WorldWideScience

Sample records for plasmids restriction mapping

  1. A User-Friendly Method for Teaching Restriction Enzyme Mapping.

    Science.gov (United States)

    Ehrman, Patrick

    1990-01-01

    Presented is a teaching progression that enhances learning through low-cost, manipulative transparencies. Discussed is instruction about restriction enzymes, plasmids, cutting plasmids, plasmid maps, recording data, and mapping restriction sites. Mapping wheels for student use is included. (CW)

  2. Restriction Enzyme Mapping: A Simple Student Practical.

    Science.gov (United States)

    Higgins, Stephen J.; And Others

    1990-01-01

    An experiment that uses the recombinant plasmid pX1108 to illustrate restriction mapping is described. The experiment involves three restriction enzymes and employs single and double restriction enzyme digestions. A list of needed materials, procedures, safety precautions, results, and discussion are included. (KR)

  3. Characterization and restriction analysis of the P sex factor and the cryptic plasmid of Vibrio cholerae strain V58.

    Science.gov (United States)

    Bartowsky, E J; Morelli, G; Kamke, M; Manning, P A

    1987-07-01

    The P plasmid of Vibrio cholerae is a derepressed sex factor restricted to V. cholerae and has been shown to express surface exclusion. We have isolated the plasmids of strain V58 and have found that in addition to P, two further cryptic plasmids are also present. P has a size of 68 kb as determined by both electron microscopy and restriction endonuclease analysis. These other plasmids are 34 and 4.7 kb in size. Restriction maps of P and the larger cryptic plasmid have been determined. It has been demonstrated that P differs from the standard Inc group test plasmids and also expresses a surface exclusion system. The ability of the type Inc plasmids to be transferred to V. cholerae by either liquid or filter matings and the stability of these plasmids in V. cholerae have also been examined.

  4. Problem-Solving Test: Restriction Endonuclease Mapping

    Science.gov (United States)

    Szeberenyi, Jozsef

    2011-01-01

    The term "restriction endonuclease mapping" covers a number of related techniques used to identify specific restriction enzyme recognition sites on small DNA molecules. A method for restriction endonuclease mapping of a 1,000-basepair (bp)-long DNA molecule is described in the fictitious experiment of this test. The most important fact needed to…

  5. Streptomyces lipmanii expresses two restriction systems that inhibit plasmid transformation and bacteriophage plaque formation.

    Science.gov (United States)

    Matsushima, P; Baltz, R H

    1989-06-01

    Bacteriophage host range studies suggested that several beta-lactam-producing streptomycetes express similar restriction-modification systems. Streptomyces lipmanii LE32 expressed two restriction-modification systems, designated SliI and SliII. A mutant strain, PM87, was defective only in SliI restriction but expressed both SliI and SliII modification. Streptomyces sp. strain A57986, a natural isolate partially deficient in the expression of SliI and SliII restriction, nevertheless modified bacteriophage DNA for both SliI and SliII specificities. Protoplasts of PM87 and A57986 were transformed by several plasmids, and the modified plasmids isolated from these strains transformed wild-type S. lipmanii efficiently.

  6. The Cloning of the Human Tumor Supressor Gene INGI: DNA Cloning into Plasmid Vector and DNA Analysis by Restriction Enzymes

    Directory of Open Access Journals (Sweden)

    Elza Ibrahim Auerkari

    2015-11-01

    Full Text Available DNA cloning is one of the most important techniques In the field of molecular biology, with a critical role in analyzing the structure and function of genes and their adjacent regulatory regions. DNA cloning is helpful in learning fundamental molecular biological techniques, since DNA cloning involves a series of them, such as polymerase chain reaction (PCR, DNA ligation, bacterial transformation, bacterial culture, plasmid DNA extraction, DNA digestion with restriction enzymes and agarose gel electrophoresis. In this paper the cloning of the human tumor suppressor gene INGI has been used to illustrate the methodology. The gene was amplified by PCR, cloned into a TA-cloning vectore, and restriction enzyme mapping was used to distinguish the sense INGI construct from the antisense INGI construct.

  7. Human papillomavirus DNA from warts for typing by endonuclease restriction patterns: purification by alkaline plasmid methods.

    Science.gov (United States)

    Chinami, M; Tanikawa, E; Hachisuka, H; Sasai, Y; Shingu, M

    1990-01-01

    The alkaline plasmid DNA extraction method of Birnboim and Doly was applied for the isolation of human papillomavirus (HPV) from warts. Tissue from common and plantar warts was digested with proteinase K, and the extrachromosomal circular covalently-closed form of HPV-DNA was rapidly extracted by alkaline sodium dodecyl sulphate and phenol-chloroform treatment. Recovery of HPV-DNA from the tissue was sufficient for determination of endonuclease restriction patterns by agarose gel electrophoresis.

  8. A mitochondrial mutator plasmid that causes senescence under dietary restricted conditions

    NARCIS (Netherlands)

    Maas, M.F.P.M.; Hoekstra, R.F.; Debets, A.J.M.

    2007-01-01

    Background Calorie or dietary restriction extends life span in a wide range of organisms including the filamentous fungus Podospora anserina. Under dietary restricted conditions, P. anserina isolates are several-fold longer lived. This is however not the case in isolates that carry one of the pAL2-1

  9. Restriction endonuclease mapping of linear unintegrated proviral DNA of bovine leukemia virus.

    OpenAIRE

    Kettmann, R; Couez, D; Burny, A

    1981-01-01

    A detailed restriction map was deduced for the genome of the exogenous bovine leukemia virus. The cleavage sites for nine restriction enzymes were mapped. The unintegrated linear viral DNA intermediate that is produced by infection of permissive cells with bovine leukemia virus was isolated. The linear viral DNA had a unique restriction map, indicating that it is not a set of random circular permutations of the RNA genome. From hybridization with a 3'-enriched probe, the DNA restriction map w...

  10. Mapping of bionic array electric field focusing in plasmid DNA-based gene electrotransfer.

    Science.gov (United States)

    Browne, C J; Pinyon, J L; Housley, D M; Crawford, E N; Lovell, N H; Klugmann, M; Housley, G D

    2016-04-01

    Molecular medicine through gene therapy is challenged to achieve targeted action. This is now possible utilizing bionic electrode arrays for focal delivery of naked (plasmid) DNA via gene electrotransfer. Here, we establish the properties of array-based electroporation affecting targeted gene delivery. An array with eight 300 μm platinum ring electrodes configured as a cochlear implant bionic interface was used to transduce HEK293 cell monolayers with a plasmid-DNA green fluorescent protein (GFP) reporter gene construct. Electroporation parameters were pulse intensity, number, duration, separation and electrode configuration. The latter determined the shape of the electric fields, which were mapped using a voltage probe. Electrode array-based electroporation was found to require ~100 × lower applied voltages for cell transduction than conventional electroporation. This was found to be due to compression of the field lines orthogonal to the array. A circular area of GFP-positive cells was created when the electrodes were ganged together as four adjacent anodes and four cathodes, whereas alternating electrode polarity created a linear area of GFP-positive cells. The refinement of gene delivery parameters was validated in vivo in the guinea pig cochlea. These findings have significant clinical ramifications, where spatiotemporal control of gene expression can be predicted by manipulation of the electric field via current steering at a cellular level.

  11. Localization and physical mapping of a plasmid-borne 23-kb nif gene cluster from Enterobacter agglomerans showing homology to the entire nif gene cluster of Klebsiella pneumoniae M5a1.

    Science.gov (United States)

    Singh, M; Kreutzer, R; Acker, G; Klingmüller, W

    1988-01-01

    A physical and genetical map of the plasmid pEA3 indigenous to Enterobacter agglomerans is presented. pEA3 is a 111-kb large plasmid containing a 23-kb large cluster of nif genes which shows extensive homology (Southern hybridization and heteroduplex analysis) to the entire nif gene cluster of Klebsiella pneumoniae (Kp) M5a1. All the nif genes on pEA3 are organized in the same manner as in K. pneumoniae, except nifJ, which is located on the left end of pEA3 nif gene cluster (near nifQB). A BamHI restriction map of pEA3 and a detailed restriction map of the 23-kb nif region on pEA3 is also presented. The nif genes of pEA3 showed a low level of acetylene reduction in Escherichia coli, demonstrating that these genes are functional and contain the whole genetic information required to fix nitrogen. The origin of vegetative replication (OriV) of pEA3 was localized about 5.5 kb from the right end of the nif gene cluster. In addition to pEA3, large plasmids from four other strains of E. agglomerans showed homology to all the Kp nif genes tested, indicating that in diazotrophic strains of E. agglomerans nif genes are usually located on plasmids. In contrast, in most of the free-living, nitrogen-fixing bacteria the nif genes are on chromosome.

  12. The Restriction Fragment Map of Rat-Liver Mitochondrial DNA : A Reconsideration

    NARCIS (Netherlands)

    Pepe, G.; Bakker, H.; Holtrop, M.; Bollen, J.E.; Bruggen, E.F.J. van; Cantatore, P.; Terpstra, P.; Saccone, C.

    1977-01-01

    1. Rat-liver mitochondrial DNA (mtDNA) contains at least 8 cleavage sites for the restriction endonuclease Eco RI, 6 for the restriction endonuclease Hind III, 2 for the restriction endonuclease Bam HI and 11 for the restriction endonuclease Hap II. 2. The physical map of the restriction fragments o

  13. An efficient program to construct restriction maps from experimental data with realistic error levels.

    OpenAIRE

    1984-01-01

    A novel algorithm has been developed to map restriction fragments, starting from experimental size values with realistic error rates. A high performing PASCAL program has been derived from this algorithm to construct linear maps in minimal computation times.

  14. Generation of a restriction minus enteropathogenic Escherichia coli E2348/69 strain that is efficiently transformed with large, low copy plasmids

    Directory of Open Access Journals (Sweden)

    Ward Jordan D

    2008-08-01

    Full Text Available Abstract Background Many microbes possess restriction-modification systems that protect them from parasitic DNA molecules. Unfortunately, the presence of a restriction-modification system in a given microbe also hampers genetic analysis. Although plasmids can be successfully conjugated into the enteropathogenic Escherichia coli strain E2348/69 and optimized protocols for competent cell preparation have been developed, we found that a large, low copy (~15 bioluminescent reporter plasmid, pJW15, that we modified for use in EPEC, was exceedingly difficult to transform into E2348/69. We reasoned that a restriction-modification system could be responsible for the low transformation efficiency of E2348/69 and sought to identify and inactivate the responsible gene(s, with the goal of creating an easily transformable strain of EPEC that could complement existing protocols for genetic manipulation of this important pathogen. Results Using bioinformatics, we identified genes in the unfinished enteropathogenic Escherichia coli (EPEC strain E2348/69 genome whose predicted products bear homology to the HsdM methyltransferases, HsdS specificity subunits, and HsdR restriction endonucleases of type I restriction-modification systems. We constructed a strain carrying a deletion of the conserved enzymatic domain of the EPEC HsdR homologue, NH4, and showed that its transformation efficiency was up to four orders of magnitude higher than that of the parent strain. Further, the modification capacity of NH4 remained intact, since plasmids that were normally recalcitrant to transformation into E2348/69 could be transformed upon passage through NH4. NH4 was unaffected in virulence factor production, since bundle forming pilus (BFP subunits and type III secreted (T3S proteins were present at equivalent levels to those seen in E2348/69. Further, NH4 was indistinguishable from E2348/69 in tissue culture infection model assays of localized adherence and T3S. Conclusion We

  15. Direct identification of antibiotic resistance genes on single plasmid molecules using CRISPR/Cas9 in combination with optical DNA mapping

    Science.gov (United States)

    Müller, Vilhelm; Rajer, Fredrika; Frykholm, Karolin; Nyberg, Lena K.; Quaderi, Saair; Fritzsche, Joachim; Kristiansson, Erik; Ambjörnsson, Tobias; Sandegren, Linus; Westerlund, Fredrik

    2016-12-01

    Bacterial plasmids are extensively involved in the rapid global spread of antibiotic resistance. We here present an assay, based on optical DNA mapping of single plasmids in nanofluidic channels, which provides detailed information about the plasmids present in a bacterial isolate. In a single experiment, we obtain the number of different plasmids in the sample, the size of each plasmid, an optical barcode that can be used to identify and trace the plasmid of interest and information about which plasmid that carries a specific resistance gene. Gene identification is done using CRISPR/Cas9 loaded with a guide-RNA (gRNA) complementary to the gene of interest that linearizes the circular plasmids at a specific location that is identified using the optical DNA maps. We demonstrate the principle on clinically relevant extended spectrum beta-lactamase (ESBL) producing isolates. We discuss how the gRNA sequence can be varied to obtain the desired information. The gRNA can either be very specific to identify a homogeneous group of genes or general to detect several groups of genes at the same time. Finally, we demonstrate an example where we use a combination of two gRNA sequences to identify carbapenemase-encoding genes in two previously not characterized clinical bacterial samples.

  16. Transfer of plasmid-mediated ampicillin resistance from Haemophilus to Neisseria gonorrhoeae requires an intervening organism.

    Science.gov (United States)

    McNicol, P J; Albritton, W L; Ronald, A R

    1986-01-01

    Haemophilus species have been implicated as the source of plasmid-mediated ampicillin resistance in Neisseria gonorrhoeae. Previous attempts to transfer conjugally the resistance plasmids from Haemophilus species to N. gonorrhoeae have met with limited success. Using both biparental and triparental mating systems, it was found that transfer will occur if the commensal Neisseria species, Neisseria cinerea, is used as a transfer intermediate. This organism stably maintains resistance plasmids of Haemophilus and facilitates transfer of these plasmids to N. gonorrhoeae, in a triparental mating system, at a transfer frequency of 10(-8). Both Haemophilus ducreyi and N. gonorrhoeae carry mobilizing plasmids capable of mediating conjugal transfer of the same resistance plasmids. However, restriction endonuclease mapping and DNA hybridization studies indicate that the mobilizing plasmids are distinctly different molecules. Limited homology is present within the transfer region of these plasmids.

  17. Updating rDNA restriction enzyme maps of Tetrahymena reveals four new intron-containing species

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Simon, E M; Engberg, J

    1985-01-01

    The extrachromosomal rDNA molecules from a number of Tetrahymena strains were characterized by restriction enzyme mapping using three different restriction enzymes combined with gel blotting and hybridization analysis. Strains from four out of six recently described species were found to contain...

  18. Derivation of a restriction map of bacteriophage T3 DNA and comparison with the map of bacteriophage T7 DNA.

    Science.gov (United States)

    Bailey, J N; Dembinski, D R; McAllister, W T

    1980-01-01

    The DNA of bacteriophage T3 was characterized by cleavage with seven restriction endonucleases. AvaI, XbaI, BglII, and HindIII each cut T3 DNA at 1 site, KpnI cleaved it at 2 sites, MboI cleaved it at 9 sites, and HpaI cleaved it at 17 sites. The sizes of the fragments produced by digestion with these enzymes were determined by using restriction fragments of T7 DNA as molecular weight standards. As a result of this analysis, the size of T3 DNA was estimated to be 38.74 kilobases. The fragments were ordered with respect to each other and to the genetic map to produce a restriction map of T3 DNA. The location and occurrence of the restriction sites in T3 DNA are compared with those in the DNA of the closely related bacteriophage T7. Images PMID:6251266

  19. Variation of clonal, mesquite-associated rhizobial and bradyrhizobial populations from surface and deep soils by symbiotic gene region restriction fragment length polymorphism and plasmid profile analysis.

    Science.gov (United States)

    Thomas, P M; Golly, K F; Zyskind, J W; Virginia, R A

    1994-04-01

    Genetic characteristics of 14 Rhizobium and 9 Bradyrhizobium mesquite (Prosopis glandulosa)-nodulating strains isolated from surface (0- to 0.5-m) and deep (4- to 6-m) rooting zones were determined in order to examine the hypothesis that surface- and deep-soil symbiont populations were related but had become genetically distinct during adaptation to contrasting soil conditions. To examine genetic diversity, Southern blots of PstI-digested genomic DNA were sequentially hybridized with the nodDABC region of Rhizobium meliloti, the Klebsiella pneumoniae nifHDK region encoding nitrogenase structural genes, and the chromosome-localized ndvB region of R. meliloti. Plasmid profile and host plant nodulation assays were also made. Isolates from mesquite nodulated beans and cowpeas but not alfalfa, clover, or soybeans. Mesquite was nodulated by diverse species of symbionts (R. meliloti, Rhizobium leguminosarum bv. phaseoli, and Parasponia bradyrhizobia). There were no differences within the groups of mesquite-associated rhizobia or bradyrhizobia in cross-inoculation response. The ndvB hybridization results showed the greatest genetic diversity among rhizobial strains. The pattern of ndvB-hybridizing fragments suggested that surface and deep strains were clonally related, but groups of related strains from each soil depth could be distinguished. Less variation was found with nifHDK and nodDABC probes. Large plasmids (>1,500 kb) were observed in all rhizobia and some bradyrhizobia. Profiles of plasmids of less than 1,000 kb were related to the soil depth and the genus of the symbiont. We suggest that interacting selection pressures for symbiotic competence and free-living survival, coupled with soil conditions that restrict genetic exchange between surface and deep-soil populations, led to the observed patterns of genetic diversity.

  20. Restriction enzyme mapping of the DNA of Streptomyces bacteriophage B alpha and its deletion derivatives.

    Science.gov (United States)

    Ishihara, H; Nakano, M M; Ogawara, H

    1982-12-01

    Cleavage analysis of actinophage B alpha DNA was done with several restriction enzymes, and a restriction map of the DNA was determined. The DNA appeared to carry cohesive ends. Deletion mutants of actinophage B alpha were isolated by five cycles of treatment with 15 mM PPi. Both mutants had deletions of 2.5 of 1.8 megadaltons near one end of the genome, and one of them lost the single EcoRI cleavage site.

  1. Error checking and graphical representation of multiple-complete-digest (MCD) restriction-fragment maps.

    Science.gov (United States)

    Thayer, E C; Olson, M V; Karp, R M

    1999-01-01

    Genetic and physical maps display the relative positions of objects or markers occurring within a target DNA molecule. In constructing maps, the primary objective is to determine the ordering of these objects. A further objective is to assign a coordinate to each object, indicating its distance from a reference end of the target molecule. This paper describes a computational method and a body of software for assigning coordinates to map objects, given a solution or partial solution to the ordering problem. We describe our method in the context of multiple-complete-digest (MCD) mapping, but it should be applicable to a variety of other mapping problems. Because of errors in the data or insufficient clone coverage to uniquely identify the true ordering of the map objects, a partial ordering is typically the best one can hope for. Once a partial ordering has been established, one often seeks to overlay a metric along the map to assess the distances between the map objects. This problem often proves intractable because of data errors such as erroneous local length measurements (e.g., large clone lengths on low-resolution physical maps). We present a solution to the coordinate assignment problem for MCD restriction-fragment mapping, in which a coordinated set of single-enzyme restriction maps are simultaneously constructed. We show that the coordinate assignment problem can be expressed as the solution of a system of linear constraints. If the linear system is free of inconsistencies, it can be solved using the standard Bellman-Ford algorithm. In the more typical case where the system is inconsistent, our program perturbs it to find a new consistent system of linear constraints, close to those of the given inconsistent system, using a modified Bellman-Ford algorithm. Examples are provided of simple map inconsistencies and the methods by which our program detects candidate data errors and directs the user to potential suspect regions of the map.

  2. Progress towards construction of a total restriction fragment map of a human chromosome.

    NARCIS (Netherlands)

    H. Vissing; F.G. Grosveld (Frank); E. Solomon; G. Moore; N. Lench; N. Shennan; R. Williamson

    1987-01-01

    textabstractWe present an approach to the construction of an overlapping restriction fragment map of a single human chromosome. A genomic cosmid library genome was constructed from a mouse-human hybrid cell line containing chromosome 17 as its only human genetic component. Cosmids containing human i

  3. The restriction mapping of c gene deletions in Streptomyces bacteriophage phi C31 and their use in cloning vector development.

    Science.gov (United States)

    Harris, J E; Chater, K F; Bruton, C J; Piret, J M

    1983-01-01

    In addition to 20 previously mapped restriction sites in the DNA of phi C31, we have determined eight sites for SphI, four for EcoRV, and two for SstII; there are none for BglII or SstI. Nine sites were in a 12-kb segment of DNA containing no previously mapped sites. Deletions causing clear-plaque morphology were located in this part of the DNA, in a 3-kb interval between an EcoRV and an SphI site at the centre of the DNA molecule. One of the deletions (delta C3) was obtained in a previously described phi C31c+::vph (viomycin phosphotransferase) derivative containing two PstI sites separated by 3.9-kb of inessential DNA. After in vitro PstI treatment, plaque-forming phages lacking the 3.9-kb fragment were obtained from the c+ phage but not from its delta C3 derivative. Thus a 36.2-kb genome, but not one of 34.4 kb, was able to give infectious virions. PstI-generated DNA fragments of up to 8 kb can be inserted in vitro into the delta C3 derivative with retention of the vph selective marker. With the insertion of a 6.03-kb PstI fragment of plasmid SCP2, the latter phage became a potential vector (with loss of vph) for BamHI-generated DNA fragments of up to 9 kb. In the course of this work, several ClaI sites in phi C31::pBR322 bifunctional replicons were shown to be lost when the DNA was propagated in a dam+ Escherichia coli strain. This will allow the use of such replicons for the cloning of ClaI-generated DNA fragments of up to 6.7 kb.

  4. MAPPING GNSS RESTRICTED ENVIRONMENTS WITH A DRONE TANDEM AND INDIRECT POSITION CONTROL

    Directory of Open Access Journals (Sweden)

    E. Cledat

    2017-08-01

    Full Text Available The problem of autonomously mapping highly cluttered environments, such as urban and natural canyons, is intractable with the current UAV technology. The reason lies in the absence or unreliability of GNSS signals due to partial sky occlusion or multi-path effects. High quality carrier-phase observations are also required in efficient mapping paradigms, such as Assisted Aerial Triangulation, to achieve high ground accuracy without the need of dense networks of ground control points. In this work we consider a drone tandem in which the first drone flies outside the canyon, where GNSS constellation is ideal, visually tracks the second drone and provides an indirect position control for it. This enables both autonomous guidance and accurate mapping of GNSS restricted environments without the need of ground control points. We address the technical feasibility of this concept considering preliminary real-world experiments in comparable conditions and we perform a mapping accuracy prediction based on a simulation scenario.

  5. Transcriptome mapping of pAR060302, a blaCMY-2-positive broad-host-range IncA/C plasmid.

    Science.gov (United States)

    Lang, Kevin S; Danzeisen, Jessica L; Xu, Wayne; Johnson, Timothy J

    2012-05-01

    The multidrug resistance-encoding plasmids belonging to the IncA/C incompatibility group have recently emerged among Escherichia coli and Salmonella enterica strains in the United States. These plasmids have a unique genetic structure compared to other enterobacterial plasmid types, a broad host range, and a propensity to acquire large numbers of antimicrobial resistance genes via their accessory regions. Using E. coli strain DH5α harboring the prototype IncA/C plasmid pAR060302, we sought to define the baseline transcriptome of IncA/C plasmids under laboratory growth and in the face of selective pressure. The effects of ampicillin, florfenicol, or streptomycin exposure were compared to those on cells left untreated at logarithmic phase using Illumina platform-based RNA sequencing (RNA-Seq). Under growth in Luria-Bertani broth lacking antibiotics, much of the backbone of pAR060302 was transcriptionally inactive, including its putative transfer regions. A few plasmid backbone genes of interest were highly transcribed, including genes of a putative toxin-antitoxin system and an H-NS-like transcriptional regulator. In contrast, numerous genes within the accessory regions of pAR060302 were highly transcribed, including the resistance genes floR, bla(CMY-2), aadA, and aacA. Treatment with ampicillin or streptomycin resulted in no genes being differentially expressed compared to controls lacking antibiotics, suggesting that many of the resistance-associated genes are not differentially expressed due to exposure to these antibiotics. In contrast, florfenicol treatment resulted in the upregulation of floR and numerous chromosomal genes. Overall, the transcriptome mapping of pAR060302 suggests that it mitigates the fitness costs of carrying resistance-associated genes through global regulation with its transcriptional regulators.

  6. Plasmid pP62BP1 isolated from an Arctic Psychrobacter sp. strain carries two highly homologous type II restriction-modification systems and a putative organic sulfate metabolism operon.

    Science.gov (United States)

    Lasek, Robert; Dziewit, Lukasz; Bartosik, Dariusz

    2012-05-01

    The complete nucleotide sequence of plasmid pP62BP1 (34,467 bp), isolated from Arctic Psychrobacter sp. DAB_AL62B, was determined and annotated. The conserved plasmid backbone is composed of several genetic modules, including a replication system (REP) with similarities to the REP region of the iteron-containing plasmid pPS10 of Pseudomonas syringae. The additional genetic load of pP62BP1 includes two highly related type II restriction-modification systems and a set of genes (slfRCHSL) encoding enzymes engaged in the metabolism of organic sulfates, plus a putative transcriptional regulator (SlfR) of the AraC family. The pP62BP1 slf locus has a compact and unique structure. It is predicted that the enzymes SlfC, SlfH, SlfS and SlfL carry out a chain of reactions leading to the transformation of alkyl sulfates into acyl-CoA, with dodecyl sulfate (SDS) as a possible starting substrate. Comparative analysis of the nucleotide sequences of pP62BP1 and other Psychrobacter spp. plasmids revealed their structural diversity. However, the presence of a few highly conserved DNA segments in pP62BP1, plasmid 1 of P. cryohalolentis K5 and pRWF-101 of Psychrobacter sp. PRwf-1 is indicative of recombinational shuffling of genetic information, and is evidence of lateral gene transfer in the Arctic environment.

  7. Comparison of canine parvovirus with mink enteritis virus by restriction site mapping.

    OpenAIRE

    McMaster, G K; Tratschin, J D; Siegl, G

    1981-01-01

    The genomes of canine parvovirus and mink enteritis virus were compared by restriction enzyme analysis of their replicative-form DNAs. Of 79 mapped sites, 68, or 86%, were found to be common for both types of DNA, indicating that canine parvovirus and mink enteritis virus are closely related viruses. Whether they evolved from a common precursor or whether canine parvovirus is derived from mink enteritis virus, however, cannot be deduced from our present data.

  8. Optical mapping of a rice B AC clone using restriction endonuclease and imaging with fluorescent microscopy at single molecule level

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    A method of constructing restriction map by optical mapping and single molecule fluorescent microscopy is described. DNA molecules were aligned and adsorbed on a glass coverslip surface by a mbdified "molecular combing"technique, and then the surface-immobilized DNAs were cleaved in situ with a restriction endonuclease. Individual DNA molecules digested by the endonuclease EcoR I were observable with fluorescent microscopy. Using optical mapping, a physical map of a rice bacterial artificial chromosome clone was constructed. This method will facilitate genomic mapping and tracing the dynamic process in real time at a single molecule level with fluorescence microscopy.

  9. Restriction mapping of a YAC contig in the hemochromatosis gene region

    Energy Technology Data Exchange (ETDEWEB)

    Burt, M.J.; Smit, D.J.; Pyper, W.R. [Univ. of Queensland, Brisbane (Australia)

    1994-09-01

    Hemochromatosis is a common inherited disorder of iron metabolism that can lead to cirrhosis, hepatocellular carcinoma, cardiomyopathy, diabetes and anthropathy. We have mapped the hemochromatosis gene to within 1 cM of HLA-A and the microsatellite D6S105, and our allele association studies have shown that D6S105 is the marker most closely associated with the hemochromatosis gene. We are currently constructing a YAC contig and restriction map of this region as part of a positional cloning strategy to identify the hemochromatosis gene. YACs containing HLA-A or D6S105 were selected, and fluorescent-in-situ-hybridization (FISH) was performed to confirm chromosomal location and exclude chimerism. YAC DNA was digested with a panel of rare cutters, separated by pulsed field gel electrophoresis, Southern blotted and probed with the vector arms to create restriction maps. YAC insert terminal ends were isolated using vectorette methodology. A contig extending 600 kb centromeric and 350 kb telomeric of HLA-A has been established. HLA-A, HLA-F and the microsatellite D6S265 have been positioned on this map. The contig does not yet overlap any D6S105 positive YACs but the telomeric end of the contig has been sequenced and is being used to identify additional YACs to bridge this interval. Restriction mapping of three D6S105 YACs has shown the presence of several CpG islands in this region. As these CpG islands are in close proximity to D6S105, they are being used to isolate coding sequences to determine whether any of these mark the position of the hemochromatosis gene.

  10. Catalytic domain of plasmid pAD1 relaxase TraX defines a group of relaxases related to restriction endonucleases.

    Science.gov (United States)

    Francia, María Victoria; Clewell, Don B; de la Cruz, Fernando; Moncalián, Gabriel

    2013-08-13

    Plasmid pAD1 is a 60-kb conjugative element commonly found in clinical isolates of Enterococcus faecalis. The relaxase TraX and the primary origin of transfer oriT2 are located close to each other and have been shown to be essential for conjugation. The oriT2 site contains a large inverted repeat (where the nic site is located) adjacent to a series of short direct repeats. TraX does not show any of the typical relaxase sequence motifs but is the prototype of a unique family of relaxases (MOBC). The present study focuses on the genetic, biochemical, and structural analysis of TraX, whose 3D structure could be predicted by protein threading. The structure consists of two domains: (i) an N-terminal domain sharing the topology of the DNA binding domain of the MarR family of transcriptional regulators and (ii) a C-terminal catalytic domain related to the PD-(D/E)XK family of restriction endonucleases. Alignment of MOBC relaxase amino acid sequences pointed to several conserved polar amino acid residues (E28, D152, E170, E172, K176, R180, Y181, and Y203) that were mutated to alanine. Functional analysis of these mutants (in vivo DNA transfer and cleavage assays) revealed the importance of these residues for relaxase activity and suggests Y181 as a potential catalytic residue similarly to His-hydrophobe-His relaxases. We also show that TraX binds specifically to dsDNA containing the oriT2 direct repeat sequences, confirming their role in transfer specificity. The results provide insights into the catalytic mechanism of MOBC relaxases, which differs radically from that of His-hydrophobe-His relaxases.

  11. An integrated restriction fragment length polymorphism--amplified fragment length polymorphism linkage map for cultivated sunflower.

    Science.gov (United States)

    Gedil, M A; Wye, C; Berry, S; Segers, B; Peleman, J; Jones, R; Leon, A; Slabaugh, M B; Knapp, S J

    2001-04-01

    Restriction fragment length polymorphism (RFLP) maps have been constructed for cultivated sunflower (Helianthus annuus L.) using three independent sets of RFLP probes. The aim of this research was to integrate RFLP markers from two sets with RFLP markers for resistance gene candidate (RGC) and amplified fragment length polymorphism (AFLP) markers. Genomic DNA samples of HA370 and HA372, the parents of the F2 population used to build the map, were screened for AFLPs using 42 primer combinations and RFLPs using 136 cDNA probes (RFLP analyses were performed on DNA digested with EcoRI, HindIII, EcoRV, or DraI). The AFLP primers produced 446 polymorphic and 1101 monomorphic bands between HA370 and HA372. The integrated map was built by genotyping 296 AFLP and 104 RFLP markers on 180 HA370 x HA372 F2 progeny (the AFLP marker assays were performed using 18 primer combinations). The HA370 x HA372 map comprised 17 linkage groups, presumably corresponding to the 17 haploid chromosomes of sunflower, had a mean density of 3.3 cM, and was 1326 cM long. Six RGC RFLP loci were polymorphic and mapped to three linkage groups (LG8, LG13, and LG15). AFLP markers were densely clustered on several linkage groups, and presumably reside in centromeric regions where recombination is reduced and the ratio of genetic to physical distance is low. Strategies for targeting markers to euchromatic DNA need to be tested in sunflower. The HA370 x HA372 map integrated 14 of 17 linkage groups from two independent RFLP maps. Three linkage groups were devoid of RFLP markers from one of the two maps.

  12. Use of sperm plasmid DNA lipofection combined with REMI (restriction enzyme-mediated insertion) for production of transgenic chickens expressing eGFP (enhanced green fluorescent protein) or human follicle-stimulating hormone.

    Science.gov (United States)

    Harel-Markowitz, Eliane; Gurevich, Michael; Shore, Laurence S; Katz, Adi; Stram, Yehuda; Shemesh, Mordechai

    2009-05-01

    Linearized p-eGFP (plasmid-enhanced green fluorescent protein) or p-hFSH (plasmid human FSH) sequences with the corresponding restriction enzyme were lipofected into sperm genomic DNA. Sperm transfected with p-eGFP were used for artificial insemination in hens, and in 17 out of 19 of the resultant chicks, the exogenous DNA was detected in their lymphocytes as determined by PCR and expressed in tissues as determined by (a) PCR, (b) specific emission of green fluorescence by the eGFP, and (c) Southern blot analysis. A complete homology was found between the Aequorea Victoria eGFP DNA and a 313-bp PCR product of extracted DNA from chick blood cells. Following insemination with sperm lipofected with p-hFSH, transgenic offspring were obtained for two generations as determined by detection of the transgene for human FSH (PCR) and expression of the gene (RT-PCR and quantitative real-time PCR) and the presence of the protein in blood (radioimmunoassay). Data demonstrate that lipofection of plasmid DNA with restriction enzyme is a highly efficient method for the production of transfected sperm to produce transgenic offspring by direct artificial insemination.

  13. Generation of a Restriction Fragment Length Polymorphism Linkage Map for Toxoplasma Gondii

    Science.gov (United States)

    Sibley, L. D.; LeBlanc, A. J.; Pfefferkorn, E. R.; Boothroyd, J. C.

    1992-01-01

    We have constructed a genetic linkage map for the parasitic protozoan, Toxoplasma gondii, using randomly selected low copy number DNA markers that define restriction fragment length polymorphisms (RFLPs). The inheritance patterns of 64 RFLP markers and two phenotypic markers were analyzed among 19 recombinant haploid progeny selected from two parallel genetic crosses between PLK and CEP strains. In these first successful interstrain crosses, these RFLP markers segregated into 11 distinct genetic linkage groups that showed close correlation with physical linkage groups previously defined by molecular karyotype. Separate linkage maps, constructed for each of the 11 chromosomes, indicated recombination frequencies range from approximately 100 to 300 kb per centimorgan. Preliminary linkage assignments were made for the loci regulating sinefungin resistance (snf-1) on chromosome IX and adenine arabinoside (ara-1) on chromosome V by linkage to RFLP markers. Despite random segregation of separate chromosomes, the majority of chromosomes failed to demonstrate internal recombination events and in 3/19 recombinant progeny no intramolecular recombination events were detected. The relatively low rate of intrachromosomal recombination predicts that tight linkage for unknown genes can be established with a relatively small set of markers. This genetic linkage map should prove useful in mapping genes that regulate drug resistance and other biological phenotypes in this important opportunistic pathogen. PMID:1360931

  14. Plasmid Biopharmaceuticals.

    Science.gov (United States)

    Prazeres, Duarte Miguel F; Monteiro, Gabriel A

    2014-12-01

    Plasmids are currently an indispensable molecular tool in life science research and a central asset for the modern biotechnology industry, supporting its mission to produce pharmaceutical proteins, antibodies, vaccines, industrial enzymes, and molecular diagnostics, to name a few key products. Furthermore, plasmids have gradually stepped up in the past 20 years as useful biopharmaceuticals in the context of gene therapy and DNA vaccination interventions. This review provides a concise coverage of the scientific progress that has been made since the emergence of what are called today plasmid biopharmaceuticals. The most relevant topics are discussed to provide researchers with an updated overview of the field. A brief outline of the initial breakthroughs and innovations is followed by a discussion of the motivation behind the medical uses of plasmids in the context of therapeutic and prophylactic interventions. The molecular characteristics and rationale underlying the design of plasmid vectors as gene transfer agents are described and a description of the most important methods used to deliver plasmid biopharmaceuticals in vivo (gene gun, electroporation, cationic lipids and polymers, and micro- and nanoparticles) is provided. The major safety issues (integration and autoimmunity) surrounding the use of plasmid biopharmaceuticals is discussed next. Aspects related to the large-scale manufacturing are also covered, and reference is made to the plasmid products that have received marketing authorization as of today.

  15. Structural similarity and distribution of small cryptic plasmids of Lactobacillus curvatus and L. sake.

    Science.gov (United States)

    Vogel, R F; Lohmann, M; Weller, A N; Hugas, M; Hammes, W P

    1991-11-15

    Plasmid profiles of strains of Lactobacillus curvatus and L. sake isolated from meat or sauerkraut were analysed to investigate plasmid homology and distribution in relation to the ecology of these organisms in fermenting foods. A hybridisation probe was constructed by cloning of pLc2, a cryptic, 2.6-kbp plasmid from L. curvatus LTH683, into the Escherichia coli plasmid pRV50. In Southern hybridisations with the digoxygenine labeled pLc2 probe, pLc2-related small plasmids were frequently detected in meat-borne strains of L. casei subsp. pseudoplantarum, L. curvatus, L. sake, L. alimentarius, L. farciminis and L. halotolerans and in L. curvatus and L. sake isolated from sauerkraut. Among 27 Lactobacillus type strains originally isolated from habitats other than meat this type of homology was detected only with plasmids of L. buchneri and L. mali. Restriction-enzyme mapping of six small cryptic plasmids from L. curvatus and L. sake revealed strong structural homology but no similarity to previously characterized plasmids of lactobacilli. The presence of a variable region in addition to a conserved one and the occurrence of deletions during cloning of pLc2 suggest that vectors derived from these plasmids are likely to be structurally unstable.

  16. Phylogenetic relationships of five pika species (genus Ochotona) based on mitochondrial DNA restriction maps

    Institute of Scientific and Technical Information of China (English)

    于宁; 郑昌琳; 施立明; 王文; 兰宏; 张亚平

    1996-01-01

    Restriction site mapping of mitochondrial DNA (mtDNA) with 16 restriction endonucleases was used to examine the phylogenetic relationships of Ochotona cansus, O. huangensis, O. thibetana, O. curzoniae and O. erythrotis. A 1-kb length variation between 0. erythrotis of subgenus Pika and other four species of subgenus Ochotona was observed, which may be a useful genetic marker for identifying the two subgenera. The phylogenetic tree constructed using PAUP based on 61 phylogenetically informative sites suggests that O. aythrotis diverged first, followed by O. cansus, while O. atrzoniae and O. huangensis are sister taxa related to O. thibetana. The results indicate that both O. cansus and O. huangensis should be treated as independent species. If the base substitution rate of pikas mtDNA was 2% per million years, then the divergence time of the two subgenera, Pika and Ochotona, is about 8.8 Ma ago of late Miocence, middle Bao-dian of Chinese mammalian age, and the divergence of the four species in subgenus

  17. Pheromone-responsive conjugative vancomycin resistance plasmids in Enterococcus faecalis isolates from humans and chicken feces.

    Science.gov (United States)

    Lim, Suk-Kyung; Tanimoto, Koichi; Tomita, Haruyoshi; Ike, Yasuyoshi

    2006-10-01

    The drug resistances and plasmid contents of a total of 85 vancomycin-resistant enterococcus (VRE) strains that had been isolated in Korea were examined. Fifty-four of the strains originated from samples of chicken feces, and 31 were isolated from hospital patients in Korea. Enterococcus faecalis KV1 and KV2, which had been isolated from a patient and a sample of chicken feces, respectively, were found to carry the plasmids pSL1 and pSL2, respectively. The plasmids transferred resistances to vancomycin, gentamicin, kanamycin, streptomycin, and erythromycin to E. faecalis strains at a high frequency of about 10(-3) per donor cell during 4 hours of broth mating. E. faecalis strains containing each of the pSL plasmids formed clumps after 2 hours of incubation in broth containing E. faecalis FA2-2 culture filtrate (i.e., the E. faecalis sex pheromone), and the plasmid subsequently transferred to the recipient strain in a 10-min short mating in broth, indicating that the plasmids are responsive to E. faecalis pheromones. The pSL plasmids did not respond to any of synthetic pheromones for the previously characterized plasmids. The pheromone specific for pSL plasmids has been designated cSL1. Southern hybridization analysis showed that specific FspI fragments from each of the pSL plasmids hybridized with the aggregation substance gene (asa1) of the pheromone-responsive plasmid pAD1, indicating that the plasmids had a gene homologous to asa1. The restriction maps of the plasmids were identical, and the size of the plasmids was estimated to be 128.1 kb. The plasmids carried five drug resistance determinants for vanA, ermB, aph(3'), aph(6'), and aac(6')/aph(2'), which encode resistance to vancomycin, erythromycin, kanamycin, streptomycin, and gentamicin/kanamycin, respectively. Nucleotide sequence analyses of the drug resistance determinants and their flanking regions are described in this report. The results described provide evidence for the exchange of genetic information

  18. Plasmid recombination in Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    McCarthy, D.

    1982-01-01

    DNA recombination in exponential phase and competent Haemophilus influenzae was measured by an electron microscopic assay that relies on the conversion of plasmid RSF0885 monomers into multimeric forms. Dimer circles were present at a frequency of 2% in plasmid preparations from competent Rd (wild-type) cells; multimers were present at a frequency of 0.2% in preparations from exponential phase cells. Thus, plasmid recombination was stimulated in competent cells. Multimer formation occurred efficiently in cells of the transformation defective mutant rec2, implying that the rec2 gene product is not required for plasmid recombination. However, the absence of multimer plasmids in preparations from competent cells of the transformation defective mutant rec1 suggests that the rec1 gene product is required. Digestion of purified plasmids with restriction endonuclease PvuII, which makes a single cut in the monomer, revealed the presence of recombination intermediates composed of two linear plasmids joined to form two pairs of arms resembling the Greek letter chi. Length measurements of these arms taken from a population of recombination intermediates gave evidence that the plasmids were joined at sites of homology. The distributions of individual DNA strands, at the intersections of the four arms, could be resolved in some recombination intermediates and were of two types. The first type of junction appeared as a single-stranded arm appended to each corner. The second type of junction consisted of a single strand of DNA linking the two linear plasmids at a site of homology. The single-stranded linker was frequently situated at the edge of a short gap on one of the plasmids in the pair. The fine structures of the recombinational joints have been interpreted in terms of previously proposed models of recombination.

  19. Construction of a high-density genetic map for grape using next generation restriction-site associated DNA sequencing

    Directory of Open Access Journals (Sweden)

    Wang Nian

    2012-08-01

    Full Text Available Abstract Background Genetic mapping and QTL detection are powerful methodologies in plant improvement and breeding. Construction of a high-density and high-quality genetic map would be of great benefit in the production of superior grapes to meet human demand. High throughput and low cost of the recently developed next generation sequencing (NGS technology have resulted in its wide application in genome research. Sequencing restriction-site associated DNA (RAD might be an efficient strategy to simplify genotyping. Combining NGS with RAD has proven to be powerful for single nucleotide polymorphism (SNP marker development. Results An F1 population of 100 individual plants was developed. In-silico digestion-site prediction was used to select an appropriate restriction enzyme for construction of a RAD sequencing library. Next generation RAD sequencing was applied to genotype the F1 population and its parents. Applying a cluster strategy for SNP modulation, a total of 1,814 high-quality SNP markers were developed: 1,121 of these were mapped to the female genetic map, 759 to the male map, and 1,646 to the integrated map. A comparison of the genetic maps to the published Vitis vinifera genome revealed both conservation and variations. Conclusions The applicability of next generation RAD sequencing for genotyping a grape F1 population was demonstrated, leading to the successful development of a genetic map with high density and quality using our designed SNP markers. Detailed analysis revealed that this newly developed genetic map can be used for a variety of genome investigations, such as QTL detection, sequence assembly and genome comparison.

  20. Cloning of Two Bacteriocin Genes from a Lactococcal Bacteriocin Plasmid

    NARCIS (Netherlands)

    Belkum, Marco J. van; Hayema, Bert Jan; Geis, Arnold; Kok, Jan; Venema, Gerard

    1989-01-01

    Lactococcus lactis subsp. cremoris 9B4 plasmid p9B4-6 (60 kilobases [kb]), which specifies bacteriocin production and immunity, was analyzed with restriction endonucleases, and fragments of this plasmid were cloned into shuttle vectors based on the broad-host-range plasmid pWVO1. Two regions on p9B4

  1. Historical Events That Spawned the Field of Plasmid Biology.

    Science.gov (United States)

    Kado, Clarence I

    2014-10-01

    This chapter revisits the historical development and outcome of studies focused on the transmissible, extrachromosomal genetic elements called plasmids. Early work on plasmids involved structural and genetic mapping of these molecules, followed by the development of an understanding of how plasmids replicate and segregate during cell division. The intriguing property of plasmid transmission between bacteria and between bacteria and higher cells has received considerable attention. The utilitarian aspects of plasmids are described, including examples of various plasmid vector systems. This chapter also discusses the functional attributes of plasmids needed for their persistence and survival in nature and in man-made environments. The term plasmid biology was first conceived at the Fallen Leaf Lake Conference on Promiscuous Plasmids, 1990, Lake Tahoe, California. The International Society for Plasmid Biology was established in 2004 (www.ISPB.org).

  2. Self-transmissible nif plasmid (pEA9) of Enterobacter agglomerans 339: molecular cloning and evidence for the existence of similar nif clusters on dissimilar plasmids in Enterobacter strains.

    Science.gov (United States)

    Steibl, H D; Siddavattam, D; Klingmüller, W

    1995-11-01

    A cosmid library was generated to the 200-kb self-transmissible nif plasmid pEA9 isolated from Enterobacter agglomerans 339. The cosmid clone identified to contain the complete nif cluster was used to determine the nif gene organization and the physical map. The restriction pattern and nif gene organization of this nif cluster showed remarkable similarities to the nif cluster identified on the 110-kb plasmid pEA3 of Enterobacter agglomerans 333. Nucleotide sequence of several randomly selected regions of the nif cluster of pEA9 showed 96% similarity when compared to the known sequences of the nif cluster of pEA3. However, the homology ended abruptly at the flanking regions of the nif clusters and no similarity could be detected with the rest of the DNA of these plasmids. This reveals the existence of similar nif clusters on dissimilar plasmids, implying the horizontal transfer of the entire nif gene cluster.

  3. Plasmid-mediated tetracycline resistance in Haemophilus ducreyi.

    OpenAIRE

    Albritton, W L; Maclean, I W; Slaney, L A; Ronald, A. R.; Deneer, H G

    1984-01-01

    Clinical isolates of Haemophilus ducreyi were shown to be resistant to tetracycline. Resistance was associated in some strains with a 30-megadalton plasmid capable of transferring resistance in conjugative matings with other strains of H. ducreyi and other species of Haemophilus. Restriction endonuclease digestion patterns suggest a relationship between H. ducreyi plasmids and other tetracycline resistance plasmids in Haemophilus. The presence of plasmid-mediated resistance to the tetracyclin...

  4. Arthrobacter luteus restriction endonuclease cleavage map of X174 RF DNA

    NARCIS (Netherlands)

    Vereijken, J.M.; Mansfeld, A.D.M. van; Baas, P.D.; Jansz, H.S.

    1975-01-01

    Cleavage of X174 RF DNA with the restriction endonuclease from Arthrobacter luteus (Alu I) produces 23 fragments of approximately 24–1100 base pairs in length. The order of most of these fragments has been established by digestion of Haemophilus influenzae Rd (Hind II) and Haemophilus aegyptius (Hae

  5. Solving large double digestion problems for DNA restriction mapping by using branch-and-bound integer linear programming.

    Science.gov (United States)

    Wu, Z; Zhang, Y

    2008-01-01

    The double digestion problem for DNA restriction mapping has been proved to be NP-complete and intractable if the numbers of the DNA fragments become large. Several approaches to the problem have been tested and proved to be effective only for small problems. In this paper, we formulate the problem as a mixed-integer linear program (MIP) by following (Waterman, 1995) in a slightly different form. With this formulation and using state-of-the-art integer programming techniques, we can solve randomly generated problems whose search space sizes are many-magnitude larger than previously reported testing sizes.

  6. Physical mapping of BK virus DNA with SacI, MboII, and AluI restriction endonucleases.

    Science.gov (United States)

    Yang, R C; Wu, R

    1978-12-01

    A new restriction endonuclease, SacI from Streptomyces achromogenes cleaves BK virus (strain MM) DNA into 3 fragments, whereas MboII from Moraxella bovis and AluI from Arthrobacter luteus give 22 and 30 fragments, respectively. All these specific DNA fragments were ordered and mapped on the viral genome by two methods first, by the reciprocal digestion method using uniformly 32P-labeled DNA; and second, by the partial digestion technique using the single-end 32P-labeled DNA. This study, together with those reported earlier, defined the location of 90 cleavage sites on the BK virus DNA.

  7. Genetic mapping and QTL analysis of growth-related traits in Pinctada fucata using restriction-site associated DNA sequencing.

    Directory of Open Access Journals (Sweden)

    Yaoguo Li

    Full Text Available The pearl oyster, Pinctada fucata (P. fucata, is one of the marine bivalves that is predominantly cultured for pearl production. To obtain more genetic information for breeding purposes, we constructed a high-density linkage map of P. fucata and identified quantitative trait loci (QTL for growth-related traits. One F1 family, which included the two parents, 48 largest progeny and 50 smallest progeny, was sampled to construct a linkage map using restriction site-associated DNA sequencing (RAD-Seq. With low coverage data, 1956.53 million clean reads and 86,342 candidate RAD loci were generated. A total of 1373 segregating SNPs were used to construct a sex-average linkage map. This spanned 1091.81 centimorgans (cM, with 14 linkage groups and an average marker interval of 1.41 cM. The genetic linkage map coverage, Coa, was 97.24%. Thirty-nine QTL-peak loci, for seven growth-related traits, were identified using the single-marker analysis, nonparametric mapping Kruskal-Wallis (KW test. Parameters included three for shell height, six for shell length, five for shell width, four for hinge length, 11 for total weight, eight for soft tissue weight and two for shell weight. The QTL peak loci for shell height, shell length and shell weight were all located in linkage group 6. The genotype frequencies of most QTL peak loci showed significant differences between the large subpopulation and the small subpopulation (P<0.05. These results highlight the effectiveness of RAD-Seq as a tool for generation of QTL-targeted and genome-wide marker data in the non-model animal, P. fucata, and its possible utility in marker-assisted selection (MAS.

  8. Plasmid typing of Shigella sonnei epidemic strains and molecular relationship of their R-plasmids.

    Science.gov (United States)

    Mendoza, M C; Gonzalez, A J; Mendez, F J; Hardisson, C

    1988-06-01

    We conducted a surveillance program on epidemic and/or endemic Shigella strains in Asturias (Spain), their frequency and dispersion in our community, and their R-plasmids. We analyzed initial isolates of Shigella sonnei from two epidemic outbreaks using antibiotic resistance patterns and plasmid profile analysis as epidemiological markers. We found that the 2 outbreaks were caused by different S. sonnei strains, which respectively carried one and two R-plasmids together with other plasmids. The molecular relationship among these and three other R-plasmids from two S. sonnei strains isolated during a previous outbreak, were studied by restriction enzyme analysis and DNA-DNA hybridizations. We were able to establish different levels of relationship among the six R-plasmids.

  9. Physical mapping of the restriction fragments obtained from bacteriophage T4 dC-DNA with the restriction endonucleases SmaI, KpnI and BglII.

    Science.gov (United States)

    Kiko, H; Niggemann, E; Rüger, W

    1979-01-01

    The cytosine-containing DNA of a mutant of bacteriophage T4 was digested with restriction endonucleases SmaI, KpnI and BglII producing 5, 7 and 13 fragments respectively. Complete physical maps of the T4 genome were constructed with the enzymes SmaI and KpnI and an almost complete map with the enzyme BglII.

  10. THE OCCURRENCE OF PLASMID DNA IN CAMPYLOBACTER JEJUNI AND CAMPYLOBACTER COLI AND ANALYSIS OF RESTRICTION ENDONUCLEASE%空肠弯曲菌质粒的提取鉴定和限制性内切酶水解片段的分析

    Institute of Scientific and Technical Information of China (English)

    孙自捷; 宋后燕; 段恕诚

    1988-01-01

    Thirty-two strains of different serotypes and biotypes of Campylobaoter jejuni and Campylobacter coli isolated from the stool of children and domestic animals were examined for the presence of plasmid DNA Agarose gel electrophoresis of alkaline-extracted DNA showed the occurrence of plasmid bands in 12 strains.Ten of them showed only one plasmid band in>28Kb area of gel,and 7 strains contained this plasmid were further analyzed by restriction endonuclease Hind Ⅲ.All restriction fragments showed heterogeneity.Other 2 of the 12 strains from domestic animals were observed and 3 and 4 plasmid bands were demonstrated in agarose gel respectively.The incidenoe of plasmid in Campylobacter jejuni strains was similar to Campylobacter coli,while the incidence of plasmid in Campylobacter strains from the stool of domestic animals was higher than in children.%使用修改的Brruboim快速碱抽提法,对32株来源不同,和不同血清型和生物型空肠弯曲菌株进行了质粒DNA检测和分析.12株细菌的质粒抽提液在琼脂糖电泳上显示有质粒带,其中10株均仅含有一条>23Kb的质粒,同时7株用限制性内切酶Hind Ⅲ消化后水解片段分析发现这一条>23Kb的质粒为非同源性.其他2株细菌在琼脂糖电泳上显示3和4条质粒带.不同生物型空肠弯曲菌的质粒携带率基本相同,而从家禽分离的空肠弯曲菌株比从儿童分离的菌株质粒携带率要高.

  11. Mapping with RAD (restriction-site associated DNA) markers to rapidly identify QTL for stem rust resistance in Lolium perenne.

    Science.gov (United States)

    Pfender, W F; Saha, M C; Johnson, E A; Slabaugh, M B

    2011-05-01

    A mapping population was created to detect quantitative trait loci (QTL) for resistance to stem rust caused by Puccinia graminis subsp. graminicola in Lolium perenne. A susceptible and a resistant plant were crossed to produce a pseudo-testcross population of 193 F(1) individuals. Markers were produced by the restriction-site associated DNA (RAD) process, which uses massively parallel and multiplexed sequencing of reduced-representation libraries. Additional simple sequence repeat (SSR) and sequence-tagged site (STS) markers were combined with the RAD markers to produce maps for the female (738 cM) and male (721 cM) parents. Stem rust phenotypes (number of pustules per plant) were determined in replicated greenhouse trials by inoculation with a field-collected, genetically heterogeneous population of urediniospores. The F(1) progeny displayed continuous distribution of phenotypes and transgressive segregation. We detected three resistance QTL. The most prominent QTL (qLpPg1) is located near 41 cM on linkage group (LG) 7 with a 2-LOD interval of 8 cM, and accounts for 30-38% of the stem rust phenotypic variance. QTL were detected also on LG1 (qLpPg2) and LG6 (qLpPg3), each accounting for approximately 10% of phenotypic variance. Alleles of loci closely linked to these QTL originated from the resistant parent for qLpPg1 and from both parents for qLpPg2 and qLpPg3. Observed quantitative nature of the resistance may be due to partial-resistance effects against all pathogen genotypes, or qualitative effects completely preventing infection by only some genotypes in the genetically mixed inoculum. RAD markers facilitated rapid construction of new genetic maps in this outcrossing species and will enable development of sequence-based markers linked to stem rust resistance in L. perenne.

  12. Chemotherapy of Bacterial Plasmids

    Science.gov (United States)

    1979-01-29

    render them non-susceptible to K: z plasmid-encoded enzymes. (3) Development of drugs which are selective inhibitor! 1 4, of plasmid DNA replication. (4... Development of drugs which inhibit phenotypic as expression of plasmid genes, and (5) Development of drugs which are inhibitors o, drug-inactivating...Barnes [2] them non-susceptible to plasmid-encoded enzymes, tabulated data on the incidence of Gram-negative 3) development of drugs which are

  13. Plasmid segregation mechanisms

    DEFF Research Database (Denmark)

    Ebersbach, Gitte; Gerdes, Kenn; Charbon, Gitte Ebersbach

    2005-01-01

    Bacterial plasmids encode partitioning (par) loci that ensure ordered plasmid segregation prior to cell division. par loci come in two types: those that encode actin-like ATPases and those that encode deviant Walker-type ATPases. ParM, the actin-like ATPase of plasmid R1, forms dynamic filaments ...

  14. Physical structure and genetic expression of the sulfonamide-resistance plasmid pLS80 and its derivatives in Streptococcus pneumoniae and Bacillus subtilis

    Energy Technology Data Exchange (ETDEWEB)

    Lopez, P.; Espinosa, M.; Lacks, S.A.

    1984-01-01

    The 10-kb chromosomal fragment of Streptococcus pneumoniae cloned in pLS80 contains the sul-d allele of the pneumococcal gene for dihydropteroate synthase. As a single copy in the chromosome this allele confers resistance to sulfanilamide at 0.2 mg/ml; in the multicopy plasmid it confers resistance to 2.0 mg/ml. The sul-d mutation was mapped by restriction analysis to a 0.4-kb region. A spontaneous deletion beginning approx. 1.5 kb to the right of the sul-d mutation prevented gene function, possibly by removing a promoter. This region could be restored by chromosomal facilitation and be demonstrated in the plasmid by selection for sulfonamide resistance. Under selection for a vector marker, tetracycline resistance, only the deleted plasmid was detectable, apparently as a result of plasmid segregation and the advantageous growth rates of cells with smaller plasmids. When such cells were selected for sulfonamide resistance, the deleted region returned to the plasmid, presumably by equilibration between the chromosome and the plasmid pool, to give a low frequency (approx. 10/sup -3/) of cells resistant to sulfanilamide at 2.0 mg/ml. Models for the mechanisms of chromosomal facilitation and equilibration are proposed. Several derivatives of pLS80 could be transferred to Bacillus subtilis, where they conferred resistance to sulfanilamide at 2 mg/ml, thereby demonstrating cross-species expression of the pneumococcal gene. Transfer of the plasmids to B. subtilis gave rise to large deletions to the left of the sul-d marker, but these deletions did not interfere with the sul-d gene function. Restriction maps of pLS80 and its variously deleted derivatives are presented.

  15. Bacteriophage selection against a plasmid-encoded sex apparatus leads to the loss of antibiotic-resistance plasmids.

    Science.gov (United States)

    Jalasvuori, Matti; Friman, Ville-Petri; Nieminen, Anne; Bamford, Jaana K H; Buckling, Angus

    2011-12-23

    Antibiotic-resistance genes are often carried by conjugative plasmids, which spread within and between bacterial species. It has long been recognized that some viruses of bacteria (bacteriophage; phage) have evolved to infect and kill plasmid-harbouring cells. This raises a question: can phages cause the loss of plasmid-associated antibiotic resistance by selecting for plasmid-free bacteria, or can bacteria or plasmids evolve resistance to phages in other ways? Here, we show that multiple antibiotic-resistance genes containing plasmids are stably maintained in both Escherichia coli and Salmonella enterica in the absence of phages, while plasmid-dependent phage PRD1 causes a dramatic reduction in the frequency of antibiotic-resistant bacteria. The loss of antibiotic resistance in cells initially harbouring RP4 plasmid was shown to result from evolution of phage resistance where bacterial cells expelled their plasmid (and hence the suitable receptor for phages). Phages also selected for a low frequency of plasmid-containing, phage-resistant bacteria, presumably as a result of modification of the plasmid-encoded receptor. However, these double-resistant mutants had a growth cost compared with phage-resistant but antibiotic-susceptible mutants and were unable to conjugate. These results suggest that bacteriophages could play a significant role in restricting the spread of plasmid-encoded antibiotic resistance.

  16. Examination of uropathogenic Escherichia coli strains conferring large plasmids

    Directory of Open Access Journals (Sweden)

    SUHARTONO

    2010-04-01

    Full Text Available Suhartono (2010 Examination of uropathogenic Escherichia coli strains conferring large plasmids. Biodiversitas 11: 59-64. Of major uropathogens, Escherichia coli has been widely known as a main pathogen of UTIs globally and has considerable medical and financial consequences. A strain of UPEC, namely E. coli ST131, confers a large plasmid encoding cephalosporinases (class C β-lactamase or AmpC that may be disseminated through horizontal transfer among bacterial populations. Therefore, it is worth examining such large plasmids by isolating, purifying, and digesting the plasmid with restriction enzymes. The examination of the large plasmids was conducted by isolating plasmid DNA visualized by agarose gel electrophoresis as well as by PFGE. The relationship of plasmids among isolates was carried out by HpaI restriction enzyme digestion. Of 36 isolates of E. coli ST 131, eight isolates possessed large plasmids, namely isolates 3, 9, 10, 12, 17, 18, 26 and 30 with the largest molecular size confirmed by agarose gel electrophoresis and PFGE was ~42kb and ~118kb respectively. Restriction enzyme analysis revealed that isolates 9, 10, 12, 17 and 18 have the common restriction patterns and those isolates might be closely related.

  17. PLASMID PROFILES AND PHAGE TYPES OF SALMONELLA-TYPHIMURIUM ISOLATED FROM SUCCESSIVE FLOCKS OF CHICKENS ON 3 PARENT STOCK FARMS

    DEFF Research Database (Denmark)

    Baggesen, Dorte Lau; Olsen, J. E.; Bisgaard, M.

    1992-01-01

    for restriction enzyme analysis and colony hybridization. The main phage type on each of the three farms was 110. Plasmid profiling, however, allowed further subtyping. All but three isolates carried the serotype-specific virulence-associated plasmid. Restriction enzyme analysis showed variations in this plasmid...

  18. Transformation of Haemophilus influenzae by plasmid RSF0885

    Energy Technology Data Exchange (ETDEWEB)

    Notani, N.K.; Setlow, J.K.; McCarthy, D.; Clayton, N.L.

    1981-12-01

    Plasmid RSF0885, which conferred ampicillin resistance, transformed competent Haemophilus influenzae cells with low efficiency (maximun, less than 0.01%). As judged by competition experiments and uptake of radioactivity, plasmid RSF0885 deoxyribonucleic acid was taken up into competent H. influenzae cells several orders of magnitude less efficiently than H. influenzae chromosomal deoxyribonucleic acid. Plasmid RSF0885 transformed cells with even lower efficiency than could be accounted for by the low uptake. Transformation was not affected by rec-1 and rec-2 mutations in the recipient, and strains cured of the plasmid did not show increased transformation. Plasmid molecules cut once with a restriction enzyme that made blunt ends did not transform. Transformation was favored by the closed circular form of the plasmid.

  19. Protein diversity confers specificity in plasmid segregation.

    Science.gov (United States)

    Fothergill, Timothy J G; Barillà, Daniela; Hayes, Finbarr

    2005-04-01

    The ParG segregation protein (8.6 kDa) of multidrug resistance plasmid TP228 is a homodimeric DNA-binding factor. The ParG dimer consists of intertwined C-terminal domains that adopt a ribbon-helix-helix architecture and a pair of flexible, unstructured N-terminal tails. A variety of plasmids possess partition loci with similar organizations to that of TP228, but instead of ParG homologs, these plasmids specify a diversity of unrelated, but similarly sized, partition proteins. These include the proteobacterial pTAR, pVT745, and pB171 plasmids. The ParG analogs of these plasmids were characterized in parallel with the ParG homolog encoded by the pseudomonal plasmid pVS1. Like ParG, the four proteins are dimeric. No heterodimerization was detectable in vivo among the proteins nor with the prototypical ParG protein, suggesting that monomer-monomer interactions are specific among the five proteins. Nevertheless, as with ParG, the ParG analogs all possess significant amounts of unordered amino acid residues, potentially highlighting a common structural link among the proteins. Furthermore, the ParG analogs bind specifically to the DNA regions located upstream of their homologous parF-like genes. These nucleoprotein interactions are largely restricted to cognate protein-DNA pairs. The results reveal that the partition complexes of these and related plasmids have recruited disparate DNA-binding factors that provide a layer of specificity to the macromolecular interactions that mediate plasmid segregation.

  20. Characterization of a novel type of MLSB resistance plasmid from Staphylococcus saprophyticus carrying a constitutively expressed erm(C) gene.

    Science.gov (United States)

    Hauschild, Tomasz; Lüthje, Petra; Schwarz, Stefan

    2006-06-15

    An erm(C)-carrying plasmid of unusual size and restriction map, designated pSES22, was identified in a Staphylococcus saprophyticus strain and sequenced completely. Constitutive expression of the erm(C) gene from pSES22 is based on a novel 22-bp tandem duplication in the erm(C) translational attenuator. Comparative analysis of the deduced Erm(C) amino acid sequence revealed that Erm(C) from pSES22 - together with an Erm(C) methylase from S. hyicus - represented a separate branch in the homology tree of Erm(C) methylases. Structural comparisons showed that plasmid pSES22 differed distinctly from all other completely sequenced erm(C)-carrying resistance plasmids. However, pSES22 was similar to several members of a diverse group of small plasmids, all of which carried closely related plasmid backbones consisting of the genes repU and pre/mob, but differed in their resistance genes.

  1. The map-1 gene family in root-knot nematodes, Meloidogyne spp.: a set of taxonomically restricted genes specific to clonal species.

    Directory of Open Access Journals (Sweden)

    Iva Tomalova

    Full Text Available Taxonomically restricted genes (TRGs, i.e., genes that are restricted to a limited subset of phylogenetically related organisms, may be important in adaptation. In parasitic organisms, TRG-encoded proteins are possible determinants of the specificity of host-parasite interactions. In the root-knot nematode (RKN Meloidogyne incognita, the map-1 gene family encodes expansin-like proteins that are secreted into plant tissues during parasitism, thought to act as effectors to promote successful root infection. MAP-1 proteins exhibit a modular architecture, with variable number and arrangement of 58 and 13-aa domains in their central part. Here, we address the evolutionary origins of this gene family using a combination of bioinformatics and molecular biology approaches. Map-1 genes were solely identified in one single member of the phylum Nematoda, i.e., the genus Meloidogyne, and not detected in any other nematode, thus indicating that the map-1 gene family is indeed a TRG family. A phylogenetic analysis of the distribution of map-1 genes in RKNs further showed that these genes are specifically present in species that reproduce by mitotic parthenogenesis, with the exception of M. floridensis, and could not be detected in RKNs reproducing by either meiotic parthenogenesis or amphimixis. These results highlight the divergence between mitotic and meiotic RKN species as a critical transition in the evolutionary history of these parasites. Analysis of the sequence conservation and organization of repeated domains in map-1 genes suggests that gene duplication(s together with domain loss/duplication have contributed to the evolution of the map-1 family, and that some strong selection mechanism may be acting upon these genes to maintain their functional role(s in the specificity of the plant-RKN interactions.

  2. CARTOGRAPHIE DU PLASMIDE pSU100, PLASMIDE CRYPTIQUE DE LACTOBACILLUS CASEI

    Directory of Open Access Journals (Sweden)

    F BENSALAH

    2003-06-01

    Ce plasmide appelé pSU100 a été cloné dans le vecteur de transformation pUC18 au site EcoRI chez E. coli JM103. Les profils électrophorétiques de restriction obtenus par des digestions simples, doubles et triples sous l’action de 33 endonucléases, ont contribué à l’élaboration d’une carte de restriction de ce plasmide. Cinq sites uniques ont été identifiés, ainsi que d’autres sites doubles et multiples. Une étude préliminaire du rôle physiologique de ce plasmide a permis de déceler une résistance à la kanamycine.

  3. Chlamydial plasmids and bacteriophages.

    Science.gov (United States)

    Pawlikowska-Warych, Małgorzata; Śliwa-Dominiak, Joanna; Deptuła, Wiesław

    2015-01-01

    Chlamydia are absolute pathogens of humans and animals; despite being rather well recognised, they are still open for discovery. One such discovery is the occurrence of extrachromosomal carriers of genetic information. In prokaryotes, such carriers include plasmids and bacteriophages, which are present only among some Chlamydia species. Plasmids were found exclusively in Chlamydia (C.) trachomatis, C. psittaci, C. pneumoniae, C. suis, C. felis, C. muridarum and C. caviae. In prokaryotic organisms, plasmids usually code for genes that facilitate survival of the bacteria in the environment (although they are not essential). In chlamydia, their role has not been definitely recognised, apart from the fact that they participate in the synthesis of glycogen and encode proteins responsible for their virulence. Furthermore, in C. suis it was evidenced that the plasmid is integrated in a genomic island and contains the tetracycline-resistance gene. Bacteriophages specific for chlamydia (chlamydiaphages) were detected only in six species: C. psittaci, C. abortus, C. felis, C. caviae C. pecorum and C. pneumoniae. These chlamydiaphages cause inhibition of the developmental cycle, and delay transformation of reticulate bodies (RBs) into elementary bodies (EBs), thus reducing the possibility of infecting other cells in time. Plasmids and bacteriophages can be used in the diagnostics of chlamydioses; although especially in the case of plasmids, they are already used for detection of chlamydial infections. In addition, bacteriophages could be used as therapeutic agents to replace antibiotics, potentially addressing the problem of increasing antibiotic-resistance among chlamydia.

  4. Effect of plasmid R391 and other IncJ plasmids on the survival of Escherichia coli after UV irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Pembroke, J.T.; Stevens, E. (University Coll., Galway (Ireland))

    1984-07-01

    The presence of the IncJ plasmids R391, R997, R705, R706, R748, and R749 was shown to sensitize Escherichia coli AB1157 and both its uvr A and lexA derivatives to UV irradiation. No alteration in post-irradiation survival was observed in a recA mutant containing these plasmids, compared with the non-plasmid-containing recA strain. Analysis of recombination frequency in Hfr crosses to recA/sup +/ cells containing plasmid R391 indicated a reduction in recombination frequency compared with that obtained in similar crosses to a non-plasmid-containing strain. This effect was not due to plasmid-encoded restriction or entry exclusion systems and therefore must be considered as a real block in recombination. When cells containing plasmid R391 were irradiated and allowed to photoreactivate, an increase in survival was observed which was comparable to that observed in the non-plasmid-containing derivative. This indicated that post-irradiation processing of UV-induced damage, or lack of such processing, by mechanisms other than photoreactivation was responsible for the UV sensitivity associated with plasmid R391.

  5. Construction and Identification of Plasmid pTA-TUB2

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    An about 1.40 Kb target gene fragment was yielded by PCR amplification with the plasmid pRB 129,which was identified by restriction enzyme digestion that the PCR product was TU B2 gene.The gene was digested by the restriction enzyme and was linked with pTA plasmid to construct pTA-TU B2 plasmid.The plasmid was transformed into Chaetomium spp.by PEG method and the transformation rate was 27/(2×105) and it is nine times higher than that of pRB 129.The transformants can grow on the PDA containing 1 000 μg*mL-1 carbendazim,which is 1 000 times higher than the original Chaetomium spp.The resistance was stable after 10 times transfer on non-selective medium.

  6. [A novel Salmonella Typhimurium plasmid, pAnkS: an example for plasmid evolution in antibiotic resistance].

