WorldWideScience

Sample records for plasmid dna encoding

  1. A combined approach of hollow microneedles and nanocarriers for skin immunization with plasmid DNA encoding ovalbumin

    Directory of Open Access Journals (Sweden)

    Pamornpathomkul B

    2017-01-01

    Full Text Available Boonnada Pamornpathomkul,1 Adisak Wongkajornsilp,2 Wanida Laiwattanapaisal,3 Theerasak Rojanarata,1 Praneet Opanasopit,1 Tanasait Ngawhirunpat1 1Department of Pharmaceutical Technology, Faculty of Pharmacy, Pharmaceutical Development of Green Innovations Group, Silpakorn University, Nakhon Pathom, 2Department of Pharmacology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, 3Department of Clinical Chemistry, Faculty of Allied Health Sciences, Chulalongkorn University, Bangkok, Thailand Abstract: The aim of this study was to investigate the use of different types of microneedles (MNs and nanocarriers for in vitro skin permeation and in vivo immunization of plasmid DNA encoding ovalbumin (pOVA. In vitro skin permeation studies indicated that hollow MNs had a superior enhancing effect on skin permeation compared with solid MN patches, electroporation (EP patches, the combination of MN and EP patches, and untreated skin. Upon using hollow MNs combined with nanocarriers for pOVA delivery, the skin permeation was higher than for the delivery of naked pOVA, as evidenced by the increased amount of pOVA in Franz diffusion cells and immunoglobulin G (IgG antibody responses. When the hollow MNs were used for the delivery of nanocarrier:pOVA complexes into the skin of mice, they induced a stronger IgG immune response than conventional subcutaneous (SC injections. In addition, immunization of mice with the hollow MNs did not induce signs of skin infection or pinpoint bleeding. Accordingly, the hollow MNs combined with a nanocarrier delivery system is a promising approach for delivering pOVA complexes to the skin for promoting successful immunization. Keywords: hollow microneedle, solid microneedle, electroporation, plasmid DNA encoding ovalbumin, skin immunization, nanocarrier

  2. Immunization with plasmid DNA encoding the hemagglutinin and the nucleoprotein confers robust protection against a lethal canine distemper virus challenge.

    Science.gov (United States)

    Dahl, Lotte; Jensen, Trine Hammer; Gottschalck, Elisabeth; Karlskov-Mortensen, Peter; Jensen, Tove Dannemann; Nielsen, Line; Andersen, Mads Klindt; Buckland, Robin; Wild, T Fabian; Blixenkrone-Møller, Merete

    2004-09-09

    We have investigated the protective effect of immunization of a highly susceptible natural host of canine distemper virus (CDV) with DNA plasmids encoding the viral nucleoprotein (N) and hemagglutinin (H). The combined intradermal and intramuscular routes of immunization elicited high virus-neutralizing serum antibody titres in mink (Mustela vison). To mimic natural exposure, we also conducted challenge infection by horizontal transmission from infected contact animals. Other groups received a lethal challenge infection by administration to the mucosae of the respiratory tract and into the muscle. One of the mink vaccinated with N plasmid alone developed severe disease after challenge. In contrast, vaccination with the H plasmid together with the N plasmid conferred solid protection against disease and we were unable to detect CDV infection in PBMCs or in different tissues after challenge. Our findings show that DNA immunization by the combined intradermal and intramuscular routes can confer solid protective immunity against naturally transmitted morbillivirus infection and disease.

  3. Construction of adiponectin-encoding plasmid DNA and gene therapy of non-obese type 2 diabetes mellitus.

    Science.gov (United States)

    Nan, Mei Hua; Park, Jeong-Sook; Myung, Chang-Seon

    2010-01-01

    Adiponectin (ADN), an insulin-sensitizing adipokine, stimulates glucose uptake, inhibits gluconeogenesis, and plays an important role in improving insulin sensitivity. Since blood levels of ADN are low in type 2 diabetes mellitus (DM), this study was designed to investigate the therapeutic effectiveness of increasing the ADN level through injection of plasmid DNA encoding ADN in type 2 DM. A non-obese type 2 DM mouse model was established via combined administration of streptozotocin with nicotinamide and exhibited significantly higher plasma glucose concentration and insulin resistance compared with normal controls according to oral glucose tolerance and insulin challenge tests. Plasmid DNA encoding mouse ADN from differentiated NIH3T3 adipocytes was constructed in pVAX1 (pVAX/ADN). Transfection of pVAX/ADN into various cell lines including HeLa, HT22, HEK293, HepG2, and SK-Hep1 cells, increased ADN mRNA expression levels in a dose-dependent manner. The administration of pVAX/ADN into non-obese type 2 DM mice via tail vein significantly increased the blood level of ADN and decreased the plasma glucose concentration. Moreover, the parameters related to insulin resistance (HOMA-IR) and insulin sensitivity (QUICKI) were significantly improved. These results suggest that ADN gene therapy could be a clinically effective tool for the treatment of type 2 DM.

  4. Effect of cytokine-encoding plasmid delivery on immune response to Japanese encephalitis virus DNA vaccine in mice.

    Science.gov (United States)

    Bharati, Kaushik; Appaiahgari, Mohan Babu; Vrati, Sudhanshu

    2005-01-01

    We have previously shown that immunization of mice with plasmid pMEa synthesizing Japanese encephalitis virus (JEV) envelope protein induced anti-JEV humoral and cellular immune responses. We now show that intra-muscular co-administration of mice with pMEa and pGM-CSF, encoding murine granulocyte-macrophage colony-stimulating factor or pIL-2, encoding murine interleukin-2 given 4 days after pMEa, augmented anti-JEV antibody titers. This did not enhance the level of protection in immunized mice against JEV. However, intra-dermal co-administration of pMEa and pGM-CSF in mice using the gene gun, enhanced anti-JEV antibody titers resulting in an increased level of protection in mice against lethal JEV challenge.

  5. Dendritic cell mediated delivery of plasmid DNA encoding LAMP/HIV-1 Gag fusion immunogen enhances T cell epitope responses in HLA DR4 transgenic mice.

    Directory of Open Access Journals (Sweden)

    Gregory G Simon

    2010-01-01

    Full Text Available This report describes the identification and bioinformatics analysis of HLA-DR4-restricted HIV-1 Gag epitope peptides, and the application of dendritic cell mediated immunization of DNA plasmid constructs. BALB/c (H-2d and HLA-DR4 (DRA1*0101, DRB1*0401 transgenic mice were immunized with immature dendritic cells transfected by a recombinant DNA plasmid encoding the lysosome-associated membrane protein-1/HIV-1 Gag (pLAMP/gag chimera antigen. Three immunization protocols were compared: 1 primary subcutaneous immunization with 1x10(5 immature dendritic cells transfected by electroporation with the pLAMP/gag DNA plasmid, and a second subcutaneous immunization with the naked pLAMP/gag DNA plasmid; 2 primary immunization as above, and a second subcutaneous immunization with a pool of overlapping peptides spanning the HIV-1 Gag sequence; and 3 immunization twice by subcutaneous injection of the pLAMP/gag DNA plasmid. Primary immunization with pLAMP/gag-transfected dendritic cells elicited the greatest number of peptide specific T-cell responses, as measured by ex vivo IFN-gamma ELISpot assay, both in BALB/c and HLA-DR4 transgenic mice. The pLAMP/gag-transfected dendritic cells prime and naked DNA boost immunization protocol also resulted in an increased apparent avidity of peptide in the ELISpot assay. Strikingly, 20 of 25 peptide-specific T-cell responses in the HLA-DR4 transgenic mice contained sequences that corresponded, entirely or partially to 18 of the 19 human HLA-DR4 epitopes listed in the HIV molecular immunology database. Selection of the most conserved epitope peptides as vaccine targets was facilitated by analysis of their representation and variability in all reported sequences. These data provide a model system that demonstrates a the superiority of immunization with dendritic cells transfected with LAMP/gag plasmid DNA, as compared to naked DNA, b the value of HLA transgenic mice as a model system for the identification and evaluation

  6. [Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

    Science.gov (United States)

    Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

    1985-11-01

    The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

  7. Hydrodynamic delivery of plasmid DNA encoding human Fc?R-Ig dimers blocks immune-complex mediated inflammation in mice

    OpenAIRE

    Shashidharamurthy, Rangaiah; Machiah, Deepa; Bozeman, Erica N.; Srivatsan, Sanjay; Patel, Jaina; Cho, Alice; Jacob, Joshy; Selvaraj, Periasamy

    2011-01-01

    Therapeutic use and function of recombinant molecules can be studied by the expression of foreign genes in mice. In this study, we have expressed human Fcgamma receptor ?Ig fusion molecules (Fc?R-Igs) in mice by administering Fc?R-Ig plasmid DNAs hydrodynamically and compared their effectiveness to purified molecules in blocking immune-complex (IC) mediated inflammation in mice. The concentration of hydrodynamically expressed Fc?R-Igs (CD16AF-Ig, CD32AR-Ig and CD32AH-Ig) reached a maximum of ...

  8. Plasmid DNA Delivery: Nanotopography Matters.

    Science.gov (United States)

    Song, Hao; Yu, Meihua; Lu, Yao; Gu, Zhengying; Yang, Yannan; Zhang, Min; Fu, Jianye; Yu, Chengzhong

    2017-12-20

    Plasmid DNA molecules with unique loop structures have widespread bioapplications, in many cases relying heavily on delivery vehicles to introduce them into cells and achieve their functions. Herein, we demonstrate that control over delicate nanotopography of silica nanoparticles as plasmid DNA vectors has significant impact on the transfection efficacy. For silica nanoparticles with rambutan-, raspberry-, and flower-like morphologies composed of spike-, hemisphere-, and bowl-type subunit nanotopographies, respectively, the rambutan-like nanoparticles with spiky surfaces demonstrate the highest plasmid DNA binding capability and transfection efficacy of 88%, higher than those reported for silica-based nanovectors. Moreover, it is shown that the surface spikes of rambutan nanoparticles provide a continuous open space to bind DNA chains via multivalent interactions and protect the gene molecules sheltered in the spiky layer against nuclease degradation, exhibiting no significant transfection decay. This unique protection feature is in great contrast to a commercial transfection agent with similar transfection performance but poor protection capability against enzymatic cleavage. Our study provides new understandings in the rational design of nonviral vectors for efficient gene delivery.

  9. DNA vaccination with a plasmid encoding LACK-TSA fusion against Leishmania major infection in BALB/c mice.

    Science.gov (United States)

    Maspi, N; Ghaffarifar, F; Sharifi, Z; Dalimi, A; Khademi, S Z

    2017-12-01

    Vaccination would be the most important strategy for the prevention and elimination of leishmaniasis. The aim of the present study was to compare the immune responses induced following DNA vaccination with LACK (Leishmania analogue of the receptor kinase C), TSA (Thiol-specific-antioxidant) genes alone or LACK-TSA fusion against cutaneous leishmaniasis (CL). Cellular and humoral immune responses were evaluated before and after challenge with Leishmania major (L. major). In addition, the mean lesion size was also measured from 3th week post-infection. All immunized mice showed a partial immunity characterized by higher interferon (IFN)-γ and Immunoglobulin G (IgG2a) levels compared to control groups (pTSA fusion. Mean lesion sizes reduced significantly in all immunized mice compared with control groups at 7th week post-infection (pTSA and TSA groups than LACK group after challenge (pTSA antigens against CL. Furthermore, this study demonstrated that a bivalent vaccine can induce stronger immune responses and protection against infectious challenge with L. major.

  10. Large-scale preparation of plasmid DNA.

    Science.gov (United States)

    Heilig, J S; Elbing, K L; Brent, R

    2001-05-01

    Although the need for large quantities of plasmid DNA has diminished as techniques for manipulating small quantities of DNA have improved, occasionally large amounts of high-quality plasmid DNA are desired. This unit describes the preparation of milligram quantities of highly purified plasmid DNA. The first part of the unit describes three methods for preparing crude lysates enriched in plasmid DNA from bacterial cells grown in liquid culture: alkaline lysis, boiling, and Triton lysis. The second part describes four methods for purifying plasmid DNA in such lysates away from contaminating RNA and protein: CsCl/ethidium bromide density gradient centrifugation, polyethylene glycol (PEG) precipitation, anion-exchange chromatography, and size-exclusion chromatography.

  11. Pharmaceutical development of the plasmid DNA vaccine pDERMATT

    NARCIS (Netherlands)

    Quaak, S.G.L.

    2009-01-01

    The discovery of tumor specific antigens and self tolerance mechanisms against these antigens led to the assumption that antigens circulating at sufficient concentration levels could break this self tolerance mechanism and evoke immunological antitumor effects. pDERMATT (plasmid DNA encoding

  12. Hydrodynamic delivery of plasmid DNA encoding human FcγR-Ig dimers blocks immune-complex mediated inflammation in mice.

    Science.gov (United States)

    Shashidharamurthy, R; Machiah, D; Bozeman, E N; Srivatsan, S; Patel, J; Cho, A; Jacob, J; Selvaraj, P

    2012-09-01

    Therapeutic use and function of recombinant molecules can be studied by the expression of foreign genes in mice. In this study, we have expressed human Fcγ receptor-Ig fusion molecules (FcγR-Igs) in mice by administering FcγR-Ig plasmid DNAs hydrodynamically and compared their effectiveness with purified molecules in blocking immune-complex (IC)-mediated inflammation in mice. The concentration of hydrodynamically expressed FcγR-Igs (CD16A(F)-Ig, CD32A(R)-Ig and CD32A(H)-Ig) reached a maximum of 130 μg ml(-1) of blood within 24 h after plasmid DNA administration. The in vivo half-life of FcγR-Igs was found to be 9-16 days and western blot analysis showed that the FcγR-Igs were expressed as a homodimer. The hydrodynamically expressed FcγR-Igs blocked 50-80% of IC-mediated inflammation up to 3 days in a reverse passive Arthus reaction model. Comparative analysis with purified molecules showed that hydrodynamically expressed FcγR-Igs are more efficient than purified molecules in blocking IC-mediated inflammation and had a higher half-life. In summary, these results suggest that the administration of a plasmid vector with the FcγR-Ig gene can be used to study the consequences of blocking IC binding to FcγRs during the development of inflammatory diseases. This approach may have potential therapeutic value in treating IC-mediated inflammatory autoimmune diseases such as lupus, arthritis and autoimmune vasculitis.

  13. Plasmid fermentation process for DNA immunization applications.

    Science.gov (United States)

    Carnes, Aaron E; Williams, James A

    2014-01-01

    Plasmid DNA for immunization applications must be of the highest purity and quality. The ability of downstream purification to efficiently produce a pure final product is directly influenced by the performance of the upstream fermentation process. While several clinical manufacturing facilities already have validated fermentation processes in place to manufacture plasmid DNA for use in humans, a simple and inexpensive laboratory-scale fermentation process can be valuable for in-house production of plasmid DNA for use in animal efficacy studies. This chapter describes a simple fed-batch fermentation process for producing bacterial cell paste enriched with high-quality plasmid DNA. A constant feeding strategy results in a medium cell density culture with continuously increasing plasmid amplification towards the end of the process. Cell banking and seed culture preparation protocols, which can dramatically influence final product yield and quality, are also described. These protocols are suitable for production of research-grade plasmid DNA at the 100 mg-to-1.5 g scale from a typical 10 L laboratory benchtop fermentor.

  14. Plasmids encoding PKI(1-31), a specific inhibitor of cAMP-stimulated gene expression, inhibit the basal transcriptional activity of some but not all cAMP-regulated DNA response elements in JEG-3 cells.

    Science.gov (United States)

    Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J

    1989-11-25

    Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids

  15. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  16. Crystallization and preliminary X-ray crystallographic studies on the parD-encoded protein Kid from Escherichia coli plasmid R1

    NARCIS (Netherlands)

    Hargreaves, D.; Giraldo, R.; Santos-Sierra, S.; Boelens, R.; Rice, D.W.; Díaz Orejas, R.; Rafferty, J.B.

    2002-01-01

    DNA replication in Escherichia coli and therefore bacterial proliferation relies upon the efficient functioning of the DnaB helicase. The toxin protein Kid from the plasmid-stability system parD encoded on plasmid R1 of E. coli is thought to target and block DnaB-dependent DNA replication. The

  17. Plasmid-encoded diacetyl (acetoin) reductase in Leuconostoc pseudomesenteroides

    DEFF Research Database (Denmark)

    Rattray, Fergal P; Myling-Petersen, Dorte; Larsen, Dianna

    2003-01-01

    A plasmid-borne diacetyl (acetoin) reductase (butA) from Leuconostoc pseudomesenteroides CHCC2114 was sequenced and cloned. Nucleotide sequence analysis revealed an open reading frame encoding a protein of 257 amino acids which had high identity at the amino acid level to diacetyl (acetoin...

  18. Plasmid-derived DNA Strand Displacement Gates for Implementing Chemical Reaction Networks.

    Science.gov (United States)

    Chen, Yuan-Jyue; Rao, Sundipta D; Seelig, Georg

    2015-11-25

    DNA nanotechnology requires large amounts of highly pure DNA as an engineering material. Plasmid DNA could meet this need since it is replicated with high fidelity, is readily amplified through bacterial culture and can be stored indefinitely in the form of bacterial glycerol stocks. However, the double-stranded nature of plasmid DNA has so far hindered its efficient use for construction of DNA nanostructures or devices that typically contain single-stranded or branched domains. In recent work, it was found that nicked double stranded DNA (ndsDNA) strand displacement gates could be sourced from plasmid DNA. The following is a protocol that details how these ndsDNA gates can be efficiently encoded in plasmids and can be derived from the plasmids through a small number of enzymatic processing steps. Also given is a protocol for testing ndsDNA gates using fluorescence kinetics measurements. NdsDNA gates can be used to implement arbitrary chemical reaction networks (CRNs) and thus provide a pathway towards the use of the CRN formalism as a prescriptive molecular programming language. To demonstrate this technology, a multi-step reaction cascade with catalytic kinetics is constructed. Further it is shown that plasmid-derived components perform better than identical components assembled from synthetic DNA.

  19. Chondroitin sulfate-polyethylenimine copolymer-coated superparamagnetic iron oxide nanoparticles as an efficient magneto-gene carrier for microRNA-encoding plasmid DNA delivery

    Science.gov (United States)

    Lo, Yu-Lun; Chou, Han-Lin; Liao, Zi-Xian; Huang, Shih-Jer; Ke, Jyun-Han; Liu, Yu-Sheng; Chiu, Chien-Chih; Wang, Li-Fang

    2015-04-01

    MicroRNA-128 (miR-128) is an attractive therapeutic molecule with powerful glioblastoma regulation properties. However, miR-128 lacks biological stability and leads to poor delivery efficacy in clinical applications. In our previous study, we demonstrated two effective transgene carriers, including polyethylenimine (PEI)-decorated superparamagnetic iron oxide nanoparticles (SPIONs) as well as chemically-conjugated chondroitin sulfate-PEI copolymers (CPs). In this contribution, we report optimized conditions for coating CPs onto the surfaces of SPIONs, forming CPIOs, for magneto-gene delivery systems. The optimized weight ratio of the CPs and SPIONs is 2 : 1, which resulted in the formation of a stable particle as a good transgene carrier. The hydrodynamic diameter of the CPIOs is ~136 nm. The gel electrophoresis results demonstrate that the weight ratio of CPIO/DNA required to completely encapsulate pDNA is >=3. The in vitro tests of CPIO/DNA were done in 293 T, CRL5802, and U87-MG cells in the presence and absence of an external magnetic field. The magnetofection efficiency of CPIO/DNA was measured in the three cell lines with or without fetal bovine serum (FBS). CPIO/DNA exhibited remarkably improved gene expression in the presence of the magnetic field and 10% FBS as compared with a gold non-viral standard, PEI/DNA, and a commercial magnetofection reagent, PolyMag/DNA. In addition, CPIO/DNA showed less cytotoxicity than PEI/DNA and PolyMag/DNA against the three cell lines. The transfection efficiency of the magnetoplex improved significantly with an assisted magnetic field. In miR-128 delivery, a microRNA plate array and fluorescence in situ hybridization were used to demonstrate that CPIO/pMIRNA-128 indeed expresses more miR-128 with the assisted magnetic field than without. In a biodistribution test, CPIO/Cy5-DNA showed higher accumulation at the tumor site where an external magnet is placed nearby.MicroRNA-128 (miR-128) is an attractive therapeutic molecule

  20. Comparative assessment of plasmid DNA delivery by encapsulation ...

    African Journals Online (AJOL)

    Tropical Journal of Pharmaceutical Research January 2018; 17 (1): 1-10 ... Purpose: To compare the gene delivery effectiveness of plasmid DNA (pDNA) ..... Intramuscular delivery of DNA ... copolymeric system for gene delivery in complete.

  1. Production and pharmaceutical formulation of plasmid DNA vaccines

    NARCIS (Netherlands)

    van der Heijden, I.

    2013-01-01

    Research leading to the thesis ‘Production and pharmaceutical formulation of plasmid DNA vaccines‘ can be divided into two parts. The first part describes the development of a Good Manufacturing Practice (GMP) compliant plasmid DNA production process of pDNA vaccines for the treatment of Human

  2. The Plasmid Complement of Lactococcus lactis UC509.9 Encodes Multiple Bacteriophage Resistance Systems

    Science.gov (United States)

    Ainsworth, Stuart; Mahony, Jennifer

    2014-01-01

    Lactococcus lactis subsp. cremoris strains are used globally for the production of fermented dairy products, particularly hard cheeses. Believed to be of plant origin, L. lactis strains that are used as starter cultures have undergone extensive adaptation to the dairy environment, partially through the acquisition of extrachromosomal DNA in the form of plasmids that specify technologically important phenotypic traits. Here, we present a detailed analysis of the eight plasmids of L. lactis UC509.9, an Irish dairy starter strain. Key industrial phenotypes were mapped, and genes that are typically associated with lactococcal plasmids were identified. Four distinct, plasmid-borne bacteriophage resistance systems were identified, including two abortive infection systems, AbiB and AbiD1, thereby supporting the observed phage resistance of L. lactis UC509.9. AbiB escape mutants were generated for phage sk1, which were found to carry mutations in orf6, which encodes the major capsid protein of this phage. PMID:24814781

  3. Two highly divergent lineages of exfoliative toxin B-encoding plasmids revealed in impetigo strains of Staphylococcus aureus.

    Science.gov (United States)

    Botka, Tibor; Růžičková, Vladislava; Svobodová, Karla; Pantůček, Roman; Petráš, Petr; Čejková, Darina; Doškař, Jiří

    2017-09-01

    Exfoliative toxin B (ETB) encoded by some large plasmids plays a crucial role in epidermolytic diseases caused by Staphylococcus aureus. We have found as yet unknown types of etb gene-positive plasmids isolated from a set of impetigo strains implicated in outbreaks of pemphigus neonatorum in Czech maternity hospitals. Plasmids from the strains of clonal complex CC121 were related to archetypal plasmid pETB TY4 . Sharing a 33-kb core sequence including virulence genes for ETB, EDIN C, and lantibiotics, they were assigned to a stand-alone lineage, named pETB TY4 -based plasmids. Differing from each other in the content of variable DNA regions, they formed four sequence types. In addition to them, a novel unique plasmid pETB608 isolated from a strain of ST130 was described. Carrying conjugative cluster genes, as well as new variants of etb and edinA genes, pETB608 could be regarded as a source of a new lineage of ETB plasmids. We have designed a helpful detection assay, which facilitates the precise identification of the all described types of ETB plasmids. Copyright © 2017 Elsevier GmbH. All rights reserved.

  4. Plasmid P1 replication: negative control by repeated DNA sequences.

    OpenAIRE

    Chattoraj, D; Cordes, K; Abeles, A

    1984-01-01

    The incompatibility locus, incA, of the unit-copy plasmid P1 is contained within a fragment that is essentially a set of nine 19-base-pair repeats. One or more copies of the fragment destabilizes the plasmid when present in trans. Here we show that extra copies of incA interfere with plasmid DNA replication and that a deletion of most of incA increases plasmid copy number. Thus, incA is not essential for replication but is required for its control. When cloned in a high-copy-number vector, pi...

  5. Comparative assessment of plasmid DNA delivery by encapsulation ...

    African Journals Online (AJOL)

    Purpose: To compare the gene delivery effectiveness of plasmid DNA (pDNA) encapsulated within poly (D,L-lactide-co-glycolide) (PLGA) nanoparticles with that adsorbed on PLGA nanoparticles. Methods: PLGA nanoparticles were prepared using solvent-evaporation method. To encapsulate pDNA within the particles, ...

  6. Plasmid DNA damage induced by helium atmospheric pressure plasma jet

    Science.gov (United States)

    Han, Xu; Cantrell, William A.; Escobar, Erika E.; Ptasinska, Sylwia

    2014-03-01

    A helium atmospheric pressure plasma jet (APPJ) is applied to induce damage to aqueous plasmid DNA. The resulting fractions of the DNA conformers, which indicate intact molecules or DNA with single- or double-strand breaks, are determined using agarose gel electrophoresis. The DNA strand breaks increase with a decrease in the distance between the APPJ and DNA samples under two working conditions of the plasma source with different parameters of applied electric pulses. The damage level induced in the plasmid DNA is also enhanced with increased plasma irradiation time. The reactive species generated in the APPJ are characterized by optical emission spectra, and their roles in possible DNA damage processes occurring in an aqueous environment are also discussed.

  7. Photoinduced silver nanoparticles/nanorings on plasmid DNA scaffolds.

    Science.gov (United States)

    Liu, Jianhua; Zhang, Xiaoliang; Yu, Mei; Li, Songmei; Zhang, Jindan

    2012-01-23

    Biological scaffolds are being actively explored for the synthesis of nanomaterials with novel structures and unexpected properties. Toroidal plasmid DNA separated from the Bacillus host is applied as a sacrificial mold for the synthesis of silver nanoparticles and nanorings. The photoirradiation method is applied to reduce Ag(I) on the plasmid. The nanoparticles are obtained by varying the concentration of the Ag(I) ion solution and the exposure time of the plasmid-Ag(I) complex under UV light at 254 nm and room temperature. It is found that the plasmid serves not only as a template but also as a reductant to drive the silver nucleation and deposition. The resulting nanoparticles have a face-centered cubic (fcc) crystal structure and 20-30 nm average diameter. The detailed mechanism is discussed, and other metals or alloys could also be synthesized with this method. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Centromere pairing by a plasmid-encoded type I ParB protein

    DEFF Research Database (Denmark)

    Ringgaard, Simon; Löwe, Jan; Gerdes, Kenn

    2007-01-01

    The par2 locus of Escherichia coli plasmid pB171 encodes two trans-acting proteins, ParA and ParB, and two cis-acting sites, parC1 and parC2, to which ParB binds cooperatively. ParA is related to MinD and oscillates in helical structures and thereby positions ParB/parC-carrying plasmids regularly......, hence identifying the N terminus of ParB as a requirement for ParB-mediated centromere pairing. These observations suggest that centromere pairing is an important intermediate step in plasmid partitioning mediated by the common type I loci....

  9. Effect of Surfactants on Plasmid DNA Stability and Release from ...

    African Journals Online (AJOL)

    Purpose: To evaluate the effect of surfactants on plasmid DNA during preparation and release from polylactic glycolide (PLGA) microspheres. Methods: Various surfactants, both ionic and non-ionic (Span, Tween, Triton X100, cetyltrimethylammonium bromide and sodium dodecyl sulphate), were added during the ...

  10. Simple method for identification of plasmid-coded proteins

    International Nuclear Information System (INIS)

    Sancar, A.; Hack, A.M.; Rupp, W.D.

    1979-01-01

    Proteins encoded by plasmid DNA are specifically labeled in uv-irradiated cells of Escherichia coli carrying recA and uvrA mutations because extensive degradation of the chromosome DNA occurs concurrently with amplification of plasmid DNA

  11. Rapid and inexpensive method for isolating plasmid DNA

    International Nuclear Information System (INIS)

    Aljanabi, S. M.; Al-Awadi, S. J.; Al-Kazaz, A. A.; Baghdad Univ.

    1997-01-01

    A small-scale and economical method for isolating plasmid DNA from bacteria is described. The method provides DNA of suitable quality for most DNA manipulation techniques. This DNA can be used for restriction endonuclease digestion, southern blot hybridization, nick translation and end labeling of DNA probes, Polymerase Chain Reaction (PCR) -based techniques, transformation, DNA cycle-sequencing, and Chain-termination method for DNA sequencing. The entire procedure is adapted to 1.5 ml microfuge tubes and takes approximately 30 mins. The DNA isolated by this method has the same purity produced by CTAB and cesium chloride precipitation and purification procedures respectively. The two previous methods require many hours to obtain the final product and require the use of very expensive equipment as ultracentrifuge. This method is well suited for the isolation of plasmid DNA from a large number of bacterial samples and in a very short time and low cost in laboratories where chemicals, expensive equipment and finance are limited factors in conducting molecular research. (authors). 11refs. 11refs

  12. Comparative metagenomic analysis of plasmid encoded functions in the human gut microbiome

    Directory of Open Access Journals (Sweden)

    Marchesi Julian R

    2010-01-01

    Full Text Available Abstract Background Little is known regarding the pool of mobile genetic elements associated with the human gut microbiome. In this study we employed the culture independent TRACA system to isolate novel plasmids from the human gut microbiota, and a comparative metagenomic analysis to investigate the distribution and relative abundance of functions encoded by these plasmids in the human gut microbiome. Results Novel plasmids were acquired from the human gut microbiome, and homologous nucleotide sequences with high identity (>90% to two plasmids (pTRACA10 and pTRACA22 were identified in the multiple human gut microbiomes analysed here. However, no homologous nucleotide sequences to these plasmids were identified in the murine gut or environmental metagenomes. Functions encoded by the plasmids pTRACA10 and pTRACA22 were found to be more prevalent in the human gut microbiome when compared to microbial communities from other environments. Among the most prevalent functions identified was a putative RelBE toxin-antitoxin (TA addiction module, and subsequent analysis revealed that this was most closely related to putative TA modules from gut associated bacteria belonging to the Firmicutes. A broad phylogenetic distribution of RelE toxin genes was observed in gut associated bacterial species (Firmicutes, Bacteroidetes, Actinobacteria and Proteobacteria, but no RelE homologues were identified in gut associated archaeal species. We also provide indirect evidence for the horizontal transfer of these genes between bacterial species belonging to disparate phylogenetic divisions, namely Gram negative Proteobacteria and Gram positive species from the Firmicutes division. Conclusions The application of a culture independent system to capture novel plasmids from the human gut mobile metagenome, coupled with subsequent comparative metagenomic analysis, highlighted the unexpected prevalence of plasmid encoded functions in the gut microbial ecosystem. In

  13. A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.

    Science.gov (United States)

    Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos

    2015-07-01

    The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

  14. Proton-induced direct and indirect damage of plasmid DNA

    Czech Academy of Sciences Publication Activity Database

    Vyšín, Luděk; Pachnerová Brabcová, Kateřina; Štěpán, V.; Moretto-Capelle, P.; Bugler, B.; Legube, G.; Cafarelli, P.; Casta, R.; Champeaux, J. P.; Sence, M.; Vlk, M.; Wagner, Richard; Štursa, Jan; Zach, Václav; Incerti, S.; Juha, Libor; Davídková, Marie

    2015-01-01

    Roč. 54, č. 3 (2015), s. 343-352 ISSN 0301-634X R&D Projects: GA ČR GA13-28721S; GA MŠk LD12008; GA MŠk LM2011019 Institutional support: RVO:68378271 ; RVO:61389005 Keywords : proton radiation * DNA plasmid * direct and indirect effects * clustered damage * repair enzymes Subject RIV: BO - Biophysics Impact factor: 1.923, year: 2015

  15. Type 3 Fimbriae Encoded on Plasmids Are Expressed from a Unique Promoter without Affecting Host Motility, Facilitating an Exceptional Phenotype That Enhances Conjugal Plasmid Transfer

    DEFF Research Database (Denmark)

    Madsen, Jonas Stenlokke; Riber, Leise; Kot, Witold

    2016-01-01

    Horizontal gene transfer (HGT), the transmission of genetic material to a recipient that is not the progeny of the donor, is fundamental in bacterial evolution. HGT is often mediated by mobile genetic elements such as conjugative plasmids, which may be in conflict with the chromosomal elements...... of the genome because they are independent replicons that may petition their own evolutionary strategy. Here we study differences between type 3 fimbriae encoded on wild type plasmids and in chromosomes. Using known and newly characterized plasmids we show that the expression of type 3 fimbriae encoded...... on plasmids is systematically different, as MrkH, a c-di-GMP dependent transcriptional activator is not needed for strong expression of the fimbriae. MrkH is required for expression of type 3 fimbriae of the Klebsiella pneumoniae chromosome, wherefrom the fimbriae operon (mrkABCDF) of plasmids is believed...

  16. DNA repair in bacterial cultures and plasmid DNA exposed to infrared laser for treatment of pain

    International Nuclear Information System (INIS)

    Canuto, K S; Sergio, L P S; Marciano, R S; Guimarães, O R; Polignano, G A C; Geller, M; Fonseca, A S; Paoli, F

    2013-01-01

    Biostimulation of tissues by low intensity lasers has been described on a photobiological basis and clinical protocols are recommended for treatment of various diseases, but their effects on DNA are controversial. The objective of this work was to evaluate effects of low intensity infrared laser exposure on survival and bacterial filamentation in Escherichia coli cultures, and induction of DNA lesions in bacterial plasmids. In E. coli cultures and plasmids exposed to an infrared laser at fluences used to treat pain, bacterial survival and filamentation and DNA lesions in plasmids were evaluated by electrophoretic profile. Data indicate that the infrared laser (i) increases survival of E. coli wild type in 24 h of stationary growth phase, (ii) induces bacterial filamentation, (iii) does not alter topological forms of plasmids and (iv) does not alter the electrophoretic profile of plasmids incubated with exonuclease III or formamidopyrimidine DNA glycosylase. A low intensity infrared laser at the therapeutic fluences used to treat pain can alter survival of E. coli wild type, induce filamentation in bacterial cells, depending on physiologic conditions and DNA repair, and induce DNA lesions other than single or double DNA strand breaks or alkali-labile sites, which are not targeted by exonuclease III or formamidopyrimidine DNA glycosylase. (letter)

  17. Damage of plasmid DNA by high energy ions

    International Nuclear Information System (INIS)

    Michaelidesova, A.; Pachnerova Brabcova, K.; Davidkova, M.

    2018-01-01

    The aim of the study was to determine the degree of direct DNA damage by high-energy ions, which are one of the components of cosmic rays, and therefore the knowledge of the biological effects of these ions is key to long-term space missions with human crew. The pBR322 plasmid containing 4361 base pairs was used in this study. The aqueous solution of plasmid pBR322 was transferred on ice to Japan to the Heavy Ion Medical Accelerator in Chiba, the Research Center for Charged Particle Therapy. Just before the experiment, the droplets of solution of known concentration were applied to the slides and the water was allowed to evaporate to produce dry DNA samples. Half of the slides were irradiated with 290 MeV/u of carbon ions and a dose rate of 20 Gy/min. The other half of the slides were irradiated with helium nuclei of 150 MeV/hr and a dose rate of 12.6 Gy/min. Both sets of slides were irradiated with doses of 0-1,400 Gy with a 200 Gy step. After irradiation, the samples were re-dissolved in distilled water, frozen and transported on ice to the Czech Republic for processing. Samples were analyzed by agarose gel electrophoresis. The plasmid was evaluated separately to determine the degree of radiation induced lesions and further to incubation with enzymes recognizing basal damage. (authors)

  18. A novel pAA virulence plasmid encoding toxins and two distinct variants of the fimbriae of enteroaggregative Escherichia coli

    DEFF Research Database (Denmark)

    Jønsson, Rie; Struve, Carsten; Boll, Erik J.

    2017-01-01

    phylogenetically distinct, strains harboring the major pilin subunits from both AAF/III and AAF/V. Whole-genome and plasmid sequencing revealed that in these six strains the agg3A and agg5A genes were located on a novel pAA plasmid variant. Moreover, the plasmid also encoded several other virulence genes including...... some not previously found on pAA plasmids. Thus, this plasmid endows the host strains with a remarkably high number of EAEC associated virulence genes hereby likely promoting strain pathogenicity....

  19. Plasmid DNA damage caused by stibine and trimethylstibine

    International Nuclear Information System (INIS)

    Andrewes, Paul; Kitchin, Kirk T.; Wallace, Kathleen

    2004-01-01

    Antimony is classified as 'possibly carcinogenic to humans' and there is also sufficient evidence for antimony carcinogenicity in experimental animals. Stibine is a volatile inorganic antimony compound to which humans can be exposed in occupational settings (e.g., lead-acid battery charging). Because it is highly toxic, stibine is considered a significant health risk; however, its genotoxicity has received little attention. For the work reported here, stibine was generated by sodium borohydride reduction of potassium antimony tartrate. Trimethylstibine is a volatile organometallic antimony compound found commonly in landfill and sewage fermentation gases at concentrations ranging between 0.1 and 100 μg/m 3 . Trimethylstibine is generally considered to pose little environmental or health risk. In the work reported here, trimethylstibine was generated by reduction of trimethylantimony dichloride using either sodium borohydride or the thiol compounds, dithioerythritol (DTE), L-cysteine, and glutathione. Here we report the evaluation of the in vitro genotoxicities of five antimony compounds--potassium antimony tartrate, stibine, potassium hexahydroxyantimonate, trimethylantimony dichloride, and trimethylstibine--using a plasmid DNA-nicking assay. Of these five antimony compounds, only stibine and trimethylstibine were genotoxic (significant nicking to pBR 322 plasmid DNA). We found stibine and trimethylstibine to be about equipotent with trimethylarsine using this plasmid DNA-nicking assay. Reaction of trimethylantimony dichloride with either glutathione or L-cysteine to produce DNA-damaging trimethylstibine was observed with a trimethylantimony dichloride concentration as low as 50 μM and L-cysteine or glutathione concentrations as low as 500 and 200 μM, respectively, for a 24 h incubation

  20. Plasmid segregation mechanisms

    DEFF Research Database (Denmark)

    Ebersbach, G.; Gerdes, Kenn

    2005-01-01

    Bacterial plasmids encode partitioning (par) loci that ensure ordered plasmid segregation prior to cell division. par loci come in two types: those that encode actin-like ATPases and those that encode deviant Walker-type ATPases. ParM, the actin-like ATPase of plasmid R1, forms dynamic filaments...... that segregate plasmids paired at mid-cell to daughter cells. Like microtubules, ParM filaments exhibit dynamic instability (i.e., catastrophic decay) whose regulation is an important component of the DNA segregation process. The Walker box ParA ATPases are related to MinD and form highly dynamic, oscillating...... filaments that are required for the subcellular movement and positioning of plasmids. The role of the observed ATPase oscillation is not yet understood. However, we propose a simple model that couples plasmid segregation to ParA oscillation. The model is consistent with the observed movement...

  1. Storing data encoded DNA in living organisms

    Science.gov (United States)

    Wong,; Pak C. , Wong; Kwong K. , Foote; Harlan, P [Richland, WA

    2006-06-06

    Current technologies allow the generation of artificial DNA molecules and/or the ability to alter the DNA sequences of existing DNA molecules. With a careful coding scheme and arrangement, it is possible to encode important information as an artificial DNA strand and store it in a living host safely and permanently. This inventive technology can be used to identify origins and protect R&D investments. It can also be used in environmental research to track generations of organisms and observe the ecological impact of pollutants. Today, there are microorganisms that can survive under extreme conditions. As well, it is advantageous to consider multicellular organisms as hosts for stored information. These living organisms can provide as memory housing and protection for stored data or information. The present invention provides well for data storage in a living organism wherein at least one DNA sequence is encoded to represent data and incorporated into a living organism.

  2. Plasmid DNA initiates replication of yellow fever vaccine in vitro and elicits virus-specific immune response in mice

    International Nuclear Information System (INIS)

    Tretyakova, Irina; Nickols, Brian; Hidajat, Rachmat; Jokinen, Jenny; Lukashevich, Igor S.; Pushko, Peter

    2014-01-01

    Yellow fever (YF) causes an acute hemorrhagic fever disease in tropical Africa and Latin America. To develop a novel experimental YF vaccine, we applied iDNA infectious clone technology. The iDNA represents plasmid that encodes the full-length RNA genome of 17D vaccine downstream from a cytomegalovirus (CMV) promoter. The vaccine was designed to transcribe the full-length viral RNA and to launch 17D vaccine virus in vitro and in vivo. Transfection with 10 ng of iDNA plasmid was sufficient to start replication of vaccine virus in vitro. Safety of the parental 17D and iDNA-derived 17D viruses was confirmed in AG129 mice deficient in receptors for IFN-α/β/γ. Finally, direct vaccination of BALB/c mice with a single 20 μg dose of iDNA plasmid resulted in seroconversion and elicitation of virus-specific neutralizing antibodies in animals. We conclude that iDNA immunization approach combines characteristics of DNA and attenuated vaccines and represents a promising vaccination strategy for YF. - Highlights: • The iDNA ® platform combines advantages of DNA and live attenuated vaccines. • Yellow fever (YF) 17D vaccine was launched from iDNA plasmid in vitro and in vivo. • Safety of iDNA-generated 17D virus was confirmed in AG129 mice. • BALB/c mice seroconverted after a single-dose vaccination with iDNA. • YF virus-neutralizing response was elicited in iDNA-vaccinated mice

  3. Plasmid DNA initiates replication of yellow fever vaccine in vitro and elicits virus-specific immune response in mice

    Energy Technology Data Exchange (ETDEWEB)

    Tretyakova, Irina; Nickols, Brian; Hidajat, Rachmat [Medigen, Inc., 8420 Gas House Pike, Suite S, Frederick, MD 21701 (United States); Jokinen, Jenny; Lukashevich, Igor S. [Department of Pharmacology and Toxicology, School of Medicine, Center for Predictive Medicine and Emerging Infectious Diseases, University of Louisville, Louisville, KY (United States); Pushko, Peter, E-mail: ppushko@medigen-usa.com [Medigen, Inc., 8420 Gas House Pike, Suite S, Frederick, MD 21701 (United States)

    2014-11-15

    Yellow fever (YF) causes an acute hemorrhagic fever disease in tropical Africa and Latin America. To develop a novel experimental YF vaccine, we applied iDNA infectious clone technology. The iDNA represents plasmid that encodes the full-length RNA genome of 17D vaccine downstream from a cytomegalovirus (CMV) promoter. The vaccine was designed to transcribe the full-length viral RNA and to launch 17D vaccine virus in vitro and in vivo. Transfection with 10 ng of iDNA plasmid was sufficient to start replication of vaccine virus in vitro. Safety of the parental 17D and iDNA-derived 17D viruses was confirmed in AG129 mice deficient in receptors for IFN-α/β/γ. Finally, direct vaccination of BALB/c mice with a single 20 μg dose of iDNA plasmid resulted in seroconversion and elicitation of virus-specific neutralizing antibodies in animals. We conclude that iDNA immunization approach combines characteristics of DNA and attenuated vaccines and represents a promising vaccination strategy for YF. - Highlights: • The iDNA{sup ®} platform combines advantages of DNA and live attenuated vaccines. • Yellow fever (YF) 17D vaccine was launched from iDNA plasmid in vitro and in vivo. • Safety of iDNA-generated 17D virus was confirmed in AG129 mice. • BALB/c mice seroconverted after a single-dose vaccination with iDNA. • YF virus-neutralizing response was elicited in iDNA-vaccinated mice.

  4. Repair of UV-irradiated plasmid DNA in excision repair deficient mutants of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Ikai, K.; Tano, K.; Ohnishi, T.; Nozu, K.

    1985-01-01

    The repair of UV-irradiated DNA of plasmid YEp13 was studied in the incision defective strains by measurement of cell transformation frequency. In Saccharomyces cerevisiae, rad1,2,3 and 4 mutants could repair UV-damaged plasmid DNA. In Escherichia coli, uvrA mutant was unable to repair UV-damaged plasmid DNA; however, pretreatment of the plasmid with Micrococcus luteus endonuclease increased repair. It was concluded that all the mutations of yeast were probably limited only to the nuclear DNA. (author)

  5. Quantification bias caused by plasmid DNA conformation in quantitative real-time PCR assay.

    Science.gov (United States)

    Lin, Chih-Hui; Chen, Yu-Chieh; Pan, Tzu-Ming

    2011-01-01

    Quantitative real-time PCR (qPCR) is the gold standard for the quantification of specific nucleic acid sequences. However, a serious concern has been revealed in a recent report: supercoiled plasmid standards cause significant over-estimation in qPCR quantification. In this study, we investigated the effect of plasmid DNA conformation on the quantification of DNA and the efficiency of qPCR. Our results suggest that plasmid DNA conformation has significant impact on the accuracy of absolute quantification by qPCR. DNA standard curves shifted significantly among plasmid standards with different DNA conformations. Moreover, the choice of DNA measurement method and plasmid DNA conformation may also contribute to the measurement error of DNA standard curves. Due to the multiple effects of plasmid DNA conformation on the accuracy of qPCR, efforts should be made to assure the highest consistency of plasmid standards for qPCR. Thus, we suggest that the conformation, preparation, quantification, purification, handling, and storage of standard plasmid DNA should be described and defined in the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) to assure the reproducibility and accuracy of qPCR absolute quantification.

  6. Effect of the atmospheric pressure nonequilibrium plasmas on the conformational changes of plasmid DNA

    International Nuclear Information System (INIS)

    Yan Xu; He Guangyuan; Shi Mengjun; Gao Xuan; Li Yin; Ma Fengyun; Yu Men; Wang Changdong; Wang Yuesheng; Yang Guangxiao; Zou Fei; Lu Xinpei; Xiong Qing; Xiong Zilan

    2009-01-01

    The cold atmospheric pressure plasma, which has been widely used for biomedical applications, may potentially affect the conformation of DNA. In this letter, an atmospheric pressure plasma plume is used to investigate its effects on the conformational changes of DNA of plasmid pAHC25. It is found that the plasma plume could cause plasmid DNA topology alteration, resulting in the percentage of the supercoiled plasmid DNA form decreased while that of the open circular and linearized form of plasmid DNA increased as detected by agrose gel electrophoresis. On the other hand, further investigation by using polymerase chain reaction method shows that the atmospheric pressure plasma jet treatments under proper conditions does not affect the genes of the plasmid DNA, which may have potential application in increasing the transformation frequency by genetic engineering.

  7. 2D Barcode for DNA Encoding

    OpenAIRE

    Elena Purcaru; Cristian Toma

    2011-01-01

    The paper presents a solution for endcoding/decoding DNA information in 2D barcodes. First part focuses on the existing techniques and symbologies in 2D barcodes field. The 2D barcode PDF417 is presented as starting point. The adaptations and optimizations on PDF417 and on DataMatrix lead to the solution - DNA2DBC - DeoxyriboNucleic Acid Two Dimensional Barcode. The second part shows the DNA2DBC encoding/decoding process step by step. In conclusions are enumerated the most important features ...

  8. DNA sequence analysis of plasmids from multidrug resistant Salmonella enterica serotype Heidelberg isolates.

    Directory of Open Access Journals (Sweden)

    Jing Han

    Full Text Available Salmonella enterica serovar Heidelberg is among the most detected serovars in swine and poultry, ranks among the top five serotypes associated with human salmonellosis and is disproportionately associated with invasive infections and mortality in humans. Salmonella are known to carry plasmids associated with antimicrobial resistance and virulence. To identify plasmid-associated genes in multidrug resistant S. enterica serovar Heidelberg, antimicrobial resistance plasmids from five isolates were sequenced using the 454 LifeSciences pyrosequencing technology. Four of the isolates contained incompatibility group (Inc A/C multidrug resistance plasmids harboring at least eight antimicrobial resistance genes. Each of these strains also carried a second resistance plasmid including two IncFIB, an IncHI2 and a plasmid lacking an identified Inc group. The fifth isolate contained an IncI1 plasmid, encoding resistance to gentamicin, streptomycin and sulfonamides. Some of the IncA/C plasmids lacked the full concert of transfer genes and yet were able to be conjugally transferred, likely due to the transfer genes carried on the companion plasmids in the strains. Several non-IncA/C resistance plasmids also carried putative virulence genes. When the sequences were compared to previously sequenced plasmids, it was found that while all plasmids demonstrated some similarity to other plasmids, they were unique, often due to differences in mobile genetic elements in the plasmids. Our study suggests that Salmonella Heidelberg isolates harbor plasmids that co-select for antimicrobial resistance and virulence, along with genes that can mediate the transfer of plasmids within and among other bacterial isolates. Prevalence of such plasmids can complicate efforts to control the spread of S. enterica serovar Heidelberg in food animal and human populations.

  9. Translational control and differential RNA decay are key elements regulating postsegregational expression of the killer protein encoded by the parB locus of plasmid R1

    DEFF Research Database (Denmark)

    Gerdes, K; Helin, K; Christensen, O W

    1988-01-01

    The parB locus of plasmid R1, which mediates plasmid stability via postsegregational killing of plasmid-free cells, encodes two genes, hok and sok. The hok gene product is a potent cell-killing protein. The hok gene is regulated at the translational level by the sok gene-encoded repressor, a small...

  10. Chemical Space of DNA-Encoded Libraries.

    Science.gov (United States)

    Franzini, Raphael M; Randolph, Cassie

    2016-07-28

    In recent years, DNA-encoded chemical libraries (DECLs) have attracted considerable attention as a potential discovery tool in drug development. Screening encoded libraries may offer advantages over conventional hit discovery approaches and has the potential to complement such methods in pharmaceutical research. As a result of the increased application of encoded libraries in drug discovery, a growing number of hit compounds are emerging in scientific literature. In this review we evaluate reported encoded library-derived structures and identify general trends of these compounds in relation to library design parameters. We in particular emphasize the combinatorial nature of these libraries. Generally, the reported molecules demonstrate the ability of this technology to afford hits suitable for further lead development, and on the basis of them, we derive guidelines for DECL design.

  11. Plasmid DNA initiates replication of yellow fever vaccine in vitro and elicits virus-specific immune response in mice.

    Science.gov (United States)

    Tretyakova, Irina; Nickols, Brian; Hidajat, Rachmat; Jokinen, Jenny; Lukashevich, Igor S; Pushko, Peter

    2014-11-01

    Yellow fever (YF) causes an acute hemorrhagic fever disease in tropical Africa and Latin America. To develop a novel experimental YF vaccine, we applied iDNA infectious clone technology. The iDNA represents plasmid that encodes the full-length RNA genome of 17D vaccine downstream from a cytomegalovirus (CMV) promoter. The vaccine was designed to transcribe the full-length viral RNA and to launch 17D vaccine virus in vitro and in vivo. Transfection with 10 ng of iDNA plasmid was sufficient to start replication of vaccine virus in vitro. Safety of the parental 17D and iDNA-derived 17D viruses was confirmed in AG129 mice deficient in receptors for IFN-α/β/γ. Finally, direct vaccination of BALB/c mice with a single 20 μg dose of iDNA plasmid resulted in seroconversion and elicitation of virus-specific neutralizing antibodies in animals. We conclude that iDNA immunization approach combines characteristics of DNA and attenuated vaccines and represents a promising vaccination strategy for YF. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. Chromosomal and plasmid-encoded factors of Shigella flexneri induce secretogenic activity ex vivo.

    Directory of Open Access Journals (Sweden)

    Christina S Faherty

    Full Text Available Shigella flexneri is a Gram-negative, facultative intracellular pathogen that causes millions of cases of watery or bloody diarrhea annually, resulting in significant global mortality. Watery diarrhea is thought to arise in the jejunum, and subsequent bloody diarrhea occurs as a result of invasion of the colonic epithelium. Previous literature has demonstrated that Shigella encodes enterotoxins, both chromosomally and on the 220 kilobase virulence plasmid. The ShigellaEnterotoxins 1 and 2 (ShET1 and ShET2 have been shown to increase water accumulation in the rabbit ileal loop model. In addition, these toxins increase the short circuit current in rabbit tissue mounted in Ussing chambers, which is a model for the ion exchange that occurs during watery diarrhea. In this study, we sought to validate the use of mouse jejunum in Ussing chamber as an alternative, more versatile model to study bacterial pathogenesis. In the process, we also identified enterotoxins in addition to ShET1 and ShET2 encoded by S. flexneri. Through analysis of proteins secreted from wildtype bacteria and various deletion mutants, we have identified four factors responsible for enterotoxin activity: ShET1 and Pic, which are encoded on the chromosome; ShET2 (encoded by sen or ospD3, which requires the type-III secretion system for secretion; and SepA, an additional factor encoded on the virulence plasmid. The use of mouse jejunum serves as a reliable and reproducible model to identify the enterotoxins elaborated by enteric bacteria. Moreover, the identification of all Shigella proteins responsible for enterotoxin activity is vital to our understanding of Shigella pathogenicity and to our success in developing safe and effective vaccine candidates.

  13. DNA-Encoded Dynamic Combinatorial Chemical Libraries.

    Science.gov (United States)

    Reddavide, Francesco V; Lin, Weilin; Lehnert, Sarah; Zhang, Yixin

    2015-06-26

    Dynamic combinatorial chemistry (DCC) explores the thermodynamic equilibrium of reversible reactions. Its application in the discovery of protein binders is largely limited by difficulties in the analysis of complex reaction mixtures. DNA-encoded chemical library (DECL) technology allows the selection of binders from a mixture of up to billions of different compounds; however, experimental results often show low a signal-to-noise ratio and poor correlation between enrichment factor and binding affinity. Herein we describe the design and application of DNA-encoded dynamic combinatorial chemical libraries (EDCCLs). Our experiments have shown that the EDCCL approach can be used not only to convert monovalent binders into high-affinity bivalent binders, but also to cause remarkably enhanced enrichment of potent bivalent binders by driving their in situ synthesis. We also demonstrate the application of EDCCLs in DNA-templated chemical reactions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Nopaline-type Ti plasmid of Agrobacterium encodes a VirF-like functional F-box protein.

    Science.gov (United States)

    Lacroix, Benoît; Citovsky, Vitaly

    2015-11-20

    During Agrobacterium-mediated genetic transformation of plants, several bacterial virulence (Vir) proteins are translocated into the host cell to facilitate infection. One of the most important of such translocated factors is VirF, an F-box protein produced by octopine strains of Agrobacterium, which presumably facilitates proteasomal uncoating of the invading T-DNA from its associated proteins. The presence of VirF also is thought to be involved in differences in host specificity between octopine and nopaline strains of Agrobacterium, with the current dogma being that no functional VirF is encoded by nopaline strains. Here, we show that a protein with homology to octopine VirF is encoded by the Ti plasmid of the nopaline C58 strain of Agrobacterium. This protein, C58VirF, possesses the hallmarks of functional F-box proteins: it contains an active F-box domain and specifically interacts, via its F-box domain, with SKP1-like (ASK) protein components of the plant ubiquitin/proteasome system. Thus, our data suggest that nopaline strains of Agrobacterium have evolved to encode a functional F-box protein VirF.

  15. Cloning and DNA sequence of the mercuric- and organomercurial-resistance determinants of plasmid pDU1358

    International Nuclear Information System (INIS)

    Griffin, H.G.; Foster, T.J.; Silver, S.; Misra, T.K.

    1987-01-01

    The broad-spectrum mercurial-resistance plasmid pDU1358 was analyzed by cloning the resistance determinants and preparing a physical and genetic map of a 45-kilobase (kb) region of the plasmid that contains two separate mercurial-resistance operons that mapped about 20 kb apart. One encoded narrow-spectrum mercurial resistance to Hg 2+ and a few organomercurials; the other specified broad-spectrum resistance to phenylmercury and additional organomercurials. Each determinant governed mercurial transport functions. Southern DNA x DNA hybridization experiments using gene-specific probes from the plasmid R100 mer operon indicated close homology with the R100 deteminant. The 2153 base pairs of the promoter-distal part of the broad-spectrum Hg 2+ -resistance operon of pDU1358 were sequenced. This region included the 3'-terminal part of the merA gene, merD, unidentified reading frame URF1, and a part of URF2 homologous to previously sequenced determinants of plasmid R100. Between the merA and merD genes, an open reading frame encoding a 212 amino acid polypeptide was identified as the merB gene that determines the enzyme organomercurial lyase that cleaves the C-Hg bond of phenylmercury

  16. Putative DNA-dependent RNA polymerase in Mitochondrial Plasmid of Paramecium caudatum Stock GT704

    Directory of Open Access Journals (Sweden)

    Trina Ekawati Tallei

    2015-10-01

    Full Text Available Mitochondria of Paramecium caudatum stock GT704 has a set of four kinds of linear plasmids with sizes of 8.2, 4.1, 2.8 and 1.4 kb. The plasmids of 8.2 and 2.8 kb exist as dimers consisting of 4.1- and 1.4-kb monomers, respectively. The plasmid 2.8 kb, designated as pGT704-2.8, contains an open reading frame encodes for putative DNA-dependent RNA polymerase (RNAP. This study reveals that this RNAP belongs to superfamily of DNA/RNA polymerase and family of T7/T3 single chain RNA polymerase and those of mitochondrial plasmid of fungi belonging to Basidiomycota and Ascomycota. It is suggested that RNAP of pGT704-2.8 can perform transcription without transcription factor as promoter recognition. Given that only two motifs were found, it could not be ascertained whether this RNAP has a full function independently or integrated with mtDNA in carrying out its function.

  17. Molecular Cloning, Expression and Characterization of Plasmid Encoding Rhomboid 4 (ROM4 of Tachyzoite of Toxoplasma gondii RH Strain

    Directory of Open Access Journals (Sweden)

    Mohammad Taghi RAHIMI

    2017-12-01

    Full Text Available AbstractBackground: The objective of this study was to clone, express and characterize the gene encoding rhomboid 4 (ROM4 proteins, a vital gene in surface adhesion and host cell invasion process of tachyzoite of T. gondii in an appropriate expression vector and eukaryotic cell for production of recombinant protein.Methods: Toxoplasma RNA was isolated from tachyzoites (RH strain and complementary DNA was synthesized. Oligonucleotide primer pair was designed based on Toxoplasma ROM4 gene sequence with XhoI and EcoRI restriction sites at 5´ end of forward and reverse primers, respectively. ROM4 gene was amplified by PCR, cloned into pTG19-T vector and the recombinant plasmid was sequenced. The gene was subcloned into pcDNA3 plasmid and expressed in CHO cells as eukaryotic cell. SDS-PAGE and western blotting were performed for protein determination and verification.Results: Cloning of ROM4 gene in pTG19-T vector was confirmed by colony-PCR and enzymatic digestion. The results of enzymatic digestion and gene sequencing confirmed successful cloning and subcloning procedures. The nucleotide sequence of the cloned ROM4 gene showed 99% homology compared to the corresponding sequences of original gene. SDS-PAGE and western blotting analyses of the purified protein revealed a single band having expected size of 65 kDa.Conclusion: This eukaryotic expression system is an appropriate system for high-level recombinant protein production of ROM4 gene from T. gondii tachyzoites used as antigenic component for serological assay and vaccine development.

  18. Direct identification of antibiotic resistance genes on single plasmid molecules using CRISPR/Cas9 in combination with optical DNA mapping

    Science.gov (United States)

    Müller, Vilhelm; Rajer, Fredrika; Frykholm, Karolin; Nyberg, Lena K.; Quaderi, Saair; Fritzsche, Joachim; Kristiansson, Erik; Ambjörnsson, Tobias; Sandegren, Linus; Westerlund, Fredrik

    2016-12-01

    Bacterial plasmids are extensively involved in the rapid global spread of antibiotic resistance. We here present an assay, based on optical DNA mapping of single plasmids in nanofluidic channels, which provides detailed information about the plasmids present in a bacterial isolate. In a single experiment, we obtain the number of different plasmids in the sample, the size of each plasmid, an optical barcode that can be used to identify and trace the plasmid of interest and information about which plasmid that carries a specific resistance gene. Gene identification is done using CRISPR/Cas9 loaded with a guide-RNA (gRNA) complementary to the gene of interest that linearizes the circular plasmids at a specific location that is identified using the optical DNA maps. We demonstrate the principle on clinically relevant extended spectrum beta-lactamase (ESBL) producing isolates. We discuss how the gRNA sequence can be varied to obtain the desired information. The gRNA can either be very specific to identify a homogeneous group of genes or general to detect several groups of genes at the same time. Finally, we demonstrate an example where we use a combination of two gRNA sequences to identify carbapenemase-encoding genes in two previously not characterized clinical bacterial samples.

  19. Resident enhanced repair: novel repair process action on plasmid DNA transformed into Escherichia coli K-12

    International Nuclear Information System (INIS)

    Strike, P.; Roberts, R.J.

    1982-01-01

    The survival of UV-irradiated DNA of plasmid NTP16 was monitored after its transformation into recipient cells containing an essentially homologous undamaged plasmid, pLV9. The presence of pLV9 resulted in a substantial increase in the fraction of damaged NTP16 molecules which survived in the recipient cells. This enhanced survival requires the host uvrA + and uvrB + gene products, but not the host recA + gene product. The requirement for both homologous DNA and the uvrA + gene products suggests that a novel repair process may act on plasmid DNA. Possible mechanisms for this process are considered

  20. TOL plasmid carriage enhances biofilm formation and increases extracellular DNA content in Pseudomonas putida KT2440

    DEFF Research Database (Denmark)

    D'Alvise, Paul; Sjoholm, O.R.; Yankelevich, T.

    2010-01-01

    laser scanning microscopy. The TOL-carrying strains formed pellicles and thick biofilms, whereas the same strains without the plasmid displayed little adherent growth. Microscopy using fluorescent nucleic acid-specific stains revealed differences in the production of extracellular polymeric substances......: TOL carriage leads to more extracellular DNA (eDNA) in pellicles and biofilms. Pellicles were dissolved by DNase I treatment. Enhanced cell lysis due to plasmid carriage was ruled out as the mechanism for eDNA release. We report, for the first time, that carriage of a conjugative plasmid leads...

  1. 3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

    Science.gov (United States)

    Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

    2008-09-01

    We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

  2. Plasmid DNA damage by heavy ions at spread-out Bragg peak energies

    NARCIS (Netherlands)

    Dang, H. M.; van Goethem, M. J.; van der Graaf, E. R.; Brandenburg, S.; Hoekstra, R.; Schlatholter, T.

    2010-01-01

    Interaction of ionizing radiation with plasmid DNA can lead to formation of single strand breaks, double strand breaks and clustered lesions. We have investigated the response of the synthetic plasmid pBR322 in aqueous solution upon irradiation with (12)C ions under spread-out Bragg peak conditions

  3. A one-step miniprep for the isolation of plasmid DNA and lambda phage particles.

    Directory of Open Access Journals (Sweden)

    George Lezin

    Full Text Available Plasmid DNA minipreps are fundamental techniques in molecular biology. Current plasmid DNA minipreps use alkali and the anionic detergent SDS in a three-solution format. In addition, alkali minipreps usually require additional column-based purification steps and cannot isolate other extra-chromosomal elements, such as bacteriophages. Non-ionic detergents (NIDs have been used occasionally as components of multiple-solution plasmid DNA minipreps, but a one-step approach has not been developed. Here, we have established a one-tube, one-solution NID plasmid DNA miniprep, and we show that this approach also isolates bacteriophage lambda particles. NID minipreps are more time-efficient than alkali minipreps, and NID plasmid DNA performs better than alkali DNA in many downstream applications. In fact, NID crude lysate DNA is sufficiently pure to be used in digestion and sequencing reactions. Microscopic analysis showed that the NID procedure fragments E. coli cells into small protoplast-like components, which may, at least in part, explain the effectiveness of this approach. This work demonstrates that one-step NID minipreps are a robust method to generate high quality plasmid DNA, and NID approaches can also isolate bacteriophage lambda particles, outperforming current standard alkali-based minipreps.

  4. Characterization of Plasmid DNA Location within Chitosan/PLGA/pDNA Nanoparticle Complexes Designed for Gene Delivery

    Directory of Open Access Journals (Sweden)

    Hali Bordelon

    2011-01-01

    Full Text Available Poly(D,L-lactide-co-glycolide- (PLGA-chitosan nanoparticles are becoming an increasingly common choice for the delivery of nucleic acids to cells for various genetic manipulation techniques. These particles are biocompatible, with tunable size and surface properties, possessing an overall positive charge that promotes complex formation with negatively charged nucleic acids. This study examines properties of the PLGA-chitosan nanoparticle/plasmid DNA complex after formation. Specifically, the study aims to determine the optimal ratio of plasmid DNA:nanoparticles for nucleic acid delivery purposes and to elucidate the location of the pDNA within these complexes. Such characterization will be necessary for the adoption of these formulations in a clinical setting. The ability of PLGA-chitosan nanoparticles to form complexes with pDNA was evaluated by using the fluorescent intercalating due OliGreen to label free plasmid DNA. By monitoring the fluorescence at different plasmid: nanoparticle ratios, the ideal plasmid:nanoparticle ration for complete complexation of plasmid was determined to be 1:50. Surface-Enhanced Raman Spectroscopy and gel digest studies suggested that even at these optimal complexation ratios, a portion of the plasmid DNA was located on the outer complex surface. This knowledge will facilitate future investigations into the functionality of the system in vitro and in vivo.

  5. Design and evaluation of protein expression in a recombinant plasmid encoding epitope gp 350/220 of the Epstein-Barr virus (EBV)

    Science.gov (United States)

    Himmah, Karimatul; Dluha, Nurul; Anyndita, Nadya V. M.; Rifa'i, Muhaimin; Widodo

    2017-05-01

    The Epstein - Barr virus (EBV) causes severe infections that may lead to cancers such as nasopharyngeal carcinoma. Development of effective EBV vaccines is necessary to prevent the virus spreading throughout the community. TheEBV has a surface protein gp 350/220, which serves as an antigen to help interact with host cells. Epitopes of the protein can potentially serve as bases for a vaccine. In a previous study, we have found a conserved epitope of gp 350/220 from all strains EBV through an in silico approach. The aim of this study is to design and overproduce a recombinant peptide of epitope gp 350/220 in E. coli. DNA encoding the conserved epitope was synthesized and cloned into plasmid pET-22b(+); the recombinant plasmid was transformed into E. coli strains DH5α and BL21. The transformed plasmid DNA was isolated and confirmed by restriction using XbaI and PstI enzymes followed by DNA sequencing. Protein expression was induced by isopropyl-D-thiogalactopyranoside (IPTG) with final concentrations of 0.1, 0.2, 1, and 2 mM in consecutive times. An osmotic shock method was used to isolate protein from periplasmic fraction of E. coli DH5α and BL21. The SDS-PAGE analysis was carried out to detect peptide target (3.4 kDa). Based on this result, the induction process did not work properly, and thus needs further investigation.

  6. Photo-transfection of mouse embryonic stem cells with plasmid DNA using femtosecond laser pulses

    CSIR Research Space (South Africa)

    Thobakgale, Lebogang

    2017-01-01

    Full Text Available This presentation is about the photo-transfection of mouse embryonic stem cells with plasmid DNA using femtosecond laser pulses. It outlines the background on embryonic stem cells (ES) and phototransfection....

  7. Optimizing hyaluronidase dose and plasmid DNA delivery greatly improves gene electrotransfer efficiency in rat skeletal muscle

    DEFF Research Database (Denmark)

    Åkerström, Thorbjörn; Vedel, Kenneth; Needham Andersen, Josefine

    2015-01-01

    Transfection of rat skeletal muscle in vivo is a widely used research model. However, gene electrotransfer protocols have been developed for mice and yield variable results in rats. We investigated whether changes in hyaluronidase pre-treatment and plasmid DNA delivery can improve transfection...... with a homogenous distribution. We also show that transfection was stable over five weeks of regular exercise or inactivity. Our findings show that species-specific plasmid DNA delivery and hyaluronidase pre-treatment greatly improves transfection efficiency in rat skeletal muscle....... efficiency in rat skeletal muscle. We found that pre-treating the muscle with a hyaluronidase dose suitable for rats (0.56. U/g b.w.) prior to plasmid DNA injection increased transfection efficiency by >200% whereas timing of the pre-treatment did not affect efficiency. Uniformly distributing plasmid DNA...

  8. Presence of Glycopeptide-Encoding Plasmids in Enterococcal Isolates from Food and Humans in Denmark

    DEFF Research Database (Denmark)

    Migura, Lourdes Garcia; Valenzuela, Antonio Jesus Sanchez; Jensen, Lars Bogø

    2011-01-01

    developed techniques for classification of plasmids. Replicons associated with sex pheromone-inducible plasmids were detected in all GR E. faecalis, whereas GR Enterococcus faecium contained plasmids known to be widely distributed among enterococci. vanA resistance is common in E. faecium isolates from meat...... and animals in Europe and is rarely found in E. faecalis. This article describes the first characterization of MGE from vanA mediated E. faecalis, thus linking this resistance genotype to pheromone responding plasmids....

