitenbeek, W.; Kluijtmans, L.A.J.; Pickkers, P.; Hoeven, J.G. van der
2008-01-01
OBJECTIVE: The physicochemical approach, described by Stewart to investigate the acid-base balance, includes the strong ion gap (SIG), a quantitative measure of "unmeasured" anions, which strongly correlates to the corrected anion gap. The chemical nature of these anions is for the most part
Infrared multiple photon dissociation spectroscopy of sodium and potassium chlorate anions.
Dain, Ryan P; Leavitt, Christopher M; Oomens, Jos; Steill, Jeffrey D; Groenewold, Gary S; Van Stipdonk, Michael J
2010-01-01
The structures of gas-phase, metal chlorate anions with the formula [M(ClO(3))(2)](-), M = Na and K, were determined using tandem mass spectrometry and infrared multiple photon dissociation (IRMPD) spectroscopy. Structural assignments for both anions are based on comparisons of the experimental vibrational spectra for the two species with those predicted by density functional theory (DFT) and involve conformations that feature either bidentate or tridentate coordination of the cation by chlorate. Our results strongly suggest that a structure in which both chlorate anions are bidentate ligands is preferred for [Na(ClO(3))(2)](-). However, for [K(ClO(3))(2)](-) the best agreement between experimental and theoretical spectra is obtained from a composite of predicted spectra for which the chlorate anions are either both bidentate or both tridentate ligands. In general, we find that the overall accuracy of DFT calculations for prediction of IR spectra is dependent on both functional and basis set, with best agreement achieved using frequencies generated at the B3LYP/6-311+g(3df) level of theory. Copyright 2009 John Wiley & Sons, Ltd.
Carbon Chain Anions and the Growth of Complex Organic Molecules in Titan’s Ionosphere
Desai, R. T.; Coates, A. J.; Wellbrock, A.; Vuitton, V.; Crary, F. J.; González-Caniulef, D.; Shebanits, O.; Jones, G. H.; Lewis, G. R.; Waite, J. H.; Cordiner, M.; Taylor, S. A.; Kataria, D. O.; Wahlund, J.-E.; Edberg, N. J. T.; Sittler, E. C.
2017-08-01
Cassini discovered a plethora of neutral and ionized molecules in Titan’s ionosphere including, surprisingly, anions and negatively charged molecules extending up to 13,800 u q-1. In this Letter, we forward model the Cassini electron spectrometer response function to this unexpected ionospheric component to achieve an increased mass resolving capability for negatively charged species observed at Titan altitudes of 950-1300 km. We report on detections consistently centered between 25.8 and 26.0 u q-1 and between 49.0-50.1 u q-1 which are identified as belonging to the carbon chain anions, CN-/C3N- and/or C2H-/C4H-, in agreement with chemical model predictions. At higher ionospheric altitudes, detections at 73-74 u q-1 could be attributed to the further carbon chain anions C5N-/C6H- but at lower altitudes and during further encounters extend over a higher mass/charge range. This, as well as further intermediary anions detected at >100 u, provide the first evidence for efficient anion chemistry in space involving structures other than linear chains. Furthermore, at altitudes below environments where chain anions have been observed and shows that anion chemistry plays a role in the formation of complex organics within a planetary atmosphere as well as in the interstellar medium.
Energy Technology Data Exchange (ETDEWEB)
Li, Peng; Vermeulen, Nicolaas A.; Gong, Xirui; Malliakas, Christos D.; Stoddart, J. Fraser; Hupp, Joseph T. [Northwestern Univ., Evanston, IL (United States). Dept. of Chemistry; Farha, Omar K. [Northwestern Univ., Evanston, IL (United States). Dept. of Chemistry; King Abdulaziz Univ., Jeddah (Saudi Arabia). Dept. of Chemistry
2016-08-22
Ionic metal-organic frameworks (MOFs) are a subclass of porous materials that have the ability to incorporate different charged species in confined nanospace by ion-exchange. To date, however, very few examples combining mesoporosity and water stability have been realized in ionic MOF chemistry. Herein, we report the rational design and synthesis of a water-stable anionic mesoporous MOF based on uranium and featuring tbo-type topology. The resulting tbo MOF exhibits exceptionally large open cavities (3.9 nm) exceeding those of all known anionic MOFs. By supercritical CO{sub 2} activation, a record-high Brunauer-Emmett-Teller (BET) surface area (2100 m{sup 2} g{sup -1}) for actinide-based MOFs has been obtained. Most importantly, however, this new uranium-based MOF is water-stable and able to absorb positively charged ions selectively over negatively charged ones, enabling the efficient separation of organic dyes and biomolecules.
International Nuclear Information System (INIS)
Arulraj, James; Rajamathi, Michael
2013-01-01
Oxalate intercalated anionic clay-like nickel zinc hydroxysalt was obtained starting from nickel zinc hydroxyacetate, Ni 3 Zn 2 (OH) 8 (OAc) 2 ·2H 2 O, by anion exchange. The intercalated oxalate species was reacted with potassium permanganate in such a way that the layered manganese oxide formed was within the interlayer region of the anionic clay resulting in a layered composite in which the negative charges on the birnessite type manganese oxide layers compensate the positive charges on the anionic clay layers. Birnessite to anionic clay ratio could be varied by varying the reaction time or the amount of potassium permanganate used. - Graphical abstract: Nickel zinc hydroxyoxalate was reacted with potassium permanganate to get nickel zinc hydroxide birnessite composites in which the positive charges on the hydroxide layers are neutralized by the negative charges on birnessite layers. Highlights: ► Anionic and cationic layered solid composites prepared. ► Ni–Zn hydroxyoxalate reacted with KMnO 4 to deposit MnO 2 in the interlayer. ► Birnessite layers coexist with anionic clay layers in the composites. ► Birnessite/anionic clay ratio controlled by amount of KMnO 4 used and reaction time
Rejuvenation processes applied to 'poisoned' anion exchangers in uranium processing
International Nuclear Information System (INIS)
Gilmore, A.J.
1979-11-01
The removal of 'poisons' from anion exchangers in uranium processing of Canadian radioactive ores is commonly called rejuvenation or regeneration. The cost of the ion exchange recovery of uranium is adversely affected by a decrease in the capacity and efficiency of the anion exchangers, due to their being 'poisoned' by silica, elemental sulphur, molybdenum and tetrathionates. These 'poisons' have a high affinity for the anion exchangers, are adsorbed in preference to the uranyl complex, and do not desorb with the reagents used normally in the uranyl desorption phase. The frequency of rejuvenation and the reagents required for rejuvenation are determined by the severity of the 'poisoning' accumulated by the exchanger in contact with the uranium leach liquor. Caustic soda (NaOH) at approximately equal to 18 cents/lb is commonly used to remove uranium anion exchangers of tetrathionate ((S 4 0 6 )/-/-) 'poisons'. A potential saving in operating cost would be of consequence if other reagents, e.g. sodium carbonate (Na 2 CO 3 ) at approximately equal to 3.6 cents/lb or calcium hydroxide (Ca(OH) 2 ) at approximately equal to 1.9 cents/lb, were effective in removing (S 4 0 6 )/-/-) from a 'poisoned' exchanger. A rejuvenation process for a test program was adopted after a perusal of the literature
Supramolecular binding and release of sulfide and hydrosulfide anions in water.
Vázquez, J; Sindelar, V
2018-06-05
Hydrogen sulfide (H2S) has become an important target for research due to its physiological properties as well as its potential applications in medicine. In this work, supramolecular binding of sulfide (S2-) and hydrosulfide (HS-) anions in water is presented for the first time. Bambusurils were used to slow down the release of these anions in water.
Reactivity of niobium cluster anions with nitrogen and carbon monoxide
Mwakapumba, Joseph; Ervin, Kent M.
1997-02-01
Reactions of small niobium cluster anions, Nbn-(n = 2-7), with CO and N2 are investigated using a flow tube reactor (flowing afterglow) apparatus. Carbon monoxide chemisorption on niobium cluster anions occurs with faster reaction rates than nitrogen chemisorption on corresponding cluster sizes. N2 addition to niobium cluster anions is much more size-selective than is CO addition. These general trends follow those reported in the literature for reactions of neutral and cationic niobium clusters with CO and N2. Extensive fragmentation of the clusters is observed upon chemisorption. A small fraction of the larger clusters survive and sequentially add multiple CO or N2 units without fragmentation. However, chemisorption saturation is not reached at the experimentally accessible pressure and reagent concentration ranges. The thermochemistry of the adsorption processes and the nature of the adsorbed species, molecular or dissociated, are discussed.
Bhut, Bharat V; Weaver, Justin; Carter, Andrew R; Wickramasinghe, S Ranil; Husson, Scott M
2011-11-01
This contribution describes the preparation of strong anion-exchange membranes with higher protein binding capacities than the best commercial resins. Quaternary amine (Q-type) anion-exchange membranes were prepared by grafting polyelectrolyte nanolayers from the surfaces of macroporous membrane supports. A focus of this study was to better understand the role of polymer nanolayer architecture on protein binding. Membranes were prepared with different polymer chain graft densities using a newly developed surface-initiated polymerization protocol designed to provide uniform and variable chain spacing. Bovine serum albumin and immunoglobulin G were used to measure binding capacities of proteins with different size. Dynamic binding capacities of IgG were measured to evaluate the impact of polymer chain density on the accessibility of large size protein to binding sites within the polyelectrolyte nanolayer under flow conditions. The dynamic binding capacity of IgG increased nearly linearly with increasing polymer chain density, which suggests that the spacing between polymer chains is sufficient for IgG to access binding sites all along the grafted polymer chains. Furthermore, the high dynamic binding capacity of IgG (>130 mg/mL) was independent of linear flow velocity, which suggests that the mass transfer of IgG molecules to the binding sites occurs primarily via convection. Overall, this research provides clear evidence that the dynamic binding capacities of large biologics can be higher for well-designed macroporous membrane adsorbers than commercial membrane or resin ion-exchange products. Specifically, using controlled polymerization leads to anion-exchange membrane adsorbers with high binding capacities that are independent of flow rate, enabling high throughput. Results of this work should help to accelerate the broader implementation of membrane adsorbers in bioprocess purification steps. Copyright © 2011 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Adélia A. A. Pozza
2009-01-01
Full Text Available Anion adsorption/desorption dynamics was studied as individual processes on surface of particles of a gibbsitic clay. The data suggest a remarkable gibbsite role as nitrate leaching retardant in soil. The opposite behavior of gibbsite towards adsorption/desorption of silicate and phosphate suggests the need of an adequate compromise solution regarding interval and rate applications of anions in cultivated gibbsitic soils. The high P adsorption verified in pH values lower than that reported for the point of zero charge of synthetic Al-hydroxides implies that this process takes place in pedogenic gibbsites through inner sphere complexation.
Effect of the counter anion of cesium on foliar uptake and translocation
Energy Technology Data Exchange (ETDEWEB)
Hasegawa, Hidenao [Department of Radioecology, Institute for Environmental Sciences, 1-7, Ienomae, Obuchi, Rokkasho, Kamikita-gun, Aomori 039-3212 (Japan)], E-mail: hhidenao@ies.or.jp; Tsukada, Hirofumi; Kawabata, Hitoshi [Department of Radioecology, Institute for Environmental Sciences, 1-7, Ienomae, Obuchi, Rokkasho, Kamikita-gun, Aomori 039-3212 (Japan); Chikuchi, Yuki [JGC Plantech Aomori Co. Ltd., Rokkasho, Aomori 039-3212 (Japan); Takaku, Yuichi; Hisamatsu, Shun' ichi [Department of Radioecology, Institute for Environmental Sciences, 1-7, Ienomae, Obuchi, Rokkasho, Kamikita-gun, Aomori 039-3212 (Japan)
2009-01-15
Direct deposition of radioactive material onto crops is one important pathway for safety assessment of radionuclides released from nuclear facilities. Foliar uptake of Cs by radish (Raphanus sativus L. cv. Redchim) was studied by applying droplets of Cs solution (CsCl or CsNO{sub 3}) on an upper leaf surface. The uptake of Cs was strongly affected by counter anions of Cs in the applied solution. Approximately 80% of Cs was absorbed for CsCl solution, while only 20% was absorbed for CsNO{sub 3}. The partition of absorbed Cs between leaf and root tuber was quite similar for both Cs compounds, which indicated that behavior of the absorbed Cs in radish was the same for both.
Physical Removal of Anions from Aqueous Media by Means of a Macrocycle-Containing Polymeric Network
Ji, Xiaofan
2018-02-13
Reported here is a hydrogel-forming polymer network that contains a water-soluble tetracationic macrocycle. Upon immersion of this polymer network in aqueous solutions containing various inorganic and organic salts, changes in the physical properties are observed that are consistent with absorption of the constituent anions into the polymer network. This absorption is ascribed to host-guest interactions involving the tetracationic macrocyclic receptor. Removal of the anions may then be achieved by lifting the resulting hydrogels out of the aqueous phase. Treating the anion-containing hydrogels with dilute HCl leads to the protonation-induced release of the bound anions. This allows the hydrogels to be recycled for reuse. The present polymer network thus provides a potentially attractive approach to removing undesired anions from aqueous environments.
Surface-enhanced Raman Spectroscopy of Ethephone Adsorbed on Silver Surface
International Nuclear Information System (INIS)
Lee, Chul Jae; Kim, Hee Jin; Karim, Mohammad Rezaul; Lee, Mu Sang
2006-01-01
We investigated the Surface-enhanced Raman Spectroscopy (SERS) spectrum of ethephone (2- chloroethylphosphonic acid). We observed significant signals in the ordinary Raman spectrum for solid-state ethephone as well as when it was adsorbed on a colloidal silver surface, strong vibrational signals were obtained at a very low concentration. The SERS spectra were obtained by silver colloids that were prepared by the γ - irradiation method. The influence of pH and the influence of anion (Cl - , Br - , I - ) on the adsorption orientation were investigated. Two different adsorption mechanisms were deduced, depending on the experimental conditions. The chlorine atom or the chlorine and two oxygen atoms were adsorbed on the colloidal silver surface. Among halide ions, Br - and I - were more strongly adsorbed on the colloidal silver surfaces. As a result, the adsorption of ethephone was less effective due to their steric hinderance
International Nuclear Information System (INIS)
Zhou, M.; Andrews, L.
1999-01-01
Laser ablation produces metal atoms, cations, and electrons for reaction with CO during condensation in excess neon at 4 K. Infrared spectra are observed for the metal carbonyls, cations, and anions, which are identified from isotopic shifts ( 13 CO, C 18 O) and splittings using mixed isotopic precursors. Density functional calculations with pseudopotentials for Rh and Ir predict the observed carbonyl stretching frequencies within 1--2%. This characterization of the simple RhCO + , RhCO, and RhCO - (and Ir) species over a 350 cm -1 range provides a scale for comparison of larger catalytically active Rh and Ir carbonyl complexes in solution and on surfaces to estimate charge on the metal center. This work provides the first spectroscopic characterization of Rh and Ir carbonyl cations and anions except for the stable tetracarbonyl anions in solution
Anion-induced structural transformation of a sulfate-incorporated 2D Cd(II)–organic framework
Energy Technology Data Exchange (ETDEWEB)
Lee, Li-Wei [Institute of Chemistry, Academia Sinica, Taipei 115, Taiwan (China); Institute of Materials Science and Engineering, National Central University, Taoyuan 320, Taiwan (China); Luo, Tzuoo-Tsair [Institute of Chemistry, Academia Sinica, Taipei 115, Taiwan (China); Wang, Chih-Min [Department of Bioscience and Biotechnology, National Taiwan Ocean University, Keelung 202, Taiwan (China); Lee, Gene-Hsiang; Peng, Shie-Ming [Department of Chemistry, National Taiwan University, Taipei 107, Taiwan (China); Liu, Yen-Hsiang [Department of Chemistry, Fu Jen Catholic University, New Taipei City 242, Taiwan (China); Lee, Sheng-Long [Institute of Materials Science and Engineering, National Central University, Taoyuan 320, Taiwan (China); Lu, Kuang-Lieh [Institute of Chemistry, Academia Sinica, Taipei 115, Taiwan (China)
2016-07-15
A Cd(II)–organic framework {[Cd_2(tpim)_4(SO_4)(H_2O)_2]·(SO_4)·21H_2O}{sub n} (1) was synthesized by reacting CdSO{sub 4}·8/3H{sub 2}O and 2,4,5-tri(4-pyridyl)imidazole (tpim) under hydrothermal conditions. A structural analysis showed that compound 1 adopts a layered structure in which the [Cd(tpim){sub 2}]{sub n} chains are linked by sulfate anions. These 2D layers are further packed into a 3D supramolecular framework via π–π interactions. The structure contains two types of SO{sub 4}{sup 2−} anions, i.e., bridging SO{sub 4}{sup 2−} and free SO{sub 4}{sup 2−} anions, the latter of which are included in the large channels of the framework. Compound 1 exhibits interesting anion exchange behavior. In the presence of SCN{sup −} anions, both the bridging and free SO{sub 4}{sup 2−} anions in 1 were completely exchanged by SCN{sup −} ligands to form a 1D species [Cd(tpim){sub 2}(SCN){sub 2}] (1A), in which the SCN{sup –} moieties function as a monodentate ligand. On the other hand, when compound 1 was ion exchanged with N{sub 3}{sup −} anions in aqueous solution, the bridging SO{sub 4}{sup 2−} moieties remained intact, and only the free guest SO{sub 4}{sup 2−} were replaced by N{sub 3}{sup −} anions. The gas adsorption behavior of the activated compound 1 was also investigated. - Highlights: • An interesting anion-induced structural transformation of a sulfate-incorporated 2D Cd(II)–organic framework is reported. • The sulfate-incorporated 2D layer compound exhibits very different anion exchange behavior with respect to SCN{sup −} and N{sub 3}{sup −}. • Both the bridging and free SO{sub 4}{sup 2−} anions in the 2D structure were completely exchanged by SCN{sup −} ligands, resulting in the formation of a 1D species. However, in the case of N{sub 3}{sup −} anions, only the free guest SO{sub 4}{sup 2−} in the structure was replaced.
Cation–Anion Interactions within the Nucleic Acid Ion Atmosphere Revealed by Ion Counting
Gebala, Magdalena; Giambasu, George M.; Lipfert, Jan; Bisaria, Namita; Bonilla, Steve; Li, Guangchao; York, Darrin M.; Herschlag, Daniel
2016-01-01
The ion atmosphere is a critical structural, dynamic, and energetic component of nucleic acids that profoundly affects their interactions with proteins and ligands. Experimental methods that “count” the number of ions thermodynamically associated with the ion atmosphere allow dissection of energetic properties of the ion atmosphere, and thus provide direct comparison to theoretical results. Previous experiments have focused primarily on the cations that are attracted to nucleic acid polyanions, but have also showed that anions are excluded from the ion atmosphere. Herein, we have systematically explored the properties of anion exclusion, testing the zeroth-order model that anions of different identity are equally excluded due to electrostatic repulsion. Using a series of monovalent salts, we find, surprisingly, that the extent of anion exclusion and cation inclusion significantly depends on salt identity. The differences are prominent at higher concentrations and mirror trends in mean activity coefficients of the electrolyte solutions. Salts with lower activity coefficients exhibit greater accumulation of both cations and anions within the ion atmosphere, strongly suggesting that cation–anion correlation effects are present in the ion atmosphere and need to be accounted for to understand electrostatic interactions of nucleic acids. To test whether the effects of cation–anion correlations extend to nucleic acid kinetics and thermodynamics, we followed the folding of P4–P6, a domain of the Tetrahymena group I ribozyme, via single-molecule fluorescence resonance energy transfer in solutions with different salts. Solutions of identical concentration but lower activity gave slower and less favorable folding. Our results reveal hitherto unknown properties of the ion atmosphere and suggest possible roles of oriented ion pairs or anion-bridged cations in the ion atmosphere for electrolyte solutions of salts with reduced activity. Consideration of these new
Hintz, Paul A.; Ervin, Kent M.
1994-04-01
Reactions of Ni-n(n=3-10), Pd-n(n=3-8), and Pt-n(n=3-7) with CO are studied in a flow tube reactor. Bimolecular rate coefficients are measured for the association reaction of CO adsorbing on the cluster surface. The rate coefficients range from about 10% of the collision rate for the trimer anions to near the collision rate for clusters larger than four atoms. The maximum number of CO molecules that bind to each cluster is determined. Whereas the saturation limits for nickel are typical for an 18 electron transition metal, the limits for platinum are lower, reflecting the electron deficient structures observed in condensed phase chemistry. The CO saturated palladium clusters represent the first examples of saturated binary palladium carbonyl compounds. Comparisons are made to similar studies on metal cation and neutral clusters and also to surface scattering studies of nickel group metals.
Energy Technology Data Exchange (ETDEWEB)
Liu Ge [Department of Chemistry, Chifeng University, Chifeng 024000 (China); Shao Jie, E-mail: njshao@live.c [Department of Chemistry and Materials Science, Nanjing Forestry University, Nanjing 210037 (China)
2011-07-15
A C{sub 2}-symmetric fluorescence and colorimetric anion sensor (1) based on pyrrole derivative was designed and synthesized according to binding site-signaling subunit approach. The compound 1 was easily prepared by reaction of pyrrole-2,5-dicarboxaldehyde with 4-nitrophenylhydrazine in ethanol (yield=78%). In DMSO, the sensor 1 exhibited a visible color change from red to brown upon exposure to anions such as AcO{sup -} and F{sup -}; however, no obvious color changes were observed when the other tested anions (e. g. H{sub 2}PO{sub 4}{sup -}, Cl{sup -}, Br{sup -} and I{sup -}) were added. There was a significant redshift ({Delta}{lambda}{sub max}=160 nm) in UV-vis spectrum during UV-vis spectral titrations. In particular, the sensor 1 showed ratiometric fluorescence responses to anions. - Highlights: {yields} C{sub 2}-symmetric fluorescence and colorimetric anion sensor based on pyrrole derivative was designed and synthesized according to binding site-signaling subunit approach. {yields} The sensor was easily prepared by reaction of pyrrole-2,5-dicarboxaldehyde with 4-nitrophenylhydrazine in ethanol (yield=78%). {yields} In DMSO, the sensor exhibited a visible color change from red to brown upon exposure to anions such as AcO{sup -} and F{sup -}, however, no obvious color changes were observed when the other anions tested (e. g. H{sub 2}PO{sub 4}{sup -}, Cl{sup -}, Br{sup -} and I{sup -}) were added. {yields} The sensor showed ratiometric fluorescence responses to anions.
Zhang, H.; Alkayal, N.; Gnanou, Yves; Hadjichristidis, Nikolaos
2013-01-01
A novel one-pot methodology combining anionic polymerization and polyhomologation, through a "bridge" molecule (BF3OEt 2), was developed for the synthesis of polyethylene (PE)-based block copolymers. The anionically synthesized macroanion reacts
Energy Technology Data Exchange (ETDEWEB)
Arulraj, James [Materials Research Group, Department of Chemistry, St. Joseph' s College, 36 Langford Road, Bangalore 560 027 (India); Rajamathi, Michael, E-mail: mikerajamathi@rediffmail.com [Materials Research Group, Department of Chemistry, St. Joseph' s College, 36 Langford Road, Bangalore 560 027 (India)
2013-02-15
Oxalate intercalated anionic clay-like nickel zinc hydroxysalt was obtained starting from nickel zinc hydroxyacetate, Ni{sub 3}Zn{sub 2}(OH){sub 8}(OAc){sub 2}{center_dot}2H{sub 2}O, by anion exchange. The intercalated oxalate species was reacted with potassium permanganate in such a way that the layered manganese oxide formed was within the interlayer region of the anionic clay resulting in a layered composite in which the negative charges on the birnessite type manganese oxide layers compensate the positive charges on the anionic clay layers. Birnessite to anionic clay ratio could be varied by varying the reaction time or the amount of potassium permanganate used. - Graphical abstract: Nickel zinc hydroxyoxalate was reacted with potassium permanganate to get nickel zinc hydroxide birnessite composites in which the positive charges on the hydroxide layers are neutralized by the negative charges on birnessite layers. Highlights: Black-Right-Pointing-Pointer Anionic and cationic layered solid composites prepared. Black-Right-Pointing-Pointer Ni-Zn hydroxyoxalate reacted with KMnO{sub 4} to deposit MnO{sub 2} in the interlayer. Black-Right-Pointing-Pointer Birnessite layers coexist with anionic clay layers in the composites. Black-Right-Pointing-Pointer Birnessite/anionic clay ratio controlled by amount of KMnO{sub 4} used and reaction time.