    Science.gov (United States)

    Sahin, Fikret; Karasartova, Djursun; Gerçeker, Devran; Aysev, A Derya; Erdem, Birsel

    2008-07-01

    In this study, a plasmid, carrying ampicillin resistance (ampR) gene, isolated from a clinical isolate of Salmonella enterica serotype Typhimurium presenting ACSSuT (ampicilin, chloramphenicol, streptomycin, sulphonamide, tetracycline) resistance phenotype, was defined. The length of complete sequence of this plasmid was 8271 base pairs (bp), and it was named as pAnkS owing to its isolation place (plasmid-Ankara- Salmonella). The plasmid was analyzed for potential reading frames and structural features indicative of transposons and transposon relics. The Xmnl enzyme restriction fragments of pAnkS were cloned into E. coli plasmid vectors (pBSK), sequenced and analyzed with the BLAST programs. Plasmid pAnkS has contained a previously defined enterohemorrhagic E. coli (EHEC) plasmid p4821 as a core region and also contained a complete Tn3-like transposon of 4950 bp consisting of the left terminal repeat, Tn3-related tnpR and tnpA genes for transposition functions, ampicillin resistance gene bla(TEM), and the right terminal repeats, pAnkS showed strong homology with another Salmonella plasmid, pNTP16, for sequences that belong to p4821 and partial Tn3 segments. It was found that pNTP16 also carries kanamycin resistance gene (kanR) in addition to ampR gene. Plasmid pAnkS is one of the few completely sequenced plasmids from Salmonella Typhimurium and is in the middle of the pathway of evolution of plasmid from p4821 to pNTP16. The identification of pAnkS might help better understanding of plasmid evolution.

  7. Broad host range plasmid-based gene transfer system in the cyanobacterium Gloeobacter violaceus which lacks thylakoids

    Institute of Scientific and Technical Information of China (English)

    GUO Haitao; XU Xudong

    2004-01-01

    Gloeobacter violaceus, a cyanobacterium lack of thylakoids, is refractory to genetic manipulations because its cells are enveloped by a thick gelatinous sheath and in colonial form.In this study, a large number of single cells were obtained by repeated pumping with a syringe with the gelatinous sheath removed.And an exogenous broad host range plasmid pKT210 was conjugatively transferred into G.violaceus.Analyses with dot-blot hybridization and restriction mapping showed that the exogenous plasmid pKT210 had been introduced into G.violaceus and stably maintained with no alteration in its structure.pKT210 extracted from G.violaceus exconjugants could be transformed into the mcr- mrr- E.coli strain DH10B but not the mcr+ mrr+ strain DH5α, which suggests that a methylase system may be present in G.violaceus.

  8. Mechanisms of plasmid segregation: have multicopy plasmids been overlooked?

    Science.gov (United States)

    Million-Weaver, Samuel; Camps, Manel

    2014-09-01

    Plasmids are self-replicating pieces of DNA typically bearing non-essential genes. Given that plasmids represent a metabolic burden to the host, mechanisms ensuring plasmid transmission to daughter cells are critical for their stable maintenance in the population. Here we review these mechanisms, focusing on two active partition strategies common to low-copy plasmids: par systems type I and type II. Both involve three components: an adaptor protein, a motor protein, and a centromere, which is a sequence area in the plasmid that is recognized by the adaptor protein. The centromere-bound adaptor nucleates polymerization of the motor, leading to filament formation, which can pull plasmids apart (par I) or push them towards opposite poles of the cell (par II). No such active partition mechanisms are known to occur in high copy number plasmids. In this case, vertical transmission is generally considered stochastic, due to the random distribution of plasmids in the cytoplasm. We discuss conceptual and experimental lines of evidence questioning the random distribution model and posit the existence of a mechanism for segregation in high copy number plasmids that moves plasmids to cell poles to facilitate transmission to daughter cells. This mechanism would involve chromosomally-encoded proteins and the plasmid origin of replication. Modulation of this proposed mechanism of segregation could provide new ways to enhance plasmid stability in the context of recombinant gene expression, which is limiting for large-scale protein production and for bioremediation.

  9. Plasmid-to-plasmid recombination in Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    Balganesh, M.; Setlow, J.K.

    1986-01-01

    No recombination between plasmids was observed after conjugal transfer of a plasmid into a cell carrying another plasmid. Two types of such recombination took place after transformation, one type being Rec/sup +/ dependent and suggesting a preferred site of recombination. The other much rarer type was at least partially Rec/sup +/ independent.

  10. Plasmid interference for curing antibiotic resistance plasmids in vivo.

    Science.gov (United States)

    Kamruzzaman, Muhammad; Shoma, Shereen; Thomas, Christopher M; Partridge, Sally R; Iredell, Jonathan R

    2017-01-01

    Antibiotic resistance increases the likelihood of death from infection by common pathogens such as Escherichia coli and Klebsiella pneumoniae in developed and developing countries alike. Most important modern antibiotic resistance genes spread between such species on self-transmissible (conjugative) plasmids. These plasmids are traditionally grouped on the basis of replicon incompatibility (Inc), which prevents coexistence of related plasmids in the same cell. These plasmids also use post-segregational killing ('addiction') systems, which poison any bacterial cells that lose the addictive plasmid, to guarantee their own survival. This study demonstrates that plasmid incompatibilities and addiction systems can be exploited to achieve the safe and complete eradication of antibiotic resistance from bacteria in vitro and in the mouse gut. Conjugative 'interference plasmids' were constructed by specifically deleting toxin and antibiotic resistance genes from target plasmids. These interference plasmids efficiently cured the corresponding antibiotic resistant target plasmid from different Enterobacteriaceae in vitro and restored antibiotic susceptibility in vivo to all bacterial populations into which plasmid-mediated resistance had spread. This approach might allow eradication of emergent or established populations of resistance plasmids in individuals at risk of severe sepsis, enabling subsequent use of less toxic and/or more effective antibiotics than would otherwise be possible, if sepsis develops. The generalisability of this approach and its potential applications in bioremediation of animal and environmental microbiomes should now be systematically explored.

  11. Molecular cloning with bifunctional plasmid vectors in Bacillus subtilis: isolation of a spontaneous mutant of Bacillus subtilis with enhanced transformability for Escherichia coli-propagated chimeric plasmid DNA.

    OpenAIRE

    Ostroff, G. R.; Pène, J. J.

    1983-01-01

    Hybrid plasmid DNA cloned in Escherichia coli undergoes deletions when returned to competent Bacillus subtilis, even in defined restriction and modification mutants of strain 168. We have isolated a mutant of B. subtilis MI112 which is stably transformed at high frequency by chimeric plasmid DNA propagated in E. coli.

  12. Bacillus stearothermophilus contains a plasmid-borne gene for alpha-amylase.

    Science.gov (United States)

    Mielenz, J R

    1983-01-01

    The gene for thermostable alpha-amylase from the thermophilic bacterium Bacillus stearothermophilus has been cloned and expressed in Escherichia coli. Each alpha-amylase-producing colony contained at least a 9.7-kilobase-pair (kb) chimeric plasmid composed of the vector pBR322 and a common 5.4-kb HindIII fragment of DNA. B. stearothermophilus contains four plasmids with sizes from 12 kb to over 108 kb. Restriction endonuclease analysis of these naturally occurring plasmids showed they also contain a 5.4-kb HindIII fragment of DNA. Cloning experiments with the four plasmids yielded alpha-amylase-producing E. coli that contained the same 9.7-kb chimeric plasmid. Restriction endonuclease analysis and further recombinant DNA experiments identified a 26-kb plasmid that contains the gene for alpha-amylase. A spontaneous mutant of B. stearothermophilus unable to produce alpha-amylase was missing the 26-kb plasmid but contained a 20-kb plasmid. A 6-kb deletion within the region of the 5.4-kb HindIII fragment yielded the 20-kb plasmid unable to code for alpha-amylase. A nick-translated probe for the alpha-amylase coding region did not hybridize to either plasmid or total cellular DNA from this mutant strain of B. stearothermophilus. These results demonstrate the gene for alpha-amylase is located exclusively on a 26-kb plasmid in B. stearothermophilus with no genetic counterpart present on the chromosome. Images PMID:6193526

  13. Long-range restriction map of the terminal part of the short arm of the human X chromosome

    Energy Technology Data Exchange (ETDEWEB)

    Petit, C.; Levilliers, J.; Weissenbach, J. (Institut Pasteur, Paris (France))

    1990-05-01

    The terminal part of the short arm of the human X chromosome has been mapped by pulsed-field gel electrophoresis (PFGE). The map, representing the distal two-thirds of Xp22.3 spans a total of 10,000 kilobases (kb) from Xpter to the DXS143 locus. A comparison with linkage data indicates that 1 centimorgan (cM) in this region corresponds to about 600 kb. CpG islands were essentially concentrated in the 1,500 kb immediately proximal to the pseudoautosomal boundary. Several loci, including the gene encoding steroid sulfatase (STS) and the loci for the X-linked recessive form of chondrodysplasia punctata (CDPX) and for Kallmann syndrome (KAL) have been placed relative to the Xp telomere. CDPX is located between 2,650 and 5,550 kb from Xpter, and STS is located between 7,250 and 7,830 kb from Xpter. KAL maps to an interval of 350 kb between 8,600 and 8,950 kb from the telomere. The X-chromosomal breakpoints of a high proportion of XX males resulting from X-Y interchange cluster to a 920-kb region proximal and close to the pseudoautosomal boundary.

  14. Plasmid interference for curing antibiotic resistance plasmids in vivo

    Science.gov (United States)

    Kamruzzaman, Muhammad; Shoma, Shereen; Thomas, Christopher M.; Partridge, Sally R.

    2017-01-01

    Antibiotic resistance increases the likelihood of death from infection by common pathogens such as Escherichia coli and Klebsiella pneumoniae in developed and developing countries alike. Most important modern antibiotic resistance genes spread between such species on self-transmissible (conjugative) plasmids. These plasmids are traditionally grouped on the basis of replicon incompatibility (Inc), which prevents coexistence of related plasmids in the same cell. These plasmids also use post-segregational killing (‘addiction’) systems, which poison any bacterial cells that lose the addictive plasmid, to guarantee their own survival. This study demonstrates that plasmid incompatibilities and addiction systems can be exploited to achieve the safe and complete eradication of antibiotic resistance from bacteria in vitro and in the mouse gut. Conjugative ‘interference plasmids’ were constructed by specifically deleting toxin and antibiotic resistance genes from target plasmids. These interference plasmids efficiently cured the corresponding antibiotic resistant target plasmid from different Enterobacteriaceae in vitro and restored antibiotic susceptibility in vivo to all bacterial populations into which plasmid-mediated resistance had spread. This approach might allow eradication of emergent or established populations of resistance plasmids in individuals at risk of severe sepsis, enabling subsequent use of less toxic and/or more effective antibiotics than would otherwise be possible, if sepsis develops. The generalisability of this approach and its potential applications in bioremediation of animal and environmental microbiomes should now be systematically explored. PMID:28245276

  15. Brazilian purpuric fever caused by Haemophilus influenzae biogroup aegyptius strains lacking the 3031 plasmid.

    Science.gov (United States)

    Tondella, M L; Quinn, F D; Perkins, B A

    1995-01-01

    Brazilian purpuric fever (BPF) is a life-threatening pediatric infection caused by Haemophilus influenzae biogroup aegyptius (Hae), an organism formerly associated with only self-limited purulent conjunctivitis. Strains of Hae causing BPF have a 24-MDa plasmid with a specific AccI restriction pattern designated 3031. This plasmid was thought to code for a virulence factor because it had been detected only among Hae strains isolated from BPF cases or their contacts. From 3 typical BPF cases recently identified in São Paulo State, sterile-site Hae isolates were obtained; these isolates were similar to earlier BPF-associated Hae except they did not possess a 3031 plasmid. HindIII restricted chromosomal DNA from these strains was probed with purified 3031 plasmid DNA under high-stringency conditions. There was no evidence that 3031 plasmid DNA had become chromosomally integrated. It appears that the 3031 plasmid does not code for BPF-specific virulence factors.

  16. Restriction fragment length polymorphism mapping of quantitative trait loci for malaria parasite susceptibility in the mosquito Aedes aegypti

    Energy Technology Data Exchange (ETDEWEB)

    Severson, D.W.; Thathy, V.; Mori, A. [Univ. of Wisconsin, Madison, WI (United States)] [and others

    1995-04-01

    Susceptibility of the mosquito Aedes aegypti to the malarial parasite Plasmodium gallinaceum was investigated as a quantitative trait using restriction fragment length polymorphisms (RFLP). Two F{sub 2} populations of mosquitoes were independently prepared from pairwise matings between a highly susceptible and a refractory strain of A. aegypti. RFLP were tested for association with oocyst development on the mosquito midgut. Two putative quantitative trait loci (QTL) were identified that significantly affect susceptibility. One QTL, pgs [2,LF98], is located on chromosome 2 and accounted for 65 and 49% of the observed phenotypic variance in the two populations, respectively. A second QTL, pgs[3,MalI], is located on chromosome 3 and accounted for 14 and 10% of the observed phenotypic variance in the two populations, respectively. Both QTL exhibit a partial dominance effect on susceptibility, wherein the dominance effect is derived from the refractory parent. No indication of epistasis between these QTL was detected. Evidence suggests that either a tightly linked cluster of independent genes or a single locus affecting susceptibility to various mosquito-borne parasites and pathogens has evolved near the LF98 locus; in addition to P. gallinaceum susceptibility, this general genome region has previously been implicated in susceptibility to the filaria nematode Brugia malayi and the yellow fever virus. 35 refs., 2 figs., 3 tabs.

  17. Characterization of a unique methyl-specific restriction system in Streptomyces avermitilis.

    OpenAIRE

    1988-01-01

    Streptomyces avermitilis contains a unique restriction system that restricts plasmid DNA containing N6-methyladenine or 5-methylcytosine. Shuttle vectors isolated from Escherichia coli RR1 or plasmids isolated from modification-proficient Streptomyces spp. cannot be directly introduced into S. avermitilis. This restriction barrier can be overcome by first transferring plasmids into Streptomyces lividans or a modification-deficient E. coli strain and then into S. avermitilis. The transformatio...

  18. Persistence Mechanisms of Conjugative Plasmids

    DEFF Research Database (Denmark)

    Bahl, Martin Iain; Hansen, Lars H.; Sørensen, Søren Johannes

    2009-01-01

    Are plasmids selfish parasitic DNA molecules or an integrated part of the bacterial genome? This chapter reviews the current understanding of the persistence mechanisms of conjugative plasmids harbored by bacterial cells and populations. The diversity and intricacy of mechanisms affecting...... the successful propagation and long-term continued existence of these extra-chromosomal elements is extensive. Apart from the accessory genetic elements that may provide plasmid-harboring cells a selective advantage, special focus is placed on the mechanisms conjugative plasmids employ to ensure their stable...... maintenance in the host cell. These importantly include the ability to self-mobilize in a process termed conjugative transfer, which may occur across species barriers. Other plasmid stabilizing mechanisms include the multimer resolution system, active partitioning, and post-segregational-killing of plasmid...

  19. Toxin Plasmids of Clostridium perfringens

    Science.gov (United States)

    Li, Jihong; Adams, Vicki; Bannam, Trudi L.; Miyamoto, Kazuaki; Garcia, Jorge P.; Uzal, Francisco A.; Rood, Julian I.

    2013-01-01

    SUMMARY In both humans and animals, Clostridium perfringens is an important cause of histotoxic infections and diseases originating in the intestines, such as enteritis and enterotoxemia. The virulence of this Gram-positive, anaerobic bacterium is heavily dependent upon its prolific toxin-producing ability. Many of the ∼16 toxins produced by C. perfringens are encoded by large plasmids that range in size from ∼45 kb to ∼140 kb. These plasmid-encoded toxins are often closely associated with mobile elements. A C. perfringens strain can carry up to three different toxin plasmids, with a single plasmid carrying up to three distinct toxin genes. Molecular Koch's postulate analyses have established the importance of several plasmid-encoded toxins when C. perfringens disease strains cause enteritis or enterotoxemias. Many toxin plasmids are closely related, suggesting a common evolutionary origin. In particular, most toxin plasmids and some antibiotic resistance plasmids of C. perfringens share an ∼35-kb region containing a Tn916-related conjugation locus named tcp (transfer of clostridial plasmids). This tcp locus can mediate highly efficient conjugative transfer of these toxin or resistance plasmids. For example, conjugative transfer of a toxin plasmid from an infecting strain to C. perfringens normal intestinal flora strains may help to amplify and prolong an infection. Therefore, the presence of toxin genes on conjugative plasmids, particularly in association with insertion sequences that may mobilize these toxin genes, likely provides C. perfringens with considerable virulence plasticity and adaptability when it causes diseases originating in the gastrointestinal tract. PMID:23699255

  20. Construction of Recombinant Plasmid Containing S. Mutans F-ATPase β Subunit Gene

    Institute of Scientific and Technical Information of China (English)

    YU Dan-ni; JIANG Li

    2005-01-01

    objective: construct a homologous recombinant plasmid which was expected to be transformed into S. mutans Methods: a region at the 5' terminus of the S. mutans F-ATPase β subunit gene was amplified by PCR, the PCR product was inserted into vector pVA891, yielding recombinant plasmid. Results: the DNA sequence of the recombinant plasmid was identified correct in whole by restriction endonuclease and DNA sequence techniques. Conclusion: the recombinant plasmid of S. mutans DNA was cloned in effect ,it may assist in construction of homologues recombinant mutant.

  1. Conjugative plasmids of Neisseria gonorrhoeae.

    Directory of Open Access Journals (Sweden)

    Emilia Pachulec

    Full Text Available Many clinical isolates of the human pathogen Neisseria gonorrhoeae contain conjugative plasmids. The host range of these plasmids is limited to Neisseria species, but presence of a tetracycline (tetM determinant inserted in several of these plasmids is an important cause of the rapid spread of tetracycline resistance. Previously plasmids with different backbones (Dutch and American type backbones and with and without different tetM determinants (Dutch and American type tetM determinants have been identified. Within the isolates tested, all plasmids with American or Dutch type tetM determinants contained a Dutch type plasmid backbone. This demonstrated that tetM determinants should not be used to differentiate between conjugal plasmid backbones. The nucleotide sequences of conjugative plasmids with Dutch type plasmid backbones either not containing the tetM determinant (pEP5233 or containing Dutch (pEP5289 or American (pEP5050 type tetM determinants were determined. Analysis of the backbone sequences showed that they belong to a novel IncP1 subfamily divergent from the IncP1alpha, beta, gamma, delta and epsilon subfamilies. The tetM determinants were inserted in a genetic load region found in all these plasmids. Insertion was accompanied by the insertion of a gene with an unknown function, and rearrangement of a toxin/antitoxin gene cluster. The genetic load region contains two toxin/antitoxins of the Zeta/Epsilon toxin/antitoxin family previously only found in Gram positive organisms and the virulence associated protein D of the VapD/VapX toxin/antitoxin family. Remarkably, presence of VapX of pJD1, a small cryptic neisserial plasmid, in the acceptor strain strongly increased the conjugation efficiency, suggesting that it functions as an antitoxin for the conjugative plasmid. The presence of the toxin and antitoxin on different plasmids might explain why the host range of this IncP1 plasmid is limited to Neisseria species. The isolated plasmids

  2. Modular construction of plasmids by parallel assembly of linear vector components.

    Science.gov (United States)

    Gao, XinZheng; Yan, Pu; Shen, Wentao; Li, Xiaoying; Zhou, Peng; Li, Yuenan

    2013-06-15

    Construction of plasmids is the basic and pivotal technology in molecular biology. The common method for constructing plasmids is to cut DNA fragments by restriction enzymes and then join the resulting fragments using ligase. We present here a modified Golden Gate cloning method for modular construction of plasmids. Unlike the original Golden Gate cloning system for cloning from entry vector to expression vector, this method can be used to construct plasmids immediately from linear DNA fragments. After polymerase chain reaction (PCR) amplification for flanking with BsaI sites, multiple linear DNA components (modules) can be parallel assembled into a circle plasmid by a single restriction-ligation reaction using the method. This method is flexible to construct different types of plasmids because the modules can be freely selected and assembled in any combination. This method was applied successfully to construct a prokaryotic expression plasmid from four modules and a plant expression plasmid from five modules (fragments). The results suggest that this method provides a simple and flexible platform for modular construction of plasmids.

  3. Comparative characterization of the PvuRts1I family of restriction enzymes and their application in mapping genomic 5-hydroxymethylcytosine.

    Science.gov (United States)

    Wang, Hua; Guan, Shengxi; Quimby, Aine; Cohen-Karni, Devora; Pradhan, Sriharsa; Wilson, Geoffrey; Roberts, Richard J; Zhu, Zhenyu; Zheng, Yu

    2011-11-01

    PvuRts1I is a modification-dependent restriction endonuclease that recognizes 5-hydroxymethylcytosine (5hmC) as well as 5-glucosylhydroxymethylcytosine (5ghmC) in double-stranded DNA. Using PvuRts1I as the founding member, we define a family of homologous proteins with similar DNA modification-dependent recognition properties. At the sequence level, these proteins share a few uniquely conserved features. We show that these enzymes introduce a double-stranded cleavage at the 3'-side away from the recognized modified cytosine. The distances between the cleavage sites and the modified cytosine are fixed within a narrow range, with the majority being 11-13 nt away in the top strand and 9-10 nt away in the bottom strand. The recognition sites of these enzymes generally require two cytosines on opposite strand around the cleavage sites, i.e. 5'-CN(11-13)↓N(9-10)G-3'/3'-GN(9-10)↓N(11-13)C-5', with at least one cytosine being modified for efficient cleavage. As one potential application for these enzymes is to provide useful tools for selectively mapping 5hmC sites, we have compared the relative selectivity of a few PvuRts1I family members towards different forms of modified cytosines. Our results show that the inherently different relative selectivity towards modified cytosines can have practical implications for their application. By using AbaSDFI, a PvuRts1I homolog with the highest relative selectivity towards 5ghmC, to analyze rat brain DNA, we show it is feasible to map genomic 5hmC sites close to base resolution. Our study offers unique tools for determining more accurate hydroxymethylomes in mammalian cells.

  4. Phenotypic plasticity in bacterial plasmids.

    Science.gov (United States)

    Turner, Paul E

    2004-01-01

    Plasmid pB15 was previously shown to evolve increased horizontal (infectious) transfer at the expense of reduced vertical (intergenerational) transfer and vice versa, a key trade-off assumed in theories of parasite virulence. Whereas the models predict that susceptible host abundance should determine which mode of transfer is selectively favored, host density failed to mediate the trade-off in pB15. One possibility is that the plasmid's transfer deviates from the assumption that horizontal spread (conjugation) occurs in direct proportion to cell density. I tested this hypothesis using Escherichia coli/pB15 associations in laboratory serial culture. Contrary to most models of plasmid transfer kinetics, my data show that pB15 invades static (nonshaking) bacterial cultures only at intermediate densities. The results can be explained by phenotypic plasticity in traits governing plasmid transfer. As cells become more numerous, the plasmid's conjugative transfer unexpectedly declines, while the trade-off between transmission routes causes vertical transfer to increase. Thus, at intermediate densities the plasmid's horizontal transfer can offset selection against plasmid-bearing cells, but at high densities pB15 conjugates so poorly that it cannot invade. I discuss adaptive vs. nonadaptive causes for the phenotypic plasticity, as well as potential mechanisms that may lead to complex transfer dynamics of plasmids in liquid environments. PMID:15166133

  5. Plasmid Rolling-Circle Replication.

    Science.gov (United States)

    Ruiz-Masó, J A; MachóN, C; Bordanaba-Ruiseco, L; Espinosa, M; Coll, M; Del Solar, G

    2015-02-01

    Plasmids are DNA entities that undergo controlled replication independent of the chromosomal DNA, a crucial step that guarantees the prevalence of the plasmid in its host. DNA replication has to cope with the incapacity of the DNA polymerases to start de novo DNA synthesis, and different replication mechanisms offer diverse solutions to this problem. Rolling-circle replication (RCR) is a mechanism adopted by certain plasmids, among other genetic elements, that represents one of the simplest initiation strategies, that is, the nicking by a replication initiator protein on one parental strand to generate the primer for leading-strand initiation and a single priming site for lagging-strand synthesis. All RCR plasmid genomes consist of a number of basic elements: leading strand initiation and control, lagging strand origin, phenotypic determinants, and mobilization, generally in that order of frequency. RCR has been mainly characterized in Gram-positive bacterial plasmids, although it has also been described in Gram-negative bacterial or archaeal plasmids. Here we aim to provide an overview of the RCR plasmids' lifestyle, with emphasis on their characteristic traits, promiscuity, stability, utility as vectors, etc. While RCR is one of the best-characterized plasmid replication mechanisms, there are still many questions left unanswered, which will be pointed out along the way in this review.

  6. Strategies and approaches in plasmidome studies—uncovering plasmid diversity disregarding of linear elements?

    Science.gov (United States)

    Dib, Julián R.; Wagenknecht, Martin; Farías, María E.; Meinhardt, Friedhelm

    2015-01-01

    The term plasmid was originally coined for circular, extrachromosomal genetic elements. Today, plasmids are widely recognized not only as important factors facilitating genome restructuring but also as vehicles for the dissemination of beneficial characters within bacterial communities. Plasmid diversity has been uncovered by means of culture-dependent or -independent approaches, such as endogenous or exogenous plasmid isolation as well as PCR-based detection or transposon-aided capture, respectively. High-throughput-sequencing made possible to cover total plasmid populations in a given environment, i.e., the plasmidome, and allowed to address the quality and significance of self-replicating genetic elements. Since such efforts were and still are rather restricted to circular molecules, here we put equal emphasis on the linear plasmids which—despite their frequent occurrence in a large number of bacteria—are largely neglected in prevalent plasmidome conceptions. PMID:26074886

  7. Polymerase chain reaction-based gene removal from plasmids

    Directory of Open Access Journals (Sweden)

    Vishnu Vardhan Krishnamurthy

    2015-09-01

    Full Text Available This data article contains supplementary figures and methods to the research article entitled, “Multiplex gene removal by two-step polymerase chain reactions” (Krishnamurthy et al., Anal. Biochem., 2015, doi:http://dx.doi.org/10.1016/j.ab.2015.03.033, which presents a restriction-enzyme free method to remove multiple DNA segments from plasmids. Restriction-free cloning methods have dramatically improved the flexibility and speed of genetic manipulation compared to conventional assays based on restriction enzyme digestion (Lale and Valla, 2014. DNA Cloning and Assembly Methods, vol. 1116. Here, we show the basic scheme and characterize the success rate for single and multiplex gene removal from plasmids. In addition, we optimize experimental conditions, including the amount of template, multiple primers mixing, and buffers for DpnI treatment, used in the one-pot reaction for multiplex gene removal.

  8. Conjugation efficiency depends on intra and intercellular interactions between distinct plasmids: Plasmids promote the immigration of other plasmids but repress co-colonizing plasmids.

    Science.gov (United States)

    Gama, João Alves; Zilhão, Rita; Dionisio, Francisco

    2017-08-24

    Conjugative plasmids encode the genes responsible for the synthesis of conjugative pili and plasmid transfer. Expression of the conjugative machinery (including conjugative pili) may be costly to bacteria, not only due to the energetic/metabolic cost associated with their expression but also because they serve as receptors for certain viruses. Consequently, the presence of two plasmids in the same cell may be disadvantageous to each plasmid, because they may impose a higher fitness cost on the host. Therefore, plasmids may encode mechanisms to cope with co-resident plasmids. Moreover, it is possible that the transfer rate of a plasmid is affected by the presence of a distinct plasmid in the recipient cell. In this work, we measured transfer rates of twelve natural plasmids belonging to seven incompatibility groups in three situations, namely when: (i) donor cells contain a plasmid and recipient cells are plasmid-free; (ii) donor cells contain two unrelated plasmids and recipient cells are plasmid-free; and (iii) half of the cells contain a given plasmid and the other half contain another, unrelated, plasmid. In the third situation, recipient cells of a plasmid are the donor cells of the other plasmid. We show that there are more negative interactions (reduction of a plasmid's conjugative efficiency) between plasmids if they reside in the same cell than if they reside in different cells. However, if plasmids interacted intercellularly, the transfer rate of one of the plasmids was often higher (when the unrelated conjugative plasmid was present in the recipient cell) than if the recipient cell was plasmid-free - a positive effect. Experimental data retrieved from the study of mutant plasmids not expressing conjugative pili on the cell surface suggest that positive effects result from a higher efficiency of mating pair formation. Overall, our results suggest that negative interactions are significantly more frequent when plasmids occupy the same cell. Such

  9. New and Redesigned pRS Plasmid Shuttle Vectors for Genetic Manipulation of Saccharomycescerevisiae.

    Science.gov (United States)

    Chee, Mark K; Haase, Steven B

    2012-05-01

    We have constructed a set of 42 plasmid shuttle vectors based on the widely used pRS series for use in the budding yeast Saccharomyces cerevisiae and the bacterium Escherichia coli. This set of pRSII plasmids includes new shuttle vectors that can be used with histidine and adenine auxotrophic laboratory yeast strains carrying mutations in the genes HIS2 and ADE1, respectively. Our pRSII plasmids also include updated versions of commonly used pRS plasmids from which common restriction sites that occur within their yeast-selectable biosynthetic marker genes have been removed to increase the availability of unique restriction sites within their polylinker regions. Hence, our pRSII plasmids are a complete set of integrating, centromere and 2μ episomal plasmids with the biosynthetic marker genes ADE2, HIS3, TRP1, LEU2, URA3, HIS2, and ADE1 and a standardized selection of at least 16 unique restriction sites in their polylinkers. Additionally, we have expanded the range of drug selection options that can be used for PCR-mediated homologous replacement using pRS plasmid templates by replacing the G418-resistance kanMX4 cassette of pRS400 with MX4 cassettes encoding resistance to phleomycin, hygromycin B, nourseothricin, and bialaphos. Finally, in the process of generating the new plasmids, we have determined several errors in existing publicly available sequences for several commonly used yeast plasmids. Using our updated sequences, we constructed pRS plasmid backbones with a unique restriction site for inserting new markers to facilitate future expansion of the pRS series.

  10. Conservation of plasmids among Escherichia coli K1 isolates of diverse origins.

    Science.gov (United States)

    Mercer, A A; Morelli, G; Heuzenroeder, M; Kamke, M; Achtman, M

    1984-12-01

    Escherichia coli K1 isolates of various O types were previously assigned to different clonal groups. Members of the two clones defined by membrane pattern 9 (MP9) and serotypes O18:K1 and O1:K1 had been found to be very similar to each other. The plasmid contents of these bacteria confirmed this conclusion. Both groups carried a self-transmissible plasmid of the FI incompatibility group that coded for colicin production and a major outer membrane protein called the plasmid-coded protein (PCP). The size of this plasmid varied from 76 to 96 megadaltons, but restriction endonuclease digestion and DNA heteroduplex analysis revealed that these plasmids were highly related. O18:K1 bacteria of MP6 had previously been determined to represent a subclone, related to but different from O18:K1 MP9 bacteria. These MP6 bacteria carried a different, smaller IncFI plasmid which did not code for colicin production or the PCP protein. This smaller plasmid was primarily related to the larger plasmid within the regions of DNA encoding incompatibility, replication, and conjugation. O1:K1 bacteria of MP5 contained other unrelated plasmids in agreement with the previous conclusion that they are unrelated to O1:K1 bacteria of MP9. The bacteria examined had been isolated from two continents over a time span of 38 years, and the results attest to conservative inheritance of plasmids within bacteria of common descent.

  11. Conservation of plasmids among Escherichia coli K1 isolates of diverse origins.

    Science.gov (United States)

    Mercer, A A; Morelli, G; Heuzenroeder, M; Kamke, M; Achtman, M

    1984-01-01

    Escherichia coli K1 isolates of various O types were previously assigned to different clonal groups. Members of the two clones defined by membrane pattern 9 (MP9) and serotypes O18:K1 and O1:K1 had been found to be very similar to each other. The plasmid contents of these bacteria confirmed this conclusion. Both groups carried a self-transmissible plasmid of the FI incompatibility group that coded for colicin production and a major outer membrane protein called the plasmid-coded protein (PCP). The size of this plasmid varied from 76 to 96 megadaltons, but restriction endonuclease digestion and DNA heteroduplex analysis revealed that these plasmids were highly related. O18:K1 bacteria of MP6 had previously been determined to represent a subclone, related to but different from O18:K1 MP9 bacteria. These MP6 bacteria carried a different, smaller IncFI plasmid which did not code for colicin production or the PCP protein. This smaller plasmid was primarily related to the larger plasmid within the regions of DNA encoding incompatibility, replication, and conjugation. O1:K1 bacteria of MP5 contained other unrelated plasmids in agreement with the previous conclusion that they are unrelated to O1:K1 bacteria of MP9. The bacteria examined had been isolated from two continents over a time span of 38 years, and the results attest to conservative inheritance of plasmids within bacteria of common descent. Images PMID:6094355

  12. In Silico Detection and Typing of Plasmids using PlasmidFinder and Plasmid Multilocus Sequence Typing

    DEFF Research Database (Denmark)

    Carattoli, Alessandra; Zankari, Ea; García-Fernández, Aurora

    2014-01-01

    In the work presented here, we designed and developed two easy-to-use Web tools for in silico detection and characterization of whole-genome sequence (WGS) and whole-plasmid sequence data from members of the family Enterobacteriaceae. These tools will facilitate bacterial typing based on draft...... genomes of multidrug-resistant Enterobacteriaceae species by the rapid detection of known plasmid types. Replicon sequences from 559 fully sequenced plasmids associated with the family Enterobacteriaceae in the NCBI nucleotide database were collected to build a consensus database for integration...... sequences identified in the 559 fully sequenced plasmids. For plasmid multilocus sequence typing (pMLST) analysis, a database that is updated weekly was generated from www.pubmlst.org and integrated into a Web tool called pMLST. Both databases were evaluated using draft genomes from a collection...

  13. Restricted and quasi-toral restricted Lie-Rinehart algebras

    Directory of Open Access Journals (Sweden)

    Sun Bing

    2015-09-01

    Full Text Available In this paper, we introduce the definition of restrictable Lie-Rinehart algebras, the concept of restrictability is by far more tractable than that of a restricted Lie-Rinehart algebra. Moreover, we obtain some properties of p-mappings and restrictable Lie-Rinehart algebras. Finally, we give some sufficient conditions for the commutativity of quasi-toral restricted Lie-Rinehart algebras and study how a quasi-toral restricted Lie-Rinehart algebra with zero center and of minimal dimension should be.

  14. In vitro replication of plasmids containing human ribosomal gene sequences: origin localization and dependence on an aprotinin-binding cytosolic protein.

    Science.gov (United States)

    Coffman, F D; Georgoff, I; Fresa, K L; Sylvester, J; Gonzalez, I; Cohen, S

    1993-11-01

    We previously investigated the role of an aprotinin-binding protein (ADR) in the initiation of DNA replication in isolated quiescent nuclei. In the present study, we have used a cell-free DNA replication system to test the ability of plasmid vectors which contain sequences from the human ribosomal RNA gene to serve as replicative templates in vitro when exposed to ADR-containing preparations. Significant dTTP incorporation was seen using DNA from either a 7-kb sequence in the 5' spacer region (CHE) or a 7-kb sequence which begins near the end of the 28S coding region and extends into the 3' spacer region (ADBB), while sequences from other regions of the rRNA gene mediated little or no dTTP incorporation. The characteristics of plasmid-directed dTTP incorporation indicate that most incorporation is due to DNA replication and not repair or damage-initiated processes. To conclusively demonstrate origin-dependent replication in the plasmid system and to further map replication origins, an approach was developed using ddGTP to restrict the length of daughter strands followed by hybridization of these replication products to restriction fragments spanning the putative origin region. This approach allowed us to identify replication origin activity apart from parent strand repair or synthesis initiated at random damaged sites. One of the origins was localized to a 1375-bp fragment within the 5' spacer region, and this fragment contains sequences homologous to those found in other replication origins.

  15. Effect of excessive cadmium chloride on the plasmids of E. coli HB 101 in vivo

    Institute of Scientific and Technical Information of China (English)

    1999-01-01

    After Escherichia coli HB101 with plasmid pWH58, pWH98, or pTBa5 were cultered respectively in amp LB broth which contained 50 mg/L CdCl2 constantly for 24 h, these plasmids were isolated from E. coli, and the effect of excessive CdCl2 on the E. coli HB101 and plasmid DNA was studied by surveying the growth of E. coli HB101 and plasmid, argarose gel electrophoresis and analysis of restriction fragment length polymorphism (RFLP) of plasmids, and plasmid transformation. The results showed that 50 mg/L CdCl2 treatment lagged the growth of E. coli HB101 for at least 4h, but after grown for 24h there were not significant differences in the growths of E. coli HB101s and the productions of plasmids between the treatment and control. These results implified that E. coli HB101 have induced adaptability to cadmium stress and excessive CdCl2 did not inhibit the replication and amp+ gene's expression of plasmid DNA in vivo of E. coli significantly. 50 mg/L CdCl2 treatment for 24 hours might cause the sequence's change of plasmid DNA, but could not lead to the random breakage of plasmid DNA strands. Moreover, after 50 mg/L of CdCl2 treatment in vivo the transformation activities of plasmid did not altered, implied excessive CdCl2 could not affect the superhelical structure of plasmid and also not break the loop of plasmid DNA evidently.

  16. Restrictive cardiomyopathy

    Science.gov (United States)

    Cardiomyopathy - restrictive; Infiltrative cardiomyopathy; Idiopathic myocardial fibrosis ... In a case of restrictive cardiomyopathy, the heart muscle is of normal size or slightly enlarged. Most of the time, it also pumps normally. However, it does ...

  17. Mapping DNA cleavage by the Type ISP restriction-modification enzymes following long-range communication between DNA sites in different orientations.

    Science.gov (United States)

    van Aelst, Kara; Saikrishnan, Kayarat; Szczelkun, Mark D

    2015-12-02

    The prokaryotic Type ISP restriction-modification enzymes are single-chain proteins comprising an Mrr-family nuclease, a superfamily 2 helicase-like ATPase, a coupler domain, a methyltransferase, and a DNA-recognition domain. Upon recognising an unmodified DNA target site, the helicase-like domain hydrolyzes ATP to cause site release (remodeling activity) and to then drive downstream translocation consuming 1-2 ATP per base pair (motor activity). On an invading foreign DNA, double-strand breaks are introduced at random wherever two translocating enzymes form a so-called collision complex following long-range communication between a pair of target sites in inverted (head-to-head) repeat. Paradoxically, structural models for collision suggest that the nuclease domains are too far apart (>30 bp) to dimerise and produce a double-strand DNA break using just two strand-cleavage events. Here, we examined the organisation of different collision complexes and how these lead to nuclease activation. We mapped DNA cleavage when a translocating enzyme collides with a static enzyme bound to its site. By following communication between sites in both head-to-head and head-to-tail orientations, we could show that motor activity leads to activation of the nuclease domains via distant interactions of the helicase or MTase-TRD. Direct nuclease dimerization is not required. To help explain the observed cleavage patterns, we also used exonuclease footprinting to demonstrate that individual Type ISP domains can swing off the DNA. This study lends further support to a model where DNA breaks are generated by multiple random nicks due to mobility of a collision complex with an overall DNA-binding footprint of ∼30 bp.

  18. Mapping DNA cleavage by the Type ISP restriction-modification enzymes following long-range communication between DNA sites in different orientations

    Science.gov (United States)

    van Aelst, Kara; Saikrishnan, Kayarat; Szczelkun, Mark D.

    2015-01-01

    The prokaryotic Type ISP restriction-modification enzymes are single-chain proteins comprising an Mrr-family nuclease, a superfamily 2 helicase-like ATPase, a coupler domain, a methyltransferase, and a DNA-recognition domain. Upon recognising an unmodified DNA target site, the helicase-like domain hydrolyzes ATP to cause site release (remodeling activity) and to then drive downstream translocation consuming 1–2 ATP per base pair (motor activity). On an invading foreign DNA, double-strand breaks are introduced at random wherever two translocating enzymes form a so-called collision complex following long-range communication between a pair of target sites in inverted (head-to-head) repeat. Paradoxically, structural models for collision suggest that the nuclease domains are too far apart (>30 bp) to dimerise and produce a double-strand DNA break using just two strand-cleavage events. Here, we examined the organisation of different collision complexes and how these lead to nuclease activation. We mapped DNA cleavage when a translocating enzyme collides with a static enzyme bound to its site. By following communication between sites in both head-to-head and head-to-tail orientations, we could show that motor activity leads to activation of the nuclease domains via distant interactions of the helicase or MTase-TRD. Direct nuclease dimerization is not required. To help explain the observed cleavage patterns, we also used exonuclease footprinting to demonstrate that individual Type ISP domains can swing off the DNA. This study lends further support to a model where DNA breaks are generated by multiple random nicks due to mobility of a collision complex with an overall DNA-binding footprint of ∼30 bp. PMID:26507855

  19. Evidence for plasmid-encoded virulence factors in the phytopathogenic bacterium Clavibacter michiganensis subsp. michiganensis NCPPB382.

    Science.gov (United States)

    Meletzus, D; Bermphol, A; Dreier, J; Eichenlaub, R

    1993-01-01

    The tomato pathogen Clavibacter michiganensis subsp. michiganensis NCPPB382, which causes bacterial wilt, harbors two plasmids pCM1 (27.5 kb) and pCM2 (72 kb). After curing of the plasmids, bacterial derivatives were still proficient in the ability to colonize the host plant and in the production of exopolysaccharides but exhibited a reduced virulence. When one of the two plasmids is lost, there is a significant delay in the development of wilting symptoms after infection and a plasmid-free derivative is not able to induce disease symptoms. By cloning of restriction fragments of both plasmids in the plasmid-free strain CMM100, two DNA fragments which restored the virulent phenotype were identified. Further analysis suggested that a fragment of plasmid pCM1 encodes an endocellulase which is involved in the expression of the pathogenic phenotype. Images PMID:8458855

  20. Instability of multiple drug resistance plasmids in Salmonella typhimurium isolated from poultry.

    Science.gov (United States)

    Brown, D J; Threlfall, E J; Rowe, B

    1991-04-01

    Plasmids in five strains of Salmonella typhimurium resistant to ampicillin, chloramphenicol, gentamicin, neomycin/kanamycin, streptomycin, sulphonamides, tetracyclines and trimethoprim (ACGKSSuTTm), CGKSSuTTm, ACSSuT or CSSuT which had been isolated from poultry in the first 3 months of 1989 have been characterized and compared with plasmids in two strains of R-types ACGKSSuTTm and ASSuTTm isolated from two patients later in the year. With the exception of the human isolate of R-type ASSuTTm, all strains carried two non-conjugative plasmids, one coding for SSu and belonging to incompatibility group Q, and a second coding for multiple resistance and belonging to the FIme incompatibility group. The human isolate of R-type ASSuTTm did not carry the IncQ SSu plasmid but like the poultry isolates, carried a non-conjugative FIme plasmid. Restriction endonuclease digestion with the enzymes EcoR I, Pst I and Hind III demonstrated that the FIme plasmids from strains of different R-types showed a high degree of homology but exhibited numerous fragment size polymorphisms. The restriction digest fingerprint of plasmids in the human isolate of R-type ACGKSSuTTm was indistinguishable from a poultry isolate of the same R-type. Analysis of segregants of one of the poultry isolates of R-type ACGKSSuTTm demonstrated that resistance determinants could be rapidly lost from the FIme plasmid to give rise to a number of R-types and fingerprint patterns. Loss of tetracycline resistance from this plasmid appeared to be correlated with the integration of other plasmid-mediated resistances into the bacterial chromosome. Evidence is presented for the rapid loss of antimicrobial resistance determinants from a multiple resistance plasmid of the FIme incompatibility group in response to withdrawal of antibiotic selective pressure.

  1. Plasmid and chromosome partitioning: surprises from phylogeny

    DEFF Research Database (Denmark)

    Gerdes, Kenn; Møller-Jensen, Jakob; Bugge Jensen, Rasmus

    2000-01-01

    Plasmids encode partitioning genes (par) that are required for faithful plasmid segregation at cell division. Initially, par loci were identified on plasmids, but more recently they were also found on bacterial chromosomes. We present here a phylogenetic analysis of par loci from plasmids and chr...

  2. Plasmid-Borne Antimicrobial Resistance of Staphylococcus aureus Isolated in a Hospital in Lisbon, Portugal.

    Science.gov (United States)

    Costa, Sofia Santos; Palma, Cláudia; Kadlec, Kristina; Fessler, Andrea T; Viveiros, Miguel; Melo-Cristino, José; Schwarz, Stefan; Couto, Isabel

    2016-12-01

    Plasmids play a key role in the genetic plasticity and survival of Staphylococcus aureus in challenging environments. Although many S. aureus plasmids have been described, still few studies portray the plasmid content of a given S. aureus population. The aim of this work was to characterize the plasmids carried by a collection of 53 S. aureus isolates collected in a large hospital in Lisbon, Portugal, and investigate their role in conferring resistance to several antimicrobial agents. Plasmids were present in 44 out of the 53 isolates and were grouped into eleven AccI restriction profiles. Plasmid curing of representative strains and comparison of antimicrobial susceptibility profiles between pairs of isogenic strains proved to be a valuable guidance tool in the identification of plasmid-located resistance genes. The plasmids harbored several resistance genes, namely blaZ (resistance to β-lactams), erm(C) (resistance to macrolides, lincosamides, and streptogramin B), cadA (resistance to cadmium and zinc), cadD (resistance to cadmium), and qacA and smr (resistance to biocides and dyes). This study demonstrates the impact of plasmids on the resistance properties of S. aureus, highlighting their role in the dissemination of antibiotic, heavy metal, and biocide resistance genes, and survival of this major pathogen in the hospital environment.

  3. Enhanced transformation efficiency of recalcitrant Bacillus cereus and Bacillus weihenstephanensis isolates upon in vitro methylation of plasmid DNA

    NARCIS (Netherlands)

    Nierop Groot, M.N.; Nieboer, F.; Abee, T.

    2008-01-01

    Digestion patterns of chromosomal DNAs of Bacillus cereus and Bacillus weihenstephanensis strains suggest that Sau3AI-type restriction modification systems are widely present among the isolates tested. In vitro methylation of plasmid DNA was used to enhance poor plasmid transfer upon electroporation

  4. Plasmid Profiles of Virulent Rhodococcus equi Strains Isolated from Infected Foals in Poland.

    Science.gov (United States)

    Kalinowski, Marcin; Grądzki, Zbigniew; Jarosz, Łukasz; Kato, Kiyoko; Hieda, Yu; Kakuda, Tsutomu; Takai, Shinji

    2016-01-01

    Rhodococcus equi is an important bacterial pathogen in foals up to 6 months old, widespread in horse farms all over the world. It was found that only virulent R. equi strains expressing 15-17 kDa virulence-associated protein (VapA) and having large virulence plasmid of 85-90 kb containing vapA gene are pathogenic for horses. To date, 12 plasmid types have been reported in VapA positive strains from horses. There are no data concerning plasmid types of Polish field R. equi strains isolated from horses and horse farm environment. The aim of the study is to determine plasmid profiles of virulent R. equi strains isolated in Poland from dead foals as well as from soil samples taken from horse breeding farms. Plasmid profiles of 10 clinical strains derived from 8 farms and 11 environmental strains from 3 farms, confirmed as virulent by PCR, were compared with 12 reference strains containing the known plasmid size and type. Plasmid DNAs were analysed by digestion with the restriction endonucleases BamHI, EcoRI, EcoT22I, and HindIII for detailed comparison and estimation of plasmid sizes. The results of RFLP analysis revealed that all except one isolates used in the study are classified as VapA 85 kb type I plasmid. One strain harboured VapA 87 kb type I plasmid. This is the first report of plasmid types of Polish field R. equi strains. The results of our preliminary investigations on horse farms located in central and eastern Poland indicate that the virulent R. equi strains thus far isolated from diseased foals and horse farms environment represent a highly uniform plasmid pattern.

  5. Molecular characterization of an outbreak of respiratory syncytial virus (subgroup A) in Havana, Cuba, by monoclonal antibodies and restriction mapping (N gene).

    Science.gov (United States)

    Valdivia, A; Chacón, D; Savón, C; Oropesa, S; Sarmiento, L; Valdes, O; Otero, A; Rosario, D; Goyenechea, A

    1997-01-01

    Twenty-one respiratory syncytial virus (RSV) strains isolated from one outbreak in Havana, Cuba (1994 to 1995), were analyzed to determine their relatedness. All isolated strains were classified as subgroup A by monoclonal antibodies. Of 21 RSV strains examined, 20 were classified as having restriction pattern NP4 and only 1 was classified as having restriction pattern NP5. PMID:9302221

  6. Molecular relationship among fosfomycin-resistant plasmids and clinical impact of fosfomycin resistance.

    Science.gov (United States)

    Mendoza, M C; Teran, F J; Mendez, F J; Hardisson, C

    1988-10-01

    We have been carrying out a surveillance programme on plasmid-mediated fosfomycin resistance in our community over the last decade and have isolated and characterized several varieties of conjugative plasmids from different enterobacteriae. In this work we show that seven varieties of plasmids are related with the Inc M group, and carry the same For determinant which encodes a modifying enzyme. The comparative study on their R-phenotype, restriction analysis and DNA-DNA hybridization showed different degrees of molecular relationship among them. The spread of For-plasmids as well as the fosfomycin resistance by other mechanisms seems to be low in spite of the great For-plasmid diversity found.

  7. Rapid plasmid library screening using RecA-coated biotinylated probes.

    Science.gov (United States)

    Rigas, B; Welcher, A A; Ward, D C; Weissman, S M

    1986-12-01

    A method for the rapid physical isolation of recombinant plasmids of interest from a mixture of plasmids such as a plasmid cDNA library is presented. This method utilizes the ability of RecA protein to form stable complexes between linear single-stranded and circular double-stranded DNA molecules sharing sequence homology, and procedures allowing isolation of biotinylated nucleic acid. Biotinylated linear DNA probes coated with RecA have been used to screen reconstituted plasmid libraries consisting of two plasmid species, one homologous and the other heterologous to the probe. When the link between biotin and the nucleotide base could be cleaved by reducing agents, the complex was purified by streptavidin-agarose chromatography and the recovered plasmid was propagated in Escherichia coli. When the link was not cleavable the complex was bound to avidin in solution and purified by cupric iminodiacetic acid-agarose chromatography. The complex was then dissociated and the plasmids were propagated in E. coli. With either protocol, homologous plasmid recovery was between 10% and 20%, and enrichment was between 10(4)- and 10(5)-fold. Potential applications and extensions of this method, such as plasmid, cosmid, and phage library screening and facilitation of physical mapping of macroregions of mammalian genomes are presented and discussed.

  8. Exploring PFGE for Detecting Large Plasmids in Campylobacter jejuni and Campylobacter coli Isolated from Various Retail Meats

    Directory of Open Access Journals (Sweden)

    Daya Marasini

    2014-10-01

    Full Text Available Campylobacter spp. is one of the most prevalent bacterial pathogens in retail meat, particularly poultry, and is a leading cause of diarrhea in humans. Studies related to Campylobacter large plasmids are limited in the literature possibly due to difficulty in isolating them using available alkaline lysis methods. The objectives of this study were to determine the prevalence of plasmids, particularly large ones, in Campylobacter spp. isolated from various Oklahoma retail meats, and to explore PFGE (Pulsed Field Gel Electrophoresis as a tool in facilitating the detection of these plasmids. One hundred and eighty nine strains (94 Campylobacter jejuni and 95 Campylobacter coli were screened for the presence of plasmids using both alkaline lysis and PFGE. Plasmids were detected in 119/189 (63% using both methods. Most of the plasmids detected by alkaline lysis were smaller than 90 kb and only three were larger than 90 kb. Plasmids over 70 kb in size were detected in 33 more strains by PFGE of which 11 strains contained larger than 90 kb plasmids. Plasmids were more prevalent in Campylobacter coli (73.5% than in Campylobacter jejuni (52%. BglII restriction analysis of plasmids isolated from 102 isolates revealed 42 different restriction patterns. In conclusion, PFGE was able to detect large plasmids up to 180 Kb in Campylobacter spp. which might have been missed if the alkaline lysis method was solely used. Campylobacter spp. isolated from retail meats harbor a diverse population of plasmids with variable sizes. To our knowledge, this is the first study to use PFGE to detect large plasmids in Campylobacter.

  9. Modular construction of plasmids through ligation-free assembly of vector components with oligonucleotide linkers.

    Science.gov (United States)

    Vroom, Jonathan A; Wang, Clifford L

    2008-06-01

    We have developed a modular method of plasmid construction that can join multiple DNA components in a single reaction. A nicking enzyme is used to create 5' and 3' overhangs on PCR-generated DNA components. Without the use of ligase or restriction enzymes, components are joined using oligonucleotide linkers that recognize the overhangs. By specifying the sequences of the linkers, desired components can be assembled in any combination and order to generate different plasmid vectors.

  10. Novel plasmids and resistance phenotypes in Yersinia pestis: unique plasmid inventory of strain Java 9 mediates high levels of arsenic resistance.

    Directory of Open Access Journals (Sweden)

    Mark Eppinger

    Full Text Available Growing evidence suggests that the plasmid repertoire of Yersinia pestis is not restricted to the three classical virulence plasmids. The Java 9 strain of Y. pestis is a biovar Orientalis isolate obtained from a rat in Indonesia. Although it lacks the Y. pestis-specific plasmid pMT, which encodes the F1 capsule, it retains virulence in mouse and non-human primate animal models. While comparing diverse Y. pestis strains using subtractive hybridization, we identified sequences in Java 9 that were homologous to a Y. enterocolitica strain carrying the transposon Tn2502, which is known to encode arsenic resistance. Here we demonstrate that Java 9 exhibits high levels of arsenic and arsenite resistance mediated by a novel promiscuous class II transposon, named Tn2503. Arsenic resistance was self-transmissible from Java 9 to other Y. pestis strains via conjugation. Genomic analysis of the atypical plasmid inventory of Java 9 identified pCD and pPCP plasmids of atypical size and two previously uncharacterized cryptic plasmids. Unlike the Tn2502-mediated arsenic resistance encoded on the Y. enterocolitica virulence plasmid; the resistance loci in Java 9 are found on all four indigenous plasmids, including the two novel cryptic plasmids. This unique mobilome introduces more than 105 genes into the species gene pool. The majority of these are encoded by the two entirely novel self-transmissible plasmids, which show partial homology and synteny to other enterics. In contrast to the reductive evolution in Y. pestis, this study underlines the major impact of a dynamic mobilome and lateral acquisition in the genome evolution of the plague bacterium.

  11. Screening large numbers of recombinant plasmids: modifications and additions to alkaline lysis for greater efficiency

    Institute of Scientific and Technical Information of China (English)

    XU Yibing; N.V. CHANDRASEKHARAN; Daniel L. SIMMONS

    2006-01-01

    Selecting bacteria transformed with recombinant plasmid is a laborious step in gene cloning experiments. This selection process is even more tedious when large numbers of clones need to be screened. We describe here modifications to the ultra fast plasmid preparation method described previously by Law and Crickmore. The modified method is coupled to an efficient PCR step to rapidly determine orientation of the inserts. Compared to traditional methods of analysis requiring growth of overnight cultures, plasmid isolation and restriction enzyme digestion to determine orientation this procedure allows for the analysis and storage of a large number of recombinants within a few hours.

  12. Plasmid Profiles and Prevalence of Intermediately Virulent Rhodococcus equi from Pigs in Nakhonpathom Province, Thailand: Identification of a New Variant of the 70-kb Virulence Plasmid, Type 18

    Directory of Open Access Journals (Sweden)

    Chaithep Poolkhet

    2010-01-01

    Full Text Available The prevalence of intermediately virulent Rhodococcus equi isolates from pig submaxillary lymph nodes from four slaughterhouses in Nakhonpathom province, Thailand, was investigated. The isolates were tested for the presence of virulence plasmids and the 20-kDa virulence-associated protein antigen (VapB gene by PCR. Of the 734 submaxillary lymph nodes tested, 19 (2.6% produced positive cultures of R. equi. All 19 isolates were positive for the VapB gene and contained virulence plasmids that were identified as type 1 (six isolates, type 6 (two isolates, type 7 (one isolate, type 16 (two isolates, and a new variant (eight isolates. Based on the restriction digestion patterns of the plasmid DNAs, we tentatively designated the variant as type 18. Investigation of the prevalence and plasmid profiles of VapB-positive R. equi in pigs should be extended throughout Thailand to evaluate potential sources of zoonotic infections.

  13. Co-resident plasmids travel together.

    Science.gov (United States)

    Gama, João Alves; Zilhão, Rita; Dionisio, Francisco

    2017-08-24

    Conjugative plasmids encode genes that enable them to transfer, by conjugation, from a given host cell to another cell. Conjugative transfer, despite being an important feature of conjugative plasmids, is not constitutive for most plasmids, the reason being that genes involved in horizontal transfer are mostly repressed. Only upon their transient de-repression are plasmids able to transfer horizontally. If host cells harbour multiple plasmids, their simultaneous transfer depends on simultaneous transient de-repression of all plasmids. If de-repression of different plasmids was random and independent events, simultaneous de-repression should be a rare event because the probability of simultaneous de-repression would be the product of the probabilities of de-repression of each plasmid. Some previous observations support this hypothesis, while others show that co-transfer of plasmids is more frequent than this reasoning indicates. Here, we show that co-transfer of multiple plasmids mainly results from non-independent events: the probability that all plasmids within a cell become de-repressed is much higher than if de-repression of plasmids genes were independent. We found a simple model for the probability of co-transfer: the plasmid having the lowest conjugation rates is the one who limits co-transfer. In this sense, cells receiving the plasmid with the lower transfer rate also receive the other plasmid. If de-repression happens simultaneously on co-resident plasmids, common cues may stimulate de-repression of distinct plasmids. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. The Chlamydophila felis plasmid is highly conserved.

    Science.gov (United States)

    Harley, Ross; Day, Sarinder; Di Rocco, Camillo; Helps, Chris

    2010-11-20

    The presence of a plasmid in the Chlamydiaceae is both species and strain specific. Knowledge of the prevalence of the plasmid in different Chlamydia species is important for future studies aiming to investigate the role of the plasmid in chlamydial biology and disease. Although strains of Chlamydophila felis with or without the plasmid have been identified, only a small number of laboratory-adapted strains have been analysed and the prevalence of the plasmid in field isolates has not been determined. This study aimed to determine the prevalence of the plasmid in C. felis-positive conjunctival and oropharyngeal clinical samples submitted for routine diagnosis of C. felis by real-time (Q)PCR. DNA extracts from four laboratory-adapted strains were also analysed. QPCR assays targeting regions of C. felis plasmid genes pCF01, pCF02 and pCF03 were developed for the detection of plasmid DNA. QPCR analysis of DNA extracts from C. felis-positive clinical samples found evidence of plasmid DNA in 591 of 595 samples representing 561 of 564 (99.5%) clinical cases. Plasmid DNA was also detected by QPCR in laboratory-adapted strains 1497V, K2487 and K2490, but not strain 905. We conclude that the plasmid is highly conserved in C. felis, and plasmid-deficient strains represent a rare but important population for future studies of chlamydial plasmid function.

  15. Characterization of the replication and stability regions of Agrobacterium tumefaciens plasmid pTAR.

    Science.gov (United States)

    Gallie, D R; Zaitlin, D; Perry, K L; Kado, C I

    1984-03-01

    A 5.4-kilobase region containing the origin of replication and stability maintenance of the 44-kilobase Agrobacterium tumefaciens plasmid pTAR has been mapped and characterized. Within this region is a 1.3-kilobase segment that is capable of directing autonomous replication. The remaining segment contains the stability locus for maintenance of pTAR during nonselective growth. Approximately 35% of pTAR shares sequence homology with pAg119, a 44-kilobase cryptic plasmid in grapevine strain 1D1119. However, no homology was detected between pTAR DNA and several Ti plasmids or several other small cryptic plasmids in many A. tumefaciens strains. A recombinant plasmid containing the origin of replication and stability maintenance region of pTAR was compatible with pTiC58, pTi15955, and pTi119 and incompatible with pAg119. A new compatibility group, Inc Ag-1, is discussed.

  16. Restricted Airspace

    Data.gov (United States)

    Federal Laboratory Consortium — Redstone Technical Test Center has restricted airspace up to 30,000 feet ASL. Airspace encompasses R-2104 (Redstone). Airspace is used extensively for airborne/UAV...

  17. [Chromatographic separation of plasmid DNA by anion-exchange cryogel].

    Science.gov (United States)

    Guo, Yantao; Shen, Shaochuan; Yun, Junxian; Yao, Kejian

    2012-08-01

    Plasmid DNA (pDNA) is used as an important vector for gene therapy, and its wide application is restricted by the purity and yield. To obtain high-purity pDNA, a chromatographic method based on anion-exchange supermacroporous cryogel was explored. The anion-exchange cryogel was prepared by grafting diethylaminoethyl-dextran to the epoxide groups of polyacrylamide-based matrix and pUC19 plasmid was used as a target to test the method. The plasmid was transferred into Escherichia coli DH5alpha, cultivated, harvested and lysed. The obtained culture was centrifuged and the supernatant was used as the plasmid feedstock, which was loaded into the anion-exchange cryogel bed for chromatographic separation. By optimizing the pH of running buffer and the elution conditions, high-purity pDNA was obtained by elution with 0.5 mol/L sodium chloride solution at pH 6.6. Compared to the traditional methods for purification of pDNA, animal source enzymes and toxic reagents were not involved in the present separation process, ensuring the safety of both the purification operations and the obtained pDNA.

  18. The involvement of tetA and tetE tetracycline resistance genes in plasmid and chromosomal resistance of Aeromonas in Brazilian strains

    Directory of Open Access Journals (Sweden)

    Ilana Teruszkin Balassiano

    2007-11-01

    Full Text Available This study analyzed the involvement of tetA and tetE genes in the tetracycline resistance of 16 strains of genus Aeromonas, isolated from clinical and food sources. Polymerase chain reactions revealed that 37.5% of the samples were positive for tetA, and also 37.5% were tetE positive. One isolate was positive for both genes. Only the isolate A. caviae 5.2 had its resistance associated to the presence of a plasmid, pSS2. The molecular characterization of pSS2 involved the construction of its restriction map and the determination of its size. The digestion of pSS2 with HindIII originated two fragments (A and B that were cloned separately into the pUC18 vector. The tetA gene was shown to be located on the HindIII-A fragment by PCR. After transforming a tetracycline-sensitive strain with pSS2, the transformants expressed the resistance phenotype and harbored a plasmid whose size was identical to that of pSS2. The results confirmed the association between pSS2 and the tetracycline resistance phenotype, and suggest a feasible dissemination of tetA and tetE among strains of Aeromonas. This study suggests the spreading tetA and tetE genes in Aeromonas in Brazil and describes a resistance plasmid that probably contributes to the dissemination of the resistance.

  19. Reassessment of QTLs for late blight resistance in the tomato accession L3708 using a restriction site associated DNA (RAD) linkage map and highly aggressive isolates of Phytophthora infestans.

    Science.gov (United States)

    Chen, Ai-Lin; Liu, Chu-Yin; Chen, Chien-Hua; Wang, Jaw-Fen; Liao, Yu-Chen; Chang, Chia-Hui; Tsai, Mong-Hsun; Hwu, Kae-Kang; Chen, Kai-Yi

    2014-01-01

    Tomato late blight caused by the oomycete pathogen Phytophthora infestans (Mont.) de Bary is a major threat to tomato production in cool and wet environments. Intensified outbreaks of late blight have been observed globally from the 1980s, and are associated with migration of new and more aggressive populations of P. infestans in the field. The objective of this study was to reassess late blight resistance in the wild tomato accession L3708 (Solanum pimpinellifolium L.) against pathogens of different aggressiveness. An F2:3 genetic mapping population was developed using L3708 as the paternal parent. Two isolates of P. infestans, Pi39A and Pi733, were used for inoculation. Pi733 is a highly aggressive genotype that defeats three known late blight resistance genes, Ph-1, Ph-2, and Ph-5t in tomato. In contrast, Pi39A is a less aggressive genotype that defeats only Ph-1. Restriction site Associated DNA Sequencing (RAD-Seq) technology was used to massively sequence 90 bp nucleotides adjacent to both sides of PstI restriction enzyme cutting sites in the genome for all individuals in the genetic mapping population. The RAD-seq data were used to construct a genetic linkage map containing 440 single nucleotide polymorphism markers. Quantitative trait locus (QTL) analysis identified a new disease-resistant QTL specific to Pi733 on chromosome 2. The Ph-3 gene located on chromosome 9 could be detected whichever isolates were used. This study demonstrated the feasibility and efficiency of RAD-Seq technology for conducting a QTL mapping experiment using an F2:3 mapping population, which allowed the identification of a new late blight resistant QTL in tomato.

  20. Reassessment of QTLs for Late Blight Resistance in the Tomato Accession L3708 Using a Restriction Site Associated DNA (RAD) Linkage Map and Highly Aggressive Isolates of Phytophthora infestans

    Science.gov (United States)

    Chen, Ai-Lin; Liu, Chu-Yin; Chen, Chien-Hua; Wang, Jaw-Fen; Liao, Yu-Chen; Chang, Chia-Hui; Tsai, Mong-Hsun; Hwu, Kae-Kang; Chen, Kai-Yi

    2014-01-01

    Tomato late blight caused by the oomycete pathogen Phytophthora infestans (Mont.) de Bary is a major threat to tomato production in cool and wet environments. Intensified outbreaks of late blight have been observed globally from the 1980s, and are associated with migration of new and more aggressive populations of P. infestans in the field. The objective of this study was to reassess late blight resistance in the wild tomato accession L3708 (Solanum pimpinellifolium L.) against pathogens of different aggressiveness. An F2:3 genetic mapping population was developed using L3708 as the paternal parent. Two isolates of P. infestans, Pi39A and Pi733, were used for inoculation. Pi733 is a highly aggressive genotype that defeats three known late blight resistance genes, Ph-1, Ph-2, and Ph-5t in tomato. In contrast, Pi39A is a less aggressive genotype that defeats only Ph-1. Restriction site Associated DNA Sequencing (RAD-Seq) technology was used to massively sequence 90 bp nucleotides adjacent to both sides of PstI restriction enzyme cutting sites in the genome for all individuals in the genetic mapping population. The RAD-seq data were used to construct a genetic linkage map containing 440 single nucleotide polymorphism markers. Quantitative trait locus (QTL) analysis identified a new disease-resistant QTL specific to Pi733 on chromosome 2. The Ph-3 gene located on chromosome 9 could be detected whichever isolates were used. This study demonstrated the feasibility and efficiency of RAD-Seq technology for conducting a QTL mapping experiment using an F2:3 mapping population, which allowed the identification of a new late blight resistant QTL in tomato. PMID:24788810

  1. Reassessment of QTLs for late blight resistance in the tomato accession L3708 using a restriction site associated DNA (RAD linkage map and highly aggressive isolates of Phytophthora infestans.

    Directory of Open Access Journals (Sweden)

    Ai-Lin Chen

    Full Text Available Tomato late blight caused by the oomycete pathogen Phytophthora infestans (Mont. de Bary is a major threat to tomato production in cool and wet environments. Intensified outbreaks of late blight have been observed globally from the 1980s, and are associated with migration of new and more aggressive populations of P. infestans in the field. The objective of this study was to reassess late blight resistance in the wild tomato accession L3708 (Solanum pimpinellifolium L. against pathogens of different aggressiveness. An F2:3 genetic mapping population was developed using L3708 as the paternal parent. Two isolates of P. infestans, Pi39A and Pi733, were used for inoculation. Pi733 is a highly aggressive genotype that defeats three known late blight resistance genes, Ph-1, Ph-2, and Ph-5t in tomato. In contrast, Pi39A is a less aggressive genotype that defeats only Ph-1. Restriction site Associated DNA Sequencing (RAD-Seq technology was used to massively sequence 90 bp nucleotides adjacent to both sides of PstI restriction enzyme cutting sites in the genome for all individuals in the genetic mapping population. The RAD-seq data were used to construct a genetic linkage map containing 440 single nucleotide polymorphism markers. Quantitative trait locus (QTL analysis identified a new disease-resistant QTL specific to Pi733 on chromosome 2. The Ph-3 gene located on chromosome 9 could be detected whichever isolates were used. This study demonstrated the feasibility and efficiency of RAD-Seq technology for conducting a QTL mapping experiment using an F2:3 mapping population, which allowed the identification of a new late blight resistant QTL in tomato.

  2. PLASMIDS FROM ANAEROCELLUM THERMOPHILUM AND USES THEREOF

    DEFF Research Database (Denmark)

    2003-01-01

    The present invention concerns the isolation of plasmids from extremely thermophilic anaerobic microorganisms and their use in genetic transformation of thermophilic and mesophilic microorganisms. More particular the invention concerns the use of thermostable plasmid vectors as tools for creating...

  3. Genome-Wide Mapping of Growth-Related Quantitative Trait Loci in Orange-Spotted Grouper (Epinephelus coioides) Using Double Digest Restriction-Site Associated DNA Sequencing (ddRADseq).

    Science.gov (United States)

    Yu, Hui; You, Xinxin; Li, Jia; Liu, Hankui; Meng, Zining; Xiao, Ling; Zhang, Haifa; Lin, Hao-Ran; Zhang, Yong; Shi, Qiong

    2016-04-06

    Mapping of quantitative trait loci (QTL) is essential for the discovery of genetic structures that related to complex quantitative traits. In this study, we identified 264,072 raw SNPs (single-nucleotide polymorphisms) by double digest restriction site associated DNA sequencing (ddRADseq), and utilized 3029 of these SNPs to construct a genetic linkage map in orange-spotted grouper (Epinephelus coioides) using a regression mapping algorithm. The genetic map contained 24 linkage groups (LGs) spanning a total genetic distance of 1231.98 cM. Twenty-seven significant growth-related QTLs were identified. Furthermore, we identified 17 genes (fez2, alg3, ece2, arvcf, sla27a4, sgk223, camk2, prrc2b, mchr1, sardh, pappa, syk, tert, wdrcp91, ftz-f1, mate1 and notch1) including three (tert, ftz-f1 and notch1) that have been reported to be involved in fish growth. To summarize, we mapped growth-related QTLs in the orange-spotted grouper. These QTLs will be useful in marker-assisted selection (MAS) efforts to improve growth-related traits in this economically important fish.

