WorldWideScience

Sample records for plasmid restriction enzyme

  1. The Cloning of the Human Tumor Supressor Gene INGI: DNA Cloning into Plasmid Vector and DNA Analysis by Restriction Enzymes

    Directory of Open Access Journals (Sweden)

    Elza Ibrahim Auerkari

    2015-11-01

    Full Text Available DNA cloning is one of the most important techniques In the field of molecular biology, with a critical role in analyzing the structure and function of genes and their adjacent regulatory regions. DNA cloning is helpful in learning fundamental molecular biological techniques, since DNA cloning involves a series of them, such as polymerase chain reaction (PCR, DNA ligation, bacterial transformation, bacterial culture, plasmid DNA extraction, DNA digestion with restriction enzymes and agarose gel electrophoresis. In this paper the cloning of the human tumor suppressor gene INGI has been used to illustrate the methodology. The gene was amplified by PCR, cloned into a TA-cloning vectore, and restriction enzyme mapping was used to distinguish the sense INGI construct from the antisense INGI construct.

  2. A User-Friendly Method for Teaching Restriction Enzyme Mapping.

    Science.gov (United States)

    Ehrman, Patrick

    1990-01-01

    Presented is a teaching progression that enhances learning through low-cost, manipulative transparencies. Discussed is instruction about restriction enzymes, plasmids, cutting plasmids, plasmid maps, recording data, and mapping restriction sites. Mapping wheels for student use is included. (CW)

  3. Restriction Enzyme Mapping: A Simple Student Practical.

    Science.gov (United States)

    Higgins, Stephen J.; And Others

    1990-01-01

    An experiment that uses the recombinant plasmid pX1108 to illustrate restriction mapping is described. The experiment involves three restriction enzymes and employs single and double restriction enzyme digestions. A list of needed materials, procedures, safety precautions, results, and discussion are included. (KR)

  4. Use of sperm plasmid DNA lipofection combined with REMI (restriction enzyme-mediated insertion) for production of transgenic chickens expressing eGFP (enhanced green fluorescent protein) or human follicle-stimulating hormone.

    Science.gov (United States)

    Harel-Markowitz, Eliane; Gurevich, Michael; Shore, Laurence S; Katz, Adi; Stram, Yehuda; Shemesh, Mordechai

    2009-05-01

    Linearized p-eGFP (plasmid-enhanced green fluorescent protein) or p-hFSH (plasmid human FSH) sequences with the corresponding restriction enzyme were lipofected into sperm genomic DNA. Sperm transfected with p-eGFP were used for artificial insemination in hens, and in 17 out of 19 of the resultant chicks, the exogenous DNA was detected in their lymphocytes as determined by PCR and expressed in tissues as determined by (a) PCR, (b) specific emission of green fluorescence by the eGFP, and (c) Southern blot analysis. A complete homology was found between the Aequorea Victoria eGFP DNA and a 313-bp PCR product of extracted DNA from chick blood cells. Following insemination with sperm lipofected with p-hFSH, transgenic offspring were obtained for two generations as determined by detection of the transgene for human FSH (PCR) and expression of the gene (RT-PCR and quantitative real-time PCR) and the presence of the protein in blood (radioimmunoassay). Data demonstrate that lipofection of plasmid DNA with restriction enzyme is a highly efficient method for the production of transfected sperm to produce transgenic offspring by direct artificial insemination.

  5. Type I restriction enzymes and their relatives.

    Science.gov (United States)

    Loenen, Wil A M; Dryden, David T F; Raleigh, Elisabeth A; Wilson, Geoffrey G

    2014-01-01

    Type I restriction enzymes (REases) are large pentameric proteins with separate restriction (R), methylation (M) and DNA sequence-recognition (S) subunits. They were the first REases to be discovered and purified, but unlike the enormously useful Type II REases, they have yet to find a place in the enzymatic toolbox of molecular biologists. Type I enzymes have been difficult to characterize, but this is changing as genome analysis reveals their genes, and methylome analysis reveals their recognition sequences. Several Type I REases have been studied in detail and what has been learned about them invites greater attention. In this article, we discuss aspects of the biochemistry, biology and regulation of Type I REases, and of the mechanisms that bacteriophages and plasmids have evolved to evade them. Type I REases have a remarkable ability to change sequence specificity by domain shuffling and rearrangements. We summarize the classic experiments and observations that led to this discovery, and we discuss how this ability depends on the modular organizations of the enzymes and of their S subunits. Finally, we describe examples of Type II restriction-modification systems that have features in common with Type I enzymes, with emphasis on the varied Type IIG enzymes.

  6. Sequence specific inhibition of DNA restriction enzyme cleavage by PNA

    DEFF Research Database (Denmark)

    Nielsen, P.E.; Egholm, M.; Berg, R.H.

    1993-01-01

    Plasmids containing double-stranded 10-mer PNA (peptide nucleic acid chimera) targets proximally flanked by two restriction enzyme sites were challenged with the complementary PNA or PNAs having one or two mismatches, and the effect on the restriction enzyme cleavage of the flanking sites...... was assayed. The following PNAs were used: T10-LysNH2, T5CT4-LysNH2 and T2CT2CT4-LysNH2 and the corresponding targets cloned into pUC 19 were flanked by BamH1, Sal1 or Pstl sites, respectively. In all cases it was found that complete inhibition of restriction enzyme cleavage was obtained...

  7. Revised selection criteria for candidate restriction enzymes in genome walking.

    Science.gov (United States)

    Taheri, Ali; Robinson, Stephen J; Parkin, Isobel; Gruber, Margaret Y

    2012-01-01

    A new method to improve the efficiency of flanking sequence identification by genome walking was developed based on an expanded, sequential list of criteria for selecting candidate enzymes, plus several other optimization steps. These criteria include: step (1) initially choosing the most appropriate restriction enzyme according to the average fragment size produced by each enzyme determined using in silico digestion of genomic DNA, step (2) evaluating the in silico frequency of fragment size distribution between individual chromosomes, step (3) selecting those enzymes that generate fragments with the majority between 100 bp and 3,000 bp, step (4) weighing the advantages and disadvantages of blunt-end sites vs. cohesive-end sites, step (5) elimination of methylation sensitive enzymes with methylation-insensitive isoschizomers, and step (6) elimination of enzymes with recognition sites within the binary vector sequence (T-DNA and plasmid backbone). Step (7) includes the selection of a second restriction enzyme with highest number of recognition sites within regions not covered by the first restriction enzyme. Step (8) considers primer and adapter sequence optimization, selecting the best adapter-primer pairs according to their hairpin/dimers and secondary structure. In step (9), the efficiency of genomic library development was improved by column-filtration of digested DNA to remove restriction enzyme and phosphatase enzyme, and most important, to remove small genomic fragments (enzymes, NsiI and NdeI, fit these criteria for the Arabidopsis thaliana genome. Their efficiency was assessed using 54 T(3) lines from an Arabidopsis SK enhancer population. Over 70% success rate was achieved in amplifying the flanking sequences of these lines. This strategy was also tested with Brachypodium distachyon to demonstrate its applicability to other larger genomes.

  8. Restriction enzyme mining for SNPs in genomes.

    Science.gov (United States)

    Chuang, Li-Yeh; Yang, Cheng-Hong; Tsui, Ke-Hung; Cheng, Yu-Huei; Chang, Phei-Lang; Wen, Cheng-Hao; Chang, Hsueh-Wei

    2008-01-01

    Many different single nucleotide polymorphisms (SNPs) genotyping methods have been developed recently. However, most of them are expensive. Using restriction enzymes for SNP genotyping is a cost-effective method. However, restriction enzyme mining for SNPs in a genome sequence is still challenging for researchers who do not have a background in genomics and bioinformatics. In this review, the basic bioinformatics tools used for restriction enzyme mining for SNP genotyping are summarized and described. The objectives of this paper include: i) the introduction of SNPs, genotyping and PCR-restriction fragment length polymorphism (RFLP); ii) a review of components for genotyping software, including tools for primer design only or restriction enzyme mining only; iii) a review of software providing the flanking sequence for primer design; iv) recent advances in PCR-RFLP tools and natural and mutagenic PCR-RFLP; v) highlighting the strategy for restriction enzyme mining for SNP genotyping; vi) a discussion of potential problems for multiple PCR-RFLP. The different implications for restriction enzymes on sense and antisense strands are also discussed. Our PCR-RFLP freeware, SNP-RFLPing, is included in this review to illustrate many characteristics of PCR-RFLP software design. Future developments will include further sophistication of PCR-RFLP software in order to provide better visualization and a more interactive environment for SNP genotyping and to integrate the software with other tools used in association studies.

  9. Plasmid dependence of Pseudomonas sp. strain NK87 enzymes that degrade 6-aminohexanoate-cyclic dimer.

    Science.gov (United States)

    Kanagawa, K; Negoro, S; Takada, N; Okada, H

    1989-06-01

    A bacterial strain, Pseudomonas sp. strain NK87, that can use 6-aminohexanoate-cyclic dimer as the sole source of carbon and nitrogen was newly isolated from wastewater of a factory which produces nylon-6. Two responsible enzymes, 6-aminohexanoate-cyclic-dimer hydrolase (P-EI) and 6-aminohexanoate-dimer hydrolase (P-EII), were found in the NK87 strain, as is the case with Flavobacterium sp. strain KI72, another 6-aminohexanoate-cyclic-dimer-metabolizing bacterium (H. Okada, S. Negoro, H. Kimura, and S. Nakamura, Nature [London] 306:203-206, 1983). The P-EI enzyme is immunologically identical to the 6-aminohexanoate-cyclic-dimer hydrolase of KI72 (F-EI). However, antiserum against the 6-aminohexanoate-dimer hydrolase purified from KI72 (F-EII) did not react with cell extracts of NK87, indicating that the F-EII and P-EII enzymes are immunologically different. Restriction endonuclease analyses show that the NK87 strain harbors at least six plasmids ranging in size from 20 to 80 kilobase pairs (kbp). The P-EI and P-EII genes were cloned in Escherichia coli. Both the P-EI and F-EI probes strongly hybridized with a 23-kbp plasmid in Southern hybridization analyses. The P-EII probe hybridized specifically with an 80-kbp plasmid, but the F-EII probe hybridized with none of the plasmids harbored in NK87. These results indicate that the P-EI gene and P-EII gene are encoded on the 23-kbp and 80-kbp plasmids, respectively.

  10. Programmable DNA-Guided Artificial Restriction Enzymes.

    Science.gov (United States)

    Enghiad, Behnam; Zhao, Huimin

    2017-02-06

    Restriction enzymes are essential tools for recombinant DNA technology that have revolutionized modern biological research. However, they have limited sequence specificity and availability. Here we report a Pyrococcus furiosus Argonaute (PfAgo) based platform for generating artificial restriction enzymes (AREs) capable of recognizing and cleaving DNA sequences at virtually any arbitrary site and generating defined sticky ends of varying length. Short DNA guides are used to direct PfAgo to target sites for cleavage at high temperatures (>87 °C) followed by reannealing of the cleaved single stranded DNAs. We used this platform to generate over 18 AREs for DNA fingerprinting and molecular cloning of PCR-amplified or genomic DNAs. These AREs work as efficiently as their naturally occurring counterparts, and some of them even do not have any naturally occurring counterparts, demonstrating easy programmability, generality, versatility, and high efficiency for this new technology.

  11. Restriction enzyme-mediated DNA family shuffling.

    Science.gov (United States)

    Behrendorff, James B Y H; Johnston, Wayne A; Gillam, Elizabeth M J

    2014-01-01

    DNA shuffling is an established recombinatorial method that was originally developed to increase the speed of directed evolution experiments beyond what could be accomplished using error-prone PCR alone. To achieve this, mutated copies of a protein-coding sequence are fragmented with DNase I and the fragments are then reassembled in a PCR without primers. The fragments anneal where there is sufficient sequence identity, resulting in full-length variants of the original gene that have inherited mutations from multiple templates. Subsequent studies demonstrated that directed evolution could be further accelerated by shuffling similar native protein-coding sequences from the same gene family, rather than mutated variants of a single gene. Generally at least 65-75 % global identity between parental sequences is required in DNA family shuffling, with recombination mostly occurring at sites with at least five consecutive nucleotides of local identity. Since DNA shuffling was originally developed, many variations on the method have been published. In particular, the use of restriction enzymes in the fragmentation step allows for greater customization of fragment lengths than DNase I digestion and avoids the risk that parental sequences may be over-digested into unusable very small fragments. Restriction enzyme-mediated fragmentation also reduces the occurrence of undigested parental sequences that would otherwise reduce the number of unique variants in the resulting library. In the current chapter, we provide a brief overview of the alternative methods currently available for DNA shuffling as well as a protocol presented here that improves on several previous implementations of restriction enzyme-mediated DNA family shuffling, in particular with regard to purification of DNA fragments for reassembly.

  12. Restriction Enzymes in Microbiology, Biotechnology and Biochemistry

    Directory of Open Access Journals (Sweden)

    Geoffrey G. Wilson

    2012-12-01

    Full Text Available Since their discovery in the nineteen-seventies, a collection of simple enzymes termed Type II restriction endonucleases, made by microbes to ward off viral infections, have transformed molecular biology, spawned the multi-billion dollar Biotechnology industry, and yielded fundamental insights into the biochemistry of life, health and disease. In this article we describe how these enzymes were discovered, and we review their properties, organizations and genetics. We summarize current ideas about the mechanism underlying their remarkable ability to recognize and bind to specific base pair sequences in DNA, and we discuss why these ideas might not be correct. We conclude by proposing an alternative explanation for sequence-recognition that resolves certain inconsistencies and provides, in our view, a more satisfactory account of the mechanism.

  13. Mechanistic insights into type III restriction enzymes.

    Science.gov (United States)

    Raghavendra, Nidhanapati K; Bheemanaik, Shivakumara; Rao, Desirazu N

    2012-01-01

    Type III restriction-modification (R-M) enzymes need to interact with two separate unmethylated DNA sequences in indirectly repeated, head-to-head orientations for efficient cleavage to occur at a defined location next to only one of the two sites. However, cleavage of sites that are not in head-to-head orientation have been observed to occur under certain reaction conditions in vitro. ATP hydrolysis is required for the long-distance communication between the sites prior to cleavage. Type III R-M enzymes comprise two subunits, Res and Mod that form a homodimeric Mod2 and a heterotetrameric Res2Mod2 complex. The Mod subunit in M2 or R2M2 complex recognizes and methylates DNA while the Res subunit in R2M2 complex is responsible for ATP hydrolysis, DNA translocation and cleavage. A vast majority of biochemical studies on Type III R-M enzymes have been undertaken using two closely related enzymes, EcoP1I and EcoP15I. Divergent opinions about how the long-distance interaction between the recognition sites exist and at least three mechanistic models based on 1D- diffusion and/or 3D- DNA looping have been proposed.

  14. Characterization and restriction analysis of the P sex factor and the cryptic plasmid of Vibrio cholerae strain V58.

    Science.gov (United States)

    Bartowsky, E J; Morelli, G; Kamke, M; Manning, P A

    1987-07-01

    The P plasmid of Vibrio cholerae is a derepressed sex factor restricted to V. cholerae and has been shown to express surface exclusion. We have isolated the plasmids of strain V58 and have found that in addition to P, two further cryptic plasmids are also present. P has a size of 68 kb as determined by both electron microscopy and restriction endonuclease analysis. These other plasmids are 34 and 4.7 kb in size. Restriction maps of P and the larger cryptic plasmid have been determined. It has been demonstrated that P differs from the standard Inc group test plasmids and also expresses a surface exclusion system. The ability of the type Inc plasmids to be transferred to V. cholerae by either liquid or filter matings and the stability of these plasmids in V. cholerae have also been examined.

  15. Streptomyces lipmanii expresses two restriction systems that inhibit plasmid transformation and bacteriophage plaque formation.

    Science.gov (United States)

    Matsushima, P; Baltz, R H

    1989-06-01

    Bacteriophage host range studies suggested that several beta-lactam-producing streptomycetes express similar restriction-modification systems. Streptomyces lipmanii LE32 expressed two restriction-modification systems, designated SliI and SliII. A mutant strain, PM87, was defective only in SliI restriction but expressed both SliI and SliII modification. Streptomyces sp. strain A57986, a natural isolate partially deficient in the expression of SliI and SliII restriction, nevertheless modified bacteriophage DNA for both SliI and SliII specificities. Protoplasts of PM87 and A57986 were transformed by several plasmids, and the modified plasmids isolated from these strains transformed wild-type S. lipmanii efficiently.

  16. Restriction enzyme-mediated integration used to produce pathogenicity mutants of Colletotrichum graminicola.

    Science.gov (United States)

    Thon, M R; Nuckles, E M; Vaillancourt, L J

    2000-12-01

    We have developed a restriction enzyme-mediated insertional mutagenesis (REMI) system for the maize pathogen Colletotrichum graminicola. In this report, we demonstrate the utility of a REMI-based mutagenesis approach to identify novel pathogenicity genes. Use of REMI increased transformation efficiency by as much as 27-fold over transformations with linearized plasmid alone. Ninety-nine transformants were examined by Southern analysis, and 51% contained simple integrations consisting of one copy of the vector integrated at a single site in the genome. All appeared to have a plasmid integration at a unique site. Sequencing across the integration sites of six transformants demonstrated that in all cases the plasmid integration occurred at the corresponding restriction enzyme-recognition site. We used an in vitro bioassay to identify two pathogenicity mutants among 660 transformants. Genomic DNA flanking the plasmid integration sites was used to identify corresponding cosmids in a wild-type genomic library. The pathogenicity of one of the mutants was restored when it was transformed with the cosmids.

  17. Type I restriction endonucleases are true catalytic enzymes.

    Science.gov (United States)

    Bianco, Piero R; Xu, Cuiling; Chi, Min

    2009-06-01

    Type I restriction endonucleases are intriguing, multifunctional complexes that restrict DNA randomly, at sites distant from the target sequence. Restriction at distant sites is facilitated by ATP hydrolysis-dependent, translocation of double-stranded DNA towards the stationary enzyme bound at the recognition sequence. Following restriction, the enzymes are thought to remain associated with the DNA at the target site, hydrolyzing copious amounts of ATP. As a result, for the past 35 years type I restriction endonucleases could only be loosely classified as enzymes since they functioned stoichiometrically relative to DNA. To further understand enzyme mechanism, a detailed analysis of DNA cleavage by the EcoR124I holoenzyme was done. We demonstrate for the first time that type I restriction endonucleases are not stoichiometric but are instead catalytic with respect to DNA. Further, the mechanism involves formation of a dimer of holoenzymes, with each monomer bound to a target sequence and, following cleavage, each dissociates in an intact form to bind and restrict subsequent DNA molecules. Therefore, type I restriction endonucleases, like their type II counterparts, are true enzymes. The conclusion that type I restriction enzymes are catalytic relative to DNA has important implications for the in vivo function of these previously enigmatic enzymes.

  18. Human papillomavirus DNA from warts for typing by endonuclease restriction patterns: purification by alkaline plasmid methods.

    Science.gov (United States)

    Chinami, M; Tanikawa, E; Hachisuka, H; Sasai, Y; Shingu, M

    1990-01-01

    The alkaline plasmid DNA extraction method of Birnboim and Doly was applied for the isolation of human papillomavirus (HPV) from warts. Tissue from common and plantar warts was digested with proteinase K, and the extrachromosomal circular covalently-closed form of HPV-DNA was rapidly extracted by alkaline sodium dodecyl sulphate and phenol-chloroform treatment. Recovery of HPV-DNA from the tissue was sufficient for determination of endonuclease restriction patterns by agarose gel electrophoresis.

  19. Restriction enzyme cutting site distribution regularity for DNA looping technology.

    Science.gov (United States)

    Shang, Ying; Zhang, Nan; Zhu, Pengyu; Luo, Yunbo; Huang, Kunlun; Tian, Wenying; Xu, Wentao

    2014-01-25

    The restriction enzyme cutting site distribution regularity and looping conditions were studied systematically. We obtained the restriction enzyme cutting site distributions of 13 commonly used restriction enzymes in 5 model organism genomes through two novel self-compiled software programs. All of the average distances between two adjacent restriction sites fell sharply with increasing statistic intervals, and most fragments were 0-499 bp. A shorter DNA fragment resulted in a lower looping rate, which was also directly proportional to the DNA concentration. When the length was more than 500 bp, the concentration did not affect the looping rate. Therefore, the best known fragment length was longer than 500 bp, and did not contain the restriction enzyme cutting sites which would be used for digestion. In order to make the looping efficiencies reach nearly 100%, 4-5 single cohesive end systems were recommended to digest the genome separately.

  20. The other face of restriction: modification-dependent enzymes.

    Science.gov (United States)

    Loenen, Wil A M; Raleigh, Elisabeth A

    2014-01-01

    The 1952 observation of host-induced non-hereditary variation in bacteriophages by Salvador Luria and Mary Human led to the discovery in the 1960s of modifying enzymes that glucosylate hydroxymethylcytosine in T-even phages and of genes encoding corresponding host activities that restrict non-glucosylated phage DNA: rglA and rglB (restricts glucoseless phage). In the 1980's, appreciation of the biological scope of these activities was dramatically expanded with the demonstration that plant and animal DNA was also sensitive to restriction in cloning experiments. The rgl genes were renamed mcrA and mcrBC (modified cytosine restriction). The new class of modification-dependent restriction enzymes was named Type IV, as distinct from the familiar modification-blocked Types I-III. A third Escherichia coli enzyme, mrr (modified DNA rejection and restriction) recognizes both methylcytosine and methyladenine. In recent years, the universe of modification-dependent enzymes has expanded greatly. Technical advances allow use of Type IV enzymes to study epigenetic mechanisms in mammals and plants. Type IV enzymes recognize modified DNA with low sequence selectivity and have emerged many times independently during evolution. Here, we review biochemical and structural data on these proteins, the resurgent interest in Type IV enzymes as tools for epigenetic research and the evolutionary pressures on these systems.

  1. Golden gate shuffling: a one-pot DNA shuffling method based on type IIs restriction enzymes.

    Directory of Open Access Journals (Sweden)

    Carola Engler

    Full Text Available We have developed a protocol to assemble in one step and one tube at least nine separate DNA fragments together into an acceptor vector, with 90% of recombinant clones obtained containing the desired construct. This protocol is based on the use of type IIs restriction enzymes and is performed by simply subjecting a mix of 10 undigested input plasmids (nine insert plasmids and the acceptor vector to a restriction-ligation and transforming the resulting mix in competent cells. The efficiency of this protocol allows generating libraries of recombinant genes by combining in one reaction several fragment sets prepared from different parental templates. As an example, we have applied this strategy for shuffling of trypsinogen from three parental templates (bovine cationic trypsinogen, bovine anionic trypsinogen and human cationic trypsinogen each divided in 9 separate modules. We show that one round of shuffling using the 27 trypsinogen entry plasmids can easily produce the 19,683 different possible combinations in one single restriction-ligation and that expression screening of a subset of the library allows identification of variants that can lead to higher expression levels of trypsin activity. This protocol, that we call 'Golden Gate shuffling', is robust, simple and efficient, can be performed with templates that have no homology, and can be combined with other shuffling protocols in order to introduce any variation in any part of a given gene.

  2. REtools: A laboratory program for restriction enzyme work: enzyme selection and reaction condition assistance

    Directory of Open Access Journals (Sweden)

    Boulukos Kim E

    2006-02-01

    Full Text Available Abstract Background Restriction enzymes are one of the everyday tools used in molecular biology. The continuously expanding panel of known restriction enzymes (several thousands renders their optimal use virtually impossible without computerized assistance. Several manufacturers propose on-line sites that assist scientists in their restriction enzyme work, however, none of these sites meet all the actual needs of laboratory workers, and they do not take into account the enzymes actually present in one's own laboratory. Results Using FileMaker Pro, we developed a stand-alone application which can run on both PCs and Macintoshes. We called it REtools, for Restriction Enzyme tools. This program, which references all currently known enzymes (>3500, permits the creation and update of a personalized list of restriction enzymes actually available in one's own laboratory. Upon opening the program, scientists will be presented with a user friendly interface that will direct them to different menus, each one corresponding to different situations that restriction enzyme users commonly encounter. We particularly emphasized the ease of use to make REtools a solution that laboratory members would actually want to use. Conclusion REtools, a user friendly and easily customized program to organize any laboratory enzyme stock, brings a software solution that will make restriction enzyme use and reaction condition determination straightforward and efficient. The usually unexplored potential of isoschizomers also becomes accessible to all, since REtools proposes all possible enzymes similar to the one(s chosen by the user. Finally, many of the commonly overlooked subtleties of restriction enzyme work, such as methylation requirement, unusual reaction conditions, or the number of flanking bases required for cleavage, are automatically provided by REtools.

  3. Processing of Nonconjugative Resistance Plasmids by Conjugation Nicking Enzyme of Staphylococci

    Energy Technology Data Exchange (ETDEWEB)

    Pollet, Rebecca M.; Ingle, James D.; Hymes, Jeff P.; Eakes, Thomas C.; Eto, Karina Yui; Kwong, Stephen M.; Ramsay, Joshua P.; Firth, Neville; Redinbo, Matthew R.; Christie, P. J.

    2016-01-04

    Antimicrobial resistance inStaphylococcus aureuspresents an increasing threat to human health. This resistance is often encoded on mobile plasmids, such as pSK41; however, the mechanism of transfer of these plasmids is not well understood. In this study, we first examine key protein-DNA interactions formed by the relaxase enzyme, NES, which initiates and terminates the transfer of the multidrug resistance plasmid pSK41. Two loops on the NES protein, hairpin loops 1 and 2, form extensive contacts with the DNA hairpin formed at theoriTregion of pSK41, and here we establish that these contacts are essential for proper DNA cleavage and religation by the full 665-residue NES proteinin vitro. Second, pSK156 and pCA347 are nonconjugativeStaphylococcus aureusplasmids that contain sequences similar to theoriTregion of pSK41 but differ in the sequence predicted to form a DNA hairpin. We show that pSK41-encoded NES is able to bind, cleave, and religate theoriTsequences of these nonconjugative plasmidsin vitro. Although pSK41 could mobilize a coresident plasmid harboring its cognateoriT, it was unable to mobilize plasmids containing the pSK156 and pCA347 variantoriTmimics, suggesting that an accessory protein like that previously shown to confer specificity in the pWBG749 system may also be involved in transmission of plasmids containing a pSK41-likeoriT. These data indicate that the conjugative relaxase intransmechanism recently described for the pWBG749 family of plasmids also applies to the pSK41 family of plasmids, further heightening the potential significance of this mechanism in the horizontal transfer of staphylococcal plasmids.

    IMPORTANCEUnderstanding the

  4. Restriction enzyme body doubles and PCR cloning: on the general use of type IIs restriction enzymes for cloning.

    Directory of Open Access Journals (Sweden)

    Eszter Tóth

    Full Text Available The procedure described here allows the cloning of PCR fragments containing a recognition site of the restriction endonuclease (Type IIP used for cloning in the sequence of the insert. A Type IIS endonuclease--a Body Double of the Type IIP enzyme--is used to generate the same protruding palindrome. Thus, the insert can be cloned to the Type IIP site of the vector without digesting the PCR product with the same Type IIP enzyme. We achieve this by incorporating the recognition site of a Type IIS restriction enzyme that cleaves the DNA outside of its recognition site in the PCR primer in such a way that the cutting positions straddle the desired overhang sequence. Digestion of the PCR product by the Body Double generates the required overhang. Hitherto the use of Type IIS restriction enzymes in cloning reactions has only been used for special applications, the approach presented here makes Type IIS enzymes as useful as Type IIP enzymes for general cloning purposes. To assist in finding Body Double enzymes, we summarised the available Type IIS enzymes which are potentially useful for Body Double cloning and created an online program (http://group.szbk.u-szeged.hu/welkergr/body_double/index.html for the selection of suitable Body Double enzymes and the design of the appropriate primers.

  5. Restriction enzyme body doubles and PCR cloning: on the general use of type IIs restriction enzymes for cloning.

    Science.gov (United States)

    Tóth, Eszter; Huszár, Krisztina; Bencsura, Petra; Kulcsár, Péter István; Vodicska, Barbara; Nyeste, Antal; Welker, Zsombor; Tóth, Szilvia; Welker, Ervin

    2014-01-01

    The procedure described here allows the cloning of PCR fragments containing a recognition site of the restriction endonuclease (Type IIP) used for cloning in the sequence of the insert. A Type IIS endonuclease--a Body Double of the Type IIP enzyme--is used to generate the same protruding palindrome. Thus, the insert can be cloned to the Type IIP site of the vector without digesting the PCR product with the same Type IIP enzyme. We achieve this by incorporating the recognition site of a Type IIS restriction enzyme that cleaves the DNA outside of its recognition site in the PCR primer in such a way that the cutting positions straddle the desired overhang sequence. Digestion of the PCR product by the Body Double generates the required overhang. Hitherto the use of Type IIS restriction enzymes in cloning reactions has only been used for special applications, the approach presented here makes Type IIS enzymes as useful as Type IIP enzymes for general cloning purposes. To assist in finding Body Double enzymes, we summarised the available Type IIS enzymes which are potentially useful for Body Double cloning and created an online program (http://group.szbk.u-szeged.hu/welkergr/body_double/index.html) for the selection of suitable Body Double enzymes and the design of the appropriate primers.

  6. DNA cleavage and methylation specificity of the single polypeptide restriction-modification enzyme LlaGI.

    Science.gov (United States)

    Smith, Rachel M; Diffin, Fiona M; Savery, Nigel J; Josephsen, Jytte; Szczelkun, Mark D

    2009-11-01

    LlaGI is a single polypeptide restriction-modification enzyme encoded on the naturally-occurring plasmid pEW104 isolated from Lactococcus lactis ssp. cremoris W10. Bioinformatics analysis suggests that the enzyme contains domains characteristic of an mrr endonuclease, a superfamily 2 DNA helicase and a gamma-family adenine methyltransferase. LlaGI was expressed and purified from a recombinant clone and its properties characterised. An asymmetric recognition sequence was identified, 5'-CTnGAyG-3' (where n is A, G, C or T and y is C or T). Methylation of the recognition site occurred on only one strand (the non-degenerate dA residue of 5'-CrTCnAG-3' being methylated at the N6 position). Double strand DNA breaks at distant, random sites were only observed when two head-to-head oriented, unmethylated copies of the site were present; single sites or pairs in tail-to-tail or head-to-tail repeat only supported a DNA nicking activity. dsDNA nuclease activity was dependent upon the presence of ATP or dATP. Our results are consistent with a directional long-range communication mechanism that is necessitated by the partial site methylation. In the accompanying manuscript [Smith et al. (2009) The single polypeptide restriction-modification enzyme LlaGI is a self-contained molecular motor that translocates DNA loops], we demonstrate that this communication is via 1-dimensional DNA loop translocation. On the basis of this data and that in the third accompanying manuscript [Smith et al. (2009) An Mrr-family nuclease motif in the single polypeptide restriction-modification enzyme LlaGI], we propose that LlaGI is the prototype of a new sub-classification of Restriction-Modification enzymes, named Type I SP (for Single Polypeptide).

  7. Plasmid control of 6-aminohexanoic acid cyclic dimer degradation enzymes of Flavobacterium sp. KI72.

    Science.gov (United States)

    Negoro, S; Shinagawa, H; Nakata, A; Kinoshita, S; Hatozaki, T; Okada, H

    1980-07-01

    Flavobacterium sp. K172, which is able to grow on 6-aminohexanoic acid cyclic dimer as the sole source of carbon and nitrogen, and plasmid control of the responsible enzymes, 6-aminohexanoic acid cyclic dimer hydrolase and 6-aminohexanoic acid linear oligomer hydrolase, were studied. The wild strain of K172 harbors three kinds of plasmid, pOAD1 (26.2 megadaltons), pOAD2 (28.8 megadaltons), and pOAD3 (37.2 megadaltons). The wild strain K172 was readily cured of its ability to grow on the cyclic dimer by mitomycin C, and the cyclic dimer hydrolase could not be detected either as catalytic activity or by antibody precipitation. No reversion of the cured strains was detected. pOAD2 was not detected in every cured strain tested but was restored in a transformant. The transformant recovered both of the enzyme activities, and the cyclic dimer hydrolase of the transformant was immunologically identical with that of the wild strain. All of the strains tested, including the wild, cured, and transformant ones, possessed identical pOAD3 irrespective of the metabolizing activity. Some of the cured strains possessed pOAD1 identical with the wild strain, but the others harbored plasmids with partially altered structures which were likely to be derived from pOAD1 by genetic rearrangements such as deletion, insertion, or substitution. These results suggested that the genes of the enzymes were borne on pOAD2.

  8. Type III restriction-modification enzymes: a historical perspective.

    Science.gov (United States)

    Rao, Desirazu N; Dryden, David T F; Bheemanaik, Shivakumara

    2014-01-01

    Restriction endonucleases interact with DNA at specific sites leading to cleavage of DNA. Bacterial DNA is protected from restriction endonuclease cleavage by modifying the DNA using a DNA methyltransferase. Based on their molecular structure, sequence recognition, cleavage position and cofactor requirements, restriction-modification (R-M) systems are classified into four groups. Type III R-M enzymes need to interact with two separate unmethylated DNA sequences in inversely repeated head-to-head orientations for efficient cleavage to occur at a defined location (25-27 bp downstream of one of the recognition sites). Like the Type I R-M enzymes, Type III R-M enzymes possess a sequence-specific ATPase activity for DNA cleavage. ATP hydrolysis is required for the long-distance communication between the sites before cleavage. Different models, based on 1D diffusion and/or 3D-DNA looping, exist to explain how the long-distance interaction between the two recognition sites takes place. Type III R-M systems are found in most sequenced bacteria. Genome sequencing of many pathogenic bacteria also shows the presence of a number of phase-variable Type III R-M systems, which play a role in virulence. A growing number of these enzymes are being subjected to biochemical and genetic studies, which, when combined with ongoing structural analyses, promise to provide details for mechanisms of DNA recognition and catalysis.

  9. [Antirestriction proteins ardA and Ocr as effective inhibitors of the type I restriction-modification enzymes].

    Science.gov (United States)

    Zavil'gel'skiĭ, G B; Rastorguev, S M

    2009-01-01

    Genes encoding antirestriction proteins (antirestrictases, inasmuch as the antirestriction proteins inhibit the activity of restriction-modification systems, but have no proper enzyme activity, the name antirestrictase is only tentative) are included in the composition of conjugative plasmids (genes ardABC) and some bacteriophages (genes ocr and darA). Antirestriction proteins inhibit of the type I restriction-modification enzymes and thus protect unmodified DNA of plasmids and bacteriophages from degradation. Antirestriction proteins belong to the "protein mimicry of DNA" family: the spatial structure is like the B-form of DNA, and therefore the antirestriction proteins operated on the principle of concurrent inhibition replacing DNA in the complex with the restriction-modification enzyme. Based on the prepared in vitro mutant forms of ArdA and Ocr, and also on natural proteins ArdA selectively inhibiting restriction activity of the type I enzymes, but not affecting their methylase activity, we have developed a model of complex formation between the antirestriction proteins and the restriction-modification enzymes R2M2S. Antirestriction proteins are capable of competing displacement of the DNA strand from two sites which are situated as follows: 1) in S-subunit (enzyme contact with the specific DNA site) and 2) in R-subunit (through this unit translocation of the DNA strand occurs followed by its degradation). Analysis of estriction and antimodification activities of proteins ArdA and Ocr depending on the expression level of genes ardA and ocr was performed (the cloning of the genes was done under strictly regulated promoter).

  10. PLASMID PROFILES AND PHAGE TYPES OF SALMONELLA-TYPHIMURIUM ISOLATED FROM SUCCESSIVE FLOCKS OF CHICKENS ON 3 PARENT STOCK FARMS

    DEFF Research Database (Denmark)

    Baggesen, Dorte Lau; Olsen, J. E.; Bisgaard, M.

    1992-01-01

    for restriction enzyme analysis and colony hybridization. The main phage type on each of the three farms was 110. Plasmid profiling, however, allowed further subtyping. All but three isolates carried the serotype-specific virulence-associated plasmid. Restriction enzyme analysis showed variations in this plasmid...

  11. Restriction enzyme-free construction of random gene mutagenesis libraries in Escherichia coli.

    Science.gov (United States)

    Pai, Jen C; Entzminger, Kevin C; Maynard, Jennifer A

    2012-02-15

    Directed evolution relies on both random and site-directed mutagenesis of individual genes and regulatory elements to create variants with altered activity profiles for engineering applications. Central to these experiments is the construction of large libraries of related variants. However, a number of technical hurdles continue to limit routine construction of random mutagenesis libraries in Escherichia coli, in particular, inefficiencies during digestion and ligation steps. Here, we report a restriction enzyme-free approach to library generation using megaprimers termed MegAnneal. Target DNA is first exponentially amplified using error-prone polymerase chain reaction (PCR) and then linearly amplified with a single 3' primer to generate long, randomly mutated, single-stranded megaprimers. These are annealed to single-stranded dUTP-containing template plasmid and extended with T7 polymerase to create a complementary strand, and the resulting termini are ligated with T4 DNA ligase. Using this approach, we are able to reliably generate libraries of approximately 10⁷ colony-forming units (cfu)/μg DNA/transformation in a single day. We have created MegAnneal libraries based on three different single-chain antibodies and identified variants with enhanced expression and ligand-binding affinity. The key advantages of this approach include facile amplification, restriction enzyme-free library generation, and a significantly reduced risk of mutations outside the targeted region and wild-type contamination as compared with current methods.

  12. Endonuclease specificity and sequence dependence of type IIS restriction enzymes.

    Directory of Open Access Journals (Sweden)

    Sverker Lundin

    Full Text Available Restriction enzymes that recognize specific sequences but cleave unknown sequence outside the recognition site are extensively utilized tools in molecular biology. Despite this, systematic functional categorization of cleavage performance has largely been lacking. We established a simple and automatable model system to assay cleavage distance variation (termed slippage and the sequence dependence thereof. We coupled this to massively parallel sequencing in order to provide sensitive and accurate measurement. With this system 14 enzymes were assayed (AcuI, BbvI, BpmI, BpuEI, BseRI, BsgI, Eco57I, Eco57MI, EcoP15I, FauI, FokI, GsuI, MmeI and SmuI. We report significant variation of slippage ranging from 1-54%, variations in sequence context dependence, as well as variation between isoschizomers. We believe this largely overlooked property of enzymes with shifted cleavage would benefit from further large scale classification and engineering efforts seeking to improve performance. The gained insights of in-vitro performance may also aid the in-vivo understanding of these enzymes.

  13. Endonuclease specificity and sequence dependence of type IIS restriction enzymes.

    Science.gov (United States)

    Lundin, Sverker; Jemt, Anders; Terje-Hegge, Finn; Foam, Napoleon; Pettersson, Erik; Käller, Max; Wirta, Valtteri; Lexow, Preben; Lundeberg, Joakim

    2015-01-01

    Restriction enzymes that recognize specific sequences but cleave unknown sequence outside the recognition site are extensively utilized tools in molecular biology. Despite this, systematic functional categorization of cleavage performance has largely been lacking. We established a simple and automatable model system to assay cleavage distance variation (termed slippage) and the sequence dependence thereof. We coupled this to massively parallel sequencing in order to provide sensitive and accurate measurement. With this system 14 enzymes were assayed (AcuI, BbvI, BpmI, BpuEI, BseRI, BsgI, Eco57I, Eco57MI, EcoP15I, FauI, FokI, GsuI, MmeI and SmuI). We report significant variation of slippage ranging from 1-54%, variations in sequence context dependence, as well as variation between isoschizomers. We believe this largely overlooked property of enzymes with shifted cleavage would benefit from further large scale classification and engineering efforts seeking to improve performance. The gained insights of in-vitro performance may also aid the in-vivo understanding of these enzymes.

  14. Controlling the enzymatic activity of a restriction enzyme by light.

    Science.gov (United States)

    Schierling, Benno; Noël, Ann-Josée; Wende, Wolfgang; Hien, Le Thi; Volkov, Eugeny; Kubareva, Elena; Oretskaya, Tatiana; Kokkinidis, Michael; Römpp, Andreas; Spengler, Bernhard; Pingoud, Alfred

    2010-01-26

    For many applications it would be desirable to be able to control the activity of proteins by using an external signal. In the present study, we have explored the possibility of modulating the activity of a restriction enzyme with light. By cross-linking two suitably located cysteine residues with a bifunctional azobenzene derivative, which can adopt a cis- or trans-configuration when illuminated by UV or blue light, respectively, enzymatic activity can be controlled in a reversible manner. To determine which residues when cross-linked show the largest "photoswitch effect," i.e., difference in activity when illuminated with UV vs. blue light, > 30 variants of a single-chain version of the restriction endonuclease PvuII were produced, modified with azobenzene, and tested for DNA cleavage activity. In general, introducing single cross-links in the enzyme leads to only small effects, whereas with multiple cross-links and additional mutations larger effects are observed. Some of the modified variants, which carry the cross-links close to the catalytic center, can be modulated in their DNA cleavage activity by a factor of up to 16 by illumination with UV (azobenzene in cis) and blue light (azobenzene in trans), respectively. The change in activity is achieved in seconds, is fully reversible, and, in the case analyzed, is due to a change in V(max) rather than K(m).

  15. Plasmid pP62BP1 isolated from an Arctic Psychrobacter sp. strain carries two highly homologous type II restriction-modification systems and a putative organic sulfate metabolism operon.

    Science.gov (United States)

    Lasek, Robert; Dziewit, Lukasz; Bartosik, Dariusz

    2012-05-01

    The complete nucleotide sequence of plasmid pP62BP1 (34,467 bp), isolated from Arctic Psychrobacter sp. DAB_AL62B, was determined and annotated. The conserved plasmid backbone is composed of several genetic modules, including a replication system (REP) with similarities to the REP region of the iteron-containing plasmid pPS10 of Pseudomonas syringae. The additional genetic load of pP62BP1 includes two highly related type II restriction-modification systems and a set of genes (slfRCHSL) encoding enzymes engaged in the metabolism of organic sulfates, plus a putative transcriptional regulator (SlfR) of the AraC family. The pP62BP1 slf locus has a compact and unique structure. It is predicted that the enzymes SlfC, SlfH, SlfS and SlfL carry out a chain of reactions leading to the transformation of alkyl sulfates into acyl-CoA, with dodecyl sulfate (SDS) as a possible starting substrate. Comparative analysis of the nucleotide sequences of pP62BP1 and other Psychrobacter spp. plasmids revealed their structural diversity. However, the presence of a few highly conserved DNA segments in pP62BP1, plasmid 1 of P. cryohalolentis K5 and pRWF-101 of Psychrobacter sp. PRwf-1 is indicative of recombinational shuffling of genetic information, and is evidence of lateral gene transfer in the Arctic environment.

  16. A type IV modification-dependent restriction enzyme SauUSI from Staphylococcus aureus subsp. aureus USA300.

    Science.gov (United States)

    Xu, Shuang-Yong; Corvaglia, Anna R; Chan, Siu-Hong; Zheng, Yu; Linder, Patrick

    2011-07-01

    A gene encoding a putative DNA helicase from Staphylococcus aureus USA300 was cloned and expressed in Escherichia coli. The protein was purified to over 90% purity by chromatography. The purified enzyme, SauUSI, predominantly cleaves modified DNA containing 5mC and 5-hydroxymethylcytosine. Cleavage of 5mC-modified plasmids indicated that the sites S5mCNGS (S = C or G) are preferentially digested. The endonuclease activity requires the presence of adenosine triphosphate (ATP) or dATP whereas the non-hydrolyzable γ-S-ATP does not support activity. SauUSI activity was inhibited by ethylenediaminetetraacetic acid. It is most active in Mg(++) buffers. No companion methylase gene was found near the SauUSI restriction gene. The absence of a cognate methylase and cleavage of modified DNA indicate that SauUSI belongs to type IV restriction endonucleases, a group that includes EcoK McrBC and Mrr. SauUSI belongs to a family of highly similar homologs found in other sequenced S. aureus, S. epidermidis and S. carnosus genomes. More distant SauUSI orthologs can be found in over 150 sequenced bacterial/archaea genomes. Finally, we demonstrated the biological function of the type IV REase in restricting 5mC-modified plasmid DNA by transformation into clinical S. aureus strain SA564, and in restricting phage λ infection when the endonuclease is expressed in E. coli.

  17. Detection of possible restriction sites for type II restriction enzymes in DNA sequences.

    Science.gov (United States)

    Gagniuc, P; Cimponeriu, D; Ionescu-Tîrgovişte, C; Mihai, Andrada; Stavarachi, Monica; Mihai, T; Gavrilă, L

    2011-01-01

    In order to make a step forward in the knowledge of the mechanism operating in complex polygenic disorders such as diabetes and obesity, this paper proposes a new algorithm (PRSD -possible restriction site detection) and its implementation in Applied Genetics software. This software can be used for in silico detection of potential (hidden) recognition sites for endonucleases and for nucleotide repeats identification. The recognition sites for endonucleases may result from hidden sequences through deletion or insertion of a specific number of nucleotides. Tests were conducted on DNA sequences downloaded from NCBI servers using specific recognition sites for common type II restriction enzymes introduced in the software database (n = 126). Each possible recognition site indicated by the PRSD algorithm implemented in Applied Genetics was checked and confirmed by NEBcutter V2.0 and Webcutter 2.0 software. In the sequence NG_008724.1 (which includes 63632 nucleotides) we found a high number of potential restriction sites for ECO R1 that may be produced by deletion (n = 43 sites) or insertion (n = 591 sites) of one nucleotide. The second module of Applied Genetics has been designed to find simple repeats sizes with a real future in understanding the role of SNPs (Single Nucleotide Polymorphisms) in the pathogenesis of the complex metabolic disorders. We have tested the presence of simple repetitive sequences in five DNA sequence. The software indicated exact position of each repeats detected in the tested sequences. Future development of Applied Genetics can provide an alternative for powerful tools used to search for restriction sites or repetitive sequences or to improve genotyping methods.

  18. A mitochondrial mutator plasmid that causes senescence under dietary restricted conditions

    NARCIS (Netherlands)

    Maas, M.F.P.M.; Hoekstra, R.F.; Debets, A.J.M.

    2007-01-01

    Background Calorie or dietary restriction extends life span in a wide range of organisms including the filamentous fungus Podospora anserina. Under dietary restricted conditions, P. anserina isolates are several-fold longer lived. This is however not the case in isolates that carry one of the pAL2-1

  19. Updating rDNA restriction enzyme maps of Tetrahymena reveals four new intron-containing species

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Simon, E M; Engberg, J

    1985-01-01

    The extrachromosomal rDNA molecules from a number of Tetrahymena strains were characterized by restriction enzyme mapping using three different restriction enzymes combined with gel blotting and hybridization analysis. Strains from four out of six recently described species were found to contain...

  20. The first discovery of RNA interference by RNA restriction enzymes to inhibit protein synthesis.

    Science.gov (United States)

    Inouye, Masayori

    2017-01-15

    In this article, I review how an RNA restriction enzyme, a highly sequence-specific endoribonuclease, was for the first time discovered in 2003 and how the concept of RNA interference using RNA restriction enzymes or mRNA interferases has been developed.

  1. II-Q restriction endonucleases--new class of type II enzymes.

    Science.gov (United States)

    Degtyarev, S K; Rechkunova, N I; Kolyhalov, A A; Dedkov, V S; Zhilkin, P A

    1990-10-11

    Unique restriction endonucleases Bpu 10l and Bsil have been isolated from Bacillus pumilas and Bacillus sphaericus, respectively. The recognition sequences and cleavage points of these enzymes have been determinated as 5'-CC1TNAGC-3'/3'-GGANT1CG-5' for Bpu 10l and 5'-C1TCGTG-3'/3'-GAGCA1C-5' for Bsil. Restriction endonucleases Bpu 10l and Bsil represent a new class of enzymes which recognize non-palindromic nucleotide sequences and hydrolize DNA within the recognition sequence. Bpu 10l and Bsil recognition sequences may be regarded as quasipalindromic and the enzymes may be designated as type II-Q restriction endonucleases.

  2. Identification and characterization of CbeI, a novel thermostable restriction enzyme from Caldicellulosiruptor bescii DSM 6725 and a member of a new subfamily of HaeIII-like enzymes.

    Science.gov (United States)

    Chung, Dae-Hwan; Huddleston, Jennifer R; Farkas, Joel; Westpheling, Janet

    2011-11-01

    Potent HaeIII-like DNA restriction activity was detected in cell-free extracts of Caldicellulosiruptor bescii DSM 6725 using plasmid DNA isolated from Escherichia coli as substrate. Incubation of the plasmid DNA in vitro with HaeIII methyltransferase protected it from cleavage by HaeIII nuclease as well as cell-free extracts of C. bescii. The gene encoding the putative restriction enzyme was cloned and expressed in E. coli with a His-tag at the C-terminus. The purified protein was 38 kDa as predicted by the 981-bp nucleic acid sequence, was optimally active at temperatures between 75°C and 85°C, and was stable for more than 1 week when stored at 35°C. The cleavage sequence was determined to be 5'-GG/CC-3', indicating that CbeI is an isoschizomer of HaeIII. A search of the C. bescii genome sequence revealed the presence of both a HaeIII-like restriction endonuclease (Athe 2438) and DNA methyltransferase (Athe 2437). Preliminary analysis of other Caldicellulosiruptor species suggested that this restriction/modification activity is widespread in this genus. A phylogenetic analysis based on sequence alignment and conserved motif searches identified features of CbeI distinct from other members of this group and classified CbeI as a member of a novel subfamily of HaeIII-like enzymes.

  3. Plasmid Biopharmaceuticals.

    Science.gov (United States)

    Prazeres, Duarte Miguel F; Monteiro, Gabriel A

    2014-12-01

    Plasmids are currently an indispensable molecular tool in life science research and a central asset for the modern biotechnology industry, supporting its mission to produce pharmaceutical proteins, antibodies, vaccines, industrial enzymes, and molecular diagnostics, to name a few key products. Furthermore, plasmids have gradually stepped up in the past 20 years as useful biopharmaceuticals in the context of gene therapy and DNA vaccination interventions. This review provides a concise coverage of the scientific progress that has been made since the emergence of what are called today plasmid biopharmaceuticals. The most relevant topics are discussed to provide researchers with an updated overview of the field. A brief outline of the initial breakthroughs and innovations is followed by a discussion of the motivation behind the medical uses of plasmids in the context of therapeutic and prophylactic interventions. The molecular characteristics and rationale underlying the design of plasmid vectors as gene transfer agents are described and a description of the most important methods used to deliver plasmid biopharmaceuticals in vivo (gene gun, electroporation, cationic lipids and polymers, and micro- and nanoparticles) is provided. The major safety issues (integration and autoimmunity) surrounding the use of plasmid biopharmaceuticals is discussed next. Aspects related to the large-scale manufacturing are also covered, and reference is made to the plasmid products that have received marketing authorization as of today.

  4. Examination of uropathogenic Escherichia coli strains conferring large plasmids

    Directory of Open Access Journals (Sweden)

    SUHARTONO

    2010-04-01

    Full Text Available Suhartono (2010 Examination of uropathogenic Escherichia coli strains conferring large plasmids. Biodiversitas 11: 59-64. Of major uropathogens, Escherichia coli has been widely known as a main pathogen of UTIs globally and has considerable medical and financial consequences. A strain of UPEC, namely E. coli ST131, confers a large plasmid encoding cephalosporinases (class C β-lactamase or AmpC that may be disseminated through horizontal transfer among bacterial populations. Therefore, it is worth examining such large plasmids by isolating, purifying, and digesting the plasmid with restriction enzymes. The examination of the large plasmids was conducted by isolating plasmid DNA visualized by agarose gel electrophoresis as well as by PFGE. The relationship of plasmids among isolates was carried out by HpaI restriction enzyme digestion. Of 36 isolates of E. coli ST 131, eight isolates possessed large plasmids, namely isolates 3, 9, 10, 12, 17, 18, 26 and 30 with the largest molecular size confirmed by agarose gel electrophoresis and PFGE was ~42kb and ~118kb respectively. Restriction enzyme analysis revealed that isolates 9, 10, 12, 17 and 18 have the common restriction patterns and those isolates might be closely related.

  5. Comparison of restriction enzymes for pulsed-field gel electrophoresis typing of Moraxella catarrhalis.

    Science.gov (United States)

    Marti, Sara; Puig, Carmen; Domenech, Arnau; Liñares, Josefina; Ardanuy, Carmen

    2013-07-01

    NotI, the most prevalent restriction enzyme used for typing Moraxella catarrhalis, failed to digest genomic DNA from respiratory samples. An improved pulsed-field gel electrophoresis (PFGE) methodology determined SpeI as the best choice for typing this bacterial species, with a good restriction of clinical samples and a good clustering correlation with NotI.

  6. Plasmid typing of Shigella sonnei epidemic strains and molecular relationship of their R-plasmids.

    Science.gov (United States)

    Mendoza, M C; Gonzalez, A J; Mendez, F J; Hardisson, C

    1988-06-01

    We conducted a surveillance program on epidemic and/or endemic Shigella strains in Asturias (Spain), their frequency and dispersion in our community, and their R-plasmids. We analyzed initial isolates of Shigella sonnei from two epidemic outbreaks using antibiotic resistance patterns and plasmid profile analysis as epidemiological markers. We found that the 2 outbreaks were caused by different S. sonnei strains, which respectively carried one and two R-plasmids together with other plasmids. The molecular relationship among these and three other R-plasmids from two S. sonnei strains isolated during a previous outbreak, were studied by restriction enzyme analysis and DNA-DNA hybridizations. We were able to establish different levels of relationship among the six R-plasmids.

  7. Chemotherapy of Bacterial Plasmids

    Science.gov (United States)

    1979-01-29

    render them non-susceptible to K: z plasmid-encoded enzymes. (3) Development of drugs which are selective inhibitor! 1 4, of plasmid DNA replication. (4... Development of drugs which inhibit phenotypic as expression of plasmid genes, and (5) Development of drugs which are inhibitors o, drug-inactivating...Barnes [2] them non-susceptible to plasmid-encoded enzymes, tabulated data on the incidence of Gram-negative 3) development of drugs which are

  8. Structure and operation of the DNA-translocating type I DNA restriction enzymes.

    Science.gov (United States)

    Kennaway, Christopher K; Taylor, James E; Song, Chun Feng; Potrzebowski, Wojciech; Nicholson, William; White, John H; Swiderska, Anna; Obarska-Kosinska, Agnieszka; Callow, Philip; Cooper, Laurie P; Roberts, Gareth A; Artero, Jean-Baptiste; Bujnicki, Janusz M; Trinick, John; Kneale, G Geoff; Dryden, David T F

    2012-01-01

    Type I DNA restriction/modification (RM) enzymes are molecular machines found in the majority of bacterial species. Their early discovery paved the way for the development of genetic engineering. They control (restrict) the influx of foreign DNA via horizontal gene transfer into the bacterium while maintaining sequence-specific methylation (modification) of host DNA. The endonuclease reaction of these enzymes on unmethylated DNA is preceded by bidirectional translocation of thousands of base pairs of DNA toward the enzyme. We present the structures of two type I RM enzymes, EcoKI and EcoR124I, derived using electron microscopy (EM), small-angle scattering (neutron and X-ray), and detailed molecular modeling. DNA binding triggers a large contraction of the open form of the enzyme to a compact form. The path followed by DNA through the complexes is revealed by using a DNA mimic anti-restriction protein. The structures reveal an evolutionary link between type I RM enzymes and type II RM enzymes.

  9. Simple and rapid human papillomavirus genotyping method by restriction fragment length polymorphism analysis with two restriction enzymes.

    Science.gov (United States)

    Chen, Linghan; Watanabe, Ken; Haruyama, Takahiro; Kobayashi, Nobuyuki

    2013-07-01

    Cervical cancer, the third most common cancer that affects women worldwide, is caused by the human papillomavirus (HPV) and is treatable when detected at an early stage. To date, more than 100 different HPV types have been described, and the development of simple, low-cost, and accurate methods to distinguish HPV genotypes is highly warranted. In this study, an HPV genotyping assay based on polymerase chain reaction (PCR) was evaluated. This method involved the use of MY09/11 primers followed by restriction fragment length polymorphism (RFLP) analysis with the restriction enzymes HpyCH4V and NlaIII. Cervical specimens preserved using CytoRich Blue fluid were collected from 1,134 female volunteers for HPV detection, and 1,111 valid samples were amplified using PCR. The PCR method was sensitive enough to detect 25 copies of HPV18, and three copies of HPV16. Out of 202 PCR-positive samples, HPV genotypes were determined in 189 samples (93.6%) by this RFLP method. Results were then evaluated further by capillary sequencing method. Concordant results between the two tests were as high as 96.0%. Thirteen samples, which tested negative with RFLP, were verified as non-specific amplifications with PCR. In conclusion, this PCR-RFLP method using restriction enzymes HpyCH4V and NlaIII is simple, non-labor intensive, and is applicable for the inexpensive determination of HPV genotypes in clinical samples.

  10. Highlights of the DNA cutters: a short history of the restriction enzymes.

    Science.gov (United States)

    Loenen, Wil A M; Dryden, David T F; Raleigh, Elisabeth A; Wilson, Geoffrey G; Murray, Noreen E

    2014-01-01

    In the early 1950's, 'host-controlled variation in bacterial viruses' was reported as a non-hereditary phenomenon: one cycle of viral growth on certain bacterial hosts affected the ability of progeny virus to grow on other hosts by either restricting or enlarging their host range. Unlike mutation, this change was reversible, and one cycle of growth in the previous host returned the virus to its original form. These simple observations heralded the discovery of the endonuclease and methyltransferase activities of what are now termed Type I, II, III and IV DNA restriction-modification systems. The Type II restriction enzymes (e.g. EcoRI) gave rise to recombinant DNA technology that has transformed molecular biology and medicine. This review traces the discovery of restriction enzymes and their continuing impact on molecular biology and medicine.

  11. Expression and purification of the modification-dependent restriction enzyme BisI and its homologous enzymes.

    Science.gov (United States)

    Xu, Shuang-Yong; Klein, Pernelle; Degtyarev, Sergey Kh; Roberts, Richard J

    2016-06-29

    The methylation-dependent restriction endonuclease (REase) BisI (G(m5)C ↓ NGC) is found in Bacillus subtilis T30. We expressed and purified the BisI endonuclease and 34 BisI homologs identified in bacterial genomes. 23 of these BisI homologs are active based on digestion of (m5)C-modified substrates. Two major specificities were found among these BisI family enzymes: Group I enzymes cut GCNGC containing two to four (m5)C in the two strands, or hemi-methylated sites containing two (m5)C in one strand; Group II enzymes only cut GCNGC sites containing three to four (m5)C, while one enzyme requires all four cytosines to be modified for cleavage. Another homolog, Esp638I cleaves GCS ↓ SGC (relaxed specificity RCN ↓ NGY, containing at least four (m5)C). Two BisI homologs show degenerate specificity cleaving unmodified DNA. Many homologs are small proteins ranging from 150 to 190 amino acid (aa) residues, but some homologs associated with mobile genetic elements are larger and contain an extra C-terminal domain. More than 156 BisI homologs are found in >60 bacterial genera, indicating that these enzymes are widespread in bacteria. They may play an important biological function in restricting pre-modified phage DNA.

  12. Restriction enzyme mapping of the DNA of Streptomyces bacteriophage B alpha and its deletion derivatives.

    Science.gov (United States)

    Ishihara, H; Nakano, M M; Ogawara, H

    1982-12-01

    Cleavage analysis of actinophage B alpha DNA was done with several restriction enzymes, and a restriction map of the DNA was determined. The DNA appeared to carry cohesive ends. Deletion mutants of actinophage B alpha were isolated by five cycles of treatment with 15 mM PPi. Both mutants had deletions of 2.5 of 1.8 megadaltons near one end of the genome, and one of them lost the single EcoRI cleavage site.

  13. Gene expression of regulatory enzymes involved in the intermediate metabolism of sheep subjected to feed restriction.

    Science.gov (United States)

    van Harten, S; Brito, R; Almeida, A M; Scanlon, T; Kilminster, T; Milton, J; Greeff, J; Oldham, C; Cardoso, L A

    2013-03-01

    The effect of feed restriction on gene expression of regulatory enzymes of intermediary metabolism was studied in two sheep breeds (Australian Merino and Dorper) subjected to two nutritional treatments: feed restriction (85% of daily maintenance requirements) and control (ad libitum feeding), during 42 days. The experimental animals (ram lambs) were divided into four groups, n = 5 (Australian Merino control (MC), Australian Merino Restriction (MR), Dorper control (DC) and Dorper Restriction (DR)). After the trial, animals were sacrificed and samples were taken from liver tissue to quantify glucose levels and gene expression of relevant intermediary metabolism enzymes (phosphofructokinase (PFK), pyruvate kinase (PK), phosphoenolpyruvate carboxykinase, fructose 1,6-bisphosphatase, glucose-6-phosphatase, glycogen synthase (GS), fatty acid synthase (FAS), glutamate dehydrogenase (GDH) and carbamoyl phosphate synthase (CPS)) through real-time PCR. During the experimental period, the MR animals lost 12.6% in BW compared with 5.3% lost by the Dorper lambs. MC and DC rams gained, respectively, 8.8% and 14% during the same period. Within the Dorper breed, restricted feed animals revealed a significant decrease over controls in the transcription of PFK (1.95-fold) and PK (2.26-fold), both glycolytic enzymes. The gluconeogenesis showed no change in the feed restricted animals of both breeds. DR feed group presented a significant decrease over the homologous Merino sheep group on GS. In both experimental breeds, FAS mRNA expression was decreased in restricted feed groups. GDH expression was decreased only in the DR animals (1.84-fold) indicating a reduced catabolism of amino acids in these animals. Finally, CPS was significantly (P enzymes and hepatic glucose production of Dorper sheep to feed restriction concurring with the BW results in the experimental groups.

  14. A new multiplexing single molecule technique for measuring restriction enzyme activity

    Science.gov (United States)

    Harbottle, Allison; Cavanaugh, Jillian; Gordon, Wendy; Loparo, Joseph; Price, Allen

    2012-02-01

    We present a new multiplexing single molecule method for observing the cleavage of DNAs by restriction enzymes. DNAs are attached to a surface at one end using a biotin-streptavidin link and to a micro bead at the other end via a digoxigenin-antidigoxigenin link. The DNAs are stretched by applying a flow. After introduction of the restriction enzyme, the exact time of cleavage of individual DNAs is recorded with video microscopy. We can image hundreds to thousands of DNAs in a single experiment. We are using our technique to search for the signature of facilitated diffusion in the measured rate dependence on ionic strength.

  15. Selection of enzymes for terminal restriction fragment length polymorphism analysis of fungal internally transcribed spacer sequences.

    Science.gov (United States)

    Alvarado, Pablo; Manjón, Jose L

    2009-07-01

    Terminal restriction fragment length polymorphism (TRFLP) profiling of the internally transcribed spacer (ITS) ribosomal DNA of unknown fungal communities is currently unsupported by a broad-range enzyme-choosing rationale. An in silico study of terminal fragment size distribution was therefore performed following virtual digestion (by use of a set of commercially available 135 type IIP restriction endonucleases) of all published fungal ITS sequences putatively annealing to primers ITS1 and ITS4. Different diversity measurements were used to rank primer-enzyme pairs according to the richness and evenness that they showed. Top-performing pairs were hierarchically clustered to test for data dependency. The enzyme set composed of MaeII, BfaI, and BstNI returned much better results than randomly chosen enzyme sets in computer simulations and is therefore recommended for in vitro TRFLP profiling of fungal ITSs.

  16. Restriction Enzyme Pattern Analysis of Mycobacteria DNA by Capillary Electrophoresis with Laser-induced Fluorescence Detection

    Institute of Scientific and Technical Information of China (English)

    Li Yuanqian; Wang Guoqing; Mi Jianping; Zhou Ying; Zeng Hongyan; Zhang Chaowu

    2006-01-01

    A new method for rapidly detecting restriction enzyme patterns of Mycobacterium DNA using capillary electrophoresis with laser-induced fluorescence detection (CE-LIFD)was developed.Polymerase chain reaction was used to amplify a 439-bp fragment of a 65,000-kDa(Mr)heat shock protein gene(hsp65)of Mycobacterium.After digesting amplification products by BstEII and HaeIII,patterns of enzyme cleavage products were detected by both CE-LIFD and agarose gel electrophoresis(AGE),respectively.Experimental parameters of CE were optimized.Restriction enzyme patterns of Mycobacterium DNA were detected in optimum electrophoresis conditions:a coated capillary column with a length of 50 cm and an internal diameter of 100 μm,an electrophoresis buffer of 45 mmol/1 Tris-boric acid-ethylenediaminetetraacetic acid,and a running voltage of 11 kV.The restriction enzyme patterns for eight species of mycobacteria were studied.Relative standard deviations of the relative migration times of DNA segments were<3.6%.Compared with AGE,CE is more outstanding in resolution and detection time,and it can be applied as a more effective means to DNA restriction enzyme pattern analysis.

  17. Pattern analysis approach reveals restriction enzyme cutting abnormalities and other cDNA library construction artifacts using raw EST data

    Directory of Open Access Journals (Sweden)

    Zhou Sun

    2012-05-01

    Full Text Available Abstract Background Expressed Sequence Tag (EST sequences are widely used in applications such as genome annotation, gene discovery and gene expression studies. However, some of GenBank dbEST sequences have proven to be “unclean”. Identification of cDNA termini/ends and their structures in raw ESTs not only facilitates data quality control and accurate delineation of transcription ends, but also furthers our understanding of the potential sources of data abnormalities/errors present in the wet-lab procedures for cDNA library construction. Results After analyzing a total of 309,976 raw Pinus taeda ESTs, we uncovered many distinct variations of cDNA termini, some of which prove to be good indicators of wet-lab artifacts, and characterized each raw EST by its cDNA terminus structure patterns. In contrast to the expected patterns, many ESTs displayed complex and/or abnormal patterns that represent potential wet-lab errors such as: a failure of one or both of the restriction enzymes to cut the plasmid vector; a failure of the restriction enzymes to cut the vector at the correct positions; the insertion of two cDNA inserts into a single vector; the insertion of multiple and/or concatenated adapters/linkers; the presence of 3′-end terminal structures in designated 5′-end sequences or vice versa; and so on. With a close examination of these artifacts, many problematic ESTs that have been deposited into public databases by conventional bioinformatics pipelines or tools could be cleaned or filtered by our methodology. We developed a software tool for Abnormality Filtering and Sequence Trimming for ESTs (AFST, http://code.google.com/p/afst/ using a pattern analysis approach. To compare AFST with other pipelines that submitted ESTs into dbEST, we reprocessed 230,783 Pinus taeda and 38,709 Arachis hypogaea GenBank ESTs. We found 7.4% of Pinus taeda and 29.2% of Arachis hypogaea GenBank ESTs are “unclean” or abnormal, all of which could be cleaned

  18. Correspondence between radioactive and functional methods in the quality control of DNA restriction and modifying enzymes

    DEFF Research Database (Denmark)

    Trujillo, L E; Pupo, E; Miranda, F;

    1996-01-01

    We evaluated the use of two radiolabeled lambda DNA/Hpa II substrates to detect 5'-->3', 3'-->5' single and double stranded DNA dependent exonuclease and phosphatase activities found as contaminants in restriction and modifying enzyme preparations. Looking for the meaning of the radioactive assay...

  19. A method for selection of restriction enzymes for sdCAPS marker construction

    Science.gov (United States)

    Development of PCR-based markers for SNP detection is prerequisite for various genetic analyses. The use of restriction enzymes following PCR amplification is a common and relatively low cost method for SNP detection. Simple and cost-effective methodologies for SNP marker development that would en...

  20. Reference genome-independent assessment of mutation density using restriction enzyme-phased sequencing

    Science.gov (United States)

    Determining the mutation rates in single individuals is a significant challenge requiring a substantial amount of sequencing and analysis. We have developed a simple method based on restriction enzyme-phased sequencing to measure the mutation density by comparing a wild type to mutagenized individua...

  1. Genome filtering using methylation-sensitive restriction enzymes with six-base pair recognition sites

    Science.gov (United States)

    The large fraction of repetitive DNA in many plant genomes has complicated all aspects of DNA sequencing and assembly, and thus techniques that enrich for genes and low-copy sequences have been employed to isolate gene space. Methyl sensitive restriction enzymes with six base pair recognition sites...

  2. Correspondence between radioactive and functional methods in the quality control of DNA restriction and modifying enzymes

    DEFF Research Database (Denmark)

    Trujillo, L E; Pupo, E; Miranda, F

    1996-01-01

    We evaluated the use of two radiolabeled lambda DNA/Hpa II substrates to detect 5'-->3', 3'-->5' single and double stranded DNA dependent exonuclease and phosphatase activities found as contaminants in restriction and modifying enzyme preparations. Looking for the meaning of the radioactive assay...

  3. The interaction of the Eco R1 restriction enzyme E.coli with nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Hollis, Donald F. [Univ. of California, Berkeley, CA (United States)

    1979-11-01

    The Eco R1 restriction enzyme can be shown to be inhibited by nucleotides which correspond to any part of its known site of phosphodiesterase activity. A series of di-, tetra-, and hexa-nucleotide fragments were synthesized and their effect on the activity of the enzyme upon superhelical Co1 E1 DNA studied. The inhibition caused by the individual mononucleotides were also studied. In general all the nucleotide fragments showed some form of interaction with the enzyme system. Tetranucleotides were stronger inhibitors than dinucleotides, which in turn were stronger inhibitors than the mononucleotides. Within each category of inhibitors, those containing the phosphodiester bond which is acted upon by the enzyme were the strongest inhibitors. Only those fragments which were consistent with the enzymes site of activity showed competitive inhibition kinetics. Nucleotides which do not fit within the site of phosphodiesterase activity show non-competitive inhibition kinetics.

  4. Generation of a restriction minus enteropathogenic Escherichia coli E2348/69 strain that is efficiently transformed with large, low copy plasmids

    Directory of Open Access Journals (Sweden)

    Ward Jordan D

    2008-08-01

    Full Text Available Abstract Background Many microbes possess restriction-modification systems that protect them from parasitic DNA molecules. Unfortunately, the presence of a restriction-modification system in a given microbe also hampers genetic analysis. Although plasmids can be successfully conjugated into the enteropathogenic Escherichia coli strain E2348/69 and optimized protocols for competent cell preparation have been developed, we found that a large, low copy (~15 bioluminescent reporter plasmid, pJW15, that we modified for use in EPEC, was exceedingly difficult to transform into E2348/69. We reasoned that a restriction-modification system could be responsible for the low transformation efficiency of E2348/69 and sought to identify and inactivate the responsible gene(s, with the goal of creating an easily transformable strain of EPEC that could complement existing protocols for genetic manipulation of this important pathogen. Results Using bioinformatics, we identified genes in the unfinished enteropathogenic Escherichia coli (EPEC strain E2348/69 genome whose predicted products bear homology to the HsdM methyltransferases, HsdS specificity subunits, and HsdR restriction endonucleases of type I restriction-modification systems. We constructed a strain carrying a deletion of the conserved enzymatic domain of the EPEC HsdR homologue, NH4, and showed that its transformation efficiency was up to four orders of magnitude higher than that of the parent strain. Further, the modification capacity of NH4 remained intact, since plasmids that were normally recalcitrant to transformation into E2348/69 could be transformed upon passage through NH4. NH4 was unaffected in virulence factor production, since bundle forming pilus (BFP subunits and type III secreted (T3S proteins were present at equivalent levels to those seen in E2348/69. Further, NH4 was indistinguishable from E2348/69 in tissue culture infection model assays of localized adherence and T3S. Conclusion We

  5. Structural insights into DNA sequence recognition by Type ISP restriction-modification enzymes.

    Science.gov (United States)

    Kulkarni, Manasi; Nirwan, Neha; van Aelst, Kara; Szczelkun, Mark D; Saikrishnan, Kayarat

    2016-05-19

    Engineering restriction enzymes with new sequence specificity has been an unaccomplished challenge, presumably because of the complexity of target recognition. Here we report detailed analyses of target recognition by Type ISP restriction-modification enzymes. We determined the structure of the Type ISP enzyme LlaGI bound to its target and compared it with the previously reported structure of a close homologue that binds to a distinct target, LlaBIII. The comparison revealed that, although the two enzymes use almost a similar set of structural elements for target recognition, the residues that read the bases vary. Change in specificity resulted not only from appropriate substitution of amino acids that contacted the bases but also from new contacts made by positionally distinct residues directly or through a water bridge. Sequence analyses of 552 Type ISP enzymes showed that the structural elements involved in target recognition of LlaGI and LlaBIII were structurally well-conserved but sequentially less-conserved. In addition, the residue positions within these structural elements were under strong evolutionary constraint, highlighting the functional importance of these regions. The comparative study helped decipher a partial consensus code for target recognition by Type ISP enzymes.

  6. Time-resolved fluorescence studies of nucleotide flipping by restriction enzymes.

    Science.gov (United States)

    Neely, Robert K; Tamulaitis, Gintautas; Chen, Kai; Kubala, Marta; Siksnys, Virginijus; Jones, Anita C

    2009-11-01

    Restriction enzymes Ecl18kI, PspGI and EcoRII-C, specific for interrupted 5-bp target sequences, flip the central base pair of these sequences into their protein pockets to facilitate sequence recognition and adjust the DNA cleavage pattern. We have used time-resolved fluorescence spectroscopy of 2-aminopurine-labelled DNA in complex with each of these enzymes in solution to explore the nucleotide flipping mechanism and to obtain a detailed picture of the molecular environment of the extrahelical bases. We also report the first study of the 7-bp cutter, PfoI, whose recognition sequence (T/CCNGGA) overlaps with that of the Ecl18kI-type enzymes, and for which the crystal structure is unknown. The time-resolved fluorescence experiments reveal that PfoI also uses base flipping as part of its DNA recognition mechanism and that the extrahelical bases are captured by PfoI in binding pockets whose structures are quite different to those of the structurally characterized enzymes Ecl18kI, PspGI and EcoRII-C. The fluorescence decay parameters of all the enzyme-DNA complexes are interpreted to provide insight into the mechanisms used by these four restriction enzymes to flip and recognize bases and the relationship between nucleotide flipping and DNA cleavage.

  7. Focussing reduced representation CpG sequencing through judicious restriction enzyme choice.

    Science.gov (United States)

    Kirschner, Sophie A; Hunewald, Oliver; Mériaux, Sophie B; Brunnhoefer, Regina; Muller, Claude P; Turner, Jonathan D

    2016-04-01

    Current restriction enzyme based reduced representation methylation analyses aim for limited, but unbiased, methylome coverage. As the current best estimate suggests that only ~20% of CpGs are dynamically regulated, we characterised the CpG and genomic context surrounding all suitable restriction enzyme sites to identify those that were located in regions rich in dynamically methylated CpGs. The restriction-site distributions for MspI, BstUI, and HhaI were non-random. CpGs in CGI and shelf+shore could be enriched, particularly in gene bodies for all genomic regions, promoters (TSS1500, TSS200), intra- (1st exon, gene body, 3'UTR, 5'UTR) and inter-genic regions. HpyCH4IV enriched CpG elements in the open sea for all genomic elements. Judicious restriction enzyme choice improves the focus of reduced representation approaches by avoiding the monopolization of read coverage by genomic regions that are irrelevant, unwanted or difficult to map, and only sequencing the most informative fraction of CpGs.

  8. Transformation of Haemophilus influenzae by plasmid RSF0885

    Energy Technology Data Exchange (ETDEWEB)

    Notani, N.K.; Setlow, J.K.; McCarthy, D.; Clayton, N.L.

    1981-12-01

    Plasmid RSF0885, which conferred ampicillin resistance, transformed competent Haemophilus influenzae cells with low efficiency (maximun, less than 0.01%). As judged by competition experiments and uptake of radioactivity, plasmid RSF0885 deoxyribonucleic acid was taken up into competent H. influenzae cells several orders of magnitude less efficiently than H. influenzae chromosomal deoxyribonucleic acid. Plasmid RSF0885 transformed cells with even lower efficiency than could be accounted for by the low uptake. Transformation was not affected by rec-1 and rec-2 mutations in the recipient, and strains cured of the plasmid did not show increased transformation. Plasmid molecules cut once with a restriction enzyme that made blunt ends did not transform. Transformation was favored by the closed circular form of the plasmid.