Vajpayee, Vaishali; Song, Young Ho; Lee, Min Hyung; Kim, Hyunuk; Wang, Ming; Stang, Peter J; Chi, Ki-Whan
2011-07-04
Novel arene-ruthenium [2+2] metalla-rectangles 4 and 5 have been synthesized by self-assembly using dipyridyl amide ligand 3 and arene-ruthenium acceptors (arene: benzoquinone (1), naphthacenedione (2)) and characterized by NMR spectroscopy and ESI-MS. The solid-state structure of 5 was determined by X-ray diffraction and shows encapsulated diethyl ether molecule in the rectangular cavity of 5. The luminescent 5 was further used for anion sensing with the amidic linkage serving as a hydrogen-bond donor site for anions and the ruthenium moiety serving as a signaling unit. A UV/Vis titration study demonstrated that although 5 interacts very weakly with common monoanions as well as with flexible dicarboxylate anions such as malonate and succinate, it displays significant binding affinity (K>10(3) in MeOH) for rigid multi-carboxylate anions such as oxalate, citrate, and tartrate, exhibiting a 1:1 stoichiometry. It has been suggested that 1:1 bidentate hydrogen bonding assisted by appropriate geometrical complementarity is mainly responsible for the increased affinity of 5 towards such anions. A fluorescence titration study revealed a large fluorescence enhancement of 5 upon binding to multi-carboxylate anions, which can be attributed to the blocking of the photoinduced electron-transfer process from the arene-Ru moiety to the amidic donor in 5 as a result of hydrogen bonding between the donor and the anion. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Materials chemistry approach to anion-sensor design
Czech Academy of Sciences Publication Activity Database
Anzenbacher Jr., P.; Jursiková, K.; Aldakov, D.; Marquez, M.; Pohl, Radek
2004-01-01
Roč. 60, č. 49 (2004), s. 11163-11168 ISSN 0040-4020 Institutional research plan: CEZ:AV0Z4055905 Keywords : conductive polymer * anion sensing * polythiophene Subject RIV: CC - Organic Chemistry Impact factor: 2.643, year: 2004
Estimation of πd-Interactions in Organic Conductors Including Magnetic Anions
Mori, Takehiko; Katsuhara, Mao
2002-03-01
Magnetic interactions in organic conductors including magnetic anions, such as λ-(BETS)2FeCl4 and κ-(BETS)2FeX4 [X = Cl and Br], are estimated from intermolecular overlap integrals; the overlaps between anions afford Jdd, and those between anions and donors give Jπ d. From this, the most stable spin alignments are decided, and such quantities as the Néel and Weiss temperatures, as well as the magnitude of spin polarization on the π-molecules are evaluated on the basis of the mean-field theory of πd-systems. The calculation is extended to several other πd-conductors, which are classified depending on the relative magnitudes of the direct dd- and indirect πd-interactions.
Photochemistry and infrared spectrum of single-bridged diborane(5) anion isolated in solid argon
Energy Technology Data Exchange (ETDEWEB)
Liu, Meng-Chen; Chin, Chih-Hao; Chen, Sian-Cong; Huang, Tzu-Ping [National Synchrotron Radiation Research Center (NSRRC), 101 Hsin-Ann Road, Hsinchu Science Park, Hsinchu 30076, Taiwan (China); Chen, Hui-Fen; Huang, Wei-Jie [Department of Medicinal and Applied Chemistry, Kaohsiung Medical University, 100, Shih-Chuan 1st Road, Kaohsiung 80708, Taiwan (China); Wu, Yu-Jong, E-mail: yjw@nsrrc.org.tw [National Synchrotron Radiation Research Center (NSRRC), 101 Hsin-Ann Road, Hsinchu Science Park, Hsinchu 30076, Taiwan (China); Department of Applied Chemistry, National Chiao Tung University, 1001, Ta-Hsueh Road, Hsinchu 30010, Taiwan (China)
2016-08-21
Three-center two-electron bonds are important for understanding electron-deficient molecules. To examine such a molecule, we produced a diborane(5) anion with a single-bridged structure upon electron bombardment during matrix deposition of Ar containing a small proportion of diborane(6). The diborane(5) anion was destroyed upon photolysis at 180, 220, 385, and 450 nm, but not at 532 nm. Moreover, the possible formation of neutral diborane(5) was observed upon photolysis at 385 and 450 nm, whereas neutral diborane(3) was observed upon photolysis at 180 and 220 nm. The observed line wavenumbers, relative intensities, and isotopic ratios of the diborane(5) anion agreed satisfactorily with those predicted by density functional theory calculations at the B3LYP/aug-cc-pVTZ level of theory. Thus, this method produced the boron hydride anion of interest with few other fragments, which enabled us to clearly identify the IR spectrum of the diborane(5) anion.
Synthesis and anion binding properties of porphyrins and related compounds
Figueira, Flávio
2016-12-02
Over the last two decades the preparation of pyrrole-based receptors for anion recognition has attracted considerable attention. In this regard porphyrins, phthalocyanines and expanded porphyrins have been used as strong and selective receptors while the combination of those with different techniques and materials can boost their applicability in different applications as chemosensors and extracting systems. Improvements in the field, including the synthesis of this kind of compounds, can contribute to the development of efficient, cheap, and easy-to-prepare anion receptors. Extensive efforts have been made to improve the affinity and selectivity of these compounds and the continuous expansion of related research makes this chemistry even more promising. In this review, we summarize the most recent developments in anion binding studies while outlining the strategies that may be used to synthesize and functionalize these type of macrocycles. © 2016 World Scientific Publishing Company.
Directory of Open Access Journals (Sweden)
Kayvan Zainabadi
Full Text Available Malaria infected erythrocytes show increased permeability to a number of solutes important for parasite growth as mediated by the Plasmodial Surface Anion Channel (PSAC. The P. falciparum clag3 genes have recently been identified as key determinants of PSAC, though exactly how they contribute to channel function and whether additional host/parasite proteins are required remain unknown. To begin to answer these questions, I have taken a biochemical approach. Here I have used an epitope-tagged CLAG3 parasite to perform co-immunoprecipitation experiments using membrane fractions of infected erythrocytes. Native PAGE and mass spectrometry studies reveal that CLAG3 participate in at least three different high molecular weight complexes: a ~720kDa complex consisting of CLAG3, RHOPH2 and RHOPH3; a ~620kDa complex consisting of CLAG3 and RHOPH2; and a ~480kDa complex composed solely of CLAG3. Importantly, these complexes can be found throughout the parasite lifecycle but are absent in untransfected controls. Extracellular biotin labeling and protease susceptibility studies localize the 480kDa complex to the erythrocyte membrane. This complex, likely composed of a homo-oligomer of 160kDa CLAG3, may represent a functional subunit, possibly the pore, of PSAC.
New enzymatic assay, parasite lactate dehydrogenase in diagnosis ...
African Journals Online (AJOL)
Background: The unique ability of plasmodial lactate dehydrogenase p(LDH) to utilise 3-acetyl pyridine dinucleotide (APAD) in lieu of NAD as a coenzyme in the conversion of pyruvate to lactate, led to the development of a biochemical assay for the detection of plasmodial parasitaemia. Researchers have reported that ...
Li, Xiang; Ko, Yeon-Jae; Wang, Haopeng; Bowen, Kit H.; Guevara-García, Alfredo; Martínez, Ana
2011-02-01
The copper-nucleoside anions, Cu-(cytidine) and Cu-(uridine), have been generated in the gas phase and studied by both experimental (anion photoelectron spectroscopy) and theoretical (density functional calculations) methods. The photoelectron spectra of both systems are dominated by single, intense, and relatively narrow peaks. These peaks are centered at 2.63 and 2.71 eV for Cu-(cytidine) and Cu-(uridine), respectively. According to our calculations, Cu-(cytidine) and Cu-(uridine) species with these peak center [vertical detachment energy (VDE)] values correspond to structures in which copper atomic anions are bound to the sugar portions of their corresponding nucleosides largely through electrostatic interactions; the observed species are anion-molecule complexes. The combination of experiment and theory also reveal the presence of a slightly higher energy, anion-molecule complex isomer in the case of the Cu-(cytidine). Furthermore, our calculations found that chemically bond isomers of these species are much more stable than their anion-molecule complex counterparts, but since their calculated VDE values are larger than the photon energy used in these experiments, they were not observed.
Li, Xiang; Ko, Yeon-Jae; Wang, Haopeng; Bowen, Kit H; Guevara-García, Alfredo; Martínez, Ana
2011-02-07
The copper-nucleoside anions, Cu(-)(cytidine) and Cu(-)(uridine), have been generated in the gas phase and studied by both experimental (anion photoelectron spectroscopy) and theoretical (density functional calculations) methods. The photoelectron spectra of both systems are dominated by single, intense, and relatively narrow peaks. These peaks are centered at 2.63 and 2.71 eV for Cu(-)(cytidine) and Cu(-)(uridine), respectively. According to our calculations, Cu(-)(cytidine) and Cu(-)(uridine) species with these peak center [vertical detachment energy (VDE)] values correspond to structures in which copper atomic anions are bound to the sugar portions of their corresponding nucleosides largely through electrostatic interactions; the observed species are anion-molecule complexes. The combination of experiment and theory also reveal the presence of a slightly higher energy, anion-molecule complex isomer in the case of the Cu(-)(cytidine). Furthermore, our calculations found that chemically bond isomers of these species are much more stable than their anion-molecule complex counterparts, but since their calculated VDE values are larger than the photon energy used in these experiments, they were not observed.
Cheng, Sara Y; Chou, George; Buie, Creighton; Vaughn, Mark W; Compton, Campbell; Cheng, Kwan H
2016-03-01
We used molecular dynamics simulations to explore the effects of asymmetric transbilayer distribution of anionic phosphatidylserine (PS) lipids on the structure of a protein on the membrane surface and subsequent protein-lipid interactions. Our simulation systems consisted of an amyloidogenic, beta-sheet rich dimeric protein (D42) absorbed to the phosphatidylcholine (PC) leaflet, or protein-contact PC leaflet, of two membrane systems: a single-component PC bilayer and double PC/PS bilayers. The latter comprised of a stable but asymmetric transbilayer distribution of PS in the presence of counterions, with a 1-component PC leaflet coupled to a 1-component PS leaflet in each bilayer. The maximally asymmetric PC/PS bilayer had a non-zero transmembrane potential (TMP) difference and higher lipid order packing, whereas the symmetric PC bilayer had a zero TMP difference and lower lipid order packing under physiologically relevant conditions. Analysis of the adsorbed protein structures revealed weaker protein binding, more folding in the N-terminal domain, more aggregation of the N- and C-terminal domains and larger tilt angle of D42 on the PC leaflet surface of the PC/PS bilayer versus the PC bilayer. Also, analysis of protein-induced membrane structural disruption revealed more localized bilayer thinning in the PC/PS versus PC bilayer. Although the electric field profile in the non-protein-contact PS leaflet of the PC/PS bilayer differed significantly from that in the non-protein-contact PC leaflet of the PC bilayer, no significant difference in the electric field profile in the protein-contact PC leaflet of either bilayer was evident. We speculate that lipid packing has a larger effect on the surface adsorbed protein structure than the electric field for a maximally asymmetric PC/PS bilayer. Our results support the mechanism that the higher lipid packing in a lipid leaflet promotes stronger protein-protein but weaker protein-lipid interactions for a dimeric protein on
Efficiency of superoxide anions in the inactivation of selected dehydrogenases
International Nuclear Information System (INIS)
Rodacka, Aleksandra; Serafin, Eligiusz; Puchala, Mieczyslaw
2010-01-01
The most ubiquitous of the primary reactive oxygen species, formed in all aerobes, is the superoxide free radical. It is believed that the superoxide anion radical shows low reactivity and in oxidative stress it is regarded mainly as an initiator of more reactive species such as · OH and ONOO - . In this paper, the effectiveness of inactivation of selected enzymes by radiation-generated superoxide radicals in comparison with the effectiveness of the other products of water radiolysis is examined. We investigate three enzymes: glyceraldehyde-3-phosphate dehydrogenase (GAPDH), alcohol dehydrogenase (ADH) and lactate dehydrogenase (LDH). We show that the direct contribution of the superoxide anion radical to GAPDH and ADH inactivation is significant. The effectiveness of the superoxide anion in the inactivation of GAPDH and ADG was only 2.4 and 2.8 times smaller, respectively, in comparison with hydroxyl radical. LDH was practically not inactivated by the superoxide anion. Despite the fact that the studied dehydrogenases belong to the same class of enzymes (oxidoreductases), all have a similar molecular weight and are tetramers, their susceptibility to free-radical damage varies. The differences in the radiosensitivity of the enzymes are not determined by the basic structural parameters analyzed. A significant role in inactivation susceptibility is played by the type of amino acid residues and their localization within enzyme molecules.
Efficiency of superoxide anions in the inactivation of selected dehydrogenases
Energy Technology Data Exchange (ETDEWEB)
Rodacka, Aleksandra, E-mail: olakow@biol.uni.lodz.p [Department of Molecular Biophysics, University of Lodz, Banacha 12/16, 90-237 Lodz (Poland); Serafin, Eligiusz, E-mail: serafin@biol.uni.lodz.p [Laboratory of Computer and Analytical Techniques, University of Lodz, Banacha 12/16, 90-237 Lodz (Poland); Puchala, Mieczyslaw, E-mail: puchala@biol.uni.lodz.p [Department of Molecular Biophysics, University of Lodz, Banacha 12/16, 90-237 Lodz (Poland)
2010-09-15
The most ubiquitous of the primary reactive oxygen species, formed in all aerobes, is the superoxide free radical. It is believed that the superoxide anion radical shows low reactivity and in oxidative stress it is regarded mainly as an initiator of more reactive species such as {sup {center_dot}}OH and ONOO{sup -}. In this paper, the effectiveness of inactivation of selected enzymes by radiation-generated superoxide radicals in comparison with the effectiveness of the other products of water radiolysis is examined. We investigate three enzymes: glyceraldehyde-3-phosphate dehydrogenase (GAPDH), alcohol dehydrogenase (ADH) and lactate dehydrogenase (LDH). We show that the direct contribution of the superoxide anion radical to GAPDH and ADH inactivation is significant. The effectiveness of the superoxide anion in the inactivation of GAPDH and ADG was only 2.4 and 2.8 times smaller, respectively, in comparison with hydroxyl radical. LDH was practically not inactivated by the superoxide anion. Despite the fact that the studied dehydrogenases belong to the same class of enzymes (oxidoreductases), all have a similar molecular weight and are tetramers, their susceptibility to free-radical damage varies. The differences in the radiosensitivity of the enzymes are not determined by the basic structural parameters analyzed. A significant role in inactivation susceptibility is played by the type of amino acid residues and their localization within enzyme molecules.
Energy Technology Data Exchange (ETDEWEB)
Li, Peng; Vermeulen, Nicolaas A.; Gong, Xirui; Malliakas, Christos D.; Stoddart, J. Fraser; Hupp, Joseph T. [Department of Chemistry, Northwestern University, Evanston, IL (United States); Farha, Omar K. [Department of Chemistry, Northwestern University, Evanston, IL (United States); Department of Chemistry, Faculty of Science, King Abdulaziz University, Jeddah (Saudi Arabia)
2016-08-22
Ionic metal-organic frameworks (MOFs) are a subclass of porous materials that have the ability to incorporate different charged species in confined nanospace by ion-exchange. To date, however, very few examples combining mesoporosity and water stability have been realized in ionic MOF chemistry. Herein, we report the rational design and synthesis of a water-stable anionic mesoporous MOF based on uranium and featuring tbo-type topology. The resulting tbo MOF exhibits exceptionally large open cavities (3.9 nm) exceeding those of all known anionic MOFs. By supercritical CO{sub 2} activation, a record-high Brunauer-Emmett-Teller (BET) surface area (2100 m{sup 2} g{sup -1}) for actinide-based MOFs has been obtained. Most importantly, however, this new uranium-based MOF is water-stable and able to absorb positively charged ions selectively over negatively charged ones, enabling the efficient separation of organic dyes and biomolecules. (copyright 2016 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Hofmeister effect of anions on calcium translocation by sarcoplasmic reticulum Ca2+-ATPase
Tadini-Buoninsegni, Francesco; Moncelli, Maria Rosa; Peruzzi, Niccolò; Ninham, Barry W.; Dei, Luigi; Nostro, Pierandrea Lo
2015-10-01
The occurrence of Hofmeister (specific ion) effects in various membrane-related physiological processes is well documented. For example the effect of anions on the transport activity of the ion pump Na+, K+-ATPase has been investigated. Here we report on specific anion effects on the ATP-dependent Ca2+ translocation by the sarcoplasmic reticulum Ca2+-ATPase (SERCA). Current measurements following ATP concentration jumps on SERCA-containing vesicles adsorbed on solid supported membranes were carried out in the presence of different potassium salts. We found that monovalent anions strongly interfere with ATP-induced Ca2+ translocation by SERCA, according to their increasing chaotropicity in the Hofmeister series. On the contrary, a significant increase in Ca2+ translocation was observed in the presence of sulphate. We suggest that the anions can affect the conformational transition between the phosphorylated intermediates E1P and E2P of the SERCA cycle. In particular, the stabilization of the E1P conformation by chaotropic anions seems to be related to their adsorption at the enzyme/water and/or at the membrane/water interface, while the more kosmotropic species affect SERCA conformation and functionality by modifying the hydration layers of the enzyme.
Extracellular determinants of anion discrimination of the Cl-/H+ antiporter protein CLC-5.
De Stefano, Silvia; Pusch, Michael; Zifarelli, Giovanni
2011-12-23
Mammalian CLC proteins comprise both Cl- channels and Cl-/H+ antiporters that carry out fundamental physiological tasks by transporting Cl- across plasma membrane and intracellular compartments. The NO3- over Cl- preference of a plant CLC transporter has been pinpointed to a conserved serine residue located at Scen and it is generally assumed that the other two binding sites of CLCs, Sext and Sin, do not substantially contribute to anion selectivity. Here we show for the Cl-/H+ antiporter CLC-5 that the conserved and extracellularly exposed Lys210 residue is critical to determine the anion specificity for transport activity. In particular, mutations that neutralize or invert the charge at this position reverse the NO3- over Cl- preference of WT CLC-5 at a concentration of 100 mm, but do not modify the coupling stoichiometry with H+. The importance of the electrical charge is shown by chemical modification of K210C with positively charged cysteine-reactive compounds that reintroduce the WT preference for Cl-. At saturating extracellular anion concentrations, neutralization of Lys210 is of little impact on the anion preference, suggesting an important role of Lys210 on the association rate of extracellular anions to Sext.
International Nuclear Information System (INIS)
Ohno, Hiroyuki; Suzuki, Chiiko; Fujita, Kyoko
2006-01-01
Horse heart cytochrome c (cyt c) was chemically modified with poly(ethylene oxide) (PEO) to dissolve it in room temperature ionic liquid 1-ethyl-3-methylimidazolium bis(trifluoromethanesulfonyl)imide ([emim][TFSI]). The redox response of the modified cyt c, hereafter PEO-cyt c, was analyzed in [emim][TFSI]. PEO modification to the surface of cyt c, which exceeded 60% of the total mass of the PEO-cyt c, was an effective method to solubilize the cyt c. In spite of the high ion density and sufficient ionic conductivity of [emim][TFSI], no redox response of pure PEO-cyt c was detected. However, a reversible redox response of PEO-cyt c was observed after adding a simple electrolyte such as KCl to [emim][TFSI]. The redox response of PEO-cyt c was sensitive to the anion radius of the added salt, and the chloride anion was found to be the best anion species to produce a redox response of PEO-cyt c in [emim][TFSI]. However, above a certain salt concentration, the resulting increase in solution viscosity would suppress the redox reaction. The results strongly indicate that the chloride anions, because of their mobility in the polypeptide matrix, compensate the charge change of heme during the electron transfer reaction. Larger anions did not show such an effect due to sterical restrictions on the migration through the protein shell to the heme pocket of cyt c
Energy Technology Data Exchange (ETDEWEB)
Hwang, Gab-Jin; Bong, Soo-Yeon; Ryu, Cheol-Hwi [Hoseo University, Asan (Korea, Republic of); Lim, Soo-Gon [Energy and Machinery Korea Co., Ltd., Changwon (Korea, Republic of); Choi, Ho-Sang [Kyungil University, Gyeongsan (Korea, Republic of)
2015-09-15
An anion exchange membrane was prepared by the chloromethylation and the amination of polyvinyl chloride (PVC), as the base polymer. The membrane properties of the prepared anion exchange membrane, including ionic conductivity, ion exchange capacity, and water content were measured. The ionic conductivity of the prepared anion exchange membrane was in the range of 0.098x10{sup -2} -7.0x10{sup -2}S cm{sup -1}. The ranges of ion exchange capacity and water content were 1.9-3.7meq./g-dry-membrane and 35.1-63.1%, respectively. The chemical stability of the prepared anion exchange membrane was tested by soaking in 30 wt% KOH solution to determine its availability as a separator in the alkaline water electrolysis. The ionic conductivity during the chemical stability test largely did not change.
Synthesis of azaphenanthridines via anionic ring closure
DEFF Research Database (Denmark)
Hansen, Henriette Møller; Lysén, M.; Begtrup, M.
2005-01-01
A new and convergent synthesis of azaphenanthridines via an anionic ring closure is reported. Ortho-lithiation/in situ borylation of cyanopyridines produces the corresponding cyanopyridylboronic esters, which undergo a Suzuki-Miyaura cross-coupling to give the key intermediates. Addition of lithium...
CSIR Research Space (South Africa)
Luo, H
2010-08-31
Full Text Available less than proton exchange membrane systems using alcohol as fuel. Many anion exchange membranes based on quaternised polymers have been developed and studied for AMFC3-5. The quaternary ammonium functional groups are the anion conductors...
Singh-Rawal, Pooja; Zsiros, Ottó; Bharti, Sudhakar; Garab, Gyozo; Jajoo, Anjana
2011-04-01
With an aim to improve our understanding of the mechanisms behind specific anion effects in biological membranes, we have studied the effects of sodium salts of anions of varying valency in thylakoid membranes. Rates of electron transport of PS II and PS I, 77K fluorescence emission and excitation spectra, cyclic electron flow around PS I and circular dichroism (CD) spectra were measured in thylakoid membranes in order to elucidate a general mechanism of action of inorganic anions on photosynthetic electron transport chain. Re-distribution of absorbed excitation energy has been observed as a signature effect of inorganic anions. In the presence of anions, such as nitrite, sulphate and phosphate, distribution of absorbed excitation energy was found to be more in favor of Photosystem I (PS I). The amount of energy distributed towards PS I depended on the valency of the anion. In this paper, we propose for the first time that energy re-distribution and its valence dependence may not be the effect of anions per se. The entry of negative charge (anion) is accompanied by influx of positive charge (protons) to maintain a balance of charge across the thylakoid membranes. As reflected by the CD spectra, the observed energy re-distribution could be a result of structural rearrangements of the protein complexes of PS II caused by changes in the ionic environment of the thylakoid lumen.
Huang, Zhongping; Ni, Chengzhu; Zhu, Zhuyi; Pan, Zaifa; Wang, Lili; Zhu, Yan
2015-05-01
The application of ion chromatography with the single pump cycling-column-switching technique was described for the analysis of trace inorganic anions in weak acid salts within a single run. Due to the hydrogen ions provided by an anion suppressor electrolyzing water, weak acid anions could be transformed into weak acids, existing as molecules, after passing through the suppressor. Therefore, an anion suppressor and ion-exclusion column were adopted to achieve on-line matrix elimination of weak acid anions with high concentration for the analysis of trace inorganic anions in weak acid salts. A series of standard solutions consisting of target anions of various concentrations from 0.005 to 10 mg/L were analyzed, with correlation coefficients r ≥ 0.9990. The limits of detection were in the range of 0.67 to 1.51 μg/L, based on the signal-to-noise ratio of 3 and a 25 μL injection volume. Relative standard deviations for retention time, peak area, and peak height were all less than 2.01%. A spiking study was performed with satisfactory recoveries between 90.3 and 104.4% for all anions. The chromatographic system was successfully applied to the analysis of trace inorganic anions in five weak acid salts. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Interaction of a potyviral VPg with anionic phospholipid vesicles
International Nuclear Information System (INIS)
Rantalainen, Kimmo I.; Christensen, Peter A.; Hafren, Anders; Otzen, Daniel E.; Kalkkinen, Nisse; Maekinen, Kristiina
2009-01-01
The viral genome-linked protein (VPg) of Potato virus A (PVA) is a multifunctional protein that belongs to a class of intrinsically disordered proteins. Typically, this type of protein gains a more stable structure upon interactions or posttranslational modifications. In a membrane lipid strip overlay binding assay, PVA VPg was found to bind phosphatidylserine (PS), but not phosphatidylcholine (PC). According to circular dichroism spectroscopy, the secondary structure of PVA VPg was stabilized upon interactions with PS and phosphatidylglycerol (PG), but not with PC vesicles. It is possible that this stabilization favored the formation of α-helical structures. Limited tryptic digestion showed that the interaction with anionic vesicles protected certain, otherwise accessible, trypsin cleavage sites. An electron microscopy study revealed that interaction with VPg substantially increased the vesicle diameter and caused the formation of pore or plaque-like electron dense spots on the vesicle surface, which gradually led to disruption of the vesicles.