  4. Genome-Wide Mapping of Growth-Related Quantitative Trait Loci in Orange-Spotted Grouper (Epinephelus coioides Using Double Digest Restriction-Site Associated DNA Sequencing (ddRADseq

    Directory of Open Access Journals (Sweden)

    Hui Yu

    2016-04-01

    Full Text Available Mapping of quantitative trait loci (QTL is essential for the discovery of genetic structures that related to complex quantitative traits. In this study, we identified 264,072 raw SNPs (single-nucleotide polymorphisms by double digest restriction site associated DNA sequencing (ddRADseq, and utilized 3029 of these SNPs to construct a genetic linkage map in orange-spotted grouper (Epinephelus coioides using a regression mapping algorithm. The genetic map contained 24 linkage groups (LGs spanning a total genetic distance of 1231.98 cM. Twenty-seven significant growth-related QTLs were identified. Furthermore, we identified 17 genes (fez2, alg3, ece2, arvcf, sla27a4, sgk223, camk2, prrc2b, mchr1, sardh, pappa, syk, tert, wdrcp91, ftz-f1, mate1 and notch1 including three (tert, ftz-f1 and notch1 that have been reported to be involved in fish growth. To summarize, we mapped growth-related QTLs in the orange-spotted grouper. These QTLs will be useful in marker-assisted selection (MAS efforts to improve growth-related traits in this economically important fish.

  5. DNASU plasmid and PSI:Biology-Materials repositories: resources to accelerate biological research.

    Science.gov (United States)

    Seiler, Catherine Y; Park, Jin G; Sharma, Amit; Hunter, Preston; Surapaneni, Padmini; Sedillo, Casey; Field, James; Algar, Rhys; Price, Andrea; Steel, Jason; Throop, Andrea; Fiacco, Michael; LaBaer, Joshua

    2014-01-01

    The mission of the DNASU Plasmid Repository is to accelerate research by providing high-quality, annotated plasmid samples and online plasmid resources to the research community through the curated DNASU database, website and repository (http://dnasu.asu.edu or http://dnasu.org). The collection includes plasmids from grant-funded, high-throughput cloning projects performed in our laboratory, plasmids from external researchers, and large collections from consortia such as the ORFeome Collaboration and the NIGMS-funded Protein Structure Initiative: Biology (PSI:Biology). Through DNASU, researchers can search for and access detailed information about each plasmid such as the full length gene insert sequence, vector information, associated publications, and links to external resources that provide additional protein annotations and experimental protocols. Plasmids can be requested directly through the DNASU website. DNASU and the PSI:Biology-Materials Repositories were previously described in the 2010 NAR Database Issue (Cormier, C.Y., Mohr, S.E., Zuo, D., Hu, Y., Rolfs, A., Kramer, J., Taycher, E., Kelley, F., Fiacco, M., Turnbull, G. et al. (2010) Protein Structure Initiative Material Repository: an open shared public resource of structural genomics plasmids for the biological community. Nucleic Acids Res., 38, D743-D749.). In this update we will describe the plasmid collection and highlight the new features in the website redesign, including new browse/search options, plasmid annotations and a dynamic vector mapping feature that was developed in collaboration with LabGenius. Overall, these plasmid resources continue to enable research with the goal of elucidating the role of proteins in both normal biological processes and disease.

  6. Plasmid required for virulence of Agrobacterium tumefaciens

    Energy Technology Data Exchange (ETDEWEB)

    Watson, B.; Currier, T.C.; Gordon, M.P.; Chilton, M.D.; Nester, E.W.

    1975-07-01

    The irreversible loss of crown gall-inducing ability of Agrobacterium tumefaciens strain C-58 during growth at 37/sup 0/C is shown to be due to loss of a large plasmid (1.2 x 10/sup 8/ daltons). The gene responsible for this high rate of plasmid loss at elevated temperatures seems to be located on the plasmid. In addition, another spontaneous avirulent variant, A. tumefaciens strain IIBNV6, is shown to lack the virulence plasmid which its virulent sibling strain, IIBV7, possesses. Deoxyribonucleic acid reassociation measurements prove that the plasmid is eliminated, not integrated into the chromosome, in both of the avirulent derivatives. Transfer of virulence from donor strain C-58 to avirulent recipient strain A136 results from the transfer of a plasmid, which appears identical to the donor plasmid by deoxyribonucleic acid reassociation measurements. The transfer of virulence in another cross, K27 x A136, was also shown to result from the transfer of a large plasmid. These findings establish unequivocally that the large plasmid determines virulence. Two additional genetic determinants have been located on the virulence plasmid of A. tumefaciens strain C-58: the ability to utilize nopaline and sensitivity to a bacteriocin produced by strain 84. The latter trait can be exploited for selection of avirulent plasmid-free derivatives of strain C-58. The trait of nopaline utilization appears to be on the virulence plasmid also in strains IIBV7 and K27.

  7. Low-dose plasmid DNA treatment increases plasma vasopressin and regulates blood pressure in experimental endotoxemia

    Directory of Open Access Journals (Sweden)

    Malardo Thiago

    2012-11-01

    Full Text Available Abstract Background Although plasmid DNA encoding an antigen from pathogens or tumor cells has been widely studied as vaccine, the use of plasmid vector (without insert as therapeutic agent requires further investigation. Results Here, we showed that plasmid DNA (pcDNA3 at low doses inhibits the production of IL-6 and TNF-α by lipopolysaccharide (LPS-stimulated macrophage cell line J774. These findings led us to evaluate whether plasmid DNA could act as an anti-inflammatory agent in a Wistar rat endotoxemia model. Rats injected simultaneously with 1.5 mg/kg of LPS and 10 or 20 μg of plasmid DNA had a remarkable attenuation of mean arterial blood pressure (MAP drop at 2 hours after treatment when compared with rats injected with LPS only. The beneficial effect of the plasmid DNA on MAP was associated with decreased expression of IL-6 in liver and increased concentration of plasma vasopressin (AVP, a known vasoconstrictor that has been investigated in hemorrhagic shock management. No difference was observed in relation to nitric oxide (NO production. Conclusion Our results demonstrate for the first time that plasmid DNA vector at low doses presents anti-inflammatory property and constitutes a novel approach with therapeutic potential in inflammatory diseases.

  8. Phosphorylation of ERK/MAP Kinase Is Required for Long-Term Potentiation in Anatomically Restricted Regions of the Lateral Amygdala in Vivo

    Science.gov (United States)

    Schafe, Glenn E.; Swank, Michael W.; Rodriguez, Sarina M.; Debiec, Jacek; Doyere, Valerie

    2008-01-01

    We have previously shown that the extracellular signal-regulated kinase/mitogen-activated protein kinase (ERK/ MAPK) is transiently activated in anatomically restricted regions of the lateral amygdala (LA) following Pavlovian fear conditioning and that blockade of ERK/MAPK activation in the LA impairs both fear memory consolidation and long-term…

  9. Origin and Evolution of Rickettsial Plasmids.

    Science.gov (United States)

    El Karkouri, Khalid; Pontarotti, Pierre; Raoult, Didier; Fournier, Pierre-Edouard

    2016-01-01

    Rickettsia species are strictly intracellular bacteria that have undergone a reductive genomic evolution. Despite their allopatric lifestyle, almost half of the 26 currently validated Rickettsia species have plasmids. In order to study the origin, evolutionary history and putative roles of rickettsial plasmids, we investigated the evolutionary processes that have shaped 20 plasmids belonging to 11 species, using comparative genomics and phylogenetic analysis between rickettsial, microbial and non-microbial genomes. Plasmids were differentially present among Rickettsia species. The 11 species had 1 to 4 plasmid (s) with a size ranging from 12 kb to 83 kb. We reconstructed pRICO, the last common ancestor of the current rickettsial plasmids. pRICO was vertically inherited mainly from Rickettsia/Orientia chromosomes and diverged vertically into a single or multiple plasmid(s) in each species. These plasmids also underwent a reductive evolution by progressive gene loss, similar to that observed in rickettsial chromosomes, possibly leading to cryptic plasmids or complete plasmid loss. Moreover, rickettsial plasmids exhibited ORFans, recent gene duplications and evidence of horizontal gene transfer events with rickettsial and non-rickettsial genomes mainly from the α/γ-proteobacteria lineages. Genes related to maintenance and plasticity of plasmids, and to adaptation and resistance to stress mostly evolved under vertical and/or horizontal processes. Those involved in nucleotide/carbohydrate transport and metabolism were under the influence of vertical evolution only, whereas genes involved in cell wall/membrane/envelope biogenesis, cycle control, amino acid/lipid/coenzyme and secondary metabolites biosynthesis, transport and metabolism underwent mainly horizontal transfer events. Rickettsial plasmids had a complex evolution, starting with a vertical inheritance followed by a reductive evolution associated with increased complexity via horizontal gene transfer as well as

  10. Localization of the human RNA polymerase I transcription factor gene (UBTF) to the D17S183 locus on chromosome 17q21 and construction of a long-range restriction map of the region

    Energy Technology Data Exchange (ETDEWEB)

    Jones, K.A.; Black, D.M.; Griffiths, B.L.; Solomon, E. [Somatic Cell Genetics Lab., London (United Kingdom)

    1995-12-10

    Human upstream binding factor (hUBF) is a sequence-specific DNA-binding protein that is essential for the activation of human 18s and 28s rRNA gene transcription. We have isolated and localized the gene (UBTF) encoding hUBF to the D17S183 locus on chromosome 17q21 by analyzing a cosmid from the region and carrying out Southern analysis on a previously constructed chromosome 17 somatic cell hybrid mapping panel using a probe from the hUBF cDNA. Confirmation of its location at this region was obtained from the results of pulsed-field gel electrophoresis analysis of genomic DNA using the hUBF cDNA and other probes from the region. These data also enabled the construction of a long-range restriction map of the region. 13 refs., 2 figs., 1 tab.

  11. An extranuclear expression system for analysis of cytoplasmic promoters of yeast linear killer plasmids.

    Science.gov (United States)

    Schründer, J; Meinhardt, F

    1995-03-01

    Based on the cytoplasmically localized killer plasmids pGKL1 and pGKL2 of Kluyveromyces lactis two new linear hybrid plasmids were constructed which consist of pGKL1, into which in addition to the previously developed cytoplasmically expressible LEU2* selectable marker a glucose dehydrogenase-encoding bacterial gene (gdh A) has been integrated. One of the hybrid plasmids carries the bacterial gene preceded by an arbitrarily placed cytoplasmic promoter (upstream conserved sequence) in front of the coding region (pRKL121). The other plasmid was constructed in such a way that the ATG start codon of the gdh A gene was fused in frame to the ATG start codon of the killer plasmid's open reading frame 5 (pRKL122). The structures of both linear hybrid plasmids were confirmed by restriction analysis, Southern hybridization, and sequencing of the junction sites. Yeast strains carrying either of the plasmids expressed the glucose dehydrogenase gene; however, expression of the in phase fused gene was 40-fold higher compared to the arbitrarily placed cytoplasmic promoter. In general, an in phase fusion was not required for expression, but efficiency is dramatically enhanced when the 5' noncoding sequences in front of the heterologous genes are the same as those found on the native killer plasmids. The developed system can serve as a reporter for determining the efficiency of the different cytoplasmic promoters present on both linear plasmids. Hybrid plasmids were stably maintained without selective pressure in K. lactis and they were transferred and expressed also in Saccharomyces cerevisiae.

  12. A novel multidrug resistance plasmid isolated from an Escherichia coli strain resistant to aminoglycosides.

    Science.gov (United States)

    Sun, Hui; Li, Shasha; Xie, Zhijing; Yang, Fangfang; Sun, Yani; Zhu, Yanli; Zhao, Xiaomin; Jiang, Shijin

    2012-07-01

    Previous studies have reported several different plasmids that confer multidrug resistance (MDR) including resistance to aminoglycosides. In this study, we investigated the aminoglycoside resistance patterns for 224 Escherichia coli isolates from diseased chickens and ducks in China, characterized a novel MDR plasmid, and collected prevalence data on similar resistance plasmids. Antibiotic susceptibilities were determined using disc diffusion and the microdilution method. The plasmid pXZ was analysed by restriction fragment length polymorphism (RFLP) with EcoRI and SalI, and sequenced. The prevalence of similar resistance plasmids was assessed by multiplex PCR and by RFLP analysis. Among the 224 E. coli isolates, 189 (84.4%) were resistant to streptomycin, 125 (55.8%) were resistant to kanamycin, 116 (51.8%) were resistant to gentamicin, 106 (47.3%) were resistant to neomycin and 98 (43.8%) were resistant to amikacin. Among the 224 E. coli isolates, 17 contained a plasmid with the MDR-encoding region of pXZ, which showed high-level resistance to aminoglycosides (MICs of gentamicin and amikacin ≥ 512 mg/L). The plasmid pXZ was digested into five fragments by EcoRI and six fragments by SalI. The plasmid pXZ was a circular DNA molecule of 76635 bp with a 51.65% guanine + cytosine content and included four resistance genes (rmtB, fosA3, bla(TEM-1) and bla(CTX-M-24)). A novel MDR plasmid, pXZ, harbouring four resistance genes (rmtB, fosA3, bla(TEM-1) and bla(CTX-M)) was identified. To our knowledge, this is the first report of an aminoglycoside resistance plasmid harbouring the fosA3 gene.

  13. Chlamydophila felis: plasmid detection in Italian isolates.

    Science.gov (United States)

    Di Francesco, Antonietta; Donati, Manuela; Salvatore, Daniela; Cevenini, Roberto; Di Paolo, Maria; Baldelli, Raffaella

    2010-04-01

    Plasmids have been detected in the majority of strains in the genus Chlamydia and in many Chlamydophila species. Previous studies showed that FP Pring and FP Cello Chlamydophila felis strains have an extrachromosomial plasmid, whereas the FP Baker strain does not. Azuma et al. recently sequenced the entire genomic DNA sequence of the Japanese Cp. felis strain Fe/C-56 and described a 7,552 base pair circular plasmid. In the present study a highly conserved plasmid gene was detected in 11 Italian Cp. felis isolates, showing 100% nucleotide identity with the plasmid gene of Fe/C-56 Cp. felis strain.

  14. Plasmid profiling of bacterial isolates from confined environments

    Science.gov (United States)

    van Houdt, Rob; Provoost, Ann; Coninx, Ilse; Leys, Natalie; Mergeay, Max

    Plasmid profiling of bacterial isolates from confined environments R. Van Houdt, I. Coninx, A. Provoost, N. Leys, and M. Mergeay Expertise group for Molecular and Cellular Biology, Institute for Environment, Health and Safety, Belgian Nuclear Research Centre (SCK•CEN), Boeretang 200, B-2400 Mol, Belgium. Human exploration of extreme and isolated hostile environments such as space requires special confined small volume habitats to protect and house the crew. However, human confinement in such small volume habitats has restrictions on waste disposal and personal hygiene and inevitably generates a particular community of microorganisms within the habitat. These microorganisms are mainly originating from the crew (skin, mucous membranes, upper respiratory tract, mouth, and gastrointestinal tract) but also include the residing environmental microorganisms. Earth-based confined habitats such as the Antarctic Research Station Concordia are used as test beds for long-duration spaceflights to study the physiologic and psychological adaptation to isolated environments. The dynamics of the environmental microbial population in such a test bed could render additional insights in assessing the potential health risks in long-duration space missions. Not only total bacterial contamination levels are important, but it is essential to identify also the predominant microbial taxa and their mobile genetic elements (MGE). These MGEs could be exchanged between bacteria by horizontal gene transfer and may alter the pathogenic potential since they often carry antibiotic resistance or more in general adaptation-enhancing traits. In this study several bacterial strains isolated in the Concordia research station were examined for their plasmid content. An optimized protocol for extraction of large plasmids showed the present of at least one plasmid in 50% of the strains. For all strains the minimal inhibitory concentration of a range of antibiotics was determined indicating resistance to

  15. Physical map of polyoma viral DNA fragments produced by cleavage with a restriction enzyme from Haemophilus aegyptius, endonuclease R-HaeIII.

    Science.gov (United States)

    Summers, J

    1975-04-01

    Digestion of polyoma viral DNA with a restriction enzyme from Haemophilus aegyptius generates at least 22 unique fragments. The fragments have been characterized with respect to size and physical order on the polyoma genome, and the 5' to 3' orientation of the (+) and (-) strands has been determined. A method for specific radiolabeling of adjacent fragments was employed to establish the fragment order. This technique may be useful for ordering the fragments produced by digestion of complex DNAs.

  16. Rapid isolation of plasmid DNA by LiCl-ethidium bromide treatment and gel filtration.

    Science.gov (United States)

    Kondo, T; Mukai, M; Kondo, Y

    1991-10-01

    We established a simple and rapid plasmid DNA purification method. Crude plasmid DNA preparations are treated with 4 M LiCl in the presence of 0.6 mg/ml ethidium bromide to precipitate RNA and proteins contained in the DNA preparations. After removal of RNA and protein precipitates, the supernatant is filtered through a Sepharose CL6B column to remove low-molecular-weight contaminants. This procedure takes only 30 min and provides pure plasmid DNA preparations that consist mainly of covalently closed circular plasmid DNA but have no detectable RNA and protein. The purified DNA preparations are susceptible to various six- and four-base-recognition restriction endonucleases, T4 DNA ligase, the Klenow fragment of DNA polymerase I, and T7 and Taq DNA polymerase. Since no special equipment is needed for this purification method, 20 or more samples of microgram to milligram levels can be treated in parallel.

  17. Toxin Kid uncouples DNA replication and cell division to enforce retention of plasmid R1 in Escherichia coli cells.

    Science.gov (United States)

    Pimentel, Belén; Nair, Radhika; Bermejo-Rodríguez, Camino; Preston, Mark A; Agu, Chukwuma A; Wang, Xindan; Bernal, Juan A; Sherratt, David J; de la Cueva-Méndez, Guillermo

    2014-02-18

    Worldwide dissemination of antibiotic resistance in bacteria is facilitated by plasmids that encode postsegregational killing (PSK) systems. These produce a stable toxin (T) and a labile antitoxin (A) conditioning cell survival to plasmid maintenance, because only this ensures neutralization of toxicity. Shortage of antibiotic alternatives and the link of TA pairs to PSK have stimulated the opinion that premature toxin activation could be used to kill these recalcitrant organisms in the clinic. However, validation of TA pairs as therapeutic targets requires unambiguous understanding of their mode of action, consequences for cell viability, and function in plasmids. Conflicting with widespread notions concerning these issues, we had proposed that the TA pair kis-kid (killing suppressor-killing determinant) might function as a plasmid rescue system and not as a PSK system, but this remained to be validated. Here, we aimed to clarify unsettled mechanistic aspects of Kid activation, and of the effects of this for kis-kid-bearing plasmids and their host cells. We confirm that activation of Kid occurs in cells that are about to lose the toxin-encoding plasmid, and we show that this provokes highly selective restriction of protein outputs that inhibits cell division temporarily, avoiding plasmid loss, and stimulates DNA replication, promoting plasmid rescue. Kis and Kid are conserved in plasmids encoding multiple antibiotic resistance genes, including extended spectrum β-lactamases, for which therapeutic options are scarce, and our findings advise against the activation of this TA pair to fight pathogens carrying these extrachromosomal DNAs.

  18. Study on the construction of recombinant plasmid coexpressing newcastle disease virus F protein and chicken IL-2

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    This study investigated the protection against the ND in chickens by a recombinant DNA vaccine. A plasmid vector encoding NDV F protein, which is reqired for virus cell fusion and is important for vaccine induced immunity, was used as a model to study how DNA vaccines may be modulated by the simulaneous expression of chicken IL-2. The NDV D26 strain F gene with CMV promotor and BGH polyA signal sequence was amplified by PCR from eukaryotic plasmid pcDNA-F, which contains the full-length NDV F gene, and clond into reconstructed eukaryotic plasmid pcDNA-IL2, which contains chicken IL-2 gene. Restriction endonuclease cleavage and PCR amplification showed that a bicistronic plasmid encoding NDV F gene and chicken IL-2 separately was successfully constructed. Two-week-old SPF chickens were intramuscularly innoculated the recombinant plasmid. Antibody and lymphocyte proliferative assay showed that the humoral and cellular immunity of chickens vaccinated the recombinant plasmid greatly increased compared with those innoculated only plasmid expressing NDV F protein. Challenged with the lethal dose of NDV F48E9 strain, 72% chickens vaccinated recombinant plasmid were survived, and 30% chickens vaccinated plasmid expressing F protein were survived. These results proved the adjuvant effect of chicken IL-2, and further showed that the efficacy of a DNA vaccine can be greatly improved by simultaneous expression of IL-2.

  19. Identification of two replicons in phage-plasmid P4.

    Science.gov (United States)

    Tocchetti, A; Serina, S; Terzano, S; Dehò, G; Ghisotti, D

    1998-06-05

    DNA replication of phage-plasmid P4 proceeds bidirectionally from the ori1 site (previously named ori), but requires a second cis-acting region, crr. Replication depends on the product of the P4 alpha gene, a protein with primase and helicase activity, that binds both ori1 and crr. A negative regulator of P4 DNA replication, the Cnr protein, is required for copy number control of plasmid P4. Using a plasmid complementation test for replication, we found that two replicons, both dependent on the alpha gene product, coexist in P4. The first replicon is made by the cnr and alpha genes and the ori1 and crr sites. The second is limited to the alpha and crr region. Thus, in the absence of the ori1 region, replication can initiate at a different site. By deletion mapping, a cis-acting region, ori2, essential for replication of the alpha-crr replicon was mapped within a 270-bp fragment in the first half of the alpha gene. The ori2 site was found to be dispensable in a replicon that contains ori1. A construct that besides crr and alpha carries also the cnr gene was unable to replicate, suggesting that Cnr not only controls replication from ori1, but also silences ori2.

  20. Transduction of plasmid DNA in Streptomyces spp. and related genera by bacteriophage FP43.

    Science.gov (United States)

    McHenney, M A; Baltz, R H

    1988-05-01

    A segment (hft) of bacteriophage FP43 DNA cloned into plasmid pIJ702 mediated high-frequency transduction of the resulting plasmid (pRHB101) by FP43 in Streptomyces griseofuscus. The transducing particles contained linear concatemers of plasmid DNA. Lysates of FP43 prepared on S. griseofuscus containing pRHB101 also transduced many other Streptomyces species, including several that restrict plaque formation by FP43 and at least two that produce restriction endonucleases that cut pRHB101 DNA. Transduction efficiencies in different species were influenced by the addition of anti-FP43 antiserum to the transduction plates, the temperature for cell growth before transduction, the multiplicity of infection, and the host on which the transducing lysate was prepared. FP43 lysates prepared on S. griseofuscus(pRHB101) also transduced species of Streptoverticillium, Chainia, and Saccharopolyspora.

  1. Exponential megapriming PCR (EMP) cloning--seamless DNA insertion into any target plasmid without sequence constraints.

    Science.gov (United States)

    Ulrich, Alexander; Andersen, Kasper R; Schwartz, Thomas U

    2012-01-01

    We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts.

  2. Exponential megapriming PCR (EMP cloning--seamless DNA insertion into any target plasmid without sequence constraints.

    Directory of Open Access Journals (Sweden)

    Alexander Ulrich

    Full Text Available We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts.

  3. Transformation of Azotobacter vinelandii OP with a broad host range plasmid containing a cloned chromosomal nif-DNA marker.

    Science.gov (United States)

    Bingle, W H

    1988-05-01

    The non-nitrogen-fixing (Nif-) strain UW10 of Azotobacter vinelandii OP (UW) was naturally induced to competence and transformed with broad host range plasmid pKT210 containing the cloned wild-type nif-10 locus from A. vinelandii UW (Nif+); this marker was unable to complement the nif-10 mutation in trans, but could through recombination with the chromosome. The most frequent type of transformation event observed was recombination between the homologous regions of the plasmid and chromosome (producing Nif+ transformants) with loss of the plasmid vector. At a substantially lower frequency, transformants expressing the plasmid-encoded antibiotic resistance determinants were isolated which were phenotypically Nif-. Agarose gel electrophoresis showed that these transformants contained a plasmid migrating with the same mobility as the original donor plasmid. During culture these transformants acquired a Nif+ phenotype without the loss of the plasmid, as judged by the use of a hybridization probe specific for the cloned nif-DNA fragment. These data indicate that plasmids carrying sequences homologous to chromosomal sequences could be maintained in recombination-proficient A. vinelandii UW. The introduction of plasmids containing sequences homologous to chromosomal sequences was facilitated by prelinearization of the plasmid using a restriction endonuclease generating cohesive ends. Because the site of linearization could be chosen outside the region of shared homology, it was unlikely that the route of plasmid establishment occurred via a homology-facilitated transformation mechanism. The data also indicated that A. vinelandii UW could harbor broad host range cloning vectors based on plasmid RSF1010 without significant impairment of its nitrogen-fixation ability.

  4. [Plasmid characteristics of naphthalene and salicylate biodegradation in Pseudomonas putida].

    Science.gov (United States)

    Zakharian, R A; Bakunin, K A; Gasparian, N S; Kocharian, Sh M; Arakelov, G M

    1980-01-01

    The object of this work was to study the physico-chemical and biological properties of DNAs of the biodegradation plasmids NAH and SAL. A comparative analysis of the physico-chemical parameters for these DNAs made it possible to detect a number of identical properties in them: the same sedimentation profile for covalently-closed circular DNA forms, 68--70 S; the molecular weight of ca. 50 MD; a roughly equal number of fragments (up to 23) was found when the DNAs of NAH and SAL were restricted by EcoRI endonuclease. The transformation of the plasmidless strain PpGI was done.

  5. IS-linked movement of a restriction-modification system.

    Directory of Open Access Journals (Sweden)

    Noriko Takahashi

    Full Text Available Potential mobility of restriction-modification systems has been suggested by evolutionary/bioinformatic analysis of prokaryotic genomes. Here we demonstrate in vivo movement of a restriction-modification system within a genome under a laboratory condition. After blocking replication of a temperature-sensitive plasmid carrying a PaeR7I restriction-modification system in Escherichia coli cells, the plasmid was found integrated into the chromosome of the surviving cells. Sequence analysis revealed that, in the majority of products, the restriction-modification system was linked to chromosomal insertion sequences (ISs. Three types of products were: (I apparent co-integration of the plasmid and the chromosome at a chromosomal IS1 or IS5 copy (24/28 analyzed; (II de novo insertion of IS1 with the entire plasmid except for a 1-3 bp terminal deletion (2/28; and (III reciprocal crossing-over between the plasmid and the chromosome involving 1-3 bp of sequence identity (2/28. An R-negative mutation apparently decreased the efficiency of successful integration by two orders of magnitude. Reconstruction experiments demonstrated that the restriction-dependence was mainly due to selection against cells without proper integration: their growth was inhibited by the restriction enzyme action. These results demonstrate collaboration of a mobile element and a restriction-modification system for successful joint migration. This collaboration may have promoted the spread and, therefore, the long-term persistence of these complexes and restriction-modification systems in a wide range of prokaryotes.

  6. Persistence of Antibiotic Resistance Plasmids in Biofilms

    Science.gov (United States)

    2014-10-01

    plasmids* in*populations*of* Gram > negative *bacteria*grown*in*biofilms*and*well>mixed*liquid*cultures.** * Task2:*Characterize*the*evolution*of*plasmid...R.! Edwards.! 2005.! Overview! of! nosocomial! infections! caused! by! gramP negative ! bacilli .!Clin.!Infect.!Dis.!41:848P854.! LoftiePEaton,!W.,!A... negative ! interaction!between!one!of! its!chromosomal!segments!and!the!plasmid! by!simply!deleting!the!appropriate!chromosomal!segment.!! 7. None

  7. Plasmid profiles of Moraxella bovis isolates.

    Science.gov (United States)

    McDonald, T J; Pugh, G W

    1986-04-01

    Two-hundred isolates of Moraxella bovis were selected at random and examined for the presence of plasmid DNA by a rapid alkaline-detergent lysis method. All isolates contained from 1 to 6 plasmids, with varying agarose-gel electrophoretic migration patterns. Most (80%) isolates carried 2 to 4 plasmids, which ranged in molecular weight from 2.6 to 80 megadaltons. Seemingly, plasmid profiles can be used as a simple, reliable epizootiologic tool to establish a strain identification scheme for M bovis.

  8. Plasmid transfer systems in the rhizobia.

    Science.gov (United States)

    Ding, Hao; Hynes, Michael F

    2009-08-01

    Rhizobia are agriculturally important bacteria that can form nitrogen-fixing nodules on the roots of leguminous plants. Agricultural application of rhizobial inoculants can play an important role in increasing leguminous crop yields. In temperate rhizobia, genes involved in nodulation and nitrogen fixation are usually located on one or more large plasmids (pSyms) or on symbiotic islands. In addition, other large plasmids of rhizobia carry genes that are beneficial for survival and competition of rhizobia in the rhizosphere. Conjugative transfer of these large plasmids thus plays an important role in the evolution of rhizobia. Therefore, understanding the mechanism of conjugative transfer of large rhizobial plasmids provides foundations for maintaining, monitoring, and predicting the behaviour of these plasmids during field release events. In this minireview, we summarize two types of known rhizobial conjugative plasmids, including quorum sensing regulated plasmids and RctA-repressed plasmids. We provide evidence for the existence of a third type of conjugative plasmid, including pRleVF39c in Rhizobium leguminosarum bv. viciae strain VF39SM, and we provide a comparison of the different types of conjugation genes found in members of the rhizobia that have had their genomes sequenced so far.

  9. Effect of chromosome homology an plasmid transformation and plasmid conjugal transfer in Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    Balganesh, M.; Setlow, J.K.

    1984-05-14

    The pairing between plasmid and the homologous part of the chromosome associated with plasmid establishment may differ from the pairing which results from integration of a homologous region of the plasmid into the chromosome. Thus the rate of novobiocin transformation decreases with duplication of the chromosomal portion in pMB2, but the rate of establishment of the plasmid increases with this duplication. A model to explain these data is given. 17 references, 5 figures, 4 tables.

  10. High-frequency conjugal plasmid transfer from gram-negative Escherichia coli to various gram-positive coryneform bacteria.

    Science.gov (United States)

    Schäfer, A; Kalinowski, J; Simon, R; Seep-Feldhaus, A H; Pühler, A

    1990-03-01

    We report on the mobilization of shuttle plasmids from gram-negative Escherichia coli to gram-positive corynebacteria mediated by P-type transfer functions. Introduction of plasmids into corynebacteria was markedly enhanced after heat treatment of the recipient cells. High-frequency plasmid transfer was also observed when the restriction system of the recipient was mutated. On the basis of our data, we conclude that efficient DNA transfer from gram-negative to gram-positive bacteria, at least to coryneform bacteria, is conceivable in certain natural ecosystems.

  11. The expression of a plasmid-specified exported protein causes structural plasmid instability in Bacillus subtilis

    NARCIS (Netherlands)

    Cordes, C.; Meima, R; Twiest, B; Kazemier, B; Venema, G; vanDijl, JM; Bron, S

    The rolling-circle plasmid pGP1 was used to study the effects of the expression of a plasmid-specified exported protein on structural plasmid stability in Bacillus subtilis. pGP1 contains a fusion between the Bacillus licheniformis penP gene, encoding a C-terminally truncated penicillinase, and the

  12. Recursive directional ligation by plasmid reconstruction allows rapid and seamless cloning of oligomeric genes.

    Science.gov (United States)

    McDaniel, Jonathan R; Mackay, J Andrew; Quiroz, Felipe García; Chilkoti, Ashutosh

    2010-04-12

    This paper reports a new strategy, recursive directional ligation by plasmid reconstruction (PRe-RDL), to rapidly clone highly repetitive polypeptides of any sequence and specified length over a large range of molecular weights. In a single cycle of PRe-RDL, two halves of a parent plasmid, each containing a copy of an oligomer, are ligated together, thereby dimerizing the oligomer and reconstituting a functional plasmid. This process is carried out recursively to assemble an oligomeric gene with the desired number of repeats. PRe-RDL has several unique features that stem from the use of type IIs restriction endonucleases: first, PRe-RDL is a seamless cloning method that leaves no extraneous nucleotides at the ligation junction. Because it uses type IIs endonucleases to ligate the two halves of the plasmid, PRe-RDL also addresses the major limitation of RDL in that it abolishes any restriction on the gene sequence that can be oligomerized. The reconstitution of a functional plasmid only upon successful ligation in PRe-RDL also addresses two other limitations of RDL: the significant background from self-ligation of the vector observed in RDL, and the decreased efficiency of ligation due to nonproductive circularization of the insert. PRe-RDL can also be used to assemble genes that encode different sequences in a predetermined order to encode block copolymers or append leader and trailer peptide sequences to the oligomerized gene.

  13. The pPSU Plasmids for Generating DNA Molecular Weight Markers.

    Science.gov (United States)

    Henrici, Ryan C; Pecen, Turner J; Johnston, James L; Tan, Song

    2017-05-26

    Visualizing nucleic acids by gel electrophoresis is one of the most common techniques in molecular biology, and reference molecular weight markers or ladders are commonly used for size estimation. We have created the pPSU1 & pPSU2 pair of molecular weight marker plasmids which produce both 100 bp and 1 kb DNA ladders when digested with two common restriction enzymes. The 100 bp ladder fragments have been optimized to migrate appropriately on both agarose and native polyacrylamide, unlike many currently available DNA ladders. Sufficient plasmid DNA can be isolated from 100 ml E. coli cultures for the two plasmids to produce 100 bp or 1 kb ladders for 1000 gels. As such, the pPSU1 and pPSU2 plasmids provide reference fragments from 50 to 10000 bp at a fraction of the cost of commercial DNA ladders. The pPSU1 and pPSU2 plasmids are available without licensing restrictions to nonprofit academic users, affording freely available high-quality, low-cost molecular weight standards for molecular biology applications.

  14. Plasmid construction using recombination activity in the fission yeast Schizosaccharomyces pombe.

    Directory of Open Access Journals (Sweden)

    Ayako Chino

    Full Text Available BACKGROUND: Construction of plasmids is crucial in modern genetic manipulation. As of now, the common method for constructing plasmids is to digest specific DNA sequences with restriction enzymes and to ligate the resulting DNA fragments with DNA ligase. Another potent method to construct plasmids, known as gap-repair cloning (GRC, is commonly used in the budding yeast Saccharomyces cerevisiae. GRC makes use of the homologous recombination activity that occurs within the yeast cells. Due to its flexible design and efficiency, GRC has been frequently used for constructing plasmids with complex structures as well as genome-wide plasmid collections. Although there have been reports indicating GRC feasibility in the fission yeast Schizosaccharomyces pombe, this species is not commonly used for GRC as systematic studies of reporting GRC efficiency in S. pombe have not been performed till date. METHODOLOGY/PRINCIPAL FINDINGS: We investigated GRC efficiency in S. pombe in this study. We first showed that GRC was feasible in S. pombe by constructing a plasmid that contained the LEU2 auxotrophic marker gene in vivo and showed sufficient efficiency with short homology sequences (>25 bp. No preference was shown for the sequence length from the cut site in the vector plasmid. We next showed that plasmids could be constructed in a proper way using 3 DNA fragments with 70% efficiency without any specific selections being made. The GRC efficiency with 3 DNA fragments was dramatically increased >95% in lig4Delta mutant cell, where non-homologous end joining is deficient. Following this approach, we successfully constructed plasmid vectors with leu1+, ade6+, his5+, and lys1+ markers with the low-copy stable plasmid pDblet as a backbone by applying GRC in S. pombe. CONCLUSIONS/SIGNIFICANCE: We concluded that GRC was sufficiently feasible in S. pombe for genome-wide gene functional analysis as well as for regular plasmid construction. Plasmids with different

  15. Purification of transfection-grade plasmid DNA from bacterial cells with superparamagnetic nanoparticles

    Science.gov (United States)

    Chiang, Chen-Li; Sung, Ching-Shan

    2006-07-01

    The functionalized magnetic nanobeads were used to develop a rapid protocol for extracting and purifying transfection-grade plasmid DNA from bacterial culture. Nanosized superparamagnetic nanoparticles (Fe 3O 4) were prepared by chemical coprecipitation method using Fe 2+, Fe 3+ salt, and ammonium hydroxide under a nitrogen atmosphere. The surface of Fe 3O 4 nanoparticles was modified by coating with the multivalent cationic agent, polyethylenimine (PEI). The PEI-modified magnetic nanobeads were employed to simplify the purification of plasmid DNA from bacterial cells. We demonstrated a useful plasmid, pRSETB-EGFP, encoding the green fluorescent protein with T7 promoter, was amplified in DE3 strain of Escherichia coli. The loaded nanobeads are recovered by magnetically driven separation and regenerated by exposure to the elution buffer with optimal ionic strength (1.25 M) and pH (9.0). Up to approximately 819 μg of high-purity (A 260/A 280 ratio=1.86) plasmid DNA was isolated from 100 ml of overnight bacterial culture. The eluted plasmid DNA was used directly for restriction enzyme digestion, bacterial cell transformation and animal cell transfection applications with success. The PEI-modified magnetic nanobead delivers significant time-savings, overall higher yields and better transfection efficiencies compared to anion-exchange and other methods. The results presented in this report show that PEI-modified magnetic nanobeads are suitable for isolation and purification of transfection-grade plasmid DNA.

  16. Position effect on expression of dsd genes cloned onto multicopy plasmids.

    Science.gov (United States)

    Carothers, A M; Heincz, M C; McFall, E

    1980-04-01

    In the D-serine deaminase system of Escherichia coli, which is regulated by positive control, we have fouand a complete lack of trans activation in vivo with multicopy dsd hybrid plasmids. A PLASmid carrying the regulatory gene, dsdC+, did not promote expression of chromosomal dsdCO+A+ loci, nor did a chromosomal dsdC+ gene promote expression of plasmid-borne dsdC delta O+A+ (dsd regulatory gene negative) restriction fragments. However, hybrid plasmids that comprise the entire dsd system (dsdC+O+A+) are highly inducible for the enzyme. These dsd hybrid plasmid deoxyribonucleic acids functioned well as templates in the in vitro coupled transcription-translation system. In vitro-synthesized dsdC+ protein promoted expression of the dsdA+ operation efficiently. Exogenously purified dsdC+ protein also activated expression of several dsdC delta O+A+ plasmid deoxyribonucleic acid templates in vitro. An explanation that reconciles these results with previous dominance studies is presented.

  17. Integration host factor is required for replication of pYGK-derived plasmids in Aggregatibacter actinomycetemcomitans.

    Science.gov (United States)

    Torres-Escobar, Ascención; Juárez-Rodríguez, María D; Demuth, Donald R

    2014-08-01

    In this study, we show that integration host factor protein (IHF) is required for replication of pYGK plasmids in Aggregatibacter actinomycetemcomitans. YGK plasmids were not replicated in A. actinomycetemcomitans strains lacking either the α- or β- subunit of IHF. However, the deletion mutants were complemented, and plasmid replication was restored when the promoter region and gene for either ihfA or ihfB was cloned into pYGK. We also identified two motifs that resemble the consensus IHF-binding site in a 813-bp fragment containing the pYGK origin of replication. Using electrophoretic mobility shift assays, purified IHFα-IHFβ protein complex was shown to bind to probes containing either of these motifs. To our knowledge, this is the first report showing that plasmid replication is IHF-dependent in the family Pasteurellaceae. In addition, using site-direct mutagenesis, the XbaI and KpnI restriction sites in the suicide vector pJT1 were modified to generate plasmid pJT10. The introduction of these new unique sites in pJT10 facilitates the transfer of transcriptional or translational lacZ fusion constructs for the generation of single-copy chromosomal insertion of the reporter construct. Plasmid pJT10 and its derivatives will be useful for genetic studies in Aggregatibacter (Actinobacillus) and probably other genera of Pasteurellaceae, including Haemophilus, Pasteurella, and Mannheimia.

  18. Mapping the carriage of flaA-restriction fragment length polymorphism Campylobacter genotypes on poultry carcasses through the processing chain and comparison to clinical isolates.

    Science.gov (United States)

    Duffy, Lesley L; Blackall, Patrick J; Cobbold, Rowland N; Fegan, Narelle

    2015-06-01

    Poultry are considered a major source for campylobacteriosis in humans. A total of 1866 Campylobacter spp. isolates collected through the poultry processing chain were typed using flaA-restriction fragment length polymorphism to measure the impact of processing on the genotypes present. Temporally related human clinical isolates (n = 497) were also typed. Isolates were obtained from whole chicken carcass rinses of chickens collected before scalding, after scalding, before immersion chilling, after immersion chilling and after packaging as well as from individual caecal samples. A total of 32 genotypes comprising at least four isolates each were recognised. Simpson's Index of Diversity (D) was calculated for each sampling site within each flock, for each flock as a whole and for the clinical isolates. From caecal collection to after packaging samples the D value did not change in two flocks, decreased in one flock and increased in the fourth flock. Dominant genotypes occurred in each flock but their constitutive percentages changed through processing. There were 23 overlapping genotypes between clinical and chicken isolates. The diversity of Campylobacter is flock dependant and may alter through processing. This study confirms that poultry are a source of campylobacteriosis in the Australian population although other sources may contribute. Crown Copyright © 2014. Published by Elsevier Ltd. All rights reserved.

  19. Transposon insertion reveals pRM, a plasmid of Rickettsia monacensis.

    Science.gov (United States)

    Baldridge, Gerald D; Burkhardt, Nicole Y; Felsheim, Roderick F; Kurtti, Timothy J; Munderloh, Ulrike G

    2007-08-01

    Until the recent discovery of pRF in Rickettsia felis, the obligate intracellular bacteria of the genus Rickettsia (Rickettsiales: Rickettsiaceae) were thought not to possess plasmids. We describe pRM, a plasmid from Rickettsia monacensis, which was detected by pulsed-field gel electrophoresis and Southern blot analyses of DNA from two independent R. monacensis populations transformed by transposon-mediated insertion of coupled green fluorescent protein and chloramphenicol acetyltransferase marker genes into pRM. Two-dimensional electrophoresis showed that pRM was present in rickettsial cells as circular and linear isomers. The 23,486-nucleotide (31.8% G/C) pRM plasmid was cloned from the transformant populations by chloramphenicol marker rescue of restriction enzyme-digested transformant DNA fragments and PCR using primers derived from sequences of overlapping restriction fragments. The plasmid was sequenced. Based on BLAST searches of the GenBank database, pRM contained 23 predicted genes or pseudogenes and was remarkably similar to the larger pRF plasmid. Two of the 23 genes were unique to pRM and pRF among sequenced rickettsial genomes, and 4 of the genes shared by pRM and pRF were otherwise found only on chromosomes of R. felis or the ancestral group rickettsiae R. bellii and R. canadensis. We obtained pulsed-field gel electrophoresis and Southern blot evidence for a plasmid in R. amblyommii isolate WB-8-2 that contained genes conserved between pRM and pRF. The pRM plasmid may provide a basis for the development of a rickettsial transformation vector.

  20. Erwinia amylovora novel plasmid pEI70: complete sequence, biogeography, and role in aggressiveness in the fire blight phytopathogen.

    Directory of Open Access Journals (Sweden)

    Pablo Llop

    Full Text Available Comparative genomics of several strains of Erwinia amylovora, a plant pathogenic bacterium causal agent of fire blight disease, revealed that its diversity is primarily attributable to the flexible genome comprised of plasmids. We recently identified and sequenced in full a novel 65.8 kb plasmid, called pEI70. Annotation revealed a lack of known virulence-related genes, but found evidence for a unique integrative conjugative element related to that of other plant and human pathogens. Comparative analyses using BLASTN showed that pEI70 is almost entirely included in plasmid pEB102 from E. billingiae, an epiphytic Erwinia of pome fruits, with sequence identities superior to 98%. A duplex PCR assay was developed to survey the prevalence of plasmid pEI70 and also that of pEA29, which had previously been described in several E. amylovora strains. Plasmid pEI70 was found widely dispersed across Europe with frequencies of 5-92%, but it was absent in E. amylovora analyzed populations from outside of Europe. Restriction analysis and hybridization demonstrated that this plasmid was identical in at least 13 strains. Curing E. amylovora strains of pEI70 reduced their aggressiveness on pear, and introducing pEI70 into low-aggressiveness strains lacking this plasmid increased symptoms development in this host. Discovery of this novel plasmid offers new insights into the biogeography, evolution and virulence determinants in E. amylovora.

  1. Erwinia amylovora novel plasmid pEI70: complete sequence, biogeography, and role in aggressiveness in the fire blight phytopathogen.

    Science.gov (United States)

    Llop, Pablo; Cabrefiga, Jordi; Smits, Theo H M; Dreo, Tanja; Barbé, Silvia; Pulawska, Joanna; Bultreys, Alain; Blom, Jochen; Duffy, Brion; Montesinos, Emilio; López, María M

    2011-01-01

    Comparative genomics of several strains of Erwinia amylovora, a plant pathogenic bacterium causal agent of fire blight disease, revealed that its diversity is primarily attributable to the flexible genome comprised of plasmids. We recently identified and sequenced in full a novel 65.8 kb plasmid, called pEI70. Annotation revealed a lack of known virulence-related genes, but found evidence for a unique integrative conjugative element related to that of other plant and human pathogens. Comparative analyses using BLASTN showed that pEI70 is almost entirely included in plasmid pEB102 from E. billingiae, an epiphytic Erwinia of pome fruits, with sequence identities superior to 98%. A duplex PCR assay was developed to survey the prevalence of plasmid pEI70 and also that of pEA29, which had previously been described in several E. amylovora strains. Plasmid pEI70 was found widely dispersed across Europe with frequencies of 5-92%, but it was absent in E. amylovora analyzed populations from outside of Europe. Restriction analysis and hybridization demonstrated that this plasmid was identical in at least 13 strains. Curing E. amylovora strains of pEI70 reduced their aggressiveness on pear, and introducing pEI70 into low-aggressiveness strains lacking this plasmid increased symptoms development in this host. Discovery of this novel plasmid offers new insights into the biogeography, evolution and virulence determinants in E. amylovora.

  2. Restricted Mobilities

    DEFF Research Database (Denmark)

    Nielsen, Mette; Lassen, Claus

    2012-01-01

    communities and shopping centres through mobility lenses. The article shows how different mobility systems enable and restrict the public access to private-public spaces, and it points out that proprietary communities create an unequal potential for human movement and access in the city. The main argument......Privatisation of public spaces in the contemporary city has increased during the last decades but only few studies have approached this field from a mobility perspective. Therefore the article seeks to rectify this by exploring two Australian examples of private spaces in the city; gated...... in the article is that the many mobility systems enable specialization of places that are targeted at a special section of the population. This means that various forms of motilities not only create new opportunities for urban life but it is also one of the most critical components of production of new exclusion...

  3. Molecular mapping of chromosomes 17 and X

    Energy Technology Data Exchange (ETDEWEB)

    Barker, D.F.

    1991-01-15

    Progress toward the construction of high density genetic maps of chromosomes 17 and X has been made by isolating and characterizing a relatively large set of polymorphic probes for each chromosome and using these probes to construct genetic maps. We have mapped the same polymorphic probes against a series of chromosome breakpoints on X and 17. The probes could be assigned to over 30 physical intervals on the X chromosome and 7 intervals on 17. In many cases, this process resulted in improved characterization of the relative locations of the breakpoints with respect to each other and the definition of new physical intervals. The strategy for isolation of the polymorphic clones utilized chromosome specific libraries of 1--15 kb segments from each of the two chromosomes. From these libraries, clones were screened for those detecting restriction fragment length polymorphisms. The markers were further characterized, the chromosomal assignments confirmed and in most cases segments of the original probes were subcloned into plasmids to produce probes with improved signal to noise ratios for use in the genetic marker studies. The linkage studies utilize the CEPH reference families and other well-characterized families in our collection which have been used for genetic disease linkage work. Preliminary maps and maps of portions of specific regions of 17 and X are provided. We have nearly completed a map of the 1 megabase Mycoplasma arthritidis genome by applying these techniques to a lambda phage library of its genome. We have found bit mapping to be an efficient means to organize a contiguous set of overlapping clones from a larger genome.

  4. Evidence that plasmid-borne botulinum neurotoxin type B genes are widespread among Clostridium botulinum serotype B strains.

    Directory of Open Access Journals (Sweden)

    Giovanna Franciosa

    Full Text Available BACKGROUND: Plasmids that encode certain subtypes of the botulinum neurotoxin type B have recently been detected in some Clostridium botulinum strains. The objective of the present study was to investigate the frequency with which plasmid carriage of the botulinum neurotoxin type B gene (bont/B occurs in strains of C. botulinum type B, Ab, and A(B, and whether plasmid carriage is bont/B subtype-related. METHODOLOGY/PRINCIPAL FINDINGS: PCR-Restriction fragment length polymorphism was employed to identify subtypes of the bont/B gene. Pulsed-field gel electrophoresis and Southern blot hybridization with specific probes were performed to analyze the genomic location of the bont/B subtype genes. All five known bont/B subtype genes were detected among the strains; the most frequently detected subtype genes were bont/B1 and /B2. Surprisingly, the bont/B subtype gene was shown to be plasmid-borne in >50% of the total strains. The same bont/B subtype gene was associated with the chromosome in some strains, whereas it was associated with a plasmid in others. All five known bont/B subtype genes were in some cases found to reside on plasmids, though with varying frequency (e.g., most of the bont/B1 subtype genes were located on plasmids, whereas all but one of the bont/B2 subtypes were chromosomally-located. Three bivalent isolates carried both bont/A and /B genes on the same plasmid. The plasmids carrying the bont gene were five different sizes, ranging from approximately 55 kb to approximately 245 kb. CONCLUSIONS/SIGNIFICANCE: The unexpected finding of the widespread distribution of plasmids harboring the bont/B gene among C. botulinum serotype B strains provides a chance to examine their contribution to the dissemination of the bont genes among heterogeneous clostridia, with potential implications on issues related to pathogenesis and food safety.

  5. Sequence-specific interactions of minor groove binders with restriction fragments of cDNAs for H tau 40 protein and MAP kinase 2. A qualitative and quantitative footprinting study.

    Science.gov (United States)

    Kittler, L; Baguley, B C; Löber, G; Waring, M J

    1999-01-01

    A series of DNA minor groove binders comprising netropsin, distamycin, the bisquaternary ammonium heterocycles SN 6999 and SN 6570, cis-diammine platinum(II)-bridged bis-netropsin, cis-diammine platinum(II)-bridged bis-distamycin and bis-glycine-linked bis-distamycin were investigated for sequence-specific interactions. The oligonucleotides used were the 154 base pair HindIII-RsaI restriction fragment of cDNA of h tau 40 protein and the 113 base pair NcoI-PvuII restriction fragment of cDNA of MAP kinase 2. Both proteins are believed to be involved in the pathology of Alzheimer's disease. For all these ligands, binding sites were localised at positions 1134-1139 (5'AATCTT3'), 1152-1156 (5'ATATT3') and 1178-1194 (5'TTTCAATCTTTTTATTT3') for the former and 720-726 (5'TATTCTT3'), 751-771 (5'AATTGTATAATAAATTTAAAA3') and 781-785 (5'TATTT3') for the latter. The AT-preference of ligand binding was obvious and footprint titration experiments were applied to estimate binding constants (Ka) for each individual binding site mentioned above. The binding strength decreases in the order netropsin > distamycin > SN 6999 approximately SN 6570>platinum-bridged netropsin or distamycin approximately bis-glycine-bridged distamycin and was found independently of the binding sites examined. GC-base pairs interspersed in short AT-tracts reduced the Ka-values by as much as two orders of magnitudes. The dependence of extended bidentate as well as of monodentate binding of netropsin and distamycin derivatives on the length of AT-stretches has been discussed.

  6. Cereulide synthetase gene cluster from emetic Bacillus cereus: Structure and location on a mega virulence plasmid related to Bacillus anthracis toxin plasmid pXO1

    Directory of Open Access Journals (Sweden)

    Wagner Martin

    2006-03-01

    Full Text Available Abstract Background Cereulide, a depsipeptide structurally related to valinomycin, is responsible for the emetic type of gastrointestinal disease caused by Bacillus cereus. Recently, it has been shown that this toxin is produced by a nonribosomal peptide synthetase (NRPS, but its exact genetic organization and biochemical synthesis is unknown. Results The complete sequence of the cereulide synthetase (ces gene cluster, which encodes the enzymatic machinery required for the biosynthesis of cereulide, was dissected. The 24 kb ces gene cluster comprises 7 CDSs and includes, besides the typical NRPS genes like a phosphopantetheinyl transferase and two CDSs encoding enzyme modules for the activation and incorporation of monomers in the growing peptide chain, a CDS encoding a putative hydrolase in the upstream region and an ABC transporter in the downstream part. The enzyme modules responsible for incorporation of the hydroxyl acids showed an unusual structure while the modules responsible for the activation of the amino acids Ala and Val showed the typical domain organization of NRPS. The ces gene locus is flanked by genetic regions with high homology to virulence plasmids of B. cereus, Bacillus thuringiensis and Bacillus anthracis. PFGE and Southern hybridization showed that the ces genes are restricted to emetic B. cereus and indeed located on a 208 kb megaplasmid, which has high similarities to pXO1-like plasmids. Conclusion The ces gene cluster that is located on a pXO1-like virulence plasmid represents, beside the insecticidal and the anthrax toxins, a third type of B. cereus group toxins encoded on megaplasmids. The ces genes are restricted to emetic toxin producers, but pXO1-like plasmids are also present in emetic-like strains. These data might indicate the presence of an ancient plasmid in B. cereus which has acquired different virulence genes over time. Due to the unusual structure of the hydroxyl acid incorporating enzyme modules of Ces

  7. Prevalence and molecular characterization of plasmid- mediated ...

    African Journals Online (AJOL)

    lactamase genes among nosocomial Staphylococcus aureus drug resistance isolates in Taiwan. .... Table 2: Plasmid profiles of the clinical antibiotic-resistant pathogens. Strain. Profile .... Madec J. Characterization of clinical canine methicillin-.

  8. antimicrobial susceptibility and plasmids from escherichia coli ...

    African Journals Online (AJOL)

    2001-10-10

    Oct 10, 2001 ... transmission to humans of E. coli containing antibiotic resistance plasmids ... resistant micro-organisms, which may in turn transfer resistance to .... cells were washed with sterile normal saline to remove leached. Я-lactamase ...

  9. Characterization of the replication and stability regions of Agrobacterium tumefaciens plasmid pTAR.

    OpenAIRE

    Gallie, D R; Zaitlin, D; Perry, K L; Kado, C I

    1984-01-01

    A 5.4-kilobase region containing the origin of replication and stability maintenance of the 44-kilobase Agrobacterium tumefaciens plasmid pTAR has been mapped and characterized. Within this region is a 1.3-kilobase segment that is capable of directing autonomous replication. The remaining segment contains the stability locus for maintenance of pTAR during nonselective growth. Approximately 35% of pTAR shares sequence homology with pAg119, a 44-kilobase cryptic plasmid in grapevine strain 1D11...

  10. Physical mapping of the Escherichia coli D-serine deaminase region: contiguity of the dsd structural and regulatory genes.

    Science.gov (United States)

    Carothers, A M; McFall, E; Palchaudhuri, S

    1980-04-01

    The genes dsdA, dsdO, and dsdC have been located on a 3.0-kilobase pair (kb) fragment of the Escherichia coli chromosome by a combination of techniques. The loci were first cloned onto lambda and various plasmid vectors. dsd hybrid plasmids were then digested with restriction enzymes, and the fragments were recloned to test for the presence of dsdC or dsdA. In one case, a 4.2-kb restriction fragment containing the dsdA operon was used to form a heteroduplex with a well-defined lambda dsd deoxyribonucleic acid. The results show that dsdA, dsdO, and at least 0.6 kb of dsdC are present on this piece of deoxyribonucleic acid. On the basis of the mapping analysis and the molecular weight of D-serine deaminase, 1.9 kb of the 4.2-kb fragment is accounted for by the three dsd loci. We conclude that dsdO and dsdC are contiguous. A detailed dsd restriction map is presented.

  11. Plasmids of psychrophilic and psychrotolerant bacteria and their role in adaptation to cold environments.

    Science.gov (United States)

    Dziewit, Lukasz; Bartosik, Dariusz

    2014-01-01

    Extremely cold environments are a challenge for all organisms. They are mostly inhabited by psychrophilic and psychrotolerant bacteria, which employ various strategies to cope with the cold. Such harsh environments are often highly vulnerable to the influence of external factors and may undergo frequent dynamic changes. The rapid adjustment of bacteria to changing environmental conditions is crucial for their survival. Such "short-term" evolution is often enabled by plasmids-extrachromosomal replicons that represent major players in horizontal gene transfer. The genomic sequences of thousands of microorganisms, including those of many cold-active bacteria have been obtained over the last decade, but the collected data have yet to be thoroughly analyzed. This report describes the results of a meta-analysis of the NCBI sequence databases to identify and characterize plasmids of psychrophilic and psychrotolerant bacteria. We have performed in-depth analyses of 66 plasmids, almost half of which are cryptic replicons not exceeding 10 kb in size. Our analyses of the larger plasmids revealed the presence of numerous genes, which may increase the phenotypic flexibility of their host strains. These genes encode enzymes possibly involved in (i) protection against cold and ultraviolet radiation, (ii) scavenging of reactive oxygen species, (iii) metabolism of amino acids, carbohydrates, nucleotides and lipids, (iv) energy production and conversion, (v) utilization of toxic organic compounds (e.g., naphthalene), and (vi) resistance to heavy metals, metalloids and antibiotics. Some of the plasmids also contain type II restriction-modification systems, which are involved in both plasmid stabilization and protection against foreign DNA. Moreover, approx. 50% of the analyzed plasmids carry genetic modules responsible for conjugal transfer or mobilization for transfer, which may facilitate the spread of these replicons among various bacteria, including across species boundaries.

  12. Plasmid and chromosome segregation in prokaryotes

    DEFF Research Database (Denmark)

    Møller-Jensen, Jakob; Bugge Jensen, Rasmus; Gerdes, Kenn

    2000-01-01

    Recent major advances in the understanding of prokaryotic DNA segregation have been achieved by using fluorescence microscopy to visualize the localization of cellular components. Plasmids and bacterial chromosomes are partitioned in a highly dynamic fashion, suggesting the presence of a mitotic......-like apparatus in prokaryotes. The identification of chromosomal homologues of the well-characterized plasmid partitioning genes indicates that there could be a general mechanism of bacterial DNA partitioning. Udgivelsesdato: July 1...

  13. Curing of plasmid pXO1 from Bacillus anthracis using plasmid incompatibility.

    Directory of Open Access Journals (Sweden)

    Xiankai Liu

    Full Text Available The large plasmid pXO1 encoding the anthrax toxin is important for the virulence of Bacillus anthracis. It is essential to cure pXO1 from B. anthracis to evaluate its role in the pathogenesis of anthrax infection. Because conventional methods for curing plasmids (e.g., curing agents or growth at elevated temperatures can induce mutations in the host chromosomal DNA, we developed a specific and reliable method to eliminate pXO1 from B. anthracis using plasmid incompatibility. Three putative replication origins of pXO1 were inserted into a temperature-sensitive plasmid to generate three incompatible plasmids. One of the three plasmids successfully eliminated the large plasmid pXO1 from B. anthracis vaccine strain A16R and wild type strain A16. These findings provided additional information about the replication/partitioning of pXO1 and demonstrated that introducing a small incompatible plasmid can generate plasmid-cured strains of B. anthracis without inducing spontaneous mutations in the host chromosome.

  14. Characterization of Plasmid pPO1 from the Hyperacidophile Picrophilus oshimae

    Directory of Open Access Journals (Sweden)

    Angel Angelov

    2011-01-01

    Full Text Available Picrophilus oshimae and Picrophilus torridus are free-living, moderately thermophilic and acidophilic organisms from the lineage of Euryarchaeota. With a pH optimum of growth at pH 0.7 and the ability to even withstand molar concentrations of sulphuric acid, these organisms represent the most extreme acidophiles known. So far, nothing is known about plasmid biology in these hyperacidophiles. Also, there are no genetic tools available for this genus. We have mobilized the 7.6 Kbp plasmid from P. oshimae in E. coli by introducing origin-containing transposons and described the plasmid in terms of its nucleotide sequence, copy number in the native host, mode of replication, and transcriptional start sites of the encoded ORFs. Plasmid pPO1 may encode a restriction/modification system in addition to its replication functions. The information gained from the pPO1 plasmid may prove useful in developing a cloning system for this group of extreme acidophiles.

  15. Characterization of KfrA proteins encoded by a plasmid of Paenibacillus popilliae ATCC 14706T

    Directory of Open Access Journals (Sweden)

    Kazuhiro Iiyama

    2015-06-01

    Full Text Available A scaffold obtained from whole-genome shotgun sequencing of Paenibacillus popilliae ATCC 14706T shares partial homology with plasmids found in other strains of P. popilliae. PCR and sequencing for gap enclosure indicated that the scaffold originated from a 15,929-bp circular DNA. The restriction patterns of a plasmid isolated from P. popilliae ATCC 14706T were identical to those expected from the sequence; thus, this circular DNA was identified as a plasmid of ATCC 14706T and designated pPOP15.9. The plasmid encodes 17 putative open reading frames. Orfs 1, 5, 7, 8, and 9 are homologous to Orfs 11, 12, 15, 16, and 17, respectively. Orf1 and Orf11 are annotated as replication initiation proteins. Orf8 and Orf16 are homologs of KfrA, a plasmid-stabilizing protein in Gram-negative bacteria. Recombinant Orf8 and Orf16 proteins were assessed for the properties of KfrA. Indeed, they formed multimers and bound to inverted repeat sequences in upstream regions of both orf8 and orf16. A phylogenetic tree based on amino acid sequences of Orf8, Orf16 and Kfr proteins did not correlate with species lineage.

  16. Construction of a novel kind of expression plasmid by homologous recombination in Saccharomyces cerevisiae

    Institute of Scientific and Technical Information of China (English)

    CHEN Xiangling; YUAN Hanying; HE Wei; HU Xianghua; LU Hong; LI Yuyang

    2005-01-01

    Based on a previously used plasmid pHC11, a new plasmid pHC11R was constructed. Cutting plasmid pHC11R with proper restriction enzymes, the resulting larger DNA fragment pHC11R' was co-transformed with a PCR amplified expression cassette of human IFNα2b into yeast. By means of the homologous sequences at both ends of two DNA fragments, a novel expression plasmid pHC11R-IFNα2b was formed via homologous recombination in the yeast. Compared with pHC11-IFNα2b, the expression plasmid pHC11R-IFNα2b was smaller in size and in absence of antibiotic resistant gene. The stability and copy number of pHC11R- IFNα2b were greatly increased and the expression level of heterologous protein was improved. As the derivatives of pHC11R, a series of recombination expression vectors pHRs containing different combination of expression elements were developed. This led to a rapid and powerful method for cloning and expressing of different genes in yeast.

  17. Construction of a recombinant bacterial plasmid containing DNA sequences for a mouse embryonic globin chain.

    Science.gov (United States)

    Fantoni, A; Bozzoni, I; Ullu, E; Farace, M G

    1979-08-10

    Messenger RNAs for mouse embryonic globins were purified from yolk sac derived eyrthroid cells in mouse fetuses. Double stranded DNAs complementary to these messengers were synthesized and blunt end ligated to a EcoRI digested and DNA polymerase I repaired pBR322 plasmid. Of the ampicillin resistant transformants, one contained a plasmid with globin-specific cDNA. The inserted sequence is about 350 base pairs long. It contains one restriction site for EcoRI and one restriction site for HinfI about 170 and 80 base pairs from one end. The insert is not cleaved by HindIII, HindII, BamHI, PstI, SalI, AvaI, TaqI, HpaII, BglI. A mixture of purified messengers coding for alpha chains and for x, y and z embryonic chains was incubated with the recombinant plasmid and the hybridized messenger was translated in a mRNA depleted reticulocyte lysate protein synthesizing system. The product of translation was identified as a z chain by carboxymethylcellulose cromatography. The recombinant plasmid is named "pBR322-egz" after embryonic globin z.

  18. Multiple plasmid interference - Pledging allegiance to my enemy's enemy.

    Science.gov (United States)

    Gama, João Alves; Zilhão, Rita; Dionisio, Francisco

    2017-08-24

    As shown in the previous article, two distinct conjugative plasmids sometimes interact within bacterial cells, implicating changes of transfer rates. In most cases of interactions within bacteria, the transfer of one of the plasmids decreases. Less frequently, the transfer rate of one of the plasmids increases. Here we analyse what happens if three distinct conjugative plasmids colonize the same bacterial cell. Our aim is to understand how interactions between two plasmids affect the transfer rate of the third plasmid. After showing that plasmids interact in 59 out of 84 possible interactions we show that, with some exceptions, if the transfer rate of a plasmid decreases in the presence of a second plasmid, a decrease is also observed in the presence of a third plasmid. Moreover, if the conjugation rate of a plasmid increases in the presence of another, an increase is also observed if there is a third plasmid in the cell. Both types of interactions are mostly independent of the third plasmid's identity, even if sometimes the third plasmid quantitatively distorts the interaction of the other two plasmids. There is a bias towards negative intensifying interactions, which provide good news concerning the spread conjugative plasmids encoding antibiotic-resistance genes and virulence factors. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Clostridium perfringens type A–E toxin plasmids

    Science.gov (United States)

    Freedman, John C.; Theoret, James R.; Wisniewski, Jessica A.; Uzal, Francisco A.; Rood, Julian I.; McClane, Bruce A.

    2014-01-01

    Clostridium perfringens relies upon plasmid-encoded toxin genes to cause intestinal infections. These toxin genes are associated with insertion sequences that may facilitate their mobilization and transfer, giving rise to new toxin plasmids with common backbones. Most toxin plasmids carry a transfer of clostridial plasmids locus mediating conjugation, which likely explains the presence of similar toxin plasmids in otherwise unrelated C. perfringens strains. The association of many toxin genes with insertion sequences and conjugative plasmids provides virulence flexibility when causing intestinal infections. However, incompatibility issues apparently limit the number of toxin plasmids maintained by a single cell. PMID:25283728

  20. Conjugative transfer of an IncA/C plasmid-borne blaCMY-2 gene through genetic re-arrangements with an IncX1 plasmid.

    Science.gov (United States)

    Wiesner, Magdalena; Fernández-Mora, Marcos; Cevallos, Miguel A; Zavala-Alvarado, Crispín; Zaidi, Mussaret B; Calva, Edmundo; Silva, Claudia

    2013-11-21

    Our observation that in the Mexican Salmonella Typhimurium population none of the ST19 and ST213 strains harbored both the Salmonella virulence plasmid (pSTV) and the prevalent IncA/C plasmid (pA/C) led us to hypothesize that restriction to horizontal transfer of these plasmids existed. We designed a conjugation scheme using ST213 strain YU39 as donor of the blaCMY-2 gene (conferring resistance to ceftriaxone; CRO) carried by pA/C, and two E. coli lab strains (DH5α and HB101) and two Typhimurium ST19 strains (SO1 and LT2) carrying pSTV as recipients. The aim of this study was to determine if the genetic background of the different recipient strains affected the transfer frequencies of pA/C. YU39 was able to transfer CRO resistance, via a novel conjugative mechanism, to all the recipient strains although at low frequencies (10-7 to 10-10). The presence of pSTV in the recipients had little effect on the conjugation frequency. The analysis of the transconjugants showed that three different phenomena were occurring associated to the transfer of blaCMY-2: 1) the co-integration of pA/C and pX1; 2) the transposition of the CMY region from pA/C to pX1; or 3) the rearrangement of pA/C. In addition, the co-lateral mobilization of a small (5 kb) ColE1-like plasmid was observed. The transconjugant plasmids involving pX1 re-arrangements (either via co-integration or ISEcp1-mediated transposition) obtained the capacity to conjugate at very high levels, similar to those found for pX1 (10-1). Two versions of the region containing blaCMY-2 were found to transpose to pX1: the large version was inserted into an intergenic region located where the "genetic load" operons are frequently inserted into pX1, while the short version was inserted into the stbDE operon involved in plasmid addiction system. This is the first study to report the acquisition of an extended spectrum cephalosporin (ESC)-resistance gene by an IncX1 plasmid. We showed that the transfer of the YU39 blaCMY-2 gene

  1. PLASMID PROFILES AND PHAGE TYPES OF SALMONELLA-TYPHIMURIUM ISOLATED FROM SUCCESSIVE FLOCKS OF CHICKENS ON 3 PARENT STOCK FARMS

    DEFF Research Database (Denmark)

    Baggesen, Dorte Lau; Olsen, J. E.; Bisgaard, M.

    1992-01-01

    Three-hundred-and-eighty-seven strains of Salmonella typhimurium obtained from successive generations of parent stock originating from three different rearing farms were characterized by phage typing and plasmid profiling. Seventy-six strains representing dominant types were selected for restrict...

  2. Construction the hairpin RNA recombinant plasmids targeting human Pokemon gene%靶向人Pokemon基因的shRNA重组质粒的构建

    Institute of Scientific and Technical Information of China (English)

    Wenmiao Cao; Tao Zhang; Buhai Wang; Xizhi Zhang; Jinghua Ren; Jie Yao

    2011-01-01

    Objective:The aim of this study was to establish the foundation for studying the role of pokemon gene in tumorigenesis and development by constructing recombinant plasmids that can express small interfering RNA (siRNA) targeting human Pokemon gene. Methods: Hairpin siRNA templates targeting Pokemon gene were synthesized and cloned into plasmid vector psiRNA-H1neo. Three vectors derived siRNAs (psiRNA1, 2, 3) and one mocking psiRNAc (as control) were constructed.The recombinant Pokemon siRNA plasmids were constructed and identified using restrictive enzyme analysis and DNA sequencing. Results: Restrictive enzyme analysis and DNA sequencing revealed the successful construction of siRNA expression plasmids. Conclusion: Constructing siRNA templates targeting Pokemon gene may provide us with practical tools for further study the role of Pokemon gene in the development of some diseases and gene therapy of tumor.

  3. Bacteriophage selection against a plasmid-encoded sex apparatus leads to the loss of antibiotic-resistance plasmids

    OpenAIRE

    Jalasvuori, Matti; Friman, Ville-Petri; Nieminen, Anne; Jaana K.H. Bamford; Buckling, Angus

    2011-01-01

    Antibiotic-resistance genes are often carried by conjugative plasmids, which spread within and between bacterial species. It has long been recognized that some viruses of bacteria (bacteriophage; phage) have evolved to infect and kill plasmid-harbouring cells. This raises a question: can phages cause the loss of plasmid-associated antibiotic resistance by selecting for plasmid-free bacteria, or can bacteria or plasmids evolve resistance to phages in other ways? Here, we show that multiple ant...

  4. Plasmid profilling and similarities in identities of probable microbes isolated from crude oil contaminated agricultural soil

    Directory of Open Access Journals (Sweden)

    Toochukwu Ekwutosi OGBULIE

    2013-05-01

    Full Text Available Plasmid analysis of bacteria isolated from agricultural soil experimentally contaminated with crude oil was carried out and the resultant bands’ depicting the different molecular sizes of the plasmid DNA molecules per isolate was obtained. There was no visible band observed for Klebsiella indicating that the organism lack plasmid DNA that confers degradative ability to it, possibly the gene could be borne on the chromosomal DNA which enabled its persistence in the polluted soil. Molecular characterization was undertaken to confirm the identities of the possible microorganisms that may be present in crude oil-contaminated soil. The result of the DNA extracted and amplified in a PCR using EcoRI and EcoRV restriction enzymes for cutting the DNA of the bacterial cells indicated no visible band for cuts made with EcoRV restriction enzyme showing that the enzyme is not specific for bacterial DNA of isolates in the samples, hence there was no amplification. By contrast though, visible bands of amplicons were observed using EcoRI restriction enzymes. The resultant visible bands of microbial profile obtained using the universal RAPD primer with nucleotide sequence of 5’—CTC AAA GCA TCT AGG TCC A---3’ showed that only Pseudomonas fluorescens and Bacillus mycoides had visible bands at identical position on the gel indicating that both species possibly had identical sequence or genes of negligible differences coding for degradation of hydrocarbons as shown by similar values in molecular weight and positions in the gel electrophoresis field.

