WorldWideScience

Sample records for plasmid dna transmission

  1. Plasmid DNA Delivery: Nanotopography Matters.

    Science.gov (United States)

    Song, Hao; Yu, Meihua; Lu, Yao; Gu, Zhengying; Yang, Yannan; Zhang, Min; Fu, Jianye; Yu, Chengzhong

    2017-12-20

    Plasmid DNA molecules with unique loop structures have widespread bioapplications, in many cases relying heavily on delivery vehicles to introduce them into cells and achieve their functions. Herein, we demonstrate that control over delicate nanotopography of silica nanoparticles as plasmid DNA vectors has significant impact on the transfection efficacy. For silica nanoparticles with rambutan-, raspberry-, and flower-like morphologies composed of spike-, hemisphere-, and bowl-type subunit nanotopographies, respectively, the rambutan-like nanoparticles with spiky surfaces demonstrate the highest plasmid DNA binding capability and transfection efficacy of 88%, higher than those reported for silica-based nanovectors. Moreover, it is shown that the surface spikes of rambutan nanoparticles provide a continuous open space to bind DNA chains via multivalent interactions and protect the gene molecules sheltered in the spiky layer against nuclease degradation, exhibiting no significant transfection decay. This unique protection feature is in great contrast to a commercial transfection agent with similar transfection performance but poor protection capability against enzymatic cleavage. Our study provides new understandings in the rational design of nonviral vectors for efficient gene delivery.

  2. Large-scale preparation of plasmid DNA.

    Science.gov (United States)

    Heilig, J S; Elbing, K L; Brent, R

    2001-05-01

    Although the need for large quantities of plasmid DNA has diminished as techniques for manipulating small quantities of DNA have improved, occasionally large amounts of high-quality plasmid DNA are desired. This unit describes the preparation of milligram quantities of highly purified plasmid DNA. The first part of the unit describes three methods for preparing crude lysates enriched in plasmid DNA from bacterial cells grown in liquid culture: alkaline lysis, boiling, and Triton lysis. The second part describes four methods for purifying plasmid DNA in such lysates away from contaminating RNA and protein: CsCl/ethidium bromide density gradient centrifugation, polyethylene glycol (PEG) precipitation, anion-exchange chromatography, and size-exclusion chromatography.

  3. Plasmid fermentation process for DNA immunization applications.

    Science.gov (United States)

    Carnes, Aaron E; Williams, James A

    2014-01-01

    Plasmid DNA for immunization applications must be of the highest purity and quality. The ability of downstream purification to efficiently produce a pure final product is directly influenced by the performance of the upstream fermentation process. While several clinical manufacturing facilities already have validated fermentation processes in place to manufacture plasmid DNA for use in humans, a simple and inexpensive laboratory-scale fermentation process can be valuable for in-house production of plasmid DNA for use in animal efficacy studies. This chapter describes a simple fed-batch fermentation process for producing bacterial cell paste enriched with high-quality plasmid DNA. A constant feeding strategy results in a medium cell density culture with continuously increasing plasmid amplification towards the end of the process. Cell banking and seed culture preparation protocols, which can dramatically influence final product yield and quality, are also described. These protocols are suitable for production of research-grade plasmid DNA at the 100 mg-to-1.5 g scale from a typical 10 L laboratory benchtop fermentor.

  4. [Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

    Science.gov (United States)

    Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

    1985-11-01

    The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

  5. Comparative assessment of plasmid DNA delivery by encapsulation ...

    African Journals Online (AJOL)

    Tropical Journal of Pharmaceutical Research January 2018; 17 (1): 1-10 ... Purpose: To compare the gene delivery effectiveness of plasmid DNA (pDNA) ..... Intramuscular delivery of DNA ... copolymeric system for gene delivery in complete.

  6. Production and pharmaceutical formulation of plasmid DNA vaccines

    NARCIS (Netherlands)

    van der Heijden, I.

    2013-01-01

    Research leading to the thesis ‘Production and pharmaceutical formulation of plasmid DNA vaccines‘ can be divided into two parts. The first part describes the development of a Good Manufacturing Practice (GMP) compliant plasmid DNA production process of pDNA vaccines for the treatment of Human

  7. Plasmid P1 replication: negative control by repeated DNA sequences.

    OpenAIRE

    Chattoraj, D; Cordes, K; Abeles, A

    1984-01-01

    The incompatibility locus, incA, of the unit-copy plasmid P1 is contained within a fragment that is essentially a set of nine 19-base-pair repeats. One or more copies of the fragment destabilizes the plasmid when present in trans. Here we show that extra copies of incA interfere with plasmid DNA replication and that a deletion of most of incA increases plasmid copy number. Thus, incA is not essential for replication but is required for its control. When cloned in a high-copy-number vector, pi...

  8. Comparative assessment of plasmid DNA delivery by encapsulation ...

    African Journals Online (AJOL)

    Purpose: To compare the gene delivery effectiveness of plasmid DNA (pDNA) encapsulated within poly (D,L-lactide-co-glycolide) (PLGA) nanoparticles with that adsorbed on PLGA nanoparticles. Methods: PLGA nanoparticles were prepared using solvent-evaporation method. To encapsulate pDNA within the particles, ...

  9. Plasmid DNA damage induced by helium atmospheric pressure plasma jet

    Science.gov (United States)

    Han, Xu; Cantrell, William A.; Escobar, Erika E.; Ptasinska, Sylwia

    2014-03-01

    A helium atmospheric pressure plasma jet (APPJ) is applied to induce damage to aqueous plasmid DNA. The resulting fractions of the DNA conformers, which indicate intact molecules or DNA with single- or double-strand breaks, are determined using agarose gel electrophoresis. The DNA strand breaks increase with a decrease in the distance between the APPJ and DNA samples under two working conditions of the plasma source with different parameters of applied electric pulses. The damage level induced in the plasmid DNA is also enhanced with increased plasma irradiation time. The reactive species generated in the APPJ are characterized by optical emission spectra, and their roles in possible DNA damage processes occurring in an aqueous environment are also discussed.

  10. Photoinduced silver nanoparticles/nanorings on plasmid DNA scaffolds.

    Science.gov (United States)

    Liu, Jianhua; Zhang, Xiaoliang; Yu, Mei; Li, Songmei; Zhang, Jindan

    2012-01-23

    Biological scaffolds are being actively explored for the synthesis of nanomaterials with novel structures and unexpected properties. Toroidal plasmid DNA separated from the Bacillus host is applied as a sacrificial mold for the synthesis of silver nanoparticles and nanorings. The photoirradiation method is applied to reduce Ag(I) on the plasmid. The nanoparticles are obtained by varying the concentration of the Ag(I) ion solution and the exposure time of the plasmid-Ag(I) complex under UV light at 254 nm and room temperature. It is found that the plasmid serves not only as a template but also as a reductant to drive the silver nucleation and deposition. The resulting nanoparticles have a face-centered cubic (fcc) crystal structure and 20-30 nm average diameter. The detailed mechanism is discussed, and other metals or alloys could also be synthesized with this method. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Virus-sized self-assembling lamellar complexes between plasmid DNA and cationic micelles promote gene transfer

    Science.gov (United States)

    Pitard, Bruno; Aguerre, Olivier; Airiau, Marc; Lachagès, Anne-Marie; Boukhnikachvili, Tsiala; Byk, Gérardo; Dubertret, Catherine; Herviou, Christian; Scherman, Daniel; Mayaux, Jean-François; Crouzet, Joël

    1997-01-01

    Gene therapy is based on the vectorization of genes to target cells and their subsequent expression. Cationic amphiphile-mediated delivery of plasmid DNA is the nonviral gene transfer method most often used. We examined the supramolecular structure of lipopolyamine/plasmid DNA complexes under various condensing conditions. Plasmid DNA complexation with lipopolyamine micelles whose mean diameter was 5 nm revealed three domains, depending on the lipopolyamine/plasmid DNA ratio. These domains respectively corresponded to negatively, neutrally, and positively charged complexes. Transmission electron microscopy and x-ray scattering experiments on complexes originating from these three domains showed that although their morphology depends on the lipopolyamine/plasmid DNA ratio, their particle structure consists of ordered domains characterized by even spacing of 80 Å, irrespective of the lipid/DNA ratio. The most active lipopolyamine/DNA complexes for gene transfer were positively charged. They were characterized by fully condensed DNA inside spherical particles (diameter: 50 nm) sandwiched between lipid bilayers. These results show that supercoiled plasmid DNA is able to transform lipopolyamine micelles into a supramolecular organization characterized by ordered lamellar domains. PMID:9405626

  12. Pharmaceutical development of the plasmid DNA vaccine pDERMATT

    NARCIS (Netherlands)

    Quaak, S.G.L.

    2009-01-01

    The discovery of tumor specific antigens and self tolerance mechanisms against these antigens led to the assumption that antigens circulating at sufficient concentration levels could break this self tolerance mechanism and evoke immunological antitumor effects. pDERMATT (plasmid DNA encoding

  13. Effect of Surfactants on Plasmid DNA Stability and Release from ...

    African Journals Online (AJOL)

    Purpose: To evaluate the effect of surfactants on plasmid DNA during preparation and release from polylactic glycolide (PLGA) microspheres. Methods: Various surfactants, both ionic and non-ionic (Span, Tween, Triton X100, cetyltrimethylammonium bromide and sodium dodecyl sulphate), were added during the ...

  14. Rapid and inexpensive method for isolating plasmid DNA

    International Nuclear Information System (INIS)

    Aljanabi, S. M.; Al-Awadi, S. J.; Al-Kazaz, A. A.; Baghdad Univ.

    1997-01-01

    A small-scale and economical method for isolating plasmid DNA from bacteria is described. The method provides DNA of suitable quality for most DNA manipulation techniques. This DNA can be used for restriction endonuclease digestion, southern blot hybridization, nick translation and end labeling of DNA probes, Polymerase Chain Reaction (PCR) -based techniques, transformation, DNA cycle-sequencing, and Chain-termination method for DNA sequencing. The entire procedure is adapted to 1.5 ml microfuge tubes and takes approximately 30 mins. The DNA isolated by this method has the same purity produced by CTAB and cesium chloride precipitation and purification procedures respectively. The two previous methods require many hours to obtain the final product and require the use of very expensive equipment as ultracentrifuge. This method is well suited for the isolation of plasmid DNA from a large number of bacterial samples and in a very short time and low cost in laboratories where chemicals, expensive equipment and finance are limited factors in conducting molecular research. (authors). 11refs. 11refs

  15. Transmissible Plasmids and Integrons Shift Escherichia coli Population Toward Larger Multiple Drug Resistance Numbers.

    Science.gov (United States)

    Suhartono, Suhartono; Savin, Mary C; Gbur, Edward E

    2018-04-01

    Transmissible plasmids and integrons may play important roles in the persistence and spread of antibiotic-resistant bacteria throughout aquatic environment by accumulating antibiotic resistance genes (ARG). Class 1 and class 2 integron (intI), mobilization (mob), sulfamethoxazole resistance (sul), and trimethoprim resistance (dfr) genes were PCR-amplified and confirmed through DNA sequencing following plasmid extraction from 139 antibiotic-resistant Escherichia coli. E. coli had previously been recovered from wastewater treatment plant effluent and receiving stream water in Northwest Arkansas and isolates had expressed resistance to one to six antibiotics. Almost half of the total isolates (47%) carried putatively transmissible plasmids with mob F12 gene as the most frequently detected mobilization gene. When two or three mob genes were detected per isolate, there was a significant shift in the population toward larger multiple drug resistance (MDR) number. Class 1 and/or 2 integrons were prevalent (46%), and the presence of integron significantly shifted the isolate population toward larger MDR number. More isolates carried single or coexistence of two or three sul genes (99.3%), and single or a combination up to five dfr genes (89.3%) than had exhibited in vitro resistance to the respective antibiotics. These findings indicate not only the role of the wastewater treatment effluent and the stream environment in coaccumulation of ARG with transmissible plasmids and integrons in multiple antibiotic-resistant E. coli populations but also suggest that density of sul and dfr resistance genes within an isolate may serve as a biomarker for mobile MDR in general.

  16. Proton-induced direct and indirect damage of plasmid DNA

    Czech Academy of Sciences Publication Activity Database

    Vyšín, Luděk; Pachnerová Brabcová, Kateřina; Štěpán, V.; Moretto-Capelle, P.; Bugler, B.; Legube, G.; Cafarelli, P.; Casta, R.; Champeaux, J. P.; Sence, M.; Vlk, M.; Wagner, Richard; Štursa, Jan; Zach, Václav; Incerti, S.; Juha, Libor; Davídková, Marie

    2015-01-01

    Roč. 54, č. 3 (2015), s. 343-352 ISSN 0301-634X R&D Projects: GA ČR GA13-28721S; GA MŠk LD12008; GA MŠk LM2011019 Institutional support: RVO:68378271 ; RVO:61389005 Keywords : proton radiation * DNA plasmid * direct and indirect effects * clustered damage * repair enzymes Subject RIV: BO - Biophysics Impact factor: 1.923, year: 2015

  17. DNA repair in bacterial cultures and plasmid DNA exposed to infrared laser for treatment of pain

    International Nuclear Information System (INIS)

    Canuto, K S; Sergio, L P S; Marciano, R S; Guimarães, O R; Polignano, G A C; Geller, M; Fonseca, A S; Paoli, F

    2013-01-01

    Biostimulation of tissues by low intensity lasers has been described on a photobiological basis and clinical protocols are recommended for treatment of various diseases, but their effects on DNA are controversial. The objective of this work was to evaluate effects of low intensity infrared laser exposure on survival and bacterial filamentation in Escherichia coli cultures, and induction of DNA lesions in bacterial plasmids. In E. coli cultures and plasmids exposed to an infrared laser at fluences used to treat pain, bacterial survival and filamentation and DNA lesions in plasmids were evaluated by electrophoretic profile. Data indicate that the infrared laser (i) increases survival of E. coli wild type in 24 h of stationary growth phase, (ii) induces bacterial filamentation, (iii) does not alter topological forms of plasmids and (iv) does not alter the electrophoretic profile of plasmids incubated with exonuclease III or formamidopyrimidine DNA glycosylase. A low intensity infrared laser at the therapeutic fluences used to treat pain can alter survival of E. coli wild type, induce filamentation in bacterial cells, depending on physiologic conditions and DNA repair, and induce DNA lesions other than single or double DNA strand breaks or alkali-labile sites, which are not targeted by exonuclease III or formamidopyrimidine DNA glycosylase. (letter)

  18. Immunization with plasmid DNA encoding the hemagglutinin and the nucleoprotein confers robust protection against a lethal canine distemper virus challenge.

    Science.gov (United States)

    Dahl, Lotte; Jensen, Trine Hammer; Gottschalck, Elisabeth; Karlskov-Mortensen, Peter; Jensen, Tove Dannemann; Nielsen, Line; Andersen, Mads Klindt; Buckland, Robin; Wild, T Fabian; Blixenkrone-Møller, Merete

    2004-09-09

    We have investigated the protective effect of immunization of a highly susceptible natural host of canine distemper virus (CDV) with DNA plasmids encoding the viral nucleoprotein (N) and hemagglutinin (H). The combined intradermal and intramuscular routes of immunization elicited high virus-neutralizing serum antibody titres in mink (Mustela vison). To mimic natural exposure, we also conducted challenge infection by horizontal transmission from infected contact animals. Other groups received a lethal challenge infection by administration to the mucosae of the respiratory tract and into the muscle. One of the mink vaccinated with N plasmid alone developed severe disease after challenge. In contrast, vaccination with the H plasmid together with the N plasmid conferred solid protection against disease and we were unable to detect CDV infection in PBMCs or in different tissues after challenge. Our findings show that DNA immunization by the combined intradermal and intramuscular routes can confer solid protective immunity against naturally transmitted morbillivirus infection and disease.

  19. Damage of plasmid DNA by high energy ions

    International Nuclear Information System (INIS)

    Michaelidesova, A.; Pachnerova Brabcova, K.; Davidkova, M.

    2018-01-01

    The aim of the study was to determine the degree of direct DNA damage by high-energy ions, which are one of the components of cosmic rays, and therefore the knowledge of the biological effects of these ions is key to long-term space missions with human crew. The pBR322 plasmid containing 4361 base pairs was used in this study. The aqueous solution of plasmid pBR322 was transferred on ice to Japan to the Heavy Ion Medical Accelerator in Chiba, the Research Center for Charged Particle Therapy. Just before the experiment, the droplets of solution of known concentration were applied to the slides and the water was allowed to evaporate to produce dry DNA samples. Half of the slides were irradiated with 290 MeV/u of carbon ions and a dose rate of 20 Gy/min. The other half of the slides were irradiated with helium nuclei of 150 MeV/hr and a dose rate of 12.6 Gy/min. Both sets of slides were irradiated with doses of 0-1,400 Gy with a 200 Gy step. After irradiation, the samples were re-dissolved in distilled water, frozen and transported on ice to the Czech Republic for processing. Samples were analyzed by agarose gel electrophoresis. The plasmid was evaluated separately to determine the degree of radiation induced lesions and further to incubation with enzymes recognizing basal damage. (authors)

  20. Solid lipid nanoparticles mediate non-viral delivery of plasmid DNA to dendritic cells

    Science.gov (United States)

    Penumarthi, Alekhya; Parashar, Deepti; Abraham, Amanda N.; Dekiwadia, Chaitali; Macreadie, Ian; Shukla, Ravi; Smooker, Peter M.

    2017-06-01

    There is an increasing demand for novel DNA vaccine delivery systems, mainly for the non-viral type as they are considered relatively safe. Therefore, solid lipid nanoparticles (SLNs) were investigated for their suitability as a non-viral DNA vaccine delivery system. SLNs were synthesised by a modified solvent-emulsification method in order to study their potential to conjugate with plasmid DNA and deliver them in vitro to dendritic cells using eGFP as the reporter plasmid. The DNA-SLN complexes were characterised by electron microscopy, gel retardation assays and dynamic light scattering. The cytotoxicity assay data supported their biocompatibility and was used to estimate safe threshold concentration resulting in high transfection rate. The transfection efficiency of these complexes in a dendritic cell line was shown to increase significantly compared to plasmid alone, and was comparable to that mediated by lipofectamine. Transmission electron microscopy studies delineated the pathway of cellular uptake. Endosomal escape was observed supporting the mechanism of transfection.

  1. Plasmid DNA damage caused by stibine and trimethylstibine

    International Nuclear Information System (INIS)

    Andrewes, Paul; Kitchin, Kirk T.; Wallace, Kathleen

    2004-01-01

    Antimony is classified as 'possibly carcinogenic to humans' and there is also sufficient evidence for antimony carcinogenicity in experimental animals. Stibine is a volatile inorganic antimony compound to which humans can be exposed in occupational settings (e.g., lead-acid battery charging). Because it is highly toxic, stibine is considered a significant health risk; however, its genotoxicity has received little attention. For the work reported here, stibine was generated by sodium borohydride reduction of potassium antimony tartrate. Trimethylstibine is a volatile organometallic antimony compound found commonly in landfill and sewage fermentation gases at concentrations ranging between 0.1 and 100 μg/m 3 . Trimethylstibine is generally considered to pose little environmental or health risk. In the work reported here, trimethylstibine was generated by reduction of trimethylantimony dichloride using either sodium borohydride or the thiol compounds, dithioerythritol (DTE), L-cysteine, and glutathione. Here we report the evaluation of the in vitro genotoxicities of five antimony compounds--potassium antimony tartrate, stibine, potassium hexahydroxyantimonate, trimethylantimony dichloride, and trimethylstibine--using a plasmid DNA-nicking assay. Of these five antimony compounds, only stibine and trimethylstibine were genotoxic (significant nicking to pBR 322 plasmid DNA). We found stibine and trimethylstibine to be about equipotent with trimethylarsine using this plasmid DNA-nicking assay. Reaction of trimethylantimony dichloride with either glutathione or L-cysteine to produce DNA-damaging trimethylstibine was observed with a trimethylantimony dichloride concentration as low as 50 μM and L-cysteine or glutathione concentrations as low as 500 and 200 μM, respectively, for a 24 h incubation

  2. Repair of UV-irradiated plasmid DNA in excision repair deficient mutants of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Ikai, K.; Tano, K.; Ohnishi, T.; Nozu, K.

    1985-01-01

    The repair of UV-irradiated DNA of plasmid YEp13 was studied in the incision defective strains by measurement of cell transformation frequency. In Saccharomyces cerevisiae, rad1,2,3 and 4 mutants could repair UV-damaged plasmid DNA. In Escherichia coli, uvrA mutant was unable to repair UV-damaged plasmid DNA; however, pretreatment of the plasmid with Micrococcus luteus endonuclease increased repair. It was concluded that all the mutations of yeast were probably limited only to the nuclear DNA. (author)

  3. Quantification bias caused by plasmid DNA conformation in quantitative real-time PCR assay.

    Science.gov (United States)

    Lin, Chih-Hui; Chen, Yu-Chieh; Pan, Tzu-Ming

    2011-01-01

    Quantitative real-time PCR (qPCR) is the gold standard for the quantification of specific nucleic acid sequences. However, a serious concern has been revealed in a recent report: supercoiled plasmid standards cause significant over-estimation in qPCR quantification. In this study, we investigated the effect of plasmid DNA conformation on the quantification of DNA and the efficiency of qPCR. Our results suggest that plasmid DNA conformation has significant impact on the accuracy of absolute quantification by qPCR. DNA standard curves shifted significantly among plasmid standards with different DNA conformations. Moreover, the choice of DNA measurement method and plasmid DNA conformation may also contribute to the measurement error of DNA standard curves. Due to the multiple effects of plasmid DNA conformation on the accuracy of qPCR, efforts should be made to assure the highest consistency of plasmid standards for qPCR. Thus, we suggest that the conformation, preparation, quantification, purification, handling, and storage of standard plasmid DNA should be described and defined in the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) to assure the reproducibility and accuracy of qPCR absolute quantification.

  4. Effect of the atmospheric pressure nonequilibrium plasmas on the conformational changes of plasmid DNA

    International Nuclear Information System (INIS)

    Yan Xu; He Guangyuan; Shi Mengjun; Gao Xuan; Li Yin; Ma Fengyun; Yu Men; Wang Changdong; Wang Yuesheng; Yang Guangxiao; Zou Fei; Lu Xinpei; Xiong Qing; Xiong Zilan

    2009-01-01

    The cold atmospheric pressure plasma, which has been widely used for biomedical applications, may potentially affect the conformation of DNA. In this letter, an atmospheric pressure plasma plume is used to investigate its effects on the conformational changes of DNA of plasmid pAHC25. It is found that the plasma plume could cause plasmid DNA topology alteration, resulting in the percentage of the supercoiled plasmid DNA form decreased while that of the open circular and linearized form of plasmid DNA increased as detected by agrose gel electrophoresis. On the other hand, further investigation by using polymerase chain reaction method shows that the atmospheric pressure plasma jet treatments under proper conditions does not affect the genes of the plasmid DNA, which may have potential application in increasing the transformation frequency by genetic engineering.

  5. Plasmid-derived DNA Strand Displacement Gates for Implementing Chemical Reaction Networks.

    Science.gov (United States)

    Chen, Yuan-Jyue; Rao, Sundipta D; Seelig, Georg

    2015-11-25

    DNA nanotechnology requires large amounts of highly pure DNA as an engineering material. Plasmid DNA could meet this need since it is replicated with high fidelity, is readily amplified through bacterial culture and can be stored indefinitely in the form of bacterial glycerol stocks. However, the double-stranded nature of plasmid DNA has so far hindered its efficient use for construction of DNA nanostructures or devices that typically contain single-stranded or branched domains. In recent work, it was found that nicked double stranded DNA (ndsDNA) strand displacement gates could be sourced from plasmid DNA. The following is a protocol that details how these ndsDNA gates can be efficiently encoded in plasmids and can be derived from the plasmids through a small number of enzymatic processing steps. Also given is a protocol for testing ndsDNA gates using fluorescence kinetics measurements. NdsDNA gates can be used to implement arbitrary chemical reaction networks (CRNs) and thus provide a pathway towards the use of the CRN formalism as a prescriptive molecular programming language. To demonstrate this technology, a multi-step reaction cascade with catalytic kinetics is constructed. Further it is shown that plasmid-derived components perform better than identical components assembled from synthetic DNA.

  6. Poly(hydroxyethyl methacrylate) based magnetic nanoparticles for plasmid DNA purification from Escherichia coli lysate

    Energy Technology Data Exchange (ETDEWEB)

    Percin, Is Latin-Small-Letter-Dotless-I k [Department of Biology, Hacettepe University, Ankara (Turkey); Karakoc, Veyis [Department of Chemistry, Biochemistry Division, Hacettepe University, Ankara (Turkey); Akgoel, Sinan [Department of Biochemistry, Ege University, Izmir (Turkey); Aksoez, Erol [Department of Biology, Hacettepe University, Ankara (Turkey); Denizli, Adil, E-mail: denizli@hacettepe.edu.tr [Department of Chemistry, Biochemistry Division, Hacettepe University, Ankara (Turkey)

    2012-07-01

    The aim of this study is to prepare poly(hydroxyethyl methacrylate-N-methacryloyl-(L)-histidine) [PHEMAH] magnetic nanoparticles for plasmid DNA (pDNA) purification from Escherichia coli (E. coli) cell lysate. Magnetic nanoparticles were produced by surfactant free emulsion polymerization. mPHEMAH nanoparticles were characterized by elemental analysis, Fourier transform infrared spectroscopy (FTIR), atomic force microscopy (AFM), vibrating sample magnetometer (VSM), electron spin resonance (ESR), thermogravimetric analyses (TGA) and transmission electron microscopy (TEM). Surface area, average particle size and size distribution were also performed. Specific surface area of the mPHEMAH nanoparticles was found to be 1180 m{sup 2}/g. Elemental analysis of MAH for nitrogen was estimated as 0.18 mmol/g polymer. The amount of pDNA adsorbed onto the mPHEMAH nanoparticles first increased and then reached a saturation value at around 1.0 mg/mL of pDNA concentration. Compared with the mPHEMA nanoparticles (50 {mu}g/g polymer), the pDNA adsorption capacity of the mPHEMAH nanoparticles (154 mg/g polymer) was improved significantly due to the MAH incorporation into the polymeric matrix. The maximum pDNA adsorption was achieved at 25 Degree-Sign C. The overall recovery of pDNA was calculated as 92%. The mPHEMAH nanoparticles could be used six times without decreasing the pDNA adsorption capacity significantly. The results indicate that the PHEMAH nanoparticles promise high selectivity for pDNA. - Highlights: Black-Right-Pointing-Pointer Magnetic nanoparticles have several advantages over conventional adsorbents. Black-Right-Pointing-Pointer MAH acted as the pseudospecific ligand, ligand immobilization step was eliminated. Black-Right-Pointing-Pointer pDNA adsorption amount was 154 mg/g. Black-Right-Pointing-Pointer Fifty-fold capacity increase was obtained when compared to conventional matrices.

  7. Poly(hydroxyethyl methacrylate) based magnetic nanoparticles for plasmid DNA purification from Escherichia coli lysate

    International Nuclear Information System (INIS)

    Perçin, Işık; Karakoç, Veyis; Akgöl, Sinan; Aksöz, Erol; Denizli, Adil

    2012-01-01

    The aim of this study is to prepare poly(hydroxyethyl methacrylate-N-methacryloyl-(L)-histidine) [PHEMAH] magnetic nanoparticles for plasmid DNA (pDNA) purification from Escherichia coli (E. coli) cell lysate. Magnetic nanoparticles were produced by surfactant free emulsion polymerization. mPHEMAH nanoparticles were characterized by elemental analysis, Fourier transform infrared spectroscopy (FTIR), atomic force microscopy (AFM), vibrating sample magnetometer (VSM), electron spin resonance (ESR), thermogravimetric analyses (TGA) and transmission electron microscopy (TEM). Surface area, average particle size and size distribution were also performed. Specific surface area of the mPHEMAH nanoparticles was found to be 1180 m 2 /g. Elemental analysis of MAH for nitrogen was estimated as 0.18 mmol/g polymer. The amount of pDNA adsorbed onto the mPHEMAH nanoparticles first increased and then reached a saturation value at around 1.0 mg/mL of pDNA concentration. Compared with the mPHEMA nanoparticles (50 μg/g polymer), the pDNA adsorption capacity of the mPHEMAH nanoparticles (154 mg/g polymer) was improved significantly due to the MAH incorporation into the polymeric matrix. The maximum pDNA adsorption was achieved at 25 °C. The overall recovery of pDNA was calculated as 92%. The mPHEMAH nanoparticles could be used six times without decreasing the pDNA adsorption capacity significantly. The results indicate that the PHEMAH nanoparticles promise high selectivity for pDNA. - Highlights: ► Magnetic nanoparticles have several advantages over conventional adsorbents. ► MAH acted as the pseudospecific ligand, ligand immobilization step was eliminated. ► pDNA adsorption amount was 154 mg/g. ► Fifty-fold capacity increase was obtained when compared to conventional matrices.

  8. Resident enhanced repair: novel repair process action on plasmid DNA transformed into Escherichia coli K-12

    International Nuclear Information System (INIS)

    Strike, P.; Roberts, R.J.

    1982-01-01

    The survival of UV-irradiated DNA of plasmid NTP16 was monitored after its transformation into recipient cells containing an essentially homologous undamaged plasmid, pLV9. The presence of pLV9 resulted in a substantial increase in the fraction of damaged NTP16 molecules which survived in the recipient cells. This enhanced survival requires the host uvrA + and uvrB + gene products, but not the host recA + gene product. The requirement for both homologous DNA and the uvrA + gene products suggests that a novel repair process may act on plasmid DNA. Possible mechanisms for this process are considered

  9. TOL plasmid carriage enhances biofilm formation and increases extracellular DNA content in Pseudomonas putida KT2440

    DEFF Research Database (Denmark)

    D'Alvise, Paul; Sjoholm, O.R.; Yankelevich, T.

    2010-01-01

    laser scanning microscopy. The TOL-carrying strains formed pellicles and thick biofilms, whereas the same strains without the plasmid displayed little adherent growth. Microscopy using fluorescent nucleic acid-specific stains revealed differences in the production of extracellular polymeric substances......: TOL carriage leads to more extracellular DNA (eDNA) in pellicles and biofilms. Pellicles were dissolved by DNase I treatment. Enhanced cell lysis due to plasmid carriage was ruled out as the mechanism for eDNA release. We report, for the first time, that carriage of a conjugative plasmid leads...

  10. 3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

    Science.gov (United States)

    Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

    2008-09-01

    We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

  11. Plasmid DNA damage by heavy ions at spread-out Bragg peak energies

    NARCIS (Netherlands)

    Dang, H. M.; van Goethem, M. J.; van der Graaf, E. R.; Brandenburg, S.; Hoekstra, R.; Schlatholter, T.

    2010-01-01

    Interaction of ionizing radiation with plasmid DNA can lead to formation of single strand breaks, double strand breaks and clustered lesions. We have investigated the response of the synthetic plasmid pBR322 in aqueous solution upon irradiation with (12)C ions under spread-out Bragg peak conditions

  12. A one-step miniprep for the isolation of plasmid DNA and lambda phage particles.

    Directory of Open Access Journals (Sweden)

    George Lezin

    Full Text Available Plasmid DNA minipreps are fundamental techniques in molecular biology. Current plasmid DNA minipreps use alkali and the anionic detergent SDS in a three-solution format. In addition, alkali minipreps usually require additional column-based purification steps and cannot isolate other extra-chromosomal elements, such as bacteriophages. Non-ionic detergents (NIDs have been used occasionally as components of multiple-solution plasmid DNA minipreps, but a one-step approach has not been developed. Here, we have established a one-tube, one-solution NID plasmid DNA miniprep, and we show that this approach also isolates bacteriophage lambda particles. NID minipreps are more time-efficient than alkali minipreps, and NID plasmid DNA performs better than alkali DNA in many downstream applications. In fact, NID crude lysate DNA is sufficiently pure to be used in digestion and sequencing reactions. Microscopic analysis showed that the NID procedure fragments E. coli cells into small protoplast-like components, which may, at least in part, explain the effectiveness of this approach. This work demonstrates that one-step NID minipreps are a robust method to generate high quality plasmid DNA, and NID approaches can also isolate bacteriophage lambda particles, outperforming current standard alkali-based minipreps.

  13. Characterization of Plasmid DNA Location within Chitosan/PLGA/pDNA Nanoparticle Complexes Designed for Gene Delivery

    Directory of Open Access Journals (Sweden)

    Hali Bordelon

    2011-01-01

    Full Text Available Poly(D,L-lactide-co-glycolide- (PLGA-chitosan nanoparticles are becoming an increasingly common choice for the delivery of nucleic acids to cells for various genetic manipulation techniques. These particles are biocompatible, with tunable size and surface properties, possessing an overall positive charge that promotes complex formation with negatively charged nucleic acids. This study examines properties of the PLGA-chitosan nanoparticle/plasmid DNA complex after formation. Specifically, the study aims to determine the optimal ratio of plasmid DNA:nanoparticles for nucleic acid delivery purposes and to elucidate the location of the pDNA within these complexes. Such characterization will be necessary for the adoption of these formulations in a clinical setting. The ability of PLGA-chitosan nanoparticles to form complexes with pDNA was evaluated by using the fluorescent intercalating due OliGreen to label free plasmid DNA. By monitoring the fluorescence at different plasmid: nanoparticle ratios, the ideal plasmid:nanoparticle ration for complete complexation of plasmid was determined to be 1:50. Surface-Enhanced Raman Spectroscopy and gel digest studies suggested that even at these optimal complexation ratios, a portion of the plasmid DNA was located on the outer complex surface. This knowledge will facilitate future investigations into the functionality of the system in vitro and in vivo.

  14. Photo-transfection of mouse embryonic stem cells with plasmid DNA using femtosecond laser pulses

    CSIR Research Space (South Africa)

    Thobakgale, Lebogang

    2017-01-01

    Full Text Available This presentation is about the photo-transfection of mouse embryonic stem cells with plasmid DNA using femtosecond laser pulses. It outlines the background on embryonic stem cells (ES) and phototransfection....

  15. Optimizing hyaluronidase dose and plasmid DNA delivery greatly improves gene electrotransfer efficiency in rat skeletal muscle

    DEFF Research Database (Denmark)

    Åkerström, Thorbjörn; Vedel, Kenneth; Needham Andersen, Josefine

    2015-01-01

    Transfection of rat skeletal muscle in vivo is a widely used research model. However, gene electrotransfer protocols have been developed for mice and yield variable results in rats. We investigated whether changes in hyaluronidase pre-treatment and plasmid DNA delivery can improve transfection...... with a homogenous distribution. We also show that transfection was stable over five weeks of regular exercise or inactivity. Our findings show that species-specific plasmid DNA delivery and hyaluronidase pre-treatment greatly improves transfection efficiency in rat skeletal muscle....... efficiency in rat skeletal muscle. We found that pre-treating the muscle with a hyaluronidase dose suitable for rats (0.56. U/g b.w.) prior to plasmid DNA injection increased transfection efficiency by >200% whereas timing of the pre-treatment did not affect efficiency. Uniformly distributing plasmid DNA...

  16. Enhanced extraction and purification of plasmid DNA from escherichia coli by applying a hybrid magnetic nanocomposite

    Energy Technology Data Exchange (ETDEWEB)

    Silva, R.J. da; Chavez-Guajardo, A.E.; Medina-llamas, J.C.; Alcaraz-Espinoza, J.J.; Melo, C.P. de [Universidade Federal de Pernambuco (UFPE), PE (Brazil)

    2016-07-01

    Full text: Plasmid DNA (pDNA), a special kind of nucleic acid usually found in bacteria, is a small molecule physically distinct from chromosomal DNA that can replicate independently. This genetic material has been used in a wide set of biotechnological methodologies, such as genetic engineering, production of recombinant drugs and gene therapy, among others. In all these applications, the extraction and purification of pDNA appears as a crucial step. In this work, we describe the synthesis of a polyaniline and maghemite (PANI/?-Fe2O3) magnetic nanocomposite (MNC) and its use in a new Escherichia coli (E. coli) pDNA extraction and purification protocol. We have used transmission electron microscopy (TEM), UV-Vis spectroscopy, infrared spectroscopy (FTIR), X-ray diffraction (XRD), dynamic light scattering (DLS) and magnetic measurements to characterize the MNC, which was synthesized through an emulsion polymerization method. The yield, purity and quality of the pDNA extracted by using our proposed MNC protocol were evaluated through UV-Vis, agarose gel electrophoreses and PCR techniques, respectively. After comparing our results to those obtained by use of a commercial kit (Promega Wizard Plus SV Minipreps), we suggest that the novel protocol here proposed appears as a competitive alternative methodology. Not only the purification step can be completed within only 10 min, but the high adsorption capacity of the MNC results in pDNA yields that are almost twice the best values obtained by using the commercial kit. Hence, this new MNC methodology can be of general interest and find widespread use in different types of biomedical applications. (author)

  17. A rapid method for screening arrayed plasmid cDNA library by PCR

    International Nuclear Information System (INIS)

    Hu Yingchun; Zhang Kaitai; Wu Dechang; Li Gang; Xiang Xiaoqiong

    1999-01-01

    Objective: To develop a PCR-based method for rapid and effective screening of arrayed plasmid cDNA library. Methods: The plasmid cDNA library was arrayed and screened by PCR with a particular set of primers. Results: Four positive clones were obtained through about one week. Conclusion: This method can be applied to screening not only normal cDNA clones, but also cDNA clones-containing small size fragments. This method offers significant advantages over traditional screening method in terms of sensitivity, specificity and efficiency

  18. Plasmid DNA Analysis of Pasteurella multocida Serotype B isolated from Haemorrhagic Septicaemia outbreaks in Malaysia

    Directory of Open Access Journals (Sweden)

    Jamal, H.

    2005-01-01

    Full Text Available A total of 150 purified isolates of Pasteurella multocida serotype B were used (Salmah, 2004 for plasmid DNA curing experiment to determine hyaluronidase activity, antibiotic resistance pattern (ARP and mice lethality test (LD50 for their role of pathogenicity. A plasmid curing experiment was carried out by using the intercalating agent; ethidium bromide and rifampicin, where it was found all the plasmids had been cured (plasmidless from Pasteurella multocida. All of these plasmidless isolates maintained their phenotypic characteristics. They showed the same antibiotic resistancepattern as before curing, produced hyaluronidase and possessed lethality activity in mice when injected intraperitoneally(i.p. Based on this observation, the antibiotic resistance, hyaluronidase activity and mice virulence could probably be chromosomal-mediated. Plasmids were detected 100% in all P. multocida isolates with identical profile of 2 plasmids size 3.0 and 5.5 kb. No large plasmids could be detected in all isolates. Since all the isolates appeared to have identicalplasmid profiles, they were subjected to restriction enzyme(RE analysis. From RE analysis results obtained, it can be concluded that the plasmid DNA in serotype B isolates are identical. Only 4 of 32 REs were found to cleave these plasmids with identical restriction fingerprints; BglII, HaeIII, RsaI and SspI. From RE analysis results, it can be concluded that the plasmid DNA isolates are identical. This plasmid might not played any role in pathogenicity of Pasteurella multocida serotype B, however this information is important for the construction of shuttle vectors in genetic studies of the pathogenicity of haemorrhagic septicaemia(HS.

  19. Purification of supercoiled DNA of plasmid Col E1 by RPC-5 chromatography

    Energy Technology Data Exchange (ETDEWEB)

    Best, A.N.; Allison, D.P.; Novelli, G.D.

    1981-07-01

    Col E1 DNA can be purified to a high degree by RPC-5 chromatography of a partially purified cell lysate with a very shallow linear NaC1 gradient at pH 7.8. Electron micrographs demonstrated that the purest fractions were composed of 93% supercoiled (form I) DNA and 7% open circular (form II) DNA. The actual chromatography can be accomplished in 13 to 14 h and is designed for the production of several milligrams of plasmid DNA.

  20. Plasmid containing a DNA ligase gene from Haemophilus influenzae

    International Nuclear Information System (INIS)

    McCarthy, D.; Griffin, K.; Setlow, J.K.

    1984-01-01

    A ligase gene from Haemophilus influenzae was cloned into the shuttle vector pDM2. Although the plasmid did not affect X-ray sensitivity, it caused an increase in UV sensitivity of the wild-type but not excision-defective H. influenzae and a decrease in UV sensitivity of the rec-1 mutant. 14 references, 2 figures

  1. Breaks in plasmid DNA strand induced by laser radiation at a wavelength of 193 nm

    International Nuclear Information System (INIS)

    Gurzadyan, G.G.; Shul'te Frolinde, D.

    1996-01-01

    DNA of plasmid pB322 irradiated with laser at a wavelength of 193 nm was treated with an extract containing proteins from E.coli K12 AB1157 (wild-type). The enzymes were found to produce single- and double-strand DNA breaks, which was interpreted as a transformation of a portion of cyclobutane pyrimidine dimers and (6-4) photoproducts into nonrepairable single-strand DNA breaks. The products resulted from ionization of DNA, in particular, single-strand breaks, transform to double-strand breaks. A comparison of these data with the data on survival of plasmid upon transformation of E.coli K12 AB1157 enables one to assess the biological significance of single- and double-strand breaks. The inactivation of the plasmid is mainly determined by the number of directly formed laser-induced single-strand breaks. 26 refs.; 2 figs

  2. Autonomous replication of plasmids bearing monkey DNA origin-enriched sequences

    International Nuclear Information System (INIS)

    Frappier, L.; Zannis-Hadjopoulos, M.

    1987-01-01

    Twelve clones of origin-enriched sequences (ORS) isolated from early replicating monkey (CV-1) DNA were examined for transient episomal replication in transfected CV-1, COS-7, and HeLa cells. Plasmid DNA was isolated at time intervals after transfection and screened by the Dpn I resistance assay or by the bromodeoxyuridine substitution assay to differentiate between input and replicated DNA. The authors have identified four monkey ORS (ORS3, -8, -9, and -12) that can support plasmid replication in mammalian cells. This replication is carried out in a controlled and semiconservative manner characteristic of mammalian replicons. ORS replication was most efficient in HeLa cells. Electron microscopy showed ORS8 and ORS12 plasmids of the correct size with replication bubbles. Using a unique restriction site in ORS12, we have mapped the replication bubble within the monkey DNA sequence

  3. TOL Plasmid Carriage Enhances Biofilm Formation and Increases Extracellular DNA Content in Pseudomonas Putida KT2440

    DEFF Research Database (Denmark)

    Smets, Barth F.; D'Alvise, Paul; Yankelovich, T.

    laser scanning microscopy. The TOL-carrying strains formed pellicles and thick biofilms, whereas the same strains without the plasmid displayed little adherent growth. Microscopy using fluorescent nucleic acid- specific stains (cytox orange, propidium iodide) revealed differences in production...... combined with specific cytostains; release of cytoplasmic material was assayed by a β-glucosidase assay. Enhanced cell lysis due to plasmid carriage was ruled out as the mechanism for eDNA release. We report, for the first time, that carriage of a conjugative plasmid leads to increased biofilm formation...

  4. Heavy ion induced damage to plasmid DNA : plateau region vs. spread out Bragg-peak

    NARCIS (Netherlands)

    Dang, H.M.; van Goethem, M.J.; van der Graaf, E.R.; Brandenburg, S.; Hoekstra, R.A.; Schlathölter, T.A.

    We have investigated the damage of synthetic plasmid pBR322 DNA in dilute aqueous solutions induced by fast carbon ions. The relative contribution of indirect damage and direct damage to the DNA itself is expected to vary with linear energy transfer along the ion track, with the direct damage

  5. Plasmid ColE1 as a Molecular Vehicle for Cloning and Amplification of DNA

    Science.gov (United States)

    Hershfield, Vickers; Boyer, Herbert W.; Yanofsky, Charles; Lovett, Michael A.; Helinski, Donald R.

    1974-01-01

    DNA fragments obtained from EcoRI endonuclease digestion of bacteriophage ϕ80pt190 (trp+) and the plasmid ColE1 were covalently joined with polynucleotide ligase. Transformation of Escherichia coli trp- strains to tryptophan independence with the recombined DNA selected for reconstituted ColE1 plasmids containing the tryptophan operon and the ϕ80 immunity region. Similarly, an EcoRI endonuclease generated fragment of plasmid pSC105 DNA containing the genetic determinant of kanamycin resistance was inserted into the ColE1 plasmid and recovered in E. coli. The plasmids containing the trp operon (ColE1-trp) and the kanamycin resistance gene were maintained under logarithmic growth conditions at a level of 25-30 copies per cell and accumulate to the extent of several hundred copies per cell in the presence of chloramphenicol. Cells carrying the ColE1-trp plasmid determined the production of highly elevated levels of trp operon-specific mRNA and tryptophan biosynthetic enzymes. Images PMID:4610576

  6. The effects of a low-intensity red laser on bacterial growth, filamentation and plasmid DNA

    International Nuclear Information System (INIS)

    Roos, C; Santos, J N; Guimarães, O R; Geller, M; Fonseca, A S; Paoli, F

    2013-01-01

    Exposure of nonphotosynthesizing microorganisms to light could increase cell division in cultures, a phenomenon denominated as biostimulation. However, data concerning the importance of the genetic characteristics of cells on this effect are as yet scarce. The aim of this work was to evaluate the effects of a low-intensity red laser on the growth, filamentation and plasmids in Escherichia coli cells proficient and deficient in DNA repair. E. coli cultures were exposed to a laser (658 nm, 10 mW, 1 and 8 J cm −2 ) to study bacterial growth and filamentation. Also, bacterial cultures hosting pBSK plasmids were exposed to the laser to study DNA topological forms from the electrophoretic profile in agarose gels. Data indicate the low-intensity red laser: (i) had no effect on the growth of E. coli wild type and exonuclease III deficient cells; (ii) induced bacterial filamentation, (iii) led to no alteration in the electrophoretic profile of plasmids from exonuclease III deficient cells, but plasmids from wild type cells were altered. A low-intensity red laser at the low fluences used in phototherapy has no effect on growth, but induces filamentation and alters the topological forms of plasmid DNA in E. coli cultures depending on the DNA repair mechanisms. (paper)

  7. Evaluation of plasmid and genomic DNA calibrants used for the quantification of genetically modified organisms.

    Science.gov (United States)

    Caprioara-Buda, M; Meyer, W; Jeynov, B; Corbisier, P; Trapmann, S; Emons, H

    2012-07-01

    The reliable quantification of genetically modified organisms (GMOs) by real-time PCR requires, besides thoroughly validated quantitative detection methods, sustainable calibration systems. The latter establishes the anchor points for the measured value and the measurement unit, respectively. In this paper, the suitability of two types of DNA calibrants, i.e. plasmid DNA and genomic DNA extracted from plant leaves, for the certification of the GMO content in reference materials as copy number ratio between two targeted DNA sequences was investigated. The PCR efficiencies and coefficients of determination of the calibration curves as well as the measured copy number ratios for three powder certified reference materials (CRMs), namely ERM-BF415e (NK603 maize), ERM-BF425c (356043 soya), and ERM-BF427c (98140 maize), originally certified for their mass fraction of GMO, were compared for both types of calibrants. In all three systems investigated, the PCR efficiencies of plasmid DNA were slightly closer to the PCR efficiencies observed for the genomic DNA extracted from seed powders rather than those of the genomic DNA extracted from leaves. Although the mean DNA copy number ratios for each CRM overlapped within their uncertainties, the DNA copy number ratios were significantly different using the two types of calibrants. Based on these observations, both plasmid and leaf genomic DNA calibrants would be technically suitable as anchor points for the calibration of the real-time PCR methods applied in this study. However, the most suitable approach to establish a sustainable traceability chain is to fix a reference system based on plasmid DNA.

  8. Functionalized tetrapod-like ZnO nanostructures for plasmid DNA purification, polymerase chain reaction and delivery

    International Nuclear Information System (INIS)

    Nie Leng; Gao Lizeng; Yan Xiyun; Wang Taihong

    2007-01-01

    Functionalized tetrapodal ZnO nanostructures are tested in plasmid DNA experiments (1) as a solid-phase adsorbent for plasmid DNA purification (2) as improving reagents in a polymerase chain reaction (PCR) and (3) as novel carriers for gene delivery. The amino-modification, the tetrapod-like shape of the nanostructure and its high biocompatibility all contribute to measurements showing promise for applications. A sol-gel method is used for silica coating and amino-modification. Plasmid DNA is purified through reversible conjugations of amino-modified ZnO tetrapods with DNA. Also, as additional reagents, functionalized tetrapods are shown to improve the amount of PCR product. For transfection, ZnO tetrapods provide some protection against deoxyribonuclease cleavage of plasmid DNA and deliver plasmid DNA into cells with little cytotoxicity

  9. Effect of the caffeine on treated and non-treated plasmid DNA with stannic chloride

    International Nuclear Information System (INIS)

    Moreno, Silvana Ramos F.; Universidade Federal Fluminense, Niteroi, RJ; Mattos, Jose C.P. de; Dantas, Flavio; Araujo, Adriano Caldeira de; Bernardo-Filho, Mario

    2000-01-01

    Caffeine, a methilxantine drug is a component of coffee, tea, stimulants and other drinks. Caffeine inhibits phosphodiesterase leading to intracellular accumulation of cyclic AMP, blocks adenosine receptors, and increases the release of Ca 2+ . We have studied the possible effect of caffeine in DNA plasmid treated or not with stannous chloride (SnCl 2 ). Previous evaluations of the effect of caffeine on the labeling of red blood cells and plasma proteins with technetium-99m have showed a decrease of % ATI in the insoluble fraction of plasma proteins. Samples of DNA were treated with SnCl 2 (0 and 200μg/ml) in 0.8% agarose. SnCl 2 has induced break on DNA and caffeine has not showed effect on the DNA. This indicates that caffeine does not eliminate the oxidant action of SnCl 2 and does not promote break in isolated DNA plasmid. (author)

  10. Protection of vanillin derivative VND3207 on plasmid DNA damage induced by different LET ionizing radiation

    International Nuclear Information System (INIS)

    Xu Huihui; Wang Li; Sui Li; Guan Hua; Wang Yu; Liu Xiaodan; Zhang Shimeng; Xu Qinzhi; Wang Xiao; Zhou Pingkun

    2011-01-01

    Objective: To evaluate the radioprotective effect of vanillin derivative VND3207 on DNA damage induced by different LET ionizing radiation. Methods: The plasmid DNA in liquid was irradiated by 60 Co γ-rays, proton or 7 Li heavy ion with or without VND3207. The conformation changes of plasmid DNA were assessed by agarose gel electrophoresis and the quantification was done using gel imaging system. Results: The DNA damage induced by proton and 7 Li heavy ion was much more serious as compared with that by 60 Co γ-rays, and the vanillin derivative VND3207 could efficiently decrease the DNA damage induced by all three types of irradiation sources, which was expressed as a significantly reduced ratio of open circular form (OC) of plasmid DNA. The radioprotective effect of VND3207 increased with the increasing of drug concentration. The protective efficiencies of 200 μmol/L VND3207 were 85.3% (t =3.70, P=0.033), 73.3% (t=10.58, P=0.017) and 80.4% (t=8.57, P=0.008) on DNA damage induction by 50 Gy of γ-rays, proton and 7 Li heavy ion, respectively. It seemed that the radioprotection of VND3207 was more effective on DNA damage induced by high LET heavy ion than that by proton. Conclusions: VND3207 has a protective effect against the genotoxicity of different LET ionizing radiation, especially for γ-rays and 7 Li heavy ion. (authors)

  11. Ca2+ promoted the low transformation efficiency of plasmid DNA exposed to PAH contaminants.

    Directory of Open Access Journals (Sweden)

    Fuxing Kang

    Full Text Available The effects of interactions between genetic materials and polycyclic aromatic hydrocarbons (PAHs on gene expression in the extracellular environment remain to be elucidated and little information is currently available on the effect of ionic strength on the transformation of plasmid DNA exposed to PAHs. Phenanthrene and pyrene were used as representative PAHs to evaluate the transformation of plasmid DNA after PAH exposure and to determine the role of Ca(2+ during the transformation. Plasmid DNA exposed to the test PAHs demonstrated low transformation efficiency. In the absence of PAHs, the transformation efficiency was 4.7 log units; however, the efficiency decreased to 3.72-3.14 log units with phenanthrene/pyrene exposures of 50 µg · L(-1. The addition of Ca(2+ enhanced the low transformation efficiency of DNA exposed to PAHs. Based on the co-sorption of Ca(2+ and phenanthrene/pyrene by DNA, we employed Fourier-transform infrared spectroscopy (FTIR, X-ray photoelectron spectroscopy (XPS, and mass spectrometry (MS to determine the mechanisms involved in PAH-induced DNA transformation. The observed low transformation efficiency of DNA exposed to either phenanthrene or pyrene can be attributed to a broken hydrogen bond in the double helix caused by planar PAHs. Added Ca(2+ formed strong electrovalent bonds with "-POO(--" groups in the DNA, weakening the interaction between PAHs and DNA based on weak molecular forces. This decreased the damage of PAHs to hydrogen bonds in double-stranded DNA by isolating DNA molecules from PAHs and consequently enhanced the transformation efficiency of DNA exposed to PAH contaminants. The findings provide insight into the effects of anthropogenic trace PAHs on DNA transfer in natural environments.

  12. Strand breaks and lethal damage in plasmid DNA subjected to 60CO-γirradiation

    International Nuclear Information System (INIS)

    Klimczak, U.

    1992-01-01

    Experiments with calf thymus DNA subjected to extracellular irradiation yield information on the role of direct and indirect effects in single-strand breakage, if this is evaluated with reference to the scavenger activity in respect of OH radicals. The role of the two processes in the occurrence of double-stand breaks and further damage leading to cell decay has so far remained largely obscure. It was the aim of the study described here to contribute to research in this field by performing in vitro experiments on biologically active DNA. For this purpose, DNA from pBR322 plasmids was irradiated in the presence of OH-radical scavengers. The number of single-strand and double-strand breaks was determined on the basis of the system's ability to eliminate OH radicals. In order to asses the influence of irradiation processes on the biological activity of DNA, investigations were carried out in E. coli for transformations caused by irradiated plasmid DNA. The results were interpreted in the light of theories about inhomogenous reaction kinetics put forward by Mark et al. (1989). It was finally discussed, which of the gamma-irradiation injuries occurring in DNA was to be held responsible for the inactivation of plasmid DNA and which enzymatic processes were additionally at work here. (orig./MG) [de

  13. Improvement of in vivo transfer of plasmid DNA in muscle : Comparison of electroporation versus ultrasound

    NARCIS (Netherlands)

    Kusumanto, Yoka H.; Mulder, Nanno H.; Dam, Wendy A.; Losen, Mario H.; Meijer, Coby; Hospers, Geke A. P.

    Plasmid-based gene delivery to muscle is a treatment strategy for many diseases with potential advantages above viral-based gene delivery methods, however, with a relative low transfection efficiency. We compared two physical methods-electroporation and ultrasound-that facilitate DNA uptake into

  14. Cholesterol-conjugated supramolecular assemblies of low generations polyamidoamine dendrimers for enhanced EGFP plasmid DNA transfection

    Energy Technology Data Exchange (ETDEWEB)

    Golkar, Nasim; Samani, Soliman Mohammadi; Tamaddon, Ali Mohammad, E-mail: amtamadon@gmail.com [Shiraz University of Medical Sciences, Department of Pharmaceutics, School of Pharmacy (Iran, Islamic Republic of)

    2016-05-15

    Aimed to prepare an enhanced gene delivery system with low cytotoxicity and high transfection efficiency, various cholesterol-conjugated derivates of low generation polyamidoamine (PAMAM) dendrimers were prepared. The conjugates were characterized by TNBS assay, FTIR, and {sup 1}H-NMR spectroscopy. Self-assembly of the dendrimer conjugates (G1-Chol, G2-Chol, and G3-Chol) was investigated by pyrene assay. Following formation of the complexes between enhanced green fluorescence protein plasmid and the dendrimer conjugates at various N (primary amine)/P (phosphate) mole ratios, plasmid condensation, biologic stability, cytotoxicity, and protein expression were investigated. The conjugates self-assembled into micellar dispersions with the critical micelle concentration values (<50 µg/ml) depending on the dendrimer generation and cholesterol/amine mole ratio. Cholesterol conjugation resulted in higher resistance of the condensed plasmid DNA in a competition assay with heparin sulfate. Also, the transfection efficiency was determined higher for the cholesterol conjugates than unmodified dendrimers in HepG2 cells, showing the highest for G2-Chol at 40 % degree of cholesterol modification (G2-Chol{sub 40 %}) among various dendrimer generations. Interestingly, such conjugate showed a complete protection of plasmid against serum nucleases. Our results confirmed that the cholesterol conjugation to PAMAM dendrimers of low generations bearing little cytotoxicity improves their several physicochemical and biological characteristics required for an enhanced delivery of plasmid DNA into cells.

  15. Size and Base Composition of RNA in Supercoiled Plasmid DNA

    Science.gov (United States)

    Williams, Peter H.; Boyer, Herbert W.; Helinski, Donald R.

    1973-01-01

    The average size and base composition of the covalently integrated RNA segment in supercoiled ColE1 DNA synthesized in Escherichia coli in the presence of chloramphenicol (CM-ColE1 DNA) have been determined by two independent methods. The two approaches yielded similar results, indicating that the RNA segment in CM-ColE1 DNA contains GMP at the 5′ end and comprises on the average 25 to 26 ribonucleotides with a base composition of 10-11 G, 3 A, 5-6 C, and 6-7 U. PMID:4359488

  16. Persistence of plasmid DNA in different soils | Kandhavelu | African ...

    African Journals Online (AJOL)

    Natural genetic transformation is believed to be the essential mechanism for the attainment of genetic plasticity in many species of bacteria. Dying cells are likely to release naked DNA that may survive for many hours. Although numerous studies have shown that horizontal gene transfer between distantly related genera, but ...

  17. Intrathecal injection of naked plasmid DNA provides long-term expression of secreted proteins.

    Science.gov (United States)

    Hughes, Travis S; Langer, Stephen J; Johnson, Kirk W; Chavez, Raymond A; Watkins, Linda R; Milligan, Erin D; Leinwand, Leslie A

    2009-01-01

    Therapeutic benefit has been reported to result from intrathecal (i.t.) injection of transgene vectors, including naked DNA. However, most studies using naked DNA have measured only the transgene expression of intracellular proteins. Here we demonstrate that i.t. injection of naked DNA can result in long-term expression of secreted proteins. Plasmids expressing either secreted alkaline phosphatase (SEAP) or human interleukin-10 (hIL-10) were injected into the i.t. space in rats, and transgene products were repeatedly measured in the cerebrospinal fluid (CSF). Both SEAP and hIL-10 were maximal at 1 and 2 days after the injection and still detectable at 4 months. The utilization of a plasmid having two features that are hypothesized to increase gene expression (matrix attachment regions (MARs) and lack of CpG dinucleotides) resulted in a significant increase in gene expression. Reinjection of SEAP or hIL-10 plasmids after 4 months significantly increased protein levels at 1 and 14 days after the reinjection. SEAP was uniformly distributed between the DNA delivery site (approximately vertebral level T13) and the lumbar puncture site (L5/L6 inter-vertebral space), was reduced at the cisterna magna, and was detectable, though at much lower levels, in serum. These data suggest that naked DNA has the potential to be used as a therapeutic tool for applications that require long-term release of transgenes into the CSF.

  18. Evaluation of the effect of non-B DNA structures on plasmid integrity via accelerated stability studies.

    Science.gov (United States)

    Ribeiro, S C; Monteiro, G A; Prazeres, D M F

    2009-04-01

    Plasmid biopharmaceuticals are a new class of medicines with an enormous potential. Attempts to increase the physical stability of highly purified supercoiled (SC) plasmid DNA in pharmaceutical aqueous solutions have relied on: (i) changing the DNA sequence, (ii) improving manufacturing to reduce deleterious impurities and initial DNA damage, and (iii) controlling the storage medium characteristics. In this work we analyzed the role of secondary structures on the degradation of plasmid molecules. Accelerated stability experiments were performed with SC, open circular (OC) and linear (L) isoforms of three plasmids which differed only in the "single-strandlike" content of their polyadenylation (poly A) signals. We have proved that the presence of more altered or interrupted (non-B) DNA secondary structures did not directly translate into an easier strand scission of the SC isoforms. Rather, those unusual structures imposed a lower degree of SC in the plasmids, leading to an increase in their resistance to thermal degradation. However, this behavior was reversed when the relaxed or L isoforms were tested, in which case the absence of SC rendered the plasmids essentially double-stranded. Overall, this work suggests that plasmid DNA sequence and secondary structures should be taken into account in future investigations of plasmid stability during prolonged storage.

  19. Tissue-specific Calibration of Real-time PCR Facilitates Absolute Quantification of Plasmid DNA in Biodistribution Studies

    Directory of Open Access Journals (Sweden)

    Joan K Ho

    2016-01-01

    Full Text Available Analysis of the tissue distribution of plasmid DNA after administration of nonviral gene delivery systems is best accomplished using quantitative real-time polymerase chain reaction (qPCR, although published strategies do not allow determination of the absolute mass of plasmid delivered to different tissues. Generally, data is expressed as the mass of plasmid relative to the mass of genomic DNA (gDNA in the sample. This strategy is adequate for comparisons of efficiency of delivery to a single site but it does not allow direct comparison of delivery to multiple tissues, as the mass of gDNA extracted per unit mass of each tissue is different. We show here that by constructing qPCR standard curves for each tissue it is possible to determine the dose of intact plasmid remaining in each tissue, which is a more useful parameter when comparing the fates of different formulations of DNA. We exemplify the use of this tissue-specific qPCR method by comparing the delivery of naked DNA, cationic DNA complexes, and neutral PEGylated DNA complexes after intramuscular injection. Generally, larger masses of intact plasmid were present 24 hours after injection of DNA complexes, and neutral complexes resulted in delivery of a larger mass of intact plasmid to the spleen.

  20. Fluoride enhances transfection activity of carbonate apatite by increasing cytoplasmic stability of plasmid DNA

    International Nuclear Information System (INIS)

    Chowdhury, E.H.

    2011-01-01

    Highlights: → Cytoplasmic stability of plasmid DNA is enhanced by fluoride incorporation into carbonate apatite carrier. → Fluoridated carbonate apatite promotes a robust increase in transgene expression. → Controlled dissolution of fluoridated carbonate apatite in endosomal acidic environment might buffer the endosomes and prevent degradation of the released DNA. -- Abstract: Intracellular delivery of a functional gene or a nucleic acid sequence to specifically knockdown a harmful gene is a potential approach to precisely treat a critical human disease. The intensive efforts in the last few decades led to the development of a number of viral and non-viral synthetic vectors. However, an ideal delivery tool in terms of the safety and efficacy has yet to be established. Recently, we have developed pH-sensing inorganic nanocrystals of carbonate apatite for efficient and cell-targeted delivery of gene and gene-silencing RNA. Here we show that addition of very low level of fluoride to the particle-forming medium facilitates a robust increase in transgene expression following post-incubation of the particles with HeLa cells. Confocal microscopic observation and Southern blotting prove the cytoplasmic existence of plasmid DNA delivered by likely formed fluoridated carbonate apatite particles while degradation of plasmid DNA presumably by cytoplasmic nucleases was noticed following delivery with apatite particles alone. The beneficial role of fluoride in enhancing carbonate apatite-mediated gene expression might be due to the buffering potential of generated fluoridated apatite in endosomal acidic environment, thereby increasing the half-life of delivered plasmid DNA.

  1. Fluoride enhances transfection activity of carbonate apatite by increasing cytoplasmic stability of plasmid DNA

    Energy Technology Data Exchange (ETDEWEB)

    Chowdhury, E.H., E-mail: md.ezharul.hoque@med.monash.edu.my [Jeffrey Cheah School of Medicine and Health Sciences, Monash University Sunway Campus, Jalan Lagoon Selatan, Bandar Sunway, Selangor Darul Ehsan (Malaysia)

    2011-06-17

    Highlights: {yields} Cytoplasmic stability of plasmid DNA is enhanced by fluoride incorporation into carbonate apatite carrier. {yields} Fluoridated carbonate apatite promotes a robust increase in transgene expression. {yields} Controlled dissolution of fluoridated carbonate apatite in endosomal acidic environment might buffer the endosomes and prevent degradation of the released DNA. -- Abstract: Intracellular delivery of a functional gene or a nucleic acid sequence to specifically knockdown a harmful gene is a potential approach to precisely treat a critical human disease. The intensive efforts in the last few decades led to the development of a number of viral and non-viral synthetic vectors. However, an ideal delivery tool in terms of the safety and efficacy has yet to be established. Recently, we have developed pH-sensing inorganic nanocrystals of carbonate apatite for efficient and cell-targeted delivery of gene and gene-silencing RNA. Here we show that addition of very low level of fluoride to the particle-forming medium facilitates a robust increase in transgene expression following post-incubation of the particles with HeLa cells. Confocal microscopic observation and Southern blotting prove the cytoplasmic existence of plasmid DNA delivered by likely formed fluoridated carbonate apatite particles while degradation of plasmid DNA presumably by cytoplasmic nucleases was noticed following delivery with apatite particles alone. The beneficial role of fluoride in enhancing carbonate apatite-mediated gene expression might be due to the buffering potential of generated fluoridated apatite in endosomal acidic environment, thereby increasing the half-life of delivered plasmid DNA.

  2. Absence of ultraviolet-inducible DNA polymerase I-like activity in Escherichia coli strains harbouring R plasmids

    International Nuclear Information System (INIS)

    Upton, C.; Pinney, R.J.

    1981-01-01

    No DNA polymerase I-like activity was found associated with the ultraviolet (u.v.)-protecting plasmids R205, R46 or pKM101 in either uninduced or u.v.-induced wild-type or DNA polymerase I-deficient strains of Escherichia coli. Nor was any plasmid-associated polymerase activity detectable in similar systems containing u.v.-irradiated DNA as template. However, plasmids R205, R46 and pKM 101 still increased survival and mutagenesis of the polymerase I-deficient E. coli strain after u.v. irradiation. (author)

  3. Dichromatic laser radiation effects on DNA of Escherichia coli and plasmids

    Science.gov (United States)

    Martins, W. A.; Polignano, G. A. C.; Guimarães, O. R.; Geller, M.; Paoli, F.; Fonseca, A. S.

    2015-04-01

    Dichromatic and consecutive laser radiations have attracted increased attention for clinical applications as offering new tools for the treatment of dysfunctional tissues in situations where monochromatic radiation is not effective. This work evaluated the survival, filamentation and morphology of Escherichia coli cells, and the induction of DNA lesions, in plasmid DNA exposed to low-intensity consecutive dichromatic laser radiation. Exponential and stationary wild type and formamidopyrimidine DNA glycosylase/MutM protein deficient E. coli cultures were exposed to consecutive low-intensity dichromatic laser radiation (infrared laser immediately after red laser) to study the survival, filamentation and morphology of bacterial cells. Plasmid DNA samples were exposed to dichromatic radiation to study DNA lesions by electrophoretic profile. Dichromatic laser radiation affects the survival, filamentation and morphology of E. coli cultures depending on the growth phase and the functional repair mechanism of oxidizing lesions in DNA, but does not induce single/double strands breaks or alkali-labile DNA lesions. Results show that low-intensity consecutive dichromatic laser radiation induces biological effects that differ from those induced by monochromatic laser radiation, suggesting that other therapeutic effects could be obtained using dichromatic radiation.

  4. Perinatal transmission of human papilomavirus DNA

    Directory of Open Access Journals (Sweden)

    Serafini Eduardo P

    2009-06-01

    Full Text Available Abstract The purpose was to study the perinatal transmission of human papillomavirus DNA (HPV-DNA in 63 mother-newborn pairs, besides looking at the epidemiological factors involved in the viral DNA transmission. The following sampling methods were used: (1 in the pregnant woman, when was recruited, in cervix and clinical lesions of the vagina, vulva and perineal region; (2 in the newborn, (a buccal, axillary and inguinal regions; (b nasopharyngeal aspirate, and (c cord blood; (3 in the children, buccal was repeated in the 4th week and 6th and 12th month of life. HPV-DNA was identified using two methodologies: multiplex PCR (PGMY09 and MY11 primers and nested-PCR (genotypes 6/11, 16, 18, 31, 33, 42, 52 and 58. Perinatal transmission was considered when concordance was found in type-specific HPV between mother/newborn or mother/child. HPV-DNA genital was detected in 49 pregnant women submitted to delivery. Eleven newborns (22.4%, n = 11/49 were HPV-DNA positive. In 8 cases (16.3%, n = 8/49 there was type specific HPV concordance between mother/newborn samples. At the end of the first month of life three children (6.1%, n = 3/49 became HPV-DNA positive, while two remained positive from birth. In 3 cases (100%, n = 3/3 there was type specific HPV concordance between mother/newborn samples. In the 6th month, a child (2%, n = 1/49 had become HPV-DNA positive between the 1st and 6th month of life, and there was type specific HPV concordance of mother/newborn samples. All the HPV-DNA positive children (22.4%, n = 11/49 at birth and at the end first month of life (6.1%, n = 3/49 became HPV-DNA negative at the age of 6 months. The HPV-DNA positive child (2%, n = 1/49 from 1st to the 6th month of life became HPV-DNA negative between the 6th and 12th month of life and one child had anogenital warts. In the twelfth month all (100%, n = 49/49 the children studied were HPV-DNA negative. A positive and significant correlation was observed between perinatal

  5. Design of expanded bed supports for the recovery of plasmid DNA by anion exchange adsorption

    DEFF Research Database (Denmark)

    Theodossiou, Irini; Søndergaard, M.; Thomas, Owen R. T.

    2001-01-01

    In this study we detail the rational design of new chromatographic adsorbents tailored for the capture of plasmid DNA. Features present on current chromatographic supports that can significantly enhance plasmid binding capacity have been identified in packed bed chromatography experiments...... and blueprints for improved expanded bed adsorbents have been put forward. The characterisation and testing of small (20-40 mum) high density (>3.7 g cm(-3)) pellicular expanded bed materials functionalised with various anion exchange structures is presented. In studies with calf thymus DNA, dynamic binding...... capacities of 1.2 and 3.4 mg ml(-1) were recorded for prototype diethylaminoethyl-and polyethylene imine-linked adsorbents which were respectively 25 and 70 fold higher than those of equivalently derivatised commercial expanded bed materials. The prototype polyethylene imine-coupled material exhibited severe...

  6. Strand breaks in plasmid DNA following positional changes of Auger-electron-emitting radionuclides

    International Nuclear Information System (INIS)

    Adelstein, S.J.; Kassis, A.I.

    1996-01-01

    The purpose of our studies is to elucidate the kinetics of DNA strand breaks caused by low-energy Auger electron emitters in close proximity to DNA. Previously we have studied the DNA break yields in plasmids after the decay of indium-111 bound to DNA or free in solution. In this work, we compare the DNA break yields in supercoiled DNA of iodine-125 decaying close to DNA following DNA intercalation, minor-groove binding, or surface binding, and at a distance form DNA. Supercoiled DNA, stored at 4 C to accumulate radiation dose from the decay of 125 I, was then resolved by gel electrophoresis into supercoiled, nicked circular, and linear forms, representing undamaged DNA, single-strand breaks, and double-strand breaks respectively. DNA-intercalated or groove-bound 125 I is more effective than surface-bound radionuclide or 125 I free in solution. The hydroxyl radical scavenger DMSO protects against damage by 125 I free in solution but has minimal effect on damage by groove-bound 125 I. (orig.)

  7. Exponential Megapriming PCR (EMP) Cloning—Seamless DNA Insertion into Any Target Plasmid without Sequence Constraints

    Science.gov (United States)

    Ulrich, Alexander; Andersen, Kasper R.; Schwartz, Thomas U.

    2012-01-01

    We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts. PMID:23300917

  8. Exponential megapriming PCR (EMP cloning--seamless DNA insertion into any target plasmid without sequence constraints.

    Directory of Open Access Journals (Sweden)

    Alexander Ulrich

    Full Text Available We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts.

  9. Plasmid DNA loaded chitosan nanoparticles for nasal mucosal immunization against hepatitis B.

    Science.gov (United States)

    Khatri, Kapil; Goyal, Amit K; Gupta, Prem N; Mishra, Neeraj; Vyas, Suresh P

    2008-04-16

    This work investigates the preparation and in vivo efficacy of plasmid DNA loaded chitosan nanoparticles for nasal mucosal immunization against hepatitis B. Chitosan pDNA nanoparticles were prepared using a complex coacervation process. Prepared nanoparticles were characterized for size, shape, surface charge, plasmid loading and ability of nanoparticles to protect DNA against nuclease digestion and for their transfection efficacy. Nasal administration of nanoparticles resulted in serum anti-HBsAg titre that was less compared to that elicited by naked DNA and alum adsorbed HBsAg, but the mice were seroprotective within 2 weeks and the immunoglobulin level was above the clinically protective level. However, intramuscular administration of naked DNA and alum adsorbed HBsAg did not elicit sIgA titre in mucosal secretions that was induced by nasal immunization with chitosan nanoparticles. Similarly, cellular responses (cytokine levels) were poor in case of alum adsorbed HBsAg. Chitosan nanoparticles thus produced humoral (both systemic and mucosal) and cellular immune responses upon nasal administration. The study signifies the potential of chitosan nanoparticles as DNA vaccine carrier and adjuvant for effective immunization through non-invasive nasal route.

  10. Isolation/separation of plasmid DNA using hemoglobin modified magnetic nanocomposites as solid-phase adsorbent.

    Science.gov (United States)

    Chen, Xu-Wei; Mao, Quan-Xing; Liu, Jia-Wei; Wang, Jian-Hua

    2012-10-15

    Hemoglobin (Hb) modified magnetic nanocomposites are prepared by immobilization of Hb onto the surface of amino-functionalized Fe(3)O(4)@SiO(2) magnetic nanoparticles via covalent bonding with glutaraldehyde as cross-linker. The obtained nanocomposites are characterized with FT-IR, SEM, XRD and surface charge analysis. A direct solid-phase extraction procedure for the isolation/separation of plasmid DNA using this nanocomposite as a novel adsorbent is thus developed. Some important experimental parameters governing the sorption efficiency, i.e., the pH of sample solution and the ionic strength, are investigated. The Hb modified magnetic nanocomposites provide a sorption capacity of 27.86 mg g(-1) for DNA. By using 2.0mg of the nanocomposites as sorption medium and a suitable acidity of pH 6.1, a sorption efficiency of 93% is achieved for 25 μg mL(-1) of DNA in 1.0 mL of sample solution. Afterwards, the absorbed DNA could be readily recovered by using 1.0 mL of Tris-HCl buffer (pH 8.9, 0.01 mol L(-1)), giving rise to a recovery of ca. 68.3%. The present solid-phased extraction protocol is applied for the isolation of plasmid DNA from Escherichia coli culture, resulting in comparable yield and purity of plasmid DNA with respect to those obtained by using commercial kits. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. Chemical and biological consequences of the radioactive decay of iodine-125 in plasmid DNA

    International Nuclear Information System (INIS)

    Linz, U.