  9. A rapid method for screening arrayed plasmid cDNA library by PCR

    International Nuclear Information System (INIS)

    Hu Yingchun; Zhang Kaitai; Wu Dechang; Li Gang; Xiang Xiaoqiong

    1999-01-01

    Objective: To develop a PCR-based method for rapid and effective screening of arrayed plasmid cDNA library. Methods: The plasmid cDNA library was arrayed and screened by PCR with a particular set of primers. Results: Four positive clones were obtained through about one week. Conclusion: This method can be applied to screening not only normal cDNA clones, but also cDNA clones-containing small size fragments. This method offers significant advantages over traditional screening method in terms of sensitivity, specificity and efficiency

  10. Plasmid DNA Analysis of Pasteurella multocida Serotype B isolated from Haemorrhagic Septicaemia outbreaks in Malaysia

    Directory of Open Access Journals (Sweden)

    Jamal, H.

    2005-01-01

    Full Text Available A total of 150 purified isolates of Pasteurella multocida serotype B were used (Salmah, 2004 for plasmid DNA curing experiment to determine hyaluronidase activity, antibiotic resistance pattern (ARP and mice lethality test (LD50 for their role of pathogenicity. A plasmid curing experiment was carried out by using the intercalating agent; ethidium bromide and rifampicin, where it was found all the plasmids had been cured (plasmidless from Pasteurella multocida. All of these plasmidless isolates maintained their phenotypic characteristics. They showed the same antibiotic resistancepattern as before curing, produced hyaluronidase and possessed lethality activity in mice when injected intraperitoneally(i.p. Based on this observation, the antibiotic resistance, hyaluronidase activity and mice virulence could probably be chromosomal-mediated. Plasmids were detected 100% in all P. multocida isolates with identical profile of 2 plasmids size 3.0 and 5.5 kb. No large plasmids could be detected in all isolates. Since all the isolates appeared to have identicalplasmid profiles, they were subjected to restriction enzyme(RE analysis. From RE analysis results obtained, it can be concluded that the plasmid DNA in serotype B isolates are identical. Only 4 of 32 REs were found to cleave these plasmids with identical restriction fingerprints; BglII, HaeIII, RsaI and SspI. From RE analysis results, it can be concluded that the plasmid DNA isolates are identical. This plasmid might not played any role in pathogenicity of Pasteurella multocida serotype B, however this information is important for the construction of shuttle vectors in genetic studies of the pathogenicity of haemorrhagic septicaemia(HS.

  11. pEVL: A Linear Plasmid for Generating mRNA IVT Templates With Extended Encoded Poly(A Sequences

    Directory of Open Access Journals (Sweden)

    Alexandra E Grier

    2016-01-01

    Full Text Available Increasing demand for large-scale synthesis of in vitro transcribed (IVT mRNA is being driven by the increasing use of mRNA for transient gene expression in cell engineering and therapeutic applications. An important determinant of IVT mRNA potency is the 3′ polyadenosine (poly(A tail, the length of which correlates with translational efficiency. However, present methods for generation of IVT mRNA rely on templates derived from circular plasmids or PCR products, in which homopolymeric tracts are unstable, thus limiting encoded poly(A tail lengths to ≃120 base pairs (bp. Here, we have developed a novel method for generation of extended poly(A tracts using a previously described linear plasmid system, pJazz. We find that linear plasmids can successfully propagate poly(A tracts up to ≃500 bp in length for IVT mRNA production. We then modified pJazz by removing extraneous restriction sites, adding a T7 promoter sequence upstream from an extended multiple cloning site, and adding a unique type-IIS restriction site downstream from the encoded poly(A tract to facilitate generation of IVT mRNA with precisely defined encoded poly(A tracts and 3′ termini. The resulting plasmid, designated pEVL, can be used to generate IVT mRNA with consistent defined lengths and terminal residue(s.

  12. Purification of supercoiled DNA of plasmid Col E1 by RPC-5 chromatography

    Energy Technology Data Exchange (ETDEWEB)

    Best, A.N.; Allison, D.P.; Novelli, G.D.

    1981-07-01

    Col E1 DNA can be purified to a high degree by RPC-5 chromatography of a partially purified cell lysate with a very shallow linear NaC1 gradient at pH 7.8. Electron micrographs demonstrated that the purest fractions were composed of 93% supercoiled (form I) DNA and 7% open circular (form II) DNA. The actual chromatography can be accomplished in 13 to 14 h and is designed for the production of several milligrams of plasmid DNA.

  13. Plasmid containing a DNA ligase gene from Haemophilus influenzae

    International Nuclear Information System (INIS)

    McCarthy, D.; Griffin, K.; Setlow, J.K.

    1984-01-01

    A ligase gene from Haemophilus influenzae was cloned into the shuttle vector pDM2. Although the plasmid did not affect X-ray sensitivity, it caused an increase in UV sensitivity of the wild-type but not excision-defective H. influenzae and a decrease in UV sensitivity of the rec-1 mutant. 14 references, 2 figures

  14. Breaks in plasmid DNA strand induced by laser radiation at a wavelength of 193 nm

    International Nuclear Information System (INIS)

    Gurzadyan, G.G.; Shul'te Frolinde, D.

    1996-01-01

    DNA of plasmid pB322 irradiated with laser at a wavelength of 193 nm was treated with an extract containing proteins from E.coli K12 AB1157 (wild-type). The enzymes were found to produce single- and double-strand DNA breaks, which was interpreted as a transformation of a portion of cyclobutane pyrimidine dimers and (6-4) photoproducts into nonrepairable single-strand DNA breaks. The products resulted from ionization of DNA, in particular, single-strand breaks, transform to double-strand breaks. A comparison of these data with the data on survival of plasmid upon transformation of E.coli K12 AB1157 enables one to assess the biological significance of single- and double-strand breaks. The inactivation of the plasmid is mainly determined by the number of directly formed laser-induced single-strand breaks. 26 refs.; 2 figs

  15. Autonomous replication of plasmids bearing monkey DNA origin-enriched sequences

    International Nuclear Information System (INIS)

    Frappier, L.; Zannis-Hadjopoulos, M.

    1987-01-01

    Twelve clones of origin-enriched sequences (ORS) isolated from early replicating monkey (CV-1) DNA were examined for transient episomal replication in transfected CV-1, COS-7, and HeLa cells. Plasmid DNA was isolated at time intervals after transfection and screened by the Dpn I resistance assay or by the bromodeoxyuridine substitution assay to differentiate between input and replicated DNA. The authors have identified four monkey ORS (ORS3, -8, -9, and -12) that can support plasmid replication in mammalian cells. This replication is carried out in a controlled and semiconservative manner characteristic of mammalian replicons. ORS replication was most efficient in HeLa cells. Electron microscopy showed ORS8 and ORS12 plasmids of the correct size with replication bubbles. Using a unique restriction site in ORS12, we have mapped the replication bubble within the monkey DNA sequence

  16. TOL Plasmid Carriage Enhances Biofilm Formation and Increases Extracellular DNA Content in Pseudomonas Putida KT2440

    DEFF Research Database (Denmark)

    Smets, Barth F.; D'Alvise, Paul; Yankelovich, T.

    laser scanning microscopy. The TOL-carrying strains formed pellicles and thick biofilms, whereas the same strains without the plasmid displayed little adherent growth. Microscopy using fluorescent nucleic acid- specific stains (cytox orange, propidium iodide) revealed differences in production...... combined with specific cytostains; release of cytoplasmic material was assayed by a β-glucosidase assay. Enhanced cell lysis due to plasmid carriage was ruled out as the mechanism for eDNA release. We report, for the first time, that carriage of a conjugative plasmid leads to increased biofilm formation...

  17. Heavy ion induced damage to plasmid DNA : plateau region vs. spread out Bragg-peak

    NARCIS (Netherlands)

    Dang, H.M.; van Goethem, M.J.; van der Graaf, E.R.; Brandenburg, S.; Hoekstra, R.A.; Schlathölter, T.A.

    We have investigated the damage of synthetic plasmid pBR322 DNA in dilute aqueous solutions induced by fast carbon ions. The relative contribution of indirect damage and direct damage to the DNA itself is expected to vary with linear energy transfer along the ion track, with the direct damage

  18. Enhanced immunogenicity of DNA fusion vaccine encoding secreted hepatitis B surface antigen and chemokine RANTES

    International Nuclear Information System (INIS)

    Kim, Seung Jo; Suh, Dongchul; Park, Sang Eun; Park, Jeong-Sook; Byun, Hyang-Min; Lee, Chan; Lee, Sun Young; Kim, Inho; Oh, Yu-Kyoung

    2003-01-01

    To increase the potency of DNA vaccines, we constructed genetic fusion vaccines encoding antigen, secretion signal, and/or chemokine RANTES. The DNA vaccines encoding secreted hepatitis B surface antigen (HBsAg) were constructed by inserting HBsAg gene into an expression vector with an endoplasmic reticulum (ER)-targeting secretory signal sequence. The plasmid encoding secretory HBsAg (pER/HBs) was fused to cDNA of RANTES, generating pER/HBs/R. For comparison, HBsAg genes were cloned into pVAX1 vector with no signal sequence (pHBs), and further linked to the N-terminus of RANTES (pHBs/R). Immunofluorescence study showed the cytoplasmic localization of HBsAg protein expressed from pHBs and pHBs/R, but not from pER/HBs and pER/HBs/R at 48 h after transfection. In mice, RANTES-fused DNA vaccines more effectively elicited the levels of HBsAg-specific IgG antibodies than pHBs. All the DNA vaccines induced higher levels of IgG 2a rather than IgG 1 antibodies. Of RANTES-fused vaccines, pER/HBs/R encoding the secreted fusion protein revealed much higher humoral and CD8 + T cell-stimulating responses compared to pHBs/R. These results suggest that the immunogenicity of DNA vaccines could be enhanced by genetic fusion to a secretory signal peptide sequence and RANTES

  19. Cloning of Salmonella typhimurium DNA encoding mutagenic DNA repair

    International Nuclear Information System (INIS)

    Thomas, S.M.; Sedgwick, S.G.

    1989-01-01

    Mutagenic DNA repair in Escherichia coli is encoded by the umuDC operon. Salmonella typhimurium DNA which has homology with E. coli umuC and is able to complement E. coli umuC122::Tn5 and umuC36 mutations has been cloned. Complementation of umuD44 mutants and hybridization with E. coli umuD also occurred, but these activities were much weaker than with umuC. Restriction enzyme mapping indicated that the composition of the cloned fragment is different from the E. coli umuDC operon. Therefore, a umu-like function of S. typhimurium has been found; the phenotype of this function is weaker than that of its E. coli counterpart, which is consistent with the weak mutagenic response of S. typhimurium to UV compared with the response in E. coli

  20. Plasmid ColE1 as a Molecular Vehicle for Cloning and Amplification of DNA

    Science.gov (United States)

    Hershfield, Vickers; Boyer, Herbert W.; Yanofsky, Charles; Lovett, Michael A.; Helinski, Donald R.

    1974-01-01

    DNA fragments obtained from EcoRI endonuclease digestion of bacteriophage ϕ80pt190 (trp+) and the plasmid ColE1 were covalently joined with polynucleotide ligase. Transformation of Escherichia coli trp- strains to tryptophan independence with the recombined DNA selected for reconstituted ColE1 plasmids containing the tryptophan operon and the ϕ80 immunity region. Similarly, an EcoRI endonuclease generated fragment of plasmid pSC105 DNA containing the genetic determinant of kanamycin resistance was inserted into the ColE1 plasmid and recovered in E. coli. The plasmids containing the trp operon (ColE1-trp) and the kanamycin resistance gene were maintained under logarithmic growth conditions at a level of 25-30 copies per cell and accumulate to the extent of several hundred copies per cell in the presence of chloramphenicol. Cells carrying the ColE1-trp plasmid determined the production of highly elevated levels of trp operon-specific mRNA and tryptophan biosynthetic enzymes. Images PMID:4610576

  1. The effects of a low-intensity red laser on bacterial growth, filamentation and plasmid DNA

    International Nuclear Information System (INIS)

    Roos, C; Santos, J N; Guimarães, O R; Geller, M; Fonseca, A S; Paoli, F

    2013-01-01

    Exposure of nonphotosynthesizing microorganisms to light could increase cell division in cultures, a phenomenon denominated as biostimulation. However, data concerning the importance of the genetic characteristics of cells on this effect are as yet scarce. The aim of this work was to evaluate the effects of a low-intensity red laser on the growth, filamentation and plasmids in Escherichia coli cells proficient and deficient in DNA repair. E. coli cultures were exposed to a laser (658 nm, 10 mW, 1 and 8 J cm −2 ) to study bacterial growth and filamentation. Also, bacterial cultures hosting pBSK plasmids were exposed to the laser to study DNA topological forms from the electrophoretic profile in agarose gels. Data indicate the low-intensity red laser: (i) had no effect on the growth of E. coli wild type and exonuclease III deficient cells; (ii) induced bacterial filamentation, (iii) led to no alteration in the electrophoretic profile of plasmids from exonuclease III deficient cells, but plasmids from wild type cells were altered. A low-intensity red laser at the low fluences used in phototherapy has no effect on growth, but induces filamentation and alters the topological forms of plasmid DNA in E. coli cultures depending on the DNA repair mechanisms. (paper)

  2. Evaluation of plasmid and genomic DNA calibrants used for the quantification of genetically modified organisms.

    Science.gov (United States)

    Caprioara-Buda, M; Meyer, W; Jeynov, B; Corbisier, P; Trapmann, S; Emons, H

    2012-07-01

    The reliable quantification of genetically modified organisms (GMOs) by real-time PCR requires, besides thoroughly validated quantitative detection methods, sustainable calibration systems. The latter establishes the anchor points for the measured value and the measurement unit, respectively. In this paper, the suitability of two types of DNA calibrants, i.e. plasmid DNA and genomic DNA extracted from plant leaves, for the certification of the GMO content in reference materials as copy number ratio between two targeted DNA sequences was investigated. The PCR efficiencies and coefficients of determination of the calibration curves as well as the measured copy number ratios for three powder certified reference materials (CRMs), namely ERM-BF415e (NK603 maize), ERM-BF425c (356043 soya), and ERM-BF427c (98140 maize), originally certified for their mass fraction of GMO, were compared for both types of calibrants. In all three systems investigated, the PCR efficiencies of plasmid DNA were slightly closer to the PCR efficiencies observed for the genomic DNA extracted from seed powders rather than those of the genomic DNA extracted from leaves. Although the mean DNA copy number ratios for each CRM overlapped within their uncertainties, the DNA copy number ratios were significantly different using the two types of calibrants. Based on these observations, both plasmid and leaf genomic DNA calibrants would be technically suitable as anchor points for the calibration of the real-time PCR methods applied in this study. However, the most suitable approach to establish a sustainable traceability chain is to fix a reference system based on plasmid DNA.

  3. Functionalized tetrapod-like ZnO nanostructures for plasmid DNA purification, polymerase chain reaction and delivery

    International Nuclear Information System (INIS)

    Nie Leng; Gao Lizeng; Yan Xiyun; Wang Taihong

    2007-01-01

    Functionalized tetrapodal ZnO nanostructures are tested in plasmid DNA experiments (1) as a solid-phase adsorbent for plasmid DNA purification (2) as improving reagents in a polymerase chain reaction (PCR) and (3) as novel carriers for gene delivery. The amino-modification, the tetrapod-like shape of the nanostructure and its high biocompatibility all contribute to measurements showing promise for applications. A sol-gel method is used for silica coating and amino-modification. Plasmid DNA is purified through reversible conjugations of amino-modified ZnO tetrapods with DNA. Also, as additional reagents, functionalized tetrapods are shown to improve the amount of PCR product. For transfection, ZnO tetrapods provide some protection against deoxyribonuclease cleavage of plasmid DNA and deliver plasmid DNA into cells with little cytotoxicity

  4. Effect of the caffeine on treated and non-treated plasmid DNA with stannic chloride

    International Nuclear Information System (INIS)

    Moreno, Silvana Ramos F.; Universidade Federal Fluminense, Niteroi, RJ; Mattos, Jose C.P. de; Dantas, Flavio; Araujo, Adriano Caldeira de; Bernardo-Filho, Mario

    2000-01-01

    Caffeine, a methilxantine drug is a component of coffee, tea, stimulants and other drinks. Caffeine inhibits phosphodiesterase leading to intracellular accumulation of cyclic AMP, blocks adenosine receptors, and increases the release of Ca 2+ . We have studied the possible effect of caffeine in DNA plasmid treated or not with stannous chloride (SnCl 2 ). Previous evaluations of the effect of caffeine on the labeling of red blood cells and plasma proteins with technetium-99m have showed a decrease of % ATI in the insoluble fraction of plasma proteins. Samples of DNA were treated with SnCl 2 (0 and 200μg/ml) in 0.8% agarose. SnCl 2 has induced break on DNA and caffeine has not showed effect on the DNA. This indicates that caffeine does not eliminate the oxidant action of SnCl 2 and does not promote break in isolated DNA plasmid. (author)

  5. Protection of vanillin derivative VND3207 on plasmid DNA damage induced by different LET ionizing radiation

    International Nuclear Information System (INIS)

    Xu Huihui; Wang Li; Sui Li; Guan Hua; Wang Yu; Liu Xiaodan; Zhang Shimeng; Xu Qinzhi; Wang Xiao; Zhou Pingkun

    2011-01-01

    Objective: To evaluate the radioprotective effect of vanillin derivative VND3207 on DNA damage induced by different LET ionizing radiation. Methods: The plasmid DNA in liquid was irradiated by 60 Co γ-rays, proton or 7 Li heavy ion with or without VND3207. The conformation changes of plasmid DNA were assessed by agarose gel electrophoresis and the quantification was done using gel imaging system. Results: The DNA damage induced by proton and 7 Li heavy ion was much more serious as compared with that by 60 Co γ-rays, and the vanillin derivative VND3207 could efficiently decrease the DNA damage induced by all three types of irradiation sources, which was expressed as a significantly reduced ratio of open circular form (OC) of plasmid DNA. The radioprotective effect of VND3207 increased with the increasing of drug concentration. The protective efficiencies of 200 μmol/L VND3207 were 85.3% (t =3.70, P=0.033), 73.3% (t=10.58, P=0.017) and 80.4% (t=8.57, P=0.008) on DNA damage induction by 50 Gy of γ-rays, proton and 7 Li heavy ion, respectively. It seemed that the radioprotection of VND3207 was more effective on DNA damage induced by high LET heavy ion than that by proton. Conclusions: VND3207 has a protective effect against the genotoxicity of different LET ionizing radiation, especially for γ-rays and 7 Li heavy ion. (authors)

  6. Estimating the Transfer Range of Plasmids Encoding Antimicrobial Resistance in a Wastewater Treatment Plant Microbial Community

    DEFF Research Database (Denmark)

    Li, Liguan; Dechesne, Arnaud; He, Zhiming

    2018-01-01

    sludge microbial community was challenged in standardized filter matings with one of three multidrug resistance plasmids (pKJK5, pB10, and RP4) harbored by Escherichia coli or Pseudomonas putida. Different donor–plasmid combinations had distinct transfer frequencies, ranging from 3 to 50 conjugation...... events per 100000 cells of the WWTP microbial community. In addition, transfer was observed to a broad phylogenetic range of 13 bacterial phyla with several taxa containing potentially pathogenic species. Preferential transfer to taxa belonging to the predicted evolutionary host range of the plasmids...... ARG transmission. However, the contribution of microbial communities in WWTPs to ARG dissemination remains poorly understood. Here, we examined for the first time plasmid permissiveness of an activated sludge microbial community by utilizing an established fluorescent bioreporter system. The activated...

  7. Toward a Better Compression for DNA Sequences Using Huffman Encoding.

    Science.gov (United States)

    Al-Okaily, Anas; Almarri, Badar; Al Yami, Sultan; Huang, Chun-Hsi

    2017-04-01

    Due to the significant amount of DNA data that are being generated by next-generation sequencing machines for genomes of lengths ranging from megabases to gigabases, there is an increasing need to compress such data to a less space and a faster transmission. Different implementations of Huffman encoding incorporating the characteristics of DNA sequences prove to better compress DNA data. These implementations center on the concepts of selecting frequent repeats so as to force a skewed Huffman tree, as well as the construction of multiple Huffman trees when encoding. The implementations demonstrate improvements on the compression ratios for five genomes with lengths ranging from 5 to 50 Mbp, compared with the standard Huffman tree algorithm. The research hence suggests an improvement on all such DNA sequence compression algorithms that use the conventional Huffman encoding. The research suggests an improvement on all DNA sequence compression algorithms that use the conventional Huffman encoding. Accompanying software is publicly available (AL-Okaily, 2016 ).

  8. Ca2+ promoted the low transformation efficiency of plasmid DNA exposed to PAH contaminants.

    Directory of Open Access Journals (Sweden)

    Fuxing Kang

    Full Text Available The effects of interactions between genetic materials and polycyclic aromatic hydrocarbons (PAHs on gene expression in the extracellular environment remain to be elucidated and little information is currently available on the effect of ionic strength on the transformation of plasmid DNA exposed to PAHs. Phenanthrene and pyrene were used as representative PAHs to evaluate the transformation of plasmid DNA after PAH exposure and to determine the role of Ca(2+ during the transformation. Plasmid DNA exposed to the test PAHs demonstrated low transformation efficiency. In the absence of PAHs, the transformation efficiency was 4.7 log units; however, the efficiency decreased to 3.72-3.14 log units with phenanthrene/pyrene exposures of 50 µg · L(-1. The addition of Ca(2+ enhanced the low transformation efficiency of DNA exposed to PAHs. Based on the co-sorption of Ca(2+ and phenanthrene/pyrene by DNA, we employed Fourier-transform infrared spectroscopy (FTIR, X-ray photoelectron spectroscopy (XPS, and mass spectrometry (MS to determine the mechanisms involved in PAH-induced DNA transformation. The observed low transformation efficiency of DNA exposed to either phenanthrene or pyrene can be attributed to a broken hydrogen bond in the double helix caused by planar PAHs. Added Ca(2+ formed strong electrovalent bonds with "-POO(--" groups in the DNA, weakening the interaction between PAHs and DNA based on weak molecular forces. This decreased the damage of PAHs to hydrogen bonds in double-stranded DNA by isolating DNA molecules from PAHs and consequently enhanced the transformation efficiency of DNA exposed to PAH contaminants. The findings provide insight into the effects of anthropogenic trace PAHs on DNA transfer in natural environments.

  9. Comparative genomics of multidrug resistance-encoding IncA/C plasmids from commensal and pathogenic Escherichia coli from multiple animal sources.

    Science.gov (United States)

    Fernández-Alarcón, Claudia; Singer, Randall S; Johnson, Timothy J

    2011-01-01

    Incompatibility group A/C (IncA/C) plasmids have received recent attention for their broad host range and ability to confer resistance to multiple antimicrobial agents. Due to the potential spread of multidrug resistance (MDR) phenotypes from foodborne pathogens to human pathogens, the dissemination of these plasmids represents a public health risk. In this study, four animal-source IncA/C plasmids isolated from Escherichia coli were sequenced and analyzed, including isolates from commercial dairy cows, pigs and turkeys in the U.S. and Chile. These plasmids were initially selected because they either contained the floR and tetA genes encoding for florfenicol and tetracycline resistance, respectively, and/or the bla(CMY-2) gene encoding for extended spectrum β-lactamase resistance. Overall, sequence analysis revealed that each of the four plasmids retained a remarkably stable and conserved backbone sequence, with differences observed primarily within their accessory regions, which presumably have evolved via horizontal gene transfer events involving multiple modules. Comparison of these plasmids with other available IncA/C plasmid sequences further defined the core and accessory elements of these plasmids in E. coli and Salmonella. Our results suggest that the bla(CMY-2) plasmid lineage appears to have derived from an ancestral IncA/C plasmid type harboring floR-tetAR-strAB and Tn21-like accessory modules. Evidence is mounting that IncA/C plasmids are widespread among enteric bacteria of production animals and these emergent plasmids have flexibility in their acquisition of MDR-encoding modules, necessitating further study to understand the evolutionary mechanisms involved in their dissemination and stability in bacterial populations.

  10. Comparative genomics of multidrug resistance-encoding IncA/C plasmids from commensal and pathogenic Escherichia coli from multiple animal sources.

    Directory of Open Access Journals (Sweden)

    Claudia Fernández-Alarcón

    Full Text Available Incompatibility group A/C (IncA/C plasmids have received recent attention for their broad host range and ability to confer resistance to multiple antimicrobial agents. Due to the potential spread of multidrug resistance (MDR phenotypes from foodborne pathogens to human pathogens, the dissemination of these plasmids represents a public health risk. In this study, four animal-source IncA/C plasmids isolated from Escherichia coli were sequenced and analyzed, including isolates from commercial dairy cows, pigs and turkeys in the U.S. and Chile. These plasmids were initially selected because they either contained the floR and tetA genes encoding for florfenicol and tetracycline resistance, respectively, and/or the bla(CMY-2 gene encoding for extended spectrum β-lactamase resistance. Overall, sequence analysis revealed that each of the four plasmids retained a remarkably stable and conserved backbone sequence, with differences observed primarily within their accessory regions, which presumably have evolved via horizontal gene transfer events involving multiple modules. Comparison of these plasmids with other available IncA/C plasmid sequences further defined the core and accessory elements of these plasmids in E. coli and Salmonella. Our results suggest that the bla(CMY-2 plasmid lineage appears to have derived from an ancestral IncA/C plasmid type harboring floR-tetAR-strAB and Tn21-like accessory modules. Evidence is mounting that IncA/C plasmids are widespread among enteric bacteria of production animals and these emergent plasmids have flexibility in their acquisition of MDR-encoding modules, necessitating further study to understand the evolutionary mechanisms involved in their dissemination and stability in bacterial populations.

  11. A plasmid-encoded nicotinamidase (PncA) is essential for infectivity of Borrelia burgdorferi in a mammalian host.

    Science.gov (United States)

    Purser, Joye E; Lawrenz, Matthew B; Caimano, Melissa J; Howell, Jerrilyn K; Radolf, Justin D; Norris, Steven J

    2003-05-01

    Borrelia burgdorferi, a spirochaete that causes Lyme borreliosis, contains 21 linear and circular plasmids thought to be important for survival in mammals or ticks. Our results demonstrate that the gene BBE22 encoding a nicotinamidase is capable of replacing the requirement for the 25 kb linear plasmid lp25 during mammalian infection. Transformation of B. burgdorferi lacking lp25 with a shuttle vector containing the lp25 gene BBE22 (pBBE22) restored infectivity in mice to a level comparable to that of wild-type Borrelia. This complementation also restored the growth and host adaptation of lp25-B. burgdorferi in dialysis membrane chambers (DMCs) implanted in rats. A single Cys to Ala conversion at the putative active site of BBE22 abrogated the ability of pBBE22 to re-establish infectivity or growth in DMCs. Additional Salmonella typhimurium complementation studies and enzymatic analysis demonstrated that the BBE22 gene product has nicotinamidase activity and is most probably required for the biosynthesis of NAD. These results indicate that some plasmid-encoded products fulfil physiological functions required in the enzootic cycle of pathogenic Borrelia.

  12. Strand breaks and lethal damage in plasmid DNA subjected to 60CO-γirradiation

    International Nuclear Information System (INIS)

    Klimczak, U.

    1992-01-01

    Experiments with calf thymus DNA subjected to extracellular irradiation yield information on the role of direct and indirect effects in single-strand breakage, if this is evaluated with reference to the scavenger activity in respect of OH radicals. The role of the two processes in the occurrence of double-stand breaks and further damage leading to cell decay has so far remained largely obscure. It was the aim of the study described here to contribute to research in this field by performing in vitro experiments on biologically active DNA. For this purpose, DNA from pBR322 plasmids was irradiated in the presence of OH-radical scavengers. The number of single-strand and double-strand breaks was determined on the basis of the system's ability to eliminate OH radicals. In order to asses the influence of irradiation processes on the biological activity of DNA, investigations were carried out in E. coli for transformations caused by irradiated plasmid DNA. The results were interpreted in the light of theories about inhomogenous reaction kinetics put forward by Mark et al. (1989). It was finally discussed, which of the gamma-irradiation injuries occurring in DNA was to be held responsible for the inactivation of plasmid DNA and which enzymatic processes were additionally at work here. (orig./MG) [de

  13. Functional properties and structural requirements of the plasmid pMV158-encoded MobM relaxase domain.

    Science.gov (United States)

    Fernández-López, Cris; Pluta, Radoslaw; Pérez-Luque, Rosa; Rodríguez-González, Lorena; Espinosa, Manuel; Coll, Miquel; Lorenzo-Díaz, Fabián; Boer, D Roeland

    2013-07-01

    A crucial element in the horizontal transfer of mobilizable and conjugative plasmids is the relaxase, a single-stranded endonuclease that nicks the origin of transfer (oriT) of the plasmid DNA. The relaxase of the pMV158 mobilizable plasmid is MobM (494 residues). In solution, MobM forms a dimer through its C-terminal domain, which is proposed to anchor the protein to the cell membrane and to participate in type 4 secretion system (T4SS) protein-protein interactions. In order to gain a deeper insight into the structural MobM requirements for efficient DNA catalysis, we studied two endonuclease domain variants that include the first 199 or 243 amino acid residues (MobMN199 and MobMN243, respectively). Our results confirmed that the two proteins behaved as monomers in solution. Interestingly, MobMN243 relaxed supercoiled DNA and cleaved single-stranded oligonucleotides harboring oriTpMV158, whereas MobMN199 was active only on supercoiled DNA. Protein stability studies using gel electrophoresis and mass spectrometry showed increased susceptibility to degradation at the domain boundary between the N- and C-terminal domains, suggesting that the domains change their relative orientation upon DNA binding. Overall, these results demonstrate that MobMN243 is capable of nicking the DNA substrate independently of its topology and that the amino acids 200 to 243 modulate substrate specificity but not the nicking activity per se. These findings suggest that these amino acids are involved in positioning the DNA for the nuclease reaction rather than in the nicking mechanism itself.

  14. Improvement of in vivo transfer of plasmid DNA in muscle : Comparison of electroporation versus ultrasound

    NARCIS (Netherlands)

    Kusumanto, Yoka H.; Mulder, Nanno H.; Dam, Wendy A.; Losen, Mario H.; Meijer, Coby; Hospers, Geke A. P.

    Plasmid-based gene delivery to muscle is a treatment strategy for many diseases with potential advantages above viral-based gene delivery methods, however, with a relative low transfection efficiency. We compared two physical methods-electroporation and ultrasound-that facilitate DNA uptake into

  15. Cholesterol-conjugated supramolecular assemblies of low generations polyamidoamine dendrimers for enhanced EGFP plasmid DNA transfection

    Energy Technology Data Exchange (ETDEWEB)

    Golkar, Nasim; Samani, Soliman Mohammadi; Tamaddon, Ali Mohammad, E-mail: amtamadon@gmail.com [Shiraz University of Medical Sciences, Department of Pharmaceutics, School of Pharmacy (Iran, Islamic Republic of)

    2016-05-15

    Aimed to prepare an enhanced gene delivery system with low cytotoxicity and high transfection efficiency, various cholesterol-conjugated derivates of low generation polyamidoamine (PAMAM) dendrimers were prepared. The conjugates were characterized by TNBS assay, FTIR, and {sup 1}H-NMR spectroscopy. Self-assembly of the dendrimer conjugates (G1-Chol, G2-Chol, and G3-Chol) was investigated by pyrene assay. Following formation of the complexes between enhanced green fluorescence protein plasmid and the dendrimer conjugates at various N (primary amine)/P (phosphate) mole ratios, plasmid condensation, biologic stability, cytotoxicity, and protein expression were investigated. The conjugates self-assembled into micellar dispersions with the critical micelle concentration values (<50 µg/ml) depending on the dendrimer generation and cholesterol/amine mole ratio. Cholesterol conjugation resulted in higher resistance of the condensed plasmid DNA in a competition assay with heparin sulfate. Also, the transfection efficiency was determined higher for the cholesterol conjugates than unmodified dendrimers in HepG2 cells, showing the highest for G2-Chol at 40 % degree of cholesterol modification (G2-Chol{sub 40 %}) among various dendrimer generations. Interestingly, such conjugate showed a complete protection of plasmid against serum nucleases. Our results confirmed that the cholesterol conjugation to PAMAM dendrimers of low generations bearing little cytotoxicity improves their several physicochemical and biological characteristics required for an enhanced delivery of plasmid DNA into cells.

  16. Size and Base Composition of RNA in Supercoiled Plasmid DNA

    Science.gov (United States)

    Williams, Peter H.; Boyer, Herbert W.; Helinski, Donald R.

    1973-01-01

    The average size and base composition of the covalently integrated RNA segment in supercoiled ColE1 DNA synthesized in Escherichia coli in the presence of chloramphenicol (CM-ColE1 DNA) have been determined by two independent methods. The two approaches yielded similar results, indicating that the RNA segment in CM-ColE1 DNA contains GMP at the 5′ end and comprises on the average 25 to 26 ribonucleotides with a base composition of 10-11 G, 3 A, 5-6 C, and 6-7 U. PMID:4359488

  17. Effect on Antibody and T-Cell Responses of Mixing Five GMP-Produced DNA Plasmids and Administration With Plasmid Expressing GM-CSF

    National Research Council Canada - National Science Library

    Sedegah, M; Charoenvit, Y; Aguiar, J; Sacci, J; Hedstrom, R; Kumar, S; Belmonte, A; Lanar, DE; Jones, TR; Abot, E

    2004-01-01

    .... In preparation for a clinical trial, we assessed the immunogenicity of GMP-produced plasmids encoding five Plasmodium falciparum proteins, PfCSP, PfSSP2, PfEXP1, PfLSA1, and PfLSA3, given as a mixture, or alone...

  18. Cloning, sequencing and expression of cDNA encoding growth ...

    Indian Academy of Sciences (India)

    Unknown

    of medicine, animal husbandry, fish farming and animal ..... northern pike (Esox lucius) growth hormone; Mol. Mar. Biol. ... prolactin 1-luciferase fusion gene in African catfish and ... 1988 Cloning and sequencing of cDNA that encodes goat.

  19. The multidrug resistance IncA/C transferable plasmid encodes a novel domain-swapped dimeric protein-disulfide isomerase.

    Science.gov (United States)

    Premkumar, Lakshmanane; Kurth, Fabian; Neyer, Simon; Schembri, Mark A; Martin, Jennifer L

    2014-01-31

    The multidrug resistance-encoding IncA/C conjugative plasmids disseminate antibiotic resistance genes among clinically relevant enteric bacteria. A plasmid-encoded disulfide isomerase is associated with conjugation. Sequence analysis of several IncA/C plasmids and IncA/C-related integrative and conjugative elements (ICE) from commensal and pathogenic bacteria identified a conserved DsbC/DsbG homolog (DsbP). The crystal structure of DsbP reveals an N-terminal domain, a linker region, and a C-terminal catalytic domain. A DsbP homodimer is formed through domain swapping of two DsbP N-terminal domains. The catalytic domain incorporates a thioredoxin-fold with characteristic CXXC and cis-Pro motifs. Overall, the structure and redox properties of DsbP diverge from the Escherichia coli DsbC and DsbG disulfide isomerases. Specifically, the V-shaped dimer of DsbP is inverted compared with EcDsbC and EcDsbG. In addition, the redox potential of DsbP (-161 mV) is more reducing than EcDsbC (-130 mV) and EcDsbG (-126 mV). Other catalytic properties of DsbP more closely resemble those of EcDsbG than EcDsbC. These catalytic differences are in part a consequence of the unusual active site motif of DsbP (CAVC); substitution to the EcDsbC-like (CGYC) motif converts the catalytic properties to those of EcDsbC. Structural comparison of the 12 independent subunit structures of DsbP that we determined revealed that conformational changes in the linker region contribute to mobility of the catalytic domain, providing mechanistic insight into DsbP function. In summary, our data reveal that the conserved plasmid-encoded DsbP protein is a bona fide disulfide isomerase and suggest that a dedicated oxidative folding enzyme is important for conjugative plasmid transfer.

  20. Persistence of plasmid DNA in different soils | Kandhavelu | African ...

    African Journals Online (AJOL)

    Natural genetic transformation is believed to be the essential mechanism for the attainment of genetic plasticity in many species of bacteria. Dying cells are likely to release naked DNA that may survive for many hours. Although numerous studies have shown that horizontal gene transfer between distantly related genera, but ...

  1. Intrathecal injection of naked plasmid DNA provides long-term expression of secreted proteins.

    Science.gov (United States)

    Hughes, Travis S; Langer, Stephen J; Johnson, Kirk W; Chavez, Raymond A; Watkins, Linda R; Milligan, Erin D; Leinwand, Leslie A

    2009-01-01

    Therapeutic benefit has been reported to result from intrathecal (i.t.) injection of transgene vectors, including naked DNA. However, most studies using naked DNA have measured only the transgene expression of intracellular proteins. Here we demonstrate that i.t. injection of naked DNA can result in long-term expression of secreted proteins. Plasmids expressing either secreted alkaline phosphatase (SEAP) or human interleukin-10 (hIL-10) were injected into the i.t. space in rats, and transgene products were repeatedly measured in the cerebrospinal fluid (CSF). Both SEAP and hIL-10 were maximal at 1 and 2 days after the injection and still detectable at 4 months. The utilization of a plasmid having two features that are hypothesized to increase gene expression (matrix attachment regions (MARs) and lack of CpG dinucleotides) resulted in a significant increase in gene expression. Reinjection of SEAP or hIL-10 plasmids after 4 months significantly increased protein levels at 1 and 14 days after the reinjection. SEAP was uniformly distributed between the DNA delivery site (approximately vertebral level T13) and the lumbar puncture site (L5/L6 inter-vertebral space), was reduced at the cisterna magna, and was detectable, though at much lower levels, in serum. These data suggest that naked DNA has the potential to be used as a therapeutic tool for applications that require long-term release of transgenes into the CSF.

  2. Evaluation of the effect of non-B DNA structures on plasmid integrity via accelerated stability studies.

    Science.gov (United States)

    Ribeiro, S C; Monteiro, G A; Prazeres, D M F

    2009-04-01

    Plasmid biopharmaceuticals are a new class of medicines with an enormous potential. Attempts to increase the physical stability of highly purified supercoiled (SC) plasmid DNA in pharmaceutical aqueous solutions have relied on: (i) changing the DNA sequence, (ii) improving manufacturing to reduce deleterious impurities and initial DNA damage, and (iii) controlling the storage medium characteristics. In this work we analyzed the role of secondary structures on the degradation of plasmid molecules. Accelerated stability experiments were performed with SC, open circular (OC) and linear (L) isoforms of three plasmids which differed only in the "single-strandlike" content of their polyadenylation (poly A) signals. We have proved that the presence of more altered or interrupted (non-B) DNA secondary structures did not directly translate into an easier strand scission of the SC isoforms. Rather, those unusual structures imposed a lower degree of SC in the plasmids, leading to an increase in their resistance to thermal degradation. However, this behavior was reversed when the relaxed or L isoforms were tested, in which case the absence of SC rendered the plasmids essentially double-stranded. Overall, this work suggests that plasmid DNA sequence and secondary structures should be taken into account in future investigations of plasmid stability during prolonged storage.

  3. THE ENDOGENOUS BACILLUS-SUBTILIS (NATTO) PLASMIDS PTA1015 AND PTA1040 CONTAIN SIGNAL PEPTIDASE-ENCODING GENES - IDENTIFICATION OF A NEW STRUCTURAL MODULE ON CRYPTIC PLASMIDS

    NARCIS (Netherlands)

    MEIJER, WJJ; DEJONG, A; BEA, G; WISMAN, A; TJALSMA, H; VENEMA, G; BRON, S; MAARTEN, J; VANDIJL, JM

    Various strains of Bacillus subtilis (natto) contain small cryptic plasmids that replicate via the rolling-circle mechanism. Like plasmids from other Gram-positive bacteria, these plasmids are composed of several distinct structural modules. A new structural module was identified on the B. subtilis

  4. Vaxfectin enhances antigen specific antibody titers and maintains Th1 type immune responses to plasmid DNA immunization.

    Science.gov (United States)

    Reyes, L; Hartikka, J; Bozoukova, V; Sukhu, L; Nishioka, W; Singh, G; Ferrari, M; Enas, J; Wheeler, C J; Manthorpe, M; Wloch, M K

    2001-06-14

    Antigen specific immune responses were characterized after intramuscular immunization of BALB/c mice with 5 antigen encoding plasmid DNAs (pDNAs) complexed with Vaxfectin, a cationic lipid formulation. Vaxfectin increased IgG titers for all of the antigens with no effect on the CTL responses to the 2 antigens for which CTL assays were performed. Both antigen specific IgG1 and IgG2a were increased, although IgG2a remained greater than IgG1. Furthermore, Vaxfectin had no effect on IFN-gamma or IL-4 production by splenocytes re-stimulated with antigen, suggesting that the Th1 type responses typical of intramuscular pDNA immunization were not altered. Studies with IL-6 -/- mice suggest that the antibody enhancement is IL-6 dependent and results in a correlative increase in antigen specific antibody secreting cells.

  5. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

  6. Tissue-specific Calibration of Real-time PCR Facilitates Absolute Quantification of Plasmid DNA in Biodistribution Studies

    Directory of Open Access Journals (Sweden)

    Joan K Ho

    2016-01-01

    Full Text Available Analysis of the tissue distribution of plasmid DNA after administration of nonviral gene delivery systems is best accomplished using quantitative real-time polymerase chain reaction (qPCR, although published strategies do not allow determination of the absolute mass of plasmid delivered to different tissues. Generally, data is expressed as the mass of plasmid relative to the mass of genomic DNA (gDNA in the sample. This strategy is adequate for comparisons of efficiency of delivery to a single site but it does not allow direct comparison of delivery to multiple tissues, as the mass of gDNA extracted per unit mass of each tissue is different. We show here that by constructing qPCR standard curves for each tissue it is possible to determine the dose of intact plasmid remaining in each tissue, which is a more useful parameter when comparing the fates of different formulations of DNA. We exemplify the use of this tissue-specific qPCR method by comparing the delivery of naked DNA, cationic DNA complexes, and neutral PEGylated DNA complexes after intramuscular injection. Generally, larger masses of intact plasmid were present 24 hours after injection of DNA complexes, and neutral complexes resulted in delivery of a larger mass of intact plasmid to the spleen.

  7. Virus-sized self-assembling lamellar complexes between plasmid DNA and cationic micelles promote gene transfer

    Science.gov (United States)

    Pitard, Bruno; Aguerre, Olivier; Airiau, Marc; Lachagès, Anne-Marie; Boukhnikachvili, Tsiala; Byk, Gérardo; Dubertret, Catherine; Herviou, Christian; Scherman, Daniel; Mayaux, Jean-François; Crouzet, Joël

    1997-01-01

    Gene therapy is based on the vectorization of genes to target cells and their subsequent expression. Cationic amphiphile-mediated delivery of plasmid DNA is the nonviral gene transfer method most often used. We examined the supramolecular structure of lipopolyamine/plasmid DNA complexes under various condensing conditions. Plasmid DNA complexation with lipopolyamine micelles whose mean diameter was 5 nm revealed three domains, depending on the lipopolyamine/plasmid DNA ratio. These domains respectively corresponded to negatively, neutrally, and positively charged complexes. Transmission electron microscopy and x-ray scattering experiments on complexes originating from these three domains showed that although their morphology depends on the lipopolyamine/plasmid DNA ratio, their particle structure consists of ordered domains characterized by even spacing of 80 Å, irrespective of the lipid/DNA ratio. The most active lipopolyamine/DNA complexes for gene transfer were positively charged. They were characterized by fully condensed DNA inside spherical particles (diameter: 50 nm) sandwiched between lipid bilayers. These results show that supercoiled plasmid DNA is able to transform lipopolyamine micelles into a supramolecular organization characterized by ordered lamellar domains. PMID:9405626

  8. Solid lipid nanoparticles mediate non-viral delivery of plasmid DNA to dendritic cells

    Science.gov (United States)

    Penumarthi, Alekhya; Parashar, Deepti; Abraham, Amanda N.; Dekiwadia, Chaitali; Macreadie, Ian; Shukla, Ravi; Smooker, Peter M.

    2017-06-01

    There is an increasing demand for novel DNA vaccine delivery systems, mainly for the non-viral type as they are considered relatively safe. Therefore, solid lipid nanoparticles (SLNs) were investigated for their suitability as a non-viral DNA vaccine delivery system. SLNs were synthesised by a modified solvent-emulsification method in order to study their potential to conjugate with plasmid DNA and deliver them in vitro to dendritic cells using eGFP as the reporter plasmid. The DNA-SLN complexes were characterised by electron microscopy, gel retardation assays and dynamic light scattering. The cytotoxicity assay data supported their biocompatibility and was used to estimate safe threshold concentration resulting in high transfection rate. The transfection efficiency of these complexes in a dendritic cell line was shown to increase significantly compared to plasmid alone, and was comparable to that mediated by lipofectamine. Transmission electron microscopy studies delineated the pathway of cellular uptake. Endosomal escape was observed supporting the mechanism of transfection.

  9. Fluoride enhances transfection activity of carbonate apatite by increasing cytoplasmic stability of plasmid DNA

    International Nuclear Information System (INIS)

    Chowdhury, E.H.

    2011-01-01

    Highlights: → Cytoplasmic stability of plasmid DNA is enhanced by fluoride incorporation into carbonate apatite carrier. → Fluoridated carbonate apatite promotes a robust increase in transgene expression. → Controlled dissolution of fluoridated carbonate apatite in endosomal acidic environment might buffer the endosomes and prevent degradation of the released DNA. -- Abstract: Intracellular delivery of a functional gene or a nucleic acid sequence to specifically knockdown a harmful gene is a potential approach to precisely treat a critical human disease. The intensive efforts in the last few decades led to the development of a number of viral and non-viral synthetic vectors. However, an ideal delivery tool in terms of the safety and efficacy has yet to be established. Recently, we have developed pH-sensing inorganic nanocrystals of carbonate apatite for efficient and cell-targeted delivery of gene and gene-silencing RNA. Here we show that addition of very low level of fluoride to the particle-forming medium facilitates a robust increase in transgene expression following post-incubation of the particles with HeLa cells. Confocal microscopic observation and Southern blotting prove the cytoplasmic existence of plasmid DNA delivered by likely formed fluoridated carbonate apatite particles while degradation of plasmid DNA presumably by cytoplasmic nucleases was noticed following delivery with apatite particles alone. The beneficial role of fluoride in enhancing carbonate apatite-mediated gene expression might be due to the buffering potential of generated fluoridated apatite in endosomal acidic environment, thereby increasing the half-life of delivered plasmid DNA.

  10. Fluoride enhances transfection activity of carbonate apatite by increasing cytoplasmic stability of plasmid DNA

    Energy Technology Data Exchange (ETDEWEB)

    Chowdhury, E.H., E-mail: md.ezharul.hoque@med.monash.edu.my [Jeffrey Cheah School of Medicine and Health Sciences, Monash University Sunway Campus, Jalan Lagoon Selatan, Bandar Sunway, Selangor Darul Ehsan (Malaysia)

    2011-06-17

    Highlights: {yields} Cytoplasmic stability of plasmid DNA is enhanced by fluoride incorporation into carbonate apatite carrier. {yields} Fluoridated carbonate apatite promotes a robust increase in transgene expression. {yields} Controlled dissolution of fluoridated carbonate apatite in endosomal acidic environment might buffer the endosomes and prevent degradation of the released DNA. -- Abstract: Intracellular delivery of a functional gene or a nucleic acid sequence to specifically knockdown a harmful gene is a potential approach to precisely treat a critical human disease. The intensive efforts in the last few decades led to the development of a number of viral and non-viral synthetic vectors. However, an ideal delivery tool in terms of the safety and efficacy has yet to be established. Recently, we have developed pH-sensing inorganic nanocrystals of carbonate apatite for efficient and cell-targeted delivery of gene and gene-silencing RNA. Here we show that addition of very low level of fluoride to the particle-forming medium facilitates a robust increase in transgene expression following post-incubation of the particles with HeLa cells. Confocal microscopic observation and Southern blotting prove the cytoplasmic existence of plasmid DNA delivered by likely formed fluoridated carbonate apatite particles while degradation of plasmid DNA presumably by cytoplasmic nucleases was noticed following delivery with apatite particles alone. The beneficial role of fluoride in enhancing carbonate apatite-mediated gene expression might be due to the buffering potential of generated fluoridated apatite in endosomal acidic environment, thereby increasing the half-life of delivered plasmid DNA.

  11. Effect of the Plasmid-DNA Vaccination on Macroscopic and Microscopic Damage Caused by the Experimental Chronic Trypanosoma cruzi Infection in the Canine Model

    Directory of Open Access Journals (Sweden)

    Olivia Rodríguez-Morales

    2013-01-01

    Full Text Available The dog is considered the main domestic reservoir for Trypanosoma cruzi infection and a suitable experimental animal model to study the pathological changes during the course of Chagas disease (CD. Vaccine development is one of CD prevention methods to protect people at risk. Two plasmids containing genes encoding a trans-sialidase protein (TcSP and an amastigote-specific glycoprotein (TcSSP4 were used as DNA vaccines in a canine model. Splenomegaly was not found in either of the recombinant plasmid-immunized groups; however, cardiomegaly was absent in animals immunized only with the plasmid containing the TcSSP4 gene. The inflammation of subendocardial and myocardial tissues was prevented only with the immunization with TcSSP4 gene. In conclusion, the vaccination with these genes has a partial protective effect on the enlargement of splenic and cardiac tissues during the chronic CD and on microscopic hearth damage, since both plasmids prevented splenomegaly but only one avoided cardiomegaly, and the lesions in heart tissue of dog immunized with plasmid containing the TcSSP4 gene covered only subepicardial tissue.

  12. Absence of ultraviolet-inducible DNA polymerase I-like activity in Escherichia coli strains harbouring R plasmids

    International Nuclear Information System (INIS)

    Upton, C.; Pinney, R.J.

    1981-01-01

    No DNA polymerase I-like activity was found associated with the ultraviolet (u.v.)-protecting plasmids R205, R46 or pKM101 in either uninduced or u.v.-induced wild-type or DNA polymerase I-deficient strains of Escherichia coli. Nor was any plasmid-associated polymerase activity detectable in similar systems containing u.v.-irradiated DNA as template. However, plasmids R205, R46 and pKM 101 still increased survival and mutagenesis of the polymerase I-deficient E. coli strain after u.v. irradiation. (author)

  13. DNA-encoded chemical libraries - achievements and remaining challenges.

    Science.gov (United States)

    Favalli, Nicholas; Bassi, Gabriele; Scheuermann, Jörg; Neri, Dario

    2018-04-23

    DNA-encoded chemical libraries (DECLs) are collections of compounds, individually coupled to DNA tags serving as amplifiable identification barcodes. Since individual compounds can be identified by the associated DNA tag, they can be stored as a mixture, allowing the synthesis and screening of combinatorial libraries of unprecedented size, facilitated by the implementation of split-and-pool synthetic procedures or other experimental methodologies. In this review, we briefly present relevant concepts and technologies, which are required for the implementation and interpretation of screening procedures with DNA-encoded chemical libraries. Moreover, we illustrate some success stories, detailing how novel ligands were discovered from encoded libraries. Finally, we critically review what can realistically be achieved with the technology at the present time, highlighting challenges and opportunities for the future. © 2018 Federation of European Biochemical Societies.

  14. Dichromatic laser radiation effects on DNA of Escherichia coli and plasmids

    Science.gov (United States)

    Martins, W. A.; Polignano, G. A. C.; Guimarães, O. R.; Geller, M.; Paoli, F.; Fonseca, A. S.

    2015-04-01

    Dichromatic and consecutive laser radiations have attracted increased attention for clinical applications as offering new tools for the treatment of dysfunctional tissues in situations where monochromatic radiation is not effective. This work evaluated the survival, filamentation and morphology of Escherichia coli cells, and the induction of DNA lesions, in plasmid DNA exposed to low-intensity consecutive dichromatic laser radiation. Exponential and stationary wild type and formamidopyrimidine DNA glycosylase/MutM protein deficient E. coli cultures were exposed to consecutive low-intensity dichromatic laser radiation (infrared laser immediately after red laser) to study the survival, filamentation and morphology of bacterial cells. Plasmid DNA samples were exposed to dichromatic radiation to study DNA lesions by electrophoretic profile. Dichromatic laser radiation affects the survival, filamentation and morphology of E. coli cultures depending on the growth phase and the functional repair mechanism of oxidizing lesions in DNA, but does not induce single/double strands breaks or alkali-labile DNA lesions. Results show that low-intensity consecutive dichromatic laser radiation induces biological effects that differ from those induced by monochromatic laser radiation, suggesting that other therapeutic effects could be obtained using dichromatic radiation.

  15. Acquisition of Carbapenem Resistance by Plasmid-Encoded-AmpC-Expressing Escherichia coli.

    Science.gov (United States)

    van Boxtel, Ria; Wattel, Agnes A; Arenas, Jesús; Goessens, Wil H F; Tommassen, Jan

    2017-01-01

    Although AmpC β-lactamases can barely degrade carbapenems, if at all, they can sequester them and prevent them from reaching their targets. Thus, carbapenem resistance in Escherichia coli and other Enterobacteriaceae can result from AmpC production and simultaneous reduction of antibiotic influx into the periplasm by mutations in the porin genes. Here we investigated the route and genetic mechanisms of acquisition of carbapenem resistance in a clinical E. coli isolate carrying bla CMY-2 on a plasmid by selecting for mutants that are resistant to increasing concentrations of meropenem. In the first step, the expression of OmpC, the only porin produced in the strain under laboratory conditions, was lost, leading to reduced susceptibility to meropenem. In the second step, the expression of the CMY-2 β-lactamase was upregulated, leading to resistance to meropenem. The loss of OmpC was due to the insertion of an IS1 element into the ompC gene or to frameshift mutations and premature stop codons in this gene. The bla CMY-2 gene was found to be located on an IncIγ plasmid, and overproduction of the CMY-2 enzyme resulted from an increased plasmid copy number due to a nucleotide substitution in the inc gene. The clinical relevance of these genetic mechanisms became evident from the analysis of previously isolated carbapenem-resistant clinical isolates, which appeared to carry similar mutations. Copyright © 2016 American Society for Microbiology.

  16. Induction of cytotoxic T-cell responses by gene gun DNA vaccination with minigenes encoding influenza A virus HA and NP CTL-epitopes

    DEFF Research Database (Denmark)

    Fomsgaard, A; Nielsen, H V; Kirkby, N

    1999-01-01

    degree of controllability. We have examined the induction of murine CTL's by this approach using DNA plasmid minigene vaccines encoding known mouse K(k) minimal CTL epitopes (8 amino acids) from the influenza A virus hemagglutinin and nucleoprotein. We here report that such an approach is feasible...

  17. Design of expanded bed supports for the recovery of plasmid DNA by anion exchange adsorption

    DEFF Research Database (Denmark)

    Theodossiou, Irini; Søndergaard, M.; Thomas, Owen R. T.

    2001-01-01

    In this study we detail the rational design of new chromatographic adsorbents tailored for the capture of plasmid DNA. Features present on current chromatographic supports that can significantly enhance plasmid binding capacity have been identified in packed bed chromatography experiments...... and blueprints for improved expanded bed adsorbents have been put forward. The characterisation and testing of small (20-40 mum) high density (>3.7 g cm(-3)) pellicular expanded bed materials functionalised with various anion exchange structures is presented. In studies with calf thymus DNA, dynamic binding...... capacities of 1.2 and 3.4 mg ml(-1) were recorded for prototype diethylaminoethyl-and polyethylene imine-linked adsorbents which were respectively 25 and 70 fold higher than those of equivalently derivatised commercial expanded bed materials. The prototype polyethylene imine-coupled material exhibited severe...

  18. Strand breaks in plasmid DNA following positional changes of Auger-electron-emitting radionuclides

    International Nuclear Information System (INIS)

    Adelstein, S.J.; Kassis, A.I.

    1996-01-01

    The purpose of our studies is to elucidate the kinetics of DNA strand breaks caused by low-energy Auger electron emitters in close proximity to DNA. Previously we have studied the DNA break yields in plasmids after the decay of indium-111 bound to DNA or free in solution. In this work, we compare the DNA break yields in supercoiled DNA of iodine-125 decaying close to DNA following DNA intercalation, minor-groove binding, or surface binding, and at a distance form DNA. Supercoiled DNA, stored at 4 C to accumulate radiation dose from the decay of 125 I, was then resolved by gel electrophoresis into supercoiled, nicked circular, and linear forms, representing undamaged DNA, single-strand breaks, and double-strand breaks respectively. DNA-intercalated or groove-bound 125 I is more effective than surface-bound radionuclide or 125 I free in solution. The hydroxyl radical scavenger DMSO protects against damage by 125 I free in solution but has minimal effect on damage by groove-bound 125 I. (orig.)

  19. Exponential Megapriming PCR (EMP) Cloning—Seamless DNA Insertion into Any Target Plasmid without Sequence Constraints

    Science.gov (United States)

    Ulrich, Alexander; Andersen, Kasper R.; Schwartz, Thomas U.

    2012-01-01

    We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts. PMID:23300917

  20. Exponential megapriming PCR (EMP cloning--seamless DNA insertion into any target plasmid without sequence constraints.

    Directory of Open Access Journals (Sweden)

    Alexander Ulrich

    Full Text Available We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts.

  1. Plasmid DNA loaded chitosan nanoparticles for nasal mucosal immunization against hepatitis B.

    Science.gov (United States)

    Khatri, Kapil; Goyal, Amit K; Gupta, Prem N; Mishra, Neeraj; Vyas, Suresh P

    2008-04-16

    This work investigates the preparation and in vivo efficacy of plasmid DNA loaded chitosan nanoparticles for nasal mucosal immunization against hepatitis B. Chitosan pDNA nanoparticles were prepared using a complex coacervation process. Prepared nanoparticles were characterized for size, shape, surface charge, plasmid loading and ability of nanoparticles to protect DNA against nuclease digestion and for their transfection efficacy. Nasal administration of nanoparticles resulted in serum anti-HBsAg titre that was less compared to that elicited by naked DNA and alum adsorbed HBsAg, but the mice were seroprotective within 2 weeks and the immunoglobulin level was above the clinically protective level. However, intramuscular administration of naked DNA and alum adsorbed HBsAg did not elicit sIgA titre in mucosal secretions that was induced by nasal immunization with chitosan nanoparticles. Similarly, cellular responses (cytokine levels) were poor in case of alum adsorbed HBsAg. Chitosan nanoparticles thus produced humoral (both systemic and mucosal) and cellular immune responses upon nasal administration. The study signifies the potential of chitosan nanoparticles as DNA vaccine carrier and adjuvant for effective immunization through non-invasive nasal route.

  2. A Ti plasmid-encoded enzyme required for degradation of mannopine is functionally homologous to the T-region-encoded enzyme required for synthesis of this opine in crown gall tumors.

    OpenAIRE

    Kim, K S; Chilton, W S; Farrand, S K

    1996-01-01

    The mocC gene encoded by the octopine/mannityl opine-type Ti plasmid pTi15955 is related at the nucleotide sequence level to mas1' encoded by the T region of this plasmid. While Mas1 is required for the synthesis of mannopine (MOP) by crown gall tumor cells, MocC is essential for the utilization of MOP by Agrobacterium spp. A cosmid clone of pTi15955, pYDH208, encodes mocC and confers the utilization of MOP on strain NT1 and on strain UIA5, a derivative of NT1 lacking the 450-kb cryptic plasm...

  3. Isolation/separation of plasmid DNA using hemoglobin modified magnetic nanocomposites as solid-phase adsorbent.

    Science.gov (United States)

    Chen, Xu-Wei; Mao, Quan-Xing; Liu, Jia-Wei; Wang, Jian-Hua

    2012-10-15

    Hemoglobin (Hb) modified magnetic nanocomposites are prepared by immobilization of Hb onto the surface of amino-functionalized Fe(3)O(4)@SiO(2) magnetic nanoparticles via covalent bonding with glutaraldehyde as cross-linker. The obtained nanocomposites are characterized with FT-IR, SEM, XRD and surface charge analysis. A direct solid-phase extraction procedure for the isolation/separation of plasmid DNA using this nanocomposite as a novel adsorbent is thus developed. Some important experimental parameters governing the sorption efficiency, i.e., the pH of sample solution and the ionic strength, are investigated. The Hb modified magnetic nanocomposites provide a sorption capacity of 27.86 mg g(-1) for DNA. By using 2.0mg of the nanocomposites as sorption medium and a suitable acidity of pH 6.1, a sorption efficiency of 93% is achieved for 25 μg mL(-1) of DNA in 1.0 mL of sample solution. Afterwards, the absorbed DNA could be readily recovered by using 1.0 mL of Tris-HCl buffer (pH 8.9, 0.01 mol L(-1)), giving rise to a recovery of ca. 68.3%. The present solid-phased extraction protocol is applied for the isolation of plasmid DNA from Escherichia coli culture, resulting in comparable yield and purity of plasmid DNA with respect to those obtained by using commercial kits. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Chemical and biological consequences of the radioactive decay of iodine-125 in plasmid DNA

    International Nuclear Information System (INIS)

    Linz, U.

    1983-09-01

    The consequences of the decay of iodine-125 incorporated into DNA were studied on a molecular basis. Doubly ( 14 C and 125 I) labelled 5-iodo-2'-deoxycytidine 5'-triphosphate (IdCTP) was synthesized and incorporated enzymatically into the SalI-cutting site of the plasmid pBR 322. Part of the radioiodinated DNA was treated with T4-DNA ligase in order to restore the circular structure of the native plasmid molecule. After 4 months of storage under various conditions the stable end products were analyzed by radio GC, radio HPLC and electron microscopy. The experiments were not only carried out with doubly-labelled DNA but also with solutions of 14 C-labelled DNA containing Na 125 I as internal radiation source. The results clearly indicate that radiolysis alone causes only minor damage. Transmutation of the covalently bound iodine, on the other hand, leads to complete destruction of the labelled nucleotide, giving rise to 14 CO 2 and 14 CO as main products. The production of 14 CO 2 which originates from both the base as well as the sugar component shows a strong solvent effect. The electron microscopy analysis of the DNA reveals that the local effects are always connected with at least one double strand break directly at the site of decay. In addition, one finds DNA double strand breaks in areas which are hundreds of base pairs apart from that site. Under certain circumstances most of the DNA molecules exhibit up to 10 breaks. A comparison between ligase-treated and untreated DNA shows that the configuration of the DNA and the position of the labelled nucleotide play in important role in the extent of the overall damage. It could be demonstrated that there is a linear correlation between gaseous fragmentation products and the number of double strand breaks. (orig./MG) [de

  5. Replication of each copy of the yeast 2 micron DNA plasmid occurs during the S phase.

    Science.gov (United States)

    Zakian, V A; Brewer, B J; Fangman, W L

    1979-08-01

    Saccharomyces cerevisiae contains 50-100 copies per cell of a circular plasmid called 2 micron DNA. Replication of this DNA was studied in two ways. The distribution of replication events among 2 micron DNA molecules was examined by density transfer experiments with asynchronous cultures. The data show that 2 micron DNA replication is similar to chromosomal DNA replication: essentially all 2 micron duplexes were of hybrid density at one cell doubling after the density transfer, with the majority having one fully dense strand and one fully light strand. The results show that replication of 2 micron DNA occurs by a semiconservative mechanism where each of the plasmid molecules replicates once each cell cycle. 2 micron DNA is the only known example of a multiple-copy, extrachromosomal DNA in which every molecule replicates in each cell cycle. Quantitative analysis of the data indicates that 2 micron DNA replication is limited to a fraction of the cell cycle. The period in the cell cycle when 2 micron DNA replicates was examined directly with synchronous cell cultures. Synchronization was accomplished by sequentially arresting cells in G1 phase using the yeast pheromone alpha-factor and incubating at the restrictive temperature for a cell cycle (cdc 7) mutant. Replication was monitored by adding 3H-uracil to cells previously labeled with 14C-uracil, and determining the 3H/14C ratio for purified DNA species. 2 micron DNA replication did not occur during the G1 arrest periods. However, the population of 2 micron DNA doubled during the synchronous S phase at the permissive temperature, with most of the replication occurring in the first third of S phase. Our results indicate that a mechanism exists which insures that the origin of replication of each 2 micron DNA molecule is activated each S phase. As with chromosomal DNA, further activation is prevented until the next cell cycle. We propose that the mechanism which controls the replication initiation of each 2 micron DNA

  6. Very low-energy and low-fluence ion beam bombardment of naked plasmid DNA

    International Nuclear Information System (INIS)

    Norarat, R.; Semsang, N.; Anuntalabhochai, S.; Yu, L.D.

    2009-01-01

    Ion beam bombardment of biological organisms has been recently applied to mutation breeding of both agricultural and horticultural plants. In order to explore relevant mechanisms, this study employed low-energy ion beams to bombard naked plasmid DNA. The study aimed at simulation of the final stage of the process of the ion beam bombardment of real cells to check whether and how very low-energy and low-fluence of ions can induce mutation. Argon and nitrogen ions at 5 keV and 2.5 keV respectively bombarded naked plasmid DNA pGFP to very low-fluences, an order of 10 13 ions/cm 2 . Subsequently, DNA states were analyzed using electrophoresis. Results provided evidences that the very low-energy and low-fluence ion bombardment indeed altered the DNA structure from supercoil to short linear fragments through multiple double strand breaks and thus induced mutation, which was confirmed by transfer of the bombarded DNA into bacteria Escherichia coli and subsequent expression of the marker gene.

  7. Antibacterial effect of cationic porphyrazines and anionic phthalocyanine and their interaction with plasmid DNA

    Science.gov (United States)

    Hassani, Leila; Hakimian, Fatemeh; Safaei, Elham; Fazeli, Zahra

    2013-11-01

    Resistance to antibiotics is a public health issue and identification of new antibacterial agents is one of the most important goals of pharmacological research. Among the novel developed antibacterial agents, porphyrin complexes and their derivatives are ideal candidates for use in medical applications. Phthalocyanines differ from porphyrins by having nitrogen atoms link the individual pyrrol units. The aza analogues of the phthalocyanines (azaPcs) such as tetramethylmetalloporphyrazines are heterocyclic Pc analogues. In this investigation, interaction of an anionic phthalocyanine (Cu(PcTs)) and two cationic tetrapyridinoporphyrazines including [Cu(2,3-tmtppa)]4+ and [Cu(3,4-tmtppa)]4+ complexes with plasmid DNA was studied using spectroscopic and gel electrophoresis methods. In addition, antibacterial effect of the complexes against Gram-positive (Staphylococcus aureus) and Gram-negative (Escherichia coli) bacteria was investigated using dilution test method. The results indicated that both porphyrazines have significant antibacterial properties, but Cu(PcTs) has weak antibacterial effect. Compairing the binding of the phthalocyanine and the porphyrazines to DNA demonstrated that the interaction of cationic porphyrazines is stronger than the anionic phthalocyanine remarkably. The extent of hypochromicity and red shift of absorption spectra indicated preferential intercalation of the two porphyrazine into the base pairs of DNA helix. Gel electrophoresis result implied Cu(2,3-tmtppa) and Cu(3,4-tmtppa) are able to perform cleavage of the plasmid DNA. Consequently, DNA binding and cleavage might be one of the antibacterial mechanisms of the complexes.

  8. Development and Synthesis of DNA-Encoded Benzimidazole Library.

    Science.gov (United States)

    Ding, Yun; Chai, Jing; Centrella, Paolo A; Gondo, Chenaimwoyo; DeLorey, Jennifer L; Clark, Matthew A

    2018-04-25

    Encoded library technology (ELT) is an effective approach to the discovery of novel small-molecule ligands for biological targets. A key factor for the success of the technology is the chemical diversity of the libraries. Here we report the development of DNA-conjugated benzimidazoles. Using 4-fluoro-3-nitrobenzoic acid as a key synthon, we synthesized a 320 million-member DNA-encoded benzimidazole library using Fmoc-protected amino acids, amines and aldehydes as diversity elements. Affinity selection of the library led to the discovery of a novel, potent and specific antagonist of the NK3 receptor.

  9. Lipofection of plasmid DNA into human mast cell lines using lipid nanoparticles generated by microfluidic mixing.

    Science.gov (United States)

    Duguay, Brett A; Huang, Kate Wei-Chen; Kulka, Marianna

    2018-04-18

    Mast cells are important immune cells that have significant roles in mediating allergy and asthma. Therefore, studying the molecular mechanisms regulating these and other processes in mast cells is important to elucidate. Methods such as lipofection, transduction, and electroporation are often employed to dissect these mechanisms by disrupting gene expression in mast cell lines. However, as with other leukocytes, human mast cells (HMCs) are often refractory to the delivery of plasmids by lipofection. In this study, we investigated the utility of lipid nanoparticles (LNPs) containing the ionizable cationic lipids 1,2-dioleoyloxy-3-dimethylaminopropane, 1,2-dioleyloxy-3-dimethylaminopropane, or 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane for the delivery of plasmid DNA into HMC lines. Herein, we demonstrate for the first time the use of LNPs to achieve significant and reproducible levels of plasmid DNA transfection in HMC-1.2 and laboratory of allergic diseases 2 (LAD2) cells. These levels reached 53.2% and 16.0% in HMC-1.2 and LAD2 cells, respectively; and outperformed Lipofectamine 3000 in both cases. Moreover, cell viability in the transfected cells remained above 65% for all LNP conditions tested. Together, these observations illustrate the efficacy of this technique for mast cell researchers and further support the use of LNPs for nucleic acid delivery into leukocytes. ©2018 Society for Leukocyte Biology.