  5. Constructing the recombinant plasmid-pLXSN-SjYF-of Yolk Ferritin gene of Schistosoma japonicum

    Institute of Scientific and Technical Information of China (English)

    ZhouJunmei; YuXinbing; WuZhongdao; ZhengYinan; LiYan

    1999-01-01

    TO construct the recotabinant plasmid —— pLXSN-SjYF to prepare for expression and DNA vaccine of Schistosoma japonicum gene. Methods :Mnpliffing DNA fragment coding yolk fereltin from a female adult Sehistosoma japonicum DNAs by PCR. The fragment was inseted into pLXSN retrovirus vector by digesting with restrictive enzymes and linking reactions. The positive clone was screened on LB plates contmaining amplcillin asld identified by restrictive enzymes digestion and PCR amplification, Resttlts The specific DNA fragmem SjYF was amplified from the female adult SjDNAs. IaLXSN-SjYF was constructed successfully and the further research will be carried out.

  6. Novel genetic environment of the plasmid-mediated KPC-3 gene detected in Escherichia coli and Citrobacter freundii isolates from China

    OpenAIRE

    Li, G.; Wei, Q; Wang, Y.; Du, X.; Zhao, Y.; Jiang, X.

    2010-01-01

    The imipenem and meropenem-resistant strains Citrobacter freundii HS70 and Escherichia coli HS510 were isolated from patients in Shanghai, China. By isoelectric focusing, PCR amplification and sequencing, these strains were each found to produce four β-lactamases: TEM-1, KPC-3, SHV-7 and CTX-M-14. A conjugation experiment and plasmid restriction digestion revealed that the bla KPC-3 gene was located on the same plasmid in both isolates. Bidirectional primer walking sequencing showed that the ...

  7. Kloning Gen Melanoma Antigen 1 (Mage-1 dari Jaringan Testis untuk mendapatkan Plasmid Rekombinan Mage-1

    Directory of Open Access Journals (Sweden)

    Gondo Mastutik

    2015-12-01

    Full Text Available Melanoma antigen-1 (Mage-1 is expressed by spermatogonia cells of normal testicular tissue and 60−80% is expressed by the liver of hepatocellular carcinoma (HC patients. Mage-1 expression is a marker for diagnosing HC and predicting gastric and colorectal cancers. Isolation of messenger ribonucleid acid (mRNA Mage-1 from the liver tissue of HC patients is difficult; therefore, Mage-1 mRNA isolates can be obtained from tissues that express Mage-1 such as normal testicular tissues . This is an explorative research that was conducted at the Institute of Tropical Diseases of Airlangga University during August 2006–August 2008. The aim was to clone the coding sequence of Mage-1 gene from testicular tissues into a vector and to get recombinant plasmid Mage-1. Isolation of the full-length Mage-1 was performed using semi-nested polymerase chain reaction (PCR which was then cloned into plasmid pET101/D-TOPO and transformed into Escherichia coli (E. coli Top10 to get recombinant plasmid Mage-1. The length of pET101/D-TOPO was 5,753 bp and Mage-1 was 927 bp. The length of recombinant plasmid was 6,680 bp (5,753+927. Restriction analysis using EcoRV showed 4,230 and 2,450 bp bands (4,230+2,450=6,680. Sequence analyses showed that Mage-1 was 100% homologous with M77481 and NM_004988, 99% homologous with BC01755. In conclusion, according to the results of the restriction and sequences analysis, the recombinant plasmid pETGM/MAGE1-Testis contains the full length coding region of Mage-1 and is useful for developing the hepatocellular carcinoma diagnostic kits.

  8. Image processing for optical mapping.

    Science.gov (United States)

    Ravindran, Prabu; Gupta, Aditya

    2015-01-01

    Optical Mapping is an established single-molecule, whole-genome analysis system, which has been used to gain a comprehensive understanding of genomic structure and to study structural variation of complex genomes. A critical component of Optical Mapping system is the image processing module, which extracts single molecule restriction maps from image datasets of immobilized, restriction digested and fluorescently stained large DNA molecules. In this review, we describe robust and efficient image processing techniques to process these massive datasets and extract accurate restriction maps in the presence of noise, ambiguity and confounding artifacts. We also highlight a few applications of the Optical Mapping system.

  9. Distribution of small native plasmids in Streptococcus pyogenes in India.

    Science.gov (United States)

    Bergmann, René; Nerlich, Andreas; Chhatwal, Gursharan S; Nitsche-Schmitz, D Patric

    2014-05-01

    Complete characterization of a Streptococcus pyogenes population from a defined geographic region comprises information on the plasmids that circulate in these bacteria. Therefore, we determined the distribution of small plasmids (pyogenes isolates from India, where diversity of strains and incidence rates of S. pyogenes infections are high. The collection comprised 77 emm-types. For plasmid detection and discrimination, we developed PCRs for different plasmid replication initiation protein genes, the putative repressor gene copG and bacteriocin genes dysA and scnM57. Plasmid distribution was limited to 13 emm-types. Co-detection analysis using aforementioned PCRs revealed four distinct plasmid sub-types, two of which were previously unknown. Representative plasmids pA852 and pA996 of the two uncharacterized plasmid sub-types were sequenced. These two plasmids could be assigned to the pMV158 and the pC194/pUB110 family of rolling-circle plasmids, respectively. The majority of small plasmids found in India belonged to the two newly characterized sub-types, with pA852- and pA996-like plasmids amounting to 42% and 22% of all detected plasmids, respectively. None of the detected plasmids coded for a known antibiotic resistance gene. Instead, all of the four plasmid sub-types carried known or potential bacteriocin genes. These genes may have influence on the evolutionary success of certain S. pyogenes genotypes. Notably, pA852-like plasmids were found in all isolates of the most prevalent emm-type 11.0. Together, a priori fitness of this genotype and increased fitness due to the acquired plasmids may have rendered type emm11.0 successful and caused the prevalence of pA852-like plasmids in India.

  10. Bronchopneumonia in wild boar (Sus scrofa) caused by Rhodococcus equi carrying the VapB type 8 plasmid.

    Science.gov (United States)

    de Vargas, Agueda Castagna; Monego, Fernanda; Gressler, Letícia Trevisan; de Avila Botton, Sônia; Lazzari, Andrea Maria; da Costa, Mateus Matiuzzi; Ecco, Roselene; Ribeiro, Márcio Garcia; Lara, Gustavo Henrique Batista; Takai, Shinji

    2013-03-25

    Rhodococcus equi is associated with pyogranulomatous infections, especially in foals, and this bacterium has also emerged as a pathogen for humans, particularly immunocompromised patients. R. equi infections in pigs, wild boar (Sus scrofa) and humans are mainly due to strains carrying the intermediate virulence (VapB) plasmid. In Brazil, R. equi carrying the VapB type 8 plasmid is the most common type recovered from humans co-infected with the human immunodeficiency virus (HIV). R. equi infection in pigs and wild boar is restricted predominantly to the lymphatic system, without any reports of pulmonary manifestations. This report describes the microbiological and histopathological findings, and molecular characterization of R. equi in two bronchopneumonia cases in wild boar using PCR and plasmid profile analysis by digestion with restriction endonucleases. The histological findings were suggestive of pyogranulomatous infection, and the plasmid profile of both R. equi isolates enabled the characterization of the strains as VapB type 8. This is the first report of bronchopneumonia in wild boar due to R. equi. The detection of the VapB type 8 plasmid in R. equi isolates emphasize that wild boar may be a potential source of pathogenic R. equi strains for humans.

  11. Complete Sequences of Four Plasmids of Lactococcus lactis subsp. cremoris SK11 Reveal Extensive Adaptation to the Dairy Environment†

    Science.gov (United States)

    Siezen, Roland J.; Renckens, Bernadet; van Swam, Iris; Peters, Sander; van Kranenburg, Richard; Kleerebezem, Michiel; de Vos, Willem M.

    2005-01-01

    Lactococcus lactis strains are known to carry plasmids encoding industrially important traits. L. lactis subsp. cremoris SK11 is widely used by the dairy industry in cheese making. Its complete plasmid complement was sequenced and found to contain the plasmids pSK11A (10,372 bp), pSK11B (13,332 bp), pSK11L (47,165 bp), and pSK11P (75,814 bp). Six highly homologous repB-containing replicons were found, all belonging to the family of lactococcal theta-type replicons. Twenty-three complete insertion sequence elements segment the plasmids into numerous modules, many of which can be identified as functional units or containing functionally related genes. Plasmid-encoded functions previously known to reside on L. lactis SK11 plasmids were now mapped in detail, e.g., lactose utilization (lacR-lacABCDFEGX), the proteolytic system (prtM-prtP, pepO, pepF), and the oligopeptide permease system (oppDFBCA). Newly identified plasmid-encoded functions could facilitate the uptake of various cations, while the pabA and pabB genes could be essential for folate biosynthesis. A competitive advantage could be obtained by using the putative flavin adenine dinucleotide-dependent d-lactate dehydrogenase and oxalate:formate antiporter for enhanced ATP synthesis, while the activity of the predicted α-acetolactate decarboxylase may contribute to the formation of an additional electron sink. Various stress response proteins are plasmid encoded, which could enhance strain robustness. A substantial number of these “adaptation” genes have not been described before on L. lactis plasmids. Moreover, several genes were identified for the first time in L. lactis, possibly reflecting horizontal gene transfer. PMID:16332824

  12. Isolation of a Pseudomonas Stutzeri strain that degrades1, 2, 4-trichlorobenzene and characterization of its degradative plasmid

    Institute of Scientific and Technical Information of China (English)

    Lei SONG; Hui WANG; Hanchang SHI; Hongying HU

    2008-01-01

    The genetic information encoding metabolic pathways for xenobiotic compounds in bacteria often resides on catabolic plasmids. The aim of the present work was to know the location of the genes for degrading 1, 2, 4-trichlorobenzen. In this paper a 1, 2, 4-trichlorobenzene-degrading strain THSL-1 was isolated from the soil of Tianjin Chemical Plant using 1, 2, 4-trichlorobenzene as the sole carbon source. The strain was identified as Pseudomonas stutzeri through morphologic survey and 16S rDNA sequence determination. A plasmid was discovered from strain THSL-1 by using the alkali lysis method. When the plasmid was transformed into E. coli. JM109 by the CaCl2 method, the transformant could grow using 1, 2, 4-trichlorobenzene as the sole carbon source and had the degradation function of 1, 2, 4-trichlorobenzene. Therefore, it could be deemed that the plasmid carried the degradative genes of 1, 2, 4-trichlorobenzene. The average size of the plasmid was finally determined to be 40.2 Kb using selectively three kinds of restricted inscribed enzymes (HindIII, BamHI, and XholI) for single cutting and double cutting the plasmid pTHSL-1, respectively.

  13. Stress responses and replication of plasmids in bacterial cells

    Directory of Open Access Journals (Sweden)

    Wegrzyn Alicja

    2002-05-01

    Full Text Available Abstract Plasmids, DNA (or rarely RNA molecules which replicate in cells autonomously (independently of chromosomes as non-essential genetic elements, play important roles for microbes grown under specific environmental conditions as well as in scientific laboratories and in biotechnology. For example, bacterial plasmids are excellent models in studies on regulation of DNA replication, and their derivatives are the most commonly used vectors in genetic engineering. Detailed mechanisms of replication initiation, which is the crucial process for efficient maintenance of plasmids in cells, have been elucidated for several plasmids. However, to understand plasmid biology, it is necessary to understand regulation of plasmid DNA replication in response to different environmental conditions in which host cells exist. Knowledge of such regulatory processes is also very important for those who use plasmids as expression vectors to produce large amounts of recombinant proteins. Variable conditions in large-scale fermentations must influence replication of plasmid DNA in cells, thus affecting the efficiency of recombinant gene expression significantly. Contrary to extensively investigated biochemistry of plasmid replication, molecular mechanisms of regulation of plasmid DNA replication in response to various environmental stress conditions are relatively poorly understood. There are, however, recently published studies that add significant data to our knowledge on relations between cellular stress responses and control of plasmid DNA replication. In this review we focus on plasmids derived from bacteriophage λ that are among the best investigated replicons. Nevertheless, recent results of studies on other plasmids are also discussed shortly.

  14. Plasmid mediated quinolone resistance in Enterobacteriaceae

    NARCIS (Netherlands)

    Veldman, K.T.; LS Klinisch Onderzoek Wagenaar

    2014-01-01

    This thesis describes the occurrence of Plasmid Mediated Quinolone Resistance (PMQR) in Salmonella and E. coli from The Netherlands and other European countries. Furthermore, the genetic background of these genes was characterized. Fluoroquinolones are widely used antibiotics in both human and

  15. Plasmid mediated quinolone resistance in Enterobacteriaceae

    NARCIS (Netherlands)

    Veldman, K.T.; LS Klinisch Onderzoek Wagenaar

    2014-01-01

    This thesis describes the occurrence of Plasmid Mediated Quinolone Resistance (PMQR) in Salmonella and E. coli from The Netherlands and other European countries. Furthermore, the genetic background of these genes was characterized. Fluoroquinolones are widely used antibiotics in both human and veter

  16. Plasmid mediated quinolone resistance in Enterobacteriaceae

    NARCIS (Netherlands)

    Veldman, K.T.; LS Klinisch Onderzoek Wagenaar

    2014-01-01

    This thesis describes the occurrence of Plasmid Mediated Quinolone Resistance (PMQR) in Salmonella and E. coli from The Netherlands and other European countries. Furthermore, the genetic background of these genes was characterized. Fluoroquinolones are widely used antibiotics in both human and veter

  17. Identification of bla KPC-2 on different plasmids of three Morganella morganii isolates.

    Science.gov (United States)

    Shi, D-S; Wang, W-P; Kuai, S-G; Shao, H-F; Huang, M

    2012-05-01

    Three Morganella morganii strains resistant to carbapenems were recovered from the surgical intensive care unit (SICU) in our hospital. Carbapenemases and extended-spectrum β-lactamases (ESBLs) were respectively detected by the modified Hodge test and the modified Clinical and Laboratory Standards Institute (CLSI) ESBL confirmatory test in all isolates. Amplification of whole-cell and plasmid DNAs extracted from isolates with primers specific for the bla (KPC) produced an amplicon confirmed to be bla (KPC-2) by sequence analysis. Pulsed-field gel electrophoresis (PFGE) typing revealed that three isolates belonged to two closely related types. Plasmids electrophoresis and restriction analysis revealed that the bla (KPC-2) was located on different plasmids. The transfer of carbapenem resistance from the three original isolates to Escherichia coli EC600 was successful by conjugation. An examination of the outer membrane proteins showed a lack of a 38-kDa outer membrane protein (OMP) compared with M. morganii susceptible to carbapenems. The production of KPC-2 and ESBLs, combined with OMP deficiency, resulted in high-level carbapenem resistance in the M. morganii strains. The genetic environment around bla (KPC-2) analysis revealed that this β-lactamase was located on the same mobile genetic elements which could transfer between different plasmids.

  18. Plasmids spread very fast in heterogeneous bacterial communities.

    Science.gov (United States)

    Dionisio, Francisco; Matic, Ivan; Radman, Miroslav; Rodrigues, Olivia R; Taddei, François

    2002-01-01

    Conjugative plasmids can mediate gene transfer between bacterial taxa in diverse environments. The ability to donate the F-type conjugative plasmid R1 greatly varies among enteric bacteria due to the interaction of the system that represses sex-pili formations (products of finOP) of plasmids already harbored by a bacterial strain with those of the R1 plasmid. The presence of efficient donors in heterogeneous bacterial populations can accelerate plasmid transfer and can spread by several orders of magnitude. Such donors allow millions of other bacteria to acquire the plasmid in a matter of days whereas, in the absence of such strains, plasmid dissemination would take years. This "amplification effect" could have an impact on the evolution of bacterial pathogens that exist in heterogeneous bacterial communities because conjugative plasmids can carry virulence or antibiotic-resistance genes. PMID:12524329

  19. Endogenous mutagenesis in recombinant sulfolobus plasmids.

    Science.gov (United States)

    Sakofsky, Cynthia J; Grogan, Dennis W

    2013-06-01

    Low rates of replication errors in chromosomal genes of Sulfolobus spp. demonstrate that these extreme thermoacidophiles can maintain genome integrity in environments with high temperature and low pH. In contrast to this genetic stability, we observed unusually frequent mutation of the β-D-glycosidase gene (lacS) of a shuttle plasmid (pJlacS) propagated in Sulfolobus acidocaldarius. The resulting Lac(-) mutants also grew faster than the Lac(+) parent, thereby amplifying the impact of the frequent lacS mutations on the population. We developed a mutant accumulation assay and corrections for the effects of copy number and differential growth for this system; the resulting measurements and calculations yielded a corrected rate of 5.1 × 10(-4) mutational events at the lacS gene per plasmid replication. Analysis of independent lacS mutants revealed three types of mutations: (i) G · C-to-A · T transitions, (ii) slipped-strand events, and (iii) deletions. These mutations were frequent in plasmid-borne lacS expressed at a high level but not in single-copy lacS in the chromosome or at lower levels of expression in a plasmid. Substitution mutations arose at only two of 12 potential priming sites of the DNA primase of the pRN1 replicon, but nearly all these mutations created nonsense (chain termination) codons. The spontaneous mutation rate of plasmid-borne lacS was 175-fold higher under high-expression than under low-expression conditions. The results suggest that important DNA repair or replication fidelity functions are impaired or overwhelmed in pJlacS, with results analogous to those of the "transcription-associated mutagenesis" seen in bacteria and eukaryotes.

  20. Diversity and homogeneity among small plasmids of Aeromonas salmonicida subsp. salmonicida linked with geographical origin

    Directory of Open Access Journals (Sweden)

    Sabrina A Attéré

    2015-11-01

    Full Text Available Furunculosis, which is caused by Aeromonas salmonicida subsp. salmonicida, is a major salmonid disease in fish farms worldwide. Several plasmids found in this bacterium confer phenotypes such drug resistance and virulence. Small plasmids (pAsa1, pAsa2, pAsa3, and pAsal1 related to ColE1- and ColE2-type replicons are usually present in its normal plasmidome. In the present study, with the objective to investigate if these plasmids display particularities related to the origin of the isolates bearing them, a total of 153 isolates, including 78 new and 75 previously described, were analyzed for the presence of small plasmids by PCR and DNA restriction fragment profiling. A geographical dichotomy between Canadian and European isolates for their propensity to do not have pAsa3 or pAsal1 was found. In addition, the genotyping analysis led to the identification of two European isolates harboring an unusual pAsal1. An investigation by next-generation sequencing (NGS of these two isolates shed light on two pAsal1 variants (pAsal1C and pAsal1D. As with pAsal1B, another pAsal1 variant previously described, these two new variants bore a second insertion sequence (ISAS5 in addition to the usual ISAS11. The characterization of these variants suggested that they could predominate over the wild-type pAsal1 in stressful conditions such as growth at temperatures of 25°C and above. To obtain a comprehensive portrait of the mutational pressure on small plasmids, 26 isolates whose DNA had been sequenced by NGS were investigated. pAsa3 and pAsal1 were more prone to mutations than pAsa1 and pAsa2, especially in the mobA gene, which encodes a relaxase and a primase. Lastly, the average copy number of each plasmid per cell was assessed using raw sequencing data. A clear trend with respect to the relative proportion per cell of each plasmid was identified. Our large-scale study revealed a geographical dichotomy in small plasmid repertoire in addition to a clear trend

  1. [Investigation of plasmid-mediated quinolone resistance in Escherichia coli strains].

    Science.gov (United States)

    Aktepe, Orhan Cem; Aşık, Gülşah; Cetinkol, Yeliz; Biçmen, Meral; Gülay, Zeynep

    2012-01-01

    Quinolones are widely used antimicrobial agents, particularly for the treatment of infections caused by gram-negative bacilli such as E.coli. As a consequence, quinolone resistance has been increasing among this species in recent years. Bacterial resistance to quinolones usually results from mutations in the chromosomal genes which encode topoisomerases and also the expression of efflux pumps and loss of porines contributed to development of quinolone resistance. However, recent studies have shown that the spread and increase of quinolone resistance may be due to the transfer of plasmid-mediated genes. To date, three groups of plasmid-mediated quinolone resistance genes, namely qnr, aac(6')-Ib-cr, and qepA, have been described. The aim of this study was to investigate the presence of plasmid-mediated quinolone resistance genes in E.coli clinical isolates. A total of 112 quinolone-resistant E.coli strains isolated from different clinical specimens (84 urine, 16 blood, 10 wound, 2 bronchoalveolar lavage) of which 78 (69.6%) were extended-spectrum beta-lactamase (ESBL) positive, in Afyon Kocatepe University Hospital, Microbiology Laboratory were included in the study. In the isolates, qnrA, qnrB, qnrS, qnrC, qepA, and aac(6')-1b-cr plasmid genes were analysed by polymerase chain reaction (PCR). After aac(6')- 1b determinant was amplified by PCR, all aac(6')-1b positive amplicons were analyzed by digestion with BseGI restriction enzyme to identify aac(6')-1b-cr variant. It was found that, none of the strains horboured qnrA, qnrB, qnrS, qnrC and qepA genes, however, plasmid-mediated quinolone resistance gene aac(6')-1b-cr was found positive in 59.8% (67/112) of the strains. It was notable that 86.6% (58/67) of those isolates were ESBL producers. The rates of quinolone resistance among E.coli isolates infections were high in our region and an increasing trend has been observed in recent years. Our data indicated that the presence of plasmid- mediated resistance genes

  2. Plasmid DNA entry into postmitotic nuclei of primary rat myotubes.

    OpenAIRE

    Dowty, M E; Williams, P.; G. Zhang; Hagstrom, J E; Wolff, J A

    1995-01-01

    These studies were initiated to elucidate the mechanism of DNA nuclear transport in mammalian cells. Biotin- or gold-labeled plasmid and plasmid DNA expression vectors for Escherichia coli beta-galactosidase or firefly luciferase were microinjected into the cytoplasm of primary rat myotubes in culture. Plasmid DNA was expressed in up to 70% of the injected myotubes, which indicates that it entered intact, postmitotic nuclei. The nuclear transport of plasmid DNA occurred through the nuclear po...

  3. Replication of plasmids in gram-negative bacteria.

    OpenAIRE

    1989-01-01

    Replication of plasmid deoxyribonucleic acid (DNA) is dependent on three stages: initiation, elongation, and termination. The first stage, initiation, depends on plasmid-encoded properties such as the replication origin and, in most cases, the replication initiation protein (Rep protein). In recent years the understanding of initiation and regulation of plasmid replication in Escherichia coli has increased considerably, but it is only for the ColE1-type plasmids that significant biochemical d...

  4. Dissemination of plasmid-encoded AmpC β-lactamases in antimicrobial resistant Salmonella serotypes originating from humans, pigs and the swine environment.

    Science.gov (United States)

    Keelara, Shivaramu; Thakur, Siddhartha

    2014-09-17

    The aim of this study was to characterize and determine the inter-serovar exchange of AmpC β-lactamase conferring plasmids isolated from humans, pigs and the swine environment. Plasmids isolated from a total of 21 antimicrobial resistant (AMR) Salmonella isolates representing human clinical cases (n=6), pigs (n=6) and the swine farm environment (n=9) were characterized by replicon typing and restriction digestion, inter-serovar transferability by conjugation, and presence of AmpC β-lactamase enzyme encoding gene blaCMY-2 by southern hybridization. Based on replicon typing, the majority (17/21, 81%) of the plasmids belonged to the I1-Iγ Inc group and were between 70 and 103kb. The potential for inter-serovar plasmid transfer was further confirmed by the PCR detection of AMR genes on the plasmids isolated from trans-conjugants. Plasmids from Salmonella serovars Anatum, Ouakam, Johannesburg and Typhimurium isolated from the same cohort of pigs and their environment and S. Heidelberg from a single human clinical isolate had identical plasmids based on digestion with multiple restriction enzymes (EcoRI, HindIII and PstI) and southern blotting. We demonstrated likely horizontal inter-serovar exchange of plasmid-encoding AmpC β-lactamases resistance among MDR Salmonella serotypes isolated from pigs, swine farm environment and clinical human cases. This study provides valuable information on the role of the swine farm environment and by extension other livestock farm environments, as a potential reservoir of resistant bacterial strains that potentially transmit resistance determinants to livestock, in this case, swine, humans and possibly other hosts by horizontal exchange of plasmids.

  5. Site-directed mutagenesis in Escherichia coli of a stable R772::Ti cointegrate plasmid from Agrobacterium tumefaciens.

    Science.gov (United States)

    Hille, J; van Kan, J; Klasen, I; Schilperoort, R

    1983-01-01

    The host range of an octopine Ti plasmid is limited to Rhizobiaceae. This has been extended also to Escherichia coli in the form of a stable cointegrate with the wide-host-range plasmid R772. Its structure was studied by constructing a physical map of R772 and of the R772::pTiB6 cointegrate. An insertion sequence present in R772, called IS70, turned out to be involved in cointegrate formation. We found one intact copy of IS70 and a small segment of IS70, respectively, at the junctions of R772 and Ti DNA. The absence of a complete second copy of IS70 is a likely explanation for the stability of the cointegrate plasmid. A procedure for site-directed mutagenesis of this cointegrate plasmid in E. coli is described. The effect of mutations in the Ti plasmid part can be studied subsequently by transferring the cointegrate into Agrobacterium tumefaciens. The advantage of this procedure for Ti plasmids over other methods used at present is discussed. Images PMID:6302080

  6. Plasmid Segregation: Spatial Awareness at the Molecular Level

    DEFF Research Database (Denmark)

    Møller-Jensen, Jakob; Gerdes, Kenn

    2007-01-01

    In bacteria, low-copy number plasmids ensure their stable inheritance by partition loci (par), which actively distribute plasmid replicates to each side of the cell division plane. Using time-lapse fluorescence microscopic tracking of segregating plasmid molecules, a new study provides novel insi...

  7. Multilocus sequence typing of IncN plasmids

    DEFF Research Database (Denmark)

    García-Fernández, Aurora; Villa, Laura; Moodley, Arshnee

    2011-01-01

    categorization of IncN plasmids. METHODS: Twelve fully sequenced IncN plasmids available at GenBank were analysed in silico for selecting the loci for the IncN-specific pMLST. A total of 58 plasmids originating from different reservoirs (human, pig, poultry, cattle and horses) and geographic regions (Italy...

  8. The 64 508 bp IncP-1beta antibiotic multiresistance plasmid pB10 isolated from a waste-water treatment plant provides evidence for recombination between members of different branches of the IncP-1beta group.

    Science.gov (United States)

    Schlüter, A; Heuer, H; Szczepanowski, R; Forney, L J; Thomas, C M; Pühler, A; Top, E M

    2003-11-01

    The complete 64508 bp nucleotide sequence of the IncP-1beta antibiotic-resistance plasmid pB10, which was isolated from a waste-water treatment plant in Germany and mediates resistance against the antimicrobial agents amoxicillin, streptomycin, sulfonamides and tetracycline and against mercury ions, was determined and analysed. A typical class 1 integron with completely conserved 5' and 3' segments is inserted between the tra and trb regions. The two mobile gene cassettes of this integron encode a beta-lactamase of the oxacillin-hydrolysing type (Oxa-2) and a gene product of unknown function (OrfE-like), respectively. The pB10-specific gene load present between the replication module (trfA1) and the origin of vegetative replication (oriV) is composed of four class II (Tn3 family) transposable elements: (i). a Tn501-like mercury-resistance (mer) transposon downstream of the trfA1 gene, (ii). a truncated derivative of the widespread streptomycin-resistance transposon Tn5393c, (iii). the insertion sequence element IS1071 and (iv). a Tn1721-like transposon that contains the tetracycline-resistance genes tetA and tetR. A very similar Tn501-like mer transposon is present in the same target site of the IncP-1beta degradative plasmid pJP4 and the IncP-1beta resistance plasmid R906, suggesting that pB10, R906 and pJP4 are derivatives of a common ancestor. Interestingly, large parts of the predicted pB10 restriction map, except for the tetracycline-resistance determinant, are identical to that of R906. It thus appears that plasmid pB10 acquired as many as five resistance genes via three transposons and one integron, which it may rapidly spread among bacterial populations given its high promiscuity. Comparison of the pB10 backbone DNA sequences with those of other sequenced IncP-1beta plasmids reveals a mosaic structure. While the conjugative transfer modules (trb and tra regions) and the replication module are very closely related to the corresponding segments of the IncP-1

  9. Molecular mapping of chromosomes 17 and X. Progress report

    Energy Technology Data Exchange (ETDEWEB)

    Barker, D.F.

    1991-01-15

    Progress toward the construction of high density genetic maps of chromosomes 17 and X has been made by isolating and characterizing a relatively large set of polymorphic probes for each chromosome and using these probes to construct genetic maps. We have mapped the same polymorphic probes against a series of chromosome breakpoints on X and 17. The probes could be assigned to over 30 physical intervals on the X chromosome and 7 intervals on 17. In many cases, this process resulted in improved characterization of the relative locations of the breakpoints with respect to each other and the definition of new physical intervals. The strategy for isolation of the polymorphic clones utilized chromosome specific libraries of 1--15 kb segments from each of the two chromosomes. From these libraries, clones were screened for those detecting restriction fragment length polymorphisms. The markers were further characterized, the chromosomal assignments confirmed and in most cases segments of the original probes were subcloned into plasmids to produce probes with improved signal to noise ratios for use in the genetic marker studies. The linkage studies utilize the CEPH reference families and other well-characterized families in our collection which have been used for genetic disease linkage work. Preliminary maps and maps of portions of specific regions of 17 and X are provided. We have nearly completed a map of the 1 megabase Mycoplasma arthritidis genome by applying these techniques to a lambda phage library of its genome. We have found bit mapping to be an efficient means to organize a contiguous set of overlapping@ clones from a larger genome.

  10. Bacteriophages limit the existence conditions for conjugative plasmids.

    Science.gov (United States)

    Harrison, Ellie; Wood, A Jamie; Dytham, Calvin; Pitchford, Jonathan W; Truman, Julie; Spiers, Andrew; Paterson, Steve; Brockhurst, Michael A

    2015-06-02

    Bacteriophages are a major cause of bacterial mortality and impose strong selection on natural bacterial populations, yet their effects on the dynamics of conjugative plasmids have rarely been tested. We combined experimental evolution, mathematical modeling, and individual-based simulations to explain how the ecological and population genetics effects of bacteriophages upon bacteria interact to determine the dynamics of conjugative plasmids and their persistence. The ecological effects of bacteriophages on bacteria are predicted to limit the existence conditions for conjugative plasmids, preventing persistence under weak selection for plasmid accessory traits. Experiments showed that phages drove faster extinction of plasmids in environments where the plasmid conferred no benefit, but they also revealed more complex effects of phages on plasmid dynamics under these conditions, specifically, the temporary maintenance of plasmids at fixation followed by rapid loss. We hypothesized that the population genetic effects of bacteriophages, specifically, selection for phage resistance mutations, may have caused this. Further mathematical modeling and individual-based simulations supported our hypothesis, showing that conjugative plasmids may hitchhike with phage resistance mutations in the bacterial chromosome. Conjugative plasmids are infectious loops of DNA capable of transmitting DNA between bacterial cells and between species. Because plasmids often carry extra genes that allow bacteria to live in otherwise-inhospitable environments, their dynamics are central to understanding bacterial adaptive evolution. The plasmid-bacterium interaction has typically been studied in isolation, but in natural bacterial communities, bacteriophages, viruses that infect bacteria, are ubiquitous. Using experiments, mathematical models, and computer simulations we show that bacteriophages drive plasmid dynamics through their ecological and evolutionary effects on bacteria and ultimately

  11. A semester-long project for teaching basic techniques in molecular biology such as restriction fragment length polymorphism analysis to undergraduate and graduate students.

    Science.gov (United States)

    DiBartolomeis, Susan M

    2011-01-01

    Several reports on science education suggest that students at all levels learn better if they are immersed in a project that is long term, yielding results that require analysis and interpretation. I describe a 12-wk laboratory project suitable for upper-level undergraduates and first-year graduate students, in which the students molecularly locate and map a gene from Drosophila melanogaster called dusky and one of dusky's mutant alleles. The mapping strategy uses restriction fragment length polymorphism analysis; hence, students perform most of the basic techniques of molecular biology (DNA isolation, restriction enzyme digestion and mapping, plasmid vector subcloning, agarose and polyacrylamide gel electrophoresis, DNA labeling, and Southern hybridization) toward the single goal of characterizing dusky and the mutant allele dusky(73). Students work as individuals, pairs, or in groups of up to four students. Some exercises require multitasking and collaboration between groups. Finally, results from everyone in the class are required for the final analysis. Results of pre- and postquizzes and surveys indicate that student knowledge of appropriate topics and skills increased significantly, students felt more confident in the laboratory, and students found the laboratory project interesting and challenging. Former students report that the lab was useful in their careers.

  12. Inducible colistin resistance via a disrupted plasmid-borne mcr-1 gene in a 2008 Vietnamese Shigella sonnei isolate

    Science.gov (United States)

    Pham Thanh, Duy; Thanh Tuyen, Ha; Nguyen Thi Nguyen, To; Chung The, Hao; Wick, Ryan R.; Thwaites, Guy E.; Baker, Stephen; Holt, Kathryn E.

    2016-01-01

    Objectives The objective of this study was to assess the presence of mcr-1 in Shigella sonnei isolated in Vietnam. Methods WGS data were analysed for the presence of the mcr-1 gene sequence. The association of mcr-1 with a plasmid was assessed by PCR and by conjugation. Results Through genome sequencing we identified a plasmid-associated inactive form of mcr-1 in a 2008 Vietnamese isolate of Shigella sonnei. The plasmid was conjugated into Escherichia coli and mcr-1 was activated upon exposure to colistin, resulting in highly colistin-resistant transconjugants. Conclusions This is the first description of the mcr-1 gene in Shigella, which is atypical given that colistin is not ordinarily used to treat diarrhoea. Our data suggest the mcr-1 gene has been circulating in human-restricted pathogens for some time but likely carries a selective fitness cost. PMID:27246235

  13. Isolation of bacterial plasmids by density gradient centrifugation in cesium trifluoroacetate (CsTFA) without the use of ethidium bromide.

    Science.gov (United States)

    Andersson, K; Hjorth, R

    1985-01-01

    Plasmids extracted from bacterial cells by alkaline extraction can easily be isolated from linear DNA by isopycnic centrifugation in CsTFA. This is a fast and simple method which circumvents the use of the intercalating dye, ethidium bromide, and consequently the problems associated with its removal. The buoyant densities for covalently closed circular DNA and linear DNA in CsTFA are 1.60 g/ml and 1.65 g/ml, respectively. The isolation is achieved regardless of plasmid size and can be accomplished at temperatures of between 4 and 30 degrees C. Plasmid DNA isolated in gradients of CsTFA are of a high purity and have been found to be intact when cleaved with restriction enzymes and ligated with T4 DNA ligase.

  14. Plasmid flux in Escherichia coli ST131 sublineages, analyzed by plasmid constellation network (PLACNET, a new method for plasmid reconstruction from whole genome sequences.

    Directory of Open Access Journals (Sweden)

    Val F Lanza

    2014-12-01

    Full Text Available Bacterial whole genome sequence (WGS methods are rapidly overtaking classical sequence analysis. Many bacterial sequencing projects focus on mobilome changes, since macroevolutionary events, such as the acquisition or loss of mobile genetic elements, mainly plasmids, play essential roles in adaptive evolution. Existing WGS analysis protocols do not assort contigs between plasmids and the main chromosome, thus hampering full analysis of plasmid sequences. We developed a method (called plasmid constellation networks or PLACNET that identifies, visualizes and analyzes plasmids in WGS projects by creating a network of contig interactions, thus allowing comprehensive plasmid analysis within WGS datasets. The workflow of the method is based on three types of data: assembly information (including scaffold links and coverage, comparison to reference sequences and plasmid-diagnostic sequence features. The resulting network is pruned by expert analysis, to eliminate confounding data, and implemented in a Cytoscape-based graphic representation. To demonstrate PLACNET sensitivity and efficacy, the plasmidome of the Escherichia coli lineage ST131 was analyzed. ST131 is a globally spread clonal group of extraintestinal pathogenic E. coli (ExPEC, comprising different sublineages with ability to acquire and spread antibiotic resistance and virulence genes via plasmids. Results show that plasmids flux in the evolution of this lineage, which is wide open for plasmid exchange. MOBF12/IncF plasmids were pervasive, adding just by themselves more than 350 protein families to the ST131 pangenome. Nearly 50% of the most frequent γ-proteobacterial plasmid groups were found to be present in our limited sample of ten analyzed ST131 genomes, which represent the main ST131 sublineages.

  15. Plasmid flux in Escherichia coli ST131 sublineages, analyzed by plasmid constellation network (PLACNET), a new method for plasmid reconstruction from whole genome sequences.

    Science.gov (United States)

    Lanza, Val F; de Toro, María; Garcillán-Barcia, M Pilar; Mora, Azucena; Blanco, Jorge; Coque, Teresa M; de la Cruz, Fernando

    2014-12-01

    Bacterial whole genome sequence (WGS) methods are rapidly overtaking classical sequence analysis. Many bacterial sequencing projects focus on mobilome changes, since macroevolutionary events, such as the acquisition or loss of mobile genetic elements, mainly plasmids, play essential roles in adaptive evolution. Existing WGS analysis protocols do not assort contigs between plasmids and the main chromosome, thus hampering full analysis of plasmid sequences. We developed a method (called plasmid constellation networks or PLACNET) that identifies, visualizes and analyzes plasmids in WGS projects by creating a network of contig interactions, thus allowing comprehensive plasmid analysis within WGS datasets. The workflow of the method is based on three types of data: assembly information (including scaffold links and coverage), comparison to reference sequences and plasmid-diagnostic sequence features. The resulting network is pruned by expert analysis, to eliminate confounding data, and implemented in a Cytoscape-based graphic representation. To demonstrate PLACNET sensitivity and efficacy, the plasmidome of the Escherichia coli lineage ST131 was analyzed. ST131 is a globally spread clonal group of extraintestinal pathogenic E. coli (ExPEC), comprising different sublineages with ability to acquire and spread antibiotic resistance and virulence genes via plasmids. Results show that plasmids flux in the evolution of this lineage, which is wide open for plasmid exchange. MOBF12/IncF plasmids were pervasive, adding just by themselves more than 350 protein families to the ST131 pangenome. Nearly 50% of the most frequent γ-proteobacterial plasmid groups were found to be present in our limited sample of ten analyzed ST131 genomes, which represent the main ST131 sublineages.

  16. Plasmid dependence of Pseudomonas sp. strain NK87 enzymes that degrade 6-aminohexanoate-cyclic dimer.

    Science.gov (United States)

    Kanagawa, K; Negoro, S; Takada, N; Okada, H

    1989-06-01

    A bacterial strain, Pseudomonas sp. strain NK87, that can use 6-aminohexanoate-cyclic dimer as the sole source of carbon and nitrogen was newly isolated from wastewater of a factory which produces nylon-6. Two responsible enzymes, 6-aminohexanoate-cyclic-dimer hydrolase (P-EI) and 6-aminohexanoate-dimer hydrolase (P-EII), were found in the NK87 strain, as is the case with Flavobacterium sp. strain KI72, another 6-aminohexanoate-cyclic-dimer-metabolizing bacterium (H. Okada, S. Negoro, H. Kimura, and S. Nakamura, Nature [London] 306:203-206, 1983). The P-EI enzyme is immunologically identical to the 6-aminohexanoate-cyclic-dimer hydrolase of KI72 (F-EI). However, antiserum against the 6-aminohexanoate-dimer hydrolase purified from KI72 (F-EII) did not react with cell extracts of NK87, indicating that the F-EII and P-EII enzymes are immunologically different. Restriction endonuclease analyses show that the NK87 strain harbors at least six plasmids ranging in size from 20 to 80 kilobase pairs (kbp). The P-EI and P-EII genes were cloned in Escherichia coli. Both the P-EI and F-EI probes strongly hybridized with a 23-kbp plasmid in Southern hybridization analyses. The P-EII probe hybridized specifically with an 80-kbp plasmid, but the F-EII probe hybridized with none of the plasmids harbored in NK87. These results indicate that the P-EI gene and P-EII gene are encoded on the 23-kbp and 80-kbp plasmids, respectively.

  17. Role of Plasmid in Production of Acetobacter Xylinum Biofilms

    Directory of Open Access Journals (Sweden)

    Abbas Rezaee

    2005-01-01

    Full Text Available Acetobacter xylinum has the ability to produce cellulotic biofilms. Bacterial cellulose is expected to be used in many industrial or biomedical materials for its unique characteristics. A. xylinum contains a complex system of plasmid DNA molecules. A 44 kilobases (kb plasmid was isolated in wild type of A. xylinum. To improve the cellulose producing ability of A. xylinum, role of the plasmid in production of cellulose was studied. The comparisons between wild type and cured cells of A. xylinum showed that there is considerably difference in cellulose production. In order to study the relationship between plasmid and the rate of cellulose production, bacteria were screened for plasmid profile by a modified method for preparation of plasmid. This method yields high levels of pure plasmid DNA that can be used for common molecular techniques, such as digestion and transformation, with high efficiency.

  18. Permissiveness of soil microbial communities towards broad host range plasmids

    DEFF Research Database (Denmark)

    Klümper, Uli

    at high frequencies from diverse donors, I showed plasmid or donor dependence of plasmid transfer to other species. Additionally, environmental factors like stress also impact the permissiveness of phylogenetic groups towards plasmids. The developed method and results increase our ability to predict......Horizontal transfer of mobile genetic elements facilitates adaptive and evolutionary processes in bacteria. Among the known mobile genetic elements, plasmids can confer their hosts with accessory adaptive traits, such as antibiotic or heavy metal resistances, or additional metabolic pathways...... and the extent of bacterial phyla permissive towards plasmid receipt are largely unknown. Historically, methods exploring the underlying genetic and environmental factors of plasmid transfer have been heavily reliant on cultivation and expression of plasmid encoded phenotypes. This has provided an incomplete...

  19. Modeling sRNA-Regulated Plasmid Maintenance

    Science.gov (United States)

    Klumpp, Stefan

    2017-01-01

    We study a theoretical model for the toxin-antitoxin (hok/sok) mechanism for plasmid maintenance in bacteria. Toxin-antitoxin systems enforce the maintenance of a plasmid through post-segregational killing of cells that have lost the plasmid. Key to their function is the tight regulation of expression of a protein toxin by an sRNA antitoxin. Here, we focus on the nonlinear nature of the regulatory circuit dynamics of the toxin-antitoxin mechanism. The mechanism relies on a transient increase in protein concentration rather than on the steady state of the genetic circuit. Through a systematic analysis of the parameter dependence of this transient increase, we confirm some known design features of this system and identify new ones: for an efficient toxin-antitoxin mechanism, the synthesis rate of the toxin’s mRNA template should be lower that of the sRNA antitoxin, the mRNA template should be more stable than the sRNA antitoxin, and the mRNA-sRNA complex should be more stable than the sRNA antitoxin. Moreover, a short half-life of the protein toxin is also beneficial to the function of the toxin-antitoxin system. In addition, we study a therapeutic scenario in which a competitor mRNA is introduced to sequester the sRNA antitoxin, causing the toxic protein to be expressed. PMID:28085919

  20. Modeling sRNA-regulated Plasmid Maintenance

    CERN Document Server

    Gong, Chen Chris

    2016-01-01

    We study a theoretical model for the toxin-antitoxin (hok/sok) mechanism for plasmid maintenance in bacteria. Toxin-antitoxin systems enforce the maintenance of a plasmid through post-segregational killing of cells that have lost the plasmid. Key to their function is the tight regulation of expression of a protein toxin by an sRNA antitoxin. Here, we focus on the nonlinear nature of the regulatory circuit dynamics of the toxin-antitoxin mechanism. The mechanism relies on a transient increase in protein concentration rather than on the steady state of the genetic circuit. Through a systematic analysis of the parameter dependence of this transient increase, we confirm some known design features of this system and identify new ones: for an efficient toxin-antitoxin mechanism, the synthesis rate of the toxin's mRNA template should be lower that of the sRNA antitoxin, the mRNA template should be more stable than the sRNA antitoxin, and the mRNA-sRNA complex should be more stable than the sRNA antitoxin. Moreover, ...

  1. AGORA: Assembly Guided by Optical Restriction Alignment

    Directory of Open Access Journals (Sweden)

    Lin Henry C

    2012-08-01

    Full Text Available Abstract Background Genome assembly is difficult due to repeated sequences within the genome, which create ambiguities and cause the final assembly to be broken up into many separate sequences (contigs. Long range linking information, such as mate-pairs or mapping data, is necessary to help assembly software resolve repeats, thereby leading to a more complete reconstruction of genomes. Prior work has used optical maps for validating assemblies and scaffolding contigs, after an initial assembly has been produced. However, optical maps have not previously been used within the genome assembly process. Here, we use optical map information within the popular de Bruijn graph assembly paradigm to eliminate paths in the de Bruijn graph which are not consistent with the optical map and help determine the correct reconstruction of the genome. Results We developed a new algorithm called AGORA: Assembly Guided by Optical Restriction Alignment. AGORA is the first algorithm to use optical map information directly within the de Bruijn graph framework to help produce an accurate assembly of a genome that is consistent with the optical map information provided. Our simulations on bacterial genomes show that AGORA is effective at producing assemblies closely matching the reference sequences. Additionally, we show that noise in the optical map can have a strong impact on the final assembly quality for some complex genomes, and we also measure how various characteristics of the starting de Bruijn graph may impact the quality of the final assembly. Lastly, we show that a proper choice of restriction enzyme for the optical map may substantially improve the quality of the final assembly. Conclusions Our work shows that optical maps can be used effectively to assemble genomes within the de Bruijn graph assembly framework. Our experiments also provide insights into the characteristics of the mapping data that most affect the performance of our algorithm, indicating the

  2. Gene transfer and transposition mutagenesis in Streptomyces roseosporus: mapping of insertions that influence daptomycin or pigment production.

    Science.gov (United States)

    McHenney, M A; Baltz, R H

    1996-09-01

    Streptomyces reseosporus, the producer of the cyclic lipopeptide antibiotic daptomycin, was shown to be a suitable host for molecular genetic manipulation. S. roseosporus does not appear to express significant restriction barriers based upon bacteriophage plaque formation studies. Plasmid DNA can be introduced into S. roseosporus by bacteriophage-FP43-mediated transduction and by conjugation from Escherichia coli. The streptomycete transposons Tn5096 and Tn5099, derived from IS493, transpose in S. roseosporus, and Tn5099-induced transposition mutants altered in the production of daptomycin, red pigment or black pigment were identified, and mapped to Dral and Asnl fragments. Three auxotrophic mutations (argB1, ade-1 and metB1) were identified among 100 individual Tn5096 insertions. Alignment and physical mapping of several Tn5099 insertions in Dral-E and Asnl-B fragments was facilitated by the presence of Dral and Asnl cleavage sites in Tn5099.

  3. pEVL: A Linear Plasmid for Generating mRNA IVT Templates With Extended Encoded Poly(A Sequences

    Directory of Open Access Journals (Sweden)

    Alexandra E Grier

    2016-01-01

    Full Text Available Increasing demand for large-scale synthesis of in vitro transcribed (IVT mRNA is being driven by the increasing use of mRNA for transient gene expression in cell engineering and therapeutic applications. An important determinant of IVT mRNA potency is the 3′ polyadenosine (poly(A tail, the length of which correlates with translational efficiency. However, present methods for generation of IVT mRNA rely on templates derived from circular plasmids or PCR products, in which homopolymeric tracts are unstable, thus limiting encoded poly(A tail lengths to ≃120 base pairs (bp. Here, we have developed a novel method for generation of extended poly(A tracts using a previously described linear plasmid system, pJazz. We find that linear plasmids can successfully propagate poly(A tracts up to ≃500 bp in length for IVT mRNA production. We then modified pJazz by removing extraneous restriction sites, adding a T7 promoter sequence upstream from an extended multiple cloning site, and adding a unique type-IIS restriction site downstream from the encoded poly(A tract to facilitate generation of IVT mRNA with precisely defined encoded poly(A tracts and 3′ termini. The resulting plasmid, designated pEVL, can be used to generate IVT mRNA with consistent defined lengths and terminal residue(s.

  4. Plasmid transfer between bacteria in soil microcosms and the field

    Directory of Open Access Journals (Sweden)

    Eric Smit

    1997-01-01

    Full Text Available In ibis review factors influencing conjugal plasmid transfer between bacteria and the possible role of naturally occurring selftransmissible plasmide for the dissemination of recombinant DNA in soil will be discussed. In microcosm studies, plasmid transfer between various species of introduced bacteria has been detected. Moreover, plamid transfer to indigenous soil micoorganisms was observed. Soil is an oligotrophic environment and plasmid transfer occurred mainly under conditions which were nutritionally favourable for bacteria, such as in the plant rhizosphere and in the presence of clay minerais or added nutrients. Mobilizable plasmids, lacking the ability to transfer themselves, have been reported to be transferred in the presence of selftransmissible plasmids. A study comparing conjugal transfer in microcosme with those in the field revealed that the transfer rates found in microcosme and in the field were similar. Transfer of chromosomal DNA by plasmid RP4 could only be shown on filters and was not observed in soil. Transfer of plasmids carrying biodegradative genes appeared to be favoured in the presence of the compound that can be degraded. Evidence was found for the presence of naturally-occurring selftransmissible plasmids in bacteria in the rhizosphere which could mobilize recombinant plasmids.

  5. Isolation and screening of plasmids from the epilithon which mobilize recombinant plasmid pD10.

    OpenAIRE

    Hill, K E; A. J. Weightman; Fry, J C

    1992-01-01

    This study examined the potential of bacteria from river epilithon to mobilize a recombinant catabolic plasmid, pD10, encoding 3-chlorobenzoate degradation and kanamycin resistance. Fifty-four mobilizing plasmids were exogenously isolated by triparental matings between strains of Pseudomonas putida and epilithic bacteria from the River Taff (South Wales, United Kingdom). Frequencies for mobilization ranged from 1.7 x 10(-8) to 4.5 x 10(-3) per recipient at 20 degrees C. The sizes of the mobil...

  6. Vaccination with Trypomastigote Surface Antigen 1-Encoding Plasmid DNA Confers Protection against Lethal Trypanosoma cruzi Infection

    OpenAIRE

    1998-01-01

    DNA vaccination was evaluated with the experimental murine model of Trypanosoma cruzi infection as a means to induce antiparasite protective immunity, and the trypomastigote surface antigen 1 (TSA-1), a target of anti-T. cruzi antibody and major histocompatibility complex (MHC) class I-restricted CD8+ cytotoxic T-lymphocyte (CTL) responses, was used as the model antigen. Following the intramuscular immunization of H-2b and H-2d mice with a plasmid DNA encoding an N-terminally truncated TSA-1 ...

  7. Genes from plasmid pKM101 in Haemophilus influenzae: separation of functions of mucA and mucB

    Energy Technology Data Exchange (ETDEWEB)

    Balganesh, M.; Setlow, J.K.

    1985-11-01

    Haemophilus influenzae, normally not mutable by UV, became UV mutable with a recombinant plasmid insertion. A 7.8-kilobase-pair (kbp) fragment of the plasmid pKM101 containing the mucA and mucB genes was ligated to the shuttle vector pDM2, and a Rec- strain of H. influenzae was transformed with the ligated mixture. All of the transformants, unlike the parent Rec- strain, were resistant to UV, could carry out postreplication repair and Weigle reactivation, showed greatly increased spontaneous mutation, and contained a plasmid carrying an insert of only 1.2 rather than 7.8 kbp. This plasmid in a umuC mutant strain of Escherichia coli complemented a pKM101 derivative lacking mucA function but with an intact mucB gene, although there was no complementation with a mucA+ mucB- plasmid, suggesting that the newly constructed plasmid coded for the mucA protein; this is in accord with the restriction analysis and hybridization between the plasmid and a probe containing all of the mucA gene but only a small fraction of mucB. When one of the H. influenzae Rec- transformants lost the plasmid, the resistance to UV was retained but the high spontaneous mutation and UV mutability were not. The fact that there was hybridization between the chromosome of the cured strain and a probe containing both muc genes but none when almost no mucB was present suggested that at least part of the mucB gene had been integrated into the Rec- chromosome. Five different postreplication repair-proficient strains became UV mutable and had high spontaneous mutation rates caused by the putative mucA plasmid, indicating that these strains already possessed a chromosomal equivalent of the mucB gene.

  8. Isolation of clinical strains of Pseudomonas aeruginosa harboring different plasmids.

    Science.gov (United States)

    Ranjbar, R; Owlia, P; Saderi, H; Bameri, Z; Izadi, M; Jonaidi, N; Morovvati, S

    2007-09-01

    Aim of this study was to investigate the presence of plasmids among the strains of P. aeruginosa isolated from clinically diagnosed cases in Tehran in 2006. A total of 38 strains of P. aeruginosa were isolated. With the exception of one isolate, all P. aeruginosa strains harbored at least one plasmid band. The electrophoretic analysis of plasmid DNAs showed different number of plasmid bands among the strains tested. The DNA band of 1.4 kbp was evident in 84.2% of the strains. Approximately 71 and 21% of the isolates harbored concomitantly two and three plasmids, respectively. Isolation of strains with diverse types of plasmids suggests the different cluster of P. aeruginosa might be disseminated during the current study period.

  9. Construction of Prokaryotic Expression Plasmid of mtrC Protein of Neisseria gonorrhoeae and Its Expression in E. Coli

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    In order to provide a rational research basis for detection of resistance of Neisseria gonorrhoeae to antimicrobial hydrophobic agents and study on the resistant mechanism of multiple transferable resistance (mtr) efflux system, plasmid pET-28a(+) encoding mtrC gene was constructed and the related target protein was expressed in Escherichia coli (E. coli) DE3. The fragments of mtrC gene of Neisseria gonorrhoeae from the standard strains were amplified and cloned into prokaryotic expression plasmid pET-28a(+) with restriction endonuclease to construct recombinant pET-mtrC which was verified by restriction endonuclease and DNA sequencing. The recombinant was transformed into E. coli DE3 to express the protein mtrC induced by IPTG. The results showed mtrC DNA fragment was proved correct through restriction endonuclease and DNA sequencing. Its sequence was 99.5 % homologus to that published on GeneBank (U14993). A 48.5 kD fusion protein which was induced by IPTG was detected by SDS-PAGE. It was concluded that the construction of prokaryotic expression plasmid of mtrC protein of Neisseria gonorrhoeae was correct and the fusion protein was successively expressed in E. coli.

  10. Type I restriction enzymes and their relatives.

    Science.gov (United States)

    Loenen, Wil A M; Dryden, David T F; Raleigh, Elisabeth A; Wilson, Geoffrey G

    2014-01-01

    Type I restriction enzymes (REases) are large pentameric proteins with separate restriction (R), methylation (M) and DNA sequence-recognition (S) subunits. They were the first REases to be discovered and purified, but unlike the enormously useful Type II REases, they have yet to find a place in the enzymatic toolbox of molecular biologists. Type I enzymes have been difficult to characterize, but this is changing as genome analysis reveals their genes, and methylome analysis reveals their recognition sequences. Several Type I REases have been studied in detail and what has been learned about them invites greater attention. In this article, we discuss aspects of the biochemistry, biology and regulation of Type I REases, and of the mechanisms that bacteriophages and plasmids have evolved to evade them. Type I REases have a remarkable ability to change sequence specificity by domain shuffling and rearrangements. We summarize the classic experiments and observations that led to this discovery, and we discuss how this ability depends on the modular organizations of the enzymes and of their S subunits. Finally, we describe examples of Type II restriction-modification systems that have features in common with Type I enzymes, with emphasis on the varied Type IIG enzymes.

  11. Conjugative botulinum neurotoxin-encoding plasmids in Clostridium botulinum.

    Directory of Open Access Journals (Sweden)

    Kristin M Marshall

    Full Text Available BACKGROUND: Clostridium botulinum produces seven distinct serotypes of botulinum neurotoxins (BoNTs. The genes encoding different subtype neurotoxins of serotypes A, B, F and several dual neurotoxin-producing strains have been shown to reside on plasmids, suggesting that intra- and interspecies transfer of BoNT-encoding plasmids may occur. The objective of the present study was to determine whether these C. botulinum BoNT-encoding plasmids are conjugative. METHODOLOGY/PRINCIPAL FINDINGS: C. botulinum BoNT-encoding plasmids pBotCDC-A3 (strain CDC-A3, pCLJ (strain 657Ba and pCLL (strain Eklund 17B were tagged with the erythromycin resistance marker (Erm using the ClosTron mutagenesis system by inserting a group II intron into the neurotoxin genes carried on these plasmids. Transfer of the tagged plasmids from the donor strains CDC-A3, 657Ba and Eklund 17B to tetracycline-resistant recipient C. botulinum strains was evaluated in mating experiments. Erythromycin and tetracycline resistant transconjugants were isolated from donor:recipient mating pairs tested. Transfer of the plasmids to the transconjugants was confirmed by pulsed-field gel electrophoresis (PFGE and Southern hybridizations. Transfer required cell-to-cell contact and was DNase resistant. This indicates that transfer of these plasmids occurs via a conjugation mechanism. CONCLUSIONS/SIGNIFICANCE: This is the first evidence supporting conjugal transfer of native botulinum neurotoxin-encoding plasmids in C. botulinum, and provides a probable mechanism for the lateral distribution of BoNT-encoding plasmids to other C. botulinum strains. The potential transfer of C. botulinum BoNT-encoding plasmids to other bacterial hosts in the environment or within the human intestine is of great concern for human pathogenicity and necessitates further characterization of these plasmids.

  12. Photonic plasmid stability of transformed Salmonella Typhimurium: A comparison of three unique plasmids

    Directory of Open Access Journals (Sweden)

    Lay Donald

    2009-07-01

    Full Text Available Abstract Background Acquiring a highly stable photonic plasmid in transformed Salmonella Typhimurium for use in biophotonic studies of bacterial tracking in vivo is critical to experimental paradigm development. The objective of this study was to determine stability of transformed Salmonella Typhimurium (S. typh-lux using three different plasmids and characterize their respective photonic properties. Results In presence of ampicillin (AMP, S. typh-lux with pCGLS-1, pAK1-lux and pXEN-1 plasmids exhibited 100% photon-emitting colonies over a 10-d study period. Photon emitters of S. typh-lux with pCGLS-1, pAK1-lux and pXEN-1 without AMP selection decreased over time (P 7 to 1 × 109 CFU, P 0.05; although photonic emissions across a range of bacterial concentrations were not different (1 × 104 to 1 × 106 CFU, P > 0.05. For very low density bacterial concentrations imaged in 96 well plates photonic emissions were positively correlated with bacterial concentration (P 3 to 1 × 105 CFU low to high were different in the 96-well plate format (P Conclusion These data characterize photon stability properties for S. typh-lux transformed with three different photon generating plasmids that may facilitate real-time Salmonella tracking using in vivo or in situ biophotonic paradigms.

  13. Development of a humanized HLA-A2.1/DP4 transgenic mouse model and the use of this model to map HLA-DP4-restricted epitopes of HBV envelope protein.

    Directory of Open Access Journals (Sweden)

    Zhitao Ru

    Full Text Available A new homozygous humanized transgenic mouse strain, HLA-A2.1(+/+HLA-DP4(+/+ hCD4(+/+mCD4(-/-IAβ(-/-β2m(-/- (HLA-A2/DP4, was obtained by crossing the previously characterized HLA-A2(+/+β2m(-/- (A2 mouse and our previously created HLA-DP4(+/+ hCD4(+/+mCD4(-/-IAβ(-/- (DP4 mouse. We confirmed that the transgenes (HLA-A2, HLA-DP4, hCD4 inherited from the parental A2 and DP4 mice are functional in the HLA-A2/DP4 mice. After immunizing HLA-A2/DP4 mice with a hepatitis B DNA vaccine, hepatitis B virus-specific antibodies, HLA-A2-restricted and HLA-DP4-restricted responses were observed to be similar to those in naturally infected humans. Therefore, the present study demonstrated that HLA-A2/DP4 transgenic mice can faithfully mimic human cellular responses. Furthermore, we reported four new HLA-DP4-restricted epitopes derived from HBsAg that were identified in both vaccinated HLA-A2/DP4 mice and HLA-DP4-positive human individuals. The HLA-A2/DP4 mouse model is a promising preclinical animal model carrying alleles present to more than a quarter of the human population. This model should facilitate the identification of novel HLA-A2- and HLA-DP4-restricted epitopes and vaccine development as well as the characterization of HLA-DP4-restricted responses against infection in humans.

  14. Plasmids in Mycoplasma species isolated from goats and sheep and their preliminary typing

    Directory of Open Access Journals (Sweden)

    Nascimento Elmiro R.

    1999-01-01

    Full Text Available One-hundred-five (105 clinical isolates of mycoplasma from caprine origin and one isolate from ovine were surveyed for plasmids, which were present in thirty-three (31% of them. These mycoplasmas originated from 13 herds. Ten of them were symptomatic for mycoplasmal disease (mastitis, polyarthritis, septicemia and three herds were asymptomatic, i.e., clinically normal. Twenty-eight isolates were Mycoplasma mycoides subspecies mycoides LC (large colony or caprine biotype, four were Mycoplasma capricolum subsp. capricolum and one was Mycoplasma cottewii. The isolated plasmids were linearized by EcoRI, EcoRV, EcoRI and EcoRV or BamHI and EcoRV, and were of five sizes (1.1, 1.6, 1.7, 1.8, and 1.9 Kbp. Based on restriction enzyme digestion and size of the linearized supercoiled extrachromosomal DNA, five plasmid types were recovered (p1II, p2III, p2V, p3I, and p4IV. The small size of these DNA elements probably exclude replicative forms of DNA virus, which are equal or larger than 8.0 Kbp.

  15. Construtcion of Neisseria Gonorrhoeae Porin B Plasmid Recombinant and Its Expression in E.coli

    Institute of Scientific and Technical Information of China (English)

    SONG Qifa; LIAO Fang; YE Siying; CUI Bing; XIONG Ping

    2005-01-01

    Summary: A prokaryotic expression recombinant plasmid pET-PIB to express porin B (PIB) of Neisseria gonorrhoeae in E.coli DE3 was constructed in order to provide a basis of research in detection, prophylactic and therapeutic vaccine against the pathogen infection. The gene encoding PIB was amplified by PCR from Neisseria gonorrhoeae and cloned into prokaryotic expression plasmid pET-28a(+) to construct a pET-PIB recombinant, which was verified by restriction endonuclease and DNA sequencing. Protein PIB was expressed in E.coli DE3 induced with IPTG. The antigenicity of the expressed protein was evaluated by indirect ELISA. Rabbits were immunized with the protein and serum was collected after immunization. To assess the immunogenicity of the protein, the titer of serum to protein PIB was determined by ELISA. DNA sequence analysis showed that the nucleic acid sequence of PIB gene was 99.28 % of homology compared with that (NGPIB18) published in GenBank. A 41 kD fused protein was detected by SDS-PAGE and was proven to have reactivity with anti-PIB polyclonal antibody from mouse. A polyclonal antibody to PIB of 1:4000 titer determined by indirect ELISA was obtained from rabbit immunized with the purified product. Recombinant plasmid encoding PIB of Neisseria gonorrhoeae was constructed. Protein PIB with antigenicity and immunogenicity was successfully expressed.

  16. Bacteriophages Limit the Existence Conditions for Conjugative Plasmids

    Science.gov (United States)

    Wood, A. Jamie; Dytham, Calvin; Pitchford, Jonathan W.; Truman, Julie; Spiers, Andrew; Paterson, Steve; Brockhurst, Michael A.

    2015-01-01

    ABSTRACT Bacteriophages are a major cause of bacterial mortality and impose strong selection on natural bacterial populations, yet their effects on the dynamics of conjugative plasmids have rarely been tested. We combined experimental evolution, mathematical modeling, and individual-based simulations to explain how the ecological and population genetics effects of bacteriophages upon bacteria interact to determine the dynamics of conjugative plasmids and their persistence. The ecological effects of bacteriophages on bacteria are predicted to limit the existence conditions for conjugative plasmids, preventing persistence under weak selection for plasmid accessory traits. Experiments showed that phages drove faster extinction of plasmids in environments where the plasmid conferred no benefit, but they also revealed more complex effects of phages on plasmid dynamics under these conditions, specifically, the temporary maintenance of plasmids at fixation followed by rapid loss. We hypothesized that the population genetic effects of bacteriophages, specifically, selection for phage resistance mutations, may have caused this. Further mathematical modeling and individual-based simulations supported our hypothesis, showing that conjugative plasmids may hitchhike with phage resistance mutations in the bacterial chromosome. PMID:26037122

  17. Plasmid genes required for microcin B17 production.

    Science.gov (United States)

    San Millán, J L; Kolter, R; Moreno, F

    1985-09-01

    The production of the antibiotic substance microcin B17 (Mcc) is determined by a 3.5-kilobase DNA fragment from plasmid pMccB17. Several Mcc- mutations on plasmid pMccB17 were obtained by both transposon insertion and nitrosoguanidine mutagenesis. Plasmids carrying these mutations were tested for their ability to complement Mcc- insertion or deletion mutations on pMM102 (pMM102 is a pBR322 derivative carrying the region encoding microcin B17). Results from these experiments indicate that at least four plasmid genes are required for microcin production.

  18. Plasmid P1 replication: negative control by repeated DNA sequences.

    OpenAIRE

    Chattoraj, D; Cordes, K.; Abeles, A

    1984-01-01

    The incompatibility locus, incA, of the unit-copy plasmid P1 is contained within a fragment that is essentially a set of nine 19-base-pair repeats. One or more copies of the fragment destabilizes the plasmid when present in trans. Here we show that extra copies of incA interfere with plasmid DNA replication and that a deletion of most of incA increases plasmid copy number. Thus, incA is not essential for replication but is required for its control. When cloned in a high-copy-number vector, pi...

  19. [Isolation of the R'his plasmids of Vibrio cholerae].

    Science.gov (United States)

    Rusina, O Iu; Tiganova, I G; Aleshkin, G I; Andreeva, I V; Skavronskaia, A G

    1987-06-01

    V. cholerae strain VT5104 capable of donor activity in conjugation has been constructed by the genetic technique based on plasmid RP4::Mucts62 integration into V. cholerae chromosome due to plasmid homology with Mucts62 inserted into the chromosome. The gene for histidine synthesis has been mobilized and transferred into the recipient cells from VT5104 donor. The conjugants obtained are able to efficiently transfer his+ gene included into the plasmid structure in conjugation with eltor recipient. Thus, the constructed strain VT5104 generates R' plasmids carrying V. cholerae chromosomal genes.

  20. Restrictions and Proportionality

    DEFF Research Database (Denmark)

    Werlauff, Erik

    2009-01-01

    The article discusses three central aspects of the freedoms under European Community law, namely 1) the prohibition against restrictions as an important extension of the prohibition against discrimination, 2) a prohibition against exit restrictions which is just as important as the prohibition...

  1. Degradative Plasmid and Heavy Metal Resistance Plasmid Naturally Coexist in Phenol and Cyanide Assimilating Bacteria

    Directory of Open Access Journals (Sweden)

    Bahig E.  Deeb

    2009-01-01

    Full Text Available Problem statement: Heavy metals are known to be powerful inhibitors of xenobiotics biodegradation activities. Alleviation the inhibitory effect of these metals on the phenol biodegradation activities in presence of heavy metals resistant plasmid was investigated. Approach: Combination of genetic systems of degradation of xenobiotic compound and heavy metal resistance was one of the approaches to the creation of polyfunctional strains for bioremediation of soil after co-contamination with organic pollutants and heavy metals. Results: A bacterial strain Pseudomonas putida PhCN (pPhCN1, pPhCN2 had been obtained. This bacterium contained two plasmids, a 120 Kb catabolic plasmid that encode for breakdown of phenol (pPhCN1 and pPhCN2 plasmid (100 Kb that code for cadmium and copper resistant. Cyanide assimilation by this bacterium was encoded by chromosomal genes. The inhibitory effect of cadmium (Cd2+ or copper (Cu2+ on the degradation of phenol and cyanide by P. putida strains PhCN and PhCN1 (contained pPhCN1 were investigated. The resistant strain PhCN showed high ability to degrade phenol and cyanide in presence of Cd2+ or Cu2+ comparing with the sensitive strain PhCN1. In addition, Cd2+ or Cu2+ was also found to exert a strong inhibitory effect on the C23O dioxygenase enzyme activity in the presence of cyanide as a nitrogen source. Conclusion: The presence of heavy metal resistance plasmid alleviated the inhibitory effect of metals on the phenol and cyanide assimilation by resistant strain.

  2. Helper plasmid cloning in Streptococcus sanguis: cloning of a tetracycline resistance determinant from the Streptococcus mutans chromosome.

    Science.gov (United States)

    Tobian, J A; Macrina, F L

    1982-10-01

    A model system for testing the helper plasmid cloning system of Gryczan et al. (Mol. Gen. Genet. 177:459-467, 1980) was devised for the Streptococcus sanguis (Challis) host-vector system. In this system, linearized pVA736 plasmid efficiently transformed an S. sanguis (Challis) host containing a homologous plasmid, pVA380-1, but did not transform a plasmidless host or a host containing a nonhomologous plasmid, pVA380. In addition, whereas monomeric circular pVA736 transformed a plasmidless host with two-hit kinetics, it transformed a pVA380-1-containing host with one-hit kinetics. This helper plasmid cloning system was used to isolate two HindIII fragments (5.0 megadaltons [Mdal] and 1.9 Mdal in size) from the chromosome of Streptococcus mutans V825 which conferred high-level tetracycline resistance. One tetracycline-resistant clone was examined and found to contain three plasmids which were sized and designated pVA868 (9.0 Mdal), pVA869 (9.5 Mdal), and pVA870 (9.8 Mdal). Results of Southern blot hybridization and restriction endonuclease digestion confirmed that all three chimeras were composed of two HindIII fragments of the S. mutans V825 chromosome, as well as a large portion, varying in size for each chimera, of the 2.8 Mdal cloning vector, pVA380-1. Incompatibility observed between pVA380-1 and each of the chimeras indicated that replication of the chimeras was governed by the pVA380-1 replicative origin. Southern blotting experiments revealed that the chimeras hybridized to Tn916, providing the first evidence that transposon-related genes of enteric streptococcal origin are disseminated among oral streptococci.