Directory of Open Access Journals (Sweden)
Jurriaan Huskens
2011-10-01
Full Text Available A supramolecular platform based on self-assembled monolayers (SAMs has been implemented in a microfluidic device. The system has been applied for the sensing of two different analyte types: biologically relevant phosphate anions and aromatic carboxylic acids, which are important for anthrax detection. A Eu(III-EDTA complex was bound to β-cyclodextrin monolayers via orthogonal supramolecular host-guest interactions. The self-assembly of the Eu(III-EDTA conjugate and naphthalene β-diketone as an antenna resulted in the formation of a highly luminescent lanthanide complex on the microchannel surface. Detection of different phosphate anions and aromatic carboxylic acids was demonstrated by monitoring the decrease in red emission following displacement of the antenna by the analyte. Among these analytes, adenosine triphosphate (ATP and pyrophosphate, as well as dipicolinic acid (DPA which is a biomarker for anthrax, showed a strong response. Parallel fabrication of five sensing SAMs in a single multichannel chip was performed, as a first demonstration of phosphate and carboxylic acid screening in a multiplexed format that allows a general detection platform for both analyte systems in a single test run with µM and nM detection sensitivity for ATP and DPA, respectively.
Gas-generated thermal oxidation of a coordination cluster for an anion-doped mesoporous metal oxide.
Hirai, Kenji; Isobe, Shigehito; Sada, Kazuki
2015-12-18
Central in material design of metal oxides is the increase of surface area and control of intrinsic electronic and optical properties, because of potential applications for energy storage, photocatalysis and photovoltaics. Here, we disclose a facile method, inspired by geochemical process, which gives rise to mesoporous anion-doped metal oxides. As a model system, we demonstrate that simple calcination of a multinuclear coordination cluster results in synchronic chemical reactions: thermal oxidation of Ti8O10(4-aminobenzoate)12 and generation of gases including amino-group fragments. The gas generation during the thermal oxidation of Ti8O10(4-aminobenzoate)12 creates mesoporosity in TiO2. Concurrently, nitrogen atoms contained in the gases are doped into TiO2, thus leading to the formation of mesoporous N-doped TiO2. The mesoporous N-doped TiO2 can be easily synthesized by calcination of the multinuclear coordination cluster, but shows better photocatalytic activity than the one prepared by a conventional sol-gel method. Owing to an intrinsic designability of coordination compounds, this facile synthetic will be applicable to a wide range of metal oxides and anion dopants.
Schlenk Techniques for Anionic Polymerization
Ratkanthwar, Kedar
2015-09-01
Anionic polymerization-high vacuum techniques (HVTs) are doubtlessly the most prominent and reliable experimental tools to prepare polymer samples with well-defined and, in many cases, complex macromolecular architectures. Due to the high demands for time and skilled technical personnel, HVTs are currently used in only a few research laboratories worldwide. Instead, most researchers in this filed are attracted to more facile Schlenk techniques. The basic principle of this technique followed in all laboratories is substantially the same, i.e. the use of alternate vacuum and inert gas atmosphere in glass apparatus for the purification/charging of monomer, solvents, additives, and for the manipulation of air-sensitive compounds such as alkyl metal initiators, organometallic or organic catalysts. However, it is executed quite differently in each research group in terms of the structure of Schlenk apparatus (manifolds, connections, purification/storage flasks, reactors, etc.), the use of small supplementary devices (soft tubing, cannulas, stopcocks, etc.) and experimental procedures. The operational methods are partly purpose-oriented while also featured by a high flexibility, which makes it impossible to describe in detail each specific one. In this chapter we will briefly exemplify the application of Schlenk techniques for anionic polymerization by describing the performance of a few experiments from our own work.
Intramolecular anionic diels-alder reactions of 1-aryl-4-oxahepta-1,6-diyne systems in DMSO.
Kudoh, Takayuki; Mori, Tomoko; Shirahama, Mitsuhito; Yamada, Masashi; Ishikawa, Teruhiko; Saito, Seiki; Kobayashi, Hisayoshi
2007-04-25
Base-promoted cycloaddition reactions of 1-aryl- or 1-aryl-7-substituted-4-oxahepta-1,6-diyne systems in DMSO have proven to involve an anionic intramolecular Diels-Alder process taking place even at room temperature in spite of the reaction suffering from temporary disruption of aromaticity. Although initially formed alpha-arylallenide anion can be protonated by DMSO, it can be back to the allenide anion probably because of a small acidity difference between alpha-arylallene and DMSO. The alpha-arylallenide anion in combination with the alpha-aryl substituent can constitute an anionic diene structure that undergoes the intramolecular Diels-Alder reaction involving the C(6)-yne part, a very fast process probably because of the increased HOMO-1 level of the anionic diene, as shown by DFT calculations. Diversified substituted naphthalenes, benzofurans, phenanthrenes, and quinolines, including biaryl architectures, are available from 4-oxahepta-1,6-diynes in a highly expeditious way.
Anion-exchange membranes in electrochemical energy systems
Varcoe, J.R.; Atanassov, P.; Dekel, D.R.; Herring, A.M.; Hickner, M.A.; Kohl, P.A.; Kucernak, A. R.; Mustain, W.E.; Nijmeijer, K.; Scott, Keith; Xu, Tongwen; Zhuang, Lin
2014-01-01
This article provides an up-to-date perspective on the use of anion-exchange membranes in fuel cells, electrolysers, redox flow batteries, reverse electrodialysis cells, and bioelectrochemical systems (e.g. microbial fuel cells). The aim is to highlight key concepts, misconceptions, the current
Energy Technology Data Exchange (ETDEWEB)
Brigaudeau-Vaissiere, M [Commissariat a l' Energie Atomique, Fontenay-aux-Roses (France). Centre d' Etude Nucleaires
1966-06-01
After giving a brief review of the theoretical principles governing the fixation of anionic complexes of metallic elements on an anion exchange resin, we consider the particular case of uranyl acetate. By plotting the partition curves we have been able to calculate the exchange constants in the resin. By studying the changes in the logarithm of the limiting partition coefficient as a function of the logarithm of the free acetate ion concentration, it has been possible to calculate the dissociation constants for the complexes in solution. The fixation of a large number of metallic acetates has been studied. All the tests have been negative except in the case of mercury. For this reason we have been able to consider the possibility of separating uranium from a certain number of elements. Some of these separations are possible even in the presence of interfering anions such as chlorides which have a greater affinity for the resin than have the acetate ions. In the case of water-ethanol and water-isopropanol mixtures, we have improved the conditions under which copper acetate and mercury acetate may be fixed. This study has enabled us to calculate the dissociation constant for the CuAc{sub 3}{sup -} complex in the mixtures water +40% (by weight) isopropanol and water +50% (by weight) isopropanol. It should also make it possible to use separation conditions which could not hitherto be applied in aqueous media. (author) [French] Apres avoir rappele les principes theoriques de la fixation des complexes anioniques des elements metalliques dans une resine echangeuse d'anions, nous avons etudie tout particulierement le cas de l'acetate d'uranyle. Le trace des courbes de partage nous a permis de calculer les constantes d'echange dans la resine. L'etude des variations du logarithme du coefficient limite de partage avec le logarithme de la concentration des ions acetate libres nous a conduits aux calculs des constantes de dissociation des complexes en solution. La fixation d
Sun, Jie; Sun, Di; Yuan, Shuai; Tian, Dongxu; Zhang, Liangliang; Wang, Xingpo; Sun, Daofeng
2012-12-14
A series of C(3i)-symmetric bicapped trigonal antiprismatic Cd(8) cages [2X@Cd(8)L(6)(H(2)O)(6)]⋅n Y⋅solvents (X = Cl(-), Y = NO(3)(-), n = 2: MOCC-4; X = Br(-), Y = NO(3)(-), n = 2: MOCC-5; X = NO(3)(-), Y = NO(3)(-), n = 2: MOCC-6; X = NO(3)(-), Y = BF(4)(-), n = 2: MOCC-7; X = NO(3)(-), Y = ClO(4)(-), n = 2: MOCC-8; X = CO(3)(2-), n = 0: MOCC-9), doubly anion templated by different anions, were solvothermally synthesized by means of a flexible ligand. Interestingly, the CO(3)(2-) template for MOCC-9 was generated in situ by two-step decomposition of DMF solvent. For other MOCCs, spherical or trigonal monovalent anions could also play the role of template in their formation. The template abilities of these anions in the formation of the cages were experimentally studied and are discussed for the first time. Anion exchange of MOCC-8 was carried out and showed anion-size selectivity. All of the cage-like compounds emit strong luminescence at room temperature. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Li, Hua; Wood, Ross J; Atkin, Rob; Endres, Frank
2014-01-01
Atomic force microscopy (AFM) force measurements elucidate the effect of cation alkyl chain length and the anion species on ionic liquid (IL) interfacial structure at highly ordered pyrolytic graphite (HOPG) surfaces as a function of potential. Three ILs are examined: 1-hexyl-3-methylimidazolium tris(pentafluoroethyl)trifluorophosphate ([HMIM] FAP), 1-ethyl-3-methylimidazolium tris(pentafluoroethyl)trifluorophosphate ([EMIM] FAP), and 1-ethyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide ([EMIM] TFSA). The step-wise force-distance profiles indicate the ILs adopt a multilayered morphology near the surface. When the surface is biased positively or negatively versus Pt quasireference electrode, both the number of steps, and the force required to rupture each step increase, indicating stronger interfacial structure. At all potentials, push-through forces for [HMIM] FAP are the highest, because the long alkyl chain results in strong cohesive interactions between cations, leading to well-formed layers that resist the AFM tip. The most layers are observed for [EMIM] FAP, because the C 2 chains are relatively rigid and the dimensions of the cation and anion are similar, facilitating neat packing. [EMIM] TFSA has the smallest push-through forces and fewest layers, and thus the weakest interfacial structure. Surface-tip attractive forces are measured for all ILs. At the same potential, the attractions are the strongest for [EMIM] TFSA and the weakest for [HMIM] FAP because the interfacial layers are better formed for the longer alkyl chain cation. This means interfacial forces are stronger, which masks the weak attractive forces. (paper)
Intestinal transporters for endogenic and pharmaceutical organic anions
DEFF Research Database (Denmark)
Grandvuinet, Anne Sophie; Vestergaard, Henrik Tang; Rapin, Nicolas
2012-01-01
This review provides an overview of intestinal human transporters for organic anions and stresses the need for standardization of the various in-vitro methods presently employed in drug-drug interaction (DDI) investigations....
Effects of Anion Mobility on Electrochemical Behaviors of Lithium–Sulfur Batteries
Energy Technology Data Exchange (ETDEWEB)
Han, Kee Sung; Chen, Junzheng; Cao, Ruiguo; Rajput, Nav Nidhi; Murugesan, Vijayakumar; Shi, Lili; Pan, Huilin; Zhang, Jiguang; Liu, Jun; Persson, Kristin A.; Mueller, Karl T.
2017-10-27
The electrolyte is a crucial component of lithium-sulfur (Li-S) batteries, as it controls polysulfide dissolution, charge shuttling processes, and solid-electrolyte interphase (SEI) layer formation. Experimentally, the overall performance of Li-S batteries varies with choice of solvent system and Li-salt used in the electrolyte, and a lack of predictive understanding about the effects of individual electrolyte components inhibits the rational design of electrolytes for Li-S batteries. Here we analyze the role of the counter anions of common Li salts (such as TfO-, FSI-, TFSI-, and TDI-) when dissolved in DOL/DME (1:1 vol.) for use in Li-S batteries. The evolution of ion-ion and ion-solvent interactions due to vari-ous anions was analyzed using 17O NMR and pulsed-field gradient (PFG) NMR and then correlated with electrochemi-cal performance in Li-S cells. These data reveal that the for-mation of the passivation layer on the anode and the loss of active materials from the cathode (evidenced by polysulfide dissolution) are related to anion mobility and affinity with lithium polysulfide, respectively. For future electrolyte de-sign, anions with lower mobility and weaker interactions with lithium polysulfides may be superior candidates for increasing the long-term stability of Li-S batteries.
Extracellular Determinants of Anion Discrimination of the Cl−/H+ Antiporter Protein CLC-5*
De Stefano, Silvia; Pusch, Michael; Zifarelli, Giovanni
2011-01-01
Mammalian CLC proteins comprise both Cl− channels and Cl−/H+ antiporters that carry out fundamental physiological tasks by transporting Cl− across plasma membrane and intracellular compartments. The NO3− over Cl− preference of a plant CLC transporter has been pinpointed to a conserved serine residue located at Scen and it is generally assumed that the other two binding sites of CLCs, Sext and Sin, do not substantially contribute to anion selectivity. Here we show for the Cl−/H+ antiporter CLC-5 that the conserved and extracellularly exposed Lys210 residue is critical to determine the anion specificity for transport activity. In particular, mutations that neutralize or invert the charge at this position reverse the NO3− over Cl− preference of WT CLC-5 at a concentration of 100 mm, but do not modify the coupling stoichiometry with H+. The importance of the electrical charge is shown by chemical modification of K210C with positively charged cysteine-reactive compounds that reintroduce the WT preference for Cl−. At saturating extracellular anion concentrations, neutralization of Lys210 is of little impact on the anion preference, suggesting an important role of Lys210 on the association rate of extracellular anions to Sext. PMID:21921031
Contribution of attendant anions on cadmium toxicity to soil enzymes.
Tian, Haixia; Kong, Long; Megharaj, Mallavarapu; He, Wenxiang
2017-11-01
Sorption and desorption are critical processes to control the mobility and biotoxicity of cadmium (Cd) in soils. It is known that attendant anion species of heavy metals could affect metal adsorption on soils and might further alter their biotoxicity. However, for Cd, the influence of attendant anions on its sorption in soils and subsequent toxicity on soil enzymes are still unknown. In this work, four Cd compounds with different salt anions (SO 4 2- , NO 3 - , Cl - , and Ac - ) were selected to investigate their impact of on the sorption, soil dehydrogenase activity (DHA) and alkaline phosphatase activity (ALP). Thus, a series of simulated Cd pollution batch experiments including measuring adsorption-desorption behavior of Cd on soils and soil enzyme activities were carried out. Results showed that CdSO 4 exhibited highest sorption capacity among the tested soils except in Hunan soil. The Cd sorption with NO 3 - displayed a similar behavior with Cl - on all tested soils. Compared with soil properties, all four kinds of anions on Cd sorption played a more significant role affecting Cd ecological toxicity to soil DHA and ALP. Cd in acetate or nitrate form appears more sensitive towards DHA than sulphate and chloride, while the later pair is more toxic towards ALP than the former. These results have important implications for evaluation of Cd contamination using soil enzyme as bioindicator. Copyright © 2017 Elsevier Ltd. All rights reserved.
Eustis, S N; Whiteside, A; Wang, D; Gutowski, M; Bowen, K H
2010-01-28
The ammonia-hydrogen bromide and ammonia-hydrogen iodide, anionic heterodimers were studied by anion photoelectron spectroscopy. In complementary studies, these anions and their neutral counterparts were also investigated via ab initio theory at the coupled cluster level. In both systems, neutral NH(3)...HX dimers were predicted to be linear, hydrogen-bonded complexes, whereas their anionic dimers were found to be proton-transferred species of the form, (NH(4)(+)X(-))(-). Both experimentally measured and theoretically predicted vertical detachment energies (VDE) are in excellent agreement for both systems, with values for (NH(4)(+)Br(-))(-) being 0.65 and 0.67 eV, respectively, and values for (NH(4)(+)I(-))(-) being 0.77 and 0.81 eV, respectively. These systems are discussed in terms of our previous study of (NH(4)(+)Cl(-))(-).
Procedure for reducing hydrogen ion concentration in acidic anion eluate
International Nuclear Information System (INIS)
Parobek, P.; Baloun, S.; Plevac, S.
1992-01-01
A procedure is suggested for reducing the concentration of hydrogen ions in the acidic anionic eluate formed during the separation of uranium. The procedure involves anex elution, precipitation, filtration, precipitate rinsing, and anex rinsing. The procedure is included in the uranium elution process and requires at least one ion exchanger column and at least one tank in the continuous or discontinuous mode. Sparing the neutralizing agent by reducing the hydrogen ion concentration in the acidic anionic eluate is a major asset of this procedure. (Z.S.). 1 fig
Uranium isotopic effect studies on cation and anion exchange resins
International Nuclear Information System (INIS)
Sarpal, S.K.; Gupta, A.R.
1975-01-01
Uranium isotope effects in exchange reactions involving hexavalent and tetravalent uranium, on ion exchange resins, have been re-examined. The earlier work on uranium isotope effects in electron exchange reactions involving hexavalent and tetravalent uranium, has been critically reviewed. New experimental data on these systems in hydrochloric acid medium, has been obtained, using break-through technique on anion-exchange columns. The isotope effects in these break-through experiments have been reinterpreted in a way which is consistent with the anion exchange behaviour of the various uranium species in these systems. (author)
International Nuclear Information System (INIS)
Muhammad, Ayyaz; Abdul Mutalib, M.I.; Wilfred, C.D.; Murugesan, T.; Shafeeq, Amir
2008-01-01
The thermophysical properties of 1-hexyl-3-methyl imidazolium based hydrophobic room temperature ionic liquids (RTILs); with tetrafluoroborate (BF 4 ), hexafluorophosphate (PF 6 ), and bis(trifluoromethylsulfonyl)imide (Tf 2 N) anions, namely density ρ (298.15 to 348.15) K, dynamic viscosity η (288.2 to 348.2) K, surface tension σ (298.15 to 338) K, and refractive index n D (302.95 to 332.95) K have been measured. The coefficients of thermal expansion α p values were calculated from the experimental density data using an empirical correlation. The thermal stability of all ILs is also investigated at two different heating rates (10 and 20) deg. C . min -1 ) using thermogravimetric analyzer (TGA). The experimental results presented in this study reveal that the choice of anion type shows the most significant effect on the properties of ILs. The chloride and water contents of ILs (as impurities) are also investigated and reported in the present work
Energy Technology Data Exchange (ETDEWEB)
Mahmoodian, Mehrnoosh [Dep. of Polymer Engineering, Nanostructured Materials Research Center, Sahand University of Technology, Tabriz 51335-1996 (Iran, Islamic Republic of); Pourabbas, Behzad, E-mail: pourabas@sut.ac.ir [Dep. of Polymer Engineering, Nanostructured Materials Research Center, Sahand University of Technology, Tabriz 51335-1996 (Iran, Islamic Republic of); Mohajerzadeh, Shams [Nano-Electronics and Thin Film Lab, School of Electrical and Computer Engineering, University of Tehran, P.O. Box 14395/515, Tehran (Iran, Islamic Republic of)
2015-05-29
The effect of different dopant anions on deposition and characteristics of polypyrrole (PPy) thin film has been studied in this work. Ultra-thin films of conducting PPy were deposited on insulating surfaces of glass and oxidized silicon wafer by in situ chemical polymerization in the presence of different anionic dopants including sodium dodecylbenzenesulfonate, sodium dodecyl sulfate, α-naphthalene sulfonic acid, anthraquinone-2-sulfonic acid sodium salt monohydrate/5-sulfosalicylic acid dehydrate, and camphor sulfonic acid. Hydrophilic/hydrophobic properties and morphology of the self-assembled monolayer of N-(3-trimethoxysilylpropyl)pyrrole, the surface modifying agent in this work, and PPy thin films were characterized before and after deposition by contact angle measurements, field emission scanning electron microscopy, and atomic force microscopy. Chemical structure, thickness, and conductivity of the thin films were also studied by attenuated total reflectance Fourier transform infrared spectrometer, ellipsometry, and four-point probe measurements. The results showed deposition of thin films of conducting PPy with comparable thickness in the range of 6-31 nm and different morphologies, uniformity, and smoothness with average roughness in the range of 0.3-6 nm and relatively high range of conductivity on the modified surfaces. - Highlights: • Conducting thin films of polypyrrole were deposited on glass and SiO{sub 2} substrates. • Surface modification using pyrrole-silane was employed prior to polymerization. • Films as thin as ≈ 7 nm were deposited using different surfactant/counter ions. • Chemistry of the counter ion affects thickness, conductivity and morphology. • Lower thickness/higher conductivity were obtained by structurally flexible dopants.
Anion-Dependent Exocyclic Mercury(II) Coordination Polymers of Bis-dithiamacrocycle
Energy Technology Data Exchange (ETDEWEB)
Siewe, Arlette Deukam; Kim, Seul Gi; Choi, Kyu Seong [Kyungnam University, Changwon (Korea, Republic of); Lee, Shim Sung [Gyeongsang National University, Jinju (Korea, Republic of)
2014-09-15
Synthesis and structural characterization of mercury(II) halides and perchlorate complexes of bis-OS{sub 2}-Synthesis and structural characterization of mercury(II) halides and perchlorate complexes of bis-OS{sub 2}- macrocycle (L) are reported. L reacts with mercury(II) chloride and bromide to yield an isostructural 2D coordination polymers with type [Hg(L)X{sub 2}]n (1: X = Cl and 2: X = Br). In 1, each Hg atom which lies outside the cavity is six-coordinate with a distorted octahedral geometry, being bound to four adjacent ligands via monodentate Hg-S bonds and two remaining sites are occupied by two terminal chlorido ligands to form a fishnet-like 2D structure. When reacting with mercury(II) iodide, L afforded a 1D coordination polymer [Hg{sub 2}(L)I{sub 4}]·CHCl{sub 3}n in which each exocyclic Hg atom is four-coordinate, being bound to two sulfur donors from different ligands doubly bridging the ligand molecules in a head-to-tail mode. The coordination sphere in 3 is completed by two iodo terminal ligands, adopting a distorted tetrahedral geometry. On reacting with mercury(II) perchlorate, L forms solvent-coordinated 1D coordination polymer ([Hg{sub 2}(L)(DMF){sub 6}](ClO{sub 4}){sub 4}·2DMF)n instead of the anion-coordination. In 4, the Hg atom is five-coordinate, being bound to two sulfur donors from two different ligands doubly bridging the ligand molecules in a side-by-side mode to form a ribbon-like 1D structure.. The three remaining coordination sites in 4 are completed by three DMF molecules in a monodentate manner. Consequently, the different structures and connectivity patterns for the observed exocyclic coordination polymers depending on the anions used are influenced not only by the coordination ability of the anions but also by anion sizes macrocycle (L) are reported. L reacts with mercury(II) chloride and bromide to yield an isostructural 2D coordination polymers with type [Hg(L)X{sub 2}]n (1: X = Cl and 2: X = Br). In 1, each Hg atom which lies
Anion photoelectron spectroscopy of radicals and clusters
Energy Technology Data Exchange (ETDEWEB)
Travis, Taylor R. [Univ. of California, Berkeley, CA (United States)
1999-12-01
Anion photoelectron spectroscopy is used to study free radicals and clusters. The low-lying 2Σ and 2π states of C2nH (n = 1--4) have been studied. The anion photoelectron spectra yielded electron affinities, term values, and vibrational frequencies for these combustion and astrophysically relevant species. Photoelectron angular distributions allowed the author to correctly assign the electronic symmetry of the ground and first excited states and to assess the degree of vibronic coupling in C2H and C4H. Other radicals studied include NCN and I3. The author was able to observe the low-lying singlet and triplet states of NCN for the first time. Measurement of the electron affinity of I3 revealed that it has a bound ground state and attachment of an argon atom to this moiety enabled him to resolve the symmetric stretching progression.
Evaluating of arsenic(V) removal from water by weak-base anion exchange adsorbents.