  10. Dissemination of plasmid-encoded AmpC β-lactamases in antimicrobial resistant Salmonella serotypes originating from humans, pigs and the swine environment.

    Science.gov (United States)

    Keelara, Shivaramu; Thakur, Siddhartha

    2014-09-17

    The aim of this study was to characterize and determine the inter-serovar exchange of AmpC β-lactamase conferring plasmids isolated from humans, pigs and the swine environment. Plasmids isolated from a total of 21 antimicrobial resistant (AMR) Salmonella isolates representing human clinical cases (n=6), pigs (n=6) and the swine farm environment (n=9) were characterized by replicon typing and restriction digestion, inter-serovar transferability by conjugation, and presence of AmpC β-lactamase enzyme encoding gene blaCMY-2 by southern hybridization. Based on replicon typing, the majority (17/21, 81%) of the plasmids belonged to the I1-Iγ Inc group and were between 70 and 103kb. The potential for inter-serovar plasmid transfer was further confirmed by the PCR detection of AMR genes on the plasmids isolated from trans-conjugants. Plasmids from Salmonella serovars Anatum, Ouakam, Johannesburg and Typhimurium isolated from the same cohort of pigs and their environment and S. Heidelberg from a single human clinical isolate had identical plasmids based on digestion with multiple restriction enzymes (EcoRI, HindIII and PstI) and southern blotting. We demonstrated likely horizontal inter-serovar exchange of plasmid-encoding AmpC β-lactamases resistance among MDR Salmonella serotypes isolated from pigs, swine farm environment and clinical human cases. This study provides valuable information on the role of the swine farm environment and by extension other livestock farm environments, as a potential reservoir of resistant bacterial strains that potentially transmit resistance determinants to livestock, in this case, swine, humans and possibly other hosts by horizontal exchange of plasmids. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Cloning of a Recombinant Plasmid Encoding Thiol-Specific Antioxidant Antigen (TSA) Gene of Leishmania majorand Expression in the Chinese Hamster Ovary Cell Line.

    Science.gov (United States)

    Fatemeh, Ghaffarifar; Fatemeh, Tabatabaie; Zohreh, Sharifi; Abdolhosein, Dalimiasl; Mohammad Zahir, Hassan; Mehdi, Mahdavi

    2012-01-01

    TSA (thiol-specific antioxidant antigen) is the immune-dominant antigen of Leishmania major and is considered to be the most promising candidate molecule for a recombinant or DNA vaccine against leishmaniasis. The aim of the present work was to express a plasmid containing the TSA gene in eukaryotic cells. Genomic DNA was extracted, and the TSA gene was amplified by polymerase chain reaction (PCR). The PCR product was cloned into the pTZ57R/T vector, followed by subcloning into the eukaryotic expression vector pcDNA3 (EcoRI and HindIII sites). The recombinant plasmid was characterised by restriction digest and PCR. Eukaryotic Chinese hamster ovary cells were transfected with the plasmid containing the TSA gene. Expression of the L. major TSA gene was confirmed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and Western blotting. The plasmid containing the TSA gene was successfully expressed, as demonstrated by a band of 22.1 kDa on Western blots. The plasmid containing the TSA gene can be expressed in a eukaryotic cell line. Thus, the recombinant plasmid may potentially be used as a DNA vaccine in animal models.

  12. Gene Transfer into the Lung by Nanoparticle Dextran-Spermine/Plasmid DNA Complexes

    Directory of Open Access Journals (Sweden)

    Syahril Abdullah

    2010-01-01

    Full Text Available A novel cationic polymer, dextran-spermine (D-SPM, has been found to mediate gene expression in a wide variety of cell lines and in vivo through systemic delivery. Here, we extended the observations by determining the optimal conditions for gene expression of D-SPM/plasmid DNA (D-SPM/pDNA in cell lines and in the lungs of BALB/c mice via instillation delivery. In vitro studies showed that D-SPM could partially protect pDNA from degradation by nuclease and exhibited optimal gene transfer efficiency at D-SPM to pDNA weight-mixing ratio of 12. In the lungs of mice, the levels of gene expression generated by D-SPM/pDNA are highly dependent on the weight-mixing ratio of D-SPM to pDNA, amount of pDNA in the complex, and the assay time postdelivery. Readministration of the complex at day 1 following the first dosing showed no significant effect on the retention and duration of gene expression. The study also showed that there was a clear trend of increasing size of the complexes as the amount of pDNA was increased, where the sizes of the D-SPM/pDNA complexes were within the nanometer range.

  13. Initiation and termination of the bacteriophage phi X174 rolling circle DNA replication in vivo: packaging of plasmid single-stranded DNA into bacteriophage phi X174 coats

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; Weisbeek, P. J.

    1982-01-01

    The bacteriophage phi X174 viral (+) origin when inserted in a plasmid can interact in vivo with the A protein produced by infecting phi X174 phages. A consequence of this interaction is packaging of single-stranded plasmid DNA into preformed phage coats resulting in infective particles (1). This

  14. Electrophoresis examination of strand breaks in plasmid DNA induced by low-energy nitrogen ion irradiation

    International Nuclear Information System (INIS)

    Zhao Yong; Tan Zheng; Du Yanhua; Qiu Guanying

    2003-01-01

    To study the effect on plasmid DNA of heavy ion in the energy range of keV where nuclear stopping interaction becomes more important or even predominant, thin film of plasmid pGEM-3Zf(-) DNA was prepared on aluminum surface and irradiated in vacuum ( -3 Pa) by low-energy nitrogen ions with energy of 30 keV (LET=285 keV/μm) at various fluence ranging from 2 x 10 10 to 8.2 x 10 13 ions/cm 2 . DNA strand breaks were analyzed by neutral electrophoresis followed by quantification with image analysis software. Low-energy nitrogen ion irradiation induced single-, double- and multiple double-strand breaks (DSB) and multiple DSB as the dominating form of DNA damages. Moreover, the linear fluence-response relationship at a low fluence range suggests that DSBs are induced predominantly by single ion track. However, strand break production is limited to a short range in the irradiated samples

  15. Effects of 32 P incorporated in plasmid DNA: strand breaks and mutagenesis

    International Nuclear Information System (INIS)

    Fonseca, Adenilson de S. da; Felzenszwalb, Israel

    1996-01-01

    In order to study the 32 P decay effects in DNA, bacterial plasmid were labeled with different activities of the radioisotope in vivo: 1,2 and 6 x 10 5 Bk/ml of bacterial culture, leading to 1,2 and 6 x 10 3 Bk/μg of nucleic acid or in vitro: 0.7, 1.5 and 3.5 x 10 3 Bk/μg of nucleic acid, stored at -20 deg C and its electroforetic profiles, transformation capacity of wild type and DNA repair. E. coli mutants cells and mutagenesis, were followed during three months. The results achieved in this work suggest that: the decay of the incorporated 32 P in vivo is able to change the pBR322 electroforetic profile, we detected a decrease on the form III (super coiled) and increase on the form II (circular), indicating single strands breaks; the decay incorporated 32 in vitro does not modify the electrophoretic profile of pBR322, suggesting that in some way the effects of the radioactive decay of incorporated 32 P is dependent of the DNA topology, the damages induced by 32 P decay increase mutation frequency in pAC189 plasmids. MRF is increased by a factor of three after 6 t 1/2 of storage, indicating direct or indirect action through mismatch DNA repair pathway. (author)

  16. A plasmid toolkit for cloning chimeric cDNAs encoding customized fusion proteins into any Gateway destination expression vector

    Science.gov (United States)

    2013-01-01

    Background Valuable clone collections encoding the complete ORFeomes for some model organisms have been constructed following the completion of their genome sequencing projects. These libraries are based on Gateway cloning technology, which facilitates the study of protein function by simplifying the subcloning of open reading frames (ORF) into any suitable destination vector. The expression of proteins of interest as fusions with functional modules is a frequent approach in their initial functional characterization. A limited number of Gateway destination expression vectors allow the construction of fusion proteins from ORFeome-derived sequences, but they are restricted to the possibilities offered by their inbuilt functional modules and their pre-defined model organism-specificity. Thus, the availability of cloning systems that overcome these limitations would be highly advantageous. Results We present a versatile cloning toolkit for constructing fully-customizable three-part fusion proteins based on the MultiSite Gateway cloning system. The fusion protein components are encoded in the three plasmids integral to the kit. These can recombine with any purposely-engineered destination vector that uses a heterologous promoter external to the Gateway cassette, leading to the in-frame cloning of an ORF of interest flanked by two functional modules. In contrast to previous systems, a third part becomes available for peptide-encoding as it no longer needs to contain a promoter, resulting in an increased number of possible fusion combinations. We have constructed the kit’s component plasmids and demonstrate its functionality by providing proof-of-principle data on the expression of prototype fluorescent fusions in transiently-transfected cells. Conclusions We have developed a toolkit for creating fusion proteins with customized N- and C-term modules from Gateway entry clones encoding ORFs of interest. Importantly, our method allows entry clones obtained from ORFeome

  17. The Bacillus subtilis Conjugative Plasmid pLS20 Encodes Two Ribbon-Helix-Helix Type Auxiliary Relaxosome Proteins That Are Essential for Conjugation.

    Science.gov (United States)

    Miguel-Arribas, Andrés; Hao, Jian-An; Luque-Ortega, Juan R; Ramachandran, Gayetri; Val-Calvo, Jorge; Gago-Córdoba, César; González-Álvarez, Daniel; Abia, David; Alfonso, Carlos; Wu, Ling J; Meijer, Wilfried J J

    2017-01-01

    Bacterial conjugation is the process by which a conjugative element (CE) is transferred horizontally from a donor to a recipient cell via a connecting pore. One of the first steps in the conjugation process is the formation of a nucleoprotein complex at the origin of transfer ( oriT ), where one of the components of the nucleoprotein complex, the relaxase, introduces a site- and strand specific nick to initiate the transfer of a single DNA strand into the recipient cell. In most cases, the nucleoprotein complex involves, besides the relaxase, one or more additional proteins, named auxiliary proteins, which are encoded by the CE and/or the host. The conjugative plasmid pLS20 replicates in the Gram-positive Firmicute bacterium Bacillus subtilis . We have recently identified the relaxase gene and the oriT of pLS20, which are separated by a region of almost 1 kb. Here we show that this region contains two auxiliary genes that we name aux1 LS20 and aux2 LS20 , and which we show are essential for conjugation. Both Aux1 LS20 and Aux2 LS20 are predicted to contain a Ribbon-Helix-Helix DNA binding motif near their N-terminus. Analyses of the purified proteins show that Aux1 LS20 and Aux2 LS20 form tetramers and hexamers in solution, respectively, and that they both bind preferentially to oriT LS20 , although with different characteristics and specificities. In silico analyses revealed that genes encoding homologs of Aux1 LS20 and/or Aux2 LS20 are located upstream of almost 400 relaxase genes of the Rel LS20 family (MOB L ) of relaxases. Thus, Aux1 LS20 and Aux2 LS20 of pLS20 constitute the founding member of the first two families of auxiliary proteins described for CEs of Gram-positive origin.

  18. The Bacillus subtilis Conjugative Plasmid pLS20 Encodes Two Ribbon-Helix-Helix Type Auxiliary Relaxosome Proteins That Are Essential for Conjugation

    Directory of Open Access Journals (Sweden)

    Andrés Miguel-Arribas

    2017-11-01

    Full Text Available Bacterial conjugation is the process by which a conjugative element (CE is transferred horizontally from a donor to a recipient cell via a connecting pore. One of the first steps in the conjugation process is the formation of a nucleoprotein complex at the origin of transfer (oriT, where one of the components of the nucleoprotein complex, the relaxase, introduces a site- and strand specific nick to initiate the transfer of a single DNA strand into the recipient cell. In most cases, the nucleoprotein complex involves, besides the relaxase, one or more additional proteins, named auxiliary proteins, which are encoded by the CE and/or the host. The conjugative plasmid pLS20 replicates in the Gram-positive Firmicute bacterium Bacillus subtilis. We have recently identified the relaxase gene and the oriT of pLS20, which are separated by a region of almost 1 kb. Here we show that this region contains two auxiliary genes that we name aux1LS20 and aux2LS20, and which we show are essential for conjugation. Both Aux1LS20 and Aux2LS20 are predicted to contain a Ribbon-Helix-Helix DNA binding motif near their N-terminus. Analyses of the purified proteins show that Aux1LS20 and Aux2LS20 form tetramers and hexamers in solution, respectively, and that they both bind preferentially to oriTLS20, although with different characteristics and specificities. In silico analyses revealed that genes encoding homologs of Aux1LS20 and/or Aux2LS20 are located upstream of almost 400 relaxase genes of the RelLS20 family (MOBL of relaxases. Thus, Aux1LS20 and Aux2LS20 of pLS20 constitute the founding member of the first two families of auxiliary proteins described for CEs of Gram-positive origin.

  19. Ti plasmid-encoded genes responsible for catabolism of the crown gall opine mannopine by Agrobacterium tumefaciens are homologs of the T-region genes responsible for synthesis of this opine by the plant tumor.

    Science.gov (United States)

    Kim, K S; Farrand, S K

    1996-06-01

    Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.

  20. Use of Ti plasmid DNA probes for determining tumorigenicity of agrobacterium strains

    International Nuclear Information System (INIS)

    Burr, T.J.; Norelli, J.L.; Katz, B.H.; Bishop, A.L.

    1990-01-01

    Probes consisting of T-DNA genes from the Ti plasmid of Agrobacterium tumefaciens were used for determining tumorigenicity of strains. Two 32 P-labeled probes hybridized with 28 of 28 tumorigenic strains of the pathogen but not with 20 of 22 nontumorigenic strains. One probe, pTHE17, consists of all but the far left portion of the T-DNA of strain C58. Probe SmaI7 consists of SmaI fragment 7 of pTiC58, including onc genes 1, 4, and 6a and most of 2. Another probe, pAL4044, consisting of the vir region of strain Ach-5, hybridized with several nontumorigenic as well as tumorigenic strains. Colony hybridizations were done with 28 tumorigenic and 22 nontumorigenic Agrobacterium strains. About 10 6 CFU of the different tumorigenic strains were detectable with this method. Southern analyses confirmed the presence or absence of Ti plasmids in strains for which tumorigenicity was questioned. Colony hybridization with the T-DNA probes provides a rapid and sensitive means for determining the tumorigenic nature of Agrobacterium strains

  1. Genotoxic activity of 4,4',5'-trimethylazapsoralen on plasmid DNA.

    Science.gov (United States)

    Lagatolla, C; Dolzani, L; Granzotto, M; Monti-Bragadin, C

    1998-01-01

    The genotoxic activities of 8-methoxypsoralen (8-MOP) and 4,4',5'-trimethylazapsoralen (4,4',5'-TMAP) on plasmid DNA have been compared. In a previous work, 4,4',5'-TMAP, a methyl derivative of a psoralen isoster, had shown potential photochemotherapeutic activity. The mutagenic activity of mono- and bifunctional lesions caused by these compounds was evaluated both after UVA irradiation, which causes the formation of both kinds of lesions, and after a two-step irradiation procedure of the psoralen-plasmid DNA complex, which allowed monoadducts and interstrand crosslinks to be studied separately. Furthermore, we used a procedure that allowed us to evaluate both the mutagenic and recombinogenic activity of the two compounds. Results indicate that the most important difference between 8-MOP and 4,4',5'-TMAP consists in their mode of photoreaction with DNA rather than in their mutagenic potential. In fact, in all of the experimental procedures, 4,4',5'-TMAP shows a lower ability than 8-MOP to generate interstrand crosslinks. However, when comparable toxicity levels are reached, the two compounds show the same mutagenic potentiality.

  2. Aqueous extract of Pinus caribaea inhibits the damage induced by ultraviolet radiations, in plasmid DNA

    Directory of Open Access Journals (Sweden)

    Marioly Vernhes Tamayo

    2017-08-01

    Full Text Available Context: The incidence of solar ultraviolet radiation (UV on Earth has increased due to diminish of the ozone layer. This enviromental agent is highly genotoxic causing numerous damage in DNA molecule. Nowadays there is a growing interest in the search of compounds capable to minimize these effects. In particular, phytocompounds have been tested as excelent candidates for their antigenotoxic properties. Aims: To evaluate the protective effect of the aqueous extract of Pinus caribaea (EPC against the damage induced by the UVB and UVC radiation. Methods: The cell-free plasmid DNA assay was employed. The forms of plasmid were separated electrophoretically in agarose gel. For genotoxic and photoprotective evaluation of P. caribaea, different concentrations of the extract (0.1 – 2.0 mg/mL and exposure times were evaluated. The CPD lesions were detected enzymatically. Additionally, the transmittance of the aqueous extract against 254 nm and 312 nm was measured. Results: None of the concentrations were genotoxic in 30 min of treatment, for superior times a clastogenic effect was observed. The EPC despite inhibiting the activity of the enzyme T4 endo V, impedes photolesions formation in DNA at concentrations ≥ 0.1 mg/mL. Conclusions: The EPC has photoprotective properties, this effect could be related with its antioxidants and absorptives capacities.

  3. Type 3 fimbriae, encoded by the conjugative plasmid pOLA52, enhance biofilm formation and transfer frequencies in Enterobacteriaceae strains

    DEFF Research Database (Denmark)

    Burmølle, Mette; Bahl, Martin Iain; Jensen, Lars Bogø

    2008-01-01

    pathogenic, members of the family Enterobacteriaceae, including Klebsiella pneumoniae, Salmonella Typhimurium, Kluyvera sp. and Enterobacter aerogenes, pOLA52 facilitated increased biofilm formation. pOLA52 is believed to represent the first example of a conjugative plasmid encoding type 3 fimbriae...

  4. Effect of thiol pendant conjugates on plasmid DNA binding, release, and stability of polymeric delivery vectors.

    Science.gov (United States)

    Bacalocostantis, Irene; Mane, Viraj P; Kang, Michael S; Goodley, Addison S; Muro, Silvia; Kofinas, Peter

    2012-05-14

    Polymers have attracted much attention as potential gene delivery vectors due to their chemical and structural versatility. However, several challenges associated with polymeric carriers, including low transfection efficiencies, insufficient cargo release, and high cytotoxicity levels have prevented clinical implementation. Strong electrostatic interactions between polymeric carriers and DNA cargo can prohibit complete cargo release within the cell. As a result, cargo DNA never reaches the cell's nucleus where gene expression takes place. In addition, highly charged cationic polymers have been correlated with high cytotoxicity levels, making them unsuitable carriers in vivo. Using poly(allylamine) (PAA) as a model, we investigated how pH-sensitive disulfide cross-linked polymer networks can improve the delivery potential of cationic polymer carriers. To accomplish this, we conjugated thiol-terminated pendant chains onto the primary amines of PAA using 2-iminothiolane, developing three new polymer vectors with 5, 13, or 20% thiol modification. Unmodified PAA and thiol-conjugated polymers were tested for their ability to bind and release plasmid DNA, their capacity to protect genetic cargo from enzymatic degradation, and their potential for endolysosomal escape. Our results demonstrate that polymer-plasmid complexes (polyplexes) formed by the 13% thiolated polymer demonstrate the greatest delivery potential. At high N/P ratios, all thiolated polymers (but not unmodified counterparts) were able to resist decomplexation in the presence of heparin, a negatively charged polysaccharide used to mimic in vivo polyplex-protein interactions. Further, all thiolated polymers exhibited higher buffering capacities than unmodified PAA and, therefore, have a greater potential for endolysosomal escape. However, 5 and 20% thiolated polymers exhibited poor DNA binding-release kinetics, making them unsuitable carriers for gene delivery. The 13% thiolated polymers, on the other hand

  5. Poly(hydroxyethyl methacrylate) based magnetic nanoparticles for plasmid DNA purification from Escherichia coli lysate

    Energy Technology Data Exchange (ETDEWEB)

    Percin, Is Latin-Small-Letter-Dotless-I k [Department of Biology, Hacettepe University, Ankara (Turkey); Karakoc, Veyis [Department of Chemistry, Biochemistry Division, Hacettepe University, Ankara (Turkey); Akgoel, Sinan [Department of Biochemistry, Ege University, Izmir (Turkey); Aksoez, Erol [Department of Biology, Hacettepe University, Ankara (Turkey); Denizli, Adil, E-mail: denizli@hacettepe.edu.tr [Department of Chemistry, Biochemistry Division, Hacettepe University, Ankara (Turkey)

    2012-07-01

    The aim of this study is to prepare poly(hydroxyethyl methacrylate-N-methacryloyl-(L)-histidine) [PHEMAH] magnetic nanoparticles for plasmid DNA (pDNA) purification from Escherichia coli (E. coli) cell lysate. Magnetic nanoparticles were produced by surfactant free emulsion polymerization. mPHEMAH nanoparticles were characterized by elemental analysis, Fourier transform infrared spectroscopy (FTIR), atomic force microscopy (AFM), vibrating sample magnetometer (VSM), electron spin resonance (ESR), thermogravimetric analyses (TGA) and transmission electron microscopy (TEM). Surface area, average particle size and size distribution were also performed. Specific surface area of the mPHEMAH nanoparticles was found to be 1180 m{sup 2}/g. Elemental analysis of MAH for nitrogen was estimated as 0.18 mmol/g polymer. The amount of pDNA adsorbed onto the mPHEMAH nanoparticles first increased and then reached a saturation value at around 1.0 mg/mL of pDNA concentration. Compared with the mPHEMA nanoparticles (50 {mu}g/g polymer), the pDNA adsorption capacity of the mPHEMAH nanoparticles (154 mg/g polymer) was improved significantly due to the MAH incorporation into the polymeric matrix. The maximum pDNA adsorption was achieved at 25 Degree-Sign C. The overall recovery of pDNA was calculated as 92%. The mPHEMAH nanoparticles could be used six times without decreasing the pDNA adsorption capacity significantly. The results indicate that the PHEMAH nanoparticles promise high selectivity for pDNA. - Highlights: Black-Right-Pointing-Pointer Magnetic nanoparticles have several advantages over conventional adsorbents. Black-Right-Pointing-Pointer MAH acted as the pseudospecific ligand, ligand immobilization step was eliminated. Black-Right-Pointing-Pointer pDNA adsorption amount was 154 mg/g. Black-Right-Pointing-Pointer Fifty-fold capacity increase was obtained when compared to conventional matrices.

  6. Poly(hydroxyethyl methacrylate) based magnetic nanoparticles for plasmid DNA purification from Escherichia coli lysate

    International Nuclear Information System (INIS)

    Perçin, Işık; Karakoç, Veyis; Akgöl, Sinan; Aksöz, Erol; Denizli, Adil

    2012-01-01

    The aim of this study is to prepare poly(hydroxyethyl methacrylate-N-methacryloyl-(L)-histidine) [PHEMAH] magnetic nanoparticles for plasmid DNA (pDNA) purification from Escherichia coli (E. coli) cell lysate. Magnetic nanoparticles were produced by surfactant free emulsion polymerization. mPHEMAH nanoparticles were characterized by elemental analysis, Fourier transform infrared spectroscopy (FTIR), atomic force microscopy (AFM), vibrating sample magnetometer (VSM), electron spin resonance (ESR), thermogravimetric analyses (TGA) and transmission electron microscopy (TEM). Surface area, average particle size and size distribution were also performed. Specific surface area of the mPHEMAH nanoparticles was found to be 1180 m 2 /g. Elemental analysis of MAH for nitrogen was estimated as 0.18 mmol/g polymer. The amount of pDNA adsorbed onto the mPHEMAH nanoparticles first increased and then reached a saturation value at around 1.0 mg/mL of pDNA concentration. Compared with the mPHEMA nanoparticles (50 μg/g polymer), the pDNA adsorption capacity of the mPHEMAH nanoparticles (154 mg/g polymer) was improved significantly due to the MAH incorporation into the polymeric matrix. The maximum pDNA adsorption was achieved at 25 °C. The overall recovery of pDNA was calculated as 92%. The mPHEMAH nanoparticles could be used six times without decreasing the pDNA adsorption capacity significantly. The results indicate that the PHEMAH nanoparticles promise high selectivity for pDNA. - Highlights: ► Magnetic nanoparticles have several advantages over conventional adsorbents. ► MAH acted as the pseudospecific ligand, ligand immobilization step was eliminated. ► pDNA adsorption amount was 154 mg/g. ► Fifty-fold capacity increase was obtained when compared to conventional matrices.

  7. Development of electrochemical reporter assay using HeLa cells transfected with vector plasmids encoding various responsive elements

    Energy Technology Data Exchange (ETDEWEB)

    Shiku, Hitoshi, E-mail: shiku@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Takeda, Michiaki; Murata, Tatsuya [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Akiba, Uichi; Hamada, Fumio [Graduate School of Engineering and Resource Science, Akita University, 1-1 Tegata gakuen-machi, Akita 010-8502 (Japan); Matsue, Tomokazu, E-mail: matsue@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan)

    2009-04-27

    Electrochemical assay using HeLa cell lines transfected with various plasmid vectors encoding SEAP (secreted alkaline phosphatase) as the reporter has been performed by using SECM (scanning electrochemical microscopy). The plasmid vector contains different responsive elements that include GRE (glucocorticoid response elements), CRE (cAMP responsive elements), or {kappa}B (binding site for NF{kappa}B (nuclear factor kappa B)) upstream of the SEAP sequence. The transfected HeLa cells were patterned on a culture dish in a 4 x 4 array of circles of diameter 300 {mu}m by using the PDMS (poly(dimethylsiloxane)) stencil technique. The cellular array was first exposed to 100 ng mL{sup -1} dexamethasone, 10 ng mL{sup -1} forskolin, or 100 ng mL{sup -1} TNF-{alpha} (tumor necrosis factor {alpha}) after which it was further cultured in an RPMI culture medium for 6 h. After incubation, the cellular array was soaked in a measuring solution containing 4.7 mM PAPP (p-aminophenylphosphate) at pH 9.5, following which electrochemical measurements were performed immediately within 40 min. The SECM method allows parallel evaluation of different cell lines transfected with pGRE-SEAP, pCRE-SEAP, and pNF{kappa}B-SEAP patterned on the same solid support for detection of the oxidation current of PAP (p-aminophenol) flux produced from only 300 HeLa cells in each stencil pattern. The results of the SECM method were highly sensitive as compared to those obtained from the conventional CL (chemiluminescence) protocol with at least 5 x 10{sup 4} cells per well.

  8. Identification of novel substrates of Shigella T3SA through analysis of its virulence plasmid-encoded secretome

    Science.gov (United States)

    Pinaud, Laurie; Ferrari, Mariana L.; Friedman, Robin; Jehmlich, Nico; von Bergen, Martin; Phalipon, Armelle; Sansonetti, Philippe J.

    2017-01-01

    Many human Gram-negative bacterial pathogens express a Type Three Secretion Apparatus (T3SA), including among the most notorious Shigella spp., Salmonella enterica, Yersinia enterocolitica and enteropathogenic Escherichia coli (EPEC). These bacteria express on their surface multiple copies of the T3SA that mediate the delivery into host cells of specific protein substrates critical to pathogenesis. Shigella spp. are Gram-negative bacterial pathogens responsible for human bacillary dysentery. The effector function of several Shigella T3SA substrates has largely been studied but their potential cellular targets are far from having been comprehensively delineated. In addition, it is likely that some T3SA substrates have escaped scrutiny as yet. Indeed, sequencing of the virulence plasmid of Shigella flexneri has revealed numerous open reading frames with unknown functions that could encode additional T3SA substrates. Taking advantage of label-free mass spectrometry detection of proteins secreted by a constitutively secreting strain of S. flexneri, we identified five novel substrates of the T3SA. We further confirmed their secretion through the T3SA and translocation into host cells using β-lactamase assays. The coding sequences of two of these novel T3SA substrates (Orf13 and Orf131a) have a guanine-cytosine content comparable to those of T3SA components and effectors. The three other T3SA substrates identified (Orf48, Orf86 and Orf176) have significant homology with antitoxin moieties of type II Toxin-Antitoxin systems usually implicated in the maintenance of low copy plasmids. While Orf13 and Orf131a might constitute new virulence effectors contributing to S. flexneri pathogenicity, potential roles for the translocation into host cells of antitoxins or antitoxin-like proteins during Shigella infection are discussed. PMID:29073283

  9. Identification of novel substrates of Shigella T3SA through analysis of its virulence plasmid-encoded secretome.

    Directory of Open Access Journals (Sweden)

    Laurie Pinaud

    Full Text Available Many human Gram-negative bacterial pathogens express a Type Three Secretion Apparatus (T3SA, including among the most notorious Shigella spp., Salmonella enterica, Yersinia enterocolitica and enteropathogenic Escherichia coli (EPEC. These bacteria express on their surface multiple copies of the T3SA that mediate the delivery into host cells of specific protein substrates critical to pathogenesis. Shigella spp. are Gram-negative bacterial pathogens responsible for human bacillary dysentery. The effector function of several Shigella T3SA substrates has largely been studied but their potential cellular targets are far from having been comprehensively delineated. In addition, it is likely that some T3SA substrates have escaped scrutiny as yet. Indeed, sequencing of the virulence plasmid of Shigella flexneri has revealed numerous open reading frames with unknown functions that could encode additional T3SA substrates. Taking advantage of label-free mass spectrometry detection of proteins secreted by a constitutively secreting strain of S. flexneri, we identified five novel substrates of the T3SA. We further confirmed their secretion through the T3SA and translocation into host cells using β-lactamase assays. The coding sequences of two of these novel T3SA substrates (Orf13 and Orf131a have a guanine-cytosine content comparable to those of T3SA components and effectors. The three other T3SA substrates identified (Orf48, Orf86 and Orf176 have significant homology with antitoxin moieties of type II Toxin-Antitoxin systems usually implicated in the maintenance of low copy plasmids. While Orf13 and Orf131a might constitute new virulence effectors contributing to S. flexneri pathogenicity, potential roles for the translocation into host cells of antitoxins or antitoxin-like proteins during Shigella infection are discussed.

  10. Photolysis of phosphodiester bonds in plasmid DNA by high intensity UV laser irradiation

    International Nuclear Information System (INIS)

    Croke, D.T.; Blau, Werner; OhUigin, Colm; Kelly, J.M.; McConnell, D.J.

    1988-01-01

    The cleavage of phosphodiester bonds in DNA exposed to high intensity UV laser pulses in aerated aqueous solution has been investigated using a krypton fluoride excimer laser (248 nm) and bacterial plasmid DNA. The dependence of strand breakage on fluence and intensity has been studied in detail and shows that the process is non-linear with respect to intensity. The relationship between the quantum yield for strand breakage and intensity shows that the strand breakage reaction involves two-photon excitation of DNA bases. The quantum yield rises with intensity from a lower value of 7 x 10 -5 until a maximum value of 4.5 x 10 -4 is attained at intensities of 10 11 W m -2 and above. This value is approximately fifty-fold higher than the quantum yield for strand breakage induced by exposure to low density UV irradiation (254 nm, 12 W m -2 ). DNA sequencing experiments have shown that strand breakage occurs by the specific cleavage of the phosphodiester bond which lies immediately 3' to guanine residues in the DNA, leaving some alkali-labile remnant attached to the terminal phosphate. A mechanism for DNA strand breakage which involves the generation of guanine radical cations is proposed. (author)

  11. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

  12. Effective plasmid DNA and small interfering RNA delivery to diseased human brain microvascular endothelial cells.

    Science.gov (United States)

    Slanina, H; Schmutzler, M; Christodoulides, M; Kim, K S; Schubert-Unkmeir, A

    2012-01-01

    Expression of exogenous DNA or small interfering RNA (siRNA) in vitro is significantly affected by the particular delivery system utilized. In this study, we evaluated the transfection efficiency of plasmid DNA and siRNA into human brain microvascular endothelial cells (HBMEC) and meningioma cells, which constitute the blood-cerebrospinal fluid barrier, a target of meningitis-causing pathogens. Chemical transfection methods and various lipofection reagents including Lipofectamin™, FuGene™, or jetPRIME®, as well as physical transfection methods and electroporation techniques were applied. To monitor the transfection efficiencies, HBMEC and meningioma cells were transfected with the reporter plasmid pTagGFP2-actin vector, and efficiency of transfection was estimated by fluorescence microscopy and flow cytometry. We established protocols based on electroporation using Cell Line Nucleofector® Kit V with the Amaxa® Nucleofector® II system from Lonza and the Neon® Transfection system from Invitrogen resulting in up to 41 and 82% green fluorescent protein-positive HBMEC, respectively. Optimal transfection solutions, pulse programs and length were evaluated. We furthermore demonstrated that lipofection is an efficient method to transfect meningioma cells with a transfection efficiency of about 81%. Finally, we applied the successful electroporation protocols to deliver synthetic siRNA to HBMEC and analyzed the role of the actin-binding protein cortactin in Neisseria meningitidis pathogenesis. Copyright © 2012 S. Karger AG, Basel.

  13. A Novel Audio Cryptosystem Using Chaotic Maps and DNA Encoding

    Directory of Open Access Journals (Sweden)

    S. J. Sheela

    2017-01-01

    Full Text Available Chaotic maps have good potential in security applications due to their inherent characteristics relevant to cryptography. This paper introduces a new audio cryptosystem based on chaotic maps, hybrid chaotic shift transform (HCST, and deoxyribonucleic acid (DNA encoding rules. The scheme uses chaotic maps such as two-dimensional modified Henon map (2D-MHM and standard map. The 2D-MHM which has sophisticated chaotic behavior for an extensive range of control parameters is used to perform HCST. DNA encoding technology is used as an auxiliary tool which enhances the security of the cryptosystem. The performance of the algorithm is evaluated for various speech signals using different encryption/decryption quality metrics. The simulation and comparison results show that the algorithm can achieve good encryption results and is able to resist several cryptographic attacks. The various types of analysis revealed that the algorithm is suitable for narrow band radio communication and real-time speech encryption applications.

  14. Construction and confirmation of the plasmid of human mitochondrial DNA 4977 bp deletion induced by ionizing radiation

    International Nuclear Information System (INIS)

    Chen Xiaosui; Zhou Lijun; Wang Yuxiao; Qu Jia; Feng Jiangbing; Lu Xue; Chen Deqing; Liu Qingjie

    2006-01-01

    Objective: To construct a stable plasmid that spanning deleted human mitochondrial DNA (mtDNA) 4977 bp induced by ionizing radiation and another one for control DNA fragment, in order to use in the human mitochondrial genome study in the future. Methods: The peripheral blood, which had no mtDNA 4977 bp deletion found in previous study, was exposed to 10 Gy 60 Co γ-rays in vitro. The total cell DNA was extracted and PCR was carried out: a nest-PCR of three-round PCR was used for the mtDNA 4977 bp deletion and one- round regular PCR was used for the control ND1 gene. The PCR products were used for transfection by electroporation and the positive clones were obtained after screening. The plasmid DNA was isolated and sequenced after enzymatic digestion and purification. The sequence result was BLASTed with the human mitochondrial genome. Results: The sizes of PCR products for the flanked 4977 bp deletion and the ND1 gene were similar with those predicted according to GeneBank. The sequences for the positive clones were above 99 per cent homologous with the human mitochondrial genome after BLASTed. Conclusion: The plasmids for deleted human mtDNA 4977 bp and control DNA fragment have been constructed successfully, and they could be used in the quality and quantity studies on human mtDNA 4977 bp deletion. (authors)

  15. Plasmid DNA transfection using magnetite cationic liposomes for construction of multilayered gene-engineered cell sheet.

    Science.gov (United States)

    Ino, Kosuke; Kawasumi, Tamayo; Ito, Akira; Honda, Hiroyuki

    2008-05-01

    Modification of cellular functions by overexpression of genes is being increasingly practiced for tissue engineering. In the present study, we investigated whether transfection efficiency could be enhanced by magnetofection that involves the use of plasmid DNA (pDNA)/magnetite cationic liposomes (MCLs) complexes (pDNA/MCL) and magnetic force. The transfection efficiencies of the magnetofection technique by pDNA/MCL in fibroblasts and keratinocytes using reporter genes were 36- and 10-fold higher, respectively, than those of a lipofection technique by cationic liposomes. Moreover, in vitro construction of three-dimensional (3D) tissues is an important challenge. We recently proposed a novel technique termed "magnetic force-based tissue engineering" (Mag-TE) to produce 3D tissues. Since the fibroblasts after magnetofection incorporated both magnetite nanoparticles and pDNA, we investigated whether multilayered heterotypic cell sheets expressing transgene could be fabricated by Mag-TE. First, the fibroblasts were seeded onto an ultra-low attachment culture plate. When a magnet was placed under the plate, the cells accumulated at the bottom of the culture plate. After 24 h of culture, the transgene-expressing cells formed a multilayered cell sheet-like structure. These results indicated that MCLs are a potent biomanipulation tool for both gene transfer and 3D tissue construction, suggesting that these techniques are useful for tissue engineering. Copyright 2007 Wiley Periodicals, Inc.

  16. Dual recombinant Lactococcus lactis for enhanced delivery of DNA vaccine reporter plasmid pPERDBY.

    Science.gov (United States)

    Yagnik, Bhrugu; Sharma, Drashya; Padh, Harish; Desai, Priti

    2017-04-01

    Food grade Lactococcus lactis has been widely used as an antigen and DNA delivery vehicle. We have previously reported the use of non-invasive L. lactis to deliver the newly constructed immunostimulatory DNA vaccine reporter plasmid, pPERDBY. In the present report, construction of dual recombinant L. lactis expressing internalin A of Listeria monocytogenes and harboring pPERDBY (LL InlA + pPERDBY) to enhance the efficiency of delivery of DNA by L. lactis is outlined. After confirmation and validation of LL InlA + pPERDBY, its DNA delivery potential was compared with previously developed non-invasive r- L. lactis::pPERDBY. The use of invasive L. lactis resulted in around threefold increases in the number of enhanced green fluorescent protein-expressing Caco-2 cells. These findings reinforce the prospective application of invasive strain of L. lactis for delivery of DNA/RNA and antigens. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

  17. A novel plasmid-encoded serotype conversion mechanism through addition of phosphoethanolamine to the O-antigen of Shigella flexneri.

    Directory of Open Access Journals (Sweden)

    Qiangzheng Sun

    Full Text Available Shigella flexneri is the major pathogen causing bacillary dysentery in developing countries. S. flexneri is divided into at least 16 serotypes based on the combination of antigenic determinants present in the O-antigen. All the serotypes (except for serotype 6 share a basic O-unit containing one N-acetyl-d-glucosamine and three l-rhamnose residues, whereas differences between the serotypes are conferred by phage-encoded glucosylation and/or O-acetylation. Serotype Xv is a newly emerged and the most prevalent serotype in China, which can agglutinate with both MASF IV-1 and 7,8 monoclonal antibodies. The factor responsible for the presence of MASF IV-1 (E1037 epitope has not yet been identified. In this study, we analyzed the LPS structure of serotype Xv strains and found that the MASF IV-1 positive phenotype depends on an O-antigen modification with a phosphoethanolamine (PEtN group attached at position 3 of one of the rhamnose residues. A plasmid carried gene, lpt-O (LPS phosphoethanolamine transferase for O-antigen, mediates the addition of PEtN for serotype Xv and other MASF IV-1 positive strains. These findings reveal a novel serotype conversion mechanism in S. flexneri and show the necessity of further extension of the serotype classification scheme recognizing the MASF IV-1 positive strains as distinctive subtypes.

  18. Immunological response and protection of mice immunized with plasmid encoding Toxoplasma gondii glycolytic enzyme malate dehydrogenase.

    Science.gov (United States)

    Hassan, I A; Wang, S; Xu, L; Yan, R; Song, X; XiangRui, L

    2014-12-01

    Toxoplasma gondii Malate dehydrogenase (TgMDH) plays an important role as part of the energy production cycle. In this investigation, immunological changes and protection efficiency of this protein delivered as a DNA vaccine have been evaluated. Mice were intramuscularly immunized with pTgMDH, followed by challenge with virulent T. gondii RH strain, 2 weeks after the booster immunization. Compared to the control groups, the results showed that pTgMDH has stimulated specific humoral response as demonstrated by significant high titers of total IgG and subclasses IgG1 and IgG2a , beside IgA and IgM, but not IgE. Analysis of cytokine profiles revealed significant increases of IFN-γ, IL-4 and IL-17, while no significant changes were detected in TGF-β1. In cell-mediated response, both T lymphocytes subpopulations CD4(+) and CD8(+) were positively recruited as significant percentages were recorded in response to immunization with TgMDH. Significant long survival rate, 17 days, has been observed in the TgMDH vaccinated group, in contrast with control groups which died within 8-9 days after challenge. These results demonstrated that TgMDH could induce significant immunological responses leading to a considerable level of protection against acute toxoplasmosis infection. © 2014 John Wiley & Sons Ltd.

  19. Expression analysis of a ''Cucurbita'' cDNA encoding endonuclease

    International Nuclear Information System (INIS)

    Szopa, J.

    1995-01-01

    The nuclear matrices of plant cell nuclei display intrinsic nuclease activity which consists in nicking supercoiled DNA. A cDNA encoding a 32 kDa endonuclease has been cloned and sequenced. The nucleotide and deduced amino-acid sequences show high homology to known 14-3-3-protein sequences from other sources. The amino-acid sequence shows agreement with consensus sequences for potential phosphorylation by protein kinase A and C and for calcium, lipid and membrane-binding sites. The nucleotide-binding site is also present within the conserved part of the sequence. By Northern blot analysis, the differential expression of the corresponding mRNA was detected; it was the strongest in sink tissues. The endonuclease activity found on DNA-polyacrylamide gel electrophoresis coincided with mRNA content and was the highest in tuber. (author). 22 refs, 6 figs

  20. Enhanced extraction and purification of plasmid DNA from escherichia coli by applying a hybrid magnetic nanocomposite

    Energy Technology Data Exchange (ETDEWEB)

    Silva, R.J. da; Chavez-Guajardo, A.E.; Medina-llamas, J.C.; Alcaraz-Espinoza, J.J.; Melo, C.P. de [Universidade Federal de Pernambuco (UFPE), PE (Brazil)

    2016-07-01

    Full text: Plasmid DNA (pDNA), a special kind of nucleic acid usually found in bacteria, is a small molecule physically distinct from chromosomal DNA that can replicate independently. This genetic material has been used in a wide set of biotechnological methodologies, such as genetic engineering, production of recombinant drugs and gene therapy, among others. In all these applications, the extraction and purification of pDNA appears as a crucial step. In this work, we describe the synthesis of a polyaniline and maghemite (PANI/?-Fe2O3) magnetic nanocomposite (MNC) and its use in a new Escherichia coli (E. coli) pDNA extraction and purification protocol. We have used transmission electron microscopy (TEM), UV-Vis spectroscopy, infrared spectroscopy (FTIR), X-ray diffraction (XRD), dynamic light scattering (DLS) and magnetic measurements to characterize the MNC, which was synthesized through an emulsion polymerization method. The yield, purity and quality of the pDNA extracted by using our proposed MNC protocol were evaluated through UV-Vis, agarose gel electrophoreses and PCR techniques, respectively. After comparing our results to those obtained by use of a commercial kit (Promega Wizard Plus SV Minipreps), we suggest that the novel protocol here proposed appears as a competitive alternative methodology. Not only the purification step can be completed within only 10 min, but the high adsorption capacity of the MNC results in pDNA yields that are almost twice the best values obtained by using the commercial kit. Hence, this new MNC methodology can be of general interest and find widespread use in different types of biomedical applications. (author)

  1. Anchoring of self-assembled plasmid DNA/ anti-DNA antibody/cationic lipid micelles on bisphosphonate-modified stent for cardiovascular gene delivery

    Directory of Open Access Journals (Sweden)

    Ma G

    2013-03-01

    Full Text Available Guilei Ma,1,# Yong Wang,1,# Ilia Fishbein,2 Mei Yu,1 Linhua Zhang,1 Ivan S Alferiev,2 Jing Yang,1 Cunxian Song,1 Robert J Levy2 1Institute of Biomedical Engineering, Chinese Academy of Medical Sciences and Peking Union Medical College, Tianjin, People's Republic of China; 2Children's Hospital of Philadelphia, Abramson Research Building, Philadelphia, PA, USA #These authors contributed equally to this work Purpose: To investigate the anchoring of plasmid DNA/anti-DNA antibody/cationic lipid tri-complex (DAC micelles onto bisphosphonate-modified 316 L coronary stents for cardiovascular site-specific gene delivery. Methods: Stents were first modified with polyallylamine bisphosphonate (PAA-BP, thereby enabling the retention of a PAA-BP molecular monolayer that permits the anchoring (via vector-binding molecules of DAC micelles. DAC micelles were then chemically linked onto the PAA-BP-modified stents by using N-succinimidyl-3-(2-pyridyldithiol-propionate (SPDP as a crosslinker. Rhodamine-labeled DNA was used to assess the anchoring of DAC micelles, and radioactive-labeled antibody was used to evaluate binding capacity and stability. DAC micelles (encoding green fluorescent protein were tethered onto the PAA-BP-modified stents, which were assessed in cell culture. The presence of a PAA-BP molecular monolayer on the steel surface was confirmed by X-ray photoelectron spectroscopy and atomic force microscope analysis. Results: The anchoring of DAC micelles was generally uniform and devoid of large-scale patches of defects. Isotopic quantification confirmed that the amount of antibody chemically linked on the stents was 17-fold higher than that of the physical adsorbed control stents and its retention time was also significantly longer. In cell culture, numerous green fluorescent protein-positive cells were found on the PAA-BP modified stents, which demonstrated high localization and efficiency of gene delivery. Conclusion: The DAC micelle

  2. Contribution of plasmid-encoded peptidase S8 (PrtP) to adhesion and transit in the gut of Lactococcus lactis IBB477 strain.

    Science.gov (United States)

    Radziwill-Bienkowska, Joanna Maria; Robert, Véronique; Drabot, Karolina; Chain, Florian; Cherbuy, Claire; Langella, Philippe; Thomas, Muriel; Bardowski, Jacek Karol; Mercier-Bonin, Muriel; Kowalczyk, Magdalena

    2017-07-01

    The ability of Lactococcus lactis to adhere to the intestinal mucosa can potentially prolong the contact with the host, and therefore favour its persistence in the gut. In the present study, the contribution of plasmid-encoded factors to the adhesive and transit properties of the L. lactis subsp. cremoris IBB477 strain was investigated. Plasmid-cured derivatives as well as deletion mutants were obtained and analysed. Adhesion tests were performed using non-coated polystyrene plates, plates coated with mucin or fibronectin and mucus-secreting HT29-MTX intestinal epithelial cells. The results indicate that two plasmids, pIBB477a and b, are involved in adhesion of the IBB477 strain. One of the genes localised on plasmid pIBB477b (AJ89_14230), which encodes cell wall-associated peptidase S8 (PrtP), mediates adhesion of the IBB477 strain to bare, mucin- and fibronectin-coated polystyrene, as well as to HT29-MTX cells. Interactions between bacteria and mucus secreted by HT29-MTX cells were further investigated by fluorescent staining and confocal microscopy. Confocal images showed that IBB477 forms dense clusters embedded in secreted mucus. Finally, the ability of IBB477 strain and its ΔprtP deletion mutant to colonise the gastrointestinal tract of conventional C57Bl/6 mice was determined. Both strains were present in the gut for up to 72 h. In summary, adhesion and persistence of IBB477 were analysed by in vitro and in vivo approaches, respectively. Our studies revealed that plasmidic genes encoding cell surface proteins are more involved in the adhesion of IBB477 strain than in the ability to confer a selective advantage in the gut.

  3. Topology of a Membrane Associated Regulator of Prokaryotic DNA Replication

    National Research Council Canada - National Science Library

    Firshein, William

    1998-01-01

    This proposal has focused on a broad host range plasmid, RK2, as a model system to study how a pair of initiation proteins encoded by the plasmid for DNA replication function when replication occurs...

  4. High diversity of genes and plasmids encoding resistance to third-generation cephalosporins and quinolones in clinical Escherichia coli from commercial poultry flocks in Italy

    DEFF Research Database (Denmark)

    Niero, Giulia; Bortolaia, Valeria; Vanni, Michele

    2018-01-01

    = 98) and layers (n = 22) between 2008 and 2012. 3GC-resistant isolates were screened for extended-spectrum and AmpC β-lactamase (ESBL/AmpC), while all isolates were tested for plasmid-mediated quinolone resistance (PMQR) genes. ESBL/AmpC- and PMQR-positive isolates were typed by pulsed-field gel......% of isolates from turkeys, broilers and layers, respectively. We identified seven ESBL/AmpC-encoding plasmid types, usually conjugative (78%), with a marked prevalence of IncI1/pST3 plasmids carrying blaCTX-M-1. PMQR occurred less frequently among isolates from turkeys (0.9%) compared to those from broilers (5......%) and layers (4%). The PMQR genes qnrS, qnrB19 and oqxA/B were located on three plasmid types and two non-typeable plasmids, mostly (85%) conjugative. ESBL/AmpC- and PMQR-positive isolates were genetically unrelated and 64% of them were additionally resistant to aminoglycosides, sulfonamides and tetracyclines...

  5. Photoresponsive Bridged Silsesquioxane Nanoparticles with Tunable Morphology for Light-Triggered Plasmid DNA Delivery

    KAUST Repository

    Fatieiev, Yevhen; Croissant, Jonas G.; Alsaiari, Shahad K.; Moosa, Basem; Anjum, Dalaver H.; Khashab, Niveen M.

    2015-01-01

    Bridged silsesquioxane nanocomposites with tunable morphologies incorporating o-nitrophenylene-ammonium bridges are described. The systematic screening of the sol-gel parameters allowed the material to reach the nanoscale –unlike most reported bridged silsesquioxane materials– with controlled dense and hollow structures of 100 to 200 nm. The hybrid composition of silsesquioxanes with 50% of organic content homogenously distributed in the nanomaterials endowed them with photoresponsive properties. Light irradiation was performed to reverse the surface charge of nanoparticles from +46 to -39 mV via the photoreaction of the organic fragments within the particles, as confirmed by spectroscopic monitorings. Furthermore, such NPs were ap-plied for the first time for the on-demand delivery of plasmid DNA in HeLa cancer cells via light actuation.

  6. Photoresponsive Bridged Silsesquioxane Nanoparticles with Tunable Morphology for Light-Triggered Plasmid DNA Delivery

    KAUST Repository

    Fatieiev, Yevhen

    2015-09-25

    Bridged silsesquioxane nanocomposites with tunable morphologies incorporating o-nitrophenylene-ammonium bridges are described. The systematic screening of the sol-gel parameters allowed the material to reach the nanoscale –unlike most reported bridged silsesquioxane materials– with controlled dense and hollow structures of 100 to 200 nm. The hybrid composition of silsesquioxanes with 50% of organic content homogenously distributed in the nanomaterials endowed them with photoresponsive properties. Light irradiation was performed to reverse the surface charge of nanoparticles from +46 to -39 mV via the photoreaction of the organic fragments within the particles, as confirmed by spectroscopic monitorings. Furthermore, such NPs were ap-plied for the first time for the on-demand delivery of plasmid DNA in HeLa cancer cells via light actuation.

  7. The DNA-encoded nucleosome organization of a eukaryotic genome.

    Science.gov (United States)

    Kaplan, Noam; Moore, Irene K; Fondufe-Mittendorf, Yvonne; Gossett, Andrea J; Tillo, Desiree; Field, Yair; LeProust, Emily M; Hughes, Timothy R; Lieb, Jason D; Widom, Jonathan; Segal, Eran

    2009-03-19

    Nucleosome organization is critical for gene regulation. In living cells this organization is determined by multiple factors, including the action of chromatin remodellers, competition with site-specific DNA-binding proteins, and the DNA sequence preferences of the nucleosomes themselves. However, it has been difficult to estimate the relative importance of each of these mechanisms in vivo, because in vivo nucleosome maps reflect the combined action of all influencing factors. Here we determine the importance of nucleosome DNA sequence preferences experimentally by measuring the genome-wide occupancy of nucleosomes assembled on purified yeast genomic DNA. The resulting map, in which nucleosome occupancy is governed only by the intrinsic sequence preferences of nucleosomes, is similar to in vivo nucleosome maps generated in three different growth conditions. In vitro, nucleosome depletion is evident at many transcription factor binding sites and around gene start and end sites, indicating that nucleosome depletion at these sites in vivo is partly encoded in the genome. We confirm these results with a micrococcal nuclease-independent experiment that measures the relative affinity of nucleosomes for approximately 40,000 double-stranded 150-base-pair oligonucleotides. Using our in vitro data, we devise a computational model of nucleosome sequence preferences that is significantly correlated with in vivo nucleosome occupancy in Caenorhabditis elegans. Our results indicate that the intrinsic DNA sequence preferences of nucleosomes have a central role in determining the organization of nucleosomes in vivo.

  8. Plasmid DNA is released from nanosized acicular material surface by low molecular weight oligonucleotides: exogenous plasmid acquisition mechanism for penetration intermediates based on the Yoshida effect.

    Science.gov (United States)

    Yoshida, N; Ide, K

    2008-10-01

    When a colloidal solution consisting of nanosized acicular material and bacterial cells is stimulated with sliding friction at the interface between the hydrogel and interface-forming material where the frictional coefficient increases rapidly, the nanosized acicular material accompanying the bacterial cells forms a penetration intermediate. This effect is known as the Yoshida effect in honor of its discoverer. Through the Yoshida effect, a novel property in which penetration intermediates incorporate exogenous plasmid DNA has been identified. This report proposes a possible mechanism for exogenous plasmid acquisition by penetration intermediates in the Yoshida effect. Escherichia coli cells, pUC18, and chrysotile were used as recipient cells, plasmid DNA, and nanosized acicular material, respectively. Even when repeatedly washing the mixture consisting of pUC18 and chrysotile, transformation efficiency by pUC18 was stable. Accordingly, pUC18 adsorbed onto chrysotile was introduced into recipient E. coli cells. At saturation, the amount of pUC18 adsorbed onto chrysotile was 0.8-1.2 microg/mg. To investigate whether pUC18 adsorbed on chrysotile is replicated by polymerase, polymerase chain reaction (PCR) was carried out with the chrysotile. Amplification of the beta-lactamase gene coded in pUC18, which was adsorbed onto chrysotile, was strongly inhibited. This suggests that DNA adsorbed onto chrysotile is not replicated in vivo. When we searched for substances to release pUC18 adsorbed onto chrysotile, we found that a 300-bp single- or double-stranded segment of DNA releases pUC18 from chrysotile. Competitive adsorption onto chrysotile between double-stranded DNA and pUC18 was then examined through the Yoshida effect. The 310- and 603-bp double-stranded nucleotides caused 50% competitive inhibition at the same molar ratio with pUC18. Hence, the adsorbed region of pUC18 is about 300 bp in length. As the culture period for recipient cells increases, transformation

  9. [Effect of endonuclease G depletion on plasmid DNA uptake and levels of homologous recombination in hela cells].

    Science.gov (United States)

    Misic, V; El-Mogy, M; Geng, S; Haj-Ahmad, Y

    2016-01-01

    Endonuclease G (EndoG) is a mitochondrial apoptosis regulator that also has roles outside of programmed cell death. It has been implicated as a defence DNase involved in the degradation of exogenous DNA after transfection of mammalian cells and in homologous recombination of viral and endogenous DNA. In this study, we looked at the effect of EndoG depletion on plasmid DNA uptake and the levels of homologous recombination in HeLa cells. We show that the proposed defence role of EndoG against uptake of non-viral DNA vectors does not extend to the cervical carcinoma HeLa cells, as targeting of EndoG expression by RNA interference failed to increase intracellular plasmid DNA levels. However, reducing EndoG levels in HeLa cells resulted in a statistically significant reduction of homologous recombination between two plasmid DNA substrates. These findings suggest that non-viral DNA vectors are also substrates for EndoG in its role in homologous recombination.

  10. Process optimisation for anion exchange monolithic chromatography of 4.2kbp plasmid vaccine (pcDNA3F).

    Science.gov (United States)

    Ongkudon, Clarence M; Danquah, Michael K

    2010-10-15

    Anion exchange monolithic chromatography is increasingly becoming a prominent tool for plasmid DNA purification but no generic protocol is available to purify all types of plasmid DNA. In this work, we established a simple framework and used it to specifically purify a plasmid DNA model from a clarified alkaline-lysed plasmid-containing cell lysate. The framework involved optimising ligand functionalisation temperature (30-80°C), mobile phase flow rate (0.1-1.8mL/min), monolith pore size (done by changing the porogen content in the polymerisation reaction by 50-80%), buffer pH (6-10), ionic strength of binding buffer (0.3-0.7M) and buffer gradient elution slope (1-10% buffer B/min). We concluded that preferential pcDNA3F adsorption and optimum resolution could be achieved within the tested conditions by loading the clarified cell lysate into 400nm pore size of monolith in 0.7M NaCl (pH 6) of binding buffer followed by increasing the NaCl concentration to 1.0M at 3%B/min. Copyright © 2010 Elsevier B.V. All rights reserved.

  11. Construction and Identification of a Recombinant Plasmid Encoding Echinococcus granulosus Oncosphere Antigen (EG95Abstract Background: Cystic echinococcosis (CE, as a zoonotic disease cause to health threat and economic losses. Despite implemented cont

    Directory of Open Access Journals (Sweden)

    Nahideh MAZAHERI

    2017-12-01

    Full Text Available AbstractBackground: Cystic echinococcosis (CE, as a zoonotic disease cause to health threat and economic losses. Despite implemented control programs, few countries have been able to decrease or eliminate this infection. Vaccination of the intermediate host offers an additional strategy to control the parasite transmission and EG95 antigen is considered more than the others in the vaccine issue. According to the high protection induced by the EG95 recombinant vaccine, this study was designed to construct recombinant plasmid formulation of EG95 antigen.Methods: In 2015, the Echinococcus granulosus eggs were recovered from an infected dog in Parasitological laboratory of Tarbiat Modares University in Tehran, Iran. Following hatching, the oncospheres of E. granulosus were activated to increase the presence of the desired mRNA. The extracted mRNA was transcribed to the cDNA which used as template in RT-PCR. Then the EG95 gene cloned into pET28a vector and the recombinant plasmids expression was  investigated in prokaryotic and eukaryotic cells.Results:  The recombinant plasmid encoding EG95 antigen was successfully constructed and identified by PCR, restriction enzyme digestion and sequencing. In vitro expression of the EG95 antigen was confirmed in prokary­otic and eukaryotic systems by SDS-PAGE and western blotting analysis.Conclusion: Because of potential advantages of DNA vaccines, including ability to induce long-term immune responses, low production cost and stability in different temperatures, this study carried out to construct the EG95 gene into a vector. This recombinant vector can be evaluated in further studies as a DNA vaccine may provide new prospects for the development of a vaccine against cystic hydatid disease.

  12. Viruses Infecting a Freshwater Filamentous Cyanobacterium (Nostoc sp.) Encode a Functional CRISPR Array and a Proteobacterial DNA Polymerase B.

    Science.gov (United States)

    Chénard, Caroline; Wirth, Jennifer F; Suttle, Curtis A

    2016-06-14

    Here we present the first genomic characterization of viruses infecting Nostoc, a genus of ecologically important cyanobacteria that are widespread in freshwater. Cyanophages A-1 and N-1 were isolated in the 1970s and infect Nostoc sp. strain PCC 7210 but remained genomically uncharacterized. Their 68,304- and 64,960-bp genomes are strikingly different from those of other sequenced cyanophages. Many putative genes that code for proteins with known functions are similar to those found in filamentous cyanobacteria, showing a long evolutionary history in their host. Cyanophage N-1 encodes a CRISPR array that is transcribed during infection and is similar to the DR5 family of CRISPRs commonly found in cyanobacteria. The presence of a host-related CRISPR array in a cyanophage suggests that the phage can transfer the CRISPR among related cyanobacteria and thereby provide resistance to infection with competing phages. Both viruses also encode a distinct DNA polymerase B that is closely related to those found in plasmids of Cyanothece sp. strain PCC 7424, Nostoc sp. strain PCC 7120, and Anabaena variabilis ATCC 29413. These polymerases form a distinct evolutionary group that is more closely related to DNA polymerases of proteobacteria than to those of other viruses. This suggests that the polymerase was acquired from a proteobacterium by an ancestral virus and transferred to the cyanobacterial plasmid. Many other open reading frames are similar to a prophage-like element in the genome of Nostoc sp. strain PCC 7524. The Nostoc cyanophages reveal a history of gene transfers between filamentous cyanobacteria and their viruses that have helped to forge the evolutionary trajectory of this previously unrecognized group of phages. Filamentous cyanobacteria belonging to the genus Nostoc are widespread and ecologically important in freshwater, yet little is known about the genomic content of their viruses. Here we report the first genomic analysis of cyanophages infecting

  13. Characterization and immunological identification of cDNA clones encoding two human DNA topoisomerase II isozymes

    International Nuclear Information System (INIS)

    Chung, T.D.Y.; Drake, F.H.; Tan, K.B.; Per, S.R.; Crooke, S.T.; Mirabelli, C.K.

    1989-01-01

    Several DNA topoisomerase II partial cDNA clones obtained from a human Raji-HN2 cDNA library were sequenced and two classes of nucleotide sequences were found. One member of the first class, SP1, was identical to an internal fragment of human HeLa cell Topo II cDNA described earlier. A member of the second class, SP11, shared extensive nucleotide (75%) and predicted peptide (92%) sequence similarities with the first two-thirds of HeLa Topo II. Each class of cDNAs hybridized to unique, nonoverlapping restriction enzyme fragments of genomic DNA from several human cell lines. Synthetic 24-mer oligonucleotide probes specific for each cDNA class hybridized to 6.5-kilobase mRNAs; furthermore, hybridization of probe specific for one class was not blocked by probe specific for the other. Antibodies raised against a synthetic SP1-encoded dodecapeptide specifically recognized the 170-kDa form of Topo II, while antibodies raised against the corresponding SP11-encoded dodecapeptide, or a second unique SP11-encoded tridecapeptide, selectively recognized the 180-kDa form of Topo II. These data provide genetic and immunochemical evidence for two Topo II isozymes

  14. Mucosal delivery of a transmission-blocking DNA vaccine encoding Giardia lamblia CWP2 by Salmonella typhimurium bactofection vehicle.

    Science.gov (United States)

    Abdul-Wahid, Aws; Faubert, Gaétan

    2007-12-05

    In this study, we investigated the use of Salmonella typhimurium (STM1 strain) as a bactofection vehicle to deliver a transmission-blocking DNA vaccine (TBDV) plasmid to the intestinal immune system. The gene encoding the full length cyst wall protein-2 (CWP2) from Giardia lamblia was subcloned into the pCDNA3 mammalian expression vector and stably introduced into S. typhimurium STM1. Eight-week-old female BALB/c mice were orally immunized every 2 weeks, for a total of three immunizations. Vaccinated and control mice were sacrificed 1 week following the last injection. Administration of the DNA vaccine led to the production of CWP2-specific cellular immune responses characterized by a mixed Th1/Th2 response. Using ELISA, antigen-specific IgA and IgG antibodies were detected in intestinal secretions. Moreover, analysis of sera demonstrated that the DNA immunization also stimulated the production of CWP2-specific IgG antibodies that were mainly of the IgG2a isotype. Finally, challenge infection with live Giardia muris cysts revealed that mice receiving the CWP2-encoding DNA vaccine were able to reduce cyst shedding by approximately 60% compared to control mice. These results demonstrate, for the first time, the development of parasite transmission-blocking immunity at the intestinal level following the administration of a mucosal DNA vaccine delivered by S. typhimurium STM1.

  15. Effect of the caffeine on treated and non-treated plasmid DNA with stannic chloride; Efeito da cafeina em DNA plasmidial tratado e nao tratado com cloreto estanoso

    Energy Technology Data Exchange (ETDEWEB)

    Moreno, Silvana Ramos F. [Universidade do Estado, Rio de Janeiro, RJ (Brazil). Inst. de Biologia. Dept. de Biofisica e Biometria]|[Universidade Federal Fluminense, Niteroi, RJ (Brazil). Faculdade de Ciencias Medicas. Curso de Pos-graduacao em Patologia Experimental; Mattos, Jose C.P. de; Dantas, Flavio; Araujo, Adriano Caldeira de; Bernardo-Filho, Mario [Universidade do Estado, Rio de Janeiro, RJ (Brazil). Inst. de Biologia. Dept. de Biofisica e Biometria]. E-mail: bernardo@uerj.br

    2000-07-01

    Caffeine, a methilxantine drug is a component of coffee, tea, stimulants and other drinks. Caffeine inhibits phosphodiesterase leading to intracellular accumulation of cyclic AMP, blocks adenosine receptors, and increases the release of Ca{sup 2+}. We have studied the possible effect of caffeine in DNA plasmid treated or not with stannous chloride (SnCl{sub 2}). Previous evaluations of the effect of caffeine on the labeling of red blood cells and plasma proteins with technetium-99m have showed a decrease of % ATI in the insoluble fraction of plasma proteins. Samples of DNA were treated with SnCl{sub 2} (0 and 200{mu}g/ml) in 0.8% agarose. SnCl{sub 2} has induced break on DNA and caffeine has not showed effect on the DNA. This indicates that caffeine does not eliminate the oxidant action of SnCl{sub 2} and does not promote break in isolated DNA plasmid. (author)

  16. A Ti plasmid-encoded enzyme required for degradation of mannopine is functionally homologous to the T-region-encoded enzyme required for synthesis of this opine in crown gall tumors.

    Science.gov (United States)

    Kim, K S; Chilton, W S; Farrand, S K

    1996-06-01

    The mocC gene encoded by the octopine/mannityl opine-type Ti plasmid pTi15955 is related at the nucleotide sequence level to mas1' encoded by the T region of this plasmid. While Mas1 is required for the synthesis of mannopine (MOP) by crown gall tumor cells, MocC is essential for the utilization of MOP by Agrobacterium spp. A cosmid clone of pTi15955, pYDH208, encodes mocC and confers the utilization of MOP on strain NT1 and on strain UIA5, a derivative of NT1 lacking the 450-kb cryptic plasmid pAtC58. NT1 or UIA5 harboring pYDH208 with an insertion mutation in mocC failed to utilize MOP as the sole carbon source. Plasmid pSa-C, which encodes only mocC, complemented this mutation in both strains. This plasmid also was sufficient to confer utilization of MOP on NT1 but not on UIA5. Computer analysis showed that MocC is related at the amino acid sequence level to members of the short-chain alcohol dehydrogenase family of oxidoreductases. Lysates prepared from Escherichia coli cells expressing mocC contained an enzymatic activity that oxidizes MOP to deoxyfructosyl glutamine (santhopine [SOP]) in the presence of NAD+. The reaction catalyzed by the MOP oxidoreductase is reversible; in the presence of NADH, the enzyme reduced SOP to MOP. The apparent Km values of the enzyme for MOP and SOP were 6.3 and 1.2 mM, respectively. Among analogs of MOP tested, only N-1-(1-deoxy-D-lyxityl)-L-glutamine and N-1-(1-deoxy-D-mannityl)-L-asparagine served as substrates for MOP oxidoreductase. These results indicate that mocC encodes an oxidoreductase that, as an oxidase, is essential for the catabolism of MOP. The reductase activity of this enzyme is precisely the reaction ascribed to its T-region-encoded homolog, Mas1, which is responsible for biosynthesis of mannopine in crown gall tumors.

  17. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  18. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

  19. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  20. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

  1. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  2. Limited Dissemination of Extended-Spectrum β-Lactamase- and Plasmid-Encoded AmpC-Producing Escherichia coli from Food and Farm Animals, Sweden.

    Science.gov (United States)

    Börjesson, Stefan; Ny, Sofia; Egervärn, Maria; Bergström, Jakob; Rosengren, Åsa; Englund, Stina; Löfmark, Sonja; Byfors, Sara

    2016-04-01

    Extended-spectrum β-lactamase (ESBL)- and plasmid-encoded ampC (pAmpC)-producing Enterobacteriaceae might spread from farm animals to humans through food. However, most studies have been limited in number of isolates tested and areas studied. We examined genetic relatedness of 716 isolates from 4,854 samples collected from humans, farm animals, and foods in Sweden to determine whether foods and farm animals might act as reservoirs and dissemination routes for ESBL/pAmpC-producing Escherichia coli. Results showed that clonal spread to humans appears unlikely. However, we found limited dissemination of genes encoding ESBL/pAmpC and plasmids carrying these genes from foods and farm animals to healthy humans and patients. Poultry and chicken meat might be a reservoir and dissemination route to humans. Although we found no evidence of clonal spread of ESBL/pAmpC-producing E. coli from farm animals or foods to humans, ESBL/pAmpC-producing E. coli with identical genes and plasmids were present in farm animals, foods, and humans.