  9. Construction and Identification of Plasmid pTA-TUB2

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    An about 1.40 Kb target gene fragment was yielded by PCR amplification with the plasmid pRB 129,which was identified by restriction enzyme digestion that the PCR product was TU B2 gene.The gene was digested by the restriction enzyme and was linked with pTA plasmid to construct pTA-TU B2 plasmid.The plasmid was transformed into Chaetomium spp.by PEG method and the transformation rate was 27/(2×105) and it is nine times higher than that of pRB 129.The transformants can grow on the PDA containing 1 000 μg*mL-1 carbendazim,which is 1 000 times higher than the original Chaetomium spp.The resistance was stable after 10 times transfer on non-selective medium.

  10. Sequence-specific protection of duplex DNA against restriction and methylation enzymes by pseudocomplementary PNAs

    DEFF Research Database (Denmark)

    Izvolsky, K I; Demidov, V V; Nielsen, P E;

    2000-01-01

    of decameric pcPNAs block an access of RNA polymerase to the corresponding promoter. Here, we show that this type of PNAs protects selected DNA sites containing all four nucleobases from the action of restriction enzymes and DNA methyltransferases. We have found that pcPNAs as short as octamers form stable......I restriction endonuclease and dam methylase. The pcPNA-assisted protection against enzymatic methylation is more efficient when the PNA-binding site embodies the methylase-recognition site rather than overlaps it. We conclude that pcPNAs may provide the robust tools allowing to sequence-specifically manipulate...

  11. [25S intron analysis followed by restriction enzyme digestion performed for genotyping Candida albicans isolates].

    Science.gov (United States)

    Karahan, Zeynep Ceren; Saran, Begüm; Yenice, Sevinç; Ağırbaşlı, Handan; Arıkan Akan, Ozay; Tekeli, Alper

    2012-04-01

    Candida albicans is the most frequently encountered fungal pathogen especially in the immunocompromised hosts. Genotyping clinical microbial isolates is important for obtaining epidemiological data and for establishing appropriate infection control strategies in the hospital setting. 25S intron analysis is an easy and reliable method used for genotyping C.albicans strains. As it has a low discriminatory power, its use is limited in epidemiological studies. In this study, our aim was to genotype clinical C.albicans isolates by using 25S intron analysis followed by restriction enzyme digestion in order to develop a more discriminative genotyping system for C.albicans. A total of 260 clinical C.albicans strains isolated from various infection sites (121 blood, 69 sputum, 36 vaginal discharge, 26 wound, 8 urine samples) were genotyped by 25S intron analysis, and all the products obtained by polymerase chain reaction (PCR) were digested with HaeIII restriction enzyme. Discriminatory power of each method was calculated. Among the isolates 184 (70.8%) were classified as genotype A, 42 (16.2%) as genotype B, and 34 (13%) as genotype C by 25S intron analysis. Discriminatory power of the method was calculated as 0.46. HaeIII restriction of genotype A, B and C isolates produced ten, one, and five restriction patterns (genotypes), respectively. By the addition of restriction enzyme analysis, the number of genotypes obtained was increased to 16, and the discriminatory power of the method to 0.79. Combining different genotyping methods increases the discriminatory power by increasing the number of genotypes obtained. However, there is also a risk to split certain strains in different genotypes by the different methods used and this makes the genotypic evaluation more difficult. On the other hand, combining 25S intron analysis with restriction enzyme analysis increases the discriminatory power without introducing a totally different method, and makes the method more suitable for

  12. Enhanced cardioprotective effects mediated by plasmid containing the short-hairpin RNA of angiotensin converting enzyme with a biodegradable hydrogel after myocardial infarction.

    Science.gov (United States)

    Wan, Wei-Guo; Jiang, Xue-Jun; Li, Xiao-Yan; Zhang, Cui; Yi, Xin; Ren, Shan; Zhang, Xian-Zheng

    2014-10-01

    The expression of foreign gene was enhanced and prolonged by sustained releasing a target gene to cells from biodegradable dextran-poly(e-caprolactone)-2-hydroxylethylmethacrylate-poly(N-isopropylacrylamide) (Dex-PCL-HEMA/PNIPAAm) hydrogel in vitro. Moreover, we have demonstrated that injection of the same hydrogel improved post-infarct ventricular remodeling. Therefore, we hypothesized that intramyocardial injection of plasmid containing the short-hairpin RNA (shRNA) of angiotensin converting enzyme (ACE) with the same hydrogel enhances the cardioprotective effects superior to either alone or after rat myocardial infarction (MI). In this study, equal volume of phosphate-buffered solution (PBS), 10 μg ACE-shRNA plasmids, hydrogel containing 10 μg negative control ACE-shRNA plasmids and hydrogel containing 10 μg ACE-shRNA plasmids were shortly injected into the infarct area of rats after MI, respectively. We found that ACE-shRNA plasmid-loaded hydrogel extended the duration of gene expression in vivo. Moreover, it was shown that direct intramyocardial injection of ACE-shRNA plasmid-loaded hydrogel significantly decreased the expression of local ACE expression, inhibited cell apoptosis, reduced infarct size, and improved cardiac function compared with the injection of either alone 30 days after MI in rats. These results suggest that injection of ACE-shRNA plasmid-loaded hydrogel into impaired myocardium obtains more cardioprotective effects than either alone in rat with MI by prolonging the gene silencing of ACE. © 2013 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 102A: 3452-3458, 2014.

  13. Polyphosphate present in DNA preparations from fungal species of Collectotrichum inhibits restriction endonucleases and other enzymes

    Science.gov (United States)

    Rodriguez, R.J.

    1993-01-01

    During the development of a procedure for the isolation of total genomic DNA from filamentous fungi (Rodriguez, R. J., and Yoder, 0. C., Exp. Mycol. 15, 232-242, 1991) a cell fraction was isolated which inhibited the digestion of DNA by restriction enzymes. After elimination of DNA, RNA, proteins, and lipids, the active compound was purified by gel filtration to yield a single fraction capable of complete inhibition of restriction enzyme activity. The inhibitor did not absorb uv light above 220 nm, and was resistant to alkali and acid at 25°C and to temperatures as high as 100°C. More extensive analyses demonstrated that the inhibitor was also capable of inhibiting T4 DNA ligase and TaqI DNA polymerase, but not DNase or RNase. Chemical analyses indicated that the inhibitor was devoid of carbohydrates, proteins, lipids, and nucleic acids but rich in phosphorus. A combination of nuclear magnetic resonance, metachromatic shift of toluidine blue, and gel filtration indicated that the inhibitor was a polyphosphate (polyP) containing approximately 60 phosphate molecules. The mechanism of inhibition appeared to involve complexing of polyP to the enzymatic proteins. All species of Colletotrichum analyzed produced polyP equivalent in chain length and concentration. A modification to the original DNA extraction procedure is described which eliminates polyP and reduces the time necessary to obtain DNA of sufficient purity for restriction enzyme digestion and TaqI polymerase amplification.

  14. Genome modifications in plant cells by custom-made restriction enzymes.

    Science.gov (United States)

    Tzfira, Tzvi; Weinthal, Dan; Marton, Ira; Zeevi, Vardit; Zuker, Amir; Vainstein, Alexander

    2012-05-01

    Genome editing, i.e. the ability to mutagenize, insert, delete and replace sequences, in living cells is a powerful and highly desirable method that could potentially revolutionize plant basic research and applied biotechnology. Indeed, various research groups from academia and industry are in a race to devise methods and develop tools that will enable not only site-specific mutagenesis but also controlled foreign DNA integration and replacement of native and transgene sequences by foreign DNA, in living plant cells. In recent years, much of the progress seen in gene targeting in plant cells has been attributed to the development of zinc finger nucleases and other novel restriction enzymes for use as molecular DNA scissors. The induction of double-strand breaks at specific genomic locations by zinc finger nucleases and other novel restriction enzymes results in a wide variety of genetic changes, which range from gene addition to the replacement, deletion and site-specific mutagenesis of endogenous and heterologous genes in living plant cells. In this review, we discuss the principles and tools for restriction enzyme-mediated gene targeting in plant cells, as well as their current and prospective use for gene targeting in model and crop plants.

  15. From Agrobacterium to viral vectors: genome modification of plant cells by rare cutting restriction enzymes.

    Science.gov (United States)

    Marton, Ira; Honig, Arik; Omid, Ayelet; De Costa, Noam; Marhevka, Elena; Cohen, Barry; Zuker, Amir; Vainstein, Alexander

    2013-01-01

    Researchers and biotechnologists require methods to accurately modify the genome of higher eukaryotic cells. Such modifications include, but are not limited to, site-specific mutagenesis, site-specific insertion of foreign DNA, and replacement and deletion of native sequences. Accurate genome modifications in plant species have been rather limited, with only a handful of plant species and genes being modified through the use of early genome-editing techniques. The development of rare-cutting restriction enzymes as a tool for the induction of site-specific genomic double-strand breaks and their introduction as a reliable tool for genome modification in animals, animal cells and human cell lines have paved the way for the adaptation of rare-cutting restriction enzymes to genome editing in plant cells. Indeed, the number of plant species and genes which have been successfully edited using zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and engineered homing endonucleases is on the rise. In our review, we discuss the basics of rare-cutting restriction enzyme-mediated genome-editing technology with an emphasis on its application in plant species.

  16. Modular construction of plasmids through ligation-free assembly of vector components with oligonucleotide linkers.

    Science.gov (United States)

    Vroom, Jonathan A; Wang, Clifford L

    2008-06-01

    We have developed a modular method of plasmid construction that can join multiple DNA components in a single reaction. A nicking enzyme is used to create 5' and 3' overhangs on PCR-generated DNA components. Without the use of ligase or restriction enzymes, components are joined using oligonucleotide linkers that recognize the overhangs. By specifying the sequences of the linkers, desired components can be assembled in any combination and order to generate different plasmid vectors.

  17. Variation of clonal, mesquite-associated rhizobial and bradyrhizobial populations from surface and deep soils by symbiotic gene region restriction fragment length polymorphism and plasmid profile analysis.

    Science.gov (United States)

    Thomas, P M; Golly, K F; Zyskind, J W; Virginia, R A

    1994-04-01

    Genetic characteristics of 14 Rhizobium and 9 Bradyrhizobium mesquite (Prosopis glandulosa)-nodulating strains isolated from surface (0- to 0.5-m) and deep (4- to 6-m) rooting zones were determined in order to examine the hypothesis that surface- and deep-soil symbiont populations were related but had become genetically distinct during adaptation to contrasting soil conditions. To examine genetic diversity, Southern blots of PstI-digested genomic DNA were sequentially hybridized with the nodDABC region of Rhizobium meliloti, the Klebsiella pneumoniae nifHDK region encoding nitrogenase structural genes, and the chromosome-localized ndvB region of R. meliloti. Plasmid profile and host plant nodulation assays were also made. Isolates from mesquite nodulated beans and cowpeas but not alfalfa, clover, or soybeans. Mesquite was nodulated by diverse species of symbionts (R. meliloti, Rhizobium leguminosarum bv. phaseoli, and Parasponia bradyrhizobia). There were no differences within the groups of mesquite-associated rhizobia or bradyrhizobia in cross-inoculation response. The ndvB hybridization results showed the greatest genetic diversity among rhizobial strains. The pattern of ndvB-hybridizing fragments suggested that surface and deep strains were clonally related, but groups of related strains from each soil depth could be distinguished. Less variation was found with nifHDK and nodDABC probes. Large plasmids (>1,500 kb) were observed in all rhizobia and some bradyrhizobia. Profiles of plasmids of less than 1,000 kb were related to the soil depth and the genus of the symbiont. We suggest that interacting selection pressures for symbiotic competence and free-living survival, coupled with soil conditions that restrict genetic exchange between surface and deep-soil populations, led to the observed patterns of genetic diversity.

  18. REBASE--a database for DNA restriction and modification: enzymes, genes and genomes.

    Science.gov (United States)

    Roberts, Richard J; Vincze, Tamas; Posfai, Janos; Macelis, Dana

    2015-01-01

    REBASE is a comprehensive and fully curated database of information about the components of restriction-modification (RM) systems. It contains fully referenced information about recognition and cleavage sites for both restriction enzymes and methyltransferases as well as commercial availability, methylation sensitivity, crystal and sequence data. All genomes that are completely sequenced are analyzed for RM system components, and with the advent of PacBio sequencing, the recognition sequences of DNA methyltransferases (MTases) are appearing rapidly. Thus, Type I and Type III systems can now be characterized in terms of recognition specificity merely by DNA sequencing. The contents of REBASE may be browsed from the web http://rebase.neb.com and selected compilations can be downloaded by FTP (ftp.neb.com). Monthly updates are also available via email.

  19. Determination of protein expression and plasmid copy number from cloned genes in Escherichia coli by flow injection analysis using an enzyme indicator vector.

    Science.gov (United States)

    Schendel, F J; Baude, E J; Flickinger, M C

    1989-10-20

    On-line determination of expression rates from cloned genes in Escherichia coli and of plasmid copy number would be useful for monitoring accumulation of non-secreted proteins. As an initial model for monitoring gene expression in intact cells, a non-gene-fusion enzyme-based indicator plasmid has been constructed containing the phoA gene coding for alkaline phosphatase (AP) in pUCIS and pACYC184. The activity of AP can be rapidly determined in permeabilized cells. A flow injection analysis (FIA) assay has been developed which allows the direct real-time measurement of the AP activity during cell growth. A model target gene coding for E. coli cyanase (cynS) has been inserted in order to determine the ratio between the expression of the target and indicator, AP. A linear relationship has been found between plasmid copy number and AP activity for the high-copy pUC vector. To minimize indicator expression, transcription terminators have been inserted between the cynS and phoA genes, altering the target-to-indicator ratio by 10- to 40-fold. These vectors may be useful for the rapid continuous determination of plasmid copy number and target gene expression for nonsecreted proteins and would overcome the limitations of in situ probe biosensors for real-time determination of the accumulation of proteins from cloned genes in E. coli.

  20. Characterization of fastidious adenovirus types 40 and 41 by DNA restriction enzyme analysis and by neutralizing monoclonal antibodies.

    NARCIS (Netherlands)

    H.G.A.M. van der Avoort (Harrie); A.G. Wermenbol; T.P.L. Zomerdijk (Timo); J.A.F.W. Kleijne; J.A.A.M. van Asten (Jack); P. Jensma; A.D.M.E. Osterhaus (Albert); A.H. Kidd; J.C. de Jong (Jan)

    1989-01-01

    textabstractThe DNA of 48 strains of adenovirus type 40 (Ad40) and of 128 strains of adenovirus type 41 (Ad41), isolated between 1971 and 1986 from various countries, was characterized by restriction enzyme analysis using nine and ten restriction endonucleases respectively. Five new DNA variants of

  1. Cloning and analysis of the four genes coding for Bpu10I restriction-modification enzymes.

    Science.gov (United States)

    Stankevicius, K; Lubys, A; Timinskas, A; Vaitkevicius, D; Janulaitis, A

    1998-02-15

    The Bpu 10I R-M system from Bacillus pumilus 10, which recognizes the asymmetric 5'-CCTNAGC sequence, has been cloned, sequenced and expressed in Escherichia coli . The system comprises four adjacent, similarly oriented genes encoding two m5C MTases and two subunits of Bpu 10I ENase (34.5 and 34 kDa). Both bpu10IR genes either in cis or trans are needed for the manifestation of R. Bpu 10I activity. Subunits of R. Bpu 10I, purified to apparent homogeneity, are both required for cleavage activity. This heterosubunit structure distinguishes the Bpu 10I restriction endonuclease from all other type II restriction enzymes described previously. The subunits reveal 25% amino acid identity. Significant similarity was also identified between a 43 amino acid region of R. Dde I and one of the regions of higher identity shared between the Bpu 10I subunits, a region that could possibly include the catalytic/Mg2+binding center. The similarity between Bpu 10I and Dde I MTases is not limited to the conserved motifs (CM) typical for m5C MTases. It extends into the variable region that lies between CMs VIII and IX. Duplication of a progenitor gene, encoding an enzyme recognizing a symmetric nucleotide sequence, followed by concerted divergent evolution, may provide a possible scenario leading to the emergence of the Bpu 10I ENase, which recognizes an overall asymmetric sequence and cleaves within it symmetrically.

  2. Electrochemical biosensor modified with dsDNA monolayer for restriction enzyme activity determination.

    Science.gov (United States)

    Zajda, Joanna; Górski, Łukasz; Malinowska, Elżbieta

    2016-06-01

    A simple and cost effective method for the determination of restriction endonuclease activity is presented. dsDNA immobilized at a gold electrode surface is used as the enzymatic substrate, and an external cationic redox probe is employed in voltammetric measurements for analytical signal generation. The assessment of enzyme activity is based on a decrease of a current signal derived from reduction of methylene blue which is present in the sample solution. For this reason, the covalent attachment of the label molecule is not required which significantly reduces costs of the analysis and simplifies the entire determination procedure. The influence of buffer components on utilized dsDNA/MCH monolayer stability and integrity is also verified. Electrochemical impedance spectroscopy measurements reveal that due to pinhole formation during enzyme activity measurement the presence of any surfactants should be avoided. Additionally, it is shown that the sensitivity of the electrochemical biosensor can be tuned by changing the restriction site location along the DNA length. Under optimal conditions the proposed biosensor exhibits a linear response toward PvuII activity within a range from 0.25 to 1.50 U/μL.

  3. Maternal protein restriction affects gene expression and enzyme activity of intestinal disaccharidases in adult rat offspring

    Energy Technology Data Exchange (ETDEWEB)

    Pinheiro, D.F.; Pacheco, P.D.G.; Alvarenga, P.V.; Buratini, J. Jr; Castilho, A.C.S.; Lima, P.F.; Sartori, D.R.S.; Vicentini-Paulino, M.L.M. [Departamento de Fisiologia, Instituto de Biociências, Universidade Estadual Paulista, Botucatu, SP (Brazil)

    2013-03-15

    This study investigated the consequences of intrauterine protein restriction on the gastrointestinal tract and particularly on the gene expression and activity of intestinal disaccharidases in the adult offspring. Wistar rat dams were fed isocaloric diets containing 6% protein (restricted, n = 8) or 17% protein (control, n = 8) throughout gestation. Male offspring (n = 5-8 in each group) were evaluated at 3 or 16 weeks of age. Maternal protein restriction during pregnancy produced offspring with growth restriction from birth (5.7 ± 0.1 vs 6.3 ± 0.1 g; mean ± SE) to weaning (42.4 ± 1.3 vs 49.1 ± 1.6 g), although at 16 weeks of age their body weight was similar to control (421.7 ± 8.9 and 428.5 ± 8.5 g). Maternal protein restriction also increased lactase activity in the proximal (0.23 ± 0.02 vs 0.15 ± 0.02), medial (0.30 ± 0.06 vs 0.14 ± 0.01) and distal (0.43 ± 0.07 vs 0.07 ± 0.02 U·g{sup -1}·min{sup -1}) small intestine, and mRNA lactase abundance in the proximal intestine (7.96 ± 1.11 vs 2.38 ± 0.47 relative units) of 3-week-old offspring rats. In addition, maternal protein restriction increased sucrase activity (1.20 ± 0.02 vs 0.91 ± 0.02 U·g{sup -1}·min{sup -1}) and sucrase mRNA abundance (4.48 ± 0.51 vs 1.95 ± 0.17 relative units) in the duodenum of 16-week-old rats. In conclusion, the present study shows for the first time that intrauterine protein restriction affects gene expression of intestinal enzymes in offspring.

  4. Maternal protein restriction affects gene expression and enzyme activity of intestinal disaccharidases in adult rat offspring.

    Science.gov (United States)

    Pinheiro, D F; Pacheco, P D G; Alvarenga, P V; Buratini, J; Castilho, A C S; Lima, P F; Sartori, D R S; Vicentini-Paulino, M L M

    2013-03-01

    This study investigated the consequences of intrauterine protein restriction on the gastrointestinal tract and particularly on the gene expression and activity of intestinal disaccharidases in the adult offspring. Wistar rat dams were fed isocaloric diets containing 6% protein (restricted, n = 8) or 17% protein (control, n = 8) throughout gestation. Male offspring (n = 5-8 in each group) were evaluated at 3 or 16 weeks of age. Maternal protein restriction during pregnancy produced offspring with growth restriction from birth (5.7 ± 0.1 vs 6.3 ± 0.1 g; mean ± SE) to weaning (42.4 ± 1.3 vs 49.1 ± 1.6 g), although at 16 weeks of age their body weight was similar to control (421.7 ± 8.9 and 428.5 ± 8.5 g). Maternal protein restriction also increased lactase activity in the proximal (0.23 ± 0.02 vs 0.15 ± 0.02), medial (0.30 ± 0.06 vs 0.14 ± 0.01) and distal (0.43 ± 0.07 vs 0.07 ± 0.02 U·g-1·min-1) small intestine, and mRNA lactase abundance in the proximal intestine (7.96 ± 1.11 vs 2.38 ± 0.47 relative units) of 3-week-old offspring rats. In addition, maternal protein restriction increased sucrase activity (1.20 ± 0.02 vs 0.91 ± 0.02 U·g-1·min-1) and sucrase mRNA abundance (4.48 ± 0.51 vs 1.95 ± 0.17 relative units) in the duodenum of 16-week-old rats. In conclusion, the present study shows for the first time that intrauterine protein restriction affects gene expression of intestinal enzymes in offspring.

  5. Recycling of protein subunits during DNA translocation and cleavage by Type I restriction-modification enzymes.

    Science.gov (United States)

    Simons, Michelle; Szczelkun, Mark D

    2011-09-01

    The Type I restriction-modification enzymes comprise three protein subunits; HsdS and HsdM that form a methyltransferase (MTase) and HsdR that associates with the MTase and catalyses Adenosine-5'-triphosphate (ATP)-dependent DNA translocation and cleavage. Here, we examine whether the MTase and HsdR components can 'turnover' in vitro, i.e. whether they can catalyse translocation and cleavage events on one DNA molecule, dissociate and then re-bind a second DNA molecule. Translocation termination by both EcoKI and EcoR124I leads to HsdR dissociation from linear DNA but not from circular DNA. Following DNA cleavage, the HsdR subunits appear unable to dissociate even though the DNA is linear, suggesting a tight interaction with the cleaved product. The MTases of EcoKI and EcoAI can dissociate from DNA following either translocation or cleavage and can initiate reactions on new DNA molecules as long as free HsdR molecules are available. In contrast, the MTase of EcoR124I does not turnover and additional cleavage of circular DNA is not observed by inclusion of RecBCD, a helicase-nuclease that degrades the linear DNA product resulting from Type I cleavage. Roles for Type I restriction endonuclease subunit dynamics in restriction alleviation in the cell are discussed.

  6. Translocation-coupled DNA cleavage by the Type ISP restriction-modification enzymes.

    Science.gov (United States)

    Chand, Mahesh K; Nirwan, Neha; Diffin, Fiona M; van Aelst, Kara; Kulkarni, Manasi; Pernstich, Christian; Szczelkun, Mark D; Saikrishnan, Kayarat

    2015-11-01

    Production of endonucleolytic double-strand DNA breaks requires separate strand cleavage events. Although catalytic mechanisms for simple, dimeric endonucleases are known, there are many complex nuclease machines that are poorly understood. Here we studied the single polypeptide Type ISP restriction-modification (RM) enzymes, which cleave random DNA between distant target sites when two enzymes collide after convergent ATP-driven translocation. We report the 2.7-Å resolution X-ray crystal structure of a Type ISP enzyme-DNA complex, revealing that both the helicase-like ATPase and nuclease are located upstream of the direction of translocation, an observation inconsistent with simple nuclease-domain dimerization. Using single-molecule and biochemical techniques, we demonstrate that each ATPase remodels its DNA-protein complex and translocates along DNA without looping it, leading to a collision complex in which the nuclease domains are distal. Sequencing of the products of single cleavage events suggests a previously undescribed endonuclease model, where multiple, stochastic strand-nicking events combine to produce DNA scission.

  7. Krebs cycle enzymes from livers of old mice are differentially regulated by caloric restriction.

    Science.gov (United States)

    Hagopian, Kevork; Ramsey, Jon J; Weindruch, Richard

    2004-08-01

    Krebs cycle enzyme activities and levels of five metabolites were determined from livers of old mice (30 months) maintained either on control or on long-term caloric restriction (CR) diets (28 months). In CR mice, the cycle was divided into two major blocks, the first containing citrate synthase, aconitase and NAD-dependent isocitrate dehydrogenase which showed decreased activities, while the second block, containing the remaining enzymes, displayed increased activity (except for fumarase, which was unchanged). CR also resulted in decreased levels of citrate, glutamate and alpha-ketoglutarate, increased levels of malate, and unchanged levels of aspartate. The alpha-ketoglutarate/glutamate and malate/alpha-ketoglutarate ratios were higher in CR, in parallel with previously reported increases with CR in pyruvate carboxylase activity and glucagon levels, respectively. The results indicate that long-term CR induces a differential regulation of Krebs cycle in old mice and this regulation may be the result of changes in gene expression levels, as well as a complex interplay between enzymes, hormones and other effectors. Truncation of Krebs cycle by CR may be an important adaptation to utilize available substrates for the gluconeogenesis necessary to sustain glycolytic tissues, such as brain.

  8. Exogenous DNA internalisation by sperm cells is improved by combining lipofection and restriction enzyme mediated integration.

    Science.gov (United States)

    Churchil, R R; Gupta, J; Singh, A; Sharma, D

    2011-06-01

    1. Three types of exogenous DNA inserts, i.e. complete linearised pVIVO2-GFP/LacZ vector (9620 bp), the LacZ gene (5317 bp) and the GFP gene (2152 bp) were used to transfect chicken spermatozoa through simple incubation of sperm cells with insert. 2. PCR assay, Dot Blot hybridisation and Southern hybridisation showed the successful internalisation of exogenous DNA by chicken sperm cells. 3. Lipofection and Restriction Enzyme Mediated Integration (REMI) were used to improve the rate of internalisation of exogenous DNA by sperm cells. 4. Results from dot blot as well as Southern hybridisation were semi-quantified and improved exogenous DNA uptake by sperm cells through lipofection and REMI. Stronger signals were observed from hybridisation of LacZ as well as GFP specific probe with the DNA from lipofected exogenous DNA transfected sperm DNA in comparison with those transfected with nude exogenous DNA.

  9. Impacts of degraded DNA on restriction enzyme associated DNA sequencing (RADSeq).

    Science.gov (United States)

    Graham, Carly F; Glenn, Travis C; McArthur, Andrew G; Boreham, Douglas R; Kieran, Troy; Lance, Stacey; Manzon, Richard G; Martino, Jessica A; Pierson, Todd; Rogers, Sean M; Wilson, Joanna Y; Somers, Christopher M

    2015-11-01

    Degraded DNA from suboptimal field sampling is common in molecular ecology. However, its impact on techniques that use restriction site associated next-generation DNA sequencing (RADSeq, GBS) is unknown. We experimentally examined the effects of in situDNA degradation on data generation for a modified double-digest RADSeq approach (3RAD). We generated libraries using genomic DNA serially extracted from the muscle tissue of 8 individual lake whitefish (Coregonus clupeaformis) following 0-, 12-, 48- and 96-h incubation at room temperature posteuthanasia. This treatment of the tissue resulted in input DNA that ranged in quality from nearly intact to highly sheared. All samples were sequenced as a multiplexed pool on an Illumina MiSeq. Libraries created from low to moderately degraded DNA (12-48 h) performed well. In contrast, the number of RADtags per individual, number of variable sites, and percentage of identical RADtags retained were all dramatically reduced when libraries were made using highly degraded DNA (96-h group). This reduction in performance was largely due to a significant and unexpected loss of raw reads as a result of poor quality scores. Our findings remained consistent after changes in restriction enzymes, modified fold coverage values (2- to 16-fold), and additional read-length trimming. We conclude that starting DNA quality is an important consideration for RADSeq; however, the approach remains robust until genomic DNA is extensively degraded.

  10. Gene expression in the DpnI and DpnII restriction enzyme systems of Streptococcus pneumoniae

    Energy Technology Data Exchange (ETDEWEB)

    Lacks, S.A.; Sabelnikov, A.G.; Chen, Jau-Der; Greenberg, B.

    1992-12-31

    Although a number of bacterial species are naturally transformable, that is, their cells are able to take up external DNA in substantial amounts and integrate it into the chromosome without artificial manipulation of the cell surface, Streptococcus pneumoniae, the first species in which this phenomenon was detected, remains a prototype of such transformation. Cells of S. pneumonias also contain potent restriction endonucleases able to severely restrict DNA introduced during viral infection. Our current understanding of the genetic basis of the complementary DpnI and DpnII restriction systems and of the biochemistry of their component enzymes are briefly reviewed. The manner in which these enzymes impinge on the transfer of chromosomal genes and of plasmeds will be examined in detail. It will be seen that far from acting against foreign DNA in general, the restriction systems seem to be designed to exclude only infecting viral DNA The presence of complementary restriction systems in different cells of S. pneumonias enhances their effectiveness in blocking viral infection and promoting species survival. This enhanced effectiveness requires the expression of alternative restriction systems. Therefore, the ability of the cells to transfer the restriction enzyme genes and to regulate their expression are important for survival of the species.

  11. [A novel Salmonella Typhimurium plasmid, pAnkS: an example for plasmid evolution in antibiotic resistance].

    Science.gov (United States)

    Sahin, Fikret; Karasartova, Djursun; Gerçeker, Devran; Aysev, A Derya; Erdem, Birsel

    2008-07-01

    In this study, a plasmid, carrying ampicillin resistance (ampR) gene, isolated from a clinical isolate of Salmonella enterica serotype Typhimurium presenting ACSSuT (ampicilin, chloramphenicol, streptomycin, sulphonamide, tetracycline) resistance phenotype, was defined. The length of complete sequence of this plasmid was 8271 base pairs (bp), and it was named as pAnkS owing to its isolation place (plasmid-Ankara- Salmonella). The plasmid was analyzed for potential reading frames and structural features indicative of transposons and transposon relics. The Xmnl enzyme restriction fragments of pAnkS were cloned into E. coli plasmid vectors (pBSK), sequenced and analyzed with the BLAST programs. Plasmid pAnkS has contained a previously defined enterohemorrhagic E. coli (EHEC) plasmid p4821 as a core region and also contained a complete Tn3-like transposon of 4950 bp consisting of the left terminal repeat, Tn3-related tnpR and tnpA genes for transposition functions, ampicillin resistance gene bla(TEM), and the right terminal repeats, pAnkS showed strong homology with another Salmonella plasmid, pNTP16, for sequences that belong to p4821 and partial Tn3 segments. It was found that pNTP16 also carries kanamycin resistance gene (kanR) in addition to ampR gene. Plasmid pAnkS is one of the few completely sequenced plasmids from Salmonella Typhimurium and is in the middle of the pathway of evolution of plasmid from p4821 to pNTP16. The identification of pAnkS might help better understanding of plasmid evolution.

  12. Restriction enzyme improves the efficiency of genetic transformations in Moniliophthora perniciosa, the causal agent of witches’ broom disease in Theobroma cacao

    Directory of Open Access Journals (Sweden)

    Francis Julio Fagundes Lopes

    2008-02-01

    Full Text Available The presence of restriction enzymes in the transformation mixture improved the efficiency of transformation in Moniliophthora perniciosa. The influence of the vector shape (linear or circular, the patterns of plasmid integration in genomic sites and the influence of the promoter used to express the gene marker were also analyzed. The addition of BamHI or NotI increased the number of transformants by 3-10-fold and 3-fold, respectively, over the control without added enzyme. The use of pre-linearized plasmid did not increase the transformation efficiency in comparison with the circular plasmid. However, the frequency of multi-copy transformants increased significantly. The transformation procedure here reported resulted in better production of protoplasts and transformation efficiency. In addition, the time necessary for the detection of the first transformants and the number of insertions were reduced.A presença de enzima de restrição na mistura de transformação aumentou a eficiência da transformação em Moniliophthora perniciosa. A influência da forma do vetor (linear ou circular, o padrão de integração do plasmídeo nos sítios genômicos e a influência do promotor usado para expressar o gene marcador foram também analisados. A adição de BamHI ou NotI aumentou o número de transformantes 3-10 vezes e 3 vezes, respectivamente, em relação ao controle sem a adição da enzima. O uso de plasmídeos pré-linearizados não aumentou a eficiência da transformação quando comparado à eficiência obtida com plasmídeos circulares. No entanto, a freqüência de transformantes multi-cópias aumentou significativamente. Juntos os procedimentos reportados aqui resultaram em processos mais eficientes de produção de protoplastos e transformação, onde o tempo necessário para o aparecimento dos transformantes e o número de inserções múltiplas foi reduzido.

  13. DNA cleavage by Type ISP Restriction-Modification enzymes is initially targeted to the 3'-5' strand.

    Science.gov (United States)

    van Aelst, Kara; Šišáková, Eva; Szczelkun, Mark D

    2013-01-01

    The mechanism by which a double-stranded DNA break is produced following collision of two translocating Type I Restriction-Modification enzymes is not fully understood. Here, we demonstrate that the related Type ISP Restriction-Modification enzymes LlaGI and LlaBIII can cooperate to cleave DNA following convergent translocation and collision. When one of these enzymes is a mutant protein that lacks endonuclease activity, DNA cleavage of the 3'-5' strand relative to the wild-type enzyme still occurs, with the same kinetics and at the same collision loci as for a reaction between two wild-type enzymes. The DNA nicking activity of the wild-type enzyme is still activated by a protein variant entirely lacking the Mrr nuclease domain and by a helicase mutant that cannot translocate. However, the helicase mutant cannot cleave the DNA despite the presence of an intact nuclease domain. Cleavage by the wild-type enzyme is not activated by unrelated protein roadblocks. We suggest that the nuclease activity of the Type ISP enzymes is activated following collision with another Type ISP enzyme and requires adenosine triphosphate binding/hydrolysis but, surprisingly, does not require interaction between the nuclease domains. Following the initial rapid endonuclease activity, additional DNA cleavage events then occur more slowly, leading to further processing of the initial double-stranded DNA break.

  14. Polymerase chain reaction-based gene removal from plasmids

    Directory of Open Access Journals (Sweden)

    Vishnu Vardhan Krishnamurthy

    2015-09-01

    Full Text Available This data article contains supplementary figures and methods to the research article entitled, “Multiplex gene removal by two-step polymerase chain reactions” (Krishnamurthy et al., Anal. Biochem., 2015, doi:http://dx.doi.org/10.1016/j.ab.2015.03.033, which presents a restriction-enzyme free method to remove multiple DNA segments from plasmids. Restriction-free cloning methods have dramatically improved the flexibility and speed of genetic manipulation compared to conventional assays based on restriction enzyme digestion (Lale and Valla, 2014. DNA Cloning and Assembly Methods, vol. 1116. Here, we show the basic scheme and characterize the success rate for single and multiplex gene removal from plasmids. In addition, we optimize experimental conditions, including the amount of template, multiple primers mixing, and buffers for DpnI treatment, used in the one-pot reaction for multiplex gene removal.

  15. Use of primer selection and restriction enzymes to assess bacterial community diversity in an agricultural soil used for potato production via terminal restriction fragment length polymorphism.

    Science.gov (United States)

    Fortuna, Ann-Marie; Marsh, Terence L; Honeycutt, C Wayne; Halteman, William A

    2011-08-01

    Terminal restriction fragment length polymorphism (T-RFLP) can be used to assess how land use management changes the dominant members of bacterial communities. We compared T-RFLP profiles obtained via amplification with forward primers (27, 63F) each coupled with the fluorescently labeled reverse primer (1392R) and multiple restriction enzymes to determine the best combination for interrogating soil bacterial populations in an agricultural soil used for potato production. Both primer pairs provide nearly universal recognition of a 1,400-bp sequence of the bacterial domain in the V(1)-V(3) region of the 16S ribosomal RNA (rRNA) gene relative to known sequences. Labeling the reverse primer allowed for direct comparison of each forward primer and the terminal restriction fragments' relative migration units obtained with each primer pair and restriction enzyme. Redundancy analysis (RDA) and nested multivariate analysis of variance (MANOVA) were used to assess the effects of primer pair and choice of restriction enzyme on the measured relative migration units. Our research indicates that the 63F-1392R amplimer pair provides a more complete description with respect to the bacterial communities present in this potato (Solanum tuberosum L.)-barley (Hordeum vulgare L.) rotation over seeded to crimson clover (Trifolium praense L.). Domain-specific 16S rRNA gene primers are rigorously tested to determine their ability to amplify across a target region of the gene. Yet, variability within or between T-RFLP profiles can result from factors independent of the primer pair. Therefore, researchers should use RDA and MANOVA analyses to evaluate the effects that additional laboratory and environmental variables have on bacterial diversity.

  16. Mechanism of DNA Recognition by the Restriction Enzyme EcoRV

    Energy Technology Data Exchange (ETDEWEB)

    Zahran, Mai [ORNL; Daidone, Isabella [University of Heidelberg; Smith, Jeremy C [ORNL; Imhof, Petra [University of Heidelberg

    2010-08-01

    EcoRV, a restriction enzyme in Escherichia coli, destroys invading foreign DNA by cleaving it at the center step of a GATATC sequence. In the EcoRV-cognate DNA crystallographic complex, a sharp kink of 50 degrees has been found at the center base-pair step (TA). Here, we examine the interplay between the intrinsic propensity of the cognate sequence to kink and the induction by the enzyme by performing all-atom molecular dynamics simulations of EcoRV unbound and interacting with three DNA sequences: the cognate sequence, GATATC (TA); the non-cognate sequence, GAATTC (AT); and with the cognate sequence methylated on the first adenine GA(CH(3))TATC (TA-CH(3)). In the unbound EcoRV, the cleft between the two C-terminal subdomains is found to be open. Binding to AT narrows the cleft and forms a partially bound state. However, the intrinsic bending propensity of AT is insufficient to allow tight binding. In contrast, the cognate TA sequence is easier to bend, allowing specific, high-occupancy hydrogen bonds to form in the complex. The absence of cleavage for this methylated sequence is found to arise from the loss of specific hydrogen bonds between the first adenine of the recognition sequence and Asn185. On the basis of the results, we suggest a three-step recognition mechanism. In the first step, EcoRV, in an open conformation, binds to the DNA at a random sequence and slides along it. In the second step, when the two outer base pairs, GAxxTC, are recognized, the R loops of the protein become more ordered, forming strong hydrogen-bonding interactions, resulting in a partially bound EcoRV-DNA complex. In the third step, the flexibility of the center base pair is probed, and in the case of the full cognate sequence the DNA bends, the complex strengthens and the protein and DNA interact more closely, allowing cleavage.

  17. A New Method for the Purification of Restriction Enzyme Not Ⅰ%限制性内切酶NotI提纯的新工艺

    Institute of Scientific and Technical Information of China (English)

    张巧; 叶贤龙; 任桂萍; 张楠; 李璐; 李德山

    2011-01-01

    BR322-Eag ⅠM. Then transformed this plasmid into E. coli 2566. Secondly,extracted the genome DNA from Nocardia otitidis-caviarum as template and obtained the restriction enzyme NotⅠR gene by PCR. After ligating the NotⅠR gene to pACYC184-PT7 ,the pACYC184-PT7-NotⅠR plasmid was transformed into the ER2566 which was protected through the methylation by pBR322-EagⅠM recombinant plasmid. The engineered strain ER2566 [ pBR322-EagⅠM,pACYC184-PT7-NotⅠR]could be induced to express restriction enzymes NotⅠ by IPTG and the induction conditions were optimized to make its expression mostly in soluble form. The enzyme was purified by (A)KTA purifier 100 protein purification system.Through DEAE Sephrose FF,phenyl HP and Superdex 75 10/300 GL molecular sieve chromatography,the Not Ⅰ enzyme was purified 35-fold, the yield was 9. 8 × 106Units / g wet cell which was up to17. 8% of the crude enzyme and the specific activity of the purified NotⅠwas 1. 37 × 106U/mg. Digestion results showed that the enzyme was purified to homogeneity and was free of detectable contamination by other DNase ( exo and endo) . After optimization of the expression and purification conditions, the yield and efficiency of NotⅠ enzyme were greatly improved in comparison with that previously reported.

  18. Novel identification of biofluids using a multiplex methylation sensitive restriction enzyme-PCR system.

    Science.gov (United States)

    Lin, Yu-Chih; Tsai, Li-Chin; Lee, James Chun-I; Su, Chih-Wen; Tzen, Jason Tze-Cheng; Linacre, Adrian; Hsieh, Hsing-Mei

    2016-11-01

    The identification of a specific body fluid encountered in a forensic investigation can give crucial information. This identification can be aided by methylation profiles based on selected markers specific to a range of biofluids. In this study, the open database of Infinium HumanMethylation450 BeadChip was searched for markers specific for semen, vaginal fluids, saliva, venous blood and menstrual blood. A total of 8 biofluid-specific methylated markers and 2 control markers were combined into a 10-plex methylation sensitive restriction enzyme-PCR (MSRE-PCR) system. Based upon the analysis of 100 DNA samples from these 5 biofluid types, unambiguous results were obtained to identify the body fluid from which it originated. Validation studies of the developed 10-plex MSRE-PCR included sensitivity, reproducibility and mixed body fluids. Co-amplification of the established MSRE-PCR system and the microsatellite loci in AmpFlSTR(®) MiniFiler™ PCR Amplification Kit was performed to generate both the methylation profile for biofluid type and the miniSTR profile. This allowed human identification and the identification of the body fluid type to be performed in a single reaction. The results of this study displayed the applicability of this 10-plex MSRE-PCR system in forensic science.

  19. Fast conversion of scFv to Fab antibodies using type IIs restriction enzymes.

    Science.gov (United States)

    Sanmark, Hanna; Huovinen, Tuomas; Matikka, Tero; Pettersson, Tiina; Lahti, Maria; Lamminmäki, Urpo

    2015-11-01

    Single chain variable fragment (scFv) antibody libraries are widely used for developing novel bioaffinity reagents, although Fab or IgG molecules are the preferred antibody formats in many final applications. Therefore, rapid conversion methods for combining multiple DNA fragments are needed to attach constant domains to the scFv derived variable domains. In this study we describe a fast and easy cloning method for the conversion of single framework scFv fragments to Fab fragments using type IIS restriction enzymes. All cloning steps excluding plating of the Fab transformants can be done in 96 well plates and the procedure can be completed in one working day. The concept was tested by converting 69 scFv clones into Fab format on 96 well plates, which resulted in 93% success rate. The method is particularly useful as a high-throughput tool for the conversion of the chosen scFv clones into Fab molecules in order to analyze them as early as possible, as the conversion can significantly affect the binding properties of the chosen clones.

  20. Methylation-sensitive restriction enzyme nested real time PCR, a potential approach for sperm DNA identification.

    Science.gov (United States)

    Bai, Lijuan; Yan, Peng; Cao, Ximei; Jia, Linna; Zhang, Ce; Guo, Dawei

    2015-08-01

    Mammal H19 gene is an imprinting gene in which the paternal allele is silenced. On H19 imprinting control region (ICR), one of the mechanisms regulating the paternal allelic specific silence is DNA methylation in somatic cells throughout the individual's whole life. Nevertheless, this pattern of DNA methylation is erased and re-established in germline. As results, in mature sperm H19 ICR shows biallelic methylation instead of paternal specific methylation in somatic cells. Although the data were mainly from experiments on mice the same mechanisms are believed existing in human germline. We designed an experiment to probe the sperm DNA by methylation sensitive restriction enzyme based nested qPCR (MSRE-nested-qPCR). The genomic DNA digested/undigested by HhaI was amplified by outer primers encompassing four HhaI sites on H19 ICR. These PCR products were used as templates for second round real-time PCR to quantify the DNA methylation level. The results showed that DNA methylation level at H19 ICR were 55.27 ± 8.36% in 32 blood samples and 101.94 ± 11.66% in 31 semen samples. Based on our data sperm DNA could be identified if H19 ICR methylation level is over 78.62%.

  1. MULTIPLE ENZYME RESTRICTION FRAGMENT LENGTH POLYMORPHISM ANALYSIS FOR HIGH RESOLUTION DISTINCTION OF PSEUDOMONAS (SENSU STRICTO) 16S RRNA GENES

    Science.gov (United States)

    Pseudomonas specific 16S rDNA PCR amplification and multiple enzyme restriction fragment length polymorphism (MERFLP) analysis using a single digestion mixture of Alu I, Hinf I, Rsa I, and Tru 9I distinguished 150 published sequences and reference strains of authentic Pseudomonas...

  2. FN-Identify: Novel Restriction Enzymes-Based Method for Bacterial Identification in Absence of Genome Sequencing.

    Science.gov (United States)

    Awad, Mohamed; Ouda, Osama; El-Refy, Ali; El-Feky, Fawzy A; Mosa, Kareem A; Helmy, Mohamed

    2015-01-01

    Sequencing and restriction analysis of genes like 16S rRNA and HSP60 are intensively used for molecular identification in the microbial communities. With aid of the rapid progress in bioinformatics, genome sequencing became the method of choice for bacterial identification. However, the genome sequencing technology is still out of reach in the developing countries. In this paper, we propose FN-Identify, a sequencing-free method for bacterial identification. FN-Identify exploits the gene sequences data available in GenBank and other databases and the two algorithms that we developed, CreateScheme and GeneIdentify, to create a restriction enzyme-based identification scheme. FN-Identify was tested using three different and diverse bacterial populations (members of Lactobacillus, Pseudomonas, and Mycobacterium groups) in an in silico analysis using restriction enzymes and sequences of 16S rRNA gene. The analysis of the restriction maps of the members of three groups using the fragment numbers information only or along with fragments sizes successfully identified all of the members of the three groups using a minimum of four and maximum of eight restriction enzymes. Our results demonstrate the utility and accuracy of FN-Identify method and its two algorithms as an alternative method that uses the standard microbiology laboratories techniques when the genome sequencing is not available.

  3. FN-Identify: Novel Restriction Enzymes-Based Method for Bacterial Identification in Absence of Genome Sequencing

    Science.gov (United States)

    Ouda, Osama; El-Refy, Ali; El-Feky, Fawzy A.; Mosa, Kareem A.

    2015-01-01

    Sequencing and restriction analysis of genes like 16S rRNA and HSP60 are intensively used for molecular identification in the microbial communities. With aid of the rapid progress in bioinformatics, genome sequencing became the method of choice for bacterial identification. However, the genome sequencing technology is still out of reach in the developing countries. In this paper, we propose FN-Identify, a sequencing-free method for bacterial identification. FN-Identify exploits the gene sequences data available in GenBank and other databases and the two algorithms that we developed, CreateScheme and GeneIdentify, to create a restriction enzyme-based identification scheme. FN-Identify was tested using three different and diverse bacterial populations (members of Lactobacillus, Pseudomonas, and Mycobacterium groups) in an in silico analysis using restriction enzymes and sequences of 16S rRNA gene. The analysis of the restriction maps of the members of three groups using the fragment numbers information only or along with fragments sizes successfully identified all of the members of the three groups using a minimum of four and maximum of eight restriction enzymes. Our results demonstrate the utility and accuracy of FN-Identify method and its two algorithms as an alternative method that uses the standard microbiology laboratories techniques when the genome sequencing is not available. PMID:26880910

  4. Modular construction of plasmids by parallel assembly of linear vector components.

    Science.gov (United States)

    Gao, XinZheng; Yan, Pu; Shen, Wentao; Li, Xiaoying; Zhou, Peng; Li, Yuenan

    2013-06-15

    Construction of plasmids is the basic and pivotal technology in molecular biology. The common method for constructing plasmids is to cut DNA fragments by restriction enzymes and then join the resulting fragments using ligase. We present here a modified Golden Gate cloning method for modular construction of plasmids. Unlike the original Golden Gate cloning system for cloning from entry vector to expression vector, this method can be used to construct plasmids immediately from linear DNA fragments. After polymerase chain reaction (PCR) amplification for flanking with BsaI sites, multiple linear DNA components (modules) can be parallel assembled into a circle plasmid by a single restriction-ligation reaction using the method. This method is flexible to construct different types of plasmids because the modules can be freely selected and assembled in any combination. This method was applied successfully to construct a prokaryotic expression plasmid from four modules and a plant expression plasmid from five modules (fragments). The results suggest that this method provides a simple and flexible platform for modular construction of plasmids.

  5. AFM studies of nonspecific binding of enzyme on DNA

    Institute of Scientific and Technical Information of China (English)

    张益; 谢恒月; 等

    1996-01-01

    Atomic force microscope(AFM) is used to study restriction endonuclease digestion of plasmid DNA,pWRr plasmid DNA is digested by Hind Ⅲ,and the specific and the nonspecific binding of the restriction endonuclease are imaged,and the biological function of the enzyme binding to nonspecific sites is discussed.In addition,it is found that nonspecific binding of Hind ǚ could not induce the DNA characteristic bending angle.

  6. Catalytic domain of plasmid pAD1 relaxase TraX defines a group of relaxases related to restriction endonucleases.

    Science.gov (United States)

    Francia, María Victoria; Clewell, Don B; de la Cruz, Fernando; Moncalián, Gabriel

    2013-08-13

    Plasmid pAD1 is a 60-kb conjugative element commonly found in clinical isolates of Enterococcus faecalis. The relaxase TraX and the primary origin of transfer oriT2 are located close to each other and have been shown to be essential for conjugation. The oriT2 site contains a large inverted repeat (where the nic site is located) adjacent to a series of short direct repeats. TraX does not show any of the typical relaxase sequence motifs but is the prototype of a unique family of relaxases (MOBC). The present study focuses on the genetic, biochemical, and structural analysis of TraX, whose 3D structure could be predicted by protein threading. The structure consists of two domains: (i) an N-terminal domain sharing the topology of the DNA binding domain of the MarR family of transcriptional regulators and (ii) a C-terminal catalytic domain related to the PD-(D/E)XK family of restriction endonucleases. Alignment of MOBC relaxase amino acid sequences pointed to several conserved polar amino acid residues (E28, D152, E170, E172, K176, R180, Y181, and Y203) that were mutated to alanine. Functional analysis of these mutants (in vivo DNA transfer and cleavage assays) revealed the importance of these residues for relaxase activity and suggests Y181 as a potential catalytic residue similarly to His-hydrophobe-His relaxases. We also show that TraX binds specifically to dsDNA containing the oriT2 direct repeat sequences, confirming their role in transfer specificity. The results provide insights into the catalytic mechanism of MOBC relaxases, which differs radically from that of His-hydrophobe-His relaxases.

  7. Reference genome-independent assessment of mutation density using restriction enzyme-phased sequencing

    Directory of Open Access Journals (Sweden)

    Monson-Miller Jennifer

    2012-02-01

    Full Text Available Abstract Background The availability of low cost sequencing has spurred its application to discovery and typing of variation, including variation induced by mutagenesis. Mutation discovery is challenging as it requires a substantial amount of sequencing and analysis to detect very rare changes and distinguish them from noise. Also challenging are the cases when the organism of interest has not been sequenced or is highly divergent from the reference. Results We describe the development of a simple method for reduced representation sequencing. Input DNA was digested with a single restriction enzyme and ligated to Y adapters modified to contain a sequence barcode and to provide a compatible overhang for ligation. We demonstrated the efficiency of this method at SNP discovery using rice and arabidopsis. To test its suitability for the discovery of very rare SNP, one control and three mutagenized rice individuals (1, 5 and 10 mM sodium azide were used to prepare genomic libraries for Illumina sequencers by ligating barcoded adapters to NlaIII restriction sites. For genome-dependent discovery 15-30 million of 80 base reads per individual were aligned to the reference sequence achieving individual sequencing coverage from 7 to 15×. We identified high-confidence base changes by comparing sequences across individuals and identified instances consistent with mutations, i.e. changes that were found in a single treated individual and were solely GC to AT transitions. For genome-independent discovery 70-mers were extracted from the sequence of the control individual and single-copy sequence was identified by comparing the 70-mers across samples to evaluate copy number and variation. This de novo "genome" was used to align the reads and identify mutations as above. Covering approximately 1/5 of the 380 Mb genome of rice we detected mutation densities ranging from 0.6 to 4 per Mb of diploid DNA depending on the mutagenic treatment. Conclusions The

  8. Rates of intercalator-driven platination of DNA determined by a restriction enzyme cleavage inhibition assay.

    Science.gov (United States)

    Choudhury, Jayati Roy; Rao, Lu; Bierbach, Ulrich

    2011-03-01

    A restriction enzyme cleavage inhibition assay was designed to determine the rates of DNA platination by four non-cross-linking platinum-acridine agents represented by the formula [Pt(am(2))LCl](NO(3))(2), where am is a diamine nonleaving group and L is an acridine derived from the intercalator 1-[2-(acridin-9-ylamino)ethyl]-1,3-dimethylthiourea (ACRAMTU). The formation of monofunctional adducts in the target sequence 5'-CGA was studied in a 40-base-pair probe containing the EcoRI restriction site GAATTC. The time dependence of endonuclease inhibition was quantitatively analyzed by polyacrylamide gel electrophoresis. The formation of monoadducts is approximately 3 times faster with double-stranded DNA than with simple nucleic acid fragments. Compound 1 (am(2) is ethane-1,2-diamine, L is ACRAMTU) reacts with a first-order rate constant of k (obs) = 1.4 ± 0.37 × 10(-4) s(-1) (t (1/2) = 83 ± 22 min). Replacement of the thiourea group in ACRAMTU with an amidine group (compound 2) accelerates the rate by fourfold (k (obs) = 5.7 ± 0.58 × 10(-4) s(-1), t (1/2) = 21 ± 2 min), and introduction of a propane-1,3-diamine nonleaving group results in a 1.5-fold enhancement in reactivity (compound 3, k (obs) = 2.1 ± 0.40 × 10(-4) s(-1), t (1/2) = 55 ± 10 min) compared with the prototype. Derivative 4, containing a 4,9-disubstituted acridine threading intercalator, was the least reactive compound in the series (k (obs) = 1.1 ± 0.40 × 10(-4) s(-1), t (1/2) = 104 ± 38 min). The data suggest a correlation may exist between the binding rates and the biological activity of the compounds. Potential pharmacological advantages of rapid formation of cytotoxic monofunctional adducts over the common purine-purine cross-links are discussed.

  9. Increasing Genome Sampling and Improving SNP Genotyping for Genotyping-by-Sequencing with New Combinations of Restriction Enzymes.

    Science.gov (United States)

    Fu, Yong-Bi; Peterson, Gregory W; Dong, Yibo

    2016-04-07

    Genotyping-by-sequencing (GBS) has emerged as a useful genomic approach for exploring genome-wide genetic variation. However, GBS commonly samples a genome unevenly and can generate a substantial amount of missing data. These technical features would limit the power of various GBS-based genetic and genomic analyses. Here we present software called IgCoverage for in silico evaluation of genomic coverage through GBS with an individual or pair of restriction enzymes on one sequenced genome, and report a new set of 21 restriction enzyme combinations that can be applied to enhance GBS applications. These enzyme combinations were developed through an application of IgCoverage on 22 plant, animal, and fungus species with sequenced genomes, and some of them were empirically evaluated with different runs of Illumina MiSeq sequencing in 12 plant species. The in silico analysis of 22 organisms revealed up to eight times more genome coverage for the new combinations consisted of pairing four- or five-cutter restriction enzymes than the commonly used enzyme combination PstI + MspI. The empirical evaluation of the new enzyme combination (HinfI + HpyCH4IV) in 12 plant species showed 1.7-6 times more genome coverage than PstI + MspI, and 2.3 times more genome coverage in dicots than monocots. Also, the SNP genotyping in 12 Arabidopsis and 12 rice plants revealed that HinfI + HpyCH4IV generated 7 and 1.3 times more SNPs (with 0-16.7% missing observations) than PstI + MspI, respectively. These findings demonstrate that these novel enzyme combinations can be utilized to increase genome sampling and improve SNP genotyping in various GBS applications.

  10. Increasing Genome Sampling and Improving SNP Genotyping for Genotyping-by-Sequencing with New Combinations of Restriction Enzymes

    Directory of Open Access Journals (Sweden)

    Yong-Bi Fu

    2016-04-01

    Full Text Available Genotyping-by-sequencing (GBS has emerged as a useful genomic approach for exploring genome-wide genetic variation. However, GBS commonly samples a genome unevenly and can generate a substantial amount of missing data. These technical features would limit the power of various GBS-based genetic and genomic analyses. Here we present software called IgCoverage for in silico evaluation of genomic coverage through GBS with an individual or pair of restriction enzymes on one sequenced genome, and report a new set of 21 restriction enzyme combinations that can be applied to enhance GBS applications. These enzyme combinations were developed through an application of IgCoverage on 22 plant, animal, and fungus species with sequenced genomes, and some of them were empirically evaluated with different runs of Illumina MiSeq sequencing in 12 plant species. The in silico analysis of 22 organisms revealed up to eight times more genome coverage for the new combinations consisted of pairing four- or five-cutter restriction enzymes than the commonly used enzyme combination PstI + MspI. The empirical evaluation of the new enzyme combination (HinfI + HpyCH4IV in 12 plant species showed 1.7–6 times more genome coverage than PstI + MspI, and 2.3 times more genome coverage in dicots than monocots. Also, the SNP genotyping in 12 Arabidopsis and 12 rice plants revealed that HinfI + HpyCH4IV generated 7 and 1.3 times more SNPs (with 0–16.7% missing observations than PstI + MspI, respectively. These findings demonstrate that these novel enzyme combinations can be utilized to increase genome sampling and improve SNP genotyping in various GBS applications.

  11. Screening large numbers of recombinant plasmids: modifications and additions to alkaline lysis for greater efficiency

    Institute of Scientific and Technical Information of China (English)

    XU Yibing; N.V. CHANDRASEKHARAN; Daniel L. SIMMONS

    2006-01-01

    Selecting bacteria transformed with recombinant plasmid is a laborious step in gene cloning experiments. This selection process is even more tedious when large numbers of clones need to be screened. We describe here modifications to the ultra fast plasmid preparation method described previously by Law and Crickmore. The modified method is coupled to an efficient PCR step to rapidly determine orientation of the inserts. Compared to traditional methods of analysis requiring growth of overnight cultures, plasmid isolation and restriction enzyme digestion to determine orientation this procedure allows for the analysis and storage of a large number of recombinants within a few hours.

  12. Random Tagging Genotyping by Sequencing (rtGBS, an Unbiased Approach to Locate Restriction Enzyme Sites across the Target Genome.

    Directory of Open Access Journals (Sweden)

    Elena Hilario

    Full Text Available Genotyping by sequencing (GBS is a restriction enzyme based targeted approach developed to reduce the genome complexity and discover genetic markers when a priori sequence information is unavailable. Sufficient coverage at each locus is essential to distinguish heterozygous from homozygous sites accurately. The number of GBS samples able to be pooled in one sequencing lane is limited by the number of restriction sites present in the genome and the read depth required at each site per sample for accurate calling of single-nucleotide polymorphisms. Loci bias was observed using a slight modification of the Elshire et al.some restriction enzyme sites were represented in higher proportions while others were poorly represented or absent. This bias could be due to the quality of genomic DNA, the endonuclease and ligase reaction efficiency, the distance between restriction sites, the preferential amplification of small library restriction fragments, or bias towards cluster formation of small amplicons during the sequencing process. To overcome these issues, we have developed a GBS method based on randomly tagging genomic DNA (rtGBS. By randomly landing on the genome, we can, with less bias, find restriction sites that are far apart, and undetected by the standard GBS (stdGBS method. The study comprises two types of biological replicates: six different kiwifruit plants and two independent DNA extractions per plant; and three types of technical replicates: four samples of each DNA extraction, stdGBS vs. rtGBS methods, and two independent library amplifications, each sequenced in separate lanes. A statistically significant unbiased distribution of restriction fragment size by rtGBS showed that this method targeted 49% (39,145 of BamH I sites shared with the reference genome, compared to only 14% (11,513 by stdGBS.

  13. Structure of 5-hydroxymethylcytosine-specific restriction enzyme, AbaSI, in complex with DNA

    Energy Technology Data Exchange (ETDEWEB)

    Horton, John R.; Borgaro, Janine G.; Griggs, Rose M.; Quimby, Aine; Guan, Shengxi; Zhang, Xing; Wilson, Geoffrey G.; Zheng, Yu; Zhu, Zhenyu; Cheng, Xiaodong (Emory-MED); (NE Biolabs)

    2014-07-03

    AbaSI, a member of the PvuRts1I-family of modification-dependent restriction endonucleases, cleaves DNA containing 5-hydroxymethylctosine (5hmC) and glucosylated 5hmC (g5hmC), but not DNA containing unmodified cytosine. AbaSI has been used as a tool for mapping the genomic locations of 5hmC, an important epigenetic modification in the DNA of higher organisms. Here we report the crystal structures of AbaSI in the presence and absence of DNA. These structures provide considerable, although incomplete, insight into how this enzyme acts. AbaSI appears to be mainly a homodimer in solution, but interacts with DNA in our structures as a homotetramer. Each AbaSI subunit comprises an N-terminal, Vsr-like, cleavage domain containing a single catalytic site, and a C-terminal, SRA-like, 5hmC-binding domain. Two N-terminal helices mediate most of the homodimer interface. Dimerization brings together the two catalytic sites required for double-strand cleavage, and separates the 5hmC binding-domains by ~ 70 Å, consistent with the known activity of AbaSI which cleaves DNA optimally between symmetrically modified cytosines ~ 22 bp apart. The eukaryotic SET and RING-associated (SRA) domains bind to DNA containing 5-methylcytosine (5mC) in the hemi-methylated CpG sequence. They make contacts in both the major and minor DNA grooves, and flip the modified cytosine out of the helix into a conserved binding pocket. In contrast, the SRA-like domain of AbaSI, which has no sequence specificity, contacts only the minor DNA groove, and in our current structures the 5hmC remains intra-helical. A conserved, binding pocket is nevertheless present in this domain, suitable for accommodating 5hmC and g5hmC. We consider it likely, therefore, that base-flipping is part of the recognition and cleavage mechanism of AbaSI, but that our structures represent an earlier, pre-flipped stage, prior to actual recognition.

  14. Structure of 5-hydroxymethylcytosine-specific restriction enzyme, AbaSI, in complex with DNA.

    Science.gov (United States)

    Horton, John R; Borgaro, Janine G; Griggs, Rose M; Quimby, Aine; Guan, Shengxi; Zhang, Xing; Wilson, Geoffrey G; Zheng, Yu; Zhu, Zhenyu; Cheng, Xiaodong

    2014-07-01

    AbaSI, a member of the PvuRts1I-family of modification-dependent restriction endonucleases, cleaves deoxyribonucleic acid (DNA) containing 5-hydroxymethylctosine (5hmC) and glucosylated 5hmC (g5hmC), but not DNA containing unmodified cytosine. AbaSI has been used as a tool for mapping the genomic locations of 5hmC, an important epigenetic modification in the DNA of higher organisms. Here we report the crystal structures of AbaSI in the presence and absence of DNA. These structures provide considerable, although incomplete, insight into how this enzyme acts. AbaSI appears to be mainly a homodimer in solution, but interacts with DNA in our structures as a homotetramer. Each AbaSI subunit comprises an N-terminal, Vsr-like, cleavage domain containing a single catalytic site, and a C-terminal, SRA-like, 5hmC-binding domain. Two N-terminal helices mediate most of the homodimer interface. Dimerization brings together the two catalytic sites required for double-strand cleavage, and separates the 5hmC binding-domains by ∼70 Å, consistent with the known activity of AbaSI which cleaves DNA optimally between symmetrically modified cytosines ∼22 bp apart. The eukaryotic SET and RING-associated (SRA) domains bind to DNA containing 5-methylcytosine (5mC) in the hemi-methylated CpG sequence. They make contacts in both the major and minor DNA grooves, and flip the modified cytosine out of the helix into a conserved binding pocket. In contrast, the SRA-like domain of AbaSI, which has no sequence specificity, contacts only the minor DNA groove, and in our current structures the 5hmC remains intra-helical. A conserved, binding pocket is nevertheless present in this domain, suitable for accommodating 5hmC and g5hmC. We consider it likely, therefore, that base-flipping is part of the recognition and cleavage mechanism of AbaSI, but that our structures represent an earlier, pre-flipped stage, prior to actual recognition.

  15. Molecular relationship among fosfomycin-resistant plasmids and clinical impact of fosfomycin resistance.

    Science.gov (United States)

    Mendoza, M C; Teran, F J; Mendez, F J; Hardisson, C

    1988-10-01

    We have been carrying out a surveillance programme on plasmid-mediated fosfomycin resistance in our community over the last decade and have isolated and characterized several varieties of conjugative plasmids from different enterobacteriae. In this work we show that seven varieties of plasmids are related with the Inc M group, and carry the same For determinant which encodes a modifying enzyme. The comparative study on their R-phenotype, restriction analysis and DNA-DNA hybridization showed different degrees of molecular relationship among them. The spread of For-plasmids as well as the fosfomycin resistance by other mechanisms seems to be low in spite of the great For-plasmid diversity found.

  16. ICRPfinder: a fast pattern design algorithm for coding sequences and its application in finding potential restriction enzyme recognition sites

    Directory of Open Access Journals (Sweden)

    Stafford Phillip

    2009-09-01

    Full Text Available Abstract Background Restriction enzymes can produce easily definable segments from DNA sequences by using a variety of cut patterns. There are, however, no software tools that can aid in gene building -- that is, modifying wild-type DNA sequences to express the same wild-type amino acid sequences but with enhanced codons, specific cut sites, unique post-translational modifications, and other engineered-in components for recombinant applications. A fast DNA pattern design algorithm, ICRPfinder, is provided in this paper and applied to find or create potential recognition sites in target coding sequences. Results ICRPfinder is applied to find or create restriction enzyme recognition sites by introducing silent mutations. The algorithm is shown capable of mapping existing cut-sites but importantly it also can generate specified new unique cut-sites within a specified region that are guaranteed not to be present elsewhere in the DNA sequence. Conclusion ICRPfinder is a powerful tool for finding or creating specific DNA patterns in a given target coding sequence. ICRPfinder finds or creates patterns, which can include restriction enzyme recognition sites, without changing the translated protein sequence. ICRPfinder is a browser-based JavaScript application and it can run on any platform, in on-line or off-line mode.

  17. Functional analysis of MmeI from methanol utilizer Methylophilus methylotrophus, a subtype IIC restriction-modification enzyme related to type I enzymes.

    Science.gov (United States)

    Nakonieczna, Joanna; Kaczorowski, Tadeusz; Obarska-Kosinska, Agnieszka; Bujnicki, Janusz M

    2009-01-01

    MmeI from Methylophilus methylotrophus belongs to the type II restriction-modification enzymes. It recognizes an asymmetric DNA sequence, 5'-TCCRAC-3' (R indicates G or A), and cuts both strands at fixed positions downstream of the specific site. This particular feature has been exploited in transcript profiling of complex genomes (using serial analysis of gene expression technology). We have shown previously that the endonucleolytic activity of MmeI is strongly dependent on the presence of S-adenosyl-l-methionine (J. Nakonieczna, J. W. Zmijewski, B. Banecki, and A. J. Podhajska, Mol. Biotechnol. 37:127-135, 2007), which puts MmeI in subtype IIG. The same cofactor is used by MmeI as a methyl group donor for modification of an adenine in the upper strand of the recognition site to N(6)-methyladenine. Both enzymatic activities reside in a single polypeptide (919 amino acids [aa]), which puts MmeI also in subtype IIC of the restriction-modification systems. Based on a molecular model, generated with the use of bioinformatic tools and validated by site-directed mutagenesis, we were able to localize three functional domains in the structure of the MmeI enzyme: (i) the N-terminal portion containing the endonucleolytic domain with the catalytic Mg2+-binding motif D(70)-X(9)-EXK(82), characteristic for the PD-(D/E)XK superfamily of nucleases; (ii) a central portion (aa 310 to 610) containing nine sequence motifs conserved among N(6)-adenine gamma-class DNA methyltransferases; (iii) the C-terminal portion (aa 610 to 919) containing a putative target recognition domain. Interestingly, all three domains showed highest similarity to the corresponding elements of type I enzymes rather than to classical type II enzymes. We have found that MmeI variants deficient in restriction activity (D70A, E80A, and K82A) can bind and methylate specific nucleotide sequence. This suggests that domains of MmeI responsible for DNA restriction and modification can act independently. Moreover, we

  18. [THE EFFECT OF DIETARY RESTRICTION DURING DEVELOPMENT OF DROSOPHILA MELANOGASTER ON THE ACTIVITY OF ANTIOXIDANT SYSTEM ENZYMES].

    Science.gov (United States)

    Zabuga, O G; Koliada, A K; Kukharskyy, V M; Bazhynova, A I; Vaiserman, A M

    2015-01-01

    In the previous study we demonstrated that dietary restriction only at the development stage of Drosophila melanogaster may impact the life span of adult flies. It was important that we didn't use qualitative (restriction of proteins or other macro- or microelements) and not a calorie restriction as well, but quantitative dietary restriction that was the proportional reduction of all food components in the larval medium. In the situations when the larvae were reared in the medium types, that contained protein and carbohydrate components in concentrations of 90-10% of food components compared to the standard one (100%), the males were characterised with the significant increase in the maximum life span. The average life span was also increased, but only in those male individuals that developed in the medium types, that contained 50% and 60% of food components compared to controls. Such an effect we haven't detected in the female flies. To study the biochemical changes associated with the physiological effects we have determined the activity of the antioxidant enzymes--superoxide dismutase (SOD) and catalase. In the male flies the 50% dietary restriction implemented during the development has led to the significant increase in a SOD and catalase activity. Also the flies of both sexes reared in the medium with the 50% of food components have been characterised with the reduction in the accumulation of glycation end products. According to these results, we suggest that the changes in the activity of antioxidant enzymes may play a role in the increase of the flies life span caused by the dietary restriction during the development.

  19. Identification and differentiation of Fasciola hepatica and Fasciola gigantica using a simple PCR-restriction enzyme method.

    Science.gov (United States)

    Rokni, Mohammad Bagher; Mirhendi, Hossein; Mizani, Azadeh; Mohebali, Mehdi; Sharbatkhori, Mitra; Kia, Eshrat Beigom; Abdoli, Hamid; Izadi, Shahrokh

    2010-02-01

    Accurate morphological differentiation between the liver fluke species Fasciola hepatica and Fasciola gigantica is difficult. We evaluated PCR-restriction enzyme profiles of internal transcribed spacer 1 (ITS1) that could aid in their identification. Fifty F. hepatica and 30 F. gigantica specimens were collected from different hosts in three provinces of Iran. For DNA extraction, we crushed fragments of the worms between two glass slides as a new method to break down the cells. DNA from the crushed materials was then extracted with a conventional phenol-chloroform method and with the newly developed technique, commercial FTA cards. A primer pair was selected to amplify a 463-bp region of the ITS1 sequence. After sequencing 14 samples and in silico analysis, cutting sites of all known enzymes were predicted and TasI was selected as the enzyme that yielded the most informative profile. Crushing produced enough DNA for PCR amplification with both the phenol-chloroform and commercial FTA card method. The DNA extracted from all samples was successfully amplified and yielded a single sharp band of the expected size. Digestion of PCR products with TasI allowed us to distinguish the two species. In all samples, molecular identification was consistent with morphological identification. Our PCR-restriction enzyme profile is a simple, rapid and reliable method for differentiating F. hepatica and F. gigantica, and can be used for diagnostic and epidemiological purposes.

  20. Dissociation from DNA of Type III Restriction-Modification enzymes during helicase-dependent motion and following endonuclease activity.

    Science.gov (United States)

    Tóth, Júlia; van Aelst, Kara; Salmons, Hannah; Szczelkun, Mark D

    2012-08-01

    DNA cleavage by the Type III Restriction-Modification (RM) enzymes requires the binding of a pair of RM enzymes at two distant, inversely orientated recognition sequences followed by helicase-catalysed ATP hydrolysis and long-range communication. Here we addressed the dissociation from DNA of these enzymes at two stages: during long-range communication and following DNA cleavage. First, we demonstrated that a communicating species can be trapped in a DNA domain without a recognition site, with a non-specific DNA association lifetime of ∼ 200 s. If free DNA ends were present the lifetime became too short to measure, confirming that ends accelerate dissociation. Secondly, we observed that Type III RM enzymes can dissociate upon DNA cleavage and go on to cleave further DNA molecules (they can 'turnover', albeit inefficiently). The relationship between the observed cleavage rate and enzyme concentration indicated independent binding of each site and a requirement for simultaneous interaction of at least two enzymes per DNA to achieve cleavage. In light of various mechanisms for helicase-driven motion on DNA, we suggest these results are most consistent with a thermally driven random 1D search model (i.e. 'DNA sliding').

  1. Structural similarity and distribution of small cryptic plasmids of Lactobacillus curvatus and L. sake.

    Science.gov (United States)

    Vogel, R F; Lohmann, M; Weller, A N; Hugas, M; Hammes, W P

    1991-11-15

    Plasmid profiles of strains of Lactobacillus curvatus and L. sake isolated from meat or sauerkraut were analysed to investigate plasmid homology and distribution in relation to the ecology of these organisms in fermenting foods. A hybridisation probe was constructed by cloning of pLc2, a cryptic, 2.6-kbp plasmid from L. curvatus LTH683, into the Escherichia coli plasmid pRV50. In Southern hybridisations with the digoxygenine labeled pLc2 probe, pLc2-related small plasmids were frequently detected in meat-borne strains of L. casei subsp. pseudoplantarum, L. curvatus, L. sake, L. alimentarius, L. farciminis and L. halotolerans and in L. curvatus and L. sake isolated from sauerkraut. Among 27 Lactobacillus type strains originally isolated from habitats other than meat this type of homology was detected only with plasmids of L. buchneri and L. mali. Restriction-enzyme mapping of six small cryptic plasmids from L. curvatus and L. sake revealed strong structural homology but no similarity to previously characterized plasmids of lactobacilli. The presence of a variable region in addition to a conserved one and the occurrence of deletions during cloning of pLc2 suggest that vectors derived from these plasmids are likely to be structurally unstable.

  2. Instability of multiple drug resistance plasmids in Salmonella typhimurium isolated from poultry.

    Science.gov (United States)

    Brown, D J; Threlfall, E J; Rowe, B

    1991-04-01

    Plasmids in five strains of Salmonella typhimurium resistant to ampicillin, chloramphenicol, gentamicin, neomycin/kanamycin, streptomycin, sulphonamides, tetracyclines and trimethoprim (ACGKSSuTTm), CGKSSuTTm, ACSSuT or CSSuT which had been isolated from poultry in the first 3 months of 1989 have been characterized and compared with plasmids in two strains of R-types ACGKSSuTTm and ASSuTTm isolated from two patients later in the year. With the exception of the human isolate of R-type ASSuTTm, all strains carried two non-conjugative plasmids, one coding for SSu and belonging to incompatibility group Q, and a second coding for multiple resistance and belonging to the FIme incompatibility group. The human isolate of R-type ASSuTTm did not carry the IncQ SSu plasmid but like the poultry isolates, carried a non-conjugative FIme plasmid. Restriction endonuclease digestion with the enzymes EcoR I, Pst I and Hind III demonstrated that the FIme plasmids from strains of different R-types showed a high degree of homology but exhibited numerous fragment size polymorphisms. The restriction digest fingerprint of plasmids in the human isolate of R-type ACGKSSuTTm was indistinguishable from a poultry isolate of the same R-type. Analysis of segregants of one of the poultry isolates of R-type ACGKSSuTTm demonstrated that resistance determinants could be rapidly lost from the FIme plasmid to give rise to a number of R-types and fingerprint patterns. Loss of tetracycline resistance from this plasmid appeared to be correlated with the integration of other plasmid-mediated resistances into the bacterial chromosome. Evidence is presented for the rapid loss of antimicrobial resistance determinants from a multiple resistance plasmid of the FIme incompatibility group in response to withdrawal of antibiotic selective pressure.

  3. Rational Design of Thermally Stable Novel Biocatalytic Nanomaterials: Enzyme Stability in Restricted Spatial Dimensions

    Science.gov (United States)

    Mudhivarthi, Vamsi K.