  3. Host cell variations resulting from F plasmid-controlled replication of the Escherichia coli chromosome.

    Science.gov (United States)

    Tresguerres, E F; Nieto, C; Casquero, I; Cánovas, J L

    1986-01-01

    Cell size and DNA concentration were measured in Escherichia coli K-12 ET64. This strain carries a dnaA (Ts) mutation that has been suppressed by the insertion of the F plasmid into the chromosome. ET64 can grow in a balanced steady state of exponential growth at the restrictive temperature for its dnaA allele (39 degrees C), in which chromosome replication is controlled by the F plasmid, and at the permissive temperature (30 degrees C), in which chromosome replication is controlled by dnaA-oriC. When cells grown at the indicated temperatures were compared, it was observed that at 39 degrees C, the cell mass increased and the amount of cellular DNA decreased slightly; therefore, the DNA concentration was strongly reduced. These changes can neither be explained by the reduction of the generation time (which is only 10-15%) nor from observed changes in the replication time and in the time between DNA synthesis termination and cell division. Variations were mainly due to the increase in cell mass per origin of replication, at initiation, in cells grown at 39 degrees C. Control of chromosome replication by the F plasmid appears to be the reason for the increase in the initiation mass. Other possible causes, such as the modification of growth temperature, the generation time, or both, were discarded. These observations suggest that at one growth rate, the F plasmid replicates at a particular cell mass to F particle number ratio, and that this ratio is higher than the cell mass to oriC ratio at the initiation of chromosome replication. This fact might be significant to coordinate the replication of two different replicons in the same cell. PMID:3511032

  4. PERCEPTUAL MAPPING BASED ON IDIOSYNCRATIC SETS OF ATTRIBUTES

    NARCIS (Netherlands)

    STEENKAMP, JBEM; VANTRIJP, HCM; TENBERGE, JMF

    1994-01-01

    The authors describe a compositional perceptual mapping procedure, unrestricted attribute-elicitation mapping (UAM), which allows consumers to describe and rate the brands in their own terminology and thus relaxes the restrictive assumptions of traditional compositional mapping techniques regarding

  5. Plasmid Stability in Dried Cells of the Desert Cyanobacterium Chroococcidiopsis and its Potential for GFP Imaging of Survivors on Earth and in Space

    Science.gov (United States)

    Billi, Daniela

    2012-06-01

    Two GFP-based plasmids, namely pTTQ18-GFP-pDU1mini and pDUCA7-GFP, of about 7 kbp and 15 kbp respectively, able to replicate in Chroococcidiopsis sp. CCMEE 029 and CCMEE 123, were developed. Both plasmids were maintained in Chroococcidiopsis cells after 18 months of dry storage as demonstrated by colony PCR, plasmid restriction analysis, GFP imaging and colony-forming ability under selection of dried transformants; thus suggesting that strategies employed by this cyanobacterium to stabilize dried chromosomal DNA, must have protected plasmid DNA. The suitability of pDU1mini-plasmid for GFP tagging in Chroococcidiopsis was investigated by using the RecA homolog of Synechocystis sp. PCC 6803. After 2 months of dry storage, the presence of dried cells with a GFP-RecASyn distribution resembling that of hydrated cells, supported its capability of preventing desiccation-induced genome damage, whereas the rewetted cells with filamentous GFP-RecASyn structures revealed sub-lethal DNA damage. The long-term stability of plasmid DNA in dried Chroococcidiopsis has implication for space research, for example when investigating the recovery of dried cells after Martian and space simulations or when developing life support systems based on phototrophs with genetically enhanced stress tolerance and stored in the dry state for prolonged periods.

  6. The RepA_N replicons of Gram-positive bacteria: a family of broadly distributed but narrow host range plasmids.

    Science.gov (United States)

    Weaver, Keith E; Kwong, Stephen M; Firth, Neville; Francia, Maria Victoria

    2009-03-01

    The pheromone-responsive conjugative plasmids of Enterococcus faecalis and the multiresistance plasmids pSK1 and pSK41 of Staphylococcus aureus are among the best studied plasmids native to Gram-positive bacteria. Although these plasmids seem largely restricted to their native hosts, protein sequence comparison of their replication initiator proteins indicates that they are clearly related. Homology searches indicate that these replicons are representatives of a large family of plasmids and a few phage that are widespread among the low G+C Gram-positive bacteria. We propose to name this family the RepA_N family of replicons after the annotated conserved domain that the initiator protein contains. Detailed sequence comparisons indicate that the initiator protein phylogeny is largely congruent with that of the host, suggesting that the replicons have evolved along with their current hosts and that intergeneric transfer has been rare. However, related proteins were identified on chromosomal regions bearing characteristics indicative of ICE elements, and the phylogeny of these proteins displayed evidence of more frequent intergeneric transfer. Comparison of stability determinants associated with the RepA_N replicons suggests that they have a modular evolution as has been observed in other plasmid families.

  7. Sequence specific inhibition of DNA restriction enzyme cleavage by PNA

    DEFF Research Database (Denmark)

    Nielsen, P.E.; Egholm, M.; Berg, R.H.

    1993-01-01

    Plasmids containing double-stranded 10-mer PNA (peptide nucleic acid chimera) targets proximally flanked by two restriction enzyme sites were challenged with the complementary PNA or PNAs having one or two mismatches, and the effect on the restriction enzyme cleavage of the flanking sites...... was assayed. The following PNAs were used: T10-LysNH2, T5CT4-LysNH2 and T2CT2CT4-LysNH2 and the corresponding targets cloned into pUC 19 were flanked by BamH1, Sal1 or Pstl sites, respectively. In all cases it was found that complete inhibition of restriction enzyme cleavage was obtained...

  8. The other way around: probiotic Lactobacillus acidophilus NP51 restrict progression of Mycobacterium avium subspecies paratuberculosis (MAP) infection in Balb/c mice via activiation of CD8 alpha+ immune cell-mediated immunity

    Science.gov (United States)

    The objective of this study was to examine the immune-modulating effects of feeding a novel probiotic Lactobacillus acidophilus strain NP51 to specific pathogen-free Balb/c mice challenged with Mycobacterium avium subspecies paratuberculosis (MAP), the causative agent of Johne’s disease (JD) in rumi...

  9. The other way around: Probiotic lactobacillus acidophilus NP51 restricts progression of Mycobacterium avium subspecies paratuberculosis (MAP) infection in Balb/c mice through activation of CD8+ T cell-mediated immunity

    Science.gov (United States)

    The objective of this study was to examine immune effects of feeding novel probiotic Lactobacillus acidophilus strain NP51 to specific pathogen-free Balb/c mice challenged with Mycobacterium avium subspecies paratuberculosis (MAP), the causative agent of Johne’s disease (JD). We hypothesized that fe...

  10. Chromosomal targeting of replicating plasmids in the yeast Hansenula polymorpha

    NARCIS (Netherlands)

    Faber, Klaas Nico; Swaving, Gert Jan; Faber, Folkert; Ab, Geert; Harder, Willem; Veenhuis, Marten; Haima, Pieter

    1992-01-01

    Using an optimized transformation protocol we have studied the possible interactions between transforming plasmid DNA and the Hansenula polymorpha genome. Plasmids consisting only of a pBR322 replicon, an antibiotic resistance marker for Escherichia coli and the Saccharomyces cerevisiae LEU2 gene we

  11. Genomic comparison of archaeal conjugative plasmids from Sulfolobus

    DEFF Research Database (Denmark)

    Greve, Bo Bjørn

    2004-01-01

    All of the known self-transmissable plasmids of the Archaea have been found in the genus Sulfolobus. To gain more insight into archaeal conjugative processes, four newly isolated self-transmissable plasmids, pKEF9, pHVE14, pARN3 and pARN4, were sequenced and subjected to a comparative sequence...

  12. Linear plasmid in the genome of Clavibacter michiganensis subsp. sepedonicus.

    Science.gov (United States)

    Brown, Susan E; Knudson, Dennis L; Ishimaru, Carol A

    2002-05-01

    Contour-clamped homogeneous electric field gel analysis of genomic DNA of the plant pathogen Clavibacter michiganensis subsp. sepedonicus revealed the presence of a previously unreported extrachromosomal element. This new element was demonstrated to be a linear plasmid. Of 11 strains evaluated, all contained either a 90-kb (pCSL1) or a 140-kb (pCSL2) linear plasmid.

  13. Homology of plasmids in strains of unicellular cyanobacteria

    NARCIS (Netherlands)

    Hondel, C.A.M.J.J. van den; Keegstra, W.; Borrias, W.E.; Arkel, G.A. van

    1979-01-01

    Six strains of unicellular cyanobacteria were examined for the presence of plasmids. Analysis of lysates of these strains by CsCl-ethidium bromide density centrifugation yielded a major chromosomal DNA band and a minor band containing covalently closed circular plasmid DNA, as shown by electron micr

  14. Production and pharmaceutical formulation of plasmid DNA vaccines

    NARCIS (Netherlands)

    van der Heijden, I.

    2013-01-01

    Research leading to the thesis ‘Production and pharmaceutical formulation of plasmid DNA vaccines‘ can be divided into two parts. The first part describes the development of a Good Manufacturing Practice (GMP) compliant plasmid DNA production process of pDNA vaccines for the treatment of Human papil

  15. Production and pharmaceutical formulation of plasmid DNA vaccines

    NARCIS (Netherlands)

    van der Heijden, I.

    2013-01-01

    Research leading to the thesis ‘Production and pharmaceutical formulation of plasmid DNA vaccines‘ can be divided into two parts. The first part describes the development of a Good Manufacturing Practice (GMP) compliant plasmid DNA production process of pDNA vaccines for the treatment of Human papil

  16. Plasmid cloning vehicle for Haemophilus influenzae and Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    McCarthy, D.; Clayton, N.L.; Setlow, J.K.

    1982-09-01

    A new plasmid cloning vehicle (pDM2) was used to introduce a library of Haemophilus influenzae chromosomal fragments into H. influenzae. Transformants of the higly recombination-defective rec-1 mutant were more likely to contain exclusively recombinant plasmids after exposure to ligated DNA mixtures than was the wild type. pDM2 could replicate in Escherichia coli K-12.

  17. Functional analysis of three plasmids from Lactobacillus plantarum

    NARCIS (Netherlands)

    Kranenburg, R. van; Golic, N.; Bongers, R.; Leer, R.J.; Vos, W.M. de; Siezen, R.J.; Kleerebezem, M.

    2005-01-01

    Lactobacillus plantarum WCFS1 harbors three plasmids, pWCFS101, pWCFS102, and pWCFS103, with sizes of 1,917, 2,365, and 36,069 bp, respectively. The two smaller plasmids are of unknown function and contain replication genes that are likely to function via the rolling-circle replication mechanism. Th

  18. Identification of IncA/C Plasmid Replication and Maintenance Genes and Development of a Plasmid Multilocus Sequence Typing Scheme.

    Science.gov (United States)

    Hancock, Steven J; Phan, Minh-Duy; Peters, Kate M; Forde, Brian M; Chong, Teik Min; Yin, Wai-Fong; Chan, Kok-Gan; Paterson, David L; Walsh, Timothy R; Beatson, Scott A; Schembri, Mark A

    2017-02-01

    Plasmids of incompatibility group A/C (IncA/C) are becoming increasingly prevalent within pathogenic Enterobacteriaceae They are associated with the dissemination of multiple clinically relevant resistance genes, including blaCMY and blaNDM Current typing methods for IncA/C plasmids offer limited resolution. In this study, we present the complete sequence of a blaNDM-1-positive IncA/C plasmid, pMS6198A, isolated from a multidrug-resistant uropathogenic Escherichia coli strain. Hypersaturated transposon mutagenesis, coupled with transposon-directed insertion site sequencing (TraDIS), was employed to identify conserved genetic elements required for replication and maintenance of pMS6198A. Our analysis of TraDIS data identified roles for the replicon, including repA, a toxin-antitoxin system; two putative partitioning genes, parAB; and a putative gene, 053 Construction of mini-IncA/C plasmids and examination of their stability within E. coli confirmed that the region encompassing 053 contributes to the stable maintenance of IncA/C plasmids. Subsequently, the four major maintenance genes (repA, parAB, and 053) were used to construct a new plasmid multilocus sequence typing (PMLST) scheme for IncA/C plasmids. Application of this scheme to a database of 82 IncA/C plasmids identified 11 unique sequence types (STs), with two dominant STs. The majority of blaNDM-positive plasmids examined (15/17; 88%) fall into ST1, suggesting acquisition and subsequent expansion of this blaNDM-containing plasmid lineage. The IncA/C PMLST scheme represents a standardized tool to identify, track, and analyze the dissemination of important IncA/C plasmid lineages, particularly in the context of epidemiological studies. Copyright © 2017 American Society for Microbiology.

  19. Deciphering conjugative plasmid permissiveness in wastewater microbiomes

    DEFF Research Database (Denmark)

    Jacquiod, Samuel Jehan Auguste; Brejnrod, Asker Daniel; Milani, Stefan Morberg

    2017-01-01

    Wastewater treatment plants (WWTPs) are designed to robustly treat polluted water. They are characterized by ceaseless flows of organic, chemical and microbial matter, followed by treatment steps before environmental release. WWTPs are hotspots of horizontal gene transfer between bacteria via...... still remains largely uncharted. Furthermore, current in vitro methods used to assess conjugation in complex microbiomes do not include in situ behaviours of recipient cells, resulting in partial understanding of transfers. We investigated the in vitro conjugation capacities of WWTP microbiomes from...... diversity of recipient bacterial phyla for the plasmid was observed, especially in WWTP outlets. We also identified permissive bacteria potentially able to cross WWTPs and engage in conjugation before and after water treatment. Bacterial activity and lifestyle seem to influence conjugation extent...

  20. Expansion of the IncX plasmid family for improved identification and typing of novel plasmids in drug-resistant Enterobacteriaceae

    DEFF Research Database (Denmark)

    Johnson, Timothy J.; Bielak, Eliza Maria; Fortini, Daniela;

    2012-01-01

    and biofilm formation. Previous plasmid-based replicon typing procedures have indicated that the prevalence of IncX plasmids is low among members of the Enterobacteriaceae. However, examination of a number of IncX-like plasmid sequences and their occurrence in various organisms suggests that IncX plasmid...

  1. [Influence of spv plasmid genes group in Salmonella Enteritidis virulence for chickens. I. Occurrence of spv plasmid genes group in Salmonella Enteritidis large virulence plasmid].

    Science.gov (United States)

    Madajczak, Grzegorz; Binek, Marian

    2005-01-01

    Many Salmonella Enteritidis virulence factors are encoded by genes localized on plasmids, especially large virulence plasmid, in highly conserved fragment, they create spv plasmid gene group. The aims of realized researches were spv genes occurrence evaluation and composition analysis among Salmonella Enteritidis strains caused infection in chickens. Researches were realized on 107 isolates, where in every cases large virulence plasmid 59 kbp size were detected. Specific nucleotides sequences of spv genes (spvRABCD) were detected in 47.7% of isolates. In the rest of examined bacteria spv genes occurred variably. Most often extreme genes of spv group, like spvR and spvD were absent, what could indicate that factors encoded by them are not most important for Salmonella Enteritidis live and their expressed virulence.

  2. Sample displacement chromatography of plasmid DNA isoforms.

    Science.gov (United States)

    Černigoj, Urh; Martinuč, Urška; Cardoso, Sara; Sekirnik, Rok; Krajnc, Nika Lendero; Štrancar, Aleš

    2015-10-02

    Sample displacement chromatography (SDC) is a chromatographic technique that utilises different relative binding affinities of components in a sample mixture and has been widely studied in the context of peptide and protein purification. Here, we report a use of SDC to separate plasmid DNA (pDNA) isoforms under overloading conditions, where supercoiled (sc) isoform acts as a displacer of open circular (oc) or linear isoform. Since displacement is more efficient when mass transfer between stationary and mobile chromatographic phases is not limited by diffusion, we investigated convective interaction media (CIM) monoliths as stationary phases for pDNA isoform separation. CIM monoliths with different hydrophobicities and thus different binding affinities for pDNA (CIM C4 HLD, CIM-histamine and CIM-pyridine) were tested under hydrophobic interaction chromatography (HIC) conditions. SD efficiency for pDNA isoform separation was shown to be dependent on column selectivity for individual isoform, column efficiency and on ammonium sulfate (AS) concentration in loading buffer (binding strength). SD and negative mode elution often operate in parallel, therefore negative mode elution additionally influences the efficiency of the overall purification process. Optimisation of chromatographic conditions achieved 98% sc pDNA homogeneity and a dynamic binding capacity of over 1mg/mL at a relatively low concentration of AS. SDC was successfully implemented for the enrichment of sc pDNA for plasmid vectors of different sizes, and for separation of linear and and sc isoforms, independently of oc:sc isoform ratio, and flow-rate used. This study therefore identifies SDC as a promising new approach to large-scale pDNA purification, which is compatible with continuous, multicolumn chromatography systems, and could therefore be used to increase productivity of pDNA production in the future. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Permissiveness of soil microbial communities towards broad host range plasmids

    DEFF Research Database (Denmark)

    Klümper, Uli

    larger than previously assumed. I was able to show abundant plasmid transfer from the Gram negative donor strains to a wide diversity of Gram positive soil bacteria, formerly thought to constitute distinct clusters of gene transfer. Moreover, among the observed transconjugants, I identified a core super...... environmental factors that modulate plasmid transfer in soil microbial communities. In order to attain these goals, I developed a high-throughput method that enabled me to evaluate the permissiveness of bacterial communities towards introduced plasmids. This new approach is based on the introduction...... fraction of soil the bacteria (up to 1 in 10,000) were able to take up any of these broad host range conjugal plasmids. The transconjugal pools comprised 11 bacterial phyla. This finding indicates that the realized transfer range of broad host range plasmids in environmental microbial communities is much...

  4. Dissemination of NDM-1-Producing Enterobacteriaceae Mediated by the IncX3-Type Plasmid.

    Directory of Open Access Journals (Sweden)

    Qing Yang

    Full Text Available The emergence and spread of NDM-1-producing Enterobacteriaceae have resulted in a worldwide public health risk that has affected some provinces of China. China is an exceptionally large country, and there is a crucial need to investigate the epidemic of blaNDM-1-positive Enterobacteriaceae in our province. A total of 186 carbapenem-resistant Enterobacteriaceae isolates (CRE were collected in a grade-3 hospital in Zhejiang province. Carbapenem-resistant genes, including blaKPC, blaIMP, blaVIM, blaOXA-48 and blaNDM-1 were screened and sequenced. Ninety isolates were identified as harboring the blaKPC-2 genes, and five blaNDM-1-positive isolates were uncovered. XbaI-PFGE revealed that three blaNDM-1-positive K. pneumoniae isolates belonged to two different clones. S1-PFGE and southern blot suggested that the blaNDM-1 genes were located on IncX3-type plasmids with two different sizes ranging from 33.3 to 54.7 kb (n=4 and 104.5 to 138.9 kb (n=1, respectively, all of which could easily transfer to Escherichia coli by conjugation and electrotransformation. The high-throughput sequencing of two plasmids was performed leading to the identification of a smaller 54-kb plasmid, which had high sequence similarity with a previously reported pCFNDM-CN, and a larger plasmid in which only a 7.8-kb sequence of a common gene environment around blaNDM-1 (blaNDM-1-trpF- dsbC-cutA1-groEL-ΔInsE, was detected. PCR mapping and sequencing demonstrated that four smaller blaNDM-1 plasmids contained a common gene environment around blaNDM-1 (IS5-blaNDM-1-trpF- dsbC-cutA1-groEL. We monitored the CRE epidemic in our hospital and determined that KPC-2 carbapenemase was a major risk to patient health and the IncX3-type plasmid played a vital role in the spread of the blaNDM-1 gene among the CRE.

  5. Complex nature of enterococcal pheromone-responsive plasmids.

    Science.gov (United States)

    Wardal, Ewa; Sadowy, Ewa; Hryniewicz, Waleria

    2010-01-01

    Pheromone-responsive plasmids constitute a unique group of approximately 20 plasmids identified, as yet, only among enterococcal species. Several of their representatives, e.g. pAD1, pCF10, pPD1 and pAM373 have been extensively studied. These plasmids possess a sophisticated conjugation mechanism based on response to sex pheromones--small peptides produced by plasmid-free recipient cells. Detailed analysis of regulation and function of the pheromone response process revealed its great complexity and dual role--in plasmid conjugation and modulation of enterococcal virulence. Among other functional modules identified in pheromone plasmids, the stabilization/partition systems play a crucial role in stable maintenance of the plasmid molecule in host bacteria. Among them, the par locus of pAD1 is one of the exceptional RNA addiction systems. Pheromone-responsive plasmids contribute also to enterococcal phenotype being an important vehicle of antibiotic resistance in this genus. Both types of acquired vancomycin resistance determinants, vanA and vanB, as well many other resistant phenotypes, were found to be located on these plasmids. They also encode two basic agents of enterococcal virulence, i.e. aggregation substance (AS) and cytolysin. AS participates in mating-pair formation during conjugation but can also facilitate the adherence ofenterococci to human tissues during infection. The second protein, cytolysin, displays hemolytic activity and helps to invade eukaryotic cells. There are still many aspects of the nature of pheromone plasmids that remain unclear and more detailed studies are needed to understand their uniqueness and complexity.

  6. Antibiotic resistance of vibrio cholerae: special considerations of R-plasmids.

    Science.gov (United States)

    Kuwahara, S

    1978-09-01

    Studies on the transmission of R plasmid by conjugation between enterobacteria and vibrio or related bacteria were reviewed. The majority of the reports confirmed successful transmission from enterobacteria to Vibrio cholerae and related species, although the transmission frequencies were extremely low and the transmitted R plasmid was very unstable except for thermosensitive kanamycin plasmid and usual R plasmid coexisting with P plasmid. Strains of V. cholerae and Aeromonas liquefaciens as well as A. salmonicida bearing R plasmid were detected in nature. R plasmid was relatively unstable in V. cholerae strains with which transmission of R plasmid to enterobacteria was confirmed. At present, only 3 R plasmids have been obtained from naturally occurring strains of V. cholerae. Although the 2 European plasmids belong to the C incompatibility group with 98 megadalton closed covalent circular DNA molecule, one plasmid belongs to the J group with more than 25 megadalton molecular weight, and no CCC of satelite DNA was detected in bacteria harboring this plasmid.

  7. Homology between nucleotide sequences of promoter regions of nah and sal operons of NAH7 plasmid of Pseudomonas putida.

    OpenAIRE

    1986-01-01

    The in vivo transcription start sites of the nah and sal operons of the NAH7 plasmid were determined by S1 nuclease mapping and the nucleotide sequence surrounding these transcription start sites was determined. Since expression of both of these operons is coordinately controlled by the product of the transcriptional activator gene nahR, the sequences were compared to locate potential sites involved in common regulation. In the 100-base-pair region preceding transcription start sites of both ...

  8. Bacterial Mitosis: ParM of Plasmid R1 Moves Plasmid DNA by an Actin-like Insertional Polymerization Mechanism

    DEFF Research Database (Denmark)

    Møller-Jensen, Jakob; Borch, Jonas; Dam, Mette

    2003-01-01

    Bacterial DNA segregation takes place in an active and ordered fashion. In the case of Escherichia coli plasmid R1, the partitioning system (par) separates paired plasmid copies and moves them to opposite cell poles. Here we address the mechanism by which the three components of the R1 par system...

  9. Type 3 fimbriae, encoded by the conjugative plasmid pOLA52, enhance biofilm formation and transfer frequencies in Enterobacteriaceae strains

    DEFF Research Database (Denmark)

    Burmølle, Mette; Bahl, Martin Iain; Jensen, Lars Bogø

    2008-01-01

    biofilm-deficient mutants, which all mapped within a putative operon with high homology to the mrkABCDF operon of Klebsiella pneumoniae, where these genes are responsible for type 3 fimbriae expression, attachment to surfaces and biofilm formation. Biofilm formation in microtitre plates and in urinary......, resulting in enhanced conjugation frequencies and biofilm formation of the plasmid-harbouring strain....

  10. Anti-Restriction Protein, KlcAHS, Promotes Dissemination of Carbapenem Resistance

    Directory of Open Access Journals (Sweden)

    Xiaofei Jiang

    2017-05-01

    Full Text Available Carbapenemase-producing Klebsiella pneumoniae (KPC has emerged and spread throughout the world. A retrospective analysis was performed on carbapenem-resistant K. pneumoniae isolated at our teaching hospital during the period 2009–2010, when the initial outbreak occurred. To determine the mechanism(s that underlies the increased infectivity exhibited by KPC, Multilocus Sequence Typing (MLST was conducted. A series of plasmids was also extracted, sequenced and analyzed. Concurrently, the complete sequences of blaKPC−2-harboring plasmids deposited in GenBank were summarized and aligned. The blaKPC−2 and KlcAHS genes in the carbapenem-resistant K. pneumoniae isolates were examined. E. coli strains, carrying different Type I Restriction and Modification (RM systems, were selected to study the interaction between RM systems, anti-RM systems and horizontal gene transfer (HGT. The ST11 clone predominated among 102 carbapenem-resistant K. pneumoniae isolates, all harbored the blaKPC−2 gene; 98% contained the KlcAHS gene. KlcAHS was one of the core genes in the backbone region of most blaKPC−2 carrying plasmids. Type I RM systems in the host bacteria reduced the rate of pHS10842 plasmid transformation by 30- to 40-fold. Presence of the anti-restriction protein, KlcAHS, on the other hand, increased transformation efficiency by 3- to 6-fold. These results indicate that RM systems can significantly restrict HGT. In contrast, KlcAHS can disrupt the RM systems and promote HGT by transformation. These findings suggest that the anti-restriction protein, KlcAHS, represents a novel mechanism that facilitates the increased transfer of blaKPC-2 and KlcAHS-carrying plasmids among K. pneumoniae strains.

  11. Plasmid DNA Manufacturing for Indirect and Direct Clinical Applications.

    Science.gov (United States)

    Schmeer, Marco; Buchholz, Tatjana; Schleef, Martin

    2017-10-01

    Plasmid DNA is currently gaining increasing importance for clinical research applications in gene therapy and genetic vaccination. For direct gene transfer into humans, good manufacturing practice (GMP)-grade plasmid DNA is mandatory. The same holds true if the drug substance contains a genetically modified cell, for example chimeric antigen receptor (CAR) T cells, where these cells as well as the contained plasmids are used. According to the responsible regulatory agencies, they have to be produced under full GMP. On the other hand, for GMP production of, for example, mRNA or viral vectors (lentiviral vectors, adeno-associated virus vectors, etc.), in many cases, High Quality Grade plasmid DNA is accepted as a starting material. The manufacturing process passes through different production steps. To ensure the right conditions are used for the plasmid, a pilot run must be conducted at the beginning. In this step, a followed upscaling with respect to reproducibility and influences on product quality is performed. Subsequently, a cell bank of the transformed productions strain is established and characterized. This cell bank is used for the cultivation process. After cell harvesting and lysis, several chromatography steps are conducted to receive a pure plasmid product. Depending on the respective required quality grade, the plasmid product is subject to several quality controls. The last step consists of formulation and filling of the product.

  12. Plasmid-associated sensitivity of Bacillus thuringiensis to UV light

    Energy Technology Data Exchange (ETDEWEB)

    Benoit, T.G.; Wilson, G.R.; Bull, D.L.; Aronson, A.I. (Department of Agriculture, College Station, TX (USA))

    1990-08-01

    Spores and vegetative cells of Bacillus thuringiensis were more sensitive to UV light than were spores or cells of plasmid-cured B. thuringiensis strains or of the closely related Bacillus cereus. Introduction of B. thuringiensis plasmids into B. cereus by cell mating increased the UV sensitivity of the cells and spores. Protoxins encoded by one or more B. thuringiensis plasmids were not involved in spore sensitivity, since a B. thuringiensis strain conditional for protoxin accumulation was equally sensitive at the permissive and nonpermissive temperatures. In addition, introduction of either a cloned protoxin gene, the cloning vector, or another plasmid not containing a protoxin gene into a plasmid-cured strain of B. thuringiensis all increased the UV sensitivity of the spores. Although the variety of small, acid-soluble proteins was the same in the spores of all strains examined, the quantity of dipicolinic acid was about twice as high in the plasmid-containing strains, and this may account for the differences in UV sensitivity of the spores. The cells of some strains harboring only B. thuringiensis plasmids were much more sensitive than cells of any of the other strains, and the differences were much greater than observed with spores.

  13. In vitro replication of cyanobacterial plasmids from Synechocystis PCC 6803.

    Science.gov (United States)

    Yang, X; Daniell, H; McFadden, B

    1994-09-01

    Little knowledge of DNA replication in cyanobacteria is available. In this study, we report the development and characterization of an in vitro system for studies of replication of the endogenous plasmids from the unicellular cyanobacterium Synechocystis 6803. This system (fraction III) was isolated at high salt concentrations and partially purified on a heparin-agarose column. DNA polymerases in Synechocystis 6803 appeared to be associated with membranes and could be released by the addition of ammonium sulfate to 20% saturation. DNA synthesis in fraction III was dependent on the addition of cyanobacterial plasmids isolated from the same strain. The in vitro replication products consist mostly of the supercoiled form of the plasmids. Unlike replication of many Escherichia coli plasmids, replication of cyanobacterial plasmids did not require added ATP, was not inhibited by omission of the ribonucleotides, and was insensitive to the RNA polymerase inhibitor rifampicin and the gyrase inhibitor novobiocin, but was inhibited by ethidium bromide. These data suggest that RNA may not be involved in the initiation of replication of cyanobacterial plasmids from Synechocystis 6803. In addition, intermediates of replication have been detected by two-dimensional gel electrophoresis. Density labeling experiments also indicate that cyanobacterial plasmid synthesis in vitro occurs by a semiconservative replication.

  14. Vaccination with trypomastigote surface antigen 1-encoding plasmid DNA confers protection against lethal Trypanosoma cruzi infection.

    Science.gov (United States)

    Wizel, B; Garg, N; Tarleton, R L

    1998-11-01

    DNA vaccination was evaluated with the experimental murine model of Trypanosoma cruzi infection as a means to induce antiparasite protective immunity, and the trypomastigote surface antigen 1 (TSA-1), a target of anti-T. cruzi antibody and major histocompatibility complex (MHC) class I-restricted CD8(+) cytotoxic T-lymphocyte (CTL) responses, was used as the model antigen. Following the intramuscular immunization of H-2(b) and H-2(d) mice with a plasmid DNA encoding an N-terminally truncated TSA-1 lacking or containing the C-terminal nonapeptide tandem repeats, the antibody level, CTL response, and protection against challenge with T. cruzi were assessed. In H-2(b) mice, antiparasite antibodies were induced only by immunization with the DNA construct encoding TSA-1 containing the C-terminal repeats. However, both DNA constructs were efficient in eliciting long-lasting CTL responses against the protective H-2Kb-restricted TSA-1515-522 epitope. In H-2(d) mice, inoculation with either of the two TSA-1-expressing vectors effectively generated antiparasite antibodies and primed CTLs that lysed T. cruzi-infected cells in an antigen-specific, MHC class I-restricted, and CD8(+)-T-cell-dependent manner. When TSA-1 DNA-vaccinated animals were challenged with T. cruzi, 14 of 22 (64%) H-2(b) and 16 of 18 (89%) H-2(d) mice survived the infection. The ability to induce significant murine anti-T. cruzi protective immunity by immunization with plasmid DNA expressing TSA-1 provides the basis for the application of this technology in the design of optimal DNA multicomponent anti-T. cruzi vaccines which may ultimately be used for the prevention or treatment of Chagas' disease.

  15. Plasmid-determined resistance to fosfomycin in Serratia marcescens.

    Science.gov (United States)

    Mendoza, C; Garcia, J M; Llaneza, J; Mendez, F J; Hardisson, C; Ortiz, J M

    1980-08-01

    Multiple-antibiotic-resistant strains of Serratia marcescens isolated from hospitalized patients were examined for their ability to transfer antibiotic resistance to Escherichia coli by conjugation. Two different patterns of linked transferable resistance were found among the transconjugants. The first comprised resistance to carbenicillin, streptomycin, and fosfomycin; the second, and more common, pattern included resistance to carbenicillin, streptomycin, kanamycin, gentamicin, tetracycline, chloramphenicol, sulfonamide, and fosfomycin. The two types of transconjugant strains carried a single plasmid of either 57 or 97 megadaltons in size. Both of these plasmids are present in parental S. marcescens strains resistant to fosfomycin. The 57-megadalton plasmid was transformed into E. coli.

  16. [Epidemiologic study of 2 S. typhimurium outbreaks using plasmid fingerprints].

    Science.gov (United States)

    Baumgartner, A; Breer, C; Schopfer, K

    1989-04-05

    An outbreak of salmonellosis in an old people's home is reported. The infectious agent, S. typhi-murium, was isolated not only from several inmates but also from sick cows of the farm belonging to the home, in animal feed, from employees of the local butcher's shop, and finally in sludge from the local sewage plant. Plasmid analysis provided evidence of a common origin for the isolated S. typhi-murium strains. The incriminated strains harboured, together with two low-molecular-weight plasmids, a plasmid of approximately 50 Mdal, which was also demonstrated in some other S. typhi-murium strains isolated from clinical cases in the area around St. Gallen.

  17. Effect of Plasmid Incompatibility on DNA Transfer to Streptococcus cremoris

    OpenAIRE

    Van Der Lelie, Daniel; Vossen, Jos M.B.M. van der; Venema, Gerard

    1988-01-01

    Several Streptococcus cremoris strains were used in protoplast transformation and interspecific protoplast fusion experiments with Streptococcus lactis and Bacillus subtilis, with pGKV110, pGKV21, and ΔpAMβ1 as the marker plasmids. ΔpAMβ1 is a 15.9-kilobase nonconjugative, deletion derivative of pAMβ1, which is considerably larger than the pGKV plasmids (approximately 4.5 kilobases). In general, ΔpAMβ1 was transferred more efficiently than the pGKV plasmids. Using electroporation, we were abl...

  18. Separation of plasmid DNA topoisomers by multimodal chromatography.

    Science.gov (United States)

    Silva-Santos, A Rita; Alves, Cláudia P A; Prazeres, Duarte Miguel F; Azevedo, Ana M

    2016-06-15

    The ability to analyze the distribution of topoisomers in a plasmid DNA sample is important when evaluating the quality of preparations intended for gene therapy and DNA vaccination or when performing biochemical studies on the action of topoisomerases and gyrases. Here, we describe the separation of supercoiled (sc) and open circular (oc) topoisomers by multimodal chromatography. A medium modified with the ligand N-benzyl-N-methyl ethanolamine and an elution scheme with increasing NaCl concentration are used to accomplish the baseline separation of sc and oc plasmid. The utility of the method is demonstrated by quantitating topoisomers in a purified plasmid sample. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Late gestational nutrient restriction

    DEFF Research Database (Denmark)

    Tygesen, Malin Plumhoff; Nielsen, Mette Olaf; Nørgaard, Peder;

    2008-01-01

    We investigated the effect of 50% nutrient restriction during the last 6 weeks of gestation on twin-pregnant ewes' plasma glucose, non-esterified fatty acid, ß-hydroxybutyrate, insulin, IGF-1 and leptin concentrations and the effects on lamb birth weight and ewes' lactation performance. Plasma...... metabolite and hormone concentrations in restricted ewes suggest that maternal tissues were being mobilised. Despite the ewes' adaptations their lambs weighed significantly less at birth. Furthermore, colostrum and milk yields were markedly reduced up until the latest measurement at 3 weeks post partum...

  20. Characterization of the plasmid encoded virulence region pat-1 of phytopathogenic Clavibacter michiganensis subsp. michiganensis.

    Science.gov (United States)

    Dreier, J; Meletzus, D; Eichenlaub, R

    1997-03-01

    The tomato pathogen Clavibacter michiganensis subsp. michiganensis NCPPB382, causing bacterial wilt and canker, harbors two plasmids, pCM1 (27.5 kb) and pCM2 (72 kb), carrying genes involved in virulence. The region of plasmid pCM2 encoding the pathogenicity locus pat-1 was mapped by deletion analysis and complementation studies to a 1.5-kb Bg/II/SmaI DNA fragment. Introduction of the pat-1 region into endophytic, plasmid-free isolates of C. michiganensis subsp. michiganensis converted these bacteria into virulent pathogens. Based on the nucleotide sequence of the pat-1 region, an open reading frame (ORF1) can be predicted, coding for a protein of 280 amino acids and 29.7 kDa with homology to serine proteases. Introduction of a frame-shift mutation in ORF1 leads to a loss of the pathogenic phenotype. Northern (RNA) hybridizations identified an 1.5-knt transcript of the pat-1 structural gene. The site of transcription initiation was mapped by primer extension and a typical -10/-35 region was located with significant homology to the consensus Escherichia coli sigma 70 and Bacillus subtilis sigma 43 promoters. Downstream of the pat-1 structural gene, a peculiar repetitive sequence motif (pat-1rep) is located, consisting of 20 direct tandem repeats preceded by a run of 14 guanosine residues. DNA sequences homologous to pat-1rep were isolated and characterized from four virulent C. michiganensis subsp. michiganensis strains exhibiting a high extent of structural conservation. The deletion of this repetitive sequence reduced virulence significantly but did not lead to a complete loss of the virulence phenotype.

  1. Antirestriction protein Ard (Type C) encoded by IncW plasmid pSa has a high similarity to the "protein transport" domain of TraC1 primase of promiscuous plasmid RP4.

    Science.gov (United States)

    Belogurov, A A; Delver, E P; Agafonova, O V; Belogurova, N G; Lee, L Y; Kado, C I

    2000-03-03

    The IncW plasmid pSa contains the gene ard encoding an antirestriction function that is specific for type I restriction and modification systems. The nucleotide sequence of ard was determined and an appropriate polypeptide of about 33 kDa was identified in Escherichia coli T7 expression system. Analysis of deduced amino acid sequence of Ard encoded by pSa revealed that this protein has no significant similarities with the known Ard proteins (ArdA and ArdB types) except the "antirestriction" motif (14 amino acid residues in length) conserved for all known Ard proteins. This finding suggests that pSa Ard may be classified as a new type of Ard proteins which we designated ArdC. The remarkable feature of ArdC is that it has a high degree of similarity (about 38 % identity) to the N-terminal region of RP4 TraC1 primase which includes about 300 amino acid residues and seems to be essential for binding to the single-stranded DNA and TraC1 protein transport to the recipient cells during the conjugal transfer of plasmid DNA. ArdC also binds to single-stranded DNA. In addition, this protein is able in vitro to protect the single-stranded but not double-stranded plasmid DNA against the activity of type II restriction endonuclease HhaI that cleaves both single and double-stranded DNA. We suggest that like TraC1, ArdC would be transported as a result of their interaction with the single-stranded DNA of transferred plasmid strand during conjugative passage through the cell envelope to the recipient bacterium. Such properties of ArdC protein might be useful to protect immediately the incoming single-stranded DNA from the host endonucleases.

  2. Multiple Antibiotic Resistance Plasmids Allow Scalable, PCR-Mediated DNA Manipulation and Near-Zero Background Cloning

    Directory of Open Access Journals (Sweden)

    Remigiusz Arnak

    2016-01-01

    Full Text Available We have constructed two plasmids that can be used for cloning as templates for PCR-based gene disruption, mutagenesis and the construction of DNA chromosome translocation cassettes. To our knowledge, these plasmids are the first vectors that confer resistance to ampicillin, kanamycin and hygromycin B in bacteria, and to geneticin (G418 and hygromycin B in Saccharomyces cerevisiae simultaneously. The option of simultaneously using up to three resistance markers provides a highly stringent control of recombinant selection and the almost complete elimination of background resistance, while unique restriction sites allow easy cloning of chosen genetic material. Moreover, we successfully used these new vectors as PCR templates for the induction of chromosome translocation in budding yeast by the bridge-induced translocation system. Cells in which translocation was induced carried chromosomal rearrangements as expected and exhibited resistance to both, G418 and hygromycin B. These features make our constructs very handy tools for many molecular biology applications.

  3. Bacterial mitosis: ParM of plasmid R1 moves plasmid DNA by an actin-like insertional polymerization mechanism.

    Science.gov (United States)

    Møller-Jensen, Jakob; Borch, Jonas; Dam, Mette; Jensen, Rasmus B; Roepstorff, Peter; Gerdes, Kenn

    2003-12-01

    Bacterial DNA segregation takes place in an active and ordered fashion. In the case of Escherichia coli plasmid R1, the partitioning system (par) separates paired plasmid copies and moves them to opposite cell poles. Here we address the mechanism by which the three components of the R1 par system act together to generate the force required for plasmid movement during segregation. ParR protein binds cooperatively to the centromeric parC DNA region, thereby forming a complex that interacts with the filament-forming actin-like ParM protein in an ATP-dependent manner, suggesting that plasmid movement is powered by insertional polymerization of ParM. Consistently, we find that segregating plasmids are positioned at the ends of extending ParM filaments. Thus, the process of R1 plasmid segregation in E. coli appears to be mechanistically analogous to the actin-based motility operating in eukaryotic cells. In addition, we find evidence suggesting that plasmid pairing is required for ParM polymerization.

  4. Influenza Plasmid DNA Vaccines: Progress and Prospects.

    Science.gov (United States)

    Bicho, Diana; Queiroz, João António; Tomaz, Cândida Teixeira

    2015-01-01

    Current influenza vaccines have long been used to fight flu infectious; however, recent advances highlight the importance of produce new alternatives. Even though traditional influenza vaccines are safe and usually effective, they need to be uploaded every year to anticipate circulating flu viruses. This limitation together with the use of embryonated chicken eggs as the substrate for vaccine production, is time-consuming and could involve potential biohazards in growth of new virus strains. Plasmid DNA produced by prokaryote microorganisms and encoding foreign proteins had emerged as a promising therapeutic tool. This technology allows the expression of a gene of interest by eukaryotic cells in order to induce protective immune responses against the pathogen of interest. In this review, we discuss the strategies to choose the best DNA vaccine to be applied in the treatment and prevention of influenza. Specifically, we give an update of influenza DNA vaccines developments, all involved techniques, their main characteristics, applicability and technical features to obtain the best option against influenza infections.

  5. Plasmid profile and pulsed-field gel electrophoresis analysis of Salmonella enterica isolates from humans in Turkey.

    Directory of Open Access Journals (Sweden)

    Kerem Ozdemir

    Full Text Available This study was conducted for typing Salmonella enterica subspecies enterica strains in Turkey using pulsed-field gel electrophoresis (PFGE and plasmid DNA profile analysis. Fourty-two strains were isolated from clinical samples obtained from unrelated patients with acute diarrhea. The samples were collected from state hospitals and public health laboratories located at seven provinces in different regions of Turkey at different times between 2004 and 2010. The strains were determined to belong to 4 different serovars. The Salmonella enterica strains belonged to the serovars Salmonella Enteritidis (n = 23, Salmonella Infantis (n = 14, Salmonella Munchen (n = 2, and Salmonella Typhi (n = 3. Forty-two Salmonella enterica strains were typed with PFGE methods using XbaI restriction enzyme and plasmid analysis. At the end of typing, 11 different PFGE band profiles were obtained. Four different PFGE profiles (type 1, 4, 9, and 10 were found among serotype S. Enteritidis species, 3 different PFGE profiles (type 3, 5, 6 were found among S. Infantis species, 2 different PFGE profiles were found among S. Typhi species (type 2 and 11, and 2 different PFGE profiles were found among S. Munchen species (type 7, 8. The UPGMA dendrogram was built on the PFGE profiles. In this study, it was determined that 4 strains of 42 Salmonella enterica strains possess no plasmid, while the isolates have 1-3 plasmids ranging from 5.0 to 150 kb and making 12 different plasmid profiles (P1-P12. In this study, we have applied the analysis of the PFGE patterns and used bioinformatics methods to identify both inter and intra serotype relationships of 4 frequently encountered serotypes for the first time in Turkey.

  6. Training Restricted Boltzmann Machines

    DEFF Research Database (Denmark)

    Fischer, Asja

    Restricted Boltzmann machines (RBMs) are probabilistic graphical models that can also be interpreted as stochastic neural networks. Training RBMs is known to be challenging. Computing the likelihood of the model parameters or its gradient is in general computationally intensive. Thus, training...

  7. Calorie restriction and stroke

    Directory of Open Access Journals (Sweden)

    Manzanero Silvia

    2011-09-01

    Full Text Available Abstract Stroke, a major cause of disability and mortality in the elderly, occurs when a cerebral blood vessel is occluded or ruptured, resulting in ischemic damage and death of brain cells. The injury mechanism involves metabolic and oxidative stress, excitotoxicity, apoptosis and inflammatory processes, including activation of glial cells and infiltration of leukocytes. In animal models, dietary energy restriction, by daily calorie reduction (CR or intermittent fasting (IF, extends lifespan and decreases the development of age-related diseases. Dietary energy restriction may also benefit neurons, as suggested by experimental evidence showing that CR and IF protect neurons against degeneration in animal models. Recent findings by our group and others suggest the possibility that dietary energy restriction may protect against stroke induced brain injury, in part by inducing the expression of neurotrophic factors, such as brain-derived neurotrophic factor (BDNF and basic fibroblast growth factor (bFGF; protein chaperones, including heat shock protein 70 (Hsp70 and glucose regulated protein 78 (GRP78; antioxidant enzymes, such as superoxide dismutases (SOD and heme oxygenase-1 (HO-1, silent information regulator T1 (SIRT1, uncoupling proteins and anti-inflammatory cytokines. This article discusses the protective mechanisms activated by dietary energy restriction in ischemic stroke.

  8. Bilinear Fourier restriction theorems

    CERN Document Server

    Demeter, Ciprian

    2012-01-01

    We provide a general scheme for proving $L^p$ estimates for certain bilinear Fourier restrictions outside the locally $L^2$ setting. As an application, we show how such estimates follow for the lacunary polygon. In contrast with prior approaches, our argument avoids any use of the Rubio de Francia Littlewood--Paley inequality.

  9. Mechanisms of Evolution in High-Consequence Drug Resistance Plasmids

    Directory of Open Access Journals (Sweden)

    Susu He

    2016-12-01

    Full Text Available The dissemination of resistance among bacteria has been facilitated by the fact that resistance genes are usually located on a diverse and evolving set of transmissible plasmids. However, the mechanisms generating diversity and enabling adaptation within highly successful resistance plasmids have remained obscure, despite their profound clinical significance. To understand these mechanisms, we have performed a detailed analysis of the mobilome (the entire mobile genetic element content of a set of previously sequenced carbapenemase-producing Enterobacteriaceae (CPE from the National Institutes of Health Clinical Center. This analysis revealed that plasmid reorganizations occurring in the natural context of colonization of human hosts were overwhelmingly driven by genetic rearrangements carried out by replicative transposons working in concert with the process of homologous recombination. A more complete understanding of the molecular mechanisms and evolutionary forces driving rearrangements in resistance plasmids may lead to fundamentally new strategies to address the problem of antibiotic resistance.

  10. Plasmid Conjugation in E. coli and Drug Resistance

    African Journals Online (AJOL)

    Prof. Ogunji

    respiratory infections etc) or prescribing the 'newest' antibiotics in the market when older “brands” may ..... influence an increase in mortality rate; high economic burden and longer hospital ... Conjugating plasmids into bacteria; Tri Parental.

  11. Electrophoretic High Molecular Weight DNA Purification Enables Optical Mapping

    OpenAIRE

    Maydan, Jason; THOMAS, Matthew; Tabanfar, Leyla; Mai, Laura; Poon, Hau-Ling; Pe, Joel; HAHN, KRISTEN; Goji, Noriko; Amoako, Kingsley; Marziali, Andre; Hanson, Dan

    2013-01-01

    Optical mapping generates an ordered restriction map from single, long DNA molecules. By overlapping restriction maps from multiple molecules, a physical map of entire chromosomes and genomes is constructed, greatly facilitating genome assembly in next generation sequencing projects, comparative genomics and strain typing. However, optical mapping relies on a method of preparing high quality DNA >250 kb in length, which can be challenging from some organisms and sample types. Here we demonstr...

  12. Characterization of IncA/C conjugative plasmid harboring bla TEM-52 and bla CTX-M-15 extended-spectrum β-lactamases in clinical isolates of Escherichia coli in Tunisia.

    Science.gov (United States)

    Chouchani, C; El Salabi, A; Marrakchi, R; Ferchichi, L; Walsh, T R

    2012-06-01

    To characterize the extended-spectrum β-lactamases (ESBLs) as well as their genetic environment in different isolates of Escherichia coli from patients with repeated urinary tract infections, large multidrug resistance (MDR) plasmids have been found. Definitive evidence for the presence of an A/C incompatibility complex (IncA/C) plasmid in the MDR isolates was provided by the probing of plasmids extracted from the clinical isolates. Conjugation experiments showed that bla genes were transferred by conjugation from the ten E. coli clinical isolates to E. coli XL1-Blue recipient. A comparative restriction fragment length polymorphism (RFLP) analysis of these plasmids showed that they are genetically similar, while the overall similarity of these plasmids supports the likelihood of recent movements among these E. coli isolates. Polymerase chain reaction (PCR) amplification and sequencing of the amplicons showed that the IncA/C plasmids harbor two ESBLs, identified as TEM-52 and CTX-M-15. Analysis of the plasmid DNA surrounding the bla (CTX-M-15) gene in the clinical isolates under study revealed a partially truncated fragment of ISEcp1 tnpA transposase. This result indicates the variety of genetic events that have enabled associations between ISEcp1 sequences and bla (CTX-M-15) genes in these clinical isolates.

  13. High-resolution genetic analysis of the requirements for horizontal transmission of the ESBL plasmid from Escherichia coli O104:H4.

    Science.gov (United States)

    Yamaichi, Yoshiharu; Chao, Michael C; Sasabe, Jumpei; Clark, Lars; Davis, Brigid M; Yamamoto, Nozomi; Mori, Hiroshi; Kurokawa, Ken; Waldor, Matthew K

    2015-01-01

    Horizontal dissemination of the genes encoding extended spectrum beta-lactamases (ESBLs) via conjugative plasmids is facilitating the increasingly widespread resistance of pathogens to beta-lactam antibiotics. However, there is relatively little known about the regulatory factors and mechanisms that govern the spread of these plasmids. Here, we carried out a high-throughput, transposon insertion site sequencing analysis (TnSeq) to identify genes that enable the maintenance and transmission of pESBL, an R64 (IncI1)-related resistance plasmid that was isolated from Escherichia coli O104:H4 linked to a recent large outbreak of gastroenteritis. With a few exceptions, the majority of the genes identified as required for maintenance and transmission of pESBL matched those of their previously defined R64 counterparts. However, our analyses of the high-density transposon insertion library in pESBL also revealed two very short and linked regions that constitute a previously unrecognized regulatory system controlling spread of IncI1 plasmids. In addition, we investigated the function of the pESBL-encoded M.EcoGIX methyltransferase, which is also encoded by many other IncI1 and IncF plasmids. This enzyme proved to protect pESBL from restriction in new hosts, suggesting it aids in expanding the plasmid's host range. Collectively, our work illustrates the power of the TnSeq approach to enable rapid and comprehensive analyses of plasmid genes and sequences that facilitate the dissemination of determinants of antibiotic resistance.

  14. Transfer of conjugative plasmids among bacteria under environmentally relevant conditions

    DEFF Research Database (Denmark)

    Musovic, Sanin

    at spredningskapacitet af en konjugerbare plasmid, der koder for kviksølv resistens via merA genet, finder sted under substrat begrænsede forhold til syntetisk bakterielt samfund. Plasmid overførsel var meget forhøjet ved kontinuert udsættelse af mikrokosms for en høj koncentration af kviksølv. De forskellige vækstrater...

  15. The Native Plasmid pML21 Plays a Role in Stress Tolerance in Enterococcus faecalis ML21, as Analyzed by Plasmid Curing Using Plasmid Incompatibility.

    Science.gov (United States)

    Zuo, Fang-Lei; Chen, Li-Li; Zeng, Zhu; Feng, Xiu-Juan; Yu, Rui; Lu, Xiao-Ming; Ma, Hui-Qin; Chen, Shang-Wu

    2016-02-01

    To investigate the role of the native plasmid pML21 in Enterococcus faecalis ML21's response to abiotic stresses, the plasmid pML21 was cured based on the principle of plasmid incompatibility and segregational instability, generating E. faecalis mutant strain ML0. The mutant and the wild strains were exposed to abiotic stresses: bile salts, low pH, H2O2, ethanol, heat, and NaCl, and their survival rate was measured. We found that curing of pML21 lead to reduced tolerance to stress in E. faecalis ML0, especially oxidative and osmotic stress. Complementation analysis suggested that the genes from pML21 played different role in stress tolerance. The result indicated that pML21 plays a role in E. faecalis ML21's response to abiotic stresses.

  16. A New Shuttle Plasmid That Stably Replicates in Clostridium acetobutylicum.

    Science.gov (United States)

    Lee, Sang-Hyun; Kwon, Min-A; Choi, Sunwha; Kim, Sooah; Kim, Jungyeon; Shin, Yong-An; Kim, Kyoung Heon

    2015-10-01

    We have developed a new shuttle plasmid, designated as pLK1-MCS that can replicate in both Clostridium acetobutylicum and Escherichia coli, by combining the pUB110 and pUC19 plasmids. Plasmid pLK1-MCS replicated more stably than previously reported plasmids containing either the pIM13 or the pAMβ1 replicon in the absence of antibiotic selective pressure. The transfer frequency of pLK1-MCS into C. acetobutylicum was similar to the transfer frequency of other shuttle plasmids. We complemented C. acetobutylicum ML1 (that does not produce solvents such as acetone, butanol, and ethanol owing to loss of the megaplasmid pSOL1 harboring the adhE1-ctfAB-adc operon) by introducing pLK1-MCS carrying the adhE1-ctfAB-adc operon into C. acetobutylicum ML1. The transformed cells were able to resume anaerobic solvent production, indicating that the new shuttle plasmid has the potential for practical use in microbial biotechnology.

  17. Plasmid copy number noise in monoclonal populations of bacteria

    Science.gov (United States)

    Wong Ng, Jérôme; Chatenay, Didier; Robert, Jérôme; Poirier, Michael Guy

    2010-01-01

    Plasmids are extra chromosomal DNA that can confer to their hosts’ supplementary characteristics such as antibiotic resistance. Plasmids code for their copy number through their own replication frequency. Even though the biochemical networks underlying the plasmid copy number (PCN) regulation processes have been studied and modeled, no measurement of the heterogeneity in PCN within a whole population has been done. We have developed a fluorescent-based measurement system, which enables determination of the mean and noise in PCN within a monoclonal population of bacteria. Two different fluorescent protein reporters were inserted: one on the chromosome and the other on the plasmid. The fluorescence of these bacteria was measured with a microfluidic flow cytometry device. We show that our measurements are consistent with known plasmid characteristics. We find that the partitioning system lowers the PCN mean and standard deviation. Finally, bacterial populations were allowed to grow without selective pressure. In this case, we were able to determine the plasmid loss rate and growth inhibition effect.

  18. Construction and Use of Flow Cytometry Optimized Plasmid-Sensor Strains

    DEFF Research Database (Denmark)

    Bahl, Martin Iain; Oregaard, Gunnar; Sørensen, Søren Johannes;

    2009-01-01

    stability of the plasmid is high. The method presented here relies on a phenotypic (green fluorescence protein) marker, which is switched on if the host bacteria loses the residing plasmid. The incorporation of flow cytometry for single-cell detection and discrimination between plasmid-free and plasmid...

  19. Allelopathy of plasmid-bearing and plasmid-free organisms competing for two complementary resources in a chemostat.

    Science.gov (United States)

    Bhattacharyya, Joydeb; Smith, Hal L; Pal, Samares

    2012-01-01

    We consider a model of competition between plasmid-bearing and plasmid-free organisms for two complementary nutrients in a chemostat. We assume that the plasmid-bearing organism produces an allelopathic agent at the cost of its reproductive abilities which is lethal to plasmid-free organism. Our analysis leads to different thresholds in terms of the model parameters acting as conditions under which the organisms associated with the system cannot thrive even in the absence of competition. Local stability of the system is obtained in the absence of one or both the organisms. Also, global stability of the system is obtained in the presence of both the organisms. Computer simulations have been carried out to illustrate various analytical results.

  20. Enhanced de novo assembly of high throughput pyrosequencing data using whole genome mapping.

    Science.gov (United States)

    Onmus-Leone, Fatma; Hang, Jun; Clifford, Robert J; Yang, Yu; Riley, Matthew C; Kuschner, Robert A; Waterman, Paige E; Lesho, Emil P

    2013-01-01

    Despite major advances in next-generation sequencing, assembly of sequencing data, especially data from novel microorganisms or re-emerging pathogens, remains constrained by the lack of suitable reference sequences. De novo assembly is the best approach to achieve an accurate finished sequence, but multiple sequencing platforms or paired-end libraries are often required to achieve full genome coverage. In this study, we demonstrated a method to assemble complete bacterial genome sequences by integrating shotgun Roche 454 pyrosequencing with optical whole genome mapping (WGM). The whole genome restriction map (WGRM) was used as the reference to scaffold de novo assembled sequence contigs through a stepwise process. Large de novo contigs were placed in the correct order and orientation through alignment to the WGRM. De novo contigs that were not aligned to WGRM were merged into scaffolds using contig branching structure information. These extended scaffolds were then aligned to the WGRM to identify the overlaps to be eliminated and the gaps and mismatches to be resolved with unused contigs. The process was repeated until a sequence with full coverage and alignment with the whole genome map was achieved. Using this method we were able to achieved 100% WGRM coverage without a paired-end library. We assembled complete sequences for three distinct genetic components of a clinical isolate of Providencia stuartii: a bacterial chromosome, a novel bla NDM-1 plasmid, and a novel bacteriophage, without separately purifying them to homogeneity.

  1. Restriction of Helmholtz Model

    Directory of Open Access Journals (Sweden)

    V.M. Polunin

    2014-07-01

    Full Text Available The results of the experimental studies of physical mechanisms of energy dissipation in the oscillating system in which air cavity held by the forces of magnetic levitation is used as the elastic element, and magnetic fluid prepared on the basis of dispersing media with different viscosity level is used as the inertial element are considered in the article. Based on the obtained results the conclusion on the restriction of the applicability of Helmholtz equation, caused by boundary effects is made.

  2. Survival and evolution of a large multidrug resistance plasmid in new clinical bacterial hosts

    DEFF Research Database (Denmark)

    Porse, Andreas; Schønning, Kristian; Munck, Christian

    2016-01-01

    of these plasmids within pathogenic hosts are poorly understood. Here we study plasmid-host adaptations following transfer of a 73 kb conjugative multidrug resistance plasmid to naïve clinical isolates of Klebsiella pneumoniae and Escherichia coli We use experimental evolution, mathematical modelling and population...... sequencing to show that the long-term persistence and molecular integrity of the plasmid is highly influenced by multiple factors within a 25 kb plasmid region constituting a host-dependent burden. In the E. coli hosts investigated here, improved plasmid stability readily evolves via IS26 mediated deletions...... of plasmid adaptation. While insertion sequences are well known to supply plasmids with adaptive traits, our findings suggest that they also play an important role in plasmid evolution by maintaining the plasticity necessary to alleviate plasmid-host constrains. Further, the observed evolutionary strategy...

  3. License restrictions at Barnwell

    Energy Technology Data Exchange (ETDEWEB)

    Autry, V.R. [S.C. Dept. of Health and Environmental Control, Columbia, SC (United States). Bureau of Radiological Health

    1991-12-31

    The State of South Carolina was delegated the authority by the US Nuclear Regulatory Commission to regulate the receipt, possession, use and disposal of radioactive material as an Agreement State. Since 1970, the state has been the principal regulatory authority for the Barnwell Low-Level Waste Disposal Facility operated by Chem-Nuclear Systems, Inc. The radioactive material license issued authorizing the receipt and disposal of low-level waste contains numerous restrictions to ensure environmental protection and compliance with shallow land disposal performance criteria. Low-level waste has evolved from minimally contaminated items to complex waste streams containing high concentrations of radionuclides and processing chemicals which necessitated these restrictions. Additionally, some waste with their specific radionuclides and concentration levels, many classified as low-level radioactive waste, are not appropriate for shallow land disposal unless additional precautions are taken. This paper will represent a number of these restrictions, the rationale for them, and how they are being dealt with at the Barnwell disposal facility.

  4. High-Voltage Electroporation of Bacteria: Genetic Transformation of Campylobacter jejuni with Plasmid DNA

    Science.gov (United States)

    Miller, Jeff F.; Dower, William J.; Tompkins, Lucy S.

    1988-02-01

    Electroporation permits the uptake of DNA by mammalian cells and plant protoplasts because it induces transient permeability of the cell membrane. We investigated the utility of high-voltage electroporation as a method for genetic transformation of intact bacterial cells by using the enteric pathogen Campylobacter jejuni as a model system. This report demonstrates that the application of high-voltage discharges to bacterial cells permits genetic transformation. Our method involves exposure of a Campylobacter cell suspension to a high-voltage exponential decay discharge (5-13 kV/cm) for a brief period of time (resistance-capacitance time constant = 2.4-26 msec) in the presence of plasmid DNA. Electrical transformation of C. jejuni results in frequencies as high as 1.2 × 106 transformants per μ g of DNA. We have investigated the effects of pulse amplitude and duration, cell growth conditions, divalent cations, and DNA concentration on the efficiency of transformation. Transformants of C. jejuni obtained by electroporation contained structurally intact plasmid molecules. In addition, evidence is presented that indicates that C. jejuni possesses DNA restriction and modification systems. The use of electroporation as a method for transforming other bacterial species and guidelines for its implementation are also discussed.

  5. Construction of Prokaryotic Expression Plasmid of Fusion Protein Including Porin A and Porin B of Neisseria Gonorrhoeae and Its Expression in E.coli

    Institute of Scientific and Technical Information of China (English)

    廖芳; 宋启发; 万沐芬

    2004-01-01

    In order to provide a rational research basis for clinical detection and genetic engineering vaccine, plasmid pET-28a (+) encoding both Porin gene PIA and PIB of Neisseria gonorrhoeae was constructed and a fusion protein in E. coli DE3 expressed. The fragments of PIA and PIB gene of Neisseria gonorrhoeae were amplified and cloned into prokaryotic expression plasmid pET-28a (+) with double restriction endonuclease cut to construct recombinant pET-PIB-PIA. The recombinant was verified with restriction endonuclease and sequenced and transformed into E. coli DE3 to express the fusion protein PIB-PIA after induced with IPTG. The results showed PIA-PIB fusion DNA fragment was proved correct through sequencing. A 67 kD (1 kD=0. 992 1 ku) fusion protein had been detected by SDS-PAGE. It was concluded that the fusion protein was successively expressed.

  6. Multiple Pathways of Plasmid DNA Transfer in Helicobacter pylori

    Science.gov (United States)

    Rohrer, Stefanie; Holsten, Lea; Weiss, Evelyn; Benghezal, Mohammed; Fischer, Wolfgang; Haas, Rainer

    2012-01-01

    Many Helicobacter pylori (Hp) strains carry cryptic plasmids of different size and gene content, the function of which is not well understood. A subgroup of these plasmids (e.g. pHel4, pHel12), contain a mobilisation region, but no cognate type IV secretion system (T4SS) for conjugative transfer. Instead, certain H. pylori strains (e.g. strain P12 carrying plasmid pHel12) can harbour up to four T4SSs in their genome (cag-T4SS, comB, tfs3, tfs4). Here, we show that such indigenous plasmids can be efficiently transferred between H. pylori strains, even in the presence of extracellular DNaseI eliminating natural transformation. Knockout of a plasmid-encoded mobA relaxase gene significantly reduced plasmid DNA transfer in the presence of DNaseI, suggesting a DNA conjugation or mobilisation process. To identify the T4SS involved in this conjugative DNA transfer, each individual T4SS was consecutively deleted from the bacterial chromosome. Using a marker-free counterselectable gene deletion procedure (rpsL counterselection method), a P12 mutant strain was finally obtained with no single T4SS (P12ΔT4SS). Mating experiments using these mutants identified the comB T4SS in the recipient strain as the major mediator of plasmid DNA transfer between H. pylori strains, both in a DNaseI-sensitive (natural transformation) as well as a DNaseI-resistant manner (conjugative transfer). However, transfer of a pHel12::cat plasmid from a P12ΔT4SS donor strain into a P12ΔT4SS recipient strain provided evidence for the existence of a third, T4SS-independent mechanism of DNA transfer. This novel type of plasmid DNA transfer, designated as alternate DNaseI-Resistant (ADR) mechanism, is observed at a rather low frequency under in vitro conditions. Taken together, our study describes for the first time the existence of three distinct pathways of plasmid DNA transfer between H. pylori underscoring the importance of horizontal gene transfer for this species. PMID:23029142

  7. Restriction enzyme-mediated integration used to produce pathogenicity mutants of Colletotrichum graminicola.

    Science.gov (United States)

    Thon, M R; Nuckles, E M; Vaillancourt, L J

    2000-12-01

    We have developed a restriction enzyme-mediated insertional mutagenesis (REMI) system for the maize pathogen Colletotrichum graminicola. In this report, we demonstrate the utility of a REMI-based mutagenesis approach to identify novel pathogenicity genes. Use of REMI increased transformation efficiency by as much as 27-fold over transformations with linearized plasmid alone. Ninety-nine transformants were examined by Southern analysis, and 51% contained simple integrations consisting of one copy of the vector integrated at a single site in the genome. All appeared to have a plasmid integration at a unique site. Sequencing across the integration sites of six transformants demonstrated that in all cases the plasmid integration occurred at the corresponding restriction enzyme-recognition site. We used an in vitro bioassay to identify two pathogenicity mutants among 660 transformants. Genomic DNA flanking the plasmid integration sites was used to identify corresponding cosmids in a wild-type genomic library. The pathogenicity of one of the mutants was restored when it was transformed with the cosmids.

  8. Quantum Error Correction Beyond Completely Positive Maps

    OpenAIRE

    Shabani, A.; Lidar, D. A.

    2006-01-01

    By introducing an operator sum representation for arbitrary linear maps, we develop a generalized theory of quantum error correction (QEC) that applies to any linear map, in particular maps that are not completely positive (CP). This theory of "linear quantum error correction" is applicable in cases where the standard and restrictive assumption of a factorized initial system-bath state does not apply.

  9. Inhibition of DNA restrictive endonucleases and Taq DNA polymerase by trimalonic acid C60

    Institute of Scientific and Technical Information of China (English)

    YANG XinLin; CHEN Zhe; MENG XianMei; LI Bo; TAN Xin

    2007-01-01

    Activities of trimalonic acid fullerene (TMA C60) on DNA restrictive enzymatic reaction were investigated by using two restrictive endonucleases Hind III and EcoR I and plasmid pEGFP-N1 with single restrictive site for both enzymes. Meanwhile,TMA C60 was also tested to clarify its effects on polymerase chain reaction (PCR) with the catalyst of Taq DNA polymerase and the template of plasmid pEGFP-N1. The products from restrictive reactions or PCR were detected by agarose gel electrophoresis. It was found that the product amounts from restrictive reactions or PCR decreased significantly with addition of TMA C60. The inhibition by TMA C60 was dose-dependent and IC50 values for reactions of Hind III,EcoR I and PCR were 16.3,6.0 and 6.0 μmol/L,respectively. Addition of two scavengers of reactive oxygen species (ROS),L-ascorbic acid-2-phosphate ester magnesium and sodium azide at the concentrations of 2―10 mmol/L did not antagonize the activities of TMA C60 against PCR and two restrictive reactions. However,increase of Taq DNA polymerase amounts in PCR system antagonized the activities of TMA C60. These data implied that TMA C60 was able to inhibit the activities of the three above-mentioned enzymes involved in DNA metabolism,and that this inhibition probably did not correlate to ROS.

  10. Altered Murine Tissue Colonization by Borrelia burgdorferi following Targeted Deletion of Linear Plasmid 17-Carried Genes

    OpenAIRE

    Casselli, Timothy; Tourand, Yvonne; Bankhead, Troy

    2012-01-01

    The causative agent of Lyme disease, Borrelia burgdorferi, possesses a segmented genome comprised of a single linear chromosome and upwards of 23 linear and circular plasmids. Much of what is known about plasmid-borne genes comes from studying laboratory clones that have spontaneously lost one or more plasmids during in vitro passage. Some plasmids, including the linear plasmid lp17, are never or rarely reported to be lost during routine culture; therefore, little is known about the requireme...