    1983-09-01

    The consequences of the decay of iodine-125 incorporated into DNA were studied on a molecular basis. Doubly ( 14 C and 125 I) labelled 5-iodo-2'-deoxycytidine 5'-triphosphate (IdCTP) was synthesized and incorporated enzymatically into the SalI-cutting site of the plasmid pBR 322. Part of the radioiodinated DNA was treated with T4-DNA ligase in order to restore the circular structure of the native plasmid molecule. After 4 months of storage under various conditions the stable end products were analyzed by radio GC, radio HPLC and electron microscopy. The experiments were not only carried out with doubly-labelled DNA but also with solutions of 14 C-labelled DNA containing Na 125 I as internal radiation source. The results clearly indicate that radiolysis alone causes only minor damage. Transmutation of the covalently bound iodine, on the other hand, leads to complete destruction of the labelled nucleotide, giving rise to 14 CO 2 and 14 CO as main products. The production of 14 CO 2 which originates from both the base as well as the sugar component shows a strong solvent effect. The electron microscopy analysis of the DNA reveals that the local effects are always connected with at least one double strand break directly at the site of decay. In addition, one finds DNA double strand breaks in areas which are hundreds of base pairs apart from that site. Under certain circumstances most of the DNA molecules exhibit up to 10 breaks. A comparison between ligase-treated and untreated DNA shows that the configuration of the DNA and the position of the labelled nucleotide play in important role in the extent of the overall damage. It could be demonstrated that there is a linear correlation between gaseous fragmentation products and the number of double strand breaks. (orig./MG) [de

  12. Isolation, Functional Characterization and Transmissibility of p3PS10, a Multidrug Resistance Plasmid of the Fish Pathogen Piscirickettsia salmonis

    Directory of Open Access Journals (Sweden)

    José Saavedra

    2018-05-01

    Full Text Available Antibiotic resistance is a major public health concern due to its association with the loss of efficacy of antimicrobial therapies. Horizontal transfer events may play a significant role in the dissemination of resistant bacterial phenotypes, being mobilizable plasmids a well-known mechanism. In this study, we aimed to gain insights into the genetics underlying the development of antibiotic resistance by Piscirickettsia salmonis isolates, a bacterial fish pathogen and causative agent of salmonid piscirickettsiosis, and the main target of antibiotics used in Chilean salmon farming. We provide experimental evidence that the plasmid p3PS10, which harbors multidrug resistance genes for chloramphenicol (cat2, tetracyclines [tet(31], aminoglycosides (sat1 and aadA1, and sulfonamides (sul2, is carried by a group of P. salmonis isolates exhibiting a markedly reduced susceptibility to oxytetracycline in vitro (128–256 μg/mL of minimal inhibitory concentration, MIC. Antibiotic susceptibility analysis extended to those antibiotics showed that MIC of chloramphenicol, streptomycin, and sulfamethoxazole/trimethoprim were high, but the MIC of florfenicol remained at the wild-type level. By means of molecular cloning, we demonstrate that those genes encoding putative resistance markers are indeed functional. Interestingly, mating assays clearly show that p3PS10 is able to be transferred into and replicate in different hosts, thereby conferring phenotypes similar to those found in the original host. According to epidemiological data, this strain is distributed across aquaculture settings in southern Chile and is likely to be responsible for oxytetracycline treatment failures. This work demonstrates that P. salmonis is more versatile than it was thought, capable of horizontally transferring DNA, and probably playing a role as a vector of resistance traits among the seawater bacterial population. However, the low transmission frequency of p3PS10 suggests a

  13. Replication of each copy of the yeast 2 micron DNA plasmid occurs during the S phase.

    Science.gov (United States)

    Zakian, V A; Brewer, B J; Fangman, W L

    1979-08-01

    Saccharomyces cerevisiae contains 50-100 copies per cell of a circular plasmid called 2 micron DNA. Replication of this DNA was studied in two ways. The distribution of replication events among 2 micron DNA molecules was examined by density transfer experiments with asynchronous cultures. The data show that 2 micron DNA replication is similar to chromosomal DNA replication: essentially all 2 micron duplexes were of hybrid density at one cell doubling after the density transfer, with the majority having one fully dense strand and one fully light strand. The results show that replication of 2 micron DNA occurs by a semiconservative mechanism where each of the plasmid molecules replicates once each cell cycle. 2 micron DNA is the only known example of a multiple-copy, extrachromosomal DNA in which every molecule replicates in each cell cycle. Quantitative analysis of the data indicates that 2 micron DNA replication is limited to a fraction of the cell cycle. The period in the cell cycle when 2 micron DNA replicates was examined directly with synchronous cell cultures. Synchronization was accomplished by sequentially arresting cells in G1 phase using the yeast pheromone alpha-factor and incubating at the restrictive temperature for a cell cycle (cdc 7) mutant. Replication was monitored by adding 3H-uracil to cells previously labeled with 14C-uracil, and determining the 3H/14C ratio for purified DNA species. 2 micron DNA replication did not occur during the G1 arrest periods. However, the population of 2 micron DNA doubled during the synchronous S phase at the permissive temperature, with most of the replication occurring in the first third of S phase. Our results indicate that a mechanism exists which insures that the origin of replication of each 2 micron DNA molecule is activated each S phase. As with chromosomal DNA, further activation is prevented until the next cell cycle. We propose that the mechanism which controls the replication initiation of each 2 micron DNA

  14. Very low-energy and low-fluence ion beam bombardment of naked plasmid DNA

    International Nuclear Information System (INIS)

    Norarat, R.; Semsang, N.; Anuntalabhochai, S.; Yu, L.D.

    2009-01-01

    Ion beam bombardment of biological organisms has been recently applied to mutation breeding of both agricultural and horticultural plants. In order to explore relevant mechanisms, this study employed low-energy ion beams to bombard naked plasmid DNA. The study aimed at simulation of the final stage of the process of the ion beam bombardment of real cells to check whether and how very low-energy and low-fluence of ions can induce mutation. Argon and nitrogen ions at 5 keV and 2.5 keV respectively bombarded naked plasmid DNA pGFP to very low-fluences, an order of 10 13 ions/cm 2 . Subsequently, DNA states were analyzed using electrophoresis. Results provided evidences that the very low-energy and low-fluence ion bombardment indeed altered the DNA structure from supercoil to short linear fragments through multiple double strand breaks and thus induced mutation, which was confirmed by transfer of the bombarded DNA into bacteria Escherichia coli and subsequent expression of the marker gene.

  15. Antibacterial effect of cationic porphyrazines and anionic phthalocyanine and their interaction with plasmid DNA

    Science.gov (United States)

    Hassani, Leila; Hakimian, Fatemeh; Safaei, Elham; Fazeli, Zahra

    2013-11-01

    Resistance to antibiotics is a public health issue and identification of new antibacterial agents is one of the most important goals of pharmacological research. Among the novel developed antibacterial agents, porphyrin complexes and their derivatives are ideal candidates for use in medical applications. Phthalocyanines differ from porphyrins by having nitrogen atoms link the individual pyrrol units. The aza analogues of the phthalocyanines (azaPcs) such as tetramethylmetalloporphyrazines are heterocyclic Pc analogues. In this investigation, interaction of an anionic phthalocyanine (Cu(PcTs)) and two cationic tetrapyridinoporphyrazines including [Cu(2,3-tmtppa)]4+ and [Cu(3,4-tmtppa)]4+ complexes with plasmid DNA was studied using spectroscopic and gel electrophoresis methods. In addition, antibacterial effect of the complexes against Gram-positive (Staphylococcus aureus) and Gram-negative (Escherichia coli) bacteria was investigated using dilution test method. The results indicated that both porphyrazines have significant antibacterial properties, but Cu(PcTs) has weak antibacterial effect. Compairing the binding of the phthalocyanine and the porphyrazines to DNA demonstrated that the interaction of cationic porphyrazines is stronger than the anionic phthalocyanine remarkably. The extent of hypochromicity and red shift of absorption spectra indicated preferential intercalation of the two porphyrazine into the base pairs of DNA helix. Gel electrophoresis result implied Cu(2,3-tmtppa) and Cu(3,4-tmtppa) are able to perform cleavage of the plasmid DNA. Consequently, DNA binding and cleavage might be one of the antibacterial mechanisms of the complexes.

  16. Lipofection of plasmid DNA into human mast cell lines using lipid nanoparticles generated by microfluidic mixing.

    Science.gov (United States)

    Duguay, Brett A; Huang, Kate Wei-Chen; Kulka, Marianna

    2018-04-18

    Mast cells are important immune cells that have significant roles in mediating allergy and asthma. Therefore, studying the molecular mechanisms regulating these and other processes in mast cells is important to elucidate. Methods such as lipofection, transduction, and electroporation are often employed to dissect these mechanisms by disrupting gene expression in mast cell lines. However, as with other leukocytes, human mast cells (HMCs) are often refractory to the delivery of plasmids by lipofection. In this study, we investigated the utility of lipid nanoparticles (LNPs) containing the ionizable cationic lipids 1,2-dioleoyloxy-3-dimethylaminopropane, 1,2-dioleyloxy-3-dimethylaminopropane, or 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane for the delivery of plasmid DNA into HMC lines. Herein, we demonstrate for the first time the use of LNPs to achieve significant and reproducible levels of plasmid DNA transfection in HMC-1.2 and laboratory of allergic diseases 2 (LAD2) cells. These levels reached 53.2% and 16.0% in HMC-1.2 and LAD2 cells, respectively; and outperformed Lipofectamine 3000 in both cases. Moreover, cell viability in the transfected cells remained above 65% for all LNP conditions tested. Together, these observations illustrate the efficacy of this technique for mast cell researchers and further support the use of LNPs for nucleic acid delivery into leukocytes. ©2018 Society for Leukocyte Biology.

  17. Gene Transfer into the Lung by Nanoparticle Dextran-Spermine/Plasmid DNA Complexes

    Directory of Open Access Journals (Sweden)

    Syahril Abdullah

    2010-01-01

    Full Text Available A novel cationic polymer, dextran-spermine (D-SPM, has been found to mediate gene expression in a wide variety of cell lines and in vivo through systemic delivery. Here, we extended the observations by determining the optimal conditions for gene expression of D-SPM/plasmid DNA (D-SPM/pDNA in cell lines and in the lungs of BALB/c mice via instillation delivery. In vitro studies showed that D-SPM could partially protect pDNA from degradation by nuclease and exhibited optimal gene transfer efficiency at D-SPM to pDNA weight-mixing ratio of 12. In the lungs of mice, the levels of gene expression generated by D-SPM/pDNA are highly dependent on the weight-mixing ratio of D-SPM to pDNA, amount of pDNA in the complex, and the assay time postdelivery. Readministration of the complex at day 1 following the first dosing showed no significant effect on the retention and duration of gene expression. The study also showed that there was a clear trend of increasing size of the complexes as the amount of pDNA was increased, where the sizes of the D-SPM/pDNA complexes were within the nanometer range.

  18. Initiation and termination of the bacteriophage phi X174 rolling circle DNA replication in vivo: packaging of plasmid single-stranded DNA into bacteriophage phi X174 coats

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; Weisbeek, P. J.

    1982-01-01

    The bacteriophage phi X174 viral (+) origin when inserted in a plasmid can interact in vivo with the A protein produced by infecting phi X174 phages. A consequence of this interaction is packaging of single-stranded plasmid DNA into preformed phage coats resulting in infective particles (1). This

  19. Electrophoresis examination of strand breaks in plasmid DNA induced by low-energy nitrogen ion irradiation

    International Nuclear Information System (INIS)

    Zhao Yong; Tan Zheng; Du Yanhua; Qiu Guanying

    2003-01-01

    To study the effect on plasmid DNA of heavy ion in the energy range of keV where nuclear stopping interaction becomes more important or even predominant, thin film of plasmid pGEM-3Zf(-) DNA was prepared on aluminum surface and irradiated in vacuum ( -3 Pa) by low-energy nitrogen ions with energy of 30 keV (LET=285 keV/μm) at various fluence ranging from 2 x 10 10 to 8.2 x 10 13 ions/cm 2 . DNA strand breaks were analyzed by neutral electrophoresis followed by quantification with image analysis software. Low-energy nitrogen ion irradiation induced single-, double- and multiple double-strand breaks (DSB) and multiple DSB as the dominating form of DNA damages. Moreover, the linear fluence-response relationship at a low fluence range suggests that DSBs are induced predominantly by single ion track. However, strand break production is limited to a short range in the irradiated samples

  20. Effects of 32 P incorporated in plasmid DNA: strand breaks and mutagenesis

    International Nuclear Information System (INIS)

    Fonseca, Adenilson de S. da; Felzenszwalb, Israel

    1996-01-01

    In order to study the 32 P decay effects in DNA, bacterial plasmid were labeled with different activities of the radioisotope in vivo: 1,2 and 6 x 10 5 Bk/ml of bacterial culture, leading to 1,2 and 6 x 10 3 Bk/μg of nucleic acid or in vitro: 0.7, 1.5 and 3.5 x 10 3 Bk/μg of nucleic acid, stored at -20 deg C and its electroforetic profiles, transformation capacity of wild type and DNA repair. E. coli mutants cells and mutagenesis, were followed during three months. The results achieved in this work suggest that: the decay of the incorporated 32 P in vivo is able to change the pBR322 electroforetic profile, we detected a decrease on the form III (super coiled) and increase on the form II (circular), indicating single strands breaks; the decay incorporated 32 in vitro does not modify the electrophoretic profile of pBR322, suggesting that in some way the effects of the radioactive decay of incorporated 32 P is dependent of the DNA topology, the damages induced by 32 P decay increase mutation frequency in pAC189 plasmids. MRF is increased by a factor of three after 6 t 1/2 of storage, indicating direct or indirect action through mismatch DNA repair pathway. (author)

  1. Use of Ti plasmid DNA probes for determining tumorigenicity of agrobacterium strains

    International Nuclear Information System (INIS)

    Burr, T.J.; Norelli, J.L.; Katz, B.H.; Bishop, A.L.

    1990-01-01

    Probes consisting of T-DNA genes from the Ti plasmid of Agrobacterium tumefaciens were used for determining tumorigenicity of strains. Two 32 P-labeled probes hybridized with 28 of 28 tumorigenic strains of the pathogen but not with 20 of 22 nontumorigenic strains. One probe, pTHE17, consists of all but the far left portion of the T-DNA of strain C58. Probe SmaI7 consists of SmaI fragment 7 of pTiC58, including onc genes 1, 4, and 6a and most of 2. Another probe, pAL4044, consisting of the vir region of strain Ach-5, hybridized with several nontumorigenic as well as tumorigenic strains. Colony hybridizations were done with 28 tumorigenic and 22 nontumorigenic Agrobacterium strains. About 10 6 CFU of the different tumorigenic strains were detectable with this method. Southern analyses confirmed the presence or absence of Ti plasmids in strains for which tumorigenicity was questioned. Colony hybridization with the T-DNA probes provides a rapid and sensitive means for determining the tumorigenic nature of Agrobacterium strains

  2. Genotoxic activity of 4,4',5'-trimethylazapsoralen on plasmid DNA.

    Science.gov (United States)

    Lagatolla, C; Dolzani, L; Granzotto, M; Monti-Bragadin, C

    1998-01-01

    The genotoxic activities of 8-methoxypsoralen (8-MOP) and 4,4',5'-trimethylazapsoralen (4,4',5'-TMAP) on plasmid DNA have been compared. In a previous work, 4,4',5'-TMAP, a methyl derivative of a psoralen isoster, had shown potential photochemotherapeutic activity. The mutagenic activity of mono- and bifunctional lesions caused by these compounds was evaluated both after UVA irradiation, which causes the formation of both kinds of lesions, and after a two-step irradiation procedure of the psoralen-plasmid DNA complex, which allowed monoadducts and interstrand crosslinks to be studied separately. Furthermore, we used a procedure that allowed us to evaluate both the mutagenic and recombinogenic activity of the two compounds. Results indicate that the most important difference between 8-MOP and 4,4',5'-TMAP consists in their mode of photoreaction with DNA rather than in their mutagenic potential. In fact, in all of the experimental procedures, 4,4',5'-TMAP shows a lower ability than 8-MOP to generate interstrand crosslinks. However, when comparable toxicity levels are reached, the two compounds show the same mutagenic potentiality.

  3. Aqueous extract of Pinus caribaea inhibits the damage induced by ultraviolet radiations, in plasmid DNA

    Directory of Open Access Journals (Sweden)

    Marioly Vernhes Tamayo

    2017-08-01

    Full Text Available Context: The incidence of solar ultraviolet radiation (UV on Earth has increased due to diminish of the ozone layer. This enviromental agent is highly genotoxic causing numerous damage in DNA molecule. Nowadays there is a growing interest in the search of compounds capable to minimize these effects. In particular, phytocompounds have been tested as excelent candidates for their antigenotoxic properties. Aims: To evaluate the protective effect of the aqueous extract of Pinus caribaea (EPC against the damage induced by the UVB and UVC radiation. Methods: The cell-free plasmid DNA assay was employed. The forms of plasmid were separated electrophoretically in agarose gel. For genotoxic and photoprotective evaluation of P. caribaea, different concentrations of the extract (0.1 – 2.0 mg/mL and exposure times were evaluated. The CPD lesions were detected enzymatically. Additionally, the transmittance of the aqueous extract against 254 nm and 312 nm was measured. Results: None of the concentrations were genotoxic in 30 min of treatment, for superior times a clastogenic effect was observed. The EPC despite inhibiting the activity of the enzyme T4 endo V, impedes photolesions formation in DNA at concentrations ≥ 0.1 mg/mL. Conclusions: The EPC has photoprotective properties, this effect could be related with its antioxidants and absorptives capacities.

  4. Effect of thiol pendant conjugates on plasmid DNA binding, release, and stability of polymeric delivery vectors.

    Science.gov (United States)

    Bacalocostantis, Irene; Mane, Viraj P; Kang, Michael S; Goodley, Addison S; Muro, Silvia; Kofinas, Peter

    2012-05-14

    Polymers have attracted much attention as potential gene delivery vectors due to their chemical and structural versatility. However, several challenges associated with polymeric carriers, including low transfection efficiencies, insufficient cargo release, and high cytotoxicity levels have prevented clinical implementation. Strong electrostatic interactions between polymeric carriers and DNA cargo can prohibit complete cargo release within the cell. As a result, cargo DNA never reaches the cell's nucleus where gene expression takes place. In addition, highly charged cationic polymers have been correlated with high cytotoxicity levels, making them unsuitable carriers in vivo. Using poly(allylamine) (PAA) as a model, we investigated how pH-sensitive disulfide cross-linked polymer networks can improve the delivery potential of cationic polymer carriers. To accomplish this, we conjugated thiol-terminated pendant chains onto the primary amines of PAA using 2-iminothiolane, developing three new polymer vectors with 5, 13, or 20% thiol modification. Unmodified PAA and thiol-conjugated polymers were tested for their ability to bind and release plasmid DNA, their capacity to protect genetic cargo from enzymatic degradation, and their potential for endolysosomal escape. Our results demonstrate that polymer-plasmid complexes (polyplexes) formed by the 13% thiolated polymer demonstrate the greatest delivery potential. At high N/P ratios, all thiolated polymers (but not unmodified counterparts) were able to resist decomplexation in the presence of heparin, a negatively charged polysaccharide used to mimic in vivo polyplex-protein interactions. Further, all thiolated polymers exhibited higher buffering capacities than unmodified PAA and, therefore, have a greater potential for endolysosomal escape. However, 5 and 20% thiolated polymers exhibited poor DNA binding-release kinetics, making them unsuitable carriers for gene delivery. The 13% thiolated polymers, on the other hand

  5. Photolysis of phosphodiester bonds in plasmid DNA by high intensity UV laser irradiation

    International Nuclear Information System (INIS)

    Croke, D.T.; Blau, Werner; OhUigin, Colm; Kelly, J.M.; McConnell, D.J.

    1988-01-01

    The cleavage of phosphodiester bonds in DNA exposed to high intensity UV laser pulses in aerated aqueous solution has been investigated using a krypton fluoride excimer laser (248 nm) and bacterial plasmid DNA. The dependence of strand breakage on fluence and intensity has been studied in detail and shows that the process is non-linear with respect to intensity. The relationship between the quantum yield for strand breakage and intensity shows that the strand breakage reaction involves two-photon excitation of DNA bases. The quantum yield rises with intensity from a lower value of 7 x 10 -5 until a maximum value of 4.5 x 10 -4 is attained at intensities of 10 11 W m -2 and above. This value is approximately fifty-fold higher than the quantum yield for strand breakage induced by exposure to low density UV irradiation (254 nm, 12 W m -2 ). DNA sequencing experiments have shown that strand breakage occurs by the specific cleavage of the phosphodiester bond which lies immediately 3' to guanine residues in the DNA, leaving some alkali-labile remnant attached to the terminal phosphate. A mechanism for DNA strand breakage which involves the generation of guanine radical cations is proposed. (author)

  6. Effective plasmid DNA and small interfering RNA delivery to diseased human brain microvascular endothelial cells.

    Science.gov (United States)

    Slanina, H; Schmutzler, M; Christodoulides, M; Kim, K S; Schubert-Unkmeir, A

    2012-01-01

    Expression of exogenous DNA or small interfering RNA (siRNA) in vitro is significantly affected by the particular delivery system utilized. In this study, we evaluated the transfection efficiency of plasmid DNA and siRNA into human brain microvascular endothelial cells (HBMEC) and meningioma cells, which constitute the blood-cerebrospinal fluid barrier, a target of meningitis-causing pathogens. Chemical transfection methods and various lipofection reagents including Lipofectamin™, FuGene™, or jetPRIME®, as well as physical transfection methods and electroporation techniques were applied. To monitor the transfection efficiencies, HBMEC and meningioma cells were transfected with the reporter plasmid pTagGFP2-actin vector, and efficiency of transfection was estimated by fluorescence microscopy and flow cytometry. We established protocols based on electroporation using Cell Line Nucleofector® Kit V with the Amaxa® Nucleofector® II system from Lonza and the Neon® Transfection system from Invitrogen resulting in up to 41 and 82% green fluorescent protein-positive HBMEC, respectively. Optimal transfection solutions, pulse programs and length were evaluated. We furthermore demonstrated that lipofection is an efficient method to transfect meningioma cells with a transfection efficiency of about 81%. Finally, we applied the successful electroporation protocols to deliver synthetic siRNA to HBMEC and analyzed the role of the actin-binding protein cortactin in Neisseria meningitidis pathogenesis. Copyright © 2012 S. Karger AG, Basel.

  7. Plasmid DNA initiates replication of yellow fever vaccine in vitro and elicits virus-specific immune response in mice

    International Nuclear Information System (INIS)

    Tretyakova, Irina; Nickols, Brian; Hidajat, Rachmat; Jokinen, Jenny; Lukashevich, Igor S.; Pushko, Peter

    2014-01-01

    Yellow fever (YF) causes an acute hemorrhagic fever disease in tropical Africa and Latin America. To develop a novel experimental YF vaccine, we applied iDNA infectious clone technology. The iDNA represents plasmid that encodes the full-length RNA genome of 17D vaccine downstream from a cytomegalovirus (CMV) promoter. The vaccine was designed to transcribe the full-length viral RNA and to launch 17D vaccine virus in vitro and in vivo. Transfection with 10 ng of iDNA plasmid was sufficient to start replication of vaccine virus in vitro. Safety of the parental 17D and iDNA-derived 17D viruses was confirmed in AG129 mice deficient in receptors for IFN-α/β/γ. Finally, direct vaccination of BALB/c mice with a single 20 μg dose of iDNA plasmid resulted in seroconversion and elicitation of virus-specific neutralizing antibodies in animals. We conclude that iDNA immunization approach combines characteristics of DNA and attenuated vaccines and represents a promising vaccination strategy for YF. - Highlights: • The iDNA ® platform combines advantages of DNA and live attenuated vaccines. • Yellow fever (YF) 17D vaccine was launched from iDNA plasmid in vitro and in vivo. • Safety of iDNA-generated 17D virus was confirmed in AG129 mice. • BALB/c mice seroconverted after a single-dose vaccination with iDNA. • YF virus-neutralizing response was elicited in iDNA-vaccinated mice

  8. Plasmid DNA initiates replication of yellow fever vaccine in vitro and elicits virus-specific immune response in mice

    Energy Technology Data Exchange (ETDEWEB)

    Tretyakova, Irina; Nickols, Brian; Hidajat, Rachmat [Medigen, Inc., 8420 Gas House Pike, Suite S, Frederick, MD 21701 (United States); Jokinen, Jenny; Lukashevich, Igor S. [Department of Pharmacology and Toxicology, School of Medicine, Center for Predictive Medicine and Emerging Infectious Diseases, University of Louisville, Louisville, KY (United States); Pushko, Peter, E-mail: ppushko@medigen-usa.com [Medigen, Inc., 8420 Gas House Pike, Suite S, Frederick, MD 21701 (United States)

    2014-11-15

    Yellow fever (YF) causes an acute hemorrhagic fever disease in tropical Africa and Latin America. To develop a novel experimental YF vaccine, we applied iDNA infectious clone technology. The iDNA represents plasmid that encodes the full-length RNA genome of 17D vaccine downstream from a cytomegalovirus (CMV) promoter. The vaccine was designed to transcribe the full-length viral RNA and to launch 17D vaccine virus in vitro and in vivo. Transfection with 10 ng of iDNA plasmid was sufficient to start replication of vaccine virus in vitro. Safety of the parental 17D and iDNA-derived 17D viruses was confirmed in AG129 mice deficient in receptors for IFN-α/β/γ. Finally, direct vaccination of BALB/c mice with a single 20 μg dose of iDNA plasmid resulted in seroconversion and elicitation of virus-specific neutralizing antibodies in animals. We conclude that iDNA immunization approach combines characteristics of DNA and attenuated vaccines and represents a promising vaccination strategy for YF. - Highlights: • The iDNA{sup ®} platform combines advantages of DNA and live attenuated vaccines. • Yellow fever (YF) 17D vaccine was launched from iDNA plasmid in vitro and in vivo. • Safety of iDNA-generated 17D virus was confirmed in AG129 mice. • BALB/c mice seroconverted after a single-dose vaccination with iDNA. • YF virus-neutralizing response was elicited in iDNA-vaccinated mice.

  9. Construction and confirmation of the plasmid of human mitochondrial DNA 4977 bp deletion induced by ionizing radiation

    International Nuclear Information System (INIS)

    Chen Xiaosui; Zhou Lijun; Wang Yuxiao; Qu Jia; Feng Jiangbing; Lu Xue; Chen Deqing; Liu Qingjie

    2006-01-01

    Objective: To construct a stable plasmid that spanning deleted human mitochondrial DNA (mtDNA) 4977 bp induced by ionizing radiation and another one for control DNA fragment, in order to use in the human mitochondrial genome study in the future. Methods: The peripheral blood, which had no mtDNA 4977 bp deletion found in previous study, was exposed to 10 Gy 60 Co γ-rays in vitro. The total cell DNA was extracted and PCR was carried out: a nest-PCR of three-round PCR was used for the mtDNA 4977 bp deletion and one- round regular PCR was used for the control ND1 gene. The PCR products were used for transfection by electroporation and the positive clones were obtained after screening. The plasmid DNA was isolated and sequenced after enzymatic digestion and purification. The sequence result was BLASTed with the human mitochondrial genome. Results: The sizes of PCR products for the flanked 4977 bp deletion and the ND1 gene were similar with those predicted according to GeneBank. The sequences for the positive clones were above 99 per cent homologous with the human mitochondrial genome after BLASTed. Conclusion: The plasmids for deleted human mtDNA 4977 bp and control DNA fragment have been constructed successfully, and they could be used in the quality and quantity studies on human mtDNA 4977 bp deletion. (authors)

  10. Plasmid DNA transfection using magnetite cationic liposomes for construction of multilayered gene-engineered cell sheet.

    Science.gov (United States)

    Ino, Kosuke; Kawasumi, Tamayo; Ito, Akira; Honda, Hiroyuki

    2008-05-01

    Modification of cellular functions by overexpression of genes is being increasingly practiced for tissue engineering. In the present study, we investigated whether transfection efficiency could be enhanced by magnetofection that involves the use of plasmid DNA (pDNA)/magnetite cationic liposomes (MCLs) complexes (pDNA/MCL) and magnetic force. The transfection efficiencies of the magnetofection technique by pDNA/MCL in fibroblasts and keratinocytes using reporter genes were 36- and 10-fold higher, respectively, than those of a lipofection technique by cationic liposomes. Moreover, in vitro construction of three-dimensional (3D) tissues is an important challenge. We recently proposed a novel technique termed "magnetic force-based tissue engineering" (Mag-TE) to produce 3D tissues. Since the fibroblasts after magnetofection incorporated both magnetite nanoparticles and pDNA, we investigated whether multilayered heterotypic cell sheets expressing transgene could be fabricated by Mag-TE. First, the fibroblasts were seeded onto an ultra-low attachment culture plate. When a magnet was placed under the plate, the cells accumulated at the bottom of the culture plate. After 24 h of culture, the transgene-expressing cells formed a multilayered cell sheet-like structure. These results indicated that MCLs are a potent biomanipulation tool for both gene transfer and 3D tissue construction, suggesting that these techniques are useful for tissue engineering. Copyright 2007 Wiley Periodicals, Inc.

  11. Dual recombinant Lactococcus lactis for enhanced delivery of DNA vaccine reporter plasmid pPERDBY.

    Science.gov (United States)

    Yagnik, Bhrugu; Sharma, Drashya; Padh, Harish; Desai, Priti

    2017-04-01

    Food grade Lactococcus lactis has been widely used as an antigen and DNA delivery vehicle. We have previously reported the use of non-invasive L. lactis to deliver the newly constructed immunostimulatory DNA vaccine reporter plasmid, pPERDBY. In the present report, construction of dual recombinant L. lactis expressing internalin A of Listeria monocytogenes and harboring pPERDBY (LL InlA + pPERDBY) to enhance the efficiency of delivery of DNA by L. lactis is outlined. After confirmation and validation of LL InlA + pPERDBY, its DNA delivery potential was compared with previously developed non-invasive r- L. lactis::pPERDBY. The use of invasive L. lactis resulted in around threefold increases in the number of enhanced green fluorescent protein-expressing Caco-2 cells. These findings reinforce the prospective application of invasive strain of L. lactis for delivery of DNA/RNA and antigens. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

  12. Photoresponsive Bridged Silsesquioxane Nanoparticles with Tunable Morphology for Light-Triggered Plasmid DNA Delivery

    KAUST Repository

    Fatieiev, Yevhen; Croissant, Jonas G.; Alsaiari, Shahad K.; Moosa, Basem; Anjum, Dalaver H.; Khashab, Niveen M.

    2015-01-01

    Bridged silsesquioxane nanocomposites with tunable morphologies incorporating o-nitrophenylene-ammonium bridges are described. The systematic screening of the sol-gel parameters allowed the material to reach the nanoscale –unlike most reported bridged silsesquioxane materials– with controlled dense and hollow structures of 100 to 200 nm. The hybrid composition of silsesquioxanes with 50% of organic content homogenously distributed in the nanomaterials endowed them with photoresponsive properties. Light irradiation was performed to reverse the surface charge of nanoparticles from +46 to -39 mV via the photoreaction of the organic fragments within the particles, as confirmed by spectroscopic monitorings. Furthermore, such NPs were ap-plied for the first time for the on-demand delivery of plasmid DNA in HeLa cancer cells via light actuation.

  13. Photoresponsive Bridged Silsesquioxane Nanoparticles with Tunable Morphology for Light-Triggered Plasmid DNA Delivery

    KAUST Repository

    Fatieiev, Yevhen

    2015-09-25

    Bridged silsesquioxane nanocomposites with tunable morphologies incorporating o-nitrophenylene-ammonium bridges are described. The systematic screening of the sol-gel parameters allowed the material to reach the nanoscale –unlike most reported bridged silsesquioxane materials– with controlled dense and hollow structures of 100 to 200 nm. The hybrid composition of silsesquioxanes with 50% of organic content homogenously distributed in the nanomaterials endowed them with photoresponsive properties. Light irradiation was performed to reverse the surface charge of nanoparticles from +46 to -39 mV via the photoreaction of the organic fragments within the particles, as confirmed by spectroscopic monitorings. Furthermore, such NPs were ap-plied for the first time for the on-demand delivery of plasmid DNA in HeLa cancer cells via light actuation.

  14. DNA sequence analysis of plasmids from multidrug resistant Salmonella enterica serotype Heidelberg isolates.

    Directory of Open Access Journals (Sweden)

    Jing Han

    Full Text Available Salmonella enterica serovar Heidelberg is among the most detected serovars in swine and poultry, ranks among the top five serotypes associated with human salmonellosis and is disproportionately associated with invasive infections and mortality in humans. Salmonella are known to carry plasmids associated with antimicrobial resistance and virulence. To identify plasmid-associated genes in multidrug resistant S. enterica serovar Heidelberg, antimicrobial resistance plasmids from five isolates were sequenced using the 454 LifeSciences pyrosequencing technology. Four of the isolates contained incompatibility group (Inc A/C multidrug resistance plasmids harboring at least eight antimicrobial resistance genes. Each of these strains also carried a second resistance plasmid including two IncFIB, an IncHI2 and a plasmid lacking an identified Inc group. The fifth isolate contained an IncI1 plasmid, encoding resistance to gentamicin, streptomycin and sulfonamides. Some of the IncA/C plasmids lacked the full concert of transfer genes and yet were able to be conjugally transferred, likely due to the transfer genes carried on the companion plasmids in the strains. Several non-IncA/C resistance plasmids also carried putative virulence genes. When the sequences were compared to previously sequenced plasmids, it was found that while all plasmids demonstrated some similarity to other plasmids, they were unique, often due to differences in mobile genetic elements in the plasmids. Our study suggests that Salmonella Heidelberg isolates harbor plasmids that co-select for antimicrobial resistance and virulence, along with genes that can mediate the transfer of plasmids within and among other bacterial isolates. Prevalence of such plasmids can complicate efforts to control the spread of S. enterica serovar Heidelberg in food animal and human populations.

  15. A combined approach of hollow microneedles and nanocarriers for skin immunization with plasmid DNA encoding ovalbumin

    Directory of Open Access Journals (Sweden)

    Pamornpathomkul B

    2017-01-01

    Full Text Available Boonnada Pamornpathomkul,1 Adisak Wongkajornsilp,2 Wanida Laiwattanapaisal,3 Theerasak Rojanarata,1 Praneet Opanasopit,1 Tanasait Ngawhirunpat1 1Department of Pharmaceutical Technology, Faculty of Pharmacy, Pharmaceutical Development of Green Innovations Group, Silpakorn University, Nakhon Pathom, 2Department of Pharmacology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, 3Department of Clinical Chemistry, Faculty of Allied Health Sciences, Chulalongkorn University, Bangkok, Thailand Abstract: The aim of this study was to investigate the use of different types of microneedles (MNs and nanocarriers for in vitro skin permeation and in vivo immunization of plasmid DNA encoding ovalbumin (pOVA. In vitro skin permeation studies indicated that hollow MNs had a superior enhancing effect on skin permeation compared with solid MN patches, electroporation (EP patches, the combination of MN and EP patches, and untreated skin. Upon using hollow MNs combined with nanocarriers for pOVA delivery, the skin permeation was higher than for the delivery of naked pOVA, as evidenced by the increased amount of pOVA in Franz diffusion cells and immunoglobulin G (IgG antibody responses. When the hollow MNs were used for the delivery of nanocarrier:pOVA complexes into the skin of mice, they induced a stronger IgG immune response than conventional subcutaneous (SC injections. In addition, immunization of mice with the hollow MNs did not induce signs of skin infection or pinpoint bleeding. Accordingly, the hollow MNs combined with a nanocarrier delivery system is a promising approach for delivering pOVA complexes to the skin for promoting successful immunization. Keywords: hollow microneedle, solid microneedle, electroporation, plasmid DNA encoding ovalbumin, skin immunization, nanocarrier

  16. Plasmid DNA is released from nanosized acicular material surface by low molecular weight oligonucleotides: exogenous plasmid acquisition mechanism for penetration intermediates based on the Yoshida effect.

    Science.gov (United States)

    Yoshida, N; Ide, K

    2008-10-01

    When a colloidal solution consisting of nanosized acicular material and bacterial cells is stimulated with sliding friction at the interface between the hydrogel and interface-forming material where the frictional coefficient increases rapidly, the nanosized acicular material accompanying the bacterial cells forms a penetration intermediate. This effect is known as the Yoshida effect in honor of its discoverer. Through the Yoshida effect, a novel property in which penetration intermediates incorporate exogenous plasmid DNA has been identified. This report proposes a possible mechanism for exogenous plasmid acquisition by penetration intermediates in the Yoshida effect. Escherichia coli cells, pUC18, and chrysotile were used as recipient cells, plasmid DNA, and nanosized acicular material, respectively. Even when repeatedly washing the mixture consisting of pUC18 and chrysotile, transformation efficiency by pUC18 was stable. Accordingly, pUC18 adsorbed onto chrysotile was introduced into recipient E. coli cells. At saturation, the amount of pUC18 adsorbed onto chrysotile was 0.8-1.2 microg/mg. To investigate whether pUC18 adsorbed on chrysotile is replicated by polymerase, polymerase chain reaction (PCR) was carried out with the chrysotile. Amplification of the beta-lactamase gene coded in pUC18, which was adsorbed onto chrysotile, was strongly inhibited. This suggests that DNA adsorbed onto chrysotile is not replicated in vivo. When we searched for substances to release pUC18 adsorbed onto chrysotile, we found that a 300-bp single- or double-stranded segment of DNA releases pUC18 from chrysotile. Competitive adsorption onto chrysotile between double-stranded DNA and pUC18 was then examined through the Yoshida effect. The 310- and 603-bp double-stranded nucleotides caused 50% competitive inhibition at the same molar ratio with pUC18. Hence, the adsorbed region of pUC18 is about 300 bp in length. As the culture period for recipient cells increases, transformation

  17. Plasmid DNA initiates replication of yellow fever vaccine in vitro and elicits virus-specific immune response in mice.

    Science.gov (United States)

    Tretyakova, Irina; Nickols, Brian; Hidajat, Rachmat; Jokinen, Jenny; Lukashevich, Igor S; Pushko, Peter

    2014-11-01

    Yellow fever (YF) causes an acute hemorrhagic fever disease in tropical Africa and Latin America. To develop a novel experimental YF vaccine, we applied iDNA infectious clone technology. The iDNA represents plasmid that encodes the full-length RNA genome of 17D vaccine downstream from a cytomegalovirus (CMV) promoter. The vaccine was designed to transcribe the full-length viral RNA and to launch 17D vaccine virus in vitro and in vivo. Transfection with 10 ng of iDNA plasmid was sufficient to start replication of vaccine virus in vitro. Safety of the parental 17D and iDNA-derived 17D viruses was confirmed in AG129 mice deficient in receptors for IFN-α/β/γ. Finally, direct vaccination of BALB/c mice with a single 20 μg dose of iDNA plasmid resulted in seroconversion and elicitation of virus-specific neutralizing antibodies in animals. We conclude that iDNA immunization approach combines characteristics of DNA and attenuated vaccines and represents a promising vaccination strategy for YF. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. [Effect of endonuclease G depletion on plasmid DNA uptake and levels of homologous recombination in hela cells].

    Science.gov (United States)

    Misic, V; El-Mogy, M; Geng, S; Haj-Ahmad, Y

    2016-01-01

    Endonuclease G (EndoG) is a mitochondrial apoptosis regulator that also has roles outside of programmed cell death. It has been implicated as a defence DNase involved in the degradation of exogenous DNA after transfection of mammalian cells and in homologous recombination of viral and endogenous DNA. In this study, we looked at the effect of EndoG depletion on plasmid DNA uptake and the levels of homologous recombination in HeLa cells. We show that the proposed defence role of EndoG against uptake of non-viral DNA vectors does not extend to the cervical carcinoma HeLa cells, as targeting of EndoG expression by RNA interference failed to increase intracellular plasmid DNA levels. However, reducing EndoG levels in HeLa cells resulted in a statistically significant reduction of homologous recombination between two plasmid DNA substrates. These findings suggest that non-viral DNA vectors are also substrates for EndoG in its role in homologous recombination.

  19. Process optimisation for anion exchange monolithic chromatography of 4.2kbp plasmid vaccine (pcDNA3F).

    Science.gov (United States)

    Ongkudon, Clarence M; Danquah, Michael K

    2010-10-15

    Anion exchange monolithic chromatography is increasingly becoming a prominent tool for plasmid DNA purification but no generic protocol is available to purify all types of plasmid DNA. In this work, we established a simple framework and used it to specifically purify a plasmid DNA model from a clarified alkaline-lysed plasmid-containing cell lysate. The framework involved optimising ligand functionalisation temperature (30-80°C), mobile phase flow rate (0.1-1.8mL/min), monolith pore size (done by changing the porogen content in the polymerisation reaction by 50-80%), buffer pH (6-10), ionic strength of binding buffer (0.3-0.7M) and buffer gradient elution slope (1-10% buffer B/min). We concluded that preferential pcDNA3F adsorption and optimum resolution could be achieved within the tested conditions by loading the clarified cell lysate into 400nm pore size of monolith in 0.7M NaCl (pH 6) of binding buffer followed by increasing the NaCl concentration to 1.0M at 3%B/min. Copyright © 2010 Elsevier B.V. All rights reserved.

  20. Putative DNA-dependent RNA polymerase in Mitochondrial Plasmid of Paramecium caudatum Stock GT704

    Directory of Open Access Journals (Sweden)

    Trina Ekawati Tallei

    2015-10-01

    Full Text Available Mitochondria of Paramecium caudatum stock GT704 has a set of four kinds of linear plasmids with sizes of 8.2, 4.1, 2.8 and 1.4 kb. The plasmids of 8.2 and 2.8 kb exist as dimers consisting of 4.1- and 1.4-kb monomers, respectively. The plasmid 2.8 kb, designated as pGT704-2.8, contains an open reading frame encodes for putative DNA-dependent RNA polymerase (RNAP. This study reveals that this RNAP belongs to superfamily of DNA/RNA polymerase and family of T7/T3 single chain RNA polymerase and those of mitochondrial plasmid of fungi belonging to Basidiomycota and Ascomycota. It is suggested that RNAP of pGT704-2.8 can perform transcription without transcription factor as promoter recognition. Given that only two motifs were found, it could not be ascertained whether this RNAP has a full function independently or integrated with mtDNA in carrying out its function.

  1. Effect of the caffeine on treated and non-treated plasmid DNA with stannic chloride; Efeito da cafeina em DNA plasmidial tratado e nao tratado com cloreto estanoso

    Energy Technology Data Exchange (ETDEWEB)

    Moreno, Silvana Ramos F. [Universidade do Estado, Rio de Janeiro, RJ (Brazil). Inst. de Biologia. Dept. de Biofisica e Biometria]|[Universidade Federal Fluminense, Niteroi, RJ (Brazil). Faculdade de Ciencias Medicas. Curso de Pos-graduacao em Patologia Experimental; Mattos, Jose C.P. de; Dantas, Flavio; Araujo, Adriano Caldeira de; Bernardo-Filho, Mario [Universidade do Estado, Rio de Janeiro, RJ (Brazil). Inst. de Biologia. Dept. de Biofisica e Biometria]. E-mail: bernardo@uerj.br

    2000-07-01

    Caffeine, a methilxantine drug is a component of coffee, tea, stimulants and other drinks. Caffeine inhibits phosphodiesterase leading to intracellular accumulation of cyclic AMP, blocks adenosine receptors, and increases the release of Ca{sup 2+}. We have studied the possible effect of caffeine in DNA plasmid treated or not with stannous chloride (SnCl{sub 2}). Previous evaluations of the effect of caffeine on the labeling of red blood cells and plasma proteins with technetium-99m have showed a decrease of % ATI in the insoluble fraction of plasma proteins. Samples of DNA were treated with SnCl{sub 2} (0 and 200{mu}g/ml) in 0.8% agarose. SnCl{sub 2} has induced break on DNA and caffeine has not showed effect on the DNA. This indicates that caffeine does not eliminate the oxidant action of SnCl{sub 2} and does not promote break in isolated DNA plasmid. (author)

  2. Lipophilic Polycation Vehicles Display High Plasmid DNA Delivery to Multiple Cell Types.

    Science.gov (United States)

    Wu, Yaoying; Smith, Adam E; Reineke, Theresa M

    2017-08-16

    A class of cationic poly(alkylamidoamine)s (PAAAs) containing lipophilic methylene linkers were designed and examined as in vitro plasmid DNA (pDNA) delivery agents. The PAAAs were synthesized via step-growth polymerization between a diamine monomer and each of four different diacid chloride monomers with varying methylene linker lengths, including glutaryl chloride, adipoyl chloride, pimeloyl chloride, and suberoyl chloride, which served to systematically increase the lipophilicity of the polymers. The synthesized polymers successfully complexed with pDNA in reduced serum medium at N/P ratios of 5 and greater, resulting in polyplexes with hydrodynamic diameters of approximately 1 μm. These polyplexes were tested for in vitro transgene expression and cytotoxicity using HDFa (human dermal fibroblast), HeLa (human cervical carcinoma), HMEC (human mammary epithelial), and HUVEC (human umbilical vein endothelial) cells. Interestingly, select PAAA polyplex formulations were found to be more effective than Lipofectamine 2000 at promoting transgene expression (GFP) while maintaining comparable or higher cell viability. Transgene expression was highest in HeLa cells (∼90% for most formulations) and lowest in HDFa cells (up to ∼20%) as measured by GFP fluorescence. In addition, the cytotoxicity of PAAA polyplex formulations was significantly increased as the molecular weight, N/P ratio, and methylene linker length were increased. The PAAA vehicles developed herein provide a new delivery vehicle design strategy of displaying attributes of both polycations and lipids, which show promise as a tunable scaffold for refining the structure-activity-toxicity profiles for future genome editing studies.

  3. Correction of the lack of commutability between plasmid DNA and genomic DNA for quantification of genetically modified organisms using pBSTopas as a model.

    Science.gov (United States)

    Zhang, Li; Wu, Yuhua; Wu, Gang; Cao, Yinglong; Lu, Changming

    2014-10-01

    Plasmid calibrators are increasingly applied for polymerase chain reaction (PCR) analysis of genetically modified organisms (GMOs). To evaluate the commutability between plasmid DNA (pDNA) and genomic DNA (gDNA) as calibrators, a plasmid molecule, pBSTopas, was constructed, harboring a Topas 19/2 event-specific sequence and a partial sequence of the rapeseed reference gene CruA. Assays of the pDNA showed similar limits of detection (five copies for Topas 19/2 and CruA) and quantification (40 copies for Topas 19/2 and 20 for CruA) as those for the gDNA. Comparisons of plasmid and genomic standard curves indicated that the slopes, intercepts, and PCR efficiency for pBSTopas were significantly different from CRM Topas 19/2 gDNA for quantitative analysis of GMOs. Three correction methods were used to calibrate the quantitative analysis of control samples using pDNA as calibrators: model a, or coefficient value a (Cva); model b, or coefficient value b (Cvb); and the novel model c or coefficient formula (Cf). Cva and Cvb gave similar estimated values for the control samples, and the quantitative bias of the low concentration sample exceeded the acceptable range within ±25% in two of the four repeats. Using Cfs to normalize the Ct values of test samples, the estimated values were very close to the reference values (bias -13.27 to 13.05%). In the validation of control samples, model c was more appropriate than Cva or Cvb. The application of Cf allowed pBSTopas to substitute for Topas 19/2 gDNA as a calibrator to accurately quantify the GMO.

  4. Persistence of plasmids, cholera toxin genes, and prophage DNA in classical Vibrio cholerae O1.

    OpenAIRE

    Cook, W L; Wachsmuth, K; Johnson, S R; Birkness, K A; Samadi, A R

    1984-01-01

    Plasmid profiles, the location of cholera toxin subunit A genes, and the presence of the defective VcA1 prophage genome in classical Vibrio cholerae isolated from patients in Bangladesh in 1982 were compared with those in older classical strains isolated during the sixth pandemic and with those in selected eltor and nontoxigenic O1 isolates. Classical strains typically had two plasmids (21 and 3 megadaltons), eltor strains typically had no plasmids, and nontoxigenic O1 strains had zero to thr...

  5. Size effect on transfection and cytotoxicity of nanoscale plasmid DNA/polyethyleneimine complexes for aerosol gene delivery

    Energy Technology Data Exchange (ETDEWEB)

    Hoon Byeon, Jeong, E-mail: jbyeon@purdue.edu [Department of Chemistry, Purdue University, West Lafayette, Indiana 47907 (United States); Kim, Jang-Woo, E-mail: jwkim@hoseo.edu [Department of Digital Display Engineering, Hoseo University, Asan 336-795 (Korea, Republic of)

    2014-02-03

    Nanoscale plasmid DNA (pDNA)/polyethyleneimine (PEI) complexes were fabricated in the aerosol state using a nebulization system consisting of a collison atomizer and a cool-walled diffusion dryer. The aerosol fabricated nanoscale complexes were collected and employed to determine fundamental properties of the complexes, such as size, structure, surface charge, and in vitro gene transfection efficiency and cytotoxicity. The results showed that mass ratio between pDNA and PEI should be optimized to enhance gene transfection efficiency without a significant loss of cell viability. These findings may support practical advancements in the field of nonviral gene delivery.

  6. Integral parametrization of the Kinetics of Crosslink production in plasmid DNA as a function of 8-methoxypsoralen concentration

    Energy Technology Data Exchange (ETDEWEB)

    Vidania, R. de; Paramio, J. M.; Bauluz, C.

    1986-07-01

    In this paper we present results of crosslink production in pBR322 DNA along a wide range of 8-methoxypsoralen (8-MOP) concentration. Experimental data were obtained as DNA renaturation percentages, from the shift in hyperchromicity after a temperature-dependent denaturation-renaturation process. the experimental results showed a three-stage profile when represented as a function of the natural logarithms of 8-MOP concentration. an integral parametrization which allows a simultaneous fit of the three observed stages is presented here. the theoretical values of crosslink production determined from the fit are useful to asses the genotoxicity of psoralen-induced crosslinks in plasmid DNA. (Author) 24 refs.

  7. Integral parametrization of the Kinetics of Crosslink production in plasmid DNA as a function of 8-methoxypsoralen concentration

    International Nuclear Information System (INIS)

    Vidania, R. de; Paramio, J. M.; Bauluz, C.

    1986-01-01

    In this paper we present results of crosslink production in pBR322 DNA along a wide range of 8-methoxypsoralen (8-MOP) concentration. Experimental data were obtained as DNA renaturation percentages, from the shift in hyperchromicity after a temperature-dependent denaturation-renaturation process. the experimental results showed a three-stage profile when represented as a function of the natural logarithms of 8-MOP concentration. an integral parametrization which allows a simultaneous fit of the three observed stages is presented here. the theoretical values of crosslink production determined from the fit are useful to asses the genotoxicity of psoralen-induced crosslinks in plasmid DNA. (Author) 24 refs

  8. Cloning and DNA sequence of the mercuric- and organomercurial-resistance determinants of plasmid pDU1358

    International Nuclear Information System (INIS)

    Griffin, H.G.; Foster, T.J.; Silver, S.; Misra, T.K.

    1987-01-01

    The broad-spectrum mercurial-resistance plasmid pDU1358 was analyzed by cloning the resistance determinants and preparing a physical and genetic map of a 45-kilobase (kb) region of the plasmid that contains two separate mercurial-resistance operons that mapped about 20 kb apart. One encoded narrow-spectrum mercurial resistance to Hg 2+ and a few organomercurials; the other specified broad-spectrum resistance to phenylmercury and additional organomercurials. Each determinant governed mercurial transport functions. Southern DNA x DNA hybridization experiments using gene-specific probes from the plasmid R100 mer operon indicated close homology with the R100 deteminant. The 2153 base pairs of the promoter-distal part of the broad-spectrum Hg 2+ -resistance operon of pDU1358 were sequenced. This region included the 3'-terminal part of the merA gene, merD, unidentified reading frame URF1, and a part of URF2 homologous to previously sequenced determinants of plasmid R100. Between the merA and merD genes, an open reading frame encoding a 212 amino acid polypeptide was identified as the merB gene that determines the enzyme organomercurial lyase that cleaves the C-Hg bond of phenylmercury

  9. DNA damage produced by exposure of supercoiled plasmid DNA to high- and low-LET ionizing radiation: Effects of hydroxyl radical quenchers. DNA breakage, neutrons, OH radicals

    International Nuclear Information System (INIS)

    Peak, J.G.; Ito, T.; Peak, M.J.; Robb, F.T.

    1994-01-01

    A supercoiled plasmid of 7300 base pairs was isolated and exposed in an aqueous environment to 60 Co γ rays and JANUS 0.85 MeV fission-spectrum neutrons. Dose responses for the production of single-strand breaks (SSBs), double-strand breaks (DSBs) and alkali-labile sites (ALSs) were compared with computations made from the conversion of the supercoil to its relaxed and linear forms. The relative biological effectiveness (RBE) for production of SSBs and DSBs was similar to that previously measured in the cellular environment. The RBE for destruction of genetic transforming activity of M13 viral DNA followed that for DNA damage. This is in contrast to the situation for biological effects such as lethality, mutagenesis, and cellular transformation measured in mammalian cells, where the RBE values are reversed. The role of hydroxyl (OH) radical in DNA damage induction by neutrons was investigated by exposure of plasmid in the presence of known quenchers of this species. Of four quenchers tested, all were able to reduce the yields of both SSBs and DSBs. These findings are consistent with a model for SSB and DSB induction by high linear energy transfer that involves OH radical mediation

  10. Explanatory chapter: how plasmid preparation kits work.

    Science.gov (United States)

    Koontz, Laura

    2013-01-01

    To isolate plasmid DNA from bacteria using a commercial plasmid miniprep kit (if interested, compare this protocol with Isolation of plasmid DNA from bacteria). Copyright © 2013 Elsevier Inc. All rights reserved.

  11. Hydrophobic and electrostatic interactions between cell penetrating peptides and plasmid DNA are important for stable non-covalent complexation and intracellular delivery.

    Science.gov (United States)

    Upadhya, Archana; Sangave, Preeti C

    2016-10-01

    Cell penetrating peptides are useful tools for intracellular delivery of nucleic acids. Delivery of plasmid DNA, a large nucleic acid, poses a challenge for peptide mediated transport. The paper investigates and compares efficacy of five novel peptide designs for complexation of plasmid DNA and subsequent delivery into cells. The peptides were designed to contain reported DNA condensing agents and basic cell penetrating sequences, octa-arginine (R 8 ) and CHK 6 HC coupled to cell penetration accelerating peptides such as Bax inhibitory mutant peptide (KLPVM) and a peptide derived from the Kaposi fibroblast growth factor (kFGF) membrane translocating sequence. A tryptophan rich peptide, an analogue of Pep-3, flanked with CH 3 on either ends was also a part of the study. The peptides were analysed for plasmid DNA complexation, protection of peptide-plasmid DNA complexes against DNase I, serum components and competitive ligands by simple agarose gel electrophoresis techniques. Hemolysis of rat red blood corpuscles (RBCs) in the presence of the peptides was used as a measure of peptide cytotoxicity. Plasmid DNA delivery through the designed peptides was evaluated in two cell lines, human cervical cancer cell line (HeLa) and (NIH/3 T3) mouse embryonic fibroblasts via expression of the secreted alkaline phosphatase (SEAP) reporter gene. The importance of hydrophobic sequences in addition to cationic sequences in peptides for non-covalent plasmid DNA complexation and delivery has been illustrated. An alternative to the employment of fatty acid moieties for enhanced gene transfer has been proposed. Comparison of peptides for plasmid DNA complexation and delivery of peptide-plasmid DNA complexes to cells estimated by expression of a reporter gene, SEAP. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd.

  12. Transformation frequency of γ irradiated plasmid DNA and the enzymatic double strand break formation by incubation in a protein extract of Escherichia coli

    International Nuclear Information System (INIS)

    Schulte-Frohlinde, D.; Mark, F.; Ventur, Y.

    1994-01-01

    It was found that incubation of γ-irradiated or DNaseI-treated plasmid DNA in a protein extract of Escherichia coli leads to enzyme-induced formation of double strand breaks (dsb) in competition with repair of precursors of these dsb. A survival curve of the plasmid DNA (as determined by transformation of E. coli) was calculated on the basis of enzyme-induced dsb as well as those produced by irradiation assuming that they are lethal. The calculated D O value was the same as that measured directly by transformation of irradiated plasmid DNA. Two models are presented that fit the experimental survival data as a function of dose. One is based on damage formation in the plasmid DNA including enzymatic conversion of single strand damage into dsb (U-model), the other is an enzymatic repair saturation model based on Michaelis-Menten kinetics. (Author)

  13. Formation of plasmid DNA strand breaks induced by low-energy ion beam: indication of nuclear stopping effects

    International Nuclear Information System (INIS)

    Chen Yu; Jiang Bingyao; Chen Youshan; Ding Xingzhao; Liu Xianghuai; Chen Ceshi; Guo Xinyou; Yin Guanglin

    1998-01-01

    Plasmid pGEM 3zf(+) was irradiated by nitrogen ion beam with energies between 20 and 100 keV and the fluence kept as 1 x 10 12 ions/cm 2 . The irradiated plasmid was assayed by neutral electrophoresis and quantified by densitometry. The yields of DNA with single-strand and double-strand breaks first increased then decreased with increasing ion energy. There was a maximal yield value in the range of 20-100 keV. The relationship between DNA double-strand breaks (DSB) cross-section and linear energy transfer (LET) also showed a peak-shaped distribution. To understand the physical process during DNA strand breaks, a Monte Carlo calculation code known as TRIM (Transport of Ions in Matter) was used to simulate energy losses due to nuclear stopping and to electronic stopping. It can be assumed that nuclear stopping plays a more important role in DNA strand breaks than electronic stopping in this energy range. The physical mechanisms of DNA strand breaks induced by a low-energy ion beam are also discussed. (orig.)

  14. Radiation-chemical discussion on inverse dose-rate effect observed in radiation-induced strand breaks of plasmid DNA

    International Nuclear Information System (INIS)

    Masuda, Takahiro

    1994-01-01

    Experimental results of inverse dose-rate effect, so-called Kada Effects, which was published by Takakura and her coworkers on radiation-induced strand breaks of plasmid DNA in aerated aqueous solution, have been kinetically analyzed and discussed on the basis of radiation chemistry. the kinetic analysis indicates that there are two possible mechanisms; 1) equilibrium mixture of O 2 - and HO 2 is responsible for strand breaks of DNA, and 2) peroxyl radical produced from citrate is effective for the strand breaks. However, the detailed kinetic analysis revealed that the latter is improbable because unimolecular decay of the peroxyl radical must be assumed to be negligible for its participation despite fast decay of analogous organic peroxyl radicals. The analysis has also given 9.93±0.10 dm 3 mol -1 s -1 per nucleotide unit, which corresponds to 7.62 x 10 4 dm 3 mol -1 s -1 per DNA molecule, as the rate constant for the reaction of the equilibrium mixture with plasmid pBR 322 DNA. Furthermore the probability that the reaction of the mixture with a nucleotide unit of DNA leads to strand breaks was obtained to be 3.36 x 10 -3 for gamma-irradiated system and 1.98 x 10 -3 for beta-irradiated system, respectively. (author)

  15. Effect of human polymorphonuclear and mononuclear leukocytes on chromosomal and plasmid DNA of Escherichia coli. Role of acid DNase

    International Nuclear Information System (INIS)

    Rozenberg-Arska, M.; van Strijp, J.A.; Hoekstra, W.P.; Verhoef, J.

    1984-01-01

    Phagocytosis and killing by polymorphonuclear and mononuclear leukocytes are important host resistance factors against invading microorganisms. Evidence showing that killing is rapidly followed by degradation of bacterial components is limited. Therefore, we studied the fate of Escherichia coli DNA following phagocytosis of E. coli by polymorphonuclear and mononuclear leukocytes. [ 3 H]Thymidine-labeled, unencapsulated E. coli PC2166 and E. coli 048K1 were incubated in serum, washed, and added to leukocytes. Uptake and killing of the bacteria and degradation of DNA were measured. Although phagocytosis and killing by mononuclear leukocytes was less efficient than that by polymorphonuclear leukocytes, only mononuclear leukocytes were able to degrade E. coli PC2166 DNA. Within 2 h, 60% of the radioactivity added to mononuclear leukocytes was released into the supernate, of which 40% was acid soluble. DNA of E. coli 048K1 was not degraded. To further analyze the capacity of mononuclear leukocytes to degrade E. coli DNA, chromosomal and plasmid DNA was isolated from ingested bacteria and subjected to agarose gel-electrophoresis. Only chromosomal DNA was degraded after phagocytosis. Plasmid DNA of E. coli carrying a gene coding for ampicillin resistance remained intact for a 2-h period after ingestion, and was still able to transform recipient E. coli cells after this period. Although we observed no DNA degradation during phagocytosis by polymorphonuclear leukocytes, lysates of both polymorphonuclear and mononuclear leukocytes contained acid-DNase activity with a pH optimum of 4.9. However, the DNase activity of mononuclear leukocytes was 20 times higher than that of polymorphonuclear leukocytes. No difference was observed between DNase activity from polymorphonuclear and mononuclear leukocytes from a chronic granulomatous disease patient with DNase activity from control polymorphonuclear and mononuclear leukocytes

  16. Auto-assembly of nanometer thick, water soluble layers of plasmid DNA complexed with diamines and basic amino acids on graphite: Greatest DNA protection is obtained with arginine

    Energy Technology Data Exchange (ETDEWEB)

    Khalil, T.T.; Boulanouar, O. [Université de Bourgogne Franche-Comté, UMR CNRS 6249 Chrono-Environnement, 16, Route de Gray, 25030 Besançon Cedex (France); Heintz, O. [Université de Bourgogne Franche-Comté, UMR CNRS 6303Laboratoire Interdisciplinaire Carnot de Bourgogne, DTAI/Centre de micro/nano caractérisation, 9 Av. A. Savary, BP 47870, F-21078 DIJON Cedex (France); Fromm, M., E-mail: michel.fromm@univ-fcomte.fr [Université de Bourgogne Franche-Comté, UMR CNRS 6249 Chrono-Environnement, 16, Route de Gray, 25030 Besançon Cedex (France)

    2017-02-01

    We have investigated the ability of diamines as well as basic amino acids to condense DNA onto highly ordered pyrolytic graphite with minimum damage after re-dissolution in water. Based on a bibliographic survey we briefly summarize DNA binding properties with diamines as compared to basic amino acids. Thus, solutions of DNA complexed with these linkers were drop-cast in order to deposit ultra-thin layers on the surface of HOPG in the absence or presence of Tris buffer. Atomic Force Microscopy analyses showed that, at a fixed ligand-DNA mixing ratio of 16, the mean thickness of the layers can be statistically predicted to lie in the range 0–50 nm with a maximum standard deviation ± 6 nm, using a simple linear law depending on the DNA concentration. The morphology of the layers appears to be ligand-dependent. While the layers containing diamines present holes, those formed in the presence of basic amino acids, except for lysine, are much more compact and dense. X-ray Photoelectron Spectroscopy measurements provide compositional information indicating that, compared to the maximum number of DNA sites to which the ligands may bind, the basic amino acids Arg and His are present in large excess. Conservation of the supercoiled topology of the DNA plasmids was studied after recovery of the complex layers in water. Remarkably, arginine has the best protection capabilities whether Tris was present or not in the initial solution. - Highlights: • Characterization of nanometer scaled layers composed of pUC21 plasmid DNA • Relation between nature of the ligand and structure of the layers • Capacities of the ligands to protect plasmids from strand break depending on their nature.

  17. Direct identification of antibiotic resistance genes on single plasmid molecules using CRISPR/Cas9 in combination with optical DNA mapping

    Science.gov (United States)

    Müller, Vilhelm; Rajer, Fredrika; Frykholm, Karolin; Nyberg, Lena K.; Quaderi, Saair; Fritzsche, Joachim; Kristiansson, Erik; Ambjörnsson, Tobias; Sandegren, Linus; Westerlund, Fredrik

    2016-12-01

    Bacterial plasmids are extensively involved in the rapid global spread of antibiotic resistance. We here present an assay, based on optical DNA mapping of single plasmids in nanofluidic channels, which provides detailed information about the plasmids present in a bacterial isolate. In a single experiment, we obtain the number of different plasmids in the sample, the size of each plasmid, an optical barcode that can be used to identify and trace the plasmid of interest and information about which plasmid that carries a specific resistance gene. Gene identification is done using CRISPR/Cas9 loaded with a guide-RNA (gRNA) complementary to the gene of interest that linearizes the circular plasmids at a specific location that is identified using the optical DNA maps. We demonstrate the principle on clinically relevant extended spectrum beta-lactamase (ESBL) producing isolates. We discuss how the gRNA sequence can be varied to obtain the desired information. The gRNA can either be very specific to identify a homogeneous group of genes or general to detect several groups of genes at the same time. Finally, we demonstrate an example where we use a combination of two gRNA sequences to identify carbapenemase-encoding genes in two previously not characterized clinical bacterial samples.

  18. Genomic integration and germline transmission of plasmid injected into crustacean Daphnia magna eggs.

    Directory of Open Access Journals (Sweden)

    Yasuhiko Kato

    Full Text Available The water flea, Daphnia, has been the subject of study in ecology, evolution, and environmental sciences for decades. Over the last few years, expressed sequence tags and a genome sequence have been determined. In addition, functional approaches of overexpression and gene silencing based on microinjection of RNAs into eggs have been established. However, the transient nature of these approaches prevents us from analyzing gene functions in later stages of development. To overcome this limitation, transgenesis would become a key tool. Here we report establishment of a transgenic line using microinjection of plasmid into Daphnia magna eggs. The green fluorescent protein (GFP gene fused with the D. magna histone H2B gene under the control of a promoter/enhancer region of the elongation factor 1α-1 (EF1α-1 gene, EF1α-1::H2B-GFP, was used as a reporter providing high resolution visualization of active chromatin. Transgenic lines were obtained from 0.67% of the total fertile adults that survived the injections. One of the transgenic animals, which exhibited fluorescence in the nuclei of cells during embryogenesis and oogenesis, had two copies of EF1α-1::H2B-GFP in a head-to-tail array. This is the first report of a transgenesis technique in Daphnia and, together with emerging genome sequences, will be useful for advancing knowledge of the molecular biology of Daphnia.

  19. Ultrasound-targeted microbubble destruction enhances naked plasmid DNA transfection in rabbit Achilles tendons in vivo.

    Science.gov (United States)

    Qiu, L; Zhang, L; Wang, L; Jiang, Y; Luo, Y; Peng, Y; Lin, L

    2012-07-01

    The study was to investigate the probability of increasing the transfection of the gene in tendons by ultrasound-targeted microbubble destruction (UTMD), and to search for the most suitable transfection conditions. A mixture of microbubbles and enhanced green fluorescent protein (EGFP) plasmids was injected into rabbit Achilles tendons by different administration routes and the tendons were ultrasound pulse by different ultrasonic conditions in order to determine the most appropriate conditions. Then, the rabbits were divided into four groups: (1) ultrasound + microbubbles + plasmid; (2) ultrasound+ plasmid; (3) microbubble + plasmid; (4) plasmid only. EGFP expression in the tendons and other tissues, and the damage to tendon and paratenon were all observed. The results showed that EGFP expression in the tendon was higher by ultrasound pulse with 2 W cm(-2) of output intensity and a 20% duty cycle for 10 min. Local injection was determined to be the better administration route. Among the four groups, EGFP expression in Group 1 was higher than that in other groups. EGFP expression was highest on seventh day, then it gradually decrease over time, and lasted more than 56 days. EGFP expression was not found in other tissues. There was no obvious injury caused by UTMD. Under suitable conditions, it is feasible to use UTMD as a safe and effective gene transfection therapy for tendon injuries.

  20. STUDY REGARDING EFFICIENCY OF INDUCED GENETIC TRANSFORMATION IN BACILLUS LICHENIFORMIS WITH PLASMID DNA

    Directory of Open Access Journals (Sweden)

    T. VINTILĂ

    2007-05-01

    Full Text Available A strain of Bacillus licheniformis was subject to genetic transformation with plasmid vectors (pLC1 and pNC61, using electroporation technique, protoplast transformation and bivalent cations (CaCl2 mediated transformation. In the case of transformation by electroporation of Bacillus licheniformis B40, the highest number of transformed colonies (3 were obtained only after a 1,79 KV electric shock, for 2,2 milliseconds. Using this transformation technique we have obtained six kanamycin resistant transformants. The frequency of Bacillus licheniformis B40 protoplasts transformation using pLC1 and pNC61 plasmid vectors is approximately 10% (TF = 10%. As a result of pLC1 plasmid integration in Bacillus licheniformis protoplasts, six kanamycin resistant transformants were obtained. The pNC61 plasmid, which confers trimethoprim resistance, does not integrate in receiver cells by protoplast transformation. The direct genetic transformation in the presence of bivalent cations (CaCl2, mediated by pLC1 and pNC61 plasmid vectors, produce a low transformation frequency. Using this technique, we have obtained three trimethoprim resistant colonies and four kanamycin resistant colonies. The chemical way of transformation is the only technique, which realizes the integration of pNC61 in B. licheniformis B40 cells.

  1. Nanospines incorporation into the structure of the hydrophobic cryogels via novel cryogelation method: an alternative sorbent for plasmid DNA purification.

    Science.gov (United States)

    Üzek, Recep; Uzun, Lokman; Şenel, Serap; Denizli, Adil

    2013-02-01

    In this study, it was aimed to prepare hydrophobic cryogels for plasmid DNA (pDNA) purification from Escherichia coli lysate. The hydrophobicity was achieved by incorporating a hydrophobic ligand, N-methacryloyl-(L)-phenylalanine (MAPA), into the cryogel backbone. In addition to the conventional cryogelation process, freeze-drying step was included to create nanospines. Three different cryogels {poly(2-hydoxyethyl methacrylate-N-methacryloyl-L-phenylalanine)-freeze dried, [P(HEMA-MAPA)-FD]; poly(2-hydoxyethyl methacrylate-N-methacryloyl-L-phenylalanine, [P(HEMA-MAPA)] and poly(2-hydoxyethyl methacrylate)-freeze dried, [P(HEMA)-FD]} were prepared, characterized, and used for DNA (salmon sperm DNA) adsorption studies from aqueous solution. The specific surface areas of cryogels were determined to be 21.4 m(2)/g for P(HEMA)-FD, 17.65 m(2)/g for P(HEMA-MAPA) and 36.0 m(2)/g for P(HEMA-MAPA)-FD. The parameters affecting adsorption such as temperature, initial DNA concentration, salt type and concentration were examined in continuous mode. The maximum adsorption capacities were observed as 45.31 mg DNA/g, 27.08 mg DNA/g and 1.81 mg DNA/g for P(HEMA-MAPA)-FD, P(HEMA-MAPA) and P(HEMA)-FD, respectively. Desorption process was performed using acetate buffer (pH 5.50) without salt. First, pDNA was isolated from E. coli lysate and the purity of pDNA was then determined by agarose gel electrophoresis. Finally, the chromatographic performance of P(HEMA-MAPA)-FD cryogel for pDNA purification was tested in FPLC. The resolution (R(s)) was 2.84, and the specific selectivity for pDNA was 237.5-folds greater than all impurities. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. A Histone-Like Protein Induces Plasmid DNA to Form Liquid Crystals in Vitro and Gene Compaction in Vivo

    Directory of Open Access Journals (Sweden)

    Shiyong Sun

    2013-12-01

    Full Text Available The liquid crystalline state is a universal phenomenon involving the formation of an ordered structure via a self-assembly process that has attracted attention from numerous scientists. In this study, the dinoflagellate histone-like protein HCcp3 is shown to induce super-coiled pUC18 plasmid DNA to enter a liquid crystalline state in vitro, and the role of HCcp3 in gene condensation in vivo is also presented. The plasmid DNA (pDNA-HCcp3 complex formed birefringent spherical particles with a semi-crystalline selected area electronic diffraction (SAED pattern. Circular dichroism (CD titrations of pDNA and HCcp3 were performed. Without HCcp3, pUC18 showed the characteristic B conformation. As the HCcp3 concentration increased, the 273 nm band sharply shifted to 282 nm. When the HCcp3 concentration became high, the base pair (bp/dimer ratio fell below 42/1, and the CD spectra of the pDNA-HCcp3 complexes became similar to that of dehydrated A-form DNA. Microscopy results showed that HCcp3 compacted the super-coiled gene into a condensed state and that inclusion bodies were formed. Our results indicated that HCcp3 has significant roles in gene condensation both in vitro and in histone-less eukaryotes in vivo. The present study indicates that HCcp3 has great potential for applications in non-viral gene delivery systems, where HCcp3 may compact genetic material to form liquid crystals.

  3. Complete nucleotide sequence of the self-transmissible TOL plasmid pD2RT provides new insight into arrangement of toluene catabolic plasmids

    DEFF Research Database (Denmark)

    Jutkina, Jekaterina; Hansen, Lars Hestbjerg; Li, Lili

    2013-01-01

    In the present study we report the complete nucleotide sequence of the toluene catabolic plasmid pD2RT of Pseudomonas migulae strain D2RT isolated from Baltic Sea water. The pD2RT is 129,894 base pairs in size with an average G+ C content of 53.75%. A total of 135 open reading frames (ORFs) were ...

  4. Persistence of plasmids, cholera toxin genes, and prophage DNA in classical Vibrio cholerae O1.

    Science.gov (United States)

    Cook, W L; Wachsmuth, K; Johnson, S R; Birkness, K A; Samadi, A R

    1984-07-01

    Plasmid profiles, the location of cholera toxin subunit A genes, and the presence of the defective VcA1 prophage genome in classical Vibrio cholerae isolated from patients in Bangladesh in 1982 were compared with those in older classical strains isolated during the sixth pandemic and with those in selected eltor and nontoxigenic O1 isolates. Classical strains typically had two plasmids (21 and 3 megadaltons), eltor strains typically had no plasmids, and nontoxigenic O1 strains had zero to three plasmids. The old and new isolates of classical V. cholerae had two HindIII chromosomal digest fragments containing cholera toxin subunit A genes, whereas the eltor strains from Eastern countries had one fragment. The eltor strains from areas surrounding the Gulf of Mexico also had two subunit A gene fragments, which were smaller and easily distinguished from the classical pattern. All classical strains had 8 to 10 HindIII fragments containing the defective VcA1 prophage genome; none of the Eastern eltor strains had these genes, and the Gulf Coast eltor strains contained a different array of weakly hybridizing genes. These data suggest that the recent isolates of classical cholera in Bangladesh are closely related to the bacterial strain(s) which caused classical cholera during the sixth pandemic. These data do not support hypotheses that either the eltor or the nontoxigenic O1 strains are precursors of the new classical strains.

  5. STUDY REGARDING EFFICIENCY OF INDUCED GENETIC TRANSFORMATION IN BACILLUS LICHENIFORMIS WITH PLASMID DNA

    Directory of Open Access Journals (Sweden)

    VINTILĂ T.