    Enzyme stability is of intense interest in bio-materials science as biocatalysts, and as sensing platforms. This is essentially because the unique properties of DNA, RNA, PAA can be coupled with the interesting and novel properties of proteins to produce systems with unprecedented control over their properties. In this article, the very first examples of enzyme/NA/inorganic hybrid nanomaterials and enzyme-Polyacrylic acid conjugates will be presented. The basic principles of design, synthesis and control of properties of these hybrid materials will be presented first, and this will be followed by a discussion of selected examples from our recent research findings. Data show that key properties of biological catalysts are improved by the inorganic framework especially when the catalyst is co-embedded with DNA. Several examples of such studies with various enzymes and proteins, including horseradish peroxidase (HRP), glucose oxidase (GO), cytochrome c (Cyt c), met-hemoglobin (Hb) and met-myoglobin (Mb) will be discussed. Additionally, key insights obtained by the standard methods of materials science including XRD, SEM and TEM as well as biochemical, calorimetric and spectroscopic methods will be discussed. Furthermore, improved structure and enhanced activities of the biocatalysts in specific cases will be demonstrated along with the potential stabilization mechanisms. Our hypothesis is that nucleic acids provide an excellent control over the enzyme-solid interactions as well as rational assembly of nanomaterials. These novel nanobiohybrid materials may aid in engineering more effective synthetic materials for gene-delivery, RNA-delivery and drug delivery applications.

  4. Ovine maternal nutrient restriction from mid to late gestation decreases heptic progesterone inactivating enzyme activity

    Science.gov (United States)

    Previously we have shown increased concentrations of progesterone and decreased liver weight in mid to late pregnant ewes provided a nutrient restricted vs. adequate diet. This alteration in peripheral progesterone could be due to increased synthesis and/or decreased clearance of progesterone. There...

  5. Inquiry-Based Experiments for Large-Scale Introduction to PCR and Restriction Enzyme Digests

    Science.gov (United States)

    Johanson, Kelly E.; Watt, Terry J.

    2015-01-01

    Polymerase chain reaction and restriction endonuclease digest are important techniques that should be included in all Biochemistry and Molecular Biology laboratory curriculums. These techniques are frequently taught at an advanced level, requiring many hours of student and faculty time. Here we present two inquiry-based experiments that are…

  6. A novel whole genome amplification method using type IIS restriction enzymes to create overhangs with random sequences.

    Science.gov (United States)

    Pan, Xiaoming; Wan, Baihui; Li, Chunchuan; Liu, Yu; Wang, Jing; Mou, Haijin; Liang, Xingguo

    2014-08-20

    Ligation-mediated polymerase chain reaction (LM-PCR) is a whole genome amplification (WGA) method, for which genomic DNA is cleaved into numerous fragments and then all of the fragments are amplified by PCR after attaching a universal end sequence. However, the self-ligation of these fragments could happen and may cause biased amplification and restriction of its application. To decrease the self-ligation probability, here we use type IIS restriction enzymes to digest genomic DNA into fragments with 4-5nt long overhangs with random sequences. After ligation to an adapter with random end sequences to above fragments, PCR is carried out and almost all present DNA sequences are amplified. In this study, whole genome of Vibrio parahaemolyticus was amplified and the amplification efficiency was evaluated by quantitative PCR. The results suggested that our approach could provide sufficient genomic DNA with good quality to meet requirements of various genetic analyses.

  7. Structural basis for catalytically restrictive dynamics of a high-energy enzyme state

    Science.gov (United States)

    Kovermann, Michael; Ådén, Jörgen; Grundström, Christin; Elisabeth Sauer-Eriksson, A.; Sauer, Uwe H.; Wolf-Watz, Magnus

    2015-07-01

    An emerging paradigm in enzymology is that transient high-energy structural states play crucial roles in enzymatic reaction cycles. Generally, these high-energy or `invisible' states cannot be studied directly at atomic resolution using existing structural and spectroscopic techniques owing to their low populations or short residence times. Here we report the direct NMR-based detection of the molecular topology and conformational dynamics of a catalytically indispensable high-energy state of an adenylate kinase variant. On the basis of matching energy barriers for conformational dynamics and catalytic turnover, it was found that the enzyme's catalytic activity is governed by its dynamic interconversion between the high-energy state and a ground state structure that was determined by X-ray crystallography. Our results show that it is possible to rationally tune enzymes' conformational dynamics and hence their catalytic power--a key aspect in rational design of enzymes catalysing novel reactions.

  8. A simple modification to improve the accuracy of methylation-sensitive restriction enzyme quantitative polymerase chain reaction.

    Science.gov (United States)

    Krygier, Magdalena; Podolak-Popinigis, Justyna; Limon, Janusz; Sachadyn, Paweł; Stanisławska-Sachadyn, Anna

    2016-05-01

    DNA digestion with endonucleases sensitive to CpG methylation such as HpaII followed by polymerase chain reaction (PCR) quantitation is commonly used in molecular studies as a simple and inexpensive solution for assessment of region-specific DNA methylation. We observed that the results of such analyses were highly overestimated if mock-digested samples were applied as the reference. We determined DNA methylation levels in several promoter regions in two setups implementing different references: mock-digested and treated with a restriction enzyme that has no recognition sites within examined amplicons. Fragmentation of reference templates allowed removing the overestimation effect, thereby improving measurement accuracy.

  9. Specific fragments of phi X174 deoxyribonucleic acid produced by a restriction enzyme from Haemophilus aegyptius, endonuclease Z.

    Science.gov (United States)

    Middleton, J H; Edgell, M H; Hutchison, C A

    1972-07-01

    A restriction-like enzyme has been purified from Haemophilus aegyptius. This nuclease, endonuclease Z, produces a rapid decrease in the viscosity of native calf thymus and H. influenzae deoxyribonucleic acids (DNA), but does not degrade homologous DNA. The specificity of endonuclease Z is different from that of the similar endonuclease isolated from H. influenzae (endonuclease R). The purified enzyme cleaves the double-stranded replicative form DNA of bacteriophage phiX174 (phiX174 RF DNA) into at least 11 specific limit fragments whose molecular sizes have been estimated by gel electrophoresis. The position of these fragments with respect to the genetic map of phiX174 can be determined by using the genetic assay for small fragments of phiX174 DNA.

  10. An Mrr-family nuclease motif in the single polypeptide restriction-modification enzyme LlaGI.

    Science.gov (United States)

    Smith, Rachel M; Josephsen, Jytte; Szczelkun, Mark D

    2009-11-01

    Bioinformatic analysis of the putative nuclease domain of the single polypeptide restriction-modification enzyme LlaGI reveals amino acid motifs characteristic of the Escherichia coli methylated DNA-specific Mrr endonuclease. Using mutagenesis, we examined the role of the conserved residues in both DNA translocation and cleavage. Mutations in those residues predicted to play a role in DNA hydrolysis produced enzymes that could translocate on DNA but were either unable to cleave the polynucleotide track or had reduced nuclease activity. Cleavage by LlaGI is not targeted to methylated DNA, suggesting that the conserved motifs in the Mrr domain are a conventional sub-family of the PD-(D/E)XK superfamily of DNA nucleases.

  11. Comparison of the accuracy and mechanism of data mining identification of the intestinal microbiota with 7 restriction enzymes.

    Science.gov (United States)

    Kobayashi, Toshio; Fujiwara, Kenji

    2013-01-01

    The intestinal microbiota compositions of 92 Japanese men were identified following consumption of identical meals for 3 days, and collected feces were analyzed through terminal restriction fragment length polymorphism. The obtained operational taxonomic units (OTUs) and subjects' smoking and drinking habits, which had 2 nominal partitions, yes or no, were analyzed by Data mining software. Identification of subjects for each habit was successfully performed and reported previously, but the identification accuracy was closely dependent on the species of the applied restriction enzymes for PCR. For the sake of better selection of enzymes and understanding the mechanisms of Data mining analysis, 516f-BslI and 516f-HaeIII, 27f-MspI and 27f-AluI and 35f-HhaI, 35f-MspI and 35f-AluI, altogether 7 enzymes, were examined comparatively. Data mining analysis provides a Decision tree for identification of subjects and their dividing pathways that is produced using a limited number of OTUs, which affects the accuracy of the results. The present report discusses not only a global comparison of accuracies for characteristics, but also the detailed mechanisms that result in better or worse results and the practical roles and functions of OTUs. The OTU at the 1st step of the constructed Decision tree was the most important for any identification, and for all cases, the combination of subsequent OTUs, which formed later in the Decision tree, was also unignorable. Detailed dividing pathways were traced and compared for the 7 enzymes and the future supporting ideas were provided for better Data mining analysis of the human intestinal microbiota.

  12. Re-evaluating the kinetics of ATP hydrolysis during initiation of DNA sliding by Type III restriction enzymes.

    Science.gov (United States)

    Tóth, Júlia; Bollins, Jack; Szczelkun, Mark D

    2015-12-15

    DNA cleavage by the Type III restriction enzymes requires long-range protein communication between recognition sites facilitated by thermally-driven 1D diffusion. This 'DNA sliding' is initiated by hydrolysis of multiple ATPs catalysed by a helicase-like domain. Two distinct ATPase phases were observed using short oligoduplex substrates; the rapid consumption of ∼10 ATPs coupled to a protein conformation switch followed by a slower phase, the duration of which was dictated by the rate of dissociation from the recognition site. Here, we show that the second ATPase phase is both variable and only observable when DNA ends are proximal to the recognition site. On DNA with sites more distant from the ends, a single ATPase phase coupled to the conformation switch was observed and subsequent site dissociation required little or no further ATP hydrolysis. The overall DNA dissociation kinetics (encompassing site release, DNA sliding and escape via a DNA end) were not influenced by the second phase. Although the data simplifies the ATP hydrolysis scheme for Type III restriction enzymes, questions remain as to why multiple ATPs are hydrolysed to prepare for DNA sliding.

  13. Identification of mycobacterial species by PCR restriction enzyme analysis of the hsp65 gene—an Indian experience.

    Science.gov (United States)

    Verma, Ajoy Kumar; Kumar, Gavish; Arora, Jyoti; Singh, Paras; Arora, Vijay Kumar; Myneedu, Vithal Prasad; Sarin, Rohit

    2015-04-01

    Nowadays, nontuberculous mycobacteria (NTM) often cause pulmonary and extrapulmonary disease. Species identification of NTM determines the line of treatment and management of the disease. The routine diagnostic methods, i.e., smear microscopy and biochemical identification, of nontuberculous mycobacteria are tedious and time consuming and not all laboratories can perform these tests on a routine basis. A PCR targeting the hsp65 gene was implemented using standard strains and was applied to 109 clinical isolates. The PCR-amplified product was subjected to restriction enzyme analysis using BstEII and HaeIII. The results obtained were compared with that of biochemical tests. Of 109 NTM, 107 were identified to species level. PCR plus restriction enzyme analysis (PRA) identified 12 types of NTM. Common species identified were Mycobacterium chelonae (32), a rapid growing NTM, and Mycobacterium avium complex (21), among the slow growing NTM. PRA and biochemical identification showed 95.32% (102/107) concordant results. PRA is fast, cheap, and accurate for identification of potentially pathogenic NTM.

  14. Enzyme

    Science.gov (United States)

    Enzymes are complex proteins that cause a specific chemical change in all parts of the body. For ... use them. Blood clotting is another example of enzymes at work. Enzymes are needed for all body ...

  15. Construction the hairpin RNA recombinant plasmids targeting human Pokemon gene%靶向人Pokemon基因的shRNA重组质粒的构建

    Institute of Scientific and Technical Information of China (English)

    Wenmiao Cao; Tao Zhang; Buhai Wang; Xizhi Zhang; Jinghua Ren; Jie Yao

    2011-01-01

    Objective:The aim of this study was to establish the foundation for studying the role of pokemon gene in tumorigenesis and development by constructing recombinant plasmids that can express small interfering RNA (siRNA) targeting human Pokemon gene. Methods: Hairpin siRNA templates targeting Pokemon gene were synthesized and cloned into plasmid vector psiRNA-H1neo. Three vectors derived siRNAs (psiRNA1, 2, 3) and one mocking psiRNAc (as control) were constructed.The recombinant Pokemon siRNA plasmids were constructed and identified using restrictive enzyme analysis and DNA sequencing. Results: Restrictive enzyme analysis and DNA sequencing revealed the successful construction of siRNA expression plasmids. Conclusion: Constructing siRNA templates targeting Pokemon gene may provide us with practical tools for further study the role of Pokemon gene in the development of some diseases and gene therapy of tumor.

  16. Analysis of simian virus 40 DNA with the restriction enzyme of Haemophilus aegyptius, endonuclease Z.

    Science.gov (United States)

    Huang, E S; Newbold, J E; Pagano, J S

    1973-04-01

    Limited digestion of simian virus 40 (SV40) DNA from both small- and large- plaque strains with the restriction endonuclease Z from Haemophilus aegyptius yielded 10 specific fragments. The number of nucleotide pairs for each fragment, determined by co-electrophoresis with phiX174 RF fragments produced by endonuclease Z, ranges from 2,050 to 80. The difference in the pattern between the large- and small-plaque strains is the disappearance of one fragment containing approximately 255 nucleotide pairs and the appearance of a new fragment with 145 nucleotide pairs. This finding can be explained either by deletions or insertions totaling 110 nucleotide pairs. Complementary RNA synthesized in vitro from the adeno-SV40 hybrid virus, strain ND-1, hybridized preferentially to four of the fragments of SV40 DNA.

  17. Impact of target site distribution for Type I restriction enzymes on the evolution of methicillin-resistant Staphylococcus aureus (MRSA) populations.

    Science.gov (United States)

    Roberts, Gareth A; Houston, Patrick J; White, John H; Chen, Kai; Stephanou, Augoustinos S; Cooper, Laurie P; Dryden, David T F; Lindsay, Jodi A

    2013-08-01

    A limited number of Methicillin-resistant Staphylococcus aureus (MRSA) clones are responsible for MRSA infections worldwide, and those of different lineages carry unique Type I restriction-modification (RM) variants. We have identified the specific DNA sequence targets for the dominant MRSA lineages CC1, CC5, CC8 and ST239. We experimentally demonstrate that this RM system is sufficient to block horizontal gene transfer between clinically important MRSA, confirming the bioinformatic evidence that each lineage is evolving independently. Target sites are distributed randomly in S. aureus genomes, except in a set of large conjugative plasmids encoding resistance genes that show evidence of spreading between two successful MRSA lineages. This analysis of the identification and distribution of target sites explains evolutionary patterns in a pathogenic bacterium. We show that a lack of specific target sites enables plasmids to evade the Type I RM system thereby contributing to the evolution of increasingly resistant community and hospital MRSA.

  18. The Type ISP Restriction-Modification enzymes LlaBIII and LlaGI use a translocation-collision mechanism to cleave non-specific DNA distant from their recognition sites.

    Science.gov (United States)

    Šišáková, Eva; van Aelst, Kara; Diffin, Fiona M; Szczelkun, Mark D

    2013-01-01

    The Type ISP Restriction-Modification (RM) enzyme LlaBIII is encoded on plasmid pJW566 and can protect Lactococcus lactis strains against bacteriophage infections in milk fermentations. It is a single polypeptide RM enzyme comprising Mrr endonuclease, DNA helicase, adenine methyltransferase and target-recognition domains. LlaBIII shares >95% amino acid sequence homology across its first three protein domains with the Type ISP enzyme LlaGI. Here, we determine the recognition sequence of LlaBIII (5'-TnAGCC-3', where the adenine complementary to the underlined base is methylated), and characterize its enzyme activities. LlaBIII shares key enzymatic features with LlaGI; namely, adenosine triphosphate-dependent DNA translocation (∼309 bp/s at 25°C) and a requirement for DNA cleavage of two recognition sites in an inverted head-to-head repeat. However, LlaBIII requires K(+) ions to prevent non-specific DNA cleavage, conditions which affect the translocation and cleavage properties of LlaGI. By identifying the locations of the non-specific dsDNA breaks introduced by LlaGI or LlaBIII under different buffer conditions, we validate that the Type ISP RM enzymes use a common translocation-collision mechanism to trigger endonuclease activity. In their favoured in vitro buffer, both LlaGI and LlaBIII produce a normal distribution of random cleavage loci centred midway between the sites. In contrast, LlaGI in K(+) ions produces a far more distributive cleavage profile.

  19. Molecular typing of canine parvovirus variants by polymerase chain reaction and restriction enzyme analysis.

    Science.gov (United States)

    Kumar, M; Nandi, S

    2010-12-01

    Canine parvovirus type 2 (CPV-2) is a pathogen of dogs, which causes acute gastroenteritis and lymphopenia mostly in young pups. This paper reports the incidence of CPV-2 infection in diarrhoeic dogs with an aim to define the involvement of various variants of canine parvovirus circulating in India. CPV-2a, a variant of CPV-2 was differentiated from CPV-2b by polymerase chain reaction (PCR). The samples positive for CPV-2b were further analysed by PCR and restriction endonuclease (RE) analysis using Mbo II to detect the CPV-2c variant. Of 129 faecal samples studied, 78 were found positive for canine parvovirus by PCR. Among the 78 samples, 27 were of CPV-2a, 39 of CPV-2b and 12 of CPV-2c type, respectively. This study also showed that CPV-2c, anew variant, is circulating in India. The CPV-2c could be successfully detected by PCR and RE analysis while CPV-2b is the major antigenic type prevalent in this region followed by CPV-2a.

  20. Mutagenesis of the redox-active disulfide in mercuric ion reductase: Catalysis by mutant enzymes restricted to flavin redox chemistry

    Energy Technology Data Exchange (ETDEWEB)

    Distefano, M.D.; Au, K.G.; Walsh, C.T. (Harvard Medical School, Boston, MA (USA))

    1989-02-07

    Mercuric reductase, a flavoenzyme that possesses a redox-active cystine, Cys{sub 135}Cys{sub 140}, catalyzes the reduction of Hg(II) to Hg(0) by NADPH. As a probe of mechanism, the authors have constructed mutants lacking a redox-active disulfide by eliminating Cys{sub 135} (Ala{sub 135}Cys{sub 140}), Cys{sub 14} (Cys{sub 135}Ala{sub 140}), or both (Ala{sub 135}Ala{sub 140}). Additionally, they have made double mutants that lack Cys{sub 135} (Ala{sub 135}Cys{sub 139}Cys{sub 140}) or Cys{sub 140} (Cys{sub 135}Cys{sub 139}Ala{sub 140}) but introduce a new Cys in place of Gly{sub 139} with the aim of constructing dithiol pairs in the active site that do not form a redox-active disulfide. The resulting mutant enzymes all lack redox-active disulfides and are hence restricted to FAD/FADH{sub 2} redox chemistry. Each mutant enzyme possesses unique physical and spectroscopic properties that reflect subtle differences in the FAD microenvironment. Preliminary evidence for the Ala{sub 135}Cys{sub 139}Cys{sub 14} mutant enzyme suggests that this protein forms a disulfide between the two adjacent Cys residues. Hg(II) titration experiments that correlate the extent of charge-transfer quenching with Hg(II) binding indicate that the Ala{sub 135}Cys{sub 140} protein binds Hg(II) with substantially less avidity than does the wild-type enzyme. All mutant mercuric reductases catalyze transhydrogenation and oxygen reduction reactions through obligatory reduced flavin intermediates at rates comparable to or greater than that of the wild-type enzyme. In multiple-turnover assays which monitored the production of Hg(0), two of the mutant enzymes were observed to proceed through at least 30 turnovers at rates ca. 1000-fold slower than that of wild-type mercuric reductase. They conclude that the Cys{sub 135} and Cys{sub 140} thiols serve as Hg(II) ligands that orient the Hg(II) for subsequent reduction by a reduced flavin intermediate.

  1. Mitochondrial DNA variation in chinook salmon and chum salmon detected by restriction enzyme analysis of polymerase chain reaction products

    Science.gov (United States)

    Cronin, M.; Spearman, R.; Wilmot, R.; Patton, J.; Bickman, J.

    1993-01-01

    We analyze intraspecific mitochondrial DNA variation in chinook salmon from drainages in the Yukon River, the Kenai River, and Oregon and California rivers; and chum salmon from the Yukon River and vancouver Island, and Washington rivers. For each species, three different portions of the mtDNA molecule were amplified seperately using the polymerase chain reaction and then digested with at least 19 restrictions enzymes. Intraspecific sequence divergences between haplotypes were less than 0.01 base subsitution per nucleotide. Nine chum salmon haplotypes were identified. Yukon River chum salmon stocks displayed more haplotypes (8) occurred in all areas. Seven chinook salmon haplotypes were identified. Four haplotypes occurred in the Yukon and Kenai rviers and four occured in the Oregon/California, with only one haplotype shared between the regions. Sample sizes were too small to quantify the degree of stock seperation among drainages, but the patterns of variation that we observed suggest utility of the technique in genetic stock identification.

  2. Constructing the recombinant plasmid-pLXSN-SjYF-of Yolk Ferritin gene of Schistosoma japonicum

    Institute of Scientific and Technical Information of China (English)

    ZhouJunmei; YuXinbing; WuZhongdao; ZhengYinan; LiYan

    1999-01-01

    TO construct the recotabinant plasmid —— pLXSN-SjYF to prepare for expression and DNA vaccine of Schistosoma japonicum gene. Methods :Mnpliffing DNA fragment coding yolk fereltin from a female adult Sehistosoma japonicum DNAs by PCR. The fragment was inseted into pLXSN retrovirus vector by digesting with restrictive enzymes and linking reactions. The positive clone was screened on LB plates contmaining amplcillin asld identified by restrictive enzymes digestion and PCR amplification, Resttlts The specific DNA fragmem SjYF was amplified from the female adult SjDNAs. IaLXSN-SjYF was constructed successfully and the further research will be carried out.

  3. Plasmid recombination in Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    McCarthy, D.

    1982-01-01

    DNA recombination in exponential phase and competent Haemophilus influenzae was measured by an electron microscopic assay that relies on the conversion of plasmid RSF0885 monomers into multimeric forms. Dimer circles were present at a frequency of 2% in plasmid preparations from competent Rd (wild-type) cells; multimers were present at a frequency of 0.2% in preparations from exponential phase cells. Thus, plasmid recombination was stimulated in competent cells. Multimer formation occurred efficiently in cells of the transformation defective mutant rec2, implying that the rec2 gene product is not required for plasmid recombination. However, the absence of multimer plasmids in preparations from competent cells of the transformation defective mutant rec1 suggests that the rec1 gene product is required. Digestion of purified plasmids with restriction endonuclease PvuII, which makes a single cut in the monomer, revealed the presence of recombination intermediates composed of two linear plasmids joined to form two pairs of arms resembling the Greek letter chi. Length measurements of these arms taken from a population of recombination intermediates gave evidence that the plasmids were joined at sites of homology. The distributions of individual DNA strands, at the intersections of the four arms, could be resolved in some recombination intermediates and were of two types. The first type of junction appeared as a single-stranded arm appended to each corner. The second type of junction consisted of a single strand of DNA linking the two linear plasmids at a site of homology. The single-stranded linker was frequently situated at the edge of a short gap on one of the plasmids in the pair. The fine structures of the recombinational joints have been interpreted in terms of previously proposed models of recombination.

  4. Plasmid profilling and similarities in identities of probable microbes isolated from crude oil contaminated agricultural soil

    Directory of Open Access Journals (Sweden)

    Toochukwu Ekwutosi OGBULIE

    2013-05-01

    Full Text Available Plasmid analysis of bacteria isolated from agricultural soil experimentally contaminated with crude oil was carried out and the resultant bands’ depicting the different molecular sizes of the plasmid DNA molecules per isolate was obtained. There was no visible band observed for Klebsiella indicating that the organism lack plasmid DNA that confers degradative ability to it, possibly the gene could be borne on the chromosomal DNA which enabled its persistence in the polluted soil. Molecular characterization was undertaken to confirm the identities of the possible microorganisms that may be present in crude oil-contaminated soil. The result of the DNA extracted and amplified in a PCR using EcoRI and EcoRV restriction enzymes for cutting the DNA of the bacterial cells indicated no visible band for cuts made with EcoRV restriction enzyme showing that the enzyme is not specific for bacterial DNA of isolates in the samples, hence there was no amplification. By contrast though, visible bands of amplicons were observed using EcoRI restriction enzymes. The resultant visible bands of microbial profile obtained using the universal RAPD primer with nucleotide sequence of 5’—CTC AAA GCA TCT AGG TCC A---3’ showed that only Pseudomonas fluorescens and Bacillus mycoides had visible bands at identical position on the gel indicating that both species possibly had identical sequence or genes of negligible differences coding for degradation of hydrocarbons as shown by similar values in molecular weight and positions in the gel electrophoresis field.

  5. An investigation of the structural requirements for ATP hydrolysis and DNA cleavage by the EcoKI Type I DNA restriction and modification enzyme.

    Science.gov (United States)

    Roberts, Gareth A; Cooper, Laurie P; White, John H; Su, Tsueu-Ju; Zipprich, Jakob T; Geary, Paul; Kennedy, Cowan; Dryden, David T F

    2011-09-01

    Type I DNA restriction/modification systems are oligomeric enzymes capable of switching between a methyltransferase function on hemimethylated host DNA and an endonuclease function on unmethylated foreign DNA. They have long been believed to not turnover as endonucleases with the enzyme becoming inactive after cleavage. Cleavage is preceded and followed by extensive ATP hydrolysis and DNA translocation. A role for dissociation of subunits to allow their reuse has been proposed for the EcoR124I enzyme. The EcoKI enzyme is a stable assembly in the absence of DNA, so recycling was thought impossible. Here, we demonstrate that EcoKI becomes unstable on long unmethylated DNA; reuse of the methyltransferase subunits is possible so that restriction proceeds until the restriction subunits have been depleted. We observed that RecBCD exonuclease halts restriction and does not assist recycling. We examined the DNA structure required to initiate ATP hydrolysis by EcoKI and find that a 21-bp duplex with single-stranded extensions of 12 bases on either side of the target sequence is sufficient to support hydrolysis. Lastly, we discuss whether turnover is an evolutionary requirement for restriction, show that the ATP hydrolysis is not deleterious to the host cell and discuss how foreign DNA occasionally becomes fully methylated by these systems.

  6. Detection of the rs10250202 polymorphism in protection of telomeres 1 gene through introducing a new restriction enzyme site for PCR-RFLP assay.

    Science.gov (United States)

    Wang, Sihua; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Wu, Yiming; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei

    2016-01-01

    Human protection of telomeres 1 (POT1) gene is a single stranded telomere binding proteins with a critical role in ensuring chromosome stability. There have been variants of POT1 gene, and the polymorphisms of POT1 gene were associated with some diseases. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) is a traditional method to detect the single nucleotide polymorphism (SNP), and it can be used to detect the polymorphism of rs10250202. But the restriction enzymes required for the detection of the polymorphism of rs10250202 are expensive. So we designed a novel PCR-RFLP assay for genotyping the POT1 rs10250202 SNP. In the study, a new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and the restriction enzyme BclI for CRS-PCR was cheaper than other enzymes. After detecting Han Chinese workers, Allele frequencies were found to be 51.54 % for allele A and 48.46 % for allele C respectively. The PCR results were confirmed by DNA sequencing. CRS-PCR provides a simple, low-cost, practical, and reproducible method.

  7. Genomic-Based Restriction Enzyme Selection for Specific Detection of Piscirickettsia salmonis by 16S rDNA PCR-RFLP

    Science.gov (United States)

    Mandakovic, Dinka; Glasner, Benjamín; Maldonado, Jonathan; Aravena, Pamela; González, Mauricio; Cambiazo, Verónica; Pulgar, Rodrigo

    2016-01-01

    The gram negative facultative bacterium P. salmonis is the etiological agent of Salmonid Rickettsial Septicaemia (SRS), a severe disease that causes important economic losses in the global salmon farmer industry. Despite efforts to control this disease, the high frequency of new epizootic events indicate that the vaccine and antibiotics treatments have limited effectiveness, therefore the preventive and diagnostic approaches must be improved. A comparison of several methodologies for SRS diagnostic indicate differences in their specificity and its capacity to detect other bacteria coexisting with P. salmonis in culture media (contamination) and fish samples (coinfection), aspects relevant for research, vaccine development and clinical diagnostic. By computer-simulation analyses, we identified a group of restriction enzymes that generate unique P. salmonis 16S rDNA band patterns, distinguishable from all other bacteria. From this information, we designed and developed a PCR-RFLP (Polymerase Chain Reaction—Restriction Fragment Length Polymorphism) assay, which was validated using 16S rDNA universal primers and restriction enzyme PmaCI for the amplification and digestion, respectively. Experimental validation was performed by comparing the restriction pattern of P. salmonis with the restriction patterns generated by bacteria that cohabit with P. salmonis (fish bacterial isolates and culture media contaminants). Our results indicate that the restriction enzyme selection pipeline was suitable to design a more specific, sensible, faster and cheaper assay than the currently used P. salmonis detection methodologies. PMID:27242682

  8. Genomic-based restriction enzyme selection for specific detection of Piscirickettsia salmonis by 16S rDNA PCR-RFLP

    Directory of Open Access Journals (Sweden)

    Dinka eMandakovic

    2016-05-01

    Full Text Available The gram negative facultative bacterium P. salmonis is the etiological agent of Salmonid Rickettsial Septicaemia (SRS, a severe disease that causes important economic losses in the global salmon farmer industry. Despite efforts to control this disease, the high frequency of new epizootic events indicate that the vaccine and antibiotics treatments have limited effectiveness, therefore the preventive and diagnostic approaches must be improved. A comparison of several methodologies for SRS diagnostic indicate differences in their specificity and its capacity to detect other bacteria coexisting with P. salmonis in culture media (contamination and fish samples (coinfection, aspects relevant for research, vaccine development and clinical diagnostic. By computer-simulation analyses, we identified a group of restriction enzymes that generate unique P. salmonis 16S rDNA band patterns, distinguishable from all other bacteria. From this information, we designed and developed a PCR-RFLP (Polymerase Chain Reaction - Restriction Fragment Length Polymorphism assay, which was validated using 16S rDNA universal primers and restriction enzyme PmaCI for the amplification and digestion, respectively. Experimental validation was performed by comparing the restriction pattern of P. salmonis with the restriction patterns generated by bacteria that cohabit with P. salmonis (fish bacterial isolates and culture media contaminants. Our results indicate that the restriction enzyme selection pipeline was suitable to design a more specific, sensible, faster and cheaper assay than the currently used P. salmonis detection methodologies.

  9. Genomic-Based Restriction Enzyme Selection for Specific Detection of Piscirickettsia salmonis by 16S rDNA PCR-RFLP.

    Science.gov (United States)

    Mandakovic, Dinka; Glasner, Benjamín; Maldonado, Jonathan; Aravena, Pamela; González, Mauricio; Cambiazo, Verónica; Pulgar, Rodrigo

    2016-01-01

    The gram negative facultative bacterium P. salmonis is the etiological agent of Salmonid Rickettsial Septicaemia (SRS), a severe disease that causes important economic losses in the global salmon farmer industry. Despite efforts to control this disease, the high frequency of new epizootic events indicate that the vaccine and antibiotics treatments have limited effectiveness, therefore the preventive and diagnostic approaches must be improved. A comparison of several methodologies for SRS diagnostic indicate differences in their specificity and its capacity to detect other bacteria coexisting with P. salmonis in culture media (contamination) and fish samples (coinfection), aspects relevant for research, vaccine development and clinical diagnostic. By computer-simulation analyses, we identified a group of restriction enzymes that generate unique P. salmonis 16S rDNA band patterns, distinguishable from all other bacteria. From this information, we designed and developed a PCR-RFLP (Polymerase Chain Reaction-Restriction Fragment Length Polymorphism) assay, which was validated using 16S rDNA universal primers and restriction enzyme PmaCI for the amplification and digestion, respectively. Experimental validation was performed by comparing the restriction pattern of P. salmonis with the restriction patterns generated by bacteria that cohabit with P. salmonis (fish bacterial isolates and culture media contaminants). Our results indicate that the restriction enzyme selection pipeline was suitable to design a more specific, sensible, faster and cheaper assay than the currently used P. salmonis detection methodologies.

  10. DNA translocation by type III restriction enzymes: a comparison of current models of their operation derived from ensemble and single-molecule measurements.

    Science.gov (United States)

    Dryden, David T F; Edwardson, J M; Henderson, Robert M

    2011-06-01

    Much insight into the interactions of DNA and enzymes has been obtained using a number of single-molecule techniques. However, recent results generated using two of these techniques-atomic force microscopy (AFM) and magnetic tweezers (MT)-have produced apparently contradictory results when applied to the action of the ATP-dependent type III restriction endonucleases on DNA. The AFM images show extensive looping of the DNA brought about by the existence of multiple DNA binding sites on each enzyme and enzyme dimerisation. The MT experiments show no evidence for looping being a requirement for DNA cleavage, but instead support a diffusive sliding of the enzyme on the DNA until an enzyme-enzyme collision occurs, leading to cleavage. Not only do these two methods appear to disagree, but also the models derived from them have difficulty explaining some ensemble biochemical results on DNA cleavage. In this 'Survey and Summary', we describe several different models put forward for the action of type III restriction enzymes and their inadequacies. We also attempt to reconcile the different models and indicate areas for further experimentation to elucidate the mechanism of these enzymes.

  11. Rapid restriction enzyme-free cloning of PCR products: a high-throughput method applicable for library construction.

    Science.gov (United States)

    Chaudhary, Vijay K; Shrivastava, Nimisha; Verma, Vaishali; Das, Shilpi; Kaur, Charanpreet; Grover, Payal; Gupta, Amita

    2014-01-01

    Herein, we describe a novel cloning strategy for PCR-amplified DNA which employs the type IIs restriction endonuclease BsaI to create a linearized vector with four base-long 5'-overhangs, and T4 DNA polymerase treatment of the insert in presence of a single dNTP to create vector-compatible four base-long overhangs. Notably, the insert preparation does not require any restriction enzyme treatment. The BsaI sites in the vector are oriented in such a manner that upon digestion with BsaI, a stuffer sequence along with both BsaI recognition sequences is removed. The sequence of the four base-long overhangs produced by BsaI cleavage were designed to be non-palindromic, non-compatible to each other. Therefore, only ligation of an insert carrying compatible ends allows directional cloning of the insert to the vector to generate a recombinant without recreating the BsaI sites. We also developed rapid protocols for insert preparation and cloning, by which the entire process from PCR to transformation can be completed in 6-8 h and DNA fragments ranging in size from 200 to 2200 bp can be cloned with equal efficiencies. One protocol uses a single tube for insert preparation if amplification is performed using polymerases with low 3'-exonuclease activity. The other protocol is compatible with any thermostable polymerase, including those with high 3'-exonuclease activity, and does not significantly increase the time required for cloning. The suitability of this method for high-throughput cloning was demonstrated by cloning batches of 24 PCR products with nearly 100% efficiency. The cloning strategy is also suitable for high efficiency cloning and was used to construct large libraries comprising more than 108 clones/µg vector. Additionally, based on this strategy, a variety of vectors were constructed for the expression of proteins in E. coli, enabling large number of different clones to be rapidly generated.

  12. A restriction enzyme-powered autonomous DNA walking machine: its application for a highly sensitive electrochemiluminescence assay of DNA

    Science.gov (United States)

    Chen, Ying; Xiang, Yun; Yuan, Ruo; Chai, Yaqin

    2014-12-01

    The construction of a restriction enzyme (Nt.AlwI)-powered DNA walking machine and its application for highly sensitive detection of DNA are described. DNA nanostructure tracks containing four overhang sequences with electrochemiluminescence (ECL) labels and complementary to the walker (target DNA) are self-assembled on the sensing electrode. The walker hybridizes with the complementary sequences on the tracks and forms specific recognition sites for Nt.AlwI, which cleaves the overhang sequences, releases the ECL labels and enables directional movement of the walker along the tracks. The formation of the nanostructure tracks and the Nt.AlwI-assisted cleavage of the overhang sequences in the presence of the walker are verified by using polyacrylamide gel electrophoresis analysis and cyclic voltammetry. The successive movement of the walker on the nanostructure tracks leads to continuous removal of massive ECL labels from the sensing electrode, which results in a significantly amplified suppression of the ECL emission for highly sensitive detection of sequence-specific DNA down to 0.19 pM. Results show that this DNA walking machine can also offer single-base mismatch discrimination capability. The successful application of the DNA walking machine for sequence-specific DNA detection can thus offer new opportunities for molecular machines in biosensing applications.The construction of a restriction enzyme (Nt.AlwI)-powered DNA walking machine and its application for highly sensitive detection of DNA are described. DNA nanostructure tracks containing four overhang sequences with electrochemiluminescence (ECL) labels and complementary to the walker (target DNA) are self-assembled on the sensing electrode. The walker hybridizes with the complementary sequences on the tracks and forms specific recognition sites for Nt.AlwI, which cleaves the overhang sequences, releases the ECL labels and enables directional movement of the walker along the tracks. The formation of the

  13. The role of the methyltransferase domain of bifunctional restriction enzyme RM.BpuSI in cleavage activity.

    Directory of Open Access Journals (Sweden)

    Arthur Sarrade-Loucheur

    Full Text Available Restriction enzyme (REase RM.BpuSI can be described as a Type IIS/C/G REase for its cleavage site outside of the recognition sequence (Type IIS, bifunctional polypeptide possessing both methyltransferase (MTase and endonuclease activities (Type IIC and endonuclease activity stimulated by S-adenosyl-L-methionine (SAM (Type IIG. The stimulatory effect of SAM on cleavage activity presents a major paradox: a co-factor of the MTase activity that renders the substrate unsusceptible to cleavage enhances the cleavage activity. Here we show that the RM.BpuSI MTase activity modifies both cleavage substrate and product only when they are unmethylated. The MTase activity is, however, much lower than that of M1.BpuSI and is thought not to be the major MTase for host DNA protection. SAM and sinefungin (SIN increase the Vmax of the RM.BpuSI cleavage activity with a proportional change in Km, suggesting the presence of an energetically more favorable pathway is taken. We further showed that RM.BpuSI undergoes substantial conformational changes in the presence of Ca(2+, SIN, cleavage substrate and/or product. Distinct conformers are inferred as the pre-cleavage/cleavage state (in the presence of Ca(2+, substrate or both and MTase state (in the presence of SIN and substrate, SIN and product or product alone. Interestingly, RM.BpuSI adopts a unique conformation when only SIN is present. This SIN-bound state is inferred as a branch point for cleavage and MTase activity and an intermediate to an energetically favorable pathway for cleavage, probably through increasing the binding affinity of the substrate to the enzyme under cleavage conditions. Mutation of a SAM-binding residue resulted in altered conformational changes in the presence of substrate or Ca(2+ and eliminated cleavage activity. The present study underscores the role of the MTase domain as facilitator of efficient cleavage activity for RM.BpuSI.

  14. IS-linked movement of a restriction-modification system.

    Directory of Open Access Journals (Sweden)

    Noriko Takahashi

    Full Text Available Potential mobility of restriction-modification systems has been suggested by evolutionary/bioinformatic analysis of prokaryotic genomes. Here we demonstrate in vivo movement of a restriction-modification system within a genome under a laboratory condition. After blocking replication of a temperature-sensitive plasmid carrying a PaeR7I restriction-modification system in Escherichia coli cells, the plasmid was found integrated into the chromosome of the surviving cells. Sequence analysis revealed that, in the majority of products, the restriction-modification system was linked to chromosomal insertion sequences (ISs. Three types of products were: (I apparent co-integration of the plasmid and the chromosome at a chromosomal IS1 or IS5 copy (24/28 analyzed; (II de novo insertion of IS1 with the entire plasmid except for a 1-3 bp terminal deletion (2/28; and (III reciprocal crossing-over between the plasmid and the chromosome involving 1-3 bp of sequence identity (2/28. An R-negative mutation apparently decreased the efficiency of successful integration by two orders of magnitude. Reconstruction experiments demonstrated that the restriction-dependence was mainly due to selection against cells without proper integration: their growth was inhibited by the restriction enzyme action. These results demonstrate collaboration of a mobile element and a restriction-modification system for successful joint migration. This collaboration may have promoted the spread and, therefore, the long-term persistence of these complexes and restriction-modification systems in a wide range of prokaryotes.

  15. Moderate dietary sodium restriction added to angiotensin converting enzyme inhibition compared with dual blockade in lowering proteinuria and blood pressure : randomised controlled trial

    NARCIS (Netherlands)

    Slagman, Maartje C. J.; Waanders, Femke; Hemmelder, Marc H.; Woittiez, Arend-Jan; Janssen, Wilbert M. T.; Lambers Heerspink, Hiddo J.; Navis, Gerjan; Laverman, Gozewijn D.

    2011-01-01

    Objective To compare the effects on proteinuria and blood pressure of addition of dietary sodium restriction or angiotensin receptor blockade at maximum dose, or their combination, in patients with non-diabetic nephropathy receiving background treatment with angiotensin converting enzyme (ACE) inhib

  16. Characterizing restriction enzyme-associated loci in historic ragweed (Ambrosia artemisiifolia) voucher specimens using custom-designed RNA probes

    DEFF Research Database (Denmark)

    Sanchez Barreiro, Fatima; Garrett Vieira, Filipe Jorge; Martin, Michael David

    2017-01-01

    Population genetic studies of non-model organisms frequently employ reduced representation library (RRL) methodologies, many of which rely on protocols in which genomic DNA is digested by one or more restriction enzymes. However, because high molecular weight DNA is recommended for these protocol...

  17. Random amplified polymorphic DNA and restriction enzyme analysis of PCR amplified rDNA in taxonomy: Two identification techniques for food-borne yeasts

    NARCIS (Netherlands)

    Baleiras Couto, M.M.; Vogels, J.T.W.E.; Hofstra, H.; Veld, J.H.J. Huis in't; Vossen, J.M.B.M. van der

    1995-01-01

    The random amplified polymorphic DNA (RAPD) assay and the restriction enzyme analysis of PCR amplified rDNA are compared for the identification of the common spoilage yeasts Zygosaccharomyces bailii, Z. rouxii, Saccharomyces cerevisiae, Candida valida and C. lipolytica. Both techniques proved to be

  18. Moderate dietary sodium restriction added to angiotensin converting enzyme inhibition compared with dual blockade in lowering proteinuria and blood pressure : randomised controlled trial

    NARCIS (Netherlands)

    Slagman, Maartje C. J.; Waanders, Femke; Hemmelder, Marc H.; Woittiez, Arend-Jan; Janssen, Wilbert M. T.; Lambers Heerspink, Hiddo J.; Navis, Gerjan; Laverman, Gozewijn D.

    2011-01-01

    Objective To compare the effects on proteinuria and blood pressure of addition of dietary sodium restriction or angiotensin receptor blockade at maximum dose, or their combination, in patients with non-diabetic nephropathy receiving background treatment with angiotensin converting enzyme (ACE)

  19. Effects of realimentation after nutrient restriction during mid- to late gestation on pancreatic digestive enzymes, serum insulin and glucose levels, and insulin-containing cell cluster morphology.

    Science.gov (United States)

    Keomanivong, F E; Camacho, L E; Lemley, C O; Kuemper, E A; Yunusova, R D; Borowicz, P P; Kirsch, J D; Vonnahme, K A; Caton, J S; Swanson, K C

    2016-04-14

    This study examined effects of stage of gestation and nutrient restriction with subsequent realimentation on maternal and foetal bovine pancreatic function. Dietary treatments were assigned on day 30 of pregnancy and included: control (CON; 100% requirements; n = 18) and restricted (R; 60% requirements; n = 30). On day 85, cows were slaughtered (CON, n = 6; R, n = 6), remained on control (CC; n = 12) and restricted (RR; n = 12), or realimented to control (RC; n = 11). On day 140, cows were slaughtered (CC, n = 6; RR, n = 6; RC, n = 5), remained on control (CCC, n = 6; RCC, n = 5) or realimented to control (RRC, n = 6). On day 254, the remaining cows were slaughtered and serum samples were collected from the maternal jugular vein and umbilical cord to determine insulin and glucose concentrations. Pancreases from cows and foetuses were removed, weighed, and subsampled for enzyme and histological analysis. As gestation progressed, maternal pancreatic α-amylase activity decreased and serum insulin concentrations increased (p ≤ 0.03). Foetal pancreatic trypsin activity increased (p enzymes are influenced by nutrient restriction and there is a potential for programming of increased foetal digestive enzyme production resulting from previous maternal nutrient restriction.

  20. [Chromatographic separation of plasmid DNA by anion-exchange cryogel].

    Science.gov (United States)

    Guo, Yantao; Shen, Shaochuan; Yun, Junxian; Yao, Kejian

    2012-08-01

    Plasmid DNA (pDNA) is used as an important vector for gene therapy, and its wide application is restricted by the purity and yield. To obtain high-purity pDNA, a chromatographic method based on anion-exchange supermacroporous cryogel was explored. The anion-exchange cryogel was prepared by grafting diethylaminoethyl-dextran to the epoxide groups of polyacrylamide-based matrix and pUC19 plasmid was used as a target to test the method. The plasmid was transferred into Escherichia coli DH5alpha, cultivated, harvested and lysed. The obtained culture was centrifuged and the supernatant was used as the plasmid feedstock, which was loaded into the anion-exchange cryogel bed for chromatographic separation. By optimizing the pH of running buffer and the elution conditions, high-purity pDNA was obtained by elution with 0.5 mol/L sodium chloride solution at pH 6.6. Compared to the traditional methods for purification of pDNA, animal source enzymes and toxic reagents were not involved in the present separation process, ensuring the safety of both the purification operations and the obtained pDNA.

  1. Cloning of Two Bacteriocin Genes from a Lactococcal Bacteriocin Plasmid

    NARCIS (Netherlands)

    Belkum, Marco J. van; Hayema, Bert Jan; Geis, Arnold; Kok, Jan; Venema, Gerard

    1989-01-01

    Lactococcus lactis subsp. cremoris 9B4 plasmid p9B4-6 (60 kilobases [kb]), which specifies bacteriocin production and immunity, was analyzed with restriction endonucleases, and fragments of this plasmid were cloned into shuttle vectors based on the broad-host-range plasmid pWVO1. Two regions on p9B4

  2. Rapid Restriction Enzyme-Free Cloning of PCR Products: A High-Throughput Method Applicable for Library Construction

    Science.gov (United States)

    Chaudhary, Vijay K.; Das, Shilpi; Kaur, Charanpreet; Grover, Payal; Gupta, Amita

    2014-01-01

    Herein, we describe a novel cloning strategy for PCR-amplified DNA which employs the type IIs restriction endonuclease BsaI to create a linearized vector with four base-long 5′-overhangs, and T4 DNA polymerase treatment of the insert in presence of a single dNTP to create vector-compatible four base-long overhangs. Notably, the insert preparation does not require any restriction enzyme treatment. The BsaI sites in the vector are oriented in such a manner that upon digestion with BsaI, a stuffer sequence along with both BsaI recognition sequences is removed. The sequence of the four base-long overhangs produced by BsaI cleavage were designed to be non-palindromic, non-compatible to each other. Therefore, only ligation of an insert carrying compatible ends allows directional cloning of the insert to the vector to generate a recombinant without recreating the BsaI sites. We also developed rapid protocols for insert preparation and cloning, by which the entire process from PCR to transformation can be completed in 6–8 h and DNA fragments ranging in size from 200 to 2200 bp can be cloned with equal efficiencies. One protocol uses a single tube for insert preparation if amplification is performed using polymerases with low 3′-exonuclease activity. The other protocol is compatible with any thermostable polymerase, including those with high 3′-exonuclease activity, and does not significantly increase the time required for cloning. The suitability of this method for high-throughput cloning was demonstrated by cloning batches of 24 PCR products with nearly 100% efficiency. The cloning strategy is also suitable for high efficiency cloning and was used to construct large libraries comprising more than 108 clones/µg vector. Additionally, based on this strategy, a variety of vectors were constructed for the expression of proteins in E. coli, enabling large number of different clones to be rapidly generated. PMID:25360695

  3. Cereulide synthetase gene cluster from emetic Bacillus cereus: Structure and location on a mega virulence plasmid related to Bacillus anthracis toxin plasmid pXO1

    Directory of Open Access Journals (Sweden)

    Wagner Martin

    2006-03-01

    Full Text Available Abstract Background Cereulide, a depsipeptide structurally related to valinomycin, is responsible for the emetic type of gastrointestinal disease caused by Bacillus cereus. Recently, it has been shown that this toxin is produced by a nonribosomal peptide synthetase (NRPS, but its exact genetic organization and biochemical synthesis is unknown. Results The complete sequence of the cereulide synthetase (ces gene cluster, which encodes the enzymatic machinery required for the biosynthesis of cereulide, was dissected. The 24 kb ces gene cluster comprises 7 CDSs and includes, besides the typical NRPS genes like a phosphopantetheinyl transferase and two CDSs encoding enzyme modules for the activation and incorporation of monomers in the growing peptide chain, a CDS encoding a putative hydrolase in the upstream region and an ABC transporter in the downstream part. The enzyme modules responsible for incorporation of the hydroxyl acids showed an unusual structure while the modules responsible for the activation of the amino acids Ala and Val showed the typical domain organization of NRPS. The ces gene locus is flanked by genetic regions with high homology to virulence plasmids of B. cereus, Bacillus thuringiensis and Bacillus anthracis. PFGE and Southern hybridization showed that the ces genes are restricted to emetic B. cereus and indeed located on a 208 kb megaplasmid, which has high similarities to pXO1-like plasmids. Conclusion The ces gene cluster that is located on a pXO1-like virulence plasmid represents, beside the insecticidal and the anthrax toxins, a third type of B. cereus group toxins encoded on megaplasmids. The ces genes are restricted to emetic toxin producers, but pXO1-like plasmids are also present in emetic-like strains. These data might indicate the presence of an ancient plasmid in B. cereus which has acquired different virulence genes over time. Due to the unusual structure of the hydroxyl acid incorporating enzyme modules of Ces

  4. The pPSU Plasmids for Generating DNA Molecular Weight Markers.

    Science.gov (United States)

    Henrici, Ryan C; Pecen, Turner J; Johnston, James L; Tan, Song

    2017-05-26

    Visualizing nucleic acids by gel electrophoresis is one of the most common techniques in molecular biology, and reference molecular weight markers or ladders are commonly used for size estimation. We have created the pPSU1 & pPSU2 pair of molecular weight marker plasmids which produce both 100 bp and 1 kb DNA ladders when digested with two common restriction enzymes. The 100 bp ladder fragments have been optimized to migrate appropriately on both agarose and native polyacrylamide, unlike many currently available DNA ladders. Sufficient plasmid DNA can be isolated from 100 ml E. coli cultures for the two plasmids to produce 100 bp or 1 kb ladders for 1000 gels. As such, the pPSU1 and pPSU2 plasmids provide reference fragments from 50 to 10000 bp at a fraction of the cost of commercial DNA ladders. The pPSU1 and pPSU2 plasmids are available without licensing restrictions to nonprofit academic users, affording freely available high-quality, low-cost molecular weight standards for molecular biology applications.

  5. Purification of transfection-grade plasmid DNA from bacterial cells with superparamagnetic nanoparticles

    Science.gov (United States)

    Chiang, Chen-Li; Sung, Ching-Shan

    2006-07-01

    The functionalized magnetic nanobeads were used to develop a rapid protocol for extracting and purifying transfection-grade plasmid DNA from bacterial culture. Nanosized superparamagnetic nanoparticles (Fe 3O 4) were prepared by chemical coprecipitation method using Fe 2+, Fe 3+ salt, and ammonium hydroxide under a nitrogen atmosphere. The surface of Fe 3O 4 nanoparticles was modified by coating with the multivalent cationic agent, polyethylenimine (PEI). The PEI-modified magnetic nanobeads were employed to simplify the purification of plasmid DNA from bacterial cells. We demonstrated a useful plasmid, pRSETB-EGFP, encoding the green fluorescent protein with T7 promoter, was amplified in DE3 strain of Escherichia coli. The loaded nanobeads are recovered by magnetically driven separation and regenerated by exposure to the elution buffer with optimal ionic strength (1.25 M) and pH (9.0). Up to approximately 819 μg of high-purity (A 260/A 280 ratio=1.86) plasmid DNA was isolated from 100 ml of overnight bacterial culture. The eluted plasmid DNA was used directly for restriction enzyme digestion, bacterial cell transformation and animal cell transfection applications with success. The PEI-modified magnetic nanobead delivers significant time-savings, overall higher yields and better transfection efficiencies compared to anion-exchange and other methods. The results presented in this report show that PEI-modified magnetic nanobeads are suitable for isolation and purification of transfection-grade plasmid DNA.

  6. Position effect on expression of dsd genes cloned onto multicopy plasmids.

    Science.gov (United States)

    Carothers, A M; Heincz, M C; McFall, E

    1980-04-01

    In the D-serine deaminase system of Escherichia coli, which is regulated by positive control, we have fouand a complete lack of trans activation in vivo with multicopy dsd hybrid plasmids. A PLASmid carrying the regulatory gene, dsdC+, did not promote expression of chromosomal dsdCO+A+ loci, nor did a chromosomal dsdC+ gene promote expression of plasmid-borne dsdC delta O+A+ (dsd regulatory gene negative) restriction fragments. However, hybrid plasmids that comprise the entire dsd system (dsdC+O+A+) are highly inducible for the enzyme. These dsd hybrid plasmid deoxyribonucleic acids functioned well as templates in the in vitro coupled transcription-translation system. In vitro-synthesized dsdC+ protein promoted expression of the dsdA+ operation efficiently. Exogenously purified dsdC+ protein also activated expression of several dsdC delta O+A+ plasmid deoxyribonucleic acid templates in vitro. An explanation that reconciles these results with previous dominance studies is presented.

  7. Plasmid-mediated tetracycline resistance in Haemophilus ducreyi.

    OpenAIRE

    Albritton, W L; Maclean, I W; Slaney, L A; Ronald, A. R.; Deneer, H G

    1984-01-01

    Clinical isolates of Haemophilus ducreyi were shown to be resistant to tetracycline. Resistance was associated in some strains with a 30-megadalton plasmid capable of transferring resistance in conjugative matings with other strains of H. ducreyi and other species of Haemophilus. Restriction endonuclease digestion patterns suggest a relationship between H. ducreyi plasmids and other tetracycline resistance plasmids in Haemophilus. The presence of plasmid-mediated resistance to the tetracyclin...

  8. Cloning and analysis of a bifunctional methyltransferase/restriction endonuclease TspGWI, the prototype of a Thermus sp. enzyme family

    Directory of Open Access Journals (Sweden)

    Zylicz-Stachula Agnieszka

    2009-05-01

    Full Text Available Abstract Background Restriction-modification systems are a diverse class of enzymes. They are classified into four major types: I, II, III and IV. We have previously proposed the existence of a Thermus sp. enzyme family, which belongs to type II restriction endonucleases (REases, however, it features also some characteristics of types I and III. Members include related thermophilic endonucleases: TspGWI, TaqII, TspDTI, and Tth111II. Results Here we describe cloning, mutagenesis and analysis of the prototype TspGWI enzyme that recognises the 5'-ACGGA-3' site and cleaves 11/9 nt downstream. We cloned, expressed, and mutagenised the tspgwi gene and investigated the properties of its product, the bifunctional TspGWI restriction/modification enzyme. Since TspGWI does not cleave DNA completely, a cloning method was devised, based on amino acid sequencing of internal proteolytic fragments. The deduced amino acid sequence of the enzyme shares significant sequence similarity with another representative of the Thermus sp. family – TaqII. Interestingly, these enzymes recognise similar, yet different sequences in the DNA. Both enzymes cleave DNA at the same distance, but differ in their ability to cleave single sites and in the requirement of S-adenosylmethionine as an allosteric activator for cleavage. Both the restriction endonuclease (REase and methyltransferase (MTase activities of wild type (wt TspGWI (either recombinant or isolated from Thermus sp. are dependent on the presence of divalent cations. Conclusion TspGWI is a bifunctional protein comprising a tandem arrangement of Type I-like domains; particularly noticeable is the central HsdM-like module comprising a helical domain and a highly conserved S-adenosylmethionine-binding/catalytic MTase domain, containing DPAVGTG and NPPY motifs. TspGWI also possesses an N-terminal PD-(D/EXK nuclease domain related to the corresponding domains in HsdR subunits, but lacks the ATP-dependent translocase module

  9. Transposon insertion reveals pRM, a plasmid of Rickettsia monacensis.

    Science.gov (United States)

    Baldridge, Gerald D; Burkhardt, Nicole Y; Felsheim, Roderick F; Kurtti, Timothy J; Munderloh, Ulrike G

    2007-08-01

    Until the recent discovery of pRF in Rickettsia felis, the obligate intracellular bacteria of the genus Rickettsia (Rickettsiales: Rickettsiaceae) were thought not to possess plasmids. We describe pRM, a plasmid from Rickettsia monacensis, which was detected by pulsed-field gel electrophoresis and Southern blot analyses of DNA from two independent R. monacensis populations transformed by transposon-mediated insertion of coupled green fluorescent protein and chloramphenicol acetyltransferase marker genes into pRM. Two-dimensional electrophoresis showed that pRM was present in rickettsial cells as circular and linear isomers. The 23,486-nucleotide (31.8% G/C) pRM plasmid was cloned from the transformant populations by chloramphenicol marker rescue of restriction enzyme-digested transformant DNA fragments and PCR using primers derived from sequences of overlapping restriction fragments. The plasmid was sequenced. Based on BLAST searches of the GenBank database, pRM contained 23 predicted genes or pseudogenes and was remarkably similar to the larger pRF plasmid. Two of the 23 genes were unique to pRM and pRF among sequenced rickettsial genomes, and 4 of the genes shared by pRM and pRF were otherwise found only on chromosomes of R. felis or the ancestral group rickettsiae R. bellii and R. canadensis. We obtained pulsed-field gel electrophoresis and Southern blot evidence for a plasmid in R. amblyommii isolate WB-8-2 that contained genes conserved between pRM and pRF. The pRM plasmid may provide a basis for the development of a rickettsial transformation vector.

  10. Physical map of polyoma viral DNA fragments produced by cleavage with a restriction enzyme from Haemophilus aegyptius, endonuclease R-HaeIII.

    Science.gov (United States)

    Summers, J

    1975-04-01

    Digestion of polyoma viral DNA with a restriction enzyme from Haemophilus aegyptius generates at least 22 unique fragments. The fragments have been characterized with respect to size and physical order on the polyoma genome, and the 5' to 3' orientation of the (+) and (-) strands has been determined. A method for specific radiolabeling of adjacent fragments was employed to establish the fragment order. This technique may be useful for ordering the fragments produced by digestion of complex DNAs.

  11. In silico enhanced restriction enzyme based methylation analysis of the human glioblastoma genome using Agilent 244K CpG Island microarrays

    Directory of Open Access Journals (Sweden)

    Anh Tran

    2010-01-01

    Full Text Available Genome wide methylation profiling of gliomas is likely to provide important clues to improving treatment outcomes. Restriction enzyme based approaches have been widely utilized for methylation profiling of cancer genomes and will continue to have importance in combination with higher density microarrays. With the availability of the human genome sequence and microarray probe sequences, these approaches can be readily characterized and optimized via in silico modeling. We adapted the previously described HpaII/MspI based Methylation Sensitive Restriction Enzyme (MSRE assay for use with two-color Agilent 244K CpG island microarrays. In this assay, fragmented genomic DNA is digested in separate reactions with isoschizomeric HpaII (methylation-sensitive and MspI (methylation-insensitive restriction enzymes. Using in silico hybridization, we found that genomic fragmentation with BfaI was superior to MseI, providing a maximum effective coverage of 22,362 CpG islands in the human genome. In addition, we confirmed the presence of an internal control group of fragments lacking HpaII/MspI sites which enable separation of methylated and unmethylated fragments. We used this method on genomic DNA isolated from normal brain, U87MG cells, and a glioblastoma patient tumor sample and confirmed selected differentially methylated CpG islands using bisulfite sequencing. Along with additional validation points, we performed a receiver operating characteristics (ROC analysis to determine the optimal threshold (p ≤ 0.001. Based on this threshold, we identified ~2400 CpG islands common to all three samples and 145 CpG islands unique to glioblastoma. These data provide more general guidance to individuals seeking to maximize effective coverage using restriction enzyme based methylation profiling approaches.

  12. Dissemination of plasmid-encoded AmpC β-lactamases in antimicrobial resistant Salmonella serotypes originating from humans, pigs and the swine environment.

    Science.gov (United States)

    Keelara, Shivaramu; Thakur, Siddhartha

    2014-09-17

    The aim of this study was to characterize and determine the inter-serovar exchange of AmpC β-lactamase conferring plasmids isolated from humans, pigs and the swine environment. Plasmids isolated from a total of 21 antimicrobial resistant (AMR) Salmonella isolates representing human clinical cases (n=6), pigs (n=6) and the swine farm environment (n=9) were characterized by replicon typing and restriction digestion, inter-serovar transferability by conjugation, and presence of AmpC β-lactamase enzyme encoding gene blaCMY-2 by southern hybridization. Based on replicon typing, the majority (17/21, 81%) of the plasmids belonged to the I1-Iγ Inc group and were between 70 and 103kb. The potential for inter-serovar plasmid transfer was further confirmed by the PCR detection of AMR genes on the plasmids isolated from trans-conjugants. Plasmids from Salmonella serovars Anatum, Ouakam, Johannesburg and Typhimurium isolated from the same cohort of pigs and their environment and S. Heidelberg from a single human clinical isolate had identical plasmids based on digestion with multiple restriction enzymes (EcoRI, HindIII and PstI) and southern blotting. We demonstrated likely horizontal inter-serovar exchange of plasmid-encoding AmpC β-lactamases resistance among MDR Salmonella serotypes isolated from pigs, swine farm environment and clinical human cases. This study provides valuable information on the role of the swine farm environment and by extension other livestock farm environments, as a potential reservoir of resistant bacterial strains that potentially transmit resistance determinants to livestock, in this case, swine, humans and possibly other hosts by horizontal exchange of plasmids.

  13. Development of RFLP-PCR method for the identification of medically important Aspergillus species using single restriction enzyme MwoI

    Directory of Open Access Journals (Sweden)

    K. Diba

    2014-06-01

    Full Text Available In this study we attempted to modify the PCR-RFLP method using restriction enzyme MwoI for the identification of medically important Aspergillus species. Our subjects included nine standard Aspergillus species and 205 Aspergillus isolates of approved hospital acquired infections and hospital indoor sources. First of all, Aspergillus isolates were identified in the level of species by using morphologic method. A twenty four hours culture was performed for each isolates to harvest Aspergillus mycelia and then genomic DNA was extracted using Phenol-Chloroform method. PCR-RFLP using single restriction enzyme MwoI was performed in ITS regions of rDNA gene. The electrophoresis data were analyzed and compared with those of morphologic identifications. Total of 205 Aspergillus isolates included 153 (75% environmental and 52 (25% clinical isolates. A. flavus was the most frequently isolate in our study (55%, followed by A. niger 65(31.7%, A. fumigatus 18(8.7%, A. nidulans and A. parasiticus 2(1% each. MwoI enabled us to discriminate eight medically important Aspergillus species including A. fumigatus, A. niger, A. flavus as the most common isolated species. PCR-RFLP method using the restriction enzyme MwoI is a rapid and reliable test for identification of at least the most medically important Aspergillus species.

  14. Development of RFLP-PCR method for the identification of medically important Aspergillus species using single restriction enzyme MwoI.

    Science.gov (United States)

    Diba, K; Mirhendi, H; Kordbacheh, P; Rezaie, S

    2014-01-01

    In this study we attempted to modify the PCR-RFLP method using restriction enzyme MwoI for the identification of medically important Aspergillus species. Our subjects included nine standard Aspergillus species and 205 Aspergillus isolates of approved hospital acquired infections and hospital indoor sources. First of all, Aspergillus isolates were identified in the level of species by using morphologic method. A twenty four hours culture was performed for each isolates to harvest Aspergillus mycelia and then genomic DNA was extracted using Phenol-Chloroform method. PCR-RFLP using single restriction enzyme MwoI was performed in ITS regions of rDNA gene. The electrophoresis data were analyzed and compared with those of morphologic identifications. Total of 205 Aspergillus isolates included 153 (75%) environmental and 52 (25%) clinical isolates. A. flavus was the most frequently isolate in our study (55%), followed by A. niger 65(31.7%), A. fumigatus 18(8.7%), A. nidulans and A. parasiticus 2(1% each). MwoI enabled us to discriminate eight medically important Aspergillus species including A. fumigatus, A. niger, A. flavus as the most common isolated species. PCR-RFLP method using the restriction enzyme MwoI is a rapid and reliable test for identification of at least the most medically important Aspergillus species.

  15. Cost-effective screening methods for various single gene defects in single cells using high magnesium and total ionic strength and restriction enzymes.

    Science.gov (United States)

    Tsai, Y H

    2000-12-01

    A reliable cost-effective protocol for the diagnosis of various defective genes in single blastomeres from preimplantation embryos has been established. Single cells were lysed in alkali buffer followed by neutralization and addition of a solution containing a high concentration of sulfhydryl reducing agents and MgCl(2) in relatively high ionic strength (0.45) (solution M) with or without restriction enzyme(s). The reaction mixture was incubated at 37 degrees C for 15 min followed by heat denaturation at 95 degrees C for 10 min. Respective polymerase chain reaction (PCR) mixture was then added to amplify each designated DNA region. The treatment of neutralized single cell lysate with adequate restriction enzyme(s) which do not cleave the target DNA sequences but shortens the genomic template DNA strands. This may facilitate primer-template annealing. The subsequent heat denaturation of the cell lysate in solution M indeed gave better signals of amplified DNA fragments on polyacrylamide gels. Defects in Tay Sachs exons 11 and 12, CF-DeltaF508 and CF-N1303K, and genomic sequences of ZFX/ZFY were successfully detected on gels after one-step PCR amplification, especially those cell lysates treated with restriction enzymes. In conclusion, a cost-effective one-step PCR method for amplifying various specific genomic regions containing a single gene defect in single cells has been established. This protocol may be applied to genetic screening for many single defective genes of biopsied single blastomeres from preimplantation in vitro fertilization (IVF) embryos.

  16. Plasmid construction using recombination activity in the fission yeast Schizosaccharomyces pombe.

    Directory of Open Access Journals (Sweden)

    Ayako Chino

    Full Text Available BACKGROUND: Construction of plasmids is crucial in modern genetic manipulation. As of now, the common method for constructing plasmids is to digest specific DNA sequences with restriction enzymes and to ligate the resulting DNA fragments with DNA ligase. Another potent method to construct plasmids, known as gap-repair cloning (GRC, is commonly used in the budding yeast Saccharomyces cerevisiae. GRC makes use of the homologous recombination activity that occurs within the yeast cells. Due to its flexible design and efficiency, GRC has been frequently used for constructing plasmids with complex structures as well as genome-wide plasmid collections. Although there have been reports indicating GRC feasibility in the fission yeast Schizosaccharomyces pombe, this species is not commonly used for GRC as systematic studies of reporting GRC efficiency in S. pombe have not been performed till date. METHODOLOGY/PRINCIPAL FINDINGS: We investigated GRC efficiency in S. pombe in this study. We first showed that GRC was feasible in S. pombe by constructing a plasmid that contained the LEU2 auxotrophic marker gene in vivo and showed sufficient efficiency with short homology sequences (>25 bp. No preference was shown for the sequence length from the cut site in the vector plasmid. We next showed that plasmids could be constructed in a proper way using 3 DNA fragments with 70% efficiency without any specific selections being made. The GRC efficiency with 3 DNA fragments was dramatically increased >95% in lig4Delta mutant cell, where non-homologous end joining is deficient. Following this approach, we successfully constructed plasmid vectors with leu1+, ade6+, his5+, and lys1+ markers with the low-copy stable plasmid pDblet as a backbone by applying GRC in S. pombe. CONCLUSIONS/SIGNIFICANCE: We concluded that GRC was sufficiently feasible in S. pombe for genome-wide gene functional analysis as well as for regular plasmid construction. Plasmids with different

  17. Structure of Type IIL Restriction-Modification Enzyme MmeI in Complex with DNA Has Implications for Engineering New Specificities.

    Science.gov (United States)

    Callahan, Scott J; Luyten, Yvette A; Gupta, Yogesh K; Wilson, Geoffrey G; Roberts, Richard J; Morgan, Richard D; Aggarwal, Aneel K

    2016-04-01

    The creation of restriction enzymes with programmable DNA-binding and -cleavage specificities has long been a goal of modern biology. The recently discovered Type IIL MmeI family of restriction-and-modification (RM) enzymes that possess a shared target recognition domain provides a framework for engineering such new specificities. However, a lack of structural information on Type IIL enzymes has limited the repertoire that can be rationally engineered. We report here a crystal structure of MmeI in complex with its DNA substrate and an S-adenosylmethionine analog (Sinefungin). The structure uncovers for the first time the interactions that underlie MmeI-DNA recognition and methylation (5'-TCCRAC-3'; R = purine) and provides a molecular basis for changing specificity at four of the six base pairs of the recognition sequence (5'-TCCRAC-3'). Surprisingly, the enzyme is resilient to specificity changes at the first position of the recognition sequence (5'-TCCRAC-3'). Collectively, the structure provides a basis for engineering further derivatives of MmeI and delineates which base pairs of the recognition sequence are more amenable to alterations than others.

  18. Applying Data Mining to Classify Age by Intestinal Microbiota in 92 Healthy Men Using a Combination of Several Restriction Enzymes for T-RFLP Experiments.

    Science.gov (United States)

    Kobayashi, Toshio; Osaki, Takako; Oikawa, Shinya

    2014-01-01

    The composition of the intestinal microbiota was measured following consumption of identical meals for 3 days in 92 Japanese men, and terminal restriction fragment length polymorphism (T-RFLP) was used to analyze their feces. The obtained operational taxonomic units (OTUs) and the subjects' ages were classified by using Data mining (DM) software that compared these data with continuous data and for 5 partitions for age divided at 5 years intervals between the ages of 30 and 50. The DM provided Decision trees in which the selected OTUs were closely related to the ages of the subjects. DM was also used to compare the OTUs from the T-RFLP data with seven restriction enzymes (two enzymes of 516f-BslI and 516f-HaeIII, two enzymes of 27f-MspI and 27f-AluI, three enzymes of 35f-HhaI, 35f-MspI and 35f-AluI) and their various combinations. The OTUs delivered from the five enzyme-digested partitions were analyzed to classify their age clusters. For use in future DM processing, we discussed the enzymes that were effective for accurate classification. We selected two OTUs (HA624 and HA995) that were useful for classifying the subject's ages. Depending on the 16S rRNA sequences of the OTUs, Ruminicoccus obeum clones 1-4 were present in 18 of 36 bacterial candidates in the older age group-related OTU (HA624). On the other hand, Ruminicoccus obeum clones 1-33 were present in 65 of 269 candidates in the younger age group-related OUT (HA995).

  19. Isolation of a new restriction enzyme, ApaCI, an isoschizomer of BamHI produced by Acetobacter pasteurianus.

    Science.gov (United States)

    Grones, J; Turna, J

    1992-01-01

    A new Type II restriction endonuclease ApaCI purified from Acetobacter pasteurianus is an isoschizomer of BamHI that cleaves at the nucleotide sequence 5'-G/GATCC-3' of double-stranded DNA. The single restriction activity present in this strain permits rapidly purified 30,000 units of cleavage activity from 10 g of freshly harvested cells. The resulting ApaCI preparation is free of contaminant nuclease activities that might interfere with in vitro manipulation of DNA.

  20. Construction of a novel kind of expression plasmid by homologous recombination in Saccharomyces cerevisiae

    Institute of Scientific and Technical Information of China (English)

    CHEN Xiangling; YUAN Hanying; HE Wei; HU Xianghua; LU Hong; LI Yuyang

    2005-01-01

    Based on a previously used plasmid pHC11, a new plasmid pHC11R was constructed. Cutting plasmid pHC11R with proper restriction enzymes, the resulting larger DNA fragment pHC11R' was co-transformed with a PCR amplified expression cassette of human IFNα2b into yeast. By means of the homologous sequences at both ends of two DNA fragments, a novel expression plasmid pHC11R-IFNα2b was formed via homologous recombination in the yeast. Compared with pHC11-IFNα2b, the expression plasmid pHC11R-IFNα2b was smaller in size and in absence of antibiotic resistant gene. The stability and copy number of pHC11R- IFNα2b were greatly increased and the expression level of heterologous protein was improved. As the derivatives of pHC11R, a series of recombination expression vectors pHRs containing different combination of expression elements were developed. This led to a rapid and powerful method for cloning and expressing of different genes in yeast.

  1. Time-resolved fluorescence of 2-aminopurine in DNA duplexes in the presence of the EcoP15I Type III restriction-modification enzyme.

    Science.gov (United States)

    Ma, Long; Wu, Xiaohua; Wilson, Geoffrey G; Jones, Anita C; Dryden, David T F

    2014-06-20

    EcoP15I is a Type III DNA restriction and modification enzyme of Escherichia coli. We show that it contains two modification (Mod) subunits for sequence-specific methylation of DNA and one copy of a restriction endonuclease (Res) subunit for cleavage of DNA containing unmethylated target sequences. Previously the Mod2 dimer in the presence of cofactors was shown to use nucleotide flipping to gain access to the adenine base targeted for methylation (Reddy and Rao, J. Mol. Biol. 298 (2000) 597-610.). Surprisingly the Mod2 enzyme also appeared to flip a second adenine in the target sequence, one which was not subject to methylation. We show using fluorescence lifetime measurements of the adenine analogue, 2-aminopurine, that only the methylatable adenine undergoes flipping by the complete Res1Mod2 enzyme and that this occurs even in the absence of cofactors. We suggest that this is due to activation of the Mod2 core by the Res subunit.

  2. Late onset of dietary restriction reverses age-related decline of malate-aspartate shuttle enzymes in the liver and kidney of mice.

    Science.gov (United States)

    Goyary, Danswrang; Sharma, Ramesh

    2008-02-01

    Dietary restriction (DR) influences several physiological processes, retards the incidences and severity of various age-related diseases and extends lifespan of various animal species. The effect of DR on the activities of malate-aspartate shuttle enzymes, viz. cytosolic and mitochondrial aspartate aminotransferase (c- and m-AsAT) and malate dehydrogenase (c- and m-MDH) was investigated in the liver and kidney of adult (5-months) and old (21-months) male mice. The results show that the activity (U/mg protein) of both c- and m-MDH and AsAT is decreased significantly in the liver and kidney of old mice compared to adult ones. However, DR in old mice reverses significantly the enzyme activities to a level closer to adult animals. Polyacrylamide gel electrophoresis (PAGE) and specific staining of c-AsAT, one of the selected isoenzymes of the shuttle, showed a similar pattern of activity expression as observed by activity measurements in both the tissues studied. Slot blot analysis of c-AsAT confirmed the lower protein content of this isoenzyme in old mice compared to adult ones and a higher level in old-dietary restricted mice. Thus, our results suggest that the late onset of DR in older mice reverses decline in malate-aspartate shuttle enzymes and that it may allow a better metabolic regulation in older animals.

  3. THE OCCURRENCE OF PLASMID DNA IN CAMPYLOBACTER JEJUNI AND CAMPYLOBACTER COLI AND ANALYSIS OF RESTRICTION ENDONUCLEASE%空肠弯曲菌质粒的提取鉴定和限制性内切酶水解片段的分析

    Institute of Scientific and Technical Information of China (English)

    孙自捷; 宋后燕; 段恕诚

    1988-01-01

    Thirty-two strains of different serotypes and biotypes of Campylobaoter jejuni and Campylobacter coli isolated from the stool of children and domestic animals were examined for the presence of plasmid DNA Agarose gel electrophoresis of alkaline-extracted DNA showed the occurrence of plasmid bands in 12 strains.Ten of them showed only one plasmid band in>28Kb area of gel,and 7 strains contained this plasmid were further analyzed by restriction endonuclease Hind Ⅲ.All restriction fragments showed heterogeneity.Other 2 of the 12 strains from domestic animals were observed and 3 and 4 plasmid bands were demonstrated in agarose gel respectively.The incidenoe of plasmid in Campylobacter jejuni strains was similar to Campylobacter coli,while the incidence of plasmid in Campylobacter strains from the stool of domestic animals was higher than in children.%使用修改的Brruboim快速碱抽提法,对32株来源不同,和不同血清型和生物型空肠弯曲菌株进行了质粒DNA检测和分析.12株细菌的质粒抽提液在琼脂糖电泳上显示有质粒带,其中10株均仅含有一条>23Kb的质粒,同时7株用限制性内切酶Hind Ⅲ消化后水解片段分析发现这一条>23Kb的质粒为非同源性.其他2株细菌在琼脂糖电泳上显示3和4条质粒带.不同生物型空肠弯曲菌的质粒携带率基本相同,而从家禽分离的空肠弯曲菌株比从儿童分离的菌株质粒携带率要高.