  11. Plasmids and rickettsial evolution: insight from Rickettsia felis.

    Directory of Open Access Journals (Sweden)

    Joseph J Gillespie

    Full Text Available BACKGROUND: The genome sequence of Rickettsia felis revealed a number of rickettsial genetic anomalies that likely contribute not only to a large genome size relative to other rickettsiae, but also to phenotypic oddities that have confounded the categorization of R. felis as either typhus group (TG or spotted fever group (SFG rickettsiae. Most intriguing was the first report from rickettsiae of a conjugative plasmid (pRF that contains 68 putative open reading frames, several of which are predicted to encode proteins with high similarity to conjugative machinery in other plasmid-containing bacteria. METHODOLOGY/PRINCIPAL FINDINGS: Using phylogeny estimation, we determined the mode of inheritance of pRF genes relative to conserved rickettsial chromosomal genes. Phylogenies of chromosomal genes were in agreement with other published rickettsial trees. However, phylogenies including pRF genes yielded different topologies and suggest a close relationship between pRF and ancestral group (AG rickettsiae, including the recently completed genome of R. bellii str. RML369-C. This relatedness is further supported by the distribution of pRF genes across other rickettsiae, as 10 pRF genes (or inactive derivatives also occur in AG (but not SFG rickettsiae, with five of these genes characteristic of typical plasmids. Detailed characterization of pRF genes resulted in two novel findings: the identification of oriV and replication termination regions, and the likelihood that a second proposed plasmid, pRFdelta, is an artifact of the original genome assembly. CONCLUSION/SIGNIFICANCE: Altogether, we propose a new rickettsial classification scheme with the addition of a fourth lineage, transitional group (TRG rickettsiae, that is unique from TG and SFG rickettsiae and harbors genes from possible exchanges with AG rickettsiae via conjugation. We offer insight into the evolution of a plastic plasmid system in rickettsiae, including the role plasmids may have played in

  12. An experimental study on use of 7T MRI for evaluation of myocardial infarction in SD rats transfected with pcDNA 3.1(+)/VEGF121 plasmid

    Science.gov (United States)

    Zhang, Yan; Tian, Ruiqing; Shen, Xiangchun; Chen, Yushu; Chen, Wei; Gan, Lu; Shen, Guiquan; Ju, Haiyue; Yang, Li; Gao, Fabao

    2016-01-01

    This study aims to build the myocardial infarction model in SD rats transfected with pcDNA 3.1(+)/VEGF121 plasmid and study the effect of the transfection using 7T MRI. Twenty-four male SD rats were randomly divided into 2 groups, pcDNA 3.1(+)/VEGF121 plasmid transfection group (with improved coronary perfusion delivery) and myocardial infarction model group. Cardiac cine magnetic resonance imaging (Cine-MRI), T2-mapping and late gadolinium enhancement (LGE) cardiac imaging were performed at 24 h, 48 h, 72 h and 7 d after myocardial infarction, respectively. The signal intensity, area at risk (AAR), myocardium infarction core (MIC) and salvageable myocardial zone (SMZ) were compared. The hearts were harvested for anatomic characterization, which was related to pathological examination (TTC staining, HE staining, Masson staining and immunohistochemical staining). The Cine-MRI results showed that pcDNA 3.1(+)/VEGF121 plasmid transfection group had higher end-diastolic volume (EDV) with a reduction in MIC and SMZ, as compared with the myocardial infarction model group. MIC, SMZ and AAR of the plasmid transfection declined over time. At 7 d, the two groups did not differ significantly in AAR and T2 value. According to Western Blotting, VEGF was up-regulated, while CaSR and caspase-3 were downregulated in the plasmid transfection group, as compared with the model group. In conclusion, a good treatment effect was achieved by coronary perfusion of pcDNA 3.1(+)/VEGF121 plasmid. 7T CMR sequences provide a non-invasive quantification of the treatment efficacy. However, the assessment of myocardial injury using T2 value and AAR in the presence of edema is less accurate. The myocardial protection of the plasmid transfection group may be related to the inhibition of myocardial apoptosis, vascular endothelial cell (VEC) proliferation and collagen proliferation. The CaSR signaling pathway may contribute to reversing the apoptosis. PMID:27648128

  13. THE ENDOGENOUS BACILLUS-SUBTILIS (NATTO) PLASMIDS PTA1015 AND PTA1040 CONTAIN SIGNAL PEPTIDASE-ENCODING GENES - IDENTIFICATION OF A NEW STRUCTURAL MODULE ON CRYPTIC PLASMIDS

    NARCIS (Netherlands)

    MEIJER, WJJ; DEJONG, A; BEA, G; WISMAN, A; TJALSMA, H; VENEMA, G; BRON, S; MAARTEN, J; VANDIJL, JM

    Various strains of Bacillus subtilis (natto) contain small cryptic plasmids that replicate via the rolling-circle mechanism. Like plasmids from other Gram-positive bacteria, these plasmids are composed of several distinct structural modules. A new structural module was identified on the B. subtilis

  14. Genetic Mapping of the Rhodopseudomonas capsulata Chromosome Shows Non-clustering of Genes Involved in Nitrogen Fixation

    National Research Council Canada - National Science Library

    WILLISON, JOHN C; AHOMBO, GABRIEL; CHABERT, JACQUELINE; MAGNIN, JEAN-PIERRE; VIGNAIS, PAULETTE M

    1985-01-01

    ... Nucléaires de Grenoble, 85 X, 38041 Grenoble Cedex, France ABSTRACT Summary: The mutant R plasmid pTH10 was used to construct a circular linkage map of the Rhodopseudomonas capsulata B10 chromosome...

  15. Plasmid mediated antibiotic resistance in isolated bacteria from burned patients.

    Science.gov (United States)

    Beige, Fahimeh; Baseri Salehi, Majid; Bahador, Nima; Mobasherzadeh, Sina

    2015-01-01

    Nowadays, the treatment of burned patients is difficult because of the high frequency of infection with antibiotic resistance bacteria. This study was conducted to evaluate the level of antibiotic resistance in Gram-negative bacteria and its relation with the existence of plasmid. The samples were collected from two hundred twenty hospitalized burned patients in Isfahan burn hospital during a three-month period (March 2012 to June 2012). The samples were isolated and the Gram-negative bacteria were identified using phenotypic method and API 20E System. Antibiotic susceptibility and plasmid profile were determined by standard Agar disc diffusion and plasmid spin column extraction methods. Totally 117 Gram-negative bacteria were isolated, the most common were Pseudomonas aerugionsa (37.6%), P. fluorescens (25.6%), Acinetobacter baumanii (20/5%) and Klebsiella pneumoniae (7.6%), respectively. The isolates showed high frequency of antibiotic resistance against ceftazidime and co-amoxiclave (100%) and low frequency of antibiotic resistance against amikacin with (70%).The results indicated that 60% of the isolates harboured plasmid. On the other hand, the patients infected with A. baumanii and P. aeruginosa were cured (with 60% frequency) whereas, those infected with P. fluorescens were not cured. Hence, probably antibiotic resistance markers of A. baumanii and P. aeruginosa are plasmid mediated; however, P. fluorescens is chromosomally mediated. Based on our findings, P. aerugionsa is a major causative agent of wound infections and amikacin could be considered as a more effective antibiotic for treatment of the burned patients.

  16. Transcription-replication collision increases recombination efficiency between plasmids.

    Science.gov (United States)

    Jialiang, Li; Feng, Chen; Zhen, Xu; Jibing, Chen; Xiang, Lv; Lingling, Zhang; Depei, Liu

    2013-11-01

    It has been proposed that the stalling of the replication forks can induce homologous recombination in several organisms, and that arrested replication forks may offer nuclease targets, thereby providing a substrate for proteins involved in double-strand repair. In this article, we constructed a plasmid with the potential for transcription-replication collision (TRC), in which DNA replication and RNA transcription occur on the same DNA template simultaneously. Theoretically, transcription will impede DNA replication and increase homologous recombination. To validate this hypothesis, another plasmid was constructed that contained a homologous sequence with the exception of some mutated sites. Co-transfection of these two plasmids into 293T cells resulted in increased recombination frequency. The ratio of these two plasmids also affected the recombination frequency. Moreover, we found high expression levels of RAD51, which indicated that the increase in the recombination rate was probably via the homologous recombination pathway. These results indicate that mutant genes in plasmids can be repaired by TRC-induced recombination.

  17. Functional amyloids as inhibitors of plasmid DNA replication

    Science.gov (United States)

    Molina-García, Laura; Gasset-Rosa, Fátima; Moreno-del Álamo, María; Fernández-Tresguerres, M. Elena; Moreno-Díaz de la Espina, Susana; Lurz, Rudi; Giraldo, Rafael

    2016-01-01

    DNA replication is tightly regulated to constrain the genetic material within strict spatiotemporal boundaries and copy numbers. Bacterial plasmids are autonomously replicating DNA molecules of much clinical, environmental and biotechnological interest. A mechanism used by plasmids to prevent over-replication is ‘handcuffing’, i.e. inactivating the replication origins in two DNA molecules by holding them together through a bridge built by a plasmid-encoded initiator protein (Rep). Besides being involved in handcuffing, the WH1 domain in the RepA protein assembles as amyloid fibres upon binding to DNA in vitro. The amyloid state in proteins is linked to specific human diseases, but determines selectable and epigenetically transmissible phenotypes in microorganisms. Here we have explored the connection between handcuffing and amyloidogenesis of full-length RepA. Using a monoclonal antibody specific for an amyloidogenic conformation of RepA-WH1, we have found that the handcuffed RepA assemblies, either reconstructed in vitro or in plasmids clustering at the bacterial nucleoid, are amyloidogenic. The replication-inhibitory RepA handcuff assembly is, to our knowledge, the first protein amyloid directly dealing with DNA. Built on an amyloid scaffold, bacterial plasmid handcuffs can bring a novel molecular solution to the universal problem of keeping control on DNA replication initiation. PMID:27147472

  18. Dcm methylation is detrimental to plasmid transformation in Clostridium thermocellum

    Energy Technology Data Exchange (ETDEWEB)

    Guss, Adam M [ORNL; Olson, Daniel G. [Thayer School of Engineering at Dartmouth; Caiazza, Nicky [Mascoma Corporation; Lynd, Lee R [Thayer School of Engineering at Dartmouth

    2012-01-01

    BACKGROUND: Industrial production of biofuels and other products by cellulolytic microorganisms is of interest but hindered by the nascent state of genetic tools. Although a genetic system for Clostridium thermocellum DSM1313 has recently been developed, available methods achieve relatively low efficiency and similar plasmids can transform C. thermocellum at dramatically different efficiencies. RESULTS: We report an increase in transformation efficiency of C. thermocellum for a variety of plasmids by using DNA that has been methylated by Escherichia coli Dam but not Dcm methylases. When isolated from a dam+ dcm+ E. coli strain, pAMG206 transforms C. thermocellum 100-fold better than the similar plasmid pAMG205, which contains an additional Dcm methylation site in the pyrF gene. Upon removal of Dcm methylation, transformation with pAMG206 showed a four- to seven-fold increase in efficiency; however, transformation efficiency of pAMG205 increased 500-fold. Removal of the Dcm methylation site from the pAM205 pyrF gene via silent mutation resulted in increased transformation efficiencies equivalent to that of pAMG206. Upon proper methylation, transformation efficiency of plasmids bearing the pMK3 and pB6A origins of replication increased ca. three orders of magnitude. CONCLUSION: E. coli Dcm methylation decreases transformation efficiency in C. thermocellum DSM1313. The use of properly methylated plasmid DNA should facilitate genetic manipulation of this industrially relevant bacterium.

  19. Dcm methylation is detrimental to plasmid transformation in Clostridium thermocellum

    Directory of Open Access Journals (Sweden)

    Guss Adam M

    2012-05-01

    Full Text Available Abstract Background Industrial production of biofuels and other products by cellulolytic microorganisms is of interest but hindered by the nascent state of genetic tools. Although a genetic system for Clostridium thermocellum DSM1313 has recently been developed, available methods achieve relatively low efficiency and similar plasmids can transform C. thermocellum at dramatically different efficiencies. Results We report an increase in transformation efficiency of C. thermocellum for a variety of plasmids by using DNA that has been methylated by Escherichia coli Dam but not Dcm methylases. When isolated from a dam+dcm+E. coli strain, pAMG206 transforms C. thermocellum 100-fold better than the similar plasmid pAMG205, which contains an additional Dcm methylation site in the pyrF gene. Upon removal of Dcm methylation, transformation with pAMG206 showed a four- to seven-fold increase in efficiency; however, transformation efficiency of pAMG205 increased 500-fold. Removal of the Dcm methylation site from the pAMG205 pyrF gene via silent mutation resulted in increased transformation efficiencies equivalent to that of pAMG206. Upon proper methylation, transformation efficiency of plasmids bearing the pMK3 and pB6A origins of replication increased ca. three orders of magnitude. Conclusions E. coli Dcm methylation decreases transformation efficiency in C. thermocellum DSM1313. The use of properly methylated plasmid DNA should facilitate genetic manipulation of this industrially relevant bacterium.

  20. Construction and identification of eukaryotic eukaryotic expression plasmid pcdna3.1-bace and its transient expression in cells

    Institute of Scientific and Technical Information of China (English)

    Huilin Gong; Guanjun Zhang; Weijiang Dong

    2006-01-01

    Objective: To generate eukaryotic expression vector of pcDNA3.1-BACE and obtain its transient expression in COS-7 cells and high expression in the neuroblastoma SK-N-SH cells. Methods: A 1503 bp cDNA fragment was amplified from the total RNA of human neuroblastoma by RT-PCR method and cloned into plasmid pcDNA3.1. The vector was identified by digestion with restriction enzymes BamHI and XhoI and sequenced by Sanger-dideoxy-mediated chain termination. The expression of BACE gene was detected by immunocytochemistry method. Results: The results showed that the cDNAfragment included 1503 bp total coding region. The recombinant eukaryotic cell expression vector of pcDNA3.1-BACE was constructed successfully,and the sequence of insert was identical to the published sequence. The COS-7 cells and the neuroblastoma SK-N-SH cells transfected with the pcDNA3.1-BACE plasmid expressed high level of BACE protein in cytoplasm. Conclusion: The recombinant plasmid pcDNA3.1-BACE can provide very useful tool for researching the reason of Alzheimer's disease and lays the important foundation for preventing the AD laterly.

  1. Golden gate shuffling: a one-pot DNA shuffling method based on type IIs restriction enzymes.

    Directory of Open Access Journals (Sweden)

    Carola Engler

    Full Text Available We have developed a protocol to assemble in one step and one tube at least nine separate DNA fragments together into an acceptor vector, with 90% of recombinant clones obtained containing the desired construct. This protocol is based on the use of type IIs restriction enzymes and is performed by simply subjecting a mix of 10 undigested input plasmids (nine insert plasmids and the acceptor vector to a restriction-ligation and transforming the resulting mix in competent cells. The efficiency of this protocol allows generating libraries of recombinant genes by combining in one reaction several fragment sets prepared from different parental templates. As an example, we have applied this strategy for shuffling of trypsinogen from three parental templates (bovine cationic trypsinogen, bovine anionic trypsinogen and human cationic trypsinogen each divided in 9 separate modules. We show that one round of shuffling using the 27 trypsinogen entry plasmids can easily produce the 19,683 different possible combinations in one single restriction-ligation and that expression screening of a subset of the library allows identification of variants that can lead to higher expression levels of trypsin activity. This protocol, that we call 'Golden Gate shuffling', is robust, simple and efficient, can be performed with templates that have no homology, and can be combined with other shuffling protocols in order to introduce any variation in any part of a given gene.

  2. The conjugative plasmid of a bean-nodulating Sinorhizobium fredii strain is assembled from sequences of two Rhizobium plasmids and the chromosome of a Sinorhizobium strain

    Directory of Open Access Journals (Sweden)

    Brom Susana

    2011-06-01

    Full Text Available Abstract Background Bean-nodulating Rhizobium etli originated in Mesoamerica, while soybean-nodulating Sinorhizobium fredii evolved in East Asia. S. fredii strains, such as GR64, have been isolated from bean nodules in Spain, suggesting the occurrence of conjugative transfer events between introduced and native strains. In R. etli CFN42, transfer of the symbiotic plasmid (pRet42d requires cointegration with the endogenous self-transmissible plasmid pRet42a. Aiming at further understanding the generation of diversity among bean nodulating strains, we analyzed the plasmids of S. fredii GR64: pSfr64a and pSfr64b (symbiotic plasmid. Results The conjugative transfer of the plasmids of strain GR64 was analyzed. Plasmid pSfr64a was self-transmissible, and required for transfer of the symbiotic plasmid. We sequenced pSfr64a, finding 166 ORFs. pSfr64a showed three large segments of different evolutionary origins; the first one presented 38 ORFs that were highly similar to genes located on the chromosome of Sinorhizobium strain NGR234; the second one harbored 51 ORFs with highest similarity to genes from pRet42d, including the replication, but not the symbiosis genes. Accordingly, pSfr64a was incompatible with the R. etli CFN42 symbiotic plasmid, but did not contribute to symbiosis. The third segment contained 36 ORFs with highest similarity to genes localized on pRet42a, 20 of them involved in conjugative transfer. Plasmid pRet42a was unable to substitute pSfr64a for induction of pSym transfer, and its own transfer was significantly diminished in GR64 background. The symbiotic plasmid pSfr64b was found to differ from typical R. etli symbiotic plasmids. Conclusions S. fredii GR64 contains a chimeric transmissible plasmid, with segments from two R. etli plasmids and a S. fredii chromosome, and a symbiotic plasmid different from the one usually found in R. etli bv phaseoli. We infer that these plasmids originated through the transfer of a symbiotic-conjugative-plasmid

  3. Construction of recombinant shuttle plasmid pIMP1-eHER2/neu and screening and identification of its stable Clostridium sporogenes transformants%重组穿梭质粒pIMP1-eHER2/neu的构建及其生孢梭菌稳定转化株的筛选与鉴定

    Institute of Scientific and Technical Information of China (English)

    张艳丽; 张文卿; 王秋波; 丁守怡; 吕锐; 孟林

    2011-01-01

    目的:制备人原癌基因HER2/neu的细胞外区域(ECD)基因修饰的重组生孢梭菌,为进一步研究其抗肿瘤作用奠定基础.方法:利用SOE-PCR将HER2/neu ECD基因连接到厌氧菌的内β1,4-葡聚糖酶的启动子和信号肽基因(eglAp)下游,构建融合基因eglAp-HER2/neu;将其插入大肠杆菌-厌氧菌穿梭质粒pIMP1,构建重组质粒;首先将重组质粒导人大肠杆菌DH5α内并进行鉴定;然后用电穿孔法将重组质粒导人生孢梭菌.利用红霉素抗性筛选重组生孢梭菌;采用菌液PCR鉴定阳性克隆.结果:酶切和测序结果显示,插入质粒pIMP1内的eglAp-HER2/neu融合基因序列及读框正确.菌液PCR结果表明,重组质粒pIMP1-eHER2/neu成功转化生孢梭菌;经过20多代抗生素压力筛选,重组生孢梭菌仍能稳定携带pIMP1-eHER2/neu.结论:成功制备了重组质粒pIMP1-eHER2/neu生孢梭菌的稳定转化株,为其进一步的抗肿瘤作用研究奠定基础.%AIM: To constaict recombinant clostridium sporogenes modified with the extracellular domain of human oncogene HER2/neu, to lay a foundation for further study of its antitumor effect. METHODS; The extracellular domain (ECD) of HER2/neu gene was attached to the downstream of promoter and signal sequence of clostridia endo-1, 4-glu-canase (eglAp) by SOE-PCR to construct fusion gene eg-Iap-HER2/neu, which was then inserted into E. Coli-clostrid-ia shuttle plasmid pIMPl to construct recombinant plasmid plMPl-eHER2/neu. The recombinant plasmid was firstly transformed into E. Coli DH5a. Then the correct construct was identified and introduced into C. Sporogenes by electro-poration. Positive clones were selected by erythromycin resistance, bacteria PCR were used for verification. RESULTS; Restriction map and sequencing result showed that the sequence and ORF of fusion gene eglAp-HER2/neu in recombinant plasmid pIMPl-eHER2/neu was correct. Bacteria PCR results indicated that the recombinant plasmid plMPl-eHER2

  4. Resolution of Multimeric Forms of Circular Plasmids and Chromosomes.

    Science.gov (United States)

    Crozat, Estelle; Fournes, Florian; Cornet, François; Hallet, Bernard; Rousseau, Philippe

    2014-10-01

    One of the disadvantages of circular plasmids and chromosomes is their high sensitivity to rearrangements caused by homologous recombination. Odd numbers of crossing-over occurring during or after replication of a circular replicon result in the formation of a dimeric molecule in which the two copies of the replicon are fused. If they are not converted back to monomers, the dimers of replicons may fail to correctly segregate at the time of cell division. Resolution of multimeric forms of circular plasmids and chromosomes is mediated by site-specific recombination, and the enzymes that catalyze this type of reaction fall into two families of proteins: the serine and tyrosine recombinase families. Here we give an overview of the variety of site-specific resolution systems found on circular plasmids and chromosomes.

  5. Isolation of T—DNA flanking plant DNA from T—DNA insertional embryo—lethal mutants of Arabidopsis thaliana by plasmid rescue technique

    Institute of Scientific and Technical Information of China (English)

    YAOXIAOLI; JIANGESUN; 等

    1996-01-01

    Three T-DNA insertional embryonic lethal mutants from NASC(The Nottingham Arabidopsis Stock Center) were first checked with their segregation ratio of abortive and normal seeds and the copy number of T-DNA insertion.The N4081 mutant has a segregation ratio of 1:3.04 in average and one T-DNA insertion site according to our assay.It was therefore chosen for further analysis.To isolate the joint fragment of T-DNA and plant DNA,the plasmid rescue technique was used.pEL-7,one of plasmids from left border of T-DNA,which contained pBR322 was selected from ampicillin plate.The T-DNA fragment of pEL-7 was checked by restriction enzyme analysis and Southern Blot.Restriction analysis confirmed the presence of known sites of EcoRI,PstI and PvuII on it.For confirming the presence of flanking plant DNA in this plasmid,pEL-7 DNA was labeled and hybridized with wild type and mutant plant DNA.The Southern Blot indicated the hybridization band in both of them.Furthermore,the junction of T-DNA/plant DNA was subcloned into bluescript SK+ and sequenced by Applied Biosystem 373A sequencer.The results showed the 822 bp fragment contained a 274 bp sequence,which is 99.6%homolog(273bp/274bp) to Ti plasmid pTi 15955,DNA.The bp of left 25 bp border repeat were also found in the juction of T-DNA and Plant DNA. Taken together,pEL-7 should coutain a joint fragment of T-DNA and flanking plant DNA.This plasmid DNA could be used for the isolation of plant gene,which will be helpful to elucidate the relationship between gene function and plant embryo development.

  6. Conjugation of plasmids of Neisseria gonorrhoeae to other Neisseria species: potential reservoirs for the beta-lactamase plasmid.

    Science.gov (United States)

    Genco, C A; Knapp, J S; Clark, V L

    1984-09-01

    The discovery that penicillinase production in Neisseria gonorrhoeae was plasmid mediated and the spread of the beta-lactamase encoding plasmids in gonococcal isolates since 1976, raise the possibility that a nonpathogenic indigenous bacterium could serve as a reservoir for these plasmids. We initiated studies to define the ability of commensal Neisseria species and Branhamella catarrhalis strains, as well as strains of the pathogen Neisseria meningitidis, to serve as recipients in conjugation with Neisseria gonorrhoeae. We found that with N. gonorrhoeae as the donor, 3 of 5 Neisseria cinerea, 2 of 5 Neisseria flava, 0 of 1 Neisseria flavescens, 1 of 3 Neisseria subflava, 0 of 6 B. catarrhalis, 0 of 7 Neisseria lactamica, 1 of 5 Neisseria mucosa, 1 of 7 Neisseria perflava/sicca, and 0 of 13 N. meningitidis strains gave detectable conjugation frequencies (greater than 10(-8). N. cinerea was the only species found to maintain the gonococcal conjugal plasmid (pLE2451). A N. cinerea transconjugant containing pLE2451 was observed to transfer both the beta-lactamase plasmid and pLE2451 to N. gonorrhoeae at high frequency.

  7. A novel plasmid pEA68 of Erwinia amylovora and the description of a new family of plasmids.

    Science.gov (United States)

    Ismail, Emadeldeen; Blom, Jochen; Bultreys, Alain; Ivanović, Milan; Obradović, Aleksa; van Doorn, Joop; Bergsma-Vlami, Maria; Maes, Martine; Willems, Anne; Duffy, Brion; Stockwell, Virginia O; Smits, Theo H M; Puławska, Joanna

    2014-12-01

    Recent genome analysis of Erwinia amylovora, the causal agent of fire blight disease on Rosaceae, has shown that the chromosome is highly conserved among strains and that plasmids are the principal source of genomic diversity. A new circular plasmid, pEA68, was found in E. amylovora strain 692 (LMG 28361), isolated in Poland from Sorbus (mountain ash) with fire blight symptoms. Annotation of the 68,763-bp IncFIIa-type plasmid revealed that it contains 79 predicted CDS, among which two operons (tra, pil) are associated with mobility. The plasmid is maintained stably in E. amylovora and does not possess genes associated with antibiotic resistance or known virulence genes. Curing E. amylovora strain 692 of pEA68 did not influence its virulence in apple shoots nor amylovoran synthesis. Of 488 strains of E. amylovora from seventeen countries, pEA68 was only found in two additional strains from Belgium. Although the spread of pEA68 is currently limited to Europe, pEA68 comprises, together with pEA72 and pEA78 both found in North America, a new plasmid family that spans two continents.

  8. Anion exchange purification of plasmid DNA using expanded bed adsorption.

    Science.gov (United States)

    Ferreira, G N; Cabral, J M; Prazeres, D M

    2000-01-01

    Recent developments in gene therapy with non-viral vectors and DNA vaccination have increased the demand for large amounts of pharmaceutical-grade plasmid DNA. The high viscosity of process streams is of major concern in the purification of plasmids, since it can cause high back pressures in column operations, thus limiting the throughput. In order to avoid these high back pressures, expanded bed anion exchange chromatography was evaluated as an alternative to fixed bed chromatography. A Streamline 25 column filled with 100 ml of Streamline QXL media, was equilibrated with 0.5 M NaCl in TE (10 mM Tris, 1 mM EDTA, pH = 8.0) buffer at an upward flow of 300 cmh-1, E. coli lysates (obtained from up to 3 liters of fermentation broth) were injected in the column. After washing out the unbound material, the media was allowed to sediment and the plasmid was eluted with 1 M NaCl in TE buffer at a downward flow of 120 cmh-1. Purification factors of 36 +/- 1 fold, 26 +/- 0.4 plasmid purity, and close to 100% yields were obtained when less than one settled column volume of plasmid feed was injected. However, both recovery yield and purity abruptly decreased when larger amounts were processed-values of 35 +/- 2 and 5 +/- 0.7 were obtained for the recovery yield and purity, respectively, when 250 ml of feedstock were processed. In these cases, gel clogging and expansion collapse were observed. The processing of larger volumes, thus larger plasmid quantities, was only possible by performing an isopropanol precipitation step prior to the chromatographic step. This step led to an enhancement of the purification step.

  9. Molecular characterization of Rhodococcus equi isolates from horses in Poland: pVapA characteristics and plasmid new variant, 85-kb type V.

    Science.gov (United States)

    Witkowski, Lucjan; Rzewuska, Magdalena; Takai, Shinji; Chrobak-Chmiel, Dorota; Kizerwetter-Świda, Magdalena; Feret, Małgorzata; Gawryś, Marta; Witkowski, Maciej; Kita, Jerzy

    2017-01-26

    Rhodococcus equi is one of the most significant bacterial pathogens affecting foals up to 6 months of age worldwide. Rhodococcosis is present in Poland however information about molecular characterization of R. equi isolates is scarce. This study describes molecular characterization of Rhodococcus equi infection on 13 horse breeding farms in Poland between 2001 and 2012. Samples were collected by tracheobronchial aspiration from pneumonic foals or during necropsy. The R. equi isolates were genotyped by plasmid profiling and pulsed-field gel electrophoresis. Totally, 58 R. equi isolates were investigated. One isolate lost its plasmid. Among the 57 VapA-positive isolates, 48 contained 85-kb type I plasmid (82.8%), 8 contained 87-kb type I plasmid (13.8%). One isolate (1.7%) had a unique restriction cleavage pattern and the 2nd fragment of EcoRI digests of this plasmid DNA was about 2600 bases smaller than that of the 85 kb type I. This new plasmid variant was designated as the "85-kb type V". Among the 58 isolates typeable with VspI-PFGE, ten PFGE clusters were detected. The majority of foals were infected mostly with isolates of low genetic diversity. Most of clinical isolates of R. equi from foals in Poland contain pVapA 85-kb type I and 87-kb type I similarly to the other European countries and the United States. However, the new variant of pVapA 85-kb type V was identified. The chromosomal variability was detected among some of the investigated isolates and the presence of farm-specific isolates might be possible.

  10. blaCMY-2-positive IncA/C plasmids from Escherichia coli and Salmonella enterica are a distinct component of a larger lineage of plasmids.

    Science.gov (United States)

    Call, Douglas R; Singer, Randall S; Meng, Da; Broschat, Shira L; Orfe, Lisa H; Anderson, Janet M; Herndon, David R; Kappmeyer, Lowell S; Daniels, Joshua B; Besser, Thomas E

    2010-02-01

    Large multidrug resistance plasmids of the A/C incompatibility complex (IncA/C) have been found in a diverse group of Gram-negative commensal and pathogenic bacteria. We present three completed sequences from IncA/C plasmids that originated from Escherichia coli (cattle) and Salmonella enterica serovar Newport (human) and that carry the cephamycinase gene blaCMY-2. These large plasmids (148 to 166 kbp) share extensive sequence identity and synteny. The most divergent plasmid, peH4H, has lost several conjugation-related genes and has gained a kanamycin resistance region. Two of the plasmids (pAM04528 and peH4H) harbor two copies of blaCMY-2, while the third plasmid (pAR060302) harbors a single copy of the gene. The majority of single-nucleotide polymorphisms comprise nonsynonymous mutations in floR. A comparative analysis of these plasmids with five other published IncA/C plasmids showed that the blaCMY-2 plasmids from E. coli and S. enterica are genetically distinct from those originating from Yersinia pestis and Photobacterium damselae and distal to one originating from Yersinia ruckeri. While the overall similarity of these plasmids supports the likelihood of recent movements among E. coli and S. enterica hosts, their greater divergence from Y. pestis or Y. ruckeri suggests less recent plasmid transfer among these pathogen groups.

  11. Mitochondrial pAL2-1 plasmid homologs are senescence factors in Podospora anserina independent of intrinsic senescence

    NARCIS (Netherlands)

    Diepeningen, van A.D.; Debets, A.J.M.; Slakhorst-Wandel, S.M.; Hoekstra, R.F.

    2008-01-01

    Since the first description of a linear mitochondrial plasmid in Podospora anserina, pAL2-1, and homologous plasmids have gone from being considered beneficial longevity plasmids, via neutral genetic elements, toward mutator plasmids causing senescence. The plasmid has an invertron structure, with t

  12. Mitochondrial pAL2-1 plasmid homologs are senescence factors in Podospora anserina independent of intrinsic senescence

    NARCIS (Netherlands)

    Diepeningen, van A.D.; Debets, A.J.M.; Slakhorst-Wandel, S.M.; Hoekstra, R.F.

    2008-01-01

    Since the first description of a linear mitochondrial plasmid in Podospora anserina, pAL2-1, and homologous plasmids have gone from being considered beneficial longevity plasmids, via neutral genetic elements, toward mutator plasmids causing senescence. The plasmid has an invertron structure, with

  13. Mitochondrial pAL2-1 plasmid homologs are senescence factors in Podospora anserina independent of intrinsic senescence

    NARCIS (Netherlands)

    van Diepeningen, Anne D; Debets, Alfons J M; Slakhorst, S Marijke; Hoekstra, Rolf F

    Since the first description of a linear mitochondrial plasmid in Podospora anserina, pAL2-1, and homologous plasmids have gone from being considered beneficial longevity plasmids, via neutral genetic elements, toward mutator plasmids causing senescence. The plasmid has an invertron structure, with

  14. Ribonucleases, antisense RNAs and the control of bacterial plasmids.

    Science.gov (United States)

    Saramago, Margarida; Bárria, Cátia; Arraiano, Cecília M; Domingues, Susana

    2015-03-01

    In the last decade regulatory RNAs have emerged as powerful tools to regulate the expression of genes both in prokaryotes and in eukaryotes. RNases, by degrading these RNA molecules, control the right amount of regulatory RNAs, which is fundamental for an accurate regulation of gene expression in the cell. Remarkably the first antisense RNAs identified were plasmid-encoded and their detailed study was crucial for the understanding of prokaryotic antisense RNAs. In this review we highlight the role of RNases in the precise modulation of antisense RNAs that control plasmid replication, maintenance and transfer.

  15. Training Restricted Boltzmann Machines

    DEFF Research Database (Denmark)

    Fischer, Asja

    Restricted Boltzmann machines (RBMs) are probabilistic graphical models that can also be interpreted as stochastic neural networks. Training RBMs is known to be challenging. Computing the likelihood of the model parameters or its gradient is in general computationally intensive. Thus, training...... relies on sampling based approximations of the log-likelihood gradient. I will present an empirical and theoretical analysis of the bias of these approximations and show that the approximation error can lead to a distortion of the learning process. The bias decreases with increasing mixing rate...... of the applied sampling procedure and I will introduce a transition operator that leads to faster mixing. Finally, a different parametrisation of RBMs will be discussed that leads to better learning results and more robustness against changes in the data representation....

  16. Very strict selectional restrictions

    CERN Document Server

    Laporte, Eric; Dias, Maria Carmelita P

    2007-01-01

    We discuss the characteristics and behaviour of two parallel classes of verbs in two Romance languages, French and Portuguese. Examples of these verbs are Port. abater [gado] and Fr. abattre [b\\'etail], both meaning "slaughter [cattle]". In both languages, the definition of the class of verbs includes several features: - They have only one essential complement, which is a direct object. - The nominal distribution of the complement is very limited, i.e., few nouns can be selected as head nouns of the complement. However, this selection is not restricted to a single noun, as would be the case for verbal idioms such as Fr. monter la garde "mount guard". - We excluded from the class constructions which are reductions of more complex constructions, e.g. Port. afinar [instrumento] com "tune [instrument] with".

  17. Transcription termination in the plasmid/virus hybrid pSSVx from Sulfolobus islandicus

    DEFF Research Database (Denmark)

    Contursi, Patrizia; Cannio, Raffaele; She, Qunxin

    2010-01-01

    The pSSVx from Sulfolobus islandicus, strain REY15/4, is a hybrid between a plasmid and a fusellovirus. A systematic study previously performed revealed the presence of nine major transcripts, the expression of which was differentially and temporally regulated over the growth cycle of S. islandicus....... In this study, two new transcripts were identified. Then, 3' termini of all the RNAs were mapped using adaptor RT-PCR and RNase protection assays, and termination/arrest positions were identified for each transcript. The majority of the identified ending positions were located in the close vicinity of a T......-rich sequence and this was consistent with termination signals identifiable for most of archaeal genes. Furthermore, termination also occurred at locations where a T-track sequence was absent but a stem-loop structure could be formed. We propose that an alternative mechanism based on secondary RNA structures...

  18. Conjugal transfer of group B streptococcal plasmids and comobilization of Escherichia coli-Streptococcus shuttle plasmids to Lactobacillus plantarum.

    OpenAIRE

    1988-01-01

    The antibiotic resistance group B streptococcal plasmids, pIP501 and pVA797, were conjugally transferred from Streptococcus faecalis to Lactobacillus plantarum. The Escherichia coli-Streptococcus shuttle plasmids, pVA838 and pSA3, were mobilized from S. sanguis to L. plantarum by pVA797 via cointegrate formation. pVA838 readily resolved from pVA797 and was present in L. plantarum as deletion derivatives. The pVA797::pSA3 cointegrate failed to resolve in L. plantarum.

  19. DNA sequence analysis of plasmids from multidrug resistant Salmonella enterica serotype Heidelberg isolates.

    Directory of Open Access Journals (Sweden)

    Jing Han

    Full Text Available Salmonella enterica serovar Heidelberg is among the most detected serovars in swine and poultry, ranks among the top five serotypes associated with human salmonellosis and is disproportionately associated with invasive infections and mortality in humans. Salmonella are known to carry plasmids associated with antimicrobial resistance and virulence. To identify plasmid-associated genes in multidrug resistant S. enterica serovar Heidelberg, antimicrobial resistance plasmids from five isolates were sequenced using the 454 LifeSciences pyrosequencing technology. Four of the isolates contained incompatibility group (Inc A/C multidrug resistance plasmids harboring at least eight antimicrobial resistance genes. Each of these strains also carried a second resistance plasmid including two IncFIB, an IncHI2 and a plasmid lacking an identified Inc group. The fifth isolate contained an IncI1 plasmid, encoding resistance to gentamicin, streptomycin and sulfonamides. Some of the IncA/C plasmids lacked the full concert of transfer genes and yet were able to be conjugally transferred, likely due to the transfer genes carried on the companion plasmids in the strains. Several non-IncA/C resistance plasmids also carried putative virulence genes. When the sequences were compared to previously sequenced plasmids, it was found that while all plasmids demonstrated some similarity to other plasmids, they were unique, often due to differences in mobile genetic elements in the plasmids. Our study suggests that Salmonella Heidelberg isolates harbor plasmids that co-select for antimicrobial resistance and virulence, along with genes that can mediate the transfer of plasmids within and among other bacterial isolates. Prevalence of such plasmids can complicate efforts to control the spread of S. enterica serovar Heidelberg in food animal and human populations.

  20. Genetic Characterization of ExPEC-Like Virulence Plasmids among a Subset of NMEC.

    Directory of Open Access Journals (Sweden)

    Bryon A Nicholson

    Full Text Available Neonatal Meningitis Escherichia coli (NMEC is one of the most common causes of neonatal bacterial meningitis in the US and elsewhere resulting in mortality or neurologic deficits in survivors. Large plasmids have been shown experimentally to increase the virulence of NMEC in the rat model of neonatal meningitis. Here, 9 ExPEC-like plasmids were isolated from NMEC and sequenced to identify the core and accessory plasmid genes of ExPEC-like virulence plasmids in NMEC and create an expanded plasmid phylogeny. Results showed sequenced virulence plasmids carry a strongly conserved core of genes with predicted functions in five distinct categories including: virulence, metabolism, plasmid stability, mobile elements, and unknown genes. The major functions of virulence-associated and plasmid core genes serve to increase in vivo fitness by adding multiple iron uptake systems to the genetic repertoire to facilitate NMEC's survival in the host's low iron environment, and systems to enhance bacterial resistance to host innate immunity. Phylogenetic analysis based on these core plasmid genes showed that at least two lineages of ExPEC-like plasmids could be discerned. Further, virulence plasmids from Avian Pathogenic E. coli and NMEC plasmids could not be differentiated based solely on the genes of the core plasmid genome.

  1. Pharmaceutical development of the plasmid DNA vaccine pDERMATT

    NARCIS (Netherlands)

    Quaak, S.G.L.

    2009-01-01

    The discovery of tumor specific antigens and self tolerance mechanisms against these antigens led to the assumption that antigens circulating at sufficient concentration levels could break this self tolerance mechanism and evoke immunological antitumor effects. pDERMATT (plasmid DNA encoding recombi

  2. Geminiviruses: a tale of a plasmid becoming a virus

    Directory of Open Access Journals (Sweden)

    Krupovic Mart

    2009-05-01

    Full Text Available Abstract Background Geminiviruses (family Geminiviridae are small single-stranded (ss DNA viruses infecting plants. Their virion morphology is unique in the known viral world – two incomplete T = 1 icosahedra are joined together to form twinned particles. Geminiviruses utilize a rolling-circle mode to replicate their genomes. A limited sequence similarity between the three conserved motifs of the rolling-circle replication initiation proteins (RCR Reps of geminiviruses and plasmids of Gram-positive bacteria allowed Koonin and Ilyina to propose that geminiviruses descend from bacterial replicons. Results Phylogenetic and clustering analyses of various RCR Reps suggest that Rep proteins of geminiviruses share a most recent common ancestor with Reps encoded on plasmids of phytoplasmas, parasitic wall-less bacteria replicating both in plant and insect cells and therefore occupying a common ecological niche with geminiviruses. Capsid protein of Satellite tobacco necrosis virus was found to be the best template for homology-based structural modeling of the geminiviral capsid protein. Good stereochemical quality of the generated models indicates that the geminiviral capsid protein shares the same structural fold, the viral jelly-roll, with the vast majority of icosahedral plant-infecting ssRNA viruses. Conclusion We propose a plasmid-to-virus transition scenario, where a phytoplasmal plasmid acquired a capsid-coding gene from a plant RNA virus to give rise to the ancestor of geminiviruses.

  3. Recombinogenic engineering of conjugative plasmids with fluorescent marker cassettes

    DEFF Research Database (Denmark)

    Reisner, A.; Molin, Søren; Zechner, E.L.

    2002-01-01

    An efficient approach for the insertion of fluorescent marker genes with sequence specificity into conjugative plasmids in Escherichia coli is described. For this purpose, homologous recombination of linear double-stranded targeting DNA was mediated by the bacteriophage lambda recombination funct...

  4. Resistant plasmid profile analysis of multidrug resistant Escherichia ...

    African Journals Online (AJOL)

    Objectives: This study was carried out to determine the resistant plasmids of ... resistance pattern of micro-organisms to common an- tibiotics1 ... ment has necessitated the need for regular monitoring of antibiotics susceptibility trends to provide the basis for developing rational prescription programs, mak- ..... Paediatrics and.

  5. Pharmaceutical development of the plasmid DNA vaccine pDERMATT

    NARCIS (Netherlands)

    Quaak, S.G.L.

    2009-01-01

    The discovery of tumor specific antigens and self tolerance mechanisms against these antigens led to the assumption that antigens circulating at sufficient concentration levels could break this self tolerance mechanism and evoke immunological antitumor effects. pDERMATT (plasmid DNA encoding

  6. Use of plasmid DNA for induction of protective immunity

    DEFF Research Database (Denmark)

    Lorenzen, Niels

    2004-01-01

    Vaccines based on plasmid DNA have been tested for a number of fish pathogens but so far it is only in case of the rhabdoviruses, where the technology has been a real break through in vaccine research. Aspects of dose, time-course and mechanisms of protection, as well as practical use are discussed....

  7. Effects of maternal plasmid GHRH treatment on offspring growth

    Science.gov (United States)

    To differentiate prenatal effects of plasmid growth hormone-releasing hormone (GHRH) treatment from maternal effects mediated by lactation on long-term growth of offspring, a cross-fostering study was designed. Pregnant sows (n = 12) were untreated (n = 6), or received either a Wt-GHRH (n = 2), or H...

  8. Plasmid containing a DNA ligase gene from Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    McCarthy, D.; Griffin, K.; Setlow, J.K.

    1984-05-01

    A ligase gene from Haemophilus influenzae was cloned into the shuttle vector pDM2. Although the plasmid did not affect X-ray sensitivity, it caused an increase in UV sensitivity of the wild-type but not excision-defective H. influenzae and a decrease in UV sensitivity of the rec-1 mutant. 14 references, 2 figures.

  9. Tragedy of the commons among antibiotic resistance plasmids.

    Science.gov (United States)

    Smith, Jeff

    2012-04-01

    As social interactions are increasingly recognized as important determinants of microbial fitness, sociobiology is being enlisted to better understand the evolution of clinically relevant microbes and, potentially, to influence their evolution to aid human health. Of special interest are situations in which there exists a "tragedy of the commons," where natural selection leads to a net reduction in fitness for all members of a population. Here, I demonstrate the existence of a tragedy of the commons among antibiotic resistance plasmids of bacteria. In serial transfer culture, plasmids evolved a greater ability to superinfect already-infected bacteria, increasing plasmid fitness when evolved genotypes were rare. Evolved plasmids, however, fell victim to their own success, reducing the density of their bacterial hosts when they became common and suffering reduced fitness through vertical transmission. Social interactions can thus be an important determinant of evolution for the molecular endosymbionts of bacteria. These results also identify an avenue of evolution that reduces proliferation of both antibiotic resistance genes and their bacterial hosts. © 2012 The Author(s). Evolution© 2012 The Society for the Study of Evolution.

  10. Agrobacterium-mediated plant transformation by novel mini-T vectors in conjunction with a high-copy vir region helper plasmid.

    Science.gov (United States)

    Zyprian, E; Kado, C I

    1990-08-01

    A new binary vector system for Agrobacterium-mediated plant transformation was developed. A set of four mini-T vectors comprised of T-DNA border sequences from nopaline-type Ti-plasmid pTiC58 flanking a chimaeric hygromycin-resistance gene for selection of transformants and up to eight unique restriction sites for cloning foreign DNA was constructed on a broad-host replicon containing the oriV of plasmid pSa. In two of the constructs these multiple cloning sites are flanked by a strong promoter to activate transcription of inserted DNA in planta. High-efficiency transformation was prompted by a high-copy, stable virulence helper plasmid pUCD2614, which contains a cloned virulence region of pTiC58 and tandem copies of the par locus of plasmid pTAR. Southern blot hybridization and genetic analyses of the progeny of transformed plants showed that the hygromycin resistance gene was stably inherited.

  11. Construction and use of a broad-host-range plasmid expressing the lamB gene for utilization of bacteriophage lambda vectors in the marine bacterium Vibrio harveyi.

    Science.gov (United States)

    Jasiecki, J; Czy, A; Gabig, M; Wegrzyn, G

    2001-07-01

    The remarkable success of Escherichia coli as a model organism in molecular genetics was dependent, among other things, on its susceptibility to genetic manipulation. Many versatile and sophisticated genetic tools for molecular biology studies are derived from bacteriophage lambda. However, this bacteriophage is specific for E. coli, and thus lambda-based techniques have been restricted to this bacterium. Plasmids expressing the E. coli gene coding for bacteriophage lambda receptor were reported previously, and introduction of such plasmids into cells of some other bacteria made them sensitive to phage lambda infection. However, we found that these systems were not efficient for Vibrio harveyi, one of the most frequently investigated species of marine bacteria. Here we describe construction of a broad-host-range plasmid expressing the lamB gene. Introduction of this plasmid to V. harveyi cells and expression of lamB made this strain susceptible to bacteriophage lambda adsorption and lambda DNA injection. Foreign genetic material could be introduced into cells of this strain using a cosmid vector.

  12. The replication origin of a repABC plasmid

    Directory of Open Access Journals (Sweden)

    Cevallos Miguel A

    2011-06-01

    Full Text Available Abstract Background repABC operons are present on large, low copy-number plasmids and on some secondary chromosomes in at least 19 α-proteobacterial genera, and are responsible for the replication and segregation properties of these replicons. These operons consist, with some variations, of three genes: repA, repB, and repC. RepA and RepB are involved in plasmid partitioning and in the negative regulation of their own transcription, and RepC is the limiting factor for replication. An antisense RNA encoded between the repB-repC genes modulates repC expression. Results To identify the minimal region of the Rhizobium etli p42d plasmid that is capable of autonomous replication, we amplified different regions of the repABC operon using PCR and cloned the regions into a suicide vector. The resulting vectors were then introduced into R. etli strains that did or did not contain p42d. The minimal replicon consisted of a repC open reading frame under the control of a constitutive promoter with a Shine-Dalgarno sequence that we designed. A sequence analysis of repC revealed the presence of a large A+T-rich region but no iterons or DnaA boxes. Silent mutations that modified the A+T content of this region eliminated the replication capability of the plasmid. The minimal replicon could not be introduced into R. etli strain containing p42d, but similar constructs that carried repC from Sinorhizobium meliloti pSymA or the linear chromosome of Agrobacterium tumefaciens replicated in the presence or absence of p42d, indicating that RepC is an incompatibility factor. A hybrid gene construct expressing a RepC protein with the first 362 amino acid residues from p42d RepC and the last 39 amino acid residues of RepC from SymA was able to replicate in the presence of p42d. Conclusions RepC is the only element encoded in the repABC operon of the R. etli p42d plasmid that is necessary and sufficient for plasmid replication and is probably the initiator protein. The ori

  13. Genetic Mapping

    Science.gov (United States)

    ... Fact Sheets Fact Sheets En Español: Mapeo Genético Genetic Mapping What is genetic mapping? How do researchers create ... genetic map? What are genetic markers? What is genetic mapping? Among the main goals of the Human Genome ...

  14. Characterization of the Lactobacillus plantarum plasmid pCD033 and generation of the plasmid free strain L. plantarum 3NSH.

    Science.gov (United States)

    Heiss, Silvia; Grabherr, Reingard; Heinl, Stefan

    2015-09-01

    Lactobacillus plantarum CD033, a strain isolated from grass silage in Austria, harbors a 7.9 kb plasmid designated pCD033. Sequence analysis identified 14 open reading frames and 8 of these were supposed to be putative coding sequences. Gene annotation revealed no putative essential genes being plasmid encoded, but a plasmid addiction system based on a PemI/PemK-like toxin-antitoxin system, able to stabilize plasmid maintenance. Absence of a replication initiation protein, a double strand origin as well as a single strand origin on plasmid pCD033 suggests replication via a new type of theta mechanism, whereby plasmid replication is potentially initiated and regulated by non-coding RNA. Detailed examination of segregational stability of plasmid vectors consisting of pCD033-fragments, combined with a selection marker, resulted in definition of a stably maintained minimal replicon. A gene encoding a RepB/OrfX-like protein was found to be not essential for plasmid replication. Alignment of the amino acid sequence of this protein with related proteins unveiled a highly conserved amino acid motif (LLDQQQ). L. plantarum CD033 was cured of pCD033 resulting in the novel plasmid free strain L. plantarum 3NSH. Plasmid curing demonstrated that no essential features are provided by pCD033 under laboratory conditions.

  15. Comparative analysis of physical maps of four Bacillus subtilis (natto) genomes.

    Science.gov (United States)

    Qiu, Dongru; Fujita, Kyoko; Sakuma, Yuko; Tanaka, Teruo; Ohashi, Yoshiaki; Ohshima, Hideyuki; Tomita, Masaru; Itaya, Mitsuhiro

    2004-10-01

    The complete SfiI and I-CeuI physical maps of four Bacillus subtilis (natto) strains, which were previously isolated as natto (fermented soybean) starters, were constructed to elucidate the genome structure. Not only the similarity in genome size and organization but also the microheterogeneity of the gene context was revealed. No large-scale genome rearrangements among the four strains were indicated by mapping of the genes, including 10 rRNA operons (rrn) and relevant genes required for natto production, to the loci corresponding to those of the B. subtilis strain Marburg 168. However, restriction fragment length polymorphism and the presence or absence of strain-specific DNA sequences, such as the prophages SP beta, skin element, and PBSX, as well as the insertion element IS4Bsu1, could be used to identify one of these strains as a Marburg type and the other three strains as natto types. The genome structure and gene heterogeneity were also consistent with the type of indigenous plasmids harbored by the strains.

  16. Property Rights, Restrictions and Responsibilities

    DEFF Research Database (Denmark)

    Enemark, Stig

    Land Administration Systems are the basis for conceptualizing rights, restrictions and responsibilities related to people, policies and places. Property rights are normally concerned with ownership and tenure whereas restrictions usually control use and activities on land. Responsibilities relate...... more to a social, ethical commitment or attitude to environmental sustainability and good husbandry. This paper provides an overall understanding of the concept of land administration systems for dealing with rights, restrictions and responsibilities in future spatially enabled government. Finally...

  17. Concept Maps

    OpenAIRE

    Schwendimann, Beat Adrian

    2014-01-01

    A concept map is a node-link diagram showing the semantic relationships among concepts. The technique for constructing concept maps is called "concept mapping". A concept map consists of nodes, arrows as linking lines, and linking phrases that describe the relationship between nodes. Two nodes connected with a labeled arrow are called a proposition. Concept maps are versatile graphic organizers that can represent many different forms of relationships between concepts. The relationship between...

  18. Participation of the lytic replicon in bacteriophage P1 plasmid maintenance.

    OpenAIRE

    1989-01-01

    P1 bacteriophage carries at least two replicons: a plasmid replicon and a viral lytic replicon. Since the isolated plasmid replicon can maintain itself stably at the low copy number characteristic of intact P1 prophage, it has been assumed that this replicon is responsible for driving prophage replication. We provide evidence that when replication from the plasmid replicon is prevented, prophage replication continues, albeit at a reduced rate. The residual plasmid replication is due to incomp...

  19. Presence of Glycopeptide-Encoding Plasmids in Enterococcal Isolates from Food and Humans in Denmark

    DEFF Research Database (Denmark)

    Migura, Lourdes Garcia; Valenzuela, Antonio Jesus Sanchez; Jensen, Lars Bogø

    2011-01-01

    developed techniques for classification of plasmids. Replicons associated with sex pheromone-inducible plasmids were detected in all GR E. faecalis, whereas GR Enterococcus faecium contained plasmids known to be widely distributed among enterococci. vanA resistance is common in E. faecium isolates from meat...... and animals in Europe and is rarely found in E. faecalis. This article describes the first characterization of MGE from vanA mediated E. faecalis, thus linking this resistance genotype to pheromone responding plasmids....

  20. Enhanced brain targeting efficiency of intranasally administered plasmid DNA: an alternative route for brain gene therapy.

    Science.gov (United States)

    Han, In-Kwon; Kim, Mi Young; Byun, Hyang-Min; Hwang, Tae Sun; Kim, Jung Mogg; Hwang, Kwang Woo; Park, Tae Gwan; Jung, Woon-Won; Chun, Taehoon; Jeong, Gil-Jae; Oh, Yu-Kyoung

    2007-01-01

    Recently, nasal administration has been studied as a noninvasive route for delivery of plasmid DNA encoding therapeutic or antigenic genes. Here, we examined the brain targeting efficiency and transport pathways of intranasally administered plasmid DNA. Quantitative polymerase chain reaction (PCR) measurements of plasmid DNA in blood and brain tissues revealed that intranasally administered pCMVbeta (7.2 kb) and pN2/CMVbeta (14.1 kb) showed systemic absorption and brain distribution. Following intranasal administration, the beta-galactosidase protein encoded by these plasmids was significantly expressed in brain tissues. Kinetic studies showed that intranasally administered plasmid DNA reached the brain with a 2,595-fold higher efficiency than intravenously administered plasmid DNA did, 10 min post-dose. Over 1 h post-dose, the brain targeting efficiencies were consistently higher for intranasally administered plasmid DNA than for intravenously administered DNA. To examine how plasmid DNA enters the brain and moves to the various regions, we examined tissues from nine brain regions, at 5 and 10 min after intranasal or intravenous administration of plasmid DNA. Intravenously administered plasmid DNA displayed similar levels of plasmid DNA in the nine different regions, whereas, intranasally administered plasmid DNA exhibited different levels of distribution among the regions, with the highest plasmid DNA levels in the olfactory bulb. Moreover, plasmid DNA was mainly detected in the endothelial cells, but not in glial cells. Our results suggest that intranasally applied plasmid DNA may reach the brain through a direct route, possibly via the olfactory bulb, and that the nasal route might be an alternative method for efficiently delivering plasmid DNA to the brain.

  1. Conservation of Plasmid-Encoded Traits among Bean-Nodulating Rhizobium Species

    OpenAIRE

    Brom, Susana; Girard, Lourdes; García-de los Santos, Alejandro; Sanjuan-Pinilla, Julio M.; Olivares, José; Sanjuan, Juan

    2002-01-01

    Rhizobium etli type strain CFN42 contains six plasmids. We analyzed the distribution of genetic markers from some of these plasmids in bean-nodulating strains belonging to different species (Rhizobium etli, Rhizobium gallicum, Rhizobium giardinii, Rhizobium leguminosarum, and Sinorhizobium fredii). Our results indicate that independent of geographic origin, R. etli strains usually share not only the pSym plasmid but also other plasmids containing symbiosis-related genes, with a similar organi...

  2. Effect of plasmid pKM101 in ultraviolet irradiated uvr+ and uvr- Escherichia coli.

    Science.gov (United States)

    Slezáriková, V; Sedliaková, M; Andreeva, I V; Rusina OYu; Skavronskaya, A G

    1992-11-16

    The effect of plasmid pKM101 on UV irradiated excision proficient and excision deficient cells was investigated. The plasmid increased the survival of excision proficient cells while partially inhibiting thymine dimer excision. The frequency of mutations was almost unchanged. In excision deficient cells the effect of the plasmid on survival was less pronounced while cell mutability was increased. Our data indicate that the mucAB genes (carried by the plasmid) influence the two types of cells in a different way.

  3. An easy and versatile 2-step protocol for targeted modification and subcloning of DNA from bacterial artificial chromosomes using non-commercial plasmids

    Directory of Open Access Journals (Sweden)

    Hartwich Heiner

    2012-03-01

    Full Text Available Abstract Background Promoter-specific expression of foreign DNA in transgenic organisms often relies on bacterial artificial chromosomes (BACs. This approach requires modification and subcloning of BAC-DNA by recombineering technologies in Escherichia coli. Most current protocols rely on commercial kits or isolation of BACs, their transfer between different host strains, and their restriction. Findings In this report we present a 2-step protocol for efficient modification and subcloning of DNA from bacterial artificial chromosomes using the non-commercial plasmids pKM208 and pTP223, distributed from addgene.com. A targeting cassette was successfully integrated into a BAC and 42 kb of this construct were subcloned. Both a plasmid-derived substrate with longer homology arms and a PCR-generated substrate with short homology arms (50 bp were used for recombination. pKM208 and pTP223 contain all required genes for recombineering, but differ in their antibiotic resistance genes. This makes the system independent of the selection markers on the DNA molecules targeted for recombination. Conclusions The time and cost saving protocol presented here compares favorably to currently used systems. Using non-commercial plasmids, it allows targeted modification and cloning of large DNA (> 40 kb fragments in vivo without restriction and ligation. Furthermore, both steps are performed in the same host eliminating the need to isolate BAC DNA and to use different bacterial strains.

  4. Presence and analysis of plasmids in human and animal associated Arcobacter species

    DEFF Research Database (Denmark)

    Douidah, Laid; De Zutter, Lieven; Van Nieuwerburgh, Filip;

    2014-01-01

    In this study, we report the screening of four Arcobacter species for the presence of small and large plasmids. Plasmids were present in 9.9% of the 273 examined strains. One Arcobacter cryaerophilus and four Arcobacter butzleri plasmids were selected for further sequencing. The size of three sma...

  5. Occurrence and persistence of indigenous transconjugants carrying conjugative plasmids in soil.

    Science.gov (United States)

    Inoue, Daisuke; Soda, Satoshi; Tsutsui, Hirofumi; Yamazaki, Yuji; Murashige, Katsushi; Sei, Kazunari; Fujita, Masanori; Ike, Michihiko

    2009-09-01

    The transfer of the self-transmissible plasmids, RP4 and pJP4, from introduced bacteria to indigenous bacteria was examined in soil and slurry microcosms. The introduced plasmids persisted in indigenous transconjugants despite the low survival of introduced donors. The potential of the transconjugants for growth and conjugation affects the persistence of introduced plasmids in soil.

  6. Novel plasmid conferring kanamycin and tetracycline resistance in turkey-derived Campylobacter jejuni strain 11601MD

    Science.gov (United States)

    In Campylobacter spp., resistance to the antibiotics kanamycin and tetracycline is frequently associated with plasmid-borne genes. However, relatively few plasmids of Campylobacter jejuni have been fully characterized to date. A novel plasmid (p11601MD; 44,095 bp.) harboring tet(O) was identified in...

  7. Studies on the expression of plasmid-borne genes in the endosymbiotic state of Rhizobium leguminosarum

    NARCIS (Netherlands)

    Krol, A.J.M.

    1982-01-01

    The subject matter of the research reported in this thesis is the role of plasmid-borne genes of Rhizobium in symbiosis and nitrogen fixation. Plasmid DNA was isolated from Rhizobium leguminosarum strain PRE and the expression of plasmid DNA in nitrogen fixing nodules was investigated by hybridizati

  8. Mosaic structure and regulation of conjugal transfer of the Escherichia coli plasmid pRK100

    NARCIS (Netherlands)

    Starcic Erjavec, Marjanca

    2003-01-01

    Plasmids are extrachromosomal DNA elements that can be found in prokaryotic as well as in eukaryotic cells. They can vary in size and genetic make-up. The plasmid pRK100, which is the study subject of this thesis, is a large (145 kb) natural conjugative plasmid, which was isolated from an uropathoge

  9. Conjugal transfer of a virulence plasmid in the opportunistic intracellular actinomycete Rhodococcus equi.

    Science.gov (United States)

    Tripathi, V N; Harding, W C; Willingham-Lane, J M; Hondalus, M K

    2012-12-01

    Rhodococcus equi is a facultative intracellular, Gram-positive, soilborne actinomycete which can cause severe pyogranulomatous pneumonia with abscessation in young horses (foals) and in immunocompromised people, such as persons with AIDS. All strains of R. equi isolated from foals and approximately a third isolated from humans contain a large, ~81-kb plasmid which is essential for the intramacrophage growth of the organism and for virulence in foals and murine in vivo model systems. We found that the entire virulence plasmid could be transferred from plasmid-containing strains of R. equi (donor) to plasmid-free R. equi strains (recipient) at a high frequency and that plasmid transmission reestablished the capacity for intracellular growth in macrophages. Plasmid transfer required living cells and cell-to-cell contact and was unaffected by the presence of DNase, factors pointing to conjugation as the major means of genetic transfer. Deletion of a putative relaxase-encoding gene, traA, located in the proposed conjugative region of the plasmid, abolished plasmid transfer. Reversion of the traA mutation restored plasmid transmissibility. Finally, plasmid transmission to other Rhodococcus species and some additional related organisms was demonstrated. This is the first study showing a virulence plasmid transfer in R. equi, and it establishes a mechanism by which the virulence plasmid can move among bacteria in the soil.

  10. The evolution of a conjugative plasmid and its ability to increase bacterial fitness

    Science.gov (United States)

    Dionisio, F; Conceição, I.C; Marques, A.C.R; Fernandes, L; Gordo, I

    2005-01-01

    Conjugative plasmids are extra-chromosomal DNA elements that are capable of horizontal transmission and are found in many natural isolated bacteria. Although plasmids may carry beneficial genes to their bacterial host, they may also cause a fitness cost. In this work, we studied the evolution of the R1 plasmid and we found that, in spite of the R1 plasmid conferring an initial cost to its host, after 420 generations the cost disappeared in all five independent evolution experiments. In fact, in two of these five experiments evolved conjugative plasmids actually conferred a fitness advantage to their hosts. Furthermore, the relative fitness of the ancestral clone bearing one of the evolved plasmids is significantly higher than both the plasmid-free ancestral cells and the evolved cells carrying the evolved plasmid. Given that the R1 plasmid may spread among different species of enterobacteria, we wondered what the effect of the evolved plasmid would be inside Salmonella enterica cells. We found that the evolved plasmid is also able to dramatically increase the relative fitness of these cells. Our results suggest that even if general usage of antibiotics is halted, conjugative plasmids that have been selected with antibiotics in previous years can still persist among bacterial populations or even invade new strains. PMID:17148179

  11. A Bipolar Spindle of Antiparallel ParM Filaments Drives Bacterial Plasmid Segregation

    DEFF Research Database (Denmark)

    Gayathri, P; Fujii, T; Møller-Jensen, Jakob;

    2012-01-01

    To ensure their stable inheritance by daughter cells during cell division, bacterial low copy-number plasmids make simple DNA segregating machines that use an elongating protein filament between sister plasmids. In the ParMRC system of Escherichia coli R1 plasmid, ParM, an actin-like protein, forms...

  12. Plasmid diversity and phylogenetic consistency in the Lyme disease agent Borrelia burgdorferi.

    Science.gov (United States)

    Casjens, Sherwood R; Gilcrease, Eddie B; Vujadinovic, Marija; Mongodin, Emmanuel F; Luft, Benjamin J; Schutzer, Steven E; Fraser, Claire M; Qiu, Wei-Gang

    2017-02-15

    Bacteria from the genus Borrelia are known to harbor numerous linear and circular plasmids. We report here a comparative analysis of the nucleotide sequences of 236 plasmids present in fourteen independent isolates of the Lyme disease agent B. burgdorferi. We have sequenced the genomes of 14 B. burgdorferi sensu stricto isolates that carry a total of 236 plasmids. These individual isolates carry between seven and 23 plasmids. Their chromosomes, the cp26 and cp32 circular plasmids, as well as the lp54 linear plasmid, are quite evolutionarily stable; however, the remaining plasmids have undergone numerous non-homologous and often duplicative recombination events. We identify 32 different putative plasmid compatibility types among the 236 plasmids, of which 15 are (usually) circular and 17 are linear. Because of past rearrangements, any given gene, even though it might be universally present in these isolates, is often found on different linear plasmid compatibility types in different isolates. For example, the arp gene and the vls cassette region are present on plasmids of four and five different compatibility types, respectively, in different isolates. A majority of the plasmid types have more than one organizationally different subtype, and the number of such variants ranges from one to eight among the 18 linear plasmid types. In spite of this substantial organizational diversity, the plasmids are not so variable that every isolate has a novel version of every plasmid (i.e., there appears to be a limited number of extant plasmid subtypes). Although there have been many past recombination events, both homologous and nonhomologous, among the plasmids, particular organizational variants of these plasmids correlate with particular chromosomal genotypes, suggesting that there has not been rapid horizontal transfer of whole linear plasmids among B. burgdorferi lineages. We argue that plasmid rearrangements are essentially non-revertable and are present at a frequency of

  13. Transgenic Crops by Direct Treatment of Exogenous DNA Without Agrobacterium tumefaciens Plasmid and Tissue Culture

    Institute of Scientific and Technical Information of China (English)

    ZhangGuodong

    1995-01-01

    Gene transfter methods are developing quickly recently,but each method has its limitations.We introduce a new gene transfer technique in this paper,which is simple,effective,and easy to operate,but does not get enough attention from scientists.This technique is used to transform plants by injecting exogenous DNA to stigma,style,ovary,young fruit or meristem of the recipient,or soaking the recipient's seeds in exogenous DNA solution.Los of heritable variations were found in many characters of many crops,It may be used to creaste new germplasms or realize gene exchange between different species,gerera,or families,even between animals and plants,A brief discussion was given to the mechanism of exogenous DNA introduction,integration into and expression in the recipient.We also discussed the merits and limitations of the technique.Currently there are two successful approaches that can be used to transform plants genetically,but each method has its limitations that are delaying the application of the techniques to certaincommercially important crops.The first tecnhique exploits a natural genetic engineer,Agrobacterium tumefaciens,which contains a tumor-inducing(Ti) plasmid that transfers a DNA segment(the T-DNA) from the plasmid to the nuclear genome of infected plants(or in vitro to plant tissue).The method is restricted to dicotyledenous plants;monocotyledenous plants are usually not susceptible to agrobacterial infection.The second technique involves direct transfter of DNA to plant protoplast ,prepared by enzymatic digestion of cell walls,for example by chemically stimulated uptake using polyethylene glycol or a high voltage pulse,generating transient'holes'in the protoplast membrane.This technique depends on a tissue culture system that allows regeneration of mature plants from protoplasts,But so far it is impossible to achieve plant regeneration from protoplasts in many crops.Both techniques use dominant selectable markers(for example,kanamycin resistance) to

  14. Determination of plasmid copy number reveals the total plasmid DNA amount is greater than the chromosomal DNA amount in Bacillus thuringiensis YBT-1520.

    Directory of Open Access Journals (Sweden)

    Chunying Zhong

    Full Text Available Bacillus thuringiensis is the most widely used bacterial bio-insecticide, and most insecticidal crystal protein-coding genes are located on plasmids. Most strains of B. thuringiensis harbor numerous diverse plasmids, although the plasmid copy numbers (PCNs of all native plasmids in this host and the corresponding total plasmid DNA amount remains unknown. In this study, we determined the PCNs of 11 plasmids (ranging from 2 kb to 416 kb in a sequenced B. thuringiensis subsp. kurstaki strain YBT-1520 using real-time qPCR. PCNs were found to range from 1.38 to 172, and were negatively correlated to plasmid size. The amount of total plasmid DNA (∼8.7 Mbp was 1.62-fold greater than the amount of chromosomal DNA (∼5.4 Mbp at the mid-exponential growth stage (OD(600 = 2.0 of the organism. Furthermore, we selected three plasmids with different sizes and replication mechanisms to determine the PCNs over the entire life cycle. We found that the PCNs dynamically shifted at different stages, reaching their maximum during the mid-exponential growth or stationary phases and remaining stable and close to their minimum after the prespore formation stage. The PCN of pBMB2062, which is the smallest plasmid (2062 bp and has the highest PCN of those tested, varied in strain YBT-1520, HD-1, and HD-136 (172, 115, and 94, respectively. These findings provide insight into both the total plasmid DNA amount of B. thuringiensis and the strong ability of the species to harbor plasmids.

  15. Remarkable stability of an instability-prone lentiviral vector plasmid in Escherichia coli Stbl3.

    Science.gov (United States)

    Al-Allaf, Faisal A; Tolmachov, Oleg E; Zambetti, Lia Paola; Tchetchelnitski, Viktoria; Mehmet, Huseyin

    2013-02-01

    Large-scale production of plasmid DNA to prepare therapeutic gene vectors or DNA-based vaccines requires a suitable bacterial host, which can stably maintain the plasmid DNA during industrial cultivation. Plasmid loss during bacterial cell divisions and structural changes in the plasmid DNA can dramatically reduce the yield of the desired recombinant plasmid DNA. While generating an HIV-based gene vector containing a bicistronic expression cassette 5'-Olig2cDNA-IRES-dsRed2-3', we encountered plasmid DNA instability, which occurred in homologous recombination deficient recA1 Escherichia coli strain Stbl2 specifically during large-scale bacterial cultivation. Unexpectedly, the new recombinant plasmid was structurally changed or completely lost in 0.5 L liquid cultures but not in the preceding 5 mL cultures. Neither the employment of an array of alternative recA1 E. coli plasmid hosts, nor the lowering of the culture incubation temperature prevented the instability. However, after the introduction of this instability-prone plasmid into the recA13E. coli strain Stbl3, the transformed bacteria grew without being overrun by plasmid-free cells, reduction in the plasmid DNA yield or structural changes in plasmid DNA. Thus, E. coli strain Stbl3 conferred structural and maintenance stability to the otherwise instability-prone lentivirus-based recombinant plasmid, suggesting that this strain can be used for the faithful maintenance of similar stability-compromised plasmids in large-scale bacterial cultivations. In contrast to Stbl2, which is derived wholly from the wild type isolate E. coli K12, E. coli Stbl3 is a hybrid strain of mixed E. coli K12 and E. coli B parentage. Therefore, we speculate that genetic determinants for the benevolent properties of E. coli Stbl3 for safe plasmid propagation originate from its E. coli B ancestor.

  16. Type 3 Fimbriae Encoded on Plasmids Are Expressed from a Unique Promoter without Affecting Host Motility, Facilitating an Exceptional Phenotype That Enhances Conjugal Plasmid Transfer

    DEFF Research Database (Denmark)

    Madsen, Jonas Stenlokke; Riber, Leise; Kot, Witold;

    2016-01-01

    on plasmids is systematically different, as MrkH, a c-di-GMP dependent transcriptional activator is not needed for strong expression of the fimbriae. MrkH is required for expression of type 3 fimbriae of the Klebsiella pneumoniae chromosome, wherefrom the fimbriae operon (mrkABCDF) of plasmids is believed...... to have originated. We find that mrkABCDFs of plasmids are highly expressed via a unique promoter that differs from the original Klebsiella promoter resulting in fundamental behavioral consequences. Plasmid associated mrkABCDFs did not influence the swimming behavior of the host, that hereby acquired...

  17. Coupling between the Basic Replicon and the Kis-Kid Maintenance System of Plasmid R1: Modulation by Kis Antitoxin Levels and Involvement in Control of Plasmid Replication

    Directory of Open Access Journals (Sweden)

    Juan López-Villarejo

    2015-02-01

    Full Text Available kis-kid, the auxiliary maintenance system of plasmid R1 and copB, the auxiliary copy number control gene of this plasmid, contribute to increase plasmid replication efficiency in cells with lower than average copy number. It is thought that Kis antitoxin levels decrease in these cells and that this acts as the switch that activates the Kid toxin; activated Kid toxin reduces copB-mRNA levels and this increases RepA levels that increases plasmid copy number. In support of this model we now report that: (i the Kis antitoxin levels do decrease in cells containing a mini-R1 plasmid carrying a repA mutation that reduces plasmid copy number; (ii kid-dependent replication rescue is abolished in cells in which the Kis antitoxin levels or the CopB levels are increased. Unexpectedly we found that this coordination significantly increases both the copy number of the repA mutant and of the wt mini-R1 plasmid. This indicates that the coordination between plasmid replication functions and kis-kid system contributes significantly to control plasmid R1 replication.

  18. High-throughput plasmid construction using homologous recombination in yeast: its mechanisms and application to protein production for X-ray crystallography.