    2007-01-01

    Full Text Available A strain of Bacillus licheniformis was subject to genetic transformation with plasmidvectors (pLC1 and pNC61, using electroporation technique, protoplasttransformation and bivalent cations (CaCl2 mediated transformation. In the case oftransformation by electroporation of Bacillus licheniformis B40, the highest numberof transformed colonies (3 were obtained only after a 1,79 KV electric shock, for 2,2milliseconds. Using this transformation technique we have obtained six kanamycinresistant transformants. The frequency of Bacillus licheniformis B40 protoplaststransformation using pLC1 and pNC61 plasmid vectors is approximately 10% (TF =10%. As a result of pLC1 plasmid integration in Bacillus licheniformis protoplasts,six kanamycin resistant transformants were obtained. The pNC61 plasmid, whichconfers trimethoprim resistance, does not integrate in receiver cells by protoplasttransformation. The direct genetic transformation in the presence of bivalent cations(CaCl2, mediated by pLC1 and pNC61 plasmid vectors, produce a lowtransformation frequency. Using this technique, we have obtained three trimethoprimresistant colonies and four kanamycin resistant colonies. The chemical way oftransformation is the only technique, which realizes the integration of pNC61 in B.licheniformis B40 cells.

  6. Detailed adsorption mechanism of plasmid DNA by newly isolated cellulose from waste flower spikes of Thypa latifolia using quantum chemical calculations.

    Science.gov (United States)

    Mujtaba, Muhammad; Kaya, Murat; Akyuz, Lalehan; Erdonmez, Demet; Akyuz, Bahar; Sargin, Idris

    2017-09-01

    Current study was designed to use the newly obtained cellulose from waste flower spikes of Thypa latifolia plant for plasmid DNA adsorption. Cellulose was isolated according to a previously described method including acid and base treatment, and cellulose content was recorded as 17%. T. latifolia cellulose was physicochemically characterized via FT-IR, TGA and SEM techniques. Detailed mechanism of plasmid DNA adsorption by newly isolated cellulose was described using chemical quantum calculations. To check the effect of Cu ++ immobilization on the affinity of cellulose for plasmid DNA, copper ions were immobilized onto T. latifolia cellulose. pUC18 plasmid DNA was used for adsorption studies. Membranes prepared with only T. latifolia cellulose and Cu ++ immobilized T. latifolia cellulose revealed different adsorption ratios as 43.9 and 86.9% respectively. This newly isolated cellulose from waste flower spikes of T. latifolia can be utilized as a suitable carrier for plasmid DNA. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Construction of adiponectin-encoding plasmid DNA and gene therapy of non-obese type 2 diabetes mellitus.

    Science.gov (United States)

    Nan, Mei Hua; Park, Jeong-Sook; Myung, Chang-Seon

    2010-01-01

    Adiponectin (ADN), an insulin-sensitizing adipokine, stimulates glucose uptake, inhibits gluconeogenesis, and plays an important role in improving insulin sensitivity. Since blood levels of ADN are low in type 2 diabetes mellitus (DM), this study was designed to investigate the therapeutic effectiveness of increasing the ADN level through injection of plasmid DNA encoding ADN in type 2 DM. A non-obese type 2 DM mouse model was established via combined administration of streptozotocin with nicotinamide and exhibited significantly higher plasma glucose concentration and insulin resistance compared with normal controls according to oral glucose tolerance and insulin challenge tests. Plasmid DNA encoding mouse ADN from differentiated NIH3T3 adipocytes was constructed in pVAX1 (pVAX/ADN). Transfection of pVAX/ADN into various cell lines including HeLa, HT22, HEK293, HepG2, and SK-Hep1 cells, increased ADN mRNA expression levels in a dose-dependent manner. The administration of pVAX/ADN into non-obese type 2 DM mice via tail vein significantly increased the blood level of ADN and decreased the plasma glucose concentration. Moreover, the parameters related to insulin resistance (HOMA-IR) and insulin sensitivity (QUICKI) were significantly improved. These results suggest that ADN gene therapy could be a clinically effective tool for the treatment of type 2 DM.

  8. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  9. Use of damaged plasmid to study DNA repair in X-ray sensitive (xrs) strains of Chinese hamster ovary (CHO) cells

    International Nuclear Information System (INIS)

    Smith-Ravin, J.; Jeggo, P.A.

    1989-01-01

    The effect of γ-irradiation of pSV2gpt DNA on its transfection frequency has been analysed using radiosensitive CHO xrs mutants showing a defect in double-strand break (dsb) rejoining. At low doses a sharp decrease in relative transfection frequency, i.e. transfection frequency of irradiated plasmid relative to untreated plasmid, as observed in xrs mutants compared with the parent line K1. Electrophoresis of irradiated plasmid DNA showed the decrease in transfection frequency in the xrs mutants correlated with the change of supercoiled molecules into open-circular forms. In the parent line CHO-K1, open-circular and supercoiled molecules have the same transfection frequency. The effect of linearization of pSV2gpt DNA by restriction enzymes on transfection frequency in xrs and wild-type strains was also examined. No difference in the relative transfection frequency between xrs and wild-type strains was detected. (author)

  10. Repair of UV-damaged incoming plasmid DNA in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Keszenman-Pereyra, David

    1990-01-01

    A whole-cell transformation assay was used for the repair of UV-damaged plasma DNA in highly-transformable haploid strains of Saccharomyces cerevisiae having different repair capabilities. The experiments described demonstrate that three epistasis groups (Friedberg 1988) are involved in the repair of UV-incoming DNA and that the repair processes act less efficiently on incoming DNA than they do on chromosomal DNA. The implications of these findings for UV repair in Saccharomyces cerevisiae are discussed. (author)

  11. Plasmid segregation mechanisms

    DEFF Research Database (Denmark)

    Ebersbach, G.; Gerdes, Kenn

    2005-01-01

    Bacterial plasmids encode partitioning (par) loci that ensure ordered plasmid segregation prior to cell division. par loci come in two types: those that encode actin-like ATPases and those that encode deviant Walker-type ATPases. ParM, the actin-like ATPase of plasmid R1, forms dynamic filaments...... that segregate plasmids paired at mid-cell to daughter cells. Like microtubules, ParM filaments exhibit dynamic instability (i.e., catastrophic decay) whose regulation is an important component of the DNA segregation process. The Walker box ParA ATPases are related to MinD and form highly dynamic, oscillating...... filaments that are required for the subcellular movement and positioning of plasmids. The role of the observed ATPase oscillation is not yet understood. However, we propose a simple model that couples plasmid segregation to ParA oscillation. The model is consistent with the observed movement...

  12. Sustained delivery of plasmid DNA from polymeric scaffolds for tissue engineering.

    Science.gov (United States)

    Storrie, Hannah; Mooney, David J

    2006-07-07

    The encapsulation of DNA into polymeric depot systems can be used to spatially and temporally control DNA release, leading to a sustained, local delivery of therapeutic factors for tissue regeneration. Prior to encapsulation, DNA may be condensed with cationic polymers to decrease particle size, protect DNA from degradation, promote interaction with cell membranes, and facilitate endosomal release via the proton sponge effect. DNA has been encapsulated with either natural or synthetic polymers to form micro- and nanospheres, porous scaffolds and hydrogels for sustained DNA release and the polymer physical and chemical properties have been shown to influence transfection efficiency. Polymeric depot systems have been applied for bone, skin, and nerve regeneration as well as therapeutic angiogenesis, indicating the broad applicability of these systems for tissue engineering.

  13. Vaxfectin enhances antigen specific antibody titers and maintains Th1 type immune responses to plasmid DNA immunization.

    Science.gov (United States)

    Reyes, L; Hartikka, J; Bozoukova, V; Sukhu, L; Nishioka, W; Singh, G; Ferrari, M; Enas, J; Wheeler, C J; Manthorpe, M; Wloch, M K

    2001-06-14

    Antigen specific immune responses were characterized after intramuscular immunization of BALB/c mice with 5 antigen encoding plasmid DNAs (pDNAs) complexed with Vaxfectin, a cationic lipid formulation. Vaxfectin increased IgG titers for all of the antigens with no effect on the CTL responses to the 2 antigens for which CTL assays were performed. Both antigen specific IgG1 and IgG2a were increased, although IgG2a remained greater than IgG1. Furthermore, Vaxfectin had no effect on IFN-gamma or IL-4 production by splenocytes re-stimulated with antigen, suggesting that the Th1 type responses typical of intramuscular pDNA immunization were not altered. Studies with IL-6 -/- mice suggest that the antibody enhancement is IL-6 dependent and results in a correlative increase in antigen specific antibody secreting cells.

  14. Effect on Antibody and T-Cell Responses of Mixing Five GMP-Produced DNA Plasmids and Administration With Plasmid Expressing GM-CSF

    National Research Council Canada - National Science Library

    Sedegah, M; Charoenvit, Y; Aguiar, J; Sacci, J; Hedstrom, R; Kumar, S; Belmonte, A; Lanar, DE; Jones, TR; Abot, E

    2004-01-01

    .... In preparation for a clinical trial, we assessed the immunogenicity of GMP-produced plasmids encoding five Plasmodium falciparum proteins, PfCSP, PfSSP2, PfEXP1, PfLSA1, and PfLSA3, given as a mixture, or alone...

  15. Quantification of plasmid DNA reference materials for Shiga toxin-producing Escherichia coli based on UV, HR-ICP-MS and digital PCR.

    Science.gov (United States)

    Liang, Wen; Xu, Li; Sui, Zhiwei; Li, Yan; Li, Lanying; Wen, Yanli; Li, Chunhua; Ren, Shuzhen; Liu, Gang

    2016-01-01

    The accuracy and metrology traceability of DNA quantification is becoming a critical theme in many fields, including diagnosis, forensic analysis, microorganism detection etc. Thus the research of DNA reference materials (RMs) and consistency of DNA quantification methods has attracted considerable research interest. In this work, we developed 3 plasmid candidate RMs, containing 3 target genes of Escherichia coli O157:H7 (E. coli O157:H7) and other Shiga toxin-producing Escherichia coli (STEC): stx1, stx2, and fliC (h7) respectively. Comprehensive investigation of the plasmid RMs was performed for their sequence, purity, homogeneity and stability, and then the concentration was quantified by three different methods: ultraviolet spectrophotometer (UV), high resolution inductively coupled plasma mass spectrometry (HR-ICP-MS) and digital PCR. As a routinely applied method for DNA analysis, UV was utilized for the quantification (OD260) and purity analysis for the plasmids. HR-ICP-MS quantified the plasmid DNA through analysing the phosphorus in DNA molecules. Digital PCR distributed the DNA samples onto a microarray chip containing thousands of reaction chambers, and quantified the DNA copy numbers by analysing the number of positive signals without any calibration curves needed. Based on the high purification of the DNA reference materials and the optimization of dPCR analysis, we successfully achieved good consistency between UV, HR-ICP-MS and dPCR, with relative deviations lower than 10 %. We then performed the co-quantification of 3 DNA RMs with three different methods together, and the uncertainties of their concentration were evaluated. Finally, the certified values and expanded uncertainties for 3 DNA RMs (pFliC, pStx1 and pStx2) were (1.60 ± 0.10) × 10(10) copies/μL, (1.53 ± 0.10) × 10(10) copies/μL and (1.70 ± 0.11) × 10(10) copies/μL respectively.Graphical abstractWe developed 3 plasmid candidate RMs, containing 3 target genes of

  16. Dendritic cell mediated delivery of plasmid DNA encoding LAMP/HIV-1 Gag fusion immunogen enhances T cell epitope responses in HLA DR4 transgenic mice.

    Directory of Open Access Journals (Sweden)

    Gregory G Simon

    2010-01-01

    Full Text Available This report describes the identification and bioinformatics analysis of HLA-DR4-restricted HIV-1 Gag epitope peptides, and the application of dendritic cell mediated immunization of DNA plasmid constructs. BALB/c (H-2d and HLA-DR4 (DRA1*0101, DRB1*0401 transgenic mice were immunized with immature dendritic cells transfected by a recombinant DNA plasmid encoding the lysosome-associated membrane protein-1/HIV-1 Gag (pLAMP/gag chimera antigen. Three immunization protocols were compared: 1 primary subcutaneous immunization with 1x10(5 immature dendritic cells transfected by electroporation with the pLAMP/gag DNA plasmid, and a second subcutaneous immunization with the naked pLAMP/gag DNA plasmid; 2 primary immunization as above, and a second subcutaneous immunization with a pool of overlapping peptides spanning the HIV-1 Gag sequence; and 3 immunization twice by subcutaneous injection of the pLAMP/gag DNA plasmid. Primary immunization with pLAMP/gag-transfected dendritic cells elicited the greatest number of peptide specific T-cell responses, as measured by ex vivo IFN-gamma ELISpot assay, both in BALB/c and HLA-DR4 transgenic mice. The pLAMP/gag-transfected dendritic cells prime and naked DNA boost immunization protocol also resulted in an increased apparent avidity of peptide in the ELISpot assay. Strikingly, 20 of 25 peptide-specific T-cell responses in the HLA-DR4 transgenic mice contained sequences that corresponded, entirely or partially to 18 of the 19 human HLA-DR4 epitopes listed in the HIV molecular immunology database. Selection of the most conserved epitope peptides as vaccine targets was facilitated by analysis of their representation and variability in all reported sequences. These data provide a model system that demonstrates a the superiority of immunization with dendritic cells transfected with LAMP/gag plasmid DNA, as compared to naked DNA, b the value of HLA transgenic mice as a model system for the identification and evaluation

  17. Effect of serotonin on the expression of antigens and DNA levels in Yersinia pestis cells with different plasmid content

    Science.gov (United States)

    Klueva, Svetlana N.; Korsukov, Vladimir N.; Schukovskaya, Tatyana N.; Kravtsov, Alexander L.

    2004-08-01

    Using flow cytometry (FCM) the influence of exogenous serotonin on culture growth, DNA content and fluorescence intensity of cells binding FITC-labelled plague polyclonal immunoglobulins was studied in Yersinia pestis EV (pFra+, pCad+, pPst+), Yersinia pestis KM218 (pFra-, pCad-, pPst-), Yersinia pestis KM 216 (pFra-, pCad-, pPst+). The results have been obtained by FCM showed serotonin accelerated Yersinia pestis EV (pFra+, pCad+, pPst+), Yersinia pestis KM218 (pFra-, pCad-, pPst-) culture growth during cultivation in Hottinger broth pH 7.2 at 28°C at concentration of 10-5 M. The presence of 10-5 M serotonin in nutrient broth could modulate DNA content in 37°C growing population of plague microbe independently of their plasmid content. Serotonin have been an impact on the distribution pattern of the cells according to their phenotypical characteristics, which was reflected in the levels of population heterogeneity in the intensity of specific immunofluorescence determined by FMC.

  18. Abnormal ultraviolet mutagenic spectrum in plasmid DNA replicated in cultured fibroblasts from a patient with the skin cancer-prone disease, xeroderma pigmentosum

    International Nuclear Information System (INIS)

    Seetharam, S.; Protic-Sabljic, M.; Seidman, M.M.; Kraemer, K.H.

    1987-01-01

    A shuttle vector plasmid, pZ189, was utilized to assess the types of mutations that cells from a patient with xeroderma pigmentosum, complementation group D, introduce into ultraviolet (UV) damaged, replicating DNA. Patients with xeroderma pigmentosum have clinical and cellular UV hypersensitivity, increased frequency of sun-induced skin cancer, and deficient DNA repair. In comparison to UV-treated pZ189 replicated in DNA repair-proficient cells, there were fewer surviving plasmids, a higher frequency of plasmids with mutations, fewer plasmids with two or more mutations in the marker gene, and a new mutagenic hotspot. The major type of base substitution mutation was the G:C to A:T transition with both cell lines. These results, together with similar findings published earlier with cells from a xeroderma pigmentosum patient in complementation group A, suggest that isolated G:C to A:T somatic mutations may be particularly important in generation of human skin cancer by UV radiation

  19. A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

    International Nuclear Information System (INIS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.

    2011-01-01

    To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

  20. Mucosal delivery of a transmission-blocking DNA vaccine encoding Giardia lamblia CWP2 by Salmonella typhimurium bactofection vehicle.

    Science.gov (United States)

    Abdul-Wahid, Aws; Faubert, Gaétan

    2007-12-05

    In this study, we investigated the use of Salmonella typhimurium (STM1 strain) as a bactofection vehicle to deliver a transmission-blocking DNA vaccine (TBDV) plasmid to the intestinal immune system. The gene encoding the full length cyst wall protein-2 (CWP2) from Giardia lamblia was subcloned into the pCDNA3 mammalian expression vector and stably introduced into S. typhimurium STM1. Eight-week-old female BALB/c mice were orally immunized every 2 weeks, for a total of three immunizations. Vaccinated and control mice were sacrificed 1 week following the last injection. Administration of the DNA vaccine led to the production of CWP2-specific cellular immune responses characterized by a mixed Th1/Th2 response. Using ELISA, antigen-specific IgA and IgG antibodies were detected in intestinal secretions. Moreover, analysis of sera demonstrated that the DNA immunization also stimulated the production of CWP2-specific IgG antibodies that were mainly of the IgG2a isotype. Finally, challenge infection with live Giardia muris cysts revealed that mice receiving the CWP2-encoding DNA vaccine were able to reduce cyst shedding by approximately 60% compared to control mice. These results demonstrate, for the first time, the development of parasite transmission-blocking immunity at the intestinal level following the administration of a mucosal DNA vaccine delivered by S. typhimurium STM1.

  1. Phototransfection of mouse embryonic stem cells with plasmid DNA using femtosecond laser pulses

    CSIR Research Space (South Africa)

    Thobakgale, Setumo L

    2017-02-01

    Full Text Available efficient in photonic interactions with biological material. As of late, laser pulses have been used for drug and DNA delivery into cells via transient optical perforation of the cellular membrane. Thus in this study, we design and construct an optical...

  2. PlasmaDNA: a free, cross-platform plasmid manipulation program for molecular biology laboratories

    Directory of Open Access Journals (Sweden)

    Rainy Jeffrey

    2007-09-01

    Full Text Available Abstract Background Most molecular biology experiments, and the techniques associated with this field of study, involve a great deal of engineering in the form of molecular cloning. Like all forms of engineering, perfect information about the starting material is crucial for successful completion of design and strategies. Results We have generated a program that allows complete in silico simulation of the cloning experiment. Starting with a primary DNA sequence, PlasmaDNA looks for restriction sites, open reading frames, primer annealing sequences, and various common domains. The databases are easily expandable by the user to fit his most common cloning needs. PlasmaDNA can manage and graphically represent multiple sequences at the same time, and keeps in memory the overhangs at the end of the sequences if any. This means that it is possible to virtually digest fragments, to add the digestion products to the project, and to ligate together fragments with compatible ends to generate the new sequences. Polymerase Chain Reaction (PCR fragments can also be virtually generated using the primer database, automatically adding to the fragments any 5' extra sequences present in the primers. Conclusion PlasmaDNA is a program available both on Windows and Apple operating systems, designed to facilitate molecular cloning experiments by building a visual map of the DNA. It then allows the complete planning and simulation of the cloning experiment. It also automatically updates the new sequences generated in the process, which is an important help in practice. The capacity to maintain multiple sequences in the same file can also be used to archive the various steps and strategies involved in the cloning of each construct. The program is freely available for download without charge or restriction.

  3. Effect of the Plasmid-DNA Vaccination on Macroscopic and Microscopic Damage Caused by the Experimental Chronic Trypanosoma cruzi Infection in the Canine Model

    Directory of Open Access Journals (Sweden)

    Olivia Rodríguez-Morales

    2013-01-01

    Full Text Available The dog is considered the main domestic reservoir for Trypanosoma cruzi infection and a suitable experimental animal model to study the pathological changes during the course of Chagas disease (CD. Vaccine development is one of CD prevention methods to protect people at risk. Two plasmids containing genes encoding a trans-sialidase protein (TcSP and an amastigote-specific glycoprotein (TcSSP4 were used as DNA vaccines in a canine model. Splenomegaly was not found in either of the recombinant plasmid-immunized groups; however, cardiomegaly was absent in animals immunized only with the plasmid containing the TcSSP4 gene. The inflammation of subendocardial and myocardial tissues was prevented only with the immunization with TcSSP4 gene. In conclusion, the vaccination with these genes has a partial protective effect on the enlargement of splenic and cardiac tissues during the chronic CD and on microscopic hearth damage, since both plasmids prevented splenomegaly but only one avoided cardiomegaly, and the lesions in heart tissue of dog immunized with plasmid containing the TcSSP4 gene covered only subepicardial tissue.

  4. DNA-based species detection capabilities using laser transmission spectroscopy.

    Science.gov (United States)

    Mahon, A R; Barnes, M A; Li, F; Egan, S P; Tanner, C E; Ruggiero, S T; Feder, J L; Lodge, D M

    2013-01-06

    Early detection of invasive species is critical for effective biocontrol to mitigate potential ecological and economic damage. Laser transmission spectroscopy (LTS) is a powerful solution offering real-time, DNA-based species detection in the field. LTS can measure the size, shape and number of nanoparticles in a solution and was used here to detect size shifts resulting from hybridization of the polymerase chain reaction product to nanoparticles functionalized with species-specific oligonucleotide probes or with the species-specific oligonucleotide probes alone. We carried out a series of DNA detection experiments using the invasive freshwater quagga mussel (Dreissena bugensis) to evaluate the capability of the LTS platform for invasive species detection. Specifically, we tested LTS sensitivity to (i) DNA concentrations of a single target species, (ii) the presence of a target species within a mixed sample of other closely related species, (iii) species-specific functionalized nanoparticles versus species-specific oligonucleotide probes alone, and (iv) amplified DNA fragments versus unamplified genomic DNA. We demonstrate that LTS is a highly sensitive technique for rapid target species detection, with detection limits in the picomolar range, capable of successful identification in multispecies samples containing target and non-target species DNA. These results indicate that the LTS DNA detection platform will be useful for field application of target species. Additionally, we find that LTS detection is effective with species-specific oligonucleotide tags alone or when they are attached to polystyrene nanobeads and with both amplified and unamplified DNA, indicating that the technique may also have versatility for broader applications.

  5. Preparation and Characterization of Cationic PLA-PEG Nanoparticles for Delivery of Plasmid DNA

    Directory of Open Access Journals (Sweden)

    Zou Weiwei

    2009-01-01

    Full Text Available Abstract The purpose of the present work was to formulate and evaluate cationic poly(lactic acid-poly(ethylene glycol (PLA-PEG nanoparticles as novel non-viral gene delivery nano-device. Cationic PLA-PEG nanoparticles were prepared by nanoprecipitation method. The gene loaded nanoparticles were obtained by incubating the report gene pEGFP with cationic PLA-PEG nanoparticles. The physicochemical properties (e.g., morphology, particle size, surface charge, DNA binding efficiency and biological properties (e.g., integrity of the released DNA, protection from nuclease degradation, plasma stability, in vitro cytotoxicity, and in vitro transfection ability in Hela cells of the gene loaded PLA-PEG nanoparticles were evaluated, respectively. The obtained cationic PLA-PEG nanoparticles and gene loaded nanoparticles were both spherical in shape with average particle size of 89.7 and 128.9 nm, polydispersity index of 0.185 and 0.161, zeta potentials of +28.9 and +16.8 mV, respectively. The obtained cationic PLA-PEG nanoparticles with high binding efficiency (>95% could protect the loaded DNA from the degradation by nuclease and plasma. The nanoparticles displayed sustained-release properties in vitro and the released DNA maintained its structural and functional integrity. It also showed lower cytotoxicity than Lipofectamine 2000 and could successfully transfect gene into Hela cells even in presence of serum. It could be concluded that the established gene loaded cationic PLA-PEG nanoparticles with excellent properties were promising non-viral nano-device, which had potential to make cancer gene therapy achievable.

  6. Electric field-mediated transport of plasmid DNA in tumor interstitium in vivo.

    Science.gov (United States)

    Henshaw, Joshua W; Zaharoff, David A; Mossop, Brian J; Yuan, Fan

    2007-11-01

    Local pulsed electric field application is a method for improving non-viral gene delivery. Mechanisms of the improvement include electroporation and electrophoresis. To understand how electrophoresis affects pDNA delivery in vivo, we quantified the magnitude of electric field-induced interstitial transport of pDNA in 4T1 and B16.F10 tumors implanted in mouse dorsal skin-fold chambers. Four different electric pulse sequences were used in this study, each consisted of 10 identical pulses that were 100 or 400 V/cm in strength and 20 or 50 ms in duration. The interval between consecutive pulses was 1 s. The largest distance of transport was obtained with the 400 V/cm and 50 ms pulse, and was 0.23 and 0.22 microm/pulse in 4T1 and B16.F10 tumors, respectively. There were no significant differences in transport distances between 4T1 and B16.F10 tumors. Results from in vivo mapping and numerical simulations revealed an approximately uniform intratumoral electric field that was predominantly in the direction of the applied field. The data in the study suggested that interstitial transport of pDNA induced by a sequence of ten electric pulses was ineffective for macroscopic delivery of genes in tumors. However, the induced transport was more efficient than passive diffusion.

  7. KEY COMPARISON: CCQM-K61: Quantitation of a linearised plasmid DNA, based on a matched standard in a matrix of non-target DNA

    Science.gov (United States)

    Woolford, Alison; Holden, Marcia; Salit, Marc; Burns, Malcolm; Ellison, Stephen L. R.

    2009-01-01

    Key comparison CCQM-K61 was performed to demonstrate and document the capability of interested national metrology institutes in the determination of the quantity of specific DNA target in an aqueous solution. The study provides support for the following measurement claim: "Quantitation of a linearised plasmid DNA, based on a matched standard in a matrix of non-target DNA". The comparison was an activity of the Bioanalysis Working Group (BAWG) of the Comité Consultatif pour la Quantité de Matière and was coordinated by NIST (Gaithersburg, USA) and LGC (Teddington, UK). The following laboratories (in alphabetical order) participated in this key comparison. DMSC (Thailand); IRMM (European Union); KRISS (Republic of Korea); LGC (UK); NIM (China); NIST (USA); NMIA (Australia); NMIJ (Japan); VNIIM (Russian Federation) Good agreement was observed between the reported results of all nine of the participants. Uncertainty estimates did not account fully for the dispersion of results even after allowance for possible inhomogeneity in calibration materials. Preliminary studies suggest that the effects of fluorescence threshold setting might contribute to the excess dispersion, and further study of this topic is suggested Main text. To reach the main text of this paper, click on Final Report. Note that this text is that which appears in Appendix B of the BIPM key comparison database kcdb.bipm.org/. The final report has been peer-reviewed and approved for publication by the CCQM, according to the provisions of the CIPM Mutual Recognition Arrangement (MRA).

  8. Plasmid DNA studies in Lactobacillus plantarum strains isolated from olive fermentations: production of and immunity to plantaricin OL15 is associated to a 9.6 Kb plasmid (pOL15

    Directory of Open Access Journals (Sweden)

    Mourad, Kacem

    2007-06-01

    Full Text Available Previously 12 Lactobacillus plantarum strains were isolated from fermented olives. Among these, only L. plantarum OL15 produced bacteriocin (plantaricin OL15. In this study, the 12 strains were examined for plasmid DNA content. Of these, 9 strains have shown one to three plasmid bands ranging in size from 5.4 to 12.2 kb. L. plantarum OL15 exhibited one plasmid (9.6 kb which was named pOL15. After curing with novobiocin and ethidium bromide, the plasmid profile analysis of non producing derivatives, showed that the 9.6 kb plasmid pOL15 harbored by the parental strain had been lost in all cases and none of them regained the ability to produce plantaricin OL15 suggesting that the production of plantaricin OL15 is plasmid linked. Plantaricin OL15 was not inactived by amylase and lipase suggesting that plantaricin OL15 activity was not dependent on the presence of either a carbohydrate or lipid moiety. Plantaricin OL15 showed activity against lactic acid bacteria of different species and also against olive spoilage and phytopathogenic bacteria, including Pseudomonas and Erwinia.En un estudio previo, se aislaron 12 cepas de Lactobacillus plantarum a partir de aceitunas fermentadas. Entre ellas, solo L. plantarum OL15 produjo bacteriocinas (plantaricin OL15. En este estudio, se examinó el contenido de AND plásmido en las 12 cepas citadas. Entre ellas, 9 cepas han mostrado de una a tres bandas de plásmido con tamaños en el rango de 5.4 a 12.2 kb. L. plantarum OL15 exhibió un plásmido (9.6 kb que se denominó pOL15. Después del curado con novobiocina y bromuro de etidio, la pérdida del plásmido pOL15 asociada a la pérdida de su facultad para producir plantaricin OL15, sugiere que la producción de plantaricina OL15 está ligada al plásmido. La plantaricin OL15 no se inactivó por amilasa ni por lipasa sugiriendo que su actividad no es dependiente de la presencia de carbohidratos o lípidos. La plantaricina OL15 mostró actividad frente a

  9. Anchoring of self-assembled plasmid DNA/ anti-DNA antibody/cationic lipid micelles on bisphosphonate-modified stent for cardiovascular gene delivery

    Directory of Open Access Journals (Sweden)

    Ma G

    2013-03-01

    Full Text Available Guilei Ma,1,# Yong Wang,1,# Ilia Fishbein,2 Mei Yu,1 Linhua Zhang,1 Ivan S Alferiev,2 Jing Yang,1 Cunxian Song,1 Robert J Levy2 1Institute of Biomedical Engineering, Chinese Academy of Medical Sciences and Peking Union Medical College, Tianjin, People's Republic of China; 2Children's Hospital of Philadelphia, Abramson Research Building, Philadelphia, PA, USA #These authors contributed equally to this work Purpose: To investigate the anchoring of plasmid DNA/anti-DNA antibody/cationic lipid tri-complex (DAC micelles onto bisphosphonate-modified 316 L coronary stents for cardiovascular site-specific gene delivery. Methods: Stents were first modified with polyallylamine bisphosphonate (PAA-BP, thereby enabling the retention of a PAA-BP molecular monolayer that permits the anchoring (via vector-binding molecules of DAC micelles. DAC micelles were then chemically linked onto the PAA-BP-modified stents by using N-succinimidyl-3-(2-pyridyldithiol-propionate (SPDP as a crosslinker. Rhodamine-labeled DNA was used to assess the anchoring of DAC micelles, and radioactive-labeled antibody was used to evaluate binding capacity and stability. DAC micelles (encoding green fluorescent protein were tethered onto the PAA-BP-modified stents, which were assessed in cell culture. The presence of a PAA-BP molecular monolayer on the steel surface was confirmed by X-ray photoelectron spectroscopy and atomic force microscope analysis. Results: The anchoring of DAC micelles was generally uniform and devoid of large-scale patches of defects. Isotopic quantification confirmed that the amount of antibody chemically linked on the stents was 17-fold higher than that of the physical adsorbed control stents and its retention time was also significantly longer. In cell culture, numerous green fluorescent protein-positive cells were found on the PAA-BP modified stents, which demonstrated high localization and efficiency of gene delivery. Conclusion: The DAC micelle

  10. Longevity of rAAV vector and plasmid DNA in blood after intramuscular injection in nonhuman primates: implications for gene doping.

    Science.gov (United States)

    Ni, W; Le Guiner, C; Gernoux, G; Penaud-Budloo, M; Moullier, P; Snyder, R O

    2011-07-01

    Legitimate uses of gene transfer technology can benefit from sensitive detection methods to determine vector biodistribution in pre-clinical studies and in human clinical trials, and similar methods can detect illegitimate gene transfer to provide sports-governing bodies with the ability to maintain fairness. Real-time PCR assays were developed to detect a performance-enhancing transgene (erythropoietin, EPO) and backbone sequences in the presence of endogenous cellular sequences. In addition to developing real-time PCR assays, the steps involved in DNA extraction, storage and transport were investigated. By real-time PCR, the vector transgene is distinguishable from the genomic DNA sequence because of the absence of introns, and the vector backbone can be identified by heterologous gene expression control elements. After performance of the assays was optimized, cynomolgus macaques received a single dose by intramuscular (IM) injection of plasmid DNA, a recombinant adeno-associated viral vector serotype 1 (rAAV1) or a rAAV8 vector expressing cynomolgus macaque EPO. Macaques received a high plasmid dose intended to achieve a significant, but not life-threatening, increase in hematocrit. rAAV vectors were used at low doses to achieve a small increase in hematocrit and to determine the limit of sensitivity for detecting rAAV sequences by single-step PCR. DNA extracted from white blood cells (WBCs) was tested to determine whether WBCs can be collaterally transfected by plasmid or transduced by rAAV vectors in this context, and can be used as a surrogate marker for gene doping. We demonstrate that IM injection of a conventional plasmid and rAAV vectors results in the presence of DNA that can be detected at high levels in blood before rapid elimination, and that rAAV genomes can persist for several months in WBCs.

  11. Modeling the yield of double-strand breaks due to formation of multiply damaged sites in irradiated plasmid DNA

    International Nuclear Information System (INIS)

    Xapsos, M.A.; Pogozelski, W.K.

    1996-01-01

    Although double-strand breaks have long been recognized as an important type of DNa lesion, it is well established that this broad class of damage does not correlate well with indicators of the effectiveness of radiation as the cellular level. Assays of double-strand breaks do not distinguish the degree of complexity or clustering of singly damaged sites produced in a single energy deposition event, which is currently hypothesized to be key to understanding cellular end points. As a step toward this understanding, double-strand breaks that are formed proportionally to dose in plasmid DNA are analyzed from the mechanistic aspect to evaluate the yield that arises from multiply damaged sites as hypothesized by Ward (Prog. Nucleic Acid Res. Mol. Biol. 35, 95-125, 1988) and Goodhead (Int. J. Radiat. Biol. 65, 7-17, 1994) as opposed to the yield that arises form single hydroxyl radicals as hypothesized by Siddiqi and Bothe (Radiat. Res. 112, 449-463, 1987). For low-LET radiation such as γ rays, the importance of multiply damaged sites is shown to increase with the solution's hydroxyl radical scavenging capacity. For moderately high-LET radiation such as 100 keV/μm helium ions, a much different behavior is observed. In this case, a large fraction of double-strand breaks are formed as a result of multiply damaged sties over a broad range of scavenging conditions. Results also indicate that the RBE for common cellular end points correlates more closely with the RBE for common cellular end points correlates more closely with the RBE for multiply damaged sites than with the RBE for total double-strand breaks over a range of LET up to at least 100 keV/μm. 22 refs., 3 figs., 2 tabs

  12. Functional activity of plasmid DNA after entry into the atmosphere of earth investigated by a new biomarker stability assay for ballistic spaceflight experiments.

    Directory of Open Access Journals (Sweden)

    Cora S Thiel

    Full Text Available Sounding rockets represent an excellent platform for testing the influence of space conditions during the passage of Earth's atmosphere and re-entry on biological, physical and chemical experiments for astrobiological purposes. We designed a robust functionality biomarker assay to analyze the biological effects of suborbital spaceflights prevailing during ballistic rocket flights. During the TEXUS-49 rocket mission in March 2011, artificial plasmid DNA carrying a fluorescent marker (enhanced green fluorescent protein: EGFP and an antibiotic resistance cassette (kanamycin/neomycin was attached on different positions of rocket exterior; (i circular every 90 degree on the outer surface concentrical of the payload, (ii in the grooves of screw heads located in between the surface application sites, and (iii on the surface of the bottom side of the payload. Temperature measurements showed two major peaks at 118 and 130 °C during the 780 seconds lasting flight on the inside of the recovery module, while outer gas temperatures of more than 1000 °C were estimated on the sample application locations. Directly after retrieval and return transport of the payload, the plasmid DNA samples were recovered. Subsequent analyses showed that DNA could be recovered from all application sites with a maximum of 53% in the grooves of the screw heads. We could further show that up to 35% of DNA retained its full biological function, i.e., mediating antibiotic resistance in bacteria and fluorescent marker expression in eukaryotic cells. These experiments show that our plasmid DNA biomarker assay is suitable to characterize the environmental conditions affecting DNA during an atmospheric transit and the re-entry and constitute the first report of the stability of DNA during hypervelocity atmospheric transit indicating that sounding rocket flights can be used to model the high-speed atmospheric entry of organics-laden artificial meteorites.

  13. Simple method for identification of plasmid-coded proteins

    International Nuclear Information System (INIS)

    Sancar, A.; Hack, A.M.; Rupp, W.D.

    1979-01-01

    Proteins encoded by plasmid DNA are specifically labeled in uv-irradiated cells of Escherichia coli carrying recA and uvrA mutations because extensive degradation of the chromosome DNA occurs concurrently with amplification of plasmid DNA

  14. Plasmid origin of replication of herpesvirus papio: DNA sequence and enhancer function.

    Science.gov (United States)

    Loeb, D D; Sung, N S; Pesano, R L; Sexton, C J; Hutchison, C; Pagano, J S

    1990-01-01

    Herpesvirus papio (HVP) is a lymphotropic virus of baboons which is related to Epstein-Barr virus (EBV) and produces latent infection. The nucleotide sequence of the 5,775-base-pair (bp) EcoRI K fragment of HVP, which has previously been shown to confer the ability to replicate autonomously, has been determined. Within this DNA fragment is a region which bears structural and sequence similarity to the ori-P region of EBV. The HVP ori-P region has a 10- by 26-bp tandem array which is related to the 20- by 30-bp tandem array from the EBV ori-P region. In HVP there is an intervening region of 764 bp followed by five partial copies of the 26-bp monomer. Both the EBV and HVP 3' regions have the potential to form dyad structures which, however, differ in arrangement. We also demonstrate that a transcriptional enhancer which requires transactivation by a virus-encoded factor is present in the HVP ori-P. Images PMID:2159548

  15. Is passive transmission of non-viral vectors through artificial insemination of sperm-DNA mixtures sufficient for chicken transgenesis?

    Science.gov (United States)

    CHAPARIAN, Shahram; ABDULAHNEJAD, Ahad; RASHIDI, Farzad; TOGHYANI, Majid; GHEISARI, Abbasali; EGHBALSAIED, Shahin

    2016-01-01

    DNA uptake in the post-acrosomal region of the spermatozoa takes place exclusively in immotile spermatozoa that are naturally unable to fertilize eggs. The present study aimed to assess whether passive transmission of non-viral vectors to the surrounding areas of chicken embryos could be an alternate mechanism in chicken sperm-mediated gene transfer. First, the presence of nucleases in rooster seminal plasma was evaluated. Semen ejaculates from five roosters were centrifuged and the supernatant was incubated with pBL2 for 1 h. A robust nuclease cocktail was detected in the rooster semen. To overcome these nucleases, plasmid-TransIT combinations were incubated with semen for 1 h. Incubation of exogenous DNA in the lipoplex structure could considerably bypass the semen nuclease effect. Then, intravaginal insemination of 1 × 109 sperm mixed with lipoplexes (40 µg pBL2:40 µl TransIT) was carried out in 15 virgin hens. Neither the epithelial tissue from the inseminated female reproductive tracts nor the produced embryos following artificial insemination showed the transgene. To remove any bias in the transgene transmission possibility, the plasmid-TransIT admixture was directly injected in close vicinity of the embryos in newly laid eggs. Nonetheless, none of the produced fetuses or chicks carried the transgene. In conclusion, the results of the present study revealed a nuclease admixture in rooster seminal plasma, and passive/active transmission of the non-viral vector into close vicinity of the chicken embryo was inefficient for producing transgenic chicks. PMID:26935324

  16. Antimicrobial susceptibility pattern and plasmid-mediated ...

    African Journals Online (AJOL)

    negative Staphylococci (CoNS) were isolated from clinical samples and isolates subjected to antibiotic susceptibility testing, plasmid curing and plasmid DNA isolation. Result: The highest percentages isolates were recovered from urine samples and ...

  17. Highly Effective Non-Viral Antitumor Gene Therapy System Comprised of Biocompatible Small Plasmid Complex Particles Consisting of pDNA, Anionic Polysaccharide, and Fully Deprotected Linear Polyethylenimine

    Directory of Open Access Journals (Sweden)

    Yoshiyuki Koyama

    2015-07-01

    Full Text Available We have reported that ternary complexes of plasmid DNA with conventional linear polyethylenimine (l-PEI and certain polyanions were very stably dispersed, and, with no cryoprotectant, they could be freeze-dried and re-hydrated without the loss of transfection ability. These properties enabled the preparation of a concentrated suspension of very small pDNA complex, by preparing the complexes at highly diluted conditions, followed by condensation via lyophilization-and-rehydration procedure. Recently, a high potency linear polyethylenimine having no residual protective groups, i.e., Polyethylenimine “Max” (PEI “Max”, is available, which has been reported to induce much higher gene expression than conventional l-PEI. We tried to prepare the small DNA/PEI “Max”/polyanion complexes by a similar freeze-drying method. Small complex particles could be obtained without apparent aggregation, but transfection activity of the rehydrated complexes was severely reduced. Complex-preparation conditions were investigated in details to achieve the freeze-dried DNA/PEI “Max”/polyanion small ternary complexes with high transfection efficiency. DNA/PEI “Max”/polyanion complexes containing cytokine-coding plasmids were then prepared, and their anti-tumor therapeutic efficacy was examined in tumor-bearing mice.

  18. In Vivo Transmission of an IncA/C Plasmid in Escherichia coli Depends on Tetracycline Concentration, and Acquisition of the Plasmid Results in a Variable Cost of Fitness.

    Science.gov (United States)

    Johnson, Timothy J; Singer, Randall S; Isaacson, Richard E; Danzeisen, Jessica L; Lang, Kevin; Kobluk, Kristi; Rivet, Bernadette; Borewicz, Klaudyna; Frye, Jonathan G; Englen, Mark; Anderson, Janet; Davies, Peter R

    2015-05-15

    IncA/C plasmids are broad-host-range plasmids enabling multidrug resistance that have emerged worldwide among bacterial pathogens of humans and animals. Although antibiotic usage is suspected to be a driving force in the emergence of such strains, few studies have examined the impact of different types of antibiotic administration on the selection of plasmid-containing multidrug resistant isolates. In this study, chlortetracycline treatment at different concentrations in pig feed was examined for its impact on selection and dissemination of an IncA/C plasmid introduced orally via a commensal Escherichia coli host. Continuous low-dose administration of chlortetracycline at 50 g per ton had no observable impact on the proportions of IncA/C plasmid-containing E. coli from pig feces over the course of 35 days. In contrast, high-dose administration of chlortetracycline at 350 g per ton significantly increased IncA/C plasmid-containing E. coli in pig feces (P IncA/C plasmid to other indigenous E. coli hosts. There was no evidence of conjugal transfer of the IncA/C plasmid to bacterial species other than E. coli. In vitro competition assays demonstrated that bacterial host background substantially impacted the cost of IncA/C plasmid carriage in E. coli and Salmonella. In vitro transfer and selection experiments demonstrated that tetracycline at 32 μg/ml was necessary to enhance IncA/C plasmid conjugative transfer, while subinhibitory concentrations of tetracycline in vitro strongly selected for IncA/C plasmid-containing E. coli. Together, these experiments improve our knowledge on the impact of differing concentrations of tetracycline on the selection of IncA/C-type plasmids. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  19. Effect of vanillin on methylene blue plus light-induced single-strand breaks in plasmid pBR322 DNA.

    Science.gov (United States)

    Kumar, S S; Ghosh, A; Devasagayam, T P; Chauhan, P S

    2000-09-20

    The ability of vanillin (4-hydroxy-3-methoxybenzaldehyde), a naturally occurring food flavouring agent, in inhibiting photosensitization-induced single-strand breaks (ssbs) in plasmid pBR322 DNA has been examined in an in vitro system, independent of DNA repair/replication processes. Photosensitization of DNA with methylene blue, visible light and oxygen, induced ssbs resulting in the production of open circular form (OC form) in a concentration-dependent manner. The yield of OC form induced by photosensitization was increased several-fold by deuteration of the buffer and was found to be inhibited by sodium azide, a scavenger of singlet oxygen (1O(2)). Vanillin, per se, did not induce but inhibited photosensitization-induced ssbs in plasmid DNA, at millimolar concentrations. The inhibitory effect of vanillin was both concentration- and time-dependent. On a molar basis, vanillin was, however, less effective than trolox, a water-soluble analogue of alpha-tocopherol. Photosensitization by methylene blue system generates singlet oxygen, as one of the major components of ROS. Therefore, interaction of singlet oxygen with vanillin was investigated. The rate constant of vanillin with 1O(2) was estimated to be 5.93x10(7)M(-1)s(-1) and that of sodium azide as 2. 7x10(8)M(-1)s(-1). The present investigations show that vanillin can protect against photosensitization-induced ssbs in the plasmid pBR322 DNA, and this effect may partly be due to its ability to scavenge 1O(2).

  20. The effect of dimethyl sulfoxide on the induction of DNA strand breaks in plasmid DNA and colony formation of PC Cl3 mammalian cells by alpha-, beta-, and Auger electron emitters (223)Ra, (188)Re, and (99m)Tc.

    Science.gov (United States)

    Runge, Roswitha; Oehme, Liane; Kotzerke, Jörg; Freudenberg, Robert

    2016-12-01

    DNA damage occurs as a consequence of both direct and indirect effects of ionizing radiation. The severity of DNA damage depends on the physical characteristics of the radiation quality, e.g., the linear energy transfer (LET). There are still contrary findings regarding direct or indirect interactions of high-LET emitters with DNA. Our aim is to determine DNA damage and the effect on cellular survival induced by (223)Ra compared to (188)Re and (99m)Tc modulated by the radical scavenger dimethyl sulfoxide (DMSO). Radioactive solutions of (223)Ra, (188)Re, or (99m)Tc were added to either plasmid DNA or to PC Cl3 cells in the absence or presence of DMSO. Following irradiation, single strand breaks (SSB) and double strand breaks (DSB) in plasmid DNA were analyzed by gel electrophoresis. To determine the radiosensitivity of the rat thyroid cell line (PC Cl3), survival curves were performed using the colony formation assay. Exposure to 120 Gy of (223)Ra, (188)Re, or (99m)Tc leads to maximal yields of SSB (80 %) in plasmid DNA. Irradiation with 540 Gy (223)Ra and 500 Gy (188)Re or (99m)Tc induced 40, 28, and 64 % linear plasmid conformations, respectively. DMSO prevented the SSB and DSB in a similar way for all radionuclides. However, with the α-emitter (223)Ra, a low level of DSB could not be prevented by DMSO. Irradiation of PC Cl3 cells with (223)Ra, (188)Re, and (99m)Tc pre-incubated with DMSO revealed enhanced survival fractions (SF) in comparison to treatment without DMSO. Protection factors (PF) were calculated using the fitted survival curves. These factors are 1.23 ± 0.04, 1.20 ± 0.19, and 1.34 ± 0.05 for (223)Ra, (188)Re, and (99m)Tc, respectively. For (223)Ra, as well as for (188)Re and (99m)Tc, dose-dependent radiation effects were found applicable for plasmid DNA and PC Cl3 cells. The radioprotection by DMSO was in the same range for high- and low-LET emitter. Overall, the results indicate the contribution of mainly indirect radiation

  1. Persistence Mechanisms of Conjugative Plasmids

    DEFF Research Database (Denmark)

    Bahl, Martin Iain; Hansen, Lars H.; Sørensen, Søren Johannes

    2009-01-01

    Are plasmids selfish parasitic DNA molecules or an integrated part of the bacterial genome? This chapter reviews the current understanding of the persistence mechanisms of conjugative plasmids harbored by bacterial cells and populations. The diversity and intricacy of mechanisms affecting the suc...

  2. Plasmid DNA linearization in the antibacterial action of a new fluorescent Ag nanoparticle-paracetamol dimer composite

    Science.gov (United States)

    Sahoo, Amaresh Kumar; Sk, Md Palashuddin; Ghosh, Siddhartha Sankar; Chattopadhyay, Arun

    2011-10-01

    Herein, we report the generation of a composite comprised of p-hydroxyacetanilide dimer and Ag nanoparticles (NPs) by reaction of AgNO3 and p-hydroxyacetanilide. The formation of the composite was established by UV-vis, FTIR and NMR spectroscopy, transmission electron microscopy and X-ray diffraction along with substantiation by mass spectrometry. Interestingly, the composite exhibited an emission spectrum with a peak at 435 nm when excited by light of wavelength 320 nm. The composite showed superior antimicrobial activity with respect to its individual components against a wide range of Gram positive and Gram negative bacteria at relatively low concentrations of Ag NPs and at which there was no apparent cytotoxicity against mammalian cells. Our results suggest that the composite strongly interacted with the bacterial cell walls leading to cell bursting. Interestingly, enhancement in the reactive oxygen species (ROS) generation in bacteria was observed in the presence of the composite. It is proposed that the ROS generation led to oxidation of the dimer to N-acetyl-p-benzoquinone imine (NAPQI). The generated NAPQI acted as a DNA gyrase inhibitor causing cell death following linearization of DNA.Herein, we report the generation of a composite comprised of p-hydroxyacetanilide dimer and Ag nanoparticles (NPs) by reaction of AgNO3 and p-hydroxyacetanilide. The formation of the composite was established by UV-vis, FTIR and NMR spectroscopy, transmission electron microscopy and X-ray diffraction along with substantiation by mass spectrometry. Interestingly, the composite exhibited an emission spectrum with a peak at 435 nm when excited by light of wavelength 320 nm. The composite showed superior antimicrobial activity with respect to its individual components against a wide range of Gram positive and Gram negative bacteria at relatively low concentrations of Ag NPs and at which there was no apparent cytotoxicity against mammalian cells. Our results suggest that the

  3. Inhibition of gamma-radiation induced DNA damage in plasmid pBR322 by TMG, a water-soluble derivative of vitamin E.

    Science.gov (United States)

    Rajagopalan, Rema; Wani, Khalida; Huilgol, Nagaraj G; Kagiya, Tsutomu V; Nair, Cherupally K Krishnan

    2002-06-01

    Alpha-tocopherol monoglucoside (TMG), a water-soluble derivative of alpha-tocopherol, has been examined for its ability to protect DNA against radiation-induced strand breaks. Gamma radiation, up to a dose of 6 Gy (dose rate, 0.7 Gy/minute), induced a dose-dependent increase in single strand breaks (SSBs) in plasmid pBR322 DNA. TMG inhibited the formation of gamma-radiation induced DNA single strand breaks (SSBs) in a concentration-dependent manner; 500 microM of TMG protected the single strand breaks completely. It also protected thymine glycol formation induced by gamma-radiation in a dose-dependent manner, based on an estimation of thymine glycol by HPLC.

  4. Inhibition of {gamma}-radiation induced DNA damage in plasmid pBR322 by TMG, a water-soluble derivative of vitamin E

    Energy Technology Data Exchange (ETDEWEB)

    Rajagopalan, R.; Nair, C.K.K. [Bhabha Atomic Research Centre, Mumbai (India); Wani, K.; Huilgol, N.G. [Nanavati Hospital and MRC, Vile Parle (India); Kagiya, Tsutomu V. [Kinki Research Foundation, Kyoto (Japan)

    2002-06-01

    Alpha-tocopherol monoglucoside (TMG), a water-soluble derivative of {alpha}-tocopherol, has been examined for its ability to protect DNA against radiation-induced strand breaks. Gamma radiation, up to a dose of 6 Gy (dose rate, 0.7 Gy/minute), induced a dose-dependent increase in single strand breaks (SSBs) in plasmid pBR322 DNA. TMG inhibited the formation of {gamma}-radiation induced DNA single strand breaks (SSBs) in a concentration-dependent manner; 500 {mu}M of TMG protected the single strand breaks completely. It also protected thymine glycol formation induced by {gamma}-radiation in a dose-dependent manner, based on an estimation of thymine glycol by HPLC. (author)

  5. Inhibition of γ-radiation induced DNA damage in plasmid pBR322 by TMG, a water-soluble derivative of vitamin E

    International Nuclear Information System (INIS)

    Rajagopalan, R.; Nair, C.K.K.; Wani, K.; Huilgol, N.G.; Kagiya, Tsutomu V.

    2002-01-01

    Alpha-tocopherol monoglucoside (TMG), a water-soluble derivative of α-tocopherol, has been examined for its ability to protect DNA against radiation-induced strand breaks. Gamma radiation, up to a dose of 6 Gy (dose rate, 0.7 Gy/minute), induced a dose-dependent increase in single strand breaks (SSBs) in plasmid pBR322 DNA. TMG inhibited the formation of γ-radiation induced DNA single strand breaks (SSBs) in a concentration-dependent manner; 500 μM of TMG protected the single strand breaks completely. It also protected thymine glycol formation induced by γ-radiation in a dose-dependent manner, based on an estimation of thymine glycol by HPLC. (author)

  6. Effect of West Nile virus DNA-plasmid vaccination on response to live virus challenge in red-tailed hawks (Buteo jamaicensis).

    Science.gov (United States)

    Redig, Patrick T; Tully, Thomas N; Ritchie, Branson W; Roy, Alma F; Baudena, M Alexandra; Chang, Gwong-Jen J

    2011-08-01

    To evaluate the safety and efficacy of an experimental adjuvanted DNA-plasmid vaccine against West Nile virus (WNV) in red-tailed hawks (Buteo jamaicensis). 19 permanently disabled but otherwise healthy red-tailed hawks of mixed ages and both sexes without detectable serum antibodies against WNV. Hawks were injected IM with an experimental WNV DNA-plasmid vaccine in an aluminum-phosphate adjuvant (n = 14) or with the adjuvant only (control group; 5). All birds received 2 injections at a 3-week interval. Blood samples for serologic evaluation were collected before the first injection and 4 weeks after the second injection (day 0). At day 0, hawks were injected SC with live WNV. Pre- and postchallenge blood samples were collected at intervals for 14 days for assessment of viremia and antibody determination; oropharyngeal and cloacal swabs were collected for assessment of viral shedding. Vaccination was not associated with morbidity or deaths. Three of the vaccinated birds seroconverted after the second vaccine injection; all other birds seroconverted following the live virus injection. Vaccinated birds had significantly less severe viremia and shorter and less-intense shedding periods, compared with the control birds. Use of the WNV DNA-plasmid vaccine in red-tailed hawks was safe, and vaccination attenuated but did not eliminate both the viremia and the intensity of postchallenge shedding following live virus exposure. Further research is warranted to conclusively determine the efficacy of this vaccine preparation for protection of red-tailed hawks and other avian species against WNV-induced disease.

  7. Development of a novel rDNA based plasmid for enhanced cell surface display on Yarrowia lipolytica

    CSIR Research Space (South Africa)

    Bulani, S

    2012-05-01

    Full Text Available (YlCWP1). mCherry was used as a model protein to assess the efficiency of the constructed plasmid. Y. lipolytica transformants harbouring the expression cassettes showed a purple colour phenotype on selective YNB-casamino plates as compared to control...

  8. Plasmids in Gram negatives: molecular typing of resistance plasmids.

    Science.gov (United States)

    Carattoli, Alessandra

    2011-12-01

    A plasmid is defined as a double stranded, circular DNA molecule capable of autonomous replication. By definition, plasmids do not carry genes essential for the growth of host cells under non-stressed conditions but they have systems which guarantee their autonomous replication also controlling the copy number and ensuring stable inheritance during cell division. Most of the plasmids confer positively selectable phenotypes by the presence of antimicrobial resistance genes. Plasmids evolve as an integral part of the bacterial genome, providing resistance genes that can be easily exchanged among bacteria of different origin and source by conjugation. A multidisciplinary approach is currently applied to study the acquisition and spread of antimicrobial resistance in clinically relevant bacterial pathogens and the established surveillance can be implemented by replicon typing of plasmids. Particular plasmid families are more frequently detected among Enterobacteriaceae and play a major role in the diffusion of specific resistance genes. For instance, IncFII, IncA/C, IncL/M, IncN and IncI1 plasmids carrying extended-spectrum beta-lactamase genes and acquired AmpC genes are currently considered to be "epidemic resistance plasmids", being worldwide detected in Enterobacteriaceae of different origin and sources. The recognition of successful plasmids is an essential first step to design intervention strategies preventing their spread. Copyright © 2011 Elsevier GmbH. All rights reserved.

  9. Electron Resonance Decay into a Biological Function: Decrease in Viability of E. coli Transformed by Plasmid DNA Irradiated with 0.5-18 eV Electrons.

    Science.gov (United States)

    Kouass Sahbani, S; Cloutier, P; Bass, A D; Hunting, D J; Sanche, L

    2015-10-01

    Transient negative ions (TNIs) are ubiquitous in electron-molecule scattering at low electron impact energies (0-20 eV) and are particularly effective in damaging large biomolecules. Because ionizing radiation generates mostly 0-20 eV electrons, TNIs are expected to play important roles in cell mutagenesis and death during radiotherapeutic cancer treatment, although this hypothesis has never been directly verified. Here, we measure the efficiency of transforming E. coli bacteria by inserting into the cells, pGEM-3ZfL(-) plasmid DNA that confers resistance to the antibiotic ampicillin. Before transformation, plasmids are irradiated with electrons of specific energies between 0.5 and 18 eV. The loss of transformation efficiency plotted as a function of irradiation energy reveals TNIs at 5.5 and 9.5 eV, corresponding to similar states observed in the yields of DNA double strand breaks. We show that TNIs are detectable in the electron-energy dependence of a biological process and can decrease cell viability.

  10. Quantification of DNA by Agarose Gel Electrophoresis and Analysis of the Topoisomers of Plasmid and M13 DNA Following Treatment with a Restriction Endonuclease or DNA Topoisomerase I

    Science.gov (United States)

    Tweedie, John W.; Stowell, Kathryn M.

    2005-01-01

    A two-session laboratory exercise for advanced undergraduate students in biochemistry and molecular biology is described. The first session introduces students to DNA quantification by ultraviolet absorbance and agarose gel electrophoresis followed by ethidium bromide staining. The second session involves treatment of various topological forms of…

  11. Extended-Spectrum-Beta-Lactamase- and Plasmid-Encoded Cephamycinase-Producing Enterobacteria in the Broiler Hatchery as a Potential Mode of Pseudo-Vertical Transmission.

    Science.gov (United States)

    Projahn, Michaela; Daehre, Katrin; Roesler, Uwe; Friese, Anika

    2017-01-01

    Antimicrobial resistance through extended-spectrum beta-lactamases (ESBLs) and transferable (plasmid-encoded) cephamycinases (pAmpCs) represents an increasing problem in human and veterinary medicine. The presence of ESBL-/pAmpC-producing commensal enterobacteria in farm animals, such as broiler chickens, is considered one possible source of food contamination and could therefore also be relevant for human colonization. Studies on transmission routes along the broiler production chain showed that 1-day-old hatchlings are already affected. In this study, ESBL-/pAmpC-positive broiler parent flocks and their corresponding eggs, as well as various environmental and air samples from the hatchery, were analyzed. The eggs were investigated concerning ESBL-/pAmpC-producing enterobacteria on the outer eggshell surface (before/after disinfection), the inner eggshell surface, and the egg content. Isolates were analyzed concerning their species, their phylogroup in the case of Escherichia coli strains, the respective resistance genes, and the phenotypical antibiotic resistance. Of the tested eggs, 0.9% (n = 560) were contaminated on their outer shell surface. Further analyses using pulsed-field gel electrophoresis showed a relationship of these strains to those isolated from the corresponding parent flocks, which demonstrates a pseudo-vertical transfer of ESBL-/pAmpC-producing enterobacteria into the hatchery. Resistant enterobacteria were also found in environmental samples from the hatchery, such as dust or surfaces which could pose as a possible contamination source for the hatchlings. All 1-day-old chicks tested negative directly after hatching. The results show a possible entry of ESBL-/pAmpC-producing enterobacteria from the parent flocks into the hatchery; however, the impact of the hatchery on colonization of the hatchlings seems to be low. ESBL-/pAmpC-producing enterobacteria occur frequently in broiler-fattening farms. Recent studies investigated the prevalence and

  12. Safety and immunogenicity of an HIV-1 gag DNA vaccine with or without IL-12 and/or IL-15 plasmid cytokine adjuvant in healthy, HIV-1 uninfected adults.

    Directory of Open Access Journals (Sweden)

    Spyros A Kalams

    Full Text Available DNA vaccines are a promising approach to vaccination since they circumvent the problem of vector-induced immunity. DNA plasmid cytokine adjuvants have been shown to augment immune responses in small animals and in macaques.We performed two first in human HIV vaccine trials in the US, Brazil and Thailand of an RNA-optimized truncated HIV-1 gag gene (p37 DNA derived from strain HXB2 administered either alone or in combination with dose-escalation of IL-12 or IL-15 plasmid cytokine adjuvants. Vaccinations with both the HIV immunogen and cytokine adjuvant were generally well-tolerated and no significant vaccine-related adverse events were identified. A small number of subjects developed asymptomatic low titer antibodies to IL-12 or IL-15. Cellular immunogenicity following 3 and 4 vaccinations was poor, with response rates to gag of 4.9%/8.7% among vaccinees receiving gag DNA alone, 0%/11.5% among those receiving gag DNA+IL-15, and no responders among those receiving DNA+high dose (1500 ug IL-12 DNA. However, after three doses, 44.4% (4/9 of vaccinees receiving gag DNA and intermediate dose (500 ug of IL-12 DNA demonstrated a detectable cellular immune response.This combination of HIV gag DNA with plasmid cytokine adjuvants was well tolerated. There were minimal responses to HIV gag DNA alone, and no apparent augmentation with either IL-12 or IL-15 plasmid cytokine adjuvants. Despite the promise of DNA vaccines, newer formulations or methods of delivery will be required to increase their immunogenicity.Clinicaltrials.gov NCT00115960 NCT00111605.

  13. Mechanisms of Evolution in High-Consequence Drug Resistance Plasmids.

    Science.gov (United States)

    He, Susu; Chandler, Michael; Varani, Alessandro M; Hickman, Alison B; Dekker, John P; Dyda, Fred

    2016-12-06

    The dissemination of resistance among bacteria has been facilitated by the fact that resistance genes are usually located on a diverse and evolving set of transmissible plasmids. However, the mechanisms generating diversity and enabling adaptation within highly successful resistance plasmids have remained obscure, despite their profound clinical significance. To understand these mechanisms, we have performed a detailed analysis of the mobilome (the entire mobile genetic element content) of a set of previously sequenced carbapenemase-producing Enterobacteriaceae (CPE) from the National Institutes of Health Clinical Center. This analysis revealed that plasmid reorganizations occurring in the natural context of colonization of human hosts were overwhelmingly driven by genetic rearrangements carried out by replicative transposons working in concert with the process of homologous recombination. A more complete understanding of the molecular mechanisms and evolutionary forces driving rearrangements in resistance plasmids may lead to fundamentally new strategies to address the problem of antibiotic resistance. The spread of antibiotic resistance among Gram-negative bacteria is a serious public health threat, as it can critically limit the types of drugs that can be used to treat infected patients. In particular, carbapenem-resistant members of the Enterobacteriaceae family are responsible for a significant and growing burden of morbidity and mortality. Here, we report on the mechanisms underlying the evolution of several plasmids carried by previously sequenced clinical Enterobacteriaceae isolates from the National Institutes of Health Clinical Center (NIH CC). Our ability to track genetic rearrangements that occurred within resistance plasmids was dependent on accurate annotation of the mobile genetic elements within the plasmids, which was greatly aided by access to long-read DNA sequencing data and knowledge of their mechanisms. Mobile genetic elements such as

  14. Behavior of IncQ Plasmids in Agrobacterium tumefaciens

    NARCIS (Netherlands)

    Hille, Jacques; Schilperoort, Rob

    1981-01-01

    Inc-Q plasmids were introduced into Agrobacterium tumefuciens, by mobilization from Escherichia coli with an Inc-P plasmid, or by transformation with purified plasmid DNA. It was found that they were stably maintained. The presence of an Inc-Q plasmid did not influence tumorigenicity. These results

  15. Low-Molecular Weight Polyethylenimine Modified with Pluronic 123 and RGD- or Chimeric RGD-NLS Peptide: Characteristics and Transfection Efficacy of Their Complexes with Plasmid DNA

    Directory of Open Access Journals (Sweden)

    Jing Hu

    2016-05-01

    Full Text Available To solve the problem of transfection efficiency vs. cytotoxicity and tumor-targeting ability when polyethylenimine (PEI was used as a nonviral gene delivery vector, new degradable PEI polymers were synthesized via cross-linking low-molecular-weight PEI with Pluronic P123 and then further coupled with a targeting peptide R4 (RGD and a bifunctional R11 (RGD-NLS, which were termed as P123-PEI-R4 and P123-PEI-R11, respectively. Agarose gel electrophoresis showed that both P123-PEI-R4 and P123-PEI-R11 efficaciously condense plasmid DNA at a polymer-to-pDNA w/w ratio of 3.0 and 0.4, respectively. The polyplexes were stable in the presence of serum and could protect plasmid DNA against DNaseI. They had uniform spherical nanoparticles with appropriate sizes around 100–280 nm and zeta-potentials about +40 mV. Furthermore, in vitro experiments showed that these polyplexes had lower cytotoxicity at any concentration compared with PEI 25 kDa, thus giving promise to high transfection efficiency as compared with another P123-PEI derivate conjugated with trifunctional peptide RGD-TAT-NLS (P123-PEI-R18. More importantly, compared with the other polymers, P123-PEI-R11 showed the highest transfection efficiency with relatively lower cytotoxicity at any concentration, indicating that the new synthetic polymer P123-PEI-R11 could be used as a safe and efficient gene deliver vector.

  16. Hydrodynamic delivery of plasmid DNA encoding human FcγR-Ig dimers blocks immune-complex mediated inflammation in mice.

    Science.gov (United States)

    Shashidharamurthy, R; Machiah, D; Bozeman, E N; Srivatsan, S; Patel, J; Cho, A; Jacob, J; Selvaraj, P

    2012-09-01

    Therapeutic use and function of recombinant molecules can be studied by the expression of foreign genes in mice. In this study, we have expressed human Fcγ receptor-Ig fusion molecules (FcγR-Igs) in mice by administering FcγR-Ig plasmid DNAs hydrodynamically and compared their effectiveness with purified molecules in blocking immune-complex (IC)-mediated inflammation in mice. The concentration of hydrodynamically expressed FcγR-Igs (CD16A(F)-Ig, CD32A(R)-Ig and CD32A(H)-Ig) reached a maximum of 130 μg ml(-1) of blood within 24 h after plasmid DNA administration. The in vivo half-life of FcγR-Igs was found to be 9-16 days and western blot analysis showed that the FcγR-Igs were expressed as a homodimer. The hydrodynamically expressed FcγR-Igs blocked 50-80% of IC-mediated inflammation up to 3 days in a reverse passive Arthus reaction model. Comparative analysis with purified molecules showed that hydrodynamically expressed FcγR-Igs are more efficient than purified molecules in blocking IC-mediated inflammation and had a higher half-life. In summary, these results suggest that the administration of a plasmid vector with the FcγR-Ig gene can be used to study the consequences of blocking IC binding to FcγRs during the development of inflammatory diseases. This approach may have potential therapeutic value in treating IC-mediated inflammatory autoimmune diseases such as lupus, arthritis and autoimmune vasculitis.

  17. Hydrodynamic delivery of plasmid DNA encoding human Fc?R-Ig dimers blocks immune-complex mediated inflammation in mice

    OpenAIRE

    Shashidharamurthy, Rangaiah; Machiah, Deepa; Bozeman, Erica N.; Srivatsan, Sanjay; Patel, Jaina; Cho, Alice; Jacob, Joshy; Selvaraj, Periasamy

    2011-01-01

    Therapeutic use and function of recombinant molecules can be studied by the expression of foreign genes in mice. In this study, we have expressed human Fcgamma receptor ?Ig fusion molecules (Fc?R-Igs) in mice by administering Fc?R-Ig plasmid DNAs hydrodynamically and compared their effectiveness to purified molecules in blocking immune-complex (IC) mediated inflammation in mice. The concentration of hydrodynamically expressed Fc?R-Igs (CD16AF-Ig, CD32AR-Ig and CD32AH-Ig) reached a maximum of ...

  18. Translesion DNA synthesis and mutation induced in a plasmid with a single adduct of the environmental contaminant 3-nitrobenzanthrone in SOS-induced Escherichia coli

    International Nuclear Information System (INIS)

    Kawanishi, M.; Kanno, T.; Yagi, T.; Enya-Takamura, T.; Fuchs, R.P.

    2003-01-01

    Full text: 3-Nitrobenzanthrone (NBA) is a powerfully mutagenic nitrated aromatic hydrocarbon found in diesel exhaust and in airborne particulate matters. NBA forms an unusual DNA adduct in vitro that has a C-C bond between the C-8 position of deoxyguanosine and the C-2 position of NBA. We previously found that this adduct is also present in the human cells treated with NBA, and induces mutations in supF shuttle vector system. In this study, we analyzed translesion DNA synthesis (TLS) over a single adduct in lacZ' gene in a plasmid in uvrAmutS Escherichia coli. The result showed that the adduct blocked DNA replication and an observed TLS frequency was 5.4% in non-SOS-induced E. coli. All progenies after the TLS had no mutation. On the other hand, TLS increased to 11.3%, and 4.8% of them had mostly G to T mutations in SOS-induced E. coli. These results suggest that this unusual adduct would be one of causes of lung cancer that is increasing in the urban areas polluted with diesel exhaust. It must be interesting to reveal which DNA polymerase is involved in this TLS

  19. Lipofection and nucleofection of substrate plasmid can generate widely different readings of DNA end-joining efficiency in different cell lines.

    Science.gov (United States)

    Magin, Simon; Saha, Janapriya; Wang, Minli; Mladenova, Veronika; Coym, Nadine; Iliakis, George

    2013-02-01

    In vivo plasmid end-joining assays are valuable tools for dissecting important qualitative and quantitative aspects of non-homologous end-joining (NHEJ)--a key mechanism for the repair of DNA double-strand breaks (DSBs) in higher eukaryotes. They enable the use of defined DNA ends as substrates for end-joining and the analysis by sequencing of the resulting junctions to identify the repair pathways engaged. Yet, plasmid assays have generated divergent results of end-joining capacity in the same DSB repair mutants when used under different conditions, which implies contributions from undefined and therefore uncontrolled parameters. To help standardize these assays, we searched for parameters underpinning these variations and identified transfection method as an important determinant. Here, we compare a lipid-based transfection method, lipofection, with an electroporation method, nucleofection, and find large, unanticipated and cell line-dependent differences in percent end-joining without recognizable trends. For example, in rodent cells, transfection using lipofection gives nearly WT end-joining in DNA-PKcs mutants and only mildly inhibited end-joining in Lig4 and Ku mutants. In contrast, transfection using nucleofection shows marked end-joining inhibition in all NHEJ mutants tested as compared to the WT. In human HCT116 cells, end-joining after nucleofection is strongly suppressed even in the WT and the differences to the mutants are small. After lipofection, in contrast, end-joining is high in WT cells and markedly suppressed in the mutants. We conclude that better understanding and control of the physicochemical/biological and analytical parameters underpinning these differences will be required to generate with plasmid assays results with quantitative power comparable to that of well-established methods of DSB analysis such as pulsed-field gel electrophoresis or γ-H2AX foci scoring. Until then, caution is needed in the interpretation of the results obtained

  20. Implication of the E. coli K12 uvrA and recA genes in the repair of 8-methoxypsoralen-induced mono adducts and crosslinks on plasmid DNA

    International Nuclear Information System (INIS)

    Paramio, J.M.; Bauluz, C.; Vidania, R. de

    1986-01-01

    Genotoxicity of psoralen damages on plasmid DNA has been studied. pBR322 DNA was randomly modified with several concentrations of 8-methoxypsoralen plus 365 nm-UV light. After transformation into E. coli strains (wild-type, uvrA and recA) plasmid survival and mutagenesis were analyzed. To study the influence of the SOS response on plasmid recovery, preirradiation of the cells was performed. In absence of cell preirradiation, crosslinks were not repaired in any strain. Mono adducts were also lethal but in part removed by the excision-repair pathway. Preirradiation of the cells significantly. increased plasmid recovery in recA+ celia. In uvrA- only the mutagenic pathway seemed to be involved in the repair of the damaged DNA. Wild type strain showed the highest increase in plasmid survival, involving the repair of mono adducts and some fraction of crosslinks mainly through an error-free repair pathway. This suggests an enhancement of the excision repair promoted by the induction of SOS functions. (Author) 32 refs

  1. Characterization of DNA polymerase β from Danio rerio by overexpression in E. coli using the in vivo/in vitro compatible pIVEX plasmid

    Directory of Open Access Journals (Sweden)

    Ishikawa Mitsuru

    2011-10-01

    Full Text Available Abstract Background Eukaryotic DNA polymerase β (pol β, the polymerase thought to be responsible for DNA repair synthesis, has been extensively characterized in rats and humans. However, pol β has not been purified or enzymatically characterized from the model fish species Danio rerio (zebrafish. We used the in vitro/in vivo dual expression system plasmid, pIVEX, to express Danio rerio pol β (Danio pol β for biochemical characterization. Results Danio pol β encoded by the in vitro/in vivo-compatible pIVEX plasmid was expressed in E. coli BL21(DE3, BL21(DE3pLysS, and KRX, and in vitro as a C-terminal His-tagged protein. Danio pol β expressed in vitro was subject to proteolysis; therefore, bacterial overexpression was used to produce the protein for kinetic analyses. KRX cells were preferred because of their reduced propensity for leaky expression of pol β. The cDNA of Danio rerio pol β encodes a protein of 337 amino acids, which is 2-3 amino acids longer than other pol β proteins, and contains a P63D amino acid substitution, unlike mammalian pol βs. This substitution lies in a hairpin sequence within an 8-kDa domain, likely to be important in DNA binding. We performed extensive biochemical characterization of Danio pol β in comparison with rat pol β, which revealed its sensitivity to metal ion activators (Mn2+ and Mg2+, its optimum salt concentration (10 mM KCl and 50 mM NaCl, alkaline pH optimum (pH 9.0, and low temperature optimum (30°C. Substituting Mn2+ for Mg2+ resulted in 8.6-fold higher catalytic efficiency (kcat/Km. Conclusions Our characterization of pol β from a model fish organism contributes to the study of the function and evolution of DNA polymerases, which are emerging as important cellular targets for chemical intervention in the development of anticancer agents.

  2. Involvement of DNA polymerase beta in repair of ionizing radiation damage as measured by in vitro plasmid assays.

    NARCIS (Netherlands)

    Vens, C.; Hofland, I.; Begg, A.C.

    2007-01-01

    Characteristic of damage introduced in DNA by ionizing radiation is the induction of a wide range of lesions. Single-strand breaks (SSBs) and base damages outnumber double-strand breaks (DSBs). If unrepaired, these lesions can lead to DSBs and increased mutagenesis. XRCC1 and DNA polymerase beta

  3. Comparison of two DNA microarrays for detection of plasmid-mediated antimicrobial resistance and virulence factor genes in clinical isolates of Enterobacteriaceae and non-Enterobacteriaceae.

    LENUS (Irish Health Repository)

    Walsh, Fiona

    2010-06-01

    A DNA microarray was developed to detect plasmid-mediated antimicrobial resistance (AR) and virulence factor (VF) genes in clinical isolates of Enterobacteriaceae and non-Enterobacteriaceae. The array was validated with the following bacterial species: Escherichiacoli (n=17); Klebsiellapneumoniae (n=3); Enterobacter spp. (n=6); Acinetobacter genospecies 3 (n=1); Acinetobacterbaumannii (n=1); Pseudomonasaeruginosa (n=2); and Stenotrophomonasmaltophilia (n=2). The AR gene profiles of these isolates were identified by polymerase chain reaction (PCR). The DNA microarray consisted of 155 and 133 AR and VF gene probes, respectively. Results were compared with the commercially available Identibac AMR-ve Array Tube. Hybridisation results indicated that there was excellent correlation between PCR and array results for AR and VF genes. Genes conferring resistance to each antibiotic class were identified by the DNA array. Unusual resistance genes were also identified, such as bla(SHV-5) in a bla(OXA-23)-positive carbapenem-resistant A. baumannii. The phylogenetic group of each E. coli isolate was verified by the array. These data demonstrate that it is possible to screen simultaneously for all important classes of mobile AR and VF genes in Enterobacteriaceae and non-Enterobacteriaceae whilst also assigning a correct phylogenetic group to E. coli isolates. Therefore, it is feasible to test clinical Gram-negative bacteria for all known AR genes and to provide important information regarding pathogenicity simultaneously.