  4. Isolation of a Pseudomonas Stutzeri strain that degrades1, 2, 4-trichlorobenzene and characterization of its degradative plasmid

    Institute of Scientific and Technical Information of China (English)

    Lei SONG; Hui WANG; Hanchang SHI; Hongying HU

    2008-01-01

    The genetic information encoding metabolic pathways for xenobiotic compounds in bacteria often resides on catabolic plasmids. The aim of the present work was to know the location of the genes for degrading 1, 2, 4-trichlorobenzen. In this paper a 1, 2, 4-trichlorobenzene-degrading strain THSL-1 was isolated from the soil of Tianjin Chemical Plant using 1, 2, 4-trichlorobenzene as the sole carbon source. The strain was identified as Pseudomonas stutzeri through morphologic survey and 16S rDNA sequence determination. A plasmid was discovered from strain THSL-1 by using the alkali lysis method. When the plasmid was transformed into E. coli. JM109 by the CaCl2 method, the transformant could grow using 1, 2, 4-trichlorobenzene as the sole carbon source and had the degradation function of 1, 2, 4-trichlorobenzene. Therefore, it could be deemed that the plasmid carried the degradative genes of 1, 2, 4-trichlorobenzene. The average size of the plasmid was finally determined to be 40.2 Kb using selectively three kinds of restricted inscribed enzymes (HindIII, BamHI, and XholI) for single cutting and double cutting the plasmid pTHSL-1, respectively.

  5. Plasmids of psychrophilic and psychrotolerant bacteria and their role in adaptation to cold environments.

    Science.gov (United States)

    Dziewit, Lukasz; Bartosik, Dariusz

    2014-01-01

    Extremely cold environments are a challenge for all organisms. They are mostly inhabited by psychrophilic and psychrotolerant bacteria, which employ various strategies to cope with the cold. Such harsh environments are often highly vulnerable to the influence of external factors and may undergo frequent dynamic changes. The rapid adjustment of bacteria to changing environmental conditions is crucial for their survival. Such "short-term" evolution is often enabled by plasmids-extrachromosomal replicons that represent major players in horizontal gene transfer. The genomic sequences of thousands of microorganisms, including those of many cold-active bacteria have been obtained over the last decade, but the collected data have yet to be thoroughly analyzed. This report describes the results of a meta-analysis of the NCBI sequence databases to identify and characterize plasmids of psychrophilic and psychrotolerant bacteria. We have performed in-depth analyses of 66 plasmids, almost half of which are cryptic replicons not exceeding 10 kb in size. Our analyses of the larger plasmids revealed the presence of numerous genes, which may increase the phenotypic flexibility of their host strains. These genes encode enzymes possibly involved in (i) protection against cold and ultraviolet radiation, (ii) scavenging of reactive oxygen species, (iii) metabolism of amino acids, carbohydrates, nucleotides and lipids, (iv) energy production and conversion, (v) utilization of toxic organic compounds (e.g., naphthalene), and (vi) resistance to heavy metals, metalloids and antibiotics. Some of the plasmids also contain type II restriction-modification systems, which are involved in both plasmid stabilization and protection against foreign DNA. Moreover, approx. 50% of the analyzed plasmids carry genetic modules responsible for conjugal transfer or mobilization for transfer, which may facilitate the spread of these replicons among various bacteria, including across species boundaries.

  6. Plasmid segregation mechanisms

    DEFF Research Database (Denmark)

    Ebersbach, Gitte; Gerdes, Kenn; Charbon, Gitte Ebersbach

    2005-01-01

    Bacterial plasmids encode partitioning (par) loci that ensure ordered plasmid segregation prior to cell division. par loci come in two types: those that encode actin-like ATPases and those that encode deviant Walker-type ATPases. ParM, the actin-like ATPase of plasmid R1, forms dynamic filaments ...

  7. Influence of nutrient restriction and melatonin supplementation of pregnant ewes on maternal and fetal pancreatic digestive enzymes and insulin-containing clusters.

    Science.gov (United States)

    Keomanivong, F E; Lemley, C O; Camacho, L E; Yunusova, R; Borowicz, P P; Caton, J S; Meyer, A M; Vonnahme, K A; Swanson, K C

    2016-03-01

    Primiparous ewes (n=32) were assigned to dietary treatments in a 2×2 factorial arrangement to determine effects of nutrient restriction and melatonin supplementation on maternal and fetal pancreatic weight, digestive enzyme activity, concentration of insulin-containing clusters and plasma insulin concentrations. Treatments consisted of nutrient intake with 60% (RES) or 100% (ADQ) of requirements and melatonin supplementation at 0 (CON) or 5 mg/day (MEL). Treatments began on day 50 of gestation and continued until day 130. On day 130, blood was collected under general anesthesia from the uterine artery, uterine vein, umbilical artery and umbilical vein for plasma insulin analysis. Ewes were then euthanized and the pancreas removed from the ewe and fetus, trimmed of mesentery and fat, weighed and snap-frozen until enzyme analysis. In addition, samples of pancreatic tissue were fixed in 10% formalin solution for histological examination including quantitative characterization of size and distribution of insulin-containing cell clusters. Nutrient restriction decreased (P⩽0.001) maternal pancreatic mass (g) and α-amylase activity (U/g, kU/pancreas, U/kg BW). Ewes supplemented with melatonin had increased pancreatic mass (P=0.03) and α-amylase content (kU/pancreas and U/kg BW). Melatonin supplementation decreased (P=0.002) maternal pancreatic insulin-positive tissue area (relative to section of tissue), and size of the largest insulin-containing cell cluster (P=0.04). Nutrient restriction decreased pancreatic insulin-positive tissue area (P=0.03) and percent of large (32 001 to 512 000 µm2) and giant (⩾512 001 µm2) insulin-containing cell clusters (P=0.04) in the fetus. Insulin concentrations in plasma from the uterine vein, umbilical artery and umbilical vein were greater (P⩽0.01) in animals receiving 100% requirements. When comparing ewes to fetuses, ewes had a greater percentage of medium insulin-containing cell clusters (2001 to 32 000 µm2) while fetuses

  8. An epidemiological survey on Escherichia coli producing plasmid-mediated AmpC enzyme and regulation of expression of AmpC enzyme%产质粒介导AmpC酶大肠埃希菌的流行病学调查及其酶的表达调控

    Institute of Scientific and Technical Information of China (English)

    邓江锦; 张文林; 张志祥; 李小庆

    2013-01-01

    Objective To explore the expression and regulation of Escherichia coli producing plasmid-mediated AmpC enzymes.Methods 30 strains of E.Coli producing plasmid-mediated AmpC enzyme were isolated.An epidemiological survey were conducted on Escherichia coli producing plasmidmediated AmpC enzyme,and transfer bonding test was carried out.6 primer bacterial plasmid DNA extracted for the multiplex PCR amplification were set.Results According to the epidemiological survey,a total of 20 strains producing β-lactamase were detected,5 of which produced AmpC β-lactamase enzymes and extended-spectrum β-lactamase enzyme,12 only produced extended-spectrum β-lactamase enzymes,and 3 produced lactamase AmpC β alone.5 strains were transferred successfully.PCR amplification test and the Genbank database sequence alignment analysis showed that 6 strains were amplified to produce plasmidmediated ampC gene,4 of which were CIT and 2 of which were type DHA.Conclusions Clinically,strains of Escherichia coli producing plasmid AmpC enzyme widely spread.Control of the regulatory mechanism of high expression is helpful in guiding clinical antibiotic uses.%目的 研究产质粒介导AmpC酶大肠埃希菌的流行病学状况及其酶的表达调控.方法 选择临床中分离到的疑似产质粒介导AmpC酶的大肠埃希菌30株,对产质粒介导AmpC酶大肠埃希菌的流行病学特征进行调查分析,并行转移接合试验.用6组引物对提取的细菌质粒DNA进行多重PCR扩增,从而对质粒介导的AmpC酶的表达调控进行分析.结果 流行病学调查,共检出20株产β-内酰胺酶菌株,其中有5株菌株同时产AmpC β-内酰胺酶和超广谱β-内酰胺酶,12株只产超广谱β-内酰胺酶,3株只产AmpC β-内酰胺酶,5株转移接合成功.PCR扩增试验后,与Genbank数据库进行序列比对分析,发现有6株扩增产生质粒介导的AmpC基因,其中CIT型4株,DHA型2株.结论 产质粒AmpC酶大肠埃希菌在临床上广泛传播,把握

  9. Isolation of bacterial plasmids by density gradient centrifugation in cesium trifluoroacetate (CsTFA) without the use of ethidium bromide.

    Science.gov (United States)

    Andersson, K; Hjorth, R

    1985-01-01

    Plasmids extracted from bacterial cells by alkaline extraction can easily be isolated from linear DNA by isopycnic centrifugation in CsTFA. This is a fast and simple method which circumvents the use of the intercalating dye, ethidium bromide, and consequently the problems associated with its removal. The buoyant densities for covalently closed circular DNA and linear DNA in CsTFA are 1.60 g/ml and 1.65 g/ml, respectively. The isolation is achieved regardless of plasmid size and can be accomplished at temperatures of between 4 and 30 degrees C. Plasmid DNA isolated in gradients of CsTFA are of a high purity and have been found to be intact when cleaved with restriction enzymes and ligated with T4 DNA ligase.

  10. Characterization of FP22, a large streptomycete bacteriophage with DNA insensitive to cleavage by many restriction enzymes.

    Science.gov (United States)

    Hahn, D R; McHenney, M A; Baltz, R H

    1990-12-01

    Bacteriophage FP22 has a very broad host range within streptomycetes and appeared to form lysogens of Streptomyces ambofaciens ATCC 15154. FP22 shared strong cross-immunity and antibody cross-reactivity with bacteriophage P23, but not with seven other streptomycete bacteriophages. FP22 particles had a head diameter of 71 nm and a tail length of 307 nm. The FP22 genome was 131 kb, which is the largest bacteriophage genome reported for streptomycetes. The G + C content of the genome was 46 mol% and restriction mapping indicated that FP22 DNA had discrete ends. NaCl- and pyrophosphate-resistant deletion mutants were readily isolated and the extent of the deletions defined at least 23 kb of dispensable DNA in two regions of the genome. The DNA was not cleaved by most restriction endonucleases (or isoschizomers) which have been identified in the streptomycetes, including the tetranucleotide cutter MboI (GATC).

  11. Maternal protein restriction reduces expression of angiotensin I-converting enzyme 2 in rat placental labyrinth zone in late pregnancy.

    Science.gov (United States)

    Gao, Haijun; Yallampalli, Uma; Yallampalli, Chandra

    2012-02-01

    Both the systemic and the uteroplacental renin-angiotensin system (RAS) display dramatic changes during pregnancy. However, whether gestational protein insufficiency affects the expressions of RAS in the placenta remains unknown. In this study, we hypothesized that the expression of Ace2 in the placental labyrinth was reduced by maternal protein restriction. Pregnant Sprague-Dawley rats were fed a normal diet or a low-protein diet (LP) from Day 1 of pregnancy until they were killed at Day 14 or Day 18. The labyrinth zone (LZ) of the placenta was then dissected and snap frozen for expression analysis by quantitative real-time PCR of Ace, Ace2, Agtr1a, Agtr1b, and Agtr2. Formalin-fixed placentas were used for immunohistochemical analysis on ACE and ACE2 proteins. The findings include 1) the expression of Ace2 in rat LZ was reduced by maternal protein restriction in late pregnancy; 2) ACE protein was mainly present in syncytiotrophoblasts, whereas ACE2 protein was found predominantly in fetal mesenchymal tissue and fetal capillaries; 3) Agtr1a was predominant in the rat LZ, and its mRNA levels, but not protein levels, were reduced by LP; 4) expressions of Ace, Ace2, and Agtr1a in the rat LZ and their response to LP occurred in a gender-dependent manner. These results may indicate that a reduced expression of Ace2 and perhaps an associated reduction in angiotensin (1-7) production in the placenta by maternal protein restriction may be responsible for fetal growth restriction and associated programming of adulthood hypertension.

  12. Angiotensin-converting enzyme inhibition and food restriction in diabetic mice do not correct the increased sensitivity for ischemia-reperfusion injury

    Directory of Open Access Journals (Sweden)

    Van der Mieren Gerry

    2012-08-01

    Full Text Available Abstract Background The number of patients with diabetes or the metabolic syndrome reaches epidemic proportions. On top of their diabetic cardiomyopathy, these patients experience frequent and severe cardiac ischemia-reperfusion (IR insults, which further aggravate their degree of heart failure. Food restriction and angiotensin-converting enzyme inhibition (ACE-I are standard therapies in these patients but the effects on cardiac IR injury have never been investigated. In this study, we tested the hypothesis that 1° food restriction and 2° ACE-I reduce infarct size and preserve cardiac contractility after IR injury in mouse models of diabetes and the metabolic syndrome. Methods C57Bl6/J wild type (WT mice, leptin deficient ob/ob (model for type II diabetes and double knock-out (LDLR-/-;ob/ob, further called DKO mice with combined leptin and LDL-receptor deficiency (model for metabolic syndrome were used. The effects of 12 weeks food restriction or ACE-I on infarct size and load-independent left ventricular contractility after 30 min regional cardiac ischemia were investigated. Differences between groups were analyzed for statistical significance by Student’s t-test or factorial ANOVA followed by a Fisher’s LSD post hoc test. Results Infarct size was larger in ob/ob and DKO versus WT. Twelve weeks of ACE-I improved pre-ischemic left ventricular contractility in ob/ob and DKO. Twelve weeks of food restriction, with a weight reduction of 35-40%, or ACE-I did not reduce the effect of IR. Conclusion ACE-I and food restriction do not correct the increased sensitivity for cardiac IR-injury in mouse models of type II diabetes and the metabolic syndrome.

  13. Reduced insulin clearance and lower insulin-degrading enzyme expression in the liver might contribute to the thrifty phenotype of protein-restricted mice.

    Science.gov (United States)

    Rezende, Luiz F; Camargo, Rafael L; Branco, Renato C S; Cappelli, Ana P G; Boschero, Antonio C; Carneiro, Everardo M

    2014-09-28

    Nutrient restriction during the early stages of life usually leads to alterations in glucose homeostasis, mainly insulin secretion and sensitivity, increasing the risk of metabolic disorders in adulthood. Despite growing evidence regarding the importance of insulin clearance during glucose homeostasis in health and disease, no information exists about this process in malnourished animals. Thus, in the present study, we aimed to determine the effect of a nutrient-restricted diet on insulin clearance using a model in which 30-d-old C57BL/6 mice were exposed to a protein-restricted diet for 14 weeks. After this period, we evaluated many metabolic variables and extracted pancreatic islet, liver, gastrocnemius muscle (GCK) and white adipose tissue samples from the control (normal-protein diet) and restricted (low-protein diet, LP) mice. Insulin concentrations were determined using RIA and protein expression and phosphorylation by Western blot analysis. The LP mice exhibited lower body weight, glycaemia, and insulinaemia, increased glucose tolerance and altered insulin dynamics after the glucose challenge. The improved glucose tolerance could partially be explained by an increase in insulin sensitivity through the phosphorylation of the insulin receptor/protein kinase B and AMP-activated protein kinase/acetyl-CoA carboxylase in the liver, whereas the changes in insulin dynamics could be attributed to reduced insulin secretion coupled with reduced insulin clearance and lower insulin-degrading enzyme (IDE) expression in the liver and GCK. In summary, protein-restricted mice not only produce and secrete less insulin, but also remove and degrade less insulin. This phenomenon has the double benefit of sparing insulin while prolonging and potentiating its effects, probably due to the lower expression of IDE in the liver, possibly with long-term consequences.

  14. Comparison of time-restricted and ad libitum self-feeding on the growth, feeding behavior and daily digestive enzyme profiles of Atlantic salmon

    Science.gov (United States)

    Shi, Ce; Liu, Ying; Yi, Mengmeng; Zheng, Jimeng; Tian, Huiqin; Du, Yishuai; Li, Xian; Sun, Guoxiang

    2017-07-01

    Although it has been hypothesized that a predictable feeding regime in animals allows physiological variables to be adjusted to maximize nutrient utilization and, hence, better growth performance, the assumption has rarely been tested. This study compares the effects of time-restricted versus free access self-feeding on the growth, feeding behavior and daily digestive enzyme rhythms of Atlantic salmon ( Salmo salar). In an experiment that lasted 6 weeks, fish (109.9 g) were divided into two groups: group 1 had free access to a self-feeder (FA); group 2 received three meals per day (2 h per meal) at dawn, midday and dusk via a time-restricted self-feeder (TR). At the end of the experiment, the fish were sampled every 3 h over a 24-h period. The results showed that the TR fish quickly synchronized their feeding behavior to the feeding window and their blood glucose showed a significant postprandial increase, while FA fish displayed no statistically significant rhythms ( P>0.05). Pepsin activity of TR fish also showed a significant daily rhythm ( P0.05). In conclusion, the study failed to confirm a link between the entrainment of daily digestive enzyme profiles and growth performance, with the TR group showing comparatively poor blood glucose regulation.

  15. Comparison of time-restricted and ad libitum self-feeding on the growth, feeding behavior and daily digestive enzyme profiles of Atlantic salmon

    Science.gov (United States)

    Shi, Ce; Liu, Ying; Yi, Mengmeng; Zheng, Jimeng; Tian, Huiqin; Du, Yishuai; Li, Xian; Sun, Guoxiang

    2016-07-01

    Although it has been hypothesized that a predictable feeding regime in animals allows physiological variables to be adjusted to maximize nutrient utilization and, hence, better growth performance, the assumption has rarely been tested. This study compares the Effects of time-restricted versus free access self-feeding on the growth, feeding behavior and daily digestive enzyme rhythms of Atlantic salmon (Salmo salar). In an experiment that lasted 6 weeks, fish (109.9 g) were divided into two groups: group 1 had free access to a self-feeder (FA); group 2 received three meals per day (2 h per meal) at dawn, midday and dusk via a time-restricted self-feeder (TR). At the end of the experiment, the fish were sampled every 3 h over a 24-h period. The results showed that the TR fish quickly synchronized their feeding behavior to the feeding window and their blood glucose showed a significant postprandial increase, while FA fish displayed no statistically significant rhythms (P0.05). In conclusion, the study failed to confirm a link between the entrainment of daily digestive enzyme profiles and growth performance, with the TR group showing comparatively poor blood glucose regulation.

  16. DNA of a circular minichromosome linearized by restriction enzymes or other reagents is resistant to further cleavage: an influence of chromatin topology on the accessibility of DNA.

    Science.gov (United States)

    Kumala, Sławomir; Hadj-Sahraoui, Yasmina; Rzeszowska-Wolny, Joanna; Hancock, Ronald

    2012-10-01

    The accessibility of DNA in chromatin is an essential factor in regulating its activities. We studied the accessibility of the DNA in a ∼170 kb circular minichromosome to DNA-cleaving reagents using pulsed-field gel electrophoresis and fibre-fluorescence in situ hybridization on combed DNA molecules. Only one of several potential sites in the minichromosome DNA was accessible to restriction enzymes in permeabilized cells, and in growing cells only a single site at an essentially random position was cut by poisoned topoisomerase II, neocarzinostatin and γ-radiation, which have multiple potential cleavage sites; further sites were then inaccessible in the linearized minichromosomes. Sequential exposure to combinations of these reagents also resulted in cleavage at only a single site. Minichromosome DNA containing single-strand breaks created by a nicking endonuclease to relax any unconstrained superhelicity was also cut at only a single position by a restriction enzyme. Further sites became accessible after ≥95% of histones H2A, H2B and H1, and most non-histone proteins were extracted. These observations suggest that a global rearrangement of the three-dimensional packing and interactions of nucleosomes occurs when a circular minichromosome is linearized and results in its DNA becoming inaccessible to probes.

  17. Use of T-RFLP and seven restriction enzymes to compare the faecal microbiota of obese and lean Japanese healthy men.

    Science.gov (United States)

    Kobayashi, T; Osaki, T; Oikawa, S

    2015-01-01

    The composition of the intestinal microbiota of 92 healthy Japanese men was measured following consumption of identical meals for 3 days; terminal restriction fragment length polymorphisms were then used to analyse the DNA content of their faeces. The obtained operational taxonomic units (OTUs) were further analysed using seven restriction enzymes: 516f-BslI and -HaeIII, 27f-MspI and -AluI, and 35f-HhaI, -MspI and -AluI. Subjects were classified by their body mass index (BMI) as lean (25.0). OTUs were then analysed using data mining software. Pearson correlation coefficients on data mining results indicated only a weak relationship between BMI and OTU diversity. Specific OTUs attributed to lean and obese subjects were further examined by data mining with six groups of enzymes and closely related accession numbers for lean and obese subjects were successfully narrowed down. 16S rRNA sequences showed Bacillus spp., Erysipelothrix spp. and Holdemania spp. to be present among 30 bacterial candidates related to the lean group. Fifteen candidates were classified Firmicutes, one was classified as Chloroflexi, and the others were not classified. 45 Microbacteriaceae, 11 uncultured Actinobacterium, and 3 other families were present among the 119 candidate OTUs related to obesity. We conclude that the presence of Firmicutes and Actinobacteria may be related to the BMI of the subject.

  18. Bacteriophage selection against a plasmid-encoded sex apparatus leads to the loss of antibiotic-resistance plasmids.

    Science.gov (United States)

    Jalasvuori, Matti; Friman, Ville-Petri; Nieminen, Anne; Bamford, Jaana K H; Buckling, Angus

    2011-12-23

    Antibiotic-resistance genes are often carried by conjugative plasmids, which spread within and between bacterial species. It has long been recognized that some viruses of bacteria (bacteriophage; phage) have evolved to infect and kill plasmid-harbouring cells. This raises a question: can phages cause the loss of plasmid-associated antibiotic resistance by selecting for plasmid-free bacteria, or can bacteria or plasmids evolve resistance to phages in other ways? Here, we show that multiple antibiotic-resistance genes containing plasmids are stably maintained in both Escherichia coli and Salmonella enterica in the absence of phages, while plasmid-dependent phage PRD1 causes a dramatic reduction in the frequency of antibiotic-resistant bacteria. The loss of antibiotic resistance in cells initially harbouring RP4 plasmid was shown to result from evolution of phage resistance where bacterial cells expelled their plasmid (and hence the suitable receptor for phages). Phages also selected for a low frequency of plasmid-containing, phage-resistant bacteria, presumably as a result of modification of the plasmid-encoded receptor. However, these double-resistant mutants had a growth cost compared with phage-resistant but antibiotic-susceptible mutants and were unable to conjugate. These results suggest that bacteriophages could play a significant role in restricting the spread of plasmid-encoded antibiotic resistance.

  19. Growth hormone genotyping by MspI restriction enzyme and PCR-RFLP method in Aceh cattle breed at Indrapuri District, Aceh Province, Indonesia

    Directory of Open Access Journals (Sweden)

    WIDYA PINTAKA BAYU PUTRA

    2014-04-01

    Full Text Available Putra WPB, Hartatik T, Sumadi. 2014. Growth hormone genotyping by MspI restriction enzyme and PCR-RFLP method in Aceh cattle breed at Indrapuri District, Aceh Province, Indonesia. Biodiversitas 15: 1-5. The objective of this research was to identify growth hormone (GH gene in Aceh cattle at Indrapuri’s Breeding and Forage Centre (IBFC of Aceh Cattle. Fourty one cattle consisting of 21 male and 20 female cattle were used in this study. Polymerase Chain Reaction (PCR - Restriction Fragment Length Polymorphism (RFLP and sequencing method was used to detect MspI site on GH gene. Based on the sequencing, it can be concluded that all cattle were monomorphic. The frequency of TT genotype and T allele were 1.00 relatively. The transition of C (cytosine into T (thymine on 1549 position caused the lost of restriction site. The insertion of T and G (guanine on 1542 and 1552 position caused the length of GH gene were 329 bp in Aceh cattle.

  20. Characterization of the restriction enzyme-like endonuclease encoded by the Entamoeba histolytica non-long terminal repeat retrotransposon EhLINE1.

    Science.gov (United States)

    Yadav, Vijay Pal; Mandal, Prabhat Kumar; Rao, Desirazu N; Bhattacharya, Sudha

    2009-12-01

    The genome of the human pathogen Entamoeba histolytica, a primitive protist, contains non-long terminal repeat retrotransposable elements called EhLINEs. These encode reverse transcriptase and endonuclease required for retrotransposition. The endonuclease shows sequence similarity with bacterial restriction endonucleases. Here we report the salient enzymatic features of one such endonuclease. The kinetics of an EhLINE1-encoded endonuclease catalyzed reaction, determined under steady-state and single-turnover conditions, revealed a significant burst phase followed by a slower steady-state phase, indicating that release of product could be the slower step in this reaction. For circular supercoiled DNA the K(m) was 2.6 x 10(-8) M and the k(cat) was 1.6 x 10(-2) sec(-1). For linear E. histolytica DNA substrate the K(m) and k(cat) values were 1.3 x 10(-8) M and 2.2 x 10(-4) sec(-1) respectively. Single-turnover reaction kinetics suggested a noncooperative mode of hydrolysis. The enzyme behaved as a monomer. While Mg(2+) was required for activity, 60% activity was seen with Mn(2+) and none with other divalent metal ions. Substitution of PDX(12-14)D (a metal-binding motif) with PAX(12-14)D caused local conformational change in the protein tertiary structure, which could contribute to reduced enzyme activity in the mutated protein. The protein underwent conformational change upon the addition of DNA, which is consistent with the known behavior of restriction endonucleases. The similarities with bacterial restriction endonucleases suggest that the EhLINE1-encoded endonuclease was possibly acquired from bacteria through horizontal gene transfer. The loss of strict sequence specificity for nicking may have been subsequently selected to facilitate spread of the retrotransposon to intergenic regions of the E. histolytica genome.

  1. Restriction enzyme analysis of Indian isolates of egg drop syndrome 1976 virus recovered from chicken, duck and quail.

    Science.gov (United States)

    Senthilkumar, N; Kataria, J M; Koti, M; Dhama, K; Dash, B B

    2004-07-01

    Egg drop syndrome 1976 (EDS-76) is caused by a haemagglutinating adenovirus belonging to group III of the genus Aviadenovirus in the family Adenoviridae. All isolates are serologically identical, but have been divided into three groups based on restriction endonuclease (RE) analysis. In this study the viral DNA of various Indian EDS-76 viral isolates (CEDS-A, CEDS-B, EDS-M, EDS-ML, EDS-1/AD/86, EDS-KC and QEDS) obtained from different avian species and different geographical regions were digested with restriction endonucleases viz., EcoRI, BamHI, HindIII and PstI. The results showed that one Indian isolate obtained from duck (DEDS-KC) was different from all other chicken and quail counterparts. All other isolates were identical to the reference viral strain BC-14, which belong to group I of EDS-76 viruses. The duck isolate EDS-KC could not be placed in any of the three groups reported earlier.

  2. Structure, Mechanism, and Specificity of a Eukaryal tRNA Restriction Enzyme Involved in Self-Nonself Discrimination

    Directory of Open Access Journals (Sweden)

    Anupam K. Chakravarty

    2014-04-01

    Full Text Available tRNA restriction by anticodon nucleases underlies cellular stress responses and self-nonself discrimination in a wide range of taxa. Anticodon breakage inhibits protein synthesis, which, in turn, results in growth arrest or cell death. The eukaryal ribotoxin PaT secreted by Pichia acaciae inhibits growth of Saccharomyces cerevisiae via cleavage of tRNAGln(UUG. We find that recombinant PaT incises a synthetic tRNAGln(UUG stem-loop RNA by transesterification at a single site 3′ of the wobble uridine, yielding 2′,3′-cyclic phosphate and 5′-OH ends. Incision is suppressed by replacement of the wobble nucleobase with adenine or guanine. The crystal structure of PaT reveals a distinctive fold and active site, essential components of which are demonstrated by mutagenesis. Pichia acaciae evades self-toxicity via a distinctive intracellular immunity protein, ImmPaT, which binds PaT and blocks nuclease activity. Our results highlight the evolutionary diversity of tRNA restriction and immunity systems.

  3. Hemolysis, Elevated Liver Enzymes, and Low Platelets, Severe Fetal Growth Restriction, Postpartum Subarachnoid Hemorrhage, and Craniotomy: A Rare Case Report and Systematic Review

    Directory of Open Access Journals (Sweden)

    Shadi Rezai

    2017-01-01

    Full Text Available Introduction. Hemolysis, elevated liver enzymes, and low platelets (HELLP syndrome is a relatively uncommon but traumatic condition occurring in the later stage of pregnancy as a complication of severe preeclampsia or eclampsia. Prompt brain computed tomography (CT or magnetic resonance imaging (MRI and a multidisciplinary management approach are required to improve perinatal outcome. Case. A 37-year-old, Gravida 6, Para 1-0-4-1, Hispanic female with a history of chronic hypertension presented at 26 weeks and 6 days of gestational age. She was noted to have hemolysis, elevated liver enzymes, and low platelets (HELLP syndrome accompanied by fetal growth restriction (FGR, during ultrasound evaluation, warranting premature delivery. The infant was delivered in stable condition suffering no permanent neurological deficit. Conclusion. HELLP syndrome is an uncommon and traumatic obstetric event which can lead to neurological deficits if not managed in a responsive and rapid manner. The central aggravating factor seems to be hypertension induced preeclamptic or eclamptic episode and complications thereof. The syndrome itself is manifested by hemolytic anemia, increased liver enzymes, and decreasing platelet counts with a majority of neurological defects resulting from hemorrhagic stroke or subarachnoid hemorrhage (SAH. To minimize adverse perinatal outcomes, obstetric management of this medical complication must include rapid clinical assessment, diagnostic examination, and neurosurgery consultation.

  4. Expression and purification of a single-chain Type IV restriction enzyme Eco94GmrSD and determination of its substrate preference.

    Science.gov (United States)

    He, Xinyi; Hull, Victoria; Thomas, Julie A; Fu, Xiaoqing; Gidwani, Sonal; Gupta, Yogesh K; Black, Lindsay W; Xu, Shuang-yong

    2015-05-19

    The first reported Type IV restriction endonuclease (REase) GmrSD consists of GmrS and GmrD subunits. In most bacteria, however, the gmrS and gmrD genes are fused together to encode a single-chain protein. The fused coding sequence for ECSTEC94C_1402 from E. coli strain STEC_94C was expressed in T7 Express. The protein designated as Eco94GmrSD displays modification-dependent ATP-stimulated REase activity on T4 DNA with glucosyl-5-hydroxymethyl-cytosines (glc-5hmC) and T4gt DNA with 5-hydroxymethyl-cytosines (5hmC). A C-terminal 6xHis-tagged protein was purified by two-column chromatography. The enzyme is active in Mg(2+) and Mn(2+) buffer. It prefers to cleave large glc-5hmC- or 5hmC-modified DNA. In phage restriction assays, Eco94GmrSD weakly restricted T4 and T4gt, whereas T4 IPI*-deficient phage (Δip1) were restricted more than 10(6)-fold, consistent with IPI* protection of E. coli DH10B from lethal expression of the closely homologous E. coli CT596 GmrSD. Eco94GmrSD is proposed to belong to the His-Asn-His (HNH)-nuclease family by the identification of a putative C-terminal REase catalytic site D507-H508-N522. Supporting this, GmrSD variants D507A, H508A, and N522A displayed no endonuclease activity. The presence of a large number of fused GmrSD homologs suggests that GmrSD is an effective phage exclusion protein that provides a mechanism to thwart T-even phage infection.

  5. A model for cell wall dissolution in mating yeast cells: polarized secretion and restricted diffusion of cell wall remodeling enzymes induces local dissolution.

    Directory of Open Access Journals (Sweden)

    Lori B Huberman

    Full Text Available Mating of the budding yeast, Saccharomyces cerevisiae, occurs when two haploid cells of opposite mating types signal using reciprocal pheromones and receptors, grow towards each other, and fuse to form a single diploid cell. To fuse, both cells dissolve their cell walls at the point of contact. This event must be carefully controlled because the osmotic pressure differential between the cytoplasm and extracellular environment causes cells with unprotected plasma membranes to lyse. If the cell wall-degrading enzymes diffuse through the cell wall, their concentration would rise when two cells touched each other, such as when two pheromone-stimulated cells adhere to each other via mating agglutinins. At the surfaces that touch, the enzymes must diffuse laterally through the wall before they can escape into the medium, increasing the time the enzymes spend in the cell wall, and thus raising their concentration at the point of attachment and restricting cell wall dissolution to points where cells touch each other. We tested this hypothesis by studying pheromone treated cells confined between two solid, impermeable surfaces. This confinement increases the frequency of pheromone-induced cell death, and this effect is diminished by reducing the osmotic pressure difference across the cell wall or by deleting putative cell wall glucanases and other genes necessary for efficient cell wall fusion. Our results support the model that pheromone-induced cell death is the result of a contact-driven increase in the local concentration of cell wall remodeling enzymes and suggest that this process plays an important role in regulating cell wall dissolution and fusion in mating cells.

  6. A model for cell wall dissolution in mating yeast cells: polarized secretion and restricted diffusion of cell wall remodeling enzymes induces local dissolution.

    Science.gov (United States)

    Huberman, Lori B; Murray, Andrew W

    2014-01-01

    Mating of the budding yeast, Saccharomyces cerevisiae, occurs when two haploid cells of opposite mating types signal using reciprocal pheromones and receptors, grow towards each other, and fuse to form a single diploid cell. To fuse, both cells dissolve their cell walls at the point of contact. This event must be carefully controlled because the osmotic pressure differential between the cytoplasm and extracellular environment causes cells with unprotected plasma membranes to lyse. If the cell wall-degrading enzymes diffuse through the cell wall, their concentration would rise when two cells touched each other, such as when two pheromone-stimulated cells adhere to each other via mating agglutinins. At the surfaces that touch, the enzymes must diffuse laterally through the wall before they can escape into the medium, increasing the time the enzymes spend in the cell wall, and thus raising their concentration at the point of attachment and restricting cell wall dissolution to points where cells touch each other. We tested this hypothesis by studying pheromone treated cells confined between two solid, impermeable surfaces. This confinement increases the frequency of pheromone-induced cell death, and this effect is diminished by reducing the osmotic pressure difference across the cell wall or by deleting putative cell wall glucanases and other genes necessary for efficient cell wall fusion. Our results support the model that pheromone-induced cell death is the result of a contact-driven increase in the local concentration of cell wall remodeling enzymes and suggest that this process plays an important role in regulating cell wall dissolution and fusion in mating cells.

  7. Short-term calorie restriction feminizes the mRNA profiles of drug metabolizing enzymes and transporters in livers of mice.

    Science.gov (United States)

    Fu, Zidong Donna; Klaassen, Curtis D

    2014-01-01

    Calorie restriction (CR) is one of the most effective anti-aging interventions in mammals. A modern theory suggests that aging results from a decline in detoxification capabilities and thus accumulation of damaged macromolecules. The present study aimed to determine how short-term CR alters mRNA profiles of genes that encode metabolism and detoxification machinery in the liver. Male C57BL/6 mice were fed CR (0, 15, 30, or 40%) diets for one month, followed by mRNA quantification of 98 xenobiotic processing genes (XPGs) in the liver, including 7 uptake transporters, 39 phase-I enzymes, 37 phase-II enzymes, 10 efflux transporters, and 5 transcription factors. In general, 15% CR did not alter mRNAs of most XPGs, whereas 30 and 40% CR altered over half of the XPGs (32 increased and 29 decreased). CR up-regulated some phase-I enzymes (fold increase), such as Cyp4a14 (12), Por (2.3), Nqo1 (1.4), Fmo2 (5.4), and Fmo3 (346), and numerous number of phase-II enzymes, such as Sult1a1 (1.2), Sult1d1 (2.0), Sult1e1 (33), Sult3a1 (2.2), Gsta4 (1.3), Gstm2 (1.3), Gstm3 (1.7), and Mgst3 (2.2). CR feminized the mRNA profiles of 32 XPGs in livers of male mice. For instance, CR decreased the male-predominantly expressed Oatp1a1 (97%) and increased the female-predominantly expressed Oatp1a4 (11). In conclusion, short-term CR alters the mRNA levels of over half of the 98 XPGs quantified in livers of male mice, and over half of these alterations appear to be due to feminization of the liver.

  8. Mapping DNA cleavage by the Type ISP restriction-modification enzymes following long-range communication between DNA sites in different orientations.

    Science.gov (United States)

    van Aelst, Kara; Saikrishnan, Kayarat; Szczelkun, Mark D

    2015-12-02

    The prokaryotic Type ISP restriction-modification enzymes are single-chain proteins comprising an Mrr-family nuclease, a superfamily 2 helicase-like ATPase, a coupler domain, a methyltransferase, and a DNA-recognition domain. Upon recognising an unmodified DNA target site, the helicase-like domain hydrolyzes ATP to cause site release (remodeling activity) and to then drive downstream translocation consuming 1-2 ATP per base pair (motor activity). On an invading foreign DNA, double-strand breaks are introduced at random wherever two translocating enzymes form a so-called collision complex following long-range communication between a pair of target sites in inverted (head-to-head) repeat. Paradoxically, structural models for collision suggest that the nuclease domains are too far apart (>30 bp) to dimerise and produce a double-strand DNA break using just two strand-cleavage events. Here, we examined the organisation of different collision complexes and how these lead to nuclease activation. We mapped DNA cleavage when a translocating enzyme collides with a static enzyme bound to its site. By following communication between sites in both head-to-head and head-to-tail orientations, we could show that motor activity leads to activation of the nuclease domains via distant interactions of the helicase or MTase-TRD. Direct nuclease dimerization is not required. To help explain the observed cleavage patterns, we also used exonuclease footprinting to demonstrate that individual Type ISP domains can swing off the DNA. This study lends further support to a model where DNA breaks are generated by multiple random nicks due to mobility of a collision complex with an overall DNA-binding footprint of ∼30 bp.

  9. Mapping DNA cleavage by the Type ISP restriction-modification enzymes following long-range communication between DNA sites in different orientations

    Science.gov (United States)

    van Aelst, Kara; Saikrishnan, Kayarat; Szczelkun, Mark D.

    2015-01-01

    The prokaryotic Type ISP restriction-modification enzymes are single-chain proteins comprising an Mrr-family nuclease, a superfamily 2 helicase-like ATPase, a coupler domain, a methyltransferase, and a DNA-recognition domain. Upon recognising an unmodified DNA target site, the helicase-like domain hydrolyzes ATP to cause site release (remodeling activity) and to then drive downstream translocation consuming 1–2 ATP per base pair (motor activity). On an invading foreign DNA, double-strand breaks are introduced at random wherever two translocating enzymes form a so-called collision complex following long-range communication between a pair of target sites in inverted (head-to-head) repeat. Paradoxically, structural models for collision suggest that the nuclease domains are too far apart (>30 bp) to dimerise and produce a double-strand DNA break using just two strand-cleavage events. Here, we examined the organisation of different collision complexes and how these lead to nuclease activation. We mapped DNA cleavage when a translocating enzyme collides with a static enzyme bound to its site. By following communication between sites in both head-to-head and head-to-tail orientations, we could show that motor activity leads to activation of the nuclease domains via distant interactions of the helicase or MTase-TRD. Direct nuclease dimerization is not required. To help explain the observed cleavage patterns, we also used exonuclease footprinting to demonstrate that individual Type ISP domains can swing off the DNA. This study lends further support to a model where DNA breaks are generated by multiple random nicks due to mobility of a collision complex with an overall DNA-binding footprint of ∼30 bp. PMID:26507855

  10. Genetic relationships between clinical and non-clinical strains of Yersinia enterocolitica biovar 1A as revealed by multilocus enzyme electrophoresis and multilocus restriction typing

    Directory of Open Access Journals (Sweden)

    Virdi Jugsharan S

    2010-05-01

    Full Text Available Abstract Background Genetic relationships among 81 strains of Y. enterocolitica biovar 1A isolated from clinical and non-clinical sources were discerned by multilocus enzyme electrophoresis (MLEE and multilocus restriction typing (MLRT using six loci each. Such studies may reveal associations between the genotypes of the strains and their sources of isolation. Results All loci were polymorphic and generated 62 electrophoretic types (ETs and 12 restriction types (RTs. The mean genetic diversity (H of the strains by MLEE and MLRT was 0.566 and 0.441 respectively. MLEE (DI = 0.98 was more discriminatory and clustered Y. enterocolitica biovar 1A strains into four groups, while MLRT (DI = 0.77 identified two distinct groups. BURST (Based Upon Related Sequence Types analysis of the MLRT data suggested aquatic serotype O:6,30-6,31 isolates to be the ancestral strains from which, clinical O:6,30-6,31 strains might have originated by host adaptation and genetic change. Conclusion MLEE revealed greater genetic diversity among strains of Y. enterocolitica biovar 1A and clustered strains in four groups, while MLRT grouped the strains into two groups. BURST analysis of MLRT data nevertheless provided newer insights into the probable evolution of clinical strains from aquatic strains.

  11. The Drosophila insulin-degrading enzyme restricts growth by modulating the PI3K pathway in a cell-autonomous manner.

    Science.gov (United States)

    Galagovsky, Diego; Katz, Maximiliano J; Acevedo, Julieta M; Sorianello, Eleonora; Glavic, Alvaro; Wappner, Pablo

    2014-03-01

    Mammalian insulin-degrading enzyme (IDE) cleaves insulin, among other peptidic substrates, but its function in insulin signaling is elusive. We use the Drosophila system to define the function of IDE in the regulation of growth and metabolism. We find that either loss or gain of function of Drosophila IDE (dIDE) can restrict growth in a cell-autonomous manner by affecting both cell size and cell number. dIDE can modulate Drosophila insulin-like peptide 2 levels, thereby restricting activation of the phosphatidylinositol-3-phosphate kinase pathway and promoting activation of Drosophila forkhead box, subgroup O transcription factor. Larvae reared in high sucrose exhibit delayed developmental timing due to insulin resistance. We find that dIDE loss of function exacerbates this phenotype and that mutants display increased levels of circulating sugar, along with augmented expression of a lipid biosynthesis marker. We propose that dIDE is a modulator of insulin signaling and that its loss of function favors insulin resistance, a hallmark of diabetes mellitus type II.

  12. Effectiveness of annealing blocking primers versus restriction enzymes for characterization of generalist diets: unexpected prey revealed in the gut contents of two coral reef fish species.

    Science.gov (United States)

    Leray, Matthieu; Agudelo, Natalia; Mills, Suzanne C; Meyer, Christopher P

    2013-01-01

    Characterization of predator-prey interactions is challenging as researchers have to rely on indirect methods that can be costly, biased and too imprecise to elucidate the complexity of food webs. DNA amplification and sequencing techniques of gut and fecal contents are promising approaches, but their success largely depends on the ability to amplify the taxonomic array of prey consumed and then match prey amplicons with reference sequences. When little a priori information on diet is available or a generalist predator is targeted, versatile primer sets (also referred to as universal or general primers) as opposed to group- or species-specific primer sets are the most powerful to unveil the full range of prey consumed. However, versatile primers are likely to preferentially amplify the predominant, less degraded predator DNA if no manipulation is performed to exclude this confounding DNA template. In this study we compare two approaches that eliminate the confounding predator template: restriction digestion and the use of annealing blocking primers. First, we use a preliminary DNA barcode library provided by the Moorea BIOCODE project to 1) evaluate the cutting frequency of commercially available restriction enzymes and 2) design predator specific annealing blocking primers. We then compare the performance of the two predator removal strategies for the detection of prey templates using two versatile primer sets from the gut contents of two generalist coral reef fish species sampled in Moorea. Our study demonstrates that blocking primers should be preferentially used over restriction digestion for predator DNA removal as they recover greater prey diversity. We also emphasize that a combination of versatile primers may be required to best represent the breadth of a generalist's diet.

  13. Short-term calorie restriction feminizes the mRNA profiles of drug metabolizing enzymes and transporters in livers of mice

    Energy Technology Data Exchange (ETDEWEB)

    Fu, Zidong Donna [Department of Pharmacology, Toxicology, and Therapeutics, University of Kansas Medical Center, Kansas City, KS 66160 (United States); Klaassen, Curtis D., E-mail: cklaasse@kumc.edu [Department of Internal Medicine, University of Kansas Medical Center, Kansas City, KS 66160 (United States)

    2014-01-01

    Calorie restriction (CR) is one of the most effective anti-aging interventions in mammals. A modern theory suggests that aging results from a decline in detoxification capabilities and thus accumulation of damaged macromolecules. The present study aimed to determine how short-term CR alters mRNA profiles of genes that encode metabolism and detoxification machinery in the liver. Male C57BL/6 mice were fed CR (0, 15, 30, or 40%) diets for one month, followed by mRNA quantification of 98 xenobiotic processing genes (XPGs) in the liver, including 7 uptake transporters, 39 phase-I enzymes, 37 phase-II enzymes, 10 efflux transporters, and 5 transcription factors. In general, 15% CR did not alter mRNAs of most XPGs, whereas 30 and 40% CR altered over half of the XPGs (32 increased and 29 decreased). CR up-regulated some phase-I enzymes (fold increase), such as Cyp4a14 (12), Por (2.3), Nqo1 (1.4), Fmo2 (5.4), and Fmo3 (346), and numerous number of phase-II enzymes, such as Sult1a1 (1.2), Sult1d1 (2.0), Sult1e1 (33), Sult3a1 (2.2), Gsta4 (1.3), Gstm2 (1.3), Gstm3 (1.7), and Mgst3 (2.2). CR feminized the mRNA profiles of 32 XPGs in livers of male mice. For instance, CR decreased the male-predominantly expressed Oatp1a1 (97%) and increased the female-predominantly expressed Oatp1a4 (11). In conclusion, short-term CR alters the mRNA levels of over half of the 98 XPGs quantified in livers of male mice, and over half of these alterations appear to be due to feminization of the liver. - Highlights: • Utilized a graded CR model in male mice • The mRNA profiles of xenobiotic processing genes (XPGs) in liver were investigated. • CR up-regulates many phase-II enzymes. • CR tends to feminize the mRNA profiles of XPGs.

  14. Protein diversity confers specificity in plasmid segregation.

    Science.gov (United States)

    Fothergill, Timothy J G; Barillà, Daniela; Hayes, Finbarr

    2005-04-01

    The ParG segregation protein (8.6 kDa) of multidrug resistance plasmid TP228 is a homodimeric DNA-binding factor. The ParG dimer consists of intertwined C-terminal domains that adopt a ribbon-helix-helix architecture and a pair of flexible, unstructured N-terminal tails. A variety of plasmids possess partition loci with similar organizations to that of TP228, but instead of ParG homologs, these plasmids specify a diversity of unrelated, but similarly sized, partition proteins. These include the proteobacterial pTAR, pVT745, and pB171 plasmids. The ParG analogs of these plasmids were characterized in parallel with the ParG homolog encoded by the pseudomonal plasmid pVS1. Like ParG, the four proteins are dimeric. No heterodimerization was detectable in vivo among the proteins nor with the prototypical ParG protein, suggesting that monomer-monomer interactions are specific among the five proteins. Nevertheless, as with ParG, the ParG analogs all possess significant amounts of unordered amino acid residues, potentially highlighting a common structural link among the proteins. Furthermore, the ParG analogs bind specifically to the DNA regions located upstream of their homologous parF-like genes. These nucleoprotein interactions are largely restricted to cognate protein-DNA pairs. The results reveal that the partition complexes of these and related plasmids have recruited disparate DNA-binding factors that provide a layer of specificity to the macromolecular interactions that mediate plasmid segregation.

  15. Comparative characterization of the PvuRts1I family of restriction enzymes and their application in mapping genomic 5-hydroxymethylcytosine.

    Science.gov (United States)

    Wang, Hua; Guan, Shengxi; Quimby, Aine; Cohen-Karni, Devora; Pradhan, Sriharsa; Wilson, Geoffrey; Roberts, Richard J; Zhu, Zhenyu; Zheng, Yu

    2011-11-01

    PvuRts1I is a modification-dependent restriction endonuclease that recognizes 5-hydroxymethylcytosine (5hmC) as well as 5-glucosylhydroxymethylcytosine (5ghmC) in double-stranded DNA. Using PvuRts1I as the founding member, we define a family of homologous proteins with similar DNA modification-dependent recognition properties. At the sequence level, these proteins share a few uniquely conserved features. We show that these enzymes introduce a double-stranded cleavage at the 3'-side away from the recognized modified cytosine. The distances between the cleavage sites and the modified cytosine are fixed within a narrow range, with the majority being 11-13 nt away in the top strand and 9-10 nt away in the bottom strand. The recognition sites of these enzymes generally require two cytosines on opposite strand around the cleavage sites, i.e. 5'-CN(11-13)↓N(9-10)G-3'/3'-GN(9-10)↓N(11-13)C-5', with at least one cytosine being modified for efficient cleavage. As one potential application for these enzymes is to provide useful tools for selectively mapping 5hmC sites, we have compared the relative selectivity of a few PvuRts1I family members towards different forms of modified cytosines. Our results show that the inherently different relative selectivity towards modified cytosines can have practical implications for their application. By using AbaSDFI, a PvuRts1I homolog with the highest relative selectivity towards 5ghmC, to analyze rat brain DNA, we show it is feasible to map genomic 5hmC sites close to base resolution. Our study offers unique tools for determining more accurate hydroxymethylomes in mammalian cells.

  16. CARTOGRAPHIE DU PLASMIDE pSU100, PLASMIDE CRYPTIQUE DE LACTOBACILLUS CASEI

    Directory of Open Access Journals (Sweden)

    F BENSALAH

    2003-06-01

    Ce plasmide appelé pSU100 a été cloné dans le vecteur de transformation pUC18 au site EcoRI chez E. coli JM103. Les profils électrophorétiques de restriction obtenus par des digestions simples, doubles et triples sous l’action de 33 endonucléases, ont contribué à l’élaboration d’une carte de restriction de ce plasmide. Cinq sites uniques ont été identifiés, ainsi que d’autres sites doubles et multiples. Une étude préliminaire du rôle physiologique de ce plasmide a permis de déceler une résistance à la kanamycine.

  17. Inhibition of DNA restrictive endonucleases and Taq DNA polymerase by trimalonic acid C60

    Institute of Scientific and Technical Information of China (English)

    YANG XinLin; CHEN Zhe; MENG XianMei; LI Bo; TAN Xin

    2007-01-01

    Activities of trimalonic acid fullerene (TMA C60) on DNA restrictive enzymatic reaction were investigated by using two restrictive endonucleases Hind III and EcoR I and plasmid pEGFP-N1 with single restrictive site for both enzymes. Meanwhile,TMA C60 was also tested to clarify its effects on polymerase chain reaction (PCR) with the catalyst of Taq DNA polymerase and the template of plasmid pEGFP-N1. The products from restrictive reactions or PCR were detected by agarose gel electrophoresis. It was found that the product amounts from restrictive reactions or PCR decreased significantly with addition of TMA C60. The inhibition by TMA C60 was dose-dependent and IC50 values for reactions of Hind III,EcoR I and PCR were 16.3,6.0 and 6.0 μmol/L,respectively. Addition of two scavengers of reactive oxygen species (ROS),L-ascorbic acid-2-phosphate ester magnesium and sodium azide at the concentrations of 2―10 mmol/L did not antagonize the activities of TMA C60 against PCR and two restrictive reactions. However,increase of Taq DNA polymerase amounts in PCR system antagonized the activities of TMA C60. These data implied that TMA C60 was able to inhibit the activities of the three above-mentioned enzymes involved in DNA metabolism,and that this inhibition probably did not correlate to ROS.

  18. [Investigation of plasmid-mediated quinolone resistance in Escherichia coli strains].

    Science.gov (United States)

    Aktepe, Orhan Cem; Aşık, Gülşah; Cetinkol, Yeliz; Biçmen, Meral; Gülay, Zeynep

    2012-01-01

    Quinolones are widely used antimicrobial agents, particularly for the treatment of infections caused by gram-negative bacilli such as E.coli. As a consequence, quinolone resistance has been increasing among this species in recent years. Bacterial resistance to quinolones usually results from mutations in the chromosomal genes which encode topoisomerases and also the expression of efflux pumps and loss of porines contributed to development of quinolone resistance. However, recent studies have shown that the spread and increase of quinolone resistance may be due to the transfer of plasmid-mediated genes. To date, three groups of plasmid-mediated quinolone resistance genes, namely qnr, aac(6')-Ib-cr, and qepA, have been described. The aim of this study was to investigate the presence of plasmid-mediated quinolone resistance genes in E.coli clinical isolates. A total of 112 quinolone-resistant E.coli strains isolated from different clinical specimens (84 urine, 16 blood, 10 wound, 2 bronchoalveolar lavage) of which 78 (69.6%) were extended-spectrum beta-lactamase (ESBL) positive, in Afyon Kocatepe University Hospital, Microbiology Laboratory were included in the study. In the isolates, qnrA, qnrB, qnrS, qnrC, qepA, and aac(6')-1b-cr plasmid genes were analysed by polymerase chain reaction (PCR). After aac(6')- 1b determinant was amplified by PCR, all aac(6')-1b positive amplicons were analyzed by digestion with BseGI restriction enzyme to identify aac(6')-1b-cr variant. It was found that, none of the strains horboured qnrA, qnrB, qnrS, qnrC and qepA genes, however, plasmid-mediated quinolone resistance gene aac(6')-1b-cr was found positive in 59.8% (67/112) of the strains. It was notable that 86.6% (58/67) of those isolates were ESBL producers. The rates of quinolone resistance among E.coli isolates infections were high in our region and an increasing trend has been observed in recent years. Our data indicated that the presence of plasmid- mediated resistance genes

  19. Novel restriction enzyme SSiI for the detection of mutation in GyrA gene of Salmonella enterica serovar Typhi

    Directory of Open Access Journals (Sweden)

    Agrawal Parul

    2010-07-01

    Full Text Available Aim: Enteric fever is an ongoing problem in the developing nations. Resistance and reduced susceptibility to ciprofloxacin narrows the therapeutic options in enteric fever. The present study was carried out with the objective of determining molecular basis of resistance to fluoroquinolone among the clinical isolates of Salmonella enterica serovar Typhi from different parts of India. Materials and Methods: A total of 60 S.Typhi clinical isolates were subjected to antimicrobial susceptibility testing and determination of minimum inhibitory concentration (MIC to ciprofloxacin and nalidixic acid. Polymerase chain reaction (PCR for GyrA gene followed by restriction fragment length polymorphism (RFLP with restriction enzyme (RE SSiI was performed to detect mutation at position Ser83. Further confirmation of mutation was done by nucleotide sequencing of GyrA gene. Results: Isolates showed 100% sensitivity to first-line drugs ampicillin, chloramphenicol, and cotrimoxazole. Twelve of the 60 isolates (18% were susceptible to nalidixic acid (NASST and the remaining 48 (82% were resistant to nalidixic acid (NARST. Of these 48 NARST strains, 46 (97.5% had reduced susceptibility to ciprofloxacin (MIC 0.25-1.0 μg/mL, whereas 2 strains (2.75% were resistant to ciprofloxacin (MIC 4.0 μg/mL. In RFLP analysis, all the NASST strains showed 3 fragments, whereas all the NARST strains showed 2 fragments due to the loss of 1 restriction site as a result of mutation. All the NARST strains with reduced susceptibility to ciprofloxacin (n = 46 had a single mutation in gyrA gene (Ser 83→Tyr or Ser 83→Phe, whereas double mutations (Ser 83→Phe and Asp 87→Asn were found in each of the 2 ciprofloxacin-resistant strains. None of the NASST strains (n = 12 revealed any mutation. Conclusion: Our study exemplifies the correlation between nalidixic acid screening test, MIC values, and the detection of mutation in GyrA gene by PCR-RFLP with a novel RE SSiI.This was further

  20. Chlamydial plasmids and bacteriophages.

    Science.gov (United States)

    Pawlikowska-Warych, Małgorzata; Śliwa-Dominiak, Joanna; Deptuła, Wiesław

    2015-01-01

    Chlamydia are absolute pathogens of humans and animals; despite being rather well recognised, they are still open for discovery. One such discovery is the occurrence of extrachromosomal carriers of genetic information. In prokaryotes, such carriers include plasmids and bacteriophages, which are present only among some Chlamydia species. Plasmids were found exclusively in Chlamydia (C.) trachomatis, C. psittaci, C. pneumoniae, C. suis, C. felis, C. muridarum and C. caviae. In prokaryotic organisms, plasmids usually code for genes that facilitate survival of the bacteria in the environment (although they are not essential). In chlamydia, their role has not been definitely recognised, apart from the fact that they participate in the synthesis of glycogen and encode proteins responsible for their virulence. Furthermore, in C. suis it was evidenced that the plasmid is integrated in a genomic island and contains the tetracycline-resistance gene. Bacteriophages specific for chlamydia (chlamydiaphages) were detected only in six species: C. psittaci, C. abortus, C. felis, C. caviae C. pecorum and C. pneumoniae. These chlamydiaphages cause inhibition of the developmental cycle, and delay transformation of reticulate bodies (RBs) into elementary bodies (EBs), thus reducing the possibility of infecting other cells in time. Plasmids and bacteriophages can be used in the diagnostics of chlamydioses; although especially in the case of plasmids, they are already used for detection of chlamydial infections. In addition, bacteriophages could be used as therapeutic agents to replace antibiotics, potentially addressing the problem of increasing antibiotic-resistance among chlamydia.

  1. Hexon based PCRs combined with restriction enzyme analysis for rapid detection and differentiation of fowl adenoviruses and egg drop syndrome virus.

    Science.gov (United States)

    Raue, R; Hess, M

    1998-08-01

    Three different polymerase chain reactions (PCRs), two of them combined with restriction enzyme analysis (REA), were developed for detection and differentiation of all 12 fowl adenovirus (FAV) serotypes and the egg drop syndrome (EDS) virus. For primer construction FAV1, FAV10 and EDS virus hexon proteins were aligned and conserved and variable regions were determined. Two primer sets (H1/H2 and H3/H4) for single use were constructed which hybridize in three conserved regions of hexon genes. Each primer pair amplifies approximately half of the hexon gene including two loop regions. An amplification product was detected with both primer sets using purified DNA from all FAV1-12 reference strains. Viral EDS DNA was negative using the H1/H2 or H3/H4 primer pair. HaeII digestion of the H1/H2 amplification products differentiates between all viruses except FAV4 and FAV5. In comparison, much more clustering among genomic closely related FAV serotypes was seen after HpaII digestion of the H3/H4 PCR products. Oligonucleotides H5/H6 located in the variable regions of EDS virus hexon gene do not detect any of the FAV serotypes. The PCRs and REA described are suitable to detect all avian adenoviruses infecting chickens, to distinguish all 12 FAV reference strains and to differentiate FAVs from the EDS virus.

  2. Sensitive and selective amplification of methylated DNA sequences using helper-dependent chain reaction in combination with a methylation-dependent restriction enzymes.

    Science.gov (United States)

    Rand, Keith N; Young, Graeme P; Ho, Thu; Molloy, Peter L

    2013-01-07

    We have developed a novel technique for specific amplification of rare methylated DNA fragments in a high background of unmethylated sequences that avoids the need of bisulphite conversion. The methylation-dependent restriction enzyme GlaI is used to selectively cut methylated DNA. Then targeted fragments are tagged using specially designed 'helper' oligonucleotides that are also used to maintain selection in subsequent amplification cycles in a process called 'helper-dependent chain reaction'. The process uses disabled primers called 'drivers' that can only prime on each cycle if the helpers recognize specific sequences within the target amplicon. In this way, selection for the sequence of interest is maintained throughout the amplification, preventing amplification of unwanted sequences. Here we show how the method can be applied to methylated Septin 9, a promising biomarker for early diagnosis of colorectal cancer. The GlaI digestion and subsequent amplification can all be done in a single tube. A detection sensitivity of 0.1% methylated DNA in a background of unmethylated DNA was achieved, which was similar to the well-established Heavy Methyl method that requires bisulphite-treated DNA.

  3. Negatively charged residues of the segment linking the enzyme and cytolysin moieties restrict the membrane-permeabilizing capacity of adenylate cyclase toxin

    Science.gov (United States)

    Masin, Jiri; Osickova, Adriana; Sukova, Anna; Fiser, Radovan; Halada, Petr; Bumba, Ladislav; Linhartova, Irena; Osicka, Radim; Sebo, Peter

    2016-01-01

    The whooping cough agent, Bordetella pertussis, secretes an adenylate cyclase toxin-hemolysin (CyaA) that plays a crucial role in host respiratory tract colonization. CyaA targets CR3-expressing cells and disrupts their bactericidal functions by delivering into their cytosol an adenylate cyclase enzyme that converts intracellular ATP to cAMP. In parallel, the hydrophobic domain of CyaA forms cation-selective pores that permeabilize cell membrane. The invasive AC and pore-forming domains of CyaA are linked by a segment that is unique in the RTX cytolysin family. We used mass spectrometry and circular dichroism to show that the linker segment forms α-helical structures that penetrate into lipid bilayer. Replacement of the positively charged arginine residues, proposed to be involved in target membrane destabilization by the linker segment, reduced the capacity of the toxin to translocate the AC domain across cell membrane. Substitutions of negatively charged residues then revealed that two clusters of negative charges within the linker segment control the size and the propensity of CyaA pore formation, thereby restricting the cell-permeabilizing capacity of CyaA. The ‘AC to Hly-linking segment’ thus appears to account for the smaller size and modest cell-permeabilizing capacity of CyaA pores, as compared to typical RTX hemolysins. PMID:27581058

  4. Use of Plasmon Coupling to Reveal the Dynamics of DNA Bending andCleavage by Single EcoRV Restriction Enzymes

    Energy Technology Data Exchange (ETDEWEB)

    Reinhard, Bjorn; Sheikholeslami, Sassan; Mastroianni, Alexander; Alivisatos, A. Paul; Liphardt, Jan

    2006-09-06

    Pairs of Au nanoparticles have recently been proposed asplasmon rulers based on the dependence of their light scattering on theinterparticle distance. Preliminary work has suggested that plasmonrulers can be used to measure and monitor dynamic distance changes overthe 1 to 100nm length scale in biology. Here, we substantiate thatplasmon rulers can be used to effectively measure dynamical biophysicalprocesses by applying the ruler to a system that has been investigatedextensively using ensemble kinetic measurements: the cleavage of DNA bythe restriction enzyme EcoRV. Temporal resolutions of up to 240 Hz wereobtained, and the end-to-end extension of up to 1000 individual dsDNAenzyme substrates could be monitored in parallel for hours. The singlemolecule cleavage trajectories acquired here agree well with valuesobtained in bulk through other methods, and confirm well-known featuresof the cleavage process, such as the fact that the DNA is bent prior tocleavage. New dynamical information is revealed as well, for instance,the degree of softening of the DNA just prior to cleavage. The unlimitedlife time, high temporal resolution, and high signal/noise make theplasmon ruler an excellent tool for studying macromolecular assembliesand conformational changes at the single molecule level.

  5. Effect of plasmid R391 and other IncJ plasmids on the survival of Escherichia coli after UV irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Pembroke, J.T.; Stevens, E. (University Coll., Galway (Ireland))

    1984-07-01

    The presence of the IncJ plasmids R391, R997, R705, R706, R748, and R749 was shown to sensitize Escherichia coli AB1157 and both its uvr A and lexA derivatives to UV irradiation. No alteration in post-irradiation survival was observed in a recA mutant containing these plasmids, compared with the non-plasmid-containing recA strain. Analysis of recombination frequency in Hfr crosses to recA/sup +/ cells containing plasmid R391 indicated a reduction in recombination frequency compared with that obtained in similar crosses to a non-plasmid-containing strain. This effect was not due to plasmid-encoded restriction or entry exclusion systems and therefore must be considered as a real block in recombination. When cells containing plasmid R391 were irradiated and allowed to photoreactivate, an increase in survival was observed which was comparable to that observed in the non-plasmid-containing derivative. This indicated that post-irradiation processing of UV-induced damage, or lack of such processing, by mechanisms other than photoreactivation was responsible for the UV sensitivity associated with plasmid R391.

  6. Transfer of plasmid-mediated ampicillin resistance from Haemophilus to Neisseria gonorrhoeae requires an intervening organism.

    Science.gov (United States)

    McNicol, P J; Albritton, W L; Ronald, A R

    1986-01-01

    Haemophilus species have been implicated as the source of plasmid-mediated ampicillin resistance in Neisseria gonorrhoeae. Previous attempts to transfer conjugally the resistance plasmids from Haemophilus species to N. gonorrhoeae have met with limited success. Using both biparental and triparental mating systems, it was found that transfer will occur if the commensal Neisseria species, Neisseria cinerea, is used as a transfer intermediate. This organism stably maintains resistance plasmids of Haemophilus and facilitates transfer of these plasmids to N. gonorrhoeae, in a triparental mating system, at a transfer frequency of 10(-8). Both Haemophilus ducreyi and N. gonorrhoeae carry mobilizing plasmids capable of mediating conjugal transfer of the same resistance plasmids. However, restriction endonuclease mapping and DNA hybridization studies indicate that the mobilizing plasmids are distinctly different molecules. Limited homology is present within the transfer region of these plasmids.

  7. Plasmids in Mycoplasma species isolated from goats and sheep and their preliminary typing

    Directory of Open Access Journals (Sweden)

    Nascimento Elmiro R.

    1999-01-01

    Full Text Available One-hundred-five (105 clinical isolates of mycoplasma from caprine origin and one isolate from ovine were surveyed for plasmids, which were present in thirty-three (31% of them. These mycoplasmas originated from 13 herds. Ten of them were symptomatic for mycoplasmal disease (mastitis, polyarthritis, septicemia and three herds were asymptomatic, i.e., clinically normal. Twenty-eight isolates were Mycoplasma mycoides subspecies mycoides LC (large colony or caprine biotype, four were Mycoplasma capricolum subsp. capricolum and one was Mycoplasma cottewii. The isolated plasmids were linearized by EcoRI, EcoRV, EcoRI and EcoRV or BamHI and EcoRV, and were of five sizes (1.1, 1.6, 1.7, 1.8, and 1.9 Kbp. Based on restriction enzyme digestion and size of the linearized supercoiled extrachromosomal DNA, five plasmid types were recovered (p1II, p2III, p2V, p3I, and p4IV. The small size of these DNA elements probably exclude replicative forms of DNA virus, which are equal or larger than 8.0 Kbp.

  8. The EcoKI Type I Restriction-Modification System in Escherichia coli Affects but Is Not an Absolute Barrier for Conjugation

    DEFF Research Database (Denmark)

    Roer, Louise; Aarestrup, Frank Møller; Hasman, Henrik

    2015-01-01

    results about restriction-modification systems based on phenotypic studies have been presented as reasons for a barrier to conjugation with and other means of uptake of exogenous DNA. In this study, we show that inactivation of the R.EcoKI restriction enzyme in strain Escherichia coli K-12 strain MG1655...... of the mutant recipient with a disrupted hsdR gene. This leads to the conclusion that EcoKI restriction-modification affects the uptake of DNA by conjugation but is not a major barrier to plasmid transfer....

  9. Mechanisms of plasmid segregation: have multicopy plasmids been overlooked?

    Science.gov (United States)

    Million-Weaver, Samuel; Camps, Manel

    2014-09-01

    Plasmids are self-replicating pieces of DNA typically bearing non-essential genes. Given that plasmids represent a metabolic burden to the host, mechanisms ensuring plasmid transmission to daughter cells are critical for their stable maintenance in the population. Here we review these mechanisms, focusing on two active partition strategies common to low-copy plasmids: par systems type I and type II. Both involve three components: an adaptor protein, a motor protein, and a centromere, which is a sequence area in the plasmid that is recognized by the adaptor protein. The centromere-bound adaptor nucleates polymerization of the motor, leading to filament formation, which can pull plasmids apart (par I) or push them towards opposite poles of the cell (par II). No such active partition mechanisms are known to occur in high copy number plasmids. In this case, vertical transmission is generally considered stochastic, due to the random distribution of plasmids in the cytoplasm. We discuss conceptual and experimental lines of evidence questioning the random distribution model and posit the existence of a mechanism for segregation in high copy number plasmids that moves plasmids to cell poles to facilitate transmission to daughter cells. This mechanism would involve chromosomally-encoded proteins and the plasmid origin of replication. Modulation of this proposed mechanism of segregation could provide new ways to enhance plasmid stability in the context of recombinant gene expression, which is limiting for large-scale protein production and for bioremediation.

  10. Plasmid-to-plasmid recombination in Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    Balganesh, M.; Setlow, J.K.

    1986-01-01

    No recombination between plasmids was observed after conjugal transfer of a plasmid into a cell carrying another plasmid. Two types of such recombination took place after transformation, one type being Rec/sup +/ dependent and suggesting a preferred site of recombination. The other much rarer type was at least partially Rec/sup +/ independent.

  11. Plasmid interference for curing antibiotic resistance plasmids in vivo.

    Science.gov (United States)

    Kamruzzaman, Muhammad; Shoma, Shereen; Thomas, Christopher M; Partridge, Sally R; Iredell, Jonathan R

    2017-01-01

    Antibiotic resistance increases the likelihood of death from infection by common pathogens such as Escherichia coli and Klebsiella pneumoniae in developed and developing countries alike. Most important modern antibiotic resistance genes spread between such species on self-transmissible (conjugative) plasmids. These plasmids are traditionally grouped on the basis of replicon incompatibility (Inc), which prevents coexistence of related plasmids in the same cell. These plasmids also use post-segregational killing ('addiction') systems, which poison any bacterial cells that lose the addictive plasmid, to guarantee their own survival. This study demonstrates that plasmid incompatibilities and addiction systems can be exploited to achieve the safe and complete eradication of antibiotic resistance from bacteria in vitro and in the mouse gut. Conjugative 'interference plasmids' were constructed by specifically deleting toxin and antibiotic resistance genes from target plasmids. These interference plasmids efficiently cured the corresponding antibiotic resistant target plasmid from different Enterobacteriaceae in vitro and restored antibiotic susceptibility in vivo to all bacterial populations into which plasmid-mediated resistance had spread. This approach might allow eradication of emergent or established populations of resistance plasmids in individuals at risk of severe sepsis, enabling subsequent use of less toxic and/or more effective antibiotics than would otherwise be possible, if sepsis develops. The generalisability of this approach and its potential applications in bioremediation of animal and environmental microbiomes should now be systematically explored.

  12. Molecular cloning with bifunctional plasmid vectors in Bacillus subtilis: isolation of a spontaneous mutant of Bacillus subtilis with enhanced transformability for Escherichia coli-propagated chimeric plasmid DNA.

    OpenAIRE

    Ostroff, G. R.; Pène, J. J.

    1983-01-01

    Hybrid plasmid DNA cloned in Escherichia coli undergoes deletions when returned to competent Bacillus subtilis, even in defined restriction and modification mutants of strain 168. We have isolated a mutant of B. subtilis MI112 which is stably transformed at high frequency by chimeric plasmid DNA propagated in E. coli.

  13. Bacillus stearothermophilus contains a plasmid-borne gene for alpha-amylase.

    Science.gov (United States)

    Mielenz, J R

    1983-01-01

    The gene for thermostable alpha-amylase from the thermophilic bacterium Bacillus stearothermophilus has been cloned and expressed in Escherichia coli. Each alpha-amylase-producing colony contained at least a 9.7-kilobase-pair (kb) chimeric plasmid composed of the vector pBR322 and a common 5.4-kb HindIII fragment of DNA. B. stearothermophilus contains four plasmids with sizes from 12 kb to over 108 kb. Restriction endonuclease analysis of these naturally occurring plasmids showed they also contain a 5.4-kb HindIII fragment of DNA. Cloning experiments with the four plasmids yielded alpha-amylase-producing E. coli that contained the same 9.7-kb chimeric plasmid. Restriction endonuclease analysis and further recombinant DNA experiments identified a 26-kb plasmid that contains the gene for alpha-amylase. A spontaneous mutant of B. stearothermophilus unable to produce alpha-amylase was missing the 26-kb plasmid but contained a 20-kb plasmid. A 6-kb deletion within the region of the 5.4-kb HindIII fragment yielded the 20-kb plasmid unable to code for alpha-amylase. A nick-translated probe for the alpha-amylase coding region did not hybridize to either plasmid or total cellular DNA from this mutant strain of B. stearothermophilus. These results demonstrate the gene for alpha-amylase is located exclusively on a 26-kb plasmid in B. stearothermophilus with no genetic counterpart present on the chromosome. Images PMID:6193526

  14. High-resolution genetic analysis of the requirements for horizontal transmission of the ESBL plasmid from Escherichia coli O104:H4.

    Science.gov (United States)

    Yamaichi, Yoshiharu; Chao, Michael C; Sasabe, Jumpei; Clark, Lars; Davis, Brigid M; Yamamoto, Nozomi; Mori, Hiroshi; Kurokawa, Ken; Waldor, Matthew K

    2015-01-01

    Horizontal dissemination of the genes encoding extended spectrum beta-lactamases (ESBLs) via conjugative plasmids is facilitating the increasingly widespread resistance of pathogens to beta-lactam antibiotics. However, there is relatively little known about the regulatory factors and mechanisms that govern the spread of these plasmids. Here, we carried out a high-throughput, transposon insertion site sequencing analysis (TnSeq) to identify genes that enable the maintenance and transmission of pESBL, an R64 (IncI1)-related resistance plasmid that was isolated from Escherichia coli O104:H4 linked to a recent large outbreak of gastroenteritis. With a few exceptions, the majority of the genes identified as required for maintenance and transmission of pESBL matched those of their previously defined R64 counterparts. However, our analyses of the high-density transposon insertion library in pESBL also revealed two very short and linked regions that constitute a previously unrecognized regulatory system controlling spread of IncI1 plasmids. In addition, we investigated the function of the pESBL-encoded M.EcoGIX methyltransferase, which is also encoded by many other IncI1 and IncF plasmids. This enzyme proved to protect pESBL from restriction in new hosts, suggesting it aids in expanding the plasmid's host range. Collectively, our work illustrates the power of the TnSeq approach to enable rapid and comprehensive analyses of plasmid genes and sequences that facilitate the dissemination of determinants of antibiotic resistance.

  15. Plasmid interference for curing antibiotic resistance plasmids in vivo

    Science.gov (United States)

    Kamruzzaman, Muhammad; Shoma, Shereen; Thomas, Christopher M.; Partridge, Sally R.

    2017-01-01

    Antibiotic resistance increases the likelihood of death from infection by common pathogens such as Escherichia coli and Klebsiella pneumoniae in developed and developing countries alike. Most important modern antibiotic resistance genes spread between such species on self-transmissible (conjugative) plasmids. These plasmids are traditionally grouped on the basis of replicon incompatibility (Inc), which prevents coexistence of related plasmids in the same cell. These plasmids also use post-segregational killing (‘addiction’) systems, which poison any bacterial cells that lose the addictive plasmid, to guarantee their own survival. This study demonstrates that plasmid incompatibilities and addiction systems can be exploited to achieve the safe and complete eradication of antibiotic resistance from bacteria in vitro and in the mouse gut. Conjugative ‘interference plasmids’ were constructed by specifically deleting toxin and antibiotic resistance genes from target plasmids. These interference plasmids efficiently cured the corresponding antibiotic resistant target plasmid from different Enterobacteriaceae in vitro and restored antibiotic susceptibility in vivo to all bacterial populations into which plasmid-mediated resistance had spread. This approach might allow eradication of emergent or established populations of resistance plasmids in individuals at risk of severe sepsis, enabling subsequent use of less toxic and/or more effective antibiotics than would otherwise be possible, if sepsis develops. The generalisability of this approach and its potential applications in bioremediation of animal and environmental microbiomes should now be systematically explored. PMID:28245276

  16. Brazilian purpuric fever caused by Haemophilus influenzae biogroup aegyptius strains lacking the 3031 plasmid.

    Science.gov (United States)

    Tondella, M L; Quinn, F D; Perkins, B A

    1995-01-01

    Brazilian purpuric fever (BPF) is a life-threatening pediatric infection caused by Haemophilus influenzae biogroup aegyptius (Hae), an organism formerly associated with only self-limited purulent conjunctivitis. Strains of Hae causing BPF have a 24-MDa plasmid with a specific AccI restriction pattern designated 3031. This plasmid was thought to code for a virulence factor because it had been detected only among Hae strains isolated from BPF cases or their contacts. From 3 typical BPF cases recently identified in São Paulo State, sterile-site Hae isolates were obtained; these isolates were similar to earlier BPF-associated Hae except they did not possess a 3031 plasmid. HindIII restricted chromosomal DNA from these strains was probed with purified 3031 plasmid DNA under high-stringency conditions. There was no evidence that 3031 plasmid DNA had become chromosomally integrated. It appears that the 3031 plasmid does not code for BPF-specific virulence factors.