    Science.gov (United States)

    Mizutani, Kimihiko

    2015-01-01

    Homologous recombination is a system for repairing the broken genomes of living organisms by connecting two DNA strands at their homologous sequences. Today, homologous recombination in yeast is used for plasmid construction as a substitute for traditional methods using restriction enzymes and ligases. This method has various advantages over the traditional method, including flexibility in the position of DNA insertion and ease of manipulation. Recently, the author of this review reported the construction of plasmids by homologous recombination in the methanol-utilizing yeast Pichia pastoris, which is known to be an excellent expression host for secretory proteins and membrane proteins. The method enabled high-throughput construction of expression systems of proteins using P. pastoris; the constructed expression systems were used to investigate the expression conditions of membrane proteins and to perform X-ray crystallography of secretory proteins. This review discusses the mechanisms and applications of homologous recombination, including the production of proteins for X-ray crystallography.

  19. Remarkable stability of an instability-prone lentiviral vector plasmid in Escherichia coli Stbl3

    OpenAIRE

    Al-Allaf, Faisal A.; Tolmachov, Oleg E.; Zambetti, Lia Paola; Tchetchelnitski, Viktoria; Mehmet, Huseyin

    2012-01-01

    Large-scale production of plasmid DNA to prepare therapeutic gene vectors or DNA-based vaccines requires a suitable bacterial host, which can stably maintain the plasmid DNA during industrial cultivation. Plasmid loss during bacterial cell divisions and structural changes in the plasmid DNA can dramatically reduce the yield of the desired recombinant plasmid DNA. While generating an HIV-based gene vector containing a bicistronic expression cassette 5′-Olig2cDNA-IRES-dsRed2-3′, we encountered ...

  20. An Improved Method for Including Upper Size Range Plasmids in Metamobilomes

    DEFF Research Database (Denmark)

    Norman, Anders; Riber, Leise; Luo, Wenting

    2014-01-01

    cloning vector (pBR322), and a 56 Kbp conjugative plasmid (pKJK10), to represent lower- and upper plasmid size ranges, respectively. Subjecting a mixture of these plasmids to the overall isolation protocol revealed a 34-fold over-amplification of pBR322 after MDA. To address this bias, we propose......, as gene functions associated with these plasmids, such as conjugation, was exclusively encoded in the data output generated through the modified protocol. Thus, with the suggested modification, access to a large uncharacterized pool of accessory elements that reside on medium-to-large plasmids has been...

  1. Host growth temperature and a conservative amino acid substitution in the replication protein of pPS10 influence plasmid host range.

    Science.gov (United States)

    Fernández-Tresguerres, M E; Martín, M; García de Viedma, D; Giraldo, R; Díaz-Orejas, R

    1995-01-01

    pPS10 is a replicon isolated from Pseudomonas syringe pv. savastanoi that can be established at 37 degrees C efficiently in Pseudomonas aeruginosa but very inefficiently in Escherichia coli. The establishment of the wild-type pPS10 replicon in E. coli is favored at low temperatures (30 degrees C or below). RepA protein of pPS10 promotes in vitro plasmid replication in extracts from E. coli, and this replication depends on host proteins DnaA, DnaB, DnaG, and SSB. Mutant plasmids able to efficiently replicate in E. coli at 37 degrees C were obtained. Three of four mutants whose mutations were mapped show a conservative Ala-->Val change in the amino-terminal region of the replication protein RepA. Plasmids carrying this mutation maintain the capacity to replicate in P. aeruginosa and have a fourfold increase in copy number in this host. The mutation does not substantially alter the autoregulation mediated by RepA. These results show that the physiological conditions of the host as well as subtle changes in the plasmid replication protein can modulate the host range of the pPS10 replicon. PMID:7635822

  2. Large plasmids of Escherichia coli and Salmonella encode highly diverse arrays of accessory genes on common replicon families.

    Science.gov (United States)

    Williams, Laura E; Wireman, Joy; Hilliard, Valda C; Summers, Anne O

    2013-01-01

    Plasmids are important in evolution and adaptation of host bacteria, yet we lack a comprehensive picture of their own natural variation. We used replicon typing and RFLP analysis to assess diversity and distribution of plasmids in the ECOR, SARA, SARB and SARC reference collections of Escherichia coli and Salmonella. Plasmids, especially large (≥30 kb) plasmids, are abundant in these collections. Host species and genotype clearly impact plasmid prevalence; plasmids are more abundant in ECOR than SAR, but, within ECOR, subgroup B2 strains have the fewest large plasmids. The majority of large plasmids have unique RFLP patterns, suggesting high variation, even within dominant replicon families IncF and IncI1. We found only four conserved plasmid types within ECOR, none of which are widely distributed. Within SAR, conserved plasmid types are primarily serovar-specific, including a pSLT-like plasmid in 13 Typhimurium strains. Conservation of pSLT contrasts with variability of other plasmids, suggesting evolution of serovar-specific virulence plasmids is distinct from that of most enterobacterial plasmids. We sequenced a conserved serovar Heidelberg plasmid but did not detect virulence or antibiotic resistance genes. Our data illustrate the high degree of natural variation in large plasmids of E. coli and Salmonella, even among plasmids sharing backbone genes.

  3. Cationic lipids delay the transfer of plasmid DNA to lysosomes.

    Science.gov (United States)

    Wattiaux, R; Jadot, M; Laurent, N; Dubois, F; Wattiaux-De Coninck, S

    1996-10-14

    Plasmid 35S DNA, naked or associated with different cationic lipid preparations was injected to rats. Subcellular distribution of radioactivity in the liver one hour after injection, was established by centrifugation methods. Results show that at that time, 35S DNA has reached lysosomes. On the contrary, when 35S DNA was complexed with lipids, radioactivity remains located in organelles whose distribution after differential and isopycnic centrifugation, is clearly distinct from that of arylsulfatase, lysosome marker enzyme. Injection of Triton WR 1339, a specific density perturbant of lysosomes, four days before 35S DNA injection causes a density decrease of radioactivity bearing structures, apparent one hour after naked 35S DNA injection but visible only after more than five hours, when 35S DNA associated with a cationic lipid is injected. These observations show that cationic lipids delay the transfer to lysosomes, of plasmid DNA taken up by the liver.

  4. Replisome Assembly at Bacterial Chromosomes and Iteron Plasmids

    Directory of Open Access Journals (Sweden)

    Katarzyna Ewa Wegrzyn

    2016-08-01

    Full Text Available The proper initiation and occurrence of DNA synthesis depends on the formation and rearrangements of nucleoprotein complexes within the origin of DNA replication. In this review article, we present the current knowledge on the molecular mechanism of replication complex assembly at the origin of bacterial chromosome and plasmid replicon containing direct repeats (iterons within the origin sequence. We describe recent findings on chromosomal and plasmid replication initiators, DnaA and Rep proteins, respectively, and their sequence-specific interactions with double and single stranded DNA. Also, we discuss the current understanding of the activities of DnaA and Rep proteins required for replisome assembly that is fundamental to the duplication and stability of genetic information in bacterial cells.

  5. Plasmids and packaging cell lines for use in phage display

    Science.gov (United States)

    Bradbury, Andrew M.

    2012-07-24

    The invention relates to a novel phagemid display system for packaging phagemid DNA into phagemid particles which completely avoids the use of helper phage. The system of the invention incorporates the use of bacterial packaging cell lines which have been transformed with helper plasmids containing all required phage proteins but not the packaging signals. The absence of packaging signals in these helper plasmids prevents their DNA from being packaged in the bacterial cell, which provides a number of significant advantages over the use of both standard and modified helper phage. Packaged phagemids expressing a protein or peptide of interest, in fusion with a phage coat protein such as g3p, are generated simply by transfecting phagemid into the packaging cell line.

  6. A Rebeccamycin Analog Provides Plasmid-Encoded Niche Defense.

    Science.gov (United States)

    Van Arnam, Ethan B; Ruzzini, Antonio C; Sit, Clarissa S; Currie, Cameron R; Clardy, Jon

    2015-11-18

    Bacterial symbionts of fungus-growing ants occupy a highly specialized ecological niche and face the constant existential threat of displacement by another strain of ant-adapted bacteria. As part of a systematic study of the small molecules underlying this fraternal competition, we discovered an analog of the antitumor agent rebeccamycin, a member of the increasingly important indolocarbazole family. While several gene clusters consistent with this molecule's newly reported modification had previously been identified in metagenomic studies, the metabolite itself has been cryptic. The biosynthetic gene cluster for 9-methoxyrebeccamycin is encoded on a plasmid in a manner reminiscent of plasmid-derived peptide antimicrobials that commonly mediate antagonism among closely related Gram-negative bacteria.

  7. Dataset of plasmid DNA extraction using different magnetic nanoparticles (MNPs

    Directory of Open Access Journals (Sweden)

    H. Rahnama

    2016-12-01

    MNPs were characterized by energy dispersive spectroscopy (EDS and transmission electron microscopy (TEM. Finally, the overall efficiency of different MNPs (Fe3O4, Fe3O4/SiO2, Fe3O4/SiO2/TiO2 in plasmid DNA isolation was compared using gel electrophoresis analysis. The data supplied in this article supports the accompanying publication “Comparative study of three magnetic nano-particles (FeSO4, FeSO4/SiO2, FeSO4/SiO2/TiO2 in plasmid DNA extraction” (H. Rahnama, A. Sattarzadeh, F. Kazemi, N. Ahmadi, F. Sanjarian, Z. Zand, 2016 [1].

  8. Liquid-Crystalline Mesophases of Plasmid DNA in Bacteria

    Science.gov (United States)

    Reich, Ziv; Wachtel, Ellen J.; Minsky, Abraham

    1994-06-01

    Bacterial plasmids may often reach a copy number larger than 1000 per cell, corresponding to a total amount of DNA that may exceed the amount of DNA within the bacterial chromosome. This observation highlights the problem of cellular accommodation of large amounts of closed-circular nucleic acids, whose interwound conformation offers negligible DNA compaction. As determined by x-ray scattering experiments conducted on intact bacteria, supercoiled plasmids segregate within the cells into dense clusters characterized by a long-range order. In vitro studies performed at physiological DNA concentrations indicated that interwound DNA spontaneously forms liquid crystalline phases whose macroscopic structural properties are determined by the features of the molecular supercoiling. Because these features respond to cellular factors, DNA supercoiling may provide a sensitive regulatory link between cellular parameters and the packaging modes of interwound DNA in vivo.

  9. Current trends in separation of plasmid DNA vaccines: a review.

    Science.gov (United States)

    Ghanem, Ashraf; Healey, Robert; Adly, Frady G

    2013-01-14

    Plasmid DNA (pDNA)-based vaccines offer more rapid avenues for development and production if compared to those of conventional virus-based vaccines. They do not rely on time- or labour-intensive cell culture processes and allow greater flexibility in shipping and storage. Stimulating antibodies and cell-mediated components of the immune system are considered as some of the major advantages associated with the use of pDNA vaccines. This review summarizes the current trends in the purification of pDNA vaccines for practical and analytical applications. Special attention is paid to chromatographic techniques aimed at reducing the steps of final purification, post primary isolation and intermediate recovery, in order to reduce the number of steps necessary to reach a purified end product from the crude plasmid.

  10. Characterization of two novel plasmids from Geobacillus sp. 610 and 1121 strains.

    Science.gov (United States)

    Kananavičiūtė, Rūta; Butaitė, Elena; Citavičius, Donaldas

    2014-01-01

    We describe two cryptic low molecular weight plasmids, pGTD7 (3279bp) and pGTG5 (1540bp), isolated from Geobacillus sp. 610 and 1121 strains, respectively. Homology analysis of the replication protein (Rep) sequences and detection of ssDNA indicate that both of them replicate via rolling circle mechanism. As revealed by sequence similarities of dso region and Rep protein, plasmid pGTD7 belongs to pC194/pUB110 plasmid family. The replicon of pGTD7 was proved to be functional in another Geobacillus host. For this purpose, a construct pUCK7, containing a replicon of the analyzed plasmid, was created and transferred to G. stearothermophilus NUB3621R strain by electroporation. Plasmid pGTG5, based on Rep protein sequence similarity, was found to be related mostly to some poorly characterized bacterial plasmids. Rep proteins encoded by these plasmids contain conservative motifs that are most similar to those of Microviridae phages. This feature suggests that pGTG5, together with other plasmids containing the same motifs, could constitute a new family of bacterial plasmids. To date, pGTG5 is the smallest plasmid identified in bacteria belonging to the genus Geobacillus. The two plasmids described in this study can be used for the construction of new vectors suitable for biotechnologically important bacteria of the genus Geobacillus.

  11. Presence and analysis of plasmids in human and animal associated arcobacter species.

    Science.gov (United States)

    Douidah, Laid; De Zutter, Lieven; Van Nieuwerburgh, Filip; Deforce, Dieter; Ingmer, Hanne; Vandenberg, Olivier; Van den Abeele, Anne-Marie; Houf, Kurt

    2014-01-01

    In this study, we report the screening of four Arcobacter species for the presence of small and large plasmids. Plasmids were present in 9.9% of the 273 examined strains. One Arcobacter cryaerophilus and four Arcobacter butzleri plasmids were selected for further sequencing. The size of three small plasmids isolated from A. butzleri and the one from A. cryaerophilus strains ranged between 4.8 and 5.1 kb, and the size of the large plasmid, isolated from A. butzleri, was 27.4 kbp. The G+C content of all plasmids ranged between 25.4% and 26.2%. A total of 95% of the large plasmid sequence represents coding information, which contrasts to the 20 to 30% for the small plasmids. Some of the open reading frames showed a high homology to putative conserved domains found in other related organisms, such as replication, mobilization and genes involved in type IV secretion system. The large plasmid carried 35 coding sequences, including seven genes in a contiguous region of 11.6 kbp that encodes an orthologous type IV secretion system found in the Wolinella succinogenes genome, Helicobacter pylori and Campylobacter jejuni plasmids, which makes this plasmid interesting for further exploration.

  12. Presence and analysis of plasmids in human and animal associated arcobacter species.

    Directory of Open Access Journals (Sweden)

    Laid Douidah

    Full Text Available In this study, we report the screening of four Arcobacter species for the presence of small and large plasmids. Plasmids were present in 9.9% of the 273 examined strains. One Arcobacter cryaerophilus and four Arcobacter butzleri plasmids were selected for further sequencing. The size of three small plasmids isolated from A. butzleri and the one from A. cryaerophilus strains ranged between 4.8 and 5.1 kb, and the size of the large plasmid, isolated from A. butzleri, was 27.4 kbp. The G+C content of all plasmids ranged between 25.4% and 26.2%. A total of 95% of the large plasmid sequence represents coding information, which contrasts to the 20 to 30% for the small plasmids. Some of the open reading frames showed a high homology to putative conserved domains found in other related organisms, such as replication, mobilization and genes involved in type IV secretion system. The large plasmid carried 35 coding sequences, including seven genes in a contiguous region of 11.6 kbp that encodes an orthologous type IV secretion system found in the Wolinella succinogenes genome, Helicobacter pylori and Campylobacter jejuni plasmids, which makes this plasmid interesting for further exploration.

  13. Efficient transformation of Bacillus thuringiensis requires nonmethylated plasmid DNA.

    OpenAIRE

    Macaluso, A; Mettus, A M

    1991-01-01

    The transformation efficiency of Bacillus thuringiensis depends upon the source of plasmid DNA. DNA isolated from B. thuringiensis, Bacillus megaterium, or a Dam- Dcm- Escherichia coli strain efficiently transformed several B. thuringiensis strains, B. thuringiensis strains were grouped according to which B. thuringiensis backgrounds were suitable sources of DNA for transformation of other B. thuringiensis strains, suggesting that B. thuringiensis strains differ in DNA modification and restri...

  14. Plasmid Isolation in Legionella pneumophila and Legionella-like Organisms.

    Science.gov (United States)

    1980-08-22

    834. 14. Macrina, F. L., D. J. Kopecko, K. R. Jones, D. J. Ayers, and S. M. McCowen. 1978. A multiple plasmic-containing Escherichi coli strain...smaller 20 Mdal cryptic plasmid and was used as a control marker with the screening procedure. Escherichia coli V517 was supplied by E. M. Lederberg...Tris-borate buffer. This purified preparation was suitable for electrophoresis. Molecular weight estimates. Escherichia coli V517 was employed as an

  15. Cloning of 1183 bp Fragment from Rhoptry Protein I (ROPI Gene of Toxoplasma gondii (RH in Expression Prokaryote Plasmid PET32a

    Directory of Open Access Journals (Sweden)

    Zahra Eslamirad

    2013-10-01

    Full Text Available Background: Toxoplasma gondii is an obligatory intracellular protozoan. Considering to high prevalence of this disease the best way to reduce the raised loses is prevention of human and animal infection, rapid diagnosis, differentiation between acute and chronic disease. Rhoptry protein 1 of Toxoplasma gondii is an excretory-secretory antigen that exists in the most stages of life cycle. According to specifications of excretory-secretory antigen that seems this antigen is a suitable candidate to produce recombinant vaccine and diagnostic kit. The main object of the present work was cloning rhoptry protein 1 (ROP1 gene of Toxoplasma gondii (RH in a cloning vector for further production of rhoptry proteins.Materials and Methods: Genomic DNA was extracted by phenol-chloroform method. The ROP1 fragment was amplified by PCR. This product was approved by sequencing and was cloned between the EcoR1 and Sal1 sites of the pTZ57R/T vector. Then transformed into Escherichia coli DH5α strain and screened by IPTG and X-Gal. After isolating of this gene from pTZ57R/T, it was subcloned into pET32a plasmid.Results: The plasmid was purified and approved by electrophoresis, enzyme restriction and PCR. After isolating of this gene from pTZ57R/T, it was subcloned into pET32a plasmid. After enzyme restriction and electrophoresis a fragment about 1183bp was separated from pET32a.Conclusion: Recombinant plasmid of ROP1 gene was constructed and ready for future study. That seems the antigen is a suitable candidate to produce recombinant vaccine and diagnostic kit.

  16. 莱姆病螺旋体重组质粒pBX1的DNA序列分析及其在大肠杆菌中的诱导表达%DNA Sequence Analysis and Expression of the Recombinant Plasmid pBX1 from Borrelia Burgdorferi B31 Strain

    Institute of Scientific and Technical Information of China (English)

    谢勇恩; 鲍朗; 胡昌华; 李学敏; 陈炜

    2001-01-01

    目的为莱姆病血清学诊断和基因工程亚单位疫苗研制提供靶抗原。方法采用377型DNA自动测序仪对莱姆病螺旋体重组质粒pBX1的插入片段进行DNA序列测定,并通过计算机软件对其进行限制性内切酶酶谱分析。然后将重组质粒pBX1在大肠杆菌中进行诱导表达,并对其表达产物进行免疫印迹分析。结果①重组质粒pBX1插入片段大小为477bp,其核苷酸序列与文献报道的p83基因全序列相应区段相比较仅有一个碱基的变异,②成功绘制了该插入片段的限制性内切酶酶谱;③重组质粒在大肠杆菌中诱导表达后获得了29kd的融合蛋白;④Western-blotting分析表明该融合蛋白能与莱姆病多价抗血清呈强阳性印迹反应。结论该研究成功地对莱姆病螺旋体83kd抗原蛋白特异性区段进行了基因重组和表达,为进一步研究其在莱姆病血清学诊断和基因工程亚单位疫苗研制中的应用奠定了基础。%Objective This study was to provide the target antigen for the development of a Lyme disease vaccine and serodiagnosis reagent.Methods We used the automatic DNA sequencing machine (Model 377) to detect the nucleotide sequence of the inserted part of the recombinant plasmid pBX1 from Borrelia burgdorferi B31 strain. The restriction enzyme map of the inserted part of pBX1 was analysed by using computer software. The expressed product of pBX1 in E.coli XLI-Blue MRF′ was analysed by using SDS-PAGE and western-blotting. Results ①DNA sequencing showed that pBX1 contained a 477bp inserted gene fragment,and when it was compared with the published sequence of the specific region of the gene of the 83kd antigen protein from Borrelia burgdorferi B31 strain,only one amino acid codon was different.②The restriction enzyme map of the inserted part of pBX1 was successfully constructed.③The recombinant plasmid pBX1 expressed a 29kd fusion protein in E.coli XL1-Blue MRF

  17. Growth dependence of conjugation explains limited plasmid invasion in biofilms: an individual‐based modelling study

    DEFF Research Database (Denmark)

    Merkey, Brian; Lardon, Laurent; Seoane, Jose Miguel;

    2011-01-01

    . By extending an individual‐based model of microbial growth and interactions to include the dynamics of plasmid carriage and transfer by individual cells, we were able to conduct in silico tests of this and other hypotheses on the dynamics of conjugal plasmid transfer in biofilms. For a generic model plasmid...... and scan speed) and spatial reach (EPS yield, conjugal pilus length) are more important for successful plasmid invasion than the recipients' growth rate or the probability of segregational loss. While this study identifies one factor that can limit plasmid invasion in biofilms, the new individual......Plasmid invasion in biofilms is often surprisingly limited in spite of the close contact of cells in a biofilm. We hypothesized that this poor plasmid spread into deeper biofilm layers is caused by a dependence of conjugation on the growth rate (relative to the maximum growth rate) of the donor...

  18. Differences in the stability of the plasmids of Yersinia pestis cultures in vitro: impact on virulence

    Directory of Open Access Journals (Sweden)

    TC Leal-Balbino

    2004-11-01

    Full Text Available Plasmid and chromosomal genes encode determinants of virulence for Yersinia pestis, the causative agent of plague. However, in vitro, Y. pestis genome is very plastic and several changes have been described. To evaluate the alterations in the plasmid content of the cultures in vitro and the impact of the alterations to their pathogenicity, three Y. pestis isolates were submitted to serial subculture, analysis of the plasmid content, and testing for the presence of characteristic genes in each plasmid of colonies selected after subculture. Different results were obtained with each strain. The plasmid content of one of them was shown to be stable; no apparent alteration was produced through 32 subcultures. In the other two strains, several alterations were observed. LD50 in mice of the parental strains and the derived cultures with different plasmid content were compared. No changes in the virulence plasmid content could be specifically correlated with changes in the LD50.

  19. Scaling-up recombinant plasmid DNA for clinical trial: current concern, solution and status.

    Science.gov (United States)

    Ismail, Ruzila; Allaudin, Zeenathul Nazariah; Lila, Mohd-Azmi Mohd

    2012-09-07

    Gene therapy and vaccines are rapidly developing field in which recombinant nucleic acids are introduced in mammalian cells for enhancement, restoration, initiation or silencing biochemical function. Beside simplicity in manipulation and rapid manufacture process, plasmid DNA-based vaccines have inherent features that make them promising vaccine candidates in a variety of diseases. This present review focuses on the safety concern of the genetic elements of plasmid such as propagation and expression units as well as their host genome for the production of recombinant plasmid DNA. The highlighted issues will be beneficial in characterizing and manufacturing plasmid DNA for save clinical use. Manipulation of regulatory units of plasmid will have impact towards addressing the safety concerns raised in human vaccine applications. The gene revolution with plasmid DNA by alteration of their plasmid and production host genetics will be promising for safe delivery and obtaining efficient outcomes.

  20. Partition-associated incompatibility caused by random assortment of pure plasmid clusters

    DEFF Research Database (Denmark)

    Ebersbach, Gitte; Sherratt, David J; Gerdes, Kenn;

    2005-01-01

    Summary Bacterial plasmids and chromosomes encode centromere-like partition loci that actively segregate DNA before cell division. The molecular mechanism behind DNA segregation in bacteria is largely unknown. Here we analyse the mechanism of partition-associated incompatibility for plasmid pB171......-lived pairing of plasmids. Instead, pure R1 and F foci were positioned along the length of the cell, and in a random order. Thus, our results raise the possibility that partition-mediated plasmid incompatibility is not caused by pairing of heterologous plasmids but instead by random positioning of pure plasmid...... clusters along the long axis of the cell. The strength of the incompatibility was correlated with the capability of the plasmids to compete for the mid-cell position....

  1. An insight of traditional plasmid curing in Vibrio species

    Directory of Open Access Journals (Sweden)

    Vengadesh eLetchumanan

    2015-07-01

    Full Text Available As the causative agent of foodborne related illness, Vibrio species causes a huge impact on the public health and management. Vibrio species is often associated with seafood as the latter plays a role as a vehicle to transmit bacterial infections. Hence, antibiotics are used not to promote growth but rather to prevent and treat bacterial infections. The extensive use of antibiotics in the aquaculture industry and environment has led to the emerging of antibiotic resistant strains. This phenomenon has triggered an alarming public health concern due to the increase number of pathogenic Vibrio strains that are resistant to clinically used antibiotics and is found in the environment. Antibiotic resistance and the genes location in the strains can be detected through plasmid curing assay. The results derived from plasmid curing assay is fast, cost effective, sufficient in providing insights and influence the antibiotic management policies in the aquaculture industry. This presentation aims in discussing and providing insights on various curing agents in Vibrio species. To our best of knowledge, this is a first review written discussing on plasmid curing in Vibrio species.

  2. Map Projection

    CERN Document Server

    Ghaderpour, Ebrahim

    2014-01-01

    In this paper, we introduce some known map projections from a model of the Earth to a flat sheet of paper or map and derive the plotting equations for these projections. The first fundamental form and the Gaussian fundamental quantities are defined and applied to obtain the plotting equations and distortions in length, shape and size for some of these map projections.

  3. Competing ParA structures space bacterial plasmids equally over the nucleoid.

    Directory of Open Access Journals (Sweden)

    Robert Ietswaart

    2014-12-01

    Full Text Available Low copy number plasmids in bacteria require segregation for stable inheritance through cell division. This is often achieved by a parABC locus, comprising an ATPase ParA, DNA-binding protein ParB and a parC region, encoding ParB-binding sites. These minimal components space plasmids equally over the nucleoid, yet the underlying mechanism is not understood. Here we investigate a model where ParA-ATP can dynamically associate to the nucleoid and is hydrolyzed by plasmid-associated ParB, thereby creating nucleoid-bound, self-organizing ParA concentration gradients. We show mathematically that differences between competing ParA concentrations on either side of a plasmid can specify regular plasmid positioning. Such positioning can be achieved regardless of the exact mechanism of plasmid movement, including plasmid diffusion with ParA-mediated immobilization or directed plasmid motion induced by ParB/parC-stimulated ParA structure disassembly. However, we find experimentally that parABC from Escherichia coli plasmid pB171 increases plasmid mobility, inconsistent with diffusion/immobilization. Instead our observations favor directed plasmid motion. Our model predicts less oscillatory ParA dynamics than previously believed, a prediction we verify experimentally. We also show that ParA localization and plasmid positioning depend on the underlying nucleoid morphology, indicating that the chromosomal architecture constrains ParA structure formation. Our directed motion model unifies previously contradictory models for plasmid segregation and provides a robust mechanistic basis for self-organized plasmid spacing that may be widely applicable.

  4. Generalized logarithmic Gauss map and its relation to (co)amoebas

    CERN Document Server

    Madani, Farid

    2012-01-01

    We define the generalized logarithmic Gauss map for algebraic varieties of the complex algebraic torus of any codimension. Moreover, we describe the set of critical points of the logarithmic mapping restricted to our variety, and we show an analogous of Mikhalkin's result on the critical points of the logarithmic map restricted to a hypersurfaces.

  5. Spread of blaCTX-M-14 Is Driven Mainly by IncK Plasmids Disseminated among Escherichia coli Phylogroups A, B1, and D in Spain▿

    Science.gov (United States)

    Valverde, Aránzazu; Cantón, Rafael; Garcillán-Barcia, M. Pilar; Novais, Ângela; Galán, Juan Carlos; Alvarado, Andrés; de la Cruz, Fernando; Baquero, Fernando; Coque, Teresa M.

    2009-01-01

    Since its first description in 2000, CTX-M-14 has become one of the most widespread extended-spectrum β-lactamases in Spain. In the present Escherichia coli multilevel population genetic study involving the characterization of phylogroups, clones, plasmids, and genetic platforms, 61 isolates from 16 hospitalized patients and 40 outpatients and healthy volunteers recovered from 2000 to 2005 were analyzed. Clonal relatedness (XbaI pulsed-field gel electrophoresis [PFGE] type, phylogenetic group, multilocus sequence type [MLST]) was established by standard methods. Analysis of transferred plasmids (I-CeuI; S1 nuclease; restriction fragment length polymorphism analysis; and analysis of RNA interference, replicase, and relaxase) was performed by PCR, sequencing, and hybridization. The genetic environment of blaCTX-M-14 was characterized by PCR on the basis of known associated structures (ISEcp1, IS903, ISCR1). The isolates were mainly recovered from patients in the community (73.8%; 45/61) with urinary tract infections (62.2%; 28/45). They were clonally unrelated by PFGE and corresponded to phylogenetic groups A (36.1%), D (34.4%), and B1 (29.5%). MLST revealed a high degree of sequence type (ST) diversity among phylogroup D isolates and the overrepresentation of the ST10 complex among phylogroup A isolates and ST359/ST155 among phylogroup B1 isolates. Two variants of blaCTX-M-14 previously designated blaCTX-M-14a (n = 59/61) and blaCTX-M-14b (n = 2/61) were detected. blaCTX-M-14a was associated with either ISEcp1 within IncK plasmids (n = 27), ISCR1 linked to an IncHI2 plasmid (n = 1), or ISCR1 linked to IncI-like plasmids (n = 3). The blaCTX-M-14b identified was associated with an ISCR1 element located in an IncHI2 plasmid (n = 1) or with ISEcp1 located in IncK (n = 1). The CTX-M-14-producing E. coli isolates in our geographic area are frequent causes of community-acquired urinary tract infections. The increase in the incidence of such isolates is mostly due to the

  6. Mechanistic basis of plasmid-specific DNA binding of the F plasmid regulatory protein, TraM.

    Science.gov (United States)

    Peng, Yun; Lu, Jun; Wong, Joyce J W; Edwards, Ross A; Frost, Laura S; Mark Glover, J N

    2014-11-11

    The conjugative transfer of bacterial F plasmids relies on TraM, a plasmid-encoded protein that recognizes multiple DNA sites to recruit the plasmid to the conjugative pore. In spite of the high degree of amino acid sequence conservation between TraM proteins, many of these proteins have markedly different DNA binding specificities that ensure the selective recruitment of a plasmid to its cognate pore. Here we present the structure of F TraM RHH (ribbon-helix-helix) domain bound to its sbmA site. The structure indicates that a pair of TraM tetramers cooperatively binds an underwound sbmA site containing 12 base pairs per turn. The sbmA is composed of 4 copies of a 5-base-pair motif, each of which is recognized by an RHH domain. The structure reveals that a single conservative amino acid difference in the RHH β-ribbon between F and pED208 TraM changes its specificity for its cognate 5-base-pair sequence motif. Specificity is also dictated by the positioning of 2-base-pair spacer elements within sbmA; in F sbmA, the spacers are positioned between motifs 1 and 2 and between motifs 3 and 4, whereas in pED208 sbmA, there is a single spacer between motifs 2 and 3. We also demonstrate that a pair of F TraM tetramers can cooperatively bind its sbmC site with an affinity similar to that of sbmA in spite of a lack of sequence similarity between these DNA elements. These results provide a basis for the prediction of the DNA binding properties of the family of TraM proteins.

  7. Topographic mapping

    Science.gov (United States)

    ,

    2008-01-01

    The U.S. Geological Survey (USGS) produced its first topographic map in 1879, the same year it was established. Today, more than 100 years and millions of map copies later, topographic mapping is still a central activity for the USGS. The topographic map remains an indispensable tool for government, science, industry, and leisure. Much has changed since early topographers traveled the unsettled West and carefully plotted the first USGS maps by hand. Advances in survey techniques, instrumentation, and design and printing technologies, as well as the use of aerial photography and satellite data, have dramatically improved mapping coverage, accuracy, and efficiency. Yet cartography, the art and science of mapping, may never before have undergone change more profound than today.

  8. Construction of Eukaryotic Expression Plasmid of bFGF Gene in Rats and Its Expression in Tenocytes

    Institute of Scientific and Technical Information of China (English)

    FENG Yong; ZHENG Dong; YANG Shuhua; LI Jing

    2007-01-01

    The bFGF plays an important role in embryonic development of tendons and ligaments and in the healing of injuried tendons and ligaments. The eukaryotic expression plasmid of rat basic fibroblast growth factor (bFGF) gene was constructed in order to further investigate the bFGF function in molecular regulatory mechanism in the repair of tendons and ligaments and to provide the foundation for the clinical application. The cDNA fragments of bFGF were cloned from the skin of rats by RT-PCR, and recombinated to the pMD18-T vector. The cDNA encoding bFGF was cloned from the pMD18-T vector by RT-PCR, digested with restriction enzyme EcoR Ⅰ, Pst Ⅰ and bound to eukaryotic expression plasmid pIRES2-EGFP to construct eukaryotic expression plasmid pIRES2-EGFP-bFGF. The pIRES2-EGFP-bFGF was transfected into the tenocytes by lipid-mediated ransfection technique. MTT test was used to detect the biological activity of bFGF in supematants after the transfection. The expression of type Ⅰ and Ⅲ collagen genes was detected by using RT-PCR. It was verified that the pIRES2-EGFP-bFGF was successfully constructed, and its transfection into tenocytes could significantly enhance the biological activity of bFGF, and increase the expression of type Ⅰ and Ⅲ collagen mRNA, suggesting that pIRES2-EGFP-mediated bFGF gene therapy was beneficial to the repair of tendons and ligaments.

  9. Characterization of Multidrug-Resistant Escherichia coli by Plasmid Replicon Typing and Pulsed-Field Gel Electrophoresis

    Science.gov (United States)

    Background: Characterization of plasmids has particular clinical significance because genes encoding important traits such as antimicrobial resistance are frequently present in plasmids. Plasmid replicon typing is a multiplex PCR based method that can be used to classify 18 of the 26 known plasmid t...

  10. Revised selection criteria for candidate restriction enzymes in genome walking.

    Science.gov (United States)

    Taheri, Ali; Robinson, Stephen J; Parkin, Isobel; Gruber, Margaret Y

    2012-01-01

    A new method to improve the efficiency of flanking sequence identification by genome walking was developed based on an expanded, sequential list of criteria for selecting candidate enzymes, plus several other optimization steps. These criteria include: step (1) initially choosing the most appropriate restriction enzyme according to the average fragment size produced by each enzyme determined using in silico digestion of genomic DNA, step (2) evaluating the in silico frequency of fragment size distribution between individual chromosomes, step (3) selecting those enzymes that generate fragments with the majority between 100 bp and 3,000 bp, step (4) weighing the advantages and disadvantages of blunt-end sites vs. cohesive-end sites, step (5) elimination of methylation sensitive enzymes with methylation-insensitive isoschizomers, and step (6) elimination of enzymes with recognition sites within the binary vector sequence (T-DNA and plasmid backbone). Step (7) includes the selection of a second restriction enzyme with highest number of recognition sites within regions not covered by the first restriction enzyme. Step (8) considers primer and adapter sequence optimization, selecting the best adapter-primer pairs according to their hairpin/dimers and secondary structure. In step (9), the efficiency of genomic library development was improved by column-filtration of digested DNA to remove restriction enzyme and phosphatase enzyme, and most important, to remove small genomic fragments (enzymes, NsiI and NdeI, fit these criteria for the Arabidopsis thaliana genome. Their efficiency was assessed using 54 T(3) lines from an Arabidopsis SK enhancer population. Over 70% success rate was achieved in amplifying the flanking sequences of these lines. This strategy was also tested with Brachypodium distachyon to demonstrate its applicability to other larger genomes.

  11. Type 3 Fimbriae Encoded on Plasmids Are Expressed from a Unique Promoter without Affecting Host Motility, Facilitating an Exceptional Phenotype That Enhances Conjugal Plasmid Transfer

    Science.gov (United States)

    Madsen, Jonas Stenløkke; Riber, Leise; Kot, Witold; Basfeld, Alrun; Burmølle, Mette; Hansen, Lars Hestbjerg; Sørensen, Søren Johannes

    2016-01-01

    Horizontal gene transfer (HGT), the transmission of genetic material to a recipient that is not the progeny of the donor, is fundamental in bacterial evolution. HGT is often mediated by mobile genetic elements such as conjugative plasmids, which may be in conflict with the chromosomal elements of the genome because they are independent replicons that may petition their own evolutionary strategy. Here we study differences between type 3 fimbriae encoded on wild type plasmids and in chromosomes. Using known and newly characterized plasmids we show that the expression of type 3 fimbriae encoded on plasmids is systematically different, as MrkH, a c-di-GMP dependent transcriptional activator is not needed for strong expression of the fimbriae. MrkH is required for expression of type 3 fimbriae of the Klebsiella pneumoniae chromosome, wherefrom the fimbriae operon (mrkABCDF) of plasmids is believed to have originated. We find that mrkABCDFs of plasmids are highly expressed via a unique promoter that differs from the original Klebsiella promoter resulting in fundamental behavioral consequences. Plasmid associated mrkABCDFs did not influence the swimming behavior of the host, that hereby acquired an exceptional phenotype being able to both actively swim (planktonic behavior) and express biofilm associated fimbriae (sessile behavior). We show that this exceptional phenotype enhances the conjugal transfer of the plasmid. PMID:27627107

  12. Type 3 fimbriae encoded on plasmids are expressed from a unique promoter without affecting host motility, facilitating an exceptional phenotype that enhances conjugal plasmid transfer

    DEFF Research Database (Denmark)

    Madsen, Jonas Stenløkke; Riber, Leise; Kot, Witold Piotr;

    2016-01-01

    of the genome because they are independent replicons that may petition their own evolutionary strategy. Here we study differences between type 3 fimbriae encoded on wild type plasmids and in chromosomes. Using known and newly characterized plasmids we show that the expression of type 3 fimbriae encoded...

  13. Conjugative transferability of the A/C plasmids from Salmonella enterica isolates that possess or lack blaCMY in the A/C plasmid backbone

    Science.gov (United States)

    The objective of this study was to gain a better understanding of the conjugative transfer of antimicrobial resistance plasmids from 205 Salmonella enterica strains, isolated from cattle to E. coli or Salmonella recipients. PCR-based replicon typing (PBRT) was used to type incompatibility plasmid r...

  14. Expansion of a plasmid classification system for Gram-positive bacteria and determination of the diversity of plasmids in Staphylococcus aureus strains of human, animal, and food origins

    DEFF Research Database (Denmark)

    Lozano, C.; Garcia-Migura, L.; Aspiroz, C.

    2012-01-01

    An expansion of a previously described plasmid classification was performed and used to reveal the plasmid content of a collection of 92 Staphylococcus aureus strains of different origins. rep genes of other genera were detected in Staphylococcus. S1 pulsed-field gel electrophoresis (PFGE) hybrid...

  15. Analysis of plasmid diversity in 96 Rhodococcus equi strains isolated in Normandy (France) and sequencing of the 87-kb type I virulence plasmid.

    Science.gov (United States)

    Duquesne, Fabien; Hébert, Laurent; Sévin, Corinne; Breuil, Marie-France; Tapprest, Jackie; Laugier, Claire; Petry, Sandrine

    2010-10-01

    To characterize the potential epidemiological relationship between the origin of Rhodococcus equi strains and the type of their virulence plasmids, we performed a comparative analysis of virulence plasmid types encountered in 96 R. equi strains isolated from (1) autopsied horses, (2) organic samples (horse faeces, manure and straw) and (3) environmental samples. Our results revealed no clear epidemiological link between virulence plasmid type and the origin of R. equi strains isolated from horse-related environments. To understand this result, we determined the nucleotide sequence of the second most frequently isolated virulence plasmid type: a 87-kb type I (pVAPA116) plasmid and compared it with the previously sequenced (and most commonly encountered) 85-kb type I (pVAPA1037) plasmid. Our results show that the divergence between these two plasmids is mainly due to the presence of three allelic exchange loci, resulting in the deletion of two genes and the insertion of three genes in pVAPA116 compared with pVAPA1037. In conclusion, it appears that the divergence between the two sequenced rhodococcal virulence plasmids is not associated with the vap pathogenicity island and may result from an evolutionary process driven by a mobility-related invertase/resolvase invA-like gene. © 2010 ANSES. Journal compilation © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd.

  16. A Site-Specific Integrative Plasmid Found in Pseudomonas aeruginosa Clinical Isolate HS87 along with A Plasmid Carrying an Aminoglycoside-Resistant Gene.

    Directory of Open Access Journals (Sweden)

    Dexi Bi

    Full Text Available Plasmids play critical roles in bacterial fitness and evolution of Pseudomonas aeruginosa. Here two plasmids found in a drug-resistant P. aeruginosa clinical isolate HS87 were completely sequenced. The pHS87b plasmid (11.2 kb carries phage-related genes and function-unknown genes. Notably, pHS87b encodes an integrase and has an adjacent tRNAThr-associated attachment site. A corresponding integrated form of pHS87b at the tRNAThr locus was identified on the chromosome of P. aeruginosa, showing that pHS87b is able to site-specifically integrate into the 3'-end of the tRNAThr gene. The pHS87a plasmid (26.8 kb displays a plastic structure containing a putative replication module, stability factors and a variable region. The RepA of pHS87a shows significant similarity to the replication proteins of pPT23A-family plasmids. pHS87a carries a transposon Tn6049, a truncated insertion sequence ΔIS1071 and a Tn402-like class 1 integron which contains an aacA4 cassette that may confer aminoglycoside resistance. Thus, pHS87b is a site-specific integrative plasmid whereas pHS87a is a plastic antibiotic resistance plasmid. The two native plasmids may promote the fitness and evolution of P. aeruginosa.

  17. Remarks on restricted Nevanlinna transforms

    CERN Document Server

    Jankowski, Lech

    2010-01-01

    The Nevanlinna transform K(z), of a measure and a real constant, plays an important role in the complex analysis and more recently in the free probability theory (boolean convolution). It is shown that its restriction k(it) (the restricted Nevanlinna transform) to the imaginary axis can be expressed as the Laplace transform of the Fourier transform (characteristic function) of the corresponding measure. Finally, a relation between the Voiculescu and the boolean convolution is indicated.

  18. Insights into dynamics of mobile genetic elements in hyperthermophilic environments from five new Thermococcus plasmids.

    Directory of Open Access Journals (Sweden)

    Mart Krupovic

    Full Text Available Mobilome of hyperthermophilic archaea dwelling in deep-sea hydrothermal vents is poorly characterized. To gain insight into genetic diversity and dynamics of mobile genetic elements in these environments we have sequenced five new plasmids from different Thermococcus strains that have been isolated from geographically remote hydrothermal vents. The plasmids were ascribed to two subfamilies, pTN2-like and pEXT9a-like. Gene content and phylogenetic analyses illuminated a robust connection between pTN2-like plasmids and Pyrococcus abyssi virus 1 (PAV1, with roughly half of the viral genome being composed of genes that have homologues in plasmids. Unexpectedly, pEXT9a-like plasmids were found to be closely related to the previously sequenced plasmid pMETVU01 from Methanocaldococcus vulcanius M7. Our data suggests that the latter observation is most compatible with an unprecedented horizontal transfer of a pEXT9a-like plasmid from Thermococcales to Methanococcales. Gene content analysis revealed that thermococcal plasmids encode Hfq-like proteins and toxin-antitoxin (TA systems of two different families, VapBC and RelBE. Notably, although abundant in archaeal genomes, to our knowledge, TA and hfq-like genes have not been previously found in archaeal plasmids or viruses. Finally, the plasmids described here might prove to be useful in developing new genetic tools for hyperthermophiles.

  19. RK2 plasmid dynamics in Caulobacter crescentus cells--two modes of DNA replication initiation.

    Science.gov (United States)

    Wegrzyn, Katarzyna; Witosinska, Monika; Schweiger, Pawel; Bury, Katarzyna; Jenal, Urs; Konieczny, Igor

    2013-06-01

    Undisturbed plasmid dynamics is required for the stable maintenance of plasmid DNA in bacterial cells. In this work, we analysed subcellular localization, DNA synthesis and nucleoprotein complex formation of plasmid RK2 during the cell cycle of Caulobacter crescentus. Our microscopic observations showed asymmetrical distribution of plasmid RK2 foci between the two compartments of Caulobacter predivisional cells, resulting in asymmetrical allocation of plasmids to progeny cells. Moreover, using a quantitative PCR (qPCR) method, we estimated that multiple plasmid particles form a single fluorescent focus and that the number of plasmids per focus is approximately equal in both swarmer and predivisional Caulobacter cells. Analysis of the dynamics of TrfA-oriV complex formation during the Caulobacter cell cycle revealed that TrfA binds oriV primarily during the G1 phase, however, plasmid DNA synthesis occurs during the S and G2 phases of the Caulobacter cell cycle. Both in vitro and in vivo analysis of RK2 replication initiation in C. crescentus cells demonstrated that it is independent of the Caulobacter DnaA protein in the presence of the longer version of TrfA protein, TrfA-44. However, in vivo stability tests of plasmid RK2 derivatives suggested that a DnaA-dependent mode of plasmid replication initiation is also possible.

  20. Polar Fixation of Plasmids during Recombinant Protein Production in Bacillus megaterium Results in Population Heterogeneity.

    Science.gov (United States)

    Münch, Karin M; Müller, Johannes; Wienecke, Sarah; Bergmann, Simone; Heyber, Steffi; Biedendieck, Rebekka; Münch, Richard; Jahn, Dieter

    2015-09-01

    During the past 2 decades, Bacillus megaterium has been systematically developed for the gram-per-liter scale production of recombinant proteins. The plasmid-based expression systems employed use a xylose-controlled promoter. Protein production analyses at the single-cell level using green fluorescent protein as a model product revealed cell culture heterogeneity characterized by a significant proportion of less productive bacteria. Due to the enormous size of B. megaterium, such bistable behavior seen in subpopulations was readily analyzed by time lapse microscopy and flow cytometry. Cell culture heterogeneity was not caused simply by plasmid loss: instead, an asymmetric distribution of plasmids during cell division was detected during the exponential-growth phase. Multicopy plasmids are generally randomly distributed between daughter cells. However, in vivo and in vitro experiments demonstrated that under conditions of strong protein production, plasmids are retained at one of the cell poles. Furthermore, it was found that cells with accumulated plasmids and high protein production ceased cell division. As a consequence, the overall protein production of the culture was achieved mainly by the subpopulation with a sufficient plasmid copy number. Based on our experimental data, we propose a model whereby the distribution of multicopy plasmids is controlled by polar fixation under protein production conditions. Thereby, cell lines with fluctuating plasmid abundance arise, which results in population heterogeneity. Our results provide initial insights into the mechanism of cellular heterogeneity during plasmid-based recombinant protein production in a Bacillus species.

  1. Insights into dynamics of mobile genetic elements in hyperthermophilic environments from five new Thermococcus plasmids.

    Science.gov (United States)

    Krupovic, Mart; Gonnet, Mathieu; Hania, Wajdi Ben; Forterre, Patrick; Erauso, Gaël

    2013-01-01

    Mobilome of hyperthermophilic archaea dwelling in deep-sea hydrothermal vents is poorly characterized. To gain insight into genetic diversity and dynamics of mobile genetic elements in these environments we have sequenced five new plasmids from different Thermococcus strains that have been isolated from geographically remote hydrothermal vents. The plasmids were ascribed to two subfamilies, pTN2-like and pEXT9a-like. Gene content and phylogenetic analyses illuminated a robust connection between pTN2-like plasmids and Pyrococcus abyssi virus 1 (PAV1), with roughly half of the viral genome being composed of genes that have homologues in plasmids. Unexpectedly, pEXT9a-like plasmids were found to be closely related to the previously sequenced plasmid pMETVU01 from Methanocaldococcus vulcanius M7. Our data suggests that the latter observation is most compatible with an unprecedented horizontal transfer of a pEXT9a-like plasmid from Thermococcales to Methanococcales. Gene content analysis revealed that thermococcal plasmids encode Hfq-like proteins and toxin-antitoxin (TA) systems of two different families, VapBC and RelBE. Notably, although abundant in archaeal genomes, to our knowledge, TA and hfq-like genes have not been previously found in archaeal plasmids or viruses. Finally, the plasmids described here might prove to be useful in developing new genetic tools for hyperthermophiles.

  2. Exploring Antibiotic Resistance Genes and Metal Resistance Genes in Plasmid Metagenomes from Wastewater Treatment Plants

    Directory of Open Access Journals (Sweden)

    An-Dong eLi

    2015-09-01

    Full Text Available Plasmids operate as independent genetic elements in microorganism communities. Through horizontal gene transfer, they can provide their host microorganisms with important functions such as antibiotic resistance and heavy metal resistance. In this study, six metagenomic libraries were constructed with plasmid DNA extracted from influent, activated sludge and digested sludge of two wastewater treatment plants. Compared with the metagenomes of the total DNA extracted from the same sectors of the wastewater treatment plant, the plasmid metagenomes had significantly higher annotation rates, indicating that the functional genes on plasmids are commonly shared by those studied microorganisms. Meanwhile, the plasmid metagenomes also encoded many more genes related to defense mechanisms, including ARGs. Searching against an antibiotic resistance genes (ARGs database and a metal resistance genes (MRGs database revealed a broad-spectrum of antibiotic (323 out of a total 618 subtypes and metal resistance genes (23 out of a total 23 types on these plasmid metagenomes. The influent plasmid metagenomes contained many more resistance genes (both ARGs and MRGs than the activated sludge and the digested sludge metagenomes. Sixteen novel plasmids with a complete circular structure that carried these resistance genes were assembled from the plasmid metagenomes. The results of this study demonstrated that the plasmids in wastewater treatment plants could be important reservoirs for resistance genes, and may play a significant role in the horizontal transfer of these genes.

  3. Exploring antibiotic resistance genes and metal resistance genes in plasmid metagenomes from wastewater treatment plants.

    Science.gov (United States)

    Li, An-Dong; Li, Li-Guan; Zhang, Tong

    2015-01-01

    Plasmids operate as independent genetic elements in microorganism communities. Through horizontal gene transfer (HGT), they can provide their host microorganisms with important functions such as antibiotic resistance and heavy metal resistance. In this study, six metagenomic libraries were constructed with plasmid DNA extracted from influent, activated sludge (AS) and digested sludge (DS) of two wastewater treatment plants (WWTPs). Compared with the metagenomes of the total DNA extracted from the same sectors of the wastewater treatment plant, the plasmid metagenomes had significantly higher annotation rates, indicating that the functional genes on plasmids are commonly shared by those studied microorganisms. Meanwhile, the plasmid metagenomes also encoded many more genes related to defense mechanisms, including ARGs. Searching against an antibiotic resistance genes (ARGs) database and a metal resistance genes (MRGs) database revealed a broad-spectrum of antibiotic (323 out of a total 618 subtypes) and MRGs (23 out of a total 23 types) on these plasmid metagenomes. The influent plasmid metagenomes contained many more resistance genes (both ARGs and MRGs) than the AS and the DS metagenomes. Sixteen novel plasmids with a complete circular structure that carried these resistance genes were assembled from the plasmid metagenomes. The results of this study demonstrated that the plasmids in WWTPs could be important reservoirs for resistance genes, and may play a significant role in the horizontal transfer of these genes.

  4. Comparative genomics of the IncA/C multidrug resistance plasmid family.

    Science.gov (United States)

    Fricke, W Florian; Welch, Timothy J; McDermott, Patrick F; Mammel, Mark K; LeClerc, J Eugene; White, David G; Cebula, Thomas A; Ravel, Jacques

    2009-08-01

    Multidrug resistance (MDR) plasmids belonging to the IncA/C plasmid family are widely distributed among Salmonella and other enterobacterial isolates from agricultural sources and have, at least once, also been identified in a drug-resistant Yersinia pestis isolate (IP275) from Madagascar. Here, we present the complete plasmid sequences of the IncA/C reference plasmid pRA1 (143,963 bp), isolated in 1971 from the fish pathogen Aeromonas hydrophila, and of the cryptic IncA/C plasmid pRAx (49,763 bp), isolated from Escherichia coli transconjugant D7-3, which was obtained through pRA1 transfer in 1980. Using comparative sequence analysis of pRA1 and pRAx with recent members of the IncA/C plasmid family, we show that both plasmids provide novel insights into the evolution of the IncA/C MDR plasmid family and the minimal machinery necessary for stable IncA/C plasmid maintenance. Our results indicate that recent members of the IncA/C plasmid family evolved from a common ancestor, similar in composition to pRA1, through stepwise integration of horizontally acquired resistance gene arrays into a conserved plasmid backbone. Phylogenetic comparisons predict type IV secretion-like conjugative transfer operons encoded on the shared plasmid backbones to be closely related to a group of integrating conjugative elements, which use conjugative transfer for horizontal propagation but stably integrate into the host chromosome during vegetative growth. A hipAB toxin-antitoxin gene cluster found on pRA1, which in Escherichia coli is involved in the formation of persister cell subpopulations, suggests persistence as an early broad-spectrum antimicrobial resistance mechanism in the evolution of IncA/C resistance plasmids.

  5. Plasmids of the pRM/pRF family occur in diverse Rickettsia species.

    Science.gov (United States)

    Baldridge, Gerald D; Burkhardt, Nicole Y; Felsheim, Roderick F; Kurtti, Timothy J; Munderloh, Ulrike G

    2008-02-01

    The recent discoveries of the pRF and pRM plasmids of Rickettsia felis and R. monacensis have contravened the long-held dogma that plasmids are not present in the bacterial genus Rickettsia (Rickettsiales; Rickettsiaceae). We report the existence of plasmids in R. helvetica, R. peacockii, R. amblyommii, and R. massiliae isolates from ixodid ticks and in an R. hoogstraalii isolate from an argasid tick. R. peacockii and four isolates of R. amblyommii from widely separated geographic locations contained plasmids that comigrated with pRM during pulsed-field gel electrophoresis and larger plasmids with mobilities similar to that of pRF. The R. peacockii plasmids were lost during long-term serial passage in cultured cells. R. montanensis did not contain a plasmid. Southern blots showed that sequences similar to those of a DnaA-like replication initiator protein, a small heat shock protein 2, and the Sca12 cell surface antigen genes on pRM and pRF were present on all of the plasmids except for that of R. massiliae, which lacked the heat shock gene and was the smallest of the plasmids. The R. hoogstraalii plasmid was most similar to pRM and contained apparent homologs of proline/betaine transporter and SpoT stringent response genes on pRM and pRF that were absent from the other plasmids. The R. hoogstraalii, R. helvetica, and R. amblyommii plasmids contained homologs of a pRM-carried gene similar to a Nitrobacter sp. helicase RecD/TraA gene, but none of the plasmids hybridized with a probe derived from a pRM-encoded gene similar to a Burkholderia sp. transposon resolvase gene.

  6. Dual-Replicon Plasmids for Elimination of Resistant Plasmids%双复制子质粒消除耐药质粒的研究

    Institute of Scientific and Technical Information of China (English)

    莫冰; 余克花; 黎帆; 李蓉; 宋矿余

    2014-01-01

    Objective To observe the eliminating effect of dual-replicon plasmids on resistant plasmids.Methods The dual-replicon plasmids pKT230-oriV were constructed and transferred into bacteria with resistant plasmids pRK290 through the transformation and conjugational trans-fer pathways.The eliminating effect of dual-replicon plasmids on resistant plasmids was ob-served.Results The bacteria were cultured for 5 generations after the transfer of dual-replicon plasmids,and resistant plasmids pRK290 in bacteria were eliminated.Conclusion The conjuga-tional transfer of dual-replicon plasmids is a pathway to eliminate resistant plasmids.%目的:观察双复制子质粒对耐药质粒的消除作用。方法构建双复制子质粒 pKT230-oriV,并通过转化或接合转移途径转入带有 pRK290质粒的细菌中,观察双复制子质粒对耐药质粒的消除作用。结果转入双复制子质粒菌培养5代后,细菌中的 pRK290耐药质粒被消除。结论双复制子利用接合转移途径是消除耐药质粒的一个途径。

  7. Physical mapping of the Escherichia coli D-serine deaminase region: contiguity of the dsd structural and regulatory genes.

    OpenAIRE

    Carothers, A M; McFall, E; Palchaudhuri, S

    1980-01-01

    The genes dsdA, dsdO, and dsdC have been located on a 3.0-kilobase pair (kb) fragment of the Escherichia coli chromosome by a combination of techniques. The loci were first cloned onto lambda and various plasmid vectors. dsd hybrid plasmids were then digested with restriction enzymes, and the fragments were recloned to test for the presence of dsdC or dsdA. In one case, a 4.2-kb restriction fragment containing the dsdA operon was used to form a heteroduplex with a well-defined lambda dsd deox...

  8. A restriction-free method for gene reconstitution using two single-primer PCRs in parallel to generate compatible cohesive ends.

    Science.gov (United States)

    Zeng, Fanli; Hao, Zhimin; Li, Pan; Meng, Yanan; Dong, Jingao; Lin, Yibin

    2017-03-17

    Restriction-free (RF) cloning, a PCR-based method for the creation of custom DNA plasmids, allows for the insertion of any sequence into any plasmid vector at any desired position, independent of restriction sites and/or ligation. Here, we describe a simple and fast method for performing gene reconstitution by modified RF cloning. Double-stranded inserts and acceptors were first amplified by regular PCR. The amplified fragments were then used as the templates in two separate linear amplification reactions containing either forward or reverse primer to generate two single-strand reverse-complement counterparts, which could anneal to each other. The annealed inserts and acceptors with 5' and 3' cohesive ends were sealed by ligation reaction. Using this method, we made 46 constructs containing insertions of up to 20 kb. The average cloning efficiency was higher than 85%, as confirmed by colony PCR and sequencing of the inserts. Our method provides an alternative cloning method capable of inserting any DNA fragment of up to at least 20 kb into a plasmid, with high efficiency. This new method does not require restriction sites or alterations of the plasmid or the gene of interest, or additional treatments. The simplicity of both primer design and the procedure itself makes the method suitable for high-throughput cloning and structural genomics.

  9. Plasmid DNA Supercoiling and Gyrase Activity in Escherichia coli Wild-Type and rpoS Stationary-Phase Cells

    Science.gov (United States)

    Reyes-Domínguez, Yazmid; Contreras-Ferrat, Gabriel; Ramírez-Santos, Jesús; Membrillo-Hernández, Jorge; Gómez-Eichelmann, M. Carmen

    2003-01-01

    Stationary-phase cells displayed a distribution of relaxed plasmids and had the ability to recover plasmid supercoiling as soon as nutrients became available. Preexisting gyrase molecules in these cells were responsible for this recovery. Stationary-phase rpoS cells showed a bimodal distribution of plasmids and failed to supercoil plasmids after the addition of nutrients, suggesting that rpoS plays a role in the regulation of plasmid topology during the stationary phase. PMID:12533486

  10. Mapping the Gendered City

    DEFF Research Database (Denmark)

    Almahmood, Mohammed Abdulrahman M; Scharnhorst, Eric; Carstensen, Trine Agervig;

    2017-01-01

    Walking is a mode of perceiving the city which also contributes to health and social benefits. This paper studies the influence of the socio-cultural aspects on the practice of walking and the meaning of walkscapes in Riyadh, one of the most auto-dependent and gender-segregated cities on the Arab...... Peninsula, where socio-cultural values and restrictions regulate men and women’s use and access to public spaces. The methodology used is a combination of movement tracking data using GPS technology and map-based workshops where participants can reflect on their walking behaviour and spatial preferences....... The results of mapping where the respondents walk show a city consisting of gender-specific walkscapes. Indoor environments, such as shopping malls, function as ‘urban shelters’ for women, so they use such spaces for walking. On the other hand, young men mainly walk in urban streets, which provide greater...

  11. Generalized gamut mapping using image derivative structures for color constancy

    NARCIS (Netherlands)

    Gijsenij, A.; Gevers, T.; van de Weijer, J.

    2010-01-01

    The gamut mapping algorithm is one of the most promising methods to achieve computational color constancy. However, so far, gamut mapping algorithms are restricted to the use of pixel values to estimate the illuminant. Therefore, in this paper, gamut mapping is extended to incorporate the statistica

  12. The EcoKI Type I Restriction-Modification System in Escherichia coli Affects but Is Not an Absolute Barrier for Conjugation

    DEFF Research Database (Denmark)

    Roer, Louise; Aarestrup, Frank Møller; Hasman, Henrik

    2015-01-01

    results about restriction-modification systems based on phenotypic studies have been presented as reasons for a barrier to conjugation with and other means of uptake of exogenous DNA. In this study, we show that inactivation of the R.EcoKI restriction enzyme in strain Escherichia coli K-12 strain MG1655...... of the mutant recipient with a disrupted hsdR gene. This leads to the conclusion that EcoKI restriction-modification affects the uptake of DNA by conjugation but is not a major barrier to plasmid transfer....

  13. Mapping Deeply

    OpenAIRE

    Denis Wood

    2015-01-01

    This is a description of an avant la lettre deep mapping project carried out by a geographer and a number of landscape architecture students in the early 1980s. Although humanists seem to take the “mapping” in deep mapping more metaphorically than cartographically, in this neighborhood mapping project, the mapmaking was taken literally, with the goal of producing an atlas of the neighborhood. In this, the neighborhood was construed as a transformer, turning the stuff of the world (gas, wate...

  14. Intracerebral metastasis showing restricted diffusion: Correlation with histopathologic findings

    Energy Technology Data Exchange (ETDEWEB)

    Duygulu, G. [Radiology Department, Ege University Medicine School, Izmir (Turkey); Ovali, G. Yilmaz [Radiology Department, Celal Bayar University Medicine School, Manisa (Turkey)], E-mail: gulgun.yilmaz@bayar.edu.tr; Calli, C.; Kitis, O.; Yuenten, N. [Radiology Department, Ege University Medicine School, Izmir (Turkey); Akalin, T. [Pathology Department, Ege University Medicine School, Izmir (Turkey); Islekel, S. [Neurosurgery Department, Ege University Medicine School, Izmir (Turkey)

    2010-04-15

    Objective: We aimed to detect the frequency of restricted diffusion in intracerebral metastases and to find whether there is correlation between the primary tumor pathology and diffusion-weighted MR imaging (DWI) findings of these metastases. Material and methods: 87 patients with intracerebral metastases were examined with routine MR imaging and DWI. 11 hemorrhagic metastatic lesions were excluded. The routine MR imaging included three plans before and after contrast enhancement. The DWI was performed with spin-echo EPI sequence with three b values (0, 500 and 1000), and ADC maps were calculated. 76 patients with metastases were grouped according to primary tumor histology and the ratios of restricted diffusion were calculated according to these groups. ADCmin values were measured within the solid components of the tumors and the ratio of metastases with restricted diffusion to that which do not show restricted diffusion were calculated. Fisher's exact and Mann-Whitney U tests were used for the statistical analysis. Results: Restricted diffusion was observed in a total of 15 metastatic lesions (19, 7%). Primary malignancy was lung carcinoma in 10 of these cases (66, 6%) (5 small cell carcinoma, 5 non-small cell carcinoma), and breast carcinoma in three cases (20%). Colon carcinoma and testicular teratocarcinoma were the other two primary tumors in which restricted diffusion in metastasis was detected. There was no statistical significant difference between the primary pathology groups which showed restricted diffusion (p > 0.05). ADCmin values of solid components of the metastasis with restricted diffusion and other metastasis without restricted diffusion also showed no significant statistical difference (0.72 {+-} 0.16 x 10{sup -3} mm{sup 2}/s and 0.78 {+-} 21 x 10{sup -3} mm{sup 2}/s respectively) (p = 0.325). Conclusion: Detection of restricted diffusion on DWI in intracerebral metastasis is not rare, particularly if the primary tumor is lung or breast

  15. Multiple drug resistant carbapenemases producing Acinetobacter baumannii isolates harbours multiple R-plasmids

    Directory of Open Access Journals (Sweden)

    Rajagopalan Saranathan

    2014-01-01

    Full Text Available Background & objectives: The nosocomial human pathogen Acinetobacter baumannii has high propensity to develop resistance to antimicrobials and to become multidrug resistant (MDR, consequently complicating the treatment. This study was carried out to investigate the presence of resistant plasmids (R-plasmids among the clinical isolates of A. baumannii. In addition, the study was performed to check the presence of common β-lactamases encoding genes on these plasmids. Methods: A total of 55 clinical isolates of A. baumannii were included in the study and all were subjected to plasmid DNA isolation, followed by PCR to check the presence of resistance gene determinants such as blaOXA-23 , blaOXA-51, blaOXA-58 and blaIMP-1 on these plasmids that encode for oxacillinase (OXA and metallo-β-lactamase (MBL type of carbapenemases. Plasmid curing experiments were carried out on selected isolates using ethidium bromide and acridine orange as curing agents and the antibiotic resistance profiles were evaluated before and after curing. Results: All the isolates were identified as A. baumannii by 16SrDNA amplification and sequencing. Plasmid DNA isolated from these isolates showed the occurrence of multiple plasmids with size ranging from 500bp to ≥ 25 kb. The percentage of blaOXA-51 and blaOXA-23 on plasmids were found to be 78 and 42 per cent, respectively and 20 isolates (36% carried blaIMP-1 gene on plasmids. Significant difference was observed in the antibiograms of plasmid cured isolates when compared to their parental ones. The clinical isolates became susceptible to more than two antibiotic classes after curing of plasmids indicating plasmid borne resistance. Interpretation & conclusions: Our study determined the plasmid mediated resistance mechanisms and occurrence of different resistance genes on various plasmids isolated from MDR A. baumannii. The present findings showed the evidence for antibiotic resistance mediated through multiple plasmids in

  16. Polynomial mappings

    CERN Document Server

    Narkiewicz, Wŀadysŀaw

    1995-01-01

    The book deals with certain algebraic and arithmetical questions concerning polynomial mappings in one or several variables. Algebraic properties of the ring Int(R) of polynomials mapping a given ring R into itself are presented in the first part, starting with classical results of Polya, Ostrowski and Skolem. The second part deals with fully invariant sets of polynomial mappings F in one or several variables, i.e. sets X satisfying F(X)=X . This includes in particular a study of cyclic points of such mappings in the case of rings of algebrai integers. The text contains several exercises and a list of open problems.

  17. Participatory Maps

    DEFF Research Database (Denmark)

    Salovaara-Moring, Inka

    2016-01-01

    practice. In particular, mapping environmental damage, endangered species, and human-made disasters has become one focal point for environmental knowledge production. This type of digital map has been highlighted as a processual turn in critical cartography, whereas in related computational journalism...... of a geo-visualization within information mapping that enhances embodiment in the experience of the information. InfoAmazonia is defined as a digitally created map-space within which journalistic practice can be seen as dynamic, performative interactions between journalists, ecosystems, space, and species...

  18. Genetics Home Reference: familial restrictive cardiomyopathy

    Science.gov (United States)

    ... Home Health Conditions familial restrictive cardiomyopathy familial restrictive cardiomyopathy Printable PDF Open All Close All Enable Javascript ... view the expand/collapse boxes. Description Familial restrictive cardiomyopathy is a genetic form of heart disease. For ...

  19. A mimicking-of-DNA-methylation-patterns pipeline for overcoming the restriction barrier of bacteria.

    Directory of Open Access Journals (Sweden)

    Guoqiang Zhang

    2012-09-01

    Full Text Available Genetic transformation of bacteria harboring multiple Restriction-Modification (R-M systems is often difficult using conventional methods. Here, we describe a mimicking-of-DNA-methylation-patterns (MoDMP pipeline to address this problem in three difficult-to-transform bacterial strains. Twenty-four putative DNA methyltransferases (MTases from these difficult-to-transform strains were cloned and expressed in an Escherichia coli strain lacking all of the known R-M systems and orphan MTases. Thirteen of these MTases exhibited DNA modification activity in Southwestern dot blot or Liquid Chromatography-Mass Spectrometry (LC-MS assays. The active MTase genes were assembled into three operons using the Saccharomyces cerevisiae DNA assembler and were co-expressed in the E. coli strain lacking known R-M systems and orphan MTases. Thereafter, results from the dot blot and restriction enzyme digestion assays indicated that the DNA methylation patterns of the difficult-to-transform strains are mimicked in these E. coli hosts. The transformation of the Gram-positive Bacillus amyloliquefaciens TA208 and B. cereus ATCC 10987 strains with the shuttle plasmids prepared from MoDMP hosts showed increased efficiencies (up to four orders of magnitude compared to those using the plasmids prepared from the E. coli strain lacking known R-M systems and orphan MTases or its parental strain. Additionally, the gene coding for uracil phosphoribosyltransferase (upp was directly inactivated using non-replicative plasmids prepared from the MoDMP host in B. amyloliquefaciens TA208. Moreover, the Gram-negative chemoautotrophic Nitrobacter hamburgensis strain X14 was transformed and expressed Green Fluorescent Protein (GFP. Finally, the sequence specificities of active MTases were identified by restriction enzyme digestion, making the MoDMP system potentially useful for other strains. The effectiveness of the MoDMP pipeline in different bacterial groups suggests a universal

  20. Protocol: a rapid and economical procedure for purification of plasmid or plant DNA with diverse applications in plant biology

    Directory of Open Access Journals (Sweden)

    Li Li

    2010-01-01

    Full Text Available Abstract Research in plant molecular biology involves DNA purification on a daily basis. Although different commercial kits enable convenient extraction of high-quality DNA from E. coli cells, PCR and agarose gel samples as well as plant tissues, each kit is designed for a particular type of DNA extraction work, and the cost of purchasing these kits over a long run can be considerable. Furthermore, a simple method for the isolation of binary plasmid from Agrobacterium tumefaciens cells with satisfactory yield is lacking. Here we describe an easy protocol using homemade silicon dioxide matrix and seven simple solutions for DNA extraction from E. coli and A. tumefaciens cells, PCR and restriction digests, agarose gel slices, and plant tissues. Compared with the commercial kits, this protocol allows rapid DNA purification from diverse sources with comparable yield and purity at negligible cost. Following this protocol, we have demonstrated: (1 DNA fragments as small as a MYC-epitope tag coding sequence can be successfully recovered from an agarose gel slice; (2 Miniprep DNA from E. coli can be eluted with as little as 5 μl water, leading to high DNA concentrations (>1 μg/μl for efficient biolistic bombardment of Arabidopsis seedlings, polyethylene glycol (PEG-mediated Arabidopsis protoplast transfection and maize protoplast electroporation; (3 Binary plasmid DNA prepared from A. tumefaciens is suitable for verification by restriction analysis without the need for large scale propagation; (4 High-quality genomic DNA is readily isolated from several plant species including Arabidopsis, tobacco and maize. Thus, the silicon dioxide matrix-based DNA purification protocol offers an easy, efficient and economical way to extract DNA for various purposes in plant research.

  1. Protocol: a rapid and economical procedure for purification of plasmid or plant DNA with diverse applications in plant biology.