  4. Effect of cytokine-encoding plasmid delivery on immune response to Japanese encephalitis virus DNA vaccine in mice.

    Science.gov (United States)

    Bharati, Kaushik; Appaiahgari, Mohan Babu; Vrati, Sudhanshu

    2005-01-01

    We have previously shown that immunization of mice with plasmid pMEa synthesizing Japanese encephalitis virus (JEV) envelope protein induced anti-JEV humoral and cellular immune responses. We now show that intra-muscular co-administration of mice with pMEa and pGM-CSF, encoding murine granulocyte-macrophage colony-stimulating factor or pIL-2, encoding murine interleukin-2 given 4 days after pMEa, augmented anti-JEV antibody titers. This did not enhance the level of protection in immunized mice against JEV. However, intra-dermal co-administration of pMEa and pGM-CSF in mice using the gene gun, enhanced anti-JEV antibody titers resulting in an increased level of protection in mice against lethal JEV challenge.

  5. Parameters influencing the introduction of plasmid DNA into cells by the use of synthetic amphiphiles as a carrier system

    OpenAIRE

    van der Woude, Irene; Willy Visser, H.; ter Beest, Martin B.A.; Wagenaar, Anno; Ruiters, Marcel H.J.; Engberts, Jan B.F.N.; Hoekstra, Dick

    1995-01-01

    Parameters that affect cellular transfection as accomplished by introducing DNA via carriers composed of cationic synthetic amphiphiles, have been investigated with the aim to obtain insight into the mechanism of DNA translocation. Such insight may be exploited in optimizing carrier properties of synthetic amphiphiles for molecules other than nucleic acids. In the present work, the interaction of vesicles composed of the cationic amphiphile dioleyloxy-propyl-trimethylammonium chloride (DOTMA)...

  6. Mutation in ESBL Plasmid from Escherichia coli O104:H4 Leads Autoagglutination and Enhanced Plasmid Dissemination

    Directory of Open Access Journals (Sweden)

    Mickaël Poidevin

    2018-02-01

    Full Text Available Conjugative plasmids are one of the main driving force of wide-spreading of multidrug resistance (MDR bacteria. They are self-transmittable via conjugation as carrying the required set of genes and cis-acting DNA locus for direct cell-to-cell transfer. IncI incompatibility plasmids are nowadays often associated with extended-spectrum beta-lactamases producing Enterobacteria in clinic and environment. pESBL-EA11 was isolated from Escherichia coli O104:H4 outbreak strain in Germany in 2011. During the previous study identifying transfer genes of pESBL-EA11, it was shown that transposon insertion at certain DNA region of the plasmid, referred to as Hft, resulted in great enhancement of transfer ability. This suggested that genetic modifications can enhance dissemination of MDR plasmids. Such ‘superspreader’ mutations have attracted little attention so far despite their high potential to worsen MDR spreading. Present study aimed to gain our understanding on regulatory elements that involved pESBL transfer. While previous studies of IncI plasmids indicated that immediate downstream gene of Hft, traA, is not essential for conjugative transfer, here we showed that overexpression of TraA in host cell elevated transfer rate of pESBL-EA11. Transposon insertion or certain nucleotide substitutions in Hft led strong TraA overexpression which resulted in activation of essential regulator TraB and likely overexpression of conjugative pili. Atmospheric Scanning Electron Microscopy observation suggested that IncI pili are distinct from other types of conjugative pili (such as long filamentous F-type pili and rather expressed throughout the cell surface. High transfer efficiency in the mutant pESBL-EA11 was involved with hyperpiliation which facilitates cell-to-cell adhesion, including autoagglutination. The capability of plasmids to evolve to highly transmissible mutant is alarming, particularly it might also have adverse effect on host pathogenicity.

  7. Multiple ways to prevent transmission of paternal mitochondrial DNA for maternal inheritance in animals.

    Science.gov (United States)

    Sato, Ken; Sato, Miyuki

    2017-10-01

    Mitochondria contain their own DNA (mtDNA). In most sexually reproducing organisms, mtDNA is inherited maternally (uniparentally); this type of inheritance is thus referred to as 'maternal (uniparental) inheritance'. Recent studies have revealed various mechanisms to prevent the transmission of sperm-derived paternal mtDNA to the offspring, thereby ensuring maternal inheritance of mtDNA. In the nematode Caenorhabditis elegans, paternal mitochondria and their mtDNA degenerate almost immediately after fertilization and are selectively degraded by autophagy, which is referred to as 'allophagy' (allogeneic [non-self] organelle autophagy). In the fruit fly Drosophila melanogaster, paternal mtDNA is largely eliminated by an endonuclease G-mediated mechanism. Paternal mitochondria are subsequently removed by endocytic and autophagic pathways after fertilization. In many mammals, including humans, paternal mitochondria enter fertilized eggs. However, the fate of paternal mitochondria and their mtDNA in mammals is still a matter of debate. In this review, we will summarize recent knowledge on the molecular mechanisms underlying the prevention of paternal mtDNA transmission, which ensures maternal mtDNA inheritance in animals. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  8. Ultrasound-mediated gene delivery of naked plasmid DNA in skeletal muscles : a case for bolus injections

    NARCIS (Netherlands)

    Gomes Sanches, P.; Muehlmeister, M.; Seip, R.; Kaijzel, E.L.; Loewik, C.; Boehmer, M.; Tiemann, K.; Grüll, H.

    2014-01-01

    Localized gene delivery has many potential clinical applications. However, the nucleic acids (e.g. pDNA and siRNA) are incapable of passively crossing the endothelium, cell membranes and other biological barriers which must be crossed to reach their intracellular targets. A possible solution is the

  9. Use of sperm plasmid DNA lipofection combined with REMI (restriction enzyme-mediated insertion) for production of transgenic chickens expressing eGFP (enhanced green fluorescent protein) or human follicle-stimulating hormone.

    Science.gov (United States)

    Harel-Markowitz, Eliane; Gurevich, Michael; Shore, Laurence S; Katz, Adi; Stram, Yehuda; Shemesh, Mordechai

    2009-05-01

    Linearized p-eGFP (plasmid-enhanced green fluorescent protein) or p-hFSH (plasmid human FSH) sequences with the corresponding restriction enzyme were lipofected into sperm genomic DNA. Sperm transfected with p-eGFP were used for artificial insemination in hens, and in 17 out of 19 of the resultant chicks, the exogenous DNA was detected in their lymphocytes as determined by PCR and expressed in tissues as determined by (a) PCR, (b) specific emission of green fluorescence by the eGFP, and (c) Southern blot analysis. A complete homology was found between the Aequorea Victoria eGFP DNA and a 313-bp PCR product of extracted DNA from chick blood cells. Following insemination with sperm lipofected with p-hFSH, transgenic offspring were obtained for two generations as determined by detection of the transgene for human FSH (PCR) and expression of the gene (RT-PCR and quantitative real-time PCR) and the presence of the protein in blood (radioimmunoassay). Data demonstrate that lipofection of plasmid DNA with restriction enzyme is a highly efficient method for the production of transfected sperm to produce transgenic offspring by direct artificial insemination.

  10. Construction of Biologically Functional Bacterial Plasmids In Vitro

    Science.gov (United States)

    Cohen, Stanley N.; Chang, Annie C. Y.; Boyer, Herbert W.; Helling, Robert B.

    1973-01-01

    The construction of new plasmid DNA species by in vitro joining of restriction endonuclease-generated fragments of separate plasmids is described. Newly constructed plasmids that are inserted into Escherichia coli by transformation are shown to be biologically functional replicons that possess genetic properties and nucleotide base sequences from both of the parent DNA molecules. Functional plasmids can be obtained by reassociation of endonuclease-generated fragments of larger replicons, as well as by joining of plasmid DNA molecules of entirely different origins. Images PMID:4594039

  11. Preventing the transmission of mitochondrial DNA disorders using prenatal or preimplantation genetic diagnosis.

    Science.gov (United States)

    Smeets, Hubert J M; Sallevelt, Suzanne C E H; Dreesen, Jos C F M; de Die-Smulders, Christine E M; de Coo, Irenaeus F M

    2015-09-01

    Mitochondrial disorders are among the most common inborn errors of metabolism; at least 15% are caused by mitochondrial DNA (mtDNA) mutations, which occur de novo or are maternally inherited. For familial heteroplasmic mtDNA mutations, the mitochondrial bottleneck defines the mtDNA mutation load in offspring, with an often high or unpredictable recurrence risk. Oocyte donation is a safe option to prevent the transmission of mtDNA disease, but the offspring resulting from oocyte donation are genetically related only to the father. Prenatal diagnosis (PND) is technically possible but usually not applicable because of limitations in predicting the phenotype. For de novo mtDNA point mutations, recurrence risks are low and PND can be offered to provide reassurance regarding fetal health. PND is also the best option for female carriers with low-level mutations demonstrating skewing to 0% or 100%. A fairly new option for preventing the transmission of mtDNA diseases is preimplantation genetic diagnosis (PGD), in which embryos with a mutant load below a mutation-specific or general expression threshold of 18% can be transferred. PGD is currently the best reproductive option for familial heteroplasmic mtDNA point mutations. Nuclear genome transfer and genome editing techniques are currently being investigated and might offer additional reproductive options for specific mtDNA disease cases. © 2015 New York Academy of Sciences.

  12. Delivery of a survivin promoter-driven antisense survivin-expressing plasmid DNA as a cancer therapeutic: a proof-of-concept study

    Directory of Open Access Journals (Sweden)

    Lin KY

    2016-05-01

    Full Text Available Kun-Yuan Lin,1 Siao Muk Cheng,2 Shing-Ling Tsai,2 Ju-Ya Tsai,1 Chun-Hui Lin,1 Chun Hei Antonio Cheung1,2 1Department of Pharmacology, College of Medicine, National Cheng Kung University, Tainan, Taiwan, ROC; 2Institute of Basic Medical Sciences, College of Medicine, National Cheng Kung University, Tainan, Taiwan, ROC Abstract: Survivin is a member of the inhibitor-of-apoptosis proteins family. It is overexpressed in many different cancer types but not in the differentiated normal tissue. In addition, overexpression of survivin promotes cancer cell survival and induces chemotherapeutic drug resistance, making it an attractive target for new anticancer interventions. Despite survivin being a promising molecular target for anticancer treatment, it is widely accepted that survivin is only a “semi-druggable” target. Therefore, it is important to develop a new strategy to target survivin for anticancer treatment. In this study, we constructed a novel survivin promoter-driven full-length antisense survivin (pSur/AS-Sur expression plasmid DNA. Promoter activity assay revealed that the activity of the survivin promoter of pSur/AS-Sur correlated with the endogenous expression of survivin at the transcriptional level in the transfected A549, MDA-MB-231, and PANC-1 cancer cells. Western blot analysis showed that liposomal delivery of pSur/AS-Sur successfully downregulated the expression of survivin in A549, MBA-MB-231, and PANC-1 cells in vitro. In addition, delivery of pSur/AS-Sur induced autophagy, caspase-dependent apoptosis, and caspase-independent apoptosis as indicated by the increased LC3B-II conversion, autophagosome formation, caspase-9/-3 and poly(ADP-ribose polymerase-1 cleavage, and apoptosis-inducing factor nuclear translocation in A549, MBA-MB-231, and PANC-1 cells. Importantly, liposomal delivery of pSur/AS-Sur was also capable of decreasing the proliferation of the survivin/MDR1 coexpressing multidrug-resistant KB-TAX50 cancer cells and

  13. Co-administration of avian influenza virus H5 plasmid DNA with chicken IL-15 and IL-18 enhanced chickens immune responses.

    Science.gov (United States)

    Lim, Kian-Lam; Jazayeri, Seyed Davoud; Yeap, Swee Keong; Alitheen, Noorjahan Banu Mohamed; Bejo, Mohd Hair; Ideris, Aini; Omar, Abdul Rahman

    2012-08-06

    DNA vaccines offer several advantages over conventional vaccines in the development of effective vaccines against avian influenza virus (AIV). However, one of the limitations of the DNA vaccine in poultry is that it induces poor immune responses. In this study, chicken interleukin (IL) -15 and IL-18 were used as genetic adjuvants to improve the immune responses induced from the H5 DNA vaccination in chickens. The immunogenicity of the recombinant plasmid DNA was analyzed based on the antibody production, T cell responses and cytokine production, following inoculation in 1-day-old (Trial 1) and 14-day-old (Trial 2) specific-pathogen-free chickens. Hence, the purpose of the present study was to explore the role of chicken IL-15 and IL-18 as adjuvants following the vaccination of chickens with the H5 DNA vaccine. The overall HI antibody titer in chickens immunized with pDis/H5 + pDis/IL-15 was higher compared to chickens immunized with pDis/H5 (p chickens exhibited a shorter time to achieve the highest HI titer in comparison to the inoculation of the 1-day-old chickens. The cellular immunity was assessed by the flow cytometry analysis to enumerate CD4+ and CD8 + T cells in the peripheral blood. The chickens inoculated with pDis/H5 + pDis/IL-15 demonstrated the highest increase in CD4+ T cells population relative to the control chickens. However, this study revealed that pDis/H5 + pDis/IL-15 was not significant (P > 0.05) in inducing CD8+ T cells. Meanwhile, with the exception of Trial 1, the flow cytometry results for Trial 2 demonstrated that the pDis/H5 + pDis/IL-18 inoculated group was able to trigger a higher increase in CD4+ T cells than the pDis/H5 group (P 0.05) in modulating CD8+ T cells population in both trials. The pDis/H5 + pDis/IL-15 inoculated group showed the highest IL-15 gene expression in both trials compared to other inoculated groups (P chicken IL-15 and IL-18,with pDis/H5 + pDis/IL-15 being a better vaccine candidate

  14. Superior induction of T cell responses to conserved HIV-1 regions by electroporated alphavirus replicon DNA compared to that with conventional plasmid DNA vaccine.

    Science.gov (United States)

    Knudsen, Maria L; Mbewe-Mvula, Alice; Rosario, Maximillian; Johansson, Daniel X; Kakoulidou, Maria; Bridgeman, Anne; Reyes-Sandoval, Arturo; Nicosia, Alfredo; Ljungberg, Karl; Hanke, Tomás; Liljeström, Peter

    2012-04-01

    Vaccination using "naked" DNA is a highly attractive strategy for induction of pathogen-specific immune responses; however, it has been only weakly immunogenic in humans. Previously, we constructed DNA-launched Semliki Forest virus replicons (DREP), which stimulate pattern recognition receptors and induce augmented immune responses. Also, in vivo electroporation was shown to enhance immune responses induced by conventional DNA vaccines. Here, we combine these two approaches and show that in vivo electroporation increases CD8(+) T cell responses induced by DREP and consequently decreases the DNA dose required to induce a response. The vaccines used in this study encode the multiclade HIV-1 T cell immunogen HIVconsv, which is currently being evaluated in clinical trials. Using intradermal delivery followed by electroporation, the DREP.HIVconsv DNA dose could be reduced to as low as 3.2 ng to elicit frequencies of HIV-1-specific CD8(+) T cells comparable to those induced by 1 μg of a conventional pTH.HIVconsv DNA vaccine, representing a 625-fold molar reduction in dose. Responses induced by both DREP.HIVconsv and pTH.HIVconsv were further increased by heterologous vaccine boosts employing modified vaccinia virus Ankara MVA.HIVconsv and attenuated chimpanzee adenovirus ChAdV63.HIVconsv. Using the same HIVconsv vaccines, the mouse observations were supported by an at least 20-fold-lower dose of DNA vaccine in rhesus macaques. These data point toward a strategy for overcoming the low immunogenicity of DNA vaccines in humans and strongly support further development of the DREP vaccine platform for clinical evaluation.

  15. Ultrasound-mediated gene delivery of naked plasmid DNA in skeletal muscles: a case for bolus injections.

    Science.gov (United States)

    Sanches, Pedro Gomes; Mühlmeister, Mareike; Seip, Ralf; Kaijzel, Eric; Löwik, Clemens; Böhmer, Marcel; Tiemann, Klaus; Grüll, Holger

    2014-12-10

    Localized gene delivery has many potential clinical applications. However, the nucleic acids (e.g. pDNA and siRNA) are incapable of passively crossing the endothelium, cell membranes and other biological barriers which must be crossed to reach their intracellular targets. A possible solution is the use of ultrasound to burst circulating microbubbles inducing transient permeabilization of surrounding tissues which mediates nucleic acid extravasation and cellular uptake. In this study we report on an optimization of the ultrasound gene delivery technique. Naked pDNA (200 μg) encoding luciferase and SonoVue® microbubbles were co-injected intravenously in mice. The hindlimb skeletal muscles were exposed to ultrasound from a non-focused transducer (1 MHz, 1.25 MPa, PRI 30s) and injection protocols and total amounts as well as ultrasound parameters were systemically varied. Gene expression was quantified relative to a control using a bioluminescence camera system at day 7 after sonication. Bioluminescence ratios in sonicated/control muscles of up to 101× were obtained. In conclusion, we were able to specifically deliver genetic material to the selected skeletal muscles and overall, the use of bolus injections and high microbubble numbers resulted in increased gene expression reflected by stronger bioluminescence signals. Based on our data, bolus injections seem to be required in order to achieve transient highly concentrated levels of nucleic acids and microbubbles at the tissue of interest which upon ultrasound exposure should lead to increased levels of gene delivery. Thus, ultrasound mediated gene delivery is a promising technique for the clinical translation of localized drug delivery. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Role of DNA methylation in expression and transmission of porcine endogenous retroviruses

    Czech Academy of Sciences Publication Activity Database

    Matoušková, Magda; Veselý, Pavel; Daniel, Petr; Mattiuzzo, G.; Hector, R.D.; Scobie, L.; Takeuchi, Y.; Hejnar, Jiří

    2013-01-01

    Roč. 87, č. 22 (2013), s. 12110-12120 ISSN 0022-538X R&D Projects: GA MŠk(CZ) LK11215 Institutional support: RVO:68378050 Keywords : PERV transmission * xenotransplantation * DNA methylation Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.648, year: 2013

  17. DNA vaccination with a plasmid encoding LACK-TSA fusion against Leishmania major infection in BALB/c mice.

    Science.gov (United States)

    Maspi, N; Ghaffarifar, F; Sharifi, Z; Dalimi, A; Khademi, S Z

    2017-12-01

    Vaccination would be the most important strategy for the prevention and elimination of leishmaniasis. The aim of the present study was to compare the immune responses induced following DNA vaccination with LACK (Leishmania analogue of the receptor kinase C), TSA (Thiol-specific-antioxidant) genes alone or LACK-TSA fusion against cutaneous leishmaniasis (CL). Cellular and humoral immune responses were evaluated before and after challenge with Leishmania major (L. major). In addition, the mean lesion size was also measured from 3th week post-infection. All immunized mice showed a partial immunity characterized by higher interferon (IFN)-γ and Immunoglobulin G (IgG2a) levels compared to control groups (pTSA fusion. Mean lesion sizes reduced significantly in all immunized mice compared with control groups at 7th week post-infection (pTSA and TSA groups than LACK group after challenge (pTSA antigens against CL. Furthermore, this study demonstrated that a bivalent vaccine can induce stronger immune responses and protection against infectious challenge with L. major.

  18. Experimental analysis of a TEM plane transmission line for DNA studies at 900 MHz EM fields

    International Nuclear Information System (INIS)

    Belloni, F; Doria, D; Lorusso, A; Nassisi, V; Velardi, L; Alifano, P; Monaco, C; Tala, A; Tredici, M; Raino, A

    2006-01-01

    A suitable plane transmission line was developed and its behaviour analysed at 900 MHz radiofrequency fields to study DNA mutability and the repair of micro-organisms. In this work, utilizing such a device, we investigated the behaviour of DNA mutability and repair of Escherichia coli strains. The transmission line was very simple and versatile in changing its characteristic resistance and field intensity by varying its sizes. In the absence of cell samples inside the transmission line, the relative modulation of the electric and/or magnetic field was ±31% with respect to the mean values, allowing the processing of more samples at different exposure fields in a single run. A slight decrease in spontaneous mutability to rifampicin-resistance of the E. coli JC411 strain was demonstrated in mismatch-repair proficient samples exposed to the radio-frequency fields during their growth on solid medium

  19. Implication of the E. coli K12 uvrA and recA genes in the repair of 8-methoxypsoralen-induced mono adducts and crosslinks on plasmid DNA; Implicacion de los genes uvrA de E. coli K12 en la reparacion de monoaductos y entrecruzamien tos inducidos en DNA plasmidico por 8-metoxipso raleno mas luz ultravioleta A

    Energy Technology Data Exchange (ETDEWEB)

    Paramio, J M; Bauluz, C; Vidania, R de

    1986-07-01

    Genotoxicity of psoralen damages on plasmid DNA has been studied. pBR322 DNA was randomly modified with several concentrations of 8-methoxypsoralen plus 365 nm-UV light. After transformation into E. coli strains (wild-type, uvrA and recA) plasmid survival and mutagenesis were analyzed. To study the influence of the SOS response on plasmid recovery, preirradiation of the cells was performed. In absence of cell preirradiation, crosslinks were not repaired in any strain. Mono adducts were also lethal but in part removed by the excision-repair pathway. Preirradiation of the cells significantly. increased plasmid recovery in recA+ celia. In uvrA- only the mutagenic pathway seemed to be involved in the repair of the damaged DNA. Wild type strain showed the highest increase in plasmid survival, involving the repair of mono adducts and some fraction of crosslinks mainly through an error-free repair pathway. This suggests an enhancement of the excision repair promoted by the induction of SOS functions. (Author) 32 refs.

  20. Transmission of HBV DNA Mediated by Ceramide-Triggered Extracellular Vesicles.

    Science.gov (United States)

    Sanada, Takahiro; Hirata, Yuichi; Naito, Yutaka; Yamamoto, Naoki; Kikkawa, Yoshiaki; Ishida, Yuji; Yamasaki, Chihiro; Tateno, Chise; Ochiya, Takahiro; Kohara, Michinori

    2017-03-01

    An extracellular vesicle (EV) is a nanovesicle that shuttles proteins, nucleic acids, and lipids, thereby influencing cell behavior. A recent crop of reports have shown that EVs are involved in infectious biology, influencing host immunity and playing a role in the viral life cycle. In the present work, we investigated the EV-mediated transmission of hepatitis B virus (HBV) infection. We investigated the EV-mediated transmission of HBV infection by using a HBV infectious culture system that uses primary human hepatocytes derived from humanized chimeric mice (PXB-cells). Purified EVs were isolated by ultracentrifugation. To analyze the EVs and virions, we used stimulated emission depletion microscopy. Purified EVs from HBV-infected PXB-cells were shown to contain HBV DNA and to be capable of transmitting HBV DNA to naive PXB-cells. These HBV-DNA-transmitting EVs were shown to be generated through a ceramide-triggered EV production pathway. Furthermore, we showed that these HBV-DNA-transmitting EVs were resistant to antibody neutralization; stimulated emission depletion microscopy showed that EVs lacked hepatitis B surface antigen, the target of neutralizing antibodies. These findings suggest that EVs harbor a DNA cargo capable of transmitting viral DNA into hepatocytes during HBV infection, representing an additional antibody-neutralization-resistant route of HBV infection.

  1. Processing of Nonconjugative Resistance Plasmids by Conjugation Nicking Enzyme of Staphylococci

    Energy Technology Data Exchange (ETDEWEB)

    Pollet, Rebecca M.; Ingle, James D.; Hymes, Jeff P.; Eakes, Thomas C.; Eto, Karina Yui; Kwong, Stephen M.; Ramsay, Joshua P.; Firth, Neville; Redinbo, Matthew R. (Curtin U.); (Sydney); (UNC)

    2016-01-04

    Antimicrobial resistance inStaphylococcus aureuspresents an increasing threat to human health. This resistance is often encoded on mobile plasmids, such as pSK41; however, the mechanism of transfer of these plasmids is not well understood. In this study, we first examine key protein-DNA interactions formed by the relaxase enzyme, NES, which initiates and terminates the transfer of the multidrug resistance plasmid pSK41. Two loops on the NES protein, hairpin loops 1 and 2, form extensive contacts with the DNA hairpin formed at theoriTregion of pSK41, and here we establish that these contacts are essential for proper DNA cleavage and religation by the full 665-residue NES proteinin vitro. Second, pSK156 and pCA347 are nonconjugativeStaphylococcus aureusplasmids that contain sequences similar to theoriTregion of pSK41 but differ in the sequence predicted to form a DNA hairpin. We show that pSK41-encoded NES is able to bind, cleave, and religate theoriTsequences of these nonconjugative plasmidsin vitro. Although pSK41 could mobilize a coresident plasmid harboring its cognateoriT, it was unable to mobilize plasmids containing the pSK156 and pCA347 variantoriTmimics, suggesting that an accessory protein like that previously shown to confer specificity in the pWBG749 system may also be involved in transmission of plasmids containing a pSK41-likeoriT. These data indicate that the conjugative relaxase intransmechanism recently described for the pWBG749 family of plasmids also applies to the pSK41 family of plasmids, further heightening the potential significance of this mechanism in the horizontal transfer of staphylococcal plasmids.

    IMPORTANCEUnderstanding the

  2. Co-administration of plasmid expressing IL-12 with 14-kDa Schistosoma mansoni fatty acid-binding protein cDNA alters immune response profiles and fails to enhance protection induced by Sm14 DNA vaccine alone.

    Science.gov (United States)

    Fonseca, Cristina T; Pacífico, Lucila G G; Barsante, Michele M; Rassi, Tatiana; Cassali, Geovanni D; Oliveira, Sérgio C

    2006-08-01

    Schistosomiasis is an endemic disease that affects 200 million people worldwide. DNA-based vaccine is a promising strategy to induce protective immunity against schistosomiasis, since both humoral and cellular immune responses are involved in parasite elimination. In this study, we evaluated the ability of Sm14 cDNA alone or in association with a plasmid expressing murine interleukin (IL)-12 to induce protection against challenge infection. Mice were immunized with four doses of the DNA vaccine and the levels of protection were determined by worm burden recovery after challenge infection. Specific antibody production to rSm14 was determined by ELISA, and cytokine production was measured in splenocyte culture supernatants stimulated with rSm14 and in bronchoalveolar lavage of vaccinated mice after challenge infection. DNA immunization with pCI/Sm14 alone induced 40.5% of worm reduction. However, the use of pCI/IL-12 as adjuvant to pCI/Sm14 immunization failed to enhance protection against challenge infection. Protection induced by pCI/Sm14 immunization correlates with specific IgG antibody production against Sm14, Th1 type of immune response with high levels of interferon (IFN)-gamma and low levels of IL-4 in splenocyte culture supernatants and in bronchoalveolar lavage after challenge infection. IL-12 co-administration with pCI/Sm14 induced a significant production of nitric oxide in splenocyte culture supernatants and also lymphocyte suppression, with reduced percentage of T cells producing IFN-gamma and tumor necrosis factor-alpha.

  3. Transmission of HBV DNA Mediated by Ceramide-Triggered Extracellular VesiclesSummary

    Directory of Open Access Journals (Sweden)

    Takahiro Sanada

    2017-03-01

    Full Text Available Background & Aims: An extracellular vesicle (EV is a nanovesicle that shuttles proteins, nucleic acids, and lipids, thereby influencing cell behavior. A recent crop of reports have shown that EVs are involved in infectious biology, influencing host immunity and playing a role in the viral life cycle. In the present work, we investigated the EV-mediated transmission of hepatitis B virus (HBV infection. Methods: We investigated the EV-mediated transmission of HBV infection by using a HBV infectious culture system that uses primary human hepatocytes derived from humanized chimeric mice (PXB-cells. Purified EVs were isolated by ultracentrifugation. To analyze the EVs and virions, we used stimulated emission depletion microscopy. Results: Purified EVs from HBV-infected PXB-cells were shown to contain HBV DNA and to be capable of transmitting HBV DNA to naive PXB-cells. These HBV-DNA–transmitting EVs were shown to be generated through a ceramide-triggered EV production pathway. Furthermore, we showed that these HBV-DNA–transmitting EVs were resistant to antibody neutralization; stimulated emission depletion microscopy showed that EVs lacked hepatitis B surface antigen, the target of neutralizing antibodies. Conclusions: These findings suggest that EVs harbor a DNA cargo capable of transmitting viral DNA into hepatocytes during HBV infection, representing an additional antibody-neutralization–resistant route of HBV infection. Keywords: HBV, Extracellular Vesicles, Transmission Pathway

  4. Development of a Novel Reference Plasmid for Accurate Quantification of Genetically Modified Kefeng6 Rice DNA in Food and Feed Samples

    Directory of Open Access Journals (Sweden)

    Liang Li

    2013-01-01

    Full Text Available Reference plasmids are an essential tool for the quantification of genetically modified (GM events. Quantitative real-time PCR (qPCR is the most commonly used method to characterize and quantify reference plasmids. However, the precision of this method is often limited by calibration curves, and qPCR data can be affected by matrix differences between the standards and samples. Here, we describe a digital PCR (dPCR approach that can be used to accurately measure the novel reference plasmid pKefeng6 and quantify the unauthorized variety of GM rice Kefeng6, eliminating the issues associated with matrix effects in calibration curves. The pKefeng6 plasmid was used as a calibrant for the quantification of Kefeng6 rice by determining the copy numbers of event- (77 bp and taxon-specific (68 bp fragments, their ratios, and their concentrations. The plasmid was diluted to five different concentrations. The third sample (S3 was optimized for the quantification range of dPCR according to previous reports. The ratio between the two fragments was 1.005, which closely approximated the value certified by sequencing, and the concentration was found to be 792 copies/μL. This method was precise, with an RSD of ~3%. These findings demonstrate the advantages of using the dPCR method to characterize reference materials.

  5. Fascioliasis transmission by Lymnaea neotropica confirmed by nuclear rDNA and mtDNA sequencing in Argentina.

    Science.gov (United States)

    Mera y Sierra, Roberto; Artigas, Patricio; Cuervo, Pablo; Deis, Erika; Sidoti, Laura; Mas-Coma, Santiago; Bargues, Maria Dolores

    2009-12-03

    Fascioliasis is widespread in livestock in Argentina. Among activities included in a long-term initiative to ascertain which are the fascioliasis areas of most concern, studies were performed in a recreational farm, including liver fluke infection in different domestic animal species, classification of the lymnaeid vector and verification of natural transmission of fascioliasis by identification of the intramolluscan trematode larval stages found in naturally infected snails. The high prevalences in the domestic animals appeared related to only one lymnaeid species present. Lymnaeid and trematode classification was verified by means of nuclear ribosomal DNA and mitochondrial DNA marker sequencing. Complete sequences of 18S rRNA gene and rDNA ITS-2 and ITS-1, and a fragment of the mtDNA cox1 gene demonstrate that the Argentinian lymnaeid belongs to the species Lymnaea neotropica. Redial larval stages found in a L. neotropica specimen were ascribed to Fasciola hepatica after analysis of the complete ITS-1 sequence. The finding of L. neotropica is the first of this lymnaeid species not only in Argentina but also in Southern Cone countries. The total absence of nucleotide differences between the sequences of specimens from Argentina and the specimens from the Peruvian type locality at the levels of rDNA 18S, ITS-2 and ITS-1, and the only one mutation at the mtDNA cox1 gene suggest a very recent spread. The ecological characteristics of this lymnaeid, living in small, superficial water collections frequented by livestock, suggest that it may be carried from one place to another by remaining in dried mud stuck to the feet of transported animals. The presence of L. neotropica adds pronounced complexity to the transmission and epidemiology of fascioliasis in Argentina, due to the great difficulties in distinguishing, by traditional malacological methods, between the three similar lymnaeid species of the controversial Galba/Fossaria group present in this country: L. viatrix

  6. Highly efficient gene delivery by mRNA electroporation in human hematopoietic cells: superiority to lipofection and passive pulsing of mRNA and to electroporation of plasmid cDNA for tumor antigen loading of dendritic cells.

    Science.gov (United States)

    Van Tendeloo, V F; Ponsaerts, P; Lardon, F; Nijs, G; Lenjou, M; Van Broeckhoven, C; Van Bockstaele, D R; Berneman, Z N

    2001-07-01

    Designing effective strategies to load human dendritic cells (DCs) with tumor antigens is a challenging approach for DC-based tumor vaccines. Here, a cytoplasmic expression system based on mRNA electroporation to efficiently introduce tumor antigens into DCs is described. Preliminary experiments in K562 cells using an enhanced green fluorescent protein (EGFP) reporter gene revealed that mRNA electroporation as compared with plasmid DNA electroporation showed a markedly improved transfection efficiency (89% versus 40% EGFP(+) cells, respectively) and induced a strikingly lower cell toxicity (15% death rate with mRNA versus 51% with plasmid DNA). Next, mRNA electroporation was applied for nonviral transfection of different types of human DCs, including monocyte-derived DCs (Mo-DCs), CD34(+) progenitor-derived DCs (34-DCs) and Langerhans cells (34-LCs). High-level transgene expression by mRNA electroporation was obtained in more than 50% of all DC types. mRNA-electroporated DCs retained their phenotype and maturational potential. Importantly, DCs electroporated with mRNA-encoding Melan-A strongly activated a Melan-A-specific cytotoxic T lymphocyte (CTL) clone in an HLA-restricted manner and were superior to mRNA-lipofected or -pulsed DCs. Optimal stimulation of the CTL occurred when Mo-DCs underwent maturation following mRNA transfection. Strikingly, a nonspecific stimulation of CTL was observed when DCs were transfected with plasmid DNA. The data clearly demonstrate that Mo-DCs electroporated with mRNA efficiently present functional antigenic peptides to cytotoxic T cells. Therefore, electroporation of mRNA-encoding tumor antigens is a powerful technique to charge human dendritic cells with tumor antigens and could serve applications in future DC-based tumor vaccines.

  7. Brucellosis Transmission between Wildlife and Livestock in the Greater Yellowstone Ecosystem: Inferences from DNA Genotyping.

    Science.gov (United States)

    O'Brien, Michael P; Beja-Pereira, Albano; Anderson, Neil; Ceballos, Ruben M; Edwards, William H; Harris, Beth; Wallen, Rick L; Costa, Vânia

    2017-04-01

    The wildlife of the Greater Yellowstone Ecosystem carries brucellosis, which was first introduced to the area by cattle in the 19th century. Brucellosis transmission between wildlife and livestock has been difficult to study due to challenges in culturing the causative agent, Brucella abortus . We examined B. abortus transmission between American bison ( Bison bison ), Rocky Mountain elk ( Cervus elaphus nelsoni), and cattle ( Bos taurus ) using variable number tandem repeat (VNTR) markers on DNA from 98 B. abortus isolates recovered from populations in Idaho, Montana, and Wyoming, US. Our analyses reveal interspecies transmission. Two outbreaks (2007, 2008) in Montana cattle had B. abortus genotypes similar to isolates from both bison and elk. Nevertheless, similarity in elk and cattle isolates from the 2008 outbreak suggest that elk are the likely source of brucellosis transmission to cattle in Montana and Wyoming. Brucella abortus isolates from sampling in Montana appear to be divided in two clusters: one found in local Montana elk, cattle, and bison; and another found mainly in elk and a bison from Wyoming, which is consistent with brucellosis having entered Montana via migration of infected elk from Wyoming. Our findings illustrate complex patterns of brucellosis transmission among elk, bison, and cattle as well as the utility of VNTRs to infer the wildlife species of origin for disease outbreaks in livestock.

  8. Site-specific deletions of chromosomally located DNA segments with the multimer resolution system of broad-host-range plasmid RP4

    DEFF Research Database (Denmark)

    Sternberg, Claus; Eberl, Leo; Sanchezromero, Juan M.

    1995-01-01

    The multimer resolution system (mrs) of the broad-host-range plasmid RP4 has been exploited to develop a general method that permits the precise excision of chromosomal segments in a variety of gram-negative bacteria. The procedure is based on the site-specific recombination between two directly ...

  9. Studies on the expression of plasmid-borne genes in the endosymbiotic state of Rhizobium leguminosarum

    NARCIS (Netherlands)

    Krol, A.J.M.

    1982-01-01

    The subject matter of the research reported in this thesis is the role of plasmid-borne genes of Rhizobium in symbiosis and nitrogen fixation. Plasmid DNA was isolated from Rhizobium leguminosarum strain PRE and the expression of plasmid DNA in nitrogen

  10. Conjugal properties of the Sinorhizobium meliloti plasmid mobilome.

    Science.gov (United States)

    Pistorio, Mariano; Giusti, María A; Del Papa, María F; Draghi, Walter O; Lozano, Mauricio J; Tejerizo, Gonzalo Torres; Lagares, Antonio

    2008-09-01

    The biology and biochemistry of plasmid transfer in soil bacteria is currently under active investigation because of its central role in prokaryote adaptation and evolution. In this work, we examined the conjugal properties of the cryptic plasmids present in a collection of the N(2)-fixing legume-symbiont Sinorhizobium meliloti. The study was performed on 65 S. meliloti isolates recovered from 25 humic soils of Argentina, which were grouped into 22 plasmid-profile types [i.e. plasmid operational taxonomic units (OTUs)]. The cumulative Shannon index calculated for the observed plasmid profiles showed a clear saturation plateau, thus indicating an adequate representation of the S. meliloti plasmid-profile types in the isolates studied. The results show that isolates of nearly 14% of the plasmid OTUs hosted transmissible plasmids and that isolates of 29% of the plasmid OTUs were able to retransfer the previously characterized mobilizable-cryptic plasmid pSmeLPU88b to a third recipient strain. It is noteworthy that isolates belonging to 14% of the plasmid OTUs proved to be refractory to the entrance of the model plasmid pSmeLPU88b, suggesting either the presence of surface exclusion phenomena or the occurrence of restriction incompatibility with the incoming replicon. Incompatibility for replication between resident plasmids and plasmid pSmeLPU88b was observed in c. 20% of the OTUs. The results reported here reveal a widespread compatibility among the conjugal functions of the cryptic plasmids in S. meliloti, and this fact, together with the observed high proportion of existing donor genotypes, points to the extrachromosomal compartment of the species as being an extremely active plasmid mobilome.

  11. Novel assay to measure the plasmid mobilizing potential of mixed microbial communities

    DEFF Research Database (Denmark)

    Klümper, Uli; Droumpali, Ariadni; Dechesne, Arnaud

    2014-01-01

    Mobilizable plasmids lack necessary genes for complete conjugation and are therefore non-self-transmissible. Instead, they rely on the conjugation system of conjugal plasmids to be horizontally transferred to new recipients. While community permissiveness, the fraction of a mixed microbial...... community that can receive self-transmissible conjugal plasmids, has been studied, the intrinsic ability of a community to mobilize plasmids that lack conjugation systems is unexplored. Here, we present a novel framework and experimental method to estimate the mobilization potential of mixed communities. We...... of the donors receiving the conjugal plasmid in the first step. Further work is needed to establish how plasmid mobilization potential varies within and across microbial communities....

  12. Drug resistance plasmids in Lactobacillus acidophilus and Lactobacillus reuteri.

    OpenAIRE

    Vescovo, M; Morelli, L; Bottazzi, V

    1982-01-01

    Sixteen strains of Lactobacillus reuteri and 20 strains of Lactobacillus acidophilus were tested for resistance to 22 antibiotics by using commercially available sensitivity disks. Evidence suggesting linkage of these resistances to plasmids was obtained by "curing" experiments with acridine dyes and high growth temperatures. Examination of plasmid patterns of agarose gel electrophoresis provided further evidence of loss in plasmid DNA under curing conditions in some of the strains examined.

  13. A System Architecture for Efficient Transmission of Massive DNA Sequencing Data.

    Science.gov (United States)

    Sağiroğlu, Mahmut Şamİl; Külekcİ, M Oğuzhan

    2017-11-01

    The DNA sequencing data analysis pipelines require significant computational resources. In that sense, cloud computing infrastructures appear as a natural choice for this processing. However, the first practical difficulty in reaching the cloud computing services is the transmission of the massive DNA sequencing data from where they are produced to where they will be processed. The daily practice here begins with compressing the data in FASTQ file format, and then sending these data via fast data transmission protocols. In this study, we address the weaknesses in that daily practice and present a new system architecture that incorporates the computational resources available on the client side while dynamically adapting itself to the available bandwidth. Our proposal considers the real-life scenarios, where the bandwidth of the connection between the parties may fluctuate, and also the computing power on the client side may be of any size ranging from moderate personal computers to powerful workstations. The proposed architecture aims at utilizing both the communication bandwidth and the computing resources for satisfying the ultimate goal of reaching the results as early as possible. We present a prototype implementation of the proposed architecture, and analyze several real-life cases, which provide useful insights for the sequencing centers, especially on deciding when to use a cloud service and in what conditions.

  14. Characterization of Erwinia amylovora strains from different host plants using repetitive-sequences PCR analysis, and restriction fragment length polymorphism and short-sequence DNA repeats of plasmid pEA29.

    Science.gov (United States)

    Barionovi, D; Giorgi, S; Stoeger, A R; Ruppitsch, W; Scortichini, M

    2006-05-01

    The three main aims of the study were the assessment of the genetic relationship between a deviating Erwinia amylovora strain isolated from Amelanchier sp. (Maloideae) grown in Canada and other strains from Maloideae and Rosoideae, the investigation of the variability of the PstI fragment of the pEA29 plasmid using restriction fragment length polymorphism (RFLP) analysis and the determination of the number of short-sequence DNA repeats (SSR) by DNA sequence analysis in representative strains. Ninety-three strains obtained from 12 plant genera and different geographical locations were examined by repetitive-sequences PCR using Enterobacterial Repetitive Intergenic Consensus, BOX and Repetitive Extragenic Palindromic primer sets. Upon the unweighted pair group method with arithmetic mean analysis, a deviating strain from Amelanchier sp. was analysed using amplified ribosomal DNA restriction analysis (ARDRA) analysis and the sequencing of the 16S rDNA gene. This strain showed 99% similarity to other E. amylovora strains in the 16S gene and the same banding pattern with ARDRA. The RFLP analysis of pEA29 plasmid using MspI and Sau3A restriction enzymes showed a higher variability than that previously observed and no clear-cut grouping of the strains was possible. The number of SSR units reiterated two to 12 times. The strains obtained from pear orchards showing for the first time symptoms of fire blight had a low number of SSR units. The strains from Maloideae exhibit a wider genetic variability than previously thought. The RFLP analysis of a fragment of the pEA29 plasmid would not seem a reliable method for typing E. amylovora strains. A low number of SSR units was observed with first epidemics of fire blight. The current detection techniques are mainly based on the genetic similarities observed within the strains from the cultivated tree-fruit crops. For a more reliable detection of the fire blight pathogen also in wild and ornamentals Rosaceous plants the genetic

  15. Plasmid marker rescue transformation proceeds by breakage-reunion in Bacillus subtilis

    International Nuclear Information System (INIS)

    Weinrauch, Y.; Dubnau, D.

    1987-01-01

    Bacillus subtilis carrying a plasmid which replicates with a copy number of about 1 was transformed with linearized homologous plasmid DNA labeled with the heavy isotopes 2 H and 15 N, in the presence of 32 Pi and 6-(p-hydroxyphenylazo)-uracil to inhibit DNA replication. Plasmid DNA was isolated from the transformed culture and fractionated in cesium chloride density gradients. The distribution of total and donor plasmid DNA was examined, using specific hybridization probes. The synthesis of new DNA, associated with the integration of donor moiety, was also monitored. Donor-specific sequences were present at a density intermediate between that of light and hybrid DNA. This recombinant DNA represented 1.4% of total plasmid DNA. The latter value corresponded well with the transforming activity (1.7%) obtained for the donor marker. Newly synthesized material associated with plasmid DNA at the recombinant density amounted to a minor portion of the recombinant plasmid DNA. These data suggest that, like chromosomal transformation, plasmid marker rescue transformation does not require replication for the integration of donor markers and, also like chromosomal transformation, proceeds by a breakage-reunion mechanism. The extent of donor DNA replacement of recipient DNA per plasmid molecule of 54 kilobases (27 kilobase pairs) was estimated as 16 kilobases

  16. Selfish Little Circles: Transmission Bias and Evolution of Large Deletion-Bearing Mitochondrial DNA in Caenorhabditis briggsae Nematodes

    Science.gov (United States)

    Clark, Katie A.; Howe, Dana K.; Gafner, Kristin; Kusuma, Danika; Ping, Sita; Estes, Suzanne; Denver, Dee R.

    2012-01-01

    Selfish DNA poses a significant challenge to genome stability and organismal fitness in diverse eukaryotic lineages. Although selfish mitochondrial DNA (mtDNA) has known associations with cytoplasmic male sterility in numerous gynodioecious plant species and is manifested as petite mutants in experimental yeast lab populations, examples of selfish mtDNA in animals are less common. We analyzed the inheritance and evolution of mitochondrial DNA bearing large heteroplasmic deletions including nad5 gene sequences (nad5Δ mtDNA), in the nematode Caenorhabditis briggsae. The deletion is widespread in C. briggsae natural populations and is associated with deleterious organismal effects. We studied the inheritance patterns of nad5Δ mtDNA using eight sets of C. briggsae mutation-accumulation (MA) lines, each initiated from a different natural strain progenitor and bottlenecked as single hermaphrodites across generations. We observed a consistent and strong drive toward higher levels of deletion-bearing molecules in the heteroplasmic pool of mtDNA after ten generations of bottlenecking. Our results demonstrate a uniform transmission bias whereby nad5Δ mtDNA accumulates to higher levels relative to intact mtDNA in multiple genetically diverse natural strains of C. briggsae. We calculated an average 1% per-generation transmission bias for deletion-bearing mtDNA relative to intact genomes. Our study, coupled with known deleterious phenotypes associated with high deletion levels, shows that nad5Δ mtDNA are selfish genetic elements that have evolved in natural populations of C. briggsae, offering a powerful new system to study selfish mtDNA dynamics in metazoans. PMID:22859984

  17. Selfish little circles: transmission bias and evolution of large deletion-bearing mitochondrial DNA in Caenorhabditis briggsae nematodes.

    Directory of Open Access Journals (Sweden)

    Katie A Clark

    Full Text Available Selfish DNA poses a significant challenge to genome stability and organismal fitness in diverse eukaryotic lineages. Although selfish mitochondrial DNA (mtDNA has known associations with cytoplasmic male sterility in numerous gynodioecious plant species and is manifested as petite mutants in experimental yeast lab populations, examples of selfish mtDNA in animals are less common. We analyzed the inheritance and evolution of mitochondrial DNA bearing large heteroplasmic deletions including nad5 gene sequences (nad5Δ mtDNA, in the nematode Caenorhabditis briggsae. The deletion is widespread in C. briggsae natural populations and is associated with deleterious organismal effects. We studied the inheritance patterns of nad5Δ mtDNA using eight sets of C. briggsae mutation-accumulation (MA lines, each initiated from a different natural strain progenitor and bottlenecked as single hermaphrodites across generations. We observed a consistent and strong drive toward higher levels of deletion-bearing molecules in the heteroplasmic pool of mtDNA after ten generations of bottlenecking. Our results demonstrate a uniform transmission bias whereby nad5Δ mtDNA accumulates to higher levels relative to intact mtDNA in multiple genetically diverse natural strains of C. briggsae. We calculated an average 1% per-generation transmission bias for deletion-bearing mtDNA relative to intact genomes. Our study, coupled with known deleterious phenotypes associated with high deletion levels, shows that nad5Δ mtDNA are selfish genetic elements that have evolved in natural populations of C. briggsae, offering a powerful new system to study selfish mtDNA dynamics in metazoans.

  18. Plasmid and chromosome segregation in prokaryotes

    DEFF Research Database (Denmark)

    Møller-Jensen, Jakob; Bugge Jensen, Rasmus; Gerdes, Kenn

    2000-01-01

    Recent major advances in the understanding of prokaryotic DNA segregation have been achieved by using fluorescence microscopy to visualize the localization of cellular components. Plasmids and bacterial chromosomes are partitioned in a highly dynamic fashion, suggesting the presence of a mitotic...

  19. Plasmids encoding PKI(1-31), a specific inhibitor of cAMP-stimulated gene expression, inhibit the basal transcriptional activity of some but not all cAMP-regulated DNA response elements in JEG-3 cells.

    Science.gov (United States)

    Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J

    1989-11-25

    Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids

  20. The technology of large-scale pharmaceutical plasmid purification ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-01-04

    Jan 4, 2010 ... DNA vaccine, the cost of purification must be decreased. Although commonly .... Three mice were killed every 4 days interval. Tissues of heart, liver, .... Now, methods such as chromatography had good prospects in plasmid ...

  1. Chlamydial plasmids and bacteriophages.

    Science.gov (United States)

    Pawlikowska-Warych, Małgorzata; Śliwa-Dominiak, Joanna; Deptuła, Wiesław

    2015-01-01

    Chlamydia are absolute pathogens of humans and animals; despite being rather well recognised, they are still open for discovery. One such discovery is the occurrence of extrachromosomal carriers of genetic information. In prokaryotes, such carriers include plasmids and bacteriophages, which are present only among some Chlamydia species. Plasmids were found exclusively in Chlamydia (C.) trachomatis, C. psittaci, C. pneumoniae, C. suis, C. felis, C. muridarum and C. caviae. In prokaryotic organisms, plasmids usually code for genes that facilitate survival of the bacteria in the environment (although they are not essential). In chlamydia, their role has not been definitely recognised, apart from the fact that they participate in the synthesis of glycogen and encode proteins responsible for their virulence. Furthermore, in C. suis it was evidenced that the plasmid is integrated in a genomic island and contains the tetracycline-resistance gene. Bacteriophages specific for chlamydia (chlamydiaphages) were detected only in six species: C. psittaci, C. abortus, C. felis, C. caviae C. pecorum and C. pneumoniae. These chlamydiaphages cause inhibition of the developmental cycle, and delay transformation of reticulate bodies (RBs) into elementary bodies (EBs), thus reducing the possibility of infecting other cells in time. Plasmids and bacteriophages can be used in the diagnostics of chlamydioses; although especially in the case of plasmids, they are already used for detection of chlamydial infections. In addition, bacteriophages could be used as therapeutic agents to replace antibiotics, potentially addressing the problem of increasing antibiotic-resistance among chlamydia.

  2. Nucleotide Sequences and Comparison of Two Large Conjugative Plasmids from Different Campylobacter species

    National Research Council Canada - National Science Library

    Batchelor, Roger A; Pearson, Bruce M; Friis, Lorna M; Guerry, Patricia; Wells, Jerry M

    2004-01-01

    .... Both plasmids are mosaic in structure, having homologues of genes found in a variety of different commensal and pathogenic bacteria, but nevertheless, showed striking similarities in DNA sequence...

  3. A new approach to produce amino-carbon nanotubes as plasmid transfection vector by [2 + 1] cycloaddition of nitrenes

    International Nuclear Information System (INIS)

    Jiang Yongjian; Jin Chen; Yang Feng; Yu Xianjun; Wang Guojian; Cheng Si; Di, Yang; Li, Ji; Fu, Deliang; N, Quanxing

    2011-01-01

    Amino-carbon nanotubes (amino-CNTs) can conjugate with the DNA by electrostatic interactions and shuttle the DNA to the cell cytoplasm or even the nucleus. Here we report a new approach to produce amino-CNTs by cycloaddition of nitrenes. Fourier transform infrared spectroscopy was used to verify the success of the functionalization, and the functionalization degree was calculated by thermal gravity analysis. Transmission electron microscope (TEM) was used to observe the solubility of the CNTs and the interactions of the amino-CNTs with the plasmids. Cell ultrathin sections were made and observed under the TEM to confirm the amino-CNTs enter the cells. Transfection experiments ultimately verify the amino-CNTs produced through cycloadditions of nitrenes can serve as plasmid vector.

  4. Survival and evolution of a large multidrug resistance plasmid in new clinical bacterial hosts

    DEFF Research Database (Denmark)

    Porse, Andreas; Schønning, Kristian; Munck, Christian

    2016-01-01

    sequencing to show that the long-term persistence and molecular integrity of the plasmid is highly influenced by multiple factors within a 25 kb plasmid region constituting a host-dependent burden. In the E. coli hosts investigated here, improved plasmid stability readily evolves via IS26 mediated deletions...... consistently followed by all evolved E. coli lineages exposes a trade-off between horizontal and vertical transmission that may ultimately limit the dissemination potential of clinical multidrug resistance plasmids in these hosts....

  5. Synthesis and structure elucidation of a copper(II) Schiff-base complex: in vitro DNA binding, pBR322 plasmid cleavage and HSA binding studies.

    Science.gov (United States)

    Tabassum, Sartaj; Ahmad, Musheer; Afzal, Mohd; Zaki, Mehvash; Bharadwaj, Parimal K

    2014-11-01

    New copper(II) complex with Schiff base ligand 4-[(2-Hydroxy-3-methoxy-benzylidene)-amino]-benzoic acid (H₂L) was synthesized and characterized by spectroscopic and analytical and single crystal X-ray diffraction studies which revealed that the complex 1 exist in a distorted octahedral environment. In vitro CT-DNA binding studies were performed by employing different biophysical technique which indicated that the 1 strongly binds to DNA in comparison to ligand via electrostatic binding mode. Complex 1 cleaves pBR322 DNA via hydrolytic pathway and recognizes minor groove of DNA double helix. The HSA binding results showed that ligand and complex 1 has ability to quench the fluorescence emission intensity of Trp 214 residue available in the subdomain IIA of HSA. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Engineering of magnetic DNA nanoparticles for tumor-targeted therapy

    International Nuclear Information System (INIS)

    Hosseinkhani, Hossein; Chen Yiru; He Wenjie; Hong Poda; Yu, Dah-Shyong; Domb, Abraham J.

    2013-01-01

    This study aims to engineer novel targeted delivery system composed of magnetic DNA nanoparticles to be effective as an efficient targeted gene therapy vehicle for tumor therapy. A polysaccharide, dextran, was chosen as the vector of plasmid DNA-encoded NK4 that acts as an HGF-antagonist and anti-angiogenic regulator for inhibitions of tumor growth, invasion, and metastasis. Spermine (Sm) was chemically introduced to the hydroxyl groups of dextran to obtain dextran-Sm. When Fe 2+ solution was added to the mixture of dextran-Sm and a plasmid DNA, homogenous DNA nanoparticles were formed via chemical metal coordination bonding with average size of 230 nm. Characterization of DNA nanoparticles was performed via dynamic light scattering measurement, electrophoretic light scattering measurement, as well as transmission electron microscope. DNA nanoparticles effectively condensed plasmid DNA into nanoparticles and enhanced the stability of DNA, while significantly improved transfection efficiency in vitro and tumor accumulation in vivo. In addition, magnetic DNA nanoparticles exhibited high efficiency in antitumor therapy with regards to tumor growth as well as survival of animals evaluated in the presence of external magnetic field. We conclude that the magnetic properties of these DNA nanoparticles would enhance the tracking of non-viral gene delivery systems when administrated in vivo in a test model. These findings suggest that DNA nanoparticles effectively deliver DNA to tumor and thereby inhibiting tumor growth.

  7. Engineering of magnetic DNA nanoparticles for tumor-targeted therapy

    Energy Technology Data Exchange (ETDEWEB)

    Hosseinkhani, Hossein, E-mail: hosseinkhani@yahoo.com [Graduate Institute of Biomedical Engineering, National Taiwan University of Science and Technology (Taiwan Tech) (China); Chen Yiru [National Yang-Ming University, Department of Biomedical Engineering (China); He Wenjie; Hong Poda [Graduate Institute of Biomedical Engineering, National Taiwan University of Science and Technology (Taiwan Tech) (China); Yu, Dah-Shyong [Nanomedicine Research Center, National Defense Medical Center (China); Domb, Abraham J. [Institute of Drug Research, The Center for Nanoscience and Nanotechnology, School of Pharmacy, Faculty of Medicine, Hebrew University of Jerusalem (Israel)

    2013-01-15

    This study aims to engineer novel targeted delivery system composed of magnetic DNA nanoparticles to be effective as an efficient targeted gene therapy vehicle for tumor therapy. A polysaccharide, dextran, was chosen as the vector of plasmid DNA-encoded NK4 that acts as an HGF-antagonist and anti-angiogenic regulator for inhibitions of tumor growth, invasion, and metastasis. Spermine (Sm) was chemically introduced to the hydroxyl groups of dextran to obtain dextran-Sm. When Fe{sup 2+} solution was added to the mixture of dextran-Sm and a plasmid DNA, homogenous DNA nanoparticles were formed via chemical metal coordination bonding with average size of 230 nm. Characterization of DNA nanoparticles was performed via dynamic light scattering measurement, electrophoretic light scattering measurement, as well as transmission electron microscope. DNA nanoparticles effectively condensed plasmid DNA into nanoparticles and enhanced the stability of DNA, while significantly improved transfection efficiency in vitro and tumor accumulation in vivo. In addition, magnetic DNA nanoparticles exhibited high efficiency in antitumor therapy with regards to tumor growth as well as survival of animals evaluated in the presence of external magnetic field. We conclude that the magnetic properties of these DNA nanoparticles would enhance the tracking of non-viral gene delivery systems when administrated in vivo in a test model. These findings suggest that DNA nanoparticles effectively deliver DNA to tumor and thereby inhibiting tumor growth.

  8. Differential Salt-Induced Dissociation of the p53 Protein Complexes with Circular and Linear Plasmid DNA Substrates Suggest Involvement of a Sliding Mechanism

    Czech Academy of Sciences Publication Activity Database

    Šebest, Peter; Brázdová, Marie; Fojta, Miroslav; Pivoňková, Hana

    2015-01-01

    Roč. 16, č. 2 (2015), s. 3163-3177 E-ISSN 1422-0067 R&D Projects: GA ČR(CZ) GAP301/11/2076; GA ČR(CZ) GBP206/12/G151 Institutional support: RVO:68081707 Keywords : TUMOR-SUPPRESSOR P53 * CISPLATIN -DAMAGED DNA * SUPERCOILED DNA Subject RIV: BO - Biophysics Impact factor: 3.257, year: 2015

  9. Chondroitin sulfate-polyethylenimine copolymer-coated superparamagnetic iron oxide nanoparticles as an efficient magneto-gene carrier for microRNA-encoding plasmid DNA delivery

    Science.gov (United States)

    Lo, Yu-Lun; Chou, Han-Lin; Liao, Zi-Xian; Huang, Shih-Jer; Ke, Jyun-Han; Liu, Yu-Sheng; Chiu, Chien-Chih; Wang, Li-Fang

    2015-04-01

    MicroRNA-128 (miR-128) is an attractive therapeutic molecule with powerful glioblastoma regulation properties. However, miR-128 lacks biological stability and leads to poor delivery efficacy in clinical applications. In our previous study, we demonstrated two effective transgene carriers, including polyethylenimine (PEI)-decorated superparamagnetic iron oxide nanoparticles (SPIONs) as well as chemically-conjugated chondroitin sulfate-PEI copolymers (CPs). In this contribution, we report optimized conditions for coating CPs onto the surfaces of SPIONs, forming CPIOs, for magneto-gene delivery systems. The optimized weight ratio of the CPs and SPIONs is 2 : 1, which resulted in the formation of a stable particle as a good transgene carrier. The hydrodynamic diameter of the CPIOs is ~136 nm. The gel electrophoresis results demonstrate that the weight ratio of CPIO/DNA required to completely encapsulate pDNA is >=3. The in vitro tests of CPIO/DNA were done in 293 T, CRL5802, and U87-MG cells in the presence and absence of an external magnetic field. The magnetofection efficiency of CPIO/DNA was measured in the three cell lines with or without fetal bovine serum (FBS). CPIO/DNA exhibited remarkably improved gene expression in the presence of the magnetic field and 10% FBS as compared with a gold non-viral standard, PEI/DNA, and a commercial magnetofection reagent, PolyMag/DNA. In addition, CPIO/DNA showed less cytotoxicity than PEI/DNA and PolyMag/DNA against the three cell lines. The transfection efficiency of the magnetoplex improved significantly with an assisted magnetic field. In miR-128 delivery, a microRNA plate array and fluorescence in situ hybridization were used to demonstrate that CPIO/pMIRNA-128 indeed expresses more miR-128 with the assisted magnetic field than without. In a biodistribution test, CPIO/Cy5-DNA showed higher accumulation at the tumor site where an external magnet is placed nearby.MicroRNA-128 (miR-128) is an attractive therapeutic molecule

  10. Application of methylation in improving plasmid transformation into Helicobacter pylori.

    Science.gov (United States)

    Zhao, Huilin; Xu, Linlin; Rong, Qianyu; Xu, Zheng; Ding, Yunfei; Zhang, Ying; Wu, Yulong; Li, Boqing; Ji, Xiaofei

    2018-05-23

    Helicobacter pylori is an important gastrointestinal pathogen. Its strains possess different levels of powerful restriction modification systems, which are significant barriers to genetic tools used for studying the role of functional genes in its pathogenesis. Methylating vectors in vitro was reported as an alternative to overcome this barrier in several bacteria. In this study we used two H. pylori-E. coli shuttle plasmids and several single/double-crossover homologous recombination gene-targeting plasmids, to test the role of methylation in H. pylori transformation. According to our results, transformants could be obtained only after shuttle plasmids were methylated before transformation. It is helpful in gene complementation and over-expression although at a low frequency. The frequency of gene-targeting transformation was also increased after methylation, especially for the single-crossover recombination plasmids, the transformants of which could only be obtained after methylation. For the double-crossover recombination targeting plasmids, the initial yield of transformants was 0.3-0.8 × 10 2 CFUs per microgram plasmid DNA. With the help of methylation, the yield was increased to 0.4-1.3 × 10 2 CFUs per microgram plasmid DNA. These results suggest that in vitro methylation can improve H. pylori transformation by different plasmids, which will benefit the pathogenic mechanism research. Copyright © 2018. Published by Elsevier B.V.

  11. Damage to plasmid DNA produced by 60Co-gamma radiation and subsequent repair processes in E. coli with and without SOS induction

    International Nuclear Information System (INIS)

    Bien, M.

    1986-01-01

    This study was carried out to provide information on the question as to whether radiation-induced separation of double-stranded DNA in E. coli is followed by repair processes leading to the formation of replicable material. For the detection of those double-strand breaks, E. coli was first transformed using enzymatically linearised dBR 322-DNA. This served as a reference standard to compare the transformations using radiated DNA. DNA was either exposed to increasing doses of 60 Co-gamma radiation or separated into one oc-fraction and one lin-fraction following exposure to 30 Gy. The DNA samples thus obtained were then used to transform three different strains of E. coli (wild strain, SFX, SFXrecA - ). In order to improve the repair yield, the cells were additionally SOS-induced using ultraviolet radiation. The mutation rates were a measure of the number of errors occurring during the various repair processes. Restriction analysis was carried out to characterise the resulting mutants in greater detail. (orig./MG) [de

  12. Ternary complex of plasmid DNA with NLS-Mu-Mu protein and cationic niosome for biocompatible and efficient gene delivery: a comparative study with protamine and lipofectamine.

    Science.gov (United States)

    Nematollahi, Mohammad Hadi; Torkzadeh-Mahanai, Masoud; Pardakhty, Abbas; Ebrahimi Meimand, Hossein Ali; Asadikaram, Gholamreza

    2017-10-28

    Non-viral gene delivery methods are considered due to safety and simplicity in human gene therapy. Since the use of cationic peptide and niosome represent a promising approach for gene delivery purposes we used recombinant fusion protein and cationic niosome as a gene carrier. A multi-domain fusion protein including nuclear localization motif (NLS) and two DNA-binding (Mu) domains, namely NLS-Mu-Mu (NMM) has been designed, cloned and expressed in E. coli DE3 strain. Afterward, the interested protein was purified by affinity chromatography. Binary vectors based on protein/DNA and ternary vectors based on protein/DNA/niosome were prepared. Protamine was used as a control. DNA condensing properties of NMM and protamine were evaluated by various experiments. Furthermore, we examined cytotoxicity, hemolysis and transfection potential of the binary and ternary complexes in HEK293T and MCF-7 cell lines. Protamine and Lipofectamine™2000 were used as positive controls, correspondingly. The recombinant NMM was expressed and purified successfully and DNA was condensed efficiently at charge ratios that were not harmful to cells. Peptidoplexes showed transfection efficiency (TE) but ternary complexes had higher TE. Additionally, NMM ternary complex was more efficient compared to protamine ternary vectors. Our results showed that niosomal ternary vector of NMM is a promising non-viral gene carrier to achieve an effective and safe carrier system for gene therapy.

  13. Influence of anoxia on the induction of mutations by phenylalanine radicals during gamma-irradiation of plasmid DNA in aqueous solution.

    Science.gov (United States)

    Kuipers, Gitta K; Slotman, Ben J; Reitsma-Wijker, Carola A; van Andel, Rob J; Poldervaart, Hester A; Lafleur, M Vincent M

    2004-12-21

    When DNA is irradiated in aqueous solution, most of the damage is inflicted by water-derived radicals. This is called the indirect effect of ionizing radiation. However in whole cells not only the primary formed water radicals play a role, because some cellular compounds form secondary radicals which can also damage DNA. It is known that the amino acid phenylalanine is able to react with water radicals, resulting in the production of secondary phenylalanine radicals which can damage and inactivate DNA. In a previous study the influence of the presence of phenylalanine during gamma-irradiation of DNA in aqueous solution under oxic conditions was studied. Under anoxic irradiation conditions different amounts and types of reactive water-derived radicals are formed compared to oxic conditions and also different phenylalanine radicals are formed. Therefore, this study examines the influence of the presence of phenylalanine under anoxic conditions on the gamma-radiation-induced mutation spectrum. The results indicate that phenylalanine radicals are damaging to DNA, but less effective compared to primary water radicals. On the mutational level, in the presence of phenylalanine radicals under anoxic conditions, the amount of mutations on G:C base pairs was significantly decreased as compared to oxic conditions. Furthermore, the results of this study indicate that nucleotide excision repair is involved in repair of both inactivating and mutagenic damage induced by phenylalanine radicals under anoxic conditions.

  14. Chemical repair activity of free radical scavenger edaravone. Reduction reactions with dGMP hydroxyl radical adducts and suppression of base lesions and AP sites on irradiated plasmid DNA

    International Nuclear Information System (INIS)

    Hata, Kuniki; Katsumura, Yosuke; Urushibara, Ayumi; Yamashita, Shinichi; Lin Mingzhang; Muroya, Yusa; Shikazono, Naoya; Yokoya, Akinari; Fu Haiying

    2015-01-01

    Reactions of edaravone (3-methyl-1-phenyl-2-pyrazolin-5-one) with deoxyguanosine monophosphate (dGMP) hydroxyl radical adducts were investigated by pulse radiolysis technique. Edaravone was found to reduce the dGMP hydroxyl radical adducts through electron transfer reactions. The rate constants of the reactions were greater than 4 × 10 8 dm 3 mol -1 s -1 and similar to those of the reactions of ascorbic acid, which is a representative antioxidant. Yields of single-strand breaks, base lesions, and abasic sites produced in pUC18 plasmid DNA by gamma ray irradiation in the presence of low concentrations (10–1000 μmol dm -3 ) of edaravone were also quantified, and the chemical repair activity of edaravone was estimated by a method recently developed by the authors. By comparing suppression efficiencies to the induction of each DNA lesion, it was found that base lesions and abasic sites were suppressed by the chemical repair activity of edaravone, although the suppression of single-strand breaks was not very effective. This phenomenon was attributed to the chemical repair activity of edaravone toward base lesions and abasic sites. However, the chemical repair activity of edaravone for base lesions was lower than that of ascorbic acid. (author)

  15. Chemical repair activity of free radical scavenger edaravone: reduction reactions with dGMP hydroxyl radical adducts and suppression of base lesions and AP sites on irradiated plasmid DNA.

    Science.gov (United States)

    Hata, Kuniki; Urushibara, Ayumi; Yamashita, Shinichi; Lin, Mingzhang; Muroya, Yusa; Shikazono, Naoya; Yokoya, Akinari; Fu, Haiying; Katsumura, Yosuke

    2015-01-01

    Reactions of edaravone (3-methyl-1-phenyl-2-pyrazolin-5-one) with deoxyguanosine monophosphate (dGMP) hydroxyl radical adducts were investigated by pulse radiolysis technique. Edaravone was found to reduce the dGMP hydroxyl radical adducts through electron transfer reactions. The rate constants of the reactions were greater than 4 × 10(8) dm(3) mol(-1) s(-1) and similar to those of the reactions of ascorbic acid, which is a representative antioxidant. Yields of single-strand breaks, base lesions, and abasic sites produced in pUC18 plasmid DNA by gamma ray irradiation in the presence of low concentrations (10-1000 μmol dm(-3)) of edaravone were also quantified, and the chemical repair activity of edaravone was estimated by a method recently developed by the authors. By comparing suppression efficiencies to the induction of each DNA lesion, it was found that base lesions and abasic sites were suppressed by the chemical repair activity of edaravone, although the suppression of single-strand breaks was not very effective. This phenomenon was attributed to the chemical repair activity of edaravone toward base lesions and abasic sites. However, the chemical repair activity of edaravone for base lesions was lower than that of ascorbic acid. © The Author 2014. Published by Oxford University Press on behalf of The Japan Radiation Research Society and Japanese Society for Radiation Oncology.

  16. Yeast transformation mediated by Agrobacterium strains harboring an Ri plasmid: comparative study between GALLS of an Ri plasmid and virE of a Ti plasmid.

    Science.gov (United States)

    Kiyokawa, Kazuya; Yamamoto, Shinji; Sato, Yukari; Momota, Naoto; Tanaka, Katsuyuki; Moriguchi, Kazuki; Suzuki, Katsunori

    2012-07-01

    Agrobacterium strains containing a Ti plasmid can transfer T-DNA not only to plants but also to fungi, including the yeast Saccharomyces cerevisiae. However, no Agrobacterium strain harboring an Ri plasmid has been evaluated in fungal transformation. Some Ri plasmids have GALLS , instead of virE1 and virE2. GALLS protein can functionally substitute in plant transformation for a structurally different protein VirE2. In this study, we compared the yeast transformation ability among Agrobacterium donors: a strain containing a Ti plasmid, strains harboring either an agropine-type or a mikimopine-type Ri plasmid, and a strain having a modified Ri plasmid supplemented with a Ti plasmid type virE operon. Agrobacterium strains possessing GALLS transformed yeast cells far less efficiently than the strain containing virE operon. Production of GALLS in recipient yeast cells improved the yeast transformation mediated by an Agrobacterium strain lacking neither GALLS nor virE operon. A reporter assay to detect mobilization of the proteins fused with Cre recombinase revealed that VirE2 protein is much more abundant in yeast cells than GALLS. Based on these results, we concluded that the low yeast transformability mediated by Agrobacterium strains having the Ri plasmid is because of low amount of mobilized GALLS in yeast cells. © 2012 The Authors Journal compilation © 2012 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.

  17. Influence of anoxia on the induction of mutations by phenylalanine radicals during gamma-irradiation of plasmid DNA in aqueous solution.

    NARCIS (Netherlands)

    Kuipers, G.K.; Slotman, B.J.; Reitsma-Wijker, CA; Andel, R.J.; Poldervaart, H.A.; Lafleur, M.V.M.

    2004-01-01

    When DNA is irradiated in aqueous solution, most of the damage is inflicted by water-derived radicals. This is called the indirect effect of ionizing radiation. However in whole cells not only the primary formed water radicals play a role, because some cellular compounds form secondary radicals

  18. Comparative Immunogenicity in Rhesus Monkeys of DNA Plasmid, Recombinant Vaccinia Virus, and Replication-Defective Adenovirus Vectors Expressing a Human Immunodeficiency Virus Type 1 gag Gene

    OpenAIRE

    Casimiro, Danilo R.; Chen, Ling; Fu, Tong-Ming; Evans, Robert K.; Caulfield, Michael J.; Davies, Mary-Ellen; Tang, Aimin; Chen, Minchun; Huang, Lingyi; Harris, Virginia; Freed, Daniel C.; Wilson, Keith A.; Dubey, Sheri; Zhu, De-Min; Nawrocki, Denise

    2003-01-01

    Cellular immune responses, particularly those associated with CD3+ CD8+ cytotoxic T lymphocytes (CTL), play a primary role in controlling viral infection, including persistent infection with human immunodeficiency virus type 1 (HIV-1). Accordingly, recent HIV-1 vaccine research efforts have focused on establishing the optimal means of eliciting such antiviral CTL immune responses. We evaluated several DNA vaccine formulations, a modified vaccinia virus Ankara vector, and a replication-defecti...

  19. Structural analysis of the ParR/parC plasmid partition complex

    DEFF Research Database (Denmark)

    Møller-Jensen, Jakob; Ringgaard, Simon; Mercogliano, Christopher P

    2007-01-01

    Accurate DNA partition at cell division is vital to all living organisms. In bacteria, this process can involve partition loci, which are found on both chromosomes and plasmids. The initial step in Escherichia coli plasmid R1 partition involves the formation of a partition complex between the DNA...

  20. A new optimized formulation of cationic solid lipid nanoparticles intended for gene delivery: development, characterization and DNA binding efficiency of TCERG1 expression plasmid.

    Science.gov (United States)

    Fàbregas, Anna; Sánchez-Hernández, Noemí; Ticó, Josep Ramon; García-Montoya, Encarna; Pérez-Lozano, Pilar; Suñé-Negre, Josep M; Hernández-Munain, Cristina; Suñé, Carlos; Miñarro, Montserrat

    2014-10-01

    Solid lipid nanoparticles (SLNs) are being considered as a new approach for therapeutics for many known diseases. In addition to drug delivery, their use as non-viral vectors for gene delivery can be achieved by the inclusion of cationic lipids, which provide a positive surface potential that favours binding to the DNA backbone. This work is based on the idea that the optimization of the components is required as the first step in simplifying the qualitative and quantitative composition of SLNs as much as possible without affecting the essential properties that define SLNs as optimal non-viral vectors for gene delivery. We selected the best lipids and surfactants in terms of particle size and zeta potential and characterized the properties of the resulting nanoparticles using X-ray photoelectron spectroscopy (XPS) and atomic force microscopy (AFM). The SLNs had a particle size of approximately 120 nm and a positive surface charge of 42 mV. In addition, we analysed the main physicochemical characteristics of the bulk components of the nanoparticles using X-ray diffraction (XRD), differential scanning calorimetry (DSC) and mass spectrometry (MS). The suitability of the optimized SLNs for DNA binding was evaluated after the lyophilisation process using a carboxyl-terminal region of the TCERG1 gene, a human factor that has been implicated in several diseases. We show that the SLNs presented high efficiency in the binding of DNA, and importantly, they presented no toxicity when assayed in an in vivo system. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Plasmid-Mediated Antimicrobial Resistance in Staphylococci and Other Firmicutes.