  17. Differential regulation of renal angiotensin-converting enzyme (ACE) and ACE2 during ACE inhibition and dietary sodium restriction in healthy rats

    NARCIS (Netherlands)

    Hamming, I.; van Goor, H.; Turner, A. J.; Rushworth, C. A.; Michaud, A. A.; Corvol, P.; Navis, G.

    2008-01-01

    Angiotensin-converting enzyme (ACE) 2 is thought to counterbalance ACE by breakdown of angiotensin (Ang) II and formation of Ang(1-7). Both enzymes are highly expressed in the kidney, but reports on their regulation differ. To enhance our understanding of the regulation of renal ACE and ACE2, we inv

  18. Sodium restriction potentiates the renoprotective effects of combined vitamin D receptor activation and angiotensin-converting enzyme inhibition in established proteinuric nephropathy

    NARCIS (Netherlands)

    Mirkovic, Katarina; Frenay, Anne-Roos S; van den Born, Jacob; van Goor, Harry; Navis, Gerjan; de Borst, Martin H

    2015-01-01

    BACKGROUND: Renin-angiotensin-aldosterone system (RAAS) blockade provides renoprotective effects in chronic kidney disease (CKD); yet progressive renal function loss remains common. Dietary sodium restriction potentiates the renoprotective effects of RAAS blockade. Vitamin D receptor activator (VDRA

  19. Plasmid profile and pulsed-field gel electrophoresis analysis of Salmonella enterica isolates from humans in Turkey.

    Directory of Open Access Journals (Sweden)

    Kerem Ozdemir

    Full Text Available This study was conducted for typing Salmonella enterica subspecies enterica strains in Turkey using pulsed-field gel electrophoresis (PFGE and plasmid DNA profile analysis. Fourty-two strains were isolated from clinical samples obtained from unrelated patients with acute diarrhea. The samples were collected from state hospitals and public health laboratories located at seven provinces in different regions of Turkey at different times between 2004 and 2010. The strains were determined to belong to 4 different serovars. The Salmonella enterica strains belonged to the serovars Salmonella Enteritidis (n = 23, Salmonella Infantis (n = 14, Salmonella Munchen (n = 2, and Salmonella Typhi (n = 3. Forty-two Salmonella enterica strains were typed with PFGE methods using XbaI restriction enzyme and plasmid analysis. At the end of typing, 11 different PFGE band profiles were obtained. Four different PFGE profiles (type 1, 4, 9, and 10 were found among serotype S. Enteritidis species, 3 different PFGE profiles (type 3, 5, 6 were found among S. Infantis species, 2 different PFGE profiles were found among S. Typhi species (type 2 and 11, and 2 different PFGE profiles were found among S. Munchen species (type 7, 8. The UPGMA dendrogram was built on the PFGE profiles. In this study, it was determined that 4 strains of 42 Salmonella enterica strains possess no plasmid, while the isolates have 1-3 plasmids ranging from 5.0 to 150 kb and making 12 different plasmid profiles (P1-P12. In this study, we have applied the analysis of the PFGE patterns and used bioinformatics methods to identify both inter and intra serotype relationships of 4 frequently encountered serotypes for the first time in Turkey.

  20. Characterization of a unique methyl-specific restriction system in Streptomyces avermitilis.

    OpenAIRE

    1988-01-01

    Streptomyces avermitilis contains a unique restriction system that restricts plasmid DNA containing N6-methyladenine or 5-methylcytosine. Shuttle vectors isolated from Escherichia coli RR1 or plasmids isolated from modification-proficient Streptomyces spp. cannot be directly introduced into S. avermitilis. This restriction barrier can be overcome by first transferring plasmids into Streptomyces lividans or a modification-deficient E. coli strain and then into S. avermitilis. The transformatio...

  1. Persistence Mechanisms of Conjugative Plasmids

    DEFF Research Database (Denmark)

    Bahl, Martin Iain; Hansen, Lars H.; Sørensen, Søren Johannes

    2009-01-01

    Are plasmids selfish parasitic DNA molecules or an integrated part of the bacterial genome? This chapter reviews the current understanding of the persistence mechanisms of conjugative plasmids harbored by bacterial cells and populations. The diversity and intricacy of mechanisms affecting...... the successful propagation and long-term continued existence of these extra-chromosomal elements is extensive. Apart from the accessory genetic elements that may provide plasmid-harboring cells a selective advantage, special focus is placed on the mechanisms conjugative plasmids employ to ensure their stable...... maintenance in the host cell. These importantly include the ability to self-mobilize in a process termed conjugative transfer, which may occur across species barriers. Other plasmid stabilizing mechanisms include the multimer resolution system, active partitioning, and post-segregational-killing of plasmid...

  2. Toxin Plasmids of Clostridium perfringens

    Science.gov (United States)

    Li, Jihong; Adams, Vicki; Bannam, Trudi L.; Miyamoto, Kazuaki; Garcia, Jorge P.; Uzal, Francisco A.; Rood, Julian I.

    2013-01-01

    SUMMARY In both humans and animals, Clostridium perfringens is an important cause of histotoxic infections and diseases originating in the intestines, such as enteritis and enterotoxemia. The virulence of this Gram-positive, anaerobic bacterium is heavily dependent upon its prolific toxin-producing ability. Many of the ∼16 toxins produced by C. perfringens are encoded by large plasmids that range in size from ∼45 kb to ∼140 kb. These plasmid-encoded toxins are often closely associated with mobile elements. A C. perfringens strain can carry up to three different toxin plasmids, with a single plasmid carrying up to three distinct toxin genes. Molecular Koch's postulate analyses have established the importance of several plasmid-encoded toxins when C. perfringens disease strains cause enteritis or enterotoxemias. Many toxin plasmids are closely related, suggesting a common evolutionary origin. In particular, most toxin plasmids and some antibiotic resistance plasmids of C. perfringens share an ∼35-kb region containing a Tn916-related conjugation locus named tcp (transfer of clostridial plasmids). This tcp locus can mediate highly efficient conjugative transfer of these toxin or resistance plasmids. For example, conjugative transfer of a toxin plasmid from an infecting strain to C. perfringens normal intestinal flora strains may help to amplify and prolong an infection. Therefore, the presence of toxin genes on conjugative plasmids, particularly in association with insertion sequences that may mobilize these toxin genes, likely provides C. perfringens with considerable virulence plasticity and adaptability when it causes diseases originating in the gastrointestinal tract. PMID:23699255

  3. High-throughput plasmid construction using homologous recombination in yeast: its mechanisms and application to protein production for X-ray crystallography.

    Science.gov (United States)

    Mizutani, Kimihiko

    2015-01-01

    Homologous recombination is a system for repairing the broken genomes of living organisms by connecting two DNA strands at their homologous sequences. Today, homologous recombination in yeast is used for plasmid construction as a substitute for traditional methods using restriction enzymes and ligases. This method has various advantages over the traditional method, including flexibility in the position of DNA insertion and ease of manipulation. Recently, the author of this review reported the construction of plasmids by homologous recombination in the methanol-utilizing yeast Pichia pastoris, which is known to be an excellent expression host for secretory proteins and membrane proteins. The method enabled high-throughput construction of expression systems of proteins using P. pastoris; the constructed expression systems were used to investigate the expression conditions of membrane proteins and to perform X-ray crystallography of secretory proteins. This review discusses the mechanisms and applications of homologous recombination, including the production of proteins for X-ray crystallography.

  4. Isolation of T—DNA flanking plant DNA from T—DNA insertional embryo—lethal mutants of Arabidopsis thaliana by plasmid rescue technique

    Institute of Scientific and Technical Information of China (English)

    YAOXIAOLI; JIANGESUN; 等

    1996-01-01

    Three T-DNA insertional embryonic lethal mutants from NASC(The Nottingham Arabidopsis Stock Center) were first checked with their segregation ratio of abortive and normal seeds and the copy number of T-DNA insertion.The N4081 mutant has a segregation ratio of 1:3.04 in average and one T-DNA insertion site according to our assay.It was therefore chosen for further analysis.To isolate the joint fragment of T-DNA and plant DNA,the plasmid rescue technique was used.pEL-7,one of plasmids from left border of T-DNA,which contained pBR322 was selected from ampicillin plate.The T-DNA fragment of pEL-7 was checked by restriction enzyme analysis and Southern Blot.Restriction analysis confirmed the presence of known sites of EcoRI,PstI and PvuII on it.For confirming the presence of flanking plant DNA in this plasmid,pEL-7 DNA was labeled and hybridized with wild type and mutant plant DNA.The Southern Blot indicated the hybridization band in both of them.Furthermore,the junction of T-DNA/plant DNA was subcloned into bluescript SK+ and sequenced by Applied Biosystem 373A sequencer.The results showed the 822 bp fragment contained a 274 bp sequence,which is 99.6%homolog(273bp/274bp) to Ti plasmid pTi 15955,DNA.The bp of left 25 bp border repeat were also found in the juction of T-DNA and Plant DNA. Taken together,pEL-7 should coutain a joint fragment of T-DNA and flanking plant DNA.This plasmid DNA could be used for the isolation of plant gene,which will be helpful to elucidate the relationship between gene function and plant embryo development.

  5. Construction of Recombinant Plasmid Containing S. Mutans F-ATPase β Subunit Gene

    Institute of Scientific and Technical Information of China (English)

    YU Dan-ni; JIANG Li

    2005-01-01

    objective: construct a homologous recombinant plasmid which was expected to be transformed into S. mutans Methods: a region at the 5' terminus of the S. mutans F-ATPase β subunit gene was amplified by PCR, the PCR product was inserted into vector pVA891, yielding recombinant plasmid. Results: the DNA sequence of the recombinant plasmid was identified correct in whole by restriction endonuclease and DNA sequence techniques. Conclusion: the recombinant plasmid of S. mutans DNA was cloned in effect ,it may assist in construction of homologues recombinant mutant.

  6. Use of multiplex PCR and PCR restriction enzyme analysis for detection and exploration of the variability in the free-living amoeba Naegleria in the environment.

    Science.gov (United States)

    Pélandakis, Michel; Pernin, Pierre

    2002-04-01

    A multiplex PCR was developed to simultaneously detect Naegleria fowleri and other Naegleria species in the environment. Multiplex PCR was also capable of identifying N. fowleri isolates with internal transcribed spacers of different sizes. In addition, restriction fragment length polymorphism analysis of the PCR product distinguished the main thermophilic Naegleria species from the sampling sites.

  7. Differences among Helicobacter pylori strains isolated from three different populations and demonstrated by restriction enzyme analysis of an internal fragment of the conserved gene hpaA.

    Science.gov (United States)

    Evans, D G; Queiroz, D M; Mendes, E N; Svennerholm, A M; Evans, D J

    1999-06-01

    Our goal was to test the idea that Helicobacter pylori genotypes vary from one population to another. Analysis of Sau3A and HinfI restriction fragment-length polymorphism (RFLP) in a 375-bp polymerase chain reaction amplicon of hpaA was used to compare 31 H. pylori isolates from a relatively small and genetically homogeneous population (Goteborg, Sweden) with those of large, genetically heterogeneous populations located in two different countries (50 isolates from Houston, TX, and 69 isolates from Minas Gerais, a state in the southeastern region of Brazil). Five different Sau3A and three different HinfI restriction patterns were found; different combinations of these comprise 10 different RFLP types, I through X. The RFLP types found in the United States and Brazil collections were very similar, except for two Brazil isolates belonging to type VIII and five Brazil isolates belonging to type X, neither type found in the United States. The overall profile of H. pylori isolates from Sweden was remarkably different, with 18 of 31 (58%) having a new Sau3A restriction pattern, termed gS; 10 of these 18 isolates had HinfI restriction pattern E (RFLP type VIII), and 8 had HinfI restriction pattern F (RFLP type IX). No isolates from Sweden belonged to RFLP type III or type X. RFLP typing of a 375-bp polymerase chain reaction-amplified DNA fragment of H. pylori hpaA revealed that H. pylori genotypes can and do vary from one population to another. We conclude that the unique RFLP profile shown by the group of H. pylori isolates from Goteborg is the result of a cohort effect in this relatively small, stable, genetically homogeneous population. Also, the overall similarity between RFLP profiles of the H. pylori isolates from Texas and Minas Gerais coincides with the fact that although geographically distanced, these populations are similar in being large, dynamic, and genetically heterogeneous.

  8. Cloning of 1183 bp Fragment from Rhoptry Protein I (ROPI Gene of Toxoplasma gondii (RH in Expression Prokaryote Plasmid PET32a

    Directory of Open Access Journals (Sweden)

    Zahra Eslamirad

    2013-10-01

    Full Text Available Background: Toxoplasma gondii is an obligatory intracellular protozoan. Considering to high prevalence of this disease the best way to reduce the raised loses is prevention of human and animal infection, rapid diagnosis, differentiation between acute and chronic disease. Rhoptry protein 1 of Toxoplasma gondii is an excretory-secretory antigen that exists in the most stages of life cycle. According to specifications of excretory-secretory antigen that seems this antigen is a suitable candidate to produce recombinant vaccine and diagnostic kit. The main object of the present work was cloning rhoptry protein 1 (ROP1 gene of Toxoplasma gondii (RH in a cloning vector for further production of rhoptry proteins.Materials and Methods: Genomic DNA was extracted by phenol-chloroform method. The ROP1 fragment was amplified by PCR. This product was approved by sequencing and was cloned between the EcoR1 and Sal1 sites of the pTZ57R/T vector. Then transformed into Escherichia coli DH5α strain and screened by IPTG and X-Gal. After isolating of this gene from pTZ57R/T, it was subcloned into pET32a plasmid.Results: The plasmid was purified and approved by electrophoresis, enzyme restriction and PCR. After isolating of this gene from pTZ57R/T, it was subcloned into pET32a plasmid. After enzyme restriction and electrophoresis a fragment about 1183bp was separated from pET32a.Conclusion: Recombinant plasmid of ROP1 gene was constructed and ready for future study. That seems the antigen is a suitable candidate to produce recombinant vaccine and diagnostic kit.

  9. Conjugative plasmids of Neisseria gonorrhoeae.

    Directory of Open Access Journals (Sweden)

    Emilia Pachulec

    Full Text Available Many clinical isolates of the human pathogen Neisseria gonorrhoeae contain conjugative plasmids. The host range of these plasmids is limited to Neisseria species, but presence of a tetracycline (tetM determinant inserted in several of these plasmids is an important cause of the rapid spread of tetracycline resistance. Previously plasmids with different backbones (Dutch and American type backbones and with and without different tetM determinants (Dutch and American type tetM determinants have been identified. Within the isolates tested, all plasmids with American or Dutch type tetM determinants contained a Dutch type plasmid backbone. This demonstrated that tetM determinants should not be used to differentiate between conjugal plasmid backbones. The nucleotide sequences of conjugative plasmids with Dutch type plasmid backbones either not containing the tetM determinant (pEP5233 or containing Dutch (pEP5289 or American (pEP5050 type tetM determinants were determined. Analysis of the backbone sequences showed that they belong to a novel IncP1 subfamily divergent from the IncP1alpha, beta, gamma, delta and epsilon subfamilies. The tetM determinants were inserted in a genetic load region found in all these plasmids. Insertion was accompanied by the insertion of a gene with an unknown function, and rearrangement of a toxin/antitoxin gene cluster. The genetic load region contains two toxin/antitoxins of the Zeta/Epsilon toxin/antitoxin family previously only found in Gram positive organisms and the virulence associated protein D of the VapD/VapX toxin/antitoxin family. Remarkably, presence of VapX of pJD1, a small cryptic neisserial plasmid, in the acceptor strain strongly increased the conjugation efficiency, suggesting that it functions as an antitoxin for the conjugative plasmid. The presence of the toxin and antitoxin on different plasmids might explain why the host range of this IncP1 plasmid is limited to Neisseria species. The isolated plasmids

  10. Construction and identification of eukaryotic eukaryotic expression plasmid pcdna3.1-bace and its transient expression in cells

    Institute of Scientific and Technical Information of China (English)

    Huilin Gong; Guanjun Zhang; Weijiang Dong

    2006-01-01

    Objective: To generate eukaryotic expression vector of pcDNA3.1-BACE and obtain its transient expression in COS-7 cells and high expression in the neuroblastoma SK-N-SH cells. Methods: A 1503 bp cDNA fragment was amplified from the total RNA of human neuroblastoma by RT-PCR method and cloned into plasmid pcDNA3.1. The vector was identified by digestion with restriction enzymes BamHI and XhoI and sequenced by Sanger-dideoxy-mediated chain termination. The expression of BACE gene was detected by immunocytochemistry method. Results: The results showed that the cDNAfragment included 1503 bp total coding region. The recombinant eukaryotic cell expression vector of pcDNA3.1-BACE was constructed successfully,and the sequence of insert was identical to the published sequence. The COS-7 cells and the neuroblastoma SK-N-SH cells transfected with the pcDNA3.1-BACE plasmid expressed high level of BACE protein in cytoplasm. Conclusion: The recombinant plasmid pcDNA3.1-BACE can provide very useful tool for researching the reason of Alzheimer's disease and lays the important foundation for preventing the AD laterly.

  11. GROWTH HORMONE GENE GENOTYPING BY Msp I RESTRICTION ENZYME AND PCR-RFLP METHODS IN ACEH CATTLE BREED AT INDRAPURI DISTRICT OF ACEH PROVINCE

    Directory of Open Access Journals (Sweden)

    W.P.B. Putra

    2014-10-01

    Full Text Available The objective of this research was to identify growth hormone (GH genes genotype in selectedAceh cattle at Indrapuri’s Breeding and Forage Centre (IBFC of Aceh Cattle. Fourty one cattleconsisting of 21 male and 20 female cattle were used in this study. The genomic DNA was extractedfrom blood using Sambrook et al. (1989 methods. Polymerase Chain Reaction - Restriction FragmentLength Polymorphism (PCR-RFLP and mehod of sequencing was used to detect MspI site on GH gene.Based on sequencing results, it can be concluded that all cattle were monomorphism. The frequency ofTT genotype were 1.00 and same as T allele frequency. The transition of C (cytosine into T (thymineon 1548 bp caused the lost of restriction site.

  12. Phenotypic plasticity in bacterial plasmids.

    Science.gov (United States)

    Turner, Paul E

    2004-01-01

    Plasmid pB15 was previously shown to evolve increased horizontal (infectious) transfer at the expense of reduced vertical (intergenerational) transfer and vice versa, a key trade-off assumed in theories of parasite virulence. Whereas the models predict that susceptible host abundance should determine which mode of transfer is selectively favored, host density failed to mediate the trade-off in pB15. One possibility is that the plasmid's transfer deviates from the assumption that horizontal spread (conjugation) occurs in direct proportion to cell density. I tested this hypothesis using Escherichia coli/pB15 associations in laboratory serial culture. Contrary to most models of plasmid transfer kinetics, my data show that pB15 invades static (nonshaking) bacterial cultures only at intermediate densities. The results can be explained by phenotypic plasticity in traits governing plasmid transfer. As cells become more numerous, the plasmid's conjugative transfer unexpectedly declines, while the trade-off between transmission routes causes vertical transfer to increase. Thus, at intermediate densities the plasmid's horizontal transfer can offset selection against plasmid-bearing cells, but at high densities pB15 conjugates so poorly that it cannot invade. I discuss adaptive vs. nonadaptive causes for the phenotypic plasticity, as well as potential mechanisms that may lead to complex transfer dynamics of plasmids in liquid environments. PMID:15166133

  13. Plasmid Rolling-Circle Replication.

    Science.gov (United States)

    Ruiz-Masó, J A; MachóN, C; Bordanaba-Ruiseco, L; Espinosa, M; Coll, M; Del Solar, G

    2015-02-01

    Plasmids are DNA entities that undergo controlled replication independent of the chromosomal DNA, a crucial step that guarantees the prevalence of the plasmid in its host. DNA replication has to cope with the incapacity of the DNA polymerases to start de novo DNA synthesis, and different replication mechanisms offer diverse solutions to this problem. Rolling-circle replication (RCR) is a mechanism adopted by certain plasmids, among other genetic elements, that represents one of the simplest initiation strategies, that is, the nicking by a replication initiator protein on one parental strand to generate the primer for leading-strand initiation and a single priming site for lagging-strand synthesis. All RCR plasmid genomes consist of a number of basic elements: leading strand initiation and control, lagging strand origin, phenotypic determinants, and mobilization, generally in that order of frequency. RCR has been mainly characterized in Gram-positive bacterial plasmids, although it has also been described in Gram-negative bacterial or archaeal plasmids. Here we aim to provide an overview of the RCR plasmids' lifestyle, with emphasis on their characteristic traits, promiscuity, stability, utility as vectors, etc. While RCR is one of the best-characterized plasmid replication mechanisms, there are still many questions left unanswered, which will be pointed out along the way in this review.

  14. Strategies and approaches in plasmidome studies—uncovering plasmid diversity disregarding of linear elements?

    Science.gov (United States)

    Dib, Julián R.; Wagenknecht, Martin; Farías, María E.; Meinhardt, Friedhelm

    2015-01-01

    The term plasmid was originally coined for circular, extrachromosomal genetic elements. Today, plasmids are widely recognized not only as important factors facilitating genome restructuring but also as vehicles for the dissemination of beneficial characters within bacterial communities. Plasmid diversity has been uncovered by means of culture-dependent or -independent approaches, such as endogenous or exogenous plasmid isolation as well as PCR-based detection or transposon-aided capture, respectively. High-throughput-sequencing made possible to cover total plasmid populations in a given environment, i.e., the plasmidome, and allowed to address the quality and significance of self-replicating genetic elements. Since such efforts were and still are rather restricted to circular molecules, here we put equal emphasis on the linear plasmids which—despite their frequent occurrence in a large number of bacteria—are largely neglected in prevalent plasmidome conceptions. PMID:26074886

  15. Repercussions of DNA tracking by the type IC restriction endonuclease EcoR124I on linear, circular and catenated substrates.

    OpenAIRE

    Szczelkun, M.D.; Dillingham, M. S.; Janscak, P; Firman, K; Halford, S.E.

    1996-01-01

    Type I restriction endonucleases such as EcoR124I cleave DNA at undefined loci, distant from their recognition sequences, by a mechanism that involves the enzyme tracking along the DNA between recognition and cleavage sites. This mechanism was examined on plasmids that carried recognition sites for EcoR124I and recombination sites for resolvase, the latter to create DNA catenanes. Supercoiled substrates with either one or two restriction sites were linearized by EcoR124I at similar rates, alt...

  16. Conjugation efficiency depends on intra and intercellular interactions between distinct plasmids: Plasmids promote the immigration of other plasmids but repress co-colonizing plasmids.

    Science.gov (United States)

    Gama, João Alves; Zilhão, Rita; Dionisio, Francisco

    2017-08-24

    Conjugative plasmids encode the genes responsible for the synthesis of conjugative pili and plasmid transfer. Expression of the conjugative machinery (including conjugative pili) may be costly to bacteria, not only due to the energetic/metabolic cost associated with their expression but also because they serve as receptors for certain viruses. Consequently, the presence of two plasmids in the same cell may be disadvantageous to each plasmid, because they may impose a higher fitness cost on the host. Therefore, plasmids may encode mechanisms to cope with co-resident plasmids. Moreover, it is possible that the transfer rate of a plasmid is affected by the presence of a distinct plasmid in the recipient cell. In this work, we measured transfer rates of twelve natural plasmids belonging to seven incompatibility groups in three situations, namely when: (i) donor cells contain a plasmid and recipient cells are plasmid-free; (ii) donor cells contain two unrelated plasmids and recipient cells are plasmid-free; and (iii) half of the cells contain a given plasmid and the other half contain another, unrelated, plasmid. In the third situation, recipient cells of a plasmid are the donor cells of the other plasmid. We show that there are more negative interactions (reduction of a plasmid's conjugative efficiency) between plasmids if they reside in the same cell than if they reside in different cells. However, if plasmids interacted intercellularly, the transfer rate of one of the plasmids was often higher (when the unrelated conjugative plasmid was present in the recipient cell) than if the recipient cell was plasmid-free - a positive effect. Experimental data retrieved from the study of mutant plasmids not expressing conjugative pili on the cell surface suggest that positive effects result from a higher efficiency of mating pair formation. Overall, our results suggest that negative interactions are significantly more frequent when plasmids occupy the same cell. Such

  17. New and Redesigned pRS Plasmid Shuttle Vectors for Genetic Manipulation of Saccharomycescerevisiae.

    Science.gov (United States)

    Chee, Mark K; Haase, Steven B

    2012-05-01

    We have constructed a set of 42 plasmid shuttle vectors based on the widely used pRS series for use in the budding yeast Saccharomyces cerevisiae and the bacterium Escherichia coli. This set of pRSII plasmids includes new shuttle vectors that can be used with histidine and adenine auxotrophic laboratory yeast strains carrying mutations in the genes HIS2 and ADE1, respectively. Our pRSII plasmids also include updated versions of commonly used pRS plasmids from which common restriction sites that occur within their yeast-selectable biosynthetic marker genes have been removed to increase the availability of unique restriction sites within their polylinker regions. Hence, our pRSII plasmids are a complete set of integrating, centromere and 2μ episomal plasmids with the biosynthetic marker genes ADE2, HIS3, TRP1, LEU2, URA3, HIS2, and ADE1 and a standardized selection of at least 16 unique restriction sites in their polylinkers. Additionally, we have expanded the range of drug selection options that can be used for PCR-mediated homologous replacement using pRS plasmid templates by replacing the G418-resistance kanMX4 cassette of pRS400 with MX4 cassettes encoding resistance to phleomycin, hygromycin B, nourseothricin, and bialaphos. Finally, in the process of generating the new plasmids, we have determined several errors in existing publicly available sequences for several commonly used yeast plasmids. Using our updated sequences, we constructed pRS plasmid backbones with a unique restriction site for inserting new markers to facilitate future expansion of the pRS series.

  18. Conservation of plasmids among Escherichia coli K1 isolates of diverse origins.

    Science.gov (United States)

    Mercer, A A; Morelli, G; Heuzenroeder, M; Kamke, M; Achtman, M

    1984-12-01

    Escherichia coli K1 isolates of various O types were previously assigned to different clonal groups. Members of the two clones defined by membrane pattern 9 (MP9) and serotypes O18:K1 and O1:K1 had been found to be very similar to each other. The plasmid contents of these bacteria confirmed this conclusion. Both groups carried a self-transmissible plasmid of the FI incompatibility group that coded for colicin production and a major outer membrane protein called the plasmid-coded protein (PCP). The size of this plasmid varied from 76 to 96 megadaltons, but restriction endonuclease digestion and DNA heteroduplex analysis revealed that these plasmids were highly related. O18:K1 bacteria of MP6 had previously been determined to represent a subclone, related to but different from O18:K1 MP9 bacteria. These MP6 bacteria carried a different, smaller IncFI plasmid which did not code for colicin production or the PCP protein. This smaller plasmid was primarily related to the larger plasmid within the regions of DNA encoding incompatibility, replication, and conjugation. O1:K1 bacteria of MP5 contained other unrelated plasmids in agreement with the previous conclusion that they are unrelated to O1:K1 bacteria of MP9. The bacteria examined had been isolated from two continents over a time span of 38 years, and the results attest to conservative inheritance of plasmids within bacteria of common descent.

  19. Conservation of plasmids among Escherichia coli K1 isolates of diverse origins.

    Science.gov (United States)

    Mercer, A A; Morelli, G; Heuzenroeder, M; Kamke, M; Achtman, M

    1984-01-01

    Escherichia coli K1 isolates of various O types were previously assigned to different clonal groups. Members of the two clones defined by membrane pattern 9 (MP9) and serotypes O18:K1 and O1:K1 had been found to be very similar to each other. The plasmid contents of these bacteria confirmed this conclusion. Both groups carried a self-transmissible plasmid of the FI incompatibility group that coded for colicin production and a major outer membrane protein called the plasmid-coded protein (PCP). The size of this plasmid varied from 76 to 96 megadaltons, but restriction endonuclease digestion and DNA heteroduplex analysis revealed that these plasmids were highly related. O18:K1 bacteria of MP6 had previously been determined to represent a subclone, related to but different from O18:K1 MP9 bacteria. These MP6 bacteria carried a different, smaller IncFI plasmid which did not code for colicin production or the PCP protein. This smaller plasmid was primarily related to the larger plasmid within the regions of DNA encoding incompatibility, replication, and conjugation. O1:K1 bacteria of MP5 contained other unrelated plasmids in agreement with the previous conclusion that they are unrelated to O1:K1 bacteria of MP9. The bacteria examined had been isolated from two continents over a time span of 38 years, and the results attest to conservative inheritance of plasmids within bacteria of common descent. Images PMID:6094355

  20. 营养限制与补偿对蒙古育成羯羊肝脏关键酶活性的影响%Feed Restriction and Realimentation Affect Activities of Hepatic Key Enzymes in Mongolia Growing Wethers

    Institute of Scientific and Technical Information of China (English)

    徐永霞; 侯先志; 王海荣; 高爱武; 李俊良; 杨金丽

    2012-01-01

    This experiment was conducted to study the effects of feed restriction and realimentation on the activities of hepatic key enzymes in Mongolia growing wethers. Forty three-month-old growing wethers with an average body weight of (14. 72 ± 1. 10) kg were selected and divided into 2 groups (control group and restricted group). The feeding trial included a 60-d feed restriction period and a 90-d feed realimentation period. The metabolizable energy (ME) and crude protein (CP) content in diets were 8. 62 MJ/kg and 5.7% for restricted group and were 10. 88 MJ/kg and 15. 0% for the control group during the feed restriction period. All growing wethers were offered the same diet (ME: 9. 75 MJ/kg; CP: 12% ) during the feed realimentation period. At the end of feed restriction and realimentation period, the activities of hexokinase (HK) , pyruvate ki-nase ( PK) , lactate dehydrogenase ( LDH) , fructose-1, 6-bisphosphatase ( FBP1) , malate dehydrogenase (MDH) , α-glycerophosphate dehydrogenase ( GAPDH) , alanine aminotransferase ( ALT) , aspartate amin-otransferase (AST) and glutamate dehydrogenase (GLDH) in liver in each group were examined. The results showed that the activities of hepatic HK, ALT, AST, GLDH of restricted group were significantly lower than those of the control group (P 0. 05). These results indicate that the activities of key enzymes in the glycolysis and protein metabolism are decreased, and the activities of key enzymes in gluconeogenesis and lipolysis are increased. That may be related to the strengthening of fat mobilization during the feed restriction period. The activities of key enzymes in protein metabolism are decreased which means to decrease protein metabolism during the feed restriction period. At the end of realimentation period, the activities of key enzymes in glycolysis, gluconeogenesis and lipid metabolism are recovered to the level of control group, while the activities of hepatic PK and key enzymes in fat synthesis and protein

  1. Degradative Plasmid and Heavy Metal Resistance Plasmid Naturally Coexist in Phenol and Cyanide Assimilating Bacteria

    Directory of Open Access Journals (Sweden)

    Bahig E.  Deeb

    2009-01-01

    Full Text Available Problem statement: Heavy metals are known to be powerful inhibitors of xenobiotics biodegradation activities. Alleviation the inhibitory effect of these metals on the phenol biodegradation activities in presence of heavy metals resistant plasmid was investigated. Approach: Combination of genetic systems of degradation of xenobiotic compound and heavy metal resistance was one of the approaches to the creation of polyfunctional strains for bioremediation of soil after co-contamination with organic pollutants and heavy metals. Results: A bacterial strain Pseudomonas putida PhCN (pPhCN1, pPhCN2 had been obtained. This bacterium contained two plasmids, a 120 Kb catabolic plasmid that encode for breakdown of phenol (pPhCN1 and pPhCN2 plasmid (100 Kb that code for cadmium and copper resistant. Cyanide assimilation by this bacterium was encoded by chromosomal genes. The inhibitory effect of cadmium (Cd2+ or copper (Cu2+ on the degradation of phenol and cyanide by P. putida strains PhCN and PhCN1 (contained pPhCN1 were investigated. The resistant strain PhCN showed high ability to degrade phenol and cyanide in presence of Cd2+ or Cu2+ comparing with the sensitive strain PhCN1. In addition, Cd2+ or Cu2+ was also found to exert a strong inhibitory effect on the C23O dioxygenase enzyme activity in the presence of cyanide as a nitrogen source. Conclusion: The presence of heavy metal resistance plasmid alleviated the inhibitory effect of metals on the phenol and cyanide assimilation by resistant strain.

  2. In Silico Detection and Typing of Plasmids using PlasmidFinder and Plasmid Multilocus Sequence Typing

    DEFF Research Database (Denmark)

    Carattoli, Alessandra; Zankari, Ea; García-Fernández, Aurora

    2014-01-01

    In the work presented here, we designed and developed two easy-to-use Web tools for in silico detection and characterization of whole-genome sequence (WGS) and whole-plasmid sequence data from members of the family Enterobacteriaceae. These tools will facilitate bacterial typing based on draft...... genomes of multidrug-resistant Enterobacteriaceae species by the rapid detection of known plasmid types. Replicon sequences from 559 fully sequenced plasmids associated with the family Enterobacteriaceae in the NCBI nucleotide database were collected to build a consensus database for integration...... sequences identified in the 559 fully sequenced plasmids. For plasmid multilocus sequence typing (pMLST) analysis, a database that is updated weekly was generated from www.pubmlst.org and integrated into a Web tool called pMLST. Both databases were evaluated using draft genomes from a collection...

  3. A mimicking-of-DNA-methylation-patterns pipeline for overcoming the restriction barrier of bacteria.

    Directory of Open Access Journals (Sweden)

    Guoqiang Zhang

    2012-09-01

    Full Text Available Genetic transformation of bacteria harboring multiple Restriction-Modification (R-M systems is often difficult using conventional methods. Here, we describe a mimicking-of-DNA-methylation-patterns (MoDMP pipeline to address this problem in three difficult-to-transform bacterial strains. Twenty-four putative DNA methyltransferases (MTases from these difficult-to-transform strains were cloned and expressed in an Escherichia coli strain lacking all of the known R-M systems and orphan MTases. Thirteen of these MTases exhibited DNA modification activity in Southwestern dot blot or Liquid Chromatography-Mass Spectrometry (LC-MS assays. The active MTase genes were assembled into three operons using the Saccharomyces cerevisiae DNA assembler and were co-expressed in the E. coli strain lacking known R-M systems and orphan MTases. Thereafter, results from the dot blot and restriction enzyme digestion assays indicated that the DNA methylation patterns of the difficult-to-transform strains are mimicked in these E. coli hosts. The transformation of the Gram-positive Bacillus amyloliquefaciens TA208 and B. cereus ATCC 10987 strains with the shuttle plasmids prepared from MoDMP hosts showed increased efficiencies (up to four orders of magnitude compared to those using the plasmids prepared from the E. coli strain lacking known R-M systems and orphan MTases or its parental strain. Additionally, the gene coding for uracil phosphoribosyltransferase (upp was directly inactivated using non-replicative plasmids prepared from the MoDMP host in B. amyloliquefaciens TA208. Moreover, the Gram-negative chemoautotrophic Nitrobacter hamburgensis strain X14 was transformed and expressed Green Fluorescent Protein (GFP. Finally, the sequence specificities of active MTases were identified by restriction enzyme digestion, making the MoDMP system potentially useful for other strains. The effectiveness of the MoDMP pipeline in different bacterial groups suggests a universal

  4. Effect of excessive cadmium chloride on the plasmids of E. coli HB 101 in vivo

    Institute of Scientific and Technical Information of China (English)

    1999-01-01

    After Escherichia coli HB101 with plasmid pWH58, pWH98, or pTBa5 were cultered respectively in amp LB broth which contained 50 mg/L CdCl2 constantly for 24 h, these plasmids were isolated from E. coli, and the effect of excessive CdCl2 on the E. coli HB101 and plasmid DNA was studied by surveying the growth of E. coli HB101 and plasmid, argarose gel electrophoresis and analysis of restriction fragment length polymorphism (RFLP) of plasmids, and plasmid transformation. The results showed that 50 mg/L CdCl2 treatment lagged the growth of E. coli HB101 for at least 4h, but after grown for 24h there were not significant differences in the growths of E. coli HB101s and the productions of plasmids between the treatment and control. These results implified that E. coli HB101 have induced adaptability to cadmium stress and excessive CdCl2 did not inhibit the replication and amp+ gene's expression of plasmid DNA in vivo of E. coli significantly. 50 mg/L CdCl2 treatment for 24 hours might cause the sequence's change of plasmid DNA, but could not lead to the random breakage of plasmid DNA strands. Moreover, after 50 mg/L of CdCl2 treatment in vivo the transformation activities of plasmid did not altered, implied excessive CdCl2 could not affect the superhelical structure of plasmid and also not break the loop of plasmid DNA evidently.

  5. Restrictive cardiomyopathy

    Science.gov (United States)

    Cardiomyopathy - restrictive; Infiltrative cardiomyopathy; Idiopathic myocardial fibrosis ... In a case of restrictive cardiomyopathy, the heart muscle is of normal size or slightly enlarged. Most of the time, it also pumps normally. However, it does ...

  6. DNA cleavage site selection by Type III restriction enzymes provides evidence for head-on protein collisions following 1D bidirectional motion

    Science.gov (United States)

    Schwarz, Friedrich W.; van Aelst, Kara; Tóth, Júlia; Seidel, Ralf; Szczelkun, Mark D.

    2011-01-01

    DNA cleavage by the Type III Restriction–Modification enzymes requires communication in 1D between two distant indirectly-repeated recognitions sites, yet results in non-specific dsDNA cleavage close to only one of the two sites. To test a recently proposed ATP-triggered DNA sliding model, we addressed why one site is selected over another during cleavage. We examined the relative cleavage of a pair of identical sites on DNA substrates with different distances to a free or protein blocked end, and on a DNA substrate using different relative concentrations of protein. Under these conditions a bias can be induced in the cleavage of one site over the other. Monte-Carlo simulations based on the sliding model reproduce the experimentally observed behaviour. This suggests that cleavage site selection simply reflects the dynamics of the preceding stochastic enzyme events that are consistent with bidirectional motion in 1D and DNA cleavage following head-on protein collision. PMID:21724613

  7. Evidence for plasmid-encoded virulence factors in the phytopathogenic bacterium Clavibacter michiganensis subsp. michiganensis NCPPB382.

    Science.gov (United States)

    Meletzus, D; Bermphol, A; Dreier, J; Eichenlaub, R

    1993-01-01

    The tomato pathogen Clavibacter michiganensis subsp. michiganensis NCPPB382, which causes bacterial wilt, harbors two plasmids pCM1 (27.5 kb) and pCM2 (72 kb). After curing of the plasmids, bacterial derivatives were still proficient in the ability to colonize the host plant and in the production of exopolysaccharides but exhibited a reduced virulence. When one of the two plasmids is lost, there is a significant delay in the development of wilting symptoms after infection and a plasmid-free derivative is not able to induce disease symptoms. By cloning of restriction fragments of both plasmids in the plasmid-free strain CMM100, two DNA fragments which restored the virulent phenotype were identified. Further analysis suggested that a fragment of plasmid pCM1 encodes an endocellulase which is involved in the expression of the pathogenic phenotype. Images PMID:8458855

  8. MethylRAD: a simple and scalable method for genome-wide DNA methylation profiling using methylation-dependent restriction enzymes.

    Science.gov (United States)

    Wang, Shi; Lv, Jia; Zhang, Lingling; Dou, Jinzhuang; Sun, Yan; Li, Xue; Fu, Xiaoteng; Dou, Huaiqian; Mao, Junxia; Hu, Xiaoli; Bao, Zhenmin

    2015-11-01

    Characterization of dynamic DNA methylomes in diverse phylogenetic groups has attracted growing interest for a better understanding of the evolution of DNA methylation as well as its function and biological significance in eukaryotes. Sequencing-based methods are promising in fulfilling this task. However, none of the currently available methods offers the 'perfect solution', and they have limitations that prevent their application in the less studied phylogenetic groups. The recently discovered Mrr-like enzymes are appealing for new method development, owing to their ability to collect 32-bp methylated DNA fragments from the whole genome for high-throughput sequencing. Here, we have developed a simple and scalable DNA methylation profiling method (called MethylRAD) using Mrr-like enzymes. MethylRAD allows for de novo (reference-free) methylation analysis, extremely low DNA input (e.g. 1 ng) and adjustment of tag density, all of which are still unattainable for most widely used methylation profiling methods such as RRBS and MeDIP. We performed extensive analyses to validate the power and accuracy of our method in both model (plant Arabidopsis thaliana) and non-model (scallop Patinopecten yessoensis) species. We further demonstrated its great utility in identification of a gene (LPCAT1) that is potentially crucial for carotenoid accumulation in scallop adductor muscle. MethylRAD has several advantages over existing tools and fills a void in the current epigenomic toolkit by providing a universal tool that can be used for diverse research applications, e.g. from model to non-model species, from ordinary to precious samples and from small to large genomes, but at an affordable cost.

  9. Resolution of Multimeric Forms of Circular Plasmids and Chromosomes.

    Science.gov (United States)

    Crozat, Estelle; Fournes, Florian; Cornet, François; Hallet, Bernard; Rousseau, Philippe

    2014-10-01

    One of the disadvantages of circular plasmids and chromosomes is their high sensitivity to rearrangements caused by homologous recombination. Odd numbers of crossing-over occurring during or after replication of a circular replicon result in the formation of a dimeric molecule in which the two copies of the replicon are fused. If they are not converted back to monomers, the dimers of replicons may fail to correctly segregate at the time of cell division. Resolution of multimeric forms of circular plasmids and chromosomes is mediated by site-specific recombination, and the enzymes that catalyze this type of reaction fall into two families of proteins: the serine and tyrosine recombinase families. Here we give an overview of the variety of site-specific resolution systems found on circular plasmids and chromosomes.

  10. Plasmid and chromosome partitioning: surprises from phylogeny

    DEFF Research Database (Denmark)

    Gerdes, Kenn; Møller-Jensen, Jakob; Bugge Jensen, Rasmus

    2000-01-01

    Plasmids encode partitioning genes (par) that are required for faithful plasmid segregation at cell division. Initially, par loci were identified on plasmids, but more recently they were also found on bacterial chromosomes. We present here a phylogenetic analysis of par loci from plasmids and chr...

  11. Plasmid-Borne Antimicrobial Resistance of Staphylococcus aureus Isolated in a Hospital in Lisbon, Portugal.

    Science.gov (United States)

    Costa, Sofia Santos; Palma, Cláudia; Kadlec, Kristina; Fessler, Andrea T; Viveiros, Miguel; Melo-Cristino, José; Schwarz, Stefan; Couto, Isabel

    2016-12-01

    Plasmids play a key role in the genetic plasticity and survival of Staphylococcus aureus in challenging environments. Although many S. aureus plasmids have been described, still few studies portray the plasmid content of a given S. aureus population. The aim of this work was to characterize the plasmids carried by a collection of 53 S. aureus isolates collected in a large hospital in Lisbon, Portugal, and investigate their role in conferring resistance to several antimicrobial agents. Plasmids were present in 44 out of the 53 isolates and were grouped into eleven AccI restriction profiles. Plasmid curing of representative strains and comparison of antimicrobial susceptibility profiles between pairs of isogenic strains proved to be a valuable guidance tool in the identification of plasmid-located resistance genes. The plasmids harbored several resistance genes, namely blaZ (resistance to β-lactams), erm(C) (resistance to macrolides, lincosamides, and streptogramin B), cadA (resistance to cadmium and zinc), cadD (resistance to cadmium), and qacA and smr (resistance to biocides and dyes). This study demonstrates the impact of plasmids on the resistance properties of S. aureus, highlighting their role in the dissemination of antibiotic, heavy metal, and biocide resistance genes, and survival of this major pathogen in the hospital environment.

  12. Enhanced transformation efficiency of recalcitrant Bacillus cereus and Bacillus weihenstephanensis isolates upon in vitro methylation of plasmid DNA

    NARCIS (Netherlands)

    Nierop Groot, M.N.; Nieboer, F.; Abee, T.

    2008-01-01

    Digestion patterns of chromosomal DNAs of Bacillus cereus and Bacillus weihenstephanensis strains suggest that Sau3AI-type restriction modification systems are widely present among the isolates tested. In vitro methylation of plasmid DNA was used to enhance poor plasmid transfer upon electroporation

  13. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    Science.gov (United States)

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  14. Plasmid Profiles of Virulent Rhodococcus equi Strains Isolated from Infected Foals in Poland.

    Science.gov (United States)

    Kalinowski, Marcin; Grądzki, Zbigniew; Jarosz, Łukasz; Kato, Kiyoko; Hieda, Yu; Kakuda, Tsutomu; Takai, Shinji

    2016-01-01

    Rhodococcus equi is an important bacterial pathogen in foals up to 6 months old, widespread in horse farms all over the world. It was found that only virulent R. equi strains expressing 15-17 kDa virulence-associated protein (VapA) and having large virulence plasmid of 85-90 kb containing vapA gene are pathogenic for horses. To date, 12 plasmid types have been reported in VapA positive strains from horses. There are no data concerning plasmid types of Polish field R. equi strains isolated from horses and horse farm environment. The aim of the study is to determine plasmid profiles of virulent R. equi strains isolated in Poland from dead foals as well as from soil samples taken from horse breeding farms. Plasmid profiles of 10 clinical strains derived from 8 farms and 11 environmental strains from 3 farms, confirmed as virulent by PCR, were compared with 12 reference strains containing the known plasmid size and type. Plasmid DNAs were analysed by digestion with the restriction endonucleases BamHI, EcoRI, EcoT22I, and HindIII for detailed comparison and estimation of plasmid sizes. The results of RFLP analysis revealed that all except one isolates used in the study are classified as VapA 85 kb type I plasmid. One strain harboured VapA 87 kb type I plasmid. This is the first report of plasmid types of Polish field R. equi strains. The results of our preliminary investigations on horse farms located in central and eastern Poland indicate that the virulent R. equi strains thus far isolated from diseased foals and horse farms environment represent a highly uniform plasmid pattern.

  15. Restriction enzyme analysis of the human cytomegalovirus genome in specimens collected from immunodeficient patients in Belém, State of Pará, Brazil

    Directory of Open Access Journals (Sweden)

    Dorotéa Lobato da Silva

    2011-10-01

    Full Text Available INTRODUCTION: Human cytomegalovirus is an opportunistic betaherpesvirus that causes persistent and serious infections in immunodeficient patients. Recurrent infections occur due to the presence of the virus in a latent state in some cell types. It is possible to examine the virus using molecular methods to aid in the immunological diagnosis and to generate a molecular viral profile in immunodeficient patients. The objective of this study was to characterize cytomegalovirus genotypes and to generate the epidemiological and molecular viral profile in immunodeficient patients. METHODS: A total of 105 samples were collected from immunodeficient patients from the City of Belém, including newborns, hemodialysis patients, transplant recipients and HIV+ patients. An IgG and IgM antibody study was completed using ELISA, and enzymatic analysis by restriction fragment length polymorphism (RFLP was performed to characterize viral genotypes. RESULTS: It was observed that 100% of the patients had IgG antibodies, 87% of which were IgG+/IgM-, consistent with a prior infection profile, 13% were IgG+/IgM+, suggestive of recent infection. The newborn group had the highest frequency (27% of the IgG+/IgM+ profile. By RFLP analysis, only one genotype was observed, gB2, which corresponded to the standard AD169 strain. CONCLUSIONS: The presence of IgM antibodies in new borns indicates that HCMV continues to be an important cause of congenital infection. The low observed genotypic diversity could be attributed to the small sample size because newborns were excluded from the RFLP analysis. This study will be continued including samples from newborns to extend the knowledge of the general and molecular epidemiology of HCMV in immunodeficient patients.

  16. The Type I Restriction Enzymes as Barriers to Horizontal Gene Transfer: Determination of the DNA Target Sequences Recognised by Livestock-Associated Methicillin-Resistant Staphylococcus aureus Clonal Complexes 133/ST771 and 398.

    Science.gov (United States)

    Chen, Kai; Stephanou, Augoustinos S; Roberts, Gareth A; White, John H; Cooper, Laurie P; Houston, Patrick J; Lindsay, Jodi A; Dryden, David T F

    2016-01-01

    The Type I DNA restriction-modification (RM) systems of Staphylococcus aureus are known to act as a significant barrier to horizontal gene transfer between S. aureus strains belonging to different clonal complexes. The livestock-associated clonal complexes CC133/771 and CC398 contain Type I RM systems not found in human MRSA strains as yet but at some point transfer will occur. When this does take place, horizontal gene transfer of resistance will happen more easily between these strains. The reservoir of antibiotic resistance, virulence and host-adaptation genes present in livestock-associated MRSA will then potentially contribute to the development of newly evolving MRSA clones. The target sites recognised by the Type I RM systems of CC133/771 and CC398 were identified as CAG(N)5RTGA and ACC(N)5RTGA, respectively. Assuming that these enzymes recognise the methylation state of adenine, the underlined A and T bases indicate the unique positions of methylation. Target methylation points for enzymes from CC1 were also identified. The methylation points for CC1-1 are CCAY(N)5TTAA and those for CC1-2 are CCAY(N)6 TGT with the underline indicating the adenine methylation site thus clearing up the ambiguity noted previously (Roberts et al. 2013, Nucleic Acids Res 41:7472-7484) for the half sites containing two adenine bases.

  17. Exploring PFGE for Detecting Large Plasmids in Campylobacter jejuni and Campylobacter coli Isolated from Various Retail Meats

    Directory of Open Access Journals (Sweden)

    Daya Marasini

    2014-10-01

    Full Text Available Campylobacter spp. is one of the most prevalent bacterial pathogens in retail meat, particularly poultry, and is a leading cause of diarrhea in humans. Studies related to Campylobacter large plasmids are limited in the literature possibly due to difficulty in isolating them using available alkaline lysis methods. The objectives of this study were to determine the prevalence of plasmids, particularly large ones, in Campylobacter spp. isolated from various Oklahoma retail meats, and to explore PFGE (Pulsed Field Gel Electrophoresis as a tool in facilitating the detection of these plasmids. One hundred and eighty nine strains (94 Campylobacter jejuni and 95 Campylobacter coli were screened for the presence of plasmids using both alkaline lysis and PFGE. Plasmids were detected in 119/189 (63% using both methods. Most of the plasmids detected by alkaline lysis were smaller than 90 kb and only three were larger than 90 kb. Plasmids over 70 kb in size were detected in 33 more strains by PFGE of which 11 strains contained larger than 90 kb plasmids. Plasmids were more prevalent in Campylobacter coli (73.5% than in Campylobacter jejuni (52%. BglII restriction analysis of plasmids isolated from 102 isolates revealed 42 different restriction patterns. In conclusion, PFGE was able to detect large plasmids up to 180 Kb in Campylobacter spp. which might have been missed if the alkaline lysis method was solely used. Campylobacter spp. isolated from retail meats harbor a diverse population of plasmids with variable sizes. To our knowledge, this is the first study to use PFGE to detect large plasmids in Campylobacter.

  18. Novel plasmids and resistance phenotypes in Yersinia pestis: unique plasmid inventory of strain Java 9 mediates high levels of arsenic resistance.

    Directory of Open Access Journals (Sweden)

    Mark Eppinger

    Full Text Available Growing evidence suggests that the plasmid repertoire of Yersinia pestis is not restricted to the three classical virulence plasmids. The Java 9 strain of Y. pestis is a biovar Orientalis isolate obtained from a rat in Indonesia. Although it lacks the Y. pestis-specific plasmid pMT, which encodes the F1 capsule, it retains virulence in mouse and non-human primate animal models. While comparing diverse Y. pestis strains using subtractive hybridization, we identified sequences in Java 9 that were homologous to a Y. enterocolitica strain carrying the transposon Tn2502, which is known to encode arsenic resistance. Here we demonstrate that Java 9 exhibits high levels of arsenic and arsenite resistance mediated by a novel promiscuous class II transposon, named Tn2503. Arsenic resistance was self-transmissible from Java 9 to other Y. pestis strains via conjugation. Genomic analysis of the atypical plasmid inventory of Java 9 identified pCD and pPCP plasmids of atypical size and two previously uncharacterized cryptic plasmids. Unlike the Tn2502-mediated arsenic resistance encoded on the Y. enterocolitica virulence plasmid; the resistance loci in Java 9 are found on all four indigenous plasmids, including the two novel cryptic plasmids. This unique mobilome introduces more than 105 genes into the species gene pool. The majority of these are encoded by the two entirely novel self-transmissible plasmids, which show partial homology and synteny to other enterics. In contrast to the reductive evolution in Y. pestis, this study underlines the major impact of a dynamic mobilome and lateral acquisition in the genome evolution of the plague bacterium.

  19. BMP2和TGFβ3双基因真核表达载体的构建%Construction of bicistronic eukaryotic expression plasmid containing BMP2 and TGFβ3 genes

    Institute of Scientific and Technical Information of China (English)

    马小松; 刘金钊; 王昌耀; 王英振; 刘世海; 刘相萍

    2011-01-01

    [目的]构建骨形态发生蛋白BMP2和转化生长因子TGFβ3双基因真核表达载体.[方法]从人胚胎组织提取总RNA,反转录成cDNA,以pGEMT/BMP2和反转录的cDNA为模板,PCR扩增出BMP2和TGFβ3两个基因全长,将两个基因片段分别定向连入双基因真核表达载体pIRES;用酶切的方法筛选出阳性重组质粒,并进行测序鉴定.[结果]酶切鉴定证明已将BMP2和TGFβ3两个基因连入载体中,测序结果完全正确.[结论]成功构建pIRESBMP2/TGFβ3双基因真核表达载体.%[ Objective]To construct a bicistronic eukayotic expression plasmid consisting of BMP2 and TGFβ3 target genes.[ Method ] The DNA fragment of BMP2 and TGFβ3 genes were obtained from pGEMT/BMP2 plasmid and human embryonal tissue by PCR, respectively. They were inserted into bicistronic eukaryotic expression plasmid vector plRES. The inserted target genes in the plasmid were verified by restriction enzyme digestion and nucleotide sequencing. [ Result ] The direction and sequences of the new bicistronic eukaryotic expression plasmid pIRES - BMP2 -TGFβ3 were correct. [ Conclusion] The bicistronic eukaryotic expression plasmid has been constructed successfully.

  20. Kinetic Properties of Four Plasmid-Mediated AmpC β-Lactamases

    Science.gov (United States)

    Bauvois, Cédric; Ibuka, Akiko Shimizu; Celso, Almeida; Alba, Jimena; Ishii, Yoshikazu; Frère, Jean-Marie; Galleni, Moreno

    2005-01-01

    The heterologous production in Escherichia coli, the purification, and the kinetic characterization of four plasmid-encoded class C β-lactamases (ACT-1, MIR-1, CMY-2, and CMY-1) were performed. Except for their instability, these enzymes are very similar to the known chromosomally encoded AmpC β-lactamases. Their kinetic parameters did not show major differences from those obtained for the corresponding chromosomal enzymes. However, the Km values of CMY-2 for cefuroxime, cefotaxime, and oxacillin were significantly decreased compared to those of the chromosomal AmpC enzymes. Finally, the susceptibility patterns of different E. coli hosts producing a plasmid- or a chromosome-encoded class C enzyme toward β-lactam antibiotics are mainly due to the overproduction of the β-lactamase in the periplasmic space of the bacteria rather than to a specific catalytic profile of the plasmid-encoded β-lactamases. PMID:16189104

  1. Pheromone-responsive conjugative vancomycin resistance plasmids in Enterococcus faecalis isolates from humans and chicken feces.

    Science.gov (United States)

    Lim, Suk-Kyung; Tanimoto, Koichi; Tomita, Haruyoshi; Ike, Yasuyoshi

    2006-10-01

    The drug resistances and plasmid contents of a total of 85 vancomycin-resistant enterococcus (VRE) strains that had been isolated in Korea were examined. Fifty-four of the strains originated from samples of chicken feces, and 31 were isolated from hospital patients in Korea. Enterococcus faecalis KV1 and KV2, which had been isolated from a patient and a sample of chicken feces, respectively, were found to carry the plasmids pSL1 and pSL2, respectively. The plasmids transferred resistances to vancomycin, gentamicin, kanamycin, streptomycin, and erythromycin to E. faecalis strains at a high frequency of about 10(-3) per donor cell during 4 hours of broth mating. E. faecalis strains containing each of the pSL plasmids formed clumps after 2 hours of incubation in broth containing E. faecalis FA2-2 culture filtrate (i.e., the E. faecalis sex pheromone), and the plasmid subsequently transferred to the recipient strain in a 10-min short mating in broth, indicating that the plasmids are responsive to E. faecalis pheromones. The pSL plasmids did not respond to any of synthetic pheromones for the previously characterized plasmids. The pheromone specific for pSL plasmids has been designated cSL1. Southern hybridization analysis showed that specific FspI fragments from each of the pSL plasmids hybridized with the aggregation substance gene (asa1) of the pheromone-responsive plasmid pAD1, indicating that the plasmids had a gene homologous to asa1. The restriction maps of the plasmids were identical, and the size of the plasmids was estimated to be 128.1 kb. The plasmids carried five drug resistance determinants for vanA, ermB, aph(3'), aph(6'), and aac(6')/aph(2'), which encode resistance to vancomycin, erythromycin, kanamycin, streptomycin, and gentamicin/kanamycin, respectively. Nucleotide sequence analyses of the drug resistance determinants and their flanking regions are described in this report. The results described provide evidence for the exchange of genetic information

  2. Design and evaluation of protein expression in a recombinant plasmid encoding epitope gp 350/220 of the Epstein-Barr virus (EBV)

    Science.gov (United States)

    Himmah, Karimatul; Dluha, Nurul; Anyndita, Nadya V. M.; Rifa'i, Muhaimin; Widodo

    2017-05-01

    The Epstein - Barr virus (EBV) causes severe infections that may lead to cancers such as nasopharyngeal carcinoma. Development of effective EBV vaccines is necessary to prevent the virus spreading throughout the community. TheEBV has a surface protein gp 350/220, which serves as an antigen to help interact with host cells. Epitopes of the protein can potentially serve as bases for a vaccine. In a previous study, we have found a conserved epitope of gp 350/220 from all strains EBV through an in silico approach. The aim of this study is to design and overproduce a recombinant peptide of epitope gp 350/220 in E. coli. DNA encoding the conserved epitope was synthesized and cloned into plasmid pET-22b(+); the recombinant plasmid was transformed into E. coli strains DH5α and BL21. The transformed plasmid DNA was isolated and confirmed by restriction using XbaI and PstI enzymes followed by DNA sequencing. Protein expression was induced by isopropyl-D-thiogalactopyranoside (IPTG) with final concentrations of 0.1, 0.2, 1, and 2 mM in consecutive times. An osmotic shock method was used to isolate protein from periplasmic fraction of E. coli DH5α and BL21. The SDS-PAGE analysis was carried out to detect peptide target (3.4 kDa). Based on this result, the induction process did not work properly, and thus needs further investigation.

  3. Plasmid Profiles and Prevalence of Intermediately Virulent Rhodococcus equi from Pigs in Nakhonpathom Province, Thailand: Identification of a New Variant of the 70-kb Virulence Plasmid, Type 18

    Directory of Open Access Journals (Sweden)

    Chaithep Poolkhet

    2010-01-01

    Full Text Available The prevalence of intermediately virulent Rhodococcus equi isolates from pig submaxillary lymph nodes from four slaughterhouses in Nakhonpathom province, Thailand, was investigated. The isolates were tested for the presence of virulence plasmids and the 20-kDa virulence-associated protein antigen (VapB gene by PCR. Of the 734 submaxillary lymph nodes tested, 19 (2.6% produced positive cultures of R. equi. All 19 isolates were positive for the VapB gene and contained virulence plasmids that were identified as type 1 (six isolates, type 6 (two isolates, type 7 (one isolate, type 16 (two isolates, and a new variant (eight isolates. Based on the restriction digestion patterns of the plasmid DNAs, we tentatively designated the variant as type 18. Investigation of the prevalence and plasmid profiles of VapB-positive R. equi in pigs should be extended throughout Thailand to evaluate potential sources of zoonotic infections.

  4. Co-resident plasmids travel together.

    Science.gov (United States)

    Gama, João Alves; Zilhão, Rita; Dionisio, Francisco

    2017-08-24

    Conjugative plasmids encode genes that enable them to transfer, by conjugation, from a given host cell to another cell. Conjugative transfer, despite being an important feature of conjugative plasmids, is not constitutive for most plasmids, the reason being that genes involved in horizontal transfer are mostly repressed. Only upon their transient de-repression are plasmids able to transfer horizontally. If host cells harbour multiple plasmids, their simultaneous transfer depends on simultaneous transient de-repression of all plasmids. If de-repression of different plasmids was random and independent events, simultaneous de-repression should be a rare event because the probability of simultaneous de-repression would be the product of the probabilities of de-repression of each plasmid. Some previous observations support this hypothesis, while others show that co-transfer of plasmids is more frequent than this reasoning indicates. Here, we show that co-transfer of multiple plasmids mainly results from non-independent events: the probability that all plasmids within a cell become de-repressed is much higher than if de-repression of plasmids genes were independent. We found a simple model for the probability of co-transfer: the plasmid having the lowest conjugation rates is the one who limits co-transfer. In this sense, cells receiving the plasmid with the lower transfer rate also receive the other plasmid. If de-repression happens simultaneously on co-resident plasmids, common cues may stimulate de-repression of distinct plasmids. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. The Chlamydophila felis plasmid is highly conserved.

    Science.gov (United States)

    Harley, Ross; Day, Sarinder; Di Rocco, Camillo; Helps, Chris

    2010-11-20

    The presence of a plasmid in the Chlamydiaceae is both species and strain specific. Knowledge of the prevalence of the plasmid in different Chlamydia species is important for future studies aiming to investigate the role of the plasmid in chlamydial biology and disease. Although strains of Chlamydophila felis with or without the plasmid have been identified, only a small number of laboratory-adapted strains have been analysed and the prevalence of the plasmid in field isolates has not been determined. This study aimed to determine the prevalence of the plasmid in C. felis-positive conjunctival and oropharyngeal clinical samples submitted for routine diagnosis of C. felis by real-time (Q)PCR. DNA extracts from four laboratory-adapted strains were also analysed. QPCR assays targeting regions of C. felis plasmid genes pCF01, pCF02 and pCF03 were developed for the detection of plasmid DNA. QPCR analysis of DNA extracts from C. felis-positive clinical samples found evidence of plasmid DNA in 591 of 595 samples representing 561 of 564 (99.5%) clinical cases. Plasmid DNA was also detected by QPCR in laboratory-adapted strains 1497V, K2487 and K2490, but not strain 905. We conclude that the plasmid is highly conserved in C. felis, and plasmid-deficient strains represent a rare but important population for future studies of chlamydial plasmid function.

  6. Restricted Airspace

    Data.gov (United States)

    Federal Laboratory Consortium — Redstone Technical Test Center has restricted airspace up to 30,000 feet ASL. Airspace encompasses R-2104 (Redstone). Airspace is used extensively for airborne/UAV...

  7. Genetic diversity and composition of a plasmid metagenome from a wastewater treatment plant.

    Science.gov (United States)

    Schlüter, Andreas; Krause, Lutz; Szczepanowski, Rafael; Goesmann, Alexander; Pühler, Alfred

    2008-08-31

    Plasmid metagenome nucleotide sequence data were recently obtained from wastewater treatment plant (WWTP) bacteria with reduced susceptibility to selected antimicrobial drugs by applying the ultrafast 454-sequencing technology. The sequence dataset comprising 36,071,493 bases (346,427 reads with an average read length of 104 bases) was analysed for genetic diversity and composition by using a newly developed bioinformatic pipeline based on assignment of environmental gene tags (EGTs) to protein families stored in the Pfam database. Short amino acid sequences deduced from the plasmid metagenome sequence reads were compared to profile hidden Markov models underlying Pfam. Obtained matches evidenced that many reads represent genes having predicted functions in plasmid replication, stability and plasmid mobility which indicates that WWTP bacteria harbour genetically stabilised and mobile plasmids. Moreover, the data confirm a high diversity of plasmids residing in WWTP bacteria. The mobile organic peroxide resistance plasmid pMAC from Acinetobacter baumannii was identified as reference plasmid for the most abundant replication module type in the sequenced sample. Accessory plasmid modules encode different transposons, insertion sequences, integrons, resistance and virulence determinants. Most of the matches to Transposase protein families were identified for transposases similar to the one of the chromate resistance transposon Tn5719. Noticeable are hits to beta-lactamase protein families which suggests that plasmids from WWTP bacteria encode different enzymes possessing beta-lactam-hydrolysing activity. Some of the sequence reads correspond to antibiotic resistance genes that were only recently identified in clinical isolates of human pathogens. EGT analysis thus proofed to be a very valuable method to explore genetic diversity and composition of the present plasmid metagenome dataset.

  8. PLASMIDS FROM ANAEROCELLUM THERMOPHILUM AND USES THEREOF

    DEFF Research Database (Denmark)

    2003-01-01

    The present invention concerns the isolation of plasmids from extremely thermophilic anaerobic microorganisms and their use in genetic transformation of thermophilic and mesophilic microorganisms. More particular the invention concerns the use of thermostable plasmid vectors as tools for creating...

  9. Plasmid required for virulence of Agrobacterium tumefaciens

    Energy Technology Data Exchange (ETDEWEB)

    Watson, B.; Currier, T.C.; Gordon, M.P.; Chilton, M.D.; Nester, E.W.

    1975-07-01

    The irreversible loss of crown gall-inducing ability of Agrobacterium tumefaciens strain C-58 during growth at 37/sup 0/C is shown to be due to loss of a large plasmid (1.2 x 10/sup 8/ daltons). The gene responsible for this high rate of plasmid loss at elevated temperatures seems to be located on the plasmid. In addition, another spontaneous avirulent variant, A. tumefaciens strain IIBNV6, is shown to lack the virulence plasmid which its virulent sibling strain, IIBV7, possesses. Deoxyribonucleic acid reassociation measurements prove that the plasmid is eliminated, not integrated into the chromosome, in both of the avirulent derivatives. Transfer of virulence from donor strain C-58 to avirulent recipient strain A136 results from the transfer of a plasmid, which appears identical to the donor plasmid by deoxyribonucleic acid reassociation measurements. The transfer of virulence in another cross, K27 x A136, was also shown to result from the transfer of a large plasmid. These findings establish unequivocally that the large plasmid determines virulence. Two additional genetic determinants have been located on the virulence plasmid of A. tumefaciens strain C-58: the ability to utilize nopaline and sensitivity to a bacteriocin produced by strain 84. The latter trait can be exploited for selection of avirulent plasmid-free derivatives of strain C-58. The trait of nopaline utilization appears to be on the virulence plasmid also in strains IIBV7 and K27.

  10. Construction of Eukaryotic Expression Plasmid of bFGF Gene in Rats and Its Expression in Tenocytes

    Institute of Scientific and Technical Information of China (English)

    FENG Yong; ZHENG Dong; YANG Shuhua; LI Jing

    2007-01-01

    The bFGF plays an important role in embryonic development of tendons and ligaments and in the healing of injuried tendons and ligaments. The eukaryotic expression plasmid of rat basic fibroblast growth factor (bFGF) gene was constructed in order to further investigate the bFGF function in molecular regulatory mechanism in the repair of tendons and ligaments and to provide the foundation for the clinical application. The cDNA fragments of bFGF were cloned from the skin of rats by RT-PCR, and recombinated to the pMD18-T vector. The cDNA encoding bFGF was cloned from the pMD18-T vector by RT-PCR, digested with restriction enzyme EcoR Ⅰ, Pst Ⅰ and bound to eukaryotic expression plasmid pIRES2-EGFP to construct eukaryotic expression plasmid pIRES2-EGFP-bFGF. The pIRES2-EGFP-bFGF was transfected into the tenocytes by lipid-mediated ransfection technique. MTT test was used to detect the biological activity of bFGF in supematants after the transfection. The expression of type Ⅰ and Ⅲ collagen genes was detected by using RT-PCR. It was verified that the pIRES2-EGFP-bFGF was successfully constructed, and its transfection into tenocytes could significantly enhance the biological activity of bFGF, and increase the expression of type Ⅰ and Ⅲ collagen mRNA, suggesting that pIRES2-EGFP-mediated bFGF gene therapy was beneficial to the repair of tendons and ligaments.

  11. Problem-Solving Test: Restriction Endonuclease Mapping

    Science.gov (United States)

    Szeberenyi, Jozsef

    2011-01-01

    The term "restriction endonuclease mapping" covers a number of related techniques used to identify specific restriction enzyme recognition sites on small DNA molecules. A method for restriction endonuclease mapping of a 1,000-basepair (bp)-long DNA molecule is described in the fictitious experiment of this test. The most important fact needed to…

  12. Mutation for Pathogenicity of Magnaporthe grisea by Restriction Enzyme Mediated Integration(REMI)%稻瘟病菌限制酶介导整合(REMI)转化的致病性诱变

    Institute of Scientific and Technical Information of China (English)

    张文荟; 周益军; 范永坚; 程兆榜; 吴淑华

    2002-01-01

    应用提高真菌转化率的技术——限制酶介导整合(restriction enzyme mediated integration,REMI)技术转化稻瘟病菌株Magnaporthe grisea131原生质体,在限制酶HindIII, KpnI或SacI介导下转化效率分别提高6.5、10、3.7倍.通过300μg/mL潮霉素筛选获得1000个以上转化子.用突变体接种水稻鉴别品种,发现其中M25和M36与M131比较其致病性发生了改变.另外还发现产孢缺陷型突变体和培养性状发生改变的突变菌株.rep-PCR试验表明REMI突变菌株由于质粒插入而与M131指纹有差异.

  13. Estimation of the Relative Abundance of Different Bacteroides and Prevotella Ribotypes in Gut Samples by Restriction Enzyme Profiling of PCR-Amplified 16S rRNA Gene Sequences

    Science.gov (United States)

    Wood, Jacqueline; Scott, Karen P.; Avguštin, Gorazd; Newbold, C. James; Flint, Harry J.

    1998-01-01

    We describe an approach for determining the genetic composition of Bacteroides and Prevotella populations in gut contents based on selective amplification of 16S rRNA gene sequences (rDNA) followed by cleavage of the amplified material with restriction enzymes. The relative contributions of different ribotypes to total Bacteroides and Prevotella 16S rDNA are estimated after end labelling of one of the PCR primers, and the contribution of Bacteroides and Prevotella sequences to total eubacterial 16S rDNA is estimated by measuring the binding of oligonucleotide probes to amplified DNA. Bacteroides and Prevotella 16S rDNA accounted for between 12 and 62% of total eubacterial 16S rDNA in samples of ruminal contents from six sheep and a cow. Ribotypes 4, 5, 6, and 7, which include most cultivated rumen Prevotella strains, together accounted for between 20 and 86% of the total amplified Bacteroides and Prevotella rDNA in these samples. The most abundant Bacteroides or Prevotella ribotype in four animals, however, was ribotype 8, for which there is only one known cultured isolate, while ribotypes 1 and 2, which include many colonic Bacteroides spp., were the most abundant in two animals. This indicates that some abundant Bacteroides and Prevotella groups in the rumen are underrepresented among cultured rumen Prevotella isolates. The approach described here provides a rapid, convenient, and widely applicable method for comparing the genotypic composition of bacterial populations in gut samples. PMID:9758785

  14. Origin and Evolution of Rickettsial Plasmids.

    Science.gov (United States)

    El Karkouri, Khalid; Pontarotti, Pierre; Raoult, Didier; Fournier, Pierre-Edouard

    2016-01-01

    Rickettsia species are strictly intracellular bacteria that have undergone a reductive genomic evolution. Despite their allopatric lifestyle, almost half of the 26 currently validated Rickettsia species have plasmids. In order to study the origin, evolutionary history and putative roles of rickettsial plasmids, we investigated the evolutionary processes that have shaped 20 plasmids belonging to 11 species, using comparative genomics and phylogenetic analysis between rickettsial, microbial and non-microbial genomes. Plasmids were differentially present among Rickettsia species. The 11 species had 1 to 4 plasmid (s) with a size ranging from 12 kb to 83 kb. We reconstructed pRICO, the last common ancestor of the current rickettsial plasmids. pRICO was vertically inherited mainly from Rickettsia/Orientia chromosomes and diverged vertically into a single or multiple plasmid(s) in each species. These plasmids also underwent a reductive evolution by progressive gene loss, similar to that observed in rickettsial chromosomes, possibly leading to cryptic plasmids or complete plasmid loss. Moreover, rickettsial plasmids exhibited ORFans, recent gene duplications and evidence of horizontal gene transfer events with rickettsial and non-rickettsial genomes mainly from the α/γ-proteobacteria lineages. Genes related to maintenance and plasticity of plasmids, and to adaptation and resistance to stress mostly evolved under vertical and/or horizontal processes. Those involved in nucleotide/carbohydrate transport and metabolism were under the influence of vertical evolution only, whereas genes involved in cell wall/membrane/envelope biogenesis, cycle control, amino acid/lipid/coenzyme and secondary metabolites biosynthesis, transport and metabolism underwent mainly horizontal transfer events. Rickettsial plasmids had a complex evolution, starting with a vertical inheritance followed by a reductive evolution associated with increased complexity via horizontal gene transfer as well as

  15. An extranuclear expression system for analysis of cytoplasmic promoters of yeast linear killer plasmids.

    Science.gov (United States)

    Schründer, J; Meinhardt, F

    1995-03-01

    Based on the cytoplasmically localized killer plasmids pGKL1 and pGKL2 of Kluyveromyces lactis two new linear hybrid plasmids were constructed which consist of pGKL1, into which in addition to the previously developed cytoplasmically expressible LEU2* selectable marker a glucose dehydrogenase-encoding bacterial gene (gdh A) has been integrated. One of the hybrid plasmids carries the bacterial gene preceded by an arbitrarily placed cytoplasmic promoter (upstream conserved sequence) in front of the coding region (pRKL121). The other plasmid was constructed in such a way that the ATG start codon of the gdh A gene was fused in frame to the ATG start codon of the killer plasmid's open reading frame 5 (pRKL122). The structures of both linear hybrid plasmids were confirmed by restriction analysis, Southern hybridization, and sequencing of the junction sites. Yeast strains carrying either of the plasmids expressed the glucose dehydrogenase gene; however, expression of the in phase fused gene was 40-fold higher compared to the arbitrarily placed cytoplasmic promoter. In general, an in phase fusion was not required for expression, but efficiency is dramatically enhanced when the 5' noncoding sequences in front of the heterologous genes are the same as those found on the native killer plasmids. The developed system can serve as a reporter for determining the efficiency of the different cytoplasmic promoters present on both linear plasmids. Hybrid plasmids were stably maintained without selective pressure in K. lactis and they were transferred and expressed also in Saccharomyces cerevisiae.

  16. A novel multidrug resistance plasmid isolated from an Escherichia coli strain resistant to aminoglycosides.

    Science.gov (United States)

    Sun, Hui; Li, Shasha; Xie, Zhijing; Yang, Fangfang; Sun, Yani; Zhu, Yanli; Zhao, Xiaomin; Jiang, Shijin

    2012-07-01

    Previous studies have reported several different plasmids that confer multidrug resistance (MDR) including resistance to aminoglycosides. In this study, we investigated the aminoglycoside resistance patterns for 224 Escherichia coli isolates from diseased chickens and ducks in China, characterized a novel MDR plasmid, and collected prevalence data on similar resistance plasmids. Antibiotic susceptibilities were determined using disc diffusion and the microdilution method. The plasmid pXZ was analysed by restriction fragment length polymorphism (RFLP) with EcoRI and SalI, and sequenced. The prevalence of similar resistance plasmids was assessed by multiplex PCR and by RFLP analysis. Among the 224 E. coli isolates, 189 (84.4%) were resistant to streptomycin, 125 (55.8%) were resistant to kanamycin, 116 (51.8%) were resistant to gentamicin, 106 (47.3%) were resistant to neomycin and 98 (43.8%) were resistant to amikacin. Among the 224 E. coli isolates, 17 contained a plasmid with the MDR-encoding region of pXZ, which showed high-level resistance to aminoglycosides (MICs of gentamicin and amikacin ≥ 512 mg/L). The plasmid pXZ was digested into five fragments by EcoRI and six fragments by SalI. The plasmid pXZ was a circular DNA molecule of 76635 bp with a 51.65% guanine + cytosine content and included four resistance genes (rmtB, fosA3, bla(TEM-1) and bla(CTX-M-24)). A novel MDR plasmid, pXZ, harbouring four resistance genes (rmtB, fosA3, bla(TEM-1) and bla(CTX-M)) was identified. To our knowledge, this is the first report of an aminoglycoside resistance plasmid harbouring the fosA3 gene.