  3. X-ray crystal structure of the passenger domain of plasmid encoded toxin(Pet), an autotransporter enterotoxin from enteroaggregative Escherichia coli (EAEC)

    Energy Technology Data Exchange (ETDEWEB)

    Domingo Meza-Aguilar, J. [Departamento de Salud Pública Facultad de Medicina UNAM, Ciudad Universitaria Coyoacán 04510, D.F. (Mexico); Laboratorio de Patogenicidad Bacteriana, Unidad de Hemato Oncología e Investigación, Hospital Infantil de México Federico Gómez 06720, D.F. (Mexico); Fromme, Petra [Department of Chemistry and Biochemistry, Arizona State University, Physical Sciences BLDG D-102, Tempe, AZ 85287 (United States); Torres-Larios, Alfredo [Instituto de Fisiología Celular UNAM, Ciudad Universitaria Coyoacán 04510, D.F. (Mexico); Mendoza-Hernández, Guillermo [Instituto de Química UNAM, Ciudad Universitaria Coyoacán 04510, D.F (Mexico); Hernandez-Chiñas, Ulises [Departamento de Salud Pública Facultad de Medicina UNAM, Ciudad Universitaria Coyoacán 04510, D.F. (Mexico); Laboratorio de Patogenicidad Bacteriana, Unidad de Hemato Oncología e Investigación, Hospital Infantil de México Federico Gómez 06720, D.F. (Mexico); Arreguin-Espinosa de los Monteros, Roberto A. [Instituto de Química UNAM, Ciudad Universitaria Coyoacán 04510, D.F (Mexico); and others

    2014-03-07

    Highlights: • X-ray crystal structure of the passenger domain of Plasmid encoded toxin at 2.3 Å. • Structural differences between Pet passenger domain and EspP protein are described. • High flexibility of the C-terminal beta helix is structurally assigned. - Abstract: Autotransporters (ATs) represent a superfamily of proteins produced by a variety of pathogenic bacteria, which include the pathogenic groups of Escherichia coli (E. coli) associated with gastrointestinal and urinary tract infections. We present the first X-ray structure of the passenger domain from the Plasmid-encoded toxin (Pet) a 100 kDa protein at 2.3 Å resolution which is a cause of acute diarrhea in both developing and industrialized countries. Pet is a cytoskeleton-altering toxin that induces loss of actin stress fibers. While Pet (pdb code: 4OM9) shows only a sequence identity of 50% compared to the closest related protein sequence, extracellular serine protease plasmid (EspP) the structural features of both proteins are conserved. A closer structural look reveals that Pet contains a β-pleaded sheet at the sequence region of residues 181–190, the corresponding structural domain in EspP consists of a coiled loop. Secondary, the Pet passenger domain features a more pronounced beta sheet between residues 135 and 143 compared to the structure of EspP.

  4. Lipophilic Polycation Vehicles Display High Plasmid DNA Delivery to Multiple Cell Types.

    Science.gov (United States)

    Wu, Yaoying; Smith, Adam E; Reineke, Theresa M

    2017-08-16

    A class of cationic poly(alkylamidoamine)s (PAAAs) containing lipophilic methylene linkers were designed and examined as in vitro plasmid DNA (pDNA) delivery agents. The PAAAs were synthesized via step-growth polymerization between a diamine monomer and each of four different diacid chloride monomers with varying methylene linker lengths, including glutaryl chloride, adipoyl chloride, pimeloyl chloride, and suberoyl chloride, which served to systematically increase the lipophilicity of the polymers. The synthesized polymers successfully complexed with pDNA in reduced serum medium at N/P ratios of 5 and greater, resulting in polyplexes with hydrodynamic diameters of approximately 1 μm. These polyplexes were tested for in vitro transgene expression and cytotoxicity using HDFa (human dermal fibroblast), HeLa (human cervical carcinoma), HMEC (human mammary epithelial), and HUVEC (human umbilical vein endothelial) cells. Interestingly, select PAAA polyplex formulations were found to be more effective than Lipofectamine 2000 at promoting transgene expression (GFP) while maintaining comparable or higher cell viability. Transgene expression was highest in HeLa cells (∼90% for most formulations) and lowest in HDFa cells (up to ∼20%) as measured by GFP fluorescence. In addition, the cytotoxicity of PAAA polyplex formulations was significantly increased as the molecular weight, N/P ratio, and methylene linker length were increased. The PAAA vehicles developed herein provide a new delivery vehicle design strategy of displaying attributes of both polycations and lipids, which show promise as a tunable scaffold for refining the structure-activity-toxicity profiles for future genome editing studies.

  5. Correction of the lack of commutability between plasmid DNA and genomic DNA for quantification of genetically modified organisms using pBSTopas as a model.

    Science.gov (United States)

    Zhang, Li; Wu, Yuhua; Wu, Gang; Cao, Yinglong; Lu, Changming

    2014-10-01

    Plasmid calibrators are increasingly applied for polymerase chain reaction (PCR) analysis of genetically modified organisms (GMOs). To evaluate the commutability between plasmid DNA (pDNA) and genomic DNA (gDNA) as calibrators, a plasmid molecule, pBSTopas, was constructed, harboring a Topas 19/2 event-specific sequence and a partial sequence of the rapeseed reference gene CruA. Assays of the pDNA showed similar limits of detection (five copies for Topas 19/2 and CruA) and quantification (40 copies for Topas 19/2 and 20 for CruA) as those for the gDNA. Comparisons of plasmid and genomic standard curves indicated that the slopes, intercepts, and PCR efficiency for pBSTopas were significantly different from CRM Topas 19/2 gDNA for quantitative analysis of GMOs. Three correction methods were used to calibrate the quantitative analysis of control samples using pDNA as calibrators: model a, or coefficient value a (Cva); model b, or coefficient value b (Cvb); and the novel model c or coefficient formula (Cf). Cva and Cvb gave similar estimated values for the control samples, and the quantitative bias of the low concentration sample exceeded the acceptable range within ±25% in two of the four repeats. Using Cfs to normalize the Ct values of test samples, the estimated values were very close to the reference values (bias -13.27 to 13.05%). In the validation of control samples, model c was more appropriate than Cva or Cvb. The application of Cf allowed pBSTopas to substitute for Topas 19/2 gDNA as a calibrator to accurately quantify the GMO.

  6. Persistence of plasmids, cholera toxin genes, and prophage DNA in classical Vibrio cholerae O1.

    OpenAIRE

    Cook, W L; Wachsmuth, K; Johnson, S R; Birkness, K A; Samadi, A R

    1984-01-01

    Plasmid profiles, the location of cholera toxin subunit A genes, and the presence of the defective VcA1 prophage genome in classical Vibrio cholerae isolated from patients in Bangladesh in 1982 were compared with those in older classical strains isolated during the sixth pandemic and with those in selected eltor and nontoxigenic O1 isolates. Classical strains typically had two plasmids (21 and 3 megadaltons), eltor strains typically had no plasmids, and nontoxigenic O1 strains had zero to thr...

  7. Size effect on transfection and cytotoxicity of nanoscale plasmid DNA/polyethyleneimine complexes for aerosol gene delivery

    Energy Technology Data Exchange (ETDEWEB)

    Hoon Byeon, Jeong, E-mail: jbyeon@purdue.edu [Department of Chemistry, Purdue University, West Lafayette, Indiana 47907 (United States); Kim, Jang-Woo, E-mail: jwkim@hoseo.edu [Department of Digital Display Engineering, Hoseo University, Asan 336-795 (Korea, Republic of)

    2014-02-03

    Nanoscale plasmid DNA (pDNA)/polyethyleneimine (PEI) complexes were fabricated in the aerosol state using a nebulization system consisting of a collison atomizer and a cool-walled diffusion dryer. The aerosol fabricated nanoscale complexes were collected and employed to determine fundamental properties of the complexes, such as size, structure, surface charge, and in vitro gene transfection efficiency and cytotoxicity. The results showed that mass ratio between pDNA and PEI should be optimized to enhance gene transfection efficiency without a significant loss of cell viability. These findings may support practical advancements in the field of nonviral gene delivery.

  8. Integral parametrization of the Kinetics of Crosslink production in plasmid DNA as a function of 8-methoxypsoralen concentration

    Energy Technology Data Exchange (ETDEWEB)

    Vidania, R. de; Paramio, J. M.; Bauluz, C.

    1986-07-01

    In this paper we present results of crosslink production in pBR322 DNA along a wide range of 8-methoxypsoralen (8-MOP) concentration. Experimental data were obtained as DNA renaturation percentages, from the shift in hyperchromicity after a temperature-dependent denaturation-renaturation process. the experimental results showed a three-stage profile when represented as a function of the natural logarithms of 8-MOP concentration. an integral parametrization which allows a simultaneous fit of the three observed stages is presented here. the theoretical values of crosslink production determined from the fit are useful to asses the genotoxicity of psoralen-induced crosslinks in plasmid DNA. (Author) 24 refs.

  9. Integral parametrization of the Kinetics of Crosslink production in plasmid DNA as a function of 8-methoxypsoralen concentration

    International Nuclear Information System (INIS)

    Vidania, R. de; Paramio, J. M.; Bauluz, C.

    1986-01-01

    In this paper we present results of crosslink production in pBR322 DNA along a wide range of 8-methoxypsoralen (8-MOP) concentration. Experimental data were obtained as DNA renaturation percentages, from the shift in hyperchromicity after a temperature-dependent denaturation-renaturation process. the experimental results showed a three-stage profile when represented as a function of the natural logarithms of 8-MOP concentration. an integral parametrization which allows a simultaneous fit of the three observed stages is presented here. the theoretical values of crosslink production determined from the fit are useful to asses the genotoxicity of psoralen-induced crosslinks in plasmid DNA. (Author) 24 refs

  10. Large IncHI2-plasmids encode extended-spectrum β-lactamases (ESBLs) in Enterobacter spp. bloodstream isolates, and support ESBL-transfer to Escherichia coli.

    Science.gov (United States)

    Nilsen, E; Haldorsen, B C; Sundsfjord, A; Simonsen, G S; Ingebretsen, A; Naseer, U; Samuelsen, O

    2013-11-01

    We investigated the prevalence of extended-spectrum β-lactamases (ESBLs) in Enterobacter spp. bloodstream isolates from 19 hospital laboratories in Norway during 2011. A total of 62/230 (27%) isolates were resistant to third-generation cephalosporins and four (1.7%) were ESBL-positive; blaCTX -M-15 (n = 3) and blaSHV -12 (n = 1). This is comparable to the prevalence of ESBLs in clinical isolates of Escherichia coli and Klebsiella pneumoniae in Norway during the same period. All ESBL-positive isolates were multidrug resistant (MDR) and harboured plasmid-mediated quinolone resistance. Three isolates supported transfer of large IncHI2-plasmids harbouring ESBL- and MDR-encoding genes to E. coli recipients by in vitro conjugation. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.

  11. DNA damage produced by exposure of supercoiled plasmid DNA to high- and low-LET ionizing radiation: Effects of hydroxyl radical quenchers. DNA breakage, neutrons, OH radicals

    International Nuclear Information System (INIS)

    Peak, J.G.; Ito, T.; Peak, M.J.; Robb, F.T.

    1994-01-01

    A supercoiled plasmid of 7300 base pairs was isolated and exposed in an aqueous environment to 60 Co γ rays and JANUS 0.85 MeV fission-spectrum neutrons. Dose responses for the production of single-strand breaks (SSBs), double-strand breaks (DSBs) and alkali-labile sites (ALSs) were compared with computations made from the conversion of the supercoil to its relaxed and linear forms. The relative biological effectiveness (RBE) for production of SSBs and DSBs was similar to that previously measured in the cellular environment. The RBE for destruction of genetic transforming activity of M13 viral DNA followed that for DNA damage. This is in contrast to the situation for biological effects such as lethality, mutagenesis, and cellular transformation measured in mammalian cells, where the RBE values are reversed. The role of hydroxyl (OH) radical in DNA damage induction by neutrons was investigated by exposure of plasmid in the presence of known quenchers of this species. Of four quenchers tested, all were able to reduce the yields of both SSBs and DSBs. These findings are consistent with a model for SSB and DSB induction by high linear energy transfer that involves OH radical mediation

  12. Explanatory chapter: how plasmid preparation kits work.

    Science.gov (United States)

    Koontz, Laura

    2013-01-01

    To isolate plasmid DNA from bacteria using a commercial plasmid miniprep kit (if interested, compare this protocol with Isolation of plasmid DNA from bacteria). Copyright © 2013 Elsevier Inc. All rights reserved.

  13. Hydrophobic and electrostatic interactions between cell penetrating peptides and plasmid DNA are important for stable non-covalent complexation and intracellular delivery.

    Science.gov (United States)

    Upadhya, Archana; Sangave, Preeti C

    2016-10-01

    Cell penetrating peptides are useful tools for intracellular delivery of nucleic acids. Delivery of plasmid DNA, a large nucleic acid, poses a challenge for peptide mediated transport. The paper investigates and compares efficacy of five novel peptide designs for complexation of plasmid DNA and subsequent delivery into cells. The peptides were designed to contain reported DNA condensing agents and basic cell penetrating sequences, octa-arginine (R 8 ) and CHK 6 HC coupled to cell penetration accelerating peptides such as Bax inhibitory mutant peptide (KLPVM) and a peptide derived from the Kaposi fibroblast growth factor (kFGF) membrane translocating sequence. A tryptophan rich peptide, an analogue of Pep-3, flanked with CH 3 on either ends was also a part of the study. The peptides were analysed for plasmid DNA complexation, protection of peptide-plasmid DNA complexes against DNase I, serum components and competitive ligands by simple agarose gel electrophoresis techniques. Hemolysis of rat red blood corpuscles (RBCs) in the presence of the peptides was used as a measure of peptide cytotoxicity. Plasmid DNA delivery through the designed peptides was evaluated in two cell lines, human cervical cancer cell line (HeLa) and (NIH/3 T3) mouse embryonic fibroblasts via expression of the secreted alkaline phosphatase (SEAP) reporter gene. The importance of hydrophobic sequences in addition to cationic sequences in peptides for non-covalent plasmid DNA complexation and delivery has been illustrated. An alternative to the employment of fatty acid moieties for enhanced gene transfer has been proposed. Comparison of peptides for plasmid DNA complexation and delivery of peptide-plasmid DNA complexes to cells estimated by expression of a reporter gene, SEAP. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd.

  14. Characterization of DNA polymerase β from Danio rerio by overexpression in E. coli using the in vivo/in vitro compatible pIVEX plasmid

    Directory of Open Access Journals (Sweden)

    Ishikawa Mitsuru

    2011-10-01

    Full Text Available Abstract Background Eukaryotic DNA polymerase β (pol β, the polymerase thought to be responsible for DNA repair synthesis, has been extensively characterized in rats and humans. However, pol β has not been purified or enzymatically characterized from the model fish species Danio rerio (zebrafish. We used the in vitro/in vivo dual expression system plasmid, pIVEX, to express Danio rerio pol β (Danio pol β for biochemical characterization. Results Danio pol β encoded by the in vitro/in vivo-compatible pIVEX plasmid was expressed in E. coli BL21(DE3, BL21(DE3pLysS, and KRX, and in vitro as a C-terminal His-tagged protein. Danio pol β expressed in vitro was subject to proteolysis; therefore, bacterial overexpression was used to produce the protein for kinetic analyses. KRX cells were preferred because of their reduced propensity for leaky expression of pol β. The cDNA of Danio rerio pol β encodes a protein of 337 amino acids, which is 2-3 amino acids longer than other pol β proteins, and contains a P63D amino acid substitution, unlike mammalian pol βs. This substitution lies in a hairpin sequence within an 8-kDa domain, likely to be important in DNA binding. We performed extensive biochemical characterization of Danio pol β in comparison with rat pol β, which revealed its sensitivity to metal ion activators (Mn2+ and Mg2+, its optimum salt concentration (10 mM KCl and 50 mM NaCl, alkaline pH optimum (pH 9.0, and low temperature optimum (30°C. Substituting Mn2+ for Mg2+ resulted in 8.6-fold higher catalytic efficiency (kcat/Km. Conclusions Our characterization of pol β from a model fish organism contributes to the study of the function and evolution of DNA polymerases, which are emerging as important cellular targets for chemical intervention in the development of anticancer agents.

  15. Transformation frequency of γ irradiated plasmid DNA and the enzymatic double strand break formation by incubation in a protein extract of Escherichia coli

    International Nuclear Information System (INIS)

    Schulte-Frohlinde, D.; Mark, F.; Ventur, Y.

    1994-01-01

    It was found that incubation of γ-irradiated or DNaseI-treated plasmid DNA in a protein extract of Escherichia coli leads to enzyme-induced formation of double strand breaks (dsb) in competition with repair of precursors of these dsb. A survival curve of the plasmid DNA (as determined by transformation of E. coli) was calculated on the basis of enzyme-induced dsb as well as those produced by irradiation assuming that they are lethal. The calculated D O value was the same as that measured directly by transformation of irradiated plasmid DNA. Two models are presented that fit the experimental survival data as a function of dose. One is based on damage formation in the plasmid DNA including enzymatic conversion of single strand damage into dsb (U-model), the other is an enzymatic repair saturation model based on Michaelis-Menten kinetics. (Author)

  16. Formation of plasmid DNA strand breaks induced by low-energy ion beam: indication of nuclear stopping effects

    International Nuclear Information System (INIS)

    Chen Yu; Jiang Bingyao; Chen Youshan; Ding Xingzhao; Liu Xianghuai; Chen Ceshi; Guo Xinyou; Yin Guanglin

    1998-01-01

    Plasmid pGEM 3zf(+) was irradiated by nitrogen ion beam with energies between 20 and 100 keV and the fluence kept as 1 x 10 12 ions/cm 2 . The irradiated plasmid was assayed by neutral electrophoresis and quantified by densitometry. The yields of DNA with single-strand and double-strand breaks first increased then decreased with increasing ion energy. There was a maximal yield value in the range of 20-100 keV. The relationship between DNA double-strand breaks (DSB) cross-section and linear energy transfer (LET) also showed a peak-shaped distribution. To understand the physical process during DNA strand breaks, a Monte Carlo calculation code known as TRIM (Transport of Ions in Matter) was used to simulate energy losses due to nuclear stopping and to electronic stopping. It can be assumed that nuclear stopping plays a more important role in DNA strand breaks than electronic stopping in this energy range. The physical mechanisms of DNA strand breaks induced by a low-energy ion beam are also discussed. (orig.)

  17. Radiation-chemical discussion on inverse dose-rate effect observed in radiation-induced strand breaks of plasmid DNA

    International Nuclear Information System (INIS)

    Masuda, Takahiro

    1994-01-01

    Experimental results of inverse dose-rate effect, so-called Kada Effects, which was published by Takakura and her coworkers on radiation-induced strand breaks of plasmid DNA in aerated aqueous solution, have been kinetically analyzed and discussed on the basis of radiation chemistry. the kinetic analysis indicates that there are two possible mechanisms; 1) equilibrium mixture of O 2 - and HO 2 is responsible for strand breaks of DNA, and 2) peroxyl radical produced from citrate is effective for the strand breaks. However, the detailed kinetic analysis revealed that the latter is improbable because unimolecular decay of the peroxyl radical must be assumed to be negligible for its participation despite fast decay of analogous organic peroxyl radicals. The analysis has also given 9.93±0.10 dm 3 mol -1 s -1 per nucleotide unit, which corresponds to 7.62 x 10 4 dm 3 mol -1 s -1 per DNA molecule, as the rate constant for the reaction of the equilibrium mixture with plasmid pBR 322 DNA. Furthermore the probability that the reaction of the mixture with a nucleotide unit of DNA leads to strand breaks was obtained to be 3.36 x 10 -3 for gamma-irradiated system and 1.98 x 10 -3 for beta-irradiated system, respectively. (author)

  18. Attenuated Salmonella enterica serovar Typhi and Shigella flexneri 2a strains mucosally deliver DNA vaccines encoding measles virus hemagglutinin, inducing specific immune responses and protection in cotton rats.

    Science.gov (United States)

    Pasetti, Marcela F; Barry, Eileen M; Losonsky, Genevieve; Singh, Mahender; Medina-Moreno, Sandra M; Polo, John M; Ulmer, Jeffrey; Robinson, Harriet; Sztein, Marcelo B; Levine, Myron M

    2003-05-01

    Measles remains a leading cause of child mortality in developing countries. Residual maternal measles antibodies and immunologic immaturity dampen immunogenicity of the current vaccine in young infants. Because cotton rat respiratory tract is susceptible to measles virus (MV) replication after intranasal (i.n.) challenge, this model can be used to assess the efficacy of MV vaccines. Pursuing a new measles vaccine strategy that might be effective in young infants, we used attenuated Salmonella enterica serovar Typhi CVD 908-htrA and Shigella flexneri 2a CVD 1208 vaccines to deliver mucosally to cotton rats eukaryotic expression plasmid pGA3-mH and Sindbis virus-based DNA replicon pMSIN-H encoding MV hemagglutinin (H). The initial i.n. dose-response with bacterial vectors alone identified a well-tolerated dosage (1 x 10(9) to 7 x 10(9) CFU) and a volume (20 micro l) that elicited strong antivector immune responses. Animals immunized i.n. on days 0, 28, and 76 with bacterial vectors carrying DNA plasmids encoding MV H or immunized parenterally with these naked DNA vaccine plasmids developed MV plaque reduction neutralizing antibodies and proliferative responses against MV antigens. In a subsequent experiment of identical design, cotton rats were challenged with wild-type MV 1 month after the third dose of vaccine or placebo. MV titers were significantly reduced in lung tissue of animals immunized with MV DNA vaccines delivered either via bacterial live vectors or parenterally. Since attenuated serovar Typhi and S. flexneri can deliver measles DNA vaccines mucosally in cotton rats, inducing measles immune responses (including neutralizing antibodies) and protection, boosting strategies can now be evaluated in animals primed with MV DNA vaccines.

  19. Effect of human polymorphonuclear and mononuclear leukocytes on chromosomal and plasmid DNA of Escherichia coli. Role of acid DNase

    International Nuclear Information System (INIS)

    Rozenberg-Arska, M.; van Strijp, J.A.; Hoekstra, W.P.; Verhoef, J.

    1984-01-01

    Phagocytosis and killing by polymorphonuclear and mononuclear leukocytes are important host resistance factors against invading microorganisms. Evidence showing that killing is rapidly followed by degradation of bacterial components is limited. Therefore, we studied the fate of Escherichia coli DNA following phagocytosis of E. coli by polymorphonuclear and mononuclear leukocytes. [ 3 H]Thymidine-labeled, unencapsulated E. coli PC2166 and E. coli 048K1 were incubated in serum, washed, and added to leukocytes. Uptake and killing of the bacteria and degradation of DNA were measured. Although phagocytosis and killing by mononuclear leukocytes was less efficient than that by polymorphonuclear leukocytes, only mononuclear leukocytes were able to degrade E. coli PC2166 DNA. Within 2 h, 60% of the radioactivity added to mononuclear leukocytes was released into the supernate, of which 40% was acid soluble. DNA of E. coli 048K1 was not degraded. To further analyze the capacity of mononuclear leukocytes to degrade E. coli DNA, chromosomal and plasmid DNA was isolated from ingested bacteria and subjected to agarose gel-electrophoresis. Only chromosomal DNA was degraded after phagocytosis. Plasmid DNA of E. coli carrying a gene coding for ampicillin resistance remained intact for a 2-h period after ingestion, and was still able to transform recipient E. coli cells after this period. Although we observed no DNA degradation during phagocytosis by polymorphonuclear leukocytes, lysates of both polymorphonuclear and mononuclear leukocytes contained acid-DNase activity with a pH optimum of 4.9. However, the DNase activity of mononuclear leukocytes was 20 times higher than that of polymorphonuclear leukocytes. No difference was observed between DNase activity from polymorphonuclear and mononuclear leukocytes from a chronic granulomatous disease patient with DNase activity from control polymorphonuclear and mononuclear leukocytes

  20. Auto-assembly of nanometer thick, water soluble layers of plasmid DNA complexed with diamines and basic amino acids on graphite: Greatest DNA protection is obtained with arginine

    Energy Technology Data Exchange (ETDEWEB)

    Khalil, T.T.; Boulanouar, O. [Université de Bourgogne Franche-Comté, UMR CNRS 6249 Chrono-Environnement, 16, Route de Gray, 25030 Besançon Cedex (France); Heintz, O. [Université de Bourgogne Franche-Comté, UMR CNRS 6303Laboratoire Interdisciplinaire Carnot de Bourgogne, DTAI/Centre de micro/nano caractérisation, 9 Av. A. Savary, BP 47870, F-21078 DIJON Cedex (France); Fromm, M., E-mail: michel.fromm@univ-fcomte.fr [Université de Bourgogne Franche-Comté, UMR CNRS 6249 Chrono-Environnement, 16, Route de Gray, 25030 Besançon Cedex (France)

    2017-02-01

    We have investigated the ability of diamines as well as basic amino acids to condense DNA onto highly ordered pyrolytic graphite with minimum damage after re-dissolution in water. Based on a bibliographic survey we briefly summarize DNA binding properties with diamines as compared to basic amino acids. Thus, solutions of DNA complexed with these linkers were drop-cast in order to deposit ultra-thin layers on the surface of HOPG in the absence or presence of Tris buffer. Atomic Force Microscopy analyses showed that, at a fixed ligand-DNA mixing ratio of 16, the mean thickness of the layers can be statistically predicted to lie in the range 0–50 nm with a maximum standard deviation ± 6 nm, using a simple linear law depending on the DNA concentration. The morphology of the layers appears to be ligand-dependent. While the layers containing diamines present holes, those formed in the presence of basic amino acids, except for lysine, are much more compact and dense. X-ray Photoelectron Spectroscopy measurements provide compositional information indicating that, compared to the maximum number of DNA sites to which the ligands may bind, the basic amino acids Arg and His are present in large excess. Conservation of the supercoiled topology of the DNA plasmids was studied after recovery of the complex layers in water. Remarkably, arginine has the best protection capabilities whether Tris was present or not in the initial solution. - Highlights: • Characterization of nanometer scaled layers composed of pUC21 plasmid DNA • Relation between nature of the ligand and structure of the layers • Capacities of the ligands to protect plasmids from strand break depending on their nature.

  1. Implementation of digital image encryption algorithm using logistic function and DNA encoding

    Science.gov (United States)

    Suryadi, MT; Satria, Yudi; Fauzi, Muhammad

    2018-03-01

    Cryptography is a method to secure information that might be in form of digital image. Based on past research, in order to increase security level of chaos based encryption algorithm and DNA based encryption algorithm, encryption algorithm using logistic function and DNA encoding was proposed. Digital image encryption algorithm using logistic function and DNA encoding use DNA encoding to scramble the pixel values into DNA base and scramble it in DNA addition, DNA complement, and XOR operation. The logistic function in this algorithm used as random number generator needed in DNA complement and XOR operation. The result of the test show that the PSNR values of cipher images are 7.98-7.99 bits, the entropy values are close to 8, the histogram of cipher images are uniformly distributed and the correlation coefficient of cipher images are near 0. Thus, the cipher image can be decrypted perfectly and the encryption algorithm has good resistance to entropy attack and statistical attack.

  2. Viruses Infecting a Freshwater Filamentous Cyanobacterium (Nostoc sp. Encode a Functional CRISPR Array and a Proteobacterial DNA Polymerase B

    Directory of Open Access Journals (Sweden)

    Caroline Chénard

    2016-06-01

    Full Text Available Here we present the first genomic characterization of viruses infecting Nostoc, a genus of ecologically important cyanobacteria that are widespread in freshwater. Cyanophages A-1 and N-1 were isolated in the 1970s and infect Nostoc sp. strain PCC 7210 but remained genomically uncharacterized. Their 68,304- and 64,960-bp genomes are strikingly different from those of other sequenced cyanophages. Many putative genes that code for proteins with known functions are similar to those found in filamentous cyanobacteria, showing a long evolutionary history in their host. Cyanophage N-1 encodes a CRISPR array that is transcribed during infection and is similar to the DR5 family of CRISPRs commonly found in cyanobacteria. The presence of a host-related CRISPR array in a cyanophage suggests that the phage can transfer the CRISPR among related cyanobacteria and thereby provide resistance to infection with competing phages. Both viruses also encode a distinct DNA polymerase B that is closely related to those found in plasmids of Cyanothece sp. strain PCC 7424, Nostoc sp. strain PCC 7120, and Anabaena variabilis ATCC 29413. These polymerases form a distinct evolutionary group that is more closely related to DNA polymerases of proteobacteria than to those of other viruses. This suggests that the polymerase was acquired from a proteobacterium by an ancestral virus and transferred to the cyanobacterial plasmid. Many other open reading frames are similar to a prophage-like element in the genome of Nostoc sp. strain PCC 7524. The Nostoc cyanophages reveal a history of gene transfers between filamentous cyanobacteria and their viruses that have helped to forge the evolutionary trajectory of this previously unrecognized group of phages.

  3. Ultrasound-targeted microbubble destruction enhances naked plasmid DNA transfection in rabbit Achilles tendons in vivo.

    Science.gov (United States)

    Qiu, L; Zhang, L; Wang, L; Jiang, Y; Luo, Y; Peng, Y; Lin, L

    2012-07-01

    The study was to investigate the probability of increasing the transfection of the gene in tendons by ultrasound-targeted microbubble destruction (UTMD), and to search for the most suitable transfection conditions. A mixture of microbubbles and enhanced green fluorescent protein (EGFP) plasmids was injected into rabbit Achilles tendons by different administration routes and the tendons were ultrasound pulse by different ultrasonic conditions in order to determine the most appropriate conditions. Then, the rabbits were divided into four groups: (1) ultrasound + microbubbles + plasmid; (2) ultrasound+ plasmid; (3) microbubble + plasmid; (4) plasmid only. EGFP expression in the tendons and other tissues, and the damage to tendon and paratenon were all observed. The results showed that EGFP expression in the tendon was higher by ultrasound pulse with 2 W cm(-2) of output intensity and a 20% duty cycle for 10 min. Local injection was determined to be the better administration route. Among the four groups, EGFP expression in Group 1 was higher than that in other groups. EGFP expression was highest on seventh day, then it gradually decrease over time, and lasted more than 56 days. EGFP expression was not found in other tissues. There was no obvious injury caused by UTMD. Under suitable conditions, it is feasible to use UTMD as a safe and effective gene transfection therapy for tendon injuries.

  4. STUDY REGARDING EFFICIENCY OF INDUCED GENETIC TRANSFORMATION IN BACILLUS LICHENIFORMIS WITH PLASMID DNA

    Directory of Open Access Journals (Sweden)

    T. VINTILĂ

    2007-05-01

    Full Text Available A strain of Bacillus licheniformis was subject to genetic transformation with plasmid vectors (pLC1 and pNC61, using electroporation technique, protoplast transformation and bivalent cations (CaCl2 mediated transformation. In the case of transformation by electroporation of Bacillus licheniformis B40, the highest number of transformed colonies (3 were obtained only after a 1,79 KV electric shock, for 2,2 milliseconds. Using this transformation technique we have obtained six kanamycin resistant transformants. The frequency of Bacillus licheniformis B40 protoplasts transformation using pLC1 and pNC61 plasmid vectors is approximately 10% (TF = 10%. As a result of pLC1 plasmid integration in Bacillus licheniformis protoplasts, six kanamycin resistant transformants were obtained. The pNC61 plasmid, which confers trimethoprim resistance, does not integrate in receiver cells by protoplast transformation. The direct genetic transformation in the presence of bivalent cations (CaCl2, mediated by pLC1 and pNC61 plasmid vectors, produce a low transformation frequency. Using this technique, we have obtained three trimethoprim resistant colonies and four kanamycin resistant colonies. The chemical way of transformation is the only technique, which realizes the integration of pNC61 in B. licheniformis B40 cells.

  5. Assessment of a DNA vaccine encoding an anchored-glycosylphosphatidylinositol tegumental antigen complexed to protamine sulphate on immunoprotection against murine schistosomiasis

    Directory of Open Access Journals (Sweden)

    Eduardo JM Nascimento

    2007-02-01

    Full Text Available Protamine sulphate/DNA complexes have been shown to protect DNA from DNase digestion in a lipid system for gene transfer. A DNA-based vaccine complexed to protamine sulphate was used to induce an immune response against Schistosoma mansoni anchored-glycosylphosphatidylinositol tegumental antigen in BALB/c mice. The protection elicited ranged from 33 to 44%. The spectrum of the elicited immune response induced by the vaccine formulation without protamine was characterized by a high level of IgG (IgG1> IgG2a. Protamine sulphate added to the DNA vaccine formulation retained the green fluorescent protein encoding-plasmid longer in muscle and spleen. The experiments in vivo showed that under protamine sulphate effect, the scope of protection remained unchanged, but a modulation in antibody production (IgG1= IgG2a was observed.

  6. Identification of a mammalian nuclear factor and human cDNA-encoded proteins that recognize DNA containing apurinic sites

    International Nuclear Information System (INIS)

    Lenz, J.; Okenquist, S.A.; LoSardo, J.E.; Hamilton, K.K.; Doetsch, P.W.

    1990-01-01

    Damage to DNA can have lethal or mutagenic consequences for cells unless it is detected and repaired by cellular proteins. Repair depends on the ability of cellular factors to distinguish the damaged sites. Electrophoretic binding assays were used to identify a factor from the nuclei of mammalian cells that bound to DNA containing apurinic sites. A binding assay based on the use of β-galactosidase fusion proteins was subsequently used to isolate recombinant clones of human cDNAs that encoded apurinic DNA-binding proteins. Two distinct human cDNAs were identified that encoded proteins that bound apurinic DNA preferentially over undamaged, methylated, or UV-irradiated DNA. These approaches may offer a general method for the detection of proteins that recognize various types of DNA damage and for the cloning of genes encoding such proteins

  7. Nanospines incorporation into the structure of the hydrophobic cryogels via novel cryogelation method: an alternative sorbent for plasmid DNA purification.

    Science.gov (United States)

    Üzek, Recep; Uzun, Lokman; Şenel, Serap; Denizli, Adil

    2013-02-01

    In this study, it was aimed to prepare hydrophobic cryogels for plasmid DNA (pDNA) purification from Escherichia coli lysate. The hydrophobicity was achieved by incorporating a hydrophobic ligand, N-methacryloyl-(L)-phenylalanine (MAPA), into the cryogel backbone. In addition to the conventional cryogelation process, freeze-drying step was included to create nanospines. Three different cryogels {poly(2-hydoxyethyl methacrylate-N-methacryloyl-L-phenylalanine)-freeze dried, [P(HEMA-MAPA)-FD]; poly(2-hydoxyethyl methacrylate-N-methacryloyl-L-phenylalanine, [P(HEMA-MAPA)] and poly(2-hydoxyethyl methacrylate)-freeze dried, [P(HEMA)-FD]} were prepared, characterized, and used for DNA (salmon sperm DNA) adsorption studies from aqueous solution. The specific surface areas of cryogels were determined to be 21.4 m(2)/g for P(HEMA)-FD, 17.65 m(2)/g for P(HEMA-MAPA) and 36.0 m(2)/g for P(HEMA-MAPA)-FD. The parameters affecting adsorption such as temperature, initial DNA concentration, salt type and concentration were examined in continuous mode. The maximum adsorption capacities were observed as 45.31 mg DNA/g, 27.08 mg DNA/g and 1.81 mg DNA/g for P(HEMA-MAPA)-FD, P(HEMA-MAPA) and P(HEMA)-FD, respectively. Desorption process was performed using acetate buffer (pH 5.50) without salt. First, pDNA was isolated from E. coli lysate and the purity of pDNA was then determined by agarose gel electrophoresis. Finally, the chromatographic performance of P(HEMA-MAPA)-FD cryogel for pDNA purification was tested in FPLC. The resolution (R(s)) was 2.84, and the specific selectivity for pDNA was 237.5-folds greater than all impurities. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Autonomous assembly of synthetic oligonucleotides built from an expanded DNA alphabet. Total synthesis of a gene encoding kanamycin resistance

    Directory of Open Access Journals (Sweden)

    Kristen K. Merritt

    2014-10-01

    Full Text Available Background: Many synthetic biologists seek to increase the degree of autonomy in the assembly of long DNA (L-DNA constructs from short synthetic DNA fragments, which are today quite inexpensive because of automated solid-phase synthesis. However, the low information density of DNA built from just four nucleotide “letters”, the presence of strong (G:C and weak (A:T nucleobase pairs, the non-canonical folded structures that compete with Watson–Crick pairing, and other features intrinsic to natural DNA, generally prevent the autonomous assembly of short single-stranded oligonucleotides greater than a dozen or so.Results: We describe a new strategy to autonomously assemble L-DNA constructs from fragments of synthetic single-stranded DNA. This strategy uses an artificially expanded genetic information system (AEGIS that adds nucleotides to the four (G, A, C, and T found in standard DNA by shuffling hydrogen-bonding units on the nucleobases, all while retaining the overall Watson–Crick base-pairing geometry. The added information density allows larger numbers of synthetic fragments to self-assemble without off-target hybridization, hairpin formation, and non-canonical folding interactions. The AEGIS pairs are then converted into standard pairs to produce a fully natural L-DNA product. Here, we report the autonomous assembly of a gene encoding kanamycin resistance using this strategy. Synthetic fragments were built from a six-letter alphabet having two AEGIS components, 5-methyl-2’-deoxyisocytidine and 2’-deoxyisoguanosine (respectively S and B, at their overlapping ends. Gaps in the overlapped assembly were then filled in using DNA polymerases, and the nicks were sealed by ligase. The S:B pairs in the ligated construct were then converted to T:A pairs during PCR amplification. When cloned into a plasmid, the product was shown to make Escherichia coli resistant to kanamycin. A parallel study that attempted to assemble similarly sized genes

  9. Molecular cloning of growth hormone encoding cDNA of Indian

    Indian Academy of Sciences (India)

    A modified rapid amplification of cDNA ends (RACE) strategy has been developed for cloning highly conserved cDNA sequences. Using this modified method, the growth hormone (GH) encoding cDNA sequences of Labeo rohita, Cirrhina mrigala and Catla catla have been cloned, characterized and overexpressed in ...

  10. A Histone-Like Protein Induces Plasmid DNA to Form Liquid Crystals in Vitro and Gene Compaction in Vivo

    Directory of Open Access Journals (Sweden)

    Shiyong Sun

    2013-12-01

    Full Text Available The liquid crystalline state is a universal phenomenon involving the formation of an ordered structure via a self-assembly process that has attracted attention from numerous scientists. In this study, the dinoflagellate histone-like protein HCcp3 is shown to induce super-coiled pUC18 plasmid DNA to enter a liquid crystalline state in vitro, and the role of HCcp3 in gene condensation in vivo is also presented. The plasmid DNA (pDNA-HCcp3 complex formed birefringent spherical particles with a semi-crystalline selected area electronic diffraction (SAED pattern. Circular dichroism (CD titrations of pDNA and HCcp3 were performed. Without HCcp3, pUC18 showed the characteristic B conformation. As the HCcp3 concentration increased, the 273 nm band sharply shifted to 282 nm. When the HCcp3 concentration became high, the base pair (bp/dimer ratio fell below 42/1, and the CD spectra of the pDNA-HCcp3 complexes became similar to that of dehydrated A-form DNA. Microscopy results showed that HCcp3 compacted the super-coiled gene into a condensed state and that inclusion bodies were formed. Our results indicated that HCcp3 has significant roles in gene condensation both in vitro and in histone-less eukaryotes in vivo. The present study indicates that HCcp3 has great potential for applications in non-viral gene delivery systems, where HCcp3 may compact genetic material to form liquid crystals.

  11. Plasmid origin of replication of herpesvirus papio: DNA sequence and enhancer function.

    Science.gov (United States)

    Loeb, D D; Sung, N S; Pesano, R L; Sexton, C J; Hutchison, C; Pagano, J S

    1990-01-01

    Herpesvirus papio (HVP) is a lymphotropic virus of baboons which is related to Epstein-Barr virus (EBV) and produces latent infection. The nucleotide sequence of the 5,775-base-pair (bp) EcoRI K fragment of HVP, which has previously been shown to confer the ability to replicate autonomously, has been determined. Within this DNA fragment is a region which bears structural and sequence similarity to the ori-P region of EBV. The HVP ori-P region has a 10- by 26-bp tandem array which is related to the 20- by 30-bp tandem array from the EBV ori-P region. In HVP there is an intervening region of 764 bp followed by five partial copies of the 26-bp monomer. Both the EBV and HVP 3' regions have the potential to form dyad structures which, however, differ in arrangement. We also demonstrate that a transcriptional enhancer which requires transactivation by a virus-encoded factor is present in the HVP ori-P. Images PMID:2159548

  12. Persistence of plasmids, cholera toxin genes, and prophage DNA in classical Vibrio cholerae O1.

    Science.gov (United States)

    Cook, W L; Wachsmuth, K; Johnson, S R; Birkness, K A; Samadi, A R

    1984-07-01

    Plasmid profiles, the location of cholera toxin subunit A genes, and the presence of the defective VcA1 prophage genome in classical Vibrio cholerae isolated from patients in Bangladesh in 1982 were compared with those in older classical strains isolated during the sixth pandemic and with those in selected eltor and nontoxigenic O1 isolates. Classical strains typically had two plasmids (21 and 3 megadaltons), eltor strains typically had no plasmids, and nontoxigenic O1 strains had zero to three plasmids. The old and new isolates of classical V. cholerae had two HindIII chromosomal digest fragments containing cholera toxin subunit A genes, whereas the eltor strains from Eastern countries had one fragment. The eltor strains from areas surrounding the Gulf of Mexico also had two subunit A gene fragments, which were smaller and easily distinguished from the classical pattern. All classical strains had 8 to 10 HindIII fragments containing the defective VcA1 prophage genome; none of the Eastern eltor strains had these genes, and the Gulf Coast eltor strains contained a different array of weakly hybridizing genes. These data suggest that the recent isolates of classical cholera in Bangladesh are closely related to the bacterial strain(s) which caused classical cholera during the sixth pandemic. These data do not support hypotheses that either the eltor or the nontoxigenic O1 strains are precursors of the new classical strains.

  13. STUDY REGARDING EFFICIENCY OF INDUCED GENETIC TRANSFORMATION IN BACILLUS LICHENIFORMIS WITH PLASMID DNA

    Directory of Open Access Journals (Sweden)

    VINTILĂ T.

    2007-01-01

    Full Text Available A strain of Bacillus licheniformis was subject to genetic transformation with plasmidvectors (pLC1 and pNC61, using electroporation technique, protoplasttransformation and bivalent cations (CaCl2 mediated transformation. In the case oftransformation by electroporation of Bacillus licheniformis B40, the highest numberof transformed colonies (3 were obtained only after a 1,79 KV electric shock, for 2,2milliseconds. Using this transformation technique we have obtained six kanamycinresistant transformants. The frequency of Bacillus licheniformis B40 protoplaststransformation using pLC1 and pNC61 plasmid vectors is approximately 10% (TF =10%. As a result of pLC1 plasmid integration in Bacillus licheniformis protoplasts,six kanamycin resistant transformants were obtained. The pNC61 plasmid, whichconfers trimethoprim resistance, does not integrate in receiver cells by protoplasttransformation. The direct genetic transformation in the presence of bivalent cations(CaCl2, mediated by pLC1 and pNC61 plasmid vectors, produce a lowtransformation frequency. Using this technique, we have obtained three trimethoprimresistant colonies and four kanamycin resistant colonies. The chemical way oftransformation is the only technique, which realizes the integration of pNC61 in B.licheniformis B40 cells.

  14. Plasmid-encoded biosynthetic genes alleviate metabolic disadvantages while increasing glucose conversion to shikimate in an engineered Escherichia coli strain.

    Science.gov (United States)

    Rodriguez, Alberto; Martínez, Juan A; Millard, Pierre; Gosset, Guillermo; Portais, Jean-Charles; Létisse, Fabien; Bolivar, Francisco

    2017-06-01

    Metabolic engineering strategies applied over the last two decades to produce shikimate (SA) in Escherichia coli have resulted in a battery of strains bearing many expression systems. However, the effects that these systems have on the host physiology and how they impact the production of SA are still not well understood. In this work we utilized an engineered E. coli strain to determine the consequences of carrying a vector that promotes SA production from glucose with a high-yield but that is also expected to impose a significant cellular burden. Kinetic comparisons in fermentors showed that instead of exerting a negative effect, the sole presence of the plasmid increased glucose consumption without diminishing the growth rate. By constitutively expressing a biosynthetic operon from this vector, the more active glycolytic metabolism was exploited to redirect intermediates toward the production of SA, which further increased the glucose consumption rate and avoided excess acetate production. Fluxomics and metabolomics experiments revealed a global remodeling of the carbon and energy metabolism in the production strain, where the increased SA production reduced the carbon available for oxidative and fermentative pathways. Moreover, the results showed that the production of SA relies on a specific setup of the pentose phosphate pathway, where both its oxidative and non-oxidative branches are strongly activated to supply erythrose-4-phosphate and balance the NADPH requirements. This work improves our understanding of the metabolic reorganization observed in E. coli in response to the plasmid-based expression of the SA biosynthetic pathway. Biotechnol. Bioeng. 2017;114: 1319-1330. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  15. Isolation and characterisation of the cDNA encoding a glycosylated accessory protein of pea chloroplast DNA polymerase.

    OpenAIRE

    Gaikwad, A; Tewari, K K; Kumar, D; Chen, W; Mukherjee, S K

    1999-01-01

    The cDNA encoding p43, a DNA binding protein from pea chloroplasts (ct) that binds to cognate DNA polymerase and stimulates the polymerase activity, has been cloned and characterised. The characteristic sequence motifs of hydroxyproline-rich glyco-proteins (HRGP) are present in the cDNA corres-ponding to the N-terminal domain of the mature p43. The protein was found to be highly O-arabinosylated. Chemically deglycosylated p43 (i.e. p29) retains its binding to both DNA and pea ct-DNA polymeras...

  16. Detailed adsorption mechanism of plasmid DNA by newly isolated cellulose from waste flower spikes of Thypa latifolia using quantum chemical calculations.

    Science.gov (United States)

    Mujtaba, Muhammad; Kaya, Murat; Akyuz, Lalehan; Erdonmez, Demet; Akyuz, Bahar; Sargin, Idris

    2017-09-01

    Current study was designed to use the newly obtained cellulose from waste flower spikes of Thypa latifolia plant for plasmid DNA adsorption. Cellulose was isolated according to a previously described method including acid and base treatment, and cellulose content was recorded as 17%. T. latifolia cellulose was physicochemically characterized via FT-IR, TGA and SEM techniques. Detailed mechanism of plasmid DNA adsorption by newly isolated cellulose was described using chemical quantum calculations. To check the effect of Cu ++ immobilization on the affinity of cellulose for plasmid DNA, copper ions were immobilized onto T. latifolia cellulose. pUC18 plasmid DNA was used for adsorption studies. Membranes prepared with only T. latifolia cellulose and Cu ++ immobilized T. latifolia cellulose revealed different adsorption ratios as 43.9 and 86.9% respectively. This newly isolated cellulose from waste flower spikes of T. latifolia can be utilized as a suitable carrier for plasmid DNA. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Highly efficient gene delivery by mRNA electroporation in human hematopoietic cells: superiority to lipofection and passive pulsing of mRNA and to electroporation of plasmid cDNA for tumor antigen loading of dendritic cells.

    Science.gov (United States)

    Van Tendeloo, V F; Ponsaerts, P; Lardon, F; Nijs, G; Lenjou, M; Van Broeckhoven, C; Van Bockstaele, D R; Berneman, Z N

    2001-07-01

    Designing effective strategies to load human dendritic cells (DCs) with tumor antigens is a challenging approach for DC-based tumor vaccines. Here, a cytoplasmic expression system based on mRNA electroporation to efficiently introduce tumor antigens into DCs is described. Preliminary experiments in K562 cells using an enhanced green fluorescent protein (EGFP) reporter gene revealed that mRNA electroporation as compared with plasmid DNA electroporation showed a markedly improved transfection efficiency (89% versus 40% EGFP(+) cells, respectively) and induced a strikingly lower cell toxicity (15% death rate with mRNA versus 51% with plasmid DNA). Next, mRNA electroporation was applied for nonviral transfection of different types of human DCs, including monocyte-derived DCs (Mo-DCs), CD34(+) progenitor-derived DCs (34-DCs) and Langerhans cells (34-LCs). High-level transgene expression by mRNA electroporation was obtained in more than 50% of all DC types. mRNA-electroporated DCs retained their phenotype and maturational potential. Importantly, DCs electroporated with mRNA-encoding Melan-A strongly activated a Melan-A-specific cytotoxic T lymphocyte (CTL) clone in an HLA-restricted manner and were superior to mRNA-lipofected or -pulsed DCs. Optimal stimulation of the CTL occurred when Mo-DCs underwent maturation following mRNA transfection. Strikingly, a nonspecific stimulation of CTL was observed when DCs were transfected with plasmid DNA. The data clearly demonstrate that Mo-DCs electroporated with mRNA efficiently present functional antigenic peptides to cytotoxic T cells. Therefore, electroporation of mRNA-encoding tumor antigens is a powerful technique to charge human dendritic cells with tumor antigens and could serve applications in future DC-based tumor vaccines.

  18. The Proteome of Biologically Active Membrane Vesicles from Piscirickettsia salmonis LF-89 Type Strain Identifies Plasmid-Encoded Putative Toxins

    Directory of Open Access Journals (Sweden)

    Cristian Oliver

    2017-09-01

    Full Text Available Piscirickettsia salmonis is the predominant bacterial pathogen affecting the Chilean salmonid industry. This bacterium is the etiological agent of piscirickettsiosis, a significant fish disease. Membrane vesicles (MVs released by P. salmonis deliver several virulence factors to host cells. To improve on existing knowledge for the pathogenicity-associated functions of P. salmonis MVs, we studied the proteome of purified MVs from the P. salmonis LF-89 type strain using multidimensional protein identification technology. Initially, the cytotoxicity of different MV concentration purified from P. salmonis LF-89 was confirmed in an in vivo adult zebrafish infection model. The cumulative mortality of zebrafish injected with MVs showed a dose-dependent pattern. Analyses identified 452 proteins of different subcellular origins; most of them were associated with the cytoplasmic compartment and were mainly related to key functions for pathogen survival. Interestingly, previously unidentified putative virulence-related proteins were identified in P. salmonis MVs, such as outer membrane porin F and hemolysin. Additionally, five amino acid sequences corresponding to the Bordetella pertussis toxin subunit 1 and two amino acid sequences corresponding to the heat-labile enterotoxin alpha chain of Escherichia coli were located in the P. salmonis MV proteome. Curiously, these putative toxins were located in a plasmid region of P. salmonis LF-89. Based on the identified proteins, we propose that the protein composition of P. salmonis LF-89 MVs could reflect total protein characteristics of this P. salmonis type strain.

  19. The Proteome of Biologically Active Membrane Vesicles from Piscirickettsia salmonis LF-89 Type Strain Identifies Plasmid-Encoded Putative Toxins.

    Science.gov (United States)

    Oliver, Cristian; Hernández, Mauricio A; Tandberg, Julia I; Valenzuela, Karla N; Lagos, Leidy X; Haro, Ronie E; Sánchez, Patricio; Ruiz, Pamela A; Sanhueza-Oyarzún, Constanza; Cortés, Marcos A; Villar, María T; Artigues, Antonio; Winther-Larsen, Hanne C; Avendaño-Herrera, Ruben; Yáñez, Alejandro J

    2017-01-01

    Piscirickettsia salmonis is the predominant bacterial pathogen affecting the Chilean salmonid industry. This bacterium is the etiological agent of piscirickettsiosis, a significant fish disease. Membrane vesicles (MVs) released by P. salmonis deliver several virulence factors to host cells. To improve on existing knowledge for the pathogenicity-associated functions of P. salmonis MVs, we studied the proteome of purified MVs from the P. salmonis LF-89 type strain using multidimensional protein identification technology. Initially, the cytotoxicity of different MV concentration purified from P. salmonis LF-89 was confirmed in an in vivo adult zebrafish infection model. The cumulative mortality of zebrafish injected with MVs showed a dose-dependent pattern. Analyses identified 452 proteins of different subcellular origins; most of them were associated with the cytoplasmic compartment and were mainly related to key functions for pathogen survival. Interestingly, previously unidentified putative virulence-related proteins were identified in P. salmonis MVs, such as outer membrane porin F and hemolysin. Additionally, five amino acid sequences corresponding to the Bordetella pertussis toxin subunit 1 and two amino acid sequences corresponding to the heat-labile enterotoxin alpha chain of Escherichia coli were located in the P. salmonis MV proteome. Curiously, these putative toxins were located in a plasmid region of P. salmonis LF-89. Based on the identified proteins, we propose that the protein composition of P. salmonis LF-89 MVs could reflect total protein characteristics of this P. salmonis type strain.

  20. Use of damaged plasmid to study DNA repair in X-ray sensitive (xrs) strains of Chinese hamster ovary (CHO) cells

    International Nuclear Information System (INIS)

    Smith-Ravin, J.; Jeggo, P.A.

    1989-01-01

    The effect of γ-irradiation of pSV2gpt DNA on its transfection frequency has been analysed using radiosensitive CHO xrs mutants showing a defect in double-strand break (dsb) rejoining. At low doses a sharp decrease in relative transfection frequency, i.e. transfection frequency of irradiated plasmid relative to untreated plasmid, as observed in xrs mutants compared with the parent line K1. Electrophoresis of irradiated plasmid DNA showed the decrease in transfection frequency in the xrs mutants correlated with the change of supercoiled molecules into open-circular forms. In the parent line CHO-K1, open-circular and supercoiled molecules have the same transfection frequency. The effect of linearization of pSV2gpt DNA by restriction enzymes on transfection frequency in xrs and wild-type strains was also examined. No difference in the relative transfection frequency between xrs and wild-type strains was detected. (author)

  1. Protective effect of the DNA vaccine encoding the major house dust mite allergens on allergic inflammation in the murine model of house dust mite allergy

    Directory of Open Access Journals (Sweden)

    Lee Jaechun

    2006-02-01

    Full Text Available Abstract Background Vaccination with naked DNA encoding antigen induces cellular and humoral immunity characterized by the activation of specific Th1 cells. Objective To evaluate the effects of vaccination with mixed naked DNA plasmids encoding Der p 1, Der p 2, Der p 3, Der f 1, Der f 2, and Der f 3, the major house dust mite allergens on the allergic inflammation to the whole house dust mites (HDM crude extract. Methods Three hundred micrograms of these gene mixtures were injected into muscle of BALB/c mice. Control mice were injected with the pcDNA 3.1 blank vector. After 3 weeks, the mice were actively sensitized and inhaled with the whole house dust mite extract intranasally. Results The vaccinated mice showed a significantly decreased synthesis of total and HDM-specific IgE compared with controls. Analysis of the cytokine profile of lymphocytes after challenge with HDM crude extract revealed that mRNA expression of interferon-γ was higher in the vaccinated mice than in the controls. Reduced infiltration of inflammatory cells and the prominent infiltration of CD8+ T cells were observed in histology of lung tissue from the vaccinated mice. Conclusion Vaccination with DNA encoding the major house dust mite allergens provides a promising approach for treating allergic responses to whole house dust mite allergens.

  2. Safety and efficacy of a xenogeneic DNA vaccine encoding for human tyrosinase as adjunctive treatment for oral malignant melanoma in dogs following surgical excision of the primary tumor.

    Science.gov (United States)

    Grosenbaugh, Deborah A; Leard, A Timothy; Bergman, Philip J; Klein, Mary K; Meleo, Karri; Susaneck, Steven; Hess, Paul R; Jankowski, Monika K; Jones, Pamela D; Leibman, Nicole F; Johnson, Maribeth H; Kurzman, Ilene D; Wolchok, Jedd D

    2011-12-01

    To evaluate the safety and efficacy of a vaccine containing plasmid DNA with an insert encoding human tyrosinase (ie, huTyr vaccine) as adjunctive treatment for oral malignant melanoma (MM) in dogs. 111 dogs (58 prospectively enrolled in a multicenter clinical trial and 53 historical controls) with stage II or III oral MM (modified World Health Organization staging scale, I to IV) in which locoregional disease control was achieved. 58 dogs received an initial series of 4 injections of huTyr vaccine (102 μg of DNA/injection) administered transdermally by use of a needle-free IM vaccination device. Dogs were monitored for adverse reactions. Surviving dogs received booster injections at 6-month intervals thereafter. Survival time for vaccinates was compared with that of historical control dogs via Kaplan-Meier survival analysis for the outcome of death. Kaplan-Meier analysis of survival time until death attributable to MM was determined to be significantly improved for dogs that received the huTyr vaccine, compared with that of historical controls. However, median survival time could not be determined for vaccinates because dogs as adjunctive treatment for oral MM. Response to DNA vaccination in dogs with oral MM may be useful in development of plasmid DNA vaccination protocols for human patients with similar disease.

  3. Repair of UV-damaged incoming plasmid DNA in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Keszenman-Pereyra, David

    1990-01-01

    A whole-cell transformation assay was used for the repair of UV-damaged plasma DNA in highly-transformable haploid strains of Saccharomyces cerevisiae having different repair capabilities. The experiments described demonstrate that three epistasis groups (Friedberg 1988) are involved in the repair of UV-incoming DNA and that the repair processes act less efficiently on incoming DNA than they do on chromosomal DNA. The implications of these findings for UV repair in Saccharomyces cerevisiae are discussed. (author)

  4. MvaT Family Proteins Encoded on IncP-7 Plasmid pCAR1 and the Host Chromosome Regulate the Host Transcriptome Cooperatively but Differently.

    Science.gov (United States)

    Yun, Choong-Soo; Takahashi, Yurika; Shintani, Masaki; Takeda, Toshiharu; Suzuki-Minakuchi, Chiho; Okada, Kazunori; Yamane, Hisakazu; Nojiri, Hideaki

    2016-02-01

    MvaT proteins are members of the H-NS family of proteins in pseudomonads. The IncP-7 conjugative plasmid pCAR1 carries an mvaT-homologous gene, pmr. In Pseudomonas putida KT2440 bearing pCAR1, pmr and the chromosomally carried homologous genes, turA and turB, are transcribed at high levels, and Pmr interacts with TurA and TurB in vitro. In the present study, we clarified how the three MvaT proteins regulate the transcriptome of P. putida KT2440(pCAR1). Analyses performed by a modified chromatin immunoprecipitation assay with microarray technology (ChIP-chip) suggested that the binding regions of Pmr, TurA, and TurB in the P. putida KT2440(pCAR1) genome are almost identical; nevertheless, transcriptomic analyses using mutants with deletions of the genes encoding the MvaT proteins during the log and early stationary growth phases clearly suggested that their regulons were different. Indeed, significant regulon dissimilarity was found between Pmr and the other two proteins. Transcription of a larger number of genes was affected by Pmr deletion during early stationary phase than during log phase, suggesting that Pmr ameliorates the effects of pCAR1 on host fitness more effectively during the early stationary phase. Alternatively, the similarity of the TurA and TurB regulons implied that they might play complementary roles as global transcriptional regulators in response to plasmid carriage. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  5. Enhancement of the priming efficacy of DNA vaccines encoding dendritic cell-targeted antigens by synergistic toll-like receptor ligands

    Directory of Open Access Journals (Sweden)

    Kornbluth Richard S

    2009-08-01

    Full Text Available Abstract Background Targeting of protein antigens to dendritic cells (DC via the DEC205 receptor enhances presentation of antigen-derived peptides on MHC-I and MHC-II molecules and, in the presence of costimulatory signals, antigen-specific immune responses. The immunogenicity and efficacy of DNA vaccination can also be enhanced by fusing the encoded antigen to single chain antibodies directed against DEC205. To further improve this strategy, we evaluated different toll-like receptor ligands (TLR and CD40 ligands (CD40L as adjuvants for DNA vaccines encoding a DEC205-single-chain antibody fused to the ovalbumin model antigen or HIV-1 Gag and assessed the priming efficacy of DNA in a DNA prime adenoviral vector boost immunization regimen. Results Mice were primed with the adjuvanted DEC-205 targeted DNA vaccines and boosted with adenoviral vectors encoding the same antigens. CD8+ T cell responses were determined after the adenoviral booster immunization, to determine how well the different DNA immunization regimens prime for the adenoviral boost. In the absence of adjuvants, targeting of DNA-encoded ovalbumin to DCs suppressed CD8+ T-cell responses after the adenoviral booster immunization. CD8+ T-cell responses to the DEC205 targeted DNA vaccines increased only slightly by adding either the TLR-9 ligand CpG, the TLR-3 ligand Poly I:C, or CD40 ligand expression plasmids. However, the combination of both TLR-ligands led to a strong enhancement of CD8+ T-cell responses compared to a non-targeted DNA vaccine. This finding was confirmed using HIV Gag as antigen. Conclusion Although DNA prime adenoviral vector boost immunizations belong to the strongest inducers of cytotoxic T cell responses in different animal models and humans, the CD8+ T cell responses can be further improved by targeting the DNA encoded antigen to DEC205 in the presence of synergistic TLR ligands CpG and Poly I:C.

  6. Novel RepA-MCM proteins encoded in plasmids pTAU4, pORA1 and pTIK4 from Sulfolobus neozealandicus

    DEFF Research Database (Denmark)

    Greve, B.; Jensen, S.; Phan, H.

    2005-01-01

    Three plasmids isolated from the crenarchaeal thermoacidophile Sulfolobus neozealandicus were characterized. Plasmids pTAU4 (7,192 bp), pORA1 (9,689 bp) and pTIK4 (13,638 bp) show unusual properties that distinguish them from previously characterized cryptic plasmids of the genus Sulfolobus. Plas...

  7. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  8. A Novel Image Encryption Algorithm Based on DNA Encoding and Spatiotemporal Chaos

    Directory of Open Access Journals (Sweden)

    Chunyan Song

    2015-10-01

    Full Text Available DNA computing based image encryption is a new, promising field. In this paper, we propose a novel image encryption scheme based on DNA encoding and spatiotemporal chaos. In particular, after the plain image is primarily diffused with the bitwise Exclusive-OR operation, the DNA mapping rule is introduced to encode the diffused image. In order to enhance the encryption, the spatiotemporal chaotic system is used to confuse the rows and columns of the DNA encoded image. The experiments demonstrate that the proposed encryption algorithm is of high key sensitivity and large key space, and it can resist brute-force attack, entropy attack, differential attack, chosen-plaintext attack, known-plaintext attack and statistical attack.

  9. Plasmid and chromosome partitioning: surprises from phylogeny

    DEFF Research Database (Denmark)

    Gerdes, Kenn; Møller-Jensen, Jakob; Bugge Jensen, Rasmus

    2000-01-01

    Plasmids encode partitioning genes (par) that are required for faithful plasmid segregation at cell division. Initially, par loci were identified on plasmids, but more recently they were also found on bacterial chromosomes. We present here a phylogenetic analysis of par loci from plasmids and chr...

  10. Sustained delivery of plasmid DNA from polymeric scaffolds for tissue engineering.

    Science.gov (United States)

    Storrie, Hannah; Mooney, David J

    2006-07-07

    The encapsulation of DNA into polymeric depot systems can be used to spatially and temporally control DNA release, leading to a sustained, local delivery of therapeutic factors for tissue regeneration. Prior to encapsulation, DNA may be condensed with cationic polymers to decrease particle size, protect DNA from degradation, promote interaction with cell membranes, and facilitate endosomal release via the proton sponge effect. DNA has been encapsulated with either natural or synthetic polymers to form micro- and nanospheres, porous scaffolds and hydrogels for sustained DNA release and the polymer physical and chemical properties have been shown to influence transfection efficiency. Polymeric depot systems have been applied for bone, skin, and nerve regeneration as well as therapeutic angiogenesis, indicating the broad applicability of these systems for tissue engineering.

  11. Pmr, a histone-like protein H1 (H-NS) family protein encoded by the IncP-7 plasmid pCAR1, is a key global regulator that alters host function.

    Science.gov (United States)

    Yun, Choong-Soo; Suzuki, Chiho; Naito, Kunihiko; Takeda, Toshiharu; Takahashi, Yurika; Sai, Fumiya; Terabayashi, Tsuguno; Miyakoshi, Masatoshi; Shintani, Masaki; Nishida, Hiromi; Yamane, Hisakazu; Nojiri, Hideaki

    2010-09-01

    Histone-like protein H1 (H-NS) family proteins are nucleoid-associated proteins (NAPs) conserved among many bacterial species. The IncP-7 plasmid pCAR1 is transmissible among various Pseudomonas strains and carries a gene encoding the H-NS family protein, Pmr. Pseudomonas putida KT2440 is a host of pCAR1, which harbors five genes encoding the H-NS family proteins PP_1366 (TurA), PP_3765 (TurB), PP_0017 (TurC), PP_3693 (TurD), and PP_2947 (TurE). Quantitative reverse transcription-PCR (qRT-PCR) demonstrated that the presence of pCAR1 does not affect the transcription of these five genes and that only pmr, turA, and turB were primarily transcribed in KT2440(pCAR1). In vitro pull-down assays revealed that Pmr strongly interacted with itself and with TurA, TurB, and TurE. Transcriptome comparisons of the pmr disruptant, KT2440, and KT2440(pCAR1) strains indicated that pmr disruption had greater effects on the host transcriptome than did pCAR1 carriage. The transcriptional levels of some genes that increased with pCAR1 carriage, such as the mexEF-oprN efflux pump genes and parI, reverted with pmr disruption to levels in pCAR1-free KT2440. Transcriptional levels of putative horizontally acquired host genes were not altered by pCAR1 carriage but were altered by pmr disruption. Identification of genome-wide Pmr binding sites by ChAP-chip (chromatin affinity purification coupled with high-density tiling chip) analysis demonstrated that Pmr preferentially binds to horizontally acquired DNA regions. The Pmr binding sites overlapped well with the location of the genes differentially transcribed following pmr disruption on both the plasmid and the chromosome. Our findings indicate that Pmr is a key factor in optimizing gene transcription on pCAR1 and the host chromosome.

  12. Submicrometre geometrically encoded fluorescent barcodes self-assembled from DNA

    Science.gov (United States)

    Lin, Chenxiang; Jungmann, Ralf; Leifer, Andrew M.; Li, Chao; Levner, Daniel; Church, George M.; Shih, William M.; Yin, Peng

    2012-10-01

    The identification and differentiation of a large number of distinct molecular species with high temporal and spatial resolution is a major challenge in biomedical science. Fluorescence microscopy is a powerful tool, but its multiplexing ability is limited by the number of spectrally distinguishable fluorophores. Here, we used (deoxy)ribonucleic acid (DNA)-origami technology to construct submicrometre nanorods that act as fluorescent barcodes. We demonstrate that spatial control over the positioning of fluorophores on the surface of a stiff DNA nanorod can produce 216 distinct barcodes that can be decoded unambiguously using epifluorescence or total internal reflection fluorescence microscopy. Barcodes with higher spatial information density were demonstrated via the construction of super-resolution barcodes with features spaced by ˜40 nm. One species of the barcodes was used to tag yeast surface receptors, which suggests their potential applications as in situ imaging probes for diverse biomolecular and cellular entities in their native environments.

  13. DNA-encoded libraries - an efficient small molecule discovery technology for the biomedical sciences.

    Science.gov (United States)

    Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas

    2018-06-27

    DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.

  14. DNA Encoding Training Using 3D Gesture Interaction.

    Science.gov (United States)

    Nicola, Stelian; Handrea, Flavia-Laura; Crişan-Vida, Mihaela; Stoicu-Tivadar, Lăcrămioara

    2017-01-01

    The work described in this paper summarizes the development process and presents the results of a human genetics training application, studying the 20 amino acids formed by the combination of the 3 nucleotides of DNA targeting mainly medical and bioinformatics students. Currently, the domain applications using recognized human gestures of the Leap Motion sensor are used in molecules controlling and learning from Mendeleev table or in visualizing the animated reactions of specific molecules with water. The novelty in the current application consists in using the Leap Motion sensor creating new gestures for the application control and creating a tag based algorithm corresponding to each amino acid, depending on the position in the 3D virtual space of the 4 nucleotides of DNA and their type. The team proposes a 3D application based on Unity editor and on Leap Motion sensor where the user has the liberty of forming different combinations of the 20 amino acids. The results confirm that this new type of study of medicine/biochemistry using the Leap Motion sensor for handling amino acids is suitable for students. The application is original and interactive and the users can create their own amino acid structures in a 3D-like environment which they could not do otherwise using traditional pen-and-paper.