Awual, M Rabiul; Hossain, M Amran; Shenashen, M A; Yaita, Tsuyoshi; Suzuki, Shinichi; Jyo, Akinori
2013-01-01
Arsenic contamination of groundwater has been called the largest mass poisoning calamity in human history and creates severe health problems. The effective adsorbents are imperative in response to the widespread removal of toxic arsenic exposure through drinking water. Evaluation of arsenic(V) removal from water by weak-base anion exchange adsorbents was studied in this paper, aiming at the determination of the effects of pH, competing anions, and feed flow rates to improvement on remediation. Two types of weak-base adsorbents were used to evaluate arsenic(V) removal efficiency both in batch and column approaches. Anion selectivity was determined by both adsorbents in batch method as equilibrium As(V) adsorption capacities. Column studies were performed in fixed-bed experiments using both adsorbent packed columns, and kinetic performance was dependent on the feed flow rate and competing anions. The weak-base adsorbents clarified that these are selective to arsenic(V) over competition of chloride, nitrate, and sulfate anions. The solution pH played an important role in arsenic(V) removal, and a higher pH can cause lower adsorption capacities. A low concentration level of arsenic(V) was also removed by these adsorbents even at a high flow rate of 250-350 h(-1). Adsorbed arsenic(V) was quantitatively eluted with 1 M HCl acid and regenerated into hydrochloride form simultaneously for the next adsorption operation after rinsing with water. The weak-base anion exchange adsorbents are to be an effective means to remove arsenic(V) from drinking water. The fast adsorption rate and the excellent adsorption capacity in the neutral pH range will render this removal technique attractive in practical use in chemical industry.
Electronic structure of incident carbon ions on a graphite surface
International Nuclear Information System (INIS)
Kiuchi, Masato; Takeuchi, Takae; Yamamoto, Masao.
1997-01-01
The electronic structure of an incident carbon ion on a graphite surface is discussed on the basis of ab initio molecular orbital calculations. A carbon cation forms a covalent bond with the graphite, and a carbon nonion is attracted to the graphite surface through van der Waals interaction. A carbon anion has no stable state on a graphite surface. The charge effects of incident ions become clear upon detailed examination of the electronic structure. (author)
Anion dynamics in the first 10 milliseconds of an argon-acetylene radio-frequency plasma
International Nuclear Information System (INIS)
Van de Wetering, F M J H; Beckers, J; Kroesen, G M W
2012-01-01
The time evolution of the smallest anions (C 2 H - and H 2 CC - ), just after plasma ignition, is studied by means of microwave cavity resonance spectroscopy (MCRS) in concert with laser-induced photodetachment under varying gas pressure and temperature in an argon-acetylene radio-frequency (13.56 MHz) plasma. These anions act as an initiator for spontaneous dust particle formation in these plasmas. With an intense 355 nm Nd:YAG laser pulse directed through the discharge, electrons are detached only from these anions present in the laser path. This results in a sudden increase in the electron density in the plasma, which can accurately and with sub-microsecond time resolution be measured with MCRS. By adjusting the time after plasma ignition at which the laser is fired through the discharge, the time evolution of the anion density can be studied. We have operated in the linear regime: the photodetachment signal is proportional to the laser intensity. This allowed us to study the trends of the photodetachment signal as a function of the operational parameters of the plasma. The density of the smallest anions steadily increases in the first few milliseconds after plasma ignition, after which it reaches a steady state. While keeping the gas density constant, increasing the gas temperature in the range 30-120 °C limits the number of smallest anions and saturates at a temperature of about 90 °C. A reaction pathway is proposed to explain the observed trends.
International Nuclear Information System (INIS)
Samskog, P.O.; Kispert, L.D.
1984-01-01
The anion radicals of bromodifluoroacetamide and chlorodifluoroacetamide are investigated by using the INDO method and EPR spectroscopy. INDO calculations for the anions give a spin density distribution in agreement with that suggested from experiment. Results of the analyses show that the unpaired electron occupies the sigma* orbital composed of the rho orbitals, along the C/sub β/-X bond, on the carbon and the unique halogen atoms. The results are compared to the radical anion in trifluoroacetamide. The electronic structure of SCF 2 CONH 2 - radical anions is a π-radical anion when X = F and a sigma*-radical anion when X = Cl and Br. 2 figures, 4 tables
Update on Anion Resin Kinetic Impairment in PWR Polishers Using ETA
International Nuclear Information System (INIS)
Carlin, William
2012-09-01
The paper is an update on the investigation of experiences with impaired anion kinetics in PWRs using ETA. 17 years worth of circumstantial evidence has led to the development of a new resin to mitigate the anion kinetic impairment issue with PWRs using ETA. A test bed was installed at Diablo Canyon Unit 1. After 1.5 years of service, the SO 4 MTC of the anion resin in the test bed is still >2.0 x10 -4 m/s (like new resin). Other resin beds operating under parallel conditions in the same unit have experienced kinetic impairment which follows the classic pattern seen in plants where ETA is used. Although the exact pathway of the ETA fouling mechanism is still not proven, the circumstantial evidence collected over many years, and a new theory on the fouling mechanism will also be presented and discussed. (authors)
Demonstrate use of capillary electrophoresis low level transient of anions
International Nuclear Information System (INIS)
Moum, Kari-Lye; Solheim, Torill; McElrath, Joel; Frattini, Paul
2012-09-01
Capillary Electrophoresis (CE) is a well-known analytical method capable of rapid detection of very low concentration of cations and anionic species such as chloride, sulfate and nitrate. These anions are of crucial importance in reducing the potential of stainless steel components to undergo stress corrosion cracking. Currently, Nuclear Power Plants (NPPs) use Ion Chromatography (IC) as the analytical technique to achieve the required detection levels of ionic species. At the Halden Reactor Project (HRP) IC was replaced by CE in 1996, and since then HRP has gained nearly 20 years of operational experience. During the last 15 years, EPRI has done research on the CE technique and has achieved extensive experience in this area. EPRI has demonstrated detection levels at ppt and sub-ppb levels. This paper presents the ability of the CE technique to follow low level transients of anions in Boiling Water Reactor (BWR) coolant. A transient caused by approx. 10 ppb chloride and sulfate was simulated in an experimental circuit simulating BWR conditions. A series of grab samples were taken and analysed using HRPs CE (Agilent G1600). (authors)
Tetrel Bonding as a Vehicle for Strong and Selective Anion Binding
Directory of Open Access Journals (Sweden)
Steve Scheiner
2018-05-01
Full Text Available Tetrel atoms T (T = Si, Ge, Sn, and Pb can engage in very strong noncovalent interactions with nucleophiles, which are commonly referred to as tetrel bonds. The ability of such bonds to bind various anions is assessed with a goal of designing an optimal receptor. The Sn atom seems to form the strongest bonds within the tetrel family. It is most effective in the context of a -SnF3 group and a further enhancement is observed when a positive charge is placed on the receptor. Connection of the -SnF3 group to either an imidazolium or triazolium provides a strong halide receptor, which can be improved if its point of attachment is changed from the C to an N atom of either ring. Aromaticity of the ring offers no advantage nor is a cyclic system superior to a simple alkyl amine of any chain length. Placing a pair of -SnF3 groups on a single molecule to form a bipodal dicationic receptor with two tetrel bonds enhances the binding, but falls short of a simple doubling. These two tetrel groups can be placed on opposite ends of an alkyl diamine chain of any length although SnF3+NH2(CH2nNH2SnF3+ with n between 2 and 4 seems to offer the strongest halide binding. Of the various anions tested, OH− binds most strongly: OH− > F− > Cl− > Br− > I−. The binding energy of the larger NO3− and HCO3− anions is more dependent upon the charge of the receptor. This pattern translates into very strong selectivity of binding one anion over another. The tetrel-bonding receptors bind far more strongly to each anion than an equivalent number of K+ counterions, which leads to equilibrium ratios in favor of the former of many orders of magnitude.
Novel Biscalix[4]arene-based Anion Receptors
Czech Academy of Sciences Publication Activity Database
Šťastný, V.; Lhoták, P.; Michlová, V.; Stibor, I.; Sýkora, Jan
2002-01-01
Roč. 58, č. 36 (2002), s. 7207-7211 ISSN 0040-4020 R&D Projects: GA ČR GA104/00/1722; GA ČR GA203/00/1011 Keywords : calixarenes * anion receptors * NMR titration Subject RIV: CI - Industrial Chemistry, Chemical Engineering Impact factor: 2.420, year: 2002
Shuang, Chendong; Wang, Jun; Li, Haibo; Li, Aimin; Zhou, Qing
2015-01-01
Polystyrenic (PS) anion-exchange resin and polyacrylic (PA) anion-exchange resin were used to investigate the effect of resin chemical structure on the adsorption of humic acid (HA). Due to the rearrangement of HA to form layers that function as barricades to further HA diffusion, PS resin exhibited 12.4 times slower kinetics for the initial adsorption rate and 8.4 times for the diffusion constant in comparison to that of the PA resin. An HA layer and a spherical cluster of HA can be observed on the surface of the PS and PA resins after adsorption, respectively. The considerable difference in HA adsorption between the PS and PA resins was due to the difference in molecule shape for interaction with different resin structures, which can essentially be explained by the hydrophobicity and various interactions of the PS resin. A given amount of HA occupies more positively charged sites and hydrophobic sites on the PS resin than were occupied by the same amount of HA on the PA resin. Increased pH resulted in an increase of HA adsorption onto the PA resin but a decrease in adsorption onto PS resin, as the non-electrostatic adsorption led to electrostatic repulsion between the HA attached to the resin and the HA dissolved in solution. These results suggest higher rates of adsorption and higher regeneration efficiency for interaction of HA with more hydrophilic anion exchange materials. Copyright © 2014 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Matsuura, K.; Muto, H.
1991-01-01
The radical anions of alkynes have been first observed by electron spin resonance spectroscopy following alkene anions previously studied. Hexyne radical anions were formed in 1-, 2-, or 3-hexyne/n--hexane mixed crystals irradiated at 4.2 or 77 K. The characters of the anions were as follows; (a) the α-proton hyperfine coupling is very large (∼4.5 mT for the 1-hexyne anion), (b) the β-proton couplings are very small (∼1.0 mT for C--H β proton with the conformational angle of 0 degree), and (c) the radicals show a negative g shift (2.0014). From these observations, it was found that the anions have a nonlinear(bent) molecule structure in the anticonfiguration (trans C--C≡C--C) with the bend angle ∼60 degree, and that the unpaired electron orbital is approximately composed of the anticombination of the sp 2 hybrid orbitals of the C≡C carbon atoms. A discussion based on complete neglect of differential overlap (CNDO) molecular orbital (MO) calculations was given for the observed negative g shift, which was shown to be characteristic of the alkyne anions which have a high-lying unpaired electron orbital and an antibonding 2p--2p π carbon orbital just above it on the upper energy side
DEFF Research Database (Denmark)
Andersen, Rikke; Sørensen, A.
2000-01-01
Carbohydrates such as alditols (polyols or sugar alcohols), monosaccharides and disaccharides are separated as anions by anion-exchange chromatography with a sodium hydroxide eluent, MA1 CarboPac column and pulsed amperometric detection. We report a high-pH anion-exchange chromatographic-pulsed a......Carbohydrates such as alditols (polyols or sugar alcohols), monosaccharides and disaccharides are separated as anions by anion-exchange chromatography with a sodium hydroxide eluent, MA1 CarboPac column and pulsed amperometric detection. We report a high-pH anion-exchange chromatographic......-pulsed amperometric detection (HPAEC-PAD) method that determines all the polyols used as food additives in food products and the most commonly found mono- and disaccharides on a routine basis. The linearity, repeatability, internal reproducibility and accuracy are described. The applicability of the method has been...
Infrared Spectroscopy of Discrete Uranyl Anion Complexes
International Nuclear Information System (INIS)
Groenewold, G. S.; Gianotto, Anita K.; McIIwain, Michael E.; Van Stipdonk, Michael J.; Kullman, Michael; Moore, David T.; Polfer, Nick; Oomens, Jos; Infante, Ivan A.; Visscher, Lucas; Siboulet, Bertrand; De Jong, Wibe A.
2008-01-01
The Free-Electron Laser for Infrared Experiments (FELIX) w 1 as used to study the wavelength-resolved multiple photon photodissociation of discrete, gas phase uranyl (UO2 2 2+) complexes containing a single anionic ligand (A), with or without ligated solvent molecules (S). The uranyl antisymmetric and symmetric stretching frequencies were measured for complexes with general formula [UO2A(S)n]+, where A was either hydroxide, methoxide, or acetate; S was water, ammonia, acetone, or acetonitrile; and n = 0-3. The values for the antisymmetric stretching frequency for uranyl ligated with only an anion ([UO2A]+) were as low or lower than measurements for [UO2]2+ ligated with as many as five strong neutral donor ligands, and are comparable to solution phase values. This result was surprising because initial DFT calculations predicted values that were 30-40 cm-1 higher, consistent with intuition but not with the data. Modification of the basis sets and use of alternative functionals improved computational accuracy for the methoxide and acetate complexes, but calculated values for the hydroxide were greater than the measurement regardless of the computational method used. Attachment of a neutral donor ligand S to [UO2A]+ produced [UO2AS]+, which produced only very modest changes to the uranyl antisymmetric stretch frequency, and did not universally shift the frequency to lower values. DFT calculations for [UO2AS]+ were in accord with trends in the data, and showed that attachment of the solvent was accommodated by weakening of the U-anion bond as well as the uranyl. When uranyl frequencies were compared for [UO2AS]+ species having different solvent neutrals, values decreased with increasing neutral nucleophilicity
Anionic water pentamer and hexamer clusters: An extensive study of structures and energetics
Ünal, Aslı; Bozkaya, Uǧur
2018-03-01
An extensive study of structures and energetics for anionic pentamer and hexamer clusters is performed employing high level ab initio quantum chemical methods, such as the density-fitted orbital-optimized linearized coupled-cluster doubles (DF-OLCCD), coupled-cluster singles and doubles (CCSD), and coupled-cluster singles and doubles with perturbative triples [CCSD(T)] methods. In this study, sixteen anionic pentamer clusters and eighteen anionic hexamer clusters are reported. Relative, binding, and vertical detachment energies (VDE) are presented at the complete basis set limit (CBS), extrapolating energies of aug4-cc-pVTZ and aug4-cc-pVQZ custom basis sets. The largest VDE values obtained at the CCSD(T)/CBS level are 9.9 and 11.2 kcal mol-1 for pentamers and hexamers, respectively, which are in very good agreement with the experimental values of 9.5 and 11.1 kcal mol-1. Our binding energy results, at the CCSD(T)/CBS level, indicate strong bindings in anionic clusters due to hydrogen bond interactions. The average binding energy per water molecules is -5.0 and -5.3 kcal mol-1 for pentamers and hexamers, respectively. Furthermore, our results demonstrate that the DF-OLCCD method approaches to the CCSD(T) quality for anionic clusters. The inexpensive analytic gradients of DF-OLCCD compared to CCSD or CCSD(T) make it very attractive for high-accuracy studies.
Pore channel surface modification for enhancing anti-fouling membrane distillation
Qiu, Haoran; Peng, Yuelian; Ge, Lei; Villacorta Hernandez, Byron; Zhu, Zhonghua
2018-06-01
Membrane surface modification by forming a functional layer is an effective way to improve the anti-fouling properties of membranes; however, the additional layer and the potential blockage of bulk pores may increase the mass transfer resistance and reduce the permeability. In this study, we applied a novel method of preparing anti-fouling membranes for membrane distillation by dispersing graphene oxide (GO) on the channel surface of polyvinylidene fluoride membranes. The surface morphology and properties were characterized by scanning electron microscopy, atomic force microscope, and Fourier transform infrared spectrometry. Compared to the membrane surface modification by nanoparticles (e.g. SiO2), GO was mainly located on the pore surface of the membrane bulk, rather than being formed as an individual layer onto the membrane surface. The performance was evaluated via a direct-contact membrane distillation process with anionic and cationic surfactants as the foulants, separately. Compared to the pristine PVDF membrane, the anti-fouling behavior and distillate flux of the GO-modified membranes were improved, especially when using the anionic surfactant as the foulant. The enhanced anti-fouling performance can be attributed to the oxygen containing functional groups in GO and the healing of the membrane pore defects. This method may provide an effective route to manipulate membrane pore surface properties for anti-fouling separation without increasing mass transfer resistance.
Distribution of anionic sites in Bruch's membrane of the rabbit eye.
Essner, E; Pino, R M
1982-06-01
The organization of anionic (negatively charged) sites in Bruch's membrane of the rabbit eye at various stages of postnatal development was studied using the cationic polymer, polyethyleneimine (PEI). PEI-positive sites were demonstrable as rows of particles (diameter ca. 18 nm) located at intervals along either side of the basal laminae of the retinal pigment epithelium and choriocapillary endothelium. In tangential sections through Bruch's membrane, stained particles appeared to be arranged in a semi-regular, lattice-like pattern in which the sites were separated from each other by an interval of approximately 50 nm. PEI-positive particles were also observed on collagen fibers where they were distributed at regular intervals along the length of the fiber. In tangential sections, collagen fibers formed a loosely packed meshwork in the central zone of Bruch's membrane. In addition, individual fibers were frequently oriented so that one end was located close to or within the substance of the basal laminae, a result suggesting that the anionic sites on these fibers might contribute to the network present in the basal laminae. The findings lend further support to the suggestion that anionic sites in Bruch's membrane may serve as a charge barrier which retards the movement of anionic molecules that are in transit from the choriocapillaris to the retinal pigment epithelium and outer neural retina.
Uranium extraction from sulfuric acid solution using anion exchange resin
International Nuclear Information System (INIS)
Sheta, M. E.; Abdel Aal, M. M.; Kandil, A. T.
2012-12-01
Uranium is currently recovered from sulfuric acid leach liquor using anion exchange resin as Amberlite IRA 402 (CT). This technology is based on fact that, uranium exists as anionic complexes. This takes place by controlling the pH of the solution, agitation time, temperature and resin to solution ratio (R/S). In this work, batch stirrer tank used for uranium extraction from sulfate medium and after extraction, elution process was done using 1M NaCl solution. After extraction and elution process, the resin was separated from the system and uranium was determined in the solution. (Author)
Introducing various ligands into superhalogen anions reduces their electronic stabilities
Smuczyńska, Sylwia; Skurski, Piotr
2008-02-01
The vertical electron detachment energies (VDE) of six NaX2- anions (where X = F, Cl, Br) were calculated at the OVGF level with the 6-311++G(3df) basis sets. In all the cases studied the VDE exceeds the electron affinity of chlorine atom and thus those species were classified as superhalogen anions. The largest vertical binding energy was found for the NaF2- system (6.644 eV). The strong VDE dependence on the ligand type, ligand-central atom distance, and the character of the highest occupied molecular orbital (HOMO) was observed and discussed.
Binding of chloroquine to ionic micelles: Effect of pH and micellar surface charge
Energy Technology Data Exchange (ETDEWEB)
Souza Santos, Marcela de, E-mail: marcelafarmausp77@gmail.com [Departamento de Física e Química, Faculdade de Ciências Farmacêuticas de Ribeirão Preto, Universidade de São Paulo, Avenida do Café, s/n, Ribeirão Preto, São Paulo 14040-903 (Brazil); Perpétua Freire de Morais Del Lama, Maria, E-mail: mpemdel@fcfrp.usp.br [Departamento de Física e Química, Faculdade de Ciências Farmacêuticas de Ribeirão Preto, Universidade de São Paulo, Avenida do Café, s/n, Ribeirão Preto, São Paulo 14040-903 (Brazil); Instituto Nacional de Ciência e Tecnologia de Bioanalítica, Departamento de Química Analítica, Universidade Estadual de Campinas, Cidade Universitária Zeferino Vaz, s/n, Campinas, São Paulo 13083-970 (Brazil); Siuiti Ito, Amando, E-mail: amandosi@ffclrp.usp.br [Departamento de Física, Faculdade de Filosofia, Ciências e Letras de Ribeirão Preto, Universidade de São Paulo, Avenida Bandeirantes, 3900, Ribeirão Preto, São Paulo 14040-901 (Brazil); and others
2014-03-15
The pharmacological action of chloroquine relies on its ability to cross biological membranes in order to accumulate inside lysosomes. The present work aimed at understanding the basis for the interaction between different chloroquine species and ionic micelles of opposite charges, the latter used as a simple membrane model. The sensitivity of absorbance and fluorescence of chloroquine to changes in its local environment was used to probe its interaction with cetyltrimethylammonium micelles presenting bromide (CTAB) and sulfate (CTAS) as counterions, in addition to dodecyl sulfate micelles bearing sodium (SDS) and tetramethylammonium (TMADS) counterions. Counterion exchange was shown to have little effect on drug–micelle interaction. Chloroquine first dissociation constant (pKa{sub 1}) shifted to opposite directions when anionic and cationic micelles were compared. Chloroquine binding constants (K{sub b}) revealed that electrostatic forces mediate charged drug–micelle association, whereas hydrophobic interactions allowed neutral chloroquine to associate with anionic and cationic micelles. Fluorescence quenching studies indicated that monoprotonated chloroquine is inserted deeper into the micelle surface of anionic micelles than its neutral form, the latter being less exposed to the aqueous phase when associated with cationic over anionic assemblies. The findings provide further evidence that chloroquine–micelle interaction is driven by a tight interplay between the drug form and the micellar surface charge, which can have a major effect on the drug biological activity. -- Highlights: • Chloroquine (CQ) pKa{sub 1} increased for SDS micelles and decreased for CTAB micelles. • CQ is solubilized to the surface of both CTAB and SDS micelles. • Monoprotonated CQ is buried deeper into SDS micelles than neutral CQ. • Neutral CQ is less exposed to aqueous phase in CTAB over SDS micelles. • Local pH and micellar surface charge mediate interaction of CQ with
Photophysics and Photochemistry of 2-Aminobenzoic Acid Anion in Aqueous Solution
Pozdnyakov, Ivan P.; Plyusnin, Victor F.; Grivin, Vjacheslav P.
2009-11-01
Nanosecond laser flash photolysis and absorption and fluorescence spectroscopy were used to study photochemical processes of 2-aminobenzoic acid anion (ABA-) in aqueous solutions. Excitation of this species gives rise to the ABA- triplet state to the ABA• radical and to the hydrated electron (eaq-). The last two species result from two-photon processes. In a neutral medium, the main decay channels of ABA- triplet state, the ABA• radical, and eaq- are T-T annihilation, recombination, and capture by the ABA- anion, respectively.
Energy Technology Data Exchange (ETDEWEB)
Edwards, W.T.; Pohl, C.A.; Rubin, R.
1987-06-01
Carbohydrates, including the monosaccharides commonly found in wood and wood pulp hydrolyzates, are separated by anion exchange chromatography using hydroxide and acetate eluants and are determined using pulsed amperometric detection. The detection method is based on oxidizing the sugars in a flow-through electrochemical cell equipped with a gold working electrode. A repeating cycle of three potentials is used: the first to oxidize the carbohydrates and measure the current generated, and two subsequent pulses to clean the electrode surface of oxidation products. The method is fast, sensitive, and requires no pre-column derivatization. It is applied to a sample of hydrolyzed wood pulp, which can be analyzed after minimal sample preparation. Detection limits are of the order of 1 mg/kg for monosaccharides in a 50 micro L injection. (Refs. 8).
An ab initio study on BeX 3- superhalogen anions (X = F, Cl, Br)
Anusiewicz, Iwona; Skurski, Piotr
2002-06-01
The vertical electron detachment energies (VDE) of 10 BeX 3- (X = F, Cl, Br) anions were calculated at the outer valence Green function (OVGF) level with the 6-311++G(3df) basis sets. The largest vertical electron binding energy was found for BeF 3- system (7.63 eV). All negatively charged species possess the vertical electron detachment energies that are larger than 5.5 eV and thus may be termed superhalogen anions. The strong dependence of the VDE of the BeX 3- species on the ligand-central atom (Be-X) distance and on the partial atomic charge localized on Be was observed and discussed, as well as the other factors that may influence the electronic stability of such anions. In addition, the usefulness of the various theoretical treatments for estimating the VDEs of superhalogen anions was tested and analyzed.
Alkylation of enolate anions formation of enol ethers
Heiszwolf, G.J.; Kloosterziel, H.