    Science.gov (United States)

    Schwarz, Stefan; Shen, Jianzhong; Wendlandt, Sarah; Fessler, Andrea T; Wang, Yang; Kadlec, Kristina; Wu, Cong-Ming

    2014-12-01

    In staphylococci and other Firmicutes, resistance to numerous classes of antimicrobial agents, which are commonly used in human and veterinary medicine, is mediated by genes that are associated with mobile genetic elements. The gene products of some of these antimicrobial resistance genes confer resistance to only specific members of a certain class of antimicrobial agents, whereas others confer resistance to the entire class or even to members of different classes of antimicrobial agents. The resistance mechanisms specified by the resistance genes fall into any of three major categories: active efflux, enzymatic inactivation, and modification/replacement/protection of the target sites of the antimicrobial agents. Among the mobile genetic elements that carry such resistance genes, plasmids play an important role as carriers of primarily plasmid-borne resistance genes, but also as vectors for nonconjugative and conjugative transposons that harbor resistance genes. Plasmids can be exchanged by horizontal gene transfer between members of the same species but also between bacteria belonging to different species and genera. Plasmids are highly flexible elements, and various mechanisms exist by which plasmids can recombine, form cointegrates, or become integrated in part or in toto into the chromosomal DNA or into other plasmids. As such, plasmids play a key role in the dissemination of antimicrobial resistance genes within the gene pool to which staphylococci and other Firmicutes have access. This chapter is intended to provide an overview of the current knowledge of plasmid-mediated antimicrobial resistance in staphylococci and other Firmicutes.

  2. Conformational and mechanical changes of DNA upon transcription factor binding detected by a QCM and transmission line model.

    Science.gov (United States)

    de-Carvalho, Jorge; Rodrigues, Rogério M M; Tomé, Brigitte; Henriques, Sílvia F; Mira, Nuno P; Sá-Correia, Isabel; Ferreira, Guilherme N M

    2014-04-21

    A novel quartz crystal microbalance (QCM) analytical method is developed based on the transmission line model (TLM) algorithm to analyze the binding of transcription factors (TFs) to immobilized DNA oligoduplexes. The method is used to characterize the mechanical properties of biological films through the estimation of the film dynamic shear moduli, G and G, and the film thickness. Using the Saccharomyces cerevisiae transcription factor Haa1 (Haa1DBD) as a biological model two sensors were prepared by immobilizing DNA oligoduplexes, one containing the Haa1 recognition element (HRE(wt)) and another with a random sequence (HRE(neg)) used as a negative control. The immobilization of DNA oligoduplexes was followed in real time and we show that DNA strands initially adsorb with low or non-tilting, laying flat close to the surface, which then lift-off the surface leading to final film tilting angles of 62.9° and 46.7° for HRE(wt) and HRE(neg), respectively. Furthermore we show that the binding of Haa1DBD to HRE(wt) leads to a more ordered and compact film, and forces a 31.7° bending of the immobilized HRE(wt) oligoduplex. This work demonstrates the suitability of the QCM to monitor the specific binding of TFs to immobilized DNA sequences and provides an analytical methodology to study protein-DNA biophysics and kinetics.

  3. Screening of degradative plasmids from Arthrobacter sp. HW08 and ...

    African Journals Online (AJOL)

    Administrator

    2011-06-08

    Jun 8, 2011 ... Media were solidified, if necessary, by the addition of 15 g agar ... genome extraction reagent kit, plasmid DNA fast extraction kit and. DNA segments ... spectrophotometer (Spectronic Instruments, Rochester, NY) and. SW content .... cultivation on LB slant for 100 times at 30 °C for 2 days, it was found that ...

  4. Isolation and properties of plasmids from Deinococcus radiodurans Sark

    International Nuclear Information System (INIS)

    Sjarief, S.H.; Kikuchi, Masahiro; Kurita, Hiromi; Kitayama, Shigeru; Watanabe, Hiroshi.

    1990-05-01

    Radioresistant bacterium, Deinococcus radiodurans, can repair completely almost all of DNA damages including double strand breaks induced by gamma-rays up to about 5 kGy. In order to reveal the repair mechanism, it is necessary to develop a cloning vector available for the genetic analysis. We tried to isolate plasmids from D.radiodurans Sark strain. In the present paper the isolation and properties of plasmids were described. (author)

  5. 53BP1 nuclear bodies form around DNA lesions generated by mitotic transmission of chromosomes under replication stress

    DEFF Research Database (Denmark)

    Lukas, Claudia; Savic, Velibor; Bekker-Jensen, Simon

    2011-01-01

    stress increases the frequency of chromosomal lesions that are transmitted to daughter cells. Throughout G1, these lesions are sequestered in nuclear compartments marked by p53-binding protein 1 (53BP1) and other chromatin-associated genome caretakers. We show that the number of such 53BP1 nuclear bodies...... increases after genetic ablation of BLM, a DNA helicase associated with dissolution of entangled DNA. Conversely, 53BP1 nuclear bodies are partially suppressed by knocking down SMC2, a condensin subunit required for mechanical stability of mitotic chromosomes. Finally, we provide evidence that 53BP1 nuclear...... bodies shield chromosomal fragile sites sequestered in these compartments against erosion. Together, these data indicate that restoration of DNA or chromatin integrity at loci prone to replication problems requires mitotic transmission to the next cell generations....

  6. Gene expression profiles in primary duodenal chick cells following transfection with avian influenza virus H5 DNA plasmid encapsulated in silver nanoparticles

    Directory of Open Access Journals (Sweden)

    Jazayeri SD

    2013-02-01

    Full Text Available Seyed Davoud Jazayeri,1 Aini Ideris,1,2 Kamyar Shameli,3 Hassan Moeini,1 Abdul Rahman Omar1,21Institute of Bioscience, 2Faculty of Veterinary Medicine, 3Faculty of Science, Universiti Putra Malaysia, Serdang, Selangor, MalaysiaAbstract: In order to develop a systemically administered safe and effective nonviral gene delivery system against avian influenza virus (AIV that induced cytokine expression, the hemagglutinin (H5 gene of AIV, A/Ck/Malaysia/5858/04 (H5N1 and green fluorescent protein were cloned into a coexpression vector pIRES (pIREGFP-H5 and formulated using green synthesis of silver nanoparticles (AgNPs with poly(ethylene glycol and transfected into primary duodenal cells taken from 18-day-old specific-pathogen-free chick embryos. The AgNPs were prepared using moderated temperature and characterized for particle size, surface charge, ultraviolet-visible spectra, DNA loading, and stability. AgNPs and AgNP-pIREGFP-H5 were prepared in the size range of 13.9 nm and 25 nm with a positive charge of +78 ± 0.6 mV and +40 ± 6.2 mV, respectively. AgNPs with a positive surface charge could encapsulate pIREGFP-H5 efficiently. The ultraviolet-visible spectra for AgNP-pIREGFP-H5 treated with DNase I showed that the AgNPs were able to encapsulate pIREGFP-H5 efficiently. Polymerase chain reaction showed that AgNP-pIREGFP-H5 entered into primary duodenal cells rapidly, as early as one hour after transfection. Green fluorescent protein expression was observed after 36 hours, peaked at 48 hours, and remained stable for up to 60 hours. In addition, green fluorescent protein expression generally increased with increasing DNA concentration and time. Cells were transfected using Lipocurax in vitro transfection reagent as a positive control. A multiplex quantitative mRNA gene expression assay in the transfected primary duodenal cells via the transfection reagent and AgNPs with pIREGFP-H5 revealed expression of interleukin (IL-18, IL-15, and IL-12

  7. TopBP1 is required at mitosis to reduce transmission of DNA damage to G1 daughter cells

    Science.gov (United States)

    Pedersen, Rune Troelsgaard; Kruse, Thomas; Nilsson, Jakob

    2015-01-01

    Genome integrity is critically dependent on timely DNA replication and accurate chromosome segregation. Replication stress delays replication into G2/M, which in turn impairs proper chromosome segregation and inflicts DNA damage on the daughter cells. Here we show that TopBP1 forms foci upon mitotic entry. In early mitosis, TopBP1 marks sites of and promotes unscheduled DNA synthesis. Moreover, TopBP1 is required for focus formation of the structure-selective nuclease and scaffold protein SLX4 in mitosis. Persistent TopBP1 foci transition into 53BP1 nuclear bodies (NBs) in G1 and precise temporal depletion of TopBP1 just before mitotic entry induced formation of 53BP1 NBs in the next cell cycle, showing that TopBP1 acts to reduce transmission of DNA damage to G1 daughter cells. Based on these results, we propose that TopBP1 maintains genome integrity in mitosis by controlling chromatin recruitment of SLX4 and by facilitating unscheduled DNA synthesis. PMID:26283799

  8. Beyond repair foci: DNA double-strand break repair in euchromatic and heterochromatic compartments analyzed by transmission electron microscopy.

    Directory of Open Access Journals (Sweden)

    Yvonne Lorat

    Full Text Available DNA double-strand breaks (DSBs generated by ionizing radiation pose a serious threat to the preservation of genetic and epigenetic information. The known importance of local chromatin configuration in DSB repair raises the question of whether breaks in different chromatin environments are recognized and repaired by the same repair machinery and with similar efficiency. An essential step in DSB processing by non-homologous end joining is the high-affinity binding of Ku70-Ku80 and DNA-PKcs to double-stranded DNA ends that holds the ends in physical proximity for subsequent repair.Using transmission electron microscopy to localize gold-labeled pKu70 and pDNA-PKcs within nuclear ultrastructure, we monitored the formation and repair of actual DSBs within euchromatin (electron-lucent and heterochromatin (electron-dense in cortical neurons of irradiated mouse brain.While DNA lesions in euchromatin (characterized by two pKu70-gold beads, reflecting the Ku70-Ku80 heterodimer are promptly sensed and rejoined, DNA packaging in heterochromatin appears to retard DSB processing, due to the time needed to unravel higher-order chromatin structures. Complex pKu70-clusters formed in heterochromatin (consisting of 4 or ≥ 6 gold beads may represent multiple breaks in close proximity caused by ionizing radiation of highly-compacted DNA. All pKu70-clusters disappeared within 72 hours post-irradiation, indicating efficient DSB rejoining. However, persistent 53BP1 clusters in heterochromatin (comprising ≥ 10 gold beads, occasionally co-localizing with γH2AX, but not pKu70 or pDNA-PKcs, may reflect incomplete or incorrect restoration of chromatin structure rather than persistently unrepaired DNA damage.Higher-order organization of chromatin determines the accessibility of DNA lesions to repair complexes, defining how readily DSBs are detected and processed. DNA lesions in heterochromatin appear to be more complex, with multiple breaks in spatial vicinity inducing

  9. Natural plasmid transformation in a high-frequency-of transformation marine Vibrio strain

    International Nuclear Information System (INIS)

    Frischer, M.E.; Thurmond, J.M.; Paul, J.H.

    1990-01-01

    The estuarine bacterium Vibrio strain DI-9 has been shown to be naturally transformable with both broad host range plasmid multimers and homologous chromosomal DNA at average frequencies of 3.5 x 10 -9 and 3.4 x 10 -7 transformants per recipient, respectively. Growth of plasmid transformants in nonselective medium resulted in cured strains that transformed 6 to 42,857 times more frequently than the parental strain, depending on the type of transforming DNA. These high-frequency-of-transformation (HfT) strains were transformed at frequencies ranging from 1.1 x 10 -8 to 1.3 x 10 -4 transformants per recipient with plasmid DNA and at an average frequency of 8.3 x 10 -5 transformants per recipient with homologous chromosomal DNA. The highest transformation frequencies were observed by using multimers of an R1162 derivative carrying the transposon Tn5 (pQSR50). Probing of total DNA preparations from one of the cured strains demonstrated that no plasmid DNA remained in the cured strains which may have provided homology to the transforming DNA. All transformants and cured strains could be differentiated from the parental strains by colony morphology. DNA binding studies indicated that late-log-phase HfT strains bound [ 3 H]bacteriophage lambda DNA 2.1 times more rapidly than the parental strain. These results suggest that the original plasmid transformation event of strain DI-9 was the result of uptake and expression of plasmid DNA by a competent mutant (HfT strain). Additionally, it was found that a strain of Vibrio parahaemolyticus, USFS 3420, could be naturally transformed with plasmid DNA. Natural plasmid transformation by high-transforming mutants may be a means of plasmid acquisition by natural aquatic bacterial populations

  10. Safety and tolerability of conserved region vaccines vectored by plasmid DNA, simian adenovirus and modified vaccinia virus ankara administered to human immunodeficiency virus type 1-uninfected adults in a randomized, single-blind phase I trial.

    Directory of Open Access Journals (Sweden)

    Emma-Jo Hayton

    Full Text Available HIV-1 vaccine development has advanced slowly due to viral antigenic diversity, poor immunogenicity and recently, safety concerns associated with human adenovirus serotype-5 vectors. To tackle HIV-1 variation, we designed a unique T-cell immunogen HIVconsv from functionally conserved regions of the HIV-1 proteome, which were presented to the immune system using a heterologous prime-boost combination of plasmid DNA, a non-replicating simian (chimpanzee adenovirus ChAdV-63 and a non-replicating poxvirus, modified vaccinia virus Ankara. A block-randomized, single-blind, placebo-controlled phase I trial HIV-CORE 002 administered for the first time candidate HIV-1- vaccines or placebo to 32 healthy HIV-1/2-uninfected adults in Oxford, UK and elicited high frequencies of HIV-1-specific T cells capable of inhibiting HIV-1 replication in vitro. Here, detail safety and tolerability of these vaccines are reported.Local and systemic reactogenicity data were collected using structured interviews and study-specific diary cards. Data on all other adverse events were collected using open questions. Serum neutralizing antibody titres to ChAdV-63 were determined before and after vaccination.Two volunteers withdrew for vaccine-unrelated reasons. No vaccine-related serious adverse events or reactions occurred during 190 person-months of follow-up. Local and systemic events after vaccination occurred in 27/32 individuals and most were mild (severity grade 1 and predominantly transient (<48 hours. Myalgia and flu-like symptoms were more strongly associated with MVA than ChAdV63 or DNA vectors and more common in vaccine recipients than in placebo. There were no intercurrent HIV-1 infections during follow-up. 2/24 volunteers had low ChAdV-63-neutralizing titres at baseline and 7 increased their titres to over 200 with a median (range of 633 (231-1533 post-vaccination, which is of no safety concern.These data demonstrate safety and good tolerability of the pSG2

  11. Safety and immunogenicity of an HIV adenoviral vector boost after DNA plasmid vaccine prime by route of administration: a randomized clinical trial.

    Directory of Open Access Journals (Sweden)

    Beryl A Koblin

    Full Text Available In the development of HIV vaccines, improving immunogenicity while maintaining safety is critical. Route of administration can be an important factor.This multicenter, open-label, randomized trial, HVTN 069, compared routes of administration on safety and immunogenicity of a DNA vaccine prime given intramuscularly at 0, 1 and 2 months and a recombinant replication-defective adenovirus type 5 (rAd5 vaccine boost given at 6 months by intramuscular (IM, intradermal (ID, or subcutaneous (SC route. Randomization was computer-generated by a central data management center; participants and staff were not blinded to group assignment. The outcomes were vaccine reactogenicity and humoral and cellular immunogenicity. Ninety healthy, HIV-1 uninfected adults in the US and Peru, aged 18-50 were enrolled and randomized. Due to the results of the Step Study, injections with rAd5 vaccine were halted; thus 61 received the booster dose of rAd5 vaccine (IM: 20; ID:21; SC:20. After the rAd5 boost, significant differences by study arm were found in severity of headache, pain and erythema/induration. Immune responses (binding and neutralizing antibodies, IFN-γ ELISpot HIV-specific responses and CD4+ and CD8+ T-cell responses by ICS at four weeks after the rAd5 booster were not significantly different by administration route of the rAd5 vaccine boost (Binding antibody responses: IM: 66.7%; ID: 70.0%; SC: 77.8%; neutralizing antibody responses: IM: 11.1%; ID: 0.0%; SC 16.7%; ELISpot responses: IM: 46.7%; ID: 35.3%; SC: 44.4%; CD4+ T-cell responses: IM: 29.4%; ID: 20.0%; SC: 35.3%; CD8+ T-cell responses: IM: 29.4%; ID: 16.7%; SC: 50.0%.This study was limited by the reduced sample size. The higher frequency of local reactions after ID and SC administration and the lack of sufficient evidence to show that there were any differences in immunogenicity by route of administration do not support changing route of administration for the rAd5 boost.ClinicalTrials.gov NCT00384787.

  12. Hepatitis B virus DNA in saliva from children with chronic hepatitis B infection: implications for saliva as a potential mode of horizontal transmission

    DEFF Research Database (Denmark)

    Heiberg, Ida Louise; Hoegh, Mette; Ladelund, Steen

    2010-01-01

    To explore the mechanism of horizontal transmission of hepatitis B virus (HBV) among children, we investigated the quantitative relationship between HBV in saliva and blood from 46 children with chronic hepatitis B. We found high levels of HBV DNA in saliva of HBeAg (+) children, suggesting saliva...... as a vehicle for horizontal transmission of HBV among children....

  13. Evidence of transmission of Mycobacterium tuberculosis by random amplified polymorphic DNA (RAPD) fingerprinting in Taipei City, Taiwan.

    Science.gov (United States)

    Harn, H J; Shen, K L; Ho, L I; Yu, K W; Liu, G C; Yueh, K C; Lee, J H

    1997-01-01

    AIMS: To determine, by strain identification of Mycobacterium tuberculosis, whether transmission has occurred between individuals or whether new strains are present. METHODS: A rapid protocol for random amplified polymorphic DNA (RAPD) analysis was developed. This protocol was applied to 64 strains of M tuberculosis that had been confirmed by culture and microbiological methods. RESULTS: There are five groups of M tuberculosis prevalent in Taipei city, Taiwan. The major types are groups I and III. Groups I and II had been prevalent until the end of last year when, according to our group analysis, they had been eradicated. However, group III was continuously present from the middle of 1995 to the middle of 1996, and group IV was present at the end of both years, which indicated that both groups were transmitted continuously. These clustered strains had demographic characteristics consistent with a finding of transmission tuberculosis. Also, there were 13 of 64 strains with unique RAPD fingerprints that were inferred to be due primarily to the reactivation of infection. In the drug resistance analysis, the major type represented included group III and part of group IV. CONCLUSIONS: Our preliminary data imply, not only that the prevalence of M tuberculosis in Taipei city is due to transmission rather than reactivation, but that drug resistance also may play a role in tuberculosis transmission. Images PMID:9378819

  14. Mechanisms of Evolution in High-Consequence Drug Resistance Plasmids

    Directory of Open Access Journals (Sweden)

    Susu He

    2016-12-01

    Full Text Available The dissemination of resistance among bacteria has been facilitated by the fact that resistance genes are usually located on a diverse and evolving set of transmissible plasmids. However, the mechanisms generating diversity and enabling adaptation within highly successful resistance plasmids have remained obscure, despite their profound clinical significance. To understand these mechanisms, we have performed a detailed analysis of the mobilome (the entire mobile genetic element content of a set of previously sequenced carbapenemase-producing Enterobacteriaceae (CPE from the National Institutes of Health Clinical Center. This analysis revealed that plasmid reorganizations occurring in the natural context of colonization of human hosts were overwhelmingly driven by genetic rearrangements carried out by replicative transposons working in concert with the process of homologous recombination. A more complete understanding of the molecular mechanisms and evolutionary forces driving rearrangements in resistance plasmids may lead to fundamentally new strategies to address the problem of antibiotic resistance.

  15. TopBP1 is required at mitosis to reduce transmission of DNA damage to G1 daughter cells

    DEFF Research Database (Denmark)

    Pedersen, Rune Troelsgaard; Kruse, Thomas; Nilsson, Jakob

    2015-01-01

    mitotic entry. In early mitosis, TopBP1 marks sites of and promotes unscheduled DNA synthesis. Moreover, TopBP1 is required for focus formation of the structure-selective nuclease and scaffold protein SLX4 in mitosis. Persistent TopBP1 foci transition into 53BP1 nuclear bodies (NBs) in G1 and precise...... temporal depletion of TopBP1 just before mitotic entry induced formation of 53BP1 NBs in the next cell cycle, showing that TopBP1 acts to reduce transmission of DNA damage to G1 daughter cells. Based on these results, we propose that TopBP1 maintains genome integrity in mitosis by controlling chromatin...

  16. Recombinogenic engineering of conjugative plasmids with fluorescent marker cassettes

    DEFF Research Database (Denmark)

    Reisner, A.; Molin, Søren; Zechner, E.L.

    2002-01-01

    An efficient approach for the insertion of fluorescent marker genes with sequence specificity into conjugative plasmids in Escherichia coli is described. For this purpose, homologous recombination of linear double-stranded targeting DNA was mediated by the bacteriophage lambda recombination...... resistance genes and fluorescent markers. The choice of 5' non-homologous extensions in primer pairs used for amplifying the marker cassettes determines the site specificity of the targeting DNA. This methodology is applicable to the modification of all plasmids that replicate in E coli and is not restricted...

  17. Crystallization and preliminary X-ray crystallographic studies on the parD-encoded protein Kid from Escherichia coli plasmid R1

    NARCIS (Netherlands)

    Hargreaves, D.; Giraldo, R.; Santos-Sierra, S.; Boelens, R.; Rice, D.W.; Díaz Orejas, R.; Rafferty, J.B.

    2002-01-01

    DNA replication in Escherichia coli and therefore bacterial proliferation relies upon the efficient functioning of the DnaB helicase. The toxin protein Kid from the plasmid-stability system parD encoded on plasmid R1 of E. coli is thought to target and block DnaB-dependent DNA replication. The

  18. AAVS1-Targeted Plasmid Integration in AAV Producer Cell Lines.

    Science.gov (United States)

    Luo, Yuxia; Frederick, Amy; Martin, John M; Scaria, Abraham; Cheng, Seng H; Armentano, Donna; Wadsworth, Samuel C; Vincent, Karen A

    2017-06-01

    Adeno-associated virus (AAV) producer cell lines are created via transfection of HeLaS3 cells with a single plasmid containing three components (the vector sequence, the AAV rep and cap genes, and a selectable marker gene). As this plasmid contains both the cis (Rep binding sites) and trans (Rep protein encoded by the rep gene) elements required for site-specific integration, it was predicted that plasmid integration might occur within the AAVS1 locus on human chromosome 19 (chr19). The objective of this study was to investigate whether integration in AAVS1 might be correlated with vector yield. Plasmid integration sites within several independent cell lines were assessed via Southern, fluorescence in situ hybridization (FISH) and PCR analyses. In the Southern analyses, the presence of fragments detected by both rep- and AAVS1-specific probes suggested that for several mid- and high-producing lines, plasmid DNA had integrated into the AAVS1 locus. Analysis with puroR and AAVS1-specific probes suggested that integration in AAVS1 was a more widespread phenomenon. High-producing AAV2-secreted alkaline phosphatase (SEAP) lines (masterwell 82 [MW82] and MW278) were evaluated via FISH using probes specific for the plasmid, AAVS1, and a chr19 marker. FISH analysis detected two plasmid integration sites in MW278 (neither in AAVS1), while a total of three sites were identified in MW82 (two in AAVS1). An inverse PCR assay confirmed integration within AAVS1 for several mid- and high-producing lines. In summary, the FISH, Southern, and PCR data provide evidence of site-specific integration of the plasmid within AAVS1 in several AAV producer cell lines. The data also suggest that integration in AAVS1 is a general phenomenon that is not necessarily restricted to high producers. The results also suggest that plasmid integration within the AAVS1 locus is not an absolute requirement for a high vector yield.

  19. AFM Imaging of Hybridization Chain Reaction Mediated Signal Transmission between Two DNA Origami Structures.

    Science.gov (United States)

    Helmig, Sarah; Gothelf, Kurt Vesterager

    2017-10-23

    Signal transfer is central to the controlled exchange of information in biology and advanced technologies. Therefore, the development of reliable, long-range signal transfer systems for artificial nanoscale assemblies is of great scientific interest. We have designed such a system for the signal transfer between two connected DNA nanostructures, using the hybridization chain reaction (HCR). Two sets of metastable DNA hairpins, one of which is immobilized at specific points along tracks on DNA origami structures, are polymerized to form a continuous DNA duplex, which is visible using atomic force microscopy (AFM). Upon addition of a designed initiator, the initiation signal is efficiently transferred more than 200 nm from a specific location on one origami structure to an end point on another origami structure. The system shows no significant loss of signal when crossing from one nanostructure to another and, therefore, has the potential to be applied to larger multi-component DNA assemblies. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Breather trapping and breather transmission in a DNA model with an interface

    DEFF Research Database (Denmark)

    Alvarez, A.; Romero, F.R.; Archilla, J.F.R.

    2006-01-01

    We study the dynamics of moving discrete breathers in an interfaced piecewise DNA molecule. This is a DNA chain in which all the base pairs are identical and there exists an interface such that the base pairs dipole moments at each side are oriented in opposite directions. The Hamiltonian...... of the Peyrard-Bishop model is augmented with a term that includes the dipole-dipole coupling between base pairs. Numerical simulations show the existence of two dynamical regimes. If the translational kinetic energy of a moving breather launched towards the interface is below a critical value, it is trapped...

  1. Lack of detectable DNA uptake by transmission of selected recipients in mono-associated rats

    DEFF Research Database (Denmark)

    Wilcks, Andrea; Jacobsen, Bodil B. L.

    2010-01-01

    for the construction of GM plants end up in pathogenic bacteria, eventually leading to untreatable disease. Three different bacterial species (Escherichia coli, Bacillus subtilis, Streptococcus gordonii), all natural inhabitants of the food and intestinal tract environment were used as recipients for uptake of DNA...... than the consumption of GM food harbouring antibiotic resistance genes.......An important concern revealed in the public discussion of the use of genetically modified (GM) plants for human consumption, is the potential transfer of DNA from these plants to bacteria present in the gastrointestinal tract. Especially, there is a concern that antibiotic resistance genes used...

  2. Reconstructing the complex evolutionary history of mobile plasmids in red algal genomes

    Science.gov (United States)

    Lee, JunMo; Kim, Kyeong Mi; Yang, Eun Chan; Miller, Kathy Ann; Boo, Sung Min; Bhattacharya, Debashish; Yoon, Hwan Su

    2016-01-01

    The integration of foreign DNA into algal and plant plastid genomes is a rare event, with only a few known examples of horizontal gene transfer (HGT). Plasmids, which are well-studied drivers of HGT in prokaryotes, have been reported previously in red algae (Rhodophyta). However, the distribution of these mobile DNA elements and their sites of integration into the plastid (ptDNA), mitochondrial (mtDNA), and nuclear genomes of Rhodophyta remain unknown. Here we reconstructed the complex evolutionary history of plasmid-derived DNAs in red algae. Comparative analysis of 21 rhodophyte ptDNAs, including new genome data for 5 species, turned up 22 plasmid-derived open reading frames (ORFs) that showed syntenic and copy number variation among species, but were conserved within different individuals in three lineages. Several plasmid-derived homologs were found not only in ptDNA but also in mtDNA and in the nuclear genome of green plants, stramenopiles, and rhizarians. Phylogenetic and plasmid-derived ORF analyses showed that the majority of plasmid DNAs originated within red algae, whereas others were derived from cyanobacteria, other bacteria, and viruses. Our results elucidate the evolution of plasmid DNAs in red algae and suggest that they spread as parasitic genetic elements. This hypothesis is consistent with their sporadic distribution within Rhodophyta. PMID:27030297

  3. Persistence of plasmid DNA in different soils

    African Journals Online (AJOL)

    STORAGESEVER

    2008-08-04

    Aug 4, 2008 ... perform better, not only in the term of bioremediation efficiency, but also in an environmentally safe ... would never interbreed in nature. Completely new, exotic genes can therefore be introduced into crops. ... zontal gene transfer from genetically modified plants. (GMP) to soil associated bacteria (Nielsen et ...

  4. Rapid molecular detection of invasive species in ballast and harbor water by integrating environmental DNA and light transmission spectroscopy.

    Science.gov (United States)

    Egan, Scott P; Grey, Erin; Olds, Brett; Feder, Jeffery L; Ruggiero, Steven T; Tanner, Carol E; Lodge, David M

    2015-04-07

    Invasive species introduced via the ballast water of commercial ships cause enormous environmental and economic damage worldwide. Accurate monitoring for these often microscopic and morphologically indistinguishable species is challenging but critical for mitigating damages. We apply eDNA sampling, which involves the filtering and subsequent DNA extraction of microscopic bits of tissue suspended in water, to ballast and harbor water sampled during a commercial ship's 1400 km voyage through the North American Great Lakes. Using a lab-based gel electrophoresis assay and a rapid, field-ready light transmission spectroscopy (LTS) assay, we test for the presence of two invasive species: quagga (Dreissena bugensis) and zebra (D. polymorpha) mussels. Furthermore, we spiked a set of uninfested ballast and harbor samples with zebra mussel tissue to further test each assay's detection capabilities. In unmanipulated samples, zebra mussel was not detected, while quagga mussel was detected in all samples at a rate of 85% for the gel assay and 100% for the LTS assay. In the spiked experimental samples, both assays detected zebra mussel in 94% of spiked samples and 0% of negative controls. Overall, these results demonstrate that eDNA sampling is effective for monitoring ballast-mediated invasions and that LTS has the potential for rapid, field-based detection.

  5. In Silico Detection and Typing of Plasmids using PlasmidFinder and Plasmid Multilocus Sequence Typing

    DEFF Research Database (Denmark)

    Carattoli, Alessandra; Zankari, Ea; García-Fernández, Aurora

    2014-01-01

    In the work presented here, we designed and developed two easy-to-use Web tools for in silico detection and characterization of whole-genome sequence (WGS) and whole-plasmid sequence data from members of the family Enterobacteriaceae. These tools will facilitate bacterial typing based on draft...... genomes of multidrug-resistant Enterobacteriaceae species by the rapid detection of known plasmid types. Replicon sequences from 559 fully sequenced plasmids associated with the family Enterobacteriaceae in the NCBI nucleotide database were collected to build a consensus database for integration...... sequences identified in the 559 fully sequenced plasmids. For plasmid multilocus sequence typing (pMLST) analysis, a database that is updated weekly was generated from www.pubmlst.org and integrated into a Web tool called pMLST. Both databases were evaluated using draft genomes from a collection...

  6. The characteristics of micrococcus (deinococcus) radiodurans sark plasmids

    International Nuclear Information System (INIS)

    Sjarief, Sri Hariani; Kikuchi, Masahiro; Watanabe, Hiroshi.

    1994-01-01

    The characterization of micrococcus (deinococcus) radiodurans sark plasmids. This bacterium has been classified as a new genus deinococcus radiodurans which is resistant to gamma-rays. It can repair itself completely almost all of DNA damages including double strand breaks induced by gamma-rays up to about 5 KGy. To reveal the repair mechanism, several investigations had been done to develop a cloning vector available for the genetic analysis. For this purpose D. radiodurans Sark are to be prepared as a vector by studying the characteristics of its plasmid. Plasmids were isolated by electrophoresis using 0.6% low-melting-temperature agarose in TAE and run for 5.5 hours, followed by the identification. An antibiotic marker was also carried out in this experiment to identify its location in the genetic materials of the cell, beside making a restriction map of the plasmid. Results have shown that D. radiodurans Sark has 4 plasmids (P1, P2, P3, and P4) and the refampicin resistant genes were not found in the plasmid. (authors). 14 refs; 4 figs

  7. Multiple drug resistant carbapenemases producing Acinetobacter baumannii isolates harbours multiple R-plasmids

    Directory of Open Access Journals (Sweden)

    Rajagopalan Saranathan

    2014-01-01

    Full Text Available Background & objectives: The nosocomial human pathogen Acinetobacter baumannii has high propensity to develop resistance to antimicrobials and to become multidrug resistant (MDR, consequently complicating the treatment. This study was carried out to investigate the presence of resistant plasmids (R-plasmids among the clinical isolates of A. baumannii. In addition, the study was performed to check the presence of common β-lactamases encoding genes on these plasmids. Methods: A total of 55 clinical isolates of A. baumannii were included in the study and all were subjected to plasmid DNA isolation, followed by PCR to check the presence of resistance gene determinants such as blaOXA-23 , blaOXA-51, blaOXA-58 and blaIMP-1 on these plasmids that encode for oxacillinase (OXA and metallo-β-lactamase (MBL type of carbapenemases. Plasmid curing experiments were carried out on selected isolates using ethidium bromide and acridine orange as curing agents and the antibiotic resistance profiles were evaluated before and after curing. Results: All the isolates were identified as A. baumannii by 16SrDNA amplification and sequencing. Plasmid DNA isolated from these isolates showed the occurrence of multiple plasmids with size ranging from 500bp to ≥ 25 kb. The percentage of blaOXA-51 and blaOXA-23 on plasmids were found to be 78 and 42 per cent, respectively and 20 isolates (36% carried blaIMP-1 gene on plasmids. Significant difference was observed in the antibiograms of plasmid cured isolates when compared to their parental ones. The clinical isolates became susceptible to more than two antibiotic classes after curing of plasmids indicating plasmid borne resistance. Interpretation & conclusions: Our study determined the plasmid mediated resistance mechanisms and occurrence of different resistance genes on various plasmids isolated from MDR A. baumannii. The present findings showed the evidence for antibiotic resistance mediated through multiple plasmids in

  8. Degenerate primer MOB typing of multiresistant clinical isolates of E. coli uncovers new plasmid backbones.

    Science.gov (United States)

    Garcillán-Barcia, M Pilar; Ruiz del Castillo, Belén; Alvarado, Andrés; de la Cruz, Fernando; Martínez-Martínez, Luis

    2015-01-01

    Degenerate Primer MOB Typing is a PCR-based protocol for the classification of γ-proteobacterial transmissible plasmids in five phylogenetic relaxase MOB families. It was applied to a multiresistant E. coli collection, previously characterized by PCR-based replicon-typing, in order to compare both methods. Plasmids from 32 clinical isolates of multiresistant E. coli (19 extended spectrum beta-lactamase producers and 13 non producers) and their transconjugants were analyzed. A total of 95 relaxases were detected, at least one per isolate, underscoring the high potential of these strains for antibiotic-resistance transmission. MOBP12 and MOBF12 plasmids were the most abundant. Most MOB subfamilies detected were present in both subsets of the collection, indicating a shared mobilome among multiresistant E. coli. The plasmid profile obtained by both methods was compared, which provided useful data upon which decisions related to the implementation of detection methods in the clinic could be based. The phylogenetic depth at which replicon and MOB-typing classify plasmids is different. While replicon-typing aims at plasmid replication regions with non-degenerate primers, MOB-typing classifies plasmids into relaxase subfamilies using degenerate primers. As a result, MOB-typing provides a deeper phylogenetic depth than replicon-typing and new plasmid groups are uncovered. Significantly, MOB typing identified 17 plasmids and an integrative and conjugative element, which were not detected by replicon-typing. Four of these backbones were different from previously reported elements. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Novel archaeal plasmid pAH1 and its interactions with the lipothrixvirus AFV1

    DEFF Research Database (Denmark)

    Basta, Tamara; Smyth, John; Forterre, Patrick

    2009-01-01

    . Although nucleotide sequence comparisons revealed extensive intergenomic exchange during the evolution of archaeal conjugative plasmids, pAH1 was shown to be stably maintained suggesting that the host system is suitable for studying plasmid-virus interactions. AFV1 infection and propagation leads to a loss...... of the circular form of pAH1 and this effect correlates positively with the increase in the intracellular quantity of AFV1 DNA. We infer that the virus inhibits plasmid replication since no pAH1 degradation was observed. This mechanism of archaeal viral inhibition of plasmid propagation is not observed...... in bacteria where relevant bacteriophages either are dependent on a conjugative plasmid for successful infection or are excluded by a resident plasmid....

  10. Deciphering conjugative plasmid permissiveness in wastewater microbiomes

    DEFF Research Database (Denmark)

    Jacquiod, Samuel Jehan Auguste; Brejnrod, Asker Daniel; Milani, Stefan Morberg

    2017-01-01

    Wastewater treatment plants (WWTPs) are designed to robustly treat polluted water. They are characterized by ceaseless flows of organic, chemical and microbial matter, followed by treatment steps before environmental release. WWTPs are hotspots of horizontal gene transfer between bacteria via...... still remains largely uncharted. Furthermore, current in vitro methods used to assess conjugation in complex microbiomes do not include in situ behaviours of recipient cells, resulting in partial understanding of transfers. We investigated the in vitro conjugation capacities of WWTP microbiomes from...... inlet sewage and outlet treated water using the broad-host range IncP-1 conjugative plasmid, pKJK5. A thorough molecular approach coupling metagenomes to 16S rRNA DNA/cDNA amplicon sequencing was established to characterize microbiomes using the ecological concept of functional response groups. A broad...

  11. Role of the RS1 sequence of the cholera vibrio in amplification of the segment of plasmid DNA carrying the gene of resistance to tetracycline and the genes of cholera toxin

    International Nuclear Information System (INIS)

    Fil'kova, S.L.; Il'ina, T.S.; Gintsburg, A.L.; Yanishevskii, N.V.; Smirnov, G.B.

    1988-01-01

    The hybrid plasmid pCO107, representing cointegrate 14(2)-5(2) of two plasmids, an F-derivative (pOX38) and a PBR322-derivative (pCT105) with an RS1 sequence of the cholera vibrio cloned in its makeup, contains two copes of RS1 at the sites of union of the two plasmids. Using a tetracycline resistance marker (Tc R ) of the plasmid pCT105, clones were isolated which have an elevated level of resistance to tetracycline (an increase of from 4- to 30-fold). Using restriction analysis and the Southern blot method of hybridization it was shown that the increase in the level of resistance of tetracycline is associated with the amplification of pCT105 portion of the cointegrate, and that the process of amplification is governed by the presence of direct repeats of the RS1 sequence at its ends. The increase in the number of copies of the pCT105 segment, which contains in its composition the genes of cholera toxin (vct), is accompanied by an increase in toxin production

  12. Antibiotic resistance and plasmid carriage among Escherichia coli isolates from chicken meat in Malaysia

    International Nuclear Information System (INIS)

    Tin Tin Myaing; Saleha, A.A.; Arifah, A.K.; Raha, A.R.

    2005-01-01

    Escherichia coli isolates from 131 raw chicken meat samples were tested for susceptibility to 12 antibiotics. Plasmids were isolated from many samples and their DNA molecular weight calculated. An 81.7% plasmid occurrence rate was observed among the isolates, ranging from 0 to 8 in number and with sizes from 1.2 to 118.6 MDa. Plasmids were detected in 93.8% of E. coIi isolates resistant to all 12 antibiotics, and in 90.5% of E. coli isolates resistant to 11. Three (2.8%) isolates harboured 8 plasmids and were resistant to all 12 antibiotics. Antibiotic resistant genes in bacteria are usually carried in extrachromosomal DNA and it is postulated that E. coli with a high number of plasmids possesses wider resistance to antibiotics. (author)

  13. Type 3 Fimbriae Encoded on Plasmids Are Expressed from a Unique Promoter without Affecting Host Motility, Facilitating an Exceptional Phenotype That Enhances Conjugal Plasmid Transfer

    DEFF Research Database (Denmark)

    Madsen, Jonas Stenlokke; Riber, Leise; Kot, Witold

    2016-01-01

    Horizontal gene transfer (HGT), the transmission of genetic material to a recipient that is not the progeny of the donor, is fundamental in bacterial evolution. HGT is often mediated by mobile genetic elements such as conjugative plasmids, which may be in conflict with the chromosomal elements...... of the genome because they are independent replicons that may petition their own evolutionary strategy. Here we study differences between type 3 fimbriae encoded on wild type plasmids and in chromosomes. Using known and newly characterized plasmids we show that the expression of type 3 fimbriae encoded...... on plasmids is systematically different, as MrkH, a c-di-GMP dependent transcriptional activator is not needed for strong expression of the fimbriae. MrkH is required for expression of type 3 fimbriae of the Klebsiella pneumoniae chromosome, wherefrom the fimbriae operon (mrkABCDF) of plasmids is believed...

  14. Plasmid and chromosome partitioning: surprises from phylogeny

    DEFF Research Database (Denmark)

    Gerdes, Kenn; Møller-Jensen, Jakob; Bugge Jensen, Rasmus

    2000-01-01

    Plasmids encode partitioning genes (par) that are required for faithful plasmid segregation at cell division. Initially, par loci were identified on plasmids, but more recently they were also found on bacterial chromosomes. We present here a phylogenetic analysis of par loci from plasmids and chr...

  15. Novel Plasmid Transformation Method Mediated by Chrysotile, Sliding Friction, and Elastic Body Exposure

    Directory of Open Access Journals (Sweden)

    Naoto Yoshida

    2007-01-01

    Full Text Available Escherichia coli as a plasmid recipient cell was dispersed in a chrysotile colloidal solution, containing chrysotile adsorbed to plasmid DNA (chrysotile-plasmid cell mixture. Following this, the chrysotile-plasmid cell mixture was dropped onto the surface of an elastic body, such as agarose, and treated physically by sliding a polystyrene streak bar over the elastic body to create friction. Plasmid DNA was easily incorporated into E. coli, and antibiotic resistance was conferred by transformation. The transformation efficiency of E. coli cultured in solid medium was greater than that of E. coli cultured in broth. To obtain greater transformation efficiency, we attempted to determine optimal transformation conditions. The following conditions resulted in the greatest transformation efficiency: the recipient cell concentration within the chrysotileplasmid cell mixture had an optical density greater than or equal to 2 at 550 nm, the vertical reaction force applied to the streak bar was greater than or equal to 40 g, and the rotation speed of the elastic body was greater than or equal to 34 rpm. Under these conditions, we observed a transformation efficiency of 107 per μg plasmid DNA. The advantage of achieving bacterial transformation using the elastic body exposure method is that competent cell preparation of the recipient cell is not required. In addition to E. coli, other Gram negative bacteria are able to acquire plasmid DNA using the elastic body exposure method.

  16. Novel plasmids and resistance phenotypes in Yersinia pestis: unique plasmid inventory of strain Java 9 mediates high levels of arsenic resistance.

    Science.gov (United States)

    Eppinger, Mark; Radnedge, Lyndsay; Andersen, Gary; Vietri, Nicholas; Severson, Grant; Mou, Sherry; Ravel, Jacques; Worsham, Patricia L

    2012-01-01

    Growing evidence suggests that the plasmid repertoire of Yersinia pestis is not restricted to the three classical virulence plasmids. The Java 9 strain of Y. pestis is a biovar Orientalis isolate obtained from a rat in Indonesia. Although it lacks the Y. pestis-specific plasmid pMT, which encodes the F1 capsule, it retains virulence in mouse and non-human primate animal models. While comparing diverse Y. pestis strains using subtractive hybridization, we identified sequences in Java 9 that were homologous to a Y. enterocolitica strain carrying the transposon Tn2502, which is known to encode arsenic resistance. Here we demonstrate that Java 9 exhibits high levels of arsenic and arsenite resistance mediated by a novel promiscuous class II transposon, named Tn2503. Arsenic resistance was self-transmissible from Java 9 to other Y. pestis strains via conjugation. Genomic analysis of the atypical plasmid inventory of Java 9 identified pCD and pPCP plasmids of atypical size and two previously uncharacterized cryptic plasmids. Unlike the Tn2502-mediated arsenic resistance encoded on the Y. enterocolitica virulence plasmid; the resistance loci in Java 9 are found on all four indigenous plasmids, including the two novel cryptic plasmids. This unique mobilome introduces more than 105 genes into the species gene pool. The majority of these are encoded by the two entirely novel self-transmissible plasmids, which show partial homology and synteny to other enterics. In contrast to the reductive evolution in Y. pestis, this study underlines the major impact of a dynamic mobilome and lateral acquisition in the genome evolution of the plague bacterium.

  17. Novel plasmids and resistance phenotypes in Yersinia pestis: unique plasmid inventory of strain Java 9 mediates high levels of arsenic resistance.

    Directory of Open Access Journals (Sweden)

    Mark Eppinger

    Full Text Available Growing evidence suggests that the plasmid repertoire of Yersinia pestis is not restricted to the three classical virulence plasmids. The Java 9 strain of Y. pestis is a biovar Orientalis isolate obtained from a rat in Indonesia. Although it lacks the Y. pestis-specific plasmid pMT, which encodes the F1 capsule, it retains virulence in mouse and non-human primate animal models. While comparing diverse Y. pestis strains using subtractive hybridization, we identified sequences in Java 9 that were homologous to a Y. enterocolitica strain carrying the transposon Tn2502, which is known to encode arsenic resistance. Here we demonstrate that Java 9 exhibits high levels of arsenic and arsenite resistance mediated by a novel promiscuous class II transposon, named Tn2503. Arsenic resistance was self-transmissible from Java 9 to other Y. pestis strains via conjugation. Genomic analysis of the atypical plasmid inventory of Java 9 identified pCD and pPCP plasmids of atypical size and two previously uncharacterized cryptic plasmids. Unlike the Tn2502-mediated arsenic resistance encoded on the Y. enterocolitica virulence plasmid; the resistance loci in Java 9 are found on all four indigenous plasmids, including the two novel cryptic plasmids. This unique mobilome introduces more than 105 genes into the species gene pool. The majority of these are encoded by the two entirely novel self-transmissible plasmids, which show partial homology and synteny to other enterics. In contrast to the reductive evolution in Y. pestis, this study underlines the major impact of a dynamic mobilome and lateral acquisition in the genome evolution of the plague bacterium.

  18. HEPATITIS B VIRUS DNA IN SALIVA FROM CHILDREN WITH CHRONIC HEPATITIS B INFECTION IMPLICATIONS FOR SALIVA AS A POTENTIAL MODE OF HORIZONTAL TRANSMISSION

    NARCIS (Netherlands)

    Heiberg, Ida Louise; Hoegh, Mette; Ladelund, Steen; Niesters, Hubert G. M.; Hogh, Birthe

    2010-01-01

    To explore the mechanism of horizontal transmission of hepatitis B virus (HBV) among children, we investigated the quantitative relationship between HBV in saliva and blood from 46 children with chronic hepatitis B. We found high levels of HBV DNA in saliva of HBeAg (+) children, suggesting saliva

  19. Hepatitis B virus DNA in saliva from children with chronic hepatitis B infection: implications for saliva as a potential mode of horizontal transmission

    DEFF Research Database (Denmark)

    Heiberg, Ida Louise; Hoegh, Mette; Ladelund, Steen

    2010-01-01

    To explore the mechanism of horizontal transmission of hepatitis B virus (HBV) among children, we investigated the quantitative relationship between HBV in saliva and blood from 46 children with chronic hepatitis B. We found high levels of HBV DNA in saliva of HBeAg (+) children, suggesting saliva...

  20. Production optimisation of a DNA vaccine candidate against ...

    African Journals Online (AJOL)

    Plasmid DNA (pDNA) vaccines are promising means to prevent and treat infectious diseases, such as leishmaniasis, but immunisation protocols require large amounts of supercoiled plasmid DNA (scpDNA). Although pDNA can be produced at a reasonable cost in bioreactors; this scale of production may not be the best ...

  1. The broad-host-range plasmid pSFA231 isolated from petroleum-contaminated sediment represents a new member of the PromA plasmid family.

    Science.gov (United States)

    Li, Xiaobin; Top, Eva M; Wang, Yafei; Brown, Celeste J; Yao, Fei; Yang, Shan; Jiang, Yong; Li, Hui

    2014-01-01

    A self-transmissible broad-host-range (BHR) plasmid pSFA231 was isolated from petroleum-contaminated sediment in Shen-fu wastewater irrigation zone, China, using the triparental mating exogenous plasmid capture method. Based on its complete sequence the plasmid has a size of 41.5 kb and codes for 50 putative open reading frames (orfs), 29 of which represent genes involved in replication, partitioning and transfer functions of the plasmid. Phylogenetic analysis grouped pSFA231 into the newly defined PromA plasmid family, which currently includes five members. Further comparative genomic analysis shows that pSFA231 shares the common backbone regions with the other PromA plasmids, i.e., genes involved in replication, maintenance and control, and conjugative transfer. Nevertheless, phylogenetic divergence was found in specific gene products. We propose to divide the PromA group into two subgroups, PromA-α (pMRAD02, pSB102) and PromA-β (pMOL98, pIPO2T, pSFA231, pTer331), based on the splits network analysis of the RepA protein. Interestingly, a cluster of hypothetical orfs located between parA and traA of pSFA231 shows high similarity with the corresponding regions on pMOL98, pIPO2T, and pTer331, suggesting these hypothetical orfs may represent "essential" plasmid backbone genes for the PromA-β subgroup. Alternatively, they may also be accessory genes that were first acquired and then stayed as the plasmid diverged. Our study increases the available collection of complete genome sequences of BHR plasmids, and since pSFA231 is the only characterized PromA plasmid from China, our findings also enhance our understanding of the genetic diversity of this plasmid group in different parts of the world.

  2. The broad-host-range plasmid pSFA231 isolated from petroleum-contaminated sediment represents a new member of the PromA plasmid family

    Directory of Open Access Journals (Sweden)

    Xiaobin eLi

    2015-01-01

    Full Text Available A self-transmissible broad-host-range (BHR plasmid pSFA231 was isolated from petroleum-contaminated sediment in Shen-fu wastewater irrigation zone, China, using the triparental mating exogenous plasmid capture method. Based on its complete sequence the plasmid has a size of 41.5 kb and codes for 50 putative open reading frames (orfs, 28 of which represent genes involved in replication, partitioning and transfer functions of the plasmid. Phylogenetic analysis grouped pSFA231 into the newly defined PromA plasmid family, which currently includes five members. Further comparative genomic analysis shows that pSFA231 shares the common backbone regions with the other PromA plasmids, i.e., genes involved in replication, maintenance and control, and conjugative transfer. Nevertheless, phylogenetic divergence was found in specific gene products. We propose to divide the PromA group into two subgroups, PromA-α (pMRAD02, pSB102 and PromA-β (pMOL98, pIPO2T, pSFA231, pTer331, based on the splits network analysis of the RepA protein. Interestingly, a cluster of hypothetical orfs located between parA and traA of pSFA231 shows high similarity with the corresponding regions on pMOL98, pIPO2T and pTer331, suggesting these hypothetical orfs may represent ‘‘essential’’ plasmid backbone genes for the PromA-β subgroup. Alternatively, they may also be accessory genes that were first acquired and then stayed as the plasmid diverged. Our study increases the available collection of complete genome sequences of BHR plasmids, and since pSFA231 is the only characterized PromA plasmid from China, our findings also enhance our understanding of the genetic diversity of this plasmid group in different parts of the world.

  3. A degenerate primer MOB typing (DPMT method to classify gamma-proteobacterial plasmids in clinical and environmental settings.

    Directory of Open Access Journals (Sweden)

    Andrés Alvarado

    Full Text Available Transmissible plasmids are responsible for the spread of genetic determinants, such as antibiotic resistance or virulence traits, causing a large ecological and epidemiological impact. Transmissible plasmids, either conjugative or mobilizable, have in common the presence of a relaxase gene. Relaxases were previously classified in six protein families according to their phylogeny. Degenerate primers hybridizing to coding sequences of conserved amino acid motifs were designed to amplify related relaxase genes from γ-Proteobacterial plasmids. Specificity and sensitivity of a selected set of 19 primer pairs were first tested using a collection of 33 reference relaxases, representing the diversity of γ-Proteobacterial plasmids. The validated set was then applied to the analysis of two plasmid collections obtained from clinical isolates. The relaxase screening method, which we call "Degenerate Primer MOB Typing" or DPMT, detected not only most known Inc/Rep groups, but also a plethora of plasmids not previously assigned to any Inc group or Rep-type.

  4. Absence of zero-temperature transmission rate of a double-chain tight-binding model for DNA with random sequence of nucleotides in thermodynamic limit

    International Nuclear Information System (INIS)

    Xiong Gang; Wang, X.R.

    2005-01-01

    The zero-temperature transmission rate spectrum of a double-chain tight-binding model for real DNA is calculated. It is shown that a band of extended-like states exists only for finite chain length with strong inter-chain coupling. While the whole spectrum tends to zero in thermodynamic limit, regardless of the strength of inter-chain coupling. It is also shown that a more faithful model for real DNA with periodic sugar-phosphate chains in backbone structures can be mapped into the above simple double-chain tight-binding model. Combined with above results, the transmission rate of real DNA with long random sequence of nucleotides is expected to be poor

  5. Reversible entrapment of plasmid deoxyribonucleic acid on different chromatographic supports.

    Science.gov (United States)

    Gabor, Boštjan; Černigoj, Urh; Barut, Miloš; Štrancar, Aleš

    2013-10-11

    HPLC based analytical assay is a powerful technique that can be used to efficiently monitor plasmid DNA (pDNA) purity and quantity throughout the entire purification process. Anion exchange monolithic and non-porous particle based stationary phases were used to study the recovery of the different pDNA isoforms from the analytical column. Three differently sized pDNA molecules of 3.0kbp, 5.2kbp and 14.0kbp were used. Plasmid DNA was injected onto columns under the binding conditions and the separation of the isoforms took place by increasing the ionic strength of the elution buffer. While there was no substantial decrease of the recovered supercoiled and linear isoforms of the pDNA with the increase of the plasmid size and with the increase of the flow rate (recoveries in all cases larger than 75%), a pronounced decrease of the oc isoform recovery was observed. The entrapment of the oc pDNA isoform occurred under non-binding conditions as well. The partial oc isoform elution from the column could be achieved by decreasing the flow rate of the elution mobile phase. The results suggested a reversible entrapment of the oc isoform in the restrictions within the pores of the monolithic material as well as within the intra-particle space of the non-porous particles. This phenomenon was observed on both types of the stationary phase morphologies and could only be connected to the size of a void space through which the pDNA needs to migrate. A prediction of reversible pDNA entrapment was successfully estimated with the calculation of Peclet numbers, Pe, which defines the ratio between a convective and diffusive mass transport. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Salmonella Typhimurium ST213 is associated with two types of IncA/C plasmids carrying multiple resistance determinants.

    Science.gov (United States)

    Wiesner, Magdalena; Calva, Edmundo; Fernández-Mora, Marcos; Cevallos, Miguel A; Campos, Freddy; Zaidi, Mussaret B; Silva, Claudia

    2011-01-11

    Salmonella Typhimurium ST213 was first detected in the Mexican Typhimurium population in 2001. It is associated with a multi-drug resistance phenotype and a plasmid-borne blaCMY-2 gene conferring resistance to extended-spectrum cephalosporins. The objective of the current study was to examine the association between the ST213 genotype and blaCMY-2 plasmids. The blaCMY-2 gene was carried by an IncA/C plasmid. ST213 strains lacking the blaCMY-2 gene carried a different IncA/C plasmid. PCR analysis of seven DNA regions distributed throughout the plasmids showed that these IncA/C plasmids were related, but the presence and absence of DNA stretches produced two divergent types I and II. A class 1 integron (dfrA12, orfF and aadA2) was detected in most of the type I plasmids. Type I contained all the plasmids carrying the blaCMY-2 gene and a subset of plasmids lacking blaCMY-2. Type II included all of the remaining blaCMY-2-negative plasmids. A sequence comparison of the seven DNA regions showed that both types were closely related to IncA/C plasmids found in Escherichia, Salmonella, Yersinia, Photobacterium, Vibrio and Aeromonas. Analysis of our Typhimurium strains showed that the region containing the blaCMY-2 gene is inserted between traA and traC as a single copy, like in the E. coli plasmid pAR060302. The floR allele was identical to that of Newport pSN254, suggesting a mosaic pattern of ancestry with plasmids from other Salmonella serovars and E. coli. Only one of the tested strains was able to conjugate the IncA/C plasmid at very low frequencies (10-7 to 10-9). The lack of conjugation ability of our IncA/C plasmids agrees with the clonal dissemination trend suggested by the chromosomal backgrounds and plasmid pattern associations. The ecological success of the newly emerging Typhimurium ST213 genotype in Mexico may be related to the carriage of IncA/C plasmids. We conclude that types I and II of IncA/C plasmids originated from a common ancestor and that the

  7. Identification of a Novel Conjugative Plasmid in Mycobacteria That Requires Both Type IV and Type VII Secretion

    KAUST Repository

    Ummels, R.

    2014-09-23

    Conjugative plasmids have been identified in a wide variety of different bacteria, ranging from proteobacteria to firmicutes, and conjugation is one of the most efficient routes for horizontal gene transfer. The most widespread mechanism of plasmid conjugation relies on different variants of the type IV secretion pathway. Here, we describe the identification of a novel type of conjugative plasmid that seems to be unique for mycobacteria. Interestingly, while this plasmid is efficiently exchanged between different species of slow-growing mycobacteria, including Mycobacterium tuberculosis, it could not be transferred to any of the fast-growing mycobacteria tested. Genetic analysis of the conjugative plasmid showed the presence of a locus containing homologues of three type IV secretion system components and a relaxase. In addition, a new type VII secretion locus was present. Using transposon insertion mutagenesis, we show that in fact both these secretion systems are essential for conjugation, indicating that this plasmid represents a new class of conjugative plasmids requiring two secretion machineries. This plasmid could form a useful new tool to exchange or introduce DNA in slow-growing mycobacteria. IMPORTANCE: Conjugative plasmids play an important role in horizontal gene transfer between different bacteria and, as such, in their adaptation and evolution. This effect is most obvious in the spread of antibiotic resistance genes. Thus far, conjugation of natural plasmids has been described only rarely for mycobacterial species. In fact, it is generally accepted that M. tuberculosis does not show any recent sign of horizontal gene transfer. In this study, we describe the identification of a new widespread conjugative plasmid that can also be efficiently transferred to M. tuberculosis. This plasmid therefore poses both a threat and an opportunity. The threat is that, through the acquisition of antibiotic resistance markers, this plasmid could start a rapid spread of

  8. Plasmid fingerprinting and virulence gene detection among indigenous strains of salmonella enterica serovar enteritidis

    International Nuclear Information System (INIS)

    Sajid, S.U.; Schwarz, S.

    2009-01-01

    Salmonella enterica serovar Enteritidis is an important frequently reported zoonotic pathogen and a common cause of human gastroenteritis worldwide. The highly conserved Serospecific plasmids (SSPs) and Salmonella plasmid virulence (Spv) genes have been shown to mediate extra-intestinal colonization and systemic infection. The objective of current study was to document the presence of SSPs and SpvB/SpvC genes prevailing in the indigenous population of serovar Enteritidis. A total of 48 epidemiologically unrelated strains of Salmonella enteritidis were included in the study. Preparation of plasmids DNA suitable for endonuclease digestion and separation of respective fragments by agarose gel electrophoresis followed previously described protocols. The plasmids of Escherichia coli V517, 1-kbp ladder, and lambda DNA HindIII fragments served as DNA size standards. Transfer of DNA fragments from agarose gels to nitrocellulose membranes was achieved by capillary blot procedure. An ECL labeled 3.6 kbp HindIII fragment of plasmid PRQ 51 was used as probe for SpvB/SpvC gene detection. Plasmid DNA fingerprinting revealed the presence of two different profiles of approximately 55 kbp and 90 kbp and were identified as virulence plasmids by DNA hybridization. The SpvB/SpvC genes were located on HindIII fragments of 3.6 kbp in each of the two types of virulence plasmids. The study confirms the presence of SSPs and SpvB/SpvC genes in indigenous strains of S. enteritidis isolated from Northern Punjab area of Pakistan and substantiate the previous data on such findings from other parts of the world. (author)

  9. DNA is a co-factor for its own replication in Xenopus egg extracts

    NARCIS (Netherlands)

    Lebofsky, Ronald; van Oijen, Antoine M.; Walter, Johannes C.

    Soluble Xenopus egg extracts efficiently replicate added plasmids using a physiological mechanism, and thus represent a powerful system to understand vertebrate DNA replication. Surprisingly, DNA replication in this system is highly sensitive to plasmid concentration, being undetectable below

  10. Genetic characterization of plasmid pRJ5 of Staphylococcus aureus compared to plasmid pE194

    International Nuclear Information System (INIS)

    Oliveira, S.S. de; Freire Bastos, M.C. de

    1993-01-01

    The pRJ5, a naturally occurring constitutive macrolide, lincosamide and streptogramin B (MLS) resistance plasmid of Staphylococcus aureus, was compared to pE194, a plasmid that confers the inducible phenotype. pRJ5 was stable in all strains of S. aureus tested, even under growth at 43 O C, which distinguished it from pE194 which was shown to be thermo-sensitive for replication. pRJ5, like pE194, was highly unstable in Bacillus subtilis when the cells were grown in nonselective conditions. Multimeric forms of pRJ5 DNA were detected in the few cells of B. subtilis that retained this plasmid. pE194 was transduced by phages φ 11 and φ 443 at frequencies 400 and 20-fold higher, respectively, than pRJ5. Both plasmids were co-transduced with the plasmid pRJ4. pRJ5 was shown to be compatible with pE194. Therefore they belong to distinct Inc groups. Hybridization studies revealed that pRJ5 shares a 1.35 kb region of homology to pE194, which is limited to the erm gene, conferring MLS resistance. (author)

  11. Cefotaxime resistant Escherichia coli collected from a healthy volunteer; characterisation and the effect of plasmid loss.

    Directory of Open Access Journals (Sweden)

    Miranda Kirchner

    Full Text Available In this study 6 CTX-M positive E. coli isolates collected during a clinical study examining the effect of antibiotic use in a human trial were analysed. The aim of the study was to analyse these isolates and assess the effect of full or partial loss of plasmid genes on bacterial fitness and pathogenicity. A DNA array was utilised to assess resistance and virulence gene carriage. Plasmids were characterised by PCR-based replicon typing and addiction system multiplex PCR. A phenotypic array and insect virulence model were utilised to assess the effect of plasmid-loss in E. coli of a large multi-resistance plasmid. All six E. coli carrying bla CTX-M-14 were detected from a single participant and were identical by pulse field gel electrophoresis and MLST. Plasmid profiling and arrays indicated absence of a large multi-drug resistance (MDR F-replicon plasmid carrying blaTEM, aadA4, strA, strB, dfrA17/19, sul1, and tetB from one isolate. Although this isolate partially retained the plasmid it showed altered fitness characteristics e.g. inability to respire in presence of antiseptics, similar to a plasmid-cured strain. However, unlike the plasmid-cured or plasmid harbouring strains, the survival rate for Galleria mellonella infected by the former strain was approximately 5-times lower, indicating other possible changes accompanying partial plasmid loss. In conclusion, our results demonstrated that an apparently healthy individual can harbour bla CTX-M-14 E. coli strains. In one such strain, isolated from the same individual, partial absence of a large MDR plasmid resulted in altered fitness and virulence characteristics, which may have implications in the ability of this strain to infect and any subsequent treatment.

  12. Comparative Sequence Analysis of Multidrug-Resistant IncA/C Plasmids from Salmonella enterica.

    Science.gov (United States)

    Hoffmann, Maria; Pettengill, James B; Gonzalez-Escalona, Narjol; Miller, John; Ayers, Sherry L; Zhao, Shaohua; Allard, Marc W; McDermott, Patrick F; Brown, Eric W; Monday, Steven R

    2017-01-01

    Determinants of multidrug resistance (MDR) are often encoded on mobile elements, such as plasmids, transposons, and integrons, which have the potential to transfer among foodborne pathogens, as well as to other virulent pathogens, increasing the threats these traits pose to human and veterinary health. Our understanding of MDR among Salmonella has been limited by the lack of closed plasmid genomes for comparisons across resistance phenotypes, due to difficulties in effectively separating the DNA of these high-molecular weight, low-copy-number plasmids from chromosomal DNA. To resolve this problem, we demonstrate an efficient protocol for isolating, sequencing and closing IncA/C plasmids from Salmonella sp. using single molecule real-time sequencing on a Pacific Biosciences (Pacbio) RS II Sequencer. We obtained six Salmonella enterica isolates from poultry, representing six different serovars, each exhibiting the MDR-Ampc resistance profile. Salmonella plasmids were obtained using a modified mini preparation and transformed with Escherichia coli DH10Br. A Qiagen Large-Construct kit™ was used to recover highly concentrated and purified plasmid DNA that was sequenced using PacBio technology. These six closed IncA/C plasmids ranged in size from 104 to 191 kb and shared a stable, conserved backbone containing 98 core genes, with only six differences among those core genes. The plasmids encoded a number of antimicrobial resistance genes, including those for quaternary ammonium compounds and mercury. We then compared our six IncA/C plasmid sequences: first with 14 IncA/C plasmids derived from S. enterica available at the National Center for Biotechnology Information (NCBI), and then with an additional 38 IncA/C plasmids derived from different taxa. These comparisons allowed us to build an evolutionary picture of how antimicrobial resistance may be mediated by this common plasmid backbone. Our project provides detailed genetic information about resistance genes in

  13. Comparative Sequence Analysis of Multidrug-Resistant IncA/C Plasmids from Salmonella enterica

    Directory of Open Access Journals (Sweden)

    Maria Hoffmann

    2017-08-01

    Full Text Available Determinants of multidrug resistance (MDR are often encoded on mobile elements, such as plasmids, transposons, and integrons, which have the potential to transfer among foodborne pathogens, as well as to other virulent pathogens, increasing the threats these traits pose to human and veterinary health. Our understanding of MDR among Salmonella has been limited by the lack of closed plasmid genomes for comparisons across resistance phenotypes, due to difficulties in effectively separating the DNA of these high-molecular weight, low-copy-number plasmids from chromosomal DNA. To resolve this problem, we demonstrate an efficient protocol for isolating, sequencing and closing IncA/C plasmids from Salmonella sp. using single molecule real-time sequencing on a Pacific Biosciences (Pacbio RS II Sequencer. We obtained six Salmonella enterica isolates from poultry, representing six different serovars, each exhibiting the MDR-Ampc resistance profile. Salmonella plasmids were obtained using a modified mini preparation and transformed with Escherichia coli DH10Br. A Qiagen Large-Construct kit™ was used to recover highly concentrated and purified plasmid DNA that was sequenced using PacBio technology. These six closed IncA/C plasmids ranged in size from 104 to 191 kb and shared a stable, conserved backbone containing 98 core genes, with only six differences among those core genes. The plasmids encoded a number of antimicrobial resistance genes, including those for quaternary ammonium compounds and mercury. We then compared our six IncA/C plasmid sequences: first with 14 IncA/C plasmids derived from S. enterica available at the National Center for Biotechnology Information (NCBI, and then with an additional 38 IncA/C plasmids derived from different taxa. These comparisons allowed us to build an evolutionary picture of how antimicrobial resistance may be mediated by this common plasmid backbone. Our project provides detailed genetic information about

  14. A toxicological study of inhalable particulates in an industrial region of Lanzhou City, northwestern China: Results from plasmid scission assay

    Science.gov (United States)

    Xiao, Zhenghui; Shao, Longyi; Zhang, Ning; Wang, Jing; Chuang, Hsiao-Chi; Deng, Zhenzhen; Wang, Zhen; BéruBé, Kelly

    2014-09-01

    The city of Lanzhou in northwestern China experiences serious air pollution episodes in the form of PM10 that is characterized by having high levels of heavy metals. The Xigu District represents the industrial core area of Lanzhou City and is denoted by having the largest petrochemical bases in western China. This study investigates heavy metal compositions and oxidative potential of airborne PM10 (particulate matter with aerodynamic diameter of 10 μm or less) collected in Xigu District in the summer and winter of 2010. An in vitro plasmid scission assay (PSA) was employed to study the oxidative potential of airborne PM10 and inductively coupled plasma-mass spectrometry (ICP-MS) was used to examine heavy metal compositions. Transmission electron microscopy coupled with energy-dispersive X-ray spectrometry (TEM/EDX) was used to investigate elemental compositions and mixing states of PM10. The average mass concentrations of PM10 collected in Xigu District were generally higher than the national standard for daily PM10 (150 μg/m3). Cr, Zn, Pb and Mn were the most abundant metals in the intact whole particles of PM10. Zn, Mn and As was the most abundant metal in the water-soluble fraction, while Cr, Pb, and V existed primarily in insoluble forms. TD20 values (i.e. toxic dosage of PM10 causing 20% of plasmid DNA damage) varied considerably in both winter and summer (from 19 μg/mL to >1000 μg/mL) but were typically higher in summer, suggesting that the winter PM10 exhibited greater bioreactivity. In addition, the PM10 collected during a dust storm episode had a highest TD20 value and thus the least oxidative damage to supercoiled plasmid DNA, while the particles collected on a hazy day had a lowest TD20 value and thus the highest oxidative damage to supercoiled plasmid DNA. The particles collected on the first day after snow fall and on a day of cold air intrusion exhibited minor oxidative potential (i.e. caused limited DNA damage). The water-soluble Zn, Mn, As, and

  15. DNA multigene characterization of Fasciola hepatica and Lymnaea neotropica and its fascioliasis transmission capacity in Uruguay, with historical correlation, human report review and infection risk analysis.

    Science.gov (United States)

    Bargues, María Dolores; Gayo, Valeria; Sanchis, Jaime; Artigas, Patricio; Khoubbane, Messaoud; Birriel, Soledad; Mas-Coma, Santiago

    2017-02-01

    Fascioliasis is a pathogenic disease transmitted by lymnaeid snails and recently emerging in humans, in part due to effects of climate changes, anthropogenic environment modifications, import/export and movements of livestock. South America is the continent presenting more human fascioliasis hyperendemic areas and the highest prevalences and intensities known. These scenarios appear mainly linked to altitude areas in Andean countries, whereas lowland areas of non-Andean countries, such as Uruguay, only show sporadic human cases or outbreaks. A study including DNA marker sequencing of fasciolids and lymnaeids, an experimental study of the life cycle in Uruguay, and a review of human fascioliasis in Uruguay, are performed. The characterization of Fasciola hepatica from cattle and horses of Uruguay included the complete sequences of the ribosomal DNA ITS-2 and ITS-1 and mitochondrial DNA cox1 and nad1. ITS-2, ITS-1, partial cox1 and rDNA 16S gene of mtDNA were used for lymnaeids. Results indicated that vectors belong to Lymnaea neotropica instead of to Lymnaea viator, as always reported from Uruguay. The life cycle and transmission features of F. hepatica by L. neotropica of Uruguay were studied under standardized experimental conditions to enable a comparison with the transmission capacity of F. hepatica by Galba truncatula at very high altitude in Bolivia. On this baseline, we reviewed the 95 human fascioliasis cases reported in Uruguay and analyzed the risk of human infection in front of future climate change estimations. The correlation of fasciolid and lymnaeid haplotypes with historical data on the introduction and spread of livestock into Uruguay allowed to understand the molecular diversity detected. Although Uruguayan L. neotropica is a highly efficient vector, its transmission capacity is markedly lower than that of Bolivian G. truncatula. This allows to understand the transmission and epidemiological differences between Andean highlands and non

  16. Tn5-induced pBS286 plasmid mutations blocking early stages of napthalene oxidation

    International Nuclear Information System (INIS)

    Kosheleva, I.A.; Tsoi, T.V.; Ivashina, T.V.; Selifonov, S.A.; Starovoitov, I.I.; Boronin, A.M.

    1988-01-01

    The authors present data on the further analysis of the structural and functional organization of the nah region of plasmid pBS286 controlling the constitutive oxidation of naphthalene by Pseudomonas putida cells. They have studied Tn5-induced mutations blocking early stages of naphthalene oxidation. They present and discuss data providing evidence that, in contrast to plasmid NAH7, the mechanism of regulation of the nahl operon of plasmid NPL-1, the parent plasmid of plasmid pBS286, with inducible synthesis of naphthalene dioxygenase can include elements of a negative control with participation of the regulatory locus R, located proximal to the structural nah genes and closely linked to or overlapped by the inverted control DNA segment (4.2 kb). They also present data on the possibility of regulation of the activity of the catechol-splitting meta-pathway genes with the participation of products of early stages of naphthalene oxidation

  17. Plasmid construction using recombination activity in the fission yeast Schizosaccharomyces pombe.

    Directory of Open Access Journals (Sweden)

    Ayako Chino

    Full Text Available BACKGROUND: Construction of plasmids is crucial in modern genetic manipulation. As of now, the common method for constructing plasmids is to digest specific DNA sequences with restriction enzymes and to ligate the resulting DNA fragments with DNA ligase. Another potent method to construct plasmids, known as gap-repair cloning (GRC, is commonly used in the budding yeast Saccharomyces cerevisiae. GRC makes use of the homologous recombination activity that occurs within the yeast cells. Due to its flexible design and efficiency, GRC has been frequently used for constructing plasmids with complex structures as well as genome-wide plasmid collections. Although there have been reports indicating GRC feasibility in the fission yeast Schizosaccharomyces pombe, this species is not commonly used for GRC as systematic studies of reporting GRC efficiency in S. pombe have not been performed till date. METHODOLOGY/PRINCIPAL FINDINGS: We investigated GRC efficiency in S. pombe in this study. We first showed that GRC was feasible in S. pombe by constructing a plasmid that contained the LEU2 auxotrophic marker gene in vivo and showed sufficient efficiency with short homology sequences (>25 bp. No preference was shown for the sequence length from the cut site in the vector plasmid. We next showed that plasmids could be constructed in a proper way using 3 DNA fragments with 70% efficiency without any specific selections being made. The GRC efficiency with 3 DNA fragments was dramatically increased >95% in lig4Delta mutant cell, where non-homologous end joining is deficient. Following this approach, we successfully constructed plasmid vectors with leu1+, ade6+, his5+, and lys1+ markers with the low-copy stable plasmid pDblet as a backbone by applying GRC in S. pombe. CONCLUSIONS/SIGNIFICANCE: We concluded that GRC was sufficiently feasible in S. pombe for genome-wide gene functional analysis as well as for regular plasmid construction. Plasmids with different

  18. Repair promoted by plasmid pKM101 is different from SOS repair

    International Nuclear Information System (INIS)

    Goze, A.; Devoret, R.

    1979-01-01

    In E. coli K12 bacteria carrying plasmid pKM101, prophage lambda was induced at UV doses higher than in plasmid-less parental bacteria. UV-induced reactivation per se was less effective. Bacteria with pKM101 showed no alteration in their division cycle. Plasmid PKM101 coded for a constitutive error-prone repair different from the inducible error-prone repair called SOS repair. Plasmid pKM101 protected E. coli bacteria from UV damage but slightly sensitized them to X-ray lesions. Protection against UV damage was effective in mutant bacteria deficient in DNA excision-repair provided that the recA, lexA and uvrE genes were functional. Survival of phages lambda and S13 after UV irradiation was enhanced in bacteria carrying plasmid pKM101; phage lambda mutagenesis was also increased. Plasmid pKM101 repaired potentially lethal DNA lesions, although Wild-type DNA sequences may not necessarily be restored; hence the mutations observed are the traces of the original DNA lesions. (Auth.)

  19. DNA based random key generation and management for OTP encryption.

    Science.gov (United States)

    Zhang, Yunpeng; Liu, Xin; Sun, Manhui

    2017-09-01

    One-time pad (OTP) is a principle of key generation applied to the stream ciphering method which offers total privacy. The OTP encryption scheme has proved to be unbreakable in theory, but difficult to realize in practical applications. Because OTP encryption specially requires the absolute randomness of the key, its development has suffered from dense constraints. DNA cryptography is a new and promising technology in the field of information security. DNA chromosomes storing capabilities can be used as one-time pad structures with pseudo-random number generation and indexing in order to encrypt the plaintext messages. In this paper, we present a feasible solution to the OTP symmetric key generation and transmission problem with DNA at the molecular level. Through recombinant DNA technology, by using only sender-receiver known restriction enzymes to combine the secure key represented by DNA sequence and the T vector, we generate the DNA bio-hiding secure key and then place the recombinant plasmid in implanted bacteria for secure key transmission. The designed bio experiments and simulation results show that the security of the transmission of the key is further improved and the environmental requirements of key transmission are reduced. Analysis has demonstrated that the proposed DNA-based random key generation and management solutions are marked by high security and usability. Published by Elsevier B.V.