    Science.gov (United States)

    Li, Jian-Feng; Li, Li; Sheen, Jen

    2010-01-14

    Research in plant molecular biology involves DNA purification on a daily basis. Although different commercial kits enable convenient extraction of high-quality DNA from E. coli cells, PCR and agarose gel samples as well as plant tissues, each kit is designed for a particular type of DNA extraction work, and the cost of purchasing these kits over a long run can be considerable. Furthermore, a simple method for the isolation of binary plasmid from Agrobacterium tumefaciens cells with satisfactory yield is lacking. Here we describe an easy protocol using homemade silicon dioxide matrix and seven simple solutions for DNA extraction from E. coli and A. tumefaciens cells, PCR and restriction digests, agarose gel slices, and plant tissues. Compared with the commercial kits, this protocol allows rapid DNA purification from diverse sources with comparable yield and purity at negligible cost. Following this protocol, we have demonstrated: (1) DNA fragments as small as a MYC-epitope tag coding sequence can be successfully recovered from an agarose gel slice; (2) Miniprep DNA from E. coli can be eluted with as little as 5 mul water, leading to high DNA concentrations (>1 mug/mul) for efficient biolistic bombardment of Arabidopsis seedlings, polyethylene glycol (PEG)-mediated Arabidopsis protoplast transfection and maize protoplast electroporation; (3) Binary plasmid DNA prepared from A. tumefaciens is suitable for verification by restriction analysis without the need for large scale propagation; (4) High-quality genomic DNA is readily isolated from several plant species including Arabidopsis, tobacco and maize. Thus, the silicon dioxide matrix-based DNA purification protocol offers an easy, efficient and economical way to extract DNA for various purposes in plant research.

  2. An algorithmic approach to multiple complete digest mapping

    Energy Technology Data Exchange (ETDEWEB)

    Fasulo, D.P.; Karp, R.M.; Thayer, E.C. [Univ. of Washington, Seattle, WA (United States)] [and others

    1997-12-01

    Multiple Complete Digest (MCD) mapping is a method of determining the locations of restriction sites along a target DNA strand. The resulting restriction sites along a target DNA strand. The resulting restriction map has many potential applications in DNA sequencing and genetics. In this work, we present a heuristic for fragment identification, one step in the process of constructing an MCD map. We assume that we are given information about one or more complete digestions of a clone library covering the area to be mapped. From this data, we identify groups of restriction fragments on different clones that correspond to the same region of the target DNA. Maintaining certain constraints on the groups allows us to form a system of simple linear inequalities whose solution yields the desired map. We demonstrate the effectiveness of our heuristic on real data provided by the Genome Center at the University of Washington. 5 refs., 6 figs.

  3. pTAR-Encoded Proteins in Plasmid Partitioning

    OpenAIRE

    Kalnin, Kirill; Stegalkina, Svetlana; Yarmolinsky, Michael

    2000-01-01

    Partition cassettes, essential for the segregational stability of low-copy-number bacterial plasmids, typically encode two autoregulated proteins and an adjacent cis-acting centromere analog to which one or perhaps both proteins bind. The diminutive partition region of pTAR of Agrobacterium spp. was reported to be exceptional, encoding only a single protein, ParA (D. R. Gallie and C. I. Kado, J. Mol. Biol. 193:465–478, 1987). However, resequencing of the region revealed two small downstream g...

  4. Recombinogenic engineering of conjugative plasmids with fluorescent marker cassettes

    DEFF Research Database (Denmark)

    Reisner, A.; Molin, Søren; Zechner, E.L.

    2002-01-01

    functions using very short regions of homology. Initial manipulation of the IncFII target plasmids R1 and R1drd19 indicated that the linear targeting DNA should be devoid of all extraneous homologies to. the target molecule for optimal insertion specificity. Indeed, a simple recombination assay proved...... that in the presence of additional homologous regions in the targeting DNA, strand exchanges occurred exclusively within the longest regions of homology. A versatile panel of vectors was created to facilitate convenient PCR amplification of targeting DNAs containing various combinations of different antibiotic...

  5. IncA/C plasmids: An emerging threat to human and animal health?

    Science.gov (United States)

    Johnson, Timothy J; Lang, Kevin S

    2012-01-01

    Incompatibility group IncA/C plasmids are large, low copy, theta-replicating plasmids that have been described in the literature for over 40 years. However, they have only recently been intensively studied on the genomic level because of their associations with the emergence of multidrug resistance in enteric pathogens of humans and animals. These plasmids are unique among other enterobacterial plasmids in many aspects, including their modular structure and gene content. While the IncA/C plasmid genome structure has now been well defined, many questions remain pertaining to their basic biological mechanisms of dissemination and regulation. Here, we discuss the history of IncA/C plasmids in light of our recent understanding of their population distribution, genomics, and effects on host bacteria.

  6. Long- term manure exposure increases soil bacterial community potential for plasmid uptake

    DEFF Research Database (Denmark)

    Musovic, Sanin; Klümper, Uli; Dechesne, Arnaud;

    2014-01-01

    Microbial communities derived from soils subject to different agronomic treatments were challenged with three broad host range plasmids, RP4, pIPO2tet and pRO101, via solid surface filter matings to assess their permissiveness. Approximately 1 in 10 000 soil bacterial cells could receive and main......Microbial communities derived from soils subject to different agronomic treatments were challenged with three broad host range plasmids, RP4, pIPO2tet and pRO101, via solid surface filter matings to assess their permissiveness. Approximately 1 in 10 000 soil bacterial cells could receive...... and maintain the plasmids. The community permissiveness increased up to 100% in communities derived from manured soil. While the plasmid transfer frequency was significantly influenced by both the type of plasmid and the agronomic treatment, the diversity of the transconjugal pools was purely plasmid dependent...

  7. Novel archaeal plasmid pAH1 and its interactions with the lipothrixvirus AFV1

    DEFF Research Database (Denmark)

    Basta, Tamara; Smyth, John; Forterre, Patrick

    2009-01-01

    to establish a system for studying plasmid-virus interactions we characterized the genome of pAH1 which closely resembles those of the Sulfolobus conjugative plasmids pARN3 and pARN4. pAH1 integrates site specifically into, and excises from, the host chromosome indicating a dynamic interaction with the latter....... Although nucleotide sequence comparisons revealed extensive intergenomic exchange during the evolution of archaeal conjugative plasmids, pAH1 was shown to be stably maintained suggesting that the host system is suitable for studying plasmid-virus interactions. AFV1 infection and propagation leads to a loss...... of the circular form of pAH1 and this effect correlates positively with the increase in the intracellular quantity of AFV1 DNA. We infer that the virus inhibits plasmid replication since no pAH1 degradation was observed. This mechanism of archaeal viral inhibition of plasmid propagation is not observed...

  8. The Plasmid Complement of the Cheese Isolate Lactococcus garvieae IPLA 31405 Revealed Adaptation to the Dairy Environment

    Science.gov (United States)

    Flórez, Ana Belén; Mayo, Baltasar

    2015-01-01

    Lactococcus garvieae is a lactic acid bacterium found in raw-milk dairy products as well as a range of aquatic and terrestrial environments. The plasmids in L. garvieae have received little attention compared to those of dairy Lactococcus lactis, in which the genes carried by these extrachromosomal elements are considered of adaptive value. The present work reports the sequencing and analysis of the plasmid complement of L. garvieae IPLA 31405, a strain isolated from a traditional, Spanish, starter-free cheese made from raw-milk. It consists of pLG9 and pLG42, of 9,124 and 42,240 nucleotides, respectively. Based on sequence and structural homology in the putative origin of replication (ori) region, pLG9 and pLG42 are predicted to replicate via a theta mechanism. Real-time, quantitative PCR showed the number of copies per chromosome equivalent of pLG9 and pLG42 to be around two and five, respectively. Sequence analysis identified eight complete open reading frames (orfs) in pLG9 and 36 in pLG42; these were organized into functional modules or cassettes containing different numbers of genes. These modules were flanked by complete or interrupted insertion sequence (IS)-like elements. Among the modules of pLG42 was a gene cluster encoding specific components of a phosphoenolpyruvate-phosphotransferase (PEP-PTS) system, including a phospho-β-galacosidase. The cluster showed a complete nucleotide identity respect to that in plasmids of L. lactis. Loss of pLG42 showed this to be involved in lactose assimilation. In the same plasmid, an operon encoding a type I restriction/modification (R/M) system was also identified. The specificity of this R/M system might be broadened by different R/M specificity subunits detected in pLG9 and in the bacterial chromosome. However, challenges of L. garvieae IPLA 31405 against L. lactis phages proved that the R/M system was not involved in phage resistance. Together, these results support the hypothesis that, as in L. lactis, pLG42

  9. Modified-cytosine restriction-system-induced recombinant cloning artefacts in Escherichia coli

    DEFF Research Database (Denmark)

    Williamson, M R; Doherty, J P; Woodcock, D M

    1993-01-01

    We have tested whether, and to what extent, recombinant clones from DNA segments with 5-methylation of cytosines recovered in methylation-restrictive (mcr+) hosts contain mutations. We constructed a model system in which the tetracycline-resistance-encoding gene (tet) from pBR322 was cloned......A+ mcr+ hosts compared with a methylation-tolerant host (mcr-). Of the clones recovered in recA+mcr+ hosts, > 20% of clones had an inactivating mutation in tet. The majority of such mutant clones contained deletions that frequently extended into the unmethylated portion of tet and even into the plasmid...

  10. Molecular motion in restricted geometries

    Indian Academy of Sciences (India)

    Siddharth Gautam; S Mitra; R Mukhopadhyay

    2008-10-01

    Molecular dynamics in restricted geometries is known to exhibit anomalous behaviour. Diffusion, translational or rotational, of molecules is altered significantly on confinement in restricted geometries. Quasielastic neutron scattering (QENS) offers a unique possibility of studying molecular motion in such systems. Both time scales involved in the motion and the geometry of motion can be studied using QENS. Molecular dynamics (MD) simulation not only provides insight into the details of the different types of motion possible but also does not suffer limitations of the experimental set-up. Here we report the effect of confinement on molecular dynamics in various restricted geometries as studied by QENS and MD simulations: An example where the QENS technique provided direct evidence of phase transition associated with change in the dynamical behaviour of the molecules is also discussed.

  11. Characterization and comparative overview of complete sequences of the first plasmids of Pandoraea across clinical and non-clinical strains

    Directory of Open Access Journals (Sweden)

    Delicia Yong

    2016-10-01

    Full Text Available To date, information on plasmid analysis in Pandoraea spp. is scarce. To address the gap of knowledge on this, the complete sequences of eight plasmids from Pandoraea spp. namely Pandoraea faecigallinarum DSM 23572 (pPF72-1, pPF72-2, Pandoraea oxalativorans DSM 23570 (pPO70-1, pPO70-2, pPO70-3, pPO70-4, Pandoraea vervacti NS15 (pPV15 and Pandoraea apista DSM 16535 (pPA35 were studied for the first time in this study. The information on plasmid sequences in Pandoraea spp. is useful because these plasmid sequences did not match to any known plasmid sequence deposited in public databases. Replication genes were not identified in some plasmids, a situation that has led to the possibility of host interaction involvement. Some plasmids were also void of par genes and intriguingly, repA gene was also not discovered in these plasmids. This further leads to the hypothesis of host-plasmid interaction. Plasmid stabilization/stability protein-encoding genes were observed in some plasmids but were not established for participating in plasmid segregation. Toxin-antitoxin systems MazEF, VapBC, RelBE, YgiT-MqsR, HigBA and ParDE were identified across the plasmids and their presence would improve plasmid maintenance. Conjugation genes were identified portraying the conjugation ability amongst Pandoraea plasmids. Additionally, we found a shared region amongst some of the plasmids that consists of conjugation genes. The identification of genes involved in replication, segregation, toxin-antitoxin systems and conjugation, would aid the design of drugs to prevent the survival or transmission of plasmids carrying pathogenic properties. Additionally, genes conferring virulence and antibiotic resistance were identified among the plasmids. The observed features in the plasmids shed light on the Pandoraea spp. as opportunistic pathogens.

  12. Role of Plasmids in Lactobacillus brevis BSO 464 Hop Tolerance and Beer Spoilage

    Science.gov (United States)

    Bergsveinson, Jordyn; Baecker, Nina; Pittet, Vanessa

    2014-01-01

    Specific isolates of lactic acid bacteria (LAB) can grow in the harsh beer environment, thus posing a threat to brew quality and the economic success of breweries worldwide. Plasmid-localized genes, such as horA, horC, and hitA, have been suggested to confer hop tolerance, a trait required for LAB survival in beer. The presence and expression of these genes among LAB, however, do not universally correlate with the ability to grow in beer. Genome sequencing of the virulent beer spoilage organism Lactobacillus brevis BSO 464 revealed the presence of eight plasmids, with plasmids 1, 2, and 3 containing horA, horC, and hitA, respectively. To investigate the roles that these and the other five plasmids play in L. brevis BSO 464 growth in beer, plasmid curing with novobiocin was used to derive 10 plasmid variants. Multiplex PCRs were utilized to determine the presence or absence of each plasmid, and how plasmid loss affected hop tolerance and growth in degassed (noncarbonated) beer was assessed. Loss of three of the eight plasmids was found to affect hop tolerance and growth in beer. Loss of plasmid 2 (horC and 28 other genes) had the most dramatic effect, with loss of plasmid 4 (120 genes) and plasmid 8 (47 genes) having significant, but smaller, impacts. These results support the contention that genes on mobile genetic elements are essential for bacterial growth in beer and that beer spoilage ability is not dependent solely on the three previously described hop tolerance genes or on the chromosome of a beer spoilage LAB isolate. PMID:25501474

  13. Plasmid profiles and antibiotic susceptibility patterns of Staphylococcus aureus isolates from Nigeria.

    Science.gov (United States)

    Olukoya, D K; Asielue, J O; Olasupo, N A; Ikea, J K

    1995-06-01

    In an investigation into the problems of infections due to Staphylococcus aureus in Nigeria, 100 strains were isolated from various hospitals in Lagos. The strains were screened for the presence of plasmids and for susceptibility to antimicrobial agents. Plasmids were extracted by modification of the method of Takahashi and Nagono[1]. The plasmids were diverse in nature. The strains were found to be highly resistant to commonly prescribed antibiotics.

  14. Investigation of diversity of plasmids carrying the blaTEM-52 gene

    DEFF Research Database (Denmark)

    Bielak, Eliza Maria; Bergenholtz, Rikke D.; Jørgensen, Mikael Skaanning

    2011-01-01

    on various other plasmids belonging to IncA/C and IncL/M, while blaTEM-52c was found on IncN-like as well as on IncR plasmids. In the majority of cases (n = 21) the blaTEM-52 gene was located on a Tn3 transposon. Seven out of 10 blaTEM-52 plasmids tested in conjugation experiments were shown to be capable...

  15. Key features of mcr-1-bearing plasmids from Escherichia coli isolated from humans and food.

    Science.gov (United States)

    Zurfluh, Katrin; Nüesch-Inderbinen, Magdalena; Klumpp, Jochen; Poirel, Laurent; Nordmann, Patrice; Stephan, Roger

    2017-01-01

    Mcr-1-harboring Enterobacteriaceae are reported worldwide since their first discovery in 2015. However, a limited number of studies are available that compared full-length plasmid sequences of human and animal origins. In this study, mcr-1-bearing plasmids from seven Escherichia coli isolates recovered from patients (n = 3), poultry meat (n = 2) and turkey meat (n = 2) in Switzerland were further analyzed and compared. Isolates were characterized by multilocus sequence typing (MLST). The mcr-1-bearing plasmids were transferred by transformation into reference strain E. coli DH5α and MCR-1-producing transformants were selected on LB-agar supplemented with 2 mg/L colistin. Purified plasmids were then sequenced and compared. MLST revealed six distinct STs, illustrating the high clonal diversity among mcr-1-positive E. coli isolates of different origins. Two different mcr-1-positive plasmids were identified from a single E. coli ST48 human isolate. All other isolates possessed a single mcr-1 harboring plasmid. Transferable IncI2 (size ca. 60-61 kb) and IncX4 (size ca. 33-35 kb) type plasmids each bearing mcr-1 were found associated with human and food isolates. None of the mcr-1-positive IncI2 and IncX4 plasmids possessed any additional resistance determinants. Surprisingly, all but one of the sequenced mcr-1-positive plasmids lacked the ISApl1 element, which is a key element mediating acquisition of mcr-1 into various plasmid backbones. There is strong evidence that the food chain may be an important transmission route for mcr-1-bearing plasmids. Our data suggest that some "epidemic" plasmids rather than specific E. coli clones might be responsible for the spread of the mcr-1 gene along the food chain.

  16. Occurrence of Plasmids in the Aromatic Degrading Bacterioplankton of the Baltic Sea

    OpenAIRE

    Ain Heinaru; Jaanis Juhanson; Eve Vedler; Eeva Heinaru; Jekaterina Jutkina

    2011-01-01

    Plasmids are mobile genetic elements that provide their hosts with many beneficial traits including in some cases the ability to degrade different aromatic compounds. To fulfill the knowledge gap regarding catabolic plasmids of the Baltic Sea water, a total of 209 biodegrading bacterial strains were isolated and screened for the presence of these mobile genetic elements. We found that both large and small plasmids are common in the cultivable Baltic Sea bacterioplankton and are particularly p...

  17. Role of plasmids in Lactobacillus brevis BSO 464 hop tolerance and beer spoilage.

    Science.gov (United States)

    Bergsveinson, Jordyn; Baecker, Nina; Pittet, Vanessa; Ziola, Barry

    2015-02-01

    Specific isolates of lactic acid bacteria (LAB) can grow in the harsh beer environment, thus posing a threat to brew quality and the economic success of breweries worldwide. Plasmid-localized genes, such as horA, horC, and hitA, have been suggested to confer hop tolerance, a trait required for LAB survival in beer. The presence and expression of these genes among LAB, however, do not universally correlate with the ability to grow in beer. Genome sequencing of the virulent beer spoilage organism Lactobacillus brevis BSO 464 revealed the presence of eight plasmids, with plasmids 1, 2, and 3 containing horA, horC, and hitA, respectively. To investigate the roles that these and the other five plasmids play in L. brevis BSO 464 growth in beer, plasmid curing with novobiocin was used to derive 10 plasmid variants. Multiplex PCRs were utilized to determine the presence or absence of each plasmid, and how plasmid loss affected hop tolerance and growth in degassed (noncarbonated) beer was assessed. Loss of three of the eight plasmids was found to affect hop tolerance and growth in beer. Loss of plasmid 2 (horC and 28 other genes) had the most dramatic effect, with loss of plasmid 4 (120 genes) and plasmid 8 (47 genes) having significant, but smaller, impacts. These results support the contention that genes on mobile genetic elements are essential for bacterial growth in beer and that beer spoilage ability is not dependent solely on the three previously described hop tolerance genes or on the chromosome of a beer spoilage LAB isolate.

  18. Cefotaxime resistant Escherichia coli collected from a healthy volunteer; characterisation and the effect of plasmid loss.

    Directory of Open Access Journals (Sweden)

    Miranda Kirchner

    Full Text Available In this study 6 CTX-M positive E. coli isolates collected during a clinical study examining the effect of antibiotic use in a human trial were analysed. The aim of the study was to analyse these isolates and assess the effect of full or partial loss of plasmid genes on bacterial fitness and pathogenicity. A DNA array was utilised to assess resistance and virulence gene carriage. Plasmids were characterised by PCR-based replicon typing and addiction system multiplex PCR. A phenotypic array and insect virulence model were utilised to assess the effect of plasmid-loss in E. coli of a large multi-resistance plasmid. All six E. coli carrying bla CTX-M-14 were detected from a single participant and were identical by pulse field gel electrophoresis and MLST. Plasmid profiling and arrays indicated absence of a large multi-drug resistance (MDR F-replicon plasmid carrying blaTEM, aadA4, strA, strB, dfrA17/19, sul1, and tetB from one isolate. Although this isolate partially retained the plasmid it showed altered fitness characteristics e.g. inability to respire in presence of antiseptics, similar to a plasmid-cured strain. However, unlike the plasmid-cured or plasmid harbouring strains, the survival rate for Galleria mellonella infected by the former strain was approximately 5-times lower, indicating other possible changes accompanying partial plasmid loss. In conclusion, our results demonstrated that an apparently healthy individual can harbour bla CTX-M-14 E. coli strains. In one such strain, isolated from the same individual, partial absence of a large MDR plasmid resulted in altered fitness and virulence characteristics, which may have implications in the ability of this strain to infect and any subsequent treatment.

  19. Cefotaxime resistant Escherichia coli collected from a healthy volunteer; characterisation and the effect of plasmid loss.

    Science.gov (United States)

    Kirchner, Miranda; Abuoun, Manal; Mafura, Muriel; Bagnall, Mary; Hunt, Theresa; Thomas, Christopher; Weile, Jan; Anjum, Muna F

    2013-01-01

    In this study 6 CTX-M positive E. coli isolates collected during a clinical study examining the effect of antibiotic use in a human trial were analysed. The aim of the study was to analyse these isolates and assess the effect of full or partial loss of plasmid genes on bacterial fitness and pathogenicity. A DNA array was utilised to assess resistance and virulence gene carriage. Plasmids were characterised by PCR-based replicon typing and addiction system multiplex PCR. A phenotypic array and insect virulence model were utilised to assess the effect of plasmid-loss in E. coli of a large multi-resistance plasmid. All six E. coli carrying bla CTX-M-14 were detected from a single participant and were identical by pulse field gel electrophoresis and MLST. Plasmid profiling and arrays indicated absence of a large multi-drug resistance (MDR) F-replicon plasmid carrying blaTEM, aadA4, strA, strB, dfrA17/19, sul1, and tetB from one isolate. Although this isolate partially retained the plasmid it showed altered fitness characteristics e.g. inability to respire in presence of antiseptics, similar to a plasmid-cured strain. However, unlike the plasmid-cured or plasmid harbouring strains, the survival rate for Galleria mellonella infected by the former strain was approximately 5-times lower, indicating other possible changes accompanying partial plasmid loss. In conclusion, our results demonstrated that an apparently healthy individual can harbour bla CTX-M-14 E. coli strains. In one such strain, isolated from the same individual, partial absence of a large MDR plasmid resulted in altered fitness and virulence characteristics, which may have implications in the ability of this strain to infect and any subsequent treatment.

  20. A cohomology theory of grading-restricted vertex algebras

    CERN Document Server

    Huang, Yi-Zhi

    2010-01-01

    We introduce a cohomology theory of grading-restricted vertex algebras. To construct the "correct" cohomologies, we consider linear maps from tensor powers of a grading-restricted vertex algebra to "rational functions valued in the algebraic completion of a module for the algebra," instead of linear maps from tensor powers of the algebra to a module for the algebra. One subtle complication arising from such "rational functions valued in the algebraic completion of a module" is that we have to carefully address the issue of convergence when we compose these linear maps with vertex operators. In particular, for each $n\\in \\N$, we have an inverse system $\\{H^{n}_{m}(V, W)\\}_{m\\in \\Z_{+}}$ of $n$-th cohomologies and an additional $n$-th cohomology $H_{\\infty}^{n}(V, W)$ of a grading-restricted vertex algebra $V$ with coefficients in a $V$-module $W$ such that $H_{\\infty}^{n}(V, W)$ is isomorphic to the inverse limit of the inverse system $\\{H^{n}_{m}(V, W)\\}_{m\\in \\Z_{+}}$. In the case of $n=2$, there is an addit...

  1. Design and evaluation of protein expression in a recombinant plasmid encoding epitope gp 350/220 of the Epstein-Barr virus (EBV)

    Science.gov (United States)

    Himmah, Karimatul; Dluha, Nurul; Anyndita, Nadya V. M.; Rifa'i, Muhaimin; Widodo

    2017-05-01

    The Epstein - Barr virus (EBV) causes severe infections that may lead to cancers such as nasopharyngeal carcinoma. Development of effective EBV vaccines is necessary to prevent the virus spreading throughout the community. TheEBV has a surface protein gp 350/220, which serves as an antigen to help interact with host cells. Epitopes of the protein can potentially serve as bases for a vaccine. In a previous study, we have found a conserved epitope of gp 350/220 from all strains EBV through an in silico approach. The aim of this study is to design and overproduce a recombinant peptide of epitope gp 350/220 in E. coli. DNA encoding the conserved epitope was synthesized and cloned into plasmid pET-22b(+); the recombinant plasmid was transformed into E. coli strains DH5α and BL21. The transformed plasmid DNA was isolated and confirmed by restriction using XbaI and PstI enzymes followed by DNA sequencing. Protein expression was induced by isopropyl-D-thiogalactopyranoside (IPTG) with final concentrations of 0.1, 0.2, 1, and 2 mM in consecutive times. An osmotic shock method was used to isolate protein from periplasmic fraction of E. coli DH5α and BL21. The SDS-PAGE analysis was carried out to detect peptide target (3.4 kDa). Based on this result, the induction process did not work properly, and thus needs further investigation.

  2. Collection Mapping.

    Science.gov (United States)

    Harbour, Denise

    2002-01-01

    Explains collection mapping for library media collections. Discusses purposes for creating collection maps, including helping with selection and weeding decisions, showing how the collection supports the curriculum, and making budget decisions; and methods of data collection, including evaluating a collaboratively taught unit with the classroom…

  3. Causal mapping

    DEFF Research Database (Denmark)

    Rasmussen, Lauge Baungaard

    2006-01-01

    The lecture note explains how to use the causal mapping method as well as the theoretical framework aoosciated to the method......The lecture note explains how to use the causal mapping method as well as the theoretical framework aoosciated to the method...

  4. Affective Maps

    DEFF Research Database (Denmark)

    Salovaara-Moring, Inka

    of environmental knowledge production. It uses InfoAmazonia, the databased platform on Amazon rainforests, as an example of affective geo-visualization within information mapping that enhances embodiment in the experience of the information. Amazonia is defined as a digitally created affective (map)space within...

  5. Effects of medium composition on the production of plasmid DNA vector potentially for human gene therapy

    Institute of Scientific and Technical Information of China (English)

    XU Zhi-nan; SHEN Wen-he; CHEN Hao; CEN Pei-lin

    2005-01-01

    Plasmid vector is increasingly applied to gene therapy or gene vaccine. The production of plasmid pCMV-AP3 for cancer gene therapy was conducted in a modified MBL medium using a recombinant E. coli BL21 system. The effects of different MMBL components on plasmid yield, cell mass and specific plasmid DNA productivity were evaluated on shake-flask scale. The results showed that glucose was the optimal carbon source. High plasmid yield (58.3 mg/L) was obtained when 5.0 g/L glucose was added to MMBL. Glycerol could be chosen as a complementary carbon source because of the highest specific plasmid productivity (37.9 mg DNA/g DCW). After tests of different levels of nitrogen source and inorganic phosphate, a modified MMBL medium was formulated for optimal plasmid production. Further study showed that the initial acetate addition (less than 4.0 g/L) in MMBL improved plasmid production significantly, although it inhibited cell growth. The results will be useful for large-scale plasmid production using recombinant E. coli system.

  6. The evolution of collective restraint: policing and obedience among non-conjugative plasmids.

    Science.gov (United States)

    Kentzoglanakis, Kyriakos; García López, Diana; Brown, Sam P; Goldstein, Richard A

    2013-04-01

    The repression of competition by mechanisms of policing is now recognized as a major force in the maintenance of cooperation. General models on the evolution of policing have focused on the interplay between individual competitiveness and mutual policing, demonstrating a positive relationship between within-group diversity and levels of policing. We expand this perspective by investigating what is possibly the simplest example of reproductive policing: copy number control (CNC) among non-conjugative plasmids, a class of extra-chromosomal vertically transmitted molecular symbionts of bacteria. Through the formulation and analysis of a multi-scale dynamical model, we show that the establishment of stable reproductive restraint among plasmids requires the co-evolution of two fundamental plasmid traits: policing, through the production of plasmid-coded trans-acting replication inhibitors, and obedience, expressed as the binding affinity of plasmid-specific targets to those inhibitors. We explain the intrinsic replication instabilities that arise in the absence of policing and we show how these instabilities are resolved by the evolution of copy number control. Increasing levels of policing and obedience lead to improvements in group performance due to tighter control of local population size (plasmid copy number), delivering benefits both to plasmids, by reducing the risk of segregational loss and to the plasmid-host partnership, by increasing the rate of cell reproduction, and therefore plasmid vertical transmission.

  7. Postsymbiotic plasmid acquisition and evolution of the repA1-replicon in Buchnera aphidicola

    Science.gov (United States)

    Van Ham, Roeland C. H. J.; González-Candelas, Fernando; Silva, Francisco J.; Sabater, Beatriz; Moya, Andrés; Latorre, Amparo

    2000-01-01

    Buchnera aphidicola is an obligate, strictly vertically transmitted, bacterial symbiont of aphids. It supplies its host with essential amino acids, nutrients required by aphids but deficient in their diet of plant phloem sap. Several lineages of Buchnera show adaptation to their nutritional role in the form of plasmid-mediated amplification of key-genes involved in the biosynthesis of tryptophan (trpEG) and leucine (leuABCD). Phylogenetic analyses of these plasmid-encoded functions have thus far suggested the absence of horizontal plasmid exchange among lineages of Buchnera. Here, we describe three new Buchnera plasmids, obtained from species of the aphid host families Lachnidae and Pemphigidae. All three plasmids belong to the repA1 family of Buchnera plasmids, which is characterized by the presence of a repA1-replicon responsible for replication initiation. A comprehensive analysis of this family of plasmids unexpectedly revealed significantly incongruent phylogenies for different plasmid and chromosomally encoded loci. We infer from these incongruencies a case of horizontal plasmid transfer in Buchnera. This process may have been mediated by secondary endosymbionts, which occasionally undergo horizontal transmission in aphids. PMID:10984505

  8. Enhancing yields of low and single copy number plasmid DNAs from Escherichia coli cells.

    Science.gov (United States)

    Wood, Whitney N; Smith, Kyle D; Ream, Jennifer A; Kevin Lewis, L

    2017-02-01

    Many plasmids used for gene cloning and heterologous protein expression in Escherichia coli cells are low copy number or single copy number plasmids. The extraction of these types of plasmids from small bacterial cell cultures produces low DNA yields. In this study, we have quantitated yields of low copy and single copy number plasmid DNAs after growth of cells in four widely used broths (SB, SOC, TB, and 2xYT) and compared results to those obtained with LB, the most common E. coli cell growth medium. TB (terrific broth) consistently generated the greatest amount of plasmid DNA, in agreement with its ability to produce higher cell titers. The superiority of TB was primarily due to its high levels of yeast extract (24g/L) and was independent of glycerol, a unique component of this broth. Interestingly, simply preparing LB with similarly high levels of yeast extract (LB24 broth) resulted in plasmid yields that were equivalent to those of TB. By contrast, increasing ampicillin concentration to enhance plasmid retention did not improve plasmid DNA recovery. These experiments demonstrate that yields of low and single copy number plasmid DNAs from minipreps can be strongly enhanced using simple and inexpensive media. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Computational design and characterization of a temperature-sensitive plasmid replicon for gram positive thermophiles

    Directory of Open Access Journals (Sweden)

    Olson Daniel G

    2012-05-01

    Full Text Available Abstract Background Temperature-sensitive (Ts plasmids are useful tools for genetic engineering, but there are currently none compatible with the gram positive, thermophilic, obligate anaerobe, Clostridium thermocellum. Traditional mutagenesis techniques yield Ts mutants at a low frequency, and therefore requires the development of high-throughput screening protocols, which are also not available for this organism. Recently there has been progress in the development of computer algorithms which can predict Ts mutations. Most plasmids currently used for genetic modification of C. thermocellum are based on the replicon of plasmid pNW33N, which replicates using the RepB replication protein. To address this problem, we set out to create a Ts plasmid by mutating the gene coding for the RepB replication protein using an algorithm designed by Varadarajan et al. (1996 for predicting Ts mutants based on the amino-acid sequence of the protein. Results A library of 34 mutant plasmids was designed, synthesized and screened, resulting in 6 mutants which exhibited a Ts phenotype. Of these 6, the one with the most temperature-sensitive phenotype (M166A was compared with the original plasmid. It exhibited lower stability at 48°C and was completely unable to replicate at 55°C. Conclusions The plasmid described in this work could be useful in future efforts to genetically engineer C. thermocellum, and the method used to generate this plasmid may be useful for others trying to make Ts plasmids.

  10. Microneedle-mediated transcutaneous immunization with plasmid DNA coated on cationic PLGA nanoparticles

    Science.gov (United States)

    Kumar, Amit; Wonganan, Piyanuch; Sandoval, Michael A.; Li, Xinran; Zhu, Saijie; Cui, Zhengrong

    2012-01-01

    Previously, it was shown that microneedle-mediated transcutaneous immunization with plasmid DNA can potentially induce a stronger immune response than intramuscular injection of the same plasmid DNA. In the present study, we showed that the immune responses induced by transcutaneous immunization by applying plasmid DNA onto a skin area pretreated with solid microneedles were significantly enhanced by coating the plasmid DNA on the surface of cationic nanoparticles. In addition, the net surface charge of the DNA-coated nanoparticles significantly affected their in vitro skin permeation and their ability to induce immune responses in vivo. Transcutaneous immunization with plasmid DNA-coated net positively charged anoparticles elicited a stronger immune response than with plasmid DNA-coated net negatively charged nanoparticles or by intramuscular immunization with plasmid DNA alone. Transcutaneous immunization with plasmid DNA-coated net positively charged nanoparticles induced comparable immune responses as intramuscular injection of them, but transcutaneous immunization was able to induce specific mucosal immunity and a more balanced T helper type 1 and type 2 response. The ability of the net positively charged DNA-coated nanoparticles to induce a strong immune response through microneedle-mediated transcutaneous immunization may be attributed to their ability to increase the expression of the antigen gene encoded by the plasmid and to more effectively stimulate the maturation of antigen-presenting cells. PMID:22921518

  11. Degenerate primer MOB typing of multiresistant clinical isolates of E. coli uncovers new plasmid backbones.

    Science.gov (United States)

    Garcillán-Barcia, M Pilar; Ruiz del Castillo, Belén; Alvarado, Andrés; de la Cruz, Fernando; Martínez-Martínez, Luis

    2015-01-01

    Degenerate Primer MOB Typing is a PCR-based protocol for the classification of γ-proteobacterial transmissible plasmids in five phylogenetic relaxase MOB families. It was applied to a multiresistant E. coli collection, previously characterized by PCR-based replicon-typing, in order to compare both methods. Plasmids from 32 clinical isolates of multiresistant E. coli (19 extended spectrum beta-lactamase producers and 13 non producers) and their transconjugants were analyzed. A total of 95 relaxases were detected, at least one per isolate, underscoring the high potential of these strains for antibiotic-resistance transmission. MOBP12 and MOBF12 plasmids were the most abundant. Most MOB subfamilies detected were present in both subsets of the collection, indicating a shared mobilome among multiresistant E. coli. The plasmid profile obtained by both methods was compared, which provided useful data upon which decisions related to the implementation of detection methods in the clinic could be based. The phylogenetic depth at which replicon and MOB-typing classify plasmids is different. While replicon-typing aims at plasmid replication regions with non-degenerate primers, MOB-typing classifies plasmids into relaxase subfamilies using degenerate primers. As a result, MOB-typing provides a deeper phylogenetic depth than replicon-typing and new plasmid groups are uncovered. Significantly, MOB typing identified 17 plasmids and an integrative and conjugative element, which were not detected by replicon-typing. Four of these backbones were different from previously reported elements.

  12. Mechanism of acquisition of chromosomal markers by plasmids in Haemophilus influenzae.

    OpenAIRE

    Setlow, J K; Cabrera-Juárez, E; Griffin, K

    1984-01-01

    The hybrid plasmid pNov1 readily acquired genetic information from the chromosome of wild-type, but not rec-2, cells. Most of the recombination had taken place 1 h after entrance of the plasmid into the cell, as judged by transformation of rec-2 by lysates made from wild-type cells exposed to pNov1. Measurement of physical transfer from radioactively labeled cellular DNA to plasmids recombining in wild-type cells failed, since there was little more radioactivity in plasmids from such cells th...

  13. Influence of Plasmid Type on the Replication of Rhodococcus equi in Host Macrophages.

    Science.gov (United States)

    Willingham-Lane, Jennifer M; Berghaus, Londa J; Giguère, Steeve; Hondalus, Mary K

    2016-01-01

    The soil-dwelling, saprophytic actinomycete Rhodococcus equi is a multihost, facultative intracellular pathogen of macrophages. When inhaled by susceptible foals, it causes severe bronchopneumonia. It is also a pathogen of pigs, which may develop submaxillary lymphadenitis upon exposure. R. equi isolates obtained from foals and pigs possess conjugative plasmids housing a pathogenicity island (PAI) containing a novel family of genes of unknown function called the virulence-associated protein or vap family. The PAI regions of the equine and swine plasmids differ in vap gene composition, with equine isolates possessing six vap genes, including the major virulence determinant vapA, while the PAIs of swine isolates house vapB and five other unique vap genes. Possession of the pVAPA-type virulence plasmid by equine isolates bestows the capacity for intramacrophage replication essential for disease development in vivo. Swine isolates of R. equi are largely unstudied. Here, we show that R. equi isolates from pigs, carrying pVAPB-type plasmids, are able to replicate in a plasmid-dependent manner in macrophages obtained from a variety of species (murine, swine, and equine) and anatomical locations. Similarly, equine isolates carrying pVAPA-type plasmids are capable of replication in swine macrophages. Plasmid swapping between equine and swine strains through conjugation did not alter the intracellular replication capacity of the parental strain, indicating that coevolution of the plasmid and chromosome is not crucial for this attribute. These results demonstrate that while distinct plasmid types exist among R. equi isolates obtained from equine and swine sources, this tropism is not determined by host species-specific intramacrophage replication capabilities. IMPORTANCE This work greatly advances our understanding of the opportunistic pathogen Rhodococcus equi, a disease agent of animals and immunocompromised people. Clinical isolates from diseased foals carry a

  14. A DNA polymerase mutation that suppresses the segregation bias of an ARS plasmid in Saccharomyces cerevisiae.

    Science.gov (United States)

    Houtteman, S W; Elder, R T

    1993-03-01

    Yeast autonomously replicating sequence (ARS) plasmids exhibit an unusual segregation pattern during mitosis. While the nucleus divides equally into mother and daughter cells, all copies of the ARS plasmid will often remain in the mother cell. A screen was designed to isolate mutations that suppress this segregation bias. A plasmid with a weak ARS (wARS) that displayed an extremely high segregation bias was constructed. When cells were grown under selection for the wARS plasmid, the resulting colonies grew slowly and had abnormal morphology. A spontaneous recessive mutation that restored normal colony morphology was identified. This mutation suppressed plasmid segregation bias, as indicated by the increased stability of the wARS plasmid in the mutant cells even though the plasmid was present at a lower copy number. An ARS1 plasmid was also more stable in mutant cells than in wild-type cells. The wild-type allele for this mutant gene was cloned and identified as POL delta (CDC2). This gene encodes DNA polymerase delta, which is essential for DNA replication. These results indicate that DNA polymerase delta plays some role in causing the segregation bias of ARS plasmids.

  15. High instability of a nematicidal Cry toxin plasmid in Bacillus thuringiensis.

    Science.gov (United States)

    Sheppard, Anna E; Nakad, Rania; Saebelfeld, Manja; Masche, Anna C; Dierking, Katja; Schulenburg, Hinrich

    2016-01-01

    In bacterial pathogens, virulence factors are often carried on plasmids and other mobile genetic elements, and as such, plasmid evolution is central in understanding pathogenicity. Bacillus thuringiensis is an invertebrate pathogen that uses plasmid-encoded crystal (Cry) toxins to establish infections inside the host. Our study aimed to quantify stability of two Cry toxin-encoding plasmids, BTI_23p and BTI_16p, under standard laboratory culturing conditions. These two plasmids are part of the genome of the B. thuringiensis strain MYBT18679, which is of particular interest because of its high pathogenicity towards nematodes. One of the plasmids, BTI_23p, was found to be highly unstable, with substantial loss occurring within a single growth cycle. Nevertheless, longer term experimental evolution in the absence of a host revealed maintenance of the plasmid at low levels in the bacterial populations. BTI_23p encodes two nematicidal Cry toxins, Cry21Aa2 and Cry14Aa1. Consistent with previous findings, loss of the plasmid abolished pathogenicity towards the nematode Caenorhabditis elegans, which could be rescued by addition of Cry21Aa2-expressing Escherichia coli. These results implicate BTI_23p as a plasmid that is required for successful infection, yet unstable when present at high frequency in the population, consistent with the role of Cry toxins as public goods.

  16. Cloning, sequencing, and sequence analysis of two novel plasmids from the thermophilic anaerobic bacterium Anaerocellum thermophilum

    DEFF Research Database (Denmark)

    Clausen, Anders; Mikkelsen, Marie Just; Schrøder, I.

    2004-01-01

    The nucleotide sequence of two novel plasmids isolated from the extreme thermophilic anaerobic bacterium Anaerocellum thermophilum DSM6725 (A. thermophilum), growing optimally at 70degreesC, has been determined. pBAS2 was found to be a 3653 bp plasmid with a GC content of 43%, and the sequence...... was found, but no single stranded intermediates, characteristic of rolling circle replication, were found on Southern blots. The larger plasmid, pBAL, was found to be a 8294 bp plasmid with a GC content of 39%. It revealed 17 ORFs, of which three showed similarity at the amino acid (aa) level to known...

  17. The evolution of collective restraint: policing and obedience among non-conjugative plasmids.

    Directory of Open Access Journals (Sweden)

    Kyriakos Kentzoglanakis

    2013-04-01

    Full Text Available The repression of competition by mechanisms of policing is now recognized as a major force in the maintenance of cooperation. General models on the evolution of policing have focused on the interplay between individual competitiveness and mutual policing, demonstrating a positive relationship between within-group diversity and levels of policing. We expand this perspective by investigating what is possibly the simplest example of reproductive policing: copy number control (CNC among non-conjugative plasmids, a class of extra-chromosomal vertically transmitted molecular symbionts of bacteria. Through the formulation and analysis of a multi-scale dynamical model, we show that the establishment of stable reproductive restraint among plasmids requires the co-evolution of two fundamental plasmid traits: policing, through the production of plasmid-coded trans-acting replication inhibitors, and obedience, expressed as the binding affinity of plasmid-specific targets to those inhibitors. We explain the intrinsic replication instabilities that arise in the absence of policing and we show how these instabilities are resolved by the evolution of copy number control. Increasing levels of policing and obedience lead to improvements in group performance due to tighter control of local population size (plasmid copy number, delivering benefits both to plasmids, by reducing the risk of segregational loss and to the plasmid-host partnership, by increasing the rate of cell reproduction, and therefore plasmid vertical transmission.

  18. Plasmid profile in oral Fusobacterium nucleatum from humans and Cebus apella monkeys

    Directory of Open Access Journals (Sweden)

    Paula Marcia O.

    2003-01-01

    Full Text Available Fusobacterium nucleatum is a strict anaerobe and is indigenous of the human oral cavity. This organism is commonly recovered from different monomicrobial and mixed infections in humans and animals. In this study, the plasmid profile, the plasmid stability and the penicillin-resistance association in oral F. nucleatum isolated from periodontal patients, healthy subjects and Cebus apella monkeys were evaluated. Forty-five F. nucleatum strains from patients, 38 from healthy subjects and seven from C. apella were identified and analyzed. Plasmid extraction was performed in all the isolated strains. These elements were found in 26.7% strains from patients and one strain from C. apella. Strains from healthy subjects did not show any plasmid. Most of strains showed two plasmid bands ranging from 4 to 16 Kb, but digestions with endonucleases showed that they belonged to a single plasmid. The plasmid profile was similar and stable in human and monkey strains. Also, plasmids were classified into three groups according to size. Two strains were positive to beta-lactamase production and no plasmid DNA-hybridization with a beta-lactamase gene probe was observed, suggesting a chromosomal resistance.

  19. Quantifying and visualizing the transfer of exogenous plasmids to environmental microbial communities

    DEFF Research Database (Denmark)

    Dechesne, Arnaud

    2015-01-01

    of a community to take up exogenous plasmid should, however, be an important element affecting the fate of mobile genetic elements released in the environment. We have devised a method to evaluate the permissiveness of a bacterial community towards exogenous plasmids, both quantitatively (how many bacteria can......, our findings highlight the high potential for exogenous plasmids to be transferred to soil microbial communities and indicate that community permissiveness – as affected by environmental conditions- needs to be considered to predict the fate of plasmids in the environment....

  20. pTAR-encoded proteins in plasmid partitioning.

    Science.gov (United States)

    Kalnin, K; Stegalkina, S; Yarmolinsky, M

    2000-04-01

    Partition cassettes, essential for the segregational stability of low-copy-number bacterial plasmids, typically encode two autoregulated proteins and an adjacent cis-acting centromere analog to which one or perhaps both proteins bind. The diminutive partition region of pTAR of Agrobacterium spp. was reported to be exceptional, encoding only a single protein, ParA (D. R. Gallie and C. I. Kado, J. Mol. Biol. 193:465-478, 1987). However, resequencing of the region revealed two small downstream genes, parB and orf-84, of which only parB was found to be essential for partitioning in A. tumefaciens. Purified ParA exhibited a weak ATPase activity that was modestly increased by nonspecific DNA. ParB bound in vitro to repeated sequences present in a region, parS, that possesses centromere and operator functions and within which we identified the primary transcription start site by primer extension. In certain respects the Par proteins behave normally in the foreign host Escherichia coli. In E. coli, as in A. tumefaciens, ParB repressed the partition operon; ParA, inactive alone, augmented this repression. Functional similarities between the partition system of pTAR and those of other plasmids and bacteria are prominent, despite differences in size, organization, and amino acid sequence.

  1. Adsorption behavior of plasmid DNA onto perfusion chromatographic matrix

    Institute of Scientific and Technical Information of China (English)

    Miladys LIMONTA; Lourdes ZUMALACARREGUI; Dayana SOLER

    2012-01-01

    Anion exchange chromatography is the most popular chromatographic method for plasmid separa-tion.POROS RI 50 is a perfusion chromatographic support which is a reversed phase matrix and is an alterna-tive to conventional ones due to its mass transfer properties.The adsorption and elution of the pIDKE2 plasmidonto reversed phase POROS RI 50 was studied.Langmuir isotherm model was adjusted in order to get the max-imum adsorption capacity and the dissociation constant for POROS RI 50-plasmid DNA (pDNA) system.Break-through curves were obtained for volumetric flows between 0.69-3.33mL/min,given dynamic capacity up to2.3 times higher than those reported for ionic exchange matrix used during the purification process of plasmidswith similar size to that of pIDKE2.The efficiency was less than 45% for the flow conditions and initial concen-tration studied,which means that the support will not be operated under saturation circumstances.

  2. Using Plasmids as DNA Vaccines for Infectious Diseases.

    Science.gov (United States)

    Tregoning, John S; Kinnear, Ekaterina

    2014-12-01

    DNA plasmids can be used to induce a protective (or therapeutic) immune response by delivering genes encoding vaccine antigens. That naked DNA (without the refinement of coat proteins or host evasion systems) can cross from outside the cell into the nucleus and be expressed is particularly remarkable given the sophistication of the immune system in preventing infection by pathogens. As a result of the ease, low cost, and speed of custom gene synthesis, DNA vaccines dangle a tantalizing prospect of the next wave of vaccine technology, promising individual designer vaccines for cancer or mass vaccines with a rapid response time to emerging pandemics. There is considerable enthusiasm for the use of DNA vaccination as an approach, but this enthusiasm should be tempered by the successive failures in clinical trials to induce a potent immune response. The technology is evolving with the development of improved delivery systems that increase expression levels, particularly electroporation and the incorporation of genetically encoded adjuvants. This review will introduce some key concepts in the use of DNA plasmids as vaccines, including how the DNA enters the cell and is expressed, how it induces an immune response, and a summary of clinical trials with DNA vaccines. The review also explores the advances being made in vector design, delivery, formulation, and adjuvants to try to realize the promise of this technology for new vaccines. If the immunogenicity and expression barriers can be cracked, then DNA vaccines may offer a step change in mass vaccination.

  3. Construction of plant expression plasmid p2355-gtfB containing glucosyltransferase B of Streptococcus mutans%变异链球菌葡糖基转移酶植物表达质粒p2355-gtfB的构建

    Institute of Scientific and Technical Information of China (English)

    陈筑; 刘建国; 马欣荣; 张燕; 唐琳; 吴家媛; 张剑

    2012-01-01

    Objective To construct plant plasmid p2355-gtfB which contains multiple catalytic sites and antigen epitopes of glucosyltransferase of Streptococcus mutans. Methods Plasmid pcDNA3-gtfB was used as template to obtain the gtfB by PCR amplification. Then gtfB was inserted into inter-mediate vector pMD18-T, subcloned from the recombi-nant plasmid T-gtfB to plant expression vector p2355, then p2355-gtfB was transformed into Agrobacterium tumefaciens EHA105 by electroporation. Results Genetic segments 2. 9 kb and 3. 7 kb were obtained through restriction enzyme mapping analysis and DNA sequencing, and inserted gene 3 675 bp was shown in the construction recombinant plasmid p2355-gtfB through series analysis and detection. Conclusion The recombinant plasmid was constructed successfully. This research provided basis for further study on plants vaccine against dental caries.%目的 构建含变异链球菌葡糖基转移酶多个免疫显性抗原表位的植物表达质粒p2355-gtfB,为其转化植物研究奠定物质基础,为可食防龋疫苗研究提供条件.方法 以真核表达质粒pcDNA3-gtfB为模板,通过聚合酶链反应(polymerase chain reaction,PCR)扩增含编码变异链球菌葡糖基转移酶抗原表位的目的基因gtfB.将回收纯化的PCR产物经T-A克隆技术克隆于中间载体pMD18-T,双酶切鉴定插入方向后,将目的基因从中间载体释放,再克隆至高效的植物表达载体p2355,用电转化法转化根癌农杆菌EHA105,对重组质粒阳性克隆株进行筛选与鉴定.结果 通过对重组质粒T-gtfB进行酶切图谱分析,获得2.9kb和3.7 kb的2个片断,将重组质粒p2355-gtfB进行酶切、PCR及测序分析,显示p2355-gtfB中插入基因长度为3 675 bp,基因序列与双脱氧链终止法的测定结果相同,证明植物表达质粒p2355-gtfB构建成功,开放阅读框架正确.结论 本研究成功构建了含变异链球菌多个葡糖基转移酶免疫显性抗原表位编码

  4. Restrictive dermopathy and fetal behaviour

    NARCIS (Netherlands)

    Mulder, EJH; Beemer, FA; Stoutenbeek, P

    2001-01-01

    We report three siblings from consecutive pregnancies affected with restrictive dermopathy (RD). During the second pregnancy, fetal behavioural development and growth were studied extensively using ultrasound at 1-4 week intervals. Dramatic and sudden changes occurred in fetal body movements and gro

  5. Legal restrictions and Investment Growth

    NARCIS (Netherlands)

    Lensink, B.W.; Scholtens, B.

    2007-01-01

    We analyze the impact of legal restrictions on investment growth at the firm level. With the help of a unique firm-level survey database, we analyze whether firm investments are related to the efficiency and quality of the judiciary. Furthermore, we analyze whether the investment behavior of large a

  6. Legal restrictions and investment growth

    NARCIS (Netherlands)

    Lensink, B.W.; Scholtens, B.

    2007-01-01

    We analyze the impact of legal restrictions on investment growth at the firm level. With the help of a unique firm-level survey database, we analyze whether firm investments are related to the efficiency and quality of the judiciary, Furthermore, we analyze whether the investment behavior of large a

  7. Restricted Morgan’s problem

    Institute of Scientific and Technical Information of China (English)

    陈树中; 曹立

    1996-01-01

    A new list of regular feedback invariant integers called right independent orders is introduced.That the restricted Morgan’s problem is equivalent to a kind of nonlinear algebraic equations is proved and the condition that the nonlinear algebraic equations degenerate into linear algebraic equations is given.

  8. Plasmid Classification in an Era of Whole-Genome Sequencing: Application in Studies of Antibiotic Resistance Epidemiology

    Science.gov (United States)

    Orlek, Alex; Stoesser, Nicole; Anjum, Muna F.; Doumith, Michel; Ellington, Matthew J.; Peto, Tim; Crook, Derrick; Woodford, Neil; Walker, A. Sarah; Phan, Hang; Sheppard, Anna E.

    2017-01-01

    Plasmids are extra-chromosomal genetic elements ubiquitous in bacteria, and commonly transmissible between host cells. Their genomes include variable repertoires of ‘accessory genes,’ such as antibiotic resistance genes, as well as ‘backbone’ loci which are largely conserved within plasmid families, and often involved in key plasmid-specific functions (e.g., replication, stable inheritance, mobility). Classifying plasmids into different types according to their phylogenetic relatedness provides insight into the epidemiology of plasmid-mediated antibiotic resistance. Current typing schemes exploit backbone loci associated with replication (replicon typing), or plasmid mobility (MOB typing). Conventional PCR-based methods for plasmid typing remain widely used. With the emergence of whole-genome sequencing (WGS), large datasets can be analyzed using in silico plasmid typing methods. However, short reads from popular high-throughput sequencers can be challenging to assemble, so complete plasmid sequences may not be accurately reconstructed. Therefore, localizing resistance genes to specific plasmids may be difficult, limiting epidemiological insight. Long-read sequencing will become increasingly popular as costs decline, especially when resolving accurate plasmid structures is the primary goal. This review discusses the application of plasmid classification in WGS-based studies of antibiotic resistance epidemiology; novel in silico plasmid analysis tools are highlighted. Due to the diverse and plastic nature of plasmid genomes, current typing schemes do not classify all plasmids, and identifying conserved, phylogenetically concordant genes for subtyping and phylogenetics is challenging. Analyzing plasmids as nodes in a network that represents gene-sharing relationships between plasmids provides a complementary way to assess plasmid diversity, and allows inferences about horizontal gene transfer to be made. PMID:28232822

  9. BMP2和TGFβ3双基因真核表达载体的构建%Construction of bicistronic eukaryotic expression plasmid containing BMP2 and TGFβ3 genes

    Institute of Scientific and Technical Information of China (English)

    马小松; 刘金钊; 王昌耀; 王英振; 刘世海; 刘相萍

    2011-01-01

    [目的]构建骨形态发生蛋白BMP2和转化生长因子TGFβ3双基因真核表达载体.[方法]从人胚胎组织提取总RNA,反转录成cDNA,以pGEMT/BMP2和反转录的cDNA为模板,PCR扩增出BMP2和TGFβ3两个基因全长,将两个基因片段分别定向连入双基因真核表达载体pIRES;用酶切的方法筛选出阳性重组质粒,并进行测序鉴定.[结果]酶切鉴定证明已将BMP2和TGFβ3两个基因连入载体中,测序结果完全正确.[结论]成功构建pIRESBMP2/TGFβ3双基因真核表达载体.%[ Objective]To construct a bicistronic eukayotic expression plasmid consisting of BMP2 and TGFβ3 target genes.[ Method ] The DNA fragment of BMP2 and TGFβ3 genes were obtained from pGEMT/BMP2 plasmid and human embryonal tissue by PCR, respectively. They were inserted into bicistronic eukaryotic expression plasmid vector plRES. The inserted target genes in the plasmid were verified by restriction enzyme digestion and nucleotide sequencing. [ Result ] The direction and sequences of the new bicistronic eukaryotic expression plasmid pIRES - BMP2 -TGFβ3 were correct. [ Conclusion] The bicistronic eukaryotic expression plasmid has been constructed successfully.

  10. Construction of a eukaryotic expression plasmid pcDNA3.1-HuR-FLAG and its transient expression in NIH3T3 cells

    Directory of Open Access Journals (Sweden)

    Tao LI

    2011-04-01

    Full Text Available Objective To construct a eukaryotic expression vector for HuR and analyze its expression and biological function in NIH3T3 cells.Methods The total RNA was extracted from NIH3T3 cells and reverse transcribed to cDNAs.The coding region sequence of mouse HuR was then amplified by PCR and subcloned into the pcDNA3.1-FLAG plasmid.The recombinant plasmid pcDNA3.1-HuR-FLAG was verified by PCR and restriction endonuclease analysis,confirmed by DNA sequence analysis,and then transiently transfected into NIH3T3 cells with Lipofectamine LTX.The expression of HuR protein was determined by Western blotting,and the mRNA level of HuR and DUSP1 were analyzed by using real-time PCR.Result The recombinant plasmid pcDNA3.1-HuR-FLAG was correctly constructed.Twenty-four hours after transfection of the recombinant plasmid into NIH3T3 cells,the fusion protein was found to have highly expressed in the cells as revealed by Western blotting.Real-time PCR results detected that the over-expression of HuR could up-regulate the expression of DUSP1.Conclusion The eukaryotic expression vector for HuR-FLAG fusion protein has been successfully constructed and transiently expressed in NIH3T3 cells.It can be used in further analysis of the posttranscriptional regulation of DUSP1 by HuR in cancer cells.

  11. Dissemination and serotype modification potential of pSFxv_2, an O-antigen PEtN modification plasmid in Shigella flexneri.

    Science.gov (United States)

    Sun, Qiangzheng; Knirel, Yuriy A; Lan, Ruiting; Wang, Jianping; Senchenkova, Sof'ya N; Shashkov, Alexander S; Wang, Yan; Wang, Yiting; Luo, Xia; Xu, Jianguo

    2014-03-01

    The O-antigens of all Shigella flexneri serotypes, except serotype 6, share a linear tetrasaccharide repeat composed of one N-acetylglucosamine and three l-rhamnose residues, and differences between the serotypes are due to modification of various monosaccharide residues with glucosyl and/or O-acetyl and/or phosphoethanolamine (PEtN) groups. Plasmid-borne opt (formerly lpt-O) gene encoding a PEtN transferase which modifies the O-antigens of S. flexneri serotype X, 4a and Y strains and converts the hosts into MASF IV-1 (E1037) positive "variant" (v) Xv, 4av and Yv serotypes, respectively. In this study, we showed that the opt-carrying plasmid pSFxv_2 can transform strains of all S. flexneri serotypes (1-6) to confer them with the MASF IV-1 epitope recognized by monoclonal antibody MASF IV-1 and typing antiserum IV. The transformants possessed modified O-antigens with a PEtN group(s) at position 3 of one or two rhamnose residues. In some serotypes, the PEtN modification competed or/and interfered with glucosylation and O-acetylation at the same or its neighboring sugar residue. We also showed that the plasmid pSFxv_2 is mobilizable to other S. flexneri strains by conjugation. Although pSFxv_2-harboring S. flexneri strains found in clinical infections are restricted to serotypes Xv, 4av, Yv and, possibly, 6v, our results demonstrate a high potential of dissemination of this plasmid in S. flexneri and emergence of new S. flexneri serotypes.

  12. IncHI2 Plasmids Are Predominant in Antibiotic-Resistant Salmonella Isolates

    Science.gov (United States)

    Chen, Wenyao; Fang, Tingzi; Zhou, Xiujuan; Zhang, Daofeng; Shi, Xianming; Shi, Chunlei

    2016-01-01

    The wide usage of antibiotics contributes to the increase in the prevalence of antibiotic-resistant Salmonella. Plasmids play a critical role in horizontal transfer of antibiotic resistance markers in Salmonella. This study aimed to screen and characterize plasmid profiles responsible for antibiotic resistance in Salmonella and ultimately to clarify the molecular mechanism of transferable plasmid-mediated antibiotic resistance. A total of 226 Salmonella isolates were examined for antimicrobial susceptibility by a disk diffusion method. Thirty-two isolates (14.2%) were resistant to at least one antibiotic. The presence of plasmid-mediated quinolone resistance (PMQR) genes and β-lactamase genes were established by PCR amplification. PCR-based replicon typing revealed that these 32 isolates represented seven plasmid incompatibility groups (IncP, HI2, A/C, FIIs, FIA, FIB, and I1), and the IncHI2 (59.4%) was predominant. Antibiotic resistance markers located on plasmids were identified through plasmid curing. Fifteen phenotypic variants were obtained with the curing efficiency of 46.9% (15/32). The cured plasmids mainly belong to the HI2 incompatibility group. The elimination of IncHI2 plasmids correlated with the loss of β-lactamase genes (blaOXA-1 and blaTEM-1) and PMQR genes (qnrA and aac(6′)-Ib-cr). Both IncHI2 and IncI1 plasmids in a S. enterica serovar Indiana isolate SJTUF 10584 were lost by curing. The blaCMY -2-carrying plasmid pS10584 from SJTUF 10584 was fully sequenced. Sequence analysis revealed that it possessed a plasmid scaffold typical for IncI1 plasmids with the unique genetic arrangement of IS1294-ΔISEcp1-blaCMY -2-blc-sugE-ΔecnR inserted into the colicin gene cia. These data suggested that IncHI2 was the major plasmid lineage contributing to the dissemination of antibiotic resistance in Salmonella and the activity of multiple mobile genetic elements may contribute to antibiotic resistance evolution and dissemination between different plasmid

  13. Genetic diversity and composition of a plasmid metagenome from a wastewater treatment plant.

    Science.gov (United States)

    Schlüter, Andreas; Krause, Lutz; Szczepanowski, Rafael; Goesmann, Alexander; Pühler, Alfred

    2008-08-31

    Plasmid metagenome nucleotide sequence data were recently obtained from wastewater treatment plant (WWTP) bacteria with reduced susceptibility to selected antimicrobial drugs by applying the ultrafast 454-sequencing technology. The sequence dataset comprising 36,071,493 bases (346,427 reads with an average read length of 104 bases) was analysed for genetic diversity and composition by using a newly developed bioinformatic pipeline based on assignment of environmental gene tags (EGTs) to protein families stored in the Pfam database. Short amino acid sequences deduced from the plasmid metagenome sequence reads were compared to profile hidden Markov models underlying Pfam. Obtained matches evidenced that many reads represent genes having predicted functions in plasmid replication, stability and plasmid mobility which indicates that WWTP bacteria harbour genetically stabilised and mobile plasmids. Moreover, the data confirm a high diversity of plasmids residing in WWTP bacteria. The mobile organic peroxide resistance plasmid pMAC from Acinetobacter baumannii was identified as reference plasmid for the most abundant replication module type in the sequenced sample. Accessory plasmid modules encode different transposons, insertion sequences, integrons, resistance and virulence determinants. Most of the matches to Transposase protein families were identified for transposases similar to the one of the chromate resistance transposon Tn5719. Noticeable are hits to beta-lactamase protein families which suggests that plasmids from WWTP bacteria encode different enzymes possessing beta-lactam-hydrolysing activity. Some of the sequence reads correspond to antibiotic resistance genes that were only recently identified in clinical isolates of human pathogens. EGT analysis thus proofed to be a very valuable method to explore genetic diversity and composition of the present plasmid metagenome dataset.

  14. Plasmids of Carotenoid-Producing Paracoccus spp. (Alphaproteobacteria) - Structure, Diversity and Evolution

    Science.gov (United States)

    Maj, Anna; Dziewit, Lukasz; Czarnecki, Jakub; Wlodarczyk, Miroslawa; Baj, Jadwiga; Skrzypczyk, Grazyna; Giersz, Dorota; Bartosik, Dariusz

    2013-01-01

    Plasmids are components of many bacterial genomes. They enable the spread of a large pool of genetic information via lateral gene transfer. Many bacterial strains contain mega-sized replicons and these are particularly common in Alphaproteobacteria. Considerably less is known about smaller alphaproteobacterial plasmids. We analyzed the genomes of 14 such plasmids residing in 4 multireplicon carotenoid-producing strains of the genus Paracoccus (Alphaproteobacteria): P. aestuarii DSM 19484, P. haeundaensis LG P-21903, P. marcusii DSM 11574 and P. marcusii OS22. Comparative analyses revealed mosaic structures of the plasmids and recombinational shuffling of diverse genetic modules involved in (i) plasmid replication, (ii) stabilization (including toxin-antitoxin systems of the relBE/parDE, tad-ata, higBA, mazEF and toxBA families) and (iii) mobilization for conjugal transfer (encoding relaxases of the MobQ, MobP or MobV families). A common feature of the majority of the plasmids is the presence of AT-rich sequence islets (located downstream of exc1-like genes) containing genes, whose homologs are conserved in the chromosomes of many bacteria (encoding e.g. RelA/SpoT, SMC-like proteins and a retron-type reverse transcriptase). The results of this study have provided insight into the diversity and plasticity of plasmids of Paracoccus spp., and of the entire Alphaproteobacteria. Some of the identified plasmids contain replication systems not described previously in this class of bacteria. The composition of the plasmid genomes revealed frequent transfer of chromosomal genes into plasmids, which significantly enriches the pool of mobile DNA that can participate in lateral transfer. Many strains of Paracoccus spp. have great biotechnological potential, and the plasmid vectors constructed in this study will facilitate genetic studies of these bacteria. PMID:24260361

  15. Characterization and comparative analysis of antibiotic resistance plasmids isolated from a wastewater treatment plant.

    Directory of Open Access Journals (Sweden)

    Teddie O Rahube

    2014-10-01

    Full Text Available A wastewater treatment plant (WWTP is an environment high in nutrient concentration with diverse bacterial populations and can provide an ideal environment for the proliferation of mobile elements such as plasmids. WWTPs have also been identified as reservoirs for antibiotic resistance genes that are associated with human pathogens. The objectives of this study were to isolate and characterize self-transmissible or mobilizable resistance plasmids associated with effluent from wastewater treatment plant. An enrichment culture approach designed to capture plasmids conferring resistance to high concentrations of erythromycin was used to capture plasmids from an urban wastewater treatment plant servicing a population of ca. 210,000. DNA sequencing of the plasmids revealed diversity of plasmids represented by incompatibility groups IncU, col-E, IncFII and IncP-1β. Genes coding resistance to clinically relevant antibiotics (macrolide, tetracycline, beta-lactam, trimethoprim, chloramphenicol, sulphonamide, quaternary ammonium compounds and heavy metals were co-located on these plasmids, often within transposable and integrative mobile elements. Several of the plasmids were self-transmissible or mobilizable and could be maintained in the absence of antibiotic selection. The IncFII plasmid pEFC36a showed the highest degree of sequence identity to plasmid R1 which has been isolated in England more than fifty years ago from a patient suffering from a Salmonella infection. Functional conservation of key regulatory features of this F-like conjugation module were demonstrated by the finding that the conjugation frequency of pEFC36a could be stimulated by the positive regulator of plasmid R1 DNA transfer genes, TraJ.

  16. Characterization and comparative analysis of antibiotic resistance plasmids isolated from a wastewater treatment plant.

    Science.gov (United States)

    Rahube, Teddie O; Viana, Laia S; Koraimann, Günther; Yost, Christopher K

    2014-01-01

    A wastewater treatment plant (WWTP) is an environment high in nutrient concentration with diverse bacterial populations and can provide an ideal environment for the proliferation of mobile elements such as plasmids. WWTPs have also been identified as reservoirs for antibiotic resistance genes that are associated with human pathogens. The objectives of this study were to isolate and characterize self-transmissible or mobilizable resistance plasmids associated with effluent from WWTP. An enrichment culture approach designed to capture plasmids conferring resistance to high concentrations of erythromycin was used to capture plasmids from an urban WWTP servicing a population of ca. 210,000. DNA sequencing of the plasmids revealed diversity of plasmids represented by incompatibility groups IncU, col-E, IncFII and IncP-1β. Genes coding resistance to clinically relevant antibiotics (macrolide, tetracycline, beta-lactam, trimethoprim, chloramphenicol, sulphonamide), quaternary ammonium compounds and heavy metals were co-located on these plasmids, often within transposable and integrative mobile elements. Several of the plasmids were self-transmissible or mobilizable and could be maintained in the absence of antibiotic selection. The IncFII plasmid pEFC36a showed the highest degree of sequence identity to plasmid R1 which has been isolated in England more than 50 years ago from a patient suffering from a Salmonella infection. Functional conservation of key regulatory features of this F-like conjugation module were demonstrated by the finding that the conjugation frequency of pEFC36a could be stimulated by the positive regulator of plasmid R1 DNA transfer genes, TraJ.

  17. Characterization of plasmids in extensively drug-resistant acinetobacter strains isolated in India and Pakistan.

    Science.gov (United States)

    Jones, Lim S; Carvalho, Maria J; Toleman, Mark A; White, P Lewis; Connor, Thomas R; Mushtaq, Ammara; Weeks, Janis L; Kumarasamy, Karthikeyan K; Raven, Katherine E; Török, M Estée; Peacock, Sharon J; Howe, Robin A; Walsh, Timothy R

    2015-02-01

    The blaNDM-1 gene is associated with extensive drug resistance in Gram-negative bacteria. This probably spread to Enterobacteriaceae from Acinetobacter spp., and we characterized plasmids associated with blaNDM-1 in Acinetobacter spp. to gain insight into their role in this dissemination. Four clinical NDM-1-producing Acinetobacter species strains from India and Pakistan were investigated. A plasmid harboring blaNDM-1, pNDM-40-1, was characterized by whole-genome sequencing of Acinetobacter bereziniae CHI-40-1 and comparison with related plasmids. The presence of similar plasmids in strains from Pakistan was sought by PCR and sequencing of amplicons. Conjugation frequency was tested and stability of pNDM-40-1 investigated by real-time PCR of isolates passaged with and without antimicrobial selection pressure. A. bereziniae and Acinetobacter haemolyticus strains contained plasmids similar to the pNDM-BJ01-like plasmids identified in Acinetobacter spp. in China. The backbone of pNDM-40-1 was almost identical to that of pNDM-BJ01-like plasmids, but the transposon harboring blaNDM-1, Tn125, contained two short deletions. Escherichia coli and Acinetobacter pittii transconjugants were readily obtained. Transconjugants retained pNDM-40-1 after a 14-day passage experiment, although stability was greater with meropenem selection. Fragments of pNDM-BJ01-like plasmid backbones are found near blaNDM-1 in some genetic contexts from Enterobacteriaceae, suggesting that cross-genus transfer has occurred. pNDM-BJ01-like plasmids have been described in isolates originating from a wide geographical region in southern Asia. In vitro data on plasmid transfer and stability suggest that these plasmids could have contributed to the spread of blaNDM-1 into Enterobacteriaceae.

  18. CALS Mapping

    DEFF Research Database (Denmark)

    Collin, Ib; Nielsen, Povl Holm; Larsen, Michael Holm

    1998-01-01

    To enhance the industrial applications of CALS, CALS Center Danmark has developed a cost efficient and transparent assessment, CALS Mapping, to uncover the potential of CALS - primarily dedicated to small and medium sized enterprises. The idea behind CALS Mapping is that the CALS State...... enterprise is, when applied in a given organisation modified with respect to the industry regarded, hence irrelevant measure parameters are eliminated to avoid redundancy. This assessment of CALS Mapping, quantify the CALS potential of an organisation with the purpose of providing decision support to the top...

  19. 30 CFR 56.11008 - Restricted clearance.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Restricted clearance. 56.11008 Section 56.11008 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Restricted clearance. Where restricted clearance creates a hazard to persons, the restricted clearance...

  20. 30 CFR 57.11008 - Restricted clearance.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Restricted clearance. 57.11008 Section 57.11008... Escapeways Travelways-Surface and Underground § 57.11008 Restricted clearance. Where restricted clearance creates a hazard to persons, the restricted clearance shall be conspicuously marked....