  15. Biomolecule-to-fluorescent-color encoder: modulation of fluorescence emission via DNA structural changes

    Science.gov (United States)

    Nishimura, Takahiro; Ogura, Yusuke; Yamada, Kenji; Ohno, Yuko; Tanida, Jun

    2014-01-01

    A biomolecule-to-fluorescent-color (B/F) encoder for optical readout of biomolecular information is proposed. In the B/F encoder, a set of fluorescence wavelengths and their intensity levels are used for coding of a biomolecular signal. A hybridization chain reaction of hairpin DNAs labeled with fluorescent reporters was performed to generate the fluorescence color codes. The fluorescence is modulated via fluorescence resonance energy transfer, which is controlled by DNA structural changes. The results demonstrate that fluorescent color codes can be configured based on two wavelengths and five intensities using the B/F encoder, and the assigned codes can be retrieved via fluorescence measurements. PMID:25071950

  16. Characterization of a Staphylococcal Plasmid Related to pUB110 and Carrying Two Novel Genes, vatC and vgbB, Encoding Resistance to Streptogramins A and B and Similar Antibiotics

    Science.gov (United States)

    Allignet, Jeanine; Liassine, Nadia; El Solh, Névine

    1998-01-01

    We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogramin A and that exhibits 58.2 to 69.8% aa identity with the Vat, VatB, and SatA proteins, and (ii) vgbB, encoding a 295-aa lactonase that inactivates streptogramin B and that shows 67% aa identity with the Vgb lactonase. pIP1714 includes a 2,985-bp fragment also found in two rolling-circle replication and mobilizable plasmids, pUB110 and pBC16, from gram-positive bacteria. In all three plasmids, the common fragment was delimited by two direct repeats of four nucleotides (GGGC) and included (i) putative genes closely related to repB, which encodes a replication protein, and to pre(mob), which encodes a protein required for conjugative mobilization and site-specific recombination, and (ii) sequences very similar to the double- and single-strand origins (dso, ssoU) and the recombination site, RSA. The antibiotic resistance genes repB and pre(mob) carried by each of these plasmids were found in the same transcriptional orientation. PMID:9661023

  17. Characterization of a staphylococcal plasmid related to pUB110 and carrying two novel genes, vatC and vgbB, encoding resistance to streptogramins A and B and similar antibiotics.

    Science.gov (United States)

    Allignet, J; Liassine, N; el Solh, N

    1998-07-01

    We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogramin A and that exhibits 58.2 to 69.8% aa identity with the Vat, VatB, and SatA proteins, and (ii) vgbB, encoding a 295-aa lactonase that inactivates streptogramin B and that shows 67% aa identity with the Vgb lactonase. pIP1714 includes a 2,985-bp fragment also found in two rolling-circle replication and mobilizable plasmids, pUB110 and pBC16, from gram-positive bacteria. In all three plasmids, the common fragment was delimited by two direct repeats of four nucleotides (GGGC) and included (i) putative genes closely related to repB, which encodes a replication protein, and to pre(mob), which encodes a protein required for conjugative mobilization and site-specific recombination, and (ii) sequences very similar to the double- and single-strand origins (dso, ssoU) and the recombination site, RSA. The antibiotic resistance genes repB and pre(mob) carried by each of these plasmids were found in the same transcriptional orientation.

  18. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  19. NDM-1 encoded by a pNDM-HN380-like plasmid pNDM-BJ03 in clinical Enterobacter cloacae.

    Science.gov (United States)

    Lü, Yang; Liu, Wei; Liang, Hui; Zhao, Shulong; Zhang, Wei; Liu, Jia; Jin, Cheng; Hu, Hongyan

    2018-02-01

    A carbapenemase-producing Enterobacter cloacae hhy03 with a bla NDM-1 and bla SHV-12 -coharboring plasmid was isolated from a sputum specimen of a patient. This is the third nucleotide sequence report of bla NDM-1 -harboring plasmid from Enterobacter cloacae that have caused lethal infections in China, indicating the spread of NDM-1 by IncX3 plasmid between Enterobacteriaceae. Copyright © 2017. Published by Elsevier Inc.

  20. Immunogenicity of DNA vaccines encoding simian immunodeficiency virus antigen targeted to dendritic cells in rhesus macaques.

    Directory of Open Access Journals (Sweden)

    Matthias Tenbusch

    Full Text Available BACKGROUND: Targeting antigens encoded by DNA vaccines to dendritic cells (DCs in the presence of adjuvants enhances their immunogenicity and efficacy in mice. METHODOLOGY/PRINCIPAL FINDINGS: To explore the immunogenicity of this approach in non-human primates, we generated a single chain antibody to the antigen uptake receptor DEC-205 expressed on rhesus macaque DCs. DNA vaccines encoding this single chain antibody fused to the SIV capsid protein were delivered to six monkeys each by either intramuscular electroporation or conventional intramuscular injection co-injected or not with poly ICLC, a stabilized poly I: C analogue, as adjuvant. Antibodies to capsid were induced by the DC-targeting and non-targeting control DNA delivered by electroporation while conventional DNA immunization at a 10-fold higher dose of DNA failed to induce detectable humoral immune responses. Substantial cellular immune responses were also observed after DNA electroporation of both DNAs, but stronger responses were induced by the non-targeting vaccine. Conventional immunization with the DC-targeting DNA at a 10-fold higher dose did not give rise to substantial cellular immune responses, neither when co-injected with poly ICLC. CONCLUSIONS/SIGNIFICANCE: The study confirms the potent immunogenicity of DNA vaccines delivered by electroporation. Targeting the DNA via a single chain antibody to DEC-205 expressed by DCs, however, does not improve the immunogenicity of the antigens in non-human primates.

  1. Complete nucleotide sequence of pGA45, a 140,698-bp incFIIY plasmid encoding blaIMI-3-mediated carbapenem resistance, from river sediment

    Directory of Open Access Journals (Sweden)

    Bingjun eDang

    2016-02-01

    Full Text Available Plasmid pGA45 was isolated from the sediment of Haihe River using E. coli CV601 (gfp-tagged as recipients and indigenous bacteria from sediment as donors. This plasmid confers reduced susceptibility to imipenem which belongs to carbapenem group. Plasmid pGA45 was fully sequenced on an Illumina HiSeq 2000 sequencing system. The complete sequence of plasmid pGA45 was 140,698 bp in length with an average G+C content of 52.03%. Sequence analysis shows that pGA45 belongs to incFIIY group and harbors a backbone region shares high homology and gene synteny to several other incF plasmids including pNDM1_EC14653, pYDC644, pNDM-Ec1GN574, pRJF866, pKOX_NDM1 and pP10164-NDM. In addition to the backbone region, plasmid pGA45 harbors two notable features including one blaIMI-3-containing region and one type VI secretion system region. The blaIMI-3-containing region is responsible for bacteria carbapenem resistance and the type VI secretion system region is probably involved in bacteria virulence, respectively. Plasmid pGA45 represents the first complete nucleotide sequence of the blaIMI-harboring plasmid from environment sample and the sequencing of this plasmid provided insight into the architecture used for the dissemination of blaIMI carbapenemase genes.

  2. Inactivation efficiency of plasmid-encoded antibiotic resistance genes during water treatment with chlorine, UV, and UV/H2O2.

    Science.gov (United States)

    Yoon, Younggun; Chung, Hay Jung; Wen Di, Doris Yoong; Dodd, Michael C; Hur, Hor-Gil; Lee, Yunho

    2017-10-15

    This study assessed the inactivation efficiency of plasmid-encoded antibiotic resistance genes (ARGs) both in extracellular form (e-ARG) and present within Escherichia coli (intracellular form, i-ARG) during water treatment with chlorine, UV (254 nm), and UV/H 2 O 2 . A quantitative real-time PCR (qPCR) method was used to quantify the ARG damage to amp R (850 bp) and kan R (806 bp) amplicons, both of which are located in the pUC4K plasmid. The plate count and flow cytometry methods were also used to determine the bacterial inactivation parameters, such as culturability and membrane damage, respectively. In the first part of the study, the kinetics of E. coli inactivation and ARG damage were determined in phosphate buffered solutions. The ARG damage occurred much more slowly than E. coli inactivation in all cases. To achieve 4-log reduction of ARG concentration at pH 7, the required chlorine exposure and UV fluence were 33-72 (mg × min)/L for chlorine and 50-130 mJ/cm 2 for UV and UV/H 2 O 2 . After increasing pH from 7 to 8, the rates of ARG damage decreased for chlorine, while they did not vary for UV and UV/H 2 O 2 . The i-ARGs mostly showed lower rates of damage compared to the e-ARGs due to the protective roles of cellular components against oxidants and UV. The contribution of OH radicals to i-ARG damage was negligible in UV/H 2 O 2 due to significant OH radical scavenging by cellular components. In all cases, the ARG damage rates were similar for amp R versus kan R , except for the chlorination of e-ARGs, in which the damage to amp R occurred faster than that to kan R . Chlorine and UV dose-dependent ARG inactivation levels determined in a wastewater effluent matrix could be reasonably explained by the kinetic data obtained from the phosphate buffered solutions and the expected oxidant (chlorine and OH radicals) demands by water matrix components. These results can be useful in optimizing chlorine and UV-based disinfection systems to achieve ARG

  3. Quantification of plasmid DNA reference materials for Shiga toxin-producing Escherichia coli based on UV, HR-ICP-MS and digital PCR.

    Science.gov (United States)

    Liang, Wen; Xu, Li; Sui, Zhiwei; Li, Yan; Li, Lanying; Wen, Yanli; Li, Chunhua; Ren, Shuzhen; Liu, Gang

    2016-01-01

    The accuracy and metrology traceability of DNA quantification is becoming a critical theme in many fields, including diagnosis, forensic analysis, microorganism detection etc. Thus the research of DNA reference materials (RMs) and consistency of DNA quantification methods has attracted considerable research interest. In this work, we developed 3 plasmid candidate RMs, containing 3 target genes of Escherichia coli O157:H7 (E. coli O157:H7) and other Shiga toxin-producing Escherichia coli (STEC): stx1, stx2, and fliC (h7) respectively. Comprehensive investigation of the plasmid RMs was performed for their sequence, purity, homogeneity and stability, and then the concentration was quantified by three different methods: ultraviolet spectrophotometer (UV), high resolution inductively coupled plasma mass spectrometry (HR-ICP-MS) and digital PCR. As a routinely applied method for DNA analysis, UV was utilized for the quantification (OD260) and purity analysis for the plasmids. HR-ICP-MS quantified the plasmid DNA through analysing the phosphorus in DNA molecules. Digital PCR distributed the DNA samples onto a microarray chip containing thousands of reaction chambers, and quantified the DNA copy numbers by analysing the number of positive signals without any calibration curves needed. Based on the high purification of the DNA reference materials and the optimization of dPCR analysis, we successfully achieved good consistency between UV, HR-ICP-MS and dPCR, with relative deviations lower than 10 %. We then performed the co-quantification of 3 DNA RMs with three different methods together, and the uncertainties of their concentration were evaluated. Finally, the certified values and expanded uncertainties for 3 DNA RMs (pFliC, pStx1 and pStx2) were (1.60 ± 0.10) × 10(10) copies/μL, (1.53 ± 0.10) × 10(10) copies/μL and (1.70 ± 0.11) × 10(10) copies/μL respectively.Graphical abstractWe developed 3 plasmid candidate RMs, containing 3 target genes of

  4. Effect of serotonin on the expression of antigens and DNA levels in Yersinia pestis cells with different plasmid content

    Science.gov (United States)

    Klueva, Svetlana N.; Korsukov, Vladimir N.; Schukovskaya, Tatyana N.; Kravtsov, Alexander L.

    2004-08-01

    Using flow cytometry (FCM) the influence of exogenous serotonin on culture growth, DNA content and fluorescence intensity of cells binding FITC-labelled plague polyclonal immunoglobulins was studied in Yersinia pestis EV (pFra+, pCad+, pPst+), Yersinia pestis KM218 (pFra-, pCad-, pPst-), Yersinia pestis KM 216 (pFra-, pCad-, pPst+). The results have been obtained by FCM showed serotonin accelerated Yersinia pestis EV (pFra+, pCad+, pPst+), Yersinia pestis KM218 (pFra-, pCad-, pPst-) culture growth during cultivation in Hottinger broth pH 7.2 at 28°C at concentration of 10-5 M. The presence of 10-5 M serotonin in nutrient broth could modulate DNA content in 37°C growing population of plague microbe independently of their plasmid content. Serotonin have been an impact on the distribution pattern of the cells according to their phenotypical characteristics, which was reflected in the levels of population heterogeneity in the intensity of specific immunofluorescence determined by FMC.

  5. Abnormal ultraviolet mutagenic spectrum in plasmid DNA replicated in cultured fibroblasts from a patient with the skin cancer-prone disease, xeroderma pigmentosum

    International Nuclear Information System (INIS)

    Seetharam, S.; Protic-Sabljic, M.; Seidman, M.M.; Kraemer, K.H.

    1987-01-01

    A shuttle vector plasmid, pZ189, was utilized to assess the types of mutations that cells from a patient with xeroderma pigmentosum, complementation group D, introduce into ultraviolet (UV) damaged, replicating DNA. Patients with xeroderma pigmentosum have clinical and cellular UV hypersensitivity, increased frequency of sun-induced skin cancer, and deficient DNA repair. In comparison to UV-treated pZ189 replicated in DNA repair-proficient cells, there were fewer surviving plasmids, a higher frequency of plasmids with mutations, fewer plasmids with two or more mutations in the marker gene, and a new mutagenic hotspot. The major type of base substitution mutation was the G:C to A:T transition with both cell lines. These results, together with similar findings published earlier with cells from a xeroderma pigmentosum patient in complementation group A, suggest that isolated G:C to A:T somatic mutations may be particularly important in generation of human skin cancer by UV radiation

  6. A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

    International Nuclear Information System (INIS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.

    2011-01-01

    To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

  7. Phototransfection of mouse embryonic stem cells with plasmid DNA using femtosecond laser pulses

    CSIR Research Space (South Africa)

    Thobakgale, Setumo L

    2017-02-01

    Full Text Available efficient in photonic interactions with biological material. As of late, laser pulses have been used for drug and DNA delivery into cells via transient optical perforation of the cellular membrane. Thus in this study, we design and construct an optical...

  8. PlasmaDNA: a free, cross-platform plasmid manipulation program for molecular biology laboratories

    Directory of Open Access Journals (Sweden)

    Rainy Jeffrey

    2007-09-01

    Full Text Available Abstract Background Most molecular biology experiments, and the techniques associated with this field of study, involve a great deal of engineering in the form of molecular cloning. Like all forms of engineering, perfect information about the starting material is crucial for successful completion of design and strategies. Results We have generated a program that allows complete in silico simulation of the cloning experiment. Starting with a primary DNA sequence, PlasmaDNA looks for restriction sites, open reading frames, primer annealing sequences, and various common domains. The databases are easily expandable by the user to fit his most common cloning needs. PlasmaDNA can manage and graphically represent multiple sequences at the same time, and keeps in memory the overhangs at the end of the sequences if any. This means that it is possible to virtually digest fragments, to add the digestion products to the project, and to ligate together fragments with compatible ends to generate the new sequences. Polymerase Chain Reaction (PCR fragments can also be virtually generated using the primer database, automatically adding to the fragments any 5' extra sequences present in the primers. Conclusion PlasmaDNA is a program available both on Windows and Apple operating systems, designed to facilitate molecular cloning experiments by building a visual map of the DNA. It then allows the complete planning and simulation of the cloning experiment. It also automatically updates the new sequences generated in the process, which is an important help in practice. The capacity to maintain multiple sequences in the same file can also be used to archive the various steps and strategies involved in the cloning of each construct. The program is freely available for download without charge or restriction.

  9. Multiple drug resistant carbapenemases producing Acinetobacter baumannii isolates harbours multiple R-plasmids

    Directory of Open Access Journals (Sweden)

    Rajagopalan Saranathan

    2014-01-01

    Full Text Available Background & objectives: The nosocomial human pathogen Acinetobacter baumannii has high propensity to develop resistance to antimicrobials and to become multidrug resistant (MDR, consequently complicating the treatment. This study was carried out to investigate the presence of resistant plasmids (R-plasmids among the clinical isolates of A. baumannii. In addition, the study was performed to check the presence of common β-lactamases encoding genes on these plasmids. Methods: A total of 55 clinical isolates of A. baumannii were included in the study and all were subjected to plasmid DNA isolation, followed by PCR to check the presence of resistance gene determinants such as blaOXA-23 , blaOXA-51, blaOXA-58 and blaIMP-1 on these plasmids that encode for oxacillinase (OXA and metallo-β-lactamase (MBL type of carbapenemases. Plasmid curing experiments were carried out on selected isolates using ethidium bromide and acridine orange as curing agents and the antibiotic resistance profiles were evaluated before and after curing. Results: All the isolates were identified as A. baumannii by 16SrDNA amplification and sequencing. Plasmid DNA isolated from these isolates showed the occurrence of multiple plasmids with size ranging from 500bp to ≥ 25 kb. The percentage of blaOXA-51 and blaOXA-23 on plasmids were found to be 78 and 42 per cent, respectively and 20 isolates (36% carried blaIMP-1 gene on plasmids. Significant difference was observed in the antibiograms of plasmid cured isolates when compared to their parental ones. The clinical isolates became susceptible to more than two antibiotic classes after curing of plasmids indicating plasmid borne resistance. Interpretation & conclusions: Our study determined the plasmid mediated resistance mechanisms and occurrence of different resistance genes on various plasmids isolated from MDR A. baumannii. The present findings showed the evidence for antibiotic resistance mediated through multiple plasmids in

  10. Isolation and characterization of two cDNA clones encoding for glutamate dehydrogenase in Nicotiana plumbaginifolia.

    Science.gov (United States)

    Ficarelli, A; Tassi, F; Restivo, F M

    1999-03-01

    We have isolated two full length cDNA clones encoding Nicotiana plumbaginifolia NADH-glutamate dehydrogenase. Both clones share amino acid boxes of homology corresponding to conserved GDH catalytic domains and putative mitochondrial targeting sequence. One clone shows a putative EF-hand loop. The level of the two transcripts is affected differently by carbon source.

  11. Preparation and Characterization of Cationic PLA-PEG Nanoparticles for Delivery of Plasmid DNA

    Directory of Open Access Journals (Sweden)

    Zou Weiwei

    2009-01-01

    Full Text Available Abstract The purpose of the present work was to formulate and evaluate cationic poly(lactic acid-poly(ethylene glycol (PLA-PEG nanoparticles as novel non-viral gene delivery nano-device. Cationic PLA-PEG nanoparticles were prepared by nanoprecipitation method. The gene loaded nanoparticles were obtained by incubating the report gene pEGFP with cationic PLA-PEG nanoparticles. The physicochemical properties (e.g., morphology, particle size, surface charge, DNA binding efficiency and biological properties (e.g., integrity of the released DNA, protection from nuclease degradation, plasma stability, in vitro cytotoxicity, and in vitro transfection ability in Hela cells of the gene loaded PLA-PEG nanoparticles were evaluated, respectively. The obtained cationic PLA-PEG nanoparticles and gene loaded nanoparticles were both spherical in shape with average particle size of 89.7 and 128.9 nm, polydispersity index of 0.185 and 0.161, zeta potentials of +28.9 and +16.8 mV, respectively. The obtained cationic PLA-PEG nanoparticles with high binding efficiency (>95% could protect the loaded DNA from the degradation by nuclease and plasma. The nanoparticles displayed sustained-release properties in vitro and the released DNA maintained its structural and functional integrity. It also showed lower cytotoxicity than Lipofectamine 2000 and could successfully transfect gene into Hela cells even in presence of serum. It could be concluded that the established gene loaded cationic PLA-PEG nanoparticles with excellent properties were promising non-viral nano-device, which had potential to make cancer gene therapy achievable.

  12. Electric field-mediated transport of plasmid DNA in tumor interstitium in vivo.

    Science.gov (United States)

    Henshaw, Joshua W; Zaharoff, David A; Mossop, Brian J; Yuan, Fan

    2007-11-01

    Local pulsed electric field application is a method for improving non-viral gene delivery. Mechanisms of the improvement include electroporation and electrophoresis. To understand how electrophoresis affects pDNA delivery in vivo, we quantified the magnitude of electric field-induced interstitial transport of pDNA in 4T1 and B16.F10 tumors implanted in mouse dorsal skin-fold chambers. Four different electric pulse sequences were used in this study, each consisted of 10 identical pulses that were 100 or 400 V/cm in strength and 20 or 50 ms in duration. The interval between consecutive pulses was 1 s. The largest distance of transport was obtained with the 400 V/cm and 50 ms pulse, and was 0.23 and 0.22 microm/pulse in 4T1 and B16.F10 tumors, respectively. There were no significant differences in transport distances between 4T1 and B16.F10 tumors. Results from in vivo mapping and numerical simulations revealed an approximately uniform intratumoral electric field that was predominantly in the direction of the applied field. The data in the study suggested that interstitial transport of pDNA induced by a sequence of ten electric pulses was ineffective for macroscopic delivery of genes in tumors. However, the induced transport was more efficient than passive diffusion.

  13. KEY COMPARISON: CCQM-K61: Quantitation of a linearised plasmid DNA, based on a matched standard in a matrix of non-target DNA

    Science.gov (United States)

    Woolford, Alison; Holden, Marcia; Salit, Marc; Burns, Malcolm; Ellison, Stephen L. R.

    2009-01-01

    Key comparison CCQM-K61 was performed to demonstrate and document the capability of interested national metrology institutes in the determination of the quantity of specific DNA target in an aqueous solution. The study provides support for the following measurement claim: "Quantitation of a linearised plasmid DNA, based on a matched standard in a matrix of non-target DNA". The comparison was an activity of the Bioanalysis Working Group (BAWG) of the Comité Consultatif pour la Quantité de Matière and was coordinated by NIST (Gaithersburg, USA) and LGC (Teddington, UK). The following laboratories (in alphabetical order) participated in this key comparison. DMSC (Thailand); IRMM (European Union); KRISS (Republic of Korea); LGC (UK); NIM (China); NIST (USA); NMIA (Australia); NMIJ (Japan); VNIIM (Russian Federation) Good agreement was observed between the reported results of all nine of the participants. Uncertainty estimates did not account fully for the dispersion of results even after allowance for possible inhomogeneity in calibration materials. Preliminary studies suggest that the effects of fluorescence threshold setting might contribute to the excess dispersion, and further study of this topic is suggested Main text. To reach the main text of this paper, click on Final Report. Note that this text is that which appears in Appendix B of the BIPM key comparison database kcdb.bipm.org/. The final report has been peer-reviewed and approved for publication by the CCQM, according to the provisions of the CIPM Mutual Recognition Arrangement (MRA).

  14. Characterization of a Staphylococcal Plasmid Related to pUB110 and Carrying Two Novel Genes, vatC and vgbB, Encoding Resistance to Streptogramins A and B and Similar Antibiotics

    OpenAIRE

    Allignet, Jeanine; Liassine, Nadia; El Solh, Névine

    1998-01-01

    We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogr...

  15. Plasmid DNA studies in Lactobacillus plantarum strains isolated from olive fermentations: production of and immunity to plantaricin OL15 is associated to a 9.6 Kb plasmid (pOL15

    Directory of Open Access Journals (Sweden)

    Mourad, Kacem

    2007-06-01

    Full Text Available Previously 12 Lactobacillus plantarum strains were isolated from fermented olives. Among these, only L. plantarum OL15 produced bacteriocin (plantaricin OL15. In this study, the 12 strains were examined for plasmid DNA content. Of these, 9 strains have shown one to three plasmid bands ranging in size from 5.4 to 12.2 kb. L. plantarum OL15 exhibited one plasmid (9.6 kb which was named pOL15. After curing with novobiocin and ethidium bromide, the plasmid profile analysis of non producing derivatives, showed that the 9.6 kb plasmid pOL15 harbored by the parental strain had been lost in all cases and none of them regained the ability to produce plantaricin OL15 suggesting that the production of plantaricin OL15 is plasmid linked. Plantaricin OL15 was not inactived by amylase and lipase suggesting that plantaricin OL15 activity was not dependent on the presence of either a carbohydrate or lipid moiety. Plantaricin OL15 showed activity against lactic acid bacteria of different species and also against olive spoilage and phytopathogenic bacteria, including Pseudomonas and Erwinia.En un estudio previo, se aislaron 12 cepas de Lactobacillus plantarum a partir de aceitunas fermentadas. Entre ellas, solo L. plantarum OL15 produjo bacteriocinas (plantaricin OL15. En este estudio, se examinó el contenido de AND plásmido en las 12 cepas citadas. Entre ellas, 9 cepas han mostrado de una a tres bandas de plásmido con tamaños en el rango de 5.4 a 12.2 kb. L. plantarum OL15 exhibió un plásmido (9.6 kb que se denominó pOL15. Después del curado con novobiocina y bromuro de etidio, la pérdida del plásmido pOL15 asociada a la pérdida de su facultad para producir plantaricin OL15, sugiere que la producción de plantaricina OL15 está ligada al plásmido. La plantaricin OL15 no se inactivó por amilasa ni por lipasa sugiriendo que su actividad no es dependiente de la presencia de carbohidratos o lípidos. La plantaricina OL15 mostró actividad frente a

  16. Encoded novel forms of HSP70 or a cytolytic protein increase DNA vaccine potency.

    Science.gov (United States)

    Garrod, Tamsin; Grubor-Bauk, Branka; Yu, Stanley; Gargett, Tessa; Gowans, Eric J

    2014-01-01

    In humans, DNA vaccines have failed to demonstrate the equivalent levels of immunogenicity that were shown in smaller animals. Previous studies have encoded adjuvants, predominantly cytokines, within these vaccines in an attempt to increase antigen-specific immune responses. However, these strategies have lacked breadth of innate immune activation and have led to disappointing results in clinical trials. Damage associated molecular patterns (DAMPs) have been identified as pattern recognition receptor (PRR) agonists. DAMPs can bind to a wide range of PRRs on dendritic cells (DCs) and thus our studies have aimed to utilize this characteristic to act as an adjuvant in a DNA vaccine approach. Specifically, HSP70 has been identified as a DAMP, but has been limited by its lack of accessibility to PRRs in and on DCs. Here, we discuss the promising results achieved with the inclusion of membrane-bound or secreted HSP70 into a DNA vaccine encoding HIV gag as the model immunogen.

  17. Longevity of rAAV vector and plasmid DNA in blood after intramuscular injection in nonhuman primates: implications for gene doping.

    Science.gov (United States)

    Ni, W; Le Guiner, C; Gernoux, G; Penaud-Budloo, M; Moullier, P; Snyder, R O

    2011-07-01

    Legitimate uses of gene transfer technology can benefit from sensitive detection methods to determine vector biodistribution in pre-clinical studies and in human clinical trials, and similar methods can detect illegitimate gene transfer to provide sports-governing bodies with the ability to maintain fairness. Real-time PCR assays were developed to detect a performance-enhancing transgene (erythropoietin, EPO) and backbone sequences in the presence of endogenous cellular sequences. In addition to developing real-time PCR assays, the steps involved in DNA extraction, storage and transport were investigated. By real-time PCR, the vector transgene is distinguishable from the genomic DNA sequence because of the absence of introns, and the vector backbone can be identified by heterologous gene expression control elements. After performance of the assays was optimized, cynomolgus macaques received a single dose by intramuscular (IM) injection of plasmid DNA, a recombinant adeno-associated viral vector serotype 1 (rAAV1) or a rAAV8 vector expressing cynomolgus macaque EPO. Macaques received a high plasmid dose intended to achieve a significant, but not life-threatening, increase in hematocrit. rAAV vectors were used at low doses to achieve a small increase in hematocrit and to determine the limit of sensitivity for detecting rAAV sequences by single-step PCR. DNA extracted from white blood cells (WBCs) was tested to determine whether WBCs can be collaterally transfected by plasmid or transduced by rAAV vectors in this context, and can be used as a surrogate marker for gene doping. We demonstrate that IM injection of a conventional plasmid and rAAV vectors results in the presence of DNA that can be detected at high levels in blood before rapid elimination, and that rAAV genomes can persist for several months in WBCs.

  18. Multi-Probe Based Artificial DNA Encoding and Matching Classifier for Hyperspectral Remote Sensing Imagery

    Directory of Open Access Journals (Sweden)

    Ke Wu

    2016-08-01

    Full Text Available In recent years, a novel matching classification strategy inspired by the artificial deoxyribonucleic acid (DNA technology has been proposed for hyperspectral remote sensing imagery. Such a method can describe brightness and shape information of a spectrum by encoding the spectral curve into a DNA strand, providing a more comprehensive way for spectral similarity comparison. However, it suffers from two problems: data volume is amplified when all of the bands participate in the encoding procedure and full-band comparison degrades the importance of bands carrying key information. In this paper, a new multi-probe based artificial DNA encoding and matching (MADEM method is proposed. In this method, spectral signatures are first transformed into DNA code words with a spectral feature encoding operation. After that, multiple probes for interesting classes are extracted to represent the specific fragments of DNA strands. During the course of spectral matching, the different probes are compared to obtain the similarity of different types of land covers. By computing the absolute vector distance (AVD between different probes of an unclassified spectrum and the typical DNA code words from the database, the class property of each pixel is set as the minimum distance class. The main benefit of this strategy is that the risk of redundant bands can be deeply reduced and critical spectral discrepancies can be enlarged. Two hyperspectral image datasets were tested. Comparing with the other classification methods, the overall accuracy can be improved from 1.22% to 10.09% and 1.19% to 15.87%, respectively. Furthermore, the kappa coefficient can be improved from 2.05% to 15.29% and 1.35% to 19.59%, respectively. This demonstrated that the proposed algorithm outperformed other traditional classification methods.

  19. Sequence of a cloned cDNA encoding human ribosomal protein S11

    Energy Technology Data Exchange (ETDEWEB)

    Lott, J B; Mackie, G A

    1988-02-11

    The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

  20. Adenoviral DNA replication: DNA sequences and enzymes required for initiation in vitro

    International Nuclear Information System (INIS)

    Stillman, B.W.; Tamanoi, F.

    1983-01-01

    In this paper evidence is provided that the 140,000-dalton DNA polymerase is encoded by the adenoviral genome and is required for the initiation of DNA replication in vitro. The DNA sequences in the template DNA that are required for the initiation of replication have also been identified, using both plasmid DNAs and synthetic oligodeoxyribonucleotides. 48 references, 7 figures, 1 table

  1. Spread of clonally related Escherichia coli harboring an IncA/C1 plasmid encoding IMP-8 and its recruitment into an unrelated MCR-1-containing isolate.

    Science.gov (United States)

    Elena, Alan; Cejas, Daniela; Magariños, Francisco; Jewtuchowicz, Virginia; Facente, Andrea; Gutkind, Gabriel; Di Conza, José; Radice, Marcela

    2018-04-16

    Ten IMP-8-producing Escherichia coli isolates were recovered from the surveillance cultures of a neonatal intensive care unit, of which eight were clonally related. A 168.2-kb- bla IMP-8 plasmid was fully sequenced, and it corresponded to the recently described IncA/C1-ST13. This plasmid was detected in all isolates, even in those no clonally related. One unrelated isolate was also resistant to colistin and positive for mcr-1. This marker was located in a 62.7-kb-IncI2 plasmid, which was also fully sequenced. Copyright © 2018 American Society for Microbiology.

  2. Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

    International Nuclear Information System (INIS)

    Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

    1985-01-01

    Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, 32 P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV

  3. Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

    Energy Technology Data Exchange (ETDEWEB)

    Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

    1985-02-01

    Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, /sup 32/P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV.

  4. Modeling the yield of double-strand breaks due to formation of multiply damaged sites in irradiated plasmid DNA

    International Nuclear Information System (INIS)

    Xapsos, M.A.; Pogozelski, W.K.

    1996-01-01

    Although double-strand breaks have long been recognized as an important type of DNa lesion, it is well established that this broad class of damage does not correlate well with indicators of the effectiveness of radiation as the cellular level. Assays of double-strand breaks do not distinguish the degree of complexity or clustering of singly damaged sites produced in a single energy deposition event, which is currently hypothesized to be key to understanding cellular end points. As a step toward this understanding, double-strand breaks that are formed proportionally to dose in plasmid DNA are analyzed from the mechanistic aspect to evaluate the yield that arises from multiply damaged sites as hypothesized by Ward (Prog. Nucleic Acid Res. Mol. Biol. 35, 95-125, 1988) and Goodhead (Int. J. Radiat. Biol. 65, 7-17, 1994) as opposed to the yield that arises form single hydroxyl radicals as hypothesized by Siddiqi and Bothe (Radiat. Res. 112, 449-463, 1987). For low-LET radiation such as γ rays, the importance of multiply damaged sites is shown to increase with the solution's hydroxyl radical scavenging capacity. For moderately high-LET radiation such as 100 keV/μm helium ions, a much different behavior is observed. In this case, a large fraction of double-strand breaks are formed as a result of multiply damaged sties over a broad range of scavenging conditions. Results also indicate that the RBE for common cellular end points correlates more closely with the RBE for common cellular end points correlates more closely with the RBE for multiply damaged sites than with the RBE for total double-strand breaks over a range of LET up to at least 100 keV/μm. 22 refs., 3 figs., 2 tabs

  5. [Molecular cloning and characterization of cDNA of the rpc10+ gene encoding the smallest subunit of nuclear RNA polymerases of Schizosaccharomyces pombe].

    Science.gov (United States)

    Shpakovskiĭ, G V; Lebedenko, E N

    1997-05-01

    The full-length cDNA of the rpc10+ gene encoding mini-subunit Rpc10, which is common for all three nuclear RNA polymerases of the fission yeast Schizosaccharomyces pombe, was cloned and sequenced. The Rpc10 subunit of Sz. pombe and its homologs from S. cerevisiae and H. sapiens are positively charged proteins with a highly conserved C-terminal region and an invariant zinc-binding domain (Zn-finger) of a typical amino acid composition: YxCx2Cx12RCx2CGxR. Functional tests of heterospecific complementation, using tetrad analysis or plasmid shuffling, showed that the Rpc10 subunit of Sz. pombe can successfully replace the homologous ABC10 alpha subunit in nuclear RNA polymerases I-III of S. cerevisiae.

  6. Novel p38α MAP kinase inhibitors identified from yoctoReactor DNA-encoded small molecule library

    DEFF Research Database (Denmark)

    Petersen, L. K.; Blakskjær, P.; Chaikuad, A.

    2016-01-01

    A highly specific and potent (7 nM cellular IC50) inhibitor of p38α kinase was identified directly from a 12.6 million membered DNA-encoded small molecule library. This was achieved using the high fidelity yoctoReactor technology (yR) for preparing the DNA-encoded library, and a homogeneous...... interactions. Moreover, the crystal structure showed, that although buried in the p38α active site, the original DNA attachment point of the compound was accessible through a channel created by the distorted P-loop conformation. This study demonstrates the usability of DNA-encoded library technologies...

  7. Functional activity of plasmid DNA after entry into the atmosphere of earth investigated by a new biomarker stability assay for ballistic spaceflight experiments.

    Directory of Open Access Journals (Sweden)

    Cora S Thiel

    Full Text Available Sounding rockets represent an excellent platform for testing the influence of space conditions during the passage of Earth's atmosphere and re-entry on biological, physical and chemical experiments for astrobiological purposes. We designed a robust functionality biomarker assay to analyze the biological effects of suborbital spaceflights prevailing during ballistic rocket flights. During the TEXUS-49 rocket mission in March 2011, artificial plasmid DNA carrying a fluorescent marker (enhanced green fluorescent protein: EGFP and an antibiotic resistance cassette (kanamycin/neomycin was attached on different positions of rocket exterior; (i circular every 90 degree on the outer surface concentrical of the payload, (ii in the grooves of screw heads located in between the surface application sites, and (iii on the surface of the bottom side of the payload. Temperature measurements showed two major peaks at 118 and 130 °C during the 780 seconds lasting flight on the inside of the recovery module, while outer gas temperatures of more than 1000 °C were estimated on the sample application locations. Directly after retrieval and return transport of the payload, the plasmid DNA samples were recovered. Subsequent analyses showed that DNA could be recovered from all application sites with a maximum of 53% in the grooves of the screw heads. We could further show that up to 35% of DNA retained its full biological function, i.e., mediating antibiotic resistance in bacteria and fluorescent marker expression in eukaryotic cells. These experiments show that our plasmid DNA biomarker assay is suitable to characterize the environmental conditions affecting DNA during an atmospheric transit and the re-entry and constitute the first report of the stability of DNA during hypervelocity atmospheric transit indicating that sounding rocket flights can be used to model the high-speed atmospheric entry of organics-laden artificial meteorites.

  8. Cloning of cDNA encoding steroid 11β-hydroxylase (P450c11)

    International Nuclear Information System (INIS)

    Chua, S.C.; Szabo, P.; Vitek, A.; Grzeschik, K.H.; John, M.; White, P.C.

    1987-01-01

    The authors have isolated bovine and human adrenal cDNA clones encoding the adrenal cytochrome P-450 specific for 11β-hydroxylation (P450c11). A bovine adrenal cDNA library constructed in the bacteriophage λ vector gt10 was probed with a previously isolated cDNA clone corresponding to part of the 3' untranslated region of the 4.2-kilobase (kb) mRNA encoding P450c11. Several clones with 3.2-kb cDNA inserts were isolated. Sequence analysis showed that they overlapped the original probe by 300 base pairs (bp). Combined cDNA and RNA sequence data demonstrated a continuous open reading frame of 1509 bases. P450c11 is predicted to contain 479 amino acid residues in the mature protein in addition to a 24-residue amino-terminal mitochondrial signal sequence. A bovine clone was used to isolate a homologous clone with a 3.5-kb insert from a human adrenal cDNA library. A region of 1100 bp was 81% homologous to 769 bp of the coding sequence of the bovine cDNA except for a 400-bp segment presumed to be an unprocessed intron. Hybridization of the human cDNA to DNA from a panel of human-rodent somatic cell hybrid lines and in situ hybridization to metaphase spreads of human chromosomes localized the gene to the middle of the long arm of chromosome 8. These data should be useful in developing reagents for heterozygote detection and prenatal diagnosis of 11β-hydroxylase deficiency, the second most frequent cause of congenital adrenal hyperplasia

  9. KPC-mediated resistance in Klebsiella pneumoniae in two hospitals in Padua, Italy, June 2009-December 2011: massive spreading of a KPC-3-encoding plasmid and involvement of non-intensive care units

    Directory of Open Access Journals (Sweden)

    Richter Sara N

    2012-07-01

    Full Text Available Abstract Background Klebsiella pneumoniae carbapenemases (KPCs producing bacteria have emerged as a cause of multidrug-resistant nosocomial infections worldwide. KPCs are plasmid-encoded enzymes capable of hydrolysing a broad spectrum of beta-lactams, including carbapenems and monobactams, therefore worryingly limiting antimicrobial treatment options. Analysis of circulating bacterial strains and KPC alleles may help understanding the route of KPC dissemination and therefore help containing the infection. Methods KPC-producing Klebsiella pneumoniae dissemination in two 1580- and 300- bed hospitals in Padua, Italy, from initial outbreak in 2009 to late 2011 was analysed. Molecular and clinical epidemiology, including bacterial strains, KPC-encoding plasmid sequences and associated resistance genes, involved hospital wards and relocation of patients were described. Routine antimicrobial susceptibility testing and MIC of carbapenems on clinical isolates were performed. Detection of resistance genes was obtained by PCR and sequencing. MLST, PFGE and ERIC were used for molecular genotyping. Plasmid analysis was obtained by digestion with restriction enzymes and deep sequencing. Results KPC-positive clinical samples were isolated from nearly 200 patients. In the initial outbreak intensive care units were almost exclusively involved, while medical, surgical and long-term wards were successively massively concerned. Analysis of KPC alleles, plasmids and bacterial sequence types (STs indicated that during the initial outbreak KPC-3 in ST258 and KPC-2 in ST147 were each confined in one of the two surveilled hospitals. While KPC-2 dissemination was effectively contained, KPC-3 in ST258 cross-spreading was observed. The simultaneous presence of two carbapenemases, VIM-1 and KPC-2, in the same isolate was also observed in three patients. Total sequencing of plasmid content of two KPC-3 strains showed novel association of resistance plasmids. Conclusions The

  10. Gene Electrotransfer of Plasmid with Tissue Specific Promoter Encoding shRNA against Endoglin Exerts Antitumor Efficacy against Murine TS/A Tumors by Vascular Targeted Effects.

    Directory of Open Access Journals (Sweden)

    Monika Stimac

    Full Text Available Vascular targeted therapies, targeting specific endothelial cell markers, are promising approaches for the treatment of cancer. One of the targets is endoglin, transforming growth factor-β (TGF-β co-receptor, which mediates proliferation, differentiation and migration of endothelial cells forming neovasculature. However, its specific, safe and long-lasting targeting remains the challenge. Therefore, in our study we evaluated the transfection efficacy, vascular targeted effects and therapeutic potential of the plasmid silencing endoglin with the tissue specific promoter, specific for endothelial cells marker endothelin-1 (ET (TS plasmid, in comparison to the plasmid with constitutive promoter (CON plasmid, in vitro and in vivo. Tissue specificity of TS plasmid was demonstrated in vitro on several cell lines, and its antiangiogenic efficacy was demonstrated by reducing tube formation of 2H11 endothelial cells. In vivo, on a murine mammary TS/A tumor model, we demonstrated good antitumor effect of gene electrotransfer (GET of either of both plasmids in treatment of smaller tumors still in avascular phase of growth, as well as on bigger tumors, already well vascularized. In support to the observations on predominantly vascular targeted effects of endoglin, histological analysis has demonstrated an increase in necrosis and a decrease in the number of blood vessels in therapeutic groups. A significant antitumor effect was observed in tumors in avascular and vascular phase of growth, possibly due to both, the antiangiogenic and the vascular disrupting effect. Furthermore, the study indicates on the potential use of TS plasmid in cancer gene therapy since the same efficacy as of CON plasmid was determined.

  11. Gene Electrotransfer of Plasmid with Tissue Specific Promoter Encoding shRNA against Endoglin Exerts Antitumor Efficacy against Murine TS/A Tumors by Vascular Targeted Effects.

    Science.gov (United States)

    Stimac, Monika; Dolinsek, Tanja; Lampreht, Ursa; Cemazar, Maja; Sersa, Gregor

    2015-01-01

    Vascular targeted therapies, targeting specific endothelial cell markers, are promising approaches for the treatment of cancer. One of the targets is endoglin, transforming growth factor-β (TGF-β) co-receptor, which mediates proliferation, differentiation and migration of endothelial cells forming neovasculature. However, its specific, safe and long-lasting targeting remains the challenge. Therefore, in our study we evaluated the transfection efficacy, vascular targeted effects and therapeutic potential of the plasmid silencing endoglin with the tissue specific promoter, specific for endothelial cells marker endothelin-1 (ET) (TS plasmid), in comparison to the plasmid with constitutive promoter (CON plasmid), in vitro and in vivo. Tissue specificity of TS plasmid was demonstrated in vitro on several cell lines, and its antiangiogenic efficacy was demonstrated by reducing tube formation of 2H11 endothelial cells. In vivo, on a murine mammary TS/A tumor model, we demonstrated good antitumor effect of gene electrotransfer (GET) of either of both plasmids in treatment of smaller tumors still in avascular phase of growth, as well as on bigger tumors, already well vascularized. In support to the observations on predominantly vascular targeted effects of endoglin, histological analysis has demonstrated an increase in necrosis and a decrease in the number of blood vessels in therapeutic groups. A significant antitumor effect was observed in tumors in avascular and vascular phase of growth, possibly due to both, the antiangiogenic and the vascular disrupting effect. Furthermore, the study indicates on the potential use of TS plasmid in cancer gene therapy since the same efficacy as of CON plasmid was determined.

  12. Superior induction of T cell responses to conserved HIV-1 regions by electroporated alphavirus replicon DNA compared to that with conventional plasmid DNA vaccine.

    Science.gov (United States)

    Knudsen, Maria L; Mbewe-Mvula, Alice; Rosario, Maximillian; Johansson, Daniel X; Kakoulidou, Maria; Bridgeman, Anne; Reyes-Sandoval, Arturo; Nicosia, Alfredo; Ljungberg, Karl; Hanke, Tomás; Liljeström, Peter

    2012-04-01

    Vaccination using "naked" DNA is a highly attractive strategy for induction of pathogen-specific immune responses; however, it has been only weakly immunogenic in humans. Previously, we constructed DNA-launched Semliki Forest virus replicons (DREP), which stimulate pattern recognition receptors and induce augmented immune responses. Also, in vivo electroporation was shown to enhance immune responses induced by conventional DNA vaccines. Here, we combine these two approaches and show that in vivo electroporation increases CD8(+) T cell responses induced by DREP and consequently decreases the DNA dose required to induce a response. The vaccines used in this study encode the multiclade HIV-1 T cell immunogen HIVconsv, which is currently being evaluated in clinical trials. Using intradermal delivery followed by electroporation, the DREP.HIVconsv DNA dose could be reduced to as low as 3.2 ng to elicit frequencies of HIV-1-specific CD8(+) T cells comparable to those induced by 1 μg of a conventional pTH.HIVconsv DNA vaccine, representing a 625-fold molar reduction in dose. Responses induced by both DREP.HIVconsv and pTH.HIVconsv were further increased by heterologous vaccine boosts employing modified vaccinia virus Ankara MVA.HIVconsv and attenuated chimpanzee adenovirus ChAdV63.HIVconsv. Using the same HIVconsv vaccines, the mouse observations were supported by an at least 20-fold-lower dose of DNA vaccine in rhesus macaques. These data point toward a strategy for overcoming the low immunogenicity of DNA vaccines in humans and strongly support further development of the DREP vaccine platform for clinical evaluation.

  13. Antimicrobial susceptibility pattern and plasmid-mediated ...

    African Journals Online (AJOL)

    negative Staphylococci (CoNS) were isolated from clinical samples and isolates subjected to antibiotic susceptibility testing, plasmid curing and plasmid DNA isolation. Result: The highest percentages isolates were recovered from urine samples and ...

  14. Extended-Spectrum-Beta-Lactamase- and Plasmid-Encoded Cephamycinase-Producing Enterobacteria in the Broiler Hatchery as a Potential Mode of Pseudo-Vertical Transmission.

    Science.gov (United States)

    Projahn, Michaela; Daehre, Katrin; Roesler, Uwe; Friese, Anika

    2017-01-01

    Antimicrobial resistance through extended-spectrum beta-lactamases (ESBLs) and transferable (plasmid-encoded) cephamycinases (pAmpCs) represents an increasing problem in human and veterinary medicine. The presence of ESBL-/pAmpC-producing commensal enterobacteria in farm animals, such as broiler chickens, is considered one possible source of food contamination and could therefore also be relevant for human colonization. Studies on transmission routes along the broiler production chain showed that 1-day-old hatchlings are already affected. In this study, ESBL-/pAmpC-positive broiler parent flocks and their corresponding eggs, as well as various environmental and air samples from the hatchery, were analyzed. The eggs were investigated concerning ESBL-/pAmpC-producing enterobacteria on the outer eggshell surface (before/after disinfection), the inner eggshell surface, and the egg content. Isolates were analyzed concerning their species, their phylogroup in the case of Escherichia coli strains, the respective resistance genes, and the phenotypical antibiotic resistance. Of the tested eggs, 0.9% (n = 560) were contaminated on their outer shell surface. Further analyses using pulsed-field gel electrophoresis showed a relationship of these strains to those isolated from the corresponding parent flocks, which demonstrates a pseudo-vertical transfer of ESBL-/pAmpC-producing enterobacteria into the hatchery. Resistant enterobacteria were also found in environmental samples from the hatchery, such as dust or surfaces which could pose as a possible contamination source for the hatchlings. All 1-day-old chicks tested negative directly after hatching. The results show a possible entry of ESBL-/pAmpC-producing enterobacteria from the parent flocks into the hatchery; however, the impact of the hatchery on colonization of the hatchlings seems to be low. ESBL-/pAmpC-producing enterobacteria occur frequently in broiler-fattening farms. Recent studies investigated the prevalence and

  15. DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries.

    Science.gov (United States)

    Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg

    2014-04-15

    DNA-encoded chemical libraries (DECLs) represent a promising tool in drug discovery. DECL technology allows the synthesis and screening of chemical libraries of unprecedented size at moderate costs. In analogy to phage-display technology, where large antibody libraries are displayed on the surface of filamentous phage and are genetically encoded in the phage genome, DECLs feature the display of individual small organic chemical moieties on DNA fragments serving as amplifiable identification barcodes. The DNA-tag facilitates the synthesis and allows the simultaneous screening of very large sets of compounds (up to billions of molecules), because the hit compounds can easily be identified and quantified by PCR-amplification of the DNA-barcode followed by high-throughput DNA sequencing. Several approaches have been used to generate DECLs, differing both in the methods used for library encoding and for the combinatorial assembly of chemical moieties. For example, DECLs can be used for fragment-based drug discovery, displaying a single molecule on DNA or two chemical moieties at the extremities of complementary DNA strands. DECLs can vary substantially in the chemical structures and the library size. While ultralarge libraries containing billions of compounds have been reported containing four or more sets of building blocks, also smaller libraries have been shown to be efficient for ligand discovery. In general, it has been found that the overall library size is a poor predictor for library performance and that the number and diversity of the building blocks are rather important indicators. Smaller libraries consisting of two to three sets of building blocks better fulfill the criteria of drug-likeness and often have higher quality. In this Account, we present advances in the DECL field from proof-of-principle studies to practical applications for drug discovery, both in industry and in academia. DECL technology can yield specific binders to a variety of target

  16. Discovery of Potent and Selective Inhibitors for ADAMTS-4 through DNA-Encoded Library Technology (ELT).

    Science.gov (United States)

    Ding, Yun; O'Keefe, Heather; DeLorey, Jennifer L; Israel, David I; Messer, Jeffrey A; Chiu, Cynthia H; Skinner, Steven R; Matico, Rosalie E; Murray-Thompson, Monique F; Li, Fan; Clark, Matthew A; Cuozzo, John W; Arico-Muendel, Christopher; Morgan, Barry A

    2015-08-13

    The aggrecan degrading metalloprotease ADAMTS-4 has been identified as a novel therapeutic target for osteoarthritis. Here, we use DNA-encoded Library Technology (ELT) to identify novel ADAMTS-4 inhibitors from a DNA-encoded triazine library by affinity selection. Structure-activity relationship studies based on the selection information led to the identification of potent and highly selective inhibitors. For example, 4-(((4-(6,7-dimethoxy-3,4-dihydroisoquinolin-2(1H)-yl)-6-(((4-methylpiperazin-1-yl)methyl)amino)-1,3,5-triazin-2-yl)amino)methyl)-N-ethyl-N-(m-tolyl)benzamide has IC50 of 10 nM against ADAMTS-4, with >1000-fold selectivity over ADAMT-5, MMP-13, TACE, and ADAMTS-13. These inhibitors have no obvious zinc ligand functionality.

  17. Frequency and persistency of DNA vaccine encoding GP25 by oral on common carp

    Directory of Open Access Journals (Sweden)

    Sri Nuryati

    2015-05-01

    Full Text Available ABSTRACT Koi herpesvirus (KHV is a major viral pathogen that infects common carp and koi. KHV disease outbreak is happened in almost all centre of common carp culture in Indonesia and caused mass mortality. Deoxyribonucleic acid (DNA vaccination method is one of ways to cope with KHV infection. Vaccines were commonly given by injection. The aim of this research was to get frequency and persistency of DNA vaccine encoding GP25 given by oral delivery method in common carp. This research would like to determine dose, frequency of vaccination, persistency of DNA vaccine and culture medium for the bacterial host. DNA vaccine persistency test was done by using polymerase chain reaction (PCR method with the specific primer for GP25 gene. The results showed that level of DNA vaccine that could be detected in feed was 7.56 ng (equal to 1.598×1010 copies. Efficient culture medium for Escherichia coli DH5α carrying DNA vaccine was LB triptone. Feeding fish with diet supplemented with 1 mL E. coli DH5α containing DNA vaccine for each fish and two times a week allowed persistence of DNA vaccine in kindney and spleen. Keywords: common carp, KHV, DNA vaccine, GP25, persistance  ABSTRAK Koi herpesvirus (KHV adalah virus patogen utama yang menginfeksi ikan mas dan ikan koi. Wabah penyakit KHV terjadi di hampir semua sentra budidaya ikan mas di Indonesia dan menyebabkan kematian massal ikan. Metode vaksinasi DNA merupakan salah satu cara yang dapat dilakukan untuk menanggulangi serangan KHV. Pemberian vaksin umumnya dilakukan dengan cara injeksi. Tujuan penelitian ini adalah untuk menguji frekuensi dan persistensi vaksin DNA GP25 antivirus KHV yang diberikan melalui oral pada ikan mas. Pada penelitian ini dilakukan uji dosis, frekuensi pemberian vaksin, persistensi vaksin DNA, dan media kultur bakteri inang. Persistensi vaksin DNA dianalisis menggunakan metode PCR dengan primer spesifik gen GP25. Hasil penelitian menunjukkan bahwa dosis vaksin DNA yang

  18. Chlamydial plasmids and bacteriophages.

    Science.gov (United States)

    Pawlikowska-Warych, Małgorzata; Śliwa-Dominiak, Joanna; Deptuła, Wiesław

    2015-01-01

    Chlamydia are absolute pathogens of humans and animals; despite being rather well recognised, they are still open for discovery. One such discovery is the occurrence of extrachromosomal carriers of genetic information. In prokaryotes, such carriers include plasmids and bacteriophages, which are present only among some Chlamydia species. Plasmids were found exclusively in Chlamydia (C.) trachomatis, C. psittaci, C. pneumoniae, C. suis, C. felis, C. muridarum and C. caviae. In prokaryotic organisms, plasmids usually code for genes that facilitate survival of the bacteria in the environment (although they are not essential). In chlamydia, their role has not been definitely recognised, apart from the fact that they participate in the synthesis of glycogen and encode proteins responsible for their virulence. Furthermore, in C. suis it was evidenced that the plasmid is integrated in a genomic island and contains the tetracycline-resistance gene. Bacteriophages specific for chlamydia (chlamydiaphages) were detected only in six species: C. psittaci, C. abortus, C. felis, C. caviae C. pecorum and C. pneumoniae. These chlamydiaphages cause inhibition of the developmental cycle, and delay transformation of reticulate bodies (RBs) into elementary bodies (EBs), thus reducing the possibility of infecting other cells in time. Plasmids and bacteriophages can be used in the diagnostics of chlamydioses; although especially in the case of plasmids, they are already used for detection of chlamydial infections. In addition, bacteriophages could be used as therapeutic agents to replace antibiotics, potentially addressing the problem of increasing antibiotic-resistance among chlamydia.

  19. DNA vaccine encoding nucleocapsid and surface proteins of wild type canine distemper virus protects its natural host against distemper.

    Science.gov (United States)

    Cherpillod, P; Tipold, A; Griot-Wenk, M; Cardozo, C; Schmid, I; Fatzer, R; Schobesberger, M; Zurbriggen, R; Bruckner, L; Roch, F; Vandevelde, M; Wittek, R; Zurbriggen, A

    2000-07-01

    Canine distemper virus (CDV), a member of the genus Morbillivirus induces a highly infectious, frequently lethal disease in dogs and other carnivores. Current vaccines against canine distemper consisting of attenuated viruses have been in use for many years and have greatly reduced the incidence of distemper in the dog population. However, certain strains may not guarantee adequate protection and others can induce post vaccinal encephalitis. We tested a DNA vaccine for its ability to protect dogs, the natural host of CDV, against distemper. We constructed plasmids containing the nucleocapsid, the fusion, and the attachment protein genes of a virulent canine distemper virus strain. Mice inoculated with these plasmids developed humoral and cellular immune responses against CDV antigens. Dogs immunized with the expression plasmids developed virus-neutralizing antibodies. Significantly, vaccinated dogs were protected against challenge with virulent CDV, whereas unvaccinated animals succumbed to distemper.

  20. Highly Effective Non-Viral Antitumor Gene Therapy System Comprised of Biocompatible Small Plasmid Complex Particles Consisting of pDNA, Anionic Polysaccharide, and Fully Deprotected Linear Polyethylenimine

    Directory of Open Access Journals (Sweden)

    Yoshiyuki Koyama

    2015-07-01

    Full Text Available We have reported that ternary complexes of plasmid DNA with conventional linear polyethylenimine (l-PEI and certain polyanions were very stably dispersed, and, with no cryoprotectant, they could be freeze-dried and re-hydrated without the loss of transfection ability. These properties enabled the preparation of a concentrated suspension of very small pDNA complex, by preparing the complexes at highly diluted conditions, followed by condensation via lyophilization-and-rehydration procedure. Recently, a high potency linear polyethylenimine having no residual protective groups, i.e., Polyethylenimine “Max” (PEI “Max”, is available, which has been reported to induce much higher gene expression than conventional l-PEI. We tried to prepare the small DNA/PEI “Max”/polyanion complexes by a similar freeze-drying method. Small complex particles could be obtained without apparent aggregation, but transfection activity of the rehydrated complexes was severely reduced. Complex-preparation conditions were investigated in details to achieve the freeze-dried DNA/PEI “Max”/polyanion small ternary complexes with high transfection efficiency. DNA/PEI “Max”/polyanion complexes containing cytokine-coding plasmids were then prepared, and their anti-tumor therapeutic efficacy was examined in tumor-bearing mice.

  1. Sequence of a cDNA encoding turtle high mobility group 1 protein.

    Science.gov (United States)

    Zheng, Jifang; Hu, Bi; Wu, Duansheng

    2005-07-01

    In order to understand sequence information about turtle HMG1 gene, a cDNA encoding HMG1 protein of the Chinese soft-shell turtle (Pelodiscus sinensis) was amplified by RT-PCR from kidney total RNA, and was cloned, sequenced and analyzed. The results revealed that the open reading frame (ORF) of turtle HMG1 cDNA is 606 bp long. The ORF codifies 202 amino acid residues, from which two DNA-binding domains and one polyacidic region are derived. The DNA-binding domains share higher amino acid identity with homologues sequences of chicken (96.5%) and mammalian (74%) than homologues sequence of rainbow trout (67%). The polyacidic region shows 84.6% amino acid homology with the equivalent region of chicken HMG1 cDNA. Turtle HMG1 protein contains 3 Cys residues located at completely conserved positions. Conservation in sequence and structure suggests that the functions of turtle HMG1 cDNA may be highly conserved during evolution. To our knowledge, this is the first report of HMG1 cDNA sequence in any reptilian.

  2. Effect of vanillin on methylene blue plus light-induced single-strand breaks in plasmid pBR322 DNA.

    Science.gov (United States)

    Kumar, S S; Ghosh, A; Devasagayam, T P; Chauhan, P S

    2000-09-20

    The ability of vanillin (4-hydroxy-3-methoxybenzaldehyde), a naturally occurring food flavouring agent, in inhibiting photosensitization-induced single-strand breaks (ssbs) in plasmid pBR322 DNA has been examined in an in vitro system, independent of DNA repair/replication processes. Photosensitization of DNA with methylene blue, visible light and oxygen, induced ssbs resulting in the production of open circular form (OC form) in a concentration-dependent manner. The yield of OC form induced by photosensitization was increased several-fold by deuteration of the buffer and was found to be inhibited by sodium azide, a scavenger of singlet oxygen (1O(2)). Vanillin, per se, did not induce but inhibited photosensitization-induced ssbs in plasmid DNA, at millimolar concentrations. The inhibitory effect of vanillin was both concentration- and time-dependent. On a molar basis, vanillin was, however, less effective than trolox, a water-soluble analogue of alpha-tocopherol. Photosensitization by methylene blue system generates singlet oxygen, as one of the major components of ROS. Therefore, interaction of singlet oxygen with vanillin was investigated. The rate constant of vanillin with 1O(2) was estimated to be 5.93x10(7)M(-1)s(-1) and that of sodium azide as 2. 7x10(8)M(-1)s(-1). The present investigations show that vanillin can protect against photosensitization-induced ssbs in the plasmid pBR322 DNA, and this effect may partly be due to its ability to scavenge 1O(2).

  3. The 380 kb pCMU01 plasmid encodes chloromethane utilization genes and redundant genes for vitamin B12- and tetrahydrofolate-dependent chloromethane metabolism in Methylobacterium extorquens CM4: a proteomic and bioinformatics study.

    Directory of Open Access Journals (Sweden)

    Sandro Roselli

    Full Text Available Chloromethane (CH3Cl is the most abundant volatile halocarbon in the atmosphere and contributes to the destruction of stratospheric ozone. The only known pathway for bacterial chloromethane utilization (cmu was characterized in Methylobacterium extorquens CM4, a methylotrophic bacterium able to utilize compounds without carbon-carbon bonds such as methanol and chloromethane as the sole carbon source for growth. Previous work demonstrated that tetrahydrofolate and vitamin B12 are essential cofactors of cmuA- and cmuB-encoded methyltransferases of chloromethane dehalogenase, and that the pathway for chloromethane utilization is distinct from that for methanol. This work reports genomic and proteomic data demonstrating that cognate cmu genes are located on the 380 kb pCMU01 plasmid, which drives the previously defined pathway for tetrahydrofolate-mediated chloromethane dehalogenation. Comparison of complete genome sequences of strain CM4 and that of four other M. extorquens strains unable to grow with chloromethane showed that plasmid pCMU01 harbors unique genes without homologs in the compared genomes (bluB2, btuB, cobA, cbiD, as well as 13 duplicated genes with homologs of chromosome-borne genes involved in vitamin B12-associated biosynthesis and transport, or in tetrahydrofolate-dependent metabolism (folC2. In addition, the presence of both chromosomal and plasmid-borne genes for corrinoid salvaging pathways may ensure corrinoid coenzyme supply in challenging environments. Proteomes of M. extorquens CM4 grown with one-carbon substrates chloromethane and methanol were compared. Of the 49 proteins with differential abundance identified, only five (CmuA, CmuB, PurU, CobH2 and a PaaE-like uncharacterized putative oxidoreductase are encoded by the pCMU01 plasmid. The mainly chromosome-encoded response to chloromethane involves gene clusters associated with oxidative stress, production of reducing equivalents (PntAA, Nuo complex, conversion of

  4. Two-step method for curing Escherichia coli of ColE1-derived plasmids

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne

    2008-01-01

    To cure Escherichia coli for plasmids derived from the ColE1 replicon advantage is taken of the fact that maintenance of this replicon requires a wild-type allele of polA, encoding DNA polymerase I. Curing is achieved by cotransduction of a mutant polA allele with metE::Tn10, fadAB::Tn10 or other...

  5. Bacterial mitosis: Partitioning protein ParA oscillates in spiral-shaped structures and positions plasmids at mid-cell

    DEFF Research Database (Denmark)

    Ebersbach, G.; Gerdes, Kenn

    2004-01-01

    The par2 locus of Escherichia coli plasmid pB171 encodes oscillating ATPase ParA, DNA binding protein ParB and two cis-acting DNA regions to which ParB binds (parC1 and parC2). Three independent techniques were used to investigate the subcellular localization of plasmids carrying par2. In cells......A-GFP oscillated in spiral-shaped structures. Amino acid substitutions in ParA simultaneously abolished ParA spiral formation, oscillation and either plasmid localization or plasmid separation at mid-cell. Therefore, our results suggest that ParA spirals position plasmids at the middle of the bacterial nucleoid...

  6. AAVS1-Targeted Plasmid Integration in AAV Producer Cell Lines.

    Science.gov (United States)

    Luo, Yuxia; Frederick, Amy; Martin, John M; Scaria, Abraham; Cheng, Seng H; Armentano, Donna; Wadsworth, Samuel C; Vincent, Karen A

    2017-06-01

    Adeno-associated virus (AAV) producer cell lines are created via transfection of HeLaS3 cells with a single plasmid containing three components (the vector sequence, the AAV rep and cap genes, and a selectable marker gene). As this plasmid contains both the cis (Rep binding sites) and trans (Rep protein encoded by the rep gene) elements required for site-specific integration, it was predicted that plasmid integration might occur within the AAVS1 locus on human chromosome 19 (chr19). The objective of this study was to investigate whether integration in AAVS1 might be correlated with vector yield. Plasmid integration sites within several independent cell lines were assessed via Southern, fluorescence in situ hybridization (FISH) and PCR analyses. In the Southern analyses, the presence of fragments detected by both rep- and AAVS1-specific probes suggested that for several mid- and high-producing lines, plasmid DNA had integrated into the AAVS1 locus. Analysis with puroR and AAVS1-specific probes suggested that integration in AAVS1 was a more widespread phenomenon. High-producing AAV2-secreted alkaline phosphatase (SEAP) lines (masterwell 82 [MW82] and MW278) were evaluated via FISH using probes specific for the plasmid, AAVS1, and a chr19 marker. FISH analysis detected two plasmid integration sites in MW278 (neither in AAVS1), while a total of three sites were identified in MW82 (two in AAVS1). An inverse PCR assay confirmed integration within AAVS1 for several mid- and high-producing lines. In summary, the FISH, Southern, and PCR data provide evidence of site-specific integration of the plasmid within AAVS1 in several AAV producer cell lines. The data also suggest that integration in AAVS1 is a general phenomenon that is not necessarily restricted to high producers. The results also suggest that plasmid integration within the AAVS1 locus is not an absolute requirement for a high vector yield.

  7. The effect of dimethyl sulfoxide on the induction of DNA strand breaks in plasmid DNA and colony formation of PC Cl3 mammalian cells by alpha-, beta-, and Auger electron emitters (223)Ra, (188)Re, and (99m)Tc.

    Science.gov (United States)

    Runge, Roswitha; Oehme, Liane; Kotzerke, Jörg; Freudenberg, Robert

    2016-12-01

    DNA damage occurs as a consequence of both direct and indirect effects of ionizing radiation. The severity of DNA damage depends on the physical characteristics of the radiation quality, e.g., the linear energy transfer (LET). There are still contrary findings regarding direct or indirect interactions of high-LET emitters with DNA. Our aim is to determine DNA damage and the effect on cellular survival induced by (223)Ra compared to (188)Re and (99m)Tc modulated by the radical scavenger dimethyl sulfoxide (DMSO). Radioactive solutions of (223)Ra, (188)Re, or (99m)Tc were added to either plasmid DNA or to PC Cl3 cells in the absence or presence of DMSO. Following irradiation, single strand breaks (SSB) and double strand breaks (DSB) in plasmid DNA were analyzed by gel electrophoresis. To determine the radiosensitivity of the rat thyroid cell line (PC Cl3), survival curves were performed using the colony formation assay. Exposure to 120 Gy of (223)Ra, (188)Re, or (99m)Tc leads to maximal yields of SSB (80 %) in plasmid DNA. Irradiation with 540 Gy (223)Ra and 500 Gy (188)Re or (99m)Tc induced 40, 28, and 64 % linear plasmid conformations, respectively. DMSO prevented the SSB and DSB in a similar way for all radionuclides. However, with the α-emitter (223)Ra, a low level of DSB could not be prevented by DMSO. Irradiation of PC Cl3 cells with (223)Ra, (188)Re, and (99m)Tc pre-incubated with DMSO revealed enhanced survival fractions (SF) in comparison to treatment without DMSO. Protection factors (PF) were calculated using the fitted survival curves. These factors are 1.23 ± 0.04, 1.20 ± 0.19, and 1.34 ± 0.05 for (223)Ra, (188)Re, and (99m)Tc, respectively. For (223)Ra, as well as for (188)Re and (99m)Tc, dose-dependent radiation effects were found applicable for plasmid DNA and PC Cl3 cells. The radioprotection by DMSO was in the same range for high- and low-LET emitter. Overall, the results indicate the contribution of mainly indirect radiation

  8. Persistence Mechanisms of Conjugative Plasmids

    DEFF Research Database (Denmark)

    Bahl, Martin Iain; Hansen, Lars H.; Sørensen, Søren Johannes

    2009-01-01

    Are plasmids selfish parasitic DNA molecules or an integrated part of the bacterial genome? This chapter reviews the current understanding of the persistence mechanisms of conjugative plasmids harbored by bacterial cells and populations. The diversity and intricacy of mechanisms affecting the suc...

  9. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

    Science.gov (United States)

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

    2016-02-17

    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  10. Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores

    Science.gov (United States)

    Bell, Nicholas A. W.; Keyser, Ulrich F.

    2016-07-01

    The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.

  11. Detection of mcr-1 encoding plasmid-mediated colistin-resistant Escherichia coli isolates from human bloodstream infection and imported chicken meat, Denmark 2015

    DEFF Research Database (Denmark)

    Hasman, H.; Hammerum, A. M.; Hansen, F.

    2015-01-01

    The plasmid-mediated colistin resistance gene, mcr-1, was detected in an Escherichia coli isolate from a Danish patient with bloodstream infection and in five E. coli isolates from imported chicken meat. One isolate from chicken meat belonged to the epidemic spreading sequence type ST131...