  20. Plasmids and packaging cell lines for use in phage display

    Science.gov (United States)

    Bradbury, Andrew M.

    2012-07-24

    The invention relates to a novel phagemid display system for packaging phagemid DNA into phagemid particles which completely avoids the use of helper phage. The system of the invention incorporates the use of bacterial packaging cell lines which have been transformed with helper plasmids containing all required phage proteins but not the packaging signals. The absence of packaging signals in these helper plasmids prevents their DNA from being packaged in the bacterial cell, which provides a number of significant advantages over the use of both standard and modified helper phage. Packaged phagemids expressing a protein or peptide of interest, in fusion with a phage coat protein such as g3p, are generated simply by transfecting phagemid into the packaging cell line.

  1. Topology of a Membrane Associated Regulator of Prokaryotic DNA Replication

    National Research Council Canada - National Science Library

    Firshein, William

    1998-01-01

    This proposal has focused on a broad host range plasmid, RK2, as a model system to study how a pair of initiation proteins encoded by the plasmid for DNA replication function when replication occurs...

  2. Characterization of Endogenous Plasmids from Lactobacillus salivarius UCC118▿ †

    OpenAIRE

    Fang, Fang; Flynn, Sarah; Li, Yin; Claesson, Marcus J.; van Pijkeren, Jan-Peter; Collins, J. Kevin; van Sinderen, Douwe; O'Toole, Paul W.

    2008-01-01

    The genome of Lactobacillus salivarius UCC118 comprises a 1.83-Mb chromosome, a 242-kb megaplasmid (pMP118), and two smaller plasmids of 20 kb (pSF118-20) and 44 kb (pSF118-44). Annotation and bioinformatic analyses suggest that both of the smaller plasmids replicate by a theta replication mechanism. Furthermore, it appears that they are transmissible, although neither possesses a complete set of conjugation genes. Plasmid pSF118-20 encodes a toxin-antitoxin system composed of pemI and pemK h...

  3. Ordering the mob: Insights into replicon and MOB typing schemes from analysis of a curated dataset of publicly available plasmids.

    Science.gov (United States)

    Orlek, Alex; Phan, Hang; Sheppard, Anna E; Doumith, Michel; Ellington, Matthew; Peto, Tim; Crook, Derrick; Walker, A Sarah; Woodford, Neil; Anjum, Muna F; Stoesser, Nicole

    2017-05-01

    Plasmid typing can provide insights into the epidemiology and transmission of plasmid-mediated antibiotic resistance. The principal plasmid typing schemes are replicon typing and MOB typing, which utilize variation in replication loci and relaxase proteins respectively. Previous studies investigating the proportion of plasmids assigned a type by these schemes ('typeability') have yielded conflicting results; moreover, thousands of plasmid sequences have been added to NCBI in recent years, without consistent annotation to indicate which sequences represent complete plasmids. Here, a curated dataset of complete Enterobacteriaceae plasmids from NCBI was compiled, and used to assess the typeability and concordance of in silico replicon and MOB typing schemes. Concordance was assessed at hierarchical replicon type resolutions, from replicon family-level to plasmid multilocus sequence type (pMLST)-level, where available. We found that 85% and 65% of the curated plasmids could be replicon and MOB typed, respectively. Overall, plasmid size and the number of resistance genes were significant independent predictors of replicon and MOB typing success. We found some degree of non-concordance between replicon families and MOB types, which was only partly resolved when partitioning plasmids into finer-resolution groups (replicon and pMLST types). In some cases, non-concordance was attributed to ambiguous boundaries between MOBP and MOBQ types; in other cases, backbone mosaicism was considered a more plausible explanation. β-lactamase resistance genes tended not to show fidelity to a particular plasmid type, though some previously reported associations were supported. Overall, replicon and MOB typing schemes are likely to continue playing an important role in plasmid analysis, but their performance is constrained by the diverse and dynamic nature of plasmid genomes. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  4. Cloning of Bacteroides fragilis plasmid genes affecting metronidazole resistance and ultraviolet survival in Escherichia coli

    International Nuclear Information System (INIS)

    Wehnert, G.U.; Abratt, V.R.; Goodman, H.J.; Woods, D.R.

    1990-01-01

    Since reduced metronidazole causes DNA damage, resistance to metronidazole was used as a selection method for the cloning of Bacteroides fragilis genes affecting DNA repair mechanisms in Escherichia coli. Genes from B. fragilis Bf-2 were cloned on a recombinant plasmid pMT100 which made E. coli AB1157 and uvrA, B, and C mutant strains more resistant to metronidazole, but more sensitive to far uv irradiation under aerobic conditions. The loci affecting metronidazole resistance and uv sensitivity were linked and located on a 5-kb DNA fragment which originated from the small 6-kb cryptic plasmid pBFC1 present in B. fragilis Bf-2 cells

  5. Study of genetic damage in the Japanese oyster induced by an environmentally-relevant exposure to diuron: evidence of vertical transmission of DNA damage.

    Science.gov (United States)

    Barranger, A; Akcha, F; Rouxel, J; Brizard, R; Maurouard, E; Pallud, M; Menard, D; Tapie, N; Budzinski, H; Burgeot, T; Benabdelmouna, A

    2014-01-01

    Pesticides represent a major proportion of the chemical pollutants detected in French coastal waters and hence a significant environmental risk with regards to marine organisms. Commercially-raised bivalves are particularly exposed to pollutants, among them pesticides, as shellfish farming zones are subject to considerable pressure from agricultural activities on the mainland. The aims of this study were to determine (1) the genotoxic effects of diuron exposure on oyster genitors and (2) the possible transmission of damaged DNA to offspring and its repercussions on oyster fitness. To investigate these points, oysters were exposed to concentrations of diuron close to those detected in the Marennes-Oleron Basin (two 7-day exposure pulses at 0.4 and 0.6 μg L(-1)) during the gametogenesis period. Genomic abnormalities were characterized using two complementary approaches. The Comet assay was applied for the measurement of early and reversible primary DNA damage, whereas flow cytometry was used to assess the clastogenic and aneugenic effect of diuron exposure. Polar Organic Chemical Integrative Samplers (POCIS) were used in exposed and assay tanks to confirm the waterborne concentration of diuron reached during the experiment. The results obtained by the Comet assay clearly showed a higher level of DNA strand breaks in both the hemocytes and spermatozoa of diuron-exposed genitors. The transmission of damaged genetic material to gamete cells could be responsible for the genetic damage measured in offspring. Indeed, flow cytometry analyses showed the presence of DNA breakage and a significant decrease in DNA content in spat from diuron-exposed genitors. The transmission of DNA damage to the offspring could be involved in the negative effects observed on offspring development (decrease in hatching rate, higher level of larval abnormalities, delay in metamorphosis) and growth. In this study, the vertical transmission of DNA damage was so highlighted by subjecting oyster

  6. Brownian Ratchet Mechanism for Faithful Segregation of Low-Copy-Number Plasmids.

    Science.gov (United States)

    Hu, Longhua; Vecchiarelli, Anthony G; Mizuuchi, Kiyoshi; Neuman, Keir C; Liu, Jian

    2017-04-11

    Bacterial plasmids are extrachromosomal DNA that provides selective advantages for bacterial survival. Plasmid partitioning can be remarkably robust. For high-copy-number plasmids, diffusion ensures that both daughter cells inherit plasmids after cell division. In contrast, most low-copy-number plasmids need to be actively partitioned by a conserved tripartite ParA-type system. ParA is an ATPase that binds to chromosomal DNA; ParB is the stimulator of the ParA ATPase and specifically binds to the plasmid at a centromere-like site, parS. ParB stimulation of the ParA ATPase releases ParA from the bacterial chromosome, after which it takes a long time to reset its DNA-binding affinity. We previously demonstrated in vitro that the ParA system can exploit this biochemical asymmetry for directed cargo transport. Multiple ParA-ParB bonds can bridge a parS-coated cargo to a DNA carpet, and they can work collectively as a Brownian ratchet that directs persistent cargo movement with a ParA-depletion zone trailing behind. By extending this model, we suggest that a similar Brownian ratchet mechanism recapitulates the full range of actively segregated plasmid motilities observed in vivo. We demonstrate that plasmid motility is tuned as the replenishment rate of the ParA-depletion zone progressively increases relative to the cargo speed, evolving from diffusion to pole-to-pole oscillation, local excursions, and, finally, immobility. When the plasmid replicates, the daughters largely display motilities similar to that of their mother, except that when the single-focus progenitor is locally excursive, the daughter foci undergo directed segregation. We show that directed segregation maximizes the fidelity of plasmid partition. Given that local excursion and directed segregation are the most commonly observed modes of plasmid motility in vivo, we suggest that the operation of the ParA-type partition system has been shaped by evolution for high fidelity of plasmid segregation

  7. Plasmid pVAX1-NH36 purification by membrane and bead perfusion chromatography.

    Science.gov (United States)

    Franco-Medrano, Diana Ivonne; Guerrero-Germán, Patricia; Montesinos-Cisneros, Rosa María; Ortega-López, Jaime; Tejeda-Mansir, Armando

    2017-03-01

    The demand for plasmid DNA (pDNA) has increased in response to the rapid advances in vaccines applications to prevent and treat infectious diseases caused by virus, bacteria or parasites, such as Leishmania species. The immunization protocols require large amounts of supercoiled plasmid DNA (sc-pDNA) challenging the development of efficient and profitable processes for capturing and purified pDNA molecules from large volumes of lysates. A typical bioprocess involves four steps: fermentation, primary recovery, intermediate recovery and final purification. Ion-exchange chromatography is one of the key operations in the purification schemes of pDNA owing the chemical structure of these macromolecules. The goal of this research was to compare the performance of the final purification step of pDNA using ion-exchange chromatography on columns packed with Mustang Q membranes or perfusive beads POROS 50 HQ. The experimental results showed that both matrixes could separate the plasmid pVAX1-NH36 (3936 bp) from impurities in clarified Escherichia coli lysates with an adequate resolution. In addition, a 24- and 21-fold global purification factor was obtained. An 88 and 63% plasmid recuperation was achieved with ion-exchange membranes and perfusion beads, respectively. A better understanding of perfusion-based matrices for the purification of pDNA was developed in this research.

  8. Origin and Evolution of Rickettsial Plasmids.

    Directory of Open Access Journals (Sweden)

    Khalid El Karkouri

    Full Text Available Rickettsia species are strictly intracellular bacteria that have undergone a reductive genomic evolution. Despite their allopatric lifestyle, almost half of the 26 currently validated Rickettsia species have plasmids. In order to study the origin, evolutionary history and putative roles of rickettsial plasmids, we investigated the evolutionary processes that have shaped 20 plasmids belonging to 11 species, using comparative genomics and phylogenetic analysis between rickettsial, microbial and non-microbial genomes.Plasmids were differentially present among Rickettsia species. The 11 species had 1 to 4 plasmid (s with a size ranging from 12 kb to 83 kb. We reconstructed pRICO, the last common ancestor of the current rickettsial plasmids. pRICO was vertically inherited mainly from Rickettsia/Orientia chromosomes and diverged vertically into a single or multiple plasmid(s in each species. These plasmids also underwent a reductive evolution by progressive gene loss, similar to that observed in rickettsial chromosomes, possibly leading to cryptic plasmids or complete plasmid loss. Moreover, rickettsial plasmids exhibited ORFans, recent gene duplications and evidence of horizontal gene transfer events with rickettsial and non-rickettsial genomes mainly from the α/γ-proteobacteria lineages. Genes related to maintenance and plasticity of plasmids, and to adaptation and resistance to stress mostly evolved under vertical and/or horizontal processes. Those involved in nucleotide/carbohydrate transport and metabolism were under the influence of vertical evolution only, whereas genes involved in cell wall/membrane/envelope biogenesis, cycle control, amino acid/lipid/coenzyme and secondary metabolites biosynthesis, transport and metabolism underwent mainly horizontal transfer events.Rickettsial plasmids had a complex evolution, starting with a vertical inheritance followed by a reductive evolution associated with increased complexity via horizontal gene

  9. Development and host compatibility of plasmids for two important ruminant pathogens, Mycoplasma bovis and Mycoplasma agalactiae.

    Directory of Open Access Journals (Sweden)

    Shukriti Sharma

    Full Text Available Mycoplasma bovis is a cause of pneumonia, mastitis, arthritis and otitis media in cattle throughout the world. However, despite its clinical significance, there is a paucity of tools to genetically manipulate it, impeding our capacity to further explore the molecular basis of its virulence. To address this limitation, we developed a series of homologous and heterologous replicable plasmids from M. bovis and M. agalactiae. The shortest replicable oriC plasmid based on the region downstream of dnaA in M. bovis was 247 bp and contained two DnaA boxes, while oriC plasmids based on the region downstream of dnaA in M. agalactiae strains 5632 and PG2 were 219 bp and 217 bp in length, respectively, and contained only a single DnaA box. The efficiency of transformation in M. bovis and M. agalactiae was inversely correlated with the size of the oriC region in the construct, and, in general, homologous oriC plasmids had a higher transformation efficiency than heterologous oriC plasmids. The larger pWholeoriC45 and pMM21-7 plasmids integrated into the genomic oriC region of M. bovis, while the smaller oriC plasmids remained extrachromosomal for up to 20 serial passages in selective media. Although specific gene disruptions were not be achieved in M. bovis in this study, the oriC plasmids developed here could still be useful as tools in complementation studies and for expression of exogenous genes in both M. bovis and M. agalactiae.

  10. Molecular processes as basis for plasmid-mediated bacterial UV-light resistance and mutagenesis

    International Nuclear Information System (INIS)

    Aleshkin, G.I.; Brukhanskij, G.V.; Skavronskaya, A.G.

    1985-01-01

    The increase of UV-resistance and UV-induced mutagenesis by lambda 1 pint intmid as well as molecular-genetic mechanisms of plasmid participation in reparation and DNA replication and its degradation after UV-irradiation in plasmid cells on pKM101 plasmid model have been investigated. Data testifying to the necessity of intmid integration in chromosome as obligatory stage of intmid participation in increasing UV-resistance of bacterial cells are obtained. It has been found that intmid raises UV-resistance of cells and increases respectively the UV-induced reverants efficiency. On the basis of the experiment data the conclusion is drawn that the intmid capacity to raise UV-resistance and, possibly, mutagenesis is bound not only with its integration into chromosome but also with pol A + chromosome replication by dependendent imtmid replication complex. It is shown that pKM101 plasmid ensures functioning in E coli cells of inducible, chloroamphenicol-resistant DNA replication, highly resistant to UV-light harmful effect and that the volume of excision reparation in E. coli cells carrying pKM101 plasmid is increased as compared with the volume of reparation in plasmid legs cells. The combination of the data obtained gives grounds to the authors to assume that inducible replication, inducible reparation of DNA and inducible decrease of DNA degradation determined by pKM101 plasmid may serve as recA + lexA + basis dependent increase of UV-resistance and mutagenesis and that these processes provide the possibility of functioning of integrative replication mechanism of plasmid participation in ensuring UV-resistance and mutagenesis of plants

  11. Development and Host Compatibility of Plasmids for Two Important Ruminant Pathogens, Mycoplasma bovis and Mycoplasma agalactiae

    Science.gov (United States)

    Sharma, Shukriti; Citti, Chistine; Sagné, Eveline; Marenda, Marc S.

    2015-01-01

    Mycoplasma bovis is a cause of pneumonia, mastitis, arthritis and otitis media in cattle throughout the world. However, despite its clinical significance, there is a paucity of tools to genetically manipulate it, impeding our capacity to further explore the molecular basis of its virulence. To address this limitation, we developed a series of homologous and heterologous replicable plasmids from M. bovis and M. agalactiae. The shortest replicable oriC plasmid based on the region downstream of dnaA in M. bovis was 247 bp and contained two DnaA boxes, while oriC plasmids based on the region downstream of dnaA in M. agalactiae strains 5632 and PG2 were 219 bp and 217 bp in length, respectively, and contained only a single DnaA box. The efficiency of transformation in M. bovis and M. agalactiae was inversely correlated with the size of the oriC region in the construct, and, in general, homologous oriC plasmids had a higher transformation efficiency than heterologous oriC plasmids. The larger pWholeoriC45 and pMM21-7 plasmids integrated into the genomic oriC region of M. bovis, while the smaller oriC plasmids remained extrachromosomal for up to 20 serial passages in selective media. Although specific gene disruptions were not be achieved in M. bovis in this study, the oriC plasmids developed here could still be useful as tools in complementation studies and for expression of exogenous genes in both M. bovis and M. agalactiae. PMID:25746296

  12. Transformation of UV-hypersensitive Chinese hamster ovary cell mutants with UV-irradiated plasmids

    International Nuclear Information System (INIS)

    Nairn, R.S.; Humphrey, R.M.; Adair, G.M.

    1988-01-01

    Transfection of UV-hypersensitive, DNA repair-deficient Chinese hamster ovary (CHO) cell lines and parental, repair-proficient CHO cells with UV-irradiated pHaprt-1 or pSV2gpt plasmids resulted in different responses by recipient cell lines to UV damage in transfected DNA. Unlike results reported for human cells, UV irradiation of transfecting DNA did not stimulate genetic transformation of CHO recipient cells. In repair-deficient CHO cells, proportionally fewer transformants were produced with increasing UV damage than in repair-proficient cells in transfections with UV-irradiated hamster adenine phosphoribosyltransferase (APRT) gene contained in plasmid pHaprt-1. Transfection of CHO cells with UV-irradiated pSV2gpt resulted in neither decline in transformation frequencies in repair-deficient cell lines relative to repair-proficient cells nor stimulation of genetic transformation by UV damage in the plasmid. Blot hybridization analysis of DNA samples isolated from transformed cells showed no dramatic changes in copy number or arrangement of transfected plasmid DNA with increasing UV dose. The authors conclude responses of recipient cells to UV-damaged transfecting plasmids depend on type of recipient cell and characteristics of the genetic sequence used for transfection. (author)

  13. Identification of a Novel Conjugative Plasmid in Mycobacteria That Requires Both Type IV and Type VII Secretion

    KAUST Repository

    Ummels, R.; Abdallah, A. M.; Kuiper, V.; Aajoud, A.; Sparrius, M.; Naeem, R.; Spaink, H. P.; van Soolingen, D.; Pain, Arnab; Bitter, W.

    2014-01-01

    Conjugative plasmids play an important role in horizontal gene transfer between different bacteria and, as such, in their adaptation and evolution. This effect is most obvious in the spread of antibiotic resistance genes. Thus far, conjugation of natural plasmids has been described only rarely for mycobacterial species. In fact, it is generally accepted that M. tuberculosis does not show any recent sign of horizontal gene transfer. In this study, we describe the identification of a new widespread conjugative plasmid that can also be efficiently transferred to M. tuberculosis. This plasmid therefore poses both a threat and an opportunity. The threat is that, through the acquisition of antibiotic resistance markers, this plasmid could start a rapid spread of antibiotic resistance genes between pathogenic mycobacteria. The opportunity is that we could use this plasmid to generate new tools for the efficient introduction of foreign DNA in slow-growing mycobacteria.

  14. Malaria prevalence defined by microscopy, antigen detection, DNA amplification and total nucleic acid amplification in a malaria-endemic region during the peak malaria transmission season.

    Science.gov (United States)

    Waitumbi, John N; Gerlach, Jay; Afonina, Irina; Anyona, Samuel B; Koros, Joseph N; Siangla, Joram; Ankoudinova, Irina; Singhal, Mitra; Watts, Kate; Polhemus, Mark E; Vermeulen, Nicolaas M; Mahoney, Walt; Steele, Matt; Domingo, Gonzalo J

    2011-07-01

    To determine the malaria prevalence by microscopy, antigen detection and nucleic acid detection in a defined subpopulation in a Plasmodium falciparum-endemic region during the peak transmission season. Blood specimens were collected in a cross-sectional study involving children aged 5-10 years (n = 195) presenting with acute fever to two clinics in Western Kenya. All specimens underwent microscopy, HRP2 and aldolase antigen detection by enzyme immunoassay (EIA), parasite-specific DNA and total nucleic acid (RNA and DNA) by real-time PCR (qPCR) and reverse-transcriptase PCR (qRT-PCR). Microscopy detected 65/195 cases of malaria infection [95% confidence interval (CI) 52-78]. HRP2 and aldolase EIA had similar sensitivity levels detecting antigen in 65/195 (95% CI, 52-78) and 57/195 (95% CI, 45-70) cases. Discordants in antigen detection vs. microscopy occurred at Detection of total nucleic acid allowed a 3 log lower limit of detection than just DNA detection by real-time PCR in vitro. In clinical specimens, 114/195 (95% CI, 100-127) were qPCR positive (DNA), and 187/195 (95% CI, 179-191) were qRT-PCR positive (DNA plus RNA). The prevalence of submicroscopic malaria infection was significantly higher when detecting total nucleic acid than just DNA in this outpatient population during the high transmission season. Defining standards for submicroscopic infection will be important for control programmes, diagnostics development efforts and molecular epidemiology studies. © 2011 Blackwell Publishing Ltd.

  15. Bacterial mitosis: Partitioning protein ParA oscillates in spiral-shaped structures and positions plasmids at mid-cell

    DEFF Research Database (Denmark)

    Ebersbach, G.; Gerdes, Kenn

    2004-01-01

    The par2 locus of Escherichia coli plasmid pB171 encodes oscillating ATPase ParA, DNA binding protein ParB and two cis-acting DNA regions to which ParB binds (parC1 and parC2). Three independent techniques were used to investigate the subcellular localization of plasmids carrying par2. In cells......A-GFP oscillated in spiral-shaped structures. Amino acid substitutions in ParA simultaneously abolished ParA spiral formation, oscillation and either plasmid localization or plasmid separation at mid-cell. Therefore, our results suggest that ParA spirals position plasmids at the middle of the bacterial nucleoid...

  16. Increasing plasmid transformation efficiency of natural spizizen method in Bacillus Subtilis by a cell permeable peptide

    Directory of Open Access Journals (Sweden)

    Mehrdad Moosazadeh Moghaddam

    2013-01-01

    Full Text Available Introduction: Some of bacterial species are able to uptake DNA molecule from environment, the yield of this process depends on some conditions such as plasmid size and host type. In the case of Bacillus subtilis, DNA uptake has low efficacy. Using Spizizen minimal medium is common method in plasmid transformation into B. subtilis, but rate of this process is not suitable and noteworthy. The aim of this study was investigation of novel method for improvement of DNA transformation into B. subtilis based on CM11 cationic peptide as a membrane permeable agent.Materials and methods: In this study, for optimization of pWB980 plasmid transformation into B. subtilis, the CM11 cationic peptide was used. For this purpose, B. subtilis competent cell preparation in the present of different concentration of peptide was implemented by two methods. In the first method, after treatment of bacteria with different amount of peptide for 14h, plasmid was added. In the second method, several concentration of peptide with plasmid was exposed to bacteria simultaneously. Bacteria that uptake DNA were screened on LB agar medium containing kanamycin. The total transformed bacteria per microgram of DNA was calculated and compared with the control.Results: Plasmid transformation in best conditions was 6.5 folds higher than the control. This result was statistically significant (P value <0.001.Discussion and conclusion: This study showed that CM11 cationic peptide as a membrane permeable agent was able to increase plasmid transformation rate into B. subtilis. This property was useful for resolution of low transformation efficacy.

  17. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.

    Science.gov (United States)

    Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo

    2017-06-25

    Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.

  18. Plasmid-Mediated Quinolone Resistance in Shigella flexneri Isolated From Macaques

    Directory of Open Access Journals (Sweden)

    Anthony J. Mannion

    2018-03-01

    Full Text Available Non-human primates (NHPs for biomedical research are commonly infected with Shigella spp. that can cause acute dysentery or chronic episodic diarrhea. These animals are often prophylactically and clinically treated with quinolone antibiotics to eradicate these possible infections. However, chromosomally- and plasmid-mediated antibiotic resistance has become an emerging concern for species in the family Enterobacteriaceae. In this study, five individual isolates of multi-drug resistant Shigella flexneri were isolated from the feces of three macaques. Antibiotic susceptibility testing confirmed resistance or decreased susceptibility to ampicillin, amoxicillin-clavulanic acid, cephalosporins, gentamicin, tetracycline, ciprofloxacin, enrofloxacin, levofloxacin, and nalidixic acid. S. flexneri isolates were susceptible to trimethoprim-sulfamethoxazole, and this drug was used to eradicate infection in two of the macaques. Plasmid DNA from all isolates was positive for the plasmid-encoded quinolone resistance gene qnrS, but not qnrA and qnrB. Conjugation and transformation of plasmid DNA from several S. flexneri isolates into antibiotic-susceptible Escherichia coli strains conferred the recipients with resistance or decreased susceptibility to quinolones and beta-lactams. Genome sequencing of two representative S. flexneri isolates identified the qnrS gene on a plasmid-like contig. These contigs showed >99% homology to plasmid sequences previously characterized from quinolone-resistant Shigella flexneri 2a and Salmonella enterica strains. Other antibiotic resistance genes and virulence factor genes were also identified in chromosome and plasmid sequences in these genomes. The findings from this study indicate macaques harbor pathogenic S. flexneri strains with chromosomally- and plasmid-encoded antibiotic resistance genes. To our knowledge, this is the first report of plasmid-mediated quinolone resistance in S. flexneri isolated from NHPs and warrants

  19. AFM Imaging of Hybridization Chain Reaction-Mediated Signal Transmission Between two DNA Origami Structures

    DEFF Research Database (Denmark)

    Helmig, Sarah Wendelbo; Gothelf, Kurt Vesterager

    2017-01-01

    transfer between two connected DNA nanostructures, using the hybridization chain reaction (HCR). Two sets of metastable DNA hairpins - of which one is immobilized in specific points along tracks on DNA origami structures - are polymerized to form a continuous DNA duplex, which is visible using atomic force...... microscopy (AFM). Upon addition of a designed initiator, the initiation signal is efficiently transferred >200 nm from a specific location on one origami structure to an end point on another origami structure. The system shows no significant loss of signal when crossing from one nanostructure to another...

  20. DNA multigene characterization of Fasciola hepatica and Lymnaea neotropica and its fascioliasis transmission capacity in Uruguay, with historical correlation, human report review and infection risk analysis

    Science.gov (United States)

    Gayo, Valeria; Sanchis, Jaime; Artigas, Patricio; Khoubbane, Messaoud; Birriel, Soledad; Mas-Coma, Santiago

    2017-01-01

    Background Fascioliasis is a pathogenic disease transmitted by lymnaeid snails and recently emerging in humans, in part due to effects of climate changes, anthropogenic environment modifications, import/export and movements of livestock. South America is the continent presenting more human fascioliasis hyperendemic areas and the highest prevalences and intensities known. These scenarios appear mainly linked to altitude areas in Andean countries, whereas lowland areas of non-Andean countries, such as Uruguay, only show sporadic human cases or outbreaks. A study including DNA marker sequencing of fasciolids and lymnaeids, an experimental study of the life cycle in Uruguay, and a review of human fascioliasis in Uruguay, are performed. Methodology/Principal findings The characterization of Fasciola hepatica from cattle and horses of Uruguay included the complete sequences of the ribosomal DNA ITS-2 and ITS-1 and mitochondrial DNA cox1 and nad1. ITS-2, ITS-1, partial cox1 and rDNA 16S gene of mtDNA were used for lymnaeids. Results indicated that vectors belong to Lymnaea neotropica instead of to Lymnaea viator, as always reported from Uruguay. The life cycle and transmission features of F. hepatica by L. neotropica of Uruguay were studied under standardized experimental conditions to enable a comparison with the transmission capacity of F. hepatica by Galba truncatula at very high altitude in Bolivia. On this baseline, we reviewed the 95 human fascioliasis cases reported in Uruguay and analyzed the risk of human infection in front of future climate change estimations. Conclusions/Significance The correlation of fasciolid and lymnaeid haplotypes with historical data on the introduction and spread of livestock into Uruguay allowed to understand the molecular diversity detected. Although Uruguayan L. neotropica is a highly efficient vector, its transmission capacity is markedly lower than that of Bolivian G. truncatula. This allows to understand the transmission and

  1. Transfer of the lambdadv plasmid to new bacterial hosts

    International Nuclear Information System (INIS)

    Kellenberger-Gujer, G.; Boy de la Tour, E.; Berg, D.E.

    1974-01-01

    Lambda dv, which was derived from bacteriophage lambda, replicates autonomously as a plasmid in Escherichia coli and consists of only the immunity region (imm/sup lambda/) and DNA replication genes (O, P) of the ancestral phage. Addition phages (lambda imm 21 --lambda dv) carry the lambda dv fragment inserted as a tandem duplication in their genome (sequence A imm 21 O P imm/sup lambda/ O P R) are formed as recombinants after lambda imm 21 infection of strains carrying lambda dv. Addition phages were used to transfer lambda dv to new bacterial hosts. Lambda dv transfer by excision of the lambda dv segment from the addition phage genome requires a bacterial Rec or a phage Red recombination system. Successful transfer is stimulated by uv irradiation of the addition phage before infection. Some properties of the newly transferred lambda dv plasmids are described. (U.S.)

  2. Estimating the Transfer Range of Plasmids Encoding Antimicrobial Resistance in a Wastewater Treatment Plant Microbial Community

    DEFF Research Database (Denmark)

    Li, Liguan; Dechesne, Arnaud; He, Zhiming

    2018-01-01

    sludge microbial community was challenged in standardized filter matings with one of three multidrug resistance plasmids (pKJK5, pB10, and RP4) harbored by Escherichia coli or Pseudomonas putida. Different donor–plasmid combinations had distinct transfer frequencies, ranging from 3 to 50 conjugation...... events per 100000 cells of the WWTP microbial community. In addition, transfer was observed to a broad phylogenetic range of 13 bacterial phyla with several taxa containing potentially pathogenic species. Preferential transfer to taxa belonging to the predicted evolutionary host range of the plasmids...... ARG transmission. However, the contribution of microbial communities in WWTPs to ARG dissemination remains poorly understood. Here, we examined for the first time plasmid permissiveness of an activated sludge microbial community by utilizing an established fluorescent bioreporter system. The activated...

  3. NanoSMGT: transgene transmission into bovine embryos using halloysite clay nanotubes or nanopolymer to improve transfection efficiency.

    Science.gov (United States)

    Campos, Vinicius Farias; de Leon, Priscila Marques Moura; Komninou, Eliza Rossi; Dellagostin, Odir Antônio; Deschamps, João Carlos; Seixas, Fabiana Kömmling; Collares, Tiago

    2011-11-01

    The objectives were to investigate whether: 1) nanotransfectants are more effective than other common transfection methods for SMGT; 2) NanoSMGT is able to transmit exogenous DNA molecules to bovine embryos; and 3) halloysite clay nanotubes (HCNs) can be used as a transfection reagent to improve transgene transmission. Four transfection systems were used: naked DNA (without transfectant), lipofection, nanopolymer, and halloysite clay nanotubes. Plasmid uptake by sperm and its transfer to embryos were quantified by conventional and real-time PCR, as well as EGFP expression by fluorescence microscopy. Furthermore, sperm motility and viability, and embryo development were investigated. Mean number of plasmids taken up was affected (P < 0.05) by transfection procedure, with the nanopolymer being the most effective transfectant (∼ 153 plasmids per spermatozoon). None of the treatments affected sperm motility or viability. The mean number of plasmids transmitted to four-cell stage embryos was higher (P < 0.05) in nanopolymer and HCNs than liposomes and naked DNA groups. The number of embryos carrying the transgene increased from 8-10% using naked DNA or liposomes to 40-45% using nanopolymer or HCN as transfectants (P < 0.05). There were no significant differences among transfection procedures regarding blastocyst formation rate of resulting embryos. However, no EGFP-expressing embryo was identified in any treatment. Therefore, nanotransfectants improved transgene transmission in bovine embryos without deleterious effects on embryo development. To our knowledge, this was the first time that bovine embryos carrying a transgene were produced by NanoSMGT. Copyright © 2011 Elsevier Inc. All rights reserved.

  4. Formation of Escherichia coli Hfr strains by integrative suppression with the P group plasmid RP1.

    OpenAIRE

    Martin, R R; Thorlton, C L; Unger, L

    1981-01-01

    Hfr strains of Escherichia coli were obtained by integrative suppression of a dnaA(Ts) mutation by the Inc P-1 plasmid RP1 without prior creation of an unnatural homology between the plasmid and the E. coli chromosome. Unmodified RP1 mobilized the polarized transfer of the chromosome in a counterclock-wise direction from a distinct origin between 81 min (pyrE) and 82 min (dnaA) with pyrE as a leading marker. Inheritance of RP1-Hfr chromosomal and antibiotic resistance genes was due to recombi...

  5. RepA and RepB exert plasmid incompatibility repressing the transcription of the repABC operon.

    Science.gov (United States)

    Pérez-Oseguera, Angeles; Cevallos, Miguel A

    2013-11-01

    Rhizobium etli CFN42 has a multipartite genome composed of one chromosome and six large plasmids with low copy numbers, all belonging to the repABC plasmid family. All elements essential for replication and segregation of these plasmids are encoded within the repABC operon. RepA and RepB direct plasmid segregation and are involved in the transcriptional regulation of the operon, and RepC is the initiator protein of the plasmid. Here we show that in addition to RepA (repressor) and RepB (corepressor), full transcriptional repression of the operon located in the symbiotic plasmid (pRetCFN42d) of this strain requires parS, the centromere-like sequence, and the operator sequence. However, the co-expression of RepA and RepB is sufficient to induce the displacement of the parental plasmid. RepA is a Walker-type ATPase that self associates in vivo and in vitro and binds specifically to the operator region in its RepA-ADP form. In contrast, RepA-ATP is capable of binding to non-specific DNA. RepA and RepB form high molecular weight DNA-protein complexes in the presence of ATP and ADP. RepA carrying ATP-pocket motif mutations induce full repression of the repABC operon without the participation of RepB and parS. These mutants specifically bind the operator sequence in their ATP or ADP bound forms. In addition, their expression in trans exerts plasmid incompatibility against the parental plasmid. RepA and RepB expressed in trans induce plasmid incompatibility because of their ability to repress the repABC operon and not only by their capacity to distort the plasmid segregation process. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. Immunization with DNA plasmids coding for crimean-congo hemorrhagic fever virus capsid and envelope proteins and/or virus-like particles induces protection and survival in challenged mice

    DEFF Research Database (Denmark)

    Hinkula, Jorma; Devignot, Stéphanie; Åkerström, Sara

    2017-01-01

    , there was no correlation with the neutralizing antibody titers alone, which were higher in the tc-VLP-vaccinated mice. However, the animals with a lower neutralizing titer, but a dominant cell-mediated Th1 response and a balanced Th2 response, resisted the CCHFV challenge. Moreover, we found that in challenged mice...... with a Th1 response (immunized by DNA/DNA and boosted by tc-VLPs), the immune response changed to Th2 at day 9 postchallenge. In addition, we were able to identify new linear B-cell epitope regions that are highly conserved between CCHFV strains. Altogether, our results suggest that a predominantly Th1-type...

  7. Replication and Transcription of Eukaryotic DNA in Esherichia coli

    Science.gov (United States)

    Morrow, John F.; Cohen, Stanley N.; Chang, Annie C. Y.; Boyer, Herbert W.; Goodman, Howard M.; Helling, Robert B.

    1974-01-01

    Fragments of amplified Xenopus laevis DNA, coding for 18S and 28S ribosomal RNA and generated by EcoRI restriction endonuclease, have been linked in vitro to the bacterial plasmid pSC101; and the recombinant molecular species have been introduced into E. coli by transformation. These recombinant plasmids, containing both eukaryotic and prokaryotic DNA, replicate stably in E. coli. RNA isolated from E. coli minicells harboring the plasmids hybridizes to amplified X. laevis rDNA. Images PMID:4600264

  8. Vaxfectin (registered trademark) Enhances Both Antibody and In Vitro T Cell Responses to Each Component of a 5-gene Plasmodium falciparum Plasmid DNA Vaccine Mixture Administered at Low Doses

    Science.gov (United States)

    2010-01-01

    received intramus- cular injections in the tibialis anterior muscle pDNA formu lated in PBS or Vaxfectin® using insulin syringes (0.3 ml: Becton Dick... phosphatidylcholine (DSPC) liposomes in Leishmania vaccine stud- ies and report long-term immunity in mice when the adjuvant was added with the

  9. DNA-PK dependent targeting of DNA-ends to a protein complex assembled on matrix attachment region DNA sequences

    International Nuclear Information System (INIS)

    Mauldin, S.K.; Getts, R.C.; Perez, M.L.; DiRienzo, S.; Stamato, T.D.

    2003-01-01

    Full text: We find that nuclear protein extracts from mammalian cells contain an activity that allows DNA ends to associate with circular pUC18 plasmid DNA. This activity requires the catalytic subunit of DNA-PK (DNA-PKcs) and Ku since it was not observed in mutants lacking Ku or DNA-PKcs but was observed when purified Ku/DNA-PKcs was added to these mutant extracts. Competition experiments between pUC18 and pUC18 plasmids containing various nuclear matrix attachment region (MAR) sequences suggest that DNA ends preferentially associate with plasmids containing MAR DNA sequences. At a 1:5 mass ratio of MAR to pUC18, approximately equal amounts of DNA end binding to the two plasmids were observed, while at a 1:1 ratio no pUC18 end-binding was observed. Calculation of relative binding activities indicates that DNA-end binding activities to MAR sequences was 7 to 21 fold higher than pUC18. Western analysis of proteins bound to pUC18 and MAR plasmids indicates that XRCC4, DNA ligase IV, scaffold attachment factor A, topoisomerase II, and poly(ADP-ribose) polymerase preferentially associate with the MAR plasmid in the absence or presence of DNA ends. In contrast, Ku and DNA-PKcs were found on the MAR plasmid only in the presence of DNA ends. After electroporation of a 32P-labeled DNA probe into human cells and cell fractionation, 87% of the total intercellular radioactivity remained in nuclei after a 0.5M NaCl extraction suggesting the probe was strongly bound in the nucleus. The above observations raise the possibility that DNA-PK targets DNA-ends to a repair and/or DNA damage signaling complex which is assembled on MAR sites in the nucleus

  10. Tomato protoplast DNA transformation : physical linkage and recombination of exogenous DNA sequences

    NARCIS (Netherlands)

    Jongsma, Maarten; Koornneef, Maarten; Zabel, Pim; Hille, Jacques

    1987-01-01

    Tomato protoplasts have been transformed with plasmid DNA's, containing a chimeric kanamycin resistance gene and putative tomato origins of replication. A calcium phosphate-DNA mediated transformation procedure was employed in combination with either polyethylene glycol or polyvinyl alcohol. There

  11. Synthesis and crystal structure determination of copper(II)-complex: In vitro DNA and HSA binding, pBR322 plasmid cleavage, cell imaging and cytotoxic studies.

    Science.gov (United States)

    Tabassum, Sartaj; Zaki, Mehvash; Ahmad, Musheer; Afzal, Mohd; Srivastav, Saurabh; Srikrishna, Saripella; Arjmand, Farukh

    2014-08-18

    New Cu(II) complex 1 of indole-3-propionic acid and 1,10-phenanthroline was synthesized and characterized by analytical, spectroscopic and single crystal X-ray diffraction. In vitro DNA binding studies of 1 was performed by employing UV-vis and fluorescence spectroscopic techniques. The binding affinity towards human serum albumin (HSA) was also investigated to understand the carrier role in body system, as the time dependent HPLC experiment of 1 revealed that bonded drug with protein releases slowly in presence of DNA. Complex 1 exhibited good anti-tumor activity (GI50 values <10 μg/ml), and to elucidate the mechanism of tumor inhibition, topoisomerase I enzymatic activity was carried out and further validated by cell imaging studies which clearly showed its nuclear localization. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  12. Efficacy and safety of telbivudine in preventing mother-to-infant transmission of HBV in pregnant women with high HBV DNA load

    Directory of Open Access Journals (Sweden)

    SUN Weihui

    2013-08-01

    Full Text Available ObjectiveTo evaluate the efficacy and safety of telbivudine given from the 12th week of gestation in preventing mother-to-infant transmission of hepatitis B virus (HBV in pregnant women with high HBV DNA load. MethodsEighty pregnant women (at 12 weeks of gestation with chronic hepatitis B, who had a HBV DNA load higher than 1.0×107 copies/ml, were enrolled. The patients were divided into two groups according to their personal preferences: treatment group (n=38 and control group (n=42. The treatment group received oral telbivudine (600 mg once daily until 12 weeks after delivery and was administered compound glycyrrhizin for liver protection, while the control group was given compound glycyrrhizin for liver protection alone. All infants in both groups were vaccinated with hepatitis B immunoglobulin (200 IU and HBV vaccine (20 μg after birth. The mother-to-infant transmission of HBV was indicated by the presence of HBsAg and HBV DNA in infants at 7 months after birth. The HBV DNA levels in these women were measured, and the positive rate of HBsAg in infants was determined. The difference in positive rate of HBsAg was analyzed by chi-square test; the between-group comparison was analyzed by group t(t′-test, and the before-after comparison was analyzed by paired t-test. ResultsThe treatment group showed significantly decreased HBV DNA and alanine aminotransferase levels before delivery. The HBV DNA load of treatment group dropped rapidly after 2 weeks of treatment and then decreased slowly until delivery. The treatment group had significantly decreased HBV DNA levels beforedelivery and at 12 weeks after delivery (t=29.15, P<0.01; t=40.06, P<0.01, but the control group showed no significant changes (P>0.05. The treatment group had significantly lower HBV DNA levels than the control group before delivery and at 12 weeks after delivery (P<0.01. No infants in the treatment group were HBV-positive, versus a positive rate of 14.3% in the

  13. Development of a screening method for genetically modified soybean by plasmid-based quantitative competitive polymerase chain reaction.

    Science.gov (United States)

    Shimizu, Eri; Kato, Hisashi; Nakagawa, Yuki; Kodama, Takashi; Futo, Satoshi; Minegishi, Yasutaka; Watanabe, Takahiro; Akiyama, Hiroshi; Teshima, Reiko; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi

    2008-07-23

    A novel type of quantitative competitive polymerase chain reaction (QC-PCR) system for the detection and quantification of the Roundup Ready soybean (RRS) was developed. This system was designed based on the advantage of a fully validated real-time PCR method used for the quantification of RRS in Japan. A plasmid was constructed as a competitor plasmid for the detection and quantification of genetically modified soy, RRS. The plasmid contained the construct-specific sequence of RRS and the taxon-specific sequence of lectin1 (Le1), and both had 21 bp oligonucleotide insertion in the sequences. The plasmid DNA was used as a reference molecule instead of ground seeds, which enabled us to precisely and stably adjust the copy number of targets. The present study demonstrated that the novel plasmid-based QC-PCR method could be a simple and feasible alternative to the real-time PCR method used for the quantification of genetically modified organism contents.

  14. Plasmid metagenomics reveals multiple antibiotic resistance gene classes among the gut microbiomes of hospitalised patients

    DEFF Research Database (Denmark)

    Jitwasinkul, Tossawan; Suriyaphol, Prapat; Tangphatsornruang, Sithichoke

    2016-01-01

    Antibiotic resistance genes are rapidly spread between pathogens and the normal flora, with plasmids playing an important role in their circulation. This study aimed to investigate antibiotic resistance plasmids in the gut microbiome of hospitalised patients. Stool samples were collected from seven...... inpatients at Siriraj Hospital (Bangkok, Thailand) and were compared with a sample from a healthy volunteer. Plasmids from the gut microbiomes extracted from the stool samples were subjected to high-throughput DNA sequencing (GS Junior). Newbler-assembled DNA reads were categorised into known and unknown...... in the gut microbiome; however, it was difficult to link these to the antibiotic resistance genes identified. That the antibiotic resistance genes came from hospital and community environments is worrying....

  15. A genetic study of a Staphylococus aureus plasmid involving cure and transference

    Directory of Open Access Journals (Sweden)

    Ana Lúcia Costa Darini

    Full Text Available High frequency transfer and elimination of drug resistance may indicate an extrachromosomal inheritance of genetic determinants. This study shows the cure and transfer of a small plasmid and tetracycline resistance in Staphylococcus aureus 1030 (55TetR strains. Several methods are available for plasmid elimination. We used ethidium bromide, an agent that binds to DNA, and thus inhibits DNA polymerase. This caused a high frequency of loss of the small plasmid and resistance to tetracycline. Transfer of tetracycline resistance was done in a mixed culture at a frequency of 10-6. This type of study is very important to physicians and epidemiology investigators and provides better knowledge on antibiotic-resistance mechanisms that may occur in vivo in a hospital environment.

  16. The complete sequence and comparative analysis of a multidrug- resistance and virulence multireplicon IncFII plasmid pEC302/04 from an extraintestinal pathogenic Escherichia coli EC302/04 indicate extensive diversity of IncFII plasmids

    Directory of Open Access Journals (Sweden)

    Wing Sze eHo

    2016-01-01

    Full Text Available Extraintestinal pathogenic Escherichia coli (ExPEC that causes extraintestinal infections often harbor plasmids encoding fitness traits such as resistance and virulence determinants that are of clinical importance. We determined the complete nucleotide sequence of plasmid pEC302/04 from a multidrug-resistant E. coli EC302/04 which was isolated from the tracheal aspirate of a patient in Malaysia. In addition, we also performed comparative sequence analyses of 18 related IncFIIA plasmids to determine the phylogenetic relationship and diversity of these plasmids. The 140,232 bp pEC302/04 is a multireplicon plasmid that bears three replication systems (FII, FIA and FIB with subtype of F2:A1:B1. The plasmid is self-transmissible with a complete transfer region. pEC302/04 also carries antibiotic resistance genes such as blaTEM-1 and a class I integron containing sul1, cml and aadA resistance genes, conferring multidrug resistance (MDR to its host, E. coli EC302/04. Besides, two iron acquisition systems (SitABCD and IutA-IucABCD which are the conserved virulence determinants of ExPEC-colicin V or B and M (ColV/ColBM-producing plasmids were identified in pEC302/04. Multiple toxin-antitoxin (TA-based addiction systems (i.e., PemI/PemK, VagC/VagD, CcdA/CcdB, and Hok/Sok and a plasmid partitioning system, ParAB and PsiAB, which are important for plasmid maintenance were also found.Comparative plasmid analysis revealed only one conserved gene, the repA1 as the core genome, showing that there is an extensive diversity among the IncFIIA plasmids. The phylogenetic relationship of 18 IncF plasmids based on the core regions revealed that ColV/ColBM-plasmids and non-ColV/ColBM plasmids were separated into two distinct groups. These plasmids, which carry highly diverse genetic contents, are also mosaic in nature. The atypical combination of genetic materials, i.e., the MDR- and ColV/ColBM-plasmid-virulence encoding regions in a single ExPEC plasmid is rare but of

  17. The Complete Sequence and Comparative Analysis of a Multidrug-Resistance and Virulence Multireplicon IncFII Plasmid pEC302/04 from an Extraintestinal Pathogenic Escherichia coli EC302/04 Indicate Extensive Diversity of IncFII Plasmids.

    Science.gov (United States)

    Ho, Wing Sze; Yap, Kien-Pong; Yeo, Chew Chieng; Rajasekaram, Ganeswrie; Thong, Kwai Lin

    2015-01-01

    Extraintestinal pathogenic Escherichia coli (ExPEC) that causes extraintestinal infections often harbor plasmids encoding fitness traits such as resistance and virulence determinants that are of clinical importance. We determined the complete nucleotide sequence of plasmid pEC302/04 from a multidrug-resistant E. coli EC302/04 which was isolated from the tracheal aspirate of a patient in Malaysia. In addition, we also performed comparative sequence analyses of 18 related IncFIIA plasmids to determine the phylogenetic relationship and diversity of these plasmids. The 140,232 bp pEC302/04 is a multireplicon plasmid that bears three replication systems (FII, FIA, and FIB) with subtype of F2:A1:B1. The plasmid is self-transmissible with a complete transfer region. pEC302/04 also carries antibiotic resistance genes such as bla TEM-1 and a class I integron containing sul1, cml and aadA resistance genes, conferring multidrug resistance (MDR) to its host, E. coli EC302/04. Besides, two iron acquisition systems (SitABCD and IutA-IucABCD) which are the conserved virulence determinants of ExPEC-colicin V or B and M (ColV/ColBM)-producing plasmids were identified in pEC302/04. Multiple toxin-antitoxin (TA)-based addiction systems (i.e., PemI/PemK, VagC/VagD, CcdA/CcdB, and Hok/Sok) and a plasmid partitioning system, ParAB, and PsiAB, which are important for plasmid maintenance were also found. Comparative plasmid analysis revealed only one conserved gene, the repA1 as the core genome, showing that there is an extensive diversity among the IncFIIA plasmids. The phylogenetic relationship of 18 IncF plasmids based on the core regions revealed that ColV/ColBM-plasmids and non-ColV/ColBM plasmids were separated into two distinct groups. These plasmids, which carry highly diverse genetic contents, are also mosaic in nature. The atypical combination of genetic materials, i.e., the MDR- and ColV/ColBM-plasmid-virulence encoding regions in a single ExPEC plasmid is rare but of clinical

  18. Minimal and contributing sequence determinants of the cis-acting locus of transfer (clt) of streptomycete plasmid pIJ101 occur within an intrinsically curved plasmid region.

    Science.gov (United States)

    Ducote, M J; Prakash, S; Pettis, G S

    2000-12-01

    Efficient interbacterial transfer of streptomycete plasmid pIJ101 requires the pIJ101 tra gene, as well as a cis-acting plasmid function known as clt. Here we show that the minimal pIJ101 clt locus consists of a sequence no greater than 54 bp in size that includes essential inverted-repeat and direct-repeat sequences and is located in close proximity to the 3' end of the korB regulatory gene. Evidence that sequences extending beyond the minimal locus and into the korB open reading frame influence clt transfer function and demonstration that clt-korB sequences are intrinsically curved raise the possibility that higher-order structuring of DNA and protein within this plasmid region may be an inherent feature of efficient pIJ101 transfer.

  19. Spontaneous mutability and light-induced mutagenesis in Salmonella typhimurium: effects of an R-plasmid

    International Nuclear Information System (INIS)

    Valdivia, L.

    1979-01-01

    The UV-protecting plasmid R46 was transferred by conjugation to a genetically marked mouse-virulent Salmonella typhimurium strain, not derived from LT2; in this host the plasmid conferred UV protection and enhanced UV mutagenesis just as it does in LT2 lines. Tra - derivatives of R46 encountered during transduction retained UV-protecting and mutagenesis-enhancing ability. Stored strains carrying the R46-derived plasmids with strong mutator effect but not UV-protecting had lost most of their original streptomycin resistance but were slightly resistant to spectinomycin; attempts to transfer such plasmids failed. R46 enhanced the weak mutagenic effect of visible light on several his and trp mutants of strain LT2, including some whose frequency of spontaneous reversion was not increased by the plasmid. A mutagenic effect was produced by visible-light irradiation of hisG46(R46), either growing cells or nonmultiplying (histidine-deprived cells at 10 0 C). Presence of catalase or cyanide during irradiation did not prevent mutagenesis, which excludes some hypothetical mechanisms. Visible-light irradiation of hisG46 or hisG46(R46) under strict anaerobiosis had little or no mutagenic effect (controls showed that revertants if produced would have been detected). This is as expected if visible-light irradiation in air causes photodynamic damage to DNA and mutations are produced during error-prone, plasmid-enhanced repair

  20. Genetic diversity of Xanthomonas axonopodis pv. citri based on plasmid profile and pulsed field gel electrophoresis

    Directory of Open Access Journals (Sweden)

    Carvalho Flávia Maria de Souza

    2005-01-01

    Full Text Available Xanthomonas axonopodis pv. citri strains that cause disease in citrus were investigated by pulsed field and plasmid profile analysis. For the first method, genomic DNA was digested by the rare-cutting enzymes Xba I and Vsp I. The strains evaluated were collected in seven different States of Brazil and in Argentina, Bolivia, Paraguay and Uruguay. Genetic variability was found among strains of X. axonopodis pv. citri from different geographical areas Argentina, Bolivia and Uruguay, with similarities varying from 0.62 to 0.83. However, the strains collected in Brazil, despite being from different States, have shown a genetic similarity ranging from 0.83 to 1.00. Cluster analysis showed a relationship between genomic similarity and geographical origin of the strains. Plasmids were observed in all strains, with a total of five different plasmids, with sizes between 57.7 and 83.0 kilobases. The 72.6 kb plasmid was the most frequent, present in 15 out of 22 strains, while the 68.1 kb plasmid was observed in two strains only. Although the plasmid diversity detected in the present study was not very great, the X. axonopodis pv. citri strains evaluated showed a considerable degree of diversity with regard to this extrachromosomal genetic element.

  1. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  2. Two-step method for curing Escherichia coli of ColE1-derived plasmids

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne

    2008-01-01

    To cure Escherichia coli for plasmids derived from the ColE1 replicon advantage is taken of the fact that maintenance of this replicon requires a wild-type allele of polA, encoding DNA polymerase I. Curing is achieved by cotransduction of a mutant polA allele with metE::Tn10, fadAB::Tn10 or other...

  3. Characterization of new plasmids from methylotrophic bacteria.

    Science.gov (United States)

    Brenner, V; Holubová, I; Benada, O; Hubácek, J

    1991-07-01

    Several tens of methanol-utilizing bacterial strains isolated from soil were screened for the presence of plasmids. From the obligate methylotroph Methylomonas sp. strain R103a plasmid pIH36 (36 kb) was isolated and its restriction map was constructed. In pink-pigmented facultative methylotrophs (PPFM), belonging to the genus Methylobacterium four plasmids were detected: plasmids pIB200 (200 kb) and pIB14 (14 kb) in the strain R15d and plasmids pWU14 (14 kb) and pWU7 (7.8 kb) in the strain M17. Because of the small size and the presence of several unique REN sites (HindIII, EcoRI, NcoI), plasmid pWU7 was chosen for the construction of a vector for cloning in methylotrophs. Cointegrates pKWU7A and pKWU7B were formed between pWU7 and the E. coli plasmid pK19 Kmr, which were checked for conjugative transfer from E. coli into the methylotrophic host.

  4. The porcine circovirus type 1 capsid gene promoter improves antigen expression and immunogenicity in a HIV-1 plasmid vaccine

    Directory of Open Access Journals (Sweden)

    Burger Marieta

    2011-02-01

    Full Text Available Abstract Background One of the promising avenues for development of vaccines against Human immunodeficiency virus type 1 (HIV-1 and other human pathogens is the use of plasmid-based DNA vaccines. However, relatively large doses of plasmid must be injected for a relatively weak response. We investigated whether genome elements from Porcine circovirus type 1 (PCV-1, an apathogenic small ssDNA-containing virus, had useful expression-enhancing properties that could allow dose-sparing in a plasmid vaccine. Results The linearised PCV-1 genome inserted 5' of the CMV promoter in the well-characterised HIV-1 plasmid vaccine pTHgrttnC increased expression of the polyantigen up to 2-fold, and elicited 3-fold higher CTL responses in mice at 10-fold lower doses than unmodified pTHgrttnC. The PCV-1 capsid gene promoter (Pcap alone was equally effective. Enhancing activity was traced to a putative composite host transcription factor binding site and a "Conserved Late Element" transcription-enhancing sequence previously unidentified in circoviruses. Conclusions We identified a novel PCV-1 genome-derived enhancer sequence that significantly increased antigen expression from plasmids in in vitro assays, and improved immunogenicity in mice of the HIV-1 subtype C vaccine plasmid, pTHgrttnC. This should allow significant dose sparing of, or increased responses to, this and other plasmid-based vaccines. We also report investigations of the potential of other circovirus-derived sequences to be similarly used.

  5. Two highly divergent lineages of exfoliative toxin B-encoding plasmids revealed in impetigo strains of Staphylococcus aureus.

    Science.gov (United States)

    Botka, Tibor; Růžičková, Vladislava; Svobodová, Karla; Pantůček, Roman; Petráš, Petr; Čejková, Darina; Doškař, Jiří

    2017-09-01

    Exfoliative toxin B (ETB) encoded by some large plasmids plays a crucial role in epidermolytic diseases caused by Staphylococcus aureus. We have found as yet unknown types of etb gene-positive plasmids isolated from a set of impetigo strains implicated in outbreaks of pemphigus neonatorum in Czech maternity hospitals. Plasmids from the strains of clonal complex CC121 were related to archetypal plasmid pETB TY4 . Sharing a 33-kb core sequence including virulence genes for ETB, EDIN C, and lantibiotics, they were assigned to a stand-alone lineage, named pETB TY4 -based plasmids. Differing from each other in the content of variable DNA regions, they formed four sequence types. In addition to them, a novel unique plasmid pETB608 isolated from a strain of ST130 was described. Carrying conjugative cluster genes, as well as new variants of etb and edinA genes, pETB608 could be regarded as a source of a new lineage of ETB plasmids. We have designed a helpful detection assay, which facilitates the precise identification of the all described types of ETB plasmids. Copyright © 2017 Elsevier GmbH. All rights reserved.

  6. STRUCTURAL AND FUNCTIONAL-ANALYSIS OF THE SINGLE-STRAND ORIGIN OF REPLICATION FROM THE LACTOCOCCAL PLASMID PWVO1

    NARCIS (Netherlands)

    SEEGERS, JFML; ZHAO, AC; MEIJER, WJJ; KHAN, SA; VENEMA, G; BRON, S

    1995-01-01

    The single-strand origin (SSO) of the rolling-circle (RC), broad-host-range lactococcal plasmid pWVO1 was functionally characterized. The activity of this SSO in the conversion of single-stranded DNA to double-stranded DNA was tested both in vivo and in vitro. In addition, the effect of this SSO on

  7. Transformation of Saccharomyces cerevisiae with UV-irradiated single-stranded plasmid.

    Science.gov (United States)

    Zgaga, Z

    1991-08-01

    UV-irradiated single-stranded replicative plasmids were used to transform different yeast strains. The low doses of UV used in this study (10-75 J/m2) caused a significant decrease in the transforming efficiency of plasmid DNA in the Rad+ strain, while they had no effect on transformation with double-stranded plasmids of comparable size. Neither the rev3 mutation, nor the rad18 or rad52 mutations influenced the efficiency of transformation with irradiated single-stranded plasmid. However, it was found to be decreased in the double rev3 rad52 mutant. Extracellular irradiation of plasmid that contains both URA3 and LEU2 genes (psLU) gave rise to up to 5% Leu- transformants among selected Ura+ ones in the repair-proficient strain. Induction of Leu- transformants was dose-dependent and only partially depressed in the rev3 mutant. These results suggest that both mutagenic and recombinational repair processes operate on UV-damaged single-stranded DNA in yeast.

  8. Protein-Nanocrystal Conjugates Support a Single Filament Polymerization Model in R1 Plasmid Segregation

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Charina L.; Claridge, Shelley A.; Garner, Ethan C.; Alivisatos, A. Paul; Mullins, R. Dyche

    2008-07-15

    To ensure inheritance by daughter cells, many low-copy number bacterial plasmids, including the R1 drug-resistance plasmid, encode their own DNA segregation systems. The par operon of plasmid R1 directs construction of a simple spindle structure that converts free energy of polymerization of an actin-like protein, ParM, into work required to move sister plasmids to opposite poles of rod-shaped cells. The structures of individual components have been solved, but little is known about the ultrastructure of the R1 spindle. To determine the number of ParM filaments in a minimal R1 spindle, we used DNA-gold nanocrystal conjugates as mimics of the R1 plasmid. Wefound that each end of a single polar ParM filament binds to a single ParR/parC-gold complex, consistent with the idea that ParM filaments bind in the hollow core of the ParR/parC ring complex. Our results further suggest that multifilament spindles observed in vivo are associated with clusters of plasmidssegregating as a unit.

  9. Characterization of plasmids in a human clinical strain of Lactococcus garvieae.

    Directory of Open Access Journals (Sweden)

    Mónica Aguado-Urda

    Full Text Available The present work describes the molecular characterization of five circular plasmids found in the human clinical strain Lactococcus garvieae 21881. The plasmids were designated pGL1-pGL5, with molecular sizes of 4,536 bp, 4,572 bp, 12,948 bp, 14,006 bp and 68,798 bp, respectively. Based on detailed sequence analysis, some of these plasmids appear to be mosaics composed of DNA obtained by modular exchange between different species of lactic acid bacteria. Based on sequence data and the derived presence of certain genes and proteins, the plasmid pGL2 appears to replicate via a rolling-circle mechanism, while the other four plasmids appear to belong to the group of lactococcal theta-type replicons. The plasmids pGL1, pGL2 and pGL5 encode putative proteins related with bacteriocin synthesis and bacteriocin secretion and immunity. The plasmid pGL5 harbors genes (txn, orf5 and orf25 encoding proteins that could be considered putative virulence factors. The gene txn encodes a protein with an enzymatic domain corresponding to the family actin-ADP-ribosyltransferases toxins, which are known to play a key role in pathogenesis of a variety of bacterial pathogens. The genes orf5 and orf25 encode two putative surface proteins containing the cell wall-sorting motif LPXTG, with mucin-binding and collagen-binding protein domains, respectively. These proteins could be involved in the adherence of L. garvieae to mucus from the intestine, facilitating further interaction with intestinal epithelial cells and to collagenous tissues such as the collagen-rich heart valves. To our knowledge, this is the first report on the characterization of plasmids in a human clinical strain of this pathogen.

  10. Development of a self-replicating plasmid system for Mycoplasma hyopneumoniae.

    Science.gov (United States)

    Maglennon, Gareth A; Cook, Beth S; Matthews, Dominic; Deeney, Alannah S; Bossé, Janine T; Langford, Paul R; Maskell, Duncan J; Tucker, Alexander W; Wren, Brendan W; Rycroft, Andrew N

    2013-07-29

    Mycoplasma hyopneumoniae is a prevalent swine respiratory pathogen that is a major cause of economic loss to pig producers. Control is achieved by a combination of antimicrobials, vaccination and management practices, but current vaccines offer only partial control and there is a need for improved preventative strategies. A major barrier to advances in understanding the pathogenesis of M. hyopneumoniae and in developing new vaccines is the lack of tools to genetically manipulate the organism. We describe the development and optimisation of the first successful plasmid-based system for the genetic manipulation of M. hyopneumoniae. Our artificial plasmids contain the origin of replication (oriC) of M. hyopneumoniae along with tetM, conferring resistance to tetracycline. With these plasmids, we have successfully transformed M. hyopneumoniae strain 232 by electroporation, generating tetracycline resistant organisms. The persistence of extrachromosomal plasmid and maintenance of plasmid DNA over serial passages shows that these artificial plasmids are capable of self-replication in M. hyopneumoniae. In addition to demonstrating the amenability of M. hyopneumoniae to genetic manipulation and in optimising the conditions necessary for successful transformation, we have used this system to determine the minimum functional oriC of M. hyopneumoniae. In doing so, we have developed a plasmid with a small oriC that is stably maintained over multiple passages that may be useful in generating targeted gene disruptions. In conclusion, we have generated a set of plasmids that will be valuable in studies of M. hyopneumoniae pathogenesis and provide a major step forward in the study of this important swine pathogen.

  11. Cloning of regions required for contact hemolysis and entry into LLC-MK2 cells from Shigella sonnei form I plasmid: virF is a positive regulator gene for these phenotypes.

    OpenAIRE

    Kato, J; Ito, K; Nakamura, A; Watanabe, H

    1989-01-01

    Two distinct regions required for both contact hemolysis and entry into LLC-MK2 cells were cloned into Escherichia coli from the Shigella sonnei form I plasmid, pSS120. The first region was cloned into an E. coli HB101 strain containing noninvasive Tn1 insertion mutants of the form I plasmid, and expression of ipa (invasion plasmid antigen) gene products was restored. The plasmid carrying the first region was then transformed into E. coli lacking the form I plasmid, and additional DNA fragmen...

  12. The cryptic plasmid is more important for Chlamydia muridarum to colonize the mouse gastrointestinal tract than to infect the genital tract.

    Directory of Open Access Journals (Sweden)

    Lili Shao

    Full Text Available Chlamydia has been detected in the gastrointestinal tracts of both animals and humans. However, the mechanism by which Chlamydia colonizes the gut remains unclear. Chlamydia muridarum is known to spread from the genital to the gastrointestinal tracts hematogenously. The C. muridarum plasmid is a key pathogenic determinant in the mouse upper genital tract although plasmid-deficient C. muridarum is still able to colonize the upper genital tract. We now report that plasmid-deficient C. muridarum exhibits significantly delayed/reduced spreading from the mouse genital to the gastrointestinal tracts. C. muridarum with or without plasmid maintained similar levels in the mouse circulatory system following intravenous inoculation but the hematogenous plasmid-deficient C. muridarum was significantly less efficient in colonizing the gastrointestinal tract. Consistently, plasmid-deficient C. muridarum failed to restore normal colonization in the gastrointestinal tract even after intragastric inoculation at a high dose. Thus, we have demonstrated a plasmid-dependent colonization of C. muridarum in the gastrointestinal tract, supporting the concept that C. muridarum may have acquired the plasmid for adaptation to the mouse gastrointestinal tract during oral-fecal transmission. Since the plasmid is more important for C. muridarum to colonize the gastrointestinal tract than to infect the genital tract, the current study has laid a foundation for further defining the host pathways targeted by the plasmid-encoded or -regulated chlamydial effectors.

  13. A conjugative 38 kB plasmid is present in multiple subspecies of Xylella fastidiosa.

    Science.gov (United States)

    Rogers, Elizabeth E; Stenger, Drake C

    2012-01-01

    A ≈ 38kB plasmid (pXF-RIV5) was present in the Riv5 strain of Xylella fastidiosa subsp. multiplex isolated from ornamental plum in southern California. The complete nucleotide sequence of pXF-RIV5 is almost identical to that of pXFAS01 from X. fastidiosa subsp. fastidiosa strain M23; the two plasmids vary at only 6 nucleotide positions. BLAST searches and phylogenetic analyses indicate pXF-RIV5 and pXFAS01 share some similarity to chromosomal and plasmid (pXF51) sequences of X. fastidiosa subsp. pauca strain 9a5c and more distant similarity to plasmids from a wide variety of bacteria. Both pXF-RIV5 and pXFAS01 encode homologues of a complete Type IV secretion system involved in conjugation and DNA transfer among bacteria. Mating pair formation proteins (Trb) from Yersinia pseudotuberculosis IP31758 are the mostly closely related non-X. fastidiosa proteins to most of the Trb proteins encoded by pXF-RIV5 and pXFAS01. Unlike many bacterial conjugative plasmids, pXF-RIV5 and pXFAS01 do not carry homologues of known accessory modules that confer selective advantage on host bacteria. However, both plasmids encode seven hypothetical proteins of unknown function and possess a small transposon-associated region encoding a putative transposase and associated factor. Vegetative replication of pXF-RIV5 and pXFAS01 appears to be under control of RepA protein and both plasmids have an origin of DNA replication (oriV) similar to that of pRP4 and pR751 from Escherichia coli. In contrast, conjugative plasmids commonly encode TrfA and have an oriV similar to those found in IncP-1 incompatibility group plasmids. The presence of nearly identical plasmids in single strains from two distinct subspecies of X. fastidiosa is indicative of recent horizontal transfer, probably subsequent to the introduction of subspecies fastidiosa to the United States in the late 19(th) century.

  14. A conjugative 38 kB plasmid is present in multiple subspecies of Xylella fastidiosa.

    Directory of Open Access Journals (Sweden)

    Elizabeth E Rogers

    Full Text Available A ≈ 38kB plasmid (pXF-RIV5 was present in the Riv5 strain of Xylella fastidiosa subsp. multiplex isolated from ornamental plum in southern California. The complete nucleotide sequence of pXF-RIV5 is almost identical to that of pXFAS01 from X. fastidiosa subsp. fastidiosa strain M23; the two plasmids vary at only 6 nucleotide positions. BLAST searches and phylogenetic analyses indicate pXF-RIV5 and pXFAS01 share some similarity to chromosomal and plasmid (pXF51 sequences of X. fastidiosa subsp. pauca strain 9a5c and more distant similarity to plasmids from a wide variety of bacteria. Both pXF-RIV5 and pXFAS01 encode homologues of a complete Type IV secretion system involved in conjugation and DNA transfer among bacteria. Mating pair formation proteins (Trb from Yersinia pseudotuberculosis IP31758 are the mostly closely related non-X. fastidiosa proteins to most of the Trb proteins encoded by pXF-RIV5 and pXFAS01. Unlike many bacterial conjugative plasmids, pXF-RIV5 and pXFAS01 do not carry homologues of known accessory modules that confer selective advantage on host bacteria. However, both plasmids encode seven hypothetical proteins of unknown function and possess a small transposon-associated region encoding a putative transposase and associated factor. Vegetative replication of pXF-RIV5 and pXFAS01 appears to be under control of RepA protein and both plasmids have an origin of DNA replication (oriV similar to that of pRP4 and pR751 from Escherichia coli. In contrast, conjugative plasmids commonly encode TrfA and have an oriV similar to those found in IncP-1 incompatibility group plasmids. The presence of nearly identical plasmids in single strains from two distinct subspecies of X. fastidiosa is indicative of recent horizontal transfer, probably subsequent to the introduction of subspecies fastidiosa to the United States in the late 19(th century.

  15. Plasmid profilling and similarities in identities of probable microbes isolated from crude oil contaminated agricultural soil

    Directory of Open Access Journals (Sweden)

    Toochukwu Ekwutosi OGBULIE

    2013-05-01

    Full Text Available Plasmid analysis of bacteria isolated from agricultural soil experimentally contaminated with crude oil was carried out and the resultant bands’ depicting the different molecular sizes of the plasmid DNA molecules per isolate was obtained. There was no visible band observed for Klebsiella indicating that the organism lack plasmid DNA that confers degradative ability to it, possibly the gene could be borne on the chromosomal DNA which enabled its persistence in the polluted soil. Molecular characterization was undertaken to confirm the identities of the possible microorganisms that may be present in crude oil-contaminated soil. The result of the DNA extracted and amplified in a PCR using EcoRI and EcoRV restriction enzymes for cutting the DNA of the bacterial cells indicated no visible band for cuts made with EcoRV restriction enzyme showing that the enzyme is not specific for bacterial DNA of isolates in the samples, hence there was no amplification. By contrast though, visible bands of amplicons were observed using EcoRI restriction enzymes. The resultant visible bands of microbial profile obtained using the universal RAPD primer with nucleotide sequence of 5’—CTC AAA GCA TCT AGG TCC A---3’ showed that only Pseudomonas fluorescens and Bacillus mycoides had visible bands at identical position on the gel indicating that both species possibly had identical sequence or genes of negligible differences coding for degradation of hydrocarbons as shown by similar values in molecular weight and positions in the gel electrophoresis field.

  16. Comparative symbiotic plasmid analysis indicates that symbiosis gene ancestor type affects plasmid genetic evolution.

    Science.gov (United States)

    Wang, X; Zhao, L; Zhang, L; Wu, Y; Chou, M; Wei, G

    2018-07-01

    Rhizobial symbiotic plasmids play vital roles in mutualistic symbiosis with legume plants by executing the functions of nodulation and nitrogen fixation. To explore the gene composition and genetic constitution of rhizobial symbiotic plasmids, comparison analyses of 24 rhizobial symbiotic plasmids derived from four rhizobial genera was carried out. Results illustrated that rhizobial symbiotic plasmids had higher proportion of functional genes participating in amino acid transport and metabolism, replication; recombination and repair; carbohydrate transport and metabolism; energy production and conversion and transcription. Mesorhizobium amorphae CCNWGS0123 symbiotic plasmid - pM0123d had similar gene composition with pR899b and pSNGR234a. All symbiotic plasmids shared 13 orthologous genes, including five nod and eight nif/fix genes which participate in the rhizobia-legume symbiosis process. These plasmids contained nod genes from four ancestors and fix genes from six ancestors. The ancestral type of pM0123d nod genes was similar with that of Rhizobium etli plasmids, while the ancestral type of pM0123d fix genes was same as that of pM7653Rb. The phylogenetic trees constructed based on nodCIJ and fixABC displayed different topological structures mainly due to nodCIJ and fixABC ancestral type discordance. The study presents valuable insights into mosaic structures and the evolution of rhizobial symbiotic plasmids. This study compared 24 rhizobial symbiotic plasmids that included four genera and 11 species, illuminating the functional gene composition and symbiosis gene ancestor types of symbiotic plasmids from higher taxonomy. It provides valuable insights into mosaic structures and the evolution of symbiotic plasmids. © 2018 The Society for Applied Microbiology.

  17. A plasmid containing the human metallothionein II gene can function as an antibody-assisted electrophoretic biosensor for heavy metals.

    Science.gov (United States)

    Wooten, Dennis C; Starr, Clarise R; Lyon, Wanda J

    2016-01-01

    Different forms of heavy metals affect biochemical systems in characteristic ways that cannot be detected with typical metal analysis methods like atomic absorption spectrometry. Further, using living systems to analyze interaction of heavy metals with biochemical systems can be laborious and unreliable. To generate a reliable easy-to-use biologically-based biosensor system, the entire human metallothionein-II (MT-II) gene was incorporated into a plasmid (pUC57-MT) easily replicated in Escherichia coli. In this system, a commercial polyclonal antibody raised against human metal-responsive transcription factor-1 protein (MTF-1 protein) could modify the electrophoretic migration patterns (i.e. cause specific decreases in agarose gel electrophoretic mobility) of the plasmid in the presence or absence of heavy metals other than zinc (Zn). In the study here, heavy metals, MTF-1 protein, and polyclonal anti-MTF-1 antibody were used to assess pUC57-MT plasmid antibody-assisted electrophoretic mobility. Anti-MTF-1 antibody bound both MTF-1 protein and pUC57-MT plasmid in a non-competitive fashion such that it could be used to differentiate specific heavy metal binding. The results showed that antibody-inhibited plasmid migration was heavy metal level-dependent. Zinc caused a unique mobility shift pattern opposite to that of other metals tested, i.e. Zn blocked the antibody ability to inhibit plasmid migration, despite a greatly increased affinity for DNA by the antibody when Zn was present. The Zn effect was reversed/modified by adding MTF-1 protein. Additionally, antibody inhibition of plasmid mobility was resistant to heat pre-treatment and trypsinization, indicating absence of residual DNA extraction-resistant bacterial DNA binding proteins. DNA binding by anti-DNA antibodies may be commonly enhanced by xenobiotic heavy metals and elevated levels of Zn, thus making them potentially effective tools for assessment of heavy metal bioavailability in aqueous solutions and

  18. Cloning, sequencing, and sequence analysis of two novel plasmids from the thermophilic anaerobic bacterium Anaerocellum thermophilum

    DEFF Research Database (Denmark)

    Clausen, Anders; Mikkelsen, Marie Just; Schrøder, I.