  17. Chlamydophila felis: plasmid detection in Italian isolates.

    Science.gov (United States)

    Di Francesco, Antonietta; Donati, Manuela; Salvatore, Daniela; Cevenini, Roberto; Di Paolo, Maria; Baldelli, Raffaella

    2010-04-01

    Plasmids have been detected in the majority of strains in the genus Chlamydia and in many Chlamydophila species. Previous studies showed that FP Pring and FP Cello Chlamydophila felis strains have an extrachromosomial plasmid, whereas the FP Baker strain does not. Azuma et al. recently sequenced the entire genomic DNA sequence of the Japanese Cp. felis strain Fe/C-56 and described a 7,552 base pair circular plasmid. In the present study a highly conserved plasmid gene was detected in 11 Italian Cp. felis isolates, showing 100% nucleotide identity with the plasmid gene of Fe/C-56 Cp. felis strain.

  18. Plasmid profiling of bacterial isolates from confined environments

    Science.gov (United States)

    van Houdt, Rob; Provoost, Ann; Coninx, Ilse; Leys, Natalie; Mergeay, Max

    Plasmid profiling of bacterial isolates from confined environments R. Van Houdt, I. Coninx, A. Provoost, N. Leys, and M. Mergeay Expertise group for Molecular and Cellular Biology, Institute for Environment, Health and Safety, Belgian Nuclear Research Centre (SCK•CEN), Boeretang 200, B-2400 Mol, Belgium. Human exploration of extreme and isolated hostile environments such as space requires special confined small volume habitats to protect and house the crew. However, human confinement in such small volume habitats has restrictions on waste disposal and personal hygiene and inevitably generates a particular community of microorganisms within the habitat. These microorganisms are mainly originating from the crew (skin, mucous membranes, upper respiratory tract, mouth, and gastrointestinal tract) but also include the residing environmental microorganisms. Earth-based confined habitats such as the Antarctic Research Station Concordia are used as test beds for long-duration spaceflights to study the physiologic and psychological adaptation to isolated environments. The dynamics of the environmental microbial population in such a test bed could render additional insights in assessing the potential health risks in long-duration space missions. Not only total bacterial contamination levels are important, but it is essential to identify also the predominant microbial taxa and their mobile genetic elements (MGE). These MGEs could be exchanged between bacteria by horizontal gene transfer and may alter the pathogenic potential since they often carry antibiotic resistance or more in general adaptation-enhancing traits. In this study several bacterial strains isolated in the Concordia research station were examined for their plasmid content. An optimized protocol for extraction of large plasmids showed the present of at least one plasmid in 50% of the strains. For all strains the minimal inhibitory concentration of a range of antibiotics was determined indicating resistance to

  19. Rapid isolation of plasmid DNA by LiCl-ethidium bromide treatment and gel filtration.

    Science.gov (United States)

    Kondo, T; Mukai, M; Kondo, Y

    1991-10-01

    We established a simple and rapid plasmid DNA purification method. Crude plasmid DNA preparations are treated with 4 M LiCl in the presence of 0.6 mg/ml ethidium bromide to precipitate RNA and proteins contained in the DNA preparations. After removal of RNA and protein precipitates, the supernatant is filtered through a Sepharose CL6B column to remove low-molecular-weight contaminants. This procedure takes only 30 min and provides pure plasmid DNA preparations that consist mainly of covalently closed circular plasmid DNA but have no detectable RNA and protein. The purified DNA preparations are susceptible to various six- and four-base-recognition restriction endonucleases, T4 DNA ligase, the Klenow fragment of DNA polymerase I, and T7 and Taq DNA polymerase. Since no special equipment is needed for this purification method, 20 or more samples of microgram to milligram levels can be treated in parallel.

  20. Cationic lipids delay the transfer of plasmid DNA to lysosomes.

    Science.gov (United States)

    Wattiaux, R; Jadot, M; Laurent, N; Dubois, F; Wattiaux-De Coninck, S

    1996-10-14

    Plasmid 35S DNA, naked or associated with different cationic lipid preparations was injected to rats. Subcellular distribution of radioactivity in the liver one hour after injection, was established by centrifugation methods. Results show that at that time, 35S DNA has reached lysosomes. On the contrary, when 35S DNA was complexed with lipids, radioactivity remains located in organelles whose distribution after differential and isopycnic centrifugation, is clearly distinct from that of arylsulfatase, lysosome marker enzyme. Injection of Triton WR 1339, a specific density perturbant of lysosomes, four days before 35S DNA injection causes a density decrease of radioactivity bearing structures, apparent one hour after naked 35S DNA injection but visible only after more than five hours, when 35S DNA associated with a cationic lipid is injected. These observations show that cationic lipids delay the transfer to lysosomes, of plasmid DNA taken up by the liver.

  1. Toxin Kid uncouples DNA replication and cell division to enforce retention of plasmid R1 in Escherichia coli cells.

    Science.gov (United States)

    Pimentel, Belén; Nair, Radhika; Bermejo-Rodríguez, Camino; Preston, Mark A; Agu, Chukwuma A; Wang, Xindan; Bernal, Juan A; Sherratt, David J; de la Cueva-Méndez, Guillermo

    2014-02-18

    Worldwide dissemination of antibiotic resistance in bacteria is facilitated by plasmids that encode postsegregational killing (PSK) systems. These produce a stable toxin (T) and a labile antitoxin (A) conditioning cell survival to plasmid maintenance, because only this ensures neutralization of toxicity. Shortage of antibiotic alternatives and the link of TA pairs to PSK have stimulated the opinion that premature toxin activation could be used to kill these recalcitrant organisms in the clinic. However, validation of TA pairs as therapeutic targets requires unambiguous understanding of their mode of action, consequences for cell viability, and function in plasmids. Conflicting with widespread notions concerning these issues, we had proposed that the TA pair kis-kid (killing suppressor-killing determinant) might function as a plasmid rescue system and not as a PSK system, but this remained to be validated. Here, we aimed to clarify unsettled mechanistic aspects of Kid activation, and of the effects of this for kis-kid-bearing plasmids and their host cells. We confirm that activation of Kid occurs in cells that are about to lose the toxin-encoding plasmid, and we show that this provokes highly selective restriction of protein outputs that inhibits cell division temporarily, avoiding plasmid loss, and stimulates DNA replication, promoting plasmid rescue. Kis and Kid are conserved in plasmids encoding multiple antibiotic resistance genes, including extended spectrum β-lactamases, for which therapeutic options are scarce, and our findings advise against the activation of this TA pair to fight pathogens carrying these extrachromosomal DNAs.

  2. Study on the construction of recombinant plasmid coexpressing newcastle disease virus F protein and chicken IL-2

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    This study investigated the protection against the ND in chickens by a recombinant DNA vaccine. A plasmid vector encoding NDV F protein, which is reqired for virus cell fusion and is important for vaccine induced immunity, was used as a model to study how DNA vaccines may be modulated by the simulaneous expression of chicken IL-2. The NDV D26 strain F gene with CMV promotor and BGH polyA signal sequence was amplified by PCR from eukaryotic plasmid pcDNA-F, which contains the full-length NDV F gene, and clond into reconstructed eukaryotic plasmid pcDNA-IL2, which contains chicken IL-2 gene. Restriction endonuclease cleavage and PCR amplification showed that a bicistronic plasmid encoding NDV F gene and chicken IL-2 separately was successfully constructed. Two-week-old SPF chickens were intramuscularly innoculated the recombinant plasmid. Antibody and lymphocyte proliferative assay showed that the humoral and cellular immunity of chickens vaccinated the recombinant plasmid greatly increased compared with those innoculated only plasmid expressing NDV F protein. Challenged with the lethal dose of NDV F48E9 strain, 72% chickens vaccinated recombinant plasmid were survived, and 30% chickens vaccinated plasmid expressing F protein were survived. These results proved the adjuvant effect of chicken IL-2, and further showed that the efficacy of a DNA vaccine can be greatly improved by simultaneous expression of IL-2.

  3. Transduction of plasmid DNA in Streptomyces spp. and related genera by bacteriophage FP43.

    Science.gov (United States)

    McHenney, M A; Baltz, R H

    1988-05-01

    A segment (hft) of bacteriophage FP43 DNA cloned into plasmid pIJ702 mediated high-frequency transduction of the resulting plasmid (pRHB101) by FP43 in Streptomyces griseofuscus. The transducing particles contained linear concatemers of plasmid DNA. Lysates of FP43 prepared on S. griseofuscus containing pRHB101 also transduced many other Streptomyces species, including several that restrict plaque formation by FP43 and at least two that produce restriction endonucleases that cut pRHB101 DNA. Transduction efficiencies in different species were influenced by the addition of anti-FP43 antiserum to the transduction plates, the temperature for cell growth before transduction, the multiplicity of infection, and the host on which the transducing lysate was prepared. FP43 lysates prepared on S. griseofuscus(pRHB101) also transduced species of Streptoverticillium, Chainia, and Saccharopolyspora.

  4. Replicon typing of plasmids carrying blaCTX-M-15 among Enterobacteriaceae isolated at the environment, livestock and human interface.

    Science.gov (United States)

    Zurfluh, Katrin; Glier, Melinda; Hächler, Herbert; Stephan, Roger

    2015-07-15

    One of the currently most important antibiotic resistance mechanisms in Enterobacteriaceae is based on the production of ESBL enzymes that inactivate β-lactam antibiotics including cephalosporins and monobactams by hydrolyzing their β-lactam ring. In humans, the most prevalent ESBL enzyme type is encoded by blaCTX-M-15. CTX-M-15 producing enterobacterial strains were also frequently isolated from environmental samples including surface water and freshwater fish. Plasmids, which can be grouped in different plasmid incompatibility types, play a key role in the horizontal spread of these multidrug resistance genes. The purpose of this study was to investigate the diversity of plasmids that carry blaCTX-M-15 genes among Enterobacteriaceae isolated at the environment, livestock and human interface. In total, 81 blaCTX-M-15-harboring isolates collected between 2009 and 2014 were tested for its ability to transfer blaCTX-M-15 by conjugation. These plasmids were further typed. Transfer of a single blaCTX-M-15-harboring plasmid was observed in 32 (39.5%) of the isolates. The most frequent replicon types detected among these plasmids are IncF-type plasmids (n=12) (mostly multi replicon plasmids with a combination of following replicons: IncFII, IncFIA and IncFIB), followed by IncI1 (n=8), IncK (n=3) and IncR (n=1). A noticeable number of plasmids (n=8) could not be assigned to any of the tested replicon types. Knowledge about the plasmid types circulating in bacterial populations is indispensable for understanding epidemiological dynamics and for establishing intervention strategies to stop further dissemination of particular plasmids.

  5. Exponential megapriming PCR (EMP) cloning--seamless DNA insertion into any target plasmid without sequence constraints.

    Science.gov (United States)

    Ulrich, Alexander; Andersen, Kasper R; Schwartz, Thomas U

    2012-01-01

    We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts.

  6. Exponential megapriming PCR (EMP cloning--seamless DNA insertion into any target plasmid without sequence constraints.

    Directory of Open Access Journals (Sweden)

    Alexander Ulrich

    Full Text Available We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts.

  7. Transformation of Azotobacter vinelandii OP with a broad host range plasmid containing a cloned chromosomal nif-DNA marker.

    Science.gov (United States)

    Bingle, W H

    1988-05-01

    The non-nitrogen-fixing (Nif-) strain UW10 of Azotobacter vinelandii OP (UW) was naturally induced to competence and transformed with broad host range plasmid pKT210 containing the cloned wild-type nif-10 locus from A. vinelandii UW (Nif+); this marker was unable to complement the nif-10 mutation in trans, but could through recombination with the chromosome. The most frequent type of transformation event observed was recombination between the homologous regions of the plasmid and chromosome (producing Nif+ transformants) with loss of the plasmid vector. At a substantially lower frequency, transformants expressing the plasmid-encoded antibiotic resistance determinants were isolated which were phenotypically Nif-. Agarose gel electrophoresis showed that these transformants contained a plasmid migrating with the same mobility as the original donor plasmid. During culture these transformants acquired a Nif+ phenotype without the loss of the plasmid, as judged by the use of a hybridization probe specific for the cloned nif-DNA fragment. These data indicate that plasmids carrying sequences homologous to chromosomal sequences could be maintained in recombination-proficient A. vinelandii UW. The introduction of plasmids containing sequences homologous to chromosomal sequences was facilitated by prelinearization of the plasmid using a restriction endonuclease generating cohesive ends. Because the site of linearization could be chosen outside the region of shared homology, it was unlikely that the route of plasmid establishment occurred via a homology-facilitated transformation mechanism. The data also indicated that A. vinelandii UW could harbor broad host range cloning vectors based on plasmid RSF1010 without significant impairment of its nitrogen-fixation ability.

  8. Improvement of PCR reaction conditions for site-directed mutagenesis of big plasmids

    Institute of Scientific and Technical Information of China (English)

    Bogdan MUNTEANU; Mario BRAUN; Kajohn BOONROD

    2012-01-01

    QuickChange mutagenesis is the method of choice for site-directed mutagenesis (SDM) of target sequences in a plasmid.It can be applied successfully to small plasmids (up to 10 kb).However,this method cannot efficiently mutate bigger plasmids.Using KOD Hot Start polymerase in combination with high performance liquid chromatography (HPLC) purified primers,we were able to achieve SDM in big plasmids (up to 16 kb) involving not only a single base change but also multiple base changes.Moreover,only six polymerase chain reaction (PCR) cycles and 0.5 μl of polymerase (instead of 18 PCR cycles and 1.0 μl of enzyme In the standard protocol) were sufficient for the reaction.

  9. [Plasmid characteristics of naphthalene and salicylate biodegradation in Pseudomonas putida].

    Science.gov (United States)

    Zakharian, R A; Bakunin, K A; Gasparian, N S; Kocharian, Sh M; Arakelov, G M

    1980-01-01

    The object of this work was to study the physico-chemical and biological properties of DNAs of the biodegradation plasmids NAH and SAL. A comparative analysis of the physico-chemical parameters for these DNAs made it possible to detect a number of identical properties in them: the same sedimentation profile for covalently-closed circular DNA forms, 68--70 S; the molecular weight of ca. 50 MD; a roughly equal number of fragments (up to 23) was found when the DNAs of NAH and SAL were restricted by EcoRI endonuclease. The transformation of the plasmidless strain PpGI was done.

  10. Calorie restriction and stroke

    Directory of Open Access Journals (Sweden)

    Manzanero Silvia

    2011-09-01

    Full Text Available Abstract Stroke, a major cause of disability and mortality in the elderly, occurs when a cerebral blood vessel is occluded or ruptured, resulting in ischemic damage and death of brain cells. The injury mechanism involves metabolic and oxidative stress, excitotoxicity, apoptosis and inflammatory processes, including activation of glial cells and infiltration of leukocytes. In animal models, dietary energy restriction, by daily calorie reduction (CR or intermittent fasting (IF, extends lifespan and decreases the development of age-related diseases. Dietary energy restriction may also benefit neurons, as suggested by experimental evidence showing that CR and IF protect neurons against degeneration in animal models. Recent findings by our group and others suggest the possibility that dietary energy restriction may protect against stroke induced brain injury, in part by inducing the expression of neurotrophic factors, such as brain-derived neurotrophic factor (BDNF and basic fibroblast growth factor (bFGF; protein chaperones, including heat shock protein 70 (Hsp70 and glucose regulated protein 78 (GRP78; antioxidant enzymes, such as superoxide dismutases (SOD and heme oxygenase-1 (HO-1, silent information regulator T1 (SIRT1, uncoupling proteins and anti-inflammatory cytokines. This article discusses the protective mechanisms activated by dietary energy restriction in ischemic stroke.

  11. Persistence of Antibiotic Resistance Plasmids in Biofilms

    Science.gov (United States)

    2014-10-01

    plasmids* in*populations*of* Gram > negative *bacteria*grown*in*biofilms*and*well>mixed*liquid*cultures.** * Task2:*Characterize*the*evolution*of*plasmid...R.! Edwards.! 2005.! Overview! of! nosocomial! infections! caused! by! gramP negative ! bacilli .!Clin.!Infect.!Dis.!41:848P854.! LoftiePEaton,!W.,!A... negative ! interaction!between!one!of! its!chromosomal!segments!and!the!plasmid! by!simply!deleting!the!appropriate!chromosomal!segment.!! 7. None

  12. Effects of the presence of ColE1 plasmid DNA in Escherichia coli on the host cell metabolism

    Directory of Open Access Journals (Sweden)

    Węgrzyn Alicja

    2006-11-01

    Full Text Available Abstract Background Although understanding of physiological interactions between plasmid DNA and its host is important for vector design and host optimization in many biotechnological applications, to our knowledge, global studies on plasmid-host interactions have not been performed to date even for well-characterized plasmids. Results Escherichia coli cells, either devoid of plasmid DNA or bearing plasmid pOri1 (with a single ColE1 replication origin or plasmid pOri2 (with double ColE1 replication origins, were cultured in a chemostat. We used a combination of metabolic flux analysis, DNA microarray and enzyme activity analysis methods to explore differences in the metabolism between these strains. We found that the presence of plasmids significantly influenced various metabolic pathways in the host cells, e.g. glycolysis, the tricarboxylic acid (TCA cycle and the pentose phosphate (PP pathway. Expression of rpiA, a gene coding for ribose-5-phosphate isomerase A, was considerably decreased in E. coli carrying a high copy number plasmid relative to E. coli carrying a low copy number plasmid and plasmid-free E. coli. The rpiA gene was cloned into an expression vector to construct plasmid pETrpiA. Following induction of pETrpiA-bearing E. coli, which harbored either pOri1 or pOri2, with isopropyl-β-D-thiogalactopyranoside (IPTG, the copy number of pOri1 and pOri2 was sigificantly higher than that measured in a host devoid of pETrpiA. Conclusion The presence of plasmids can significantly influence some metabolic pathways in the host cell. We believe that the results of detailed metabolic analysis may be useful in optimizing host strains, vectors and cultivation conditions for various biotechnological purposes.

  13. AQUA Cloning: A Versatile and Simple Enzyme-Free Cloning Approach.

    Directory of Open Access Journals (Sweden)

    Hannes M Beyer

    Full Text Available Assembly cloning is increasingly replacing conventional restriction enzyme and DNA-ligase-dependent cloning methods for reasons of efficiency and performance. Here, we describe AQUA (advanced quick assembly, a simple and versatile seamless assembly cloning approach. We demonstrate the applicability and versatility of AQUA Cloning in selected proof-of-principle applications including targeted insertion-, deletion- and site-directed point-mutagenesis, and combinatorial cloning. Furthermore, we show the one pot de novo assembly of multiple DNA fragments into a single circular plasmid encoding a complex light- and chemically-regulated Boolean A NIMPLY B logic operation. AQUA Cloning harnesses intrinsic in vivo processing of linear DNA fragments with short regions of homology of 16 to 32 bp mediated by Escherichia coli. It does not require any kits, enzymes or preparations of reagents and is the simplest assembly cloning protocol to date.

  14. Plasmid profiles of Moraxella bovis isolates.

    Science.gov (United States)

    McDonald, T J; Pugh, G W

    1986-04-01

    Two-hundred isolates of Moraxella bovis were selected at random and examined for the presence of plasmid DNA by a rapid alkaline-detergent lysis method. All isolates contained from 1 to 6 plasmids, with varying agarose-gel electrophoretic migration patterns. Most (80%) isolates carried 2 to 4 plasmids, which ranged in molecular weight from 2.6 to 80 megadaltons. Seemingly, plasmid profiles can be used as a simple, reliable epizootiologic tool to establish a strain identification scheme for M bovis.

  15. Plasmid transfer systems in the rhizobia.

    Science.gov (United States)

    Ding, Hao; Hynes, Michael F

    2009-08-01

    Rhizobia are agriculturally important bacteria that can form nitrogen-fixing nodules on the roots of leguminous plants. Agricultural application of rhizobial inoculants can play an important role in increasing leguminous crop yields. In temperate rhizobia, genes involved in nodulation and nitrogen fixation are usually located on one or more large plasmids (pSyms) or on symbiotic islands. In addition, other large plasmids of rhizobia carry genes that are beneficial for survival and competition of rhizobia in the rhizosphere. Conjugative transfer of these large plasmids thus plays an important role in the evolution of rhizobia. Therefore, understanding the mechanism of conjugative transfer of large rhizobial plasmids provides foundations for maintaining, monitoring, and predicting the behaviour of these plasmids during field release events. In this minireview, we summarize two types of known rhizobial conjugative plasmids, including quorum sensing regulated plasmids and RctA-repressed plasmids. We provide evidence for the existence of a third type of conjugative plasmid, including pRleVF39c in Rhizobium leguminosarum bv. viciae strain VF39SM, and we provide a comparison of the different types of conjugation genes found in members of the rhizobia that have had their genomes sequenced so far.

  16. Cultivation-independent screening revealed hot spots of IncP-1, IncP-7 and IncP-9 plasmid occurrence in different environmental habitats

    NARCIS (Netherlands)

    Dealtry, Simone; Ding, Guo-Chun; Weichelt, Viola; Dunon, Vincent; Schlüter, Andreas; Martini, María Carla; Del Papa, María Florencia; Lagares, Antonio; Amos, Gregory Charles Auton; Wellington, Elizabeth Margaret Helen; Gaze, William Hugo; Sipkema, Detmer; Sjöling, Sara; Springael, Dirk; Heuer, Holger; van Elsas, Jan Dirk; Thomas, Christopher; Smalla, Kornelia

    2014-01-01

    IncP-1, IncP-7 and IncP-9 plasmids often carry genes encoding enzymes involved in the degradation of man-made and natural contaminants, thus contributing to bacterial survival in polluted environments. However, the lack of suitable molecular tools often limits the detection of these plasmids in the

  17. Effect of chromosome homology an plasmid transformation and plasmid conjugal transfer in Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    Balganesh, M.; Setlow, J.K.

    1984-05-14

    The pairing between plasmid and the homologous part of the chromosome associated with plasmid establishment may differ from the pairing which results from integration of a homologous region of the plasmid into the chromosome. Thus the rate of novobiocin transformation decreases with duplication of the chromosomal portion in pMB2, but the rate of establishment of the plasmid increases with this duplication. A model to explain these data is given. 17 references, 5 figures, 4 tables.

  18. High-frequency conjugal plasmid transfer from gram-negative Escherichia coli to various gram-positive coryneform bacteria.

    Science.gov (United States)

    Schäfer, A; Kalinowski, J; Simon, R; Seep-Feldhaus, A H; Pühler, A

    1990-03-01

    We report on the mobilization of shuttle plasmids from gram-negative Escherichia coli to gram-positive corynebacteria mediated by P-type transfer functions. Introduction of plasmids into corynebacteria was markedly enhanced after heat treatment of the recipient cells. High-frequency plasmid transfer was also observed when the restriction system of the recipient was mutated. On the basis of our data, we conclude that efficient DNA transfer from gram-negative to gram-positive bacteria, at least to coryneform bacteria, is conceivable in certain natural ecosystems.

  19. The expression of a plasmid-specified exported protein causes structural plasmid instability in Bacillus subtilis

    NARCIS (Netherlands)

    Cordes, C.; Meima, R; Twiest, B; Kazemier, B; Venema, G; vanDijl, JM; Bron, S

    The rolling-circle plasmid pGP1 was used to study the effects of the expression of a plasmid-specified exported protein on structural plasmid stability in Bacillus subtilis. pGP1 contains a fusion between the Bacillus licheniformis penP gene, encoding a C-terminally truncated penicillinase, and the

  20. Recursive directional ligation by plasmid reconstruction allows rapid and seamless cloning of oligomeric genes.

    Science.gov (United States)

    McDaniel, Jonathan R; Mackay, J Andrew; Quiroz, Felipe García; Chilkoti, Ashutosh

    2010-04-12

    This paper reports a new strategy, recursive directional ligation by plasmid reconstruction (PRe-RDL), to rapidly clone highly repetitive polypeptides of any sequence and specified length over a large range of molecular weights. In a single cycle of PRe-RDL, two halves of a parent plasmid, each containing a copy of an oligomer, are ligated together, thereby dimerizing the oligomer and reconstituting a functional plasmid. This process is carried out recursively to assemble an oligomeric gene with the desired number of repeats. PRe-RDL has several unique features that stem from the use of type IIs restriction endonucleases: first, PRe-RDL is a seamless cloning method that leaves no extraneous nucleotides at the ligation junction. Because it uses type IIs endonucleases to ligate the two halves of the plasmid, PRe-RDL also addresses the major limitation of RDL in that it abolishes any restriction on the gene sequence that can be oligomerized. The reconstitution of a functional plasmid only upon successful ligation in PRe-RDL also addresses two other limitations of RDL: the significant background from self-ligation of the vector observed in RDL, and the decreased efficiency of ligation due to nonproductive circularization of the insert. PRe-RDL can also be used to assemble genes that encode different sequences in a predetermined order to encode block copolymers or append leader and trailer peptide sequences to the oligomerized gene.

  1. KPC-mediated resistance in Klebsiella pneumoniae in two hospitals in Padua, Italy, June 2009-December 2011: massive spreading of a KPC-3-encoding plasmid and involvement of non-intensive care units

    Directory of Open Access Journals (Sweden)

    Richter Sara N

    2012-07-01

    Full Text Available Abstract Background Klebsiella pneumoniae carbapenemases (KPCs producing bacteria have emerged as a cause of multidrug-resistant nosocomial infections worldwide. KPCs are plasmid-encoded enzymes capable of hydrolysing a broad spectrum of beta-lactams, including carbapenems and monobactams, therefore worryingly limiting antimicrobial treatment options. Analysis of circulating bacterial strains and KPC alleles may help understanding the route of KPC dissemination and therefore help containing the infection. Methods KPC-producing Klebsiella pneumoniae dissemination in two 1580- and 300- bed hospitals in Padua, Italy, from initial outbreak in 2009 to late 2011 was analysed. Molecular and clinical epidemiology, including bacterial strains, KPC-encoding plasmid sequences and associated resistance genes, involved hospital wards and relocation of patients were described. Routine antimicrobial susceptibility testing and MIC of carbapenems on clinical isolates were performed. Detection of resistance genes was obtained by PCR and sequencing. MLST, PFGE and ERIC were used for molecular genotyping. Plasmid analysis was obtained by digestion with restriction enzymes and deep sequencing. Results KPC-positive clinical samples were isolated from nearly 200 patients. In the initial outbreak intensive care units were almost exclusively involved, while medical, surgical and long-term wards were successively massively concerned. Analysis of KPC alleles, plasmids and bacterial sequence types (STs indicated that during the initial outbreak KPC-3 in ST258 and KPC-2 in ST147 were each confined in one of the two surveilled hospitals. While KPC-2 dissemination was effectively contained, KPC-3 in ST258 cross-spreading was observed. The simultaneous presence of two carbapenemases, VIM-1 and KPC-2, in the same isolate was also observed in three patients. Total sequencing of plasmid content of two KPC-3 strains showed novel association of resistance plasmids. Conclusions The

  2. Integration host factor is required for replication of pYGK-derived plasmids in Aggregatibacter actinomycetemcomitans.

    Science.gov (United States)

    Torres-Escobar, Ascención; Juárez-Rodríguez, María D; Demuth, Donald R

    2014-08-01

    In this study, we show that integration host factor protein (IHF) is required for replication of pYGK plasmids in Aggregatibacter actinomycetemcomitans. YGK plasmids were not replicated in A. actinomycetemcomitans strains lacking either the α- or β- subunit of IHF. However, the deletion mutants were complemented, and plasmid replication was restored when the promoter region and gene for either ihfA or ihfB was cloned into pYGK. We also identified two motifs that resemble the consensus IHF-binding site in a 813-bp fragment containing the pYGK origin of replication. Using electrophoretic mobility shift assays, purified IHFα-IHFβ protein complex was shown to bind to probes containing either of these motifs. To our knowledge, this is the first report showing that plasmid replication is IHF-dependent in the family Pasteurellaceae. In addition, using site-direct mutagenesis, the XbaI and KpnI restriction sites in the suicide vector pJT1 were modified to generate plasmid pJT10. The introduction of these new unique sites in pJT10 facilitates the transfer of transcriptional or translational lacZ fusion constructs for the generation of single-copy chromosomal insertion of the reporter construct. Plasmid pJT10 and its derivatives will be useful for genetic studies in Aggregatibacter (Actinobacillus) and probably other genera of Pasteurellaceae, including Haemophilus, Pasteurella, and Mannheimia.

  3. TOL PLASMID-SPECIFIED XYLENE OXYGENASE IS A WIDE SUBSTRATE RANGE MONOOXYGENASE CAPABLE OF OLEFIN EPOXIDATION

    NARCIS (Netherlands)

    Wubbolts, Marcel; REUVEKAMP, P; Witholt, Bernard

    1994-01-01

    Xylene oxygenase, which is encoded on the TOL plasmid pWWO of Pseudomonas putida mt-2, is a key enzyme system in the degradation of toluene and xylenes by this organism. It was expressed in an Escherichia coli recombinant strain carrying the xy1MA structural genes. This recombinant, which expressed

  4. Erwinia amylovora novel plasmid pEI70: complete sequence, biogeography, and role in aggressiveness in the fire blight phytopathogen.

    Directory of Open Access Journals (Sweden)

    Pablo Llop

    Full Text Available Comparative genomics of several strains of Erwinia amylovora, a plant pathogenic bacterium causal agent of fire blight disease, revealed that its diversity is primarily attributable to the flexible genome comprised of plasmids. We recently identified and sequenced in full a novel 65.8 kb plasmid, called pEI70. Annotation revealed a lack of known virulence-related genes, but found evidence for a unique integrative conjugative element related to that of other plant and human pathogens. Comparative analyses using BLASTN showed that pEI70 is almost entirely included in plasmid pEB102 from E. billingiae, an epiphytic Erwinia of pome fruits, with sequence identities superior to 98%. A duplex PCR assay was developed to survey the prevalence of plasmid pEI70 and also that of pEA29, which had previously been described in several E. amylovora strains. Plasmid pEI70 was found widely dispersed across Europe with frequencies of 5-92%, but it was absent in E. amylovora analyzed populations from outside of Europe. Restriction analysis and hybridization demonstrated that this plasmid was identical in at least 13 strains. Curing E. amylovora strains of pEI70 reduced their aggressiveness on pear, and introducing pEI70 into low-aggressiveness strains lacking this plasmid increased symptoms development in this host. Discovery of this novel plasmid offers new insights into the biogeography, evolution and virulence determinants in E. amylovora.

  5. Erwinia amylovora novel plasmid pEI70: complete sequence, biogeography, and role in aggressiveness in the fire blight phytopathogen.

    Science.gov (United States)

    Llop, Pablo; Cabrefiga, Jordi; Smits, Theo H M; Dreo, Tanja; Barbé, Silvia; Pulawska, Joanna; Bultreys, Alain; Blom, Jochen; Duffy, Brion; Montesinos, Emilio; López, María M

    2011-01-01

    Comparative genomics of several strains of Erwinia amylovora, a plant pathogenic bacterium causal agent of fire blight disease, revealed that its diversity is primarily attributable to the flexible genome comprised of plasmids. We recently identified and sequenced in full a novel 65.8 kb plasmid, called pEI70. Annotation revealed a lack of known virulence-related genes, but found evidence for a unique integrative conjugative element related to that of other plant and human pathogens. Comparative analyses using BLASTN showed that pEI70 is almost entirely included in plasmid pEB102 from E. billingiae, an epiphytic Erwinia of pome fruits, with sequence identities superior to 98%. A duplex PCR assay was developed to survey the prevalence of plasmid pEI70 and also that of pEA29, which had previously been described in several E. amylovora strains. Plasmid pEI70 was found widely dispersed across Europe with frequencies of 5-92%, but it was absent in E. amylovora analyzed populations from outside of Europe. Restriction analysis and hybridization demonstrated that this plasmid was identical in at least 13 strains. Curing E. amylovora strains of pEI70 reduced their aggressiveness on pear, and introducing pEI70 into low-aggressiveness strains lacking this plasmid increased symptoms development in this host. Discovery of this novel plasmid offers new insights into the biogeography, evolution and virulence determinants in E. amylovora.

  6. Restricted Mobilities

    DEFF Research Database (Denmark)

    Nielsen, Mette; Lassen, Claus

    2012-01-01

    communities and shopping centres through mobility lenses. The article shows how different mobility systems enable and restrict the public access to private-public spaces, and it points out that proprietary communities create an unequal potential for human movement and access in the city. The main argument......Privatisation of public spaces in the contemporary city has increased during the last decades but only few studies have approached this field from a mobility perspective. Therefore the article seeks to rectify this by exploring two Australian examples of private spaces in the city; gated...... in the article is that the many mobility systems enable specialization of places that are targeted at a special section of the population. This means that various forms of motilities not only create new opportunities for urban life but it is also one of the most critical components of production of new exclusion...

  7. Construction of pGEX-4T-2-PLEKHQ1 prokaryotic plasmid and pCMV-Myc-PLEKHQ1 eukaryotic plasmid and their protein expression%原核质粒pGEX-4T-2-PLEKHQ1及真核质粒pCMV-Myc-PLEKHQ1的构建与蛋白表达

    Institute of Scientific and Technical Information of China (English)

    陆琤; 周晨辰; 张鹏飞; 张硌

    2015-01-01

    目的:构建基因PLEKHQ1的原核质粒及真核质粒。方法:全长编码基因PLEKHQ1的聚合酶链反应(PCR)产物经EcoRⅠ和Kpn1双酶切后,分别与双酶切后的载体pGEX-4T-2及载体pCMV-Myc相连,在pGEX-4T-2-PLEKHQ1转化E.coli DH5α提取质粒后,转化E.coli BL21中诱导GST-Q1融合蛋白表达,利用谷胱甘肽琼脂糖4B纯化诱导的融合蛋白;而pCMV-Myc-PLEKHQ1则瞬转至293TX细胞;用蛋白质印迹法(Western blot)检测GST-Q1和Myc-Q1融合蛋白表达。结果:将获得的重组质粒进行双酶切鉴定,得到约1500 bp的目的片段,符合预计大小。质粒经测序分析正确后,Western blot检测到诱导及纯化后的GST-Q1和转染293TX后的Myc-Q1蛋白。结论:成功构建的pGEX-4T-2-PLEKHQ1和pCMV-Myc-PLEKHQ1重组质粒,为深入研究PLEKHQ1功能奠定良好的基础。%Objective:To construct prokaryotic plasmid and eukaryotic plasmid of PLEKHQ1 gene. Methods: The PCR product of the PLEKHQ1 coding sequence, which was digested with EcoR1 and Kpn1 restriction enzymes, was taped into the plasmid pGEX-4T-2 and pCMV-Myc. Then pGEX-4T-2-PLEKHQ1 was transformed into E.coli DH5α and plasmid DNA was extracted. After that, the expression of GST-Q1 fusion protein was induced in BL21 and was purified by Glutathione Sepharose 4B. While the pCMV-Myc-PLEKHQ1 was transfected into TX cells. The expression of both GST-Q1 and Myc-Q1 was detected by Western blot. Results:The restriction enzyme digestion showed target fragment of 1500bp, which was as expected. The recombinant plasmid was sequenced right and GST-Q1 protein and Myc-Q1 protein could be detected by Western blot. Conclusion:The recombinant prokaryotic plasmid and eukaryotic expression plasmid were successfully constructed, which laid a foundation for further research for PLEKHQ1.

  8. Inhibition of DNA restrictive endonucleases by aqueous nanoparticle suspension of methanophosphonate fullerene derivatives and its mechanisms

    Institute of Scientific and Technical Information of China (English)

    SONG GaoGuang; YAO Lu; HUANG Cheng; XIE Xin; TAN Xin; YANG XinLin

    2009-01-01

    Aqueous nanoparticle suspension of fullerene and its derivatives are currently attracting much atten-tion. To determine the effects of aqueous nanoparticle suspension of a mono-methanophosphonate fuIlerene and bis-methanophosphonate fuIlerene (denoted as n-MMPF and n-BMPF, respectively) on the activities of ONA restrictive endonucleases, plasmid pEGFP-N1 was cleaved at a single but differently restrictive site by EcoR I, BamH I, and isozymes Cfr9 I and Xma I, respectively. Both n-MMPF and n-BMPF inhibited the activity of EcoR I, while n-BMPF exhibited stronger inhibition than n-MMPF. Addi-tion of n-BMPF into reaction mixtures inhibited the activities of all the four enzymes, and IC50 values for EcoR I, BamH I, Cfr9 I and Xma I were 4.3, 30, 11.7 and 8.3 μmol/L, respectively. When EcoR I was completely inhibited by n-BMPF, addition of excess amounts of pEGFP-N1 could not produce the product linear plasmid; however, increase of EcoR I amounts antagonized EcoR I inhibition of n-BMPF. Two scavengers of reactive oxygen species (ROS), mannitol and sodium azide at the concentrations of 2-10 mmool/L, did not reverse inhibition of n-BMPF, implying that this inhibition probably is not corre-lated to ROS. These results suggested that aqueous nano-fullerenee might act as inhibitors of DNA restrictive endonucleases.

  9. Inhibition of DNA restrictive endonucleases by aqueous nanoparticle suspension of methanophosphonate fullerene derivatives and its mechanisms

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Aqueous nanoparticle suspension of fullerene and its derivatives are currently attracting much attention. To determine the effects of aqueous nanoparticle suspension of a mono-methanophosphonate fullerene and bis-methanophosphonate fullerene (denoted as n-MMPF and n-BMPF, respectively) on the activities of DNA restrictive endonucleases, plasmid pEGFP-N1 was cleaved at a single but differently restrictive site by EcoR I, BamH I, and isozymes Cfr9 I and Xma I, respectively. Both n-MMPF and n-BMPF inhibited the activity of EcoR I, while n-BMPF exhibited stronger inhibition than n-MMPF. Addition of n-BMPF into reaction mixtures inhibited the activities of all the four enzymes, and IC50 values for EcoR I, BamH I, Cfr9 I and Xma I were 4.3, >30, 11.7 and 8.3 μmol/L, respectively. When EcoR I was completely inhibited by n-BMPF, addition of excess amounts of pEGFP-N1 could not produce the product linear plasmid; however, increase of EcoR I amounts antagonized EcoR I inhibition of n-BMPF. Two scavengers of reactive oxygen species (ROS), mannitol and sodium azide at the concentrations of 2-10 mmol/L, did not reverse inhibition of n-BMPF, implying that this inhibition probably is not correlated to ROS. These results suggested that aqueous nano-fullerenes might act as inhibitors of DNA restrictive endonucleases.

  10. Attenuation of Symbiotic Effectiveness by Rhizobium meliloti SAF22 Related to the Presence of a Cryptic Plasmid

    OpenAIRE

    Velazquez, E.; Mateos, P. F.; Pedrero, P.; Dazzo, F. B.; Martinez-Molina, E.

    1995-01-01

    Several wild-type strains of Rhizobium meliloti isolated from alfalfa nodules exhibited different plasmid profiles, yet did not differ in growth rate in yeast-mannitol medium, utilization of 43 different carbon sources, intrinsic resistance to 14 antibiotics, or detection of 16 enzyme activities. In contrast, three measures of effectiveness in symbiotic nitrogen fixation with alfalfa (shoot length, dry weight, and nitrogen content) indicated that R. meliloti SAF22, whose plasmid profile diffe...

  11. Genetic diversity of Xanthomonas axonopodis pv. citri based on plasmid profile and pulsed field gel electrophoresis

    Directory of Open Access Journals (Sweden)

    Carvalho Flávia Maria de Souza

    2005-01-01

    Full Text Available Xanthomonas axonopodis pv. citri strains that cause disease in citrus were investigated by pulsed field and plasmid profile analysis. For the first method, genomic DNA was digested by the rare-cutting enzymes Xba I and Vsp I. The strains evaluated were collected in seven different States of Brazil and in Argentina, Bolivia, Paraguay and Uruguay. Genetic variability was found among strains of X. axonopodis pv. citri from different geographical areas Argentina, Bolivia and Uruguay, with similarities varying from 0.62 to 0.83. However, the strains collected in Brazil, despite being from different States, have shown a genetic similarity ranging from 0.83 to 1.00. Cluster analysis showed a relationship between genomic similarity and geographical origin of the strains. Plasmids were observed in all strains, with a total of five different plasmids, with sizes between 57.7 and 83.0 kilobases. The 72.6 kb plasmid was the most frequent, present in 15 out of 22 strains, while the 68.1 kb plasmid was observed in two strains only. Although the plasmid diversity detected in the present study was not very great, the X. axonopodis pv. citri strains evaluated showed a considerable degree of diversity with regard to this extrachromosomal genetic element.

  12. Genomics of high molecular weight plasmids isolated from an on-farm biopurification system.

    Science.gov (United States)

    Martini, María C; Wibberg, Daniel; Lozano, Mauricio; Torres Tejerizo, Gonzalo; Albicoro, Francisco J; Jaenicke, Sebastian; van Elsas, Jan Dirk; Petroni, Alejandro; Garcillán-Barcia, M Pilar; de la Cruz, Fernando; Schlüter, Andreas; Pühler, Alfred; Pistorio, Mariano; Lagares, Antonio; Del Papa, María F

    2016-06-20

    The use of biopurification systems (BPS) constitutes an efficient strategy to eliminate pesticides from polluted wastewaters from farm activities. BPS environments contain a high microbial density and diversity facilitating the exchange of information among bacteria, mediated by mobile genetic elements (MGEs), which play a key role in bacterial adaptation and evolution in such environments. Here we sequenced and characterized high-molecular-weight plasmids from a bacterial collection of an on-farm BPS. The high-throughput-sequencing of the plasmid pool yielded a total of several Mb sequence information. Assembly of the sequence data resulted in six complete replicons. Using in silico analyses we identified plasmid replication genes whose encoding proteins represent 13 different Pfam families, as well as proteins involved in plasmid conjugation, indicating a large diversity of plasmid replicons and suggesting the occurrence of horizontal gene transfer (HGT) events within the habitat analyzed. In addition, genes conferring resistance to 10 classes of antimicrobial compounds and those encoding enzymes potentially involved in pesticide and aromatic hydrocarbon degradation were found. Global analysis of the plasmid pool suggest that the analyzed BPS represents a key environment for further studies addressing the dissemination of MGEs carrying catabolic genes and pathway assembly regarding degradation capabilities.

  13. TEM-1-encoding small plasmids impose dissimilar fitness costs on Haemophilus influenzae and Haemophilus parainfluenzae.

    Science.gov (United States)

    Søndergaard, Annette; Lund, Marianne; Nørskov-Lauritsen, Niels

    2015-12-01

    Only two beta-lactamases, TEM-1 and ROB-1, have been observed in Haemophilus influenzae, while four different TEM but no ROB enzymes have been found in Haemophilus parainfluenzae. In order to investigate the mechanisms behind the dissemination of small beta-lactamase-encoding plasmids in H. influenzae and H. parainfluenzae, we assessed the fitness cost of three TEM-1- (pPN223, pA1209, pA1606), one TEM-15- (pSF3) and one ROB-1-bearing (pB1000) plasmid when expressed in either bacterial species. All plasmids were stable in H. influenzae and H. parainfluenzae except pB1000, which showed on average (sample mean) 76% curing in H. parainfluenzae after 5  days of subculture. Competition assays between isogenic strains with and without plasmid showed no competitive disadvantage of pPN223 and pA1606 in H. influenzae, or of pA1209 in H. parainfluenzae. In contrast, pSF3 and pB1000 were associated with significant competitive disadvantages in both species. Some of the competitive disadvantages may be related to differences in plasmid copy number and mRNA expression of the beta-lactamase genes, as revealed by quantitative PCR analysis. In conclusion, plasmids encoding TEM beta-lactamases isolated from H. influenzae and H. parainfluenzae can be stably transferred between species. The fast curing of pB1000 in H. parainfluenzae observed in this study correlates to the fact that ROB-1 has never been reported for this species. TEM-1-encoding plasmids are associated with the lowest level of fitness cost, but different TEM-1 plasmids confer different levels of fitness cost on the two hosts.

  14. Evidence that plasmid-borne botulinum neurotoxin type B genes are widespread among Clostridium botulinum serotype B strains.

    Directory of Open Access Journals (Sweden)

    Giovanna Franciosa

    Full Text Available BACKGROUND: Plasmids that encode certain subtypes of the botulinum neurotoxin type B have recently been detected in some Clostridium botulinum strains. The objective of the present study was to investigate the frequency with which plasmid carriage of the botulinum neurotoxin type B gene (bont/B occurs in strains of C. botulinum type B, Ab, and A(B, and whether plasmid carriage is bont/B subtype-related. METHODOLOGY/PRINCIPAL FINDINGS: PCR-Restriction fragment length polymorphism was employed to identify subtypes of the bont/B gene. Pulsed-field gel electrophoresis and Southern blot hybridization with specific probes were performed to analyze the genomic location of the bont/B subtype genes. All five known bont/B subtype genes were detected among the strains; the most frequently detected subtype genes were bont/B1 and /B2. Surprisingly, the bont/B subtype gene was shown to be plasmid-borne in >50% of the total strains. The same bont/B subtype gene was associated with the chromosome in some strains, whereas it was associated with a plasmid in others. All five known bont/B subtype genes were in some cases found to reside on plasmids, though with varying frequency (e.g., most of the bont/B1 subtype genes were located on plasmids, whereas all but one of the bont/B2 subtypes were chromosomally-located. Three bivalent isolates carried both bont/A and /B genes on the same plasmid. The plasmids carrying the bont gene were five different sizes, ranging from approximately 55 kb to approximately 245 kb. CONCLUSIONS/SIGNIFICANCE: The unexpected finding of the widespread distribution of plasmids harboring the bont/B gene among C. botulinum serotype B strains provides a chance to examine their contribution to the dissemination of the bont genes among heterogeneous clostridia, with potential implications on issues related to pathogenesis and food safety.

  15. Pectic enzymes

    NARCIS (Netherlands)

    Benen, J.A.E.; Voragen, A.G.J.; Visser, J.

    2003-01-01

    The pectic enzymes comprise a diverse group of enzymes. They consist of main-chain depolymerases and esterases active on methyl- and acetylesters of galacturonosyl uronic acid residues. The depolymerizing enzymes comprise hydrolases as wel as lyases

  16. Pectic enzymes

    NARCIS (Netherlands)

    Benen, J.A.E.; Voragen, A.G.J.; Visser, J.

    2003-01-01

    The pectic enzymes comprise a diverse group of enzymes. They consist of main-chain depolymerases and esterases active on methyl- and acetylesters of galacturonosyl uronic acid residues. The depolymerizing enzymes comprise hydrolases as wel as lyases

  17. Enzyme assays.

    Science.gov (United States)

    Reymond, Jean-Louis; Fluxà, Viviana S; Maillard, Noélie

    2009-01-07

    Enzyme assays are analytical tools to visualize enzyme activities. In recent years a large variety of enzyme assays have been developed to assist the discovery and optimization of industrial enzymes, in particular for "white biotechnology" where selective enzymes are used with great success for economically viable, mild and environmentally benign production processes. The present article highlights the aspects of fluorogenic and chromogenic substrates, sensors, and enzyme fingerprinting, which are our particular areas of interest.

  18. Survivin基因及CDK1基因联合靶向shRNA真核表达载体的构建%Constructing recombinant survivin and CDK1 tandem shRNAs pU6-M4 plasmid

    Institute of Scientific and Technical Information of China (English)

    陈淑萍; 符生苗; 周红桃; 蔡俊宏; 李成学; 王福利; 许茂轩

    2014-01-01

    目的:构建靶向Survivin基因及CDK1基因的短发夹样RNA (Short hairpin RNA,shRNA)真核表达载体。方法根据Genbank报道的Survivin序列及CDK1序列,遵循shRNA设计原则设计并合成各自靶向的Survivin、CDK1基因的shRNA寡核苷酸序列,构建pU6-shRNA-Survivin重组质粒、pU6-shRNA-CDK1重组质粒及pU6-shRNA-Survivin-U6-shRNA-CDK1双基因序列串联重组质粒,并进行限制性内切酶酶切及基因测序鉴定。结果经酶切及测序结果分析,pU6-shRNA-Survivin重组质粒、pU6-shRNA-CDK1重组质粒及pU6-shR-NA-Survivin-U6-shRNA-CDK1双基因系列串联重组质粒均成功构建。结论成功构建Survivin基因及CDK1基因联合靶向shRNA重组质粒,为进一步研究Survivin基因和CDK1基因联合干扰提供了新的方法。%Objective To construct recombinant survivin and CDK1 tandem shRNAs pU6-M4 plasmids. Methods Sequences of survivin and CDK1 and the restriction enzyme cutting sites of them were designed and synthe-sized based on the date from GeneBank. Recombinant plasmids of pU6-M4-Survivin-shRNA and pU6-M4-CDK1-shR-NA were constructed and identified. Two determined plasmids were digested by restriction endonucleases then taped by T4 DNA ligase. The ligated products were transformed into competent TH5a cells, and then the recombinant clones were identified by sequencing. Results Restriction enzyme cleave identification and sequencing proved that recombi-nant survivin and CDK1 tandem shRNAs pU6-M4 plasmids were successfully constructed. Conclusion Recombi-nant survivin and CDK1 tandem shRNAs pU6-M4 plasmids were correctly constructed.

  19. Self-transmissible nif plasmid (pEA9) of Enterobacter agglomerans 339: molecular cloning and evidence for the existence of similar nif clusters on dissimilar plasmids in Enterobacter strains.

    Science.gov (United States)

    Steibl, H D; Siddavattam, D; Klingmüller, W

    1995-11-01

    A cosmid library was generated to the 200-kb self-transmissible nif plasmid pEA9 isolated from Enterobacter agglomerans 339. The cosmid clone identified to contain the complete nif cluster was used to determine the nif gene organization and the physical map. The restriction pattern and nif gene organization of this nif cluster showed remarkable similarities to the nif cluster identified on the 110-kb plasmid pEA3 of Enterobacter agglomerans 333. Nucleotide sequence of several randomly selected regions of the nif cluster of pEA9 showed 96% similarity when compared to the known sequences of the nif cluster of pEA3. However, the homology ended abruptly at the flanking regions of the nif clusters and no similarity could be detected with the rest of the DNA of these plasmids. This reveals the existence of similar nif clusters on dissimilar plasmids, implying the horizontal transfer of the entire nif gene cluster.

  20. Prevalence and molecular characterization of plasmid- mediated ...

    African Journals Online (AJOL)

    lactamase genes among nosocomial Staphylococcus aureus drug resistance isolates in Taiwan. .... Table 2: Plasmid profiles of the clinical antibiotic-resistant pathogens. Strain. Profile .... Madec J. Characterization of clinical canine methicillin-.

  1. antimicrobial susceptibility and plasmids from escherichia coli ...

    African Journals Online (AJOL)

    2001-10-10

    Oct 10, 2001 ... transmission to humans of E. coli containing antibiotic resistance plasmids ... resistant micro-organisms, which may in turn transfer resistance to .... cells were washed with sterile normal saline to remove leached. Я-lactamase ...

  2. Plasmid and chromosome segregation in prokaryotes

    DEFF Research Database (Denmark)

    Møller-Jensen, Jakob; Bugge Jensen, Rasmus; Gerdes, Kenn

    2000-01-01

    Recent major advances in the understanding of prokaryotic DNA segregation have been achieved by using fluorescence microscopy to visualize the localization of cellular components. Plasmids and bacterial chromosomes are partitioned in a highly dynamic fashion, suggesting the presence of a mitotic......-like apparatus in prokaryotes. The identification of chromosomal homologues of the well-characterized plasmid partitioning genes indicates that there could be a general mechanism of bacterial DNA partitioning. Udgivelsesdato: July 1...

  3. Curing of plasmid pXO1 from Bacillus anthracis using plasmid incompatibility.

    Directory of Open Access Journals (Sweden)

    Xiankai Liu

    Full Text Available The large plasmid pXO1 encoding the anthrax toxin is important for the virulence of Bacillus anthracis. It is essential to cure pXO1 from B. anthracis to evaluate its role in the pathogenesis of anthrax infection. Because conventional methods for curing plasmids (e.g., curing agents or growth at elevated temperatures can induce mutations in the host chromosomal DNA, we developed a specific and reliable method to eliminate pXO1 from B. anthracis using plasmid incompatibility. Three putative replication origins of pXO1 were inserted into a temperature-sensitive plasmid to generate three incompatible plasmids. One of the three plasmids successfully eliminated the large plasmid pXO1 from B. anthracis vaccine strain A16R and wild type strain A16. These findings provided additional information about the replication/partitioning of pXO1 and demonstrated that introducing a small incompatible plasmid can generate plasmid-cured strains of B. anthracis without inducing spontaneous mutations in the host chromosome.

  4. Characterization of Plasmid pPO1 from the Hyperacidophile Picrophilus oshimae

    Directory of Open Access Journals (Sweden)

    Angel Angelov

    2011-01-01

    Full Text Available Picrophilus oshimae and Picrophilus torridus are free-living, moderately thermophilic and acidophilic organisms from the lineage of Euryarchaeota. With a pH optimum of growth at pH 0.7 and the ability to even withstand molar concentrations of sulphuric acid, these organisms represent the most extreme acidophiles known. So far, nothing is known about plasmid biology in these hyperacidophiles. Also, there are no genetic tools available for this genus. We have mobilized the 7.6 Kbp plasmid from P. oshimae in E. coli by introducing origin-containing transposons and described the plasmid in terms of its nucleotide sequence, copy number in the native host, mode of replication, and transcriptional start sites of the encoded ORFs. Plasmid pPO1 may encode a restriction/modification system in addition to its replication functions. The information gained from the pPO1 plasmid may prove useful in developing a cloning system for this group of extreme acidophiles.

  5. Characterization of KfrA proteins encoded by a plasmid of Paenibacillus popilliae ATCC 14706T

    Directory of Open Access Journals (Sweden)

    Kazuhiro Iiyama

    2015-06-01

    Full Text Available A scaffold obtained from whole-genome shotgun sequencing of Paenibacillus popilliae ATCC 14706T shares partial homology with plasmids found in other strains of P. popilliae. PCR and sequencing for gap enclosure indicated that the scaffold originated from a 15,929-bp circular DNA. The restriction patterns of a plasmid isolated from P. popilliae ATCC 14706T were identical to those expected from the sequence; thus, this circular DNA was identified as a plasmid of ATCC 14706T and designated pPOP15.9. The plasmid encodes 17 putative open reading frames. Orfs 1, 5, 7, 8, and 9 are homologous to Orfs 11, 12, 15, 16, and 17, respectively. Orf1 and Orf11 are annotated as replication initiation proteins. Orf8 and Orf16 are homologs of KfrA, a plasmid-stabilizing protein in Gram-negative bacteria. Recombinant Orf8 and Orf16 proteins were assessed for the properties of KfrA. Indeed, they formed multimers and bound to inverted repeat sequences in upstream regions of both orf8 and orf16. A phylogenetic tree based on amino acid sequences of Orf8, Orf16 and Kfr proteins did not correlate with species lineage.

  6. Approaches to enzyme and substrate design of the murine Dnmt3a DNA methyltransferase.

    Science.gov (United States)

    Jurkowska, Renata Z; Siddique, Abu Nasar; Jurkowski, Tomasz P; Jeltsch, Albert

    2011-07-01

    Dnmt3a-C, the catalytic domain of the Dnmt3a DNA-(cytosine-C5)-methyltransferase, is active in an isolated form but, like the full-length Dnmt3a, shows only weak DNA methylation activity. To improve this activity by directed evolution, we set up a selection system in which Dnmt3a-C methylated its own expression plasmid in E. coli, and protected it from cleavage by methylation-sensitive restriction enzymes. However, despite screening about 400 clones that were selected in three rounds from a random mutagenesis library of 60 000 clones, we were not able to isolate a variant with improved activity, most likely because of a background of uncleaved plasmids and plasmids that had lost the restriction sites. To improve the catalytic activity of Dnmt3a-C by optimization of the sequence of the DNA substrate, we analyzed its flanking-sequence preference in detail by bisulfite DNA-methylation analysis and sequencing of individual clones. Based on the enrichment and depletion of certain bases in the positions flanking >1300 methylated CpG sites, we were able to define a sequence-preference profile for Dnmt3a-C from the -6 to the +6 position of the flanking sequence. This revealed preferences for T over a purine at position -2, A over G at -1, a pyrimidine at +1, and A and T over G at +3. We designed one "good" substrate optimized for methylation and one "bad" substrate designed not to be efficiently methylated, and showed that the optimized substrate is methylated >20 times more rapidly at its central CpG site. The optimized Dnmt3a-C substrate can be applied in enzymatic high-throughput assays with Dnmt3a-C (e.g., for inhibitor screening), because the increased activity provides an improved dynamic range and better signal/noise ratio.

  7. Immune Responses in Mice Injected with gD Plasmid DNA of Infectious Bovine Rhinotracheitis Virus

    Institute of Scientific and Technical Information of China (English)

    LI Ji-chang; TONG Guang-zhi; QIU Hua-ji

    2004-01-01

    The gene encoding gD of isolate Luojing of infectious bovine rhinotracheitis virus (IBRV)was amplified,sequenced, and cloned into plasmid pcDNA 3.1, resulting in a recombinant pcDNA-gD. Groups of BALB/c mice were injected with 100 μ g of plasmid only or together with liposome. After immunization, serum samples were collected from mice every 2 weeks for a 10-week period and tested for protein-specific antibody with enzyme-linked immunosorbent assay(ELISA). It was showed that the plasmid encoding IBRV glycopretein D developed gene-specific antibody. This report indicates the potential of DNA injection as a method of vaccination.

  8. Construction of a recombinant bacterial plasmid containing DNA sequences for a mouse embryonic globin chain.

    Science.gov (United States)

    Fantoni, A; Bozzoni, I; Ullu, E; Farace, M G

    1979-08-10

    Messenger RNAs for mouse embryonic globins were purified from yolk sac derived eyrthroid cells in mouse fetuses. Double stranded DNAs complementary to these messengers were synthesized and blunt end ligated to a EcoRI digested and DNA polymerase I repaired pBR322 plasmid. Of the ampicillin resistant transformants, one contained a plasmid with globin-specific cDNA. The inserted sequence is about 350 base pairs long. It contains one restriction site for EcoRI and one restriction site for HinfI about 170 and 80 base pairs from one end. The insert is not cleaved by HindIII, HindII, BamHI, PstI, SalI, AvaI, TaqI, HpaII, BglI. A mixture of purified messengers coding for alpha chains and for x, y and z embryonic chains was incubated with the recombinant plasmid and the hybridized messenger was translated in a mRNA depleted reticulocyte lysate protein synthesizing system. The product of translation was identified as a z chain by carboxymethylcellulose cromatography. The recombinant plasmid is named "pBR322-egz" after embryonic globin z.

  9. Multiple plasmid interference - Pledging allegiance to my enemy's enemy.

    Science.gov (United States)

    Gama, João Alves; Zilhão, Rita; Dionisio, Francisco

    2017-08-24

    As shown in the previous article, two distinct conjugative plasmids sometimes interact within bacterial cells, implicating changes of transfer rates. In most cases of interactions within bacteria, the transfer of one of the plasmids decreases. Less frequently, the transfer rate of one of the plasmids increases. Here we analyse what happens if three distinct conjugative plasmids colonize the same bacterial cell. Our aim is to understand how interactions between two plasmids affect the transfer rate of the third plasmid. After showing that plasmids interact in 59 out of 84 possible interactions we show that, with some exceptions, if the transfer rate of a plasmid decreases in the presence of a second plasmid, a decrease is also observed in the presence of a third plasmid. Moreover, if the conjugation rate of a plasmid increases in the presence of another, an increase is also observed if there is a third plasmid in the cell. Both types of interactions are mostly independent of the third plasmid's identity, even if sometimes the third plasmid quantitatively distorts the interaction of the other two plasmids. There is a bias towards negative intensifying interactions, which provide good news concerning the spread conjugative plasmids encoding antibiotic-resistance genes and virulence factors. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Clostridium perfringens type A–E toxin plasmids

    Science.gov (United States)

    Freedman, John C.; Theoret, James R.; Wisniewski, Jessica A.; Uzal, Francisco A.; Rood, Julian I.; McClane, Bruce A.

    2014-01-01

    Clostridium perfringens relies upon plasmid-encoded toxin genes to cause intestinal infections. These toxin genes are associated with insertion sequences that may facilitate their mobilization and transfer, giving rise to new toxin plasmids with common backbones. Most toxin plasmids carry a transfer of clostridial plasmids locus mediating conjugation, which likely explains the presence of similar toxin plasmids in otherwise unrelated C. perfringens strains. The association of many toxin genes with insertion sequences and conjugative plasmids provides virulence flexibility when causing intestinal infections. However, incompatibility issues apparently limit the number of toxin plasmids maintained by a single cell. PMID:25283728

  11. Construction of targeted plasmid vector pcDNA3.1-Egr.1p-p16 and its expression in pancreatic cancer JF305 cells induced by radiation in vitro

    Institute of Scientific and Technical Information of China (English)

    Hong-Bing Ma; Ming-Hua Bai; Xi-Jing Wang; Zheng-Li Di; Hui Xia; Zheng Li; Jie Liu; Jie Ma; Hua-Fen Kang; Cong-Mei Wu

    2007-01-01

    AIM: To construct pcDNA3.1-Egr.1p-p16 recombinant plasmid and investigate the expression of p16 in pancreatic cancer JF305 cells induced by radiation and the feasibility of gene radiotherapy for pancreatic carcinoma.METHODS: Human p16 cDNA was ligated to th edownstream of Egr-1 promotor to construct pcDNA3.1-Egr.1p-p16 plasmid by restriction enzyme digested. The recombined plasmids were transfected into pancreatic cancer JF305 cells with lipofectamine. p16 mRNA level was detected by RT-PCR. The expression of p16 after different doses of X-ray radiation was detected by Western blot technique. Cell survival was assessed by clonogenic assays and cell viability was analysed by trypen blue exclusion. Flow cytometry was performed to study the apoptosis of JF305 cells.RESULTS: Restriction enzyme digestion showed the correctly constructed pcDNA3.1-Egr.1p-p16. The p16expression in cells transfected with pcDNA3.1-Egr.1p-p16induced by different doses of radiation was higher than that in the control group (P < 0.05). Eight hours after 2 Gy X-ray radiation, the expression reached its peak(87.00 ng/L), and was significantly higher than that in the control group (P < 0.0.5). Clonogenic analysis and trypan blue extraction test showed that the pcDNA3.1-Egr.1p-p16 transfer enhanced radiation-induced cell killing in p16-null JF305 cell lines. The induction of apoptosis was lower in combined transfection and irradiation group than that in irradiation alone.CONCLUSION: X-ray can induce the recombinant plasmid pcDNA3.1-Egr.1p-p16 expression in JF305 cells.The detection of dose and time provides an experimental basis for in vivo study in future.

  12. Evolution of an incompatibility group IncA/C plasmid harboring blaCMY-16 and qnrA6 genes and its transfer through three clones of Providencia stuartii during a two-year outbreak in a Tunisian burn unit.

    Science.gov (United States)

    Arpin, C; Thabet, L; Yassine, H; Messadi, A A; Boukadida, J; Dubois, V; Coulange-Mayonnove, L; Andre, C; Quentin, C

    2012-03-01

    During a 2-year period in 2005 and 2006, 64 multidrug-resistant Providencia stuartii isolates, including 58 strains from 58 patients and 6 strains obtained from the same tracheal aspirator, were collected in a burn unit of a Tunisian hospital. They divided into four antibiotypes (ATB1 to ATB4) and three SmaI pulsotypes (PsA to PsC), including 49 strains belonging to clone PsA (48 of ATB1 and 1 of ATB4), 11 strains to clone PsB (7 of ATB2 and 4 of ATB3), and 4 strains to clone PsC (ATB3). All strains, except for the PsA/ATB4 isolate, were highly resistant to broad-spectrum cephalosporins due to the production of the plasmid-mediated CMY-16 β-lactamase. In addition, the 15 strains of ATB2 and ATB3 exhibited decreased quinolone susceptibility associated with QnrA6. Most strains (ATB1 and ATB3) were gentamicin resistant, related to an AAC(6')-Ib' enzyme. All these genes were located on a conjugative plasmid belonging to the incompatibility group IncA/C(2) of 195, 175, or 100 kb. Despite differences in size and in number of resistance determinants, they derived from the same plasmid, as demonstrated by similar profiles in plasmid restriction analysis and strictly homologous sequences of repAIncA/C(2), unusual antibiotic resistance genes (e.g., aphA-6), and their genetic environments. Further investigation suggested that deletions, acquisition of the ISCR1 insertion sequence, and integron cassette mobility accounted for these variations. Thus, this outbreak was due to both the spread of three clonal strains and the dissemination of a single IncA/C(2) plasmid which underwent a remarkable evolution during the epidemic period.

  13. Historical Events That Spawned the Field of Plasmid Biology.

    Science.gov (United States)

    Kado, Clarence I

    2014-10-01

    This chapter revisits the historical development and outcome of studies focused on the transmissible, extrachromosomal genetic elements called plasmids. Early work on plasmids involved structural and genetic mapping of these molecules, followed by the development of an understanding of how plasmids replicate and segregate during cell division. The intriguing property of plasmid transmission between bacteria and between bacteria and higher cells has received considerable attention. The utilitarian aspects of plasmids are described, including examples of various plasmid vector systems. This chapter also discusses the functional attributes of plasmids needed for their persistence and survival in nature and in man-made environments. The term plasmid biology was first conceived at the Fallen Leaf Lake Conference on Promiscuous Plasmids, 1990, Lake Tahoe, California. The International Society for Plasmid Biology was established in 2004 (www.ISPB.org).

  14. Conjugative transfer of an IncA/C plasmid-borne blaCMY-2 gene through genetic re-arrangements with an IncX1 plasmid.

    Science.gov (United States)

    Wiesner, Magdalena; Fernández-Mora, Marcos; Cevallos, Miguel A; Zavala-Alvarado, Crispín; Zaidi, Mussaret B; Calva, Edmundo; Silva, Claudia

    2013-11-21

    Our observation that in the Mexican Salmonella Typhimurium population none of the ST19 and ST213 strains harbored both the Salmonella virulence plasmid (pSTV) and the prevalent IncA/C plasmid (pA/C) led us to hypothesize that restriction to horizontal transfer of these plasmids existed. We designed a conjugation scheme using ST213 strain YU39 as donor of the blaCMY-2 gene (conferring resistance to ceftriaxone; CRO) carried by pA/C, and two E. coli lab strains (DH5α and HB101) and two Typhimurium ST19 strains (SO1 and LT2) carrying pSTV as recipients. The aim of this study was to determine if the genetic background of the different recipient strains affected the transfer frequencies of pA/C. YU39 was able to transfer CRO resistance, via a novel conjugative mechanism, to all the recipient strains although at low frequencies (10-7 to 10-10). The presence of pSTV in the recipients had little effect on the conjugation frequency. The analysis of the transconjugants showed that three different phenomena were occurring associated to the transfer of blaCMY-2: 1) the co-integration of pA/C and pX1; 2) the transposition of the CMY region from pA/C to pX1; or 3) the rearrangement of pA/C. In addition, the co-lateral mobilization of a small (5 kb) ColE1-like plasmid was observed. The transconjugant plasmids involving pX1 re-arrangements (either via co-integration or ISEcp1-mediated transposition) obtained the capacity to conjugate at very high levels, similar to those found for pX1 (10-1). Two versions of the region containing blaCMY-2 were found to transpose to pX1: the large version was inserted into an intergenic region located where the "genetic load" operons are frequently inserted into pX1, while the short version was inserted into the stbDE operon involved in plasmid addiction system. This is the first study to report the acquisition of an extended spectrum cephalosporin (ESC)-resistance gene by an IncX1 plasmid. We showed that the transfer of the YU39 blaCMY-2 gene

  15. PLASMID PROFILES AND PHAGE TYPES OF SALMONELLA-TYPHIMURIUM ISOLATED FROM SUCCESSIVE FLOCKS OF CHICKENS ON 3 PARENT STOCK FARMS

    DEFF Research Database (Denmark)

    Baggesen, Dorte Lau; Olsen, J. E.; Bisgaard, M.

    1992-01-01

    Three-hundred-and-eighty-seven strains of Salmonella typhimurium obtained from successive generations of parent stock originating from three different rearing farms were characterized by phage typing and plasmid profiling. Seventy-six strains representing dominant types were selected for restrict...

  16. Bacteriophage selection against a plasmid-encoded sex apparatus leads to the loss of antibiotic-resistance plasmids

    OpenAIRE

    Jalasvuori, Matti; Friman, Ville-Petri; Nieminen, Anne; Jaana K.H. Bamford; Buckling, Angus

    2011-01-01

    Antibiotic-resistance genes are often carried by conjugative plasmids, which spread within and between bacterial species. It has long been recognized that some viruses of bacteria (bacteriophage; phage) have evolved to infect and kill plasmid-harbouring cells. This raises a question: can phages cause the loss of plasmid-associated antibiotic resistance by selecting for plasmid-free bacteria, or can bacteria or plasmids evolve resistance to phages in other ways? Here, we show that multiple ant...

  17. Construction of human Parkin gene plasmid%人Parkin基因重组质粒的构建

    Institute of Scientific and Technical Information of China (English)

    李普阳; 夏学巍; 李勇; 张伟

    2011-01-01

    Objective To constuct human Parkin geneplasmid with molecular biological technique.Method Total RNA was extracted from human fetal Substantia nigra tissue, Parkin cDNA fragment was amplified by RT-PCR, this fragment was cloned in pGEM-T vector.The fragments was analysed after cutting by specific restriction enzyme.Result The cloned cDNA sequence was the right people Parkin coding sequence of the cDNA.Conclusion Human Parkin gene plasmid is constructed successfully.%目的 应用分子生物学技术构建人Parkin基因重组质粒.方法 从人类胎儿黑质组织中提取总RNA,以RT-PCR法扩增Parkin的cDNA片段;将此片段克隆于pUCm-T载体中,经过特异性限制性内切酶酶切分析片段正确后,进行全序列分析.结果 克隆的cDNA与Gene Bank上的序列相比完全一致,得到了编码正确的人Parkin的cDNA全序列.结论 成功构建了人Parkin基因重组质粒.

  18. Novel genetic environment of the plasmid-mediated KPC-3 gene detected in Escherichia coli and Citrobacter freundii isolates from China

    OpenAIRE

    Li, G.; Wei, Q; Wang, Y.; Du, X.; Zhao, Y.; Jiang, X.

    2010-01-01

    The imipenem and meropenem-resistant strains Citrobacter freundii HS70 and Escherichia coli HS510 were isolated from patients in Shanghai, China. By isoelectric focusing, PCR amplification and sequencing, these strains were each found to produce four β-lactamases: TEM-1, KPC-3, SHV-7 and CTX-M-14. A conjugation experiment and plasmid restriction digestion revealed that the bla KPC-3 gene was located on the same plasmid in both isolates. Bidirectional primer walking sequencing showed that the ...

  19. Kloning Gen Melanoma Antigen 1 (Mage-1 dari Jaringan Testis untuk mendapatkan Plasmid Rekombinan Mage-1

    Directory of Open Access Journals (Sweden)

    Gondo Mastutik

    2015-12-01

    Full Text Available Melanoma antigen-1 (Mage-1 is expressed by spermatogonia cells of normal testicular tissue and 60−80% is expressed by the liver of hepatocellular carcinoma (HC patients. Mage-1 expression is a marker for diagnosing HC and predicting gastric and colorectal cancers. Isolation of messenger ribonucleid acid (mRNA Mage-1 from the liver tissue of HC patients is difficult; therefore, Mage-1 mRNA isolates can be obtained from tissues that express Mage-1 such as normal testicular tissues . This is an explorative research that was conducted at the Institute of Tropical Diseases of Airlangga University during August 2006–August 2008. The aim was to clone the coding sequence of Mage-1 gene from testicular tissues into a vector and to get recombinant plasmid Mage-1. Isolation of the full-length Mage-1 was performed using semi-nested polymerase chain reaction (PCR which was then cloned into plasmid pET101/D-TOPO and transformed into Escherichia coli (E. coli Top10 to get recombinant plasmid Mage-1. The length of pET101/D-TOPO was 5,753 bp and Mage-1 was 927 bp. The length of recombinant plasmid was 6,680 bp (5,753+927. Restriction analysis using EcoRV showed 4,230 and 2,450 bp bands (4,230+2,450=6,680. Sequence analyses showed that Mage-1 was 100% homologous with M77481 and NM_004988, 99% homologous with BC01755. In conclusion, according to the results of the restriction and sequences analysis, the recombinant plasmid pETGM/MAGE1-Testis contains the full length coding region of Mage-1 and is useful for developing the hepatocellular carcinoma diagnostic kits.

  20. Distribution of small native plasmids in Streptococcus pyogenes in India.

    Science.gov (United States)

    Bergmann, René; Nerlich, Andreas; Chhatwal, Gursharan S; Nitsche-Schmitz, D Patric

    2014-05-01

    Complete characterization of a Streptococcus pyogenes population from a defined geographic region comprises information on the plasmids that circulate in these bacteria. Therefore, we determined the distribution of small plasmids (pyogenes isolates from India, where diversity of strains and incidence rates of S. pyogenes infections are high. The collection comprised 77 emm-types. For plasmid detection and discrimination, we developed PCRs for different plasmid replication initiation protein genes, the putative repressor gene copG and bacteriocin genes dysA and scnM57. Plasmid distribution was limited to 13 emm-types. Co-detection analysis using aforementioned PCRs revealed four distinct plasmid sub-types, two of which were previously unknown. Representative plasmids pA852 and pA996 of the two uncharacterized plasmid sub-types were sequenced. These two plasmids could be assigned to the pMV158 and the pC194/pUB110 family of rolling-circle plasmids, respectively. The majority of small plasmids found in India belonged to the two newly characterized sub-types, with pA852- and pA996-like plasmids amounting to 42% and 22% of all detected plasmids, respectively. None of the detected plasmids coded for a known antibiotic resistance gene. Instead, all of the four plasmid sub-types carried known or potential bacteriocin genes. These genes may have influence on the evolutionary success of certain S. pyogenes genotypes. Notably, pA852-like plasmids were found in all isolates of the most prevalent emm-type 11.0. Together, a priori fitness of this genotype and increased fitness due to the acquired plasmids may have rendered type emm11.0 successful and caused the prevalence of pA852-like plasmids in India.

  1. Bronchopneumonia in wild boar (Sus scrofa) caused by Rhodococcus equi carrying the VapB type 8 plasmid.

    Science.gov (United States)

    de Vargas, Agueda Castagna; Monego, Fernanda; Gressler, Letícia Trevisan; de Avila Botton, Sônia; Lazzari, Andrea Maria; da Costa, Mateus Matiuzzi; Ecco, Roselene; Ribeiro, Márcio Garcia; Lara, Gustavo Henrique Batista; Takai, Shinji

    2013-03-25

    Rhodococcus equi is associated with pyogranulomatous infections, especially in foals, and this bacterium has also emerged as a pathogen for humans, particularly immunocompromised patients. R. equi infections in pigs, wild boar (Sus scrofa) and humans are mainly due to strains carrying the intermediate virulence (VapB) plasmid. In Brazil, R. equi carrying the VapB type 8 plasmid is the most common type recovered from humans co-infected with the human immunodeficiency virus (HIV). R. equi infection in pigs and wild boar is restricted predominantly to the lymphatic system, without any reports of pulmonary manifestations. This report describes the microbiological and histopathological findings, and molecular characterization of R. equi in two bronchopneumonia cases in wild boar using PCR and plasmid profile analysis by digestion with restriction endonucleases. The histological findings were suggestive of pyogranulomatous infection, and the plasmid profile of both R. equi isolates enabled the characterization of the strains as VapB type 8. This is the first report of bronchopneumonia in wild boar due to R. equi. The detection of the VapB type 8 plasmid in R. equi isolates emphasize that wild boar may be a potential source of pathogenic R. equi strains for humans.