  12. Limited similarity between plasmids encoding CTX-M-1 β-lactamase in Escherichia coli from humans, pigs, cattle, organic poultry layers and horses in Denmark

    DEFF Research Database (Denmark)

    Jakobsen, Lotte; Bortolaia, Valeria; Bielak, Eliza Maria

    2015-01-01

    in Denmark between 2006 and 2010. In total, 65 CTX-M-1-producing isolates from patients (n=22), pigs (n=21), cattle (n=4), organic poultry layers (n=3) and horses (n=15) were typed by pulsed-field gel electrophoresis (PFGE). Plasmids harbouring blaCTX-M-1 were characterised by S1 PFGE, PCR-based replicon...

  13. Comparative Sequence Analysis of Multidrug-Resistant IncA/C Plasmids from Salmonella enterica.

    Science.gov (United States)

    Hoffmann, Maria; Pettengill, James B; Gonzalez-Escalona, Narjol; Miller, John; Ayers, Sherry L; Zhao, Shaohua; Allard, Marc W; McDermott, Patrick F; Brown, Eric W; Monday, Steven R

    2017-01-01

    Determinants of multidrug resistance (MDR) are often encoded on mobile elements, such as plasmids, transposons, and integrons, which have the potential to transfer among foodborne pathogens, as well as to other virulent pathogens, increasing the threats these traits pose to human and veterinary health. Our understanding of MDR among Salmonella has been limited by the lack of closed plasmid genomes for comparisons across resistance phenotypes, due to difficulties in effectively separating the DNA of these high-molecular weight, low-copy-number plasmids from chromosomal DNA. To resolve this problem, we demonstrate an efficient protocol for isolating, sequencing and closing IncA/C plasmids from Salmonella sp. using single molecule real-time sequencing on a Pacific Biosciences (Pacbio) RS II Sequencer. We obtained six Salmonella enterica isolates from poultry, representing six different serovars, each exhibiting the MDR-Ampc resistance profile. Salmonella plasmids were obtained using a modified mini preparation and transformed with Escherichia coli DH10Br. A Qiagen Large-Construct kit™ was used to recover highly concentrated and purified plasmid DNA that was sequenced using PacBio technology. These six closed IncA/C plasmids ranged in size from 104 to 191 kb and shared a stable, conserved backbone containing 98 core genes, with only six differences among those core genes. The plasmids encoded a number of antimicrobial resistance genes, including those for quaternary ammonium compounds and mercury. We then compared our six IncA/C plasmid sequences: first with 14 IncA/C plasmids derived from S. enterica available at the National Center for Biotechnology Information (NCBI), and then with an additional 38 IncA/C plasmids derived from different taxa. These comparisons allowed us to build an evolutionary picture of how antimicrobial resistance may be mediated by this common plasmid backbone. Our project provides detailed genetic information about resistance genes in

  14. Comparative Sequence Analysis of Multidrug-Resistant IncA/C Plasmids from Salmonella enterica

    Directory of Open Access Journals (Sweden)

    Maria Hoffmann

    2017-08-01

    Full Text Available Determinants of multidrug resistance (MDR are often encoded on mobile elements, such as plasmids, transposons, and integrons, which have the potential to transfer among foodborne pathogens, as well as to other virulent pathogens, increasing the threats these traits pose to human and veterinary health. Our understanding of MDR among Salmonella has been limited by the lack of closed plasmid genomes for comparisons across resistance phenotypes, due to difficulties in effectively separating the DNA of these high-molecular weight, low-copy-number plasmids from chromosomal DNA. To resolve this problem, we demonstrate an efficient protocol for isolating, sequencing and closing IncA/C plasmids from Salmonella sp. using single molecule real-time sequencing on a Pacific Biosciences (Pacbio RS II Sequencer. We obtained six Salmonella enterica isolates from poultry, representing six different serovars, each exhibiting the MDR-Ampc resistance profile. Salmonella plasmids were obtained using a modified mini preparation and transformed with Escherichia coli DH10Br. A Qiagen Large-Construct kit™ was used to recover highly concentrated and purified plasmid DNA that was sequenced using PacBio technology. These six closed IncA/C plasmids ranged in size from 104 to 191 kb and shared a stable, conserved backbone containing 98 core genes, with only six differences among those core genes. The plasmids encoded a number of antimicrobial resistance genes, including those for quaternary ammonium compounds and mercury. We then compared our six IncA/C plasmid sequences: first with 14 IncA/C plasmids derived from S. enterica available at the National Center for Biotechnology Information (NCBI, and then with an additional 38 IncA/C plasmids derived from different taxa. These comparisons allowed us to build an evolutionary picture of how antimicrobial resistance may be mediated by this common plasmid backbone. Our project provides detailed genetic information about

  15. Agrobacterium T-DNA-encoded protein Atu6002 interferes with the host auxin response

    Science.gov (United States)

    Lacroix, Benoît; Gizatullina, Diana I.; Babst, Benjamin A.; Gifford, Andrew N.; Citovsky, Vitaly

    2013-01-01

    Summary Several genes in the Agrobacterium tumefaciens transferred (T) DNA encode proteins that are involved in developmental alterations leading to the formation of tumors in infected plants. We investigated the role of the protein encoded by the Atu6002 gene, the function of which is completely unknown. The Atu6002 expression occurs in Agrobacterium-induced tumors, and is also activated upon activation of plant cell division by growth hormones. Within the expressing plant cells, the Atu6002 protein is targeted to the plasma membrane. Interestingly, constitutive ectopic expression of Atu6002 in transgenic tobacco plants lead to a severe developmental phenotype characterized by stunted growth, shorter internodes, lanceolate leaves, increased branching, and modified flower morphology. These Atu6002-expressing plants also displayed impaired response to auxin. However, auxin cellular uptake and polar transport were not significantly inhibited in these plants, suggesting that Atu6002 interferes with auxin perception or signaling pathways. PMID:24128370

  16. Inhibition of gamma-radiation induced DNA damage in plasmid pBR322 by TMG, a water-soluble derivative of vitamin E.

    Science.gov (United States)

    Rajagopalan, Rema; Wani, Khalida; Huilgol, Nagaraj G; Kagiya, Tsutomu V; Nair, Cherupally K Krishnan

    2002-06-01

    Alpha-tocopherol monoglucoside (TMG), a water-soluble derivative of alpha-tocopherol, has been examined for its ability to protect DNA against radiation-induced strand breaks. Gamma radiation, up to a dose of 6 Gy (dose rate, 0.7 Gy/minute), induced a dose-dependent increase in single strand breaks (SSBs) in plasmid pBR322 DNA. TMG inhibited the formation of gamma-radiation induced DNA single strand breaks (SSBs) in a concentration-dependent manner; 500 microM of TMG protected the single strand breaks completely. It also protected thymine glycol formation induced by gamma-radiation in a dose-dependent manner, based on an estimation of thymine glycol by HPLC.

  17. Inhibition of {gamma}-radiation induced DNA damage in plasmid pBR322 by TMG, a water-soluble derivative of vitamin E

    Energy Technology Data Exchange (ETDEWEB)

    Rajagopalan, R.; Nair, C.K.K. [Bhabha Atomic Research Centre, Mumbai (India); Wani, K.; Huilgol, N.G. [Nanavati Hospital and MRC, Vile Parle (India); Kagiya, Tsutomu V. [Kinki Research Foundation, Kyoto (Japan)

    2002-06-01

    Alpha-tocopherol monoglucoside (TMG), a water-soluble derivative of {alpha}-tocopherol, has been examined for its ability to protect DNA against radiation-induced strand breaks. Gamma radiation, up to a dose of 6 Gy (dose rate, 0.7 Gy/minute), induced a dose-dependent increase in single strand breaks (SSBs) in plasmid pBR322 DNA. TMG inhibited the formation of {gamma}-radiation induced DNA single strand breaks (SSBs) in a concentration-dependent manner; 500 {mu}M of TMG protected the single strand breaks completely. It also protected thymine glycol formation induced by {gamma}-radiation in a dose-dependent manner, based on an estimation of thymine glycol by HPLC. (author)

  18. Inhibition of γ-radiation induced DNA damage in plasmid pBR322 by TMG, a water-soluble derivative of vitamin E

    International Nuclear Information System (INIS)

    Rajagopalan, R.; Nair, C.K.K.; Wani, K.; Huilgol, N.G.; Kagiya, Tsutomu V.

    2002-01-01

    Alpha-tocopherol monoglucoside (TMG), a water-soluble derivative of α-tocopherol, has been examined for its ability to protect DNA against radiation-induced strand breaks. Gamma radiation, up to a dose of 6 Gy (dose rate, 0.7 Gy/minute), induced a dose-dependent increase in single strand breaks (SSBs) in plasmid pBR322 DNA. TMG inhibited the formation of γ-radiation induced DNA single strand breaks (SSBs) in a concentration-dependent manner; 500 μM of TMG protected the single strand breaks completely. It also protected thymine glycol formation induced by γ-radiation in a dose-dependent manner, based on an estimation of thymine glycol by HPLC. (author)

  19. Ultrasound-mediated gene delivery of naked plasmid DNA in skeletal muscles: a case for bolus injections.

    Science.gov (United States)

    Sanches, Pedro Gomes; Mühlmeister, Mareike; Seip, Ralf; Kaijzel, Eric; Löwik, Clemens; Böhmer, Marcel; Tiemann, Klaus; Grüll, Holger

    2014-12-10

    Localized gene delivery has many potential clinical applications. However, the nucleic acids (e.g. pDNA and siRNA) are incapable of passively crossing the endothelium, cell membranes and other biological barriers which must be crossed to reach their intracellular targets. A possible solution is the use of ultrasound to burst circulating microbubbles inducing transient permeabilization of surrounding tissues which mediates nucleic acid extravasation and cellular uptake. In this study we report on an optimization of the ultrasound gene delivery technique. Naked pDNA (200 μg) encoding luciferase and SonoVue® microbubbles were co-injected intravenously in mice. The hindlimb skeletal muscles were exposed to ultrasound from a non-focused transducer (1 MHz, 1.25 MPa, PRI 30s) and injection protocols and total amounts as well as ultrasound parameters were systemically varied. Gene expression was quantified relative to a control using a bioluminescence camera system at day 7 after sonication. Bioluminescence ratios in sonicated/control muscles of up to 101× were obtained. In conclusion, we were able to specifically deliver genetic material to the selected skeletal muscles and overall, the use of bolus injections and high microbubble numbers resulted in increased gene expression reflected by stronger bioluminescence signals. Based on our data, bolus injections seem to be required in order to achieve transient highly concentrated levels of nucleic acids and microbubbles at the tissue of interest which upon ultrasound exposure should lead to increased levels of gene delivery. Thus, ultrasound mediated gene delivery is a promising technique for the clinical translation of localized drug delivery. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Effect of West Nile virus DNA-plasmid vaccination on response to live virus challenge in red-tailed hawks (Buteo jamaicensis).

    Science.gov (United States)

    Redig, Patrick T; Tully, Thomas N; Ritchie, Branson W; Roy, Alma F; Baudena, M Alexandra; Chang, Gwong-Jen J

    2011-08-01

    To evaluate the safety and efficacy of an experimental adjuvanted DNA-plasmid vaccine against West Nile virus (WNV) in red-tailed hawks (Buteo jamaicensis). 19 permanently disabled but otherwise healthy red-tailed hawks of mixed ages and both sexes without detectable serum antibodies against WNV. Hawks were injected IM with an experimental WNV DNA-plasmid vaccine in an aluminum-phosphate adjuvant (n = 14) or with the adjuvant only (control group; 5). All birds received 2 injections at a 3-week interval. Blood samples for serologic evaluation were collected before the first injection and 4 weeks after the second injection (day 0). At day 0, hawks were injected SC with live WNV. Pre- and postchallenge blood samples were collected at intervals for 14 days for assessment of viremia and antibody determination; oropharyngeal and cloacal swabs were collected for assessment of viral shedding. Vaccination was not associated with morbidity or deaths. Three of the vaccinated birds seroconverted after the second vaccine injection; all other birds seroconverted following the live virus injection. Vaccinated birds had significantly less severe viremia and shorter and less-intense shedding periods, compared with the control birds. Use of the WNV DNA-plasmid vaccine in red-tailed hawks was safe, and vaccination attenuated but did not eliminate both the viremia and the intensity of postchallenge shedding following live virus exposure. Further research is warranted to conclusively determine the efficacy of this vaccine preparation for protection of red-tailed hawks and other avian species against WNV-induced disease.

  1. Achievements, Challenges, and Opportunities in DNA-Encoded Library Research: An Academic Point of View.

    Science.gov (United States)

    Yuen, Lik Hang; Franzini, Raphael M

    2017-05-04

    DNA-encoded chemical libraries (DECLs) are pools of DNA-tagged small molecules that enable facile screening and identification of bio-macromolecule binders. The successful development of DECLs has led to their increasingly important role in drug development, and screening hits have entered clinical trials. In this review, we summarize the development and currently active research areas of DECLs with a focus on contributions from groups at academic institutes. We further look at opportunities and future directions of DECL research in medicinal chemistry and chemical biology based on the symbiotic relationship between academia and industry. Challenges associated with the application of DECLs in academic drug discovery are further discussed. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Development of a novel rDNA based plasmid for enhanced cell surface display on Yarrowia lipolytica

    CSIR Research Space (South Africa)

    Bulani, S

    2012-05-01

    Full Text Available (YlCWP1). mCherry was used as a model protein to assess the efficiency of the constructed plasmid. Y. lipolytica transformants harbouring the expression cassettes showed a purple colour phenotype on selective YNB-casamino plates as compared to control...

  3. DNA Vaccine Encoding the Chimeric Form of Schistosoma mansoni Sm-TSP2 and Sm29 Confers Partial Protection against Challenge Infection

    Science.gov (United States)

    Gonçalves de Assis, Natan Raimundo; Batistoni de Morais, Suellen; Figueiredo, Bárbara Castro Pimentel; Ricci, Natasha Delaqua; de Almeida, Leonardo Augusto; da Silva Pinheiro, Carina; Martins, Vicente de Paulo; Oliveira, Sergio Costa

    2015-01-01

    Schistosomiasis is an important parasitic disease worldwide that affects more than 207 million people in 76 countries and causes approximately 250,000 deaths per year. The best long-term strategy to control schistosomiasis is through immunization combined with drug treatment. Due to the ability of DNA vaccines to generate humoral and cellular immune responses, such vaccines are considered a promising approach against schistosomiasis. Sm29 and tetraspanin-2 (Sm-TSP2) are two proteins that are located in the S. mansoni tegument of adult worms and schistosomula and induce high levels of protection through recombinant protein immunization. In this study, we transfected BHK-21 cells with plasmids encoding Sm29, Sm-TSP2 or a chimera containing both genes. Using RT-PCR analysis and western blot, we confirmed that the DNA vaccine constructs were transcribed and translated, respectively, in BHK-21 cells. After immunization of mice, we evaluated the reduction in worm burden. We observed worm burden reductions of 17-22%, 22%, 31-32% and 24-32% in animals immunized with the pUMVC3/Sm29, pUMVC3/SmTSP-2, pUMVC3/Chimera and pUMVC3/Sm29 + pUMVC3/SmTSP-2 plasmids, respectively. We evaluated the humoral response elicited by DNA vaccines, and animals immunized with pUMVC3/Sm29 and pUMVC3/Sm29 + pUMVC3/SmTSP-2 showed higher titers of anti-Sm29 antibodies. The cytokine profile produced by the spleen cells of immunized mice was then evaluated. We observed higher production of Th1 cytokines, such as TNF-α and IFN-γ, in vaccinated mice and no significant production of IL-4 and IL-5. The DNA vaccines tested in this study showed the ability to generate a protective immune response against schistosomiasis, probably through the production of Th1 cytokines. However, future strategies aiming to optimize the protective response induced by a chimeric DNA construct need to be developed. PMID:25942636

  4. DNA Vaccine Encoding the Chimeric Form of Schistosoma mansoni Sm-TSP2 and Sm29 Confers Partial Protection against Challenge Infection.

    Directory of Open Access Journals (Sweden)

    Natan Raimundo Gonçalves de Assis

    Full Text Available Schistosomiasis is an important parasitic disease worldwide that affects more than 207 million people in 76 countries and causes approximately 250,000 deaths per year. The best long-term strategy to control schistosomiasis is through immunization combined with drug treatment. Due to the ability of DNA vaccines to generate humoral and cellular immune responses, such vaccines are considered a promising approach against schistosomiasis. Sm29 and tetraspanin-2 (Sm-TSP2 are two proteins that are located in the S. mansoni tegument of adult worms and schistosomula and induce high levels of protection through recombinant protein immunization. In this study, we transfected BHK-21 cells with plasmids encoding Sm29, Sm-TSP2 or a chimera containing both genes. Using RT-PCR analysis and western blot, we confirmed that the DNA vaccine constructs were transcribed and translated, respectively, in BHK-21 cells. After immunization of mice, we evaluated the reduction in worm burden. We observed worm burden reductions of 17-22%, 22%, 31-32% and 24-32% in animals immunized with the pUMVC3/Sm29, pUMVC3/SmTSP-2, pUMVC3/Chimera and pUMVC3/Sm29 + pUMVC3/SmTSP-2 plasmids, respectively. We evaluated the humoral response elicited by DNA vaccines, and animals immunized with pUMVC3/Sm29 and pUMVC3/Sm29 + pUMVC3/SmTSP-2 showed higher titers of anti-Sm29 antibodies. The cytokine profile produced by the spleen cells of immunized mice was then evaluated. We observed higher production of Th1 cytokines, such as TNF-α and IFN-γ, in vaccinated mice and no significant production of IL-4 and IL-5. The DNA vaccines tested in this study showed the ability to generate a protective immune response against schistosomiasis, probably through the production of Th1 cytokines. However, future strategies aiming to optimize the protective response induced by a chimeric DNA construct need to be developed.

  5. Recombinant DNA specifying the human amyloid. beta. precursor protein (ABPP) encodes a 95-kDa polypeptide

    Energy Technology Data Exchange (ETDEWEB)

    Mita, S; Sadlock, J; Herbert, J; Schon, E A

    1988-10-11

    Although the ABPP gene give rise to multiple mRNAs, the primary translation product of this gene is unknown. The longest published cDNA sequences predict a 770-aa polypeptide of 87 kDa. However, in immunoblots, ABPP migrated as a single species of >92 kDa in rat brain, and in human, as a species of 95-100 kDa in non-membrane bound form, as multiple species of 110-135 kDa in membrane-associated form and as a 130-kDa species in fibroblasts. The sizes of these larger species relative to the MW of ABPP predicted from the cDNA sequences have been attributed to postranslational modification. However, the authors have isolated a cDNA (lambdaHAP2) from a human fetal muscle lambdagt11 cDNA library encoding an 843-aa polypeptide with a deduced MW of 94,642. This cDNA contains both exons encoding an 843-aa polypeptide with a deduced MW of 94.642. This cDNA contains both exons encoding the protease inhibitor domains. Primer extension analysis indicates that the 5' terminus of this cDNA is 14 nt from a transcriptional start site. This cDNA, encoding the longest ABPP described to date, may explain some of the observations on the sizes of tissue-derived ABPP.

  6. Plasmid-Mediated Quinolone Resistance in Shigella flexneri Isolated From Macaques

    Directory of Open Access Journals (Sweden)

    Anthony J. Mannion

    2018-03-01

    Full Text Available Non-human primates (NHPs for biomedical research are commonly infected with Shigella spp. that can cause acute dysentery or chronic episodic diarrhea. These animals are often prophylactically and clinically treated with quinolone antibiotics to eradicate these possible infections. However, chromosomally- and plasmid-mediated antibiotic resistance has become an emerging concern for species in the family Enterobacteriaceae. In this study, five individual isolates of multi-drug resistant Shigella flexneri were isolated from the feces of three macaques. Antibiotic susceptibility testing confirmed resistance or decreased susceptibility to ampicillin, amoxicillin-clavulanic acid, cephalosporins, gentamicin, tetracycline, ciprofloxacin, enrofloxacin, levofloxacin, and nalidixic acid. S. flexneri isolates were susceptible to trimethoprim-sulfamethoxazole, and this drug was used to eradicate infection in two of the macaques. Plasmid DNA from all isolates was positive for the plasmid-encoded quinolone resistance gene qnrS, but not qnrA and qnrB. Conjugation and transformation of plasmid DNA from several S. flexneri isolates into antibiotic-susceptible Escherichia coli strains conferred the recipients with resistance or decreased susceptibility to quinolones and beta-lactams. Genome sequencing of two representative S. flexneri isolates identified the qnrS gene on a plasmid-like contig. These contigs showed >99% homology to plasmid sequences previously characterized from quinolone-resistant Shigella flexneri 2a and Salmonella enterica strains. Other antibiotic resistance genes and virulence factor genes were also identified in chromosome and plasmid sequences in these genomes. The findings from this study indicate macaques harbor pathogenic S. flexneri strains with chromosomally- and plasmid-encoded antibiotic resistance genes. To our knowledge, this is the first report of plasmid-mediated quinolone resistance in S. flexneri isolated from NHPs and warrants

  7. Plasmids in Gram negatives: molecular typing of resistance plasmids.

    Science.gov (United States)

    Carattoli, Alessandra

    2011-12-01

    A plasmid is defined as a double stranded, circular DNA molecule capable of autonomous replication. By definition, plasmids do not carry genes essential for the growth of host cells under non-stressed conditions but they have systems which guarantee their autonomous replication also controlling the copy number and ensuring stable inheritance during cell division. Most of the plasmids confer positively selectable phenotypes by the presence of antimicrobial resistance genes. Plasmids evolve as an integral part of the bacterial genome, providing resistance genes that can be easily exchanged among bacteria of different origin and source by conjugation. A multidisciplinary approach is currently applied to study the acquisition and spread of antimicrobial resistance in clinically relevant bacterial pathogens and the established surveillance can be implemented by replicon typing of plasmids. Particular plasmid families are more frequently detected among Enterobacteriaceae and play a major role in the diffusion of specific resistance genes. For instance, IncFII, IncA/C, IncL/M, IncN and IncI1 plasmids carrying extended-spectrum beta-lactamase genes and acquired AmpC genes are currently considered to be "epidemic resistance plasmids", being worldwide detected in Enterobacteriaceae of different origin and sources. The recognition of successful plasmids is an essential first step to design intervention strategies preventing their spread. Copyright © 2011 Elsevier GmbH. All rights reserved.

  8. A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.

    Science.gov (United States)

    Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C

    2008-12-01

    A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.

  9. Mucosal application of gp140 encoding DNA polyplexes to different tissues results in altered immunological outcomes in mice.

    Directory of Open Access Journals (Sweden)

    Jamie F S Mann

    Full Text Available Increasing evidence suggests that mucosally targeted vaccines will enhance local humoral and cellular responses whilst still eliciting systemic immunity. We therefore investigated the capacity of nasal, sublingual or vaginal delivery of DNA-PEI polyplexes to prime immune responses prior to mucosal protein boost vaccination. Using a plasmid expressing the model antigen HIV CN54gp140 we show that each of these mucosal surfaces were permissive for DNA priming and production of antigen-specific antibody responses. The elicitation of systemic immune responses using nasally delivered polyplexed DNA followed by recombinant protein boost vaccination was equivalent to a systemic prime-boost regimen, but the mucosally applied modality had the advantage in that significant levels of antigen-specific IgA were detected in vaginal mucosal secretions. Moreover, mucosal vaccination elicited both local and systemic antigen-specific IgG(+ and IgA(+ antibody secreting cells. Finally, using an Influenza challenge model we found that a nasal or sublingual, but not vaginal, DNA prime/protein boost regimen protected against infectious challenge. These data demonstrate that mucosally applied plasmid DNA complexed to PEI followed by a mucosal protein boost generates sufficient antigen-specific humoral antibody production to protect from mucosal viral challenge.

  10. Efficacy of DNA vaccine encoding koi herpesvirus glycoprotein GP-25in common carp juvenile by immersion

    Directory of Open Access Journals (Sweden)

    Soko Nuswantoro

    2013-11-01

    Full Text Available Koi herpesvirus (KHV is a herpesvirus that particularly infects and causes mass mortality to koi and common carp. Therefore, the protection of common carp from KHV infection is urgently needed. In this study, we developed an application of DNA vaccine encoding KHV glycoprotein-25 by immersion method to increase survival of common carp against KHV infection. A total of 400 common carp juveniles at 30-day-old were immersed in 1-L water containing 1.3×108CFU/mL of the killed Escherichia coli cells carrying DNA vaccine. Three frequencies and three duration of fish immersion were tested, namely: 1×30 minutes, 1×60 minutes, 1× 90 minutes, 2×90 minutes and 3×90 minutes by interval of 24 hours. Reversetranscription polymerase chain reaction analysis showed that DNA vaccine was successfully expressed in the vaccinated fish. Fish at twenty eight days post vaccination were challenged by injecting 10-4 mL of KHV per fish. The result showed that vaccination by 1×30 minutes immersion allowed 61% of fish survived, and this was significantly higher (p<0.05 compared to control (without vaccination, but it was similar among vaccination treatments (p>0.05. The relative percent survival of vaccinated fish were also similar among treatments (p>0.05. DNA vaccination has increased fish survival about two fold higher compared to unvaccinated fish control (26.67%. Thus, DNA vaccination was effectively delivered by immersion for 1×30 minutes, and this technique can be useful to level up the resistance of common carp juveniles against KHV infection. Keywords: DNA vaccine, KHV, glycoprotein, immersion, common carp

  11. Characterization of plasmids in a human clinical strain of Lactococcus garvieae.

    Directory of Open Access Journals (Sweden)

    Mónica Aguado-Urda

    Full Text Available The present work describes the molecular characterization of five circular plasmids found in the human clinical strain Lactococcus garvieae 21881. The plasmids were designated pGL1-pGL5, with molecular sizes of 4,536 bp, 4,572 bp, 12,948 bp, 14,006 bp and 68,798 bp, respectively. Based on detailed sequence analysis, some of these plasmids appear to be mosaics composed of DNA obtained by modular exchange between different species of lactic acid bacteria. Based on sequence data and the derived presence of certain genes and proteins, the plasmid pGL2 appears to replicate via a rolling-circle mechanism, while the other four plasmids appear to belong to the group of lactococcal theta-type replicons. The plasmids pGL1, pGL2 and pGL5 encode putative proteins related with bacteriocin synthesis and bacteriocin secretion and immunity. The plasmid pGL5 harbors genes (txn, orf5 and orf25 encoding proteins that could be considered putative virulence factors. The gene txn encodes a protein with an enzymatic domain corresponding to the family actin-ADP-ribosyltransferases toxins, which are known to play a key role in pathogenesis of a variety of bacterial pathogens. The genes orf5 and orf25 encode two putative surface proteins containing the cell wall-sorting motif LPXTG, with mucin-binding and collagen-binding protein domains, respectively. These proteins could be involved in the adherence of L. garvieae to mucus from the intestine, facilitating further interaction with intestinal epithelial cells and to collagenous tissues such as the collagen-rich heart valves. To our knowledge, this is the first report on the characterization of plasmids in a human clinical strain of this pathogen.

  12. Serine Protease Variants Encoded by Echis ocellatus Venom Gland cDNA: Cloning and Sequencing Analysis

    Directory of Open Access Journals (Sweden)

    S. S. Hasson

    2010-01-01

    Full Text Available Envenoming by Echis saw-scaled viper is the leading cause of death and morbidity in Africa due to snake bite. Despite its medical importance, there have been few investigations into the toxin composition of the venom of this viper. Here, we report the cloning of cDNA sequences encoding four groups or isoforms of the haemostasis-disruptive Serine protease proteins (SPs from the venom glands of Echis ocellatus. All these SP sequences encoded the cysteine residues scaffold that form the 6-disulphide bonds responsible for the characteristic tertiary structure of venom serine proteases. All the Echis ocellatus EoSP groups showed varying degrees of sequence similarity to published viper venom SPs. However, these groups also showed marked intercluster sequence conservation across them which were significantly different from that of previously published viper SPs. Because viper venom SPs exhibit a high degree of sequence similarity and yet exert profoundly different effects on the mammalian haemostatic system, no attempt was made to assign functionality to the new Echis ocellatus EoSPs on the basis of sequence alone. The extraordinary level of interspecific and intergeneric sequence conservation exhibited by the Echis ocellatus EoSPs and analogous serine proteases from other viper species leads us to speculate that antibodies to representative molecules should neutralise (that we will exploit, by epidermal DNA immunization the biological function of this important group of venom toxins in vipers that are distributed throughout Africa, the Middle East, and the Indian subcontinent.

  13. Isolation and sequence analysis of a cDNA clone encoding the fifth complement component

    DEFF Research Database (Denmark)

    Lundwall, Åke B; Wetsel, Rick A; Kristensen, Torsten

    1985-01-01

    DNA clone of 1.85 kilobase pairs was isolated. Hybridization of the mixed-sequence probe to the complementary strand of the plasmid insert and sequence analysis by the dideoxy method predicted the expected protein sequence of C5a (positions 1-12), amino-terminal to the anticipated priming site. The sequence......, subcloned into M13 mp8, and sequenced at random by the dideoxy technique, thereby generating a contiguous sequence of 1703 base pairs. This clone contained coding sequence for the C-terminal 262 amino acid residues of the beta-chain, the entire C5a fragment, and the N-terminal 98 residues of the alpha......'-chain. The 3' end of the clone had a polyadenylated tail preceded by a polyadenylation recognition site, a 3'-untranslated region, and base pairs homologous to the human Alu concensus sequence. Comparison of the derived partial human C5 protein sequence with that previously determined for murine C3 and human...

  14. Genomic comparison of Escherichia coli O104:H4 isolates from 2009 and 2011 reveals plasmid, and prophage heterogeneity, including shiga toxin encoding phage stx2.

    Directory of Open Access Journals (Sweden)

    Sanaa A Ahmed

    Full Text Available In May of 2011, an enteroaggregative Escherichia coli O104:H4 strain that had acquired a Shiga toxin 2-converting phage caused a large outbreak of bloody diarrhea in Europe which was notable for its high prevalence of hemolytic uremic syndrome cases. Several studies have described the genomic inventory and phylogenies of strains associated with the outbreak and a collection of historical E. coli O104:H4 isolates using draft genome assemblies. We present the complete, closed genome sequences of an isolate from the 2011 outbreak (2011C-3493 and two isolates from cases of bloody diarrhea that occurred in the Republic of Georgia in 2009 (2009EL-2050 and 2009EL-2071. Comparative genome analysis indicates that, while the Georgian strains are the nearest neighbors to the 2011 outbreak isolates sequenced to date, structural and nucleotide-level differences are evident in the Stx2 phage genomes, the mer/tet antibiotic resistance island, and in the prophage and plasmid profiles of the strains, including a previously undescribed plasmid with homology to the pMT virulence plasmid of Yersinia pestis. In addition, multiphenotype analysis showed that 2009EL-2071 possessed higher resistance to polymyxin and membrane-disrupting agents. Finally, we show evidence by electron microscopy of the presence of a common phage morphotype among the European and Georgian strains and a second phage morphotype among the Georgian strains. The presence of at least two stx2 phage genotypes in host genetic backgrounds that may derive from a recent common ancestor of the 2011 outbreak isolates indicates that the emergence of stx2 phage-containing E. coli O104:H4 strains probably occurred more than once, or that the current outbreak isolates may be the result of a recent transfer of a new stx2 phage element into a pre-existing stx2-positive genetic background.

  15. Electron Resonance Decay into a Biological Function: Decrease in Viability of E. coli Transformed by Plasmid DNA Irradiated with 0.5-18 eV Electrons.

    Science.gov (United States)

    Kouass Sahbani, S; Cloutier, P; Bass, A D; Hunting, D J; Sanche, L

    2015-10-01

    Transient negative ions (TNIs) are ubiquitous in electron-molecule scattering at low electron impact energies (0-20 eV) and are particularly effective in damaging large biomolecules. Because ionizing radiation generates mostly 0-20 eV electrons, TNIs are expected to play important roles in cell mutagenesis and death during radiotherapeutic cancer treatment, although this hypothesis has never been directly verified. Here, we measure the efficiency of transforming E. coli bacteria by inserting into the cells, pGEM-3ZfL(-) plasmid DNA that confers resistance to the antibiotic ampicillin. Before transformation, plasmids are irradiated with electrons of specific energies between 0.5 and 18 eV. The loss of transformation efficiency plotted as a function of irradiation energy reveals TNIs at 5.5 and 9.5 eV, corresponding to similar states observed in the yields of DNA double strand breaks. We show that TNIs are detectable in the electron-energy dependence of a biological process and can decrease cell viability.

  16. Quantification of DNA by Agarose Gel Electrophoresis and Analysis of the Topoisomers of Plasmid and M13 DNA Following Treatment with a Restriction Endonuclease or DNA Topoisomerase I

    Science.gov (United States)

    Tweedie, John W.; Stowell, Kathryn M.

    2005-01-01

    A two-session laboratory exercise for advanced undergraduate students in biochemistry and molecular biology is described. The first session introduces students to DNA quantification by ultraviolet absorbance and agarose gel electrophoresis followed by ethidium bromide staining. The second session involves treatment of various topological forms of…

  17. Cloning and expression of a cDNA encoding human sterol carrier protein 2

    International Nuclear Information System (INIS)

    Yamamoto, Ritsu; Kallen, C.B.; Babalola, G.O.; Rennert, H.; Strauss, J.F. III; Billheimer, J.T.

    1991-01-01

    The authors report the cloning and expression of a cDNA encoding human sterol carrier protein 2 (SCP 2 ). The 1.3-kilobase (kb) cDNA contains an open reading frame which encompasses a 143-amino acid sequence which is 89% identical to the rat SCP 2 amino acid sequence. The deduced amino acid sequence of the polypeptide reveals a 20-residue amino-terminal leader sequence in front of the mature polypeptide, which contains a carboxyl-terminal tripeptide (Ala-Lys-Leu) related to the peroxisome targeting sequence. The expressed cDNA in COS-7 cells yields a 15.3-kDa polypeptide and increased amounts of a 13.2-kDa polypeptide, both reacting with a specific rabbit antiserum to rat liver SCP 2 . The cDNA insert hybridizes with 3.2- and 1.8-kb mRNA species in human liver poly(A) + RNA. In human fibroblasts and placenta the 1.8-kb mRNA was most abundant. Southern blot analysis suggests either that there are multiple copies of the SCP 2 gene in the human genome or that the SCP 2 gene is very large. Coexpression of the SCP 2 cDNA with expression vectors for cholesterol side-chain cleavage enzyme and adrenodoxin resulted in a 2.5-fold enhancement of progestin synthesis over that obtained with expression of the steroidogenic enzyme system alone. These findings are concordant with the notion that SCP 2 plays a role in regulating steroidogenesis, among other possible functions

  18. Arabidopsis thaliana GYRB3 does not encode a DNA gyrase subunit.

    Directory of Open Access Journals (Sweden)

    Katherine M Evans-Roberts

    2010-03-01

    Full Text Available DNA topoisomerases are enzymes that control the topology of DNA in all cells. DNA gyrase is unique among the topoisomerases in that it is the only enzyme that can actively supercoil DNA using the free energy of ATP hydrolysis. Until recently gyrase was thought to be unique to bacteria, but has now been discovered in plants. The genome of the model plant, Arabidopsis thaliana, is predicted to encode four gyrase subunits: AtGyrA, AtGyrB1, AtGyrB2 and AtGyrB3.We found, contrary to previous data, that AtGyrB3 is not essential to the survival of A. thaliana. Bioinformatic analysis suggests AtGyrB3 is considerably shorter than other gyrase B subunits, lacking part of the ATPase domain and other key motifs found in all type II topoisomerases; but it does contain a putative DNA-binding domain. Partially purified AtGyrB3 cannot bind E. coli GyrA or support supercoiling. AtGyrB3 cannot complement an E. coli gyrB temperature-sensitive strain, whereas AtGyrB2 can. Yeast two-hybrid analysis suggests that AtGyrB3 cannot bind to AtGyrA or form a dimer.These data strongly suggest that AtGyrB3 is not a gyrase subunit but has another unknown function. One possibility is that it is a nuclear protein with a role in meiosis in pollen.

  19. A conjugative 38 kB plasmid is present in multiple subspecies of Xylella fastidiosa.

    Science.gov (United States)

    Rogers, Elizabeth E; Stenger, Drake C

    2012-01-01

    A ≈ 38kB plasmid (pXF-RIV5) was present in the Riv5 strain of Xylella fastidiosa subsp. multiplex isolated from ornamental plum in southern California. The complete nucleotide sequence of pXF-RIV5 is almost identical to that of pXFAS01 from X. fastidiosa subsp. fastidiosa strain M23; the two plasmids vary at only 6 nucleotide positions. BLAST searches and phylogenetic analyses indicate pXF-RIV5 and pXFAS01 share some similarity to chromosomal and plasmid (pXF51) sequences of X. fastidiosa subsp. pauca strain 9a5c and more distant similarity to plasmids from a wide variety of bacteria. Both pXF-RIV5 and pXFAS01 encode homologues of a complete Type IV secretion system involved in conjugation and DNA transfer among bacteria. Mating pair formation proteins (Trb) from Yersinia pseudotuberculosis IP31758 are the mostly closely related non-X. fastidiosa proteins to most of the Trb proteins encoded by pXF-RIV5 and pXFAS01. Unlike many bacterial conjugative plasmids, pXF-RIV5 and pXFAS01 do not carry homologues of known accessory modules that confer selective advantage on host bacteria. However, both plasmids encode seven hypothetical proteins of unknown function and possess a small transposon-associated region encoding a putative transposase and associated factor. Vegetative replication of pXF-RIV5 and pXFAS01 appears to be under control of RepA protein and both plasmids have an origin of DNA replication (oriV) similar to that of pRP4 and pR751 from Escherichia coli. In contrast, conjugative plasmids commonly encode TrfA and have an oriV similar to those found in IncP-1 incompatibility group plasmids. The presence of nearly identical plasmids in single strains from two distinct subspecies of X. fastidiosa is indicative of recent horizontal transfer, probably subsequent to the introduction of subspecies fastidiosa to the United States in the late 19(th) century.

  20. A conjugative 38 kB plasmid is present in multiple subspecies of Xylella fastidiosa.

    Directory of Open Access Journals (Sweden)

    Elizabeth E Rogers

    Full Text Available A ≈ 38kB plasmid (pXF-RIV5 was present in the Riv5 strain of Xylella fastidiosa subsp. multiplex isolated from ornamental plum in southern California. The complete nucleotide sequence of pXF-RIV5 is almost identical to that of pXFAS01 from X. fastidiosa subsp. fastidiosa strain M23; the two plasmids vary at only 6 nucleotide positions. BLAST searches and phylogenetic analyses indicate pXF-RIV5 and pXFAS01 share some similarity to chromosomal and plasmid (pXF51 sequences of X. fastidiosa subsp. pauca strain 9a5c and more distant similarity to plasmids from a wide variety of bacteria. Both pXF-RIV5 and pXFAS01 encode homologues of a complete Type IV secretion system involved in conjugation and DNA transfer among bacteria. Mating pair formation proteins (Trb from Yersinia pseudotuberculosis IP31758 are the mostly closely related non-X. fastidiosa proteins to most of the Trb proteins encoded by pXF-RIV5 and pXFAS01. Unlike many bacterial conjugative plasmids, pXF-RIV5 and pXFAS01 do not carry homologues of known accessory modules that confer selective advantage on host bacteria. However, both plasmids encode seven hypothetical proteins of unknown function and possess a small transposon-associated region encoding a putative transposase and associated factor. Vegetative replication of pXF-RIV5 and pXFAS01 appears to be under control of RepA protein and both plasmids have an origin of DNA replication (oriV similar to that of pRP4 and pR751 from Escherichia coli. In contrast, conjugative plasmids commonly encode TrfA and have an oriV similar to those found in IncP-1 incompatibility group plasmids. The presence of nearly identical plasmids in single strains from two distinct subspecies of X. fastidiosa is indicative of recent horizontal transfer, probably subsequent to the introduction of subspecies fastidiosa to the United States in the late 19(th century.

  1. cDNA encoding a polypeptide including a hev ein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  2. Safety and immunogenicity of an HIV-1 gag DNA vaccine with or without IL-12 and/or IL-15 plasmid cytokine adjuvant in healthy, HIV-1 uninfected adults.

    Directory of Open Access Journals (Sweden)

    Spyros A Kalams

    Full Text Available DNA vaccines are a promising approach to vaccination since they circumvent the problem of vector-induced immunity. DNA plasmid cytokine adjuvants have been shown to augment immune responses in small animals and in macaques.We performed two first in human HIV vaccine trials in the US, Brazil and Thailand of an RNA-optimized truncated HIV-1 gag gene (p37 DNA derived from strain HXB2 administered either alone or in combination with dose-escalation of IL-12 or IL-15 plasmid cytokine adjuvants. Vaccinations with both the HIV immunogen and cytokine adjuvant were generally well-tolerated and no significant vaccine-related adverse events were identified. A small number of subjects developed asymptomatic low titer antibodies to IL-12 or IL-15. Cellular immunogenicity following 3 and 4 vaccinations was poor, with response rates to gag of 4.9%/8.7% among vaccinees receiving gag DNA alone, 0%/11.5% among those receiving gag DNA+IL-15, and no responders among those receiving DNA+high dose (1500 ug IL-12 DNA. However, after three doses, 44.4% (4/9 of vaccinees receiving gag DNA and intermediate dose (500 ug of IL-12 DNA demonstrated a detectable cellular immune response.This combination of HIV gag DNA with plasmid cytokine adjuvants was well tolerated. There were minimal responses to HIV gag DNA alone, and no apparent augmentation with either IL-12 or IL-15 plasmid cytokine adjuvants. Despite the promise of DNA vaccines, newer formulations or methods of delivery will be required to increase their immunogenicity.Clinicaltrials.gov NCT00115960 NCT00111605.

  3. Behavior of IncQ Plasmids in Agrobacterium tumefaciens

    NARCIS (Netherlands)

    Hille, Jacques; Schilperoort, Rob

    1981-01-01

    Inc-Q plasmids were introduced into Agrobacterium tumefuciens, by mobilization from Escherichia coli with an Inc-P plasmid, or by transformation with purified plasmid DNA. It was found that they were stably maintained. The presence of an Inc-Q plasmid did not influence tumorigenicity. These results

  4. Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

    International Nuclear Information System (INIS)

    Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

    1988-01-01

    Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

  5. Characterization of cDNA encoding human placental anticoagulant protein (PP4): Homology with the lipocortin family

    International Nuclear Information System (INIS)

    Grundmann, U.; Abel, K.J.; Bohn, H.; Loebermann, H.; Lottspeich, F.; Kuepper, H.

    1988-01-01

    A cDNA library prepared from human placenta was screened for sequences encoding the placental protein 4 (PP4). PP4 is an anticoagulant protein that acts as an indirect inhibitor of the thromboplastin-specific complex, which is involved in the blood coagulation cascade. Partial amino acid sequence information from PP4-derived cyanogen bromide fragments was used to design three oligonucleotide probes for screening the library. From 10 6 independent recombinants, 18 clones were identified that hybridized to all three probes. These 18 recombinants contained cDNA inserts encoding a protein of 320 amino acid residues. In addition to the PP4 cDNA the authors identified 9 other recombinants encoding a protein with considerable similarity (74%) to PP4, which was termed PP4-X. PP4 and PP4-X belong to the lipocortin family, as judged by their homology to lipocortin I and calpactin I

  6. Isolation and sequence of complementary DNA encoding human extracellular superoxide dismutase

    International Nuclear Information System (INIS)

    Hjalmarsson, K.; Marklund, S.L.; Engstroem, A.; Edlund, T.

    1987-01-01

    A complementary DNA (cDNA) clone from a human placenta cDNA library encoding extracellular superoxide dismutase has been isolated and the nucleotide sequence determined. The cDNA has a very high G + C content. EC-SOD is synthesized with a putative 18-amino acid signal peptide, preceding the 222 amino acids in the mature enzyme, indicating that the enzyme is a secretory protein. The first 95 amino acids of the mature enzyme show no sequence homology with other sequenced proteins and there is one possible N-glycosylation site (Asn-89). The amino acid sequence from residues 96-193 shows strong homology (∼ 50%) with the final two-thirds of the sequences of all know eukaryotic CuZn SODs, whereas the homology with the P. leiognathi CuZn SOD is clearly lower. The ligands to Cu and Zn, the cysteines forming the intrasubunit disulfide bridge in the CuZn SODs, and the arginine found in all CuZn SODs in the entrance to the active site can all be identified in EC-SOD. A comparison with bovine CuZn SOD, the three-dimensional structure of which is known, reveals that the homologies occur in the active site and the divergencies are in the part constituting the subunit contact area in CuZn SOD. Amino acid sequence 194-222 in the carboxyl-terminal end of EC-SOD is strongly hydrophilic and contains nine amino acids with a positive charge. This sequence probably confers the affinity of EC-SOD for heparin and heparan sulfate. An analysis of the amino acid sequence homologies with CuZn SODs from various species indicates that the EC-SODs may have evolved form the CuZn SODs before the evolution of fungi and plants

  7. Prioritizing multiple therapeutic targets in parallel using automated DNA-encoded library screening

    Science.gov (United States)

    Machutta, Carl A.; Kollmann, Christopher S.; Lind, Kenneth E.; Bai, Xiaopeng; Chan, Pan F.; Huang, Jianzhong; Ballell, Lluis; Belyanskaya, Svetlana; Besra, Gurdyal S.; Barros-Aguirre, David; Bates, Robert H.; Centrella, Paolo A.; Chang, Sandy S.; Chai, Jing; Choudhry, Anthony E.; Coffin, Aaron; Davie, Christopher P.; Deng, Hongfeng; Deng, Jianghe; Ding, Yun; Dodson, Jason W.; Fosbenner, David T.; Gao, Enoch N.; Graham, Taylor L.; Graybill, Todd L.; Ingraham, Karen; Johnson, Walter P.; King, Bryan W.; Kwiatkowski, Christopher R.; Lelièvre, Joël; Li, Yue; Liu, Xiaorong; Lu, Quinn; Lehr, Ruth; Mendoza-Losana, Alfonso; Martin, John; McCloskey, Lynn; McCormick, Patti; O'Keefe, Heather P.; O'Keeffe, Thomas; Pao, Christina; Phelps, Christopher B.; Qi, Hongwei; Rafferty, Keith; Scavello, Genaro S.; Steiginga, Matt S.; Sundersingh, Flora S.; Sweitzer, Sharon M.; Szewczuk, Lawrence M.; Taylor, Amy; Toh, May Fern; Wang, Juan; Wang, Minghui; Wilkins, Devan J.; Xia, Bing; Yao, Gang; Zhang, Jean; Zhou, Jingye; Donahue, Christine P.; Messer, Jeffrey A.; Holmes, David; Arico-Muendel, Christopher C.; Pope, Andrew J.; Gross, Jeffrey W.; Evindar, Ghotas

    2017-07-01

    The identification and prioritization of chemically tractable therapeutic targets is a significant challenge in the discovery of new medicines. We have developed a novel method that rapidly screens multiple proteins in parallel using DNA-encoded library technology (ELT). Initial efforts were focused on the efficient discovery of antibacterial leads against 119 targets from Acinetobacter baumannii and Staphylococcus aureus. The success of this effort led to the hypothesis that the relative number of ELT binders alone could be used to assess the ligandability of large sets of proteins. This concept was further explored by screening 42 targets from Mycobacterium tuberculosis. Active chemical series for six targets from our initial effort as well as three chemotypes for DHFR from M. tuberculosis are reported. The findings demonstrate that parallel ELT selections can be used to assess ligandability and highlight opportunities for successful lead and tool discovery.

  8. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.

    Science.gov (United States)

    Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo

    2017-06-25

    Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.

  9. Low-Molecular Weight Polyethylenimine Modified with Pluronic 123 and RGD- or Chimeric RGD-NLS Peptide: Characteristics and Transfection Efficacy of Their Complexes with Plasmid DNA

    Directory of Open Access Journals (Sweden)

    Jing Hu

    2016-05-01

    Full Text Available To solve the problem of transfection efficiency vs. cytotoxicity and tumor-targeting ability when polyethylenimine (PEI was used as a nonviral gene delivery vector, new degradable PEI polymers were synthesized via cross-linking low-molecular-weight PEI with Pluronic P123 and then further coupled with a targeting peptide R4 (RGD and a bifunctional R11 (RGD-NLS, which were termed as P123-PEI-R4 and P123-PEI-R11, respectively. Agarose gel electrophoresis showed that both P123-PEI-R4 and P123-PEI-R11 efficaciously condense plasmid DNA at a polymer-to-pDNA w/w ratio of 3.0 and 0.4, respectively. The polyplexes were stable in the presence of serum and could protect plasmid DNA against DNaseI. They had uniform spherical nanoparticles with appropriate sizes around 100–280 nm and zeta-potentials about +40 mV. Furthermore, in vitro experiments showed that these polyplexes had lower cytotoxicity at any concentration compared with PEI 25 kDa, thus giving promise to high transfection efficiency as compared with another P123-PEI derivate conjugated with trifunctional peptide RGD-TAT-NLS (P123-PEI-R18. More importantly, compared with the other polymers, P123-PEI-R11 showed the highest transfection efficiency with relatively lower cytotoxicity at any concentration, indicating that the new synthetic polymer P123-PEI-R11 could be used as a safe and efficient gene deliver vector.

  10. Translesion DNA synthesis and mutation induced in a plasmid with a single adduct of the environmental contaminant 3-nitrobenzanthrone in SOS-induced Escherichia coli

    International Nuclear Information System (INIS)

    Kawanishi, M.; Kanno, T.; Yagi, T.; Enya-Takamura, T.; Fuchs, R.P.

    2003-01-01

    Full text: 3-Nitrobenzanthrone (NBA) is a powerfully mutagenic nitrated aromatic hydrocarbon found in diesel exhaust and in airborne particulate matters. NBA forms an unusual DNA adduct in vitro that has a C-C bond between the C-8 position of deoxyguanosine and the C-2 position of NBA. We previously found that this adduct is also present in the human cells treated with NBA, and induces mutations in supF shuttle vector system. In this study, we analyzed translesion DNA synthesis (TLS) over a single adduct in lacZ' gene in a plasmid in uvrAmutS Escherichia coli. The result showed that the adduct blocked DNA replication and an observed TLS frequency was 5.4% in non-SOS-induced E. coli. All progenies after the TLS had no mutation. On the other hand, TLS increased to 11.3%, and 4.8% of them had mostly G to T mutations in SOS-induced E. coli. These results suggest that this unusual adduct would be one of causes of lung cancer that is increasing in the urban areas polluted with diesel exhaust. It must be interesting to reveal which DNA polymerase is involved in this TLS

  11. The SXT conjugative element and linear prophage N15 encode toxin-antitoxin-stabilizing systems homologous to the tad-ata module of the Paracoccus aminophilus plasmid pAMI2.

    Science.gov (United States)

    Dziewit, Lukasz; Jazurek, Magdalena; Drewniak, Lukasz; Baj, Jadwiga; Bartosik, Dariusz

    2007-03-01

    A group of proteic toxin-antitoxin (TA) cassettes whose representatives are widely distributed among bacterial genomes has been identified. These cassettes occur in chromosomes, plasmids, bacteriophages, and noncomposite transposons, as well as in the SXT conjugative element of Vibrio cholerae. The following four homologous loci were subjected to detailed comparative studies: (i) tad-ata from plasmid pAMI2 of Paracoccus aminophilus (the prototype of this group), (ii) gp49-gp48 from the linear bacteriophage N15 of Escherichia coli, (iii) s045-s044 from SXT, and (iv) Z3230-Z3231 from the genomic island of enterohemorrhagic Escherichia coli O157:H7 strain EDL933. Functional analysis revealed that all but one of these loci (Z3230-Z3231) are able to stabilize heterologous replicons, although the host ranges varied. The TA cassettes analyzed have the following common features: (i) the toxins are encoded by the first gene of each operon; (ii) the antitoxins contain a predicted helix-turn-helix motif of the XRE family; and (iii) the cassettes have two promoters that are different strengths, one which is located upstream of the toxin gene and one which is located upstream of the antitoxin gene. All four toxins tested are functional in E. coli; overexpression of the toxins (in the absence of antitoxin) results in a bacteriostatic effect manifested by elongation of bacterial cells and growth arrest. The toxins have various effects on cell viability, which suggests that they may recognize different intracellular targets. Preliminary data suggest that different cellular proteases are involved in degradation of antitoxins encoded by the loci analyzed.

  12. Isolation, nucleotide sequence and expression of a cDNA encoding feline granulocyte colony-stimulating factor.

    Science.gov (United States)

    Dunham, S P; Onions, D E

    2001-06-21

    A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.

  13. Lipofection and nucleofection of substrate plasmid can generate widely different readings of DNA end-joining efficiency in different cell lines.

    Science.gov (United States)

    Magin, Simon; Saha, Janapriya; Wang, Minli; Mladenova, Veronika; Coym, Nadine; Iliakis, George

    2013-02-01

    In vivo plasmid end-joining assays are valuable tools for dissecting important qualitative and quantitative aspects of non-homologous end-joining (NHEJ)--a key mechanism for the repair of DNA double-strand breaks (DSBs) in higher eukaryotes. They enable the use of defined DNA ends as substrates for end-joining and the analysis by sequencing of the resulting junctions to identify the repair pathways engaged. Yet, plasmid assays have generated divergent results of end-joining capacity in the same DSB repair mutants when used under different conditions, which implies contributions from undefined and therefore uncontrolled parameters. To help standardize these assays, we searched for parameters underpinning these variations and identified transfection method as an important determinant. Here, we compare a lipid-based transfection method, lipofection, with an electroporation method, nucleofection, and find large, unanticipated and cell line-dependent differences in percent end-joining without recognizable trends. For example, in rodent cells, transfection using lipofection gives nearly WT end-joining in DNA-PKcs mutants and only mildly inhibited end-joining in Lig4 and Ku mutants. In contrast, transfection using nucleofection shows marked end-joining inhibition in all NHEJ mutants tested as compared to the WT. In human HCT116 cells, end-joining after nucleofection is strongly suppressed even in the WT and the differences to the mutants are small. After lipofection, in contrast, end-joining is high in WT cells and markedly suppressed in the mutants. We conclude that better understanding and control of the physicochemical/biological and analytical parameters underpinning these differences will be required to generate with plasmid assays results with quantitative power comparable to that of well-established methods of DSB analysis such as pulsed-field gel electrophoresis or γ-H2AX foci scoring. Until then, caution is needed in the interpretation of the results obtained

  14. Implication of the E. coli K12 uvrA and recA genes in the repair of 8-methoxypsoralen-induced mono adducts and crosslinks on plasmid DNA

    International Nuclear Information System (INIS)

    Paramio, J.M.; Bauluz, C.; Vidania, R. de

    1986-01-01

    Genotoxicity of psoralen damages on plasmid DNA has been studied. pBR322 DNA was randomly modified with several concentrations of 8-methoxypsoralen plus 365 nm-UV light. After transformation into E. coli strains (wild-type, uvrA and recA) plasmid survival and mutagenesis were analyzed. To study the influence of the SOS response on plasmid recovery, preirradiation of the cells was performed. In absence of cell preirradiation, crosslinks were not repaired in any strain. Mono adducts were also lethal but in part removed by the excision-repair pathway. Preirradiation of the cells significantly. increased plasmid recovery in recA+ celia. In uvrA- only the mutagenic pathway seemed to be involved in the repair of the damaged DNA. Wild type strain showed the highest increase in plasmid survival, involving the repair of mono adducts and some fraction of crosslinks mainly through an error-free repair pathway. This suggests an enhancement of the excision repair promoted by the induction of SOS functions. (Author) 32 refs

  15. Safety and immunogenicity of an oral DNA vaccine encoding Sip of Streptococcus agalactiae from Nile tilapia Oreochromis niloticus delivered by live attenuated Salmonella typhimurium.

    Science.gov (United States)

    Huang, L Y; Wang, K Y; Xiao, D; Chen, D F; Geng, Y; Wang, J; He, Y; Wang, E L; Huang, J L; Xiao, G Y

    2014-05-01

    Attenuated Salmonella typhimurium SL7207 was used as a carrier for a reconstructed DNA vaccine against Streptococcus agalactiae. A 1.02 kb DNA fragment, encoding for a portion of the surface immunogenic protein (Sip) of S. agalactiae was inserted into pVAX1. The recombinant plasmid pVAX1-sip was transfected in EPC cells to detect the transient expression by an indirect immunofluorescence assay, together with Western blot analysis. The pVAX1-sip was transformed by electroporation into SL7207. The stability of pVAX1-sip into Salmonella was over 90% after 50 generations with antibiotic selection in vitro while remained stable over 80% during 35 generations under antibiotic-free conditions. The LD50 of SL/pVAX1-sip was 1.7 × 10(11) CFU/fish by intragastric administration which indicated a quite low virulence. Tilapias were inoculated orally at 10(8) CFU/fish, the recombinant bacteria were found present in intestinal tract, spleens and livers and eventually eliminated from the tissues 4 weeks after immunization. Fish immunized at 10(7), 10(8) and 10(9) CFU/fish with different immunization times caused various levels of serum antibody and an effective protection against lethal challenge with the wild-type strain S. agalactiae. Integration studies showed that the pVAX1-sip did not integrate with tilapia chromosomes. The DNA vaccine SL/pVAX1-sip was proved to be safe and effective in protecting tilapias against S. agalactiae infection. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein

    Science.gov (United States)

    Wang, W.; Takezawa, D.; Poovaiah, B. W.

    1996-01-01

    A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

  17. RepA and RepB exert plasmid incompatibility repressing the transcription of the repABC operon.

    Science.gov (United States)

    Pérez-Oseguera, Angeles; Cevallos, Miguel A

    2013-11-01

    Rhizobium etli CFN42 has a multipartite genome composed of one chromosome and six large plasmids with low copy numbers, all belonging to the repABC plasmid family. All elements essential for replication and segregation of these plasmids are encoded within the repABC operon. RepA and RepB direct plasmid segregation and are involved in the transcriptional regulation of the operon, and RepC is the initiator protein of the plasmid. Here we show that in addition to RepA (repressor) and RepB (corepressor), full transcriptional repression of the operon located in the symbiotic plasmid (pRetCFN42d) of this strain requires parS, the centromere-like sequence, and the operator sequence. However, the co-expression of RepA and RepB is sufficient to induce the displacement of the parental plasmid. RepA is a Walker-type ATPase that self associates in vivo and in vitro and binds specifically to the operator region in its RepA-ADP form. In contrast, RepA-ATP is capable of binding to non-specific DNA. RepA and RepB form high molecular weight DNA-protein complexes in the presence of ATP and ADP. RepA carrying ATP-pocket motif mutations induce full repression of the repABC operon without the participation of RepB and parS. These mutants specifically bind the operator sequence in their ATP or ADP bound forms. In addition, their expression in trans exerts plasmid incompatibility against the parental plasmid. RepA and RepB expressed in trans induce plasmid incompatibility because of their ability to repress the repABC operon and not only by their capacity to distort the plasmid segregation process. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. Isolation and characterization of human cDNA clones encoding the α and the α' subunits of casein kinase II

    International Nuclear Information System (INIS)

    Lozeman, F.J.; Litchfield, D.W.; Piening, C.; Takio, Koji; Walsh, K.A.; Krebs, E.G.

    1990-01-01

    Casein kinase II is a widely distributed protein serine/threonine kinase. The holoenzyme appears to be a tetramer, containing two α or α' subunits (or one of each) and two β subunits. Complementary DNA clones encoding the subunits of casein kinase II were isolated from a human T-cell λgt 10 library using cDNA clones isolated from Drosophila melanogasten. One of the human cDNA clones (hT4.1) was 2.2 kb long, including a coding region of 1176 bp preceded by 156 bp (5' untranslated region) and followed by 871 bp (3' untranslated region). The hT4.1 close was nearly identical in size and sequence with a cDNA clone from HepG2 human hepatoma cultured cells. Another of the human T-cell cDNA clones (hT9.1) was 1.8 kb long, containing a coding region of 1053 bp preceded by 171 by (5' untranslated region) and followed by 550 bp (3' untranslated region). Amino acid sequences deduced from these two cDNA clones were about 85% identical. Most of the difference between the two encoded polypeptides was in the carboxy-terminal region, but heterogeneity was distributed throughout the molecules. Partial amino acid sequence was determined in a mixture of α and α' subunits from bovine lung casein kinase II. The bovine sequences aligned with the 2 human cDNA-encoded polypeptides with only 2 discrepancies out of 535 amino acid positions. This confirmed that the two human T-cell cDNA clones encoded the α and α' subunits of casein kinase II. These studies show that there are two distinct catalytic subunits for casein II (α and α') and that the sequence of these subunits is largely conserved between the bovine and the human

  19. The ada operon of Mycobacterium tuberculosis encodes two DNA methyltransferases for inducible repair of DNA alkylation damage.

    Science.gov (United States)

    Yang, Mingyi; Aamodt, Randi M; Dalhus, Bjørn; Balasingham, Seetha; Helle, Ina; Andersen, Pernille; Tønjum, Tone; Alseth, Ingrun; Rognes, Torbjørn; Bjørås, Magnar

    2011-06-10

    The ada operon of Mycobacterium tuberculosis, which encodes a composite protein of AdaA and AlkA and a separate AdaB/Ogt protein, was characterized. M. tuberculosis treated with N-methyl-N'-nitro-N-nitrosoguanidine induced transcription of the adaA-alkA and adaB genes, suggesting that M. tuberculosis mount an inducible response to methylating agents. Survival assays of the methyltransferase defective Escherichia coli mutant KT233 (ada ogt), showed that expression of the adaB gene rescued the alkylation sensitivity. Further, adaB but not adaA-alkA complemented the hypermutator phenotype of KT233. Purified AdaA-AlkA and AdaB possessed methyltransferase activity. These data suggested that AdaB counteract the cytotoxic and mutagenic effect of O(6)-methylguanine, while AdaA-AlkA most likely transfers methyl groups from innocuous methylphosphotriesters. AdaA-AlkA did not possess alkylbase DNA glycosylase activity nor rescue the alkylation sensitivity of the E. coli mutant BK2118 (tag alkA). We propose that AdaA-AlkA is a positive regulator of the adaptive response in M. tuberculosis. It thus appears that the ada operon of M. tuberculosis suppresses the mutagenic effect of alkylation but not the cytotoxic effect of lesions such as 3-methylpurines. Collectively, these data indicate that M. tuberculosis hypermutator strains with defective adaptive response genes might sustain robustness to cytotoxic alkylation DNA damage and confer a selective advantage contributing to host adaptation. Copyright © 2011 Elsevier B.V. All rights reserved.

  20. Combined virus-like particle and fusion protein-encoding DNA vaccination of cotton rats induces protection against respiratory syncytial virus without causing vaccine-enhanced disease

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, Hye Suk; Lee, Young-Tae; Kim, Ki-Hye; Park, Soojin; Kwon, Young-Man; Lee, Youri; Ko, Eun-Ju; Jung, Yu-Jin [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); Lee, Jong Seok [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); National Institute of Biological Resources, Incheon (Korea, Republic of); Kim, Yu-Jin [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); Lee, Yu-Na; Kim, Min-Chul [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); Animal and Plant Quarantine Agency, Gyeonggi-do, Gimcheon, Gyeongsangbukdo (Korea, Republic of); Cho, Minkyoung [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); Kang, Sang-Moo, E-mail: skang24@gsu.edu [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States)

    2016-07-15

    A safe and effective vaccine against respiratory syncytial virus (RSV) should confer protection without causing vaccine-enhanced disease. Here, using a cotton rat model, we investigated the protective efficacy and safety of an RSV combination vaccine composed of F-encoding plasmid DNA and virus-like particles containing RSV fusion (F) and attachment (G) glycoproteins (FFG-VLP). Cotton rats with FFG-VLP vaccination controlled lung viral replication below the detection limit, and effectively induced neutralizing activity and antibody-secreting cell responses. In comparison with formalin inactivated RSV (FI-RSV) causing severe RSV disease after challenge, FFG-VLP vaccination did not cause weight loss, airway hyper-responsiveness, IL-4 cytokines, histopathology, and infiltrates of proinflammatory cells such as eosinophils. FFG-VLP was even more effective in preventing RSV-induced pulmonary inflammation than live RSV infections. This study provides evidence that FFG-VLP can be developed into a safe and effective RSV vaccine candidate. - Highlights: • Combined RSV FFG VLP vaccine is effective in inducing F specific responses. • FFG VLP vaccine confers RSV neutralizing activity and viral control in cotton rats. • Cotton rats with RSV FFG VLP vaccination do not show vaccine-enhanced disease. • Cotton rats with FFG VLP vaccine induce F specific antibody secreting cell responses. • Cotton rats with FFG VLP do not induce lung cellular infiltrates and Th2 cytokine.

  1. Combined virus-like particle and fusion protein-encoding DNA vaccination of cotton rats induces protection against respiratory syncytial virus without causing vaccine-enhanced disease

    International Nuclear Information System (INIS)

    Hwang, Hye Suk; Lee, Young-Tae; Kim, Ki-Hye; Park, Soojin; Kwon, Young-Man; Lee, Youri; Ko, Eun-Ju; Jung, Yu-Jin; Lee, Jong Seok; Kim, Yu-Jin; Lee, Yu-Na; Kim, Min-Chul; Cho, Minkyoung; Kang, Sang-Moo

    2016-01-01

    A safe and effective vaccine against respiratory syncytial virus (RSV) should confer protection without causing vaccine-enhanced disease. Here, using a cotton rat model, we investigated the protective efficacy and safety of an RSV combination vaccine composed of F-encoding plasmid DNA and virus-like particles containing RSV fusion (F) and attachment (G) glycoproteins (FFG-VLP). Cotton rats with FFG-VLP vaccination controlled lung viral replication below the detection limit, and effectively induced neutralizing activity and antibody-secreting cell responses. In comparison with formalin inactivated RSV (FI-RSV) causing severe RSV disease after challenge, FFG-VLP vaccination did not cause weight loss, airway hyper-responsiveness, IL-4 cytokines, histopathology, and infiltrates of proinflammatory cells such as eosinophils. FFG-VLP was even more effective in preventing RSV-induced pulmonary inflammation than live RSV infections. This study provides evidence that FFG-VLP can be developed into a safe and effective RSV vaccine candidate. - Highlights: • Combined RSV FFG VLP vaccine is effective in inducing F specific responses. • FFG VLP vaccine confers RSV neutralizing activity and viral control in cotton rats. • Cotton rats with RSV FFG VLP vaccination do not show vaccine-enhanced disease. • Cotton rats with FFG VLP vaccine induce F specific antibody secreting cell responses. • Cotton rats with FFG VLP do not induce lung cellular infiltrates and Th2 cytokine.

  2. Characterization of the cDNA encoding human nucleophosmin and studies of its role in normal and abnormal growth

    International Nuclear Information System (INIS)

    Chan, Waiyee; Liu, Qingrong; Borjigin, J.; Busch, H.; Rennert, O.M.; Tease, L.A.; Chan, Puikwong

    1989-01-01

    A cDNA encoding human nucleophosmin (protein B23) was obtained by screening a human placental cDNA library in δgtll first with monoclonal antibody to rat nucleophosmin and then with confirmed partial cDNA of human nucleophosmin as probes. The cDNA had 1,311 bp with a coding sequence encoding a protein of 294 amino acids. The identity of the cDNA was confirmed by the presence of encoded amino acid sequences identical with those determined by sequencing pure rat nucleophosmin (a total of 138 amino acids). The most striking feature of the sequence is an acidic cluster located in the middle of the molecule. The cluster consists of 26 Asp/Glu and 1 Phe and Ala. Comparison of human nucleophosmin and Xenopus nucleolar protein NO38 shows 64.3% sequence identity. The N-terminal 130 amino acids of human nucleophosmin also bear 50% identity with that of Xenopus nucleoplasmin. Northern blot analysis of rat liver total RNA with a partial nucleophosmin cDNA as probe demonstrated a homogeneous mRNA band of about 1.6 kb. Similar observations were made in hypertrophic rat liver and Novikoff hepatoma. When the protein levels were compared with Western blot immunoassays, Navikoff hepatoma showed 20 times more nucleophosmin, while only about 5 times more nucleophosmin was observed in hypertrophic rat liver than in unstimulated normal liver

  3. Involvement of DNA polymerase beta in repair of ionizing radiation damage as measured by in vitro plasmid assays.

    NARCIS (Netherlands)

    Vens, C.; Hofland, I.; Begg, A.C.

    2007-01-01

    Characteristic of damage introduced in DNA by ionizing radiation is the induction of a wide range of lesions. Single-strand breaks (SSBs) and base damages outnumber double-strand breaks (DSBs). If unrepaired, these lesions can lead to DSBs and increased mutagenesis. XRCC1 and DNA polymerase beta

  4. Comparison of two DNA microarrays for detection of plasmid-mediated antimicrobial resistance and virulence factor genes in clinical isolates of Enterobacteriaceae and non-Enterobacteriaceae.