    2004-01-01

    The nucleotide sequence of two novel plasmids isolated from the extreme thermophilic anaerobic bacterium Anaerocellum thermophilum DSM6725 (A. thermophilum), growing optimally at 70degreesC, has been determined. pBAS2 was found to be a 3653 bp plasmid with a GC content of 43%, and the sequence re...... with highest similarity to DNA repair protein from Campylobacter jejuni (25% aa). Orf34 showed similarity to sigma factors with highest similarity (28% aa) to the sporulation specific Sigma factor, Sigma 28(K) from Bacillus thuringiensis....

  19. Plasmid-mediated mineralization of 4-chlorobiphenyl

    International Nuclear Information System (INIS)

    Shields, M.S.; Hooper, S.W.; Sayler, G.S.

    1985-01-01

    Strains of Alcaligenes and Acinetobacter spp. were isolated from a mixed culture already proven to be proficient at complete mineralization of monohalogenated biphenyls. These strains were shown to harbor a 35 x 10(6)-dalton plasmid mediating a complete pathway for 4-chlorobiphenyl (4CB) oxidation. Subsequent plasmid curing of these bacteria resulted in the abolishment of the 4CB mineralization phenotype and loss of even early 4CB metabolism by Acinetobacter spp. Reestablishment of the Alcaligenes plasmid, denoted pSS50, in the cured Acinetobacter spp. via filter surface mating resulted in the restoration of 4CB mineralization abilities. 4CB mineralization, however, proved to be an unstable characteristic in some subcultured strains. Such loss was not found to coincide with any detectable alteration in plasmid size. Cultures capable of complete mineralization, as well as those limited to partial metabolism of 4CB, produced 4-chlorobenzoate as a metabolite. Demonstration of mineralization of a purified 14 C-labeled chlorobenzoate showed it to be a true intermediate in 4CB mineralization. Unlike the mineralization capability, the ability to produce a metabolite has proven to be stable on subculture. These results indicate the occurrence of a novel plasmid, or evolved catabolic plasmid, that mediates the complete mineralization of 4CB

  20. The partitioning and copy number control systems of the selfish yeast plasmid: an optimized molecular design for stable persistence in host cells.

    Science.gov (United States)

    Yen-Ting-Liu; Sau, Saumitra; Ma, Chien-Hui; Kachroo, Aashiq H; Rowley, Paul A; Chang, Keng-Ming; Fan, Hsiu-Fang; Jayaram, Makkuni

    2014-10-01

    The multi-copy 2 micron plasmid of Saccharomyces cerevisiae, a resident of the nucleus, is remarkable for its high chromosome-like stability. The plasmid does not appear to contribute to the fitness of the host, nor does it impose a significant metabolic burden on the host at its steady state copy number. The plasmid may be viewed as a highly optimized selfish DNA element whose genome design is devoted entirely towards efficient replication, equal segregation and copy number maintenance. A partitioning system comprised of two plasmid coded proteins, Rep1 and Rep2, and a partitioning locus STB is responsible for equal or nearly equal segregation of plasmid molecules to mother and daughter cells. Current evidence supports a model in which the Rep-STB system promotes the physical association of the plasmid with chromosomes and thus plasmid segregation by a hitchhiking mechanism. The Flp site-specific recombination system housed by the plasmid plays a critical role in maintaining steady state plasmid copy number. A decrease in plasmid population due to rare missegregation events is rectified by plasmid amplification via a recombination induced rolling circle replication mechanism. Appropriate plasmid amplification, without runaway increase in copy number, is ensured by positive and negative regulation of FLP gene expression by plasmid coded proteins and by the control of Flp level/activity through host mediated post-translational modification(s) of Flp. The Flp system has been successfully utilized to understand mechanisms of site-specific recombination, to bring about directed genetic alterations for addressing fundamental problems in biology, and as a tool in biotechnological applications.

  1. Effect of 8-MOP plus treatment on survival and repair of plasmid pBR322

    International Nuclear Information System (INIS)

    Bauluz, C.; Vidania, R.

    1992-01-01

    We have studied the lethality produced in pBR322 DNA after PUVA treatment (8-MOP+UVA). As recipients, we used a collection of E. coli strains differing in their repair capacities and analysed the involvement of several DNA repair pathways in the removal of plasmid lesions. We have also studied the effect of UVA radiation alone, in order to determine more precisely the effect attributable only to psoralen molecules. Results showed a strong lethal effect derived from PUVA treatment; however, some plasmid recovery was achieved in bacterial hosts proficient in Excision repair and SOS repair. another repair pathway, only detectable at high density of lesions, appeared to be relevant for the removal of 8-MOP:DNA adducts. (author)

  2. Transmission of the PabI family of restriction DNA glycosylase genes: mobility and long-term inheritance.

    Science.gov (United States)

    Kojima, Kenji K; Kobayashi, Ichizo

    2015-10-19

    R.PabI is an exceptional restriction enzyme that functions as a DNA glycosylase. The enzyme excises an unmethylated base from its recognition sequence to generate apurinic/apyrimidinic (AP) sites, and also displays AP lyase activity, cleaving the DNA backbone at the AP site to generate the 3'-phospho alpha, beta-unsaturated aldehyde end in addition to the 5'-phosphate end. The resulting ends are difficult to religate with DNA ligase. The enzyme was originally isolated in Pyrococcus, a hyperthermophilic archaeon, and additional homologs subsequently identified in the epsilon class of the Gram-negative bacterial phylum Proteobacteria, such as Helicobacter pylori. Systematic analysis of R.PabI homologs and their neighboring genes in sequenced genomes revealed co-occurrence of R.PabI with M.PabI homolog methyltransferase genes. R.PabI and M.PabI homolog genes are occasionally found at corresponding (orthologous) loci in different species, such as Helicobacter pylori, Helicobacter acinonychis and Helicobacter cetorum, indicating long-term maintenance of the gene pair. One R.PabI and M.PabI homolog gene pair is observed immediately after the GMP synthase gene in both Campylobacter and Helicobacter, representing orthologs beyond genera. The mobility of the PabI family of restriction-modification (RM) system between genomes is evident upon comparison of genomes of sibling strains/species. Analysis of R.PabI and M.PabI homologs in H. pylori revealed an insertion of integrative and conjugative elements (ICE), and replacement with a gene of unknown function that may specify a membrane-associated toxin (hrgC). In view of the similarity of HrgC with toxins in type I toxin-antitoxin systems, we addressed the biological significance of this substitution. Our data indicate that replacement with hrgC occurred in the common ancestor of hspAmerind and hspEAsia. Subsequently, H. pylori with and without hrgC were intermixed at this locus, leading to complex distribution of hrgC in East

  3. Construction and Identification of a Recombinant Plasmid Encoding Echinococcus granulosus Oncosphere Antigen (EG95Abstract Background: Cystic echinococcosis (CE, as a zoonotic disease cause to health threat and economic losses. Despite implemented cont

    Directory of Open Access Journals (Sweden)

    Nahideh MAZAHERI

    2017-12-01

    Full Text Available AbstractBackground: Cystic echinococcosis (CE, as a zoonotic disease cause to health threat and economic losses. Despite implemented control programs, few countries have been able to decrease or eliminate this infection. Vaccination of the intermediate host offers an additional strategy to control the parasite transmission and EG95 antigen is considered more than the others in the vaccine issue. According to the high protection induced by the EG95 recombinant vaccine, this study was designed to construct recombinant plasmid formulation of EG95 antigen.Methods: In 2015, the Echinococcus granulosus eggs were recovered from an infected dog in Parasitological laboratory of Tarbiat Modares University in Tehran, Iran. Following hatching, the oncospheres of E. granulosus were activated to increase the presence of the desired mRNA. The extracted mRNA was transcribed to the cDNA which used as template in RT-PCR. Then the EG95 gene cloned into pET28a vector and the recombinant plasmids expression was  investigated in prokaryotic and eukaryotic cells.Results:  The recombinant plasmid encoding EG95 antigen was successfully constructed and identified by PCR, restriction enzyme digestion and sequencing. In vitro expression of the EG95 antigen was confirmed in prokary­otic and eukaryotic systems by SDS-PAGE and western blotting analysis.Conclusion: Because of potential advantages of DNA vaccines, including ability to induce long-term immune responses, low production cost and stability in different temperatures, this study carried out to construct the EG95 gene into a vector. This recombinant vector can be evaluated in further studies as a DNA vaccine may provide new prospects for the development of a vaccine against cystic hydatid disease.

  4. Quorum-Dependent Mannopine-Inducible Conjugative Transfer of an Agrobacterium Opine-Catabolic Plasmid

    Science.gov (United States)

    Wetzel, Margaret E.; Kim, Kun-Soo; Miller, Marilyn; Olsen, Gary J.

    2014-01-01

    The Ti plasmid in Agrobacterium tumefaciens strain 15955 carries two alleles of traR that regulate conjugative transfer. The first is a functional allele, called traR, that is transcriptionally induced by the opine octopine. The second, trlR, is a nonfunctional, dominant-negative mutant located in an operon that is inducible by the opine mannopine (MOP). Based on these findings, we predicted that there exist wild-type agrobacterial strains harboring plasmids in which MOP induces a functional traR and, hence, conjugation. We analyzed 11 MOP-utilizing field isolates and found five where MOP induced transfer of the MOP-catabolic element and increased production of the acyl-homoserine lactone (acyl-HSL) quormone. The transmissible elements in these five strains represent a set of highly related plasmids. Sequence analysis of one such plasmid, pAoF64/95, revealed that the 176-kb element is not a Ti plasmid but carries genes for catabolism of MOP, mannopinic acid (MOA), agropinic acid (AGA), and the agrocinopines. The plasmid additionally carries all of the genes required for conjugative transfer, including the regulatory genes traR, traI, and traM. The traR gene, however, is not located in the MOP catabolism region. The gene, instead, is monocistronic and located within the tra-trb-rep gene cluster. A traR mutant failed to transfer the plasmid and produced little to no quormone even when grown with MOP, indicating that TraRpAoF64/95 is the activator of the tra regulon. A traM mutant was constitutive for transfer and acyl-HSL production, indicating that the anti-activator function of TraM is conserved. PMID:24363349

  5. Breastfeeding and transmission of cytomegalovirus to preterm infants. Case report and kinetic of CMV-DNA in breast milk.

    Science.gov (United States)

    Chiavarini, Manuela; Bragetti, Patrizia; Sensini, Alessandra; Cenci, Elio; Castronari, Roberto; Rossi, Marta J; Fantauzzi, Ambra; Minelli, Liliana

    2011-01-19

    Breastfeeding has a major impact on CMV epidemiology. Postnatal CMV reactivation's incidence during lactation is nearby the maternal seroprevalence. Although perinatal CMV infection has practically no consequences in term newborn, it may cause, in some cases, a severe symptomatic disease in preterm newborns. The aims of the present study are to evaluate the rate and clinical expression of CMV infection breast milk transmitted in preterm infants and to check the safety of the freezing treated breast milk. The study included fifty-seven preterm infants and their CMV seropositive mothers. Fresh breast milk samples have been collected from 1(st) to 9(th) postpartum week. Both fresh breast milk and 72, 96, 120 hours frozen samples have been examined, checking the presence of CMV; urine samples have been tested too. 70.2% of tested mothers showed reactivation of the infection, and CMV-positive breast milk during the six weeks postpartum has been found. However, only one infant was infected by CMV, developing hepatic affection concomitantly with a multi-system involvement, as shown CMV DNA detection in urine, saliva, blood, gastric aspirate, and stools. Freezing breast milk at -20°C and pasteurization may respectively reduce or eliminate the viral load.

  6. Breastfeeding and transmission of cytomegalovirus to preterm infants. Case report and kinetic of CMV-DNA in breast milk

    Directory of Open Access Journals (Sweden)

    Rossi Marta J

    2011-01-01

    Full Text Available Abstract Background Breastfeeding has a major impact on CMV epidemiology. Postnatal CMV reactivation's incidence during lactation is nearby the maternal seroprevalence. Although perinatal CMV infection has practically no consequences in term newborn, it may cause, in some cases, a severe symptomatic disease in preterm newborns. The aims of the present study are to evaluate the rate and clinical expression of CMV infection breast milk transmitted in preterm infants and to check the safety of the freezing treated breast milk. Methods The study included fifty-seven preterm infants and their CMV seropositive mothers. Fresh breast milk samples have been collected from 1st to 9th postpartum week. Both fresh breast milk and 72, 96, 120 hours frozen samples have been examined, checking the presence of CMV; urine samples have been tested too. Results 70.2% of tested mothers showed reactivation of the infection, and CMV-positive breast milk during the six weeks postpartum has been found. However, only one infant was infected by CMV, developing hepatic affection concomitantly with a multi-system involvement, as shown CMV DNA detection in urine, saliva, blood, gastric aspirate, and stools. Conclusion Freezing breast milk at -20°C and pasteurization may respectively reduce or eliminate the viral load.

  7. Construction and expression of pEgr-sHemopexin recombinant plasmid induced by ionizing radiation in vitro

    International Nuclear Information System (INIS)

    Wang Guiquan; Jilin Univ., Changchun; Xu Chuanjie; Yang Wen; Piao Chunji; Dong Zhen

    2005-01-01

    Objective: To clone mouse secretable Hemopexin (sPEX) cDNA, construct pEgr-sPEX recombinant plasmid and detect the expression of recombinant plasmid in B16F10 cells. Methods: Hemopexin cDNA was amplified from the NIH3T3 cells by RT-PCR. After the cDNA identified by sequencing, the pEgr-sPEX recombinant plasmid was constructed and the plasmid was transfected into B16F10 cells with liposome and the expression of PEX induced by ionizing radiation in B16F10 cells was detected by Western blotting. Results: The sequencing results proved the cloned sPEX cDNA to be completely identical with that reported in the GenBank. The mouse sPEX cDNA was inserted correctly into expression vector and expressed successfully. Conclusion: The mouse sPEX cDNA is cloned successfully and it is confirmed that pEgr-sPEX possesses the radiation inducing expression characteristics in vitro. (authors)

  8. Characterization of Endogenous Plasmids from Lactobacillus salivarius UCC118▿ †

    Science.gov (United States)

    Fang, Fang; Flynn, Sarah; Li, Yin; Claesson, Marcus J.; van Pijkeren, Jan-Peter; Collins, J. Kevin; van Sinderen, Douwe; O'Toole, Paul W.

    2008-01-01

    The genome of Lactobacillus salivarius UCC118 comprises a 1.83-Mb chromosome, a 242-kb megaplasmid (pMP118), and two smaller plasmids of 20 kb (pSF118-20) and 44 kb (pSF118-44). Annotation and bioinformatic analyses suggest that both of the smaller plasmids replicate by a theta replication mechanism. Furthermore, it appears that they are transmissible, although neither possesses a complete set of conjugation genes. Plasmid pSF118-20 encodes a toxin-antitoxin system composed of pemI and pemK homologs, and this plasmid could be cured when PemI was produced in trans. The minimal replicon of pSF118-20 was determined by deletion analysis. Shuttle vector derivatives of pSF118-20 were generated that included the replication region (pLS203) and the replication region plus mobilization genes (pLS208). The plasmid pLS203 was stably maintained without selection in Lactobacillus plantarum, Lactobacillus fermentum, and the pSF118-20-cured derivative strain of L. salivarius UCC118 (strain LS201). Cloning in pLS203 of genes encoding luciferase and green fluorescent protein, and expression from a constitutive L. salivarius promoter, demonstrated the utility of this vector for the expression of heterologous genes in Lactobacillus. This study thus expands the knowledge base and vector repertoire of probiotic lactobacilli. PMID:18390685

  9. [Construction and identification of eukaryotic plasmid pGC-silencer-U6/Neo/GFP/ABCG2].

    Science.gov (United States)

    Yu, Yanping; Zhang, Song; Kong, Weijia

    2010-09-01

    To construct three short hairpin RNA (shRNA) interference expression plasmid vectors of human ABCG2 gene, to assay the expression of ABCG2 in a human nasopharyngeal carcinoma (NPC) cell line, CEN-2 cell line, and to detect the RNAi effect of shRNA. Targeting ABCG2 gene sequence, three plasmid expression vectors coding for shRNA and a control vector containing random DNA fragment were constructed. The recombinant plasmids were amplified in Ecoli. DH5 and then identified by restriction digestion, PCR and sequencing. The recombinant plasmids were transfected into CEN-2 cells. ABCG2 expression was assayed by real-time quantitative PCR and Western blot. The construction of pGC-silencer-U6/Neo/GFP/ABCG2 was succeed. The shRNA plasmids significantly down-regulated the ABCG2 expression in CEN-2 cells, at both mRNA level and protein level. Recombinant plasmid 1 had the strongest effect compared with plasmids 2 and 3 (P < 0.05), with an inhibition ratio of 75% at the mRNA level and 68% at the protein level. pGC-silencer-U6/Neo/GFP/ABCG2 has been successfully constructed and it can down-regulate ABCG2 expression after transfected into CEN-2 cells, which could help further studies of ABCG2 functions CEN-2 cell line and contribute to the NPC gene therapy.

  10. Adenoviral DNA replication: DNA sequences and enzymes required for initiation in vitro

    International Nuclear Information System (INIS)

    Stillman, B.W.; Tamanoi, F.

    1983-01-01

    In this paper evidence is provided that the 140,000-dalton DNA polymerase is encoded by the adenoviral genome and is required for the initiation of DNA replication in vitro. The DNA sequences in the template DNA that are required for the initiation of replication have also been identified, using both plasmid DNAs and synthetic oligodeoxyribonucleotides. 48 references, 7 figures, 1 table

  11. Molecular cloning and restriction analysis of EcoRI-fragments of Vicia faba rDNA

    International Nuclear Information System (INIS)

    Yakura, Kimitaka; Tanifuji, Shigeyuki.

    1983-01-01

    EcoRI-fragments of Vicia faba rDNA were cloned in plasmid pBR325. Southern blot hybridization of BamHI-digests of these cloned plasmids and Vicia genomic DNA led to the determination of relative positions of BamHI sites in the rDNA and the physical map that had been tentatively made is corrected. (author)

  12. Plasmid Mediated Antibiotic and Heavy Metal Resistance in Bacillus Strains Isolated From Soils in Rize, Turkey

    Directory of Open Access Journals (Sweden)

    Elif SEVİM

    2015-09-01

    Full Text Available Fifteen Bacillus strains which were isolated from soil samples were examined for resistance to 17 different antibiotics (ampicillin, methicillin, erythromycin, norfloxacin, cephalotine, gentamycin, ciprofloxacin, streptomycin, tobramycin, chloramphenicol, trimethoprim-sulfamethoxazole, tetracycline, vancomycin, oxacilin, neomycin, kanamycin and, novabiocin and to 10 different heavy metals (copper, lead, cobalt, chrome, iron, mercury, zinc, nickel, manganese and, cadmium and for the presence of plasmid DNA. A total of eleven strains (67% were resistant to at least one antibiotic. The most common resistance was observed against methicillin and oxacillin. The most resistance strains were found as Bacillus sp. B3 and Bacillus sp. B11. High heavy metal resistance against copper, chromium, zinc, iron and nickel was detected, but mercury and cobalt resistance was not detected, except for 3 strains (B3, B11, and B12 which showed mercury resistance. It has been determined that seven Bacillus strains have plasmids. The isolated plasmids were transformed into the Bacillus subtilis W168 and it was shown that heavy metal and antibiotic resistance determinants were carried on these plasmids. These results showed that there was a correlation between plasmid content and resistance for both antibiotic and heavy metal resistance

  13. Effect of degradative plasmid CAM-OCT on responses of Pseudomonas bacteria to UV light

    International Nuclear Information System (INIS)

    McBeth, D.L.

    1989-01-01

    The effect of plasmid CAM-OCT on responses to UV irradiation was compared in Pseudomonas aeruginosa, in Pseudomonas putida, and in Pseudomonas putida mutants carrying mutations in UV response genes. CAM-OCT substantially increased both survival and mutagenesis in the two species. P. aeruginosa strains without CAM-OCT exhibited much higher UV sensitivity than did P. putida strains. UV-induced mutagenesis of plasmid-free P. putida was easily detected in three different assays (two reversion assays and one forward mutation assay), whereas UV mutagenesis of P. aeruginosa without CAM-OCT was seen only in the forward mutation assay. These results suggest major differences in DNA repair between the two species and highlight the presence of error-prone repair functions on CAM-OCT. A number of P. putida mutants carrying chromosomal mutations affecting either survival or mutagenesis after UV irradiation were isolated, and the effect of CAM-OCT on these mutants was determined. All mutations producing a UV-sensitive phenotype in P. putida were fully suppressed by the plasmid, whereas the plasmid had a more variable effect on mutagenesis mutations, suppressing some and producing no suppression of others. On the basis of the results reported here and results obtained by others with plasmids carrying UV response genes, it appears that CAM-OCT may differ either in regulation or in the number and functions of UV response genes encoded

  14. Construction of pTM series plasmids for gene expression in Brucella species.

    Science.gov (United States)

    Tian, Mingxing; Qu, Jing; Bao, Yanqing; Gao, Jianpeng; Liu, Jiameng; Wang, Shaohui; Sun, Yingjie; Ding, Chan; Yu, Shengqing

    2016-04-01

    Brucellosis, the most common widespread zoonotic disease, is caused by Brucella spp., which are facultative, intracellular, Gram-negative bacteria. With the development of molecular biology techniques, more and more virulence-associated factors have been identified in Brucella spp. A suitable plasmid system is an important tool to study virulence genes in Brucella. In this study, we constructed three constitutive replication plasmids (pTM1-Cm, pTM2-Amp, and pTM3-Km) using the replication origin (rep) region derived from the pBBR1-MCS vector. Also, a DNA fragment containing multiple cloning sites (MCSs) and a terminator sequence derived from the pCold vector were produced for complementation of the deleted genes. Besides pGH-6×His, a plasmid containing the groE promoter of Brucella spp. was constructed to express exogenous proteins in Brucella with high efficiency. Furthermore, we constructed the inducible expression plasmid pZT-6×His, containing the tetracycline-inducible promoter pzt1, which can induce expression by the addition of tetracycline in the Brucella culture medium. The constructed pTM series plasmids will play an important role in the functional investigation of Brucella spp. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Structures of actin-like ParM filaments show architecture of plasmid-segregating spindles.

    Science.gov (United States)

    Bharat, Tanmay A M; Murshudov, Garib N; Sachse, Carsten; Löwe, Jan

    2015-07-02

    Active segregation of Escherichia coli low-copy-number plasmid R1 involves formation of a bipolar spindle made of left-handed double-helical actin-like ParM filaments. ParR links the filaments with centromeric parC plasmid DNA, while facilitating the addition of subunits to ParM filaments. Growing ParMRC spindles push sister plasmids to the cell poles. Here, using modern electron cryomicroscopy methods, we investigate the structures and arrangements of ParM filaments in vitro and in cells, revealing at near-atomic resolution how subunits and filaments come together to produce the simplest known mitotic machinery. To understand the mechanism of dynamic instability, we determine structures of ParM filaments in different nucleotide states. The structure of filaments bound to the ATP analogue AMPPNP is determined at 4.3 Å resolution and refined. The ParM filament structure shows strong longitudinal interfaces and weaker lateral interactions. Also using electron cryomicroscopy, we reconstruct ParM doublets forming antiparallel spindles. Finally, with whole-cell electron cryotomography, we show that doublets are abundant in bacterial cells containing low-copy-number plasmids with the ParMRC locus, leading to an asynchronous model of R1 plasmid segregation.

  16. Localization of Low Copy Number Plasmid pRC4 in Replicating Rod and Non-Replicating Cocci Cells of Rhodococcus erythropolis PR4.

    Directory of Open Access Journals (Sweden)

    Divya Singhi

    Full Text Available Rhodococcus are gram-positive bacteria, which can exist in two different shapes rod and cocci. A number of studies have been done in the past on replication and stability of small plasmids in this bacterium; however, there are no reports on spatial localization and segregation of these plasmids. In the present study, a low copy number plasmid pDS3 containing pRC4 replicon was visualized in growing cells of Rhodococcus erythropolis PR4 (NBRC100887 using P1 parS-ParB-GFP system. Cells were initially cocci and then became rod shaped in exponential phase. Cocci cells were found to be non-replicating as evident by the presence of single fluorescence focus corresponding to the plasmid and diffuse fluorescence of DnaB-GFP. Rod shaped cells contained plasmid either present as one fluorescent focus observed at the cell center or two foci localized at quarter positions. The results suggest that the plasmid is replicated at the cell center and then it goes to quarter position. In order to observe the localization of plasmid with respect to nucleoid, plasmid segregation was also studied in filaments where it was found to be replicated at the cell center in a nucleoid free region. To the best of our knowledge, this is the first report on segregation of small plasmids in R. erythropolis.

  17. Mechanisms Involved in Acquisition of blaNDM Genes by IncA/C2 and IncFIIY Plasmids.

    Science.gov (United States)

    Wailan, Alexander M; Sidjabat, Hanna E; Yam, Wan Keat; Alikhan, Nabil-Fareed; Petty, Nicola K; Sartor, Anna L; Williamson, Deborah A; Forde, Brian M; Schembri, Mark A; Beatson, Scott A; Paterson, David L; Walsh, Timothy R; Partridge, Sally R

    2016-07-01

    blaNDM genes confer carbapenem resistance and have been identified on transferable plasmids belonging to different incompatibility (Inc) groups. Here we present the complete sequences of four plasmids carrying a blaNDM gene, pKP1-NDM-1, pEC2-NDM-3, pECL3-NDM-1, and pEC4-NDM-6, from four clinical samples originating from four different patients. Different plasmids carry segments that align to different parts of the blaNDM region found on Acinetobacter plasmids. pKP1-NDM-1 and pEC2-NDM-3, from Klebsiella pneumoniae and Escherichia coli, respectively, were identified as type 1 IncA/C2 plasmids with almost identical backbones. Different regions carrying blaNDM are inserted in different locations in the antibiotic resistance island known as ARI-A, and ISCR1 may have been involved in the acquisition of blaNDM-3 by pEC2-NDM-3. pECL3-NDM-1 and pEC4-NDM-6, from Enterobacter cloacae and E. coli, respectively, have similar IncFIIY backbones, but different regions carrying blaNDM are found in different locations. Tn3-derived inverted-repeat transposable elements (TIME) appear to have been involved in the acquisition of blaNDM-6 by pEC4-NDM-6 and the rmtC 16S rRNA methylase gene by IncFIIY plasmids. Characterization of these plasmids further demonstrates that even very closely related plasmids may have acquired blaNDM genes by different mechanisms. These findings also illustrate the complex relationships between antimicrobial resistance genes, transposable elements, and plasmids and provide insights into the possible routes for transmission of blaNDM genes among species of the Enterobacteriaceae family. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  18. Unique Helicase Determinants in the Essential Conjugative TraI Factor from Salmonella enterica Serovar Typhimurium Plasmid pCU1

    Energy Technology Data Exchange (ETDEWEB)

    McLaughlin, Krystle J.; Nash, Rebekah P.; Redinbo, Mathew R. (UNC)

    2014-06-16

    The widespread development of multidrug-resistant bacteria is a major health emergency. Conjugative DNA plasmids, which harbor a wide range of antibiotic resistance genes, also encode the protein factors necessary to orchestrate the propagation of plasmid DNA between bacterial cells through conjugative transfer. Successful conjugative DNA transfer depends on key catalytic components to nick one strand of the duplex DNA plasmid and separate the DNA strands while cell-to-cell transfer occurs. The TraI protein from the conjugative Salmonella plasmid pCU1 fulfills these key catalytic roles, as it contains both single-stranded DNA-nicking relaxase and ATP-dependent helicase domains within a single, 1,078-residue polypeptide. In this work, we unraveled the helicase determinants of Salmonella pCU1 TraI through DNA binding, ATPase, and DNA strand separation assays. TraI binds DNA substrates with high affinity in a manner influenced by nucleic acid length and the presence of a DNA hairpin structure adjacent to the nick site. TraI selectively hydrolyzes ATP, and mutations in conserved helicase motifs eliminate ATPase activity. Surprisingly, the absence of a relatively short (144-residue) domain at the extreme C terminus of the protein severely diminishes ATP-dependent strand separation. Collectively, these data define the helicase motifs of the conjugative factor TraI from Salmonella pCU1 and reveal a previously uncharacterized C-terminal functional domain that uncouples ATP hydrolysis from strand separation activity.

  19. Diversity and homogeneity among small plasmids of Aeromonas salmonicida subsp. salmonicida linked with geographical origin

    Directory of Open Access Journals (Sweden)

    Sabrina A Attéré

    2015-11-01

    Full Text Available Furunculosis, which is caused by Aeromonas salmonicida subsp. salmonicida, is a major salmonid disease in fish farms worldwide. Several plasmids found in this bacterium confer phenotypes such drug resistance and virulence. Small plasmids (pAsa1, pAsa2, pAsa3, and pAsal1 related to ColE1- and ColE2-type replicons are usually present in its normal plasmidome. In the present study, with the objective to investigate if these plasmids display particularities related to the origin of the isolates bearing them, a total of 153 isolates, including 78 new and 75 previously described, were analyzed for the presence of small plasmids by PCR and DNA restriction fragment profiling. A geographical dichotomy between Canadian and European isolates for their propensity to do not have pAsa3 or pAsal1 was found. In addition, the genotyping analysis led to the identification of two European isolates harboring an unusual pAsal1. An investigation by next-generation sequencing (NGS of these two isolates shed light on two pAsal1 variants (pAsal1C and pAsal1D. As with pAsal1B, another pAsal1 variant previously described, these two new variants bore a second insertion sequence (ISAS5 in addition to the usual ISAS11. The characterization of these variants suggested that they could predominate over the wild-type pAsal1 in stressful conditions such as growth at temperatures of 25°C and above. To obtain a comprehensive portrait of the mutational pressure on small plasmids, 26 isolates whose DNA had been sequenced by NGS were investigated. pAsa3 and pAsal1 were more prone to mutations than pAsa1 and pAsa2, especially in the mobA gene, which encodes a relaxase and a primase. Lastly, the average copy number of each plasmid per cell was assessed using raw sequencing data. A clear trend with respect to the relative proportion per cell of each plasmid was identified. Our large-scale study revealed a geographical dichotomy in small plasmid repertoire in addition to a clear trend

  20. Investigation of plasmid DNA and antibiotic resistance in some ...

    African Journals Online (AJOL)

    Twenty-eight strains of Salmonella, Pseudomonas, and Escherichia coli isolated from cultures of stool, urine and wound were tested for their susceptibility to various antimicrobial agents. All the strains were resistant to erythromycin and tetracycline. Nineteen Salmonella isolates were susceptible to chloramphenicol and ...

  1. Plasmid transfer by conjugation in Xylella fastidiosa.

    Science.gov (United States)

    Recombination and horizontal gene transfer have been implicated in the adaption of Xylella fastidiosa (Xf) to infect a wide variety of different plant species. There is evidence that certain strains of Xf carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as ...

  2. Standardized Cloning and Curing of Plasmids

    DEFF Research Database (Denmark)

    Lauritsen, Ida; Kim, Se Hyeuk; Porse, Andreas

    2018-01-01

    and exchange of genetic parts in the Standard European Vectors Architecture (SEVA) vector system. Additionally, to facilitate rapid testing and iterative bioengineering using different vector designs, we provide a one-step protocol for a universal CRISPR-Cas9-based plasmid curing system (pFREE) and demonstrate...

  3. Optimization of plasmid electrotransformation into Escherichia coli ...

    African Journals Online (AJOL)

    In order to improve electroporation, optical density of bacteria, recovery time and electrical parameter (field strength and capacitance) were optimized using the Taguchi statistical method. ANOVA of obtained data indicated that the optimal conditions of electrotransformation of pET-28a (+) plasmid into Escherichia coli ...

  4. Plasmid mediated quinolone resistance in Enterobacteriaceae

    NARCIS (Netherlands)

    Veldman, K.T.; LS Klinisch Onderzoek Wagenaar

    2014-01-01

    This thesis describes the occurrence of Plasmid Mediated Quinolone Resistance (PMQR) in Salmonella and E. coli from The Netherlands and other European countries. Furthermore, the genetic background of these genes was characterized. Fluoroquinolones are widely used antibiotics in both human and

  5. Antimicrobial resistance and plasmid profiles of Aeromonas ...

    African Journals Online (AJOL)

    The purpose of this study was to investigate the presence of Aeromonas hydrophila at commonly used water collection points on the River Njoro and to determine the in-vitro antimicrobial susceptibility and plasmid profiles of isolates. In total, 126 samples were collected and 36.5% of them were positive for A. hydrophila.

  6. Antimicrobial resistance patterns and plasmid profiles of ...

    African Journals Online (AJOL)

    Objectives: To determine the frequency of resistance of Staphylococcus aureus to various antimicrobial agents, and the relationship between antimicrobial resistance of the isolates and carriage of plasmids. Design: A random sampling of milk and meat samples was carried out. Setting: Milk was collected from various dairy ...

  7. Plasmid stability in dried cells of the desert cyanobacterium Chroococcidiopsis and its potential for GFP imaging of survivors on Earth and in space.

    Science.gov (United States)

    Billi, Daniela

    2012-06-01

    Two GFP-based plasmids, namely pTTQ18-GFP-pDU1(mini) and pDUCA7-GFP, of about 7 kbp and 15 kbp respectively, able to replicate in Chroococcidiopsis sp. CCMEE 029 and CCMEE 123, were developed. Both plasmids were maintained in Chroococcidiopsis cells after 18 months of dry storage as demonstrated by colony PCR, plasmid restriction analysis, GFP imaging and colony-forming ability under selection of dried transformants; thus suggesting that strategies employed by this cyanobacterium to stabilize dried chromosomal DNA, must have protected plasmid DNA. The suitability of pDU1(mini)-plasmid for GFP tagging in Chroococcidiopsis was investigated by using the RecA homolog of Synechocystis sp. PCC 6803. After 2 months of dry storage, the presence of dried cells with a GFP-RecA(Syn) distribution resembling that of hydrated cells, supported its capability of preventing desiccation-induced genome damage, whereas the rewetted cells with filamentous GFP-RecA(Syn) structures revealed sub-lethal DNA damage. The long-term stability of plasmid DNA in dried Chroococcidiopsis has implication for space research, for example when investigating the recovery of dried cells after Martian and space simulations or when developing life support systems based on phototrophs with genetically enhanced stress tolerance and stored in the dry state for prolonged periods.

  8. Cloning of a Recombinant Plasmid Encoding Thiol-Specific Antioxidant Antigen (TSA) Gene of Leishmania majorand Expression in the Chinese Hamster Ovary Cell Line.

    Science.gov (United States)

    Fatemeh, Ghaffarifar; Fatemeh, Tabatabaie; Zohreh, Sharifi; Abdolhosein, Dalimiasl; Mohammad Zahir, Hassan; Mehdi, Mahdavi

    2012-01-01

    TSA (thiol-specific antioxidant antigen) is the immune-dominant antigen of Leishmania major and is considered to be the most promising candidate molecule for a recombinant or DNA vaccine against leishmaniasis. The aim of the present work was to express a plasmid containing the TSA gene in eukaryotic cells. Genomic DNA was extracted, and the TSA gene was amplified by polymerase chain reaction (PCR). The PCR product was cloned into the pTZ57R/T vector, followed by subcloning into the eukaryotic expression vector pcDNA3 (EcoRI and HindIII sites). The recombinant plasmid was characterised by restriction digest and PCR. Eukaryotic Chinese hamster ovary cells were transfected with the plasmid containing the TSA gene. Expression of the L. major TSA gene was confirmed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and Western blotting. The plasmid containing the TSA gene was successfully expressed, as demonstrated by a band of 22.1 kDa on Western blots. The plasmid containing the TSA gene can be expressed in a eukaryotic cell line. Thus, the recombinant plasmid may potentially be used as a DNA vaccine in animal models.

  9. Characterization and plasmid elimination of NDM-1-producing Acinetobacter calcoaceticus from China.

    Directory of Open Access Journals (Sweden)

    Yang Sun

    Full Text Available The presence of multidrug-resistant bacterial pathogens in the environment poses a serious threat to public health. The opportunistic Acinetobacter spp. are among the most prevalent causes of nosocomial infections. Here, we performed complete genome sequencing of the Acinetobacter calcoaceticus strain XM1570, which was originally cultivated from the sputum of a patient diagnosed with pneumonia in Xiamen in 2010. We identified carbapenem resistance associated gene bla(NDM-1 located on a 47.3-kb plasmid. Three methods--natural reproduction, sodium dodecyl sulfate treatment and nalidixic acid treatment--were used to eliminate the bla(NDM-1-encoding plasmid, which achieved elimination rates of 3.32% (10/301, 83.78% (278/332, and 84.17% (298/354, respectively. Plasmid elimination dramatically increased antibiotic sensitivity, reducing the minimum bacteriostatic concentration of meropenem from 256 µg/ml in the clinical strain to 0.125 µg/ml in the plasmid-eliminated strain. Conjugation transfer assays showed that the bla(NDM-1-containing plasmid could be transferred into Escherichia coli DH5α:pBR322 in vitro as well as in vivo in mice. The bla(NDM-1 genetic environment was in accordance with that of other bla(NDM-1 genes identified from India, Japan, and Hong-Kong. The multilocus sequence type of the isolate was identified as ST-70. Two novel genes encoding intrinsic OXA and ADC were identified and named as OXA-417 and ADC-72. The finding of bla(NDM-1 in species like A. calcoaceticus demonstrates the wide spread of this gene in gram-negative bacteria which is possible by conjugative plasmid transfer. The results of this study may help in the development of a treatment strategy for controlling NDM-1 bacterial infection and transmission.

  10. Characteristics of plasmids in multi-drug-resistant Enterobacteriaceae isolated during prospective surveillance of a newly opened hospital in Iraq.

    Directory of Open Access Journals (Sweden)

    Xiao-Zhe Huang

    Full Text Available BACKGROUND: Gram-negative multidrug-resistant (MDR bacteria are major causes of nosocomial infections, and antibiotic resistance in these organisms is often plasmid mediated. Data are scarce pertaining to molecular mechanisms of antibiotic resistance in resource constrained areas such as Iraq. METHODOLOGY/PRINCIPAL FINDINGS: In this study, all MDR Enterobacteriaceae (n = 38 and randomly selected non-MDR counterparts (n = 41 isolated from patients, healthcare workers and environmental surfaces in a newly opened hospital in Iraq were investigated to characterize plasmids found in these isolates and determine their contribution to antibiotic resistance. Our results demonstrated that MDR E. coli and K. pneumoniae isolates harbored significantly more (≥ 3 plasmids compared to their non-MDR counterparts, which carried ≤ 2 plasmids (p<0.01. Various large plasmids (~52 to 100 kb from representative isolates were confirmed to contain multiple resistance genes by DNA microarray analysis. Aminoglycoside (acc, aadA, aph, strA/B, and ksgA, β-lactam (bla(TEM1, bla(AMPC, bla(CTX-M-15, bla(OXA-1, bla(VIM-2 and bla(SHV, sulfamethoxazole/trimethoprim (sul/dfr, tetracycline (tet and chloramphenicol (cat resistance genes were detected on these plasmids. Additionally, multiple plasmids carrying multiple antibiotic resistance genes were found in the same host strain. Genetic transfer-associated genes were identified on the plasmids from both MDR and non-MDR isolates. Seven plasmid replicon types (FII, FIA, FIB, B/O, K, I1 and N were detected in the isolates, while globally disseminated IncA/C and IncHI1 plasmids were not detected in these isolates. CONCLUSIONS/SIGNIFICANCE: This is the first report of the characteristics of the plasmids found in Enterobacteriaceae isolated following the opening of a new hospital in Iraq. The information provided here furthers our understanding of the mechanisms of drug resistance in this specific region and their evolutionary

  11. An Enterobacter Plasmid as a New Genetic Background for the Transposon Tn1331

    Science.gov (United States)

    2011-11-25

    determined to be 99% similar to E. cloacae by both 16S rDNA and Phoenix analysis and was designated Enterobacter sp W001. Enterobacter sp W001 was...adolescents. JAMA. 2002;287(23):3096–3102. 9. Foster TJ. Plasmid- determined resistance to antimicrobial drugs and toxic metal ions in bacteria. Microbiol...mediated type II dihydrofolate reductase gene among trimethoprim -resistant urinary pathogens in Greek hospitals. J Antimicrob Chemother. 1992;29

  12. Electrotransformation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis with Various Plasmids

    OpenAIRE

    Serror, Pascale; Sasaki, Takashi; Ehrlich, S. Dusko; Maguin, Emmanuelle

    2002-01-01

    We describe, for the first time, a detailed electroporation procedure for Lactobacillus delbrueckii. Three L. delbrueckii strains were successfully transformed. Under optimal conditions, the transformation efficiency was 104 transformants per μg of DNA. Using this procedure, we identified several plasmids able to replicate in L. delbrueckii and integrated an integrative vector based on phage integrative elements into the L. delbrueckii subsp. bulgaricus chromosome. These vectors provide a goo...

  13. The cost of copy number in a selfish genetic element: the 2-μm plasmid of Saccharomyces cerevisiae.

    Science.gov (United States)

    Harrison, Ellie; Koufopanou, V; Burt, A; MacLean, R C

    2012-11-01

    Many autonomously replicating genetic elements exist as multiple copies within the cell. The copy number of these elements is often assumed to have important fitness consequences for both element and host, yet the forces shaping its evolution are not well understood. The 2 μm is a multicopy plasmid of Saccharomyces yeasts, encoding just four genes that are solely involved in plasmid replication. One simple model for the fitness relationship between yeasts and 2 μm is that plasmid copy number evolves as a trade-off between selection for increased vertical transmission, favouring high copy number, and selection for decreased virulence, favouring low copy number. To test this model, we experimentally manipulated the copy number of the plasmid and directly measured the fitness cost, in terms of growth rate reduction, associated with high plasmid copy number. We find that the fitness burden imposed by the 2 μm increases with plasmid copy number, such that each copy imposes a fitness burden of 0.17% (± 0.008%), greatly exceeding the cost expected for it to be stably maintained in yeast populations. Our results demonstrate the crucial importance of copy number in the evolution of yeast per 2 μm associations and pave the way for future studies examining how selection can shape the cost of multicopy elements. © 2012 The Authors. Journal of Evolutionary Biology © 2012 European Society For Evolutionary Biology.

  14. Plasmid mediated enhancement of uv resistance in Streptococcus faecalis

    International Nuclear Information System (INIS)

    Miehl, R.; Miller, M.; Yasbin, R.E.

    1980-01-01

    A 38.5-Mdal plasmid of Streptococcus faecalis subdp. zymogenes has been shown to enhance survival following uv irradiation. In addition, the presence of this plasmid increases the mutation frequencies following uv irradiation and enhanced W-reactivation. The data presented indicate that S. faecalis has an inducible error-prone repair system and that the plasmid enhances these repair functions

  15. Sequence analysis and characterization of rolling-circle replicating plasmid pVCM01 from Salmonella enterica

    Directory of Open Access Journals (Sweden)

    Penido, A. F. B.

    2013-12-01

    Full Text Available Aims: Characterization of cryptic plasmid pVCM01 (accession number JX133088 isolated from Salmonella enterica Enteritidis. Methodology and results: The complete sequence of pVCM01 was obtained. This plasmid possesses 1981 bp, with G+C content of 57% in agreement of the range of Salmonella genomic DNA. pVCM01 has a high degree of similarity to pB and pJ plasmids. It possesses six main open reading frames, only one have a very high degree of amino acid identity with protein involved in the rolling-circle-like replication (RCR. Based on the sequence similarities, pVCM01 plasmid belonged to the pC194/pUB110 rolling-circle replicating plasmid family. The Rep pVCM01 possesses the motifs: FLTLTVRN, HPHFHTL, SGDGYVKHERW, which were present in all Rep proteins. Conclusion, significance and impact of study: The small size of pVCM01 plasmid and its stability in E. coli cells, make it an attractive candidate to develop new vectors, such as cloning and/or expression vector.

  16. Plasmids in Mycoplasma species isolated from goats and sheep and their preliminary typing

    Directory of Open Access Journals (Sweden)

    Nascimento Elmiro R.

    1999-01-01

    Full Text Available One-hundred-five (105 clinical isolates of mycoplasma from caprine origin and one isolate from ovine were surveyed for plasmids, which were present in thirty-three (31% of them. These mycoplasmas originated from 13 herds. Ten of them were symptomatic for mycoplasmal disease (mastitis, polyarthritis, septicemia and three herds were asymptomatic, i.e., clinically normal. Twenty-eight isolates were Mycoplasma mycoides subspecies mycoides LC (large colony or caprine biotype, four were Mycoplasma capricolum subsp. capricolum and one was Mycoplasma cottewii. The isolated plasmids were linearized by EcoRI, EcoRV, EcoRI and EcoRV or BamHI and EcoRV, and were of five sizes (1.1, 1.6, 1.7, 1.8, and 1.9 Kbp. Based on restriction enzyme digestion and size of the linearized supercoiled extrachromosomal DNA, five plasmid types were recovered (p1II, p2III, p2V, p3I, and p4IV. The small size of these DNA elements probably exclude replicative forms of DNA virus, which are equal or larger than 8.0 Kbp.

  17. Binding mechanisms for histamine and agmatine ligands in plasmid deoxyribonucleic acid purifications.

    Science.gov (United States)

    Sousa, Ângela; Pereira, Patrícia; Sousa, Fani; Queiroz, João A

    2014-10-31

    Histamine and agmatine amino acid derivatives were immobilized into monolithic disks, in order to combine the specificity and selectivity of the ligand with the high mass transfer and binding capacity offered by monolithic supports, to purify potential plasmid DNA biopharmaceuticals. Different elution strategies were explored by changing the type and salt concentration, as well as the pH, in order to understand the retention pattern of different plasmids isoforms The pVAX1-LacZ supercoiled isoform was isolated from a mixture of pDNA isoforms by using NaCl increasing stepwise gradient and also by ammonium sulfate decreasing stepwise gradient, in both histamine and agmatine monoliths. Acidic pH in the binding buffer mainly strengthened ionic interactions with both ligands in the presence of sodium chloride. Otherwise, for histamine ligand, pH values higher than 7 intensified hydrophobic interactions in the presence of ammonium sulfate. In addition, circular dichroism spectroscopy studies revealed that the binding and elution chromatographic conditions, such as the combination of high ionic strength with extreme pH values can reversibly influence the structural stability of the target nucleic acid. Therefore, ascending sodium chloride gradients with pH manipulation can be preferable chromatographic conditions to be explored in the purification of plasmid DNA biopharmaceuticals, in order to avoid the environmental impact of ammonium sulfate. Copyright © 2014. Published by Elsevier B.V.

  18. Transfection of HeLa-cells with pEGFP plasmid by impedance power-assisted electroporation

    DEFF Research Database (Denmark)

    Glahder, Jacob; Norrild, Bodil; Persson, Mikael B

    2005-01-01

    Bioimpedance spectrometry was applied to study cell viability and pEGFP plasmid-transfection efficiency in electroporation (EP) of 20,000 HeLa cells with 0.3 microg DNA in 90 microl low conductivity 0.32 M sucrose medium of pH 7.5. Monopolar rectangular pulses, of field strength 75 V/mm, and puls...

  19. Deletion mutants of region E1 a of AD12 E1 plasmids: Effect on oncogenic transformation

    NARCIS (Netherlands)

    Bos, J.L.; Jochemsen, A.G.; Bernards, R.A.; Schrier, P.I.; Ormondt, H. van; Eb, A.J. van der

    1983-01-01

    Plasmids containing the El region of Ad12 DNA can transform certain rodent cells into oncogenic cells. To study the role of the Ela subregion in the process of oncogenic transformation, Ad12 region El mutants carrying deletions in the Ela region were constructed. Deletion mutants pR7 and pR8 affect

  20. Isolation and characterization of kikA, a region on IncN group plasmids that determines killing of Klebsiella oxytoca.

    OpenAIRE

    Hengen, P N; Denicourt, D; Iyer, V N

    1992-01-01

    Transfer of the IncN group plasmid pCU1 from Escherichia coli to Klebsiella oxytoca by conjugation kills a large proportion (90 to 95%) of the recipients of plasmid DNA, whereas transfer to E. coli or even to the closely related Enterobacter aerogenes does not. Two regions, kikA and kikB, have been identified on pCU1 that contribute to the Kik (killing in klebsiellas) phenotype. We have localized the kikA region to 500 bp by deletion analysis and show by DNA-DNA hybridization that kikA is hig...

  1. Radioautographic test for genetic cotton transformation by pCaVItoxneo hybrid plasmid

    International Nuclear Information System (INIS)

    Imamkhodjaeva, A.S.

    2006-01-01

    Full text: Search for novel technologies in biology, application of up-to-date methods in gene engineering, manipulation with the recombinant DNA, in particular, open opportunities for experiments with plants. To identify some DNA fragments in an organism's genome, radioautographic methods, such as dot- and blot-hybridization are frequently used. As a rule, genomic DNA is first isolated from the plant's organ. Its purification and subsequent manipulation is followed by hybridization with a probe labeled with radioactive components. The purified DNA, cDNA of RNA reverse transcription or a DNA fragment cloned in E-coli could serve as the probe. Radioautography shows homologically hybridized fragments. We have performed express dot-hybridization analysis on hybrid plasmid transformation of G.Hirsutum L. (108F) and G. Barbadense L. (C-6037) cotton sorts. pCaVItoxneo plasmid obtained on the basis of independently replicated plasmid-like DNA of the G.Hirsutum L. (pGHm2) cotton mitochondria was used (Yusupov T., 1994). There are hybrid two-domain gene of insectotoxin and enzymatically active kanamycine - phosphotransferase in the plasmid. The whole content is controlled by the plant promoter of cauliflower mosaic virus (19 S SFMV). The plasmid in question was added to the pollen sprouting medium followed by the transfer of the suspension on the pistil stigmas of the pre-prepared cotton flowers. The seed budding as the result of the experiment were analyzed by means of dot-hybridization method. DNA probes used for radioactive hybridization were labeled by method of Fainberg and Vagelstein (1990). To perform that DNA was dissolved in Tris-EDTA (10:1), containing 10mM of Tris HCl and 1mM EDTA, denaturated at 100 d eg C for 2 minutes with subsequent addition of oligonucleotide primers and annealing. DNA synthesis in the presence of 32 P labeled dATP and dCTP (Tashkent) was performed in the reaction mixture of potassium-phosphate buffer containing 67mM of MgCl 2 , 1 mg/ml of

  2. DNA immunisation. New histochemical and morphometric data

    Directory of Open Access Journals (Sweden)

    D Ehirchiou

    2010-01-01

    Full Text Available Splenic germinal center reactions were measured during primary response to a plasmidic DNA intramuscular injection. Cardiotoxin-pretreated Balb/c mice were immunized with DNA plasmids encoding or not the SAG1 protein, a membrane antigen of Toxoplasma gondii. Specific anti-SAG1 antibodies were detected on days 16 and 36 after injection of coding plasmids. The results of ELISAs showed that the SAG1-specific antibodies are of the IgG2a class. Morphometric analyses were done on serial immunostained cryosections of spleen and draining or non-draining lymph nodes. This new approach made it possible to evaluate the chronological changes induced by DNA immunisation in the germinal centres (in number and in size. Significant increases in the number of germinal centres were measured in the spleen and only in draining lymph nodes after plasmid injection. the measured changes of the germinal centers appeared to result from the adjuvant stimulatory effect of the plasmidic DNA since both the coding and the noncoding plasmid DNA induced them. No measurable changes were recorded in the Tdependent zone of lymph organs.

  3. High-frequency transformation of a methylotrophic yeast, Candida boidinii, with autonomously replicating plasmids which are also functional in Saccharomyces cerevisiae.

    OpenAIRE

    Sakai, Y; Goh, T K; Tani, Y

    1993-01-01

    We have developed a transformation system which uses autonomous replicating plasmids for a methylotrophic yeast, Candida boidinii. Two autonomous replication sequences, CARS1 and CARS2, were newly cloned from the genome of C. boidinii. Plasmids having both a CARS fragment and the C. boidinii URA3 gene transformed C. boidinii ura3 cells to Ura+ phenotype at frequencies of up to 10(4) CFU/micrograms of DNA. From Southern blot analysis, CARS plasmids seemed to exist in polymeric forms as well as...

  4. The master activator of IncA/C conjugative plasmids stimulates genomic islands and multidrug resistance dissemination.

    Science.gov (United States)

    Carraro, Nicolas; Matteau, Dominick; Luo, Peng; Rodrigue, Sébastien; Burrus, Vincent

    2014-10-01

    Dissemination of antibiotic resistance genes occurs mostly by conjugation, which mediates DNA transfer between cells in direct contact. Conjugative plasmids of the IncA/C incompatibility group have become a substantial threat due to their broad host-range, the extended spectrum of antimicrobial resistance they confer, their prevalence in enteric bacteria and their very efficient spread by conjugation. However, their biology remains largely unexplored. Using the IncA/C conjugative plasmid pVCR94ΔX as a prototype, we have investigated the regulatory circuitry that governs IncA/C plasmids dissemination and found that the transcriptional activator complex AcaCD is essential for the expression of plasmid transfer genes. Using chromatin immunoprecipitation coupled with exonuclease digestion (ChIP-exo) and RNA sequencing (RNA-seq) approaches, we have identified the sequences recognized by AcaCD and characterized the AcaCD regulon. Data mining using the DNA motif recognized by AcaCD revealed potential AcaCD-binding sites upstream of genes involved in the intracellular mobility functions (recombination directionality factor and mobilization genes) in two widespread classes of genomic islands (GIs) phylogenetically unrelated to IncA/C plasmids. The first class, SGI1, confers and propagates multidrug resistance in Salmonella enterica and Proteus mirabilis, whereas MGIVmi1 in Vibrio mimicus belongs to a previously uncharacterized class of GIs. We have demonstrated that through expression of AcaCD, IncA/C plasmids specifically trigger the excision and mobilization of the GIs at high frequencies. This study provides new evidence of the considerable impact of IncA/C plasmids on bacterial genome plasticity through their own mobility and the mobilization of genomic islands.

  5. Development of plasmid vector and electroporation condition for gene transfer in sporogenic lactic acid bacterium, Bacillus coagulans.

    Science.gov (United States)

    Rhee, Mun Su; Kim, Jin-Woo; Qian, Yilei; Ingram, L O; Shanmugam, K T

    2007-07-01

    Bacillus coagulans is a sporogenic lactic acid bacterium that ferments glucose and xylose, major components of plant biomass, a potential feedstock for cellulosic ethanol. The temperature and pH for optimum rate of growth of B. coagulans (50 to 55 degrees C, pH 5.0) are very similar to that of commercially developed fungal cellulases (50 degrees C; pH 4.8). Due to this match, simultaneous saccharification and fermentation (SSF) of cellulose to products by B. coagulans is expected to require less cellulase than needed if the SSF is conducted at a sub-optimal temperature, such as 30 degrees C, the optimum for yeast, the main biocatalyst used by the ethanol industry. To fully exploit B. coagulans as a platform organism, we have developed an electroporation method to transfer plasmid DNA into this genetically recalcitrant bacterium. We also constructed a B. coagulans/E. coli shuttle vector, plasmid pMSR10 that contains the rep region from a native plasmid (pMSR0) present in B. coagulans strain P4-102B. The native plasmid, pMSR0 (6823bp), has 9 ORFs, and replicates by rolling-circle mode of replication. Plasmid pNW33N, developed for Geobacillus stearothermophilus, was also transformed into this host and stably maintained while several other Bacillus/Escherichia coli shuttle vector plasmids were not transformed into B. coagulans. The transformation efficiency of B. coagulans strain P4-102B using the plasmids pNW33N or pMSR10 was about 1.5x10(16) per mole of DNA. The availability of shuttle vectors and an electroporation method is expected to aid in genetic and metabolic engineering of B. coagulans.

  6. Functional characterization of replication and stability factors of an incompatibility group P-1 plasmid from Xylella fastidiosa.

    Science.gov (United States)

    Lee, Min Woo; Rogers, Elizabeth E; Stenger, Drake C

    2010-12-01

    Xylella fastidiosa strain riv11 harbors a 25-kbp plasmid (pXF-RIV11) belonging to the IncP-1 incompatibility group. Replication and stability factors of pXF-RIV11 were identified and used to construct plasmids able to replicate in X. fastidiosa and Escherichia coli. Replication in X. fastidiosa required a 1.4-kbp region from pXF-RIV11 containing a replication initiation gene (trfA) and the adjacent origin of DNA replication (oriV). Constructs containing trfA and oriV from pVEIS01, a related IncP-1 plasmid of the earthworm symbiont Verminephrobacter eiseniae, also were competent for replication in X. fastidiosa. Constructs derived from pXF-RIV11 but not pVEIS01 replicated in Agrobacterium tumefaciens, Xanthomonas campestris, and Pseudomonas syringae. Although plasmids bearing replication elements from pXF-RIV11 or pVEIS01 could be maintained in X. fastidiosa under antibiotic selection, removal of selection resulted in plasmid extinction after 3 weekly passages. Addition of a toxin-antitoxin addiction system (pemI/pemK) from pXF-RIV11 improved plasmid stability such that >80 to 90% of X. fastidiosa cells retained plasmid after 5 weekly passages in the absence of antibiotic selection. Expression of PemK in E. coli was toxic for cell growth, but toxicity was nullified by coexpression of PemI antitoxin. Deletion of N-terminal sequences of PemK containing the conserved motif RGD abolished toxicity. In vitro assays revealed a direct interaction of PemI with PemK, suggesting that antitoxin activity of PemI is mediated by toxin sequestration. IncP-1 plasmid replication and stability factors were added to an E. coli cloning vector to constitute a stable 6.0-kbp shuttle vector (pXF20-PEMIK) suitable for use in X. fastidiosa.

  7. The Plasmid Mobilome of the Model Plant-Symbiont Sinorhizobium meliloti: Coming up with New Questions and Answers.

    Science.gov (United States)

    Lagares, Antonio; Sanjuán, Juan; Pistorio, Mariano

    2014-10-01

    Rhizobia are Gram-negative Alpha- and Betaproteobacteria living in the underground which have the ability to associate with legumes for the establishment of nitrogen-fixing symbioses. Sinorhizobium meliloti in particular-the symbiont of Medicago, Melilotus, and Trigonella spp.-has for the past decades served as a model organism for investigating, at the molecular level, the biology, biochemistry, and genetics of a free-living and symbiotic soil bacterium of agricultural relevance. To date, the genomes of seven different S. meliloti strains have been fully sequenced and annotated, and several other draft genomic sequences are also available. The vast amount of plasmid DNA that S. meliloti frequently bears (up to 45% of its total genome), the conjugative ability of some of those plasmids, and the extent of the plasmid diversity has provided researchers with an extraordinary system to investigate functional and structural plasmid molecular biology within the evolutionary context surrounding a plant-associated model bacterium. Current evidence indicates that the plasmid mobilome in S. meliloti is composed of replicons varying greatly in size and having diverse conjugative systems and properties along with different evolutionary stabilities and biological roles. While plasmids carrying symbiotic functions (pSyms) are known to have high structural stability (approaching that of chromosomes), the remaining plasmid mobilome (referred to as the non-pSym, functionally cryptic, or accessory compartment) has been shown to possess remarkable diversity and to be highly active in conjugation. In light of the modern genomic and current biochemical data on the plasmids of S. meliloti, the current article revises their main structural components, their transfer and regulatory mechanisms, and their potential as vehicles in shaping the evolution of the rhizobial genome.

  8. The sudden dominance of blaCTX-M harbouring plasmids in Shigella spp. Circulating in Southern Vietnam.

    Directory of Open Access Journals (Sweden)

    Nhu Thi Khanh Nguyen

    2010-06-01

    Full Text Available Plasmid mediated antimicrobial resistance in the Enterobacteriaceae is a global problem. The rise of CTX-M class extended spectrum beta lactamases (ESBLs has been well documented in industrialized countries. Vietnam is representative of a typical transitional middle income country where the spectrum of infectious diseases combined with the spread of drug resistance is shifting and bringing new healthcare challenges.We collected hospital admission data from the pediatric population attending the hospital for tropical diseases in Ho Chi Minh City with Shigella infections. Organisms were cultured from all enrolled patients and subjected to antimicrobial susceptibility testing. Those that were ESBL positive were subjected to further investigation. These investigations included PCR amplification for common ESBL genes, plasmid investigation, conjugation, microarray hybridization and DNA sequencing of a bla(CTX-M encoding plasmid.We show that two different bla(CTX-M genes are circulating in this bacterial population in this location. Sequence of one of the ESBL plasmids shows that rather than the gene being integrated into a preexisting MDR plasmid, the bla(CTX-M gene is located on relatively simple conjugative plasmid. The sequenced plasmid (pEG356 carried the bla(CTX-M-24 gene on an ISEcp1 element and demonstrated considerable sequence homology with other IncFI plasmids.The rapid dissemination, spread of antimicrobial resistance and changing population of Shigella spp. concurrent with economic growth are pertinent to many other countries undergoing similar development. Third generation cephalosporins are commonly used empiric antibiotics in Ho Chi Minh City. We recommend that these agents should not be considered for therapy of dysentery in this setting.

  9. Plasmid Complement of Lactococcus lactis NCDO712 Reveals a Novel Pilus Gene Cluster.

    Science.gov (United States)

    Tarazanova, Mariya; Beerthuyzen, Marke; Siezen, Roland; Fernandez-Gutierrez, Marcela M; de Jong, Anne; van der Meulen, Sjoerd; Kok, Jan; Bachmann, Herwig

    2016-01-01

    Lactococcus lactis MG1363 is an important gram-positive model organism. It is a plasmid-free and phage-cured derivative of strain NCDO712. Plasmid-cured strains facilitate studies on molecular biological aspects, but many properties which make L. lactis an important organism in the dairy industry are plasmid encoded. We sequenced the total DNA of strain NCDO712 and, contrary to earlier reports, revealed that the strain carries 6 rather than 5 plasmids. A new 50-kb plasmid, designated pNZ712, encodes functional nisin immunity (nisCIP) and copper resistance (lcoRSABC). The copper resistance could be used as a marker for the conjugation of pNZ712 to L. lactis MG1614. A genome comparison with the plasmid cured daughter strain MG1363 showed that the number of single nucleotide polymorphisms that accumulated in the laboratory since the strains diverted more than 30 years ago is limited to 11 of which only 5 lead to amino acid changes. The 16-kb plasmid pSH74 was found to contain a novel 8-kb pilus gene cluster spaCB-spaA-srtC1-srtC2, which is predicted to encode a pilin tip protein SpaC, a pilus basal subunit SpaB, and a pilus backbone protein SpaA. The sortases SrtC1/SrtC2 are most likely involved in pilus polymerization while the chromosomally encoded SrtA could act to anchor the pilus to peptidoglycan in the cell wall. Overexpression of the pilus gene cluster from a multi-copy plasmid in L. lactis MG1363 resulted in cell chaining, aggregation, rapid sedimentation and increased conjugation efficiency of the cells. Electron microscopy showed that the over-expression of the pilus gene cluster leads to appendices on the cell surfaces. A deletion of the gene encoding the putative basal protein spaB, by truncating spaCB, led to more pilus-like structures on the cell surface, but cell aggregation and cell chaining were no longer observed. This is consistent with the prediction that spaB is involved in the anchoring of the pili to the cell.

  10. Plasmid Flux in Escherichia coli ST131 Sublineages, Analyzed by Plasmid Constellation Network (PLACNET), a New Method for Plasmid Reconstruction from Whole Genome Sequences

    Science.gov (United States)

    Garcillán-Barcia, M. Pilar; Mora, Azucena; Blanco, Jorge; Coque, Teresa M.; de la Cruz, Fernando

    2014-01-01

    Bacterial whole genome sequence (WGS) methods are rapidly overtaking classical sequence analysis. Many bacterial sequencing projects focus on mobilome changes, since macroevolutionary events, such as the acquisition or loss of mobile genetic elements, mainly plasmids, play essential roles in adaptive evolution. Existing WGS analysis protocols do not assort contigs between plasmids and the main chromosome, thus hampering full analysis of plasmid sequences. We developed a method (called plasmid constellation networks or PLACNET) that identifies, visualizes and analyzes plasmids in WGS projects by creating a network of contig interactions, thus allowing comprehensive plasmid analysis within WGS datasets. The workflow of the method is based on three types of data: assembly information (including scaffold links and coverage), comparison to reference sequences and plasmid-diagnostic sequence features. The resulting network is pruned by expert analysis, to eliminate confounding data, and implemented in a Cytoscape-based graphic representation. To demonstrate PLACNET sensitivity and efficacy, the plasmidome of the Escherichia coli lineage ST131 was analyzed. ST131 is a globally spread clonal group of extraintestinal pathogenic E. coli (ExPEC), comprising different sublineages with ability to acquire and spread antibiotic resistance and virulence genes via plasmids. Results show that plasmids flux in the evolution of this lineage, which is wide open for plasmid exchange. MOBF12/IncF plasmids were pervasive, adding just by themselves more than 350 protein families to the ST131 pangenome. Nearly 50% of the most frequent γ–proteobacterial plasmid groups were found to be present in our limited sample of ten analyzed ST131 genomes, which represent the main ST131 sublineages. PMID:25522143

  11. Plasmid flux in Escherichia coli ST131 sublineages, analyzed by plasmid constellation network (PLACNET), a new method for plasmid reconstruction from whole genome sequences.

    Science.gov (United States)

    Lanza, Val F; de Toro, María; Garcillán-Barcia, M Pilar; Mora, Azucena; Blanco, Jorge; Coque, Teresa M; de la Cruz, Fernando

    2014-12-01

    Bacterial whole genome sequence (WGS) methods are rapidly overtaking classical sequence analysis. Many bacterial sequencing projects focus on mobilome changes, since macroevolutionary events, such as the acquisition or loss of mobile genetic elements, mainly plasmids, play essential roles in adaptive evolution. Existing WGS analysis protocols do not assort contigs between plasmids and the main chromosome, thus hampering full analysis of plasmid sequences. We developed a method (called plasmid constellation networks or PLACNET) that identifies, visualizes and analyzes plasmids in WGS projects by creating a network of contig interactions, thus allowing comprehensive plasmid analysis within WGS datasets. The workflow of the method is based on three types of data: assembly information (including scaffold links and coverage), comparison to reference sequences and plasmid-diagnostic sequence features. The resulting network is pruned by expert analysis, to eliminate confounding data, and implemented in a Cytoscape-based graphic representation. To demonstrate PLACNET sensitivity and efficacy, the plasmidome of the Escherichia coli lineage ST131 was analyzed. ST131 is a globally spread clonal group of extraintestinal pathogenic E. coli (ExPEC), comprising different sublineages with ability to acquire and spread antibiotic resistance and virulence genes via plasmids. Results show that plasmids flux in the evolution of this lineage, which is wide open for plasmid exchange. MOBF12/IncF plasmids were pervasive, adding just by themselves more than 350 protein families to the ST131 pangenome. Nearly 50% of the most frequent γ-proteobacterial plasmid groups were found to be present in our limited sample of ten analyzed ST131 genomes, which represent the main ST131 sublineages.

  12. Plasmid flux in Escherichia coli ST131 sublineages, analyzed by plasmid constellation network (PLACNET, a new method for plasmid reconstruction from whole genome sequences.

    Directory of Open Access Journals (Sweden)

    Val F Lanza

    2014-12-01

    Full Text Available Bacterial whole genome sequence (WGS methods are rapidly overtaking classical sequence analysis. Many bacterial sequencing projects focus on mobilome changes, since macroevolutionary events, such as the acquisition or loss of mobile genetic elements, mainly plasmids, play essential roles in adaptive evolution. Existing WGS analysis protocols do not assort contigs between plasmids and the main chromosome, thus hampering full analysis of plasmid sequences. We developed a method (called plasmid constellation networks or PLACNET that identifies, visualizes and analyzes plasmids in WGS projects by creating a network of contig interactions, thus allowing comprehensive plasmid analysis within WGS datasets. The workflow of the method is based on three types of data: assembly information (including scaffold links and coverage, comparison to reference sequences and plasmid-diagnostic sequence features. The resulting network is pruned by expert analysis, to eliminate confounding data, and implemented in a Cytoscape-based graphic representation. To demonstrate PLACNET sensitivity and efficacy, the plasmidome of the Escherichia coli lineage ST131 was analyzed. ST131 is a globally spread clonal group of extraintestinal pathogenic E. coli (ExPEC, comprising different sublineages with ability to acquire and spread antibiotic resistance and virulence genes via plasmids. Results show that plasmids flux in the evolution of this lineage, which is wide open for plasmid exchange. MOBF12/IncF plasmids were pervasive, adding just by themselves more than 350 protein families to the ST131 pangenome. Nearly 50% of the most frequent γ-proteobacterial plasmid groups were found to be present in our limited sample of ten analyzed ST131 genomes, which represent the main ST131 sublineages.

  13. The Plasmid Complement of Lactococcus lactis UC509.9 Encodes Multiple Bacteriophage Resistance Systems

    Science.gov (United States)

    Ainsworth, Stuart; Mahony, Jennifer

    2014-01-01

    Lactococcus lactis subsp. cremoris strains are used globally for the production of fermented dairy products, particularly hard cheeses. Believed to be of plant origin, L. lactis strains that are used as starter cultures have undergone extensive adaptation to the dairy environment, partially through the acquisition of extrachromosomal DNA in the form of plasmids that specify technologically important phenotypic traits. Here, we present a detailed analysis of the eight plasmids of L. lactis UC509.9, an Irish dairy starter strain. Key industrial phenotypes were mapped, and genes that are typically associated with lactococcal plasmids were identified. Four distinct, plasmid-borne bacteriophage resistance systems were identified, including two abortive infection systems, AbiB and AbiD1, thereby supporting the observed phage resistance of L. lactis UC509.9. AbiB escape mutants were generated for phage sk1, which were found to carry mutations in orf6, which encodes the major capsid protein of this phage. PMID:24814781

  14. Ecological and genetic determinants of plasmid distribution in Escherichia coli.

    Science.gov (United States)

    Medaney, Frances; Ellis, Richard J; Raymond, Ben

    2016-11-01

    Bacterial plasmids are important carriers of virulence and antibiotic resistance genes. Nevertheless, little is known of the determinants of plasmid distribution in bacterial populations. Here the factors affecting the diversity and distribution of the large plasmids of Escherichia coli were explored in cattle grazing on semi-natural grassland, a set of populations with low frequencies of antibiotic resistance genes. Critically, the population genetic structure of bacterial hosts was chararacterized. This revealed structured E. coli populations with high diversity between sites and individuals but low diversity within cattle hosts. Plasmid profiles, however, varied considerably within the same E. coli genotype. Both ecological and genetic factors affected plasmid distribution: plasmid profiles were affected by site, E. coli diversity, E. coli genotype and the presence of other large plasmids. Notably 3/26 E. coli serotypes accounted for half the observed plasmid-free isolates indicating that within species variation can substantially affect carriage of the major conjugative plasmids. The observed population structure suggest that most of the opportunities for within species plasmid transfer occur between different individuals of the same genotype and support recent experimental work indicating that plasmid-host coevolution, and epistatic interactions on fitness costs are likely to be important in determining occupancy. © 2016 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.

  15. Covalently bound DNA on naked iron oxide nanoparticles: Intelligent colloidal nano-vector for cell transfection.

    Science.gov (United States)

    Magro, Massimiliano; Martinello, Tiziana; Bonaiuto, Emanuela; Gomiero, Chiara; Baratella, Davide; Zoppellaro, Giorgio; Cozza, Giorgio; Patruno, Marco; Zboril, Radek; Vianello, Fabio

    2017-11-01

    Conversely to common coated iron oxide nanoparticles, novel naked surface active maghemite nanoparticles (SAMNs) can covalently bind DNA. Plasmid (pDNA) harboring the coding gene for GFP was directly chemisorbed onto SAMNs, leading to a novel DNA nanovector (SAMN@pDNA). The spontaneous internalization of SAMN@pDNA into cells was compared with an extensively studied fluorescent SAMN derivative (SAMN@RITC). Moreover, the transfection efficiency of SAMN@pDNA was evaluated and explained by computational model. SAMN@pDNA was prepared and characterized by spectroscopic and computational methods, and molecular dynamic simulation. The size and hydrodynamic properties of SAMN@pDNA and SAMN@RITC were studied by electron transmission microscopy, light scattering and zeta-potential. The two nanomaterials were tested by confocal scanning microscopy on equine peripheral blood-derived mesenchymal stem cells (ePB-MSCs) and GFP expression by SAMN@pDNA was determined. Nanomaterials characterized by similar hydrodynamic properties were successfully internalized and stored into mesenchymal stem cells. Transfection by SAMN@pDNA occurred and GFP expression was higher than lipofectamine procedure, even in the absence of an external magnetic field. A computational model clarified that transfection efficiency can be ascribed to DNA availability inside cells. Direct covalent binding of DNA on naked magnetic nanoparticles led to an extremely robust gene delivery tool. Hydrodynamic and chemical-physical properties of SAMN@pDNA were responsible of the successful uptake by cells and of the efficiency of GFP gene transfection. SAMNs are characterized by colloidal stability, excellent cell uptake, persistence in the host cells, low toxicity and are proposed as novel intelligent DNA nanovectors for efficient cell transfection. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Y Chromosome DNA in Women's Vaginal Samples as a Biomarker of Recent Vaginal Sex and Condom Use With Male Partners in the HPV Infection and Transmission Among Couples Through Heterosexual Activity Cohort Study.

    Science.gov (United States)

    Malagón, Talía; Burchell, Ann; El-Zein, Mariam; Guénoun, Julie; Tellier, Pierre-Paul; Coutlée, François; Franco, Eduardo L

    2018-01-01

    Y chromosome DNA from male epithelial and sperm cells was detected in vaginal samples after unprotected sex in experimental studies. We assessed the strength of this association in an observational setting to examine the utility of Y chromosome DNA as a biomarker of recent sexual behaviors in epidemiological studies. The HPV (human papillomavirus) Infection and Transmission Among Couples Through Heterosexual Activity cohort study enrolled 502 women attending a university or college in Montréal, Canada, and their male partners from 2005 to 2010. Participants completed self-administered questionnaires. We used real-time polymerase chain reaction to test women's baseline vaginal samples for Y chromosome DNA and assessed which sexual behaviors were independent predictors of Y chromosome DNA positivity and quantity with logistic and negative binomial regression. Y chromosome DNA positivity decreased from 77% in women in partnerships reporting vaginal sex 0 to 1 day ago to 13% in women in partnerships reporting last vaginal sex of 15 or more days ago (adjusted odds ratio, 0.09; 95% confidence interval, 0.02-0.36). The mean proportion of exfoliated vaginal sample cells with Y chromosome DNA was much lower for women who reported always using condoms (0.01%) than for women who reported never using condoms (2.07%) (adjusted ratio, 26.8; 95% confidence interval, 8.9-80.5). No association was found with reported oral/digital sex frequency or concurrency of partnerships. Y chromosome DNA quantity is strongly associated with days since last vaginal sex and lack of condom use in observational settings. Y chromosome DNA quantity may prove useful as a correlate of recent vaginal sex in observational studies lacking data on sexual behavior, such as surveillance studies of human papillomavirus infection prevalence.

  17. Effects of radiation on DNA

    International Nuclear Information System (INIS)

    Braddock, M.