  2. Restriction/modification polypeptides, polynucleotides, and methods

    Energy Technology Data Exchange (ETDEWEB)

    Westpheling, Janet; Chung, DaeHwan; Huddleston, Jennifer; Farkas, Joel A

    2015-02-24

    The present invention relates to the discovery of a novel restriction/modification system in Caldicellulosiruptor bescii. The discovered restriction enzyme is a HaeIII-like restriction enzyme that possesses a thermophilic activity profile. The restriction/modification system also includes a methyltransferase, M.CbeI, that methylates at least one cytosine residue in the CbeI recognition sequence to m.sup.4C. Thus, the invention provides, in various aspects, isolated CbeI or M.CbeI polypeptides, or biologically active fragments thereof; isolated polynucleotides that encode the CbeI or M.CbeI polypeptides or biologically active fragments thereof, including expression vectors that include such polynucleotide sequences; methods of digesting DNA using a CbeI polypeptide; methods of treating a DNA molecule using a M.CbeI polypeptide; and methods of transforming a Caldicellulosiruptor cell.

  3. Stress responses and replication of plasmids in bacterial cells

    Directory of Open Access Journals (Sweden)

    Wegrzyn Alicja

    2002-05-01

    Full Text Available Abstract Plasmids, DNA (or rarely RNA molecules which replicate in cells autonomously (independently of chromosomes as non-essential genetic elements, play important roles for microbes grown under specific environmental conditions as well as in scientific laboratories and in biotechnology. For example, bacterial plasmids are excellent models in studies on regulation of DNA replication, and their derivatives are the most commonly used vectors in genetic engineering. Detailed mechanisms of replication initiation, which is the crucial process for efficient maintenance of plasmids in cells, have been elucidated for several plasmids. However, to understand plasmid biology, it is necessary to understand regulation of plasmid DNA replication in response to different environmental conditions in which host cells exist. Knowledge of such regulatory processes is also very important for those who use plasmids as expression vectors to produce large amounts of recombinant proteins. Variable conditions in large-scale fermentations must influence replication of plasmid DNA in cells, thus affecting the efficiency of recombinant gene expression significantly. Contrary to extensively investigated biochemistry of plasmid replication, molecular mechanisms of regulation of plasmid DNA replication in response to various environmental stress conditions are relatively poorly understood. There are, however, recently published studies that add significant data to our knowledge on relations between cellular stress responses and control of plasmid DNA replication. In this review we focus on plasmids derived from bacteriophage λ that are among the best investigated replicons. Nevertheless, recent results of studies on other plasmids are also discussed shortly.

  4. Detection and analysis of plasmid-mediated carbapenem-hydrolyzing enzyme KPC-2 in carbapenem-resistant Escherichia coli%大肠埃希菌质粒型碳青霉烯酶KPC-2检测和分析

    Institute of Scientific and Technical Information of China (English)

    蒯守刚; 邵海枫; 王卫萍; 史利宁; 张小卫; 范明

    2009-01-01

    Objective To study molecular epidemiology and carbapenem-resistance mechanism of four Escherichia coli strains isolated from general surgery wards. Methods Antibiotic susceptibility was carried out by K-B gar diffusion and agar dilution methods. Carbapenemases were screened by three dimensional test and EDTA-Na_2-disk synergy test. Pulsed-field gel electropboresis (PFGE) was performed to analyze molecular epidemiology of isolates. Plasmid was extracted by using an alkalinelysis technique. Conjunction experiment, transformation assay, specific PCR and DNA sequencing were performed to confirm carbapenemase genotype and its transmission mechanism Results Four Escherichia coli isolates were resistant to most antimicrobials including carbapenem. PFGE showed that the four isolates belong to four different clonal strains. Specific PCR and DNA sequence analysis identified that carbapenem resistance in four clinical isolates was mediated by KPC-2 encoded on an approximately 56 000 bp plasmid, and this plasmid did not harbor aminoglycosides and fluorquinolones resistant genes. Conclusion Four Escherichia coli isolates with carbapenem resistance are obtained from our hospital, and KPC-2 plasmid is main cause of carbapenem resistance in these isolates.%目的 研究普外科病区出现的4株碳青霉烯类药物耐药大肠埃希菌的分子流行病学特征及耐药机制.方法 用K-B纸片法和琼脂稀释法进行药物敏感试验,三维酶抑制试验和EDTA-Na_2协同试验分析酶的性质,通过脉冲场琼脂糖凝胶电泳(PFGE)分析耐药株的分子流行病学特征,特异性PCR及序列分析、接合试验、碱裂解法提取质粒和质粒转化试验研究碳青霉烯耐药的分子机制.结果 4株大肠埃希菌对包括碳青霉烯在内的多种抗菌药物广泛耐药,PFGE显示4株分离株属于不同的克隆型,对碳青霉烯类药物的耐药主要由相对分子质量约56 000的质粒携带的KPC-2基因介导,转化试验显示对氨基

  5. Plasmid mediated quinolone resistance in Enterobacteriaceae

    NARCIS (Netherlands)

    Veldman, K.T.; LS Klinisch Onderzoek Wagenaar

    2014-01-01

    This thesis describes the occurrence of Plasmid Mediated Quinolone Resistance (PMQR) in Salmonella and E. coli from The Netherlands and other European countries. Furthermore, the genetic background of these genes was characterized. Fluoroquinolones are widely used antibiotics in both human and

  6. Plasmid mediated quinolone resistance in Enterobacteriaceae

    NARCIS (Netherlands)

    Veldman, K.T.; LS Klinisch Onderzoek Wagenaar

    2014-01-01

    This thesis describes the occurrence of Plasmid Mediated Quinolone Resistance (PMQR) in Salmonella and E. coli from The Netherlands and other European countries. Furthermore, the genetic background of these genes was characterized. Fluoroquinolones are widely used antibiotics in both human and veter

  7. Plasmid mediated quinolone resistance in Enterobacteriaceae

    NARCIS (Netherlands)

    Veldman, K.T.; LS Klinisch Onderzoek Wagenaar

    2014-01-01

    This thesis describes the occurrence of Plasmid Mediated Quinolone Resistance (PMQR) in Salmonella and E. coli from The Netherlands and other European countries. Furthermore, the genetic background of these genes was characterized. Fluoroquinolones are widely used antibiotics in both human and veter

  8. IncA/C plasmids harboured in serious multidrug-resistant Vibrio cholerae serogroup O139 strains in China.

    Science.gov (United States)

    Wang, Ruibai; Yu, Dong; Zhu, Lianhui; Li, Jie; Yue, Junjie; Kan, Biao

    2015-03-01

    Vibrio cholerae serogroup O139 emerged in 1992 and is one of two major serogroups to have caused cholera epidemics. After 1998, serious multidrug-resistant (MDR) O139 strains quickly became common in China, showing a multidrug resistance profile to eight antibiotics. It is a great threat to public health, and elucidation of its mechanisms of resistance will provide a helpful guide for the clinical treatment and prevention of cholera. In this study, mega-plasmids from MDR V. cholerae O139 strains were identified by pulsed-field gel electrophoresis (PFGE) without enzyme digestion. One plasmid was isolated and sequenced, belonging to the IncA/C family. Ten antibiotic resistance genes were found in the MDR regions, including a blaTEM-20 gene, and these genes endowed the host with resistance to seven antibiotics. This kind of plasmid was positive in 71.2% (198/278) of toxigenic O139 strains, and the rate of plasmid positivity was consistent with the yearly change in MDR rates of these strains. This study reveals an important role of the IncA/C family plasmid in the spread of multiple antibiotic resistance of epidemic V. cholerae serogroup O139 strains, which has recombined with plasmids from different bacterial species and transferred among V. cholerae strains. Copyright © 2014 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  9. Identification of bla KPC-2 on different plasmids of three Morganella morganii isolates.

    Science.gov (United States)

    Shi, D-S; Wang, W-P; Kuai, S-G; Shao, H-F; Huang, M

    2012-05-01

    Three Morganella morganii strains resistant to carbapenems were recovered from the surgical intensive care unit (SICU) in our hospital. Carbapenemases and extended-spectrum β-lactamases (ESBLs) were respectively detected by the modified Hodge test and the modified Clinical and Laboratory Standards Institute (CLSI) ESBL confirmatory test in all isolates. Amplification of whole-cell and plasmid DNAs extracted from isolates with primers specific for the bla (KPC) produced an amplicon confirmed to be bla (KPC-2) by sequence analysis. Pulsed-field gel electrophoresis (PFGE) typing revealed that three isolates belonged to two closely related types. Plasmids electrophoresis and restriction analysis revealed that the bla (KPC-2) was located on different plasmids. The transfer of carbapenem resistance from the three original isolates to Escherichia coli EC600 was successful by conjugation. An examination of the outer membrane proteins showed a lack of a 38-kDa outer membrane protein (OMP) compared with M. morganii susceptible to carbapenems. The production of KPC-2 and ESBLs, combined with OMP deficiency, resulted in high-level carbapenem resistance in the M. morganii strains. The genetic environment around bla (KPC-2) analysis revealed that this β-lactamase was located on the same mobile genetic elements which could transfer between different plasmids.

  10. Plasmids spread very fast in heterogeneous bacterial communities.

    Science.gov (United States)

    Dionisio, Francisco; Matic, Ivan; Radman, Miroslav; Rodrigues, Olivia R; Taddei, François

    2002-01-01

    Conjugative plasmids can mediate gene transfer between bacterial taxa in diverse environments. The ability to donate the F-type conjugative plasmid R1 greatly varies among enteric bacteria due to the interaction of the system that represses sex-pili formations (products of finOP) of plasmids already harbored by a bacterial strain with those of the R1 plasmid. The presence of efficient donors in heterogeneous bacterial populations can accelerate plasmid transfer and can spread by several orders of magnitude. Such donors allow millions of other bacteria to acquire the plasmid in a matter of days whereas, in the absence of such strains, plasmid dissemination would take years. This "amplification effect" could have an impact on the evolution of bacterial pathogens that exist in heterogeneous bacterial communities because conjugative plasmids can carry virulence or antibiotic-resistance genes. PMID:12524329

  11. Endogenous mutagenesis in recombinant sulfolobus plasmids.

    Science.gov (United States)

    Sakofsky, Cynthia J; Grogan, Dennis W

    2013-06-01

    Low rates of replication errors in chromosomal genes of Sulfolobus spp. demonstrate that these extreme thermoacidophiles can maintain genome integrity in environments with high temperature and low pH. In contrast to this genetic stability, we observed unusually frequent mutation of the β-D-glycosidase gene (lacS) of a shuttle plasmid (pJlacS) propagated in Sulfolobus acidocaldarius. The resulting Lac(-) mutants also grew faster than the Lac(+) parent, thereby amplifying the impact of the frequent lacS mutations on the population. We developed a mutant accumulation assay and corrections for the effects of copy number and differential growth for this system; the resulting measurements and calculations yielded a corrected rate of 5.1 × 10(-4) mutational events at the lacS gene per plasmid replication. Analysis of independent lacS mutants revealed three types of mutations: (i) G · C-to-A · T transitions, (ii) slipped-strand events, and (iii) deletions. These mutations were frequent in plasmid-borne lacS expressed at a high level but not in single-copy lacS in the chromosome or at lower levels of expression in a plasmid. Substitution mutations arose at only two of 12 potential priming sites of the DNA primase of the pRN1 replicon, but nearly all these mutations created nonsense (chain termination) codons. The spontaneous mutation rate of plasmid-borne lacS was 175-fold higher under high-expression than under low-expression conditions. The results suggest that important DNA repair or replication fidelity functions are impaired or overwhelmed in pJlacS, with results analogous to those of the "transcription-associated mutagenesis" seen in bacteria and eukaryotes.

  12. Diversity and homogeneity among small plasmids of Aeromonas salmonicida subsp. salmonicida linked with geographical origin

    Directory of Open Access Journals (Sweden)

    Sabrina A Attéré

    2015-11-01

    Full Text Available Furunculosis, which is caused by Aeromonas salmonicida subsp. salmonicida, is a major salmonid disease in fish farms worldwide. Several plasmids found in this bacterium confer phenotypes such drug resistance and virulence. Small plasmids (pAsa1, pAsa2, pAsa3, and pAsal1 related to ColE1- and ColE2-type replicons are usually present in its normal plasmidome. In the present study, with the objective to investigate if these plasmids display particularities related to the origin of the isolates bearing them, a total of 153 isolates, including 78 new and 75 previously described, were analyzed for the presence of small plasmids by PCR and DNA restriction fragment profiling. A geographical dichotomy between Canadian and European isolates for their propensity to do not have pAsa3 or pAsal1 was found. In addition, the genotyping analysis led to the identification of two European isolates harboring an unusual pAsal1. An investigation by next-generation sequencing (NGS of these two isolates shed light on two pAsal1 variants (pAsal1C and pAsal1D. As with pAsal1B, another pAsal1 variant previously described, these two new variants bore a second insertion sequence (ISAS5 in addition to the usual ISAS11. The characterization of these variants suggested that they could predominate over the wild-type pAsal1 in stressful conditions such as growth at temperatures of 25°C and above. To obtain a comprehensive portrait of the mutational pressure on small plasmids, 26 isolates whose DNA had been sequenced by NGS were investigated. pAsa3 and pAsal1 were more prone to mutations than pAsa1 and pAsa2, especially in the mobA gene, which encodes a relaxase and a primase. Lastly, the average copy number of each plasmid per cell was assessed using raw sequencing data. A clear trend with respect to the relative proportion per cell of each plasmid was identified. Our large-scale study revealed a geographical dichotomy in small plasmid repertoire in addition to a clear trend

  13. Plasmid DNA entry into postmitotic nuclei of primary rat myotubes.

    OpenAIRE

    Dowty, M E; Williams, P.; G. Zhang; Hagstrom, J E; Wolff, J A

    1995-01-01

    These studies were initiated to elucidate the mechanism of DNA nuclear transport in mammalian cells. Biotin- or gold-labeled plasmid and plasmid DNA expression vectors for Escherichia coli beta-galactosidase or firefly luciferase were microinjected into the cytoplasm of primary rat myotubes in culture. Plasmid DNA was expressed in up to 70% of the injected myotubes, which indicates that it entered intact, postmitotic nuclei. The nuclear transport of plasmid DNA occurred through the nuclear po...

  14. Replication of plasmids in gram-negative bacteria.

    OpenAIRE

    1989-01-01

    Replication of plasmid deoxyribonucleic acid (DNA) is dependent on three stages: initiation, elongation, and termination. The first stage, initiation, depends on plasmid-encoded properties such as the replication origin and, in most cases, the replication initiation protein (Rep protein). In recent years the understanding of initiation and regulation of plasmid replication in Escherichia coli has increased considerably, but it is only for the ColE1-type plasmids that significant biochemical d...

  15. Plasmid Segregation: Spatial Awareness at the Molecular Level

    DEFF Research Database (Denmark)

    Møller-Jensen, Jakob; Gerdes, Kenn

    2007-01-01

    In bacteria, low-copy number plasmids ensure their stable inheritance by partition loci (par), which actively distribute plasmid replicates to each side of the cell division plane. Using time-lapse fluorescence microscopic tracking of segregating plasmid molecules, a new study provides novel insi...

  16. Multilocus sequence typing of IncN plasmids

    DEFF Research Database (Denmark)

    García-Fernández, Aurora; Villa, Laura; Moodley, Arshnee

    2011-01-01

    categorization of IncN plasmids. METHODS: Twelve fully sequenced IncN plasmids available at GenBank were analysed in silico for selecting the loci for the IncN-specific pMLST. A total of 58 plasmids originating from different reservoirs (human, pig, poultry, cattle and horses) and geographic regions (Italy...

  17. The relaxase of the Rhizobium etli symbiotic plasmid shows nic site cis-acting preference.

    Science.gov (United States)

    Pérez-Mendoza, Daniel; Lucas, María; Muñoz, Socorro; Herrera-Cervera, José A; Olivares, José; de la Cruz, Fernando; Sanjuán, Juan

    2006-11-01

    Genetic and biochemical characterization of TraA, the relaxase of symbiotic plasmid pRetCFN42d from Rhizobium etli, is described. After purifying the relaxase domain (N265TraA), we demonstrated nic binding and cleavage activity in vitro and thus characterized for the first time the nick site (nic) of a plasmid in the family Rhizobiaceae. We studied the range of N265TraA relaxase specificity in vitro by testing different oligonucleotides in binding and nicking assays. In addition, the ability of pRetCFN42d to mobilize different Rhizobiaceae plasmid origins of transfer (oriT) was examined. Data obtained with these approaches allowed us to establish functional and phylogenetic relationships between different plasmids of this family. Our results suggest novel characteristics of the R. etli pSym relaxase for previously described conjugative systems, with emphasis on the oriT cis-acting preference of this enzyme and its possible biological relevance.

  18. Production of plasmid-encoding NDM-1 in clinical Raoultella ornithinolytica and Leclercia adecarboxylata from China.

    Science.gov (United States)

    Sun, Fengjun; Yin, Zhe; Feng, Jiao; Qiu, Yefeng; Zhang, Defu; Luo, Wenbo; Yang, Huiying; Yang, Wenhui; Wang, Jie; Chen, Weijun; Xia, Peiyuan; Zhou, Dongsheng

    2015-01-01

    Raoultella ornithinolytica YNKP001 and Leclercia adecarboxylata P10164, which harbor conjugative plasmids pYNKP001-NDM and pP10164-NDM, respectively, were isolated from two different Chinese patients, and their complete nucleotide sequences were determined. Production of NDM-1 enzyme by these plasmids accounts for the carbapenem resistance of these two strains. This is the first report of bla NDM in L. adecarboxylata and third report of this gene in R. ornithinolytica. pYNKP001-NDM is very similar to the IncN2 NDM-1-encoding plasmids pTR3, pNDM-ECS01, and p271A, whereas pP10164-NDM is similar to the IncFIIY bla NDM-1-carrying plasmid pKOX_NDM1. The bla NDM-1 genes of pYNKP001-NDM and pP10164-NDM are embedded in Tn125-like elements, which represent two distinct truncated versions of the NDM-1-encoding Tn125 prototype observed in pNDM-BJ01. Flanking of these two Tn125-like elements by miniature inverted repeat element (MITE) or its remnant indicates that MITE facilitates transposition and mobilization of bla NDM-1 gene contexts.

  19. Production of plasmid-encoding NDM-1 in clinical Raoultella ornithinolytica and Leclercia adecarboxylata from China

    Directory of Open Access Journals (Sweden)

    Dongsheng eZhou

    2015-05-01

    Full Text Available Raoultella ornithinolytica YNKP001 and Leclercia adecarboxylata P10164, harboring conjugative plasmids pYNKP001-NDM and pP10164-NDM with determination of complete nucleotide sequences, respectively, were isolated from two different Chinese patients. Production of NDM-1 enzyme by these plasmids accounts for carbapenem resistance of these two strains. This is the first report of blaNDM in L. adecarboxylata and the third report of this gene in R. ornithinolytica. pYNKP001-NDM is very similar to the IncN2 NDM-1-encoding plasmids pTR3, pNDM-ECS01 and p271A, while pP10164-NDM is similar to the IncFIIY blaNDM-1-carrying plasmid pKOX_NDM1. The blaNDM-1 genes of pYNKP001-NDM and pP10164-NDM are embedded in Tn125-like elements, which represent two distinct truncated versions of the prototype NDM-1-encoding Tn125 as observed in pNDM-BJ01. Flanking of these two Tn125-like elements by miniature inverted repeat element (MITE or its remnant denotes MITE felicitates transposition and mobilization of blaNDM-1 gene contexts.

  20. Horizontol dissemination of TEM- and SHV-typr beta-lactamase genes-carrying resistance plasmids amongst clonical isolates of Enterobacteriaceae Disseminação horizontal de plasmídios de resistência contendo genes de beta-lactamase dos tipos TEM e SHV entre isolados clínicos de Enterobacteriaceae

    Directory of Open Access Journals (Sweden)

    Osman Birol Ozgumus

    2008-12-01

    Full Text Available The extended-spectrum β-lactamase (ESBL-producing bacteria have been isolated at increasing frequency worldwide. Expression of ESBL is often associated with multidrug resistance and dissemination by resistance plasmids. During a two-month period in 2000, 133 clinical isolates of enterobacterial strains were randomly collected from outpatients and inpatients at a university hospital in Turkey. The ESBL producing strains were determined by double-disk synergy (DDS testing. Twenty ESBL producing strains (15% including Escherichia coli (n = 9, Klebsiella pneumoniae (n = 7, Klebsiella oxytoca (n = 2 and Enterobacter aerogenes (n = 2 were detected and further analyzed for their resistance transfer features, plasmid profile and nature of the resistance genes. Plasmid transfer assays were performed using broth mating techniques. TEM- and SHV- genes were analyzed by polymerase chain reaction (PCR and hybridization using specific probes. EcoRI restriction enzyme analyses of R plasmids were used in the detection of epidemic plasmids. Fourteen plasmid profiles (A, B1, B2, C1, and C2 to L were obtained with EcoRI restriction enzyme analysis. Most of these plasmids were detected to carry both TEM- and SHV-derived genes by PCR, and confirmed by localizing each gene by hybridization assay. Epidemiological evidence indicated that there was an apparent horizontal dissemination of conjugative R plasmids among multidrug-resistant enterobacterial genera and species in this hospitalO isolamento de bactérias produtoras de beta-lactamases de espectro expandido (ESBL está aumentando no mundo todo. Freqüentemente, a expressão de ESBL está associada com resistência a múltiplas drogas e disseminação por plasmídios de resistência. Durante um período de dois meses em 2000, 133 isolados clínicos de cepas de enterobactérias foram obtidos aleatoriamente de pacientes internos e externos de um hospital universitário na Turquia. As cepas produtoras de ESBL foram

  1. Comparison of restriction enzyme pattern analysis and full gene sequencing of 16S rRNA gene for Nocardia species identification, the first report of Nocardia transvalensis isolated of sputum from Iran, and review of the literature.

    Science.gov (United States)

    Fatahi-Bafghi, Mehdi; Heidarieh, Parvin; Rasouli-Nasab, Masoumeh; Habibnia, Shadi; Hashemi-Shahraki, Abdorazagh; Eshraghi, Seyyed Saeed

    2016-10-01

    Nocardial infections occur in different organs of the body and are common in immune disorder diseases of individuals. The aim of this study was to assess Nocardia species identification by phenotypic tests and molecular techniques applied to nocardiosis in Iranian patients. In the current study, various clinical samples were collected and cultured on conventional media and using the paraffin baiting method. Various phenotypic tests were performed. For accurate identification at the species level, restriction fragment length polymorphisms (RFLP) in the hsp65 and partial 16S rRNA genes and full gene sequencing of the 16S rRNA gene were used. Twenty-seven Nocardia spp. were isolated and analysis of phenotypic tests results showed Nocardia asteroides complex, Nocardia otitidiscaviarum, Nocardia nova, and Nocardia spp. New RFLP patterns of Nocardia strains with hsp65 and partial 16S rRNA genes were obtained. Full gene sequencing of the 16S rRNA gene identified Nocardia cyriacigeorgica, N. otitidiscaviarum, Nocardia farcinica, Nocardia transvalensis, and N. nova. Nocardia infections are rarely reported and this genus is the cause of various illnesses. Accurate identification of Nocardia spp. is important for epidemiology studies and treatment. It should also be noted that some species may have similar RFLP patterns; therefore, full gene sequencing of the 16S rRNA gene is necessary for confirmation.

  2. Bacteriophages limit the existence conditions for conjugative plasmids.

    Science.gov (United States)

    Harrison, Ellie; Wood, A Jamie; Dytham, Calvin; Pitchford, Jonathan W; Truman, Julie; Spiers, Andrew; Paterson, Steve; Brockhurst, Michael A

    2015-06-02

    Bacteriophages are a major cause of bacterial mortality and impose strong selection on natural bacterial populations, yet their effects on the dynamics of conjugative plasmids have rarely been tested. We combined experimental evolution, mathematical modeling, and individual-based simulations to explain how the ecological and population genetics effects of bacteriophages upon bacteria interact to determine the dynamics of conjugative plasmids and their persistence. The ecological effects of bacteriophages on bacteria are predicted to limit the existence conditions for conjugative plasmids, preventing persistence under weak selection for plasmid accessory traits. Experiments showed that phages drove faster extinction of plasmids in environments where the plasmid conferred no benefit, but they also revealed more complex effects of phages on plasmid dynamics under these conditions, specifically, the temporary maintenance of plasmids at fixation followed by rapid loss. We hypothesized that the population genetic effects of bacteriophages, specifically, selection for phage resistance mutations, may have caused this. Further mathematical modeling and individual-based simulations supported our hypothesis, showing that conjugative plasmids may hitchhike with phage resistance mutations in the bacterial chromosome. Conjugative plasmids are infectious loops of DNA capable of transmitting DNA between bacterial cells and between species. Because plasmids often carry extra genes that allow bacteria to live in otherwise-inhospitable environments, their dynamics are central to understanding bacterial adaptive evolution. The plasmid-bacterium interaction has typically been studied in isolation, but in natural bacterial communities, bacteriophages, viruses that infect bacteria, are ubiquitous. Using experiments, mathematical models, and computer simulations we show that bacteriophages drive plasmid dynamics through their ecological and evolutionary effects on bacteria and ultimately

  3. Inducible colistin resistance via a disrupted plasmid-borne mcr-1 gene in a 2008 Vietnamese Shigella sonnei isolate

    Science.gov (United States)

    Pham Thanh, Duy; Thanh Tuyen, Ha; Nguyen Thi Nguyen, To; Chung The, Hao; Wick, Ryan R.; Thwaites, Guy E.; Baker, Stephen; Holt, Kathryn E.

    2016-01-01

    Objectives The objective of this study was to assess the presence of mcr-1 in Shigella sonnei isolated in Vietnam. Methods WGS data were analysed for the presence of the mcr-1 gene sequence. The association of mcr-1 with a plasmid was assessed by PCR and by conjugation. Results Through genome sequencing we identified a plasmid-associated inactive form of mcr-1 in a 2008 Vietnamese isolate of Shigella sonnei. The plasmid was conjugated into Escherichia coli and mcr-1 was activated upon exposure to colistin, resulting in highly colistin-resistant transconjugants. Conclusions This is the first description of the mcr-1 gene in Shigella, which is atypical given that colistin is not ordinarily used to treat diarrhoea. Our data suggest the mcr-1 gene has been circulating in human-restricted pathogens for some time but likely carries a selective fitness cost. PMID:27246235

  4. 限制性内切酶介导的串珠镰刀菌插入突变和致病性突变体的分离%Inserter mutation by restriction enzyme-mediated integration in Fusarium moniliforme and isolation of pathogenicity mutant

    Institute of Scientific and Technical Information of China (English)

    赵培宝; 周庆新; 郭芳先; 李多川

    2007-01-01

    插入突变是研究和分离生物功能基因的重要技术手段,即通过将外源标记基因随即插入生物基因组创建突变体,再利用“质粒拯救”、TAIL—PCR或Reverse-PCR等技术来克隆突变基因。插入突变的前提是遗传转化,目前已在100多种丝状真菌中实现了转化。真菌转化常用技术主要是REMI(restriction enzyme-mediated integration)转化和ATMT(agrobacterium tumefaciens—mediated transformation)转化。

  5. Plasmid flux in Escherichia coli ST131 sublineages, analyzed by plasmid constellation network (PLACNET, a new method for plasmid reconstruction from whole genome sequences.

    Directory of Open Access Journals (Sweden)

    Val F Lanza

    2014-12-01

    Full Text Available Bacterial whole genome sequence (WGS methods are rapidly overtaking classical sequence analysis. Many bacterial sequencing projects focus on mobilome changes, since macroevolutionary events, such as the acquisition or loss of mobile genetic elements, mainly plasmids, play essential roles in adaptive evolution. Existing WGS analysis protocols do not assort contigs between plasmids and the main chromosome, thus hampering full analysis of plasmid sequences. We developed a method (called plasmid constellation networks or PLACNET that identifies, visualizes and analyzes plasmids in WGS projects by creating a network of contig interactions, thus allowing comprehensive plasmid analysis within WGS datasets. The workflow of the method is based on three types of data: assembly information (including scaffold links and coverage, comparison to reference sequences and plasmid-diagnostic sequence features. The resulting network is pruned by expert analysis, to eliminate confounding data, and implemented in a Cytoscape-based graphic representation. To demonstrate PLACNET sensitivity and efficacy, the plasmidome of the Escherichia coli lineage ST131 was analyzed. ST131 is a globally spread clonal group of extraintestinal pathogenic E. coli (ExPEC, comprising different sublineages with ability to acquire and spread antibiotic resistance and virulence genes via plasmids. Results show that plasmids flux in the evolution of this lineage, which is wide open for plasmid exchange. MOBF12/IncF plasmids were pervasive, adding just by themselves more than 350 protein families to the ST131 pangenome. Nearly 50% of the most frequent γ-proteobacterial plasmid groups were found to be present in our limited sample of ten analyzed ST131 genomes, which represent the main ST131 sublineages.

  6. Plasmid flux in Escherichia coli ST131 sublineages, analyzed by plasmid constellation network (PLACNET), a new method for plasmid reconstruction from whole genome sequences.

    Science.gov (United States)

    Lanza, Val F; de Toro, María; Garcillán-Barcia, M Pilar; Mora, Azucena; Blanco, Jorge; Coque, Teresa M; de la Cruz, Fernando

    2014-12-01

    Bacterial whole genome sequence (WGS) methods are rapidly overtaking classical sequence analysis. Many bacterial sequencing projects focus on mobilome changes, since macroevolutionary events, such as the acquisition or loss of mobile genetic elements, mainly plasmids, play essential roles in adaptive evolution. Existing WGS analysis protocols do not assort contigs between plasmids and the main chromosome, thus hampering full analysis of plasmid sequences. We developed a method (called plasmid constellation networks or PLACNET) that identifies, visualizes and analyzes plasmids in WGS projects by creating a network of contig interactions, thus allowing comprehensive plasmid analysis within WGS datasets. The workflow of the method is based on three types of data: assembly information (including scaffold links and coverage), comparison to reference sequences and plasmid-diagnostic sequence features. The resulting network is pruned by expert analysis, to eliminate confounding data, and implemented in a Cytoscape-based graphic representation. To demonstrate PLACNET sensitivity and efficacy, the plasmidome of the Escherichia coli lineage ST131 was analyzed. ST131 is a globally spread clonal group of extraintestinal pathogenic E. coli (ExPEC), comprising different sublineages with ability to acquire and spread antibiotic resistance and virulence genes via plasmids. Results show that plasmids flux in the evolution of this lineage, which is wide open for plasmid exchange. MOBF12/IncF plasmids were pervasive, adding just by themselves more than 350 protein families to the ST131 pangenome. Nearly 50% of the most frequent γ-proteobacterial plasmid groups were found to be present in our limited sample of ten analyzed ST131 genomes, which represent the main ST131 sublineages.

  7. Role of Plasmid in Production of Acetobacter Xylinum Biofilms

    Directory of Open Access Journals (Sweden)

    Abbas Rezaee

    2005-01-01

    Full Text Available Acetobacter xylinum has the ability to produce cellulotic biofilms. Bacterial cellulose is expected to be used in many industrial or biomedical materials for its unique characteristics. A. xylinum contains a complex system of plasmid DNA molecules. A 44 kilobases (kb plasmid was isolated in wild type of A. xylinum. To improve the cellulose producing ability of A. xylinum, role of the plasmid in production of cellulose was studied. The comparisons between wild type and cured cells of A. xylinum showed that there is considerably difference in cellulose production. In order to study the relationship between plasmid and the rate of cellulose production, bacteria were screened for plasmid profile by a modified method for preparation of plasmid. This method yields high levels of pure plasmid DNA that can be used for common molecular techniques, such as digestion and transformation, with high efficiency.

  8. Permissiveness of soil microbial communities towards broad host range plasmids

    DEFF Research Database (Denmark)

    Klümper, Uli

    at high frequencies from diverse donors, I showed plasmid or donor dependence of plasmid transfer to other species. Additionally, environmental factors like stress also impact the permissiveness of phylogenetic groups towards plasmids. The developed method and results increase our ability to predict......Horizontal transfer of mobile genetic elements facilitates adaptive and evolutionary processes in bacteria. Among the known mobile genetic elements, plasmids can confer their hosts with accessory adaptive traits, such as antibiotic or heavy metal resistances, or additional metabolic pathways...... and the extent of bacterial phyla permissive towards plasmid receipt are largely unknown. Historically, methods exploring the underlying genetic and environmental factors of plasmid transfer have been heavily reliant on cultivation and expression of plasmid encoded phenotypes. This has provided an incomplete...

  9. Modeling sRNA-Regulated Plasmid Maintenance

    Science.gov (United States)

    Klumpp, Stefan

    2017-01-01

    We study a theoretical model for the toxin-antitoxin (hok/sok) mechanism for plasmid maintenance in bacteria. Toxin-antitoxin systems enforce the maintenance of a plasmid through post-segregational killing of cells that have lost the plasmid. Key to their function is the tight regulation of expression of a protein toxin by an sRNA antitoxin. Here, we focus on the nonlinear nature of the regulatory circuit dynamics of the toxin-antitoxin mechanism. The mechanism relies on a transient increase in protein concentration rather than on the steady state of the genetic circuit. Through a systematic analysis of the parameter dependence of this transient increase, we confirm some known design features of this system and identify new ones: for an efficient toxin-antitoxin mechanism, the synthesis rate of the toxin’s mRNA template should be lower that of the sRNA antitoxin, the mRNA template should be more stable than the sRNA antitoxin, and the mRNA-sRNA complex should be more stable than the sRNA antitoxin. Moreover, a short half-life of the protein toxin is also beneficial to the function of the toxin-antitoxin system. In addition, we study a therapeutic scenario in which a competitor mRNA is introduced to sequester the sRNA antitoxin, causing the toxic protein to be expressed. PMID:28085919

  10. Modeling sRNA-regulated Plasmid Maintenance

    CERN Document Server

    Gong, Chen Chris

    2016-01-01

    We study a theoretical model for the toxin-antitoxin (hok/sok) mechanism for plasmid maintenance in bacteria. Toxin-antitoxin systems enforce the maintenance of a plasmid through post-segregational killing of cells that have lost the plasmid. Key to their function is the tight regulation of expression of a protein toxin by an sRNA antitoxin. Here, we focus on the nonlinear nature of the regulatory circuit dynamics of the toxin-antitoxin mechanism. The mechanism relies on a transient increase in protein concentration rather than on the steady state of the genetic circuit. Through a systematic analysis of the parameter dependence of this transient increase, we confirm some known design features of this system and identify new ones: for an efficient toxin-antitoxin mechanism, the synthesis rate of the toxin's mRNA template should be lower that of the sRNA antitoxin, the mRNA template should be more stable than the sRNA antitoxin, and the mRNA-sRNA complex should be more stable than the sRNA antitoxin. Moreover, ...

  11. The HaeIV restriction modification system of Haemophilus aegyptius is encoded by a single polypeptide.

    Science.gov (United States)

    Piekarowicz, A; Golaszewska, M; Sunday, A O; Siwińska, M; Stein, D C

    1999-11-12

    The HaeIV restriction endonuclease (ENase) belongs to a distinct class of ENases, characterized by its ability to cleave double-stranded DNA on both sides of its recognition sequence, excising a short DNA fragment that includes the recognition sequence. The gene encoding the HaeIV ENase was cloned from Haemophilus aegyptius into pUC19 using a previously described system that does not need the knowledge that a particular ENase is produced by a bacterial strain. DNA sequence analysis of the insert contained on this plasmid identified a single open reading frame (ORF), with the predicted protein having an apparent molecular mass of approximately 110 kDa. The protein encoded by this ORF was purified to homogeneity from Escherichia coli strain ER1944 carrying the haeIVRM gene on a recombinant plasmid under the control of the inducible ara promoter. The protein possessed both ENase and methyltransferase (MTase) activities. Amino acid sequence analysis was able to identify several conserved motifs found in DNA MTases, located in the middle of the protein. The enzyme recognizes the interrupted palindromic sequence 5' GAPyNNNNNPuTC 3', cleaving double-stranded DNA on both strands upstream and downstream of the recognition sequence, releasing an approximately 33 bp fragment. The ENase possessed an absolute requirement only for Mg(+2). ATP had no influence on ENase or MTase activities. The ENase made the first strand cleavage randomly on either side of the recognition sequence, but the second cleavage occurred more slowly. The MTase activity modified symmetrically located adenine residues on both strands within the recognition sequence yielding N6-methyl adenine. Furthermore, the MTase was active as a dimer.

  12. Geographically diverse Australian isolates of Melissococcus pluton exhibit minimal genotypic diversity by restriction endonuclease analysis.

    Science.gov (United States)

    Djordjevic, S P; Smith, L A; Forbes, W A; Hornitzky, M A

    1999-04-15

    Melissococcus pluton, the causative agent of European foulbrood is an economically significant disease of honey bees (Apis mellifera) across most regions of the world and is prevalent throughout most states of Australia. 49 Isolates of M. pluton recovered from diseased colonies or honey samples in New South Wales, Queensland, South Australia, Tasmania and Victoria were compared using SDS-PAGE, Western immunoblotting and restriction endonuclease analyses. DNA profiles of all 49 geographically diverse isolates showed remarkably similar AluI profiles although four isolates (one each from Queensland, South Australia, New South Wales and Victoria) displayed minor profile variations compared to AluI patterns of all other isolates. DNA from a subset of the 49 Australian and three isolates from the United Kingdom were digested separately with the restriction endonucleases CfoI, RsaI and DraI. Restriction endonuclease fragment patterns generated using these enzymes were also similar although minor variations were noted. SDS-PAGE of whole cell proteins from 13 of the 49 isolates from different states of Australia, including the four isolates which displayed minor profile variations (AluI) produced indistinguishable patterns. Major immunoreactive proteins of approximate molecular masses of 21, 24, 28, 30, 36, 40, 44, 56, 60, 71, 79 and 95 kDa were observed in immunoblots of whole cell lysates of 22 of the 49 isolates and reacted with rabbit hyperimmune antibodies raised against M. pluton whole cells. Neither SDS-PAGE or immunoblotting was capable of distinguishing differences between geographically diverse isolates of M. pluton. Collectively these data confirm that Australian isolates of M. pluton are genetically homogeneous and that this species may be clonal. Plasmid DNA was not detected in whole cell DNA profiles of any isolate resolved using agarose gel electrophoresis.

  13. Characterization of a novel type of MLSB resistance plasmid from Staphylococcus saprophyticus carrying a constitutively expressed erm(C) gene.

    Science.gov (United States)

    Hauschild, Tomasz; Lüthje, Petra; Schwarz, Stefan

    2006-06-15

    An erm(C)-carrying plasmid of unusual size and restriction map, designated pSES22, was identified in a Staphylococcus saprophyticus strain and sequenced completely. Constitutive expression of the erm(C) gene from pSES22 is based on a novel 22-bp tandem duplication in the erm(C) translational attenuator. Comparative analysis of the deduced Erm(C) amino acid sequence revealed that Erm(C) from pSES22 - together with an Erm(C) methylase from S. hyicus - represented a separate branch in the homology tree of Erm(C) methylases. Structural comparisons showed that plasmid pSES22 differed distinctly from all other completely sequenced erm(C)-carrying resistance plasmids. However, pSES22 was similar to several members of a diverse group of small plasmids, all of which carried closely related plasmid backbones consisting of the genes repU and pre/mob, but differed in their resistance genes.

  14. pEVL: A Linear Plasmid for Generating mRNA IVT Templates With Extended Encoded Poly(A Sequences

    Directory of Open Access Journals (Sweden)

    Alexandra E Grier

    2016-01-01

    Full Text Available Increasing demand for large-scale synthesis of in vitro transcribed (IVT mRNA is being driven by the increasing use of mRNA for transient gene expression in cell engineering and therapeutic applications. An important determinant of IVT mRNA potency is the 3′ polyadenosine (poly(A tail, the length of which correlates with translational efficiency. However, present methods for generation of IVT mRNA rely on templates derived from circular plasmids or PCR products, in which homopolymeric tracts are unstable, thus limiting encoded poly(A tail lengths to ≃120 base pairs (bp. Here, we have developed a novel method for generation of extended poly(A tracts using a previously described linear plasmid system, pJazz. We find that linear plasmids can successfully propagate poly(A tracts up to ≃500 bp in length for IVT mRNA production. We then modified pJazz by removing extraneous restriction sites, adding a T7 promoter sequence upstream from an extended multiple cloning site, and adding a unique type-IIS restriction site downstream from the encoded poly(A tract to facilitate generation of IVT mRNA with precisely defined encoded poly(A tracts and 3′ termini. The resulting plasmid, designated pEVL, can be used to generate IVT mRNA with consistent defined lengths and terminal residue(s.

  15. Bacterial spores as particulate carriers for gene gun delivery of plasmid DNA.

    Science.gov (United States)

    Aps, Luana R M M; Tavares, Milene B; Rozenfeld, Julio H K; Lamy, M Teresa; Ferreira, Luís C S; Diniz, Mariana O

    2016-06-20

    Bacillus subtilis spores represent a suitable platform for the adsorption of proteins, enzymes and viral particles at physiological conditions. In the present work, we demonstrate that purified spores can also adsorb DNA on their surface after treatment with cationic molecules. In addition, we demonstrate that DNA-coated B. subtilis spores can be used as particulate carriers and act as an alternative to gold microparticles for the biolistic (gene gun) administration of plasmid DNA in mice. Gene gun delivery of spores pre-treated with DODAB (dioctadecyldimethylammonium bromide) allowed efficient plasmid DNA absorption and induced protein expression levels similar to those obtained with gold microparticles. More importantly, we demonstrated that a DNA vaccine adsorbed on spores can be loaded into biolistic cartridges and efficiently delivered into mice, which induced specific cellular and antibody responses. Altogether, these data indicate that B. subtilis spores represent a simple and low cost alternative for the in vivo delivery of DNA vaccines by the gene gun technology.

  16. Restriction of bacteriophage plaque formation in Streptomyces spp.

    Science.gov (United States)

    Cox, K L; Baltz, R H

    1984-08-01

    Several Streptomyces species that produce restriction endonucleases were characterized for their ability to propagate 10 different broad host range bacteriophages. Each species displayed a different pattern of plaque formation. A restrictionless mutant of S. albus G allowed plaque formation by all 10 phages, whereas the wild-type strain showed plaques with only 2 phages. DNA isolated from three of the phages was analyzed for the presence of restriction sites for Streptomyces species-encoded enzymes, and a very strong correlation was established between the failure to form plaques on Streptomyces species that produced particular restriction enzymes and the presence of the corresponding restriction sites in the phage DNA. Also, the phages that lacked restriction sites in their DNA generally formed plaques on the corresponding restriction endonuclease-producing hosts at high efficiency. The DNAs from the three phages analyzed also generally contained either many or no restriction sites for the Streptomyces species-produced enzymes, suggesting a strong evolutionary trend to either eliminate all or tolerate many restriction sites. The data indicate that restriction plays a major role in host range determination for Streptomyces phages. Analysis of bacteriophage host ranges of many other uncharacterized Streptomyces hosts has identified four relatively nonrestricting hosts, at least two of which may be suitable hosts for gene cloning. The data also suggest that several restriction systems remain to be identified in the genus Streptomyces.

  17. Physical structure and genetic expression of the sulfonamide-resistance plasmid pLS80 and its derivatives in Streptococcus pneumoniae and Bacillus subtilis

    Energy Technology Data Exchange (ETDEWEB)

    Lopez, P.; Espinosa, M.; Lacks, S.A.

    1984-01-01

    The 10-kb chromosomal fragment of Streptococcus pneumoniae cloned in pLS80 contains the sul-d allele of the pneumococcal gene for dihydropteroate synthase. As a single copy in the chromosome this allele confers resistance to sulfanilamide at 0.2 mg/ml; in the multicopy plasmid it confers resistance to 2.0 mg/ml. The sul-d mutation was mapped by restriction analysis to a 0.4-kb region. A spontaneous deletion beginning approx. 1.5 kb to the right of the sul-d mutation prevented gene function, possibly by removing a promoter. This region could be restored by chromosomal facilitation and be demonstrated in the plasmid by selection for sulfonamide resistance. Under selection for a vector marker, tetracycline resistance, only the deleted plasmid was detectable, apparently as a result of plasmid segregation and the advantageous growth rates of cells with smaller plasmids. When such cells were selected for sulfonamide resistance, the deleted region returned to the plasmid, presumably by equilibration between the chromosome and the plasmid pool, to give a low frequency (approx. 10/sup -3/) of cells resistant to sulfanilamide at 2.0 mg/ml. Models for the mechanisms of chromosomal facilitation and equilibration are proposed. Several derivatives of pLS80 could be transferred to Bacillus subtilis, where they conferred resistance to sulfanilamide at 2 mg/ml, thereby demonstrating cross-species expression of the pneumococcal gene. Transfer of the plasmids to B. subtilis gave rise to large deletions to the left of the sul-d marker, but these deletions did not interfere with the sul-d gene function. Restriction maps of pLS80 and its variously deleted derivatives are presented.

  18. Construction and expression of recombinant plasmid pENTR-CMV-EGFP -hsa-mir-16-1/15a%重组质粒pENTR-CMV-EGFP-hsa-mir-16-1/15a的构建与表达

    Institute of Scientific and Technical Information of China (English)

    方潇碧; 张春鸿; 黄亚; 林森; 黄振校; 吴丽萍; 施清圆; 李文峰; 廖志苏

    2011-01-01

    目的:构建针对人鼻咽癌CNE-2Z细胞Bcl-2基因pENTR-CMV-EGFP-hsa-mir-16.1/15a真核表达质粒,转染至CNE-2Z细胞并检测其表达.方法:采用PCR法从重组质粒PGH-16-1/15a中获得16-1/15a-X2370G全长序列,在T4 DNA Ligase连接酶作用下连接入重组载体pENTR-CMV-EGFP.重组质粒经酶切及测序鉴定.将构建成功的重组质粒转染入人鼻咽癌细胞株CNE-2Z,用荧光显微镜观察转染结果.结果:重组质粒pENTR-CMV-EGFP-hsa-mir-16-1/15a经酶切与测序证实构建成功,转染至鼻咽癌CNE-2Z细胞后,荧光显微镜观察证实该重组质粒能在CNE-2Z中表达.结论:成功构建真核表达质粒DENTR-CMV-EGFP-hsa-mir-16-1/15a,并在鼻咽癌CNE-2Z细胞中得到表达,可用于进一步检测其抗肿瘤机制.%Objective To construct the eukaryotic expression plasmid pENTR-CMV-EGFP-hsa-mir-16-1/15a of human Bcl-2 gene,transfect it into nasopharyngeal carcinoma cells CNE-2Z and detect its expression.Methods The full-length cDNA of 16-1/15a-X2370G gene was amplified by PCR from the recombinant plasmid PCH-16-1/15a, then was linked with the recombinant vector pENTR-CMV-EGFP by T4 DNA Ligase. The recomhinant plasmid was identified by restriction enzyme digestion and sequence analvsis. Then the plasmid was correctly transfected into NPC cell CNE-2Z , and the effect of transfection was directly observed under fluorescence microscope. Results The green fluorescent protein was mainly detectd in the CNE-2Z cell , which suggested that the recomhinant plasmid was constructed successfully. Conclusion The eukaryotic expression plasmid pENTR-CMV-EGFP-hsa-mir-I6-1/15a was constructed successfully and expressed in NPC cell CNE-2Z. Its mechanism of antitumor will be further investigated.

  19. Plasmid composition and virulence-associated factors of Yersinia pestis isolates from a plague outbreak at the Paraíba State, Brazil Composição plasmidial e fatores associados à virulência em cepas de Yersinia pestis de um surto de peste no Estado da Paraíba, Brasil

    Directory of Open Access Journals (Sweden)

    Nilma Cintra Leal

    1989-10-01

    Full Text Available Pathogenic Yersinia pestis isolates were collected during a plague outbreak at the Paraiba State in 1986. The Y. pestis isolates were investigated for the presence of virulence-associated factors and plasmid content. All strains analysed were proficient in the expression of the VW and fraction 1 antigens, pigment adsorption and pesticin-fibronolysin-coagulase production. A similar plasmid profile composed by four plasmid with molecular weight of 60, 44, 14.9, and 6.4 Megadaltons (MD was found in all strains. DNA cleavage with EcoRI restriction enzyme further demonstrated the uniform plasmid content of the Y. pestis isolates. Seven additional Y. pestis strains, previously isolated in the same region but in an endemic state, showed the same plasmid fingerprint. The lack of any detectable difference between epidemic and endemic isolates as well as the value of plasmid fingerprints in epidemiology of Y. pestis is discussed.Cepas patogênicas de Yersinia pestis foram coletadas durante um surto de peste no Estado da Paraíba em 1986. Os isolados de Y. pestis foram analisados quanto a presença de fatores associados à virulência e conteúdo plasmidial. Todas as linhagens analisadas foram proficientes na expressão dos antígenos VW e fração 1, além de possuírem capacidade de adsorção de pigmentos e produção de pesticina-fibrinolisina-coagulase. Um perfil plasmidial semelhante composto por quatro plasmídeos com peso molecular de 60, 44, 14.9, e 6.4 MD foi encontrado em todas as linhagens. A clivagem do DNA plasmidial com a enzima de restrição EcoRI demonstrou o conteúdo plasmidial uniforme dos isolados de Y. pestis. Sete outras linhagens de Y. pestis, isoladas previamente no mesmo local mas em condição endêmica, mostraram o mesmo perfil plasmidial. A falta de diferenças entre os isolados epidêmicos e endêmicos assim como o uso do perfil plasmidial na epidemiologic de Y. pestis e discutida.

  20. Cultivation-independent screening revealed hot spots of IncP-1, IncP-7 and IncP-9 plasmid occurrence in different environmental habitats.

    Directory of Open Access Journals (Sweden)

    Simone Dealtry

    Full Text Available IncP-1, IncP-7 and IncP-9 plasmids often carry genes encoding enzymes involved in the degradation of man-made and natural contaminants, thus contributing to bacterial survival in polluted environments. However, the lack of suitable molecular tools often limits the detection of these plasmids in the environment. In this study, PCR followed by Southern blot hybridization detected the presence of plasmid-specific sequences in total community (TC- DNA or fosmid DNA from samples originating from different environments and geographic regions. A novel primer system targeting IncP-9 plasmids was developed and applied along with established primers for IncP-1 and IncP-7. Screening TC-DNA from biopurification systems (BPS which are used on farms for the purification of pesticide-contaminated water revealed high abundances of IncP-1 plasmids belonging to different subgroups as well as IncP-7 and IncP-9. The novel IncP-9 primer-system targeting the rep gene of nine IncP-9 subgroups allowed the detection of a high diversity of IncP-9 plasmid specific sequences in environments with different sources of pollution. Thus polluted sites are "hot spots" of plasmids potentially carrying catabolic genes.

  1. Plasmid transfer between bacteria in soil microcosms and the field

    Directory of Open Access Journals (Sweden)

    Eric Smit

    1997-01-01

    Full Text Available In ibis review factors influencing conjugal plasmid transfer between bacteria and the possible role of naturally occurring selftransmissible plasmide for the dissemination of recombinant DNA in soil will be discussed. In microcosm studies, plasmid transfer between various species of introduced bacteria has been detected. Moreover, plamid transfer to indigenous soil micoorganisms was observed. Soil is an oligotrophic environment and plasmid transfer occurred mainly under conditions which were nutritionally favourable for bacteria, such as in the plant rhizosphere and in the presence of clay minerais or added nutrients. Mobilizable plasmids, lacking the ability to transfer themselves, have been reported to be transferred in the presence of selftransmissible plasmids. A study comparing conjugal transfer in microcosme with those in the field revealed that the transfer rates found in microcosme and in the field were similar. Transfer of chromosomal DNA by plasmid RP4 could only be shown on filters and was not observed in soil. Transfer of plasmids carrying biodegradative genes appeared to be favoured in the presence of the compound that can be degraded. Evidence was found for the presence of naturally-occurring selftransmissible plasmids in bacteria in the rhizosphere which could mobilize recombinant plasmids.

  2. Isolation and screening of plasmids from the epilithon which mobilize recombinant plasmid pD10.

    OpenAIRE

    Hill, K E; A. J. Weightman; Fry, J C

    1992-01-01

    This study examined the potential of bacteria from river epilithon to mobilize a recombinant catabolic plasmid, pD10, encoding 3-chlorobenzoate degradation and kanamycin resistance. Fifty-four mobilizing plasmids were exogenously isolated by triparental matings between strains of Pseudomonas putida and epilithic bacteria from the River Taff (South Wales, United Kingdom). Frequencies for mobilization ranged from 1.7 x 10(-8) to 4.5 x 10(-3) per recipient at 20 degrees C. The sizes of the mobil...

  3. Plasmid DNA Analysis of Pathogenic Escherichia coli in Musk Deer%麝致病性大肠杆菌的质粒DNA分析

    Institute of Scientific and Technical Information of China (English)

    罗燕; 程建国; 郑士华; 赵翠; 李蓓; 李敏

    2009-01-01

    [Objective] The pathogenic Escherichia coli in musk deer was classified at molecular level to provide basic materials for molecular epidemiology of pathogenic Escherichia coli in musk deer. [Method] Plasmids from 24 pathogenic Escherichia coli in musk deer were extracted by the Lysis Triton method, and then identified by single enzyme digestion with three endonucleases of Hind Ⅲ, EcoR Ⅰ and BamH Ⅰ. [Result] The yield rate of plasmids was 91.6%, and 24 pathogenic Escherichia coli in musk deer had the identical or similar plasmid profiles. [Conclusion] Plasmid DNA analysis offers scientific basis for molecular epidemiology of pathogenic Escherichia coli in musk deer in Sichuan Institute of Musk Deer Breeding.

  4. Restriction digestion method for haplotyping the potato psyllid, Bactericera cockerelli

    Science.gov (United States)

    A restriction digestion method has been developed for haplotyping the potato psyllid, Bactericera cockerelli Sulc., an economically important pest of solanaceous crops. This method differentiates the four known potato psyllid haplotypes by utilizing restriction enzyme digestion of a portion of the ...

  5. Vaccination with Trypomastigote Surface Antigen 1-Encoding Plasmid DNA Confers Protection against Lethal Trypanosoma cruzi Infection

    OpenAIRE

    1998-01-01

    DNA vaccination was evaluated with the experimental murine model of Trypanosoma cruzi infection as a means to induce antiparasite protective immunity, and the trypomastigote surface antigen 1 (TSA-1), a target of anti-T. cruzi antibody and major histocompatibility complex (MHC) class I-restricted CD8+ cytotoxic T-lymphocyte (CTL) responses, was used as the model antigen. Following the intramuscular immunization of H-2b and H-2d mice with a plasmid DNA encoding an N-terminally truncated TSA-1 ...

  6. Genes from plasmid pKM101 in Haemophilus influenzae: separation of functions of mucA and mucB

    Energy Technology Data Exchange (ETDEWEB)

    Balganesh, M.; Setlow, J.K.

    1985-11-01

    Haemophilus influenzae, normally not mutable by UV, became UV mutable with a recombinant plasmid insertion. A 7.8-kilobase-pair (kbp) fragment of the plasmid pKM101 containing the mucA and mucB genes was ligated to the shuttle vector pDM2, and a Rec- strain of H. influenzae was transformed with the ligated mixture. All of the transformants, unlike the parent Rec- strain, were resistant to UV, could carry out postreplication repair and Weigle reactivation, showed greatly increased spontaneous mutation, and contained a plasmid carrying an insert of only 1.2 rather than 7.8 kbp. This plasmid in a umuC mutant strain of Escherichia coli complemented a pKM101 derivative lacking mucA function but with an intact mucB gene, although there was no complementation with a mucA+ mucB- plasmid, suggesting that the newly constructed plasmid coded for the mucA protein; this is in accord with the restriction analysis and hybridization between the plasmid and a probe containing all of the mucA gene but only a small fraction of mucB. When one of the H. influenzae Rec- transformants lost the plasmid, the resistance to UV was retained but the high spontaneous mutation and UV mutability were not. The fact that there was hybridization between the chromosome of the cured strain and a probe containing both muc genes but none when almost no mucB was present suggested that at least part of the mucB gene had been integrated into the Rec- chromosome. Five different postreplication repair-proficient strains became UV mutable and had high spontaneous mutation rates caused by the putative mucA plasmid, indicating that these strains already possessed a chromosomal equivalent of the mucB gene.

  7. Isolation of clinical strains of Pseudomonas aeruginosa harboring different plasmids.

    Science.gov (United States)

    Ranjbar, R; Owlia, P; Saderi, H; Bameri, Z; Izadi, M; Jonaidi, N; Morovvati, S

    2007-09-01

    Aim of this study was to investigate the presence of plasmids among the strains of P. aeruginosa isolated from clinically diagnosed cases in Tehran in 2006. A total of 38 strains of P. aeruginosa were isolated. With the exception of one isolate, all P. aeruginosa strains harbored at least one plasmid band. The electrophoretic analysis of plasmid DNAs showed different number of plasmid bands among the strains tested. The DNA band of 1.4 kbp was evident in 84.2% of the strains. Approximately 71 and 21% of the isolates harbored concomitantly two and three plasmids, respectively. Isolation of strains with diverse types of plasmids suggests the different cluster of P. aeruginosa might be disseminated during the current study period.

  8. Construction of Prokaryotic Expression Plasmid of mtrC Protein of Neisseria gonorrhoeae and Its Expression in E. Coli

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    In order to provide a rational research basis for detection of resistance of Neisseria gonorrhoeae to antimicrobial hydrophobic agents and study on the resistant mechanism of multiple transferable resistance (mtr) efflux system, plasmid pET-28a(+) encoding mtrC gene was constructed and the related target protein was expressed in Escherichia coli (E. coli) DE3. The fragments of mtrC gene of Neisseria gonorrhoeae from the standard strains were amplified and cloned into prokaryotic expression plasmid pET-28a(+) with restriction endonuclease to construct recombinant pET-mtrC which was verified by restriction endonuclease and DNA sequencing. The recombinant was transformed into E. coli DE3 to express the protein mtrC induced by IPTG. The results showed mtrC DNA fragment was proved correct through restriction endonuclease and DNA sequencing. Its sequence was 99.5 % homologus to that published on GeneBank (U14993). A 48.5 kD fusion protein which was induced by IPTG was detected by SDS-PAGE. It was concluded that the construction of prokaryotic expression plasmid of mtrC protein of Neisseria gonorrhoeae was correct and the fusion protein was successively expressed in E. coli.

  9. [Construction of genomic library of L. interrogans serovar lai using lambda gt11 as the vector and a study of recombiant plasmid pDL121].

    Science.gov (United States)

    Liu, H; Dai, B; Jing, B; Wu, W; Li, S; Fang, Z; Zhao, H; Ye, D; Yan, R; Liu, J; Song, S; Yang, Y; Zhang, Y; Liu, F; Tu, Y; Yang, H; Huang, Z; Liang, L; Hu, L; Zhao, M

    1997-03-01

    A genomic library of L. interrogans serovar lai strain 017 has been constructed using lambda gt11 as the vector. DNA was partially digested by two blunt-end restriction enzymes, then methylated with EcoR I methylase; after EcoR I linker was added to the DNA, the linker-ended DNA was ligated to the dephosphorylated EcoR I digested lambda gt11 arms. The recombined DNA was packaged in vitro, and used to transduct E. coli Y1090 for amplification. There were 2.1 x 10(6) recombinant bacteriophages as recognized by their ability to form white plaques plated on Lac host in the presence of both IPTG and X-Ga1. A positive clone, designated lambda DL12, was screened with a rabbit anti-serum against L. interrogans serovar lai from the genomic library. The DNA from lambda DL12 was subcloned into plasmid pUC18. A recombinant (designated as pDL121) was obtained. SDS-PAGE analysis indicated that a 23 kd was expressed in E. coli JM 103 harboring pDL121. Western blotting analysis showed that a specific protein band molecular weight of 23 kd could be recognized by the rabbit antiserum against L. interrogans serovar lai strain 017.

  10. Construction and expression of recombinant plasmid TAZ-pcDNA3 .1 and TAZ-pEGFP-C2%T AZ 基因重组质粒的构建与表达

    Institute of Scientific and Technical Information of China (English)

    仲念念; 朱伶俐; 王旋; 房娜

    2015-01-01

    Objective Two recombinant plasmids , TAZ‐pcDNA3 .1 and TAZ‐pEGFP‐C2 , were established . The protein expression of TAZ in HEK293 cells was detected by Western Blot and the roles of TAZ in promoting cell proliferation and migration were further explored . Methods AZ gene was amplified by PCR , fragments were recovered followed by connection with glue T carrier , blue‐white screening , transformation and extraction of plasmid DNA . Then the plasmid DNA was digested , connected by T 4 DNA Ligase , and then sub‐cloned into pEGFP‐C2 and pcDNA3 .1 to construct new recombinant plasmids . These plasmids were transfected into HEK293 cells to observe the distribution of TAZ using a fluorescence detector . The protein expression was detected by Western Blot .Results By restriction enzyme identification and sequence analysis , the recombinant plasmids were successfully constructed . Fluorescent photos show that the distribution of TAZ molecule was in the nucleus and cytoplasm . Western Blot test results showed that TAZ molecule could induce over‐expression of specific proteins . Conclusion Two recombinant plasmids were successfully constructed . The effects of TAZ over‐expression were validated , which will lay a foundation for revealing the mechanism of TAZ in promoting cell proliferation and migration .%目的:构建重组质粒TAZ‐pcDNA31.及 TAZ‐pEGFP‐C2,并应用Western Blot检测TAZ蛋白在细胞内的表达情况,初步探索TAZ分子促进细胞增殖和迁移的作用机制。方法通过PCR扩增获得 TAZ基因片段,胶回收后连接T载体,蓝白斑筛选,转化,提质粒,酶切,用T4 DNA Ligase连接,亚克隆进入pEGFP‐C2和pcDNA31.获得新的重组质粒,分别转染 HEK293细胞,智能型荧光细胞监测仪观察TAZ分子在细胞内的分布情况,Western Blot检测其在细胞内的表达情况。结果重组质粒经双酶切鉴定和测序证明构建成功,荧光照片显示 TAZ分子分布在

  11. Conjugative botulinum neurotoxin-encoding plasmids in Clostridium botulinum.

    Directory of Open Access Journals (Sweden)

    Kristin M Marshall

    Full Text Available BACKGROUND: Clostridium botulinum produces seven distinct serotypes of botulinum neurotoxins (BoNTs. The genes encoding different subtype neurotoxins of serotypes A, B, F and several dual neurotoxin-producing strains have been shown to reside on plasmids, suggesting that intra- and interspecies transfer of BoNT-encoding plasmids may occur. The objective of the present study was to determine whether these C. botulinum BoNT-encoding plasmids are conjugative. METHODOLOGY/PRINCIPAL FINDINGS: C. botulinum BoNT-encoding plasmids pBotCDC-A3 (strain CDC-A3, pCLJ (strain 657Ba and pCLL (strain Eklund 17B were tagged with the erythromycin resistance marker (Erm using the ClosTron mutagenesis system by inserting a group II intron into the neurotoxin genes carried on these plasmids. Transfer of the tagged plasmids from the donor strains CDC-A3, 657Ba and Eklund 17B to tetracycline-resistant recipient C. botulinum strains was evaluated in mating experiments. Erythromycin and tetracycline resistant transconjugants were isolated from donor:recipient mating pairs tested. Transfer of the plasmids to the transconjugants was confirmed by pulsed-field gel electrophoresis (PFGE and Southern hybridizations. Transfer required cell-to-cell contact and was DNase resistant. This indicates that transfer of these plasmids occurs via a conjugation mechanism. CONCLUSIONS/SIGNIFICANCE: This is the first evidence supporting conjugal transfer of native botulinum neurotoxin-encoding plasmids in C. botulinum, and provides a probable mechanism for the lateral distribution of BoNT-encoding plasmids to other C. botulinum strains. The potential transfer of C. botulinum BoNT-encoding plasmids to other bacterial hosts in the environment or within the human intestine is of great concern for human pathogenicity and necessitates further characterization of these plasmids.

  12. Photonic plasmid stability of transformed Salmonella Typhimurium: A comparison of three unique plasmids

    Directory of Open Access Journals (Sweden)

    Lay Donald

    2009-07-01

    Full Text Available Abstract Background Acquiring a highly stable photonic plasmid in transformed Salmonella Typhimurium for use in biophotonic studies of bacterial tracking in vivo is critical to experimental paradigm development. The objective of this study was to determine stability of transformed Salmonella Typhimurium (S. typh-lux using three different plasmids and characterize their respective photonic properties. Results In presence of ampicillin (AMP, S. typh-lux with pCGLS-1, pAK1-lux and pXEN-1 plasmids exhibited 100% photon-emitting colonies over a 10-d study period. Photon emitters of S. typh-lux with pCGLS-1, pAK1-lux and pXEN-1 without AMP selection decreased over time (P 7 to 1 × 109 CFU, P 0.05; although photonic emissions across a range of bacterial concentrations were not different (1 × 104 to 1 × 106 CFU, P > 0.05. For very low density bacterial concentrations imaged in 96 well plates photonic emissions were positively correlated with bacterial concentration (P 3 to 1 × 105 CFU low to high were different in the 96-well plate format (P Conclusion These data characterize photon stability properties for S. typh-lux transformed with three different photon generating plasmids that may facilitate real-time Salmonella tracking using in vivo or in situ biophotonic paradigms.

  13. Construtcion of Neisseria Gonorrhoeae Porin B Plasmid Recombinant and Its Expression in E.coli

    Institute of Scientific and Technical Information of China (English)

    SONG Qifa; LIAO Fang; YE Siying; CUI Bing; XIONG Ping

    2005-01-01

    Summary: A prokaryotic expression recombinant plasmid pET-PIB to express porin B (PIB) of Neisseria gonorrhoeae in E.coli DE3 was constructed in order to provide a basis of research in detection, prophylactic and therapeutic vaccine against the pathogen infection. The gene encoding PIB was amplified by PCR from Neisseria gonorrhoeae and cloned into prokaryotic expression plasmid pET-28a(+) to construct a pET-PIB recombinant, which was verified by restriction endonuclease and DNA sequencing. Protein PIB was expressed in E.coli DE3 induced with IPTG. The antigenicity of the expressed protein was evaluated by indirect ELISA. Rabbits were immunized with the protein and serum was collected after immunization. To assess the immunogenicity of the protein, the titer of serum to protein PIB was determined by ELISA. DNA sequence analysis showed that the nucleic acid sequence of PIB gene was 99.28 % of homology compared with that (NGPIB18) published in GenBank. A 41 kD fused protein was detected by SDS-PAGE and was proven to have reactivity with anti-PIB polyclonal antibody from mouse. A polyclonal antibody to PIB of 1:4000 titer determined by indirect ELISA was obtained from rabbit immunized with the purified product. Recombinant plasmid encoding PIB of Neisseria gonorrhoeae was constructed. Protein PIB with antigenicity and immunogenicity was successfully expressed.

  14. Study on construction and expression of chimeric plasmid of HIV-1 CN54 strain gagprotease gene and Poliovirus cDNA%HIV-Ⅰ CN54株gagprotease基因嵌合脊髓灰质炎病毒cDNA质粒的构建和表达研究

    Institute of Scientific and Technical Information of China (English)

    张阳德; 路晓林; 李年丰; 赵劲风; 陈伟; 李亚勇; 乐园

    2006-01-01

    [Objective] To construct a chimeric expression plasmid which contains HIV-1 CN54 strain gagprotease gene and Poliovirus cDNA, identify and examine the recombinant plasmid and its gene expression. [Methods]HIV-1 CN54 strain gagprotease gene with cleavage enzyme site in its two ends was obtained through PCR technique. It was orientedly inserted into the expression plasmid pSVA14, replacing one structural gene fragment of Polioviurs. Later the recombinant plasmid was proved correct construction by restriction enzyme cleavage identification.With liposome transfection way, the recombinant plasmid was trasnfected into cultured Hela cells. Western blot was adopted to examine the gene expression. [Results] Proved through electrophoresis in gel, HIV-1 gagprotease gene was successfully amplified. No mutation occurred in its bases identified by gene sequencing. Identification by restriction endonuclease enzyme showed gagprotease gene was correctly inserted into poliovirus cDNA. Western blot test showed that HIV related protein was expressed in cultured Hela cells. [Conclusion] A chimeric Polioviurs-HIV gagproteae gene expression plasmid was constructed, which could provide the base for Poliovirus as a HIV gene expression vector. It is of great significance to invent an AIDS vaccine based on Poliovirus vector.%目的 构建HIV-1 CN54株gagprotease基因嵌合脊髓灰质炎病毒cDNA的表达质粒,并鉴定、检测基因及其表达.方法 用PCR技术获得人免疫缺陷病毒CN54株的gagprotease基因,并使其两端带上合适的酶切位点,将其定向插入到包含脊髓灰质炎病毒cDNA的表达质粒pSVA14中,替代其部分结构基因,构建HIV基因嵌合缺陷性脊髓灰质炎病毒基因组的表达质粒.经筛选、鉴定后用脂质体转染技术将新构建的质粒转入Hela细胞内,用Western Blot方法检测目的基因在Hela细胞内的表达.结果 PCR技术扩增所得的人免疫缺陷病毒CN54株gagprotease基因经琼脂糖凝胶电泳

  15. Bacteriophages Limit the Existence Conditions for Conjugative Plasmids

    Science.gov (United States)

    Wood, A. Jamie; Dytham, Calvin; Pitchford, Jonathan W.; Truman, Julie; Spiers, Andrew; Paterson, Steve; Brockhurst, Michael A.

    2015-01-01

    ABSTRACT Bacteriophages are a major cause of bacterial mortality and impose strong selection on natural bacterial populations, yet their effects on the dynamics of conjugative plasmids have rarely been tested. We combined experimental evolution, mathematical modeling, and individual-based simulations to explain how the ecological and population genetics effects of bacteriophages upon bacteria interact to determine the dynamics of conjugative plasmids and their persistence. The ecological effects of bacteriophages on bacteria are predicted to limit the existence conditions for conjugative plasmids, preventing persistence under weak selection for plasmid accessory traits. Experiments showed that phages drove faster extinction of plasmids in environments where the plasmid conferred no benefit, but they also revealed more complex effects of phages on plasmid dynamics under these conditions, specifically, the temporary maintenance of plasmids at fixation followed by rapid loss. We hypothesized that the population genetic effects of bacteriophages, specifically, selection for phage resistance mutations, may have caused this. Further mathematical modeling and individual-based simulations supported our hypothesis, showing that conjugative plasmids may hitchhike with phage resistance mutations in the bacterial chromosome. PMID:26037122

  16. Plasmid genes required for microcin B17 production.

    Science.gov (United States)

    San Millán, J L; Kolter, R; Moreno, F

    1985-09-01

    The production of the antibiotic substance microcin B17 (Mcc) is determined by a 3.5-kilobase DNA fragment from plasmid pMccB17. Several Mcc- mutations on plasmid pMccB17 were obtained by both transposon insertion and nitrosoguanidine mutagenesis. Plasmids carrying these mutations were tested for their ability to complement Mcc- insertion or deletion mutations on pMM102 (pMM102 is a pBR322 derivative carrying the region encoding microcin B17). Results from these experiments indicate that at least four plasmid genes are required for microcin production.

  17. Plasmid P1 replication: negative control by repeated DNA sequences.

    OpenAIRE

    Chattoraj, D; Cordes, K.; Abeles, A

    1984-01-01

    The incompatibility locus, incA, of the unit-copy plasmid P1 is contained within a fragment that is essentially a set of nine 19-base-pair repeats. One or more copies of the fragment destabilizes the plasmid when present in trans. Here we show that extra copies of incA interfere with plasmid DNA replication and that a deletion of most of incA increases plasmid copy number. Thus, incA is not essential for replication but is required for its control. When cloned in a high-copy-number vector, pi...

  18. [Isolation of the R'his plasmids of Vibrio cholerae].

    Science.gov (United States)

    Rusina, O Iu; Tiganova, I G; Aleshkin, G I; Andreeva, I V; Skavronskaia, A G

    1987-06-01

    V. cholerae strain VT5104 capable of donor activity in conjugation has been constructed by the genetic technique based on plasmid RP4::Mucts62 integration into V. cholerae chromosome due to plasmid homology with Mucts62 inserted into the chromosome. The gene for histidine synthesis has been mobilized and transferred into the recipient cells from VT5104 donor. The conjugants obtained are able to efficiently transfer his+ gene included into the plasmid structure in conjugation with eltor recipient. Thus, the constructed strain VT5104 generates R' plasmids carrying V. cholerae chromosomal genes.

  19. Identification of beef using restriction fragment length polymorphism–

    Directory of Open Access Journals (Sweden)

    R. A. Al-Sanjary

    2009-01-01

    Full Text Available To differentiate the beef from other types of meat consumed by human, DNA markers based on polymerase chain reaction restriction fragment length polymorphism technique is performed by using universal primers designed on mitochondrial cytochrome b gene to obtain amplified band 359 bp, then digested with some of restriction enzymes like Tru91, RsaI, Hinf I, Hae III, Alu I, Taq I, Mob I. The result revealed that, the Hinf I enzyme produce three bands 198, 117, 44 bp and the Hae III enzyme revealed two band 285, 74 bp, the Alu I enzyme also produced two band but the molecular weight are 190, 169 bp. The other enzymes did not reveal any digestion of the amplified bands and this result is a characteristic unique to beef compared with other types of meat when using same enzymes.

  20. Restrictions and Proportionality

    DEFF Research Database (Denmark)

    Werlauff, Erik

    2009-01-01

    The article discusses three central aspects of the freedoms under European Community law, namely 1) the prohibition against restrictions as an important extension of the prohibition against discrimination, 2) a prohibition against exit restrictions which is just as important as the prohibition...

  1. Designing and constructing an 100 bp DNA Ladder by combining PCR and enzyme digestion methods

    Directory of Open Access Journals (Sweden)

    Saidijam M

    2011-05-01

    Full Text Available "n Normal 0 false false false EN-US X-NONE AR-SA MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:Arial; mso-bidi-theme-font:minor-bidi;} Background: Molecular DNA markers are one of the most important tools in molecular biology labs. The size of DNA molecules is determined by comparing them with known bands of markers during gel electrophoresis. There are many different protocols to produce these kinds of molecular markers. In this study we have suggested an efficient strategy to produce molecular weight markers in industrial proportions."n"nMethods : To achieve the desired sizes of DNA fragments, a combination of two previously known methods, restriction enzyme digestion and polymerase chain reaction (PCR, were used. The enzymatic digestion process was based on designing and constructing plasmids which equaled in size with the desired length of DNA fragments and produced the desired DNA fragment upon linearization. In the PCR method, the desired length of DNA fragments were cloned in multiple cloning sites of pTZ57R plasmid and in a PCR reaction, the new constructed plasmid was used as a template to produce the final fragment."n"nResults : Upon application of this strategy, 2000 and 3000 bp DNA fragments were produced by enzymatic digestion of plasmids of the same size. Moreover, 100 to 1500 bp fragments were produced during PCR using only a set of

  2. Food Enzymes

    Science.gov (United States)

    McBroom, Rachel; Oliver-Hoyo, Maria T.

    2007-01-01

    Many students view biology and chemistry as two unrelated, separate sciences; how these courses are generally taught in high schools may do little to change that impression. The study of enzymes provide a great opportunity for both biology and chemistry teachers to share with students the interdisciplinary nature of science. This article describes…

  3. Food Enzymes

    Science.gov (United States)

    McBroom, Rachel; Oliver-Hoyo, Maria T.

    2007-01-01

    Many students view biology and chemistry as two unrelated, separate sciences; how these courses are generally taught in high schools may do little to change that impression. The study of enzymes provide a great opportunity for both biology and chemistry teachers to share with students the interdisciplinary nature of science. This article describes…

  4. Enzyme immunoassay

    DEFF Research Database (Denmark)

    Feldt-Rasmussen, B; Dinesen, B; Deckert, M

    1985-01-01

    An enzyme linked immunoadsorbent assay for urinary albumin using commercially available reagents is described. The assay range is 2.5-120 micrograms/l. When samples are analysed in two standard dilutions, the assayable albumin concentration range is 2.5-240 mg/l, covering the clinical range from...