    LENUS (Irish Health Repository)

    Walsh, Fiona

    2010-06-01

    A DNA microarray was developed to detect plasmid-mediated antimicrobial resistance (AR) and virulence factor (VF) genes in clinical isolates of Enterobacteriaceae and non-Enterobacteriaceae. The array was validated with the following bacterial species: Escherichiacoli (n=17); Klebsiellapneumoniae (n=3); Enterobacter spp. (n=6); Acinetobacter genospecies 3 (n=1); Acinetobacterbaumannii (n=1); Pseudomonasaeruginosa (n=2); and Stenotrophomonasmaltophilia (n=2). The AR gene profiles of these isolates were identified by polymerase chain reaction (PCR). The DNA microarray consisted of 155 and 133 AR and VF gene probes, respectively. Results were compared with the commercially available Identibac AMR-ve Array Tube. Hybridisation results indicated that there was excellent correlation between PCR and array results for AR and VF genes. Genes conferring resistance to each antibiotic class were identified by the DNA array. Unusual resistance genes were also identified, such as bla(SHV-5) in a bla(OXA-23)-positive carbapenem-resistant A. baumannii. The phylogenetic group of each E. coli isolate was verified by the array. These data demonstrate that it is possible to screen simultaneously for all important classes of mobile AR and VF genes in Enterobacteriaceae and non-Enterobacteriaceae whilst also assigning a correct phylogenetic group to E. coli isolates. Therefore, it is feasible to test clinical Gram-negative bacteria for all known AR genes and to provide important information regarding pathogenicity simultaneously.

  5. Cloning of a cDNA encoding a novel human nuclear phosphoprotein belonging to the WD-40 family

    DEFF Research Database (Denmark)

    Honoré, B; Leffers, H; Madsen, Peder

    1994-01-01

    We have cloned and expressed in vaccinia virus a cDNA encoding an ubiquitous 501-amino-acid (aa) phosphoprotein that corresponds to protein IEF SSP 9502 (79,400 Da, pI 4.5) in the master 2-D-gel keratinocyte protein database [Celis et al., Electrophoresis 14 (1993) 1091-1198]. The deduced aa...

  6. A cDNA encoding a pRB-binding protein with properties of the transcription factor E2F

    DEFF Research Database (Denmark)

    Helin, K; Lees, J A; Vidal, M

    1992-01-01

    The retinoblastoma protein (pRB) plays an important role in the control of cell proliferation, apparently by binding to and regulating cellular transcription factors such as E2F. Here we describe the characterization of a cDNA clone that encodes a protein with properties of E2F. This clone, RBP3...

  7. Molecular cloning and expression of cDNA encoding a lumenal calcium binding glycoprotein from sarcoplasmic reticulum

    International Nuclear Information System (INIS)

    Leberer, E.; Charuk, J.H.M.; MacLennan, D.H.; Green, N.M.

    1989-01-01

    Antibody screening was used to isolate a cDNA encoding the 160-kDa glycoprotein of rabbit skeletal muscle sarcoplasmic reticulum. The cDNA is identical to that encoding the 53-kDa glycoprotein except that it contains an in-frame insertion of 1,308 nucleotides near its 5' end, apparently resulting from alternative splicing. The protein encoded by the cDNA would contain a 19-residue NH 2 -terminal signal sequence and a 453-residue COOH-terminal sequence identical to the 53-kDa glycoprotein. It would also contain a 436-amino acid insert between these sequences. This insert would be highly acidic, suggesting that it might bind Ca 2+ . The purified 160-kDa glycoprotein and the glycoprotein expressed in COS-1 cells transfected with cDNA encoding the 160-kDa glycoprotein were shown to bind 45 C 2+ in a gel overlay assay. The protein was shown to be located in the lumen of the sarcoplasmic reticulum and to be associated through Ca 2+ with the membrane. The authors propose that this lumenal Ca 2+ binding glycoprotein of the sarcoplasmic reticulum be designated sarcalumenin

  8. Purification and Genetic Characterization of Enterocin I from Enterococcus faecium 6T1a, a Novel Antilisterial Plasmid-Encoded Bacteriocin Which Does Not Belong to the Pediocin Family of Bacteriocins

    Science.gov (United States)

    Floriano, Belén; Ruiz-Barba, José L.; Jiménez-Díaz, Rufino

    1998-01-01

    Enterocin I (ENTI) is a novel bacteriocin produced by Enterococcus faecium 6T1a, a strain originally isolated from a Spanish-style green olive fermentation. The bacteriocin is active against many olive spoilage and food-borne gram-positive pathogenic bacteria, including clostridia, propionibacteria, and Listeria monocytogenes. ENTI was purified to homogeneity by ammonium sulfate precipitation, binding to an SP-Sepharose fast-flow column, and phenyl-Sepharose CL-4B and C2/C18 reverse-phase chromatography. The purification procedure resulted in a final yield of 954% and a 170,000-fold increase in specific activity. The primary structure of ENTI was determined by amino acid and nucleotide sequencing. ENTI consists of 44 amino acids and does not show significant sequence similarity with any other previously described bacteriocin. Sequencing of the entI structural gene, which is located on the 23-kb plasmid pEF1 of E. faecium 6T1a, revealed the absence of a leader peptide at the N-terminal region of the gene product. A second open reading frame, ORF2, located downstream of entI, encodes a putative protein that is 72.7% identical to ENTI. entI and ORF2 appear to be cotranscribed, yielding an mRNA of ca. 0.35 kb. A gene encoding immunity to ENTI was not identified. However, curing experiments demonstrated that both enterocin production and immunity are conferred by pEF1. PMID:9835578

  9. Protective efficacy of cationic-PLGA microspheres loaded with DNA vaccine encoding the sip gene of Streptococcus agalactiae in tilapia.

    Science.gov (United States)

    Ma, Yan-Ping; Ke, Hao; Liang, Zhi-Ling; Ma, Jiang-Yao; Hao, Le; Liu, Zhen-Xing

    2017-07-01

    Streptococcus agalactiae (S. agalactiae) is an important fish pathogen, which has received more attention in the past decade due to the increasing economic losses in the tilapia industry worldwide. As existing effective vaccines of S. agalactiae in fish have obvious disadvantage, to select immunoprotective antigens and package materials would undoubtedly contribute to the development of novel oral vaccines. In the present study, surface immunogenic protein (sip) was selected from the S. agalactiae serovar I a genomes as immunogenic protein in DNA vaccine form with cationic chitosan and biodegradable and biocompatible PLGA. The pcSip plasmid in cationic-PLGA was successfully expressed in tissues of immunized tilapia and the immunogenicity was assessed in tilapia challenge model. A significant increase was observed in the cytokine levels of IL-1β, TNF-α, CC1, CC2 in spleen and kidney tissues. Furthermore, immunized tilapia conferred different levels of protection against challenge with a lethal dose of highly virulent serovar I a S. agalactiae. Our results indicated that the pcSip plasmid in cationic-PLGA induced high level of antibodies and protection against S. agalactiae infection, could be effective oral DNA vaccine candidates. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Vaccination with DNA encoding truncated enterohemorrhagic Escherichia coli (EHEC factor for adherence-1 gene (efa-1’ confers protective immunity to mice infected with E. coli O157:H7

    Directory of Open Access Journals (Sweden)

    Roberto eRiquelme-Neira

    2016-01-01

    Full Text Available Enterohemorrhagic Escherichia coli (EHEC O157:H7 is the predominant causative agent of hemorrhagic colitis in humans and is the cause of haemolytic uraemic syndrome and other illnesses. Cattle have been implicated as the main reservoir of this organism. Here, we evaluated the immunogenicity and protective efficacy of a DNA vaccine encoding conserved sequences of truncated EHEC factor for adherence-1 (efa-1’ in a mouse model. Intranasal administration of plasmid DNA carrying the efa-1’ gene (pVAXefa-1’ into C57BL/6 mice elicited both humoral and cellular immune responses. In animals immunized with pVAXefa-1`, EHEC-secreted protein-specific IgM and IgG antibodies were detected in sera at day 45. Anti-EHEC-secreted protein sIgA was also detected in nasal and bronchoalveolar lavages. In addition, antigen-specific T-cell-proliferation, IL-10 and IFN-γ were observed upon re-stimulation with either heat-killed bacteria or EHEC-secreted proteins. Vaccinated animals were also protected against challenge with E. coli O157:H7 strain EDL933. These results suggest that DNA vaccine encoding efa-1´ have therapeutic potential in interventions against EHEC infections. This approach could lead to a new strategy in the production of vaccines that prevent infections in cattle.

  11. Parameters influencing the introduction of plasmid DNA into cells by the use of synthetic amphiphiles as a carrier system

    OpenAIRE

    van der Woude, Irene; Willy Visser, H.; ter Beest, Martin B.A.; Wagenaar, Anno; Ruiters, Marcel H.J.; Engberts, Jan B.F.N.; Hoekstra, Dick

    1995-01-01

    Parameters that affect cellular transfection as accomplished by introducing DNA via carriers composed of cationic synthetic amphiphiles, have been investigated with the aim to obtain insight into the mechanism of DNA translocation. Such insight may be exploited in optimizing carrier properties of synthetic amphiphiles for molecules other than nucleic acids. In the present work, the interaction of vesicles composed of the cationic amphiphile dioleyloxy-propyl-trimethylammonium chloride (DOTMA)...

  12. A Novel IncA/C1 Group Conjugative Plasmid, Encoding VIM-1 Metallo-Beta-Lactamase, Mediates the Acquisition of Carbapenem Resistance in ST104 Klebsiella pneumoniae Isolates from Neonates in the Intensive Care Unit of V. Monaldi Hospital in Naples.

    Science.gov (United States)

    Esposito, Eliana P; Gaiarsa, Stefano; Del Franco, Mariateresa; Crivaro, Valeria; Bernardo, Mariano; Cuccurullo, Susanna; Pennino, Francesca; Triassi, Maria; Marone, Piero; Sassera, Davide; Zarrilli, Raffaele

    2017-01-01

    The emergence of carbapenemase producing Enterobacteriaceae has raised major public health concern. The aim of this study was to investigate the molecular epidemiology and the mechanism of carbapenem resistance acquisition of multidrug-resistant Klebsiella pneumoniae isolates from 20 neonates in the neonatal intensive care unit (NICU) of the V. Monaldi Hospital in Naples, Italy, from April 2015 to March 2016. Genotype analysis by pulsed-field gel electrophoresis (PFGE) and multi-locus sequence typing (MLST) identified PFGE type A and subtypes A1 and A2 in 17, 2, and 1 isolates, respectively, and assigned all isolates to sequence type (ST) 104. K. pneumoniae isolates were resistant to all classes of β-lactams including carbapenems, fosfomycin, gentamicin, and trimethoprim-sulfamethoxazole, but susceptible to quinolones, amikacin, and colistin. Conjugation experiments demonstrated that resistance to third-generation cephems and imipenem could be transferred along with an IncA/C plasmid containing the extended spectrum β-lactamase bla SHV -12 and carbapenem-hydrolyzing metallo-β-lactamase bla V IM-1 genes. The plasmid that we called pIncAC_KP4898 was 156,252 bp in size and included a typical IncA/C backbone, which was assigned to ST12 and core genome (cg) ST12.1 using the IncA/C plasmid MLST (PMLST) scheme. pIncAC_KP4898 showed a mosaic structure with bla V IM-1 into a class I integron, bla SHV -12 flanked by IS6 elements, a mercury resistance and a macrolide 2'-phosphotransferase clusters, ant(3″), aph(3″), aacA4, qnrA1, sul1 , and dfrA14 conferring resistance to aminoglycosides, quinolones, sulfonamides, and trimethoprim, respectively, several genes predicted to encode transfer functions and proteins involved in DNA transposition. The acquisition of pIncAC_KP4898 carrying bla V IM-1 and bla SHV -12 contributed to the spread of ST104 K. pneumoniae in the NICU of V. Monaldi Hospital in Naples.

  13. A Novel IncA/C1 Group Conjugative Plasmid, Encoding VIM-1 Metallo-Beta-Lactamase, Mediates the Acquisition of Carbapenem Resistance in ST104 Klebsiella pneumoniae Isolates from Neonates in the Intensive Care Unit of V. Monaldi Hospital in Naples

    Directory of Open Access Journals (Sweden)

    Eliana P. Esposito

    2017-11-01

    Full Text Available The emergence of carbapenemase producing Enterobacteriaceae has raised major public health concern. The aim of this study was to investigate the molecular epidemiology and the mechanism of carbapenem resistance acquisition of multidrug-resistant Klebsiella pneumoniae isolates from 20 neonates in the neonatal intensive care unit (NICU of the V. Monaldi Hospital in Naples, Italy, from April 2015 to March 2016. Genotype analysis by pulsed-field gel electrophoresis (PFGE and multi-locus sequence typing (MLST identified PFGE type A and subtypes A1 and A2 in 17, 2, and 1 isolates, respectively, and assigned all isolates to sequence type (ST 104. K. pneumoniae isolates were resistant to all classes of β-lactams including carbapenems, fosfomycin, gentamicin, and trimethoprim–sulfamethoxazole, but susceptible to quinolones, amikacin, and colistin. Conjugation experiments demonstrated that resistance to third-generation cephems and imipenem could be transferred along with an IncA/C plasmid containing the extended spectrum β-lactamase blaSHV -12 and carbapenem-hydrolyzing metallo-β-lactamase blaV IM-1 genes. The plasmid that we called pIncAC_KP4898 was 156,252 bp in size and included a typical IncA/C backbone, which was assigned to ST12 and core genome (cg ST12.1 using the IncA/C plasmid MLST (PMLST scheme. pIncAC_KP4898 showed a mosaic structure with blaV IM-1 into a class I integron, blaSHV -12 flanked by IS6 elements, a mercury resistance and a macrolide 2′-phosphotransferase clusters, ant(3″, aph(3″, aacA4, qnrA1, sul1, and dfrA14 conferring resistance to aminoglycosides, quinolones, sulfonamides, and trimethoprim, respectively, several genes predicted to encode transfer functions and proteins involved in DNA transposition. The acquisition of pIncAC_KP4898 carrying blaV IM-1 and blaSHV -12 contributed to the spread of ST104 K. pneumoniae in the NICU of V. Monaldi Hospital in Naples.

  14. Detection of an IncA/C plasmid encoding VIM-4 and CMY-4 β-lactamases in Klebsiella oxytoca and Citrobacter koseri from an inpatient in a cardiac rehabilitation unit.

    Science.gov (United States)

    Caltagirone, Mariasofia; Bitar, Ibrahim; Piazza, Aurora; Spalla, Melissa; Nucleo, Elisabetta; Navarra, Antonella; Migliavacca, Roberta

    2015-07-01

    A 62-year-old patient was transferred to the cardiac rehabilitation unit of the I.R.C.C.S. Fondazione S. Maugeri after undergoing a heart transplantation at the Acute Care Hospital I.R.C.C.S. S. Matteo of Pavia. On 1 August 2013 and during hospitalization in the rehabilitation unit, Klebsiella oxytoca and Citrobacter koseri clinical isolates were simultaneously recovered from the patient's preputial swab. Both the K. oxytoca and C. koseri strains were carbapenem- resistant by MicroScan System (Beckman Coulter). Carbapenem-resistant K. pneumoniae had previously been reported in the same rehabilitation facility. The aim of the study was to identify the carbapenem resistance mechanisms among the enterobacterial species recovered. Phenotypic screening tests useful to detect the β-lactamases/carbapenemases were performed. Carbapenem MICs were obtained by Etest. AmpC and MBL encoding genes were identified by PCR and sequencing. Conjugation assays and plasmid characterization were performed. Both of the K. oxytoca and C. koseri isolates were multi drug resistant, showing resistance to amoxicillin-clavulanic acid, three generation cephalosporins, ertapenem (K. oxytoca MIC, >32 mg/L; C. koseri MIC, 4 mg/L), imipenem (K. oxytoca MIC, 4 mg/L; C. koseri MIC, 12 mg/L), thrimethoprim sulphamethoxazole and gentamicin. Susceptibility was retained to fluoroquinolones, colistin and tigecycline. Molecular characterization confirmed the co-presence of blaCMY-4 and blaVIM-4 determinants in a 150 Kb transferable plasmid of IncA/C group. This case is the first detection in Italy of the K. oxytoca and C. koseri clinical isolates co-producing the CMY-4 and VIM-4 enzymes.

  15. The plasmid-encoded Ipf and Klf fimbriae display different expression and varying roles in the virulence of Salmonella enterica serovar Infantis in mouse vs. avian hosts.

    Directory of Open Access Journals (Sweden)

    Gili Aviv

    2017-08-01

    Full Text Available Salmonella enterica serovar Infantis is one of the prevalent Salmonella serovars worldwide. Different emergent clones of S. Infantis were shown to acquire the pESI virulence-resistance megaplasmid affecting its ecology and pathogenicity. Here, we studied two previously uncharacterized pESI-encoded chaperone-usher fimbriae, named Ipf and Klf. While Ipf homologs are rare and were found only in S. enterica subspecies diarizonae and subspecies VII, Klf is related to the known K88-Fae fimbria and klf clusters were identified in seven S. enterica subspecies I serovars, harboring interchanging alleles of the fimbria major subunit, KlfG. Regulation studies showed that the klf genes expression is negatively and positively controlled by the pESI-encoded regulators KlfL and KlfB, respectively, and are activated by the ancestral leucine-responsive regulator (Lrp. ipf genes are negatively regulated by Fur and activated by OmpR. Furthermore, induced expression of both klf and ipf clusters occurs under microaerobic conditions and at 41°C compared to 37°C, in-vitro. Consistent with these results, we demonstrate higher expression of ipf and klf in chicks compared to mice, characterized by physiological temperature of 41.2°C and 37°C, respectively. Interestingly, while Klf was dispensable for S. Infantis colonization in the mouse, Ipf was required for maximal colonization in the murine ileum. In contrast to these phenotypes in mice, both Klf and Ipf contributed to a restrained infection in chicks, where the absence of these fimbriae has led to moderately higher bacterial burden in the avian host. Taken together, these data suggest that physiological differences between host species, such as the body temperature, can confer differences in fimbriome expression, affecting Salmonella colonization and other host-pathogen interplays.

  16. Molecular cloning and functional expression of a human cDNA encoding the antimutator enzyme 8-hydroxyguanine-DNA glycosylase

    Science.gov (United States)

    Roldán-Arjona, Teresa; Wei, Ying-Fei; Carter, Kenneth C.; Klungland, Arne; Anselmino, Catherine; Wang, Rui-Ping; Augustus, Meena; Lindahl, Tomas

    1997-01-01

    The major mutagenic base lesion in DNA caused by exposure to reactive oxygen species is 8-hydroxyguanine (8-oxo-7,8-dihydroguanine). In bacteria and Saccharomyces cerevisiae, this damaged base is excised by a DNA glycosylase with an associated lyase activity for chain cleavage. We have cloned, sequenced, and expressed a human cDNA with partial sequence homology to the relevant yeast gene. The encoded 47-kDa human enzyme releases free 8-hydroxyguanine from oxidized DNA and introduces a chain break in a double-stranded oligonucleotide specifically at an 8-hydroxyguanine residue base paired with cytosine. Expression of the human protein in a DNA repair-deficient E. coli mutM mutY strain partly suppresses its spontaneous mutator phenotype. The gene encoding the human enzyme maps to chromosome 3p25. These results show that human cells have an enzyme that can initiate base excision repair at mutagenic DNA lesions caused by active oxygen. PMID:9223306

  17. Processing of Nonconjugative Resistance Plasmids by Conjugation Nicking Enzyme of Staphylococci

    Energy Technology Data Exchange (ETDEWEB)

    Pollet, Rebecca M.; Ingle, James D.; Hymes, Jeff P.; Eakes, Thomas C.; Eto, Karina Yui; Kwong, Stephen M.; Ramsay, Joshua P.; Firth, Neville; Redinbo, Matthew R. (Curtin U.); (Sydney); (UNC)

    2016-01-04

    Antimicrobial resistance inStaphylococcus aureuspresents an increasing threat to human health. This resistance is often encoded on mobile plasmids, such as pSK41; however, the mechanism of transfer of these plasmids is not well understood. In this study, we first examine key protein-DNA interactions formed by the relaxase enzyme, NES, which initiates and terminates the transfer of the multidrug resistance plasmid pSK41. Two loops on the NES protein, hairpin loops 1 and 2, form extensive contacts with the DNA hairpin formed at theoriTregion of pSK41, and here we establish that these contacts are essential for proper DNA cleavage and religation by the full 665-residue NES proteinin vitro. Second, pSK156 and pCA347 are nonconjugativeStaphylococcus aureusplasmids that contain sequences similar to theoriTregion of pSK41 but differ in the sequence predicted to form a DNA hairpin. We show that pSK41-encoded NES is able to bind, cleave, and religate theoriTsequences of these nonconjugative plasmidsin vitro. Although pSK41 could mobilize a coresident plasmid harboring its cognateoriT, it was unable to mobilize plasmids containing the pSK156 and pCA347 variantoriTmimics, suggesting that an accessory protein like that previously shown to confer specificity in the pWBG749 system may also be involved in transmission of plasmids containing a pSK41-likeoriT. These data indicate that the conjugative relaxase intransmechanism recently described for the pWBG749 family of plasmids also applies to the pSK41 family of plasmids, further heightening the potential significance of this mechanism in the horizontal transfer of staphylococcal plasmids.

    IMPORTANCEUnderstanding the

  18. The double par locus of virulence factor pB171: DNA segregation is correlated with oscillation of ParA

    DEFF Research Database (Denmark)

    Ebersbach, G; Gerdes, K; Charbon, Gitte Ebersbach

    2001-01-01

    Prokaryotic plasmids and chromosomes encode partitioning (par) loci that segregate DNA to daughter cells before cell division. Recent database analyses showed that almost all known par loci encode an ATPase and a DNA-binding protein, and one or more cis-acting regions where the proteins act. All...

  19. The Mycobacterium tuberculosis Rv2540c DNA sequence encodes a bifunctional chorismate synthase

    Directory of Open Access Journals (Sweden)

    Santos Diógenes S

    2008-04-01

    Full Text Available Abstract Background The emergence of multi- and extensively-drug resistant Mycobacterium tuberculosis strains has created an urgent need for new agents to treat tuberculosis (TB. The enzymes of shikimate pathway are attractive targets to the development of antitubercular agents because it is essential for M. tuberculosis and is absent from humans. Chorismate synthase (CS is the seventh enzyme of this route and catalyzes the NADH- and FMN-dependent synthesis of chorismate, a precursor of aromatic amino acids, naphthoquinones, menaquinones, and mycobactins. Although the M. tuberculosis Rv2540c (aroF sequence has been annotated to encode a chorismate synthase, there has been no report on its correct assignment and functional characterization of its protein product. Results In the present work, we describe DNA amplification of aroF-encoded CS from M. tuberculosis (MtCS, molecular cloning, protein expression, and purification to homogeneity. N-terminal amino acid sequencing, mass spectrometry and gel filtration chromatography were employed to determine identity, subunit molecular weight and oligomeric state in solution of homogeneous recombinant MtCS. The bifunctionality of MtCS was determined by measurements of both chorismate synthase and NADH:FMN oxidoreductase activities. The flavin reductase activity was characterized, showing the existence of a complex between FMNox and MtCS. FMNox and NADH equilibrium binding was measured. Primary deuterium, solvent and multiple kinetic isotope effects are described and suggest distinct steps for hydride and proton transfers, with the former being more rate-limiting. Conclusion This is the first report showing that a bacterial CS is bifunctional. Primary deuterium kinetic isotope effects show that C4-proS hydrogen is being transferred during the reduction of FMNox by NADH and that hydride transfer contributes significantly to the rate-limiting step of FMN reduction reaction. Solvent kinetic isotope effects and

  20. Ultrasound-mediated gene delivery of naked plasmid DNA in skeletal muscles : a case for bolus injections

    NARCIS (Netherlands)

    Gomes Sanches, P.; Muehlmeister, M.; Seip, R.; Kaijzel, E.L.; Loewik, C.; Boehmer, M.; Tiemann, K.; Grüll, H.

    2014-01-01

    Localized gene delivery has many potential clinical applications. However, the nucleic acids (e.g. pDNA and siRNA) are incapable of passively crossing the endothelium, cell membranes and other biological barriers which must be crossed to reach their intracellular targets. A possible solution is the

  1. Intranasal delivery of cationic PLGA nano/microparticles-loaded FMDV DNA vaccine encoding IL-6 elicited protective immunity against FMDV challenge.

    Directory of Open Access Journals (Sweden)

    Gang Wang

    Full Text Available Mucosal vaccination has been demonstrated to be an effective means of eliciting protective immunity against aerosol infections of foot and mouth disease virus (FMDV and various approaches have been used to improve mucosal response to this pathogen. In this study, cationic PLGA (poly(lactide-co-glycolide nano/microparticles were used as an intranasal delivery vehicle as a means administering FMDV DNA vaccine encoding the FMDV capsid protein and the bovine IL-6 gene as a means of enhancing mucosal and systemic immune responses in animals. Three eukaryotic expression plasmids with or without bovine IL-6 gene (pc-P12A3C, pc-IL2AP12A3C and pc-P12AIL3C were generated. The two latter plasmids were designed with the IL-6 gene located either before or between the P12A and 3C genes, respectively, as a means of determining if the location of the IL-6 gene affected capsid assembly and the subsequent immune response. Guinea pigs and rats were intranasally vaccinated with the respective chitosan-coated PLGA nano/microparticles-loaded FMDV DNA vaccine formulations. Animals immunized with pc-P12AIL3C (followed by animals vaccinated with pc-P12A3C and pc-IL2AP12A3C developed the highest levels of antigen-specific serum IgG and IgA antibody responses and the highest levels of sIgA (secretory IgA present in mucosal tissues. However, the highest levels of neutralizing antibodies were generated in pc-IL2AP12A3C-immunized animals (followed by pc-P12AIL3C- and then in pc-P12A3C-immunized animals. pc-IL2AP12A3C-immunized animals also developed stronger cell mediated immune responses (followed by pc-P12AIL3C- and pc-P12A3C-immunized animals as evidenced by antigen-specific T-cell proliferation and expression levels of IFN-γ by both CD4+ and CD8+ splenic T cells. The percentage of animals protected against FMDV challenge following immunizations with pc-IL2AP12A3C, pc-P12AIL3C or pc-P12A3C were 3/5, 1/5 and 0/5, respectively. These data suggested that intranasal delivery

  2. Use of sperm plasmid DNA lipofection combined with REMI (restriction enzyme-mediated insertion) for production of transgenic chickens expressing eGFP (enhanced green fluorescent protein) or human follicle-stimulating hormone.

    Science.gov (United States)

    Harel-Markowitz, Eliane; Gurevich, Michael; Shore, Laurence S; Katz, Adi; Stram, Yehuda; Shemesh, Mordechai

    2009-05-01

    Linearized p-eGFP (plasmid-enhanced green fluorescent protein) or p-hFSH (plasmid human FSH) sequences with the corresponding restriction enzyme were lipofected into sperm genomic DNA. Sperm transfected with p-eGFP were used for artificial insemination in hens, and in 17 out of 19 of the resultant chicks, the exogenous DNA was detected in their lymphocytes as determined by PCR and expressed in tissues as determined by (a) PCR, (b) specific emission of green fluorescence by the eGFP, and (c) Southern blot analysis. A complete homology was found between the Aequorea Victoria eGFP DNA and a 313-bp PCR product of extracted DNA from chick blood cells. Following insemination with sperm lipofected with p-hFSH, transgenic offspring were obtained for two generations as determined by detection of the transgene for human FSH (PCR) and expression of the gene (RT-PCR and quantitative real-time PCR) and the presence of the protein in blood (radioimmunoassay). Data demonstrate that lipofection of plasmid DNA with restriction enzyme is a highly efficient method for the production of transfected sperm to produce transgenic offspring by direct artificial insemination.

  3. Lab-on-a-chip platform for high throughput drug discovery with DNA-encoded chemical libraries

    Science.gov (United States)

    Grünzner, S.; Reddavide, F. V.; Steinfelder, C.; Cui, M.; Busek, M.; Klotzbach, U.; Zhang, Y.; Sonntag, F.

    2017-02-01

    The fast development of DNA-encoded chemical libraries (DECL) in the past 10 years has received great attention from pharmaceutical industries. It applies the selection approach for small molecular drug discovery. Because of the limited choices of DNA-compatible chemical reactions, most DNA-encoded chemical libraries have a narrow structural diversity and low synthetic yield. There is also a poor correlation between the ranking of compounds resulted from analyzing the sequencing data and the affinity measured through biochemical assays. By combining DECL with dynamical chemical library, the resulting DNA-encoded dynamic library (EDCCL) explores the thermodynamic equilibrium of reversible reactions as well as the advantages of DNA encoded compounds for manipulation/detection, thus leads to enhanced signal-to-noise ratio of the selection process and higher library quality. However, the library dynamics are caused by the weak interactions between the DNA strands, which also result in relatively low affinity of the bidentate interaction, as compared to a stable DNA duplex. To take advantage of both stably assembled dual-pharmacophore libraries and EDCCLs, we extended the concept of EDCCLs to heat-induced EDCCLs (hi-EDCCLs), in which the heat-induced recombination process of stable DNA duplexes and affinity capture are carried out separately. To replace the extremely laborious and repetitive manual process, a fully automated device will facilitate the use of DECL in drug discovery. Herein we describe a novel lab-on-a-chip platform for high throughput drug discovery with hi-EDCCL. A microfluidic system with integrated actuation was designed which is able to provide a continuous sample circulation by reducing the volume to a minimum. It consists of a cooled and a heated chamber for constant circulation. The system is capable to generate stable temperatures above 75 °C in the heated chamber to melt the double strands of the DNA and less than 15 °C in the cooled chamber

  4. Construction of Biologically Functional Bacterial Plasmids In Vitro

    Science.gov (United States)

    Cohen, Stanley N.; Chang, Annie C. Y.; Boyer, Herbert W.; Helling, Robert B.

    1973-01-01

    The construction of new plasmid DNA species by in vitro joining of restriction endonuclease-generated fragments of separate plasmids is described. Newly constructed plasmids that are inserted into Escherichia coli by transformation are shown to be biologically functional replicons that possess genetic properties and nucleotide base sequences from both of the parent DNA molecules. Functional plasmids can be obtained by reassociation of endonuclease-generated fragments of larger replicons, as well as by joining of plasmid DNA molecules of entirely different origins. Images PMID:4594039

  5. DNA prime/Adenovirus boost malaria vaccine encoding P. falciparum CSP and AMA1 induces sterile protection associated with cell-mediated immunity.

    Directory of Open Access Journals (Sweden)

    Ilin Chuang

    Full Text Available BACKGROUND: Gene-based vaccination using prime/boost regimens protects animals and humans against malaria, inducing cell-mediated responses that in animal models target liver stage malaria parasites. We tested a DNA prime/adenovirus boost malaria vaccine in a Phase 1 clinical trial with controlled human malaria infection. METHODOLOGY/PRINCIPAL FINDINGS: The vaccine regimen was three monthly doses of two DNA plasmids (DNA followed four months later by a single boost with two non-replicating human serotype 5 adenovirus vectors (Ad. The constructs encoded genes expressing P. falciparum circumsporozoite protein (CSP and apical membrane antigen-1 (AMA1. The regimen was safe and well-tolerated, with mostly mild adverse events that occurred at the site of injection. Only one AE (diarrhea, possibly related to immunization, was severe (Grade 3, preventing daily activities. Four weeks after the Ad boost, 15 study subjects were challenged with P. falciparum sporozoites by mosquito bite, and four (27% were sterilely protected. Antibody responses by ELISA rose after Ad boost but were low (CSP geometric mean titer 210, range 44-817; AMA1 geometric mean micrograms/milliliter 11.9, range 1.5-102 and were not associated with protection. Ex vivo IFN-γ ELISpot responses after Ad boost were modest (CSP geometric mean spot forming cells/million peripheral blood mononuclear cells 86, range 13-408; AMA1 348, range 88-1270 and were highest in three protected subjects. ELISpot responses to AMA1 were significantly associated with protection (p = 0.019. Flow cytometry identified predominant IFN-γ mono-secreting CD8+ T cell responses in three protected subjects. No subjects with high pre-existing anti-Ad5 neutralizing antibodies were protected but the association was not statistically significant. SIGNIFICANCE: The DNA/Ad regimen provided the highest sterile immunity achieved against malaria following immunization with a gene-based subunit vaccine (27%. Protection

  6. Efficacy of chimeric DNA vaccines encoding Eimeria tenella 5401 and chicken IFN-γ or IL-2 against coccidiosis in chickens.

    Science.gov (United States)

    Song, Xiaokai; Huang, Xinmei; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui

    2015-09-01

    Chimeric DNA vaccines encoding Eimeria tenella (E. tenella) surface antigen 5401 were constructed and their efficacies against E. tenella challenge were studied. The open reading frame (ORF) of 5401 was cloned into the prokaryotic expression vector pGEX-4T2 to express the recombinant protein and the expressed recombinant protein was identified by Western blot. The ORF of 5401 and chicken cytokine gene IFN-γ or IL-2 were cloned into the eukaryotic expression vector pVAX1 consecutively to construct DNA vaccines pVAX-5401-IFN-γ, pVAX-5401-IL-2 and pVAX-5401. The expression of aim genes in vivo was detected by reverse transcription-polymerase chain reaction and Western blot. Fourteen-day-old chickens were inoculated twice at an interval of 7 days with 100 µg of plasmids pVAX-5401, pVAX-5401-IFN-γ and pVAX-5401-IL-2 or 200 µg of recombinant 5401 protein by leg intramuscular injection, respectively. Seven days after the second inoculation, all chickens except the unchallenged control group were challenged orally with 5 × 10(4) sporulated oocysts of E. tenella. Seven days after challenge, all chickens were weighted and slaughtered to determine the effects of immunization. The results showed the recombinant protein was about 90 kDa and reacted with antiserum against soluble sporozoites. The animal experiment showed that all the DNA vaccines pVAX-5401, pVAX-5401-IFN-γ or pVAX-5401-IL-2 and the recombinant 5401 protein could obviously alleviate body weight loss and cecal lesions as compared with non-vaccinated challenged control and empty vector pVAX1control. Furthermore, pVAX-5401-IFN-γ or pVAX-5401-IL-2 induced anti-coccidial index (ACI) of 180.01 or 177.24 which were significantly higher than that of pVAX-5401. The results suggested that 5401 was an effective candidate antigen for vaccine. This finding also suggested that chicken IFN-γ or IL-2 could effectively improve the efficacies of DNA vaccines against avian coccidiosis. Copyright © 2015 Elsevier

  7. Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    You Wanhui

    2012-04-01

    Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

  8. Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome.

    Directory of Open Access Journals (Sweden)

    Dongsheng Li

    Full Text Available Infectious cDNA clones of RNA viruses are important research tools, but flavivirus cDNA clones have proven difficult to assemble and propagate in bacteria. This has been attributed to genetic instability and/or host cell toxicity, however the mechanism leading to these difficulties has not been fully elucidated. Here we identify and characterize an efficient cryptic bacterial promoter in the cDNA encoding the dengue virus (DENV 5' UTR. Following cryptic transcription in E. coli, protein expression initiated at a conserved in-frame AUG that is downstream from the authentic DENV initiation codon, yielding a DENV polyprotein fragment that was truncated at the N-terminus. A more complete understanding of constitutive viral protein expression in E. coli might help explain the cloning and propagation difficulties generally observed with flavivirus cDNA.

  9. Delivery of a survivin promoter-driven antisense survivin-expressing plasmid DNA as a cancer therapeutic: a proof-of-concept study

    Directory of Open Access Journals (Sweden)

    Lin KY

    2016-05-01

    Full Text Available Kun-Yuan Lin,1 Siao Muk Cheng,2 Shing-Ling Tsai,2 Ju-Ya Tsai,1 Chun-Hui Lin,1 Chun Hei Antonio Cheung1,2 1Department of Pharmacology, College of Medicine, National Cheng Kung University, Tainan, Taiwan, ROC; 2Institute of Basic Medical Sciences, College of Medicine, National Cheng Kung University, Tainan, Taiwan, ROC Abstract: Survivin is a member of the inhibitor-of-apoptosis proteins family. It is overexpressed in many different cancer types but not in the differentiated normal tissue. In addition, overexpression of survivin promotes cancer cell survival and induces chemotherapeutic drug resistance, making it an attractive target for new anticancer interventions. Despite survivin being a promising molecular target for anticancer treatment, it is widely accepted that survivin is only a “semi-druggable” target. Therefore, it is important to develop a new strategy to target survivin for anticancer treatment. In this study, we constructed a novel survivin promoter-driven full-length antisense survivin (pSur/AS-Sur expression plasmid DNA. Promoter activity assay revealed that the activity of the survivin promoter of pSur/AS-Sur correlated with the endogenous expression of survivin at the transcriptional level in the transfected A549, MDA-MB-231, and PANC-1 cancer cells. Western blot analysis showed that liposomal delivery of pSur/AS-Sur successfully downregulated the expression of survivin in A549, MBA-MB-231, and PANC-1 cells in vitro. In addition, delivery of pSur/AS-Sur induced autophagy, caspase-dependent apoptosis, and caspase-independent apoptosis as indicated by the increased LC3B-II conversion, autophagosome formation, caspase-9/-3 and poly(ADP-ribose polymerase-1 cleavage, and apoptosis-inducing factor nuclear translocation in A549, MBA-MB-231, and PANC-1 cells. Importantly, liposomal delivery of pSur/AS-Sur was also capable of decreasing the proliferation of the survivin/MDR1 coexpressing multidrug-resistant KB-TAX50 cancer cells and

  10. Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

    International Nuclear Information System (INIS)

    Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

    1988-01-01

    Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

  11. Co-administration of avian influenza virus H5 plasmid DNA with chicken IL-15 and IL-18 enhanced chickens immune responses.

    Science.gov (United States)

    Lim, Kian-Lam; Jazayeri, Seyed Davoud; Yeap, Swee Keong; Alitheen, Noorjahan Banu Mohamed; Bejo, Mohd Hair; Ideris, Aini; Omar, Abdul Rahman

    2012-08-06

    DNA vaccines offer several advantages over conventional vaccines in the development of effective vaccines against avian influenza virus (AIV). However, one of the limitations of the DNA vaccine in poultry is that it induces poor immune responses. In this study, chicken interleukin (IL) -15 and IL-18 were used as genetic adjuvants to improve the immune responses induced from the H5 DNA vaccination in chickens. The immunogenicity of the recombinant plasmid DNA was analyzed based on the antibody production, T cell responses and cytokine production, following inoculation in 1-day-old (Trial 1) and 14-day-old (Trial 2) specific-pathogen-free chickens. Hence, the purpose of the present study was to explore the role of chicken IL-15 and IL-18 as adjuvants following the vaccination of chickens with the H5 DNA vaccine. The overall HI antibody titer in chickens immunized with pDis/H5 + pDis/IL-15 was higher compared to chickens immunized with pDis/H5 (p chickens exhibited a shorter time to achieve the highest HI titer in comparison to the inoculation of the 1-day-old chickens. The cellular immunity was assessed by the flow cytometry analysis to enumerate CD4+ and CD8 + T cells in the peripheral blood. The chickens inoculated with pDis/H5 + pDis/IL-15 demonstrated the highest increase in CD4+ T cells population relative to the control chickens. However, this study revealed that pDis/H5 + pDis/IL-15 was not significant (P > 0.05) in inducing CD8+ T cells. Meanwhile, with the exception of Trial 1, the flow cytometry results for Trial 2 demonstrated that the pDis/H5 + pDis/IL-18 inoculated group was able to trigger a higher increase in CD4+ T cells than the pDis/H5 group (P 0.05) in modulating CD8+ T cells population in both trials. The pDis/H5 + pDis/IL-15 inoculated group showed the highest IL-15 gene expression in both trials compared to other inoculated groups (P chicken IL-15 and IL-18,with pDis/H5 + pDis/IL-15 being a better vaccine candidate

  12. DNA Vaccine Electroporation and Molecular Adjuvants

    Science.gov (United States)

    2016-03-16

    Suschak and Schmaljohn DNA Vaccine Electroporation and Molecular Adjuvants 1 Abstract To date, there is no protective vaccine for Ebola virus...the formulation of DNA launched virus-like particles (VLP). In this case, the antigen is encoded in one DNA plasmid, while structural proteins are...Virol, 2010. 155(12): p. 2083-103. 2. Feldmann, H. and T.W. Geisbert, Ebola haemorrhagic fever. Lancet, 2011. 377(9768): p. 849-62. 3. Hart, M.K

  13. Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

    Science.gov (United States)

    Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

    1992-01-01

    A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

  14. RNase-L regulates the stability of mitochondrial DNA-encoded mRNAs in mouse embryo fibroblasts

    International Nuclear Information System (INIS)

    Chandrasekaran, Krish; Mehrabian, Zara; Li Xiaoling; Hassel, Bret

    2004-01-01

    Accelerated decrease in the levels of mitochondrial DNA-encoded mRNA (mt-mRNA) occurs in neuronal cells exposed either to the excitatory amino acid, glutamate or to the sodium ionophore, monensin, suggesting a role of mitochondrial RNase(s) on the stability of mt-mRNAs. Here we report that in mouse embryo fibroblasts that are devoid of the interferon-regulated RNase, RNase-L, the monensin-induced decrease in the half-life of mt-mRNA was reduced. In monensin (250 nM)-treated RNase-L +/+ cells the average half-life of mt-mRNA, determined after termination of transcription with actinomycin D, was found to be 3 h, whereas in monensin-treated RNase-L -/- cells the half-life of mt-mRNA was >6 h. In contrast, the stability of nuclear DNA-encoded β-actin mRNA was unaffected. Induction of RNase-L expression in mouse 3T3 fibroblasts further decreased the monensin-induced reduction in mt-mRNA half-life to 1.5 h. The results indicate that the RNase-L-dependent decrease in mtDNA-encoded mRNA transcript levels occurs through a decrease in the half-life of mt-mRNA, and that RNase-L may play a role in the stability of mt-mRNA

  15. Plasmid DNA linearization in the antibacterial action of a new fluorescent Ag nanoparticle-paracetamol dimer composite

    Science.gov (United States)

    Sahoo, Amaresh Kumar; Sk, Md Palashuddin; Ghosh, Siddhartha Sankar; Chattopadhyay, Arun

    2011-10-01

    Herein, we report the generation of a composite comprised of p-hydroxyacetanilide dimer and Ag nanoparticles (NPs) by reaction of AgNO3 and p-hydroxyacetanilide. The formation of the composite was established by UV-vis, FTIR and NMR spectroscopy, transmission electron microscopy and X-ray diffraction along with substantiation by mass spectrometry. Interestingly, the composite exhibited an emission spectrum with a peak at 435 nm when excited by light of wavelength 320 nm. The composite showed superior antimicrobial activity with respect to its individual components against a wide range of Gram positive and Gram negative bacteria at relatively low concentrations of Ag NPs and at which there was no apparent cytotoxicity against mammalian cells. Our results suggest that the composite strongly interacted with the bacterial cell walls leading to cell bursting. Interestingly, enhancement in the reactive oxygen species (ROS) generation in bacteria was observed in the presence of the composite. It is proposed that the ROS generation led to oxidation of the dimer to N-acetyl-p-benzoquinone imine (NAPQI). The generated NAPQI acted as a DNA gyrase inhibitor causing cell death following linearization of DNA.Herein, we report the generation of a composite comprised of p-hydroxyacetanilide dimer and Ag nanoparticles (NPs) by reaction of AgNO3 and p-hydroxyacetanilide. The formation of the composite was established by UV-vis, FTIR and NMR spectroscopy, transmission electron microscopy and X-ray diffraction along with substantiation by mass spectrometry. Interestingly, the composite exhibited an emission spectrum with a peak at 435 nm when excited by light of wavelength 320 nm. The composite showed superior antimicrobial activity with respect to its individual components against a wide range of Gram positive and Gram negative bacteria at relatively low concentrations of Ag NPs and at which there was no apparent cytotoxicity against mammalian cells. Our results suggest that the

  16. Unique Helicase Determinants in the Essential Conjugative TraI Factor from Salmonella enterica Serovar Typhimurium Plasmid pCU1

    Energy Technology Data Exchange (ETDEWEB)

    McLaughlin, Krystle J.; Nash, Rebekah P.; Redinbo, Mathew R. (UNC)

    2014-06-16

    The widespread development of multidrug-resistant bacteria is a major health emergency. Conjugative DNA plasmids, which harbor a wide range of antibiotic resistance genes, also encode the protein factors necessary to orchestrate the propagation of plasmid DNA between bacterial cells through conjugative transfer. Successful conjugative DNA transfer depends on key catalytic components to nick one strand of the duplex DNA plasmid and separate the DNA strands while cell-to-cell transfer occurs. The TraI protein from the conjugative Salmonella plasmid pCU1 fulfills these key catalytic roles, as it contains both single-stranded DNA-nicking relaxase and ATP-dependent helicase domains within a single, 1,078-residue polypeptide. In this work, we unraveled the helicase determinants of Salmonella pCU1 TraI through DNA binding, ATPase, and DNA strand separation assays. TraI binds DNA substrates with high affinity in a manner influenced by nucleic acid length and the presence of a DNA hairpin structure adjacent to the nick site. TraI selectively hydrolyzes ATP, and mutations in conserved helicase motifs eliminate ATPase activity. Surprisingly, the absence of a relatively short (144-residue) domain at the extreme C terminus of the protein severely diminishes ATP-dependent strand separation. Collectively, these data define the helicase motifs of the conjugative factor TraI from Salmonella pCU1 and reveal a previously uncharacterized C-terminal functional domain that uncouples ATP hydrolysis from strand separation activity.

  17. Host-Specific Patterns of Genetic Diversity among IncI1-I gamma and IncK Plasmids Encoding CMY-2 beta-Lactamase in Escherichia coli Isolates from Humans, Poultry Meat, Poultry, and Dogs in Denmark

    DEFF Research Database (Denmark)

    Hansen, Katrine Hartung; Bortolaia, Valeria; Nielsen, Christine Ahl

    2016-01-01

    and commensal E. coli isolates collected from 2006 to 2012 from humans, retail poultry meat, broilers, and dogs. Multilocus sequence typing (MLST), antimicrobial susceptibility testing, and conjugation were performed in conjunction with plasmid replicon typing, plasmid multilocus sequence typing (p......MLST), restriction fragment length polymorphism (RFLP), and sequencing of selected bla(CMY-2)-harboring plasmids. MLST revealed high strain diversity, with few E. coli lineages occurring in multiple host species and sample types. bla(CMY-2) was detected on plasmids in 83 (89%) isolates. Most (75%) of the plasmids...... were conjugative and did not (96%) cotransfer resistance to antimicrobials other than cephalosporins. The main replicon types identified were IncI1-I gamma (55%) and IncK (39%). Isolates from different host species mainly carried distinct plasmid subtypes. Seven of the 18 human isolates harbored IncI1...

  18. Protein-Nanocrystal Conjugates Support a Single Filament Polymerization Model in R1 Plasmid Segregation

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Charina L.; Claridge, Shelley A.; Garner, Ethan C.; Alivisatos, A. Paul; Mullins, R. Dyche

    2008-07-15

    To ensure inheritance by daughter cells, many low-copy number bacterial plasmids, including the R1 drug-resistance plasmid, encode their own DNA segregation systems. The par operon of plasmid R1 directs construction of a simple spindle structure that converts free energy of polymerization of an actin-like protein, ParM, into work required to move sister plasmids to opposite poles of rod-shaped cells. The structures of individual components have been solved, but little is known about the ultrastructure of the R1 spindle. To determine the number of ParM filaments in a minimal R1 spindle, we used DNA-gold nanocrystal conjugates as mimics of the R1 plasmid. Wefound that each end of a single polar ParM filament binds to a single ParR/parC-gold complex, consistent with the idea that ParM filaments bind in the hollow core of the ParR/parC ring complex. Our results further suggest that multifilament spindles observed in vivo are associated with clusters of plasmidssegregating as a unit.

  19. Plasmid Complement of Lactococcus lactis NCDO712 Reveals a Novel Pilus Gene Cluster.

    Science.gov (United States)

    Tarazanova, Mariya; Beerthuyzen, Marke; Siezen, Roland; Fernandez-Gutierrez, Marcela M; de Jong, Anne; van der Meulen, Sjoerd; Kok, Jan; Bachmann, Herwig

    2016-01-01

    Lactococcus lactis MG1363 is an important gram-positive model organism. It is a plasmid-free and phage-cured derivative of strain NCDO712. Plasmid-cured strains facilitate studies on molecular biological aspects, but many properties which make L. lactis an important organism in the dairy industry are plasmid encoded. We sequenced the total DNA of strain NCDO712 and, contrary to earlier reports, revealed that the strain carries 6 rather than 5 plasmids. A new 50-kb plasmid, designated pNZ712, encodes functional nisin immunity (nisCIP) and copper resistance (lcoRSABC). The copper resistance could be used as a marker for the conjugation of pNZ712 to L. lactis MG1614. A genome comparison with the plasmid cured daughter strain MG1363 showed that the number of single nucleotide polymorphisms that accumulated in the laboratory since the strains diverted more than 30 years ago is limited to 11 of which only 5 lead to amino acid changes. The 16-kb plasmid pSH74 was found to contain a novel 8-kb pilus gene cluster spaCB-spaA-srtC1-srtC2, which is predicted to encode a pilin tip protein SpaC, a pilus basal subunit SpaB, and a pilus backbone protein SpaA. The sortases SrtC1/SrtC2 are most likely involved in pilus polymerization while the chromosomally encoded SrtA could act to anchor the pilus to peptidoglycan in the cell wall. Overexpression of the pilus gene cluster from a multi-copy plasmid in L. lactis MG1363 resulted in cell chaining, aggregation, rapid sedimentation and increased conjugation efficiency of the cells. Electron microscopy showed that the over-expression of the pilus gene cluster leads to appendices on the cell surfaces. A deletion of the gene encoding the putative basal protein spaB, by truncating spaCB, led to more pilus-like structures on the cell surface, but cell aggregation and cell chaining were no longer observed. This is consistent with the prediction that spaB is involved in the anchoring of the pili to the cell.

  20. rad-Dependent response of the chk1-encoded protein kinase at the DNA damage checkpoint

    NARCIS (Netherlands)

    Walworth, N.C.; Bernards, R.A.

    1996-01-01

    Exposure of eukaryotic cells to agents that generate DNA damage results in transient arrest of progression through the cell cycle. In fission yeast, the DNA damage checkpoint associated with cell cycle arrest before mitosis requires the protein kinase p56chk1. DNA damage induced by ultraviolet

  1. Safety and immunogenicity of a novel therapeutic DNA vaccine encoding chicken type II collagen for rheumatoid arthritis in normal rats.

    Science.gov (United States)

    Juan, Long; Xiao, Zhao; Song, Yun; Zhijian, Zhang; Jing, Jin; Kun, Yu; Yuna, Hao; Dongfa, Dai; Lili, Ding; Liuxin, Tan; Fei, Liang; Nan, Liu; Fang, Yuan; Yuying, Sun; Yongzhi, Xi

    2015-01-01

    Current clinically available treatments for rheumatoid arthritis (RA) fail to cure the disease or unsatisfactorily halt disease progression. To overcome these limitations, the development of therapeutic DNA vaccines and boosters may offer new promising strategies. Because type II collagen (CII) as a critical autoantigen in RA and native chicken type II collagen (nCCII) has been used to effectively treat RA, we previously developed a novel therapeutic DNA vaccine encoding CCII (pcDNA-CCOL2A1) with efficacy comparable to that of the current "gold standard", methotrexate(MTX). Here, we systemically evaluated the safety and immunogenicity of the pcDNA-CCOL2A1 vaccine in normal Wistar rats. Group 1 received only a single intramuscular injection into the hind leg with pcDNA-CCOL2A1 at the maximum dosage of 3 mg/kg on day 0; Group 2 was injected with normal saline (NS) as a negative control. All rats were monitored daily for any systemic adverse events, reactions at the injection site, and changes in body weights. Plasma and tissues from all experimental rats were collected on day 14 for routine examinations of hematology and biochemistry parameters, anti-CII IgG antibody reactivity, and histopathology. Our results indicated clearly that at the maximum dosage of 3 mg/kg, the pcDNA-CCOL2A1 vaccine was safe and well-tolerated. No abnormal clinical signs or deaths occurred in the pcDNA-CCOL2A1 group compared with the NS group. Furthermore, no major alterations were observed in hematology, biochemistry, and histopathology, even at the maximum dose. In particularly, no anti-CII IgG antibodies were detected in vaccinated normal rats at 14 d after vaccination; this was relevant because we previously demonstrated that the pcDNA-CCOL2A1 vaccine, when administered at the therapeutic dosage of 300 μg/kg alone, did not induce anti-CII IgG antibody production and significantly reduced levels of anti-CII IgG antibodies in the plasma of rats with established collagen-induced arthritis

  2. Bacteriophage T5 encodes a homolog of the eukaryotic transcription coactivator PC4 implicated in recombination-dependent DNA replication.

    Science.gov (United States)

    Steigemann, Birthe; Schulz, Annina; Werten, Sebastiaan

    2013-11-15

    The RNA polymerase II cofactor PC4 globally regulates transcription of protein-encoding genes through interactions with unwinding DNA, the basal transcription machinery and transcription activators. Here, we report the surprising identification of PC4 homologs in all sequenced representatives of the T5 family of bacteriophages, as well as in an archaeon and seven phyla of eubacteria. We have solved the crystal structure of the full-length T5 protein at 1.9Å, revealing a striking resemblance to the characteristic single-stranded DNA (ssDNA)-binding core domain of PC4. Intriguing novel structural features include a potential regulatory region at the N-terminus and a C-terminal extension of the homodimerisation interface. The genome organisation of T5-related bacteriophages points at involvement of the PC4 homolog in recombination-dependent DNA replication, strongly suggesting that the protein corresponds to the hitherto elusive replicative ssDNA-binding protein of the T5 family. Our findings imply that PC4-like factors intervene in multiple unwinding-related processes by acting as versatile modifiers of nucleic acid conformation and raise the possibility that the eukaryotic transcription coactivator derives from ancestral DNA replication, recombination and repair factors. © 2013.

  3. DNA immunisation. New histochemical and morphometric data

    Directory of Open Access Journals (Sweden)

    D Ehirchiou

    2010-01-01

    Full Text Available Splenic germinal center reactions were measured during primary response to a plasmidic DNA intramuscular injection. Cardiotoxin-pretreated Balb/c mice were immunized with DNA plasmids encoding or not the SAG1 protein, a membrane antigen of Toxoplasma gondii. Specific anti-SAG1 antibodies were detected on days 16 and 36 after injection of coding plasmids. The results of ELISAs showed that the SAG1-specific antibodies are of the IgG2a class. Morphometric analyses were done on serial immunostained cryosections of spleen and draining or non-draining lymph nodes. This new approach made it possible to evaluate the chronological changes induced by DNA immunisation in the germinal centres (in number and in size. Significant increases in the number of germinal centres were measured in the spleen and only in draining lymph nodes after plasmid injection. the measured changes of the germinal centers appeared to result from the adjuvant stimulatory effect of the plasmidic DNA since both the coding and the noncoding plasmid DNA induced them. No measurable changes were recorded in the Tdependent zone of lymph organs.

  4. Implication of the E. coli K12 uvrA and recA genes in the repair of 8-methoxypsoralen-induced mono adducts and crosslinks on plasmid DNA; Implicacion de los genes uvrA de E. coli K12 en la reparacion de monoaductos y entrecruzamien tos inducidos en DNA plasmidico por 8-metoxipso raleno mas luz ultravioleta A

    Energy Technology Data Exchange (ETDEWEB)

    Paramio, J M; Bauluz, C; Vidania, R de

    1986-07-01

    Genotoxicity of psoralen damages on plasmid DNA has been studied. pBR322 DNA was randomly modified with several concentrations of 8-methoxypsoralen plus 365 nm-UV light. After transformation into E. coli strains (wild-type, uvrA and recA) plasmid survival and mutagenesis were analyzed. To study the influence of the SOS response on plasmid recovery, preirradiation of the cells was performed. In absence of cell preirradiation, crosslinks were not repaired in any strain. Mono adducts were also lethal but in part removed by the excision-repair pathway. Preirradiation of the cells significantly. increased plasmid recovery in recA+ celia. In uvrA- only the mutagenic pathway seemed to be involved in the repair of the damaged DNA. Wild type strain showed the highest increase in plasmid survival, involving the repair of mono adducts and some fraction of crosslinks mainly through an error-free repair pathway. This suggests an enhancement of the excision repair promoted by the induction of SOS functions. (Author) 32 refs.

  5. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  6. Co-administration of plasmid expressing IL-12 with 14-kDa Schistosoma mansoni fatty acid-binding protein cDNA alters immune response profiles and fails to enhance protection induced by Sm14 DNA vaccine alone.

    Science.gov (United States)

    Fonseca, Cristina T; Pacífico, Lucila G G; Barsante, Michele M; Rassi, Tatiana; Cassali, Geovanni D; Oliveira, Sérgio C

    2006-08-01

    Schistosomiasis is an endemic disease that affects 200 million people worldwide. DNA-based vaccine is a promising strategy to induce protective immunity against schistosomiasis, since both humoral and cellular immune responses are involved in parasite elimination. In this study, we evaluated the ability of Sm14 cDNA alone or in association with a plasmid expressing murine interleukin (IL)-12 to induce protection against challenge infection. Mice were immunized with four doses of the DNA vaccine and the levels of protection were determined by worm burden recovery after challenge infection. Specific antibody production to rSm14 was determined by ELISA, and cytokine production was measured in splenocyte culture supernatants stimulated with rSm14 and in bronchoalveolar lavage of vaccinated mice after challenge infection. DNA immunization with pCI/Sm14 alone induced 40.5% of worm reduction. However, the use of pCI/IL-12 as adjuvant to pCI/Sm14 immunization failed to enhance protection against challenge infection. Protection induced by pCI/Sm14 immunization correlates with specific IgG antibody production against Sm14, Th1 type of immune response with high levels of interferon (IFN)-gamma and low levels of IL-4 in splenocyte culture supernatants and in bronchoalveolar lavage after challenge infection. IL-12 co-administration with pCI/Sm14 induced a significant production of nitric oxide in splenocyte culture supernatants and also lymphocyte suppression, with reduced percentage of T cells producing IFN-gamma and tumor necrosis factor-alpha.

  7. Yeast DNA-repair gene RAD14 encodes a zinc metalloprotein with affinity for ultraviolet-damaged DNA

    International Nuclear Information System (INIS)

    Guzder, S.N.; Sung, P.; Prakash, S.; Prakash, L.

    1993-01-01

    Xeroderma pigmentosum (XP) patients suffer from a high incidence of skin cancers due to a defect in excision repair of UV light-damaged DNA. Of the seven XP complementation groups, A--G, group A represents a severe and frequent form of the disease. The Saccharomyces cerevisiae RAD14 gene is a homolog of the XP-A correcting (XPAC) gene. Like XP-A cells, rad14-null mutants are defective in the incision step of excision repair of UV-damaged DNA. The authors have purified RAD14 protein to homogeneity from extract of a yeast strain genetically tailored to overexpress RAD14. As determined by atomic emission spectroscopy, RAD14 contains one zinc atom. They also show in vitro that RAD14 binds zinc but does not bind other divalent metal ions. In DNA mobility-shift assays, RAD14 binds specifically to UV-damaged DNA. Removal of cyclobutane pyrimidine dimers from damaged DNA by enzymatic photoreactivation has no effect on binding, strongly suggesting that RAD14 recognizes pyrimidine(6-4)pyrimidone photoproduct sites. These findings indicate that RAD14 functions in damage recognition during excision repair. 37 refs., 4 figs

  8. Nucleotide sequence of a human cDNA encoding a ras-related protein (rap1B)

    Energy Technology Data Exchange (ETDEWEB)

    Pizon, V; Lerosey, I; Chardin, P; Tavitian, A [INSERM, Paris (France)

    1988-08-11

    The authors have previously characterized two human ras-related genes rap1 and rap2. Using the rap1 clone as probe they isolated and sequenced a new rap cDNA encoding the 184aa rap1B protein. The rap1B protein is 95% identical to rap1 and shares several properties with the ras protein suggesting that it could bind GTP/GDP and have a membrane location. As for rap1, the structural characteristics of rap1B suggest that the rap and ras proteins might interact on the same effector.

  9. Identification of the polypeptides encoded in the unassigned reading frames 2, 4, 4L, and 5 of human mitochondrial DNA

    International Nuclear Information System (INIS)

    Mariottini, P.; Chomyn, A.; Riley, M.; Cottrell, B.; Doolittle, R.F.; Attardi, G.

    1986-01-01

    In previous work, antibodies prepared against chemically synthesized peptides predicted from the DNA sequence were used to identify the polypeptides encoded in three of the eight unassigned reading frames (URFs) of human mitochondrial DNA (mtDNA). In the present study, this approach has been extended to other human mtDNA URFs. In particular, antibodies directed against the NH 2 -terminal octapeptide of the putative URF2 product specifically precipitated component 11 of the HeLa cell mitochondrial translation products, the reaction being inhibited by the specific peptide. Similarly, antibodies directed against the COOH-terminal nonapeptide of the putative URF4 product reacted specifically with components 4 and 5, and antibodies against a COOH-terminal heptapeptide of the presumptive URF4L product reacted specifically with component 26. Antibodies against the NH 2 -terminal heptapeptide of the putative product of URF5 reacted with component 1, but only to a marginal extent; however, the results of a trypsin fingerprinting analysis of component 1 point strongly to this component as being the authentic product of URF5. The polypeptide assignments to the mtDNA URFs analyzed here are supported by the relative electrophoretic mobilities of proteins 11, 4-5, 26, and 1, which are those expected for the molecular weights predicted from the DNA sequence for the products of URF2, URF4, URF4L, and URF5, respectively. With the present assignment, seven of the eight human mtDNA URFs have been shown to be expressed in HeLa cells

  10. Light-dependent, plastome-wide association of the plastid-encoded RNA polymerase with chloroplast DNA.

    Science.gov (United States)

    Finster, Sabrina; Eggert, Erik; Zoschke, Reimo; Weihe, Andreas; Schmitz-Linneweber, Christian

    2013-12-01

    Plastid genes are transcribed by two types of RNA polymerases: a plastid-encoded eubacterial-type RNA polymerase (PEP) and nuclear-encoded phage-type RNA polymerases (NEPs). To investigate the spatio-temporal expression of PEP, we tagged its α-subunit with a hemagglutinin epitope (HA). Transplastomic tobacco plants were generated and analyzed for the distribution of the tagged polymerase in plastid sub-fractions, and associated genes were identified under various light conditions. RpoA:HA was detected as early as the 3rd day after imbibition, and was constitutively expressed in green tissue over 60 days of plant development. We found that the tagged polymerase subunit preferentially associated with the plastid membranes, and was less abundant in the soluble stroma fraction. Attachment of RpoA:HA to the membrane fraction during early seedling development was independent of DNA, but at later stages of development, DNA appears to facilitate attachment of the polymerase to membranes. To survey PEP-dependent transcription units, we probed for nucleic acids enriched in RpoA:HA precipitates using a tobacco chloroplast whole-genome tiling array. The most strongly co-enriched DNA fragments represent photosynthesis genes (e.g. psbA, psbC, psbD and rbcL), whose expression is known to be driven by PEP promoters, while NEP-dependent genes were less abundant in RpoA:HA precipitates. Additionally, we demonstrate that the association of PEP with photosynthesis-related genes was reduced during the dark period, indicating that plastome-wide PEP-DNA association is a light-dependent process. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  11. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  12. An Oral DNA Vaccine Encoding Endoglin Eradicates Breast Tumors by Blocking Their Blood Supply

    National Research Council Canada - National Science Library

    Reisfeld, Ralph A

    2007-01-01

    In an effort to meet the urgent need for the development of novel and effective treatments for metastatic breast cancer, we developed and evaluated a novel, oral DNA vaccine targeting endoglin (CD105...

  13. The protein encoded by the proto-oncogene DEK changes the topology of chromatin and reduces the efficiency of DNA replication in a chromatin-specific manner

    DEFF Research Database (Denmark)

    Alexiadis, V; Waldmann, T; Andersen, Jens S.

    2000-01-01

    The structure of chromatin regulates the genetic activity of the underlying DNA sequence. We report here that the protein encoded by the proto-oncogene DEK, which is involved in acute myelogenous leukemia, induces alterations of the superhelical density of DNA in chromatin. The change in topology...

  14. Effect of degradative plasmid CAM-OCT on responses of Pseudomonas bacteria to UV light

    International Nuclear Information System (INIS)

    McBeth, D.L.

    1989-01-01

    The effect of plasmid CAM-OCT on responses to UV irradiation was compared in Pseudomonas aeruginosa, in Pseudomonas putida, and in Pseudomonas putida mutants carrying mutations in UV response genes. CAM-OCT substantially increased both survival and mutagenesis in the two species. P. aeruginosa strains without CAM-OCT exhibited much higher UV sensitivity than did P. putida strains. UV-induced mutagenesis of plasmid-free P. putida was easily detected in three different assays (two reversion assays and one forward mutation assay), whereas UV mutagenesis of P. aeruginosa without CAM-OCT was seen only in the forward mutation assay. These results suggest major differences in DNA repair between the two species and highlight the presence of error-prone repair functions on CAM-OCT. A number of P. putida mutants carrying chromosomal mutations affecting either survival or mutagenesis after UV irradiation were isolated, and the effect of CAM-OCT on these mutants was determined. All mutations producing a UV-sensitive phenotype in P. putida were fully suppressed by the plasmid, whereas the plasmid had a more variable effect on mutagenesis mutations, suppressing some and producing no suppression of others. On the basis of the results reported here and results obtained by others with plasmids carrying UV response genes, it appears that CAM-OCT may differ either in regulation or in the number and functions of UV response genes encoded

  15. SAXS Study of Sterically Stabilized Lipid Nanocarriers Functionalized by DNA

    Science.gov (United States)

    Angelov, Borislav; Angelova, Angelina; Filippov, Sergey; Karlsson, Göran; Terrill, Nick; Lesieur, Sylviane; Štěpánek, Petr

    2012-03-01

    The structure of novel spontaneously self-assembled plasmid DNA/lipid complexes is investigated by means of synchrotron radiation small-angle X-ray scattering (SAXS) and Cryo-TEM imaging. Liquid crystalline (LC) hydrated lipid systems are prepared using the non-ionic lipids monoolein and DOPE-PEG2000 and the cationic amphiphile CTAB. The employed plasmid DNA (pDNA) is encoding for the human protein brain-derived neurotrophic factor (BDNF). A coexistence of nanoparticulate objects with different LC inner organizations is established. A transition from bicontinuous membrane sponges, cubosome intermediates and unilamelar liposomes to multilamellar vesicles, functionalized by pDNA, is favoured upon binding and compaction of pBDNF onto the cationic PEGylated lipid nanocarriers. The obtained sterically stabilized multicompartment nanoobjects, with confined supercoiled plasmid DNA (pBDNF), are important in the context of multicompartment lipid nanocarriers of interest for gene therapy of neurodegenerative diseases.

  16. SAXS Study of Sterically Stabilized Lipid Nanocarriers Functionalized by DNA

    International Nuclear Information System (INIS)

    Angelov, Borislav; Filippov, Sergey; Štepánek, Petr; Angelova, Angelina; Lesieur, Sylviane; Karlsson, Göran; Terrill, Nick

    2012-01-01

    The structure of novel spontaneously self-assembled plasmid DNA/lipid complexes is investigated by means of synchrotron radiation small-angle X-ray scattering (SAXS) and Cryo-TEM imaging. Liquid crystalline (LC) hydrated lipid systems are prepared using the non-ionic lipids monoolein and DOPE-PEG 2000 and the cationic amphiphile CTAB. The employed plasmid DNA (pDNA) is encoding for the human protein brain-derived neurotrophic factor (BDNF). A coexistence of nanoparticulate objects with different LC inner organizations is established. A transition from bicontinuous membrane sponges, cubosome intermediates and unilamelar liposomes to multilamellar vesicles, functionalized by pDNA, is favoured upon binding and compaction of pBDNF onto the cationic PEGylated lipid nanocarriers. The obtained sterically stabilized multicompartment nanoobjects, with confined supercoiled plasmid DNA (pBDNF), are important in the context of multicompartment lipid nanocarriers of interest for gene therapy of neurodegenerative diseases.