1970-01-01
The alkylation of ambident enolate anions-obtained from aliphatic ketones (and one particular type of aldehyde)-was studied using various solvents, bases, alkylating agents and substrates. Alkylation with a reactive alkylating agent (dialkyl sulfates, triethyloxonium fluoroborate) in an aprotic
Andreeva, Nadezhda A; Chaban, Vitaly V
2017-03-01
Efficient design of ionic compounds requires a systematic understanding of cation-anion interactions. Weakening of electrostatic attraction is essential to increase the liquid range of the ionic compound and decrease its melting point. Here, we report simulations of the closest-approach cation-anion distances in a variety of ion pairs containing the tetrakis(pentafluorophenyl)borate (TFPB - ) anion. Small alkali cations (Li + , Na + ) penetrate the TFPB - core, whereas K + and larger organic cations do not. In the latter case, the shortest possible distance from the cations to the boron atom of TFPB - ranges from 0.50 nm to 0.63 nm. TFPB - was shown to be substantially rigid, providing a steric hindrance to thermodynamically efficient cation-anion coordination. Our results prove that TFPB - is more efficient for electrostatic charge confinement than the tetraoctylammonium cation, whereas the perfluorophenyl group is more efficient than linear alkyl chains. These simulations will motivate development of TFPB - -based ionic liquids with low phase transition points. Graphical Abstract Ionic configuration of the equilibrated "TFPB + K"system.
Anion-exchange Studies of Radioactive Trace Elements in Sulphuric Acid Solutions
Energy Technology Data Exchange (ETDEWEB)
Samsahl, K
1963-01-15
As part of a chemical group separation procedure used as a pretreatment in gamma spectrometric analysis, a study has been made of the adsorption from sulphuric acid solutions on strongly basic anion exchange resins, prepared in the hydroxide and the sulphate forms, of trace activities of Na, P, K, Ca, Sc, Cr, Mn, Fe, Co, Ni, Cu, Zn, Ga, Rb, Sr, Zr, Nb, Mo, Tc, Ag, Cd, In, Cs, Ba, La, Ce, Hf, Ta, W, Ir, Pa and Np. Besides adsorbing some of the trace elements in the solution, the anion exchange resin in the hydroxide form will neutralize the bulk of the sulphuric acid. This makes possible the subsequent sequential separation of chloride complexes on short anion-exchange columns by a stepwise increasing of the HCl concentration of the solution. On the basis of the results obtained in the present and earlier experiments, a new improved chemical group-separation procedure for mixtures of radioactive trace elements is outlined.
Evaluation of the presence of major anionic surfactants in marine sediments.
Cantarero, S; Camino-Sánchez, F J; Zafra-Gómez, A; Ballesteros, O; Navalón, A; Vílchez, J L; Verge, C; Reis, M S; Saraiva, P M
2012-03-01
The contamination of aquatic environments has become the focus of increasing regulation and public concern due to their potential and unknown negative effects on the ecosystems. The present work develops a monitoring and statistical study, based on the analysis of variance test (ANOVA) and the multivariable analysis, both for insoluble soap and LAS in order to compare the behavior of different anionic surfactants in this environmental compartment. First, a novel and successfully validated methodology to analyze insoluble soap in these samples is developed. The matrix effect and the comparison of different extraction techniques were also performed. The optimized analytical methodologies were applied to 48 representative samples collected from the Almeria Coast (Spain) and then a statistical analysis to correlate anionic surfactant concentration and several variables associated with marine sediment samples was also developed. The results obtained showed relevant conclusions related to the environmental behavior of anionic surfactants in marine sediments. Copyright © 2011 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Cao, Wei; Wang, Zhenqian; Zeng, Qingling; Shen, Chunhua
2016-01-01
Highlights: • 13 C NMR and XPS were successfully used to characterize quaternary ammonium groups in the surface of crop straw based anion adsorbents. • The results obtained from different kinds of crop straw material clearly confirmed the presence of quaternary ammonium groups. • The composition of C-groups and N-groups also were determined by curving fitting of high-resolution XPS C1 and N1 spectra. - Abstract: Despite amino groups modified crop straw has been intensively studied as new and low-cost adsorbent for removal of anionic species from water, there is still a lack of clear characterization for amino groups, especially quaternary ammonium groups in the surface of crop straw. In this study, we used 13 C NMR and XPS technologies to characterize adsorbents with quaternary ammonium groups prepared from rice straw, corn stalk and sugarcane bagasse. 13 C NMR spectra clearly showed the presence of quaternary ammonium groups in lignocelluloses structure of modified crop straw. The increase of nitrogen observed in XPS survey spectra also indicated the existence of quaternary ammonium group in the surface of the adsorbents. The curve fitting of high-resolution XPS N1s and C1s spectra were conducted to probe the composition of nitrogen and carbon contained groups, respectively. The results showed the proportion of quaternary ammonium group significantly increased in the prepared adsorbent’s surface that was dominated by methyl/methylene, hydroxyl, quaternary ammonium, ether and carbonyl groups. This study proved that 13 C NMR and XPS could be successfully utilized for characterization of quaternary ammonium modified crop straw adsorbents.
Halasinski, Thomas M.; Hudgins, Douglas M.; Salama, Farid; Allamandola, Louis J.; Mead, Susan (Technical Monitor)
1999-01-01
The absorption spectra of pentacene (C22H14) and its radical cation (C22H14(+)) and anion (C22H14(-)) isolated in inert-gas matrices of Ne, Ar, and Kr are reported from the ultraviolet to the near-infrared. The associated vibronic band systems and their spectroscopic assignments are discussed together with the physical and chemical conditions governing ion (and counterion) production in the solid matrix. In particular, the formation of isolated pentacene anions is found to be optimized in matrices doped with alkali metal (Na and K).
Surface functional groups in capacitive deionization with porous carbon electrodes
Hemmatifar, Ali; Oyarzun, Diego I.; Palko, James W.; Hawks, Steven A.; Stadermann, Michael; Santiago, Juan G.; Stanford Microfluidics Lab Team; Lawrence Livermore National Lab Team
2017-11-01
Capacitive deionization (CDI) is a promising technology for removal of toxic ions and salt from water. In CDI, an applied potential of about 1 V to pairs of porous electrodes (e.g. activated carbon) induces ion electromigration and electrostatic adsorption at electrode surfaces. Immobile surface functional groups play a critical role in the type and capacity of ion adsorption, and this can dramatically change desalination performance. We here use models and experiments to study weak electrolyte surface groups which protonate and/or depropotante based on their acid/base dissociation constants and local pore pH. Net chemical surface charge and differential capacitance can thus vary during CDI operation. In this work, we present a CDI model based on weak electrolyte acid/base equilibria theory. Our model incorporates preferential cation (anion) adsorption for activated carbon with acidic (basic) surface groups. We validated our model with experiments on custom built CDI cells with a variety of functionalizations. To this end, we varied electrolyte pH and measured adsorption of individual anionic and cationic ions using inductively coupled plasma mass spectrometry (ICP-MS) and ion chromatography (IC) techniques. Our model shows good agreement with experiments and provides a framework useful in the design of CDI control schemes.
Chemical stabilization of graphite surfaces
Energy Technology Data Exchange (ETDEWEB)
Bistrika, Alexander A.; Lerner, Michael M.
2018-04-03
Embodiments of a device, or a component of a device, including a stabilized graphite surface, methods of stabilizing graphite surfaces, and uses for the devices or components are disclosed. The device or component includes a surface comprising graphite, and a plurality of haloaryl ions and/or haloalkyl ions bound to at least a portion of the graphite. The ions may be perhaloaryl ions and/or perhaloalkyl ions. In certain embodiments, the ions are perfluorobenzenesulfonate anions. Embodiments of the device or component including stabilized graphite surfaces may maintain a steady-state oxidation or reduction surface current density after being exposed to continuous oxidation conditions for a period of at least 1-100 hours. The device or component is prepared by exposing a graphite-containing surface to an acidic aqueous solution of the ions under oxidizing conditions. The device or component can be exposed in situ to the solution.
Directory of Open Access Journals (Sweden)
Eva Vaulina Yulistia Delsy
2017-05-01
Full Text Available This research determines the mathematical equation which calculate the Concentration Micelle Critic theoretical anionic surfactant. The research was conducted the depiction of each surfactant anionic three-dimensional compound models, followed by optimizing the model structure anionic surfactant by using AM1 calculation method. Furthermore the calculation of descriptors (QSPR method, then it was analyzed statistically using Multiple Linear Regression (MLR. The results of statistical calculations showed that to calculate the theoretical CMC anionic surfactant can use the QSPR equation: log CMC = 4.157+0.118qC1+7.698qC2+0.425α–0.010µ-0.129RD–0.138 log P+0.021BM–0.034Avdw, n = 100 ; r = 0.927 ; r2 = 0.860 ; SE = 0.352 ; F= 30.888 ; PRESS = 23.506
Extreme electron correlation effects on the electric properties of atomic anions
International Nuclear Information System (INIS)
Canuto, S.
1994-01-01
The contribution of the electron correlation effects to the calculated dipole polarizability and hyper-polarizability of the first-row atomic anions is calculated and analyzed. It is shown that the total correlation contribution to the dipole hyperpolarizability is extremely large with the Hartree-Fock model accounting for only a small fraction of the accurate result. The linear and, more pronounced, the nonlinear response of atomic anions to the application of an electric field emphatically shows the effects of the correlated motion of the electrons
Resonance Raman Spectrum of the Transient (SCN)2 Free Radical Anion
DEFF Research Database (Denmark)
Wilbrandt, Robert Walter; Jensen, N. H.; Pagsberg, Palle Bjørn
1979-01-01
The resonance Raman spectrum of the transient species (λmax = 475 nm, τ½ = 1.6 μs) formed by pulse radiolysis of aqueous solutions of thiocyanate, SCN2−, is reported. The spectrum is discussed in terms of the previous assignment of this transient to the radical anion, (SCN)−2. The observed...... vibrational frequencies of the radical anion are consistent with substantial weakening of the S---S and the Ctriple bond; length as m-dashN bonds are compared with neutral thiocyanogen....
International Nuclear Information System (INIS)
Parobek, P.; Baloun, S.; Plevac, S.
1989-01-01
The method is described of reducing the concentration of hydrogen ions in acid anionic eluate produced in the separation of uranium or other metals, in which anion exchanger elution, precipitation, filtration and precipitate and anion exchanger washing are used. The technological line for such elution comprises at least one ion exchange column and at least one container. They together form the first and the second stages of preparation of the acid anion elution solution, the sorption-elution separation of hydrogen ions on an cation exchanger being inserted between them. The preparation of the solution is divide into two stages. In the first stage, the acid and part of the solution for the preparation of the acid anion elution solution are supplied. The resulting enriched acid elution solution is fe onto the cation exchanger where the hydrogen ion concentration i reduced. It is then carried into the second stage where it is mixed with the remaining part of the solution. (B.S.)
Molecular Evolution of Slow and Quick Anion Channels (SLACs and QUACs/ALMTs).
Dreyer, Ingo; Gomez-Porras, Judith Lucia; Riaño-Pachón, Diego Mauricio; Hedrich, Rainer; Geiger, Dietmar
2012-01-01
Electrophysiological analyses conducted about 25 years ago detected two types of anion channels in the plasma membrane of guard cells. One type of channel responds slowly to changes in membrane voltage while the other responds quickly. Consequently, they were named SLAC, for SLow Anion Channel, and QUAC, for QUick Anion Channel. Recently, genes SLAC1 and QUAC1/ALMT12, underlying the two different anion current components, could be identified in the model plant Arabidopsis thaliana. Expression of the gene products in Xenopus oocytes confirmed the quick and slow current kinetics. In this study we provide an overview on our current knowledge on slow and quick anion channels in plants and analyze the molecular evolution of ALMT/QUAC-like and SLAC-like channels. We discovered fingerprints that allow screening databases for these channel types and were able to identify 192 (177 non-redundant) SLAC-like and 422 (402 non-redundant) ALMT/QUAC-like proteins in the fully sequenced genomes of 32 plant species. Phylogenetic analyses provided new insights into the molecular evolution of these channel types. We also combined sequence alignment and clustering with predictions of protein features, leading to the identification of known conserved phosphorylation sites in SLAC1-like channels along with potential sites that have not been yet experimentally confirmed. Using a similar strategy to analyze the hydropathicity of ALMT/QUAC-like channels, we propose a modified topology with additional transmembrane regions that integrates structure and function of these membrane proteins. Our results suggest that cross-referencing phylogenetic analyses with position-specific protein properties and functional data could be a very powerful tool for genome research approaches in general.
Molecular evolution of slow and quick anion channels (SLACs and QUACs/ALMTs
Directory of Open Access Journals (Sweden)
Ingo eDreyer
2012-11-01
Full Text Available Electrophysiological analyses conducted about 25 years ago detected two types of anion channels in the plasma membrane of guard cells. One type of channel responds slowly to changes in membrane voltage while the other responds quickly. Consequently, they were named SLAC, for SLow Anion Channel, and QUAC, for QUick Anion Channel. Recently, genes SLAC1 and QUAC1/ALMT12, underlying the two different anion current components, could be identified in the model plant Arabidopsis thaliana. Expression of the gene products in Xenopus oocytes confirmed the quick and slow current kinetics. In this study we provide an overview on our current knowledge on slow and quick anion channels in plants and analyze the molecular evolution of ALMT/QUAC-like and SLAC-like channels. We discovered fingerprints that allow screening databases for these channel types and were able to identify 192 (177 non-redundant SLAC-like and 422 (402 non-redundant ALMT/QUAC-like proteins in the fully sequenced genomes of 32 plant species. Phylogenetic analyses provided new insights into the molecular evolution of these channel types. We also combined sequence alignment and clustering with predictions of protein features, leading to the identification of known conserved phosphorylation sites in SLAC1-like channels along with potential sites that have not been yet experimentally confirmed. Using a similar strategy to analyze the hydropathicity of ALMT/QUAC-like channels, we propose a modified topology with additional transmembrane regions that integrates structure and function of these membrane proteins. Our results suggest that cross-referencing phylogenetic analyses with position-specific protein properties and functional data could be a very powerful tool for genome research approaches in general.
Cui, Ying; Niu, Yan-Li; Cao, Man-Li; Wang, Ke; Mo, Hao-Jun; Zhong, Yong-Rui; Ye, Bao-Hui
2008-07-07
A ruthenium(II) complex [Ru(bpy) 2(H 2bbim)](PF 6) 2 ( 1) as anions receptor has been exploited, where Ru(II)-bpy moiety acts as a chromophore and the H 2bbim ligand as an anion binding site. A systematic study suggests that 1 interacts with the Cl (-), Br (-), I (-), NO 3 (-), HSO 4 (-), and H 2PO 4 (-) anions via the formation of hydrogen bonds. Whereas 1 undergoes a stepwise process with the addition of F (-) and OAc (-) anions: formation of the monodeprotonated complex [Ru(bpy) 2(Hbbim)] with a low anion concentration, followed by the double-deprotonated complex [Ru(bpy) 2(bbim)], in the presence of a high anion concentration. These stepwise processes concomitant with the changes of vivid colors from yellow to orange brown and then to violet can be used for probing the F (-) and OAc (-) anions by naked eye. The deprotonation processes are not only determined by the basicity of the anion but also related to the strength of hydrogen bonding, as well as the stability of the formed compounds. Moreover, a double-deprotonated complex [Ru(bpy) 2(bbim)].CH 3OH.H 2O ( 3) has been synthesized, and the structural changes induced by the deprotonation has also been investigated. In addition, complexes [Ru(bpy) 2(Hbbim)] 2(HOAc) 3Cl 2.12H 2O ( 2), [Ru(bpy) 2(Hbbim)](HCCl 3CO 2)(CCl 3CO 2).2H 2O ( 4), and [Ru(bpy) 2(H 2bbim)](CF 3CO 2) 2.4H 2O ( 5) have been synthesized to observe the second sphere coordination between the Ru(II)-H 2bbim moiety and carboxylate groups via hydrogen bonds in the solid state.
Energy Technology Data Exchange (ETDEWEB)
Sur, Babita [Dipartimento di Chimica, Universita di Torino, Via P. Giuria 5, 10125 Torino (Italy); Department of Chemical Engineering, Calcutta University, 92 Acharya P. C. Road, Kolkata 700009 (India); De Laurentiis, Elisa; Minella, Marco; Maurino, Valter; Minero, Claudio [Dipartimento di Chimica, Universita di Torino, Via P. Giuria 5, 10125 Torino (Italy); Vione, Davide [Dipartimento di Chimica, Universita di Torino, Via P. Giuria 5, 10125 Torino (Italy); Centro Interdipartimentale NatRisk, Universita di Torino, Via Leonardo da Vinci 44, 10095 Grugliasco (Italy)
2012-06-01
Anionic 2-nitro-4-chlorophenol (NCP) may occur in surface waters as a nitroderivative of 4-chlorophenol, which is a transformation intermediate of the herbicide dichlorprop. Here we show that NCP would undergo efficient photochemical transformation in environmental waters, mainly by direct photolysis and reaction with {center_dot}OH. NCP has a polychromatic photolysis quantum yield {Phi}{sub NCP} = (1.27 {+-} 0.22) {center_dot} 10{sup -5}, a rate constant with {center_dot}OH k{sub NCP,}{center_dot}{sub OH} = (1.09 {+-} 0.09) {center_dot} 10{sup 10} M{sup -1} s{sup -1}, a rate constant with {sup 1}O{sub 2}k{sub NCP,1O2} = (2.15 {+-} 0.38) {center_dot} 10{sup 7} M{sup -1} s{sup -1}, a rate constant with the triplet state of anthraquinone-2-sulphonate k{sub NCP,3AQ2S*} = (5.90 {+-} 0.43) {center_dot} 10{sup 8} M{sup -1} s{sup -1}, and is poorly reactive toward CO{sub 3}{sup -}{center_dot}. The k{sub NCP,3AQ2S*} value is representative of reaction with the triplet states of chromophoric dissolved organic matter. The inclusion of photochemical reactivity data into a model of surface-water photochemistry allowed the NCP transformation kinetics to be predicted as a function of water chemical composition and column depth. Very good agreement between model predictions and field data was obtained for the shallow lagoons of the Rhone delta (Southern France). Highlights: Black-Right-Pointing-Pointer Phototransformation kinetics of 2-nitro-4-chlorophenol, relevant to surface waters. Black-Right-Pointing-Pointer Determination of photochemical reactivity data in the laboratory. Black-Right-Pointing-Pointer Model approach to combine photochemical reactivity with environmental variables. Black-Right-Pointing-Pointer Good agreement with field data in lagoon water (Rhone delta, Southern France). Black-Right-Pointing-Pointer Direct photolysis and reaction with {center_dot}OH as main photoprocesses in the environment.
Review on anionic redox for high-capacity lithium- and sodium-ion batteries
International Nuclear Information System (INIS)
Zhao, Chenglong; Lu, Yaxiang; Hu, Yong-Sheng; Chen, Liquan; Wang, Qidi; Li, Baohua
2017-01-01
Rechargeable batteries, especially lithium-ion batteries, are now widely used as power sources for portable electronics and electric vehicles, but material innovations are still needed to satisfy the increasing demand for larger energy density. Recently, lithium- and sodium-rich electrode materials, including the A 2 MO 3 -family layered compounds (A = Li, Na; M = Mn 4+ , Ru 4+ , etc), have been extensively studied as potential high-capacity electrode materials for a cumulative cationic and anionic redox activity. Negatively charged oxide ions can potentially donate electrons to compensate for the absence of oxidable transition metals as a redox center to further increase the reversible capacity. Understanding and controlling the state-of-the-art anionic redox processes is pivotal for the design of advanced energy materials, highlighted in rechargeable batteries. Hence, experimental and theoretical approaches have been developed to consecutively study the diverting processes, states, and structures involved. In this review, we attempt to present a literature overview and provide insight into the reaction mechanism with respect to the anionic redox processes, proposing some opinions as target oriented. It is hoped that, through this discussion, the search for anionic redox electrode materials with high-capacity rechargeable batteries can be advanced, and practical applications realized as soon as possible. (topical review)
Directory of Open Access Journals (Sweden)
Khoiruddin
2016-02-01
Full Text Available Mixed matrix anion exchange membranes (AEMs were synthesized using dry-wet phase inversion. The casting solutions were prepared by dispersing finely ground anion-exchange resin particles in N,N-dimethylacetamide (DMAc solutions of polysulfone (PSf. Subsequently, nanosilica particles were introduced into the membranes. The results show that evaporation time (tev and solution composition contributed to membrane properties formation. A longer tev produces membranes with reduced void fraction inside the membranes, thus the amount of water adsorbed and membrane conductivity are reduced. Meanwhile, the permselectivity was improved by increasing tev, since a longer tev produces membranes with a narrower channel for ion migration and more effective Donnan exclusion. The incorporation of 0.5 %-wt nanosilica particles into the polymer matrix led to conductivity improvement (from 2.27 to 3.41 mS.cm-1. This may be associated with additional pathway formation by hydroxyl groups on the silica surface that entraps water and assists ion migration. However, at further silica loading (1.0 and 1.5 %-wt, these properties decreased (to 1.9 and 1.4 mS.cm-1 respectively, which attributed to inaccessibility of ion-exchange functional groups due to membrane compactness. It was found from the results that nanosilica contributes to membrane formation (increases casting solution viscosity then reduces void fraction and membrane functional group addition (provides hydroxyl groups.
Li, Junbo; Zhao, Jianlong; Wu, Wenlan; Liang, Ju; Guo, Jinwu; Zhou, Huiyun; Liang, Lijuan
2016-06-01
In this paper, double hydrophilic ionic liquid block copolymers (ILBCs), poly poly[1-methyl-3-(2-methacryloyloxy propylimidazolium bromine)]- block-(N-isopropylacrylamide) (PMMPImB- b-PNIPAAm) was first synthesized by reversible additionfragmentation chain transfer (RAFT) and then attached on the surface of gold nanoparticles (Au NPs) via a strong gold-sulfur bonding for preparing hybrid nanoparticles (PMMPImB- b-PNIPAAm-@-Au NPs). The hybrid NPs had a three layers micelle-like structure, including a gold core, thermo-responsive inner shell and anion responsive outer corona. The self-assembling behavior of thermal- and anion-response from shell and corona were respectively investigated by change of temperature and addition of (CF3SO2)2N-. The results showed the hybrid NPs retained a stable dispersion beyond the lower critical solution temperature (LCST) because of the space or electrostatic protecting by outer PMMPImB. However, with increasing concentration of (CF3SO2)2N-, the micellization of self-assembling PMMPImB- b-PNIPAAm-@-Au NPs was induced to form micellar structure containing the core with hydrophobic PMMPImB-(CF3SO2)2N- surrounded by composite shell of Au NPs-PNIPAAm via the anionresponsive properties of ILBCs. These results indicated that the block copolymers protected plasmonic nanoparticles remain self-assembling properties of block copolymers when phase transition from outer corona polymer.
Directory of Open Access Journals (Sweden)
Tianlei Wang
2016-09-01
Full Text Available Layered double hydroxides (LDHs, luminescent π-conjugated anionic polymer and montmorillonite (MMT were orderly assembled into luminescent multilayer films via layer-by-layer self-assembly method. The electronic microenvironment (EME, the structure of which is like a traditional capacitor, can be constructed by exfoliated LDHs or MMT nanosheets. In addition, the rigid inorganic laminated configuration can offer stable surroundings between the interlayers. As a result, we conclude that EME can extend the luminescent lifespans of multilayer films substantially, due to affecting relaxation times of π-conjugated anionic polymer. Consequently, because of the remarkable impact on better photoemission behaviors of luminescent π-conjugated anionic polymer, EME assembled by LDHs or MMT nanosheets have had high hopes attached to them. They are expected to have the potential for designing, constructing, and investigating novel light-emitting thin films.