    1985-07-01

    The hydroxyl radical (OH radical) is the most damaging radical produced by the effect of ionizing radiation in water. The rate of reaction of the OH radical with purified, native and isodisperse DNA has been determined as compared with calf thymus DNA. This has been achieved by direct observation of the rate of formation of the DNA-OH radical adduct, and by competition with SCN - . Results obtained from direct observation are consistent with calculations which have been performed using the encounter frequency model of Braams and Ebert. However, results obtained for OH radical with DNA derived from competition plots suggest a rate constant somewhat lower than that obtained from direct observation. The relative merits of both techniques are discussed. In order to study the effect of energy deposited directly in the DNA, dry films of purified plasmid DNA have been irradiated in a system where the indirect effects of radical interaction have been minimized. The present results indicate that with different molecular lengths of plasmid DNA, non-random breakage may occur, and that additional damage may be brought about at sites of previously existing damage. Differences in the sensitivity of plasmid DNA molecules of varying lengths to radiation induced double strand breaks have been demonstrated. (author)

  18. A fresh method of DNA transformation to the seeds irradiated by Co ...

    African Journals Online (AJOL)

    Jane

    2011-06-29

    Jun 29, 2011 ... To find out a simpler method that can directly transfer the aim gene into plant ... Key words: DNA transformation, irradiated seeds, purple medic, salt screening. ..... characterization of a maize mitochondrial plasmid-like DNA.

  19. Radioprotection against DNA damage by an extract of Indian green mussel, Perna viridis (L.)

    Digital Repository Service at National Institute of Oceanography (India)

    Kumaran, S.P.; Kutty, B.C.; Chatterji, A.; Parameswaran, P.S.; Mishra, K.P.

    -irradiation Prevention of DNA damage both in plasmid and lymphocytes and cell death in lymphocytes appears correlated with reduction of oxidatively generated free radicals It is concluded that protection against radiation-induced cell death and DNA damage by MH...

  20. Construction of a recombinant eukaryotic human ZHX1 gene expression plasmid and the role of ZHX1 in hepatocellular carcinoma.

    Science.gov (United States)

    Wang, Jianping; Liu, Dejie; Liang, Xiaohong; Gao, Lifen; Yue, Xuetian; Yang, Yang; Ma, Chunhong; Liu, Jun

    2013-11-01

    The zinc-fingers and homeoboxes protein 1 (ZHX1) consists of 873 amino acid residues, is localized in the cell nucleus and appears to act as a transcriptional repressor. Previous studies have shown that ZHX1 interacts with nuclear factor Y subunit α (NF-YA), DNA methyltransferases (DNMT) 3B and ZHX2, all of which are involved in tumorigenesis. However, the exact role of ZHX1 in tumorigenesis remains unknown. The aim of the current study was to construct a recombinant eukaryotic expression plasmid containing the human ZHX1 (hZHX1) gene and to investigate the biological activities of ZHX1 in hepatocellular carcinoma (HCC). Reverse transcription-polymerase chain reaction (RT‑PCR) was used to amplify the N- and C-terminal fragments (ZHX1‑N and ZHX1‑C, respectively) of the hZHX1 gene. The two PCR fragments were cloned into the pEASY-T1 vector and subcloned into the pcDNA3 plasmid to generate a recombinant pcDNA3‑ZHX1 plasmid. Following identification by enzyme digestion and DNA sequencing, the recombinant pcDNA3‑ZHX1 plasmid was transfected into SMMC-7721 cells. The level of ZHX1 expression was detected by RT-PCR and western blot analysis. Cell growth curve assays were used to evaluate the effect of ZHX1 on cell proliferation. Moreover, the differential expression of ZHX1 between cancer and adjacent cirrhotic liver tissue was investigated by quantitative PCR (qPCR). Enzyme digestion and DNA sequencing confirmed the successful construction of the recombinant plasmid, pcDNA3‑ZHX1. qPCR and western blot analysis demonstrated that ZHX1 was efficiently expressed in SMMC-7721 cells and overexpression of ZHX1 may inhibit the proliferation of SMMC-7721 cells. In addition, reduced ZHX1 expression is widespread among cancer tissues from HCC patients. In conclusion, a recombinant eukaryotic expression plasmid, pcDNA3‑ZHX1, was successfully constructed. In addition, the current results indicate that a low expression of ZHX1 may be responsible for hepatocarcinogenesis.

  1. Interplay of a non-conjugative integrative element and a conjugative plasmid in the spread of antibiotic resistance via suicidal plasmid transfer from an aquaculture Vibrio isolate.

    Science.gov (United States)

    Nonaka, Lisa; Yamamoto, Tatsuya; Maruyama, Fumito; Hirose, Yuu; Onishi, Yuki; Kobayashi, Takeshi; Suzuki, Satoru; Nomura, Nobuhiko; Masuda, Michiaki; Yano, Hirokazu

    2018-01-01

    The capture of antimicrobial resistance genes (ARGs) by mobile genetic elements (MGEs) plays a critical role in resistance acquisition for human-associated bacteria. Although aquaculture environments are recognized as important reservoirs of ARGs, intra- and intercellular mobility of MGEs discovered in marine organisms is poorly characterized. Here, we show a new pattern of interspecies ARGs transfer involving a 'non-conjugative' integrative element. To identify active MGEs in a Vibrio ponticus isolate, we conducted whole-genome sequencing of a transconjugant obtained by mating between Escherichia coli and Vibrio ponticus. This revealed integration of a plasmid (designated pSEA1) into the chromosome, consisting of a self-transmissible plasmid backbone of the MOBH group, ARGs, and a 13.8-kb integrative element Tn6283. Molecular genetics analysis suggested a two-step gene transfer model. First, Tn6283 integrates into the recipient chromosome during suicidal plasmid transfer, followed by homologous recombination between the Tn6283 copy in the chromosome and that in the newly transferred pSEA1. Tn6283 is unusual among integrative elements in that it apparently does not encode transfer function and its excision barely generates unoccupied donor sites. Thus, its movement is analogous to the transposition of insertion sequences rather than to that of canonical integrative and conjugative elements. Overall, this study reveals the presence of a previously unrecognized type of MGE in a marine organism, highlighting diversity in the mode of interspecies gene transfer.

  2. Association and Expression of Virulence from Plasmids of the Group B Strain in Pseudomonas syringae pv. eriobotryae

    Directory of Open Access Journals (Sweden)

    Tran Dang Khanh

    2018-04-01

    Full Text Available Pseudomonas syringae pv. eriobotryae causes serious stem canker in loquat (Eriobotrya japonica trees. This study was conducted to determine whether plasmids are involved with its virulence. The strain NAE89, which belonged to the B group, harbored two plasmids at approximately 6.2 and 50 Mdal that caused stem canker and halo leaf spots on loquat plants. Following digestion with BamHI and ligation into the BamHI cloning site of the broad range host cosmid pLAFR3, four DNA fragments at 3.8, 6.6, 12.3, and 22.8 kb were generated. Although the plasmid-encoded virulence gene psvA was undigested with the BamHI, the halo leaf spot gene may be adjacent to the psvA gene was digested. A pLAFR3 cosmid clone was introduced into the non-pathogenic PE0 and NAE89-1 strains by triparental matings and the pathogenicity was recovered. As a result, the pLAFR3 cosmid clone was introduced into the largest size DNA fragment of 22.8 kb and determined to be the causal agent of canker on the stem of the loquat. This study revealed that the psvA gene, previously found in the 50 Mdal plasmid, was also observed in the 22.8 kb DNA fragment.

  3. CARTOGRAPHIE DU PLASMIDE pSU100, PLASMIDE CRYPTIQUE DE LACTOBACILLUS CASEI

    Directory of Open Access Journals (Sweden)

    F BENSALAH

    2003-06-01

    Ce plasmide appelé pSU100 a été cloné dans le vecteur de transformation pUC18 au site EcoRI chez E. coli JM103. Les profils électrophorétiques de restriction obtenus par des digestions simples, doubles et triples sous l’action de 33 endonucléases, ont contribué à l’élaboration d’une carte de restriction de ce plasmide. Cinq sites uniques ont été identifiés, ainsi que d’autres sites doubles et multiples. Une étude préliminaire du rôle physiologique de ce plasmide a permis de déceler une résistance à la kanamycine.

  4. Dealing with the evolutionary downside of CRISPR immunity: bacteria and beneficial plasmids.

    Directory of Open Access Journals (Sweden)

    Wenyan Jiang

    Full Text Available The immune systems that protect organisms from infectious agents invariably have a cost for the host. In bacteria and archaea CRISPR-Cas loci can serve as adaptive immune systems that protect these microbes from infectiously transmitted DNAs. When those DNAs are borne by lytic viruses (phages, this protection can provide a considerable advantage. CRISPR-Cas immunity can also prevent cells from acquiring plasmids and free DNA bearing genes that increase their fitness. Here, we use a combination of experiments and mathematical-computer simulation models to explore this downside of CRISPR-Cas immunity and its implications for the maintenance of CRISPR-Cas loci in microbial populations. We analyzed the conjugational transfer of the staphylococcal plasmid pG0400 into Staphylococcus epidermidis RP62a recipients that bear a CRISPR-Cas locus targeting this plasmid. Contrary to what is anticipated for lytic phages, which evade CRISPR by mutations in the target region, the evasion of CRISPR immunity by plasmids occurs at the level of the host through loss of functional CRISPR-Cas immunity. The results of our experiments and models indicate that more than 10(-4 of the cells in CRISPR-Cas positive populations are defective or deleted for the CRISPR-Cas region and thereby able to receive and carry the plasmid. Most intriguingly, the loss of CRISPR function even by large deletions can have little or no fitness cost in vitro. These theoretical and experimental results can account for the considerable variation in the existence, number and function of CRISPR-Cas loci within and between bacterial species. We postulate that as a consequence of the opposing positive and negative selection for immunity, CRISPR-Cas systems are in a continuous state of flux. They are lost when they bear immunity to laterally transferred beneficial genes, re-acquired by horizontal gene transfer, and ascend in environments where phage are a major source of mortality.

  5. Quantifying and resolving multiple vector transformants in S. cerevisiae plasmid libraries.

    Science.gov (United States)

    Scanlon, Thomas C; Gray, Elizabeth C; Griswold, Karl E

    2009-11-20

    In addition to providing the molecular machinery for transcription and translation, recombinant microbial expression hosts maintain the critical genotype-phenotype link that is essential for high throughput screening and recovery of proteins encoded by plasmid libraries. It is known that Escherichia coli cells can be simultaneously transformed with multiple unique plasmids and thusly complicate recombinant library screening experiments. As a result of their potential to yield misleading results, bacterial multiple vector transformants have been thoroughly characterized in previous model studies. In contrast to bacterial systems, there is little quantitative information available regarding multiple vector transformants in yeast. Saccharomyces cerevisiae is the most widely used eukaryotic platform for cell surface display, combinatorial protein engineering, and other recombinant library screens. In order to characterize the extent and nature of multiple vector transformants in this important host, plasmid-born gene libraries constructed by yeast homologous recombination were analyzed by DNA sequencing. It was found that up to 90% of clones in yeast homologous recombination libraries may be multiple vector transformants, that on average these clones bear four or more unique mutant genes, and that these multiple vector cells persist as a significant proportion of library populations for greater than 24 hours during liquid outgrowth. Both vector concentration and vector to insert ratio influenced the library proportion of multiple vector transformants, but their population frequency was independent of transformation efficiency. Interestingly, the average number of plasmids born by multiple vector transformants did not vary with their library population proportion. These results highlight the potential for multiple vector transformants to dominate yeast libraries constructed by homologous recombination. The previously unrecognized prevalence and persistence of multiply

  6. Quantifying and resolving multiple vector transformants in S. cerevisiae plasmid libraries

    Directory of Open Access Journals (Sweden)

    Gray Elizabeth C

    2009-11-01

    Full Text Available Abstract Background In addition to providing the molecular machinery for transcription and translation, recombinant microbial expression hosts maintain the critical genotype-phenotype link that is essential for high throughput screening and recovery of proteins encoded by plasmid libraries. It is known that Escherichia coli cells can be simultaneously transformed with multiple unique plasmids and thusly complicate recombinant library screening experiments. As a result of their potential to yield misleading results, bacterial multiple vector transformants have been thoroughly characterized in previous model studies. In contrast to bacterial systems, there is little quantitative information available regarding multiple vector transformants in yeast. Saccharomyces cerevisiae is the most widely used eukaryotic platform for cell surface display, combinatorial protein engineering, and other recombinant library screens. In order to characterize the extent and nature of multiple vector transformants in this important host, plasmid-born gene libraries constructed by yeast homologous recombination were analyzed by DNA sequencing. Results It was found that up to 90% of clones in yeast homologous recombination libraries may be multiple vector transformants, that on average these clones bear four or more unique mutant genes, and that these multiple vector cells persist as a significant proportion of library populations for greater than 24 hours during liquid outgrowth. Both vector concentration and vector to insert ratio influenced the library proportion of multiple vector transformants, but their population frequency was independent of transformation efficiency. Interestingly, the average number of plasmids born by multiple vector transformants did not vary with their library population proportion. Conclusion These results highlight the potential for multiple vector transformants to dominate yeast libraries constructed by homologous recombination. The

  7. Effect of 8-MOP plus UVA treatment on survival and repair of plasmid pBR322

    International Nuclear Information System (INIS)

    Bauluz, C.; Vidania, R. de

    1991-01-01

    We have studied the lethality produced in pBR322 DNA after PUVA treatment (8-MOP+UVA). As recipients, we used a collection of E. coli strains differing in their repair capacities and analysed the involvement of several DNA repair pathways in the removal of plasmid lesions. We have also studied the effect of UVA radiation alone, in order to determine more precisely the effect attributable only to psoralen molecules. Results showed a strong lethal effect derived from PUVA treatment; however, some plasmid recovery was achieved in bacterial hosts proficient in Excision repair and SOS repair. Another repair pathway, only detectable at high density of lesions, appeared to be relevant for the removal of 8-MOP:DNA adducts.(Author) 11 refs

  8. Characterization of replication and conjugation of plasmid pWTY27 from a widely distributed Streptomyces species

    Directory of Open Access Journals (Sweden)

    Wang Tao

    2012-11-01

    Full Text Available Abstract Background Streptomyces species are widely distributed in natural habitats, such as soils, lakes, plants and some extreme environments. Replication loci of several Streptomyces theta-type plasmids have been reported, but are not characterized in details. Conjugation loci of some Streptomyces rolling-circle-type plasmids are identified and mechanism of conjugal transferring are described. Results We report the detection of a widely distributed Streptomyces strain Y27 and its indigenous plasmid pWTY27 from fourteen plants and four soil samples cross China by both culturing and nonculturing methods. The complete nucleotide sequence of pWTY27 consisted of 14,288 bp. A basic locus for plasmid replication comprised repAB genes and an adjacent iteron sequence, to a long inverted-repeat (ca. 105 bp of which the RepA protein bound specifically in vitro, suggesting that RepA may recognize a second structure (e.g. a long stem-loop of the iteron DNA. A plasmid containing the locus propagated in linear mode when the telomeres of a linear plasmid were attached, indicating a bi-directional replication mode for pWTY27. As for rolling-circle plasmids, a single traA gene and a clt sequence (covering 16 bp within traA and its adjacent 159 bp on pWTY27 were required for plasmid transfer. TraA recognized and bound specifically to the two regions of the clt sequence, one containing all the four DC1 of 7 bp (TGACACC and one DC2 (CCCGCCC and most of IC1, and another covering two DC2 and part of IC1, suggesting formation of a high-ordered DNA-protein complex. Conclusions This work (i isolates a widespread Streptomyces strain Y27 and sequences its indigenous theta-type plasmid pWTY27; (ii identifies the replication and conjugation loci of pWTY27 and; (iii characterizes the binding sequences of the RepA and TraA proteins.

  9. Characterization of replication and conjugation of plasmid pWTY27 from a widely distributed Streptomyces species

    Science.gov (United States)

    2012-01-01

    Background Streptomyces species are widely distributed in natural habitats, such as soils, lakes, plants and some extreme environments. Replication loci of several Streptomyces theta-type plasmids have been reported, but are not characterized in details. Conjugation loci of some Streptomyces rolling-circle-type plasmids are identified and mechanism of conjugal transferring are described. Results We report the detection of a widely distributed Streptomyces strain Y27 and its indigenous plasmid pWTY27 from fourteen plants and four soil samples cross China by both culturing and nonculturing methods. The complete nucleotide sequence of pWTY27 consisted of 14,288 bp. A basic locus for plasmid replication comprised repAB genes and an adjacent iteron sequence, to a long inverted-repeat (ca. 105 bp) of which the RepA protein bound specifically in vitro, suggesting that RepA may recognize a second structure (e.g. a long stem-loop) of the iteron DNA. A plasmid containing the locus propagated in linear mode when the telomeres of a linear plasmid were attached, indicating a bi-directional replication mode for pWTY27. As for rolling-circle plasmids, a single traA gene and a clt sequence (covering 16 bp within traA and its adjacent 159 bp) on pWTY27 were required for plasmid transfer. TraA recognized and bound specifically to the two regions of the clt sequence, one containing all the four DC1 of 7 bp (TGACACC) and one DC2 (CCCGCCC) and most of IC1, and another covering two DC2 and part of IC1, suggesting formation of a high-ordered DNA-protein complex. Conclusions This work (i) isolates a widespread Streptomyces strain Y27 and sequences its indigenous theta-type plasmid pWTY27; (ii) identifies the replication and conjugation loci of pWTY27 and; (iii) characterizes the binding sequences of the RepA and TraA proteins. PMID:23134842

  10. Comparative Sequence Analysis of Plasmids from Lactobacillus delbrueckii and Construction of a Shuttle Cloning Vector▿

    Science.gov (United States)

    Lee, Ju-Hoon; Halgerson, Jamie S.; Kim, Jeong-Hwan; O'Sullivan, Daniel J.

    2007-01-01

    While plasmids are very commonly associated with the majority of the lactic acid bacteria, they are only very rarely associated with Lactobacillus delbrueckii, with only four characterized to date. In this study, the complete sequence of a native plasmid, pDOJ1, from a strain of Lactobacillus delbrueckii subsp. bulgaricus was determined. It consisted of a circular DNA molecule of 6,220 bp with a G+C content of 44.6% and a characteristic ori and encoded six open reading frames (ORFs), of which functions could be predicted for three—a mobilization (Mob) protein, a transposase, and a fused primase-helicase replication protein. Comparative analysis of pDOJ1 and the other available L. delbrueckii plasmids (pLBB1, pJBL2, pN42, and pLL1212) revealed a very similar organization and amino acid identities between 85 and 98% for the putative proteins of all six predicted ORFs from pDOJ1, reflecting a common origin for L. delbrueckii plasmids. Analysis of the fused primase-helicase replication gene found a similar fused organization only in the theta replicating group B plasmids from Streptococcus thermophilus. This observation and the ability of the replicon to function in S. thermophilus support the idea that the origin of plasmids in L. delbrueckii was likely from S. thermophilus. This may reflect the close association of these two species in dairy fermentations, particularly yogurt production. As no vector based on plasmid replicons from L. delbrueckii has previously been constructed, an Escherichia coli-L. delbrueckii shuttle cloning vector, pDOJ4, was constructed from pDOJ1, the p15A ori, the chloramphenicol resistance gene of pCI372, and the lacZ polylinker from pUC18. This cloning vector was successfully introduced into E. coli, L. delbrueckii subsp. bulgaricus, S. thermophilus, and Lactococcus lactis. This shuttle cloning vector provides a new tool for molecular analysis of Lactobacillus delbrueckii and other lactic acid bacteria. PMID:17526779

  11. Efficient Sleeping Beauty DNA Transposition From DNA Minicircles

    Directory of Open Access Journals (Sweden)

    Nynne Sharma

    2013-01-01

    Full Text Available DNA transposon-based vectors have emerged as new potential delivery tools in therapeutic gene transfer. Such vectors are now showing promise in hematopoietic stem cells and primary human T cells, and clinical trials with transposon-engineered cells are on the way. However, the use of plasmid DNA as a carrier of the vector raises safety concerns due to the undesirable administration of bacterial sequences. To optimize vectors based on the Sleeping Beauty (SB DNA transposon for clinical use, we examine here SB transposition from DNA minicircles (MCs devoid of the bacterial plasmid backbone. Potent DNA transposition, directed by the hyperactive SB100X transposase, is demonstrated from MC donors, and the stable transfection rate is significantly enhanced by expressing the SB100X transposase from MCs. The stable transfection rate is inversely related to the size of circular donor, suggesting that a MC-based SB transposition system benefits primarily from an increased cellular uptake and/or enhanced expression which can be observed with DNA MCs. DNA transposon and transposase MCs are easily produced, are favorable in size, do not carry irrelevant DNA, and are robust substrates for DNA transposition. In accordance, DNA MCs should become a standard source of DNA transposons not only in therapeutic settings but also in the daily use of the SB system.

  12. Circulation of a multiresistant, conjugative, IncA/C plasmid within the nosocomial Providencia stuartii population in the Athens area.

    Science.gov (United States)

    Giakkoupi, Panagiota; Tryfinopoulou, Kyriaki; Polemis, Michalis; Pappa, Olga; Miriagou, Vivi; Vatopoulos, Alkiviadis

    2015-05-01

    The objective of the study is to report a multidrug-resistant outbreak of Providencia stuartii that occurred in inpatients in the Athens area in 2012 resulting from a very successful transmissible A/C multidrug-resistant plasmid. Thirteen multidrug-resistant P. stuartii clinical isolates from 5 hospitals were studied. Molecular typing was performed by pulsed-field gel electrophoresis. Antibiotic resistance genes and their genetic surround were detected by PCR and sequencing. Plasmid analysis included conjugation experiments using liquid cultures, sizing by S1 digestion, and incompatibility replicon typing by PCR. Isolates were grouped into 2 distinct clonal types A and B, exhibiting similarity less than 70%. Isolates of type A were recovered from patients hospitalized in 4 different hospitals with no obvious epidemiological linkage, while isolates of type B were recovered from patients treated in a single hospital. Both clonal types harbored a conjugative plasmid of 130 bp and IncA/C replicon type carrying 5 β-lactamase genes bla(SHV-5), bla(VEB-1), bla(VIM-1), bla(OXA-10), and bla(TEM-1) and aminoglycosides resistant determinants. All β-lactamase genes were included in stable structures as IS26, IS1999, and In-e541. The current plasmid seemed to have many common determinants with previously reported plasmids derived from P. stuartii and Proteus mirabilis clinical isolates and exhibited the ability to circulate in nosocomial bacterial populations. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Evidence for the role of horizontal transfer in generating pVT1, a large mosaic conjugative plasmid from the clam pathogen, Vibrio tapetis.

    Directory of Open Access Journals (Sweden)

    Gaël Erauso

    Full Text Available The marine bacterium Vibrio tapetis is the causative agent of the brown ring disease, which affects the clam Ruditapes philippinarum and causes heavy economic losses in North of Europe and in Eastern Asia. Further characterization of V. tapetis isolates showed that all the investigated strains harbored at least one large plasmid. We determined the sequence of the 82,266 bp plasmid pVT1 from the CECT4600(T reference strain and analyzed its genetic content. pVT1 is a mosaic plasmid closely related to several conjugative plasmids isolated from Vibrio vulnificus strains and was shown to be itself conjugative in Vibrios. In addition, it contains DNA regions that have similarity with several other plasmids from marine bacteria (Vibrio sp., Shewanella sp., Listonella anguillarum and Photobacterium profundum. pVT1 contains a number of mobile elements, including twelve Insertion Sequences or inactivated IS genes and an RS1 phage element related to the CTXphi phage of V. cholerae. The genetic organization of pVT1 underscores an important role of horizontal gene transfer through conjugative plasmid shuffling and transposition events in the acquisition of new genetic resources and in generating the pVT1 modular organization. In addition, pVT1 presents a copy number of 9, relatively high for a conjugative plasmid, and appears to belong to a new type of replicon, which may be specific to Vibrionaceae and Shewanelleacae.

  14. Replicating animal mitochondrial DNA

    Directory of Open Access Journals (Sweden)

    Emily A. McKinney

    2013-01-01

    Full Text Available The field of mitochondrial DNA (mtDNA replication has been experiencing incredible progress in recent years, and yet little is certain about the mechanism(s used by animal cells to replicate this plasmid-like genome. The long-standing strand-displacement model of mammalian mtDNA replication (for which single-stranded DNA intermediates are a hallmark has been intensively challenged by a new set of data, which suggests that replication proceeds via coupled leading-and lagging-strand synthesis (resembling bacterial genome replication and/or via long stretches of RNA intermediates laid on the mtDNA lagging-strand (the so called RITOLS. The set of proteins required for mtDNA replication is small and includes the catalytic and accessory subunits of DNA polymerase y, the mtDNA helicase Twinkle, the mitochondrial single-stranded DNA-binding protein, and the mitochondrial RNA polymerase (which most likely functions as the mtDNA primase. Mutations in the genes coding for the first three proteins are associated with human diseases and premature aging, justifying the research interest in the genetic, biochemical and structural properties of the mtDNA replication machinery. Here we summarize these properties and discuss the current models of mtDNA replication in animal cells.

  15. Electroporation-based DNA delivery technology

    DEFF Research Database (Denmark)

    Gothelf, A; Gehl, Julie

    2014-01-01

    DNA delivery to for example skin and muscle can easily be performed with electroporation. The method is efficient, feasible, and inexpensive and the future possibilities are numerous. Here we present our protocol for gene transfection to mouse skin using naked plasmid DNA and electric pulses....

  16. Plasmids foster diversification and adaptation of bacterial populations in soil.

    Science.gov (United States)

    Heuer, Holger; Smalla, Kornelia

    2012-11-01

    It is increasingly being recognized that the transfer of conjugative plasmids across species boundaries plays a vital role in the adaptability of bacterial populations in soil. There are specific driving forces and constraints of plasmid transfer within bacterial communities in soils. Plasmid-mediated genetic variation allows bacteria to respond rapidly with adaptive responses to challenges such as irregular antibiotic or metal concentrations, or opportunities such as the utilization of xenobiotic compounds. Cultivation-independent detection and capture of plasmids from soil bacteria, and complete sequencing have provided new insights into the role and ecology of plasmids. Broad host range plasmids such as those belonging to IncP-1 transfer a wealth of accessory functions which are carried by similar plasmid backbones. Plasmids with a narrower host range can be more specifically adapted to particular species and often transfer genes which complement chromosomally encoded functions. Plasmids seem to be an ancient and successful strategy to ensure survival of a soil population in spatial and temporal heterogeneous conditions with various environmental stresses or opportunities that occur irregularly or as a novel challenge in soil. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  17. Permissiveness of soil microbial communities towards broad host range plasmids

    DEFF Research Database (Denmark)

    Klümper, Uli

    . Plasmids are implicated in the rapid spread of antibiotic resistance and the emergence of multi-resistant pathogenic bacteria, making it crucial to be able to quantify, understand, and, ideally, control plasmid transfer in mixed microbial communities. The fate of plasmids in microbial communities...... of microbial communities may be directly interconnected through transfer of BHR plasmids at a so far unrecognized level. The developed method furthermore enabled me to explore how agronomic practices may affect gene transfer in soil microbial communities. I compared bacterial communities extracted from plots...

  18. Characterization of IncN plasmids carrying blaCTX-M-1 and qnr genes in Escherichia coli and Salmonella from animals, the environment and humans

    DEFF Research Database (Denmark)

    Dolejska, Monika; Villa, Laura; Hasman, Henrik

    2013-01-01

    were compared using restriction fragment length polymorphism (RFLP), plasmid multilocus sequence typing (pMLST) and hybridization with repN, qnrS1, qnrB19 or blaCTX-M-1 probes. Plasmids pKT58A and pHHA45 were sequenced using the 454-Genome Sequencer FLX platform on a library constructed from plasmid...... DNA purified from the respective E. coli transformants.Results Three types of IncN plasmids carrying blaCTX-M-1, qnrS1 and qnrB19 genes were identified in strains isolated from the Czech Republic, Poland, Slovakia, Denmark, Italy and the Netherlands, corresponding to pMLST sequence type (ST) 1, ST3...

  19. The dose of HBV genome contained plasmid has a great impact on HBV persistence in hydrodynamic injection mouse model.

    Science.gov (United States)

    Li, Lei; Li, Sheng; Zhou, Yun; Yang, Lu; Zhou, Di; Yang, Yan; Lu, Mengji; Yang, Dongliang; Song, Jingjiao

    2017-10-25

    Hydrodynamic injection (HI) of hepatitis B virus (HBV) mouse model is an useful tool for HBV related research in vivo. However, only 40% of C57/BL6 mice injected with 10 μg HBV genome contained plasmid (pAAV-HBV1.2), serum HBsAg more than 6 months and none of the BALB/c mice injected with 10 μg pAAV-HBV1.2 plasmid DNA, serum HBsAg positive more than 4 weeks in the previous study. In this study, C57/BL6 and BALB/c mice were hydrodynamic injected with different doses of pAAV-HBV1.2 plasmid DNA. HBV related serum markers were detected by ELISA. ALT levels in the serum were measured using full automated biochemistry analyzer. HBcAg positive cells in the liver were detected by immunohistochemical staining. The mRNA levels of IRF3, ISGs including ISG15, OAS, PKR and immune factors including IFNγ, TNFα, TGFβ, IL-6, IL-10, PDL1 in liver of the mice were quantified by qRT-PCR. The results showed that the mice injected with 100 μg high-concentration or 1 μg low-concentration of pAAV-HBV1.2 plasmid DNA did not excert dominant influence on HBV persistence. In contrast, injection of 5 μg intermediate-dose of pAAV-HBV1.2 plasmid DNA led to significant prolonged HBsAg expression and HBV persistence in both C57/BL6 (80% of the mice with HBsAg positive more than 6 months) and BALB/c (60% of the mice with HBsAg positive more than 3 months) mice. IFNγ was significant up-regulated in liver of the mice injected with 1 μg or 100 μg pAAV-HBV1.2 plasmid DNA. TNFα was up-regulated significantly in liver of the mice injected with 100 μg pAAV-HBV1.2 plasmid DNA. Moreover, PDL1 was significant up-regulated in liver of the mice injected with 5 μg pAAV-HBV1.2 plasmid DNA. In this paper we demonstrated that, in the HBV HI mouse model, the concentration of injected pAAV-HBV1.2 plasmid DNA contributes to the diverse kinetics of HBsAg and HBeAg in the serum as well as HBcAg expression level in the liver, which then determined the HBV persisternce, while the antiviral

  20. CRISPR-spacer integration reporter plasmids reveal distinct genuine acquisition specificities among CRISPR-Cas I-E variants of Escherichia coli.

    Science.gov (United States)

    Díez-Villaseñor, César; Guzmán, Noemí M; Almendros, Cristóbal; García-Martínez, Jesús; Mojica, Francisco J M

    2013-05-01

    Prokaryotes immunize themselves against transmissible genetic elements by the integration (acquisition) in clustered regularly interspaced short palindromic repeats (CRISPR) loci of spacers homologous to invader nucleic acids, defined as protospacers. Following acquisition, mono-spacer CRISPR RNAs (termed crRNAs) guide CRISPR-associated (Cas) proteins to degrade (interference) protospacers flanked by an adjacent motif in extrachomosomal DNA. During acquisition, selection of spacer-precursors adjoining the protospacer motif and proper orientation of the integrated fragment with respect to the leader (sequence leading transcription of the flanking CRISPR array) grant efficient interference by at least some CRISPR-Cas systems. This adaptive stage of the CRISPR action is poorly characterized, mainly due to the lack of appropriate genetic strategies to address its study and, at least in Escherichia coli, the need of Cas overproduction for insertion detection. In this work, we describe the development and application in Escherichia coli strains of an interference-independent assay based on engineered selectable CRISPR-spacer integration reporter plasmids. By using this tool without the constraint of interference or cas overexpression, we confirmed fundamental aspects of this process such as the critical requirement of Cas1 and Cas2 and the identity of the CTT protospacer motif for the E. coli K12 system. In addition, we defined the CWT motif for a non-K12 CRISPR-Cas variant, and obtained data supporting the implication of the leader in spacer orientation, the preferred acquisition from plasmids harboring cas genes and the occurrence of a sequential cleavage at the insertion site by a ruler mechanism.

  1. CRISPR-spacer integration reporter plasmids reveal distinct genuine acquisition specificities among CRISPR-Cas I-E variants of Escherichia coli

    Science.gov (United States)

    Díez-Villaseñor, César; Guzmán, Noemí M.; Almendros, Cristóbal; García-Martínez, Jesús; Mojica, Francisco J.M.

    2013-01-01

    Prokaryotes immunize themselves against transmissible genetic elements by the integration (acquisition) in clustered regularly interspaced short palindromic repeats (CRISPR) loci of spacers homologous to invader nucleic acids, defined as protospacers. Following acquisition, mono-spacer CRISPR RNAs (termed crRNAs) guide CRISPR-associated (Cas) proteins to degrade (interference) protospacers flanked by an adjacent motif in extrachomosomal DNA. During acquisition, selection of spacer-precursors adjoining the protospacer motif and proper orientation of the integrated fragment with respect to the leader (sequence leading transcription of the flanking CRISPR array) grant efficient interference by at least some CRISPR-Cas systems. This adaptive stage of the CRISPR action is poorly characterized, mainly due to the lack of appropriate genetic strategies to address its study and, at least in Escherichia coli, the need of Cas overproduction for insertion detection. In this work, we describe the development and application in Escherichia coli strains of an interference-independent assay based on engineered selectable CRISPR-spacer integration reporter plasmids. By using this tool without the constraint of interference or cas overexpression, we confirmed fundamental aspects of this process such as the critical requirement of Cas1 and Cas2 and the identity of the CTT protospacer motif for the E. coli K12 system. In addition, we defined the CWT motif for a non-K12 CRISPR-Cas variant, and obtained data supporting the implication of the leader in spacer orientation, the preferred acquisition from plasmids harboring cas genes and the occurrence of a sequential cleavage at the insertion site by a ruler mechanism. PMID:23445770

  2. DNA probe for strain typing of Cryptococcus neoformans.

    OpenAIRE

    Varma, A; Kwon-Chung, K J

    1992-01-01

    A 7-kb linear plasmid, harbored by a URA5 transformant, hybridized to all the chromosomes of Cryptococcus neoformans separated by contour-clamped homogeneous electric field electrophoresis. Its linear maintenance was determined to have been facilitated by the presence of telomere-like sequences at its free ends. Hybridization of this plasmid to AccI-digested genomic DNAs of 26 C. neoformans strains generated 21 unique DNA fingerprints. The DNA fingerprints of isolates within the same serotype...

  3. DNA preservation in silk.

    Science.gov (United States)

    Liu, Yawen; Zheng, Zhaozhu; Gong, He; Liu, Meng; Guo, Shaozhe; Li, Gang; Wang, Xiaoqin; Kaplan, David L

    2017-06-27

    The structure of DNA is susceptible to alterations at high temperature and on changing pH, irradiation and exposure to DNase. Options to protect and preserve DNA during storage are important for applications in genetic diagnosis, identity authentication, drug development and bioresearch. In the present study, the stability of total DNA purified from human dermal fibroblast cells, as well as that of plasmid DNA, was studied in silk protein materials. The DNA/silk mixtures were stabilized on filter paper (silk/DNA + filter) or filter paper pre-coated with silk and treated with methanol (silk/DNA + PT-filter) as a route to practical utility. After air-drying and water extraction, 50-70% of the DNA and silk could be retrieved and showed a single band on electrophoretic gels. 6% silk/DNA + PT-filter samples provided improved stability in comparison with 3% silk/DNA + filter samples and DNA + filter samples for DNA preservation, with ∼40% of the band intensity remaining at 37 °C after 40 days and ∼10% after exposure to UV light for 10 hours. Quantitative analysis using the PicoGreen assay confirmed the results. The use of Tris/borate/EDTA (TBE) buffer enhanced the preservation and/or extraction of the DNA. The DNA extracted after storage maintained integrity and function based on serving as a functional template for PCR amplification of the gene for zinc finger protein 750 (ZNF750) and for transgene expression of red fluorescence protein (dsRed) in HEK293 cells. The high molecular weight and high content of a crystalline beta-sheet structure formed on the coated surfaces likely accounted for the preservation effects observed for the silk/DNA + PT-filter samples. Although similar preservation effects were also obtained for lyophilized silk/DNA samples, the rapid and simple processing available with the silk-DNA-filter membrane system makes it appealing for future applications.

  4. Broad host range plasmids can invade an unexpectedly diverse fraction of a soil bacterial community

    DEFF Research Database (Denmark)

    Klümper, Uli; Riber, Leise; Dechesne, Arnaud

    2014-01-01

    and Actinobacteria suggests that inter-Gram plasmid transfer of IncP-1 and IncPromA-type plasmids is a frequent phenomenon. While the plasmid receiving fractions of the community were both plasmid- and donor- dependent, we identified a core super-permissive fraction that could take up different plasmids from diverse...

  5. Characterizing DNA condensation and conformational changes in organic solvents.

    Directory of Open Access Journals (Sweden)

    Fuyou Ke

    Full Text Available Organic solvents offer a new approach to formulate DNA into novel structures suitable for gene delivery. In this study, we examined the in situ behavior of DNA in N, N-dimethylformamide (DMF at low concentration via laser light scattering (LLS, TEM, UV absorbance and Zeta potential analysis. Results revealed that, in DMF, a 21bp oligonucleotide remained intact, while calf thymus DNA and supercoiled plasmid DNA were condensed and denatured. During condensation and denaturation, the size was decreased by a factor of 8-10, with calf thymus DNA forming spherical globules while plasmid DNA exhibited a toroid-like conformation. In the condensed state, DNA molecules were still able to release the counterions to be negatively charged, indicating that the condensation was mainly driven by the excluded volume interactions. The condensation induced by DMF was reversible for plasmid DNA but not for calf thymus DNA. When plasmid DNA was removed from DMF and resuspended in an aqueous solution, the DNA was quickly regained a double stranded configuration. These findings provide further insight into the behavior and condensation mechanism of DNA in an organic solvent and may aid in developing more efficient non-viral gene delivery systems.

  6. Plasmid Conjugation in E. coli and Drug Resistance | Igwe ...

    African Journals Online (AJOL)

    This study aimed at determining the antibiotics susceptibility pattern of E. coli isolates claimed to be multidrug resistance using disc diffusion method. It also determined the presence of transferable resistance plasmids through conjugation and evaluated the medical significance of plasmid encoding E. coli and drug ...

  7. Resistant plasmid profile analysis of multidrug resistant Escherichia ...

    African Journals Online (AJOL)

    Multiple drug resistance isolates causing UTI has seri- ous implications for the empiric therapy against patho- genic isolates and for the possible co-selection of antimicrobial resistant mediated by multi drug resistant plasmids21,22. E. coli from clinical isolates are known to harbour plasmids of different molecular sizes23.

  8. Functional analysis of three plasmids from Lactobacillus plantarum

    NARCIS (Netherlands)

    Kranenburg, R. van; Golic, N.; Bongers, R.; Leer, R.J.; Vos, W.M. de; Siezen, R.J.; Kleerebezem, M.

    2005-01-01

    Lactobacillus plantarum WCFS1 harbors three plasmids, pWCFS101, pWCFS102, and pWCFS103, with sizes of 1,917, 2,365, and 36,069 bp, respectively. The two smaller plasmids are of unknown function and contain replication genes that are likely to function via the rolling-circle replication mechanism.

  9. Transfer of conjugative plasmids among bacteria under environmentally relevant conditions

    DEFF Research Database (Denmark)

    Musovic, Sanin

    Mobile genetiske elementer (f.eks. plasmider), der ofte bærer ekstra funktioner såsom antibiotikaresistens, eller kataboliske- og xenobiotiske nedbrydnings gener, antages at have en meget vigtigt evolutionær rolle for bakterier. I denne PhD afhandling undersøgte jeg størrelsen af plasmid overførs...

  10. Two novel conjugative plasmids from a single strain of Sulfolobus

    NARCIS (Netherlands)

    Erauso, G.; Stedman, K.M.; Werken, van de H.J.G.; Zillig, W.; Oost, van der J.

    2006-01-01

    Two conjugative plasmids (CPs) were isolated and characterized from the same 'Sulfolobus islandicus' strain, SOG2/4, The plasmids were separated from each other and transferred into Sulfolobus soltataricus. One has a high copy number and is not stable (pSOG1) whereas the other has a low copy number

  11. The technology of large-scale pharmaceutical plasmid purification ...

    African Journals Online (AJOL)

    Further test demonstrated that the pcDNAlacZ purified with CTAB and authoritative endotoxin-free plasmid Kit had the similar transfection efficiency in vivo and in vitro. CTAB can be used for plasmid purification; the main advantages of the DNAs purified with CTAB include the avoidance of animal-derived enzymes, toxic ...

  12. Attenuated Shigella as a DNA Delivery Vehicle for DNA-Mediated Immunization

    Science.gov (United States)

    Sizemore, Donata R.; Branstrom, Arthur A.; Sadoff, Jerald C.

    1995-10-01

    Direct inoculation of DNA, in the form of purified bacterial plasmids that are unable to replicate in mammalian cells but are able to direct cell synthesis of foreign proteins, is being explored as an approach to vaccine development. Here, a highly attenuated Shigella vector invaded mammalian cells and delivered such plasmids into the cytoplasm of cells, and subsequent production of functional foreign protein was measured. Because this Shigella vector was designed to deliver DNA to colonic mucosa, the method is a potential basis for oral and other mucosal DNA immunization and gene therapy strategies.

  13. Identification of IncA/C Plasmid Replication and Maintenance Genes and Development of a Plasmid Multilocus Sequence Typing Scheme.

    Science.gov (United States)

    Hancock, Steven J; Phan, Minh-Duy; Peters, Kate M; Forde, Brian M; Chong, Teik Min; Yin, Wai-Fong; Chan, Kok-Gan; Paterson, David L; Walsh, Timothy R; Beatson, Scott A; Schembri, Mark A

    2017-02-01

    Plasmids of incompatibility group A/C (IncA/C) are becoming increasingly prevalent within pathogenic Enterobacteriaceae They are associated with the dissemination of multiple clinically relevant resistance genes, including bla CMY and bla NDM Current typing methods for IncA/C plasmids offer limited resolution. In this study, we present the complete sequence of a bla NDM-1 -positive IncA/C plasmid, pMS6198A, isolated from a multidrug-resistant uropathogenic Escherichia coli strain. Hypersaturated transposon mutagenesis, coupled with transposon-directed insertion site sequencing (TraDIS), was employed to identify conserved genetic elements required for replication and maintenance of pMS6198A. Our analysis of TraDIS data identified roles for the replicon, including repA, a toxin-antitoxin system; two putative partitioning genes, parAB; and a putative gene, 053 Construction of mini-IncA/C plasmids and examination of their stability within E. coli confirmed that the region encompassing 053 contributes to the stable maintenance of IncA/C plasmids. Subsequently, the four major maintenance genes (repA, parAB, and 053) were used to construct a new plasmid multilocus sequence typing (PMLST) scheme for IncA/C plasmids. Application of this scheme to a database of 82 IncA/C plasmids identified 11 unique sequence types (STs), with two dominant STs. The majority of bla NDM -positive plasmids examined (15/17; 88%) fall into ST1, suggesting acquisition and subsequent expansion of this bla NDM -containing plasmid lineage. The IncA/C PMLST scheme represents a standardized tool to identify, track, and analyze the dissemination of important IncA/C plasmid lineages, particularly in the context of epidemiological studies. Copyright © 2017 American Society for Microbiology.

  14. A replicative plasmid vector allows efficient complementation of pathogenic Leptospira strains.

    Science.gov (United States)

    Pappas, Christopher J; Benaroudj, Nadia; Picardeau, Mathieu

    2015-05-01

    Leptospirosis, an emerging zoonotic disease, remains poorly understood because of a lack of genetic manipulation tools available for pathogenic leptospires. Current genetic manipulation techniques include insertion of DNA by random transposon mutagenesis and homologous recombination via suicide vectors. This study describes the construction of a shuttle vector, pMaORI, that replicates within saprophytic, intermediate, and pathogenic leptospires. The shuttle vector was constructed by the insertion of a 2.9-kb DNA segment including the parA, parB, and rep genes into pMAT, a plasmid that cannot replicate in Leptospira spp. and contains a backbone consisting of an aadA cassette, ori R6K, and oriT RK2/RP4. The inserted DNA segment was isolated from a 52-kb region within Leptospira mayottensis strain 200901116 that is not found in the closely related strain L. mayottensis 200901122. Because of the size of this region and the presence of bacteriophage-like proteins, it is possible that this region is a result of a phage-related genomic island. The stability of the pMaORI plasmid within pathogenic strains was tested by passaging cultures 10 times without selection and confirming the presence of pMaORI. Concordantly, we report the use of trans complementation in the pathogen Leptospira interrogans. Transformation of a pMaORI vector carrying a functional copy of the perR gene in a null mutant background restores the expression of PerR and susceptibility to hydrogen peroxide comparable to that of wild-type cells. In conclusion, we demonstrate the replication of a stable plasmid vector in a large panel of Leptospira strains, including pathogens. The shuttle vector described will expand our ability to perform genetic manipulation of Leptospira spp. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  15. Expansion of the IncX plasmid family for improved identification and typing of novel plasmids in drug-resistant Enterobacteriaceae

    DEFF Research Database (Denmark)

    Johnson, Timothy J.; Bielak, Eliza Maria; Fortini, Daniela

    2012-01-01

    and biofilm formation. Previous plasmid-based replicon typing procedures have indicated that the prevalence of IncX plasmids is low among members of the Enterobacteriaceae. However, examination of a number of IncX-like plasmid sequences and their occurrence in various organisms suggests that IncX plasmid...

  16. Peroxynitrite modified DNA presents better epitopes for anti-DNA autoantibodies in diabetes type 1 patients.

    Science.gov (United States)

    Tripathi, Prashant; Moinuddin; Dixit, Kiran; Mir, Abdul Rouf; Habib, Safia; Alam, Khursheed; Ali, Asif

    2014-07-01

    Peroxynitrite (ONOO(-)), formed by the reaction between nitric oxide (NO) and superoxide (O2(-)), has been implicated in the etiology of numerous disease processes. Peroxynitrite interacts with DNA via direct oxidative reactions or via indirect radical-mediated mechanism. It can inflict both oxidative and nitrosative damages on DNA bases, generating abasic sites, resulting in the single strand breaks. Plasmid pUC 18 isolated from Escherichiacoli was modified with peroxynitrite, generated by quenched flow process. Modifications incurred in plasmid DNA were characterized by ultraviolet and fluorescence spectroscopy, circular dichroism, HPLC and melting temperature studies. Binding characteristics and specificity of antibodies from diabetes patients were analyzed by direct binding and inhibition ELISA. Peroxynitrite modification of pUC 18 plasmid resulted in the formation of strand breaks and base modification. The major compound formed when peroxynitrite reacted with DNA was 8-nitroguanine, a specific marker for peroxynitrite induced DNA damage in inflamed tissues. The concentration of 8-nitroguanine was found to be 3.8 μM. Sera from diabetes type 1 patients from different age groups were studied for their binding to native and peroxynitrite modified plasmid. Direct binding and competitive-inhibition ELISA results showed higher recognition of peroxynitrite modified plasmid, as compared to the native form, by auto-antibodies present in diabetes patients. The preferential recognition of modified plasmid by diabetes autoantibodies was further reiterated by gel shift assay. Experimentally induced anti-peroxynitrite-modified plasmid IgG was used as a probe to detect nitrosative lesions in the DNA isolated from diabetes patients. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Specificity of DNA import into isolated mitochondria from plants and mammals

    Directory of Open Access Journals (Sweden)

    Koulintchenko M. V.

    2014-01-01

    Full Text Available Aim. Investigation of different features of DNA import into plant and human mitochondria, for a better understanding of mitochondrial genetics and generation of biotechnological tools. Methods. DNA up-take experiments with isolated plant mitochondria, using as substrates various sequences associated or not with the specific terminal inverted repeats (TIRs present at each end of the plant mitochondrial linear plasmids. Results. It was established that the DNA import efficiency has a non-linear dependence on DNA size. It was shown that import into plant mitochondria of DNA molecules of «medium» sizes, i. e. between 4 and 7 kb, barely has any sequence specificity: neither TIRs from the 11.6 kb Brassica plasmid, nor TIRs from the Zea mays S-plasmids influenced DNA import into Solanum tuberosum mitochondria. Conclusions. The data obtained support the hypothesis about species-specific import mechanism operating under the mitochondrial linear plasmids transfer into plant mitochondria.

  18. Plasmid-mediated UV-protection in Streptococcus lactis

    Energy Technology Data Exchange (ETDEWEB)

    Chopin, M.C.; Rouault, A. (Institut National de la Recherche Agronomique, Rennes (France). Lab. de Recherches de Technologie Laitiere); Moillo-Batt, A. (Institut National de la Sante et de la Recherche Medicale (INSERM), Hopital de Pontchaillon, 35 - Rennes (France))

    1985-02-01

    Streptococcus lactis strain IL594 contains 9 plasmids, designated pIL1 to pIL9. On the basis of protoplast-induced curing experiments the authors showed that derivatives containing pIL7 were resistant to UV-irradiation while derivatives lacking pIL7 were sensitive. The pIL7-determined UV-protection was confirmed by co-transfer of the plasmid and of the character into a plasmid-free derivative of S. lactis IL594. Moreover, prophage induction required higher UV-fluence in this derivative carrying pIL7 than in the plasmid-free strain. This is the first report of a plasmid-mediated UV-protection in group N streptococci.

  19. Plasmid-mediated UV-protection in Streptococcus lactis

    International Nuclear Information System (INIS)

    Chopin, M.-C.; Rouault, A.

    1985-01-01

    Streptococcus lactis strain IL594 contains 9 plasmids, designated pIL1 to pIL9. On the basis of protoplast-induced curing experiments the authors showed that derivatives containing pIL7 were resistant to UV-irradiation while derivatives lacking pIL7 were sensitive. The pIL7-determined UV-protection was confirmed by cotransfer of the plasmid and of the character into a plasmid-free derivative of S. lactis IL594. Moreover, prophage induction required higher UV-fluence in this derivative carrying pIL7 than in the plasmid-free strain. This is the first report of a plasmid-mediated UV-protection in group N streptococci. (orig.)

  20. A replicating plasmid-based vector for GFP expression in Mycoplasma hyopneumoniae.

    Science.gov (United States)

    Ishag, H Z A; Liu, M J; Yang, R S; Xiong, Q Y; Feng, Z X; Shao, G Q

    2016-04-28

    Mycoplasma hyopneumoniae (M. hyopneumoniae) causes porcine enzootic pneumonia (PEP) that significantly affects the pig industry worldwide. Despite the availability of the whole genome sequence, studies on the pathogenesis of this organism have been limited due to the lack of a genetic manipulation system. Therefore, the aim of the current study was to generate a general GFP reporter vector based on a replicating plasmid. Here, we describe the feasibility of GFP reporter expression in M. hyopneumoniae (strain 168L) controlled by the p97 gene promoter of this mycoplasma. An expression plasmid (pMD18-TOgfp) containing the p97 gene promoter, and origin of replication (oriC) of M. hyopneumoniae, tetracycline resistant marker (tetM), and GFP was constructed and used to transform competent M. hyopneumoniae cells. We observed green fluorescence in M. hyopneumoniae transformants under fluorescence microscopy, which indicates that there was expression of the GFP reporter that was driven by the p97 gene promoter. Additionally, an electroporation method for M. hyopneumoniae with an efficiency of approximately 1 x 10(-6) transformants/μg plasmid DNA was optimized and is described herein. In conclusion, our data demonstrate the susceptibility of M. hyopneumoniae to genetic manipulation whereby foreign genes are expressed. This work may encourage the development of genetic tools to manipulate the genome of M. hyopneumoniae for functional genomic analyses.

  1. The effect of mutation on Rhodococcus equi virulence plasmid gene expression and mouse virulence.

    Science.gov (United States)

    Ren, Jun; Prescott, John F

    2004-11-15

    An 81 kb virulence plasmid containing a pathogenicity island (PI) plays a crucial role in the pathogenesis of Rhodococcus equi pneumonia in foals but its specific function in virulence and regulation of plasmid-encoded virulence genes is unclear. Using a LacZ selection marker developed for R. equi in this study, in combination with an apramycin resistance gene, an efficient two-stage homologous recombination targeted gene mutation procedure was used to mutate three virulence plasmid genes, a LysR regulatory gene homologue (ORF4), a ResD-like two-component response regulator homologue (ORF8), and a gene (ORF10) of unknown function that is highly expressed by R. equi inside macrophages, as well as the chromosomal gene operon, phoPR. Virulence testing by liver clearance after intravenous injection in mice showed that the ORF4 and ORF8 mutants were fully attenuated, that the phoPR mutant was hypervirulent, and that virulence of the ORF10 mutant remained unchanged. A virulence plasmid DNA microarray was used to compare the plasmid gene expression profile of each of the four gene-targeted mutants against the parental R. equi strain. Changes were limited to PI genes and gene induction was observed for all mutants, suggesting that expression of virulence plasmid genes is dominated by a negative regulatory network. The finding of attenuation of ORF4 and ORF8 mutants despite enhanced transcription of vapA suggests that factors other than VapA are important for full expression of virulence. ORF1, a putative Lsr antigen gene, was strongly and similarly induced in all mutants, implying a common regulatory pathway affecting this gene for all four mutated genes. ORF8 is apparently the centre of this common pathway. Two distinct highly correlated gene induction patterns were observed, that of the ORF4 and ORF8 mutants, and that of the ORF10 and phoPR mutants. The gene induction pattern distinguishing these two groups paralleled their virulence in mice.

  2. Metagenomic analyses of novel viruses and plasmids from a cultured environmental sample of hyperthermophilic neutrophiles

    DEFF Research Database (Denmark)

    Garrett, Roger Antony; Prangishvili, David; Shah, Shiraz Ali

    2010-01-01

    Two novel viral genomes and four plasmids were assembled from an environmental sample collected from a hot spring at Yellowstone National Park, USA, and maintained anaerobically in a bioreactor at 85°C and pH 6. The double-stranded DNA viral genomes are linear (22.7 kb) and circular (17.7 kb...... respectively. Strategies are considered for assembling genomes of smaller genetic elements from complex environmental samples, and for establishing possible host identities on the basis of sequence similarity to host CRISPR immune systems....

  3. Electrotransformation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis with Various Plasmids

    Science.gov (United States)

    Serror, Pascale; Sasaki, Takashi; Ehrlich, S. Dusko; Maguin, Emmanuelle

    2002-01-01

    We describe, for the first time, a detailed electroporation procedure for Lactobacillus delbrueckii. Three L. delbrueckii strains were successfully transformed. Under optimal conditions, the transformation efficiency was 104 transformants per μg of DNA. Using this procedure, we identified several plasmids able to replicate in L. delbrueckii and integrated an integrative vector based on phage integrative elements into the L. delbrueckii subsp. bulgaricus chromosome. These vectors provide a good basis for developing molecular tools for L. delbrueckii and open the field of genetic studies in L. delbrueckii. PMID:11772607

  4. Restriction Fragment Length Polymorphisms of Virulence Plasmids in Rhodococcus equi

    Science.gov (United States)

    Takai, Shinji; Shoda, Masato; Sasaki, Yukako; Tsubaki, Shiro; Fortier, Guillaume; Pronost, Stephane; Rahal, Karim; Becu, Teotimo; Begg, Angela; Browning, Glenn; Nicholson, Vivian M.; Prescott, John F.

    1999-01-01

    Virulent Rhodococcus equi, which is a well-known cause of pyogranulomatous pneumonia in foals, possesses a large plasmid encoding virulence-associated 15- to 17-kDa antigens. Foal and soil isolates from five countries—Argentina, Australia, Canada, France, and Japan—were investigated for the presence of 15- to 17-kDa antigens by colony blotting, using the monoclonal antibody 10G5, and the gene coding for 15- to 17-kDa antigens by PCR. Plasmid DNAs extracted from positive isolates were digested with restriction endonucleases BamHI, EcoRI, EcoT22I, and HindIII, and the digestion patterns that resulted divided the plasmids of virulent isolates into five closely related types. Three of the five types had already been reported in Canadian and Japanese isolates, and the two new types had been found in French and Japanese isolates. Therefore, we tentatively designated these five types 85-kb type I (pREAT701), 85-kb type II (a new type), 87-kb type I (EcoRI and BamHI type 2 [V. M. Nicholson and J. F. Prescott, J. Clin. Microbiol. 35:738–740, 1997]), 87-kb type II (a new type), and 90-kb (pREL1) plasmids. The 85-kb type I plasmid was found in isolates from Argentina, Australia, Canada, and France. Plasmid 87-kb type I was isolated in specimens from Argentina, Canada, and France. The 85-kb type II plasmid appeared in isolates from France. On the other hand, plasmids 87-kb type II and 90-kb were found only in isolates from Japan. These results revealed geographic differences in the distribution of the virulence plasmids found in the five countries and suggested that the restriction fragment length polymorphism of virulence plasmids might be useful to elucidate the molecular epidemiology of virulent R. equi in the world. PMID:10488224

  5. Transposition of a Ds element from a plasmid into the plant genome in Nicotiana plumbaginifolia protoplast-derived cells.

    Science.gov (United States)

    Houba-Hérin, N; Domin, M; Pédron, J

    1994-07-01

    Nicotiana plumbaginifolia haploid protoplasts were co-transformed with two plasmids, one with a NPT-II/Ds element and one with a gene encoding an amino-terminal truncated Ac transposase. It is shown that Ds can efficiently transpose from extrachromosomal DNA to N. plumbaginifolia chromosomes when the Ac transposase gene is present in trans. Ds has been shown to have transposed into the plant genome in a limited number of copies (1.9 copies per genome), for 21/32 transgenic lines tested. The flanking sequences present in the original plasmid are missing in these 21 plants. In only two of 21 plants was part of the transposase construct integrated. By segregation analysis of transgenic progeny, Ds was shown to be present in the heterozygous state in 10 lines even though haploid protoplasts had been originally transformed. This observation could indicate that integration occurred after or during DNA replication that leads to protoplast diploidization.

  6. Functional properties and structural requirements of the plasmid pMV158-encoded MobM relaxase domain.

    Science.gov (United States)

    Fernández-López, Cris; Pluta, Radoslaw; Pérez-Luque, Rosa; Rodríguez-González, Lorena; Espinosa, Manuel; Coll, Miquel; Lorenzo-Díaz, Fabián; Boer, D Roeland

    2013-07-01

    A crucial element in the horizontal transfer of mobilizable and conjugative plasmids is the relaxase, a single-stranded endonuclease that nicks the origin of transfer (oriT) of the plasmid DNA. The relaxase of the pMV158 mobilizable plasmid is MobM (494 residues). In solution, MobM forms a dimer through its C-terminal domain, which is proposed to anchor the protein to the cell membrane and to participate in type 4 secretion system (T4SS) protein-protein interactions. In order to gain a deeper insight into the structural MobM requirements for efficient DNA catalysis, we studied two endonuclease domain variants that include the first 199 or 243 amino acid residues (MobMN199 and MobMN243, respectively). Our results confirmed that the two proteins behaved as monomers in solution. Interestingly, MobMN243 relaxed supercoiled DNA and cleaved single-stranded oligonucleotides harboring oriTpMV158, whereas MobMN199 was active only on supercoiled DNA. Protein stability studies using gel electrophoresis and mass spectrometry showed increased susceptibility to degradation at the domain boundary between the N- and C-terminal domains, suggesting that the domains change their relative orientation upon DNA binding. Overall, these results demonstrate that MobMN243 is capable of nicking the DNA substrate independently of its topology and that the amino acids 200 to 243 modulate substrate specificity but not the nicking activity per se. These findings suggest that these amino acids are involved in positioning the DNA for the nuclease reaction rather than in the nicking mechanism itself.

  7. Insights into the quality of DnaA boxes and their cooperativity

    DEFF Research Database (Denmark)

    Hansen, Flemming G.; Christensen, Bjarke Bak; Nielsen, Christina Bang

    2006-01-01

    Plasmids carrying the mioC promoter region with its two DnaA boxes are as efficient in titration of DnaA protein as plasmids carrying a replicationinactivated oriC region with its five DnaA boxes. The two DnaA boxes upstream of the mioC promoter were mutated in various ways to study the cooperati......Plasmids carrying the mioC promoter region with its two DnaA boxes are as efficient in titration of DnaA protein as plasmids carrying a replicationinactivated oriC region with its five DnaA boxes. The two DnaA boxes upstream of the mioC promoter were mutated in various ways to study...... the cooperativity between the DnaA boxes, and to study in vivo the in vitrodefined 9mer DnaA box consensus sequence TTA/TTNCACA). The quality and cooperativity of the DnaA oxes were determined in two complementary ways: as titration of DnaA protein leading to derepression of the dnaA promoter, and as repression...... of the mioC promoter caused by the DnaA protein binding to the DnaA boxes. Titration of DnaA protein correlated with repression of the mioC promoter. The level of titration and repression with the normal promoter-proximal box (TTTTCCACA) depends strongly on the presence and the quality of a DnaA box...

  8. Application of DNA-DNA colony hybridization to the detection of catabolic genotypes in environmental samples

    International Nuclear Information System (INIS)

    Sayler, G.S.; Shields, M.S.; Tedford, E.T.; Breen, A.; Hooper, S.W.; Sirotkin, K.M.; Davis, J.W.

    1985-01-01

    The application of preexisting DNA hybridization techniques was investigated for potential in determining populations of specific gene sequences in environmental samples. Cross-hybridizations among two degradative plasmids, TOL and NAH, and two cloning vehicles, pLAFR1 and RSF1010, were determined. The detection limits for the TOL plasmid against a nonhomologous plasmid-bearing bacterial background was ascertained. The colony hybridization technique allowed detection of one colony containing TOL plasmid among 10(6) Escherichia coli colonies of nonhomologous DNA. Comparisons between population estimates derived from growth on selective substrates and from hybridizations were examined. Findings indicated that standard sole carbon source enumeration procedures for degradative populations lead to overestimations due to nonspecific growth of other bacteria on the microcontaminant carbon sources present in the media. Population estimates based on the selective growth of a microcosm population on two aromatic substrates (toluene and naphthalene) and estimates derived from DNA-DNA colony hybridizations, using the TOL or NAH plasmid as a probe, corresponded with estimates of substrate mineralization rates and past exposure to environmental contaminants. The applications of such techniques are hoped to eventually allow enumeration of any specific gene sequences in the environment, including both anabolic and catabolic genes. In addition, this procedure should prove useful in monitoring recombinant DNA clones released into environmental situations

  9. Microarray-based analysis of IncA/C plasmid-associated genes from multidrug-resistant Salmonella enterica.

    Science.gov (United States)

    Lindsey, Rebecca L; Frye, Jonathan G; Fedorka-Cray, Paula J; Meinersmann, Richard J

    2011-10-01

    In the family Enterobacteriaceae, plasmids have been classified according to 27 incompatibility (Inc) or replicon types that are based on the inability of different plasmids with the same replication mechanism to coexist in the same cell. Certain replicon types such as IncA/C are associated with multidrug resistance (MDR). We developed a microarray that contains 286 unique 70-mer oligonucleotide probes based on sequences from five IncA/C plasmids: pYR1 (Yersinia ruckeri), pPIP1202 (Yersinia pestis), pP99-018 (Photobacterium damselae), pSN254 (Salmonella enterica serovar Newport), and pP91278 (Photobacterium damselae). DNA from 59 Salmonella enterica isolates was hybridized to the microarray and analyzed for the presence or absence of genes. These isolates represented 17 serovars from 14 different animal hosts and from different geographical regions in the United States. Qualitative cluster analysis was performed using CLUSTER 3.0 to group microarray hybridization results. We found that IncA/C plasmids occurred in two lineages distinguished by a major insertion-deletion (indel) region that contains genes encoding mostly hypothetical proteins. The most variable genes were represented by transposon-associated genes as well as four antimicrobial resistance genes (aphA, merP, merA, and aadA). Sixteen mercury resistance genes were identified and highly conserved, suggesting that mercury ion-related exposure is a stronger pressure than anticipated. We used these data to construct a core IncA/C genome and an accessory genome. The results of our studies suggest that the transfer of antimicrobial resistance determinants by transfer of IncA/C plasmids is somewhat less common than exchange within the plasmids orchestrated by transposable elements, such as transposons, integrating and conjugative elements (ICEs), and insertion sequence common regions (ISCRs), and thus pose less opportunity for exchange of antimicrobial resistance.

  10. Development of a transformation system for Chlamydia trachomatis: restoration of glycogen biosynthesis by acquisition of a plasmid shuttle vector.

    Directory of Open Access Journals (Sweden)

    Yibing Wang

    2011-09-01

    Full Text Available Chlamydia trachomatis remains one of the few major human pathogens for which there is no transformation system. C. trachomatis has a unique obligate intracellular developmental cycle. The extracellular infectious elementary body (EB is an infectious, electron-dense structure that, following host cell infection, differentiates into a non-infectious replicative form known as a reticulate body (RB. Host cells infected by C. trachomatis that are treated with penicillin are not lysed because this antibiotic prevents the maturation of RBs into EBs. Instead the RBs fail to divide although DNA replication continues. We have exploited these observations to develop a transformation protocol based on expression of β-lactamase that utilizes rescue from the penicillin-induced phenotype. We constructed a vector which carries both the chlamydial endogenous plasmid and an E.coli plasmid origin of replication so that it can shuttle between these two bacterial recipients. The vector, when introduced into C. trachomatis L2 under selection conditions, cures the endogenous chlamydial plasmid. We have shown that foreign promoters operate in vivo in C. trachomatis and that active β-lactamase and chloramphenicol acetyl transferase are expressed. To demonstrate the technology we have isolated chlamydial transformants that express the green fluorescent protein (GFP. As proof of principle, we have shown that manipulation of chlamydial biochemistry is possible by transformation of a plasmid-free C. trachomatis recipient strain. The acquisition of the plasmid restores the ability of the plasmid-free C. trachomatis to synthesise and accumulate glycogen within inclusions. These findings pave the way for a comprehensive genetic study on chlamydial gene function that has hitherto not been possible. Application of this technology avoids the use of therapeutic antibiotics and therefore the procedures do not require high level containment and will allow the analysis of genome

  11. DNA Vaccine Electroporation and Molecular Adjuvants

    Science.gov (United States)

    2016-03-16

    Suschak and Schmaljohn DNA Vaccine Electroporation and Molecular Adjuvants 1 Abstract To date, there is no protective vaccine for Ebola virus...the formulation of DNA launched virus-like particles (VLP). In this case, the antigen is encoded in one DNA plasmid, while structural proteins are...Virol, 2010. 155(12): p. 2083-103. 2. Feldmann, H. and T.W. Geisbert, Ebola haemorrhagic fever. Lancet, 2011. 377(9768): p. 849-62. 3. Hart, M.K

  12. Oral DNA Vaccine in Chickens

    Directory of Open Access Journals (Sweden)

    Seyed Davoud Jazayeri

    2012-01-01

    Full Text Available Attenuated Salmonella has been used as a carrier for DNA vaccine. However, in vitro and in vivo studies on the bacteria following transfection of plasmid DNA were poorly studied. In this paper, eukaryotic expression plasmids encoding avian influenza virus (AIV subtype H5N1 genes, pcDNA3.1/HA, NA, and NP, were transfected into an attenuated Salmonella enteric typhimurium SV4089. In vitro stability of the transfected plasmids into Salmonella were over 90% after 100 generations. The attenuated Salmonella were able to invade MCF-7 (1.2% and MCF-10A (0.5% human breast cancer cells. Newly hatched specific-pathogen-free (SPF chicks were inoculated once by oral gavage with 109 colony-forming unit (CFU of the attenuated Salmonella. No abnormal clinical signs or deaths were recorded after inoculation. Viable bacteria were detected 3 days after inoculation by plating from spleen, liver, and cecum. Fluorescent in situ hybridization (FISH and polymerase chain reaction (PCR were carried out for confirmation. Salmonella was not detected in blood cultures although serum antibody immune responses to Salmonella O antiserum group D1 factor 1, 9, and 12 antigens were observed in all the inoculated chickens after 7 days up to 35 days. Our results showed that live attenuated S. typhimurium SV4089 harboring pcDNA3.1/HA, NA, and NP may provide a unique alternative as a carrier for DNA oral vaccine in chickens.

  13. One Novel Multiple-Target Plasmid Reference Molecule Targeting Eight Genetically Modified Canola Events for Genetically Modified Canola Detection.

    Science.gov (United States)

    Li, Zhuqing; Li, Xiang; Wang, Canhua; Song, Guiwen; Pi, Liqun; Zheng, Lan; Zhang, Dabing; Yang, Litao

    2017-09-27

    Multiple-target plasmid DNA reference materials have been generated and utilized as good substitutes of matrix-based reference materials in the analysis of genetically modified organisms (GMOs). Herein, we report the construction of one multiple-target plasmid reference molecule, pCAN, which harbors eight GM canola event-specific sequences (RF1, RF2, MS1, MS8, Topas 19/2, Oxy235, RT73, and T45) and a partial sequence of the canola endogenous reference gene PEP. The applicability of this plasmid reference material in qualitative and quantitative PCR assays of the eight GM canola events was evaluated, including the analysis of specificity, limit of detection (LOD), limit of quantification (LOQ), and performance of pCAN in the analysis of various canola samples, etc. The LODs are 15 copies for RF2, MS1, and RT73 assays using pCAN as the calibrator and 10 genome copies for the other events. The LOQ in each event-specific real-time PCR assay is 20 copies. In quantitative real-time PCR analysis, the PCR efficiencies of all event-specific and PEP assays are between 91% and 97%, and the squared regression coefficients (R 2 ) are all higher than 0.99. The quantification bias values varied from 0.47% to 20.68% with relative standard deviation (RSD) from 1.06% to 24.61% in the quantification of simulated samples. Furthermore, 10 practical canola samples sampled from imported shipments in the port of Shanghai, China, were analyzed employing pCAN as the calibrator, and the results were comparable with those assays using commercial certified materials as the calibrator. Concluding from these results, we believe that this newly developed pCAN plasmid is one good candidate for being a plasmid DNA reference material in the detection and quantification of the eight GM canola events in routine analysis.

  14. Resistance to nitrofurantoin and UV-irradiation in recA; uvrA; and uvrA, lexA, Escherichia coli mutants conferred by an R-plasmid from an Escherichia coli clinical isolate

    Energy Technology Data Exchange (ETDEWEB)

    Obaseiki-Ebor, E.E. (Univ. of Benin, Benin City (Nigeria). Faculty of Pharmacy, Dept. of Pharmaceutical Microbiology)

    1984-01-01

    There have been some reports of R-plasmids conferring nitrofuran resistance by decreasing the reduction of nitrofurantoin. The mechanism by which these R-plasmids mediate nitrofurantoin resistance is still not properly understood. Since DNA repair mutants are very sensitive to nitrofurantoin, it was therefore of interest to see whether R-plasmids conferring nitrofurantoin resistance affected the nitrofurantoin sensitivity of recA; uvrA and uvrA, lexA strains of E. coli K-12. Protection against UV-irradiation was also estimated. The experiments showed that the nitrofurantoin resistance conferred by R-plasmid pBN105 was not due to defective nitrofurantoin reduction or altered permeability of the cell. Because it is known that repair-deficient bacteria have increased susceptibility to nitrofurantoin, it may be suggested that the mechanisms of UV and nitrofurantoin protection conferred by pBN105 to the DNA repair mutant strains are related.

  15. Resistance to nitrofurantoin and UV-irradiation in recA; uvrA; and uvrA, lexA, Escherichia coli mutants conferred by an R-plasmid from an Escherichia coli clinical isolate

    International Nuclear Information System (INIS)

    Obaseiki-Ebor, E.E.

    1984-01-01

    There have been some reports of R-plasmids conferring nitrofuran resistance by decreasing the reduction of nitrofurantoin. The mechanism by which these R-plasmids mediate nitrofurantoin resistance is still not properly understood. Since DNA repair mutants are very sensitive to nitrofurantoin, it was therefore of interest to see whether R-plasmids conferring nitrofurantoin resistance affected the nitrofurantoin sensitivity of recA; uvrA and uvrA, lexA strains of E. coli K-12. Protection against UV-irradiation was also estimated. The experiments showed that the nitrofurantoin resistance conferred by R-plasmid pBN105 was not due to defective nitrofurantoin reduction or altered permeability of the cell. Because it is known that repair-deficient bacteria have increased susceptibility to nitrofurantoin, it may be suggested that the mechanisms of UV and nitrofurantoin protection conferred by pBN105 to the DNA repair mutant strains are related. (Auth.)

  16. Molecular characterization of a 21.4 kilobase antibiotic resistance plasmid from an α-hemolytic Escherichia coli O108:H- human clinical isolate.

    Directory of Open Access Journals (Sweden)

    Fay E Dawes

    Full Text Available This study characterizes the 21.4 kilobase plasmid pECTm80 isolated from Escherichia coli strain 80, an α hemolytic human clinical diarrhoeal isolate (serotype O108:H-. DNA sequence analysis of pECTm80 revealed it belonged to incompatibility group X1, and contained plasmid partition and toxin-antitoxin systems, an R6K-like triple origin (ori replication system, genes required for replication regulation, insertion sequences IS1R, ISEc37 and a truncated transposase gene (Tn3-like ΔtnpA of the Tn3 family, and carried a class 2 integron. The class 2 integron of pECTm80 contains an intact cassette array dfrA1-sat2, encoding resistance to trimethoprim and streptothricin, and an aadA1 gene cassette truncated by the insertion of IS1R. The complex plasmid replication system includes α, β and γ origins of replication. Pairwise BLASTn comparison of pECTm80 with plasmid pE001 reveals a conserved plasmid backbone suggestive of a common ancestral lineage. Plasmid pECTm80 is of potential clinical importance, as it carries multiple genes to ensure its stable maintenance through successive bacterial cell divisions and multiple antibiotic resistance genes.

  17. Recovery of infectious type Asia1 foot-and-mouth disease virus from suckling mice directly inoculated with an RNA polymerase I/II-driven unidirectional transcription plasmid.

    Science.gov (United States)

    Lian, Kaiqi; Yang, Fan; Zhu, Zixiang; Cao, Weijun; Jin, Ye; Li, Dan; Zhang, Keshan; Guo, Jianhong; Zheng, Haixue; Liu, Xiangtao

    2015-10-02

    We developed an RNA polymerase (pol) I- and II-driven plasmid-based reverse genetics system to rescue infectious foot-and-mouth disease virus (FMDV) from cloned cDNA. In this plasmid-based transfection, the full-length viral cDNA was flanked by hammerhead ribozyme (HamRz) and hepatitis delta ribozyme (HdvRz) sequences, which were arranged downstream of the two promoters (cytomegalovirus (CMV) and pol I promoter) and upstream of the terminators and polyadenylation signal, respectively. The utility of this method was demonstrated by the recovery of FMDV Asia1 HN/CHA/06 in BHK-21 cells transfected with cDNA plasmids. Furthermore, infectious FMDV Asia1 HN/CHA/06 could be rescued from suckling mice directly inoculated with cDNA plasmids. Thus, this reverse genetics system can be applied to fundamental research and vaccine studies, most notably to rescue those viruses for which there is currently an absence of a suitable cell culture system. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Antibiotic resistance plasmids of Staphylococcus aureus and their clinical importance

    International Nuclear Information System (INIS)

    Lacey, R.W.

    1975-0