  5. Construction and expressing activity of microRNA-125a plasmid expression vectors%MicroRNA-125a质粒表达载体的构建及其表达活性

    Institute of Scientific and Technical Information of China (English)

    张涛; 李东; 李华; 高辉

    2012-01-01

    背景:pSuper是一种非编码RNA的真核表达载体,可在细胞质内表达miRNA前体,经过细胞自身的Dicer酶切后形成miRNA成熟体,其过程能够完全模仿细胞内源性miRNA形成过程.因此,利用pSuper表达载体构建一种肝癌抑制性miRNA:miR-125a的表达载体,为下一步研究其抗癌机制奠定了基础.目的:构建miR-125a的真核表达质粒pSuper-miR-125a,并验证其表达miR-125a的效率和特异性.方法:PCR扩增miR-125a前体(Pre-miR-125a)的目的片段,将其T-A克隆入pMD18-T过渡质粒载体,限制性内切酶切下目的片段,连接入pSuper质粒表达载体得到pSuper-miR-125a重组质粒;将重组质粒转染Hela细胞,miRNA定量PCR检测重组质粒表达miR-125a的效率和特异性.结果与结论:成功将miR-125a前体(Pre-miR-125a)片段克隆入真核表达质粒pSuper H1启动子下游,获得pSuper-miR-125a重组表达质粒,转染该质粒进入Hela细胞后能够在细胞内高效和特异的表达miR-125a,进一步证明 pSuper真核表达质粒适合miRNA的表达研究.%BACKGROUND: pSuper is a kind of eukaryotic expression vectors of non-coding RNA. It expresses the precursor of miRNA in plasma, and then the precursor is cut by Dicer enzyme to produce mature miRNA. This process completely imitates the formation process of endogenous miRNA. In this study, pSuper is utilized to construct an expression vector of miR-125a, which could inhibit liver cancer. It provides basis for the further investigation on antitumor mechanism. OBJECTIVE: To construct the eukaryotic plasmid pSuper-miR-125a expressing miR-125a and to confirm the expressing efficiency and specificity of miR-125a in the plasmid. METHODS: Target fragments in the precursor of miR-125a (Pre-miR-125a) were amplified by PCR. The fragments were cloned into pMD18-T transition plasmid using T-A cloning method. The target fragments were cut by restriction enzyme and then connected to pSuper plasmid to construct recombinant plasmid p

  6. Helper plasmid cloning in Streptococcus sanguis: cloning of a tetracycline resistance determinant from the Streptococcus mutans chromosome.

    Science.gov (United States)

    Tobian, J A; Macrina, F L

    1982-10-01

    A model system for testing the helper plasmid cloning system of Gryczan et al. (Mol. Gen. Genet. 177:459-467, 1980) was devised for the Streptococcus sanguis (Challis) host-vector system. In this system, linearized pVA736 plasmid efficiently transformed an S. sanguis (Challis) host containing a homologous plasmid, pVA380-1, but did not transform a plasmidless host or a host containing a nonhomologous plasmid, pVA380. In addition, whereas monomeric circular pVA736 transformed a plasmidless host with two-hit kinetics, it transformed a pVA380-1-containing host with one-hit kinetics. This helper plasmid cloning system was used to isolate two HindIII fragments (5.0 megadaltons [Mdal] and 1.9 Mdal in size) from the chromosome of Streptococcus mutans V825 which conferred high-level tetracycline resistance. One tetracycline-resistant clone was examined and found to contain three plasmids which were sized and designated pVA868 (9.0 Mdal), pVA869 (9.5 Mdal), and pVA870 (9.8 Mdal). Results of Southern blot hybridization and restriction endonuclease digestion confirmed that all three chimeras were composed of two HindIII fragments of the S. mutans V825 chromosome, as well as a large portion, varying in size for each chimera, of the 2.8 Mdal cloning vector, pVA380-1. Incompatibility observed between pVA380-1 and each of the chimeras indicated that replication of the chimeras was governed by the pVA380-1 replicative origin. Southern blotting experiments revealed that the chimeras hybridized to Tn916, providing the first evidence that transposon-related genes of enteric streptococcal origin are disseminated among oral streptococci.

  7. Host cell variations resulting from F plasmid-controlled replication of the Escherichia coli chromosome.

    Science.gov (United States)

    Tresguerres, E F; Nieto, C; Casquero, I; Cánovas, J L

    1986-01-01

    Cell size and DNA concentration were measured in Escherichia coli K-12 ET64. This strain carries a dnaA (Ts) mutation that has been suppressed by the insertion of the F plasmid into the chromosome. ET64 can grow in a balanced steady state of exponential growth at the restrictive temperature for its dnaA allele (39 degrees C), in which chromosome replication is controlled by the F plasmid, and at the permissive temperature (30 degrees C), in which chromosome replication is controlled by dnaA-oriC. When cells grown at the indicated temperatures were compared, it was observed that at 39 degrees C, the cell mass increased and the amount of cellular DNA decreased slightly; therefore, the DNA concentration was strongly reduced. These changes can neither be explained by the reduction of the generation time (which is only 10-15%) nor from observed changes in the replication time and in the time between DNA synthesis termination and cell division. Variations were mainly due to the increase in cell mass per origin of replication, at initiation, in cells grown at 39 degrees C. Control of chromosome replication by the F plasmid appears to be the reason for the increase in the initiation mass. Other possible causes, such as the modification of growth temperature, the generation time, or both, were discarded. These observations suggest that at one growth rate, the F plasmid replicates at a particular cell mass to F particle number ratio, and that this ratio is higher than the cell mass to oriC ratio at the initiation of chromosome replication. This fact might be significant to coordinate the replication of two different replicons in the same cell. PMID:3511032

  8. Encapsulation and delivery of plasmid DNA by virus-like nanoparticles engineered from Macrobrachium rosenbergii nodavirus.

    Science.gov (United States)

    Jariyapong, Pitchanee; Chotwiwatthanakun, Charoonroj; Somrit, Monsicha; Jitrapakdee, Sarawut; Xing, Li; Cheng, Holland R; Weerachatyanukul, Wattana

    2014-01-22

    Virus-like particles (VLPs) are potential candidates in developing biological containers for packaging therapeutic or biologically active agents. Here, we expressed Macrobrachium rosenbergii nodavirus (MrNv) capsid protein (encoding amino acids M1-N371 with 6 histidine residuals) in an Escherichia coli BL21(DE3). These easily purified capsid protein self-assembled into VLPs, and disassembly/reassembly could be controlled in a calcium-dependent manner. Physically, MrNv VLPs resisted to digestive enzymes, a property that should be advantageous for protection of active compounds against harsh conditions. We also proved that MrNv VLPs were capable of encapsulating plasmid DNA in the range of 0.035-0.042 mol ratio (DNA/protein) or 2-3 plasmids/VLP (assuming that MrNV VLPs is T=1, i made up of 60 capsid monomers). These VLPs interacted with cultured insect cells and delivered loaded plasmid DNA into the cells as shown by green fluorescent protein (GFP) reporter. With many advantageous properties including self-encapsulation, MrNv VLPs are good candidates for delivery of therapeutic agents.

  9. [Localization of denitrification genes in plasmid DNA of bacteria Azospirillum brasilense].

    Science.gov (United States)

    Petrova, L P; Varshalomidze, O É; Shelud'ko, A V; Katsy, E I

    2010-07-01

    In 85-Mda plasmid (p85) of plant-associated bacteria Azospirillum brasilense Sp245 model strain, the genes encoding copper-containing nitrite reductase (nirK); heterodimeric NO-reductase (norCB); NorQ and NorD proteins affecting synthesis and (or) activation of NirK and (or) NO-reductase (norQD); catalytic subunit I ofcytochrom c oxidase (CccoN); presumable NO sensor carrying two hemeerythrine domains (orf181); and an enzyme required for synthesis of presumable NO antagonist, homocystein (metC) were identified. In the same region of p85, orf293 encoding transcriptional regulator of LysR type, orf208 whose protein product carries a formylmethanofuran dehydrogenase subunit E domain, and an orf164-encoding conservative secretory protein with unknown function were also found. Localization of a set of denitrification genes in the plasmid DNA A. brasilense Sp245 adjacent to IS elements ISAzba1 and ISAzba2 indicates potential mobility of these genes and high probability of their horizontal transfer among populations of rhizospheric bacteria. A site homologous to p85 nirK-orf208-orf181 genes was detected in the 115 kb plasmid of A. brasilense Sp7 type strain.

  10. Plasmid Stability in Dried Cells of the Desert Cyanobacterium Chroococcidiopsis and its Potential for GFP Imaging of Survivors on Earth and in Space

    Science.gov (United States)

    Billi, Daniela

    2012-06-01

    Two GFP-based plasmids, namely pTTQ18-GFP-pDU1mini and pDUCA7-GFP, of about 7 kbp and 15 kbp respectively, able to replicate in Chroococcidiopsis sp. CCMEE 029 and CCMEE 123, were developed. Both plasmids were maintained in Chroococcidiopsis cells after 18 months of dry storage as demonstrated by colony PCR, plasmid restriction analysis, GFP imaging and colony-forming ability under selection of dried transformants; thus suggesting that strategies employed by this cyanobacterium to stabilize dried chromosomal DNA, must have protected plasmid DNA. The suitability of pDU1mini-plasmid for GFP tagging in Chroococcidiopsis was investigated by using the RecA homolog of Synechocystis sp. PCC 6803. After 2 months of dry storage, the presence of dried cells with a GFP-RecASyn distribution resembling that of hydrated cells, supported its capability of preventing desiccation-induced genome damage, whereas the rewetted cells with filamentous GFP-RecASyn structures revealed sub-lethal DNA damage. The long-term stability of plasmid DNA in dried Chroococcidiopsis has implication for space research, for example when investigating the recovery of dried cells after Martian and space simulations or when developing life support systems based on phototrophs with genetically enhanced stress tolerance and stored in the dry state for prolonged periods.

  11. The RepA_N replicons of Gram-positive bacteria: a family of broadly distributed but narrow host range plasmids.

    Science.gov (United States)

    Weaver, Keith E; Kwong, Stephen M; Firth, Neville; Francia, Maria Victoria

    2009-03-01

    The pheromone-responsive conjugative plasmids of Enterococcus faecalis and the multiresistance plasmids pSK1 and pSK41 of Staphylococcus aureus are among the best studied plasmids native to Gram-positive bacteria. Although these plasmids seem largely restricted to their native hosts, protein sequence comparison of their replication initiator proteins indicates that they are clearly related. Homology searches indicate that these replicons are representatives of a large family of plasmids and a few phage that are widespread among the low G+C Gram-positive bacteria. We propose to name this family the RepA_N family of replicons after the annotated conserved domain that the initiator protein contains. Detailed sequence comparisons indicate that the initiator protein phylogeny is largely congruent with that of the host, suggesting that the replicons have evolved along with their current hosts and that intergeneric transfer has been rare. However, related proteins were identified on chromosomal regions bearing characteristics indicative of ICE elements, and the phylogeny of these proteins displayed evidence of more frequent intergeneric transfer. Comparison of stability determinants associated with the RepA_N replicons suggests that they have a modular evolution as has been observed in other plasmid families.

  12. Assaying chromatin structure and remodeling by restriction enzyme accessibility

    OpenAIRE

    Trotter, Kevin W.; Archer, Trevor K.

    2012-01-01

    The packaging of eukaryotic DNA into nucleosomes, the fundamental unit of chromatin, creates a barrier to nuclear processes, such as transcription, DNA replication, recombination, and repair(1). This obstructive nature of chromatin can be overcome by the enzymatic activity of chromatin remodeling complexes which creates a more favorable environment for the association of essential factors and regulators to sequences within target genes. Here we describe a detailed approach for analyzing chrom...

  13. Determining mutation density using Restriction Enzyme Sequence Comparative Analysis (RESCAN)

    Science.gov (United States)

    The average mutation density of a mutant population is a major consideration when developing resources for the efficient, cost-effective implementation of reverse genetics methods such as Targeting of Induced Local Lesions in Genomes (TILLING). Reliable estimates of mutation density can be achieved ...

  14. Chromosomal targeting of replicating plasmids in the yeast Hansenula polymorpha

    NARCIS (Netherlands)

    Faber, Klaas Nico; Swaving, Gert Jan; Faber, Folkert; Ab, Geert; Harder, Willem; Veenhuis, Marten; Haima, Pieter

    1992-01-01

    Using an optimized transformation protocol we have studied the possible interactions between transforming plasmid DNA and the Hansenula polymorpha genome. Plasmids consisting only of a pBR322 replicon, an antibiotic resistance marker for Escherichia coli and the Saccharomyces cerevisiae LEU2 gene we

  15. Genomic comparison of archaeal conjugative plasmids from Sulfolobus

    DEFF Research Database (Denmark)

    Greve, Bo Bjørn

    2004-01-01

    All of the known self-transmissable plasmids of the Archaea have been found in the genus Sulfolobus. To gain more insight into archaeal conjugative processes, four newly isolated self-transmissable plasmids, pKEF9, pHVE14, pARN3 and pARN4, were sequenced and subjected to a comparative sequence...

  16. Linear plasmid in the genome of Clavibacter michiganensis subsp. sepedonicus.

    Science.gov (United States)

    Brown, Susan E; Knudson, Dennis L; Ishimaru, Carol A

    2002-05-01

    Contour-clamped homogeneous electric field gel analysis of genomic DNA of the plant pathogen Clavibacter michiganensis subsp. sepedonicus revealed the presence of a previously unreported extrachromosomal element. This new element was demonstrated to be a linear plasmid. Of 11 strains evaluated, all contained either a 90-kb (pCSL1) or a 140-kb (pCSL2) linear plasmid.

  17. Homology of plasmids in strains of unicellular cyanobacteria

    NARCIS (Netherlands)

    Hondel, C.A.M.J.J. van den; Keegstra, W.; Borrias, W.E.; Arkel, G.A. van

    1979-01-01

    Six strains of unicellular cyanobacteria were examined for the presence of plasmids. Analysis of lysates of these strains by CsCl-ethidium bromide density centrifugation yielded a major chromosomal DNA band and a minor band containing covalently closed circular plasmid DNA, as shown by electron micr

  18. Production and pharmaceutical formulation of plasmid DNA vaccines

    NARCIS (Netherlands)

    van der Heijden, I.

    2013-01-01

    Research leading to the thesis ‘Production and pharmaceutical formulation of plasmid DNA vaccines‘ can be divided into two parts. The first part describes the development of a Good Manufacturing Practice (GMP) compliant plasmid DNA production process of pDNA vaccines for the treatment of Human papil

  19. Production and pharmaceutical formulation of plasmid DNA vaccines

    NARCIS (Netherlands)

    van der Heijden, I.

    2013-01-01

    Research leading to the thesis ‘Production and pharmaceutical formulation of plasmid DNA vaccines‘ can be divided into two parts. The first part describes the development of a Good Manufacturing Practice (GMP) compliant plasmid DNA production process of pDNA vaccines for the treatment of Human papil

  20. Plasmid cloning vehicle for Haemophilus influenzae and Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    McCarthy, D.; Clayton, N.L.; Setlow, J.K.

    1982-09-01

    A new plasmid cloning vehicle (pDM2) was used to introduce a library of Haemophilus influenzae chromosomal fragments into H. influenzae. Transformants of the higly recombination-defective rec-1 mutant were more likely to contain exclusively recombinant plasmids after exposure to ligated DNA mixtures than was the wild type. pDM2 could replicate in Escherichia coli K-12.

  1. Functional analysis of three plasmids from Lactobacillus plantarum

    NARCIS (Netherlands)

    Kranenburg, R. van; Golic, N.; Bongers, R.; Leer, R.J.; Vos, W.M. de; Siezen, R.J.; Kleerebezem, M.

    2005-01-01

    Lactobacillus plantarum WCFS1 harbors three plasmids, pWCFS101, pWCFS102, and pWCFS103, with sizes of 1,917, 2,365, and 36,069 bp, respectively. The two smaller plasmids are of unknown function and contain replication genes that are likely to function via the rolling-circle replication mechanism. Th

  2. Identification of IncA/C Plasmid Replication and Maintenance Genes and Development of a Plasmid Multilocus Sequence Typing Scheme.

    Science.gov (United States)

    Hancock, Steven J; Phan, Minh-Duy; Peters, Kate M; Forde, Brian M; Chong, Teik Min; Yin, Wai-Fong; Chan, Kok-Gan; Paterson, David L; Walsh, Timothy R; Beatson, Scott A; Schembri, Mark A

    2017-02-01

    Plasmids of incompatibility group A/C (IncA/C) are becoming increasingly prevalent within pathogenic Enterobacteriaceae They are associated with the dissemination of multiple clinically relevant resistance genes, including blaCMY and blaNDM Current typing methods for IncA/C plasmids offer limited resolution. In this study, we present the complete sequence of a blaNDM-1-positive IncA/C plasmid, pMS6198A, isolated from a multidrug-resistant uropathogenic Escherichia coli strain. Hypersaturated transposon mutagenesis, coupled with transposon-directed insertion site sequencing (TraDIS), was employed to identify conserved genetic elements required for replication and maintenance of pMS6198A. Our analysis of TraDIS data identified roles for the replicon, including repA, a toxin-antitoxin system; two putative partitioning genes, parAB; and a putative gene, 053 Construction of mini-IncA/C plasmids and examination of their stability within E. coli confirmed that the region encompassing 053 contributes to the stable maintenance of IncA/C plasmids. Subsequently, the four major maintenance genes (repA, parAB, and 053) were used to construct a new plasmid multilocus sequence typing (PMLST) scheme for IncA/C plasmids. Application of this scheme to a database of 82 IncA/C plasmids identified 11 unique sequence types (STs), with two dominant STs. The majority of blaNDM-positive plasmids examined (15/17; 88%) fall into ST1, suggesting acquisition and subsequent expansion of this blaNDM-containing plasmid lineage. The IncA/C PMLST scheme represents a standardized tool to identify, track, and analyze the dissemination of important IncA/C plasmid lineages, particularly in the context of epidemiological studies. Copyright © 2017 American Society for Microbiology.

  3. Identification of pOENI-1 and Related Plasmids in Oenococcus oeni Strains Performing the Malolactic Fermentation in Wine

    Science.gov (United States)

    Favier, Marion; Bilhère, Eric; Lonvaud-Funel, Aline; Moine, Virginie; Lucas, Patrick M.

    2012-01-01

    Plasmids in lactic acid bacteria occasionally confer adaptive advantages improving the growth and behaviour of their host cells. They are often associated to starter cultures used in the food industry and could be a signature of their superiority. Oenococcus oeni is the main lactic acid bacteria species encountered in wine. It performs the malolactic fermentation that occurs in most wines after alcoholic fermentation and contributes to their quality and stability. Industrial O. oeni starters may be used to better control malolactic fermentation. Starters are selected empirically by virtue of their fermentation kinetics and capacity to survive in wine. This study was initiated with the aim to determine whether O. oeni contains plasmids of technological interest. Screening of 11 starters and 33 laboratory strains revealed two closely related plasmids, named pOENI-1 (18.3-kb) and pOENI-1v2 (21.9-kb). Sequence analyses indicate that they use the theta mode of replication, carry genes of maintenance and replication and two genes possibly involved in wine adaptation encoding a predicted sulphite exporter (tauE) and a NADH:flavin oxidoreductase of the old yellow enzyme family (oye). Interestingly, pOENI-1 and pOENI-1v2 were detected only in four strains, but this included three industrial starters. PCR screenings also revealed that tauE is present in six of the 11 starters, being probably inserted in the chromosome of some strains. Microvinification assays performed using strains with and without plasmids did not disclose significant differences of survival in wine or fermentation kinetics. However, analyses of 95 wines at different phases of winemaking showed that strains carrying the plasmids or the genes tauE and oye were predominant during spontaneous malolactic fermentation. Taken together, the results revealed a family of related plasmids associated with industrial starters and indigenous strains performing spontaneous malolactic fermentation that possibly

  4. Identification of pOENI-1 and related plasmids in Oenococcus oeni strains performing the malolactic fermentation in wine.

    Science.gov (United States)

    Favier, Marion; Bilhère, Eric; Lonvaud-Funel, Aline; Moine, Virginie; Lucas, Patrick M

    2012-01-01

    Plasmids in lactic acid bacteria occasionally confer adaptive advantages improving the growth and behaviour of their host cells. They are often associated to starter cultures used in the food industry and could be a signature of their superiority. Oenococcus oeni is the main lactic acid bacteria species encountered in wine. It performs the malolactic fermentation that occurs in most wines after alcoholic fermentation and contributes to their quality and stability. Industrial O. oeni starters may be used to better control malolactic fermentation. Starters are selected empirically by virtue of their fermentation kinetics and capacity to survive in wine. This study was initiated with the aim to determine whether O. oeni contains plasmids of technological interest. Screening of 11 starters and 33 laboratory strains revealed two closely related plasmids, named pOENI-1 (18.3-kb) and pOENI-1v2 (21.9-kb). Sequence analyses indicate that they use the theta mode of replication, carry genes of maintenance and replication and two genes possibly involved in wine adaptation encoding a predicted sulphite exporter (tauE) and a NADH:flavin oxidoreductase of the old yellow enzyme family (oye). Interestingly, pOENI-1 and pOENI-1v2 were detected only in four strains, but this included three industrial starters. PCR screenings also revealed that tauE is present in six of the 11 starters, being probably inserted in the chromosome of some strains. Microvinification assays performed using strains with and without plasmids did not disclose significant differences of survival in wine or fermentation kinetics. However, analyses of 95 wines at different phases of winemaking showed that strains carrying the plasmids or the genes tauE and oye were predominant during spontaneous malolactic fermentation. Taken together, the results revealed a family of related plasmids associated with industrial starters and indigenous strains performing spontaneous malolactic fermentation that possibly

  5. Identification of pOENI-1 and related plasmids in Oenococcus oeni strains performing the malolactic fermentation in wine.

    Directory of Open Access Journals (Sweden)

    Marion Favier

    Full Text Available Plasmids in lactic acid bacteria occasionally confer adaptive advantages improving the growth and behaviour of their host cells. They are often associated to starter cultures used in the food industry and could be a signature of their superiority. Oenococcus oeni is the main lactic acid bacteria species encountered in wine. It performs the malolactic fermentation that occurs in most wines after alcoholic fermentation and contributes to their quality and stability. Industrial O. oeni starters may be used to better control malolactic fermentation. Starters are selected empirically by virtue of their fermentation kinetics and capacity to survive in wine. This study was initiated with the aim to determine whether O. oeni contains plasmids of technological interest. Screening of 11 starters and 33 laboratory strains revealed two closely related plasmids, named pOENI-1 (18.3-kb and pOENI-1v2 (21.9-kb. Sequence analyses indicate that they use the theta mode of replication, carry genes of maintenance and replication and two genes possibly involved in wine adaptation encoding a predicted sulphite exporter (tauE and a NADH:flavin oxidoreductase of the old yellow enzyme family (oye. Interestingly, pOENI-1 and pOENI-1v2 were detected only in four strains, but this included three industrial starters. PCR screenings also revealed that tauE is present in six of the 11 starters, being probably inserted in the chromosome of some strains. Microvinification assays performed using strains with and without plasmids did not disclose significant differences of survival in wine or fermentation kinetics. However, analyses of 95 wines at different phases of winemaking showed that strains carrying the plasmids or the genes tauE and oye were predominant during spontaneous malolactic fermentation. Taken together, the results revealed a family of related plasmids associated with industrial starters and indigenous strains performing spontaneous malolactic fermentation that

  6. Deciphering conjugative plasmid permissiveness in wastewater microbiomes

    DEFF Research Database (Denmark)

    Jacquiod, Samuel Jehan Auguste; Brejnrod, Asker Daniel; Milani, Stefan Morberg

    2017-01-01

    Wastewater treatment plants (WWTPs) are designed to robustly treat polluted water. They are characterized by ceaseless flows of organic, chemical and microbial matter, followed by treatment steps before environmental release. WWTPs are hotspots of horizontal gene transfer between bacteria via...... still remains largely uncharted. Furthermore, current in vitro methods used to assess conjugation in complex microbiomes do not include in situ behaviours of recipient cells, resulting in partial understanding of transfers. We investigated the in vitro conjugation capacities of WWTP microbiomes from...... diversity of recipient bacterial phyla for the plasmid was observed, especially in WWTP outlets. We also identified permissive bacteria potentially able to cross WWTPs and engage in conjugation before and after water treatment. Bacterial activity and lifestyle seem to influence conjugation extent...

  7. Expansion of the IncX plasmid family for improved identification and typing of novel plasmids in drug-resistant Enterobacteriaceae

    DEFF Research Database (Denmark)

    Johnson, Timothy J.; Bielak, Eliza Maria; Fortini, Daniela;

    2012-01-01

    and biofilm formation. Previous plasmid-based replicon typing procedures have indicated that the prevalence of IncX plasmids is low among members of the Enterobacteriaceae. However, examination of a number of IncX-like plasmid sequences and their occurrence in various organisms suggests that IncX plasmid...

  8. Construction of Recombinant Plasmid Harboring APP717 Mutation and Preliminary Study of APP Proteolysis

    Institute of Scientific and Technical Information of China (English)

    LI Xiaoqing; XUE Zheng; ZHANG Suming

    2007-01-01

    In order to investigate the pathogenesis of Alzheimer disease (AD) and study the enzy-matic progress of amyloid precursor protein (APP), the fluorescent eukaryotic expression plasmid of C99 was constructed containing APP717 mutation. The fragment encoding the last 99-aa of APP(which was named C99 containing APP717 mutation), together with the fragment encoding yellow fluorescence protein (which was named YFP) were amplified by PCR. The two fragments (YFP andC99) were inserted into the vector pcDNA3.0. The recombinant plasmid pcDNA3.0-YFP-C99 was accomplished and its authenticity was confirmed by enzyme digestion and sequencing. Then SH-SY5Y cells were transiently transfected with the recombinant plasmid pcDNA3.0-YFP-C99. The expression of the fusion gene was detected by laser confocalmicroscopy. Amyloid-β (Aβ) was de- tected by both microscopy and immunochemistry. The authenticity of the construct was confirmed by the endonuclease digestion and DNA sequencing. The YFP fluorescence could be seen and proved the expression of fusion gene. Aβ labeled by YFP was detected by confocalmicroscopy and confirmed by immunocytochemistry. It was found that Aβ accumulated and deposited in the intracytoplasm, mem-brane and outside of the cell. Furthermore, Aβ accumulated mainly within the cell ahead of the depo-sition in the cell space and the cell shape was rough. It was suggested that Aβ could be generatedwithin the cells. Aβ accumulated in the cell at the early stage before the deposition outside of the cells.Intracellular Aβ accumulation induced the secondary damage to the cells and caused the cell shape rough. Taken together, the recombinant plasmid, pcDNA3.0-YFP-C99 could be a useful tool to fur-ther study the cleavage mechanism of APP and to explore the pathogenesis of AD.

  9. Interleukin-12 plasmid DNA delivery using l-thyroxine-conjugated polyethylenimine nanocarriers

    Science.gov (United States)

    Dehshahri, Ali; Sadeghpour, Hossein; Kazemi Oskuee, Reza; Fadaei, Mahin; Sabahi, Zahra; Alhashemi, Samira Hossaini; Mohazabieh, Erfaneh

    2014-05-01

    In this study, l-thyroxine was covalently grafted on 25 kDa branched polyethylenimine (PEI), and the ability of the nano-sized polyplexes for transferring plasmid encoding interleukin-12 (IL-12) gene was evaluated. As there are several problems in systemic administration of recombinant IL-12 protein, local expression of the plasmid encoding IL-12 gene inside the tumor tissue has been considered as an effective alternative approach. The l-thyroxine-conjugated PEI polyplexes were prepared using pUMVC3-hIL12 plasmid, and their transfection activity was determined in HepG2 human liver carcinoma and Neuro2A neuroblastoma cell lines. The polyplexes characterized in terms of DNA condensation ability, particle size, zeta potential, and buffering capacity as well as cytotoxicity and resistance to enzyme digestion. The results revealed that l-thyroxine conjugation of PEI increased gene transfer ability by up to two fold relative to unmodified 25 kDa PEI, the gold standard for non-viral gene delivery, with the highest increase occurring at degrees of conjugation around 10 %. pDNA condensation tests and dynamic light scattering measurements exhibited the ability of PEI conjugates to optimally condense the plasmid DNA into polyplexes in the size range around 200 nm. The modified polymers showed remarkable buffering capacity and protection against enzymatic degradation comparable to that of unmodified PEI. These results suggest that l-thyroxine conjugation of PEI is a simple modification strategy for future investigations aimed at developing a targeting gene vehicle.

  10. CONSTRUCTION OF RECOMBINANT PLASMID PIRES-BAX-HGF%pIRES-Bax-HGF重组质粒的构建

    Institute of Scientific and Technical Information of China (English)

    黄涛; 常青; 徐平

    2011-01-01

    Objective To construct the plasmid vector of pIRES-Bax-HGF. Methods The Bax gene sequence was cloned from ovarian cancer samples, and HGF gene sequence from pBluescript Ⅱ SK+HGF plasmid derived from ATCC. Bax and HGF coding sequence were inserted into pIRES plasmid by step double enzyme digestion. Results Enzyme digestion and sequencing indicated that the construction of recombinant pIRES-Bax-HGF plasmid was successful. Conclusion Obtaining the coding genes of both Bax and HGF, and successfully creating the plasmid vector of plRES-Bax-HGF establish a foundation for further study of the effects of HGF and Bax on vascular endothelial cells, smooth muscle cells, and fibrocytes, which steps out an important step to treat post-CABG restenosis at gene level.%目的 构建pIRES-Bax-HGF质粒载体.方法 采用RT-PCR方法从卵巢癌标本中克隆Bax的基因序列,从ATCC来源的pBlueseriptⅡ SK+HGF质粒中克隆HGF的基因序列.分步双酶切插入到plRES载体质粒中.结果 酶切鉴定及测序表明,重组pIRES-Bax-HGF质粒构建成功.结论 获取HGF及Bax编码基因并成功构建重组pIRES-Bax-HGF质粒载体,为进一步研究HGF及Bax对血管内皮细胞、平滑肌细胞、纤维细胞等的影响奠定了基础,也向基因水平干预冠状动脉旁路移植术术后再狭窄的形成迈出了重要一步.

  11. [Influence of spv plasmid genes group in Salmonella Enteritidis virulence for chickens. I. Occurrence of spv plasmid genes group in Salmonella Enteritidis large virulence plasmid].

    Science.gov (United States)

    Madajczak, Grzegorz; Binek, Marian

    2005-01-01

    Many Salmonella Enteritidis virulence factors are encoded by genes localized on plasmids, especially large virulence plasmid, in highly conserved fragment, they create spv plasmid gene group. The aims of realized researches were spv genes occurrence evaluation and composition analysis among Salmonella Enteritidis strains caused infection in chickens. Researches were realized on 107 isolates, where in every cases large virulence plasmid 59 kbp size were detected. Specific nucleotides sequences of spv genes (spvRABCD) were detected in 47.7% of isolates. In the rest of examined bacteria spv genes occurred variably. Most often extreme genes of spv group, like spvR and spvD were absent, what could indicate that factors encoded by them are not most important for Salmonella Enteritidis live and their expressed virulence.

  12. Application of restriction display PCR technique in the preparation of cDNA microarray probes

    Institute of Scientific and Technical Information of China (English)

    Zhao-Hui Sun; Wen-Li Ma; Bao Zhang; Yi-Fei Peng; Wen-Ling Zheng

    2005-01-01

    AIM: To develop a simplified and efficient method for the preparation of hepatitis C virus (HCV) cDNA microarray probes.METHODS: With the technique of restriction display PCR (RD-PCR), restriction enzyme Sau3A I was chosen to digest the full-length HCV cDNAs. The products were classified and re-amplified by RD-PCR. We separated the differential genes by polyacrylamide gel electrophoresis and silver staining. Single bands cut out from the polyacrylamide gel were isolated. The third-round PCR was performed using the single bands as PCR template.The RD-PCR fragments were purified and cloned into the pMD18-T vector. The recombinant plasmids were extracted from positive clones, and the target gene fragments were sequenced. The cDNA microarray was prepared by spotting RD-PCR products to the surface of amino-modified glass slides using a robot. We validated the detection of microarray by hybridization and sequence analysis.RESULTS: A total of 24 different cDNA fragments ranging from 200 to 800 bp were isolated and sequenced,which were the specific gene fragments of HCV. These fragments could be further used as probes in microarray preparation. The diagnostic capability of the microarray was evaluated after the washing and scanning steps. The results of hybridization and sequence analysis showed that the specificity, sensitivity, accuracy, reproducibility,and linearity in detecting HCV RNA were satisfactory.CONCLUSION: The RD-PCR technique is of great value in obtaining a large number of size-comparable gene probes, which provides a speedy protocol in generating probes for the preparation of microarrays. Microarray prepared as such could be further optimized and applied in the clinical diagnosis of HCV.

  13. Sample displacement chromatography of plasmid DNA isoforms.

    Science.gov (United States)

    Černigoj, Urh; Martinuč, Urška; Cardoso, Sara; Sekirnik, Rok; Krajnc, Nika Lendero; Štrancar, Aleš

    2015-10-02

    Sample displacement chromatography (SDC) is a chromatographic technique that utilises different relative binding affinities of components in a sample mixture and has been widely studied in the context of peptide and protein purification. Here, we report a use of SDC to separate plasmid DNA (pDNA) isoforms under overloading conditions, where supercoiled (sc) isoform acts as a displacer of open circular (oc) or linear isoform. Since displacement is more efficient when mass transfer between stationary and mobile chromatographic phases is not limited by diffusion, we investigated convective interaction media (CIM) monoliths as stationary phases for pDNA isoform separation. CIM monoliths with different hydrophobicities and thus different binding affinities for pDNA (CIM C4 HLD, CIM-histamine and CIM-pyridine) were tested under hydrophobic interaction chromatography (HIC) conditions. SD efficiency for pDNA isoform separation was shown to be dependent on column selectivity for individual isoform, column efficiency and on ammonium sulfate (AS) concentration in loading buffer (binding strength). SD and negative mode elution often operate in parallel, therefore negative mode elution additionally influences the efficiency of the overall purification process. Optimisation of chromatographic conditions achieved 98% sc pDNA homogeneity and a dynamic binding capacity of over 1mg/mL at a relatively low concentration of AS. SDC was successfully implemented for the enrichment of sc pDNA for plasmid vectors of different sizes, and for separation of linear and and sc isoforms, independently of oc:sc isoform ratio, and flow-rate used. This study therefore identifies SDC as a promising new approach to large-scale pDNA purification, which is compatible with continuous, multicolumn chromatography systems, and could therefore be used to increase productivity of pDNA production in the future. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Permissiveness of soil microbial communities towards broad host range plasmids

    DEFF Research Database (Denmark)

    Klümper, Uli

    larger than previously assumed. I was able to show abundant plasmid transfer from the Gram negative donor strains to a wide diversity of Gram positive soil bacteria, formerly thought to constitute distinct clusters of gene transfer. Moreover, among the observed transconjugants, I identified a core super...... environmental factors that modulate plasmid transfer in soil microbial communities. In order to attain these goals, I developed a high-throughput method that enabled me to evaluate the permissiveness of bacterial communities towards introduced plasmids. This new approach is based on the introduction...... fraction of soil the bacteria (up to 1 in 10,000) were able to take up any of these broad host range conjugal plasmids. The transconjugal pools comprised 11 bacterial phyla. This finding indicates that the realized transfer range of broad host range plasmids in environmental microbial communities is much...

  15. Complementary specificity of restriction endonucleases of Diplococcus pneumoniae with respect to DNA methylation. [Haemophilus influenzae, Escherichia coli, Paramecium aurelia

    Energy Technology Data Exchange (ETDEWEB)

    Lacks, S.; Greenberg, B.

    1977-01-01

    Restriction endonucleases Dpn I and Dpn II are produced by two distinct strains of Diplococcus pneumoniae. The two enzymes show complementary specificity with respect to methylation of sites in DNA. From the identity of its cleavage site with that of Mbo I, it appears that Dpn II cleaves at the unmodified sequence 5'-G-A-T-C-3'. Dpn I cleaves at the same sequence when the adenine residue is methylated. Both enzymes produce only double-strand breaks in susceptible DNA. Their susceptibility to Dpn I and not Dpn II shows that essentially all the G-A-T-C sequences are methylated in DNA from the pneumococcal strain that produces Dpn II as well as in DNA from Hemophilus influenzae and Escherichia coli. In the dam-3 mutant of E. coli none of these sequences appear to be methylated. Residual adenine methylation in the dam-3 mutant DNA most likely occurs at different sites. Different but characteristic degrees of methylation at G-A-T-C sites are found in the DNA of bacterial viruses grown in E. coli. DNAs from mammalian cells and viruses are not methylated at this sequence. Mitochondrial DNA from Paramecium aurelia is not methylated, but a small proportion of G-A-T-C sequences in the macronuclear DNA of this eukaryote appear to be methylated. Possible roles of sequence-specific methylation in the accommodation of plasmids, in the replication of DNA, in the regulation of gene function and in the restriction of viral infection are discussed.

  16. Complex nature of enterococcal pheromone-responsive plasmids.

    Science.gov (United States)

    Wardal, Ewa; Sadowy, Ewa; Hryniewicz, Waleria

    2010-01-01

    Pheromone-responsive plasmids constitute a unique group of approximately 20 plasmids identified, as yet, only among enterococcal species. Several of their representatives, e.g. pAD1, pCF10, pPD1 and pAM373 have been extensively studied. These plasmids possess a sophisticated conjugation mechanism based on response to sex pheromones--small peptides produced by plasmid-free recipient cells. Detailed analysis of regulation and function of the pheromone response process revealed its great complexity and dual role--in plasmid conjugation and modulation of enterococcal virulence. Among other functional modules identified in pheromone plasmids, the stabilization/partition systems play a crucial role in stable maintenance of the plasmid molecule in host bacteria. Among them, the par locus of pAD1 is one of the exceptional RNA addiction systems. Pheromone-responsive plasmids contribute also to enterococcal phenotype being an important vehicle of antibiotic resistance in this genus. Both types of acquired vancomycin resistance determinants, vanA and vanB, as well many other resistant phenotypes, were found to be located on these plasmids. They also encode two basic agents of enterococcal virulence, i.e. aggregation substance (AS) and cytolysin. AS participates in mating-pair formation during conjugation but can also facilitate the adherence ofenterococci to human tissues during infection. The second protein, cytolysin, displays hemolytic activity and helps to invade eukaryotic cells. There are still many aspects of the nature of pheromone plasmids that remain unclear and more detailed studies are needed to understand their uniqueness and complexity.

  17. Antibiotic resistance of vibrio cholerae: special considerations of R-plasmids.

    Science.gov (United States)

    Kuwahara, S

    1978-09-01

    Studies on the transmission of R plasmid by conjugation between enterobacteria and vibrio or related bacteria were reviewed. The majority of the reports confirmed successful transmission from enterobacteria to Vibrio cholerae and related species, although the transmission frequencies were extremely low and the transmitted R plasmid was very unstable except for thermosensitive kanamycin plasmid and usual R plasmid coexisting with P plasmid. Strains of V. cholerae and Aeromonas liquefaciens as well as A. salmonicida bearing R plasmid were detected in nature. R plasmid was relatively unstable in V. cholerae strains with which transmission of R plasmid to enterobacteria was confirmed. At present, only 3 R plasmids have been obtained from naturally occurring strains of V. cholerae. Although the 2 European plasmids belong to the C incompatibility group with 98 megadalton closed covalent circular DNA molecule, one plasmid belongs to the J group with more than 25 megadalton molecular weight, and no CCC of satelite DNA was detected in bacteria harboring this plasmid.

  18. Bacterial Mitosis: ParM of Plasmid R1 Moves Plasmid DNA by an Actin-like Insertional Polymerization Mechanism

    DEFF Research Database (Denmark)

    Møller-Jensen, Jakob; Borch, Jonas; Dam, Mette

    2003-01-01

    Bacterial DNA segregation takes place in an active and ordered fashion. In the case of Escherichia coli plasmid R1, the partitioning system (par) separates paired plasmid copies and moves them to opposite cell poles. Here we address the mechanism by which the three components of the R1 par system...

  19. Diagnóstico e genotipagem do vírus da pseudoraiva por nested-PCR e análise de restrição enzimática Diagnosis and genotyping of pseudorabies virus by nested-PCR and restriction enzyme analysis

    Directory of Open Access Journals (Sweden)

    Antônio Augusto Fonseca Júnior

    2010-04-01

    virus isolation, DNA purification enzyme restriction analysis and a long electrophoresis. The aim of this research was to describe a faster and more sensitive method to detect and genotype PrV based on nested-PCR and restriction enzyme analysis. Twenty PrV isolates from south and southeast regions of Brazil, and the standard strain Shope were grown in PK-15 cells and submitted to PCR for glycoprotein E gene amplification. Additionally were tested 75 clinical samples (swine brain, with 25 positives for virus isolation and seroneutralization, and 50 negatives from a flock free PR with negative results in seroneutralization test. There was 100% of agreement between results of nested-PCR and virus isolation and seroneutralization and all samples detected were classified as genotype II. The nested-PCR, combined with restriction enzyme analysis, was able to detect and genotype PrV in 1-2 days with a sensitivity of 10-1,3 TCID50 mL-1. It was faster than classical methods described in the literature that require at least 7 days to be completed.

  20. Mining for Restriction Endonucleases in Nicaragua

    Directory of Open Access Journals (Sweden)

    Suyén S. Espinoza-Miranda

    2012-12-01

    Full Text Available The Molecular Biology Center at the University of Central America in Nicaragua (CBM-UCA was founded in 1999 to strengthen biotechnology research capacity and education in Nicaragua and the Central American region. One of the first projects launched by the CBM-UCA was bio-prospecting for key industrial enzymes. This ongoing study seeks to discover and characterize restriction enzymes (RE in bacteria, and to create a database of microorganisms isolated and identified by 16S rDNA sequencing methodology. In this paper we highlight the importance of studying the extreme environmental conditions for building knowledge of Nicaraguan biodiversity through modern molecular biology techniques such as metagenomics. The isolation of prototype enzymes such as EcoRV and ClaI is presented as an update and extension of previously undertaken work.

  1. Anti-Restriction Protein, KlcAHS, Promotes Dissemination of Carbapenem Resistance

    Directory of Open Access Journals (Sweden)

    Xiaofei Jiang

    2017-05-01

    Full Text Available Carbapenemase-producing Klebsiella pneumoniae (KPC has emerged and spread throughout the world. A retrospective analysis was performed on carbapenem-resistant K. pneumoniae isolated at our teaching hospital during the period 2009–2010, when the initial outbreak occurred. To determine the mechanism(s that underlies the increased infectivity exhibited by KPC, Multilocus Sequence Typing (MLST was conducted. A series of plasmids was also extracted, sequenced and analyzed. Concurrently, the complete sequences of blaKPC−2-harboring plasmids deposited in GenBank were summarized and aligned. The blaKPC−2 and KlcAHS genes in the carbapenem-resistant K. pneumoniae isolates were examined. E. coli strains, carrying different Type I Restriction and Modification (RM systems, were selected to study the interaction between RM systems, anti-RM systems and horizontal gene transfer (HGT. The ST11 clone predominated among 102 carbapenem-resistant K. pneumoniae isolates, all harbored the blaKPC−2 gene; 98% contained the KlcAHS gene. KlcAHS was one of the core genes in the backbone region of most blaKPC−2 carrying plasmids. Type I RM systems in the host bacteria reduced the rate of pHS10842 plasmid transformation by 30- to 40-fold. Presence of the anti-restriction protein, KlcAHS, on the other hand, increased transformation efficiency by 3- to 6-fold. These results indicate that RM systems can significantly restrict HGT. In contrast, KlcAHS can disrupt the RM systems and promote HGT by transformation. These findings suggest that the anti-restriction protein, KlcAHS, represents a novel mechanism that facilitates the increased transfer of blaKPC-2 and KlcAHS-carrying plasmids among K. pneumoniae strains.

  2. Construction of recombinant plasmid of human FGFR4 gene and expression of fusion protein%人 FGFR4基因重组质粒的构建及融合蛋白的表达

    Institute of Scientific and Technical Information of China (English)

    刘彩红; 张婷婷; 纪书婷

    2015-01-01

    目的:探讨成纤维细胞生长因子4( FGFR4)重组质粒的构建方法,并检测FGFR4融合蛋白的表达。方法从HepG2细胞中提取总RNA,采用RT-PCR方法扩增FGFR4的全长编码序列,双酶切后与pcDNA3.1/Myc-HisA载体连接,构建pcDNA3.1/Myc-HisA-FGFR4重组质粒。重组质粒经双酶切和测序鉴定后瞬时转染人胚肾HEK293细胞,采用Western blot法检测FGFR4融合蛋白的表达。结果 FGFR4编码序列被成功克隆至pcDNA 3.1/Myc-HisA质粒中,成功构建了pcDNA3.1/Myc-HisA-FGFR4载体。转染HEK293细胞后检测到FGFR4融合蛋白的稳定表达,分子量约为89 kD。结论成功构建了FGFR4全长编码基因重组质粒,并检测到转染后FGFR4蛋白在HEK293细胞中的表达。%Objective To investigate the construction method of the recombinant plasmid of fibroblast growth factor re-ceptor 4(FGFR4) and to identify the expression of its fusion protein.Methods Total RNA was extracted from HepG2 cells.We obtained the full length of human FGFR4 coding sequence by RT-PCR, digested it by restriction enzyme and joined it with pcDNA3.1/Myc-HisA to construct the pcDNA3.1/Myc-HisA-FGFR4 recombinant plasmid.After the recom-binant plasmid was identified by enzyme digestion and sequencing, the plasmid was transfected into HEK293 cells.The ex-pression of fusion protein in HEK293 cells was detected by Western blotting.Results The coding sequence of human FG-FR4 was successfully cloned into pcDNA3.1/Myc-HisA.The pcDNA3.1/Myc-HisA-FGFR4 vector was successfully con-structed.After transfecting HEK293 cells, the stable expression of FGFR4 fusion protein with a molecular weight of 89 kD was detected.Conclusion The recombinant plasmid of FGFR4 full-length coding gene was successfully constructed and the FGFR4 protein was expressed in HEK293 cells.

  3. Effects of an intravitreal injection of interleukin-35-expressing plasmid on pro-inflammatory and anti-inflammatory cytokines

    Science.gov (United States)

    Hou, Chao; Wu, Qianni; Ouyang, Chen; Huang, Ting

    2016-01-01

    In order to explore the potential effects of interleukin (IL)-35 on IL-10, transforming growth factor-β (TGF-β), interferon-γ (INF)-γ, IL-12 and IL-17, a pcDNA3.1-IL-35 plasmid was injected into the vitreous cavity of BALB/c mice. Enzyme-linked immunosorbent assay, western blot analysis and quantitative PCR analysis were performed to confirm the successful expression of IL-35. Slit-lamp biomicroscopy, hematoxylin and eosin staining and immunofluorescence were employed to detect the status of eyes, and western blot analysis was performed to examine the expression of corneal graft rejection-related cytokines. There were no abnormalities in the eyes pre-mydriasis or post-mydriasis and no injuries to the cornea or retina following the injection of IL-35-expressing plasmid. An immunofluorescence assay detected the positive expression of IL-35 in corneal epithelial cells from IL-35-injected mice and negative staining in the control group. Further study revealed that IL-35 enhanced the expression of IL-10 and TGF-β which reached their highest levels at 1 and 2 weeks after injection, respectively (pIL-35-expressing plasmid (pIL-35-expressing plasmid in mice downregulates the expression of pro-inflammatory cytokines and upregulates the expression of anti-inflammatory cytokines. Thus, IL-35 may further be assessed as a potential target for the treatment of corneal graft rejection. PMID:27460435

  4. Linear forms of plasmid DNA are superior to supercoiled structures as active templates for gene expression in plant protoplasts.

    Science.gov (United States)

    Ballas, N; Zakai, N; Friedberg, D; Loyter, A

    1988-07-01

    Introduction of the plasmids pUC8CaMVCAT and pNOSCAT into plant protoplasts is known to result in transient expression of the chloramphenicol acetyl transferase (CAT) gene. Also, transfection with the plasmid pDO432 results in transient appearance of the luciferase enzyme. In the present work we have used these systems to study the effect of DNA topology on the expression of the above recombinant genes. Linear forms of the above plasmids exhibited much higher activity in supporting gene expression than their corresponding super-coiled structures. CAT activity in protoplasts transfected with the linear forms of pUC8CaMVCAT and pNOSCAT was up to ten-fold higher than that observed in protoplasts transfected by the supercoiled template of these plasmids. This effect was observed in protoplasts derived from two different lines of Petunia hybrida and from a Nicotiana tabacum cell line. Transfection with the relaxed form of pUC8CaMVCAT resulted in very low expression of the CAT gene.Northern blot analysis revealed that the amount of poly(A)(+) RNA extracted from protoplasts transformed with the linear forms of the DNA was about 10-fold higher than that found in protoplasts transformed with supercoiled DNA.Southern blot analysis revealed that about the same amounts of supercoiled and linear DNA molecules were present in nuclei of transfected protoplasts. No significant quantitative differences have been observed between the degradation rates of the various DNA templates used.

  5. Plasmid DNA Manufacturing for Indirect and Direct Clinical Applications.

    Science.gov (United States)

    Schmeer, Marco; Buchholz, Tatjana; Schleef, Martin

    2017-10-01

    Plasmid DNA is currently gaining increasing importance for clinical research applications in gene therapy and genetic vaccination. For direct gene transfer into humans, good manufacturing practice (GMP)-grade plasmid DNA is mandatory. The same holds true if the drug substance contains a genetically modified cell, for example chimeric antigen receptor (CAR) T cells, where these cells as well as the contained plasmids are used. According to the responsible regulatory agencies, they have to be produced under full GMP. On the other hand, for GMP production of, for example, mRNA or viral vectors (lentiviral vectors, adeno-associated virus vectors, etc.), in many cases, High Quality Grade plasmid DNA is accepted as a starting material. The manufacturing process passes through different production steps. To ensure the right conditions are used for the plasmid, a pilot run must be conducted at the beginning. In this step, a followed upscaling with respect to reproducibility and influences on product quality is performed. Subsequently, a cell bank of the transformed productions strain is established and characterized. This cell bank is used for the cultivation process. After cell harvesting and lysis, several chromatography steps are conducted to receive a pure plasmid product. Depending on the respective required quality grade, the plasmid product is subject to several quality controls. The last step consists of formulation and filling of the product.

  6. Plasmid-associated sensitivity of Bacillus thuringiensis to UV light

    Energy Technology Data Exchange (ETDEWEB)

    Benoit, T.G.; Wilson, G.R.; Bull, D.L.; Aronson, A.I. (Department of Agriculture, College Station, TX (USA))

    1990-08-01

    Spores and vegetative cells of Bacillus thuringiensis were more sensitive to UV light than were spores or cells of plasmid-cured B. thuringiensis strains or of the closely related Bacillus cereus. Introduction of B. thuringiensis plasmids into B. cereus by cell mating increased the UV sensitivity of the cells and spores. Protoxins encoded by one or more B. thuringiensis plasmids were not involved in spore sensitivity, since a B. thuringiensis strain conditional for protoxin accumulation was equally sensitive at the permissive and nonpermissive temperatures. In addition, introduction of either a cloned protoxin gene, the cloning vector, or another plasmid not containing a protoxin gene into a plasmid-cured strain of B. thuringiensis all increased the UV sensitivity of the spores. Although the variety of small, acid-soluble proteins was the same in the spores of all strains examined, the quantity of dipicolinic acid was about twice as high in the plasmid-containing strains, and this may account for the differences in UV sensitivity of the spores. The cells of some strains harboring only B. thuringiensis plasmids were much more sensitive than cells of any of the other strains, and the differences were much greater than observed with spores.

  7. In vitro replication of cyanobacterial plasmids from Synechocystis PCC 6803.

    Science.gov (United States)

    Yang, X; Daniell, H; McFadden, B

    1994-09-01

    Little knowledge of DNA replication in cyanobacteria is available. In this study, we report the development and characterization of an in vitro system for studies of replication of the endogenous plasmids from the unicellular cyanobacterium Synechocystis 6803. This system (fraction III) was isolated at high salt concentrations and partially purified on a heparin-agarose column. DNA polymerases in Synechocystis 6803 appeared to be associated with membranes and could be released by the addition of ammonium sulfate to 20% saturation. DNA synthesis in fraction III was dependent on the addition of cyanobacterial plasmids isolated from the same strain. The in vitro replication products consist mostly of the supercoiled form of the plasmids. Unlike replication of many Escherichia coli plasmids, replication of cyanobacterial plasmids did not require added ATP, was not inhibited by omission of the ribonucleotides, and was insensitive to the RNA polymerase inhibitor rifampicin and the gyrase inhibitor novobiocin, but was inhibited by ethidium bromide. These data suggest that RNA may not be involved in the initiation of replication of cyanobacterial plasmids from Synechocystis 6803. In addition, intermediates of replication have been detected by two-dimensional gel electrophoresis. Density labeling experiments also indicate that cyanobacterial plasmid synthesis in vitro occurs by a semiconservative replication.

  8. Identification of novel open reading frames from metagenomic libraries generated from extremophilic organisms: application of metagenomics and high throughput screening for novel enzyme isolation

    CSIR Research Space (South Africa)

    Visser, Daniel F

    2006-10-01

    Full Text Available South African mines. Genomic DNA was isolated from these biofilms, and various metagenomic libraries generated. These libraries were in turn screened for industrially important enzymes, in particular proteases and lipases. Resultant hits had plasmid DNA...

  9. Vaccination with trypomastigote surface antigen 1-encoding plasmid DNA confers protection against lethal Trypanosoma cruzi infection.

    Science.gov (United States)

    Wizel, B; Garg, N; Tarleton, R L

    1998-11-01

    DNA vaccination was evaluated with the experimental murine model of Trypanosoma cruzi infection as a means to induce antiparasite protective immunity, and the trypomastigote surface antigen 1 (TSA-1), a target of anti-T. cruzi antibody and major histocompatibility complex (MHC) class I-restricted CD8(+) cytotoxic T-lymphocyte (CTL) responses, was used as the model antigen. Following the intramuscular immunization of H-2(b) and H-2(d) mice with a plasmid DNA encoding an N-terminally truncated TSA-1 lacking or containing the C-terminal nonapeptide tandem repeats, the antibody level, CTL response, and protection against challenge with T. cruzi were assessed. In H-2(b) mice, antiparasite antibodies were induced only by immunization with the DNA construct encoding TSA-1 containing the C-terminal repeats. However, both DNA constructs were efficient in eliciting long-lasting CTL responses against the protective H-2Kb-restricted TSA-1515-522 epitope. In H-2(d) mice, inoculation with either of the two TSA-1-expressing vectors effectively generated antiparasite antibodies and primed CTLs that lysed T. cruzi-infected cells in an antigen-specific, MHC class I-restricted, and CD8(+)-T-cell-dependent manner. When TSA-1 DNA-vaccinated animals were challenged with T. cruzi, 14 of 22 (64%) H-2(b) and 16 of 18 (89%) H-2(d) mice survived the infection. The ability to induce significant murine anti-T. cruzi protective immunity by immunization with plasmid DNA expressing TSA-1 provides the basis for the application of this technology in the design of optimal DNA multicomponent anti-T. cruzi vaccines which may ultimately be used for the prevention or treatment of Chagas' disease.

  10. Plasmid-determined resistance to fosfomycin in Serratia marcescens.

    Science.gov (United States)

    Mendoza, C; Garcia, J M; Llaneza, J; Mendez, F J; Hardisson, C; Ortiz, J M

    1980-08-01

    Multiple-antibiotic-resistant strains of Serratia marcescens isolated from hospitalized patients were examined for their ability to transfer antibiotic resistance to Escherichia coli by conjugation. Two different patterns of linked transferable resistance were found among the transconjugants. The first comprised resistance to carbenicillin, streptomycin, and fosfomycin; the second, and more common, pattern included resistance to carbenicillin, streptomycin, kanamycin, gentamicin, tetracycline, chloramphenicol, sulfonamide, and fosfomycin. The two types of transconjugant strains carried a single plasmid of either 57 or 97 megadaltons in size. Both of these plasmids are present in parental S. marcescens strains resistant to fosfomycin. The 57-megadalton plasmid was transformed into E. coli.

  11. [Epidemiologic study of 2 S. typhimurium outbreaks using plasmid fingerprints].

    Science.gov (United States)

    Baumgartner, A; Breer, C; Schopfer, K

    1989-04-05

    An outbreak of salmonellosis in an old people's home is reported. The infectious agent, S. typhi-murium, was isolated not only from several inmates but also from sick cows of the farm belonging to the home, in animal feed, from employees of the local butcher's shop, and finally in sludge from the local sewage plant. Plasmid analysis provided evidence of a common origin for the isolated S. typhi-murium strains. The incriminated strains harboured, together with two low-molecular-weight plasmids, a plasmid of approximately 50 Mdal, which was also demonstrated in some other S. typhi-murium strains isolated from clinical cases in the area around St. Gallen.

  12. Effect of Plasmid Incompatibility on DNA Transfer to Streptococcus cremoris

    OpenAIRE

    Van Der Lelie, Daniel; Vossen, Jos M.B.M. van der; Venema, Gerard

    1988-01-01

    Several Streptococcus cremoris strains were used in protoplast transformation and interspecific protoplast fusion experiments with Streptococcus lactis and Bacillus subtilis, with pGKV110, pGKV21, and ΔpAMβ1 as the marker plasmids. ΔpAMβ1 is a 15.9-kilobase nonconjugative, deletion derivative of pAMβ1, which is considerably larger than the pGKV plasmids (approximately 4.5 kilobases). In general, ΔpAMβ1 was transferred more efficiently than the pGKV plasmids. Using electroporation, we were abl...

  13. Separation of plasmid DNA topoisomers by multimodal chromatography.

    Science.gov (United States)

    Silva-Santos, A Rita; Alves, Cláudia P A; Prazeres, Duarte Miguel F; Azevedo, Ana M

    2016-06-15

    The ability to analyze the distribution of topoisomers in a plasmid DNA sample is important when evaluating the quality of preparations intended for gene therapy and DNA vaccination or when performing biochemical studies on the action of topoisomerases and gyrases. Here, we describe the separation of supercoiled (sc) and open circular (oc) topoisomers by multimodal chromatography. A medium modified with the ligand N-benzyl-N-methyl ethanolamine and an elution scheme with increasing NaCl concentration are used to accomplish the baseline separation of sc and oc plasmid. The utility of the method is demonstrated by quantitating topoisomers in a purified plasmid sample. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Late gestational nutrient restriction

    DEFF Research Database (Denmark)

    Tygesen, Malin Plumhoff; Nielsen, Mette Olaf; Nørgaard, Peder;

    2008-01-01

    We investigated the effect of 50% nutrient restriction during the last 6 weeks of gestation on twin-pregnant ewes' plasma glucose, non-esterified fatty acid, ß-hydroxybutyrate, insulin, IGF-1 and leptin concentrations and the effects on lamb birth weight and ewes' lactation performance. Plasma...... metabolite and hormone concentrations in restricted ewes suggest that maternal tissues were being mobilised. Despite the ewes' adaptations their lambs weighed significantly less at birth. Furthermore, colostrum and milk yields were markedly reduced up until the latest measurement at 3 weeks post partum...

  15. Antirestriction protein Ard (Type C) encoded by IncW plasmid pSa has a high similarity to the "protein transport" domain of TraC1 primase of promiscuous plasmid RP4.

    Science.gov (United States)

    Belogurov, A A; Delver, E P; Agafonova, O V; Belogurova, N G; Lee, L Y; Kado, C I

    2000-03-03

    The IncW plasmid pSa contains the gene ard encoding an antirestriction function that is specific for type I restriction and modification systems. The nucleotide sequence of ard was determined and an appropriate polypeptide of about 33 kDa was identified in Escherichia coli T7 expression system. Analysis of deduced amino acid sequence of Ard encoded by pSa revealed that this protein has no significant similarities with the known Ard proteins (ArdA and ArdB types) except the "antirestriction" motif (14 amino acid residues in length) conserved for all known Ard proteins. This finding suggests that pSa Ard may be classified as a new type of Ard proteins which we designated ArdC. The remarkable feature of ArdC is that it has a high degree of similarity (about 38 % identity) to the N-terminal region of RP4 TraC1 primase which includes about 300 amino acid residues and seems to be essential for binding to the single-stranded DNA and TraC1 protein transport to the recipient cells during the conjugal transfer of plasmid DNA. ArdC also binds to single-stranded DNA. In addition, this protein is able in vitro to protect the single-stranded but not double-stranded plasmid DNA against the activity of type II restriction endonuclease HhaI that cleaves both single and double-stranded DNA. We suggest that like TraC1, ArdC would be transported as a result of their interaction with the single-stranded DNA of transferred plasmid strand during conjugative passage through the cell envelope to the recipient bacterium. Such properties of ArdC protein might be useful to protect immediately the incoming single-stranded DNA from the host endonucleases.

  16. Multiple Antibiotic Resistance Plasmids Allow Scalable, PCR-Mediated DNA Manipulation and Near-Zero Background Cloning

    Directory of Open Access Journals (Sweden)

    Remigiusz Arnak

    2016-01-01

    Full Text Available We have constructed two plasmids that can be used for cloning as templates for PCR-based gene disruption, mutagenesis and the construction of DNA chromosome translocation cassettes. To our knowledge, these plasmids are the first vectors that confer resistance to ampicillin, kanamycin and hygromycin B in bacteria, and to geneticin (G418 and hygromycin B in Saccharomyces cerevisiae simultaneously. The option of simultaneously using up to three resistance markers provides a highly stringent control of recombinant selection and the almost complete elimination of background resistance, while unique restriction sites allow easy cloning of chosen genetic material. Moreover, we successfully used these new vectors as PCR templates for the induction of chromosome translocation in budding yeast by the bridge-induced translocation system. Cells in which translocation was induced carried chromosomal rearrangements as expected and exhibited resistance to both, G418 and hygromycin B. These features make our constructs very handy tools for many molecular biology applications.

  17. Broad host range plasmid-based gene transfer system in the cyanobacterium Gloeobacter violaceus which lacks thylakoids

    Institute of Scientific and Technical Information of China (English)

    GUO Haitao; XU Xudong

    2004-01-01

    Gloeobacter violaceus, a cyanobacterium lack of thylakoids, is refractory to genetic manipulations because its cells are enveloped by a thick gelatinous sheath and in colonial form.In this study, a large number of single cells were obtained by repeated pumping with a syringe with the gelatinous sheath removed.And an exogenous broad host range plasmid pKT210 was conjugatively transferred into G.violaceus.Analyses with dot-blot hybridization and restriction mapping showed that the exogenous plasmid pKT210 had been introduced into G.violaceus and stably maintained with no alteration in its structure.pKT210 extracted from G.violaceus exconjugants could be transformed into the mcr- mrr- E.coli strain DH10B but not the mcr+ mrr+ strain DH5α, which suggests that a methylase system may be present in G.violaceus.

  18. Bacterial mitosis: ParM of plasmid R1 moves plasmid DNA by an actin-like insertional polymerization mechanism.

    Science.gov (United States)

    Møller-Jensen, Jakob; Borch, Jonas; Dam, Mette; Jensen, Rasmus B; Roepstorff, Peter; Gerdes, Kenn

    2003-12-01

    Bacterial DNA segregation takes place in an active and ordered fashion. In the case of Escherichia coli plasmid R1, the partitioning system (par) separates paired plasmid copies and moves them to opposite cell poles. Here we address the mechanism by which the three components of the R1 par system act together to generate the force required for plasmid movement during segregation. ParR protein binds cooperatively to the centromeric parC DNA region, thereby forming a complex that interacts with the filament-forming actin-like ParM protein in an ATP-dependent manner, suggesting that plasmid movement is powered by insertional polymerization of ParM. Consistently, we find that segregating plasmids are positioned at the ends of extending ParM filaments. Thus, the process of R1 plasmid segregation in E. coli appears to be mechanistically analogous to the actin-based motility operating in eukaryotic cells. In addition, we find evidence suggesting that plasmid pairing is required for ParM polymerization.

  19. Influenza Plasmid DNA Vaccines: Progress and Prospects.

    Science.gov (United States)

    Bicho, Diana; Queiroz, João António; Tomaz, Cândida Teixeira

    2015-01-01

    Current influenza vaccines have long been used to fight flu infectious; however, recent advances highlight the importance of produce new alternatives. Even though traditional influenza vaccines are safe and usually effective, they need to be uploaded every year to anticipate circulating flu viruses. This limitation together with the use of embryonated chicken eggs as the substrate for vaccine production, is time-consuming and could involve potential biohazards in growth of new virus strains. Plasmid DNA produced by prokaryote microorganisms and encoding foreign proteins had emerged as a promising therapeutic tool. This technology allows the expression of a gene of interest by eukaryotic cells in order to induce protective immune responses against the pathogen of interest. In this review, we discuss the strategies to choose the best DNA vaccine to be applied in the treatment and prevention of influenza. Specifically, we give an update of influenza DNA vaccines developments, all involved techniques, their main characteristics, applicability and technical features to obtain the best option against influenza infections.

  20. Training Restricted Boltzmann Machines

    DEFF Research Database (Denmark)

    Fischer, Asja

    Restricted Boltzmann machines (RBMs) are probabilistic graphical models that can also be interpreted as stochastic neural networks. Training RBMs is known to be challenging. Computing the likelihood of the model parameters or its gradient is in general computationally intensive. Thus, training...

  1. Bilinear Fourier restriction theorems

    CERN Document Server

    Demeter, Ciprian

    2012-01-01

    We provide a general scheme for proving $L^p$ estimates for certain bilinear Fourier restrictions outside the locally $L^2$ setting. As an application, we show how such estimates follow for the lacunary polygon. In contrast with prior approaches, our argument avoids any use of the Rubio de Francia Littlewood--Paley inequality.

  2. A semester-long project for teaching basic techniques in molecular biology such as restriction fragment length polymorphism analysis to undergraduate and graduate students.

    Science.gov (United States)

    DiBartolomeis, Susan M

    2011-01-01

    Several reports on science education suggest that students at all levels learn better if they are immersed in a project that is long term, yielding results that require analysis and interpretation. I describe a 12-wk laboratory project suitable for upper-level undergraduates and first-year graduate students, in which the students molecularly locate and map a gene from Drosophila melanogaster called dusky and one of dusky's mutant alleles. The mapping strategy uses restriction fragment length polymorphism analysis; hence, students perform most of the basic techniques of molecular biology (DNA isolation, restriction enzyme digestion and mapping, plasmid vector subcloning, agarose and polyacrylamide gel electrophoresis, DNA labeling, and Southern hybridization) toward the single goal of characterizing dusky and the mutant allele dusky(73). Students work as individuals, pairs, or in groups of up to four students. Some exercises require multitasking and collaboration between groups. Finally, results from everyone in the class are required for the final analysis. Results of pre- and postquizzes and surveys indicate that student knowledge of appropriate topics and skills increased significantly, students felt more confident in the laboratory, and students found the laboratory project interesting and challenging. Former students report that the lab was useful in their careers.

  3. Mechanisms of Evolution in High-Consequence Drug Resistance Plasmids

    Directory of Open Access Journals (Sweden)

    Susu He

    2016-12-01

    Full Text Available The dissemination of resistance among bacteria has been facilitated by the fact that resistance genes are usually located on a diverse and evolving set of transmissible plasmids. However, the mechanisms generating diversity and enabling adaptation within highly successful resistance plasmids have remained obscure, despite their profound clinical significance. To understand these mechanisms, we have performed a detailed analysis of the mobilome (the entire mobile genetic element content of a set of previously sequenced carbapenemase-producing Enterobacteriaceae (CPE from the National Institutes of Health Clinical Center. This analysis revealed that plasmid reorganizations occurring in the natural context of colonization of human hosts were overwhelmingly driven by genetic rearrangements carried out by replicative transposons working in concert with the process of homologous recombination. A more complete understanding of the molecular mechanisms and evolutionary forces driving rearrangements in resistance plasmids may lead to fundamentally new strategies to address the problem of antibiotic resistance.

  4. Plasmid Conjugation in E. coli and Drug Resistance

    African Journals Online (AJOL)

    Prof. Ogunji

    respiratory infections etc) or prescribing the 'newest' antibiotics in the market when older “brands” may ..... influence an increase in mortality rate; high economic burden and longer hospital ... Conjugating plasmids into bacteria; Tri Parental.

  5. Characterization of IncA/C conjugative plasmid harboring bla TEM-52 and bla CTX-M-15 extended-spectrum β-lactamases in clinical isolates of Escherichia coli in Tunisia.

    Science.gov (United States)

    Chouchani, C; El Salabi, A; Marrakchi, R; Ferchichi, L; Walsh, T R

    2012-06-01

    To characterize the extended-spectrum β-lactamases (ESBLs) as well as their genetic environment in different isolates of Escherichia coli from patients with repeated urinary tract infections, large multidrug resistance (MDR) plasmids have been found. Definitive evidence for the presence of an A/C incompatibility complex (IncA/C) plasmid in the MDR isolates was provided by the probing of plasmids extracted from the clinical isolates. Conjugation experiments showed that bla genes were transferred by conjugation from the ten E. coli clinical isolates to E. coli XL1-Blue recipient. A comparative restriction fragment length polymorphism (RFLP) analysis of these plasmids showed that they are genetically similar, while the overall similarity of these plasmids supports the likelihood of recent movements among these E. coli isolates. Polymerase chain reaction (PCR) amplification and sequencing of the amplicons showed that the IncA/C plasmids harbor two ESBLs, identified as TEM-52 and CTX-M-15. Analysis of the plasmid DNA surrounding the bla (CTX-M-15) gene in the clinical isolates under study revealed a partially truncated fragment of ISEcp1 tnpA transposase. This result indicates the variety of genetic events that have enabled associations between ISEcp1 sequences and bla (CTX-M-15) genes in these clinical isolates.

  6. Transfer of conjugative plasmids among bacteria under environmentally relevant conditions

    DEFF Research Database (Denmark)

    Musovic, Sanin

    at spredningskapacitet af en konjugerbare plasmid, der koder for kviksølv resistens via merA genet, finder sted under substrat begrænsede forhold til syntetisk bakterielt samfund. Plasmid overførsel var meget forhøjet ved kontinuert udsættelse af mikrokosms for en høj koncentration af kviksølv. De forskellige vækstrater...

  7. The Native Plasmid pML21 Plays a Role in Stress Tolerance in Enterococcus faecalis ML21, as Analyzed by Plasmid Curing Using Plasmid Incompatibility.

    Science.gov (United States)

    Zuo, Fang-Lei; Chen, Li-Li; Zeng, Zhu; Feng, Xiu-Juan; Yu, Rui; Lu, Xiao-Ming; Ma, Hui-Qin; Chen, Shang-Wu

    2016-02-01

    To investigate the role of the native plasmid pML21 in Enterococcus faecalis ML21's response to abiotic stresses, the plasmid pML21 was cured based on the principle of plasmid incompatibility and segregational instability, generating E. faecalis mutant strain ML0. The mutant and the wild strains were exposed to abiotic stresses: bile salts, low pH, H2O2, ethanol, heat, and NaCl, and their survival rate was measured. We found that curing of pML21 lead to reduced tolerance to stress in E. faecalis ML0, especially oxidative and osmotic stress. Complementation analysis suggested that the genes from pML21 played different role in stress tolerance. The result indicated that pML21 plays a role in E. faecalis ML21's response to abiotic stresses.

  8. Restriction endonucleases digesting DNA in PCR buffer

    Institute of Scientific and Technical Information of China (English)

    LIU Xue-dong; ZHENG Dong; ZHOU Yan-na; MAO Wei-wei; MA Jian-zhang

    2005-01-01

    Six commonly used restriction endonucleases (Res) (Acc I, Ban II, EcoR I, Hind III, Sac I, Sca I) were tested for their ability to directly digest DNA completely in the Polymerase Chain Reaction (PCR) buffers. The results showed that: with the requirement for additional magnesium supplemented as activator, Res, except EcoR I appeared star activity, completely digested unmethylated lambda DNA after overnight incubation in PCR buffer and functioned as equally well as in recommended Restriction Enzyme Buffer provided with each enzyme; all Res tested completely digested PCR products in PCR buffer, it implied digestion of PCR products may often be performed directly in the PCR tube without the requirement for any precipitation or purification steps; and the concentration of MgCl2 from 2.5 mmol·L-1 to 10 mmol·L-1 did not significantly affect activity of Res in PCR buffer. This simplified method for RE digestion of PCR products could have applications in restriction fragment length polymorphism (RFLP) analysis and single-stranded conformational polymorphism (SSCP) analysis of large PCR products. However, usage of this procedure for cloning applications needs further data.

  9. Restriction endonuclease mapping of linear unintegrated proviral DNA of bovine leukemia virus.

    OpenAIRE

    Kettmann, R; Couez, D; Burny, A

    1981-01-01

    A detailed restriction map was deduced for the genome of the exogenous bovine leukemia virus. The cleavage sites for nine restriction enzymes were mapped. The unintegrated linear viral DNA intermediate that is produced by infection of permissive cells with bovine leukemia virus was isolated. The linear viral DNA had a unique restriction map, indicating that it is not a set of random circular permutations of the RNA genome. From hybridization with a 3'-enriched probe, the DNA restriction map w...

  10. Transfection of bone marrow mesenchymal stem cells using green fluorescence protein labeled hVEGF165 recombinant plasmid mediated by liposome

    Institute of Scientific and Technical Information of China (English)

    Tao Wang; Tian-An Liao; Shao-Bo Zhong

    2013-01-01

    Objective:To study the role of bone marrow mesenchymal stem cells (BMSCs) in construction of vascularized engineered tissue. Methods: hVEGF165 was amplified via RT-PCR before recombinant with pShuttle-green fluorescence protein;green fluorescent protein (GFP)-CMV. Then the recombinant shuttle plasmid was transfected into BMSCs with LipofectamineTM 2000 for packaging and amplifying. hVEGF165 mRNA expression in BMSCs cells was tested. Results:The sequence of hVEGF165 in pShuttle-GFP-hVEGF165 plasmid was confirmed by double-enzyme cleavage method and sequencing. hVEGF165 was highly expressed in BMSCs. Conclusions:The GFP/hVEGF165 recombinant plasmid vector was constructed successfully and expressed effectively in host cells, which may be helpful for discussing the possibility of the application of VEGF165-BMSCs in tissue engineering and ischemic disease cure.

  11. A New Shuttle Plasmid That Stably Replicates in Clostridium acetobutylicum.

    Science.gov (United States)

    Lee, Sang-Hyun; Kwon, Min-A; Choi, Sunwha; Kim, Sooah; Kim, Jungyeon; Shin, Yong-An; Kim, Kyoung Heon

    2015-10-01

    We have developed a new shuttle plasmid, designated as pLK1-MCS that can replicate in both Clostridium acetobutylicum and Escherichia coli, by combining the pUB110 and pUC19 plasmids. Plasmid pLK1-MCS replicated more stably than previously reported plasmids containing either the pIM13 or the pAMβ1 replicon in the absence of antibiotic selective pressure. The transfer frequency of pLK1-MCS into C. acetobutylicum was similar to the transfer frequency of other shuttle plasmids. We complemented C. acetobutylicum ML1 (that does not produce solvents such as acetone, butanol, and ethanol owing to loss of the megaplasmid pSOL1 harboring the adhE1-ctfAB-adc operon) by introducing pLK1-MCS carrying the adhE1-ctfAB-adc operon into C. acetobutylicum ML1. The transformed cells were able to resume anaerobic solvent production, indicating that the new shuttle plasmid has the potential for practical use in microbial biotechnology.

  12. Plasmid copy number noise in monoclonal populations of bacteria

    Science.gov (United States)

    Wong Ng, Jérôme; Chatenay, Didier; Robert, Jérôme; Poirier, Michael Guy

    2010-01-01

    Plasmids are extra chromosomal DNA that can confer to their hosts’ supplementary characteristics such as antibiotic resistance. Plasmids code for their copy number through their own replication frequency. Even though the biochemical networks underlying the plasmid copy number (PCN) regulation processes have been studied and modeled, no measurement of the heterogeneity in PCN within a whole population has been done. We have developed a fluorescent-based measurement system, which enables determination of the mean and noise in PCN within a monoclonal population of bacteria. Two different fluorescent protein reporters were inserted: one on the chromosome and the other on the plasmid.