Diffusion and retention of organic anions in Callovian-Oxfordian clay rock
International Nuclear Information System (INIS)
Rasamimanana, Sabrina
2016-01-01
The Callovo-Oxfordian mud-stone (CO_x) is studied as a possible host rock for a deep disposal of radioactive waste (Cigeo project). Indeed, besides being very weakly permeable, it presents a high content of clayey minerals, capable of retaining radionuclides under cationic form and to delay strongly their transport. Nevertheless, some waste packages may release a significant amount of organic molecules, capable of complexing these radionuclides and drastically increase their mobility. So, the objective of this work was to better understand the diffusive behavior of several organic molecules of interest in this mudstone, by investigating at first their affinity with the host rock. The retention of organic molecules under anionic form (acetate, phthalate, adipate, benzoate, and citrate) was quantified on to the dispersed CO_x mudstone using adsorption/desorption batch experiments. Experiments on de-carbonated rock and clay fraction only (≤ 2μm) were also performed to identify solid phases and chemical functions responsible for the retention. a correlation of the intensity of retention, R_d, was pointed out whit the dipole moment μ(Orga.), providing a qualitative estimate of retention capacity for polar hydrophilic organic molecules. So, phthalate, slightly polar, displays a reversible retention (R_d ≅1,6 L.kg"-"1), mainly on clayey phases. Citrate, very polar and strongly adsorbed (R_d ≅ 40 L.kg"-"1), displays a persistent desorption hysteresis and an affinity to different solid phases (clayey minerals and minor oxides). Lastly, acetate, adipate and benzoate, weakly polar, display a lower affinity with rock (R_d ≤ 0,2 L.kg"-"1). The diffusive behavior in compact rock of these organic anions was then studied. The effective diffusion coefficient and retardation factor values were quantified. The low diffusivity, [D_e/D_0](Organic Anions) ≅ 0,1 a0,25 * [D_e/D_0](Water) evidences an effect of anionic exclusion, with a same intensity as that observed for
Eckenrode, Heather M; Jen, Shih-Hui; Han, Jun; Yeh, An-Gong; Dai, Hai-Lung
2005-03-17
Nonlinear optical probe, second harmonic generation (SHG), of the adsorption of the dye molecule malachite green (MG), in cationic form at pH polystyrene microspheres in aqueous solution is used to study the effect of surface charge and composition on molecular adsorption. Three types of polystyrene microspheres with different surface composition are investigated: (1) a sulfate terminated, anionic surface, (2) a neutral surface without any functional group termination, and (3) an amine terminated, cationic surface. The cationic dye was found to adsorb at all three surfaces, regardless of surface charge. The adsorption free energies, DeltaG's, measured for the three surfaces are -12.67, -12.39, and -10.46 kcal/mol, respectively, with the trend as expected from the charge interactions. The adsorption density on the anionic surface, where attractive charge-charge interaction dominates, is determined by the surface negative charge density. The adsorption densities on the neutral and cationic surfaces are on the other hand higher, perhaps as a result of a balance between minimizing repulsive charge interaction and maximizing attractive molecule-substrate and intermolecular interactions. The relative strength of the SH intensity per molecule, in combination of a model calculation, reveals that the C(2) axis of the MG molecule is nearly perpendicular to the surface on the anionic surface and tilts away from the surface norm when the surface is neutral and further away when cationic. Changing the pH of the solution may alter the surface charge and subsequently affect the adsorption configuration and SH intensity.
Synthesis of Terpyridine-Terminated Polymers by Anionic Polymerization
Guerrero-Sanchez, C.A.; Lohmeijer, B.G.G.; Meier, M.A.R.; Schubert, U.S.
2005-01-01
The synthesis of terpyridine-functionalized polystyrene was achieved by reacting 4‘-chloro-2,2‘:6‘,2‘ ‘-terpyridine (terminating agent) with "living" polymeric carbanions synthesized by anionic polymerization. The obtained polymers were characterized by gel permeation chromatography, nuclear
Kim, Sook-Hee; Hong, Seong-Jin; Yoo, Jaeduk; Kim, Sung Kuk; Sessler, Janathan L.; Lee, Chang-Hee
2014-01-01
A strapped calix[4]pyrrole bearing an 1,3-indanedione group at a β-pyrrolic position has been synthesized and studied as a ratiometric cyanide selective chemosensor. A concentration-dependent bleaching of the initial yellow color was observed upon addition of the cyanide anion. The bleaching, which was observed exclusively with the cyanide anion, occurred even in the presence of other anions. Spectroscopic studies provides support for a mechanistic interpretation wherein the cyanide anion forms a complex with the receptor (K = 2.78 × 104 M-1) through a fast equilibrium, which is followed by slow nucleophilic addition to the β-position of the 1,3-indanedione group. A minimum inhibitory effect from other anions was observed, a feature that could be beneficial in the selective sensing of the cyanide anion. PMID:19639968
Mechanism of protection of adenosine from sulphate radical anion ...
Indian Academy of Sciences (India)
Unknown
Keywords. Repair by caffeic acid; repair of adenosine radicals; oxidation by sulphate radical anions. ... known that hydroxycinnamic acids are natural anti- oxidants ... acid. 2. Experimental ..... ously and independently under kinetic conditions at.
Zhang, H.
2013-08-07
A novel one-pot methodology combining anionic polymerization and polyhomologation, through a "bridge" molecule (BF3OEt 2), was developed for the synthesis of polyethylene (PE)-based block copolymers. The anionically synthesized macroanion reacts with the "bridge" molecule to afford a 3-arm star (trimacromolecular borane) which serves as an initiator for the polyhomologation. 2013 The Royal Society of Chemistry.
Evaluation of calix[4]arene tethered Schiff bases for anion recognition
International Nuclear Information System (INIS)
Chawla, H.M.; Munjal, Priyanka
2016-01-01
Two calix[4]arene tethered Schiff base derivatives (L1 and L2) have been synthesized and their ion recognition capability has been evaluated through NMR, UV–vis and fluorescence spectroscopy. L1 interacts with cyanide ions very selectively to usher a significant change in color and fluorescence intensity. On the other hand L2 does not show selectivity for anion sensing despite having the same functional groups as those present in L1. The differential observations may be attributed to plausible stereo control of anion recognition and tautomerization in the synthesized Schiff base derivatives.
Evaluation of calix[4]arene tethered Schiff bases for anion recognition
Energy Technology Data Exchange (ETDEWEB)
Chawla, H.M., E-mail: hmchawla@chemistry.iitd.ac.in; Munjal, Priyanka
2016-11-15
Two calix[4]arene tethered Schiff base derivatives (L1 and L2) have been synthesized and their ion recognition capability has been evaluated through NMR, UV–vis and fluorescence spectroscopy. L1 interacts with cyanide ions very selectively to usher a significant change in color and fluorescence intensity. On the other hand L2 does not show selectivity for anion sensing despite having the same functional groups as those present in L1. The differential observations may be attributed to plausible stereo control of anion recognition and tautomerization in the synthesized Schiff base derivatives.
Hole localization, migration, and the formation of peroxide anion in perovskite SrTiO3
Chen, Hungru; Umezawa, Naoto
2014-07-01
Hybrid density functional calculations are carried out to investigate the behavior of holes in SrTiO3. As in many other oxides, it is shown that a hole tend to localize on one oxygen forming an O- anion with a concomitant lattice distortion; therefore a hole polaron. The calculated emission energy from the recombination of the localized hole and a conduction-band electron is about 2.5 eV, in good agreement with experiments. Therefore the localization of the hole or self-trapping is likely to be responsible for the green photoluminescence at low temperature, which was previously attributed to an unknown defect state. Compared to an electron, the calculated hole polaron mobility is three orders of magnitude lower at room temperature. In addition, two O- anions can bind strongly to form an O22- peroxide anion. No electronic states associated with the O22- peroxide anion are located inside the band gap or close to the band edges, indicating that it is electronically inactive. We suggest that in addition to the oxygen vacancy, the formation of the O22- peroxide anion can be an alternative to compensate acceptor doping in SrTiO3.
Directory of Open Access Journals (Sweden)
Roto Roto
2009-03-01
Full Text Available ABSTRAK Keberadaan logam khrom di dalam sistem perairan bersifat polutan yang harus ditangani dengan baik, dan untuk khrom (Vl yang sering dijumpai dalam bentuk anion dapat diolah dengan menggunakan mekanisme pertukaran ion. Suatu agen penukar anion telah dibuat berupa senyawa hidrotalsit Zn-Al-SOa melalui proses sintesis, karakterisasi serta dilakukan pula pengujian aplikasinya untuk pengurangan polutant anion khrom (VI dalam bentuk ion dikromat. Sintesis hidrotalsit Zn-Al-SOa dilakukan dengan metode stoikiometri pada pH 8 dan perlakuan hidrotermal. Aplikasi pertukaran dikromat dengan anion sulfat dalam antar lapis hidrotalsit serta uji regenerasi bahan diamati dengan bantuan analisis struktur dan analisis kinetika reaksi pertukaran. Produk pertukaran ion dikarakterisasi dengan XRD, spektrofotometri IR dan spektrometri serapan atom. Rumus kimia hidrotalsit produk diketahui adalah Zn0,74Al0,26(OH1,74(SO40,13.0,52H2O. Anion dikromat dapat menukar sulfat dalam antarlapis hidrotalsit yang ditunjukkan dalam spektra IR dan pola XRD. Kapasitas pertukaran anion untuk dikromat diketahui 216,84 mek/100 g, sedangkan kinetika reaksi pertukaran ion mengikuti orde dua dengan k = 3 x 10-8 ppm-1.detik-1. Hasil menunjukkan Zn-Al-Cr2O7 dapat mudah diregenerasi. ABSTRACT Chrom as pollutant in aquatics system usually establishes as crom (VI and should be worked with special treatment and as an example is ion exchanger. Material Zn-Al-SO4 hydrotalcite product have been synthesized and its application as anion exchanger for dichromate have been studied. Synthesis of Zn-Al-SO4 hydrotalcite was carried out by stoichiometric method at pH 8 and hydrothermal treatment. Sulphate in hydrotalcite interlayer was exchanged by dichromate. Kinetics of ion exchange was also investigated. The product of ion exchange was characterized by XRD, IR spectrophotometry and atomic adsorption spectrometry. The chemical formula of the hydrotalcite is Zn0.74Al0.26(OH1.74(SO4 0
Adsorption and intercalation of anionic surfactants onto layered ...
Indian Academy of Sciences (India)
Layered double hydroxides (LDH) with brucite like structure was modified with various anionic surfactants containing sulfonate, carboxyl, phosphonate and sulfate end group through ion-exchange method. XRD reports indicated that the sulfonate group containing surfactants led to an adsorption process whereas the sulfate ...
based anion exchange membrane for alkaline polymer electrolyte
Indian Academy of Sciences (India)
Administrator
Abstract. Hydroxyl ion (OH–) conducting anion exchange membranes based on modified poly (phenylene oxide) are fabricated for their application in alkaline polymer electrolyte fuel cells (APEFCs). In the present study, chloromethylation of poly(phenylene oxide) (PPO) is performed by aryl substitution rather than benzyl.
Adsorption and intercalation of anionic surfactants onto layered ...
Indian Academy of Sciences (India)
Unknown
Department of Polymer Technology, Kamaraj College of Engineering and Technology, Virudhunagar 626 ... Layered double hydroxides (LDH) with brucite like structure was modified with various anionic ... Recently the application of layered double hydroxides ..... Yuan Q, Wei M, Wang Z and Duan X 2004 Clays Clay Miner.
Bachorz, Rafał A; Klopper, Wim; Gutowski, Maciej; Li, Xiang; Bowen, Kit H
2008-08-07
The photoelectron spectrum (PES) of the uracil anion is reported and discussed from the perspective of quantum chemical calculations of the vertical detachment energies (VDEs) of the anions of various tautomers of uracil. The PES peak maximum is found at an electron binding energy of 2.4 eV, and the width of the main feature suggests that the parent anions are in a valence rather than a dipole-bound state. The canonical tautomer as well as four tautomers that result from proton transfer from an NH group to a C atom were investigated computationally. At the Hartree-Fock and second-order Moller-Plesset perturbation theory levels, the adiabatic electron affinity (AEA) and the VDE have been converged to the limit of a complete basis set to within +/-1 meV. Post-MP2 electron-correlation effects have been determined at the coupled-cluster level of theory including single, double, and noniterative triple excitations. The quantum chemical calculations suggest that the most stable valence anion of uracil is the anion of a tautomer that results from a proton transfer from N1H to C5. It is characterized by an AEA of 135 meV and a VDE of 1.38 eV. The peak maximum is as much as 1 eV larger, however, and the photoelectron intensity is only very weak at 1.38 eV. The PES does not lend support either to the valence anion of the canonical tautomer, which is the second most stable anion, and whose VDE is computed at about 0.60 eV. Agreement between the peak maximum and the computed VDE is only found for the third most stable tautomer, which shows an AEA of approximately -0.1 eV and a VDE of 2.58 eV. This tautomer results from a proton transfer from N3H to C5. The results illustrate that the characteristics of biomolecular anions are highly dependent on their tautomeric form. If indeed the third most stable anion is observed in the experiment, then it remains an open question why and how this species is formed under the given conditions.
Thermal Properties of Anionic Polyurethane Composition for Leather Finishing
Directory of Open Access Journals (Sweden)
Olga KOVTUNENKO
2016-09-01
Full Text Available Thermal properties of anionic polyurethane composition mixed with collagen product and hydrophilic sodium form of montmorillonite for use in the finishing of leather were studied by thermogravimetric method. The thermal indices of processes of thermal and thermo-oxidative destruction depending on the polyurethane composition were determined. The influence of anionic polyurethane composition on thermal behavior of chromium tanned gelatin films that imitate the leather were studied. APU composition with natural compounds increases their thermal stability both in air and in nitrogen atmosphere due to the formation of additional bonds between active groups of APU, protein and chrome tanning agent as the result of chemical reactions between organic and inorganic parts with the new structure formation.DOI: http://dx.doi.org/10.5755/j01.ms.22.3.10043
Rejuvenation of the anion exchanger used for uranium recovery
International Nuclear Information System (INIS)
Yan, T.-Y.; Espenscheid, W.F.
1986-01-01
The present invention is directed to improving the performance of strong base anionic exchange resins used in uranium recovery that exhibit an undesirable decrease in loading capacity and in total exchange capacity. The invention comprises treating an anionic exchange resin to remove physically adsorbed and occluded fouling agents and to remove poisons which may be chemically bound to active ion groups on the resin. The process involves treating the resin, after the uranium ion exchange stage, with an alkaline carbonate solution, preferably treating the resin with an acid eluant first. The acid treatment dissolves insoluble fouling agents which are physically occluded or adsorbed by the resin and that the weak base treatment augments that result and probably removes poisons which are physically or chemically bound to the resin
Design of Anion Exchange Membranes and Electrodialysis Studies for Water Desalination
Directory of Open Access Journals (Sweden)
Muhammad Imran Khan
2016-05-01
Full Text Available Anion exchange membranes are highly versatile and nowadays have many applications, ranging from water treatment to sensing materials. The preparation of anion exchange membranes (AEMs from brominated poly(2,6-dimethyl-1,6-phenylene oxide (BPPO and methyl(diphenylphosphine (MDPP for electrodialysis was performed. The physiochemical properties and electrochemical performance of fabricated membranes can be measured by changing MDPP contents in the membrane matrix. The influence of a quaternary phosphonium group associated with the removal of NaCl from water is discussed. The prepared membranes have ion exchange capacities (IEC 1.09–1.52 mmol/g, water uptake (WR 17.14%–21.77%, linear expansion ratio (LER 7.96%–11.86%, tensile strength (TS 16.66–23.97 MPa and elongation at break (Eb 485.57%–647.98%. The prepared anion exchange membranes were employed for the electrodialytic removal of 0.1 M NaCl aqueous solution at a constant applied voltage. It is found that the reported membranes could be the promising candidate for NaCl removal via electrodialysis.
Hydrothermal syntheses and anion-induced structural transformation of three Cadmium phosphonates
Hu, Han; Zhai, Fupeng; Liu, Xiaofeng; Ling, Yun; Chen, Zhenxia; Zhou, Yaming
2018-05-01
Three cadmium phosphonate coordinated polymers, namely as [Cd5(ptz)3(SO4)2(5H2O)]·6H2O (Cdptz-1), [Cd3(ptz)2(Cl)2(4H2O)]·2H2O (Cdptz-2) and [Cd4(ptz)2(SO4)(Cl)(OH)H2O]·H2O (Cdptz-3) have been hydrothermally synthesized using 4-(1,2,4-triazol-4-yl)phenylphosphonic acid (H2ptz) as ligand. Single crystal X-ray analyses revealed Cdptz-2 as layered structure and Cdptz-1,3 as pillar-layered structures with Cl- or SO42- as bridging anions. Due to the weak bonding between metal and anions, Cdptz-1 and 2 can reversibly convert into each other by simple immersing in the corresponding solution at room temperature. While the transformations between Cdptz-1,2 and Cdptz-3 can only happen under hydrothermal condition. The causes for the transformation involve the metal-ligand bond breaking/formation, replacement of anions and enhancement/decrement of the network dimensionality.
Directory of Open Access Journals (Sweden)
James L. Wardell
2016-12-01
Full Text Available The crystal structures of two ammonium salts of 2-amino-4-nitrobenzoic acid are described, namely dimethylazanium 2-amino-4-nitrobenzoate, C2H8N+·C7H5N2O4−, (I, and dibutylazanium 2-amino-4-nitrobenzoate, C8H20N+·C7H5N2O4−, (II. The asymmetric unit of (I comprises a single cation and a single anion. In the anion, small twists are noted for the carboxylate and nitro groups from the ring to which they are connected, as indicated by the dihedral angles of 11.45 (13 and 3.71 (15°, respectively; the dihedral angle between the substituents is 7.9 (2°. The asymmetric unit of (II comprises two independent pairs of cations and anions. In the cations, different conformations are noted in the side chains in that three chains have an all-trans [(+-antiperiplanar] conformation, while one has a distinctive kink resulting in a (+-synclinal conformation. The anions, again, exhibit twists with the dihedral angles between the carboxylate and nitro groups and the ring being 12.73 (6 and 4.30 (10°, respectively, for the first anion and 8.1 (4 and 12.6 (3°, respectively, for the second. The difference between anions in (I and (II is that in the anions of (II, the terminal groups are conrotatory, forming dihedral angles of 17.02 (8 and 19.0 (5°, respectively. In each independent anion of (I and (II, an intramolecular amino-N—H...O(carboxylate hydrogen bond is formed. In the crystal of (I, anions are linked into a jagged supramolecular chain by charge-assisted amine-N—H...O(carboxylate hydrogen bonds and these are connected into layers via charge-assisted ammonium-N—H...O(carboxylate hydrogen bonds. The resulting layers stack along the a axis, being connected by nitro-N—O...π(arene and methyl-C—H...O(nitro interactions. In the crystal of (II, the anions are connected into four-ion aggregates by charge-assisted amino-N—H...O(carboxylate hydrogen bonding. The formation of ammonium-N—H...O(carboxylate hydrogen bonds, involving
International Nuclear Information System (INIS)
Moskvin, A.I.; Poznyakov, A.N.; AN SSSR, Moscow. Inst. Geokhimii i Analiticheskoj Khimii)
1979-01-01
Complexing of pentavolent forms of Np, Pu, Am actinides with anions of acetic, oxalic acids and EDTA is studied using the method of coprecipitation with iron hydroxide. Composition and stability constants of the actinide complexes formed are determined. The acids anions are arranged in a row in the order of decrease of complexing tendency that is EDTA anion>C 2 O 4 2- >CH 3 COO -
The role of surface charge in cellular uptake and cytotoxicity of medical nanoparticles
Directory of Open Access Journals (Sweden)
Fröhlich E
2012-11-01
Full Text Available Eleonore FröhlichCenter for Medical Research, Medical University of Graz, Graz, AustriaAbstract: Many types of nanoparticles (NPs are tested for use in medical products, particularly in imaging and gene and drug delivery. For these applications, cellular uptake is usually a prerequisite and is governed in addition to size by surface characteristics such as hydrophobicity and charge. Although positive charge appears to improve the efficacy of imaging, gene transfer, and drug delivery, a higher cytotoxicity of such constructs has been reported. This review summarizes findings on the role of surface charge on cytotoxicity in general, action on specific cellular targets, modes of toxic action, cellular uptake, and intracellular localization of NPs. Effects of serum and intercell type differences are addressed. Cationic NPs cause more pronounced disruption of plasma-membrane integrity, stronger mitochondrial and lysosomal damage, and a higher number of autophagosomes than anionic NPs. In general, nonphagocytic cells ingest cationic NPs to a higher extent, but charge density and hydrophobicity are equally important; phagocytic cells preferentially take up anionic NPs. Cells do not use different uptake routes for cationic and anionic NPs, but high uptake rates are usually linked to greater biological effects. The different uptake preferences of phagocytic and nonphagocytic cells for cationic and anionic NPs may influence the efficacy and selectivity of NPs for drug delivery and imaging.Keywords: endocytosis, plasma membrane, lysosomes, polystyrene particles, quantum dots, dendrimers
Surface active agents from Egyptian petroleum distillates
Energy Technology Data Exchange (ETDEWEB)
Kassem, T.M.
Kerosene and solar distillates from local crude petroleum 'Morgan' were fractionated. These fractions were refined with oleum and then distilled. The normal paraffins were separated from the refined fractions by the urea adduction technique. These paraffin cuts were subjected to 50% chlorination and the obtained monochlorinated paraffins were used in the synthesis of alkylbenzenes and alkyldiphenyls which were converted to anionic surfactants by sulphonation with 95% sulphuric acid. The sulphonyl chlorides of alkylbenzenes and of alkyldiphenyls were prepared and then converted to the corresponding sulphonamides. The prepared sulphonamides were then processed to nonionic surfactants through condensation with ethylene oxide. The ethoxylates were sulphated with chlorosulphonic acid and phosphated with phosphorus pentoxide to anionic surfactants. The surface active properties and the biodegradability of all the prepared surfactants were determined.
The alkylation of imine anions formation of enamines
Heiszwolf, G.J.; Kloosterziel, H.
1970-01-01
The ambident anions derived from imines were alkylated using a variety of solvents and alkylating agents. Under reactive conditions enamines (N-alkylation) are formed as the main products instead of the usually obsd. homologous imines (C-alkylation). The influence of the type of imine, solvent, and
International Nuclear Information System (INIS)
Plyuto, I.V.; Shpak, A.P.; Plyuto, Yu.V.; Chuiko, A.A.
1989-01-01
A comparative study of the geometric and electronic structure of the chromate anion CrO 4 2- and a chromate group on the surface of finely divided silica (≡Si-O) 2 - CrO 2 , which was simulated by a CrO 9 Si 6 H 12 cluster, has been carried out by the SCF-MO-LCAO method in the all-valence-electron CNDO/2 approximation. The data obtained on the equilibrium geometry of the chromate group attest to the formation of a double bond between the Cr atom and each O atom (which is not bonded to Si). It has been shown that the support has a significant stabilizing in fluence on the energy of the MO's of the chromate group. The chromate group on an SiO 2 surface is characterized by partial delocalization of the frontier MO's among the skeletal bonds; however, the dominant contribution to the HOMO is made by the 2p AO of the oxygen atoms in the coordination shell of the Cr atom (∼70%), and the dominant contribution to the LUMO is made by the 3d AO of the chromium atom (∼50%). The positions and composition of the lowest unoccupied molecular orbitals point out the possibility of the display of electron-acceptor properties by a chromate group of an SiO 2 surface
Rezvani, Zolfaghar; Arjomandi Rad, Farzad; Khodam, Fatemeh
2015-01-21
In the present work, Mg2Al-layered double hydroxide (LDH) intercalated with cubane-1,4-dicarboxylate anions was prepared from the reaction of solutions of Mg(ii) and Al(iii) nitrate salts with an alkaline solution of cubane-1,4-dicarboxylic acid by using the coprecipitation method. The successful preparation of a nanohybrid of cubane-1,4-dicarboxylate(cubane-dc) anions with LDH was confirmed by powder X-ray diffraction, FTIR spectroscopy and thermal gravimetric analysis (TGA). The increase in the basal spacing of LDHs from 8.67 Å to 13.40 Å shows that cubane-dc anions were successfully incorporated into the interlayer space. Thermogravimetric analyses confirm that the thermal stability of the intercalated cubane-dc anions is greater than that of the pure form before intercalation because of host-guest interactions involving hydrogen bonds. The interlayer structure, hydrogen bonding, and subsequent distension of LDH compounds containing cubane-dc anions were shown by molecular simulation. The RDF (radial distribution function), mean square displacement (MSD), and self-diffusion coefficient were calculated using the trajectory files on the basis of molecular dynamics (MD) simulations, and the results indicated that the cubane-dc anions were more stable when intercalated into the LDH layers. A good agreement was obtained between calculated and measured X-ray diffraction patterns and between experimental and calculated basal spacings.
Macrocyclic bis(ureas as ligands for anion complexation
Directory of Open Access Journals (Sweden)
Claudia Kretschmer
2014-08-01
Full Text Available Two macrocyclic bis(ureas 1 and 2, both based on diphenylurea, have been synthesized. Compound 1 represents the smaller ring with two ethynylene groups as linkers and 2 the larger ring with two butadiynylene groups. On thermal treatment to 130 °C molecule 1 splits up into two dihydroindoloquinolinone (3 molecules. Both compounds 1 and 2 form adducts with polar molecules such as dimethyl sulfoxide (DMSO and dimethylformamide (DMF and act as complexing agents towards a series of anions (Cl−, Br−, I−, NO3−, HSO4−. The crystal structures of 3, 2·2DMSO, 2·2DMF, and of the complex NEt4[Br·2] have been determined. Quantitative investigations of the complexation equilibria were performed via 1H NMR titrations. While 1 is a rather weak complexing agent, the large ring of 2 binds anions with association constants up to log K = 7.93 for chloride ions.
Induction of Apoptosis by Superoxide Anion and the Protective Effects of Selenium and Vitamin E
Institute of Scientific and Technical Information of China (English)
无
2001-01-01
Objective The purpose of this study is to investigate the effect of superoxide anion on the apoptosis of cultured fibroblasts and the protective role of selenium and Vitamin E. Methods Cultured fibroblasts (NIH3T3), with or without selenium or vitamin E in the medium, were treated by superoxide anion produced by xanthine/xanthine oxidase reaction system and changes in cell structure and DNA were observed microscopically and electrophoretically. Results Apoptosis was observed when superoxide anion at a concentration of 5 nmol/L or 10 nmol/L had acted on the fibroblasts for 5-10 h. Selenium and Vitamin E in the medium inhibited the apoptosis significantly when their concentrations reached 1.15 mol/L and 2.3 mol/L respectively. Conclusion Selenium and vitamin E have protective effect against the apoptosis induced by superoxide anion. The effect of selenium is more remarkable than that of vitamin E.
International Nuclear Information System (INIS)
Takeda, Kunihiko; Obanawa, Heiichiro; Hata, Masahisa; Sato, Katsuya
1985-01-01
The equilibria of bicarbonate ion between two phases were studied for the carbon isotope separation using anion exchangers. The condition of the formation of a bicarbonate adsorption band was quantitatively discussed. The formation of the adsorption band depends on the difference of S-potential which is the sum of the standard redection chemical potentials and L-potential which is the sum of the reduction chemical potential. The isotopic separation factor observed was about 1.012, independent of the concentrations of acid and alkali in the solutions. The isotopic separation factor was considered to be determined by the reaction of bicarbonate ion on anion exchangers and carbon dioxide dissolved in solutions. The enriched carbon isotope whose isotopic abundance ratio ( 13 C/ 12 C) was 1.258 was obtained with the column packed with anion exchangers. (author)
International Nuclear Information System (INIS)
Qi Kai; Qiu Yubing; Chen Zhenyu; Guo Xingpeng
2012-01-01
Highlights: ► Corrosive galvanic cells form on PPy film with the electrochemical reduction of O 2. ► Suitable electrochemical stimulation can inhibit the PPy’s corrosion. ► PPy film doped with larger sized anions has better corrosion resistance performance. - Abstract: The effects of environmental factors, electrochemical stimulation, and doping anions on the corrosion behaviour of conductive polypyrrole (PPy) films in alkaline aqueous media were studied with cyclic voltammetry, Fourier transform infrared spectroscopy, and X-ray photoelectron spectroscopy. High concentrations of electrolyte, low dissolved oxygen and low temperatures enhance the stability of PPy. Polarising PPy at a negative potential inhibits its corrosion obviously. PPy doped with large counter anions shows better corrosion resistance than PPy doped with small counter ions. The possible mechanism involved in PPy corrosion process is discussed.
Kobyłecka, Monika; Gu, Jiande; Rak, Janusz; Leszczynski, Jerzy
2008-01-01
The propensity of four representative conformations of 2'-deoxyadenosine-5'-monophosphate (5'-dAMPH) to bind an excess electron has been studied at the B3LYP /6-31++G(d,p) level. While isolated canonical adenine does not support stable valence anions in the gas phase, all considered neutral conformations of 5'-dAMPH form adiabatically stable anions. The type of an anionic 5'-dAMPH state, i.e., the valence, dipole bound, or mixed (valence/dipole bound), depends on the internal hydrogen bond(s) pattern exhibited by a particular tautomer. The most stable anion results from an electron attachment to the neutral syn-south conformer. The formation of this anion is associated with a barrier-free proton transfer triggered by electron attachment and the internal rotation around the C4'-C5' bond. The adiabatic electron affinity of the a&barbelow;south-syn anion is 1.19eV, while its vertical detachment energy is 1.89eV. Our results are compared with the photoelectron spectrum (PES) of 5'-dAMPH- measured recently by Stokes et al., [J. Chem. Phys. 128, 044314 (2008)]. The computational VDE obtained for the most stable anionic structure matches well with the experimental electron binding energy region of maximum intensity. A further understanding of DNA damage might require experimental and computational studies on the systems in which purine nucleotides are engaged in hydrogen bonding.
Anionic Surfactant as a Corrosion Inhibitor for Synthesized Ferrous Alloy in Acidic Solution
Directory of Open Access Journals (Sweden)
Farida Kellou-Kerkouche
2013-01-01
Full Text Available The effect of temperature on the corrosion behaviour of a synthesized iron-based alloy in 1 N sulphuric acid solution has been examined by means of three electrochemical techniques. Thereafter, we studied the influence of an anionic surfactant (sodium dodecyl benzene sulfonate at various concentrations on the electrochemical behaviour of the ferrous alloy. The obtained results show that the temperature increase reduced the performance of the used alloy, in the acidic environment. Otherwise, the surfactant inhibits the alloy dissolution in the sulphuric acid, through its adsorption on the metal surface without modifying the mechanism of corrosion process. We also noticed that the highest inhibition effect is obtained at a concentration above its critical micelle concentration (CMC. Langmuir adsorption isotherm fits well with the experimental data.
Determination of anionic concentrations in ground water samples using ion chromatography
International Nuclear Information System (INIS)
Prathibha, P.; Saradhi, I.V.; Pandit, G.G.; Puranik, V.D.
2011-01-01
Ion chromatography is a powerful separation technique for the quantitative measurement of anions in aqueous samples as well as in soil, sediment and air particulate samples leached in aqueous solutions. Ion chromatographic technique is developed by making use of suppressed ion conductivity detection (Small et.al.,1975) and it is a rapid multi ion analysis technique. The time, processing and effort required for the analysis of anions is much less compared to other techniques available such as ion selective electrode technique. In the present paper ground water samples collected around New BARC campus, Visakhapatnam are analyzed for anions using Ion chromatograph. The data generated will establish the current baseline status of the ionic contaminants in the study area. Groundwater samples are collected at 13 locations around BARC Vizag campus covering 30 km radius in September, 2009, April and July, 2010. The water samples include samples from hand pump and open wells in villages. The water samples are analyzed for fluoride, chloride, nitrate and sulphate using Metrohm make Ion chromatograph. The fluoride concentration in samples varied from 0.22 to 1.26 ppm, chloride from 18.7 to 810.9, nitrate from 1.34 to 378.5 ppm and sulphate from 13.29 to 250.69 ppm. No significant seasonal variations are observed in the samples collected from various locations except chloride at two locations. Ions Chromatograph is found to be a useful tool for simultaneous analysis of environmental samples with good accuracy where the concentrations of anions vary within an order of magnitude among them themselves. (author)
Zeolite-like Metal–Organic Framework (MOF) Encaged Pt(II)-Porphyrin for Anion-Selective Sensing
Masih, Dilshad
2018-03-26
The selectivity and sensitivity of sensors are of great interest to the materials chemistry community, and a lot of effort is now devoted to improving these characteristics. More specifically, the selective sensing of anions is one of the largest challenges impeding the sensing-research area due to their similar physical and chemical behaviors. In this work, platinum–metalated porphyrin (Pt(II)TMPyP) was successfully encapsulated in a rho-type zeolite-like metal–organic framework (rho-ZMOF) and applied for anion-selective sensing. The sensing activity and selectivity of the MOF-encaged Pt(II)TMPyP for various anions in aqueous and methanolic media were compared to that of the free (nonencapsulated) Pt(II)TMPyP. While the photoinduced triplet-state electron transfer of Pt(II)TMPyP showed a very low detection limit for anions with no selectivity, the Pt(II)TMPyP encapsulated in the rho-ZMOF framework possessed a unique chemical structure to overcome such limitations. This new approach has the potential for use in other complex sensing applications, including biosensors, which require ion selectivity.
Jiang, Yangwei; Zhang, Dong; Zhang, Yaoyang; Deng, Zhenyu; Zhang, Linxi
2014-05-28
The adsorption-desorption transition of DNA in DNA-dendrimer solutions is observed when high-valence anions, such as hexavalent anions, are added to the DNA-dendrimer solutions. In the DNA-dendrimer solutions with low-valence anions, dendrimers bind tightly with the V-shaped double-stranded DNA. When high-valence anions, such as pentavalent or hexavalent anions, are added to the DNA-dendrimer solutions, the double-stranded DNA chains can be stretched straightly and the dendrimers are released from the double-stranded DNA chains. In fact, adding high-valence anions to the solutions can change the charge spatial distribution in the DNA-dendrimer solutions, and weaken the electrostatic interactions between the positively charged dendrimers and the oppositely charged DNA chains. Adsorption-desorption transition of DNA is induced by the overcharging of dendrimers. This investigation is capable of helping us understand how to control effectively the release of DNA in gene/drug delivery because an effective gene delivery for dendrimers includes non-covalent DNA-dendrimer binding and the effective release of DNA in gene therapy.
Dehghani, M; Haghighi, A Binaee; Zamanian, Z
2010-06-01
The aim of this research is to study the feasibility of removing nitrates from water by means of anion exchange. In the purposed work an attempt was made to utilize strong basic anion resin to remove nitrate in the presence of competitive anion. Amberjet Cl- 4200 ion exchange resin was used in a batch scale. The fixation rate of nitrate without the presences of any competitive anion was almost constant (94.60-96.43) when the nitrate concentrations are in the range of 100-150 mg L(-1). The fixation rate of nitrate in the presences of two competitive anions (sulphate and chloride) was reduced to 82% when the concentration of nitrate was 100 mg L(-1).
Solvation of monovalent anions in formamide and methanol: Parameterization of the IEF-PCM model
International Nuclear Information System (INIS)
Boees, Elvis S.; Bernardi, Edson; Stassen, Hubert; Goncalves, Paulo F.B.
2008-01-01
The thermodynamics of solvation for a series of monovalent anions in formamide and methanol has been studied using the polarizable continuum model (PCM). The parameterization of this continuum model was guided by molecular dynamics simulations. The parameterized PCM model predicts the Gibbs free energies of solvation for 13 anions in formamide and 16 anions in methanol in very good agreement with experimental data. Two sets of atomic radii were tested in the definition of the solute cavities in the PCM and their performances are evaluated and discussed. Mean absolute deviations of the calculated free energies of solvation from the experimental values are in the range of 1.3-2.1 kcal/mol
Zhao, Haiyan; Leamer, Lauren A; Gabbaï, François P
2013-06-21
Stimulated by the growing importance and recognized toxicity of anions such as fluoride, cyanide and azides, we have, in the past few years, developed a family of Lewis acidic triarylboranes that can be used for the complexation of these anions in organic and protic solvents, including water. A central aspect of our approach lies in the decoration of the boranes with peripheral ammonium, phosphonium, sulfonium stibonium or telluronium groups. The presence of these cationic groups provides a Coulombic drive for the capture of the anion, leading to boranes that can be used in aqueous solutions where anion hydration and/or protonation are usually competitive. The anion affinity of these boranes can be markedly enhanced by narrowing the separation between the anion binding site (i.e. the boron atom) and the onium ion. In such systems, the latent Lewis acidity of the onium ion also plays a role as manifested by the formation of B-X→E (E = P, S, Sb, or Te; X = F, CN or N3) chelate motifs that provide additional stability to the resulting complexes. These effects, which are maximum in stibonium and telluronium boranes, show that the Lewis acidity of heavy onium ions can be exploited for anion coordination and capture. The significance of these advances is illustrated by the development of applications in anion sensing, fluorination chemistry and (18)F radiolabeling for positron emission tomography.
Efficiency of producing anion and relative humidity of the indigenous woody plants in Jeju islands
Son, S.-G.; Kim, K.-J.; Kim, H.-J.; Kim, C.-M.; Byun, K.-O.
2009-04-01
This study is to evaluate the ability of interior plants to produce anion and relative humidity that can purify polluted indoor air. Four indigenous woody plants in Jeju islands such as Sarcandra glaber (Thunb.) Nakai, Illicium anisatum L, Cleyera japonica Thunb. and Ilex rotunda Thunb. were used. Sansevieria trifasciata cv. Laurentii was also used as a comparative plant. The amount of anion and increment of relative humidity produced by five species of indoor plants was assessed by anion measurement (ITC-201A)in a sealed acryl chamber (118Ã-118Ã-119.5cm). The highest amount of anion was 515 ea/cm3produced by I. rotunda. The amounts of anion were 293 ea/cm3, 273 ea/cm3, and 211 ea/cm3 in S. glaber, I. anisatum and C. japonica, respecively while it was 220 ea/cm3 in S. trifasciata. The increment of relative humidity was highest in I. anisatum as 27.4% while it was lowest in S. trifasciata as 14.0%. This result suggested that all four indigenous plants tested were more effective to purify the indoor polluted air than S. trifasciata. Key words: interior plant, S. glaber, I. anisatum, C. japonica, I. rotunda, indoor polluted air
Removal of plutonium from nitric acid-oxalic acid solutions using anion exchange method
International Nuclear Information System (INIS)
Kasar, U.M.; Pawar, S.M.; Joshi, A.R.
1999-01-01
An anion exchange method using Amberlyst A-26 (MP) resin was developed for removal of Pu from nitric acid-oxalic acid solutions without destroying oxalate. The method consists of sorption of Pu(IV) on Amberlyst A-26, a macroporous anion exchange resin, from nitric acid-oxalic acid medium in the presence of Al(NO 3 ) 3 . Pu(IV) breakthrough capacity of Amberlyst A-26 using synthetic feed solution was determined. (author)
Dong, Zhen-Zhen; Yang, Chao; Vellaisamy, Kasipandi; Li, Guodong; Leung, Chung-Hang; Ma, Dik-Lung
2017-10-27
We have developed a Ag@Au core-shell nanoparticle (NP)/iridium(III) complex-based sensing platform for the sensitive luminescence "turn-on" sensing of cyanide ions, an acutely toxic pollutant. The assay is based on the quenching effect of Ag@Au NPs on the emission of complex 1, but luminescence is restored after the addition of cyanide anions due to their ability to dissolve the Au shell. Our sensing platform exhibited a high sensitivity toward cyanide anions with a detection limit of 0.036 μM, and also showed high selectivity for cyanide over 10-fold excess amounts of other anions. The sensing platform was also successfully applied to monitor cyanide anions in drinking water and in living cells.
Environmental behavior of inorganic anions
International Nuclear Information System (INIS)
Garland, T.R.; Cataldo, D.A.; Fellows, R.J.; Wildung, R.E.
1987-01-01
Recent efforts have addressed two aspects of anion behavior in the soil/plant system. The first involves evaluation of the gaseous component of the terrestrial iodine cycle in soils and plants. Field analyses of 129 I in soils and vegetation adjacent to a fuels reprocessing facility, which was idle for 10 years prior to the study, indicated that there may be a significant gaseous component to the terrestrial iodine cycle. Soil substrates, including a silt-sand, organic forest soil, quartz sand, and a sterilized soil, were amended with radioiodide, and the rates and quality of the volatile components evaluated
Changing certain dietary cationic and anionic minerals: Impact on ...
African Journals Online (AJOL)
Changing certain dietary cationic and anionic minerals: Impact on blood chemistry, milk ... Increased blood pH and serum HCO3 were noticed in buffaloes fed with LC ... Serum calcium and chloride increased with decreased DCAD level while ...
Energy Technology Data Exchange (ETDEWEB)
Li Feng; Zhang Lihong; Evans, David G.; Forano, Claude; Duan Xue
2004-12-15
Layered double hydroxide (LDH) with the Mg{sup 2+}/Al{sup 3+} molar ratio of 2.0 containing interlayer organic pesticide glyphosate anions (MgAl-Gly-LDH) has been synthesized by the use of anion exchange and coprecipitation routes. Intercalation experiments with glyphosate (Gly) reveal a correlation between the temperatures for thermal treatments and the types of reaction it undergoes with Gly. The grafting of the Gly anion onto hydroxylated sheets of LDH by moderate thermal treatments (hydrothermal treatments and calcinations) was confirmed by a combination of several techniques, including powder X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FT-IR), thermogravimetry analysis (TGA-DTG), and {sup 31}P nuclear magnetic resonance (NMR). The thermal decomposition of MgAl-Gly-LDH results in the removal of loosely held interlayer water, grafting reaction between the interlayer anions and hydroxyl groups on the lattice of LDH, dehydroxylation of the lattice and decomposition of the interlayer species in succession, thus leading to a variety of crystallographic transitions.
Biogeochemical behaviour of anionic radionuclides in soil: evidence for biotic interactions
International Nuclear Information System (INIS)
Fevrier, L.; Martin-Garin, A.
2004-01-01
Among studies on radionuclides, very few have been devoted to the behaviour of long-lived anionic radionuclides as 99 Tc and 79 Se in soils. Yet these two species are supposed to be highly mobile in soils, because of their anionic forms. The understanding of their biogeochemical behaviour in soils will improve both the ecological and health risk assessment. Very often the interactions between the radionuclides and the different components of soil are considered only from a physico-chemical point of view. However in surface horizons and more specially in the rhizosphere, the micro-organisms can not be ignored as they can affect either directly or indirectly the speciation of most of the chemical species, and particularly these of Se and Tc. This study demonstrates the role of the microbial compartment in the retention of Se and Tc in soil by comparing experiments with a sterilized soil (no microbial activity) to experiments with a soil more or less amended with organic carbon and / or nitrate, to stimulate its microbial activity. Kd coefficients for Se and Tc were determined in batch experiments, whereas transport of Se and Tc was investigated through column leaching experiments. Kd for Se was enhanced for the natural soil without amendment compared to the value obtained for the sterilized soil. The retention of Se was higher again in the natural soil amended with glucose and nitrate together. In addition, these amendments facilitated the development of a biofilm at the entrance of the column, which can directly retain Se. This effect was less obvious for Tc in batch experiments, but was revealed by leaching experiments where a high quantity of Tc was retained in the soil column when added with glucose and nitrate. These results give evidence that micro-organisms are responsible for a greater retention of Se and Tc in soil. (author)
Kraut, Jeffrey A; Nagami, Glenn T
2013-11-01
The serum anion gap has been utilized to identify errors in the measurement of electrolytes, to detect paraproteins, and, most relevant to the nephrologist, to evaluate patients with suspected acid-base disorders. In regard to the latter purpose, traditionally an increased anion gap is identified when it exceeds the upper limit of normal for a particular clinical laboratory measurement. However, because there is a wide range of normal values (often 8-10 mEq/L), an increase in anion concentration can be present in the absence of an increased anion gap. In addition, the type of retained anion can affect the magnitude of the increase in anion gap relative to change in serum [HCO3(-)] being greater with lactic acidosis compared with ketoacidosis. This review examines the methods of calculation of the serum anion gap in textbooks and published literature, the effect of perturbations other than changes in acid-base balance, and its effectiveness in identifying mild and more severe disturbances in acid-base balance. Limitations of the present methods of determining the normal anion gap and change in the anion gap are highlighted. The possibility of identifying the baseline value for individuals to optimize the use of the calculation in the detection of metabolic acidosis is suggested.
MRP3, an organic anion transporter able to transport anti-cancer drugs
Kool, Marcel; van der Linden, Marcel; de Haas, Marcel; Scheffer, George L.; de Vree, J. Marleen L.; Smith, Alexander J.; Jansen, Gerrit; Peters, Godefridus J.; Ponne, Nico; Scheper, Rik J.; Elferink, Ronald P. J. Oude; Baas, Frank; Borst, Piet
1999-01-01
The human multidrug-resistance protein (MRP) gene family contains at least six members: MRP1, encoding the multidrug-resistance protein; MRP2 or cMOAT, encoding the canalicular multispecific organic anion transporter; and four homologs, called MRP3, MRP4, MRP5, and MRP6. In this report, we characterize MRP3, the closest homolog of MRP1. Cell lines were retrovirally transduced with MRP3 cDNA, and new monoclonal antibodies specific for MRP3 were generated. We show that MRP3 is an organic anion ...
Arnould, Mark A; Buehner, Rita W; Wesdemiotis, Chrys; Vargas, Rafael
2005-01-01
Electrospray ionization of polyesters composed of isophthalic acid and neopentyl glycol produces carboxylate anions in negative mode and mainly sodium ion adducts in positive mode. A tandem mass spectrometry (MS/MS) study of these ions in a quadrupole ion trap shows that the collisionally activated dissociation pathways of the anions are simpler than those of the corresponding cations. Charge-remote fragmentations predominate in both cases, but the spectra obtained in negative mode are devoid of the complicating cation exchange observed in positive mode. MS/MS of the Na(+) adducts gives rise to a greater number of fragments but not necessarily more structural information. In either positive or negative mode, polyester oligomers with different end groups fragment by similar mechanisms. The observed fragments are consistent with rearrangements initiated by the end groups. Single-stage ESI mass spectra also are more complex in positive mode because of extensive H/Na substitutions; this is also true for matrix-assisted laser desorption ionization (MALDI) mass spectra. Hence, formation and analysis of anions might be the method of choice for determining block length, end group structure and copolymer sequence, provided the polyester contains at least one carboxylic acid end group that is ionizable to anions.
Formation of hydrotalcite in aqueous solutions and intercalation of ATP by anion exchange.
Tamura, Hiroki; Chiba, Jun; Ito, Masahiro; Takeda, Takashi; Kikkawa, Shinichi; Mawatari, Yasuteru; Tabata, Masayoshi
2006-08-15
The formation reaction and the intercalation of adenosine triphosphate (ATP) were studied for hydrotalcite (HT), a layered double hydroxide (LDH) of magnesium and aluminum. Hydrotalcite with nitrate ions in the interlayer (HT-NO(3)) was formed (A) by dropwise addition of a solution of magnesium and aluminum nitrates (pH ca. 3) to a sodium hydroxide solution (pH ca. 14) until the pH decreased from 14 to 10 and (B) by dropwise addition of the NaOH solution to the solution of magnesium and aluminum nitrates with pH increasing from 3 to 10. The precipitate obtained with method B was contaminated with aluminum hydroxide and the crystallinity of the product was low, possibly because aluminum hydroxide precipitates at pH 4 or 5 and remains even after HT-NO(3) forms at pH above 8. With method A, however, the precipitate was pure HT-NO(3) with increased crystallinity, since the solubility of aluminum hydroxide at pH above and around 10 is high as dissolved aluminate anions are stable in this high pH region, and there was no aluminum hydroxide contamination. The formed HT-NO(3) had a composition of [Mg(0.71)Al(0.29)(OH)(2)](NO(3))(0.29).0.58H(2)O. To intercalate ATP anions into the HT-NO(3), HT-NO(3) was dispersed in an ATP solution at pH 7. It was found that the interlayer nitrate ions were completely exchanged with ATP anions by ion exchange, and the interlayer distance expanded almost twice with a free space distance of 1.2 nm. The composition of HT-ATP was established as [Mg(0.68)Al(0.32)(OH)(2)](ATP)(0.080)0.88H(2)O. The increased distance could be explained with a calculated molecular configuration of the ATP as follows: An ATP molecule is bound to an interlayer surface with the triphosphate group, the adenosine group bends owing to its bond angles and projects into the interlayer to a height of 1 nm, and the adenosine groups aligned in the interlayer support the interlayer distance.
Cui, Ying; Mo, Hao-Jun; Chen, Jin-Can; Niu, Yan-Li; Zhong, Yong-Rui; Zheng, Kang-Cheng; Ye, Bao-Hui
2007-08-06
A new anion sensor [Ru(bpy)2(H2biim)](PF6)2 (1) (bpy = 2,2'-bipyridine and H2biim = 2,2'-biimidazole) has been developed, in which the Ru(II)-bpy moiety acts as a chromophore and the H2biim ligand as an anion receptor via hydrogen bonding. A systematic investigation shows that 1 is an eligible sensor for various anions. It donates protons for hydrogen bonding to Cl-, Br-, I-, NO3-, HSO4-, H2PO4-, and OAc- anions and further actualizes monoproton transfer to the OAc- anion, changing color from yellow to orange brown. The fluoride ion has a high affinity toward the N-H group of the H2biim ligand for proton transfer, rather than hydrogen bonding, because of the formation of the highly stable HF2- anion, resulting in stepwise deprotonation of the two N-H fragments. These processes are signaled by vivid color changes from yellow to orange brown and then to violet because of second-sphere donor-acceptor interactions between Ru(II)-H2biim and the anions. The significant color changes can be distinguished visually. The processes are not only determined by the basicity of anion but also by the strength of hydrogen bonding and the stability of the anion-receptor complexes. The design strategy and remarkable photophysical properties of sensor 1 help to extend the development of anion sensors.
Zhang, Hao; Yang, Minmin; Luan, Qian; Tang, Hu; Huang, Fenghong; Xiang, Xia; Yang, Chen; Bao, Yuping
2017-05-17
Cellulose anionic hydrogels were successfully prepared by dissolving TEMPO-oxidized cellulose nanofibers in NaOH/urea aqueous solution and being cross-linked with epichlorohydrin. The hydrogels exhibited microporous structure and high hydrophilicity, which contribute to the excellent water absorption property. The growth indexes, including the germination rate, root length, shoot length, fresh weight, and dry weight of the seedlings, were investigated. The results showed that cellulose anionic hydrogels with suitable carboxylate contents as plant growth regulators could be beneficial for seed germination and growth. Moreover, they presented preferable antifungal activity during the breeding and growth of the sesame seed breeding. Thus, the cellulose anionic hydrogels with suitable carboxylate contents could be applied as soilless culture mediums for plant growth. This research provided a simple and effective method for the fabrication of cellulose anionic hydrogel and evaluated its application in agriculture.
International Nuclear Information System (INIS)
Ranga Rao Pulimi, V.; Jeevanandam, P.
2009-01-01
The effect of using different anions (nitrate, chloride, sulfate, and acetate) during the precursor synthesis, by homogeneous precipitation, on the magnetic properties of the final product (nanocrystalline NiO), has been studied. The precursors and the oxide were characterized by various analytical techniques including powder X-ray diffraction, FT-IR spectroscopy, thermal gravimetry (TGA), and magnetic measurements. The synthesized NiO samples possess crystallite size in the range, ∼2-6 nm, depending on the anion of the nickel salt. The nickel oxide nanoparticles exhibit superparamagnetic behavior. Acetate and sulfate anions lead to NiO with higher saturation magnetization (∼1.2-1.8 emu/g), while chloride and nitrate anions lead to NiO nanoparticles with lower saturation magnetization (∼0.1-0.4 emu/g) values. The observed magnetic behavior has been attributed to the size effect.
Energy Technology Data Exchange (ETDEWEB)
Ranga Rao Pulimi, V. [Department of Chemistry, Indian Institute of Technology Roorkee, Roorkee 247667 (India); Jeevanandam, P. [Department of Chemistry, Indian Institute of Technology Roorkee, Roorkee 247667 (India)], E-mail: jeevafcy@iitr.ernet.in
2009-09-15
The effect of using different anions (nitrate, chloride, sulfate, and acetate) during the precursor synthesis, by homogeneous precipitation, on the magnetic properties of the final product (nanocrystalline NiO), has been studied. The precursors and the oxide were characterized by various analytical techniques including powder X-ray diffraction, FT-IR spectroscopy, thermal gravimetry (TGA), and magnetic measurements. The synthesized NiO samples possess crystallite size in the range, {approx}2-6 nm, depending on the anion of the nickel salt. The nickel oxide nanoparticles exhibit superparamagnetic behavior. Acetate and sulfate anions lead to NiO with higher saturation magnetization ({approx}1.2-1.8 emu/g), while chloride and nitrate anions lead to NiO nanoparticles with lower saturation magnetization ({approx}0.1-0.4 emu/g) values. The observed magnetic behavior has been attributed to the size effect.
Electronic spectra of anions intercalated in layered double hydroxides
Indian Academy of Sciences (India)
groups of the layers and interlayer water through the termi- nal atom symmetry ... results in a reaction with the metal hydroxide layers lead- ing to the ..... List of band positions observed for potassium salts of anion and LDH samples. Salts.
Bolel, Priyanka; Datta, Shubhashis; Mahapatra, Niharendu; Halder, Mintu
2014-01-09
Protein-ligand electrostatic interaction can be looked upon as ion receptor-ligand interaction, and the binding cavity of protein can be either an anion or cation receptor depending on the charge of the guest. Here we focus on the exploration of pH-modulated binding of a number of anionic ligands, specific to the subdomain IIA cavity of HSA, such as carmoisine, tartrazine, cochineal red, and warfarin. The logarithm of the binding constant is found to vary linearly with the square-root of ionic strength, indicating applicability of the Debye-Hückel limiting law to protein-ligand electrostatic binding equilibrium, and concludes that the subdomain IIA cavity is an anion receptor. The present approach is very unique that one can calculate the effective charge of the protein-based anion receptor pocket, and the calculated charge has been found to vary between +1 and +3 depending on the pH and ligand itself. The study also indicates that in such cases of specific ligand binding the pocket charge rather than the overall or surface charge of the macromolecule seems to have a paramount role in determining the strength of interaction. For the first time, it is demonstrated that the Debye-Hückel interionic interaction model can be successfully applied to understand the protein-based receptor-ligand electrostatic interaction in general.
Cationic and Anionic Disorder in CZTSSe Kesterite Compounds: A Chemical Crystallography Study.
Bais, Pierre; Caldes, Maria Teresa; Paris, Michaël; Guillot-Deudon, Catherine; Fertey, Pierre; Domengès, Bernadette; Lafond, Alain
2017-10-02
The cationic and anionic disorder in the Cu 2 ZnSnSe 4 -Cu 2 ZnSnS 4 (CZTSe-CZTS) system has been investigated through a chemical crystallography approach including X-ray diffraction (in conventional and resonant setup), 119 Sn and 77 Se NMR spectroscopy, and high-resolution transmission electron microscopy (HRTEM) techniques. Single-crystal XRD analysis demonstrates that the studied compounds behave as a solid solution with the kesterite crystal structure in the whole S/(S + Se) composition range. As previously reported for pure sulfide and pure selenide compounds, the 119 Sn NMR spectroscopy study gives clear evidence that the level of Cu/Zn disorder in mixed S/Se compounds depends on the thermal history of the samples (slow cooled or quenched). This conclusion is also supported by the investigation of the 77 Se NMR spectra. The resonant single-crystal XRD technique shows that regardless of the duration of annealing step below the order-disorder critical temperature the ordering is not a long-range phenomenon. Finally, for the very first time, HREM images of pure selenide and mixed S/Se crystals clearly show that these compounds have different microstructures. Indeed, only the mixed S/Se compound exhibits a mosaic-type contrast which could be the sign of short-range anionic order. Calculated images corroborate that HRTEM contrast is highly dependent on the nature of the anion as well as on the local anionic order.
Energy Technology Data Exchange (ETDEWEB)
Philip, Vivek M [ORNL; Harris, Jason B [ORNL; Adams, Rachel M [ORNL; Nguyen, Don [University of Tennessee, Knoxville (UTK); Spires, Jeremy [University of Tennessee, Knoxville (UTK); Howell, Elizabeth E. [University of Tennessee, Knoxville (UTK); Hinde, Robert J [ORNL
2011-01-01
Protein structures are stabilized using noncovalent interactions. In addition to the traditional noncovalent interactions, newer types of interactions are thought to be present in proteins. One such interaction, an anion pair, in which the positively charged edge of an aromatic ring interacts with an anion, forming a favorable anion quadrupole interaction, has been previously proposed [Jackson, M. R., et al. (2007) J. Phys. Chem. B111, 8242 8249]. To study the role of anion interactions in stabilizing protein structure, we analyzed pairwise interactions between phenylalanine (Phe) and the anionic amino acids, aspartate (Asp) and glutamate (Glu). Particular emphasis was focused on identification of Phe Asp or Glu pairs separated by less than 7 in the high-resolution, nonredundant Protein Data Bank. Simplifying Phe to benzene and Asp or Glu to formate molecules facilitated in silico analysis of the pairs. Kitaura Morokuma energy calculations were performed on roughly 19000 benzene formate pairs and the resulting energies analyzed as a function of distance and angle. Edgewise interactions typically produced strongly stabilizing interaction energies (2 to 7.3 kcal/mol), while interactions involving the ring face resulted in weakly stabilizing to repulsive interaction energies. The strongest, most stabilizing interactions were identified as preferentially occurring in buried residues. Anion pairs are found throughout protein structures, in helices as well as strands. Numerous pairs also had nearby cation interactions as well as potential stacking. While more than 1000 structures did not contain an anion pair, the 3134 remaining structures contained approximately 2.6 anion pairs per protein, suggesting it is a reasonably common motif that could contribute to the overall structural stability of a protein.
Roy, Amit Saha; Saha, Pinaki; Adhikary, Nirmal Das; Ghosh, Prasanta
2011-03-21
The diamagnetic VO(2+)-iminobenzosemiquinonate anion radical (L(R)(IS)(•-), R = H, Me) complexes, (L(-))(VO(2+))(L(R)(IS)(•-)): (L(1)(-))(VO(2+))(L(H)(IS)(•-))•3/2MeOH (1•3/2MeOH), (L(2)(-))(VO(2+))(L(H)(IS)(•-)) (2), and (L(2)(-))(VO(2+))(L(Me)(IS)(•-))•1/2 L(Me)(AP) (3•1/2 L(Me)(AP)), incorporating tridentate monoanionic NNO-donor ligands {L = L(1)(-) or L(2)(-), L(1)H = (2-[(phenylpyridin-2-yl-methylene)amino]phenol; L(2)H = 1-(2-pyridylazo)-2-naphthol; L(H)(IS)(•-) = o-iminobenzosemiquinonate anion radical; L(Me)(IS)(•-) = o-imino-p-methylbenzosemiquinonate anion radical; and L(Me)(AP) = o-amino-p-methylphenol} have been isolated and characterized by elemental analyses, IR, mass, NMR, and UV-vis spectra, including the single-crystal X-ray structure determinations of 1•3/2MeOH and 3•1/2 L(Me)(AP). Complexes 1•3/2MeOH, 2, and 3•1/2 L(Me)(AP) absorb strongly in the visible region because of intraligand (IL) and ligand-to-metal charge transfers (LMCT). 1•3/2MeOH is luminescent (λ(ext), 333 nm; λ(em), 522, 553 nm) in frozen dichloromethane-toluene glass at 77 K due to π(diimine→)π(diimine)* transition. The V-O(phenolato) (cis to the V═O) lengths, 1.940(2) and 1.984(2) Å, respectively, in 1•3/2MeOH and 3•1/2 L(Me)(AP) are consistent with the VO(2+) description. The V-O(iminosemiquinonate) (trans to the V═O) lengths, 2.1324(19) in 1•3/2MeOH and 2.083(2) Å in 3•1/2 L(Me)(AP), are expectedly ∼0.20 Å longer due to the trans influence of the V═O bond. Because of the stronger affinity of the paramagnetic VO(2+) ion to the L(H)(IS)(•-) or L(Me)(IS)(•-), the V-N(iminosemiquinonate) lengths, 1.908(2) and 1.921(2) Å, respectively, in 1•3/2MeOH and 3•1/2 L(Me)(AP), are unexpectedly shorter. Density functional theory (DFT) calculations using B3LYP, B3PW91, and PBE1PBE functionals on 1 and 2 have established that the closed shell singlet (CSS) solutions (VO(3+)-amidophenolato (L(R)(AP)(2-)) coordination) of these
Dithieno[3,2-a:2',3'-c]phenazine-based Chemical Probe for Anions: A Spectroscopic Study of Binding
El-Assaad, Tarek H.
2015-04-27
The synthesis of a new anion-responsive molecule N,N\\'-(2,5-bis(4-(tert-butyl)phenyl)dithieno[3,2-a:2\\',3\\'-c]phenazine-9,10-diyl)bis(4-methylbenzenesulfonamide) (1) is reported. The sensitivities of the spectroscopic properties of 1 in the presence of various anions were examined using UV-vis absorption spectroscopy, fluorescence and 1H NMR titration experiments. Strong binding of 1 to carboxylate, cyanide, fluoride and dihydrogen phosphate anions results in an increase in quantum yield for emission of 1, and changes in its 1H NMR chemical shifts. A significant electrostatic interaction of the tetrabutylammonium cation with 1, upon strong binding with the counter anion, was also indicated by the chemical shifts observed in the 1H NMR titrations. Binding constants of 1 to anions are also calculated based on the binding isotherms derived from NMR and UV-Vis titrations. DFT calculations show that the anion does not significantly impact the HOMO/LUMO levels (and subsequently the S0 -> S1 transition), but rather changes the strength of the S0 -> S2 transition, which accounts for the observed changes in the UV-vis spectra.
The immobilization of anion exchange resins in polymer modified cements
International Nuclear Information System (INIS)
Dyer, A.; Morgan, P.D.
1991-09-01
Organic anion exchange resins, loaded with 99-Tc as the pertechnate ion, were incorporated into polymer modified cements (Flexocrete Ltd, Preston). BFS/OPC (9:1 mix) also was modified by three polymers from the same source (styrene acrylic (2) styrene butadiene) and loaded with anion exchanger containing the pertechnate. Composites were tested for initial compressive strengths, under water and radiation stability and leach rate. IAEA standard leach testing was with simulated sea and ground waters. Ground water leaching also was carried out on composites subjected to 1.10 9 rads (γ). Leach testing correlated well with compressive strength. Modified composites performed better than the BFS/OPC mix under all conditions studied and were able to encapsulate higher resin loadings. (author)
Deng, S. H. M.; Kong, Xiang-Yu; Wang, Xue-Bin
2015-01-01
Due to the fast solvent evaporation in electrospray ionization (ESI), the concentration of initially dilute electrolyte solutions rapidly increases to afford the formation of supersaturated droplets and generation of various pristine anhydrous salt clusters in the gas phase. The size, composition, and charge distributions of these clusters, in principle, witness the nucleation evolution in solutions. Herein, we report a microscopic study on the initial stage of nucleation and crystallization of sodium/potassium thiocyanate salt solutions simulated in the ESI process. Singly charged M x (SCN)x + 1 - , doubly charged M y (SCN)y + 2 2 - (M = Na, K), and triply charged K z (SCN)z + 3 3 - anion clusters (x, y, and z stand for the number of alkali atoms in the singly, doubly, and triply charged clusters, respectively) were produced via electrospray of the corresponding salt solutions and were characterized by negative ion photoelectron spectroscopy (NIPES). The vertical detachment energies (VDEs) of these sodium/potassium thiocyanate cluster anions were obtained, and theoretical calculations were carried out for the sodium thiocyanate clusters in assisting spectral identification. The measured VDEs of singly charged anions M x (SCN)x + 1 - (M = Na and K) demonstrate that they are superhalogen anions. The existence of doubly charged anions M y (SCN)y + 2 2 - (y = 2x, x ≥ 4 and 3 for M = Na and K, respectively) and triply charged anions K z (SCN)z + 3 3 - (z = 3x, x ≥ 6) was initially discovered from the photoelectron spectra for those singly charged anions of M x (SCN)x + 1 - with the same mass-to-charge ratio (m/z), and later independently confirmed by the observation of their distinct mass spectral distributions and by taking their NIPE spectra for those pure multiply charged anions with their m/z different from the singly charged species. For large clusters, multiply charged clusters were found to become preferred, but at higher temperatures, those multiply charged
Spectral modulation through controlling anions in nanocaged phosphors
Bian, H.; Liu, Y.; Yan, D.; Zhu, H.; Liu, C.; Xu, C.S.; Liu, Y.; Zhang, H.; Wang, X.
2013-01-01
A new approach has been proposed and validated to modulate the emission spectra of europium-doped 12CaO center dot 7Al(2)O(3) phosphors by tuning the nonradiative and radiative transition rates, realized by controlling the sort and amount of the encaged anions. A single wavelength at 255 nm can
Ultrathin nanofibrous films prepared from cadmium hydroxide nanostrands and anionic surfactants.
Peng, Xinsheng; Karan, Santanu; Ichinose, Izumi
2009-08-04
We developed a simple fabrication method of ultrathin nanofibrous films from the dispersion of cadmium hydroxide nanostrands and anionic surfactants. The nanostrands were prepared in a dilute aqueous solution of cadmium chloride by using 2-aminoethanol. They were highly positively charged and gave bundlelike fibers upon mixing an aqueous solution of anionic surfactant. The nanostrand/surfactant composite fibers were filtered on an inorganic membrane filter. The resultant nanofibrous film was very uniform in the area of a few centimeters square when the thickness was not less than 60 nm. The films obtained with sodium tetradecyl sulfate (STS) had a composition close to the electroneutral complex, [Cd37(OH)68(H2O)n] x 6(STS), as confirmed by energy dispersive X-ray analysis. They were water-repellent with a contact angle of 117 degrees, and the value slightly decreased with the alkyl chain length of anionic surfactants. Ultrathin nanofibrous films were stable enough to be used for ultrafiltration at pressure difference of 90 kPa. We could effectively separate Au nanoparticles of 40 nm at an extremely high filtration rate of 14000 L/(h m2 bar).
A modified Poisson-Boltzmann surface excess calculation with a field dependent dielectric constant
International Nuclear Information System (INIS)
Gordillo, G.J.; Molina, F.V.; Posadas, D.
1990-01-01
The Unequal Radius Modified Gouy-Chapman (URMGC) was applied to mixtures of electrolytes. It was considered that the two anions, (1) and (2), have different radius, r 1 and r 2 , being r 2 smaller than r 1 . The dielectric constant was taken as a function of the electric field, using the theoretical Booth equation, or as a linear dependence varying between 6 and 78 when r 2 1 . The results show that the surface excess of anion 2 is much greater than the one predicted by Gouy-Chapman theory when the proportion of 2 increases in the mixture, while both the other anion and the cation show negative deviation. This effect is more evident in mixtures than in the case of single electrolytes, and has a maximum for a composition that depends on the chosen parameters for the model. (Author) [es
Anion exchange of 58 elements in hydrobromic acid and in hydriodic acid
International Nuclear Information System (INIS)
Marsh, S.F.; Alarid, J.E.; Hammond, C.F.; McLeod, M.J.; Roensch, F.R.; Rein, J.E.
1978-02-01
Anion exchange distributions of 58 elements have been measured from 0.1-8.7M HBr and from 0.1-7.4M HI onto three strong-base resins, 8 and 4% cross-linked and macroporous. Data were obtained by 16- to 18-h dynamic batch contacts. Anion exchange in these media is compared to that in HCl. The effect of resin cross-linkage is considerably greater in HI media than in HBr and HCl media. Examples are presented of potentially useful separations using HBr and HI media alone and in combination with HCl
Anion and cation partitioning between olivine, plagioclase phenocrysts and the host magma
International Nuclear Information System (INIS)
Yurimoto, Hisayoshi; Sueno, Shigeho
1984-01-01
Partition coefficients for -1, -2, -3, +1, +2, +3, +4 and +5 valent ions between the groundmass of tholeiite basalt and coexisting olivine and plagioclase phenocrysts from the Mid-Atlantic Ridge have been determined by secondary ion mass spectrometry. The present cation partitioning strongly supports the 'crystal structure control' mechanism. The partition coefficient for an anion is also under control of the crystal structure, so that each of the cation and anion positions in the crystal structure gives rise to a parabola-shaped peak on the partition coefficient vs. ionic radius diagram. (author)
Energy Technology Data Exchange (ETDEWEB)
Cao, Wei, E-mail: weicao@hqu.edu.cn; Wang, Zhenqian; Zeng, Qingling; Shen, Chunhua
2016-12-15
Highlights: • {sup 13}C NMR and XPS were successfully used to characterize quaternary ammonium groups in the surface of crop straw based anion adsorbents. • The results obtained from different kinds of crop straw material clearly confirmed the presence of quaternary ammonium groups. • The composition of C-groups and N-groups also were determined by curving fitting of high-resolution XPS C1 and N1 spectra. - Abstract: Despite amino groups modified crop straw has been intensively studied as new and low-cost adsorbent for removal of anionic species from water, there is still a lack of clear characterization for amino groups, especially quaternary ammonium groups in the surface of crop straw. In this study, we used {sup 13}C NMR and XPS technologies to characterize adsorbents with quaternary ammonium groups prepared from rice straw, corn stalk and sugarcane bagasse. {sup 13}C NMR spectra clearly showed the presence of quaternary ammonium groups in lignocelluloses structure of modified crop straw. The increase of nitrogen observed in XPS survey spectra also indicated the existence of quaternary ammonium group in the surface of the adsorbents. The curve fitting of high-resolution XPS N1s and C1s spectra were conducted to probe the composition of nitrogen and carbon contained groups, respectively. The results showed the proportion of quaternary ammonium group significantly increased in the prepared adsorbent’s surface that was dominated by methyl/methylene, hydroxyl, quaternary ammonium, ether and carbonyl groups. This study proved that {sup 13}C NMR and XPS could be successfully utilized for characterization of quaternary ammonium modified crop straw adsorbents.
Anionic silicate organic frameworks constructed from hexacoordinate silicon centres
Roeser, Jérôme; Prill, Dragica; Bojdys, Michael J.; Fayon, Pierre; Trewin, Abbie; Fitch, Andrew N.; Schmidt, Martin U.; Thomas, Arne
2017-10-01
Crystalline frameworks composed of hexacoordinate silicon species have thus far only been observed in a few high pressure silicate phases. By implementing reversible Si-O chemistry for the crystallization of covalent organic frameworks, we demonstrate the simple one-pot synthesis of silicate organic frameworks based on octahedral dianionic SiO6 building units. Clear evidence of the hexacoordinate environment around the silicon atoms is given by 29Si nuclear magnetic resonance analysis. Characterization by high-resolution powder X-ray diffraction, density functional theory calculation and analysis of the pair-distribution function showed that those anionic frameworks—M2[Si(C16H10O4)1.5], where M = Li, Na, K and C16H10O4 is 9,10-dimethylanthracene-2,3,6,7-tetraolate—crystallize as two-dimensional hexagonal layers stabilized in a fully eclipsed stacking arrangement with pronounced disorder in the stacking direction. Permanent microporosity with high surface area (up to 1,276 m2 g-1) was evidenced by gas-sorption measurements. The negatively charged backbone balanced with extra-framework cations and the permanent microporosity are characteristics that are shared with zeolites.
Radiation stability of anion-exchange resins based on epichlorohydrin and vinylpyridines
International Nuclear Information System (INIS)
Zainutdinov, S.S.; Dzhalilov, A.T.; Askarov, M.A.
1983-01-01
The vigorous development of nuclear technology and atomic energy and the hydrometallurgy of the rare and radioactive metals has made it necessary to create and use ion-exchange materials possessing a high resistance to the action of ionizing radiations and the temperature. In view of this, the necessity has arisen for obtaining ion-exchange materials possessing adequate radiation stability. The results of an investigation of the radiation stability of anion-exchange resins based on the products of spontaneous polymerization in the interaction of epichlorohydrin with vinylpyridines show that they possess higher radiation resistance than the industrial anion-exchange resin AN-31 used at the present time
Directory of Open Access Journals (Sweden)
Loreta TAMAŠAUSKAITĖ-TAMAŠIŪNAITĖ
2011-03-01
Full Text Available The influence of anion nature on the reduction of bismuth sulfide film deposited on gold using the successive ionic layer adsorption and reaction method in solutions containing Ni2+ ions has been investigated by electrochemical quartz crystal microbalance combined with cyclic voltammetry and X-ray photoelectron spectroscopy. It has been determined that the reduction of bismuth sulfide film in the nickel plating solution depends on the anion nature: larger cathodic current and mass changes (Dƒ are observed in the solution containing acetate anion as compared to those in the solution containing sulfate anion. As the reduction of bismuth sulfide film in the background solutions depends on the nature of anion, it influences the cathodic reduction of Ni2+ ions prior to OPD of Ni. A greater current and mass change (Dƒ is conditioned by simultaneously occurring reduction of bismuth sulfide film when the film is reduced in the acetate nickel plating electrolyte in contrast to that in the sulfate one.http://dx.doi.org/10.5755/j01.ms.17.1.244
Heterogeneous nucleation of calcium oxalate on native oxide surfaces
International Nuclear Information System (INIS)
Song, L.; Pattillo, M.J.; Graff, G.L.; Campbell, A.A.; Bunker, B.C.
1994-04-01
The aqueous deposition of calcium oxalate onto colloidal oxides has been studied as a model system for understanding heterogeneous nucleation processes of importance in biomimetic synthesis of ceramic thin films. Calcium oxalate nucleation has been monitored by measuring induction times for nucleation using Constant Composition techniques and by measuring nucleation densities on extended oxide surfaces using an atomic force microscope. Results show that the dependence of calcium oxalate nucleation on solution supersaturation fits the functional form predicted by classical nucleation theories. Anionic surfaces appear to promote nucleation better than cationic surfaces, lowering the effective energy barrier to heterogeneous nucleation