  17. Immuno-efficacy of DNA vaccines encoding PLP1 and ROP18 against experimental Toxoplasma gondii infection in mice.

    Science.gov (United States)

    Chen, Yajun; Yu, Miao; Hemandez, J A; Li, Jiexi; Yuan, Zi-Guo; Yan, Haikuo

    2018-05-01

    We constructed a new plasmid pIRESneo/ROP18/PLP1 that was injected intramuscularly into Kunming mice to evaluate its immune efficacy. The immunized mice exhibited significantly increased serum IgG2a levels, lymphocyte counts and Th1-type cytokine (IL-2, IL-12 and IFN-γ) levels. Moreover, the immunized mice exhibited longer survival times (44.7 ± 2.1 days for ROP18/PLP1 and 47.2 ± 2.9 days for ROP18/PLP1 + IL-18) and lower brain cyst burden (68.9% for ROP18/PLP1 and 72.4% for ROP18/PLP1 + IL-18) than control mice after T. gondii challenge. Our results demonstrate that the multiple-gene DNA vaccine including both ROP18 and PLP1 elicits greater protection against T. gondii challenge and stronger immunogenicity than single-gene vaccines. Copyright © 2018 Elsevier Inc. All rights reserved.

  18. Development of a Novel Reference Plasmid for Accurate Quantification of Genetically Modified Kefeng6 Rice DNA in Food and Feed Samples

    Directory of Open Access Journals (Sweden)

    Liang Li

    2013-01-01

    Full Text Available Reference plasmids are an essential tool for the quantification of genetically modified (GM events. Quantitative real-time PCR (qPCR is the most commonly used method to characterize and quantify reference plasmids. However, the precision of this method is often limited by calibration curves, and qPCR data can be affected by matrix differences between the standards and samples. Here, we describe a digital PCR (dPCR approach that can be used to accurately measure the novel reference plasmid pKefeng6 and quantify the unauthorized variety of GM rice Kefeng6, eliminating the issues associated with matrix effects in calibration curves. The pKefeng6 plasmid was used as a calibrant for the quantification of Kefeng6 rice by determining the copy numbers of event- (77 bp and taxon-specific (68 bp fragments, their ratios, and their concentrations. The plasmid was diluted to five different concentrations. The third sample (S3 was optimized for the quantification range of dPCR according to previous reports. The ratio between the two fragments was 1.005, which closely approximated the value certified by sequencing, and the concentration was found to be 792 copies/μL. This method was precise, with an RSD of ~3%. These findings demonstrate the advantages of using the dPCR method to characterize reference materials.

  19. Strategies to enhance immunogenicity of cDNA vaccine encoded antigens by modulation of antigen processing

    NARCIS (Netherlands)

    Platteel, Anouk C M; Marit de Groot, A; Andersen, Peter; Ovaa, Huib; Kloetzel, Peter M; Mishto, Michele; Sijts, Alice J A M

    2016-01-01

    Most vaccines are based on protective humoral responses while for intracellular pathogens CD8(+) T cells are regularly needed to provide protection. However, poor processing efficiency of antigens is often a limiting factor in CD8(+) T cell priming, hampering vaccine efficacy. The multistage cDNA

  20. Impact of co-carriage of IncA/C plasmids with additional plasmids on the transfer of antimicrobial resistance in Salmonella enterica isolates.

    Science.gov (United States)

    Han, Jing; Pendleton, Sean J; Deck, Joanna; Singh, Ruby; Gilbert, Jeffrey; Johnson, Timothy J; Sanad, Yasser M; Nayak, Rajesh; Foley, Steven L

    2018-04-20

    Antimicrobial resistance in Salmonella enterica is often plasmid encoded. A key resistance plasmid group is the incompatibility group (Inc) A/C plasmids that often carry multiple resistance determinants. Previous studies showed that IncA/C plasmids were often co-located with other plasmids. The current study was undertaken to evaluate the impact of plasmid co-carriage on antimicrobial resistance and plasmid transfer. A total of 1267 Salmonella isolates, representing multiple serotypes and sources were previously subjected to susceptibility testing and 251 isolates with resistance to at least 5 antimicrobial agents were identified for further study. Each isolate was subjected to PCR-based replicon typing, and those with IncA/C plasmids were selected for plasmid isolation, PCR-based mapping of IncA/C plasmid backbone genes, and conjugation assays to evaluate resistance plasmid transferability. Of the 87 identified IncA/C positive isolates, approximately 75% carried a plasmid with another identified replicon type, with the most common being I1 (39%), FIA, FIIA, FIB and HI2 (each 15%). PCR-based mapping indicated significant diversity in IncA/C backbone content, especially in regions encoding transfer-associated and hypothetical proteins. Conjugation experiments showed that nearly 68% of the isolates transferred resistance plasmids, with 90% containing additional identified plasmids or larger (>50 kb) non-typeable plasmids. The majority of IncA/C-positive strains were able to conjugally transfer antimicrobial resistance to the recipient, encoded by IncA/C and/or co-carried plasmids. These findings highlight the importance of co-located plasmids for resistance dissemination either by directly transferring resistance genes or by potentially providing the needed conjugation machinery for IncA/C plasmid transfer. Copyright © 2018. Published by Elsevier B.V.

  1. Diverse replication-associated protein encoding circular DNA viruses in guano samples of Central-Eastern European bats.

    Science.gov (United States)

    Kemenesi, Gábor; Kurucz, Kornélia; Zana, Brigitta; Földes, Fanni; Urbán, Péter; Vlaschenko, Anton; Kravchenko, Kseniia; Budinski, Ivana; Szodoray-Parádi, Farkas; Bücs, Szilárd; Jére, Csaba; Csősz, István; Szodoray-Parádi, Abigél; Estók, Péter; Görföl, Tamás; Boldogh, Sándor; Jakab, Ferenc

    2018-03-01

    Circular replication-associated protein encoding single-stranded DNA (CRESS DNA) viruses are increasingly recognized worldwide in a variety of samples. Representative members include well-described veterinary pathogens with worldwide distribution, such as porcine circoviruses or beak and feather disease virus. In addition, numerous novel viruses belonging to the family Circoviridae with unverified pathogenic roles have been discovered in different human samples. Viruses of the family Genomoviridae have also been described as being highly abundant in different faecal and environmental samples, with case reports showing them to be suspected pathogens in human infections. In order to investigate the genetic diversity of these viruses in European bat populations, we tested guano samples from Georgia, Hungary, Romania, Serbia and Ukraine. This resulted in the detection of six novel members of the family Circoviridae and two novel members of the family Genomoviridae. Interestingly, a gemini-like virus, namely niminivirus, which was originally found in raw sewage samples in Nigeria, was also detected in our samples. We analyzed the nucleotide composition of members of the family Circoviridae to determine the possible host origins of these viruses. This study provides the first dataset on CRESS DNA viruses of European bats, and members of several novel viral species were discovered.

  2. Quantitative PCR is a Valuable Tool to Monitor the Performance of DNA-Encoded Chemical Library Selections.

    Science.gov (United States)

    Li, Yizhou; Zimmermann, Gunther; Scheuermann, Jörg; Neri, Dario

    2017-05-04

    Phage-display libraries and DNA-encoded chemical libraries (DECLs) represent useful tools for the isolation of specific binding molecules from large combinatorial sets of compounds. With both methods, specific binders are recovered at the end of affinity capture procedures by using target proteins of interest immobilized on a solid support. However, although the efficiency of phage-display selections is routinely quantified by counting the phage titer before and after the affinity capture step, no similar quantification procedures have been reported for the characterization of DECL selections. In this article, we describe the potential and limitations of quantitative PCR (qPCR) methods for the evaluation of selection efficiency by using a combinatorial chemical library with more than 35 million compounds. In the experimental conditions chosen for the selections, a quantification of DNA input/recovery over five orders of magnitude could be performed, revealing a successful enrichment of abundant binders, which could be confirmed by DNA sequencing. qPCR provided rapid information about the performance of selections, thus facilitating the optimization of experimental conditions. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Plasmid Conjugation in E. coli and Drug Resistance | Igwe ...

    African Journals Online (AJOL)

    This study aimed at determining the antibiotics susceptibility pattern of E. coli isolates claimed to be multidrug resistance using disc diffusion method. It also determined the presence of transferable resistance plasmids through conjugation and evaluated the medical significance of plasmid encoding E. coli and drug ...

  4. Investigation of DNA Integration into Reproductive Organs Following Intramuscular Injection of DNA in Mice

    Directory of Open Access Journals (Sweden)

    Fatemeh Vahedi

    2012-10-01

    Full Text Available Background: DNA immunization with plasmid DNA encoding bacterial, viral, parasitic, and tumor antigens has been reported to trigger protective immunity. The use of plasmid DNA vaccinations against many diseases has produced promising results in animal and human clinical trials; however, safety concerns about the use of DNA vaccines exist, such as the possibility of integration into the host genome, and elicitation of adverse immune responses. Methods: In this study, we examined the potential integration and bio-distribution of pcDNA3.1+PA, a new vaccine candidate with GenBank accession # EF550208, encoding the PA63 gene, in reproductive organs of mice; ovaries and uterus in female, and testis in male. Animals of both sexes were injected intramuscularly with pcDNA3.1+PA. Host genome integration and tissue distribution were examined using PCR and RT-PCR two times monthly for six months. Results: RT-PCR confirmed that pcDNA3.1+PA was not integrated into the host genome and did not enter reproductive organs. Conclusions: This finding has important implications for the use of pcDNA3.1+PA plasmid as a vaccine and opens new perspectives in the DNA vaccine area.

  5. Site-specific deletions of chromosomally located DNA segments with the multimer resolution system of broad-host-range plasmid RP4

    DEFF Research Database (Denmark)

    Sternberg, Claus; Eberl, Leo; Sanchezromero, Juan M.

    1995-01-01

    The multimer resolution system (mrs) of the broad-host-range plasmid RP4 has been exploited to develop a general method that permits the precise excision of chromosomal segments in a variety of gram-negative bacteria. The procedure is based on the site-specific recombination between two directly ...

  6. Studies on the expression of plasmid-borne genes in the endosymbiotic state of Rhizobium leguminosarum

    NARCIS (Netherlands)

    Krol, A.J.M.

    1982-01-01

    The subject matter of the research reported in this thesis is the role of plasmid-borne genes of Rhizobium in symbiosis and nitrogen fixation. Plasmid DNA was isolated from Rhizobium leguminosarum strain PRE and the expression of plasmid DNA in nitrogen

  7. Prokaryotic DNA segregation by an actin-like filament

    DEFF Research Database (Denmark)

    Møller-Jensen, Jakob; Bugge Jensen, Rasmus; Löwe, Jan

    2002-01-01

    The mechanisms responsible for prokaryotic DNA segregation are largely unknown. The partitioning locus (par) encoded by the Escherichia coli plasmid R1 actively segregates its replicon to daughter cells. We show here that the ParM ATPase encoded by par forms dynamic actin-like filaments with prop...... point for ParM polymerization. Hence, we provide evidence for a simple prokaryotic analogue of the eukaryotic mitotic spindle apparatus.......The mechanisms responsible for prokaryotic DNA segregation are largely unknown. The partitioning locus (par) encoded by the Escherichia coli plasmid R1 actively segregates its replicon to daughter cells. We show here that the ParM ATPase encoded by par forms dynamic actin-like filaments...

  8. Molecular cloning and sequence of cDNA encoding the plasma membrane proton pump (H+-ATPase) of Arabidopsis thaliana

    International Nuclear Information System (INIS)

    Harper, J.F.; Surowy, T.K.; Sussman, M.R.

    1989-01-01

    In plants, the transport of solutes across the plasma membrane is driven by a proton pump (H + -ATPase) that produces an electric potential and pH gradient. The authors isolated and sequenced a full-length cDNA clone that encodes this enzyme in Arabidopsis thaliana. The protein predicted from its nucleotide sequence encodes 959 amino acids and has a molecular mass of 104,207 Da. The plant protein shows structural features common to a family of cation-translocating ATPases found in the plasma membrane of prokaryotic and eukaryotic cells, with the greatest overall identity in amino acid sequence (36%) to the H + -ATPase observed in the plasma membrane of fungi. The structure predicted from a hydropathy plant contains at least eight transmembrane segments, with most of the protein (73%) extending into the cytoplasm and only 5% of the residues exposed on the external surface. Unique features of the plant enzyme include diverged sequences at the amino and carboxyl termini as well as greater hydrophilic character in three extracellular loops

  9. Evaluation of protective effect of multiantigenic DNA vaccine encoding MIC3 and ROP18 antigen segments of Toxoplasma gondii in mice.

    Science.gov (United States)

    Qu, Daofeng; Han, Jianzhong; Du, Aifang

    2013-07-01

    The high incidence and severe damage caused by Toxoplasma gondii infection clearly indicates the need for the development of a vaccine. In this study, we evaluated the immune responses and protection against toxoplasmosis by immunizing ICR mice with a multiantigenic DNA vaccine. To develop the multiantigenic vaccine, two T. gondii antigens, MIC3 and ROP18, selected on the basis of previous studies were chosen. ICR mice were immunized subcutaneously with PBS, empty pcDNA3.1 vector, pMIC3, pROP18, and pROP18-MIC3, respectively. The results of lymphocyte proliferation assay, cytokine, and antibody determinations showed that mice immunized with pROP18-MIC3 elicited stronger humoral and Th1-type cellular immune responses than those immunized with single-gene plasmids, empty plasmid, or phosphate-buffered saline. After a lethal challenge with the highly virulent T. gondii RH strain, a prolonged survival time in pROP18-MIC3-immunized mice was observed in comparison to control groups. Our study indicates that the introduction of multiantigenic DNA vaccine is more powerful and efficient than single-gene vaccine, and deserves further evaluation and development.

  10. The sudden dominance of blaCTX-M harbouring plasmids in Shigella spp. Circulating in Southern Vietnam.

    Directory of Open Access Journals (Sweden)

    Nhu Thi Khanh Nguyen

    2010-06-01

    Full Text Available Plasmid mediated antimicrobial resistance in the Enterobacteriaceae is a global problem. The rise of CTX-M class extended spectrum beta lactamases (ESBLs has been well documented in industrialized countries. Vietnam is representative of a typical transitional middle income country where the spectrum of infectious diseases combined with the spread of drug resistance is shifting and bringing new healthcare challenges.We collected hospital admission data from the pediatric population attending the hospital for tropical diseases in Ho Chi Minh City with Shigella infections. Organisms were cultured from all enrolled patients and subjected to antimicrobial susceptibility testing. Those that were ESBL positive were subjected to further investigation. These investigations included PCR amplification for common ESBL genes, plasmid investigation, conjugation, microarray hybridization and DNA sequencing of a bla(CTX-M encoding plasmid.We show that two different bla(CTX-M genes are circulating in this bacterial population in this location. Sequence of one of the ESBL plasmids shows that rather than the gene being integrated into a preexisting MDR plasmid, the bla(CTX-M gene is located on relatively simple conjugative plasmid. The sequenced plasmid (pEG356 carried the bla(CTX-M-24 gene on an ISEcp1 element and demonstrated considerable sequence homology with other IncFI plasmids.The rapid dissemination, spread of antimicrobial resistance and changing population of Shigella spp. concurrent with economic growth are pertinent to many other countries undergoing similar development. Third generation cephalosporins are commonly used empiric antibiotics in Ho Chi Minh City. We recommend that these agents should not be considered for therapy of dysentery in this setting.

  11. A plastome mutation affects processing of both chloroplast and nuclear DNA-encoded plastid proteins.

    Science.gov (United States)

    Johnson, E M; Schnabelrauch, L S; Sears, B B

    1991-01-01

    Immunoblotting of a chloroplast mutant (pm7) of Oenothera showed that three proteins, cytochrome f and the 23 kDa and 16 kDa subunits of the oxygen-evolving subcomplex of photosystem II, were larger than the corresponding mature proteins of the wild type and, thus, appear to be improperly processed in pm7. The mutant is also chlorotic and has little or no internal membrane development in the plastids. The improperly processed proteins, and other proteins that are completely missing, represent products of both the plastid and nuclear genomes. To test for linkage of these defects, a green revertant of pm7 was isolated from cultures in which the mutant plastids were maintained in a nuclear background homozygous for the plastome mutator (pm) gene. In this revertant, all proteins analyzed co-reverted to the wild-type condition, indicating that a single mutation in a plastome gene is responsible for the complex phenotype of pm7. These results suggest that the defect in pm7 lies in a gene that affects a processing protease encoded in the chloroplast genome.

  12. Immunogenicity and protective efficacy of Semliki forest virus replicon-based DNA vaccines encoding goatpox virus structural proteins

    International Nuclear Information System (INIS)

    Zheng Min; Jin Ningyi; Liu Qi; Huo Xiaowei; Li Yang; Hu Bo; Ma Haili; Zhu Zhanbo; Cong Yanzhao; Li Xiao; Jin Minglan; Zhu Guangze

    2009-01-01

    Goatpox, caused by goatpox virus (GTPV), is an acute feverish and contagious disease in goats often associated with high morbidity and high mortality. To resolve potential safety risks and vaccination side effects of existing live attenuated goatpox vaccine (AV41), two Semliki forest virus (SFV) replicon-based bicistronic expression DNA vaccines (pCSm-AAL and pCSm-BAA) which encode GTPV structural proteins corresponding to the Vaccinia virus proteins A27, L1, A33, and B5, respectively, were constructed. Then, theirs ability to induce humoral and cellular response in mice and goats, and protect goats against virulent virus challenge were evaluated. The results showed that, vaccination with pCSm-AAL and pCSm-BAA in combination could elicit strong humoral and cellular responses in mice and goats, provide partial protection against viral challenge in goats, and reduce disease symptoms. Additionally, priming vaccination with the above-mentioned DNA vaccines could significantly reduce the goats' side reactions from boosting vaccinations with current live vaccine (AV41), which include skin lesions at the inoculation site and fevers. Data obtained in this study could not only facilitate improvement of the current goatpox vaccination strategy, but also provide valuable guidance to suitable candidates for evaluation and development of orthopoxvirus vaccines.

  13. Association and Expression of Virulence from Plasmids of the Group B Strain in Pseudomonas syringae pv. eriobotryae

    Directory of Open Access Journals (Sweden)

    Tran Dang Khanh

    2018-04-01

    Full Text Available Pseudomonas syringae pv. eriobotryae causes serious stem canker in loquat (Eriobotrya japonica trees. This study was conducted to determine whether plasmids are involved with its virulence. The strain NAE89, which belonged to the B group, harbored two plasmids at approximately 6.2 and 50 Mdal that caused stem canker and halo leaf spots on loquat plants. Following digestion with BamHI and ligation into the BamHI cloning site of the broad range host cosmid pLAFR3, four DNA fragments at 3.8, 6.6, 12.3, and 22.8 kb were generated. Although the plasmid-encoded virulence gene psvA was undigested with the BamHI, the halo leaf spot gene may be adjacent to the psvA gene was digested. A pLAFR3 cosmid clone was introduced into the non-pathogenic PE0 and NAE89-1 strains by triparental matings and the pathogenicity was recovered. As a result, the pLAFR3 cosmid clone was introduced into the largest size DNA fragment of 22.8 kb and determined to be the causal agent of canker on the stem of the loquat. This study revealed that the psvA gene, previously found in the 50 Mdal plasmid, was also observed in the 22.8 kb DNA fragment.

  14. Isolation and structure of a cDNA encoding the B1 (CD20) cell-surface antigen of human B lymphocytes

    International Nuclear Information System (INIS)

    Tender, T.F.; Streuli, M.; Schlossman, S.F.; Saito, H.

    1988-01-01

    The B1 (CD20) molecule is a M/sub r/ 33,000 phosphoprotein on the surface of human B lymphocytes that may serve a central role in the homoral immune response by regulating B-cell proliferation and differentiation. In this report, a cDNA clone that encodes the B1 molecule was isolated and the amino acid sequence of B1 was determined. B-cell-specific cDNA clones were selected from a human tonsillar cDNA library by differential hybridization with labeled cDNA derived from either size-fractionated B-cell mRNA or size-fractionated T-cell mRNA. Of the 261 cDNA clones isolated, 3 cross-hybridizing cDNA clones were chosen as potential candidates for encoding B1 based on their selective hybridization to RNA from B1-positive cell lines. The longest clone, pB1-21, contained a 2.8-kilobase insert with an 891-base-pair open reading frame that encodes a protein of 33 kDa. mRNA synthesized from the pB1-21 cDNA clone in vitro was translated into a protein of the same apparent molecular weight as B1. Limited proteinase digestion of the pB1-21 translation product and B1 generated peptides of the same sizes, indicating that the pB1-21 cDNA encodes the B1 molecule. Gel blot analysis indicated that pB1-21 hybridized with two mRNA species of 2.8 and 3.4 kilobases only in B1-positive cell lines. The amino acid sequence deduced from the pB1-21 nucleotide sequence apparently lacks a signal sequence and contains three extensive hydrophobic regions. The deduced B1 amino acid sequence shows no significant homology with other known patients

  15. Systematic evaluation and optimization of modification reactions of oligonucleotides with amines and carboxylic acids for the synthesis of DNA-encoded chemical libraries.

    Science.gov (United States)

    Franzini, Raphael M; Samain, Florent; Abd Elrahman, Maaly; Mikutis, Gediminas; Nauer, Angela; Zimmermann, Mauro; Scheuermann, Jörg; Hall, Jonathan; Neri, Dario

    2014-08-20

    DNA-encoded chemical libraries are collections of small molecules, attached to DNA fragments serving as identification barcodes, which can be screened against multiple protein targets, thus facilitating the drug discovery process. The preparation of large DNA-encoded chemical libraries crucially depends on the availability of robust synthetic methods, which enable the efficient conjugation to oligonucleotides of structurally diverse building blocks, sharing a common reactive group. Reactions of DNA derivatives with amines and/or carboxylic acids are particularly attractive for the synthesis of encoded libraries, in view of the very large number of building blocks that are commercially available. However, systematic studies on these reactions in the presence of DNA have not been reported so far. We first investigated conditions for the coupling of primary amines to oligonucleotides, using either a nucleophilic attack on chloroacetamide derivatives or a reductive amination on aldehyde-modified DNA. While both methods could be used for the production of secondary amines, the reductive amination approach was generally associated with higher yields and better purity. In a second endeavor, we optimized conditions for the coupling of a diverse set of 501 carboxylic acids to DNA derivatives, carrying primary and secondary amine functions. The coupling efficiency was generally higher for primary amines, compared to secondary amine substituents, but varied considerably depending on the structure of the acids and on the synthetic methods used. Optimal reaction conditions could be found for certain sets of compounds (with conversions >80%), but multiple reaction schemes are needed when assembling large libraries with highly diverse building blocks. The reactions and experimental conditions presented in this article should facilitate the synthesis of future DNA-encoded chemical libraries, while outlining the synthetic challenges that remain to be overcome.

  16. In vitro efficacy of a gene-activated nerve guidance conduit incorporating non-viral PEI-pDNA nanoparticles carrying genes encoding for NGF, GDNF and c-Jun.

    Science.gov (United States)

    Lackington, William A; Raftery, Rosanne M; O'Brien, Fergal J

    2018-06-07

    Despite the success of tissue engineered nerve guidance conduits (NGCs) for the treatment of small peripheral nerve injuries, autografts remain the clinical gold standard for larger injuries. The delivery of neurotrophic factors from conduits might enhance repair for more effective treatment of larger injuries but the efficacy of such systems is dependent on a safe, effective platform for controlled and localised therapeutic delivery. Gene therapy might offer an innovative approach to control the timing, release and level of neurotrophic factor production by directing cells to transiently sustain therapeutic protein production in situ. In this study, a gene-activated NGC was developed by incorporating non-viral polyethyleneimine-plasmid DNA (PEI-pDNA) nanoparticles (N/P 7 ratio, 2μg dose) with the pDNA encoding for nerve growth factor (NGF), glial derived neurotrophic factor (GDNF) or the transcription factor c-Jun. The physicochemical properties of PEI-pDNA nanoparticles, morphology, size and charge, were shown to be suitable for gene delivery and demonstrated high Schwann cell transfection efficiency (60±13%) in vitro. While all three genes showed therapeutic potential in terms of enhancing neurotrophic cytokine production while promoting neurite outgrowth, delivery of the gene encoding for c-Jun showed the greatest capacity to enhance regenerative cellular processes in vitro. Ultimately, this gene-activated NGC construct was shown to be capable of transfecting both Schwann cells (S42 cells) and neuronal cells (PC12 and dorsal root ganglia) in vitro, demonstrating potential for future therapeutic applications in vivo. The basic requirements of biomaterial-based nerve guidance conduits have now been well established and include being able to bridge a nerve injury to support macroscopic guidance between nerve stumps, while being strong enough to withstand longitudinal tension and circumferential compression, in addition to being mechanically sound to facilitate

  17. Increased B and T Cell Responses in M. bovis Bacille Calmette-Guérin Vaccinated Pigs Co-Immunized with Plasmid DNA Encoding a Prototype Tuberculosis Antigen

    DEFF Research Database (Denmark)

    Bruffaerts, Nicolas; Pedersen, Lasse Eggers; Vandermeulen, Gaëlle

    2015-01-01

    derivative of tuberculin (PPD) were induced in all (BCG) vaccinated animals, but responses were much stronger in BCG-pAg85A vaccinated pigs. Finally, Ag85A-specific IFN-γ producing CD8+ T cells were detected by intracellular cytokine staining and a synthetic peptide, spanning Ag85A131-150 and encompassing...

  18. Molecular typing of Salmonella typhi strains from Dhaka (Bangladesh) and development of DNA probes identifying plasmid-encoded multidrug-resistant isolates

    NARCIS (Netherlands)

    P.W.M. Hermans (Peter); S.K. Saha; W.J. van Leeuwen (Wibeke); H.A. Verbrugh (Henri); A.F. van Belkum (Alex); W.H.F. Goessens (Wil)

    1996-01-01

    textabstractSeventy-eight Salmonella typhi strains isolated in 1994 and 1995 from patients living in Dhaka, Bangladesh, were subjected to phage typing, ribotyping, IS200 fingerprinting, and PCR fingerprinting. The collection displayed a high degree of genetic

  19. Drug resistance plasmids in Lactobacillus acidophilus and Lactobacillus reuteri.

    OpenAIRE

    Vescovo, M; Morelli, L; Bottazzi, V

    1982-01-01

    Sixteen strains of Lactobacillus reuteri and 20 strains of Lactobacillus acidophilus were tested for resistance to 22 antibiotics by using commercially available sensitivity disks. Evidence suggesting linkage of these resistances to plasmids was obtained by "curing" experiments with acridine dyes and high growth temperatures. Examination of plasmid patterns of agarose gel electrophoresis provided further evidence of loss in plasmid DNA under curing conditions in some of the strains examined.

  20. SHV-type extended-spectrum beta-lactamase (ESBL are encoded in related plasmids from enterobacteria clinical isolates from Mexico beta-Lactamasas de espectro extendido (BLEE tipo SHV están codificadas en plásmidos relacionados en aislamientos clínicos de enterobacterias en México

    Directory of Open Access Journals (Sweden)

    Ulises Garza-Ramos

    2007-12-01

    Full Text Available OBJECTIVE: In this work we report the molecular characterization of beta-lactam antibiotics resistance conferred by genes contained in plasmids from enterobacteria producing extended-spectrum beta-lactamases (ESBL. MATERIAL AND METHODS: Fourteen enterobacterial clinical isolates selected from a group of strains obtained from seven different hospitals in Mexico during 1990-1992 and 1996-1998 were analyzed at the Bacterial Resistance Laboratory (National Institute Public Health, Cuernavaca. Molecular characterization included PFGE, IEF of beta-lactamases, bacterial conjugation, PCR amplification and DNA sequencing, plasmid extraction and restriction. RESULTS: Isolates were genetically unrelated. ESBL identified were SHV-2 (5/14 and SHV-5 (9/14 type. Cephalosporin-resistance was transferable in 9 of 14 (64% clinical isolates with only one conjugative plasmid, DNA finger printing showed a similar band pattern in plasmids. CONCLUSIONS: The dissemination of cephalosporin resistance was due to related plasmids carrying the ESBL genes.OBJETIVO: En este trabajo se reporta la caracterización molecular de la resistencia a antibiótico beta-lactámicos conferida por genes contenidos en plásmidos de enterobacterias productoras de beta-lactamasas de espectro extendido (BLEEs. MATERIAL Y MÉTODOS: Catorce aislamientos clínicos de enterobacterias fueron seleccionados por conveniencia de un banco de cepas obtenidas de siete diferentes hospitales de México durante los periodos 1990-1992 y 1996-1998 y fueron procesados en el Laboratorio de Resistencia Bacteriana (Instituto Nacional de Salud Pública, Cuernavaca. En la caracterización se empleó PFGE, IEF para beta-lactamasas, conjugación bacteriana, amplificación por PCR y secuenciación de DNA, extracción y restricción de plásmidos. RESULTADOS: Las 14 cepas fueron no relacionadas genéticamente. Se identificaron BLEEs tipo SHV-2 (5/14 y SHV-5 (9/14. La resistencia a cefalosporinas fue transferida por

  1. Characterization of Erwinia amylovora strains from different host plants using repetitive-sequences PCR analysis, and restriction fragment length polymorphism and short-sequence DNA repeats of plasmid pEA29.

    Science.gov (United States)

    Barionovi, D; Giorgi, S; Stoeger, A R; Ruppitsch, W; Scortichini, M

    2006-05-01

    The three main aims of the study were the assessment of the genetic relationship between a deviating Erwinia amylovora strain isolated from Amelanchier sp. (Maloideae) grown in Canada and other strains from Maloideae and Rosoideae, the investigation of the variability of the PstI fragment of the pEA29 plasmid using restriction fragment length polymorphism (RFLP) analysis and the determination of the number of short-sequence DNA repeats (SSR) by DNA sequence analysis in representative strains. Ninety-three strains obtained from 12 plant genera and different geographical locations were examined by repetitive-sequences PCR using Enterobacterial Repetitive Intergenic Consensus, BOX and Repetitive Extragenic Palindromic primer sets. Upon the unweighted pair group method with arithmetic mean analysis, a deviating strain from Amelanchier sp. was analysed using amplified ribosomal DNA restriction analysis (ARDRA) analysis and the sequencing of the 16S rDNA gene. This strain showed 99% similarity to other E. amylovora strains in the 16S gene and the same banding pattern with ARDRA. The RFLP analysis of pEA29 plasmid using MspI and Sau3A restriction enzymes showed a higher variability than that previously observed and no clear-cut grouping of the strains was possible. The number of SSR units reiterated two to 12 times. The strains obtained from pear orchards showing for the first time symptoms of fire blight had a low number of SSR units. The strains from Maloideae exhibit a wider genetic variability than previously thought. The RFLP analysis of a fragment of the pEA29 plasmid would not seem a reliable method for typing E. amylovora strains. A low number of SSR units was observed with first epidemics of fire blight. The current detection techniques are mainly based on the genetic similarities observed within the strains from the cultivated tree-fruit crops. For a more reliable detection of the fire blight pathogen also in wild and ornamentals Rosaceous plants the genetic

  2. MicroRNA expression in rainbow trout (Oncorhynchus mykiss) vaccinated with a DNA vaccine encoding the glycoprotein gene of Viral hemorrhagic septicemia virus

    DEFF Research Database (Denmark)

    Bela-Ong, Dennis; Schyth, Brian Dall; Lorenzen, Niels

    particularly to sea-farmed rainbow trout and thus necessitates strategies to mitigate potential disease outbreaks. A DNA vaccine encoding the glycoprotein gene of VHSV has been developed and shown to elicit protective immune responses in laboratory trials. It is important to identify key factors as biomarkers...

  3. Cloning, characterization and heterologous expression of epoxide hydrolase-encoding cDNA sequences from yeasts belonging to the genera Rhodotorula and Rhodosporidium

    NARCIS (Netherlands)

    Visser, H.; Weijers, C.A.G.M.; Ooyen, van A.J.J.; Verdoes, J.C.

    2002-01-01

    Epoxide hydrolase-encoding cDNA sequences were isolated from the basidiomycetous yeast species Rhodosporidium toruloides CBS 349, Rhodosporidium toruloides CBS 14 and Rhodotorula araucariae CBS 6031 in order to evaluate the molecular data and potential application of this type of enzymes. The

  4. scsB, a cDNA encoding the hydrogenosomal beta subunit of succinyl-CoA synthetase from the anaerobic fungus Neocallimastix frontalis

    NARCIS (Netherlands)

    Brondijk, THC; Durand, R; vanderGiezen, M; Gottschal, JC; Prins, RA; Fevre, M

    1996-01-01

    A clone containing a Neocallimastix frontalis cDNA assumed to encode the beta subunit of succinyl-CoA synthetase (SCSB) was identified by sequence homology with prokaryotic and eukaryotic counterparts. An open reading frame of 1311 bp was found. The deduced 437 amino acid sequence showed a high

  5. Diversity and homogeneity among small plasmids of Aeromonas salmonicida subsp. salmonicida linked with geographical origin

    Directory of Open Access Journals (Sweden)

    Sabrina A Attéré

    2015-11-01

    Full Text Available Furunculosis, which is caused by Aeromonas salmonicida subsp. salmonicida, is a major salmonid disease in fish farms worldwide. Several plasmids found in this bacterium confer phenotypes such drug resistance and virulence. Small plasmids (pAsa1, pAsa2, pAsa3, and pAsal1 related to ColE1- and ColE2-type replicons are usually present in its normal plasmidome. In the present study, with the objective to investigate if these plasmids display particularities related to the origin of the isolates bearing them, a total of 153 isolates, including 78 new and 75 previously described, were analyzed for the presence of small plasmids by PCR and DNA restriction fragment profiling. A geographical dichotomy between Canadian and European isolates for their propensity to do not have pAsa3 or pAsal1 was found. In addition, the genotyping analysis led to the identification of two European isolates harboring an unusual pAsal1. An investigation by next-generation sequencing (NGS of these two isolates shed light on two pAsal1 variants (pAsal1C and pAsal1D. As with pAsal1B, another pAsal1 variant previously described, these two new variants bore a second insertion sequence (ISAS5 in addition to the usual ISAS11. The characterization of these variants suggested that they could predominate over the wild-type pAsal1 in stressful conditions such as growth at temperatures of 25°C and above. To obtain a comprehensive portrait of the mutational pressure on small plasmids, 26 isolates whose DNA had been sequenced by NGS were investigated. pAsa3 and pAsal1 were more prone to mutations than pAsa1 and pAsa2, especially in the mobA gene, which encodes a relaxase and a primase. Lastly, the average copy number of each plasmid per cell was assessed using raw sequencing data. A clear trend with respect to the relative proportion per cell of each plasmid was identified. Our large-scale study revealed a geographical dichotomy in small plasmid repertoire in addition to a clear trend

  6. Plasmid marker rescue transformation proceeds by breakage-reunion in Bacillus subtilis

    International Nuclear Information System (INIS)

    Weinrauch, Y.; Dubnau, D.

    1987-01-01

    Bacillus subtilis carrying a plasmid which replicates with a copy number of about 1 was transformed with linearized homologous plasmid DNA labeled with the heavy isotopes 2 H and 15 N, in the presence of 32 Pi and 6-(p-hydroxyphenylazo)-uracil to inhibit DNA replication. Plasmid DNA was isolated from the transformed culture and fractionated in cesium chloride density gradients. The distribution of total and donor plasmid DNA was examined, using specific hybridization probes. The synthesis of new DNA, associated with the integration of donor moiety, was also monitored. Donor-specific sequences were present at a density intermediate between that of light and hybrid DNA. This recombinant DNA represented 1.4% of total plasmid DNA. The latter value corresponded well with the transforming activity (1.7%) obtained for the donor marker. Newly synthesized material associated with plasmid DNA at the recombinant density amounted to a minor portion of the recombinant plasmid DNA. These data suggest that, like chromosomal transformation, plasmid marker rescue transformation does not require replication for the integration of donor markers and, also like chromosomal transformation, proceeds by a breakage-reunion mechanism. The extent of donor DNA replacement of recipient DNA per plasmid molecule of 54 kilobases (27 kilobase pairs) was estimated as 16 kilobases

  7. Transposition of a Ds element from a plasmid into the plant genome in Nicotiana plumbaginifolia protoplast-derived cells.

    Science.gov (United States)

    Houba-Hérin, N; Domin, M; Pédron, J

    1994-07-01

    Nicotiana plumbaginifolia haploid protoplasts were co-transformed with two plasmids, one with a NPT-II/Ds element and one with a gene encoding an amino-terminal truncated Ac transposase. It is shown that Ds can efficiently transpose from extrachromosomal DNA to N. plumbaginifolia chromosomes when the Ac transposase gene is present in trans. Ds has been shown to have transposed into the plant genome in a limited number of copies (1.9 copies per genome), for 21/32 transgenic lines tested. The flanking sequences present in the original plasmid are missing in these 21 plants. In only two of 21 plants was part of the transposase construct integrated. By segregation analysis of transgenic progeny, Ds was shown to be present in the heterozygous state in 10 lines even though haploid protoplasts had been originally transformed. This observation could indicate that integration occurred after or during DNA replication that leads to protoplast diploidization.

  8. Heterologous expression of a Rauvolfia cDNA encoding strictosidine glucosidase, a biosynthetic key to over 2000 monoterpenoid indole alkaloids.

    Science.gov (United States)

    Gerasimenko, Irina; Sheludko, Yuri; Ma, Xueyan; Stöckigt, Joachim

    2002-04-01

    Strictosidine glucosidase (SG) is an enzyme that catalyses the second step in the biosynthesis of various classes of monoterpenoid indole alkaloids. Based on the comparison of cDNA sequences of SG from Catharanthus roseus and raucaffricine glucosidase (RG) from Rauvolfia serpentina, primers for RT-PCR were designed and the cDNA encoding SG was cloned from R. serpentina cell suspension cultures. The active enzyme was expressed in Escherichia coli and purified to homogeneity. Analysis of its deduced amino-acid sequence assigned the SG from R. serpentina to family 1 of glycosyl hydrolases. In contrast to the SG from C. roseus, the enzyme from R. serpentina is predicted to lack an uncleavable N-terminal signal sequence, which is believed to direct proteins to the endoplasmic reticulum. The temperature and pH optimum, enzyme kinetic parameters and substrate specificity of the heterologously expressed SG were studied and compared to those of the C. roseus enzyme, revealing some differences between the two glucosidases. In vitro deglucosylation of strictosidine by R. serpentina SG proceeds by the same mechanism as has been shown for the C. roseus enzyme preparation. The reaction gives rise to the end product cathenamine and involves 4,21-dehydrocorynantheine aldehyde as an intermediate. The enzymatic hydrolysis of dolichantoside (Nbeta-methylstrictosidine) leads to several products. One of them was identified as a new compound, 3-isocorreantine A. From the data it can be concluded that the divergence of the biosynthetic pathways leading to different classes of indole alkaloids formed in R. serpentina and C. roseus cell suspension cultures occurs at a later stage than strictosidine deglucosylation.

  9. Engineering of magnetic DNA nanoparticles for tumor-targeted therapy

    International Nuclear Information System (INIS)

    Hosseinkhani, Hossein; Chen Yiru; He Wenjie; Hong Poda; Yu, Dah-Shyong; Domb, Abraham J.

    2013-01-01

    This study aims to engineer novel targeted delivery system composed of magnetic DNA nanoparticles to be effective as an efficient targeted gene therapy vehicle for tumor therapy. A polysaccharide, dextran, was chosen as the vector of plasmid DNA-encoded NK4 that acts as an HGF-antagonist and anti-angiogenic regulator for inhibitions of tumor growth, invasion, and metastasis. Spermine (Sm) was chemically introduced to the hydroxyl groups of dextran to obtain dextran-Sm. When Fe 2+ solution was added to the mixture of dextran-Sm and a plasmid DNA, homogenous DNA nanoparticles were formed via chemical metal coordination bonding with average size of 230 nm. Characterization of DNA nanoparticles was performed via dynamic light scattering measurement, electrophoretic light scattering measurement, as well as transmission electron microscope. DNA nanoparticles effectively condensed plasmid DNA into nanoparticles and enhanced the stability of DNA, while significantly improved transfection efficiency in vitro and tumor accumulation in vivo. In addition, magnetic DNA nanoparticles exhibited high efficiency in antitumor therapy with regards to tumor growth as well as survival of animals evaluated in the presence of external magnetic field. We conclude that the magnetic properties of these DNA nanoparticles would enhance the tracking of non-viral gene delivery systems when administrated in vivo in a test model. These findings suggest that DNA nanoparticles effectively deliver DNA to tumor and thereby inhibiting tumor growth.

  10. Engineering of magnetic DNA nanoparticles for tumor-targeted therapy

    Energy Technology Data Exchange (ETDEWEB)

    Hosseinkhani, Hossein, E-mail: hosseinkhani@yahoo.com [Graduate Institute of Biomedical Engineering, National Taiwan University of Science and Technology (Taiwan Tech) (China); Chen Yiru [National Yang-Ming University, Department of Biomedical Engineering (China); He Wenjie; Hong Poda [Graduate Institute of Biomedical Engineering, National Taiwan University of Science and Technology (Taiwan Tech) (China); Yu, Dah-Shyong [Nanomedicine Research Center, National Defense Medical Center (China); Domb, Abraham J. [Institute of Drug Research, The Center for Nanoscience and Nanotechnology, School of Pharmacy, Faculty of Medicine, Hebrew University of Jerusalem (Israel)

    2013-01-15

    This study aims to engineer novel targeted delivery system composed of magnetic DNA nanoparticles to be effective as an efficient targeted gene therapy vehicle for tumor therapy. A polysaccharide, dextran, was chosen as the vector of plasmid DNA-encoded NK4 that acts as an HGF-antagonist and anti-angiogenic regulator for inhibitions of tumor growth, invasion, and metastasis. Spermine (Sm) was chemically introduced to the hydroxyl groups of dextran to obtain dextran-Sm. When Fe{sup 2+} solution was added to the mixture of dextran-Sm and a plasmid DNA, homogenous DNA nanoparticles were formed via chemical metal coordination bonding with average size of 230 nm. Characterization of DNA nanoparticles was performed via dynamic light scattering measurement, electrophoretic light scattering measurement, as well as transmission electron microscope. DNA nanoparticles effectively condensed plasmid DNA into nanoparticles and enhanced the stability of DNA, while significantly improved transfection efficiency in vitro and tumor accumulation in vivo. In addition, magnetic DNA nanoparticles exhibited high efficiency in antitumor therapy with regards to tumor growth as well as survival of animals evaluated in the presence of external magnetic field. We conclude that the magnetic properties of these DNA nanoparticles would enhance the tracking of non-viral gene delivery systems when administrated in vivo in a test model. These findings suggest that DNA nanoparticles effectively deliver DNA to tumor and thereby inhibiting tumor growth.

  11. Discovery of cofactor-specific, bactericidal Mycobacterium tuberculosis InhA inhibitors using DNA-encoded library technology.

    Science.gov (United States)

    Soutter, Holly H; Centrella, Paolo; Clark, Matthew A; Cuozzo, John W; Dumelin, Christoph E; Guie, Marie-Aude; Habeshian, Sevan; Keefe, Anthony D; Kennedy, Kaitlyn M; Sigel, Eric A; Troast, Dawn M; Zhang, Ying; Ferguson, Andrew D; Davies, Gareth; Stead, Eleanor R; Breed, Jason; Madhavapeddi, Prashanti; Read, Jon A

    2016-12-06

    Millions of individuals are infected with and die from tuberculosis (TB) each year, and multidrug-resistant (MDR) strains of TB are increasingly prevalent. As such, there is an urgent need to identify novel drugs to treat TB infections. Current frontline therapies include the drug isoniazid, which inhibits the essential NADH-dependent enoyl-acyl-carrier protein (ACP) reductase, InhA. To inhibit InhA, isoniazid must be activated by the catalase-peroxidase KatG. Isoniazid resistance is linked primarily to mutations in the katG gene. Discovery of InhA inhibitors that do not require KatG activation is crucial to combat MDR TB. Multiple discovery efforts have been made against InhA in recent years. Until recently, despite achieving high potency against the enzyme, these efforts have been thwarted by lack of cellular activity. We describe here the use of DNA-encoded X-Chem (DEX) screening, combined with selection of appropriate physical properties, to identify multiple classes of InhA inhibitors with cell-based activity. The utilization of DEX screening allowed the interrogation of very large compound libraries (10 11 unique small molecules) against multiple forms of the InhA enzyme in a multiplexed format. Comparison of the enriched library members across various screening conditions allowed the identification of cofactor-specific inhibitors of InhA that do not require activation by KatG, many of which had bactericidal activity in cell-based assays.

  12. Identification and characterization of a novel Cut family cDNA that encodes human copper transporter protein CutC

    International Nuclear Information System (INIS)

    Li Jixi; Ji Chaoneng; Chen Jinzhong; Yang Zhenxing; Wang Yijing; Fei, Xiangwei; Zheng Mei; Gu Xing; Wen Ge; Xie Yi; Mao Yumin

    2005-01-01

    Copper is an essential heavy metal trace element that plays important roles in cell physiology. The Cut family was associated with the copper homeostasis and involved in several important metabolisms, such as uptake, storage, delivery, and efflux of copper. In this study, a novel Cut family cDNA was isolated from the human fetal brain library, which encodes a 273 amino acid protein with a molecular mass of about 29.3 kDa and a calculated pI of 8.17. It was named hCutC (human copper transporter protein CutC). The ORF of hCutC gene was cloned into pQE30 vector and expressed in Escherichia coli M15. The secreted hCutC protein was purified to a homogenicity of 95% by using the Ni-NTA affinity chromatography. RT-PCR analysis showed that the hCutC gene expressed extensively in human tissues. Subcellular location analysis of hCutC-EGFP fusion protein revealed that hCutC was distributed to cytoplasm of COS-7 cells, and both cytoplasm and nucleus of AD293 cells. The results suggest that hCutC may be one shuttle protein and play important roles in intracellular copper trafficking

  13. Loss of long term protection with the inclusion of HIV pol to a DNA vaccine encoding gag.

    Science.gov (United States)

    Garrod, Tamsin J; Gargett, Tessa; Yu, Wenbo; Major, Lee; Burrell, Christopher J; Wesselingh, Steven; Suhrbier, Andreas; Grubor-Bauk, Branka; Gowans, Eric J

    2014-11-04

    Traditional vaccine strategies that induce antibody responses have failed to protect against HIV infection in clinical trials, and thus cell-mediated immunity is now an additional criterion. Recent clinical trials that aimed to induce strong T cell responses failed to do so. Therefore, to enhance induction of protective T cell responses, it is crucial that the optimum antigen combination is chosen. Limited research has been performed into the number of antigens selected for an HIV vaccine. This study aimed to compare DNA vaccines encoding either a single HIV antigen or a combination of two antigens, using intradermal vaccination of C57BL/6 mice. Immune assays were performed on splenocytes, and in vivo protection was examined by challenge with a chimeric virus, EcoHIV, able to infect mouse but not human leukocytes, at 10 days (short term) and 60 days (long term) post final vaccination. At 60 days there was significantly lower frequency of induced antigen-specific CD8(+) T cells in the spleens of pCMVgag-pol-vaccinated mice compared with mice which received pCMVgag only. Most importantly, short term viral control of EcoHIV was similar for pCMVgag and pCMVgag-pol-vaccinated mice at day 10, but only the pCMVgag-vaccinated significantly controlled EcoHIV at day 60 compared with pCMV-vaccinated mice, showing that control was reduced with the inclusion of the HIV pol gene. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Plasmid and chromosome segregation in prokaryotes

    DEFF Research Database (Denmark)

    Møller-Jensen, Jakob; Bugge Jensen, Rasmus; Gerdes, Kenn

    2000-01-01

    Recent major advances in the understanding of prokaryotic DNA segregation have been achieved by using fluorescence microscopy to visualize the localization of cellular components. Plasmids and bacterial chromosomes are partitioned in a highly dynamic fashion, suggesting the presence of a mitotic...

  15. Molecular characterization of a 21.4 kilobase antibiotic resistance plasmid from an α-hemolytic Escherichia coli O108:H- human clinical isolate.

    Directory of Open Access Journals (Sweden)

    Fay E Dawes

    Full Text Available This study characterizes the 21.4 kilobase plasmid pECTm80 isolated from Escherichia coli strain 80, an α hemolytic human clinical diarrhoeal isolate (serotype O108:H-. DNA sequence analysis of pECTm80 revealed it belonged to incompatibility group X1, and contained plasmid partition and toxin-antitoxin systems, an R6K-like triple origin (ori replication system, genes required for replication regulation, insertion sequences IS1R, ISEc37 and a truncated transposase gene (Tn3-like ΔtnpA of the Tn3 family, and carried a class 2 integron. The class 2 integron of pECTm80 contains an intact cassette array dfrA1-sat2, encoding resistance to trimethoprim and streptothricin, and an aadA1 gene cassette truncated by the insertion of IS1R. The complex plasmid replication system includes α, β and γ origins of replication. Pairwise BLASTn comparison of pECTm80 with plasmid pE001 reveals a conserved plasmid backbone suggestive of a common ancestral lineage. Plasmid pECTm80 is of potential clinical importance, as it carries multiple genes to ensure its stable maintenance through successive bacterial cell divisions and multiple antibiotic resistance genes.

  16. NOGA-guided analysis of regional myocardial perfusion abnormalities treated with intramyocardial injections of plasmid encoding vascular endothelial growth factor A-165 in patients with chronic myocardial ischemia: subanalysis of the EUROINJECT-ONE multicenter double-blind randomized study

    DEFF Research Database (Denmark)

    Gyongyosi, Mariann; Khorsand, Aliasghar; Zamini, Sholeh

    2005-01-01

    . The ROI was projected onto the baseline and follow-up rest and stress polar maps of the 99m-Tc-sestamibi/tetrofosmin single-photon emission computed tomography scintigraphy calculating the extent and severity (expressed as the mean normalized tracer uptake) of the ROI automatically. The extents of the ROI....... CONCLUSIONS: Projection of the NOGA-guided injection area onto the single-photon emission computed tomography polar maps permits quantitative evaluation of myocardial perfusion in regions treated with angiogenic substances. Injections of phVEGF A165 plasmid improve, but do not normalize, the stress...

  17. The technology of large-scale pharmaceutical plasmid purification ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-01-04

    Jan 4, 2010 ... DNA vaccine, the cost of purification must be decreased. Although commonly .... Three mice were killed every 4 days interval. Tissues of heart, liver, .... Now, methods such as chromatography had good prospects in plasmid ...

  18. High dose of plasmid IL-15 inhibits immune responses in an influenza non-human primates immunogenicity model

    International Nuclear Information System (INIS)

    Yin Jiangmei; Dai Anlan; Laddy, Dominick J.; Yan Jian; Arango, Tatiana; Khan, Amir S.; Lewis, Mark G.; Andersen, Hanne; Kutzler, Michele A.; Draghia-Akli, Ruxandra; Weiner, David B.; Boyer, Jean D.

    2009-01-01

    Interleukin (IL)-15, is a cytokine that is important for the maintenance of long-lasting, high-avidity T cell response to invading pathogens and has, therefore, been used in vaccine and therapeutic platforms as an adjuvant. In addition to pure protein delivery, plasmids encoding the IL-15 gene have been utilized. However, it is critical to determine the appropriate dose to maximize the adjuvanting effects. We immunized rhesus macaques with different doses of IL-15 expressing plasmid in an influenza non-human primate immunogenicity model. We found that co-immunization of rhesus macaques with a Flu DNA-based vaccine and low doses of plasmid encoding macaque IL-15 enhanced the production of IFN-γ (0.5 mg) and the proliferation of CD4 + and CD8 + T cells, as well as T CM levels in proliferating CD8 + T cells (0.25 mg). Whereas, high doses of IL-15 (4 mg) decrease the production of IFN-γ and the proliferation of CD4 + and CD8 + T cells and T CM levels in the proliferating CD4 + and CD8 + T cells. In addition, the data of hemagglutination inhibition (HI) antibody titer suggest that although not significantly different, there appears to be a slight increase in antibodies at lower doses of IL-15. Importantly, however, the higher doses of IL-15 decrease the antibody levels significantly. This study demonstrates the importance of optimizing DNA-based cytokine adjuvants.

  19. Enhanced immune response and protective effects of nano-chitosan-based DNA vaccine encoding T cell epitopes of Esat-6 and FL against Mycobacterium tuberculosis infection.

    Directory of Open Access Journals (Sweden)

    Ganzhu Feng

    Full Text Available Development of a novel and effective vaccine against Mycobacterium tuberculosis (M.tb is a challenging for preventing TB infection. In this study, a novel nanoparticle-based recombinant DNA vaccine was developed, which contains Esat-6 three T cell epitopes (Esat-6/3e and fms-like tyrosine kinase 3 ligand (FL genes (termed Esat-6/3e-FL, and was enveloped with chitosan (CS nanoparticles (nano-chitosan. The immunologic and protective efficacy of the nano-chitosan-based DNA vaccine (termed nano-Esat-6/3e-FL was assessed in C57BL/6 mice after intramuscular prime vaccination with the plasmids DNA and nasal boost with the Esat-6/3e peptides. The results showed that the immunized mice remarkably elicited enhanced T cell responses and protection against M.tb H37Rv challenge. These findings indicate that the nano-chitosan can significantly elevate the immunologic and protective effects of the DNA vaccine, and the nano-Esat-6/3e-FL is a useful vaccine for preventing M.tb infection in mice.

  20. Oral DNA Vaccine in Chickens

    Directory of Open Access Journals (Sweden)

    Seyed Davoud Jazayeri

    2012-01-01

    Full Text Available Attenuated Salmonella has been used as a carrier for DNA vaccine. However, in vitro and in vivo studies on the bacteria following transfection of plasmid DNA were poorly studied. In this paper, eukaryotic expression plasmids encoding avian influenza virus (AIV subtype H5N1 genes, pcDNA3.1/HA, NA, and NP, were transfected into an attenuated Salmonella enteric typhimurium SV4089. In vitro stability of the transfected plasmids into Salmonella were over 90% after 100 generations. The attenuated Salmonella were able to invade MCF-7 (1.2% and MCF-10A (0.5% human breast cancer cells. Newly hatched specific-pathogen-free (SPF chicks were inoculated once by oral gavage with 109 colony-forming unit (CFU of the attenuated Salmonella. No abnormal clinical signs or deaths were recorded after inoculation. Viable bacteria were detected 3 days after inoculation by plating from spleen, liver, and cecum. Fluorescent in situ hybridization (FISH and polymerase chain reaction (PCR were carried out for confirmation. Salmonella was not detected in blood cultures although serum antibody immune responses to Salmonella O antiserum group D1 factor 1, 9, and 12 antigens were observed in all the inoculated chickens after 7 days up to 35 days. Our results showed that live attenuated S. typhimurium SV4089 harboring pcDNA3.1/HA, NA, and NP may provide a unique alternative as a carrier for DNA oral vaccine in chickens.

  1. Molecular Characterization of Plasmids Encoding CTX-M β-Lactamases and their Associated Addiction Systems Circulating Among Escherichia coli from Retail Chickens, Chicken Farms, and Slaughterhouses in Korea.

    Science.gov (United States)

    Jo, Su-Jin; Woo, Gun-Jo

    2016-02-01

    Extended-spectrum β-lactamases (ESBLs), particularly those of the CTX-M types, are the predominant resistance determinants of Escherichia coli that are rapidly spreading worldwide. To determine CTX-M types, E. coli isolates were collected from retail chickens (n = 390) and environmental samples from chicken farms (n = 32) and slaughterhouses (n = 67) in Korea. Fifteen strains harboring blaCTX-M genes were isolated from 358 E. coli isolates. The most common CTX-M type was eight of CTX-M-15, followed by six of CTX-M-1 and one of CTX-M- 14. The blaCTX-M genes were identified in the isolates from retail chickens (n = 9), followed by feces, water pipes, floors, and walls. Conjugations confirmed the transferability of the plasmids carrying blaCTX-M genes to the recipient E. coli J53 strain. Furthermore, eight addiction systems carried by the replicons in CTX-M types were confirmed. The dominant system was identified as ccdAB, vagCD, and pndAC in donor strains and transconjugants. The clonal relationship between the two strains carrying blaCTX-M genes indicates that E. coli may transmit from the farm to retail chickens, suggesting a possible public health risk. Our findings demonstrate that the detection of CTX-M types in E. coli isolates is important for tracking ESBL production in animals, and suggest linkage of multiple addiction systems in plasmids bearing blaCTX-M genes.

  2. Plasmids foster diversification and adaptation of bacterial populations in soil.

    Science.gov (United States)

    Heuer, Holger; Smalla, Kornelia

    2012-11-01

    It is increasingly being recognized that the transfer of conjugative plasmids across species boundaries plays a vital role in the adaptability of bacterial populations in soil. There are specific driving forces and constraints of plasmid transfer within bacterial communities in soils. Plasmid-mediated genetic variation allows bacteria to respond rapidly with adaptive responses to challenges such as irregular antibiotic or metal concentrations, or opportunities such as the utilization of xenobiotic compounds. Cultivation-independent detection and capture of plasmids from soil bacteria, and complete sequencing have provided new insights into the role and ecology of plasmids. Broad host range plasmids such as those belonging to IncP-1 transfer a wealth of accessory functions which are carried by similar plasmid backbones. Plasmids with a narrower host range can be more specifically adapted to particular species and often transfer genes which complement chromosomally encoded functions. Plasmids seem to be an ancient and successful strategy to ensure survival of a soil population in spatial and temporal heterogeneous conditions with various environmental stresses or opportunities that occur irregularly or as a novel challenge in soil. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  3. Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

    Science.gov (United States)

    Laing, E; Pretorius, I S

    1993-05-01

    A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

  4. pTC Plasmids from Sulfolobus Species in the Geothermal Area of Tengchong, China: Genomic Conservation and Naturally-Occurring Variations as a Result of Transposition by Mobile Genetic Elements.

    Science.gov (United States)

    Xiang, Xiaoyu; Huang, Xiaoxing; Wang, Haina; Huang, Li

    2015-02-12

    Plasmids occur frequently in Archaea. A novel plasmid (denoted pTC1) containing typical conjugation functions has been isolated from Sulfolobus tengchongensis RT8-4, a strain obtained from a hot spring in Tengchong, China, and characterized. The plasmid is a circular double-stranded DNA molecule of 20,417 bp. Among a total of 26 predicted pTC1 ORFs, 23 have homologues in other known Sulfolobus conjugative plasmids (CPs). pTC1 resembles other Sulfolobus CPs in genome architecture, and is most highly conserved in the genomic region encoding conjugation functions. However, attempts to demonstrate experimentally the capacity of the plasmid for conjugational transfer were unsuccessful. A survey revealed that pTC1 and its closely related plasmid variants were widespread in the geothermal area of Tengchong. Variations of the plasmids at the target sites for transposition by an insertion sequence (IS) and a miniature inverted-repeat transposable element (MITE) were readily detected. The IS was efficiently inserted into the pTC1 genome, and the inserted sequence was inactivated and degraded more frequently in an imprecise manner than in a precise manner. These results suggest that the host organism has evolved a strategy to maintain a balance between the insertion and elimination of mobile genetic elements to permit genomic plasticity while inhibiting their fast spreading.

  5. pTC Plasmids from Sulfolobus Species in the Geothermal Area of Tengchong, China: Genomic Conservation and Naturally-Occurring Variations as a Result of Transposition by Mobile Genetic Elements

    Directory of Open Access Journals (Sweden)

    Xiaoyu Xiang

    2015-02-01

    Full Text Available Plasmids occur frequently in Archaea. A novel plasmid (denoted pTC1 containing typical conjugation functions has been isolated from Sulfolobus tengchongensis RT8-4, a strain obtained from a hot spring in Tengchong, China, and characterized. The plasmid is a circular double-stranded DNA molecule of 20,417 bp. Among a total of 26 predicted pTC1 ORFs, 23 have homologues in other known Sulfolobus conjugative plasmids (CPs. pTC1 resembles other Sulfolobus CPs in genome architecture, and is most highly conserved in the genomic region encoding conjugation functions. However, attempts to demonstrate experimentally the capacity of the plasmid for conjugational transfer were unsuccessful. A survey revealed that pTC1 and its closely related plasmid variants were widespread in the geothermal area of Tengchong. Variations of the plasmids at the target sites for transposition by an insertion sequence (IS and a miniature inverted-repeat transposable element (MITE were readily detected. The IS was efficiently inserted into the pTC1 genome, and the inserted sequence was inactivated and degraded more frequently in an imprecise manner than in a precise manner. These results suggest that the host organism has evolved a strategy to maintain a balance between the insertion and elimination of mobile genetic elements to permit genomic plasticity while inhibiting their fast spreading.

  6. Nucleotide Sequences and Comparison of Two Large Conjugative Plasmids from Different Campylobacter species

    National Research Council Canada - National Science Library

    Batchelor, Roger A; Pearson, Bruce M; Friis, Lorna M; Guerry, Patricia; Wells, Jerry M

    2004-01-01

    .... Both plasmids are mosaic in structure, having homologues of genes found in a variety of different commensal and pathogenic bacteria, but nevertheless, showed striking similarities in DNA sequence...

  7. Isolation and sequence of cDNA encoding a cytochrome P-450 from an insecticide-resistant strain of the house fly, Musca domestica.

    OpenAIRE

    Feyereisen, R; Koener, J F; Farnsworth, D E; Nebert, D W

    1989-01-01

    A cDNA expression library from phenobarbital-treated house fly (Musca domestica) was screened with rabbit antisera directed against partially purified house fly cytochrome P-450. Two overlapping clones with insert lengths of 1.3 and 1.5 kilobases were isolated. The sequence of a 1629-base-pair (bp) cDNA was obtained, with an open reading frame (nucleotides 81-1610) encoding a P-450 protein of 509 residues (Mr = 58,738). The insect P-450 protein contains a hydrophobic NH2 terminus and a 22-res...

  8. Sequential priming with simian immunodeficiency virus (SIV) DNA vaccines, with or without encoded cytokines, and a replicating adenovirus-SIV recombinant followed by protein boosting does not control a pathogenic SIVmac251 mucosal challenge.

    Science.gov (United States)

    Demberg, Thorsten; Boyer, Jean D; Malkevich, Nina; Patterson, L Jean; Venzon, David; Summers, Ebonita L; Kalisz, Irene; Kalyanaraman, V S; Lee, Eun Mi; Weiner, David B; Robert-Guroff, Marjorie

    2008-11-01

    Previously, combination DNA/nonreplicating adenovirus (Ad)- or poxvirus-vectored vaccines have strongly protected against SHIV(89.6P), DNAs expressing cytokines have modulated immunity elicited by DNA vaccines, and replication-competent Ad-recombinant priming and protein boosting has strongly protected against simian immunodeficiency virus (SIV) challenge. Here we evaluated a vaccine strategy composed of these promising components. Seven rhesus macaques per group were primed twice with multigenic SIV plasmid DNA with or without interleukin-12 (IL-12) DNA or IL-15 DNA. After a multigenic replicating Ad-SIV immunization, all groups received two booster immunizations with SIV gp140 and SIV Nef protein. Four control macaques received control DNA plasmids, empty Ad vector, and adjuvant. All vaccine components were immunogenic, but the cytokine DNAs had little effect. Macaques that received IL-15-DNA exhibited higher peak anti-Nef titers, a more rapid anti-Nef anamnestic response postchallenge, and expanded CD8(CM) T cells 2 weeks postchallenge compared to the DNA-only group. Other immune responses were indistinguishable between groups. Overall, no protection against intrarectal challenge with SIV(mac251) was observed, although immunized non-Mamu-A*01 macaques as a group exhibited a statistically significant 1-log decline in acute viremia compared to non-Mamu-A*01 controls. Possible factors contributing to the poor outcome include administration of cytokine DNAs to sites different from the Ad recombinants (intramuscular and intratracheal, respectively), too few DNA priming immunizations, a suboptimal DNA delivery method, failure to ensure delivery of SIV and cytokine plasmids to the same cell, and instability and short half-life of the IL-15 component. Future experiments should address these issues to determine if this combination approach is able to control a virulent SIV challenge.

  9. Synthesis and structure elucidation of a copper(II) Schiff-base complex: in vitro DNA binding, pBR322 plasmid cleavage and HSA binding studies.

    Science.gov (United States)

    Tabassum, Sartaj; Ahmad, Musheer; Afzal, Mohd; Zaki, Mehvash; Bharadwaj, Parimal K

    2014-11-01

    New copper(II) complex with Schiff base ligand 4-[(2-Hydroxy-3-methoxy-benzylidene)-amino]-benzoic acid (H₂L) was synthesized and characterized by spectroscopic and analytical and single crystal X-ray diffraction studies which revealed that the complex 1 exist in a distorted octahedral environment. In vitro CT-DNA binding studies were performed by employing different biophysical technique which indicated that the 1 strongly binds to DNA in comparison to ligand via electrostatic binding mode. Complex 1 cleaves pBR322 DNA via hydrolytic pathway and recognizes minor groove of DNA double helix. The HSA binding results showed that ligand and complex 1 has ability to quench the fluorescence emission intensity of Trp 214 residue available in the subdomain IIA of HSA. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Quantifying and resolving multiple vector transformants in S. cerevisiae plasmid libraries.

    Science.gov (United States)

    Scanlon, Thomas C; Gray, Elizabeth C; Griswold, Karl E

    2009-11-20

    In addition to providing the molecular machinery for transcription and translation, recombinant microbial expression hosts maintain the critical genotype-phenotype link that is essential for high throughput screening and recovery of proteins encoded by plasmid libraries. It is known that Escherichia coli cells can be simultaneously transformed with multiple unique plasmids and thusly complicate recombinant library screening experiments. As a result of their potential to yield misleading results, bacterial multiple vector transformants have been thoroughly characterized in previous model studies. In contrast to bacterial systems, there is little quantitative information available regarding multiple vector transformants in yeast. Saccharomyces cerevisiae is the most widely used eukaryotic platform for cell surface display, combinatorial protein engineering, and other recombinant library screens. In order to characterize the extent and nature of multiple vector transformants in this important host, plasmid-born gene libraries constructed by yeast homologous recombination were analyzed by DNA sequencing. It was found that up to 90% of clones in yeast homologous recombination libraries may be multiple vector transformants, that on average these clones bear four or more unique mutant genes, and that these multiple vector cells persist as a significant proportion of library populations for greater than 24 hours during liquid outgrowth. Both vector concentration and vector to insert ratio influenced the library proportion of multiple vector transformants, but their population frequency was independent of transformation efficiency. Interestingly, the average number of plasmids born by multiple vector transformants did not vary with their library population proportion. These results highlight the potential for multiple vector transformants to dominate yeast libraries constructed by homologous recombination. The previously unrecognized prevalence and persistence of multiply

  11. Quantifying and resolving multiple vector transformants in S. cerevisiae plasmid libraries

    Directory of Open Access Journals (Sweden)

    Gray Elizabeth C

    2009-11-01

    Full Text Available Abstract Background In addition to providing the molecular machinery for transcription and translation, recombinant microbial expression hosts maintain the critical genotype-phenotype link that is essential for high throughput screening and recovery of proteins encoded by plasmid libraries. It is known that Escherichia coli cells can be simultaneously transformed with multiple unique plasmids and thusly complicate recombinant library screening experiments. As a result of their potential to yield misleading results, bacterial multiple vector transformants have been thoroughly characterized in previous model studies. In contrast to bacterial systems, there is little quantitative information available regarding multiple vector transformants in yeast. Saccharomyces cerevisiae is the most widely used eukaryotic platform for cell surface display, combinatorial protein engineering, and other recombinant library screens. In order to characterize the extent and nature of multiple vector transformants in this important host, plasmid-born gene libraries constructed by yeast homologous recombination were analyzed by DNA sequencing. Results It was found that up to 90% of clones in yeast homologous recombination libraries may be multiple vector transformants, that on average these clones bear four or more unique mutant genes, and that these multiple vector cells persist as a significant proportion of library populations for greater than 24 hours during liquid outgrowth. Both vector concentration and vector to insert ratio influenced the library proportion of multiple vector transformants, but their population frequency was independent of transformation efficiency. Interestingly, the average number of plasmids born by multiple vector transformants did not vary with their library population proportion. Conclusion These results highlight the potential for multiple vector transformants to dominate yeast libraries constructed by homologous recombination. The

  12. Differential Salt-Induced Dissociation of the p53 Protein Complexes with Circular and Linear Plasmid DNA Substrates Suggest Involvement of a Sliding Mechanism

    Czech Academy of Sciences Publication Activity Database

    Šebest, Peter; Brázdová, Marie; Fojta, Miroslav; Pivoňková, Hana

    2015-01-01

    Roč. 16, č. 2 (2015), s. 3163-3177 E-ISSN 1422-0067 R&D Projects: GA ČR(CZ) GAP301/11/2076; GA ČR(CZ) GBP206/12/G151 Institutional support: RVO:68081707 Keywords : TUMOR-SUPPRESSOR P53 * CISPLATIN -DAMAGED DNA * SUPERCOILED DNA Subject RIV: BO - Biophysics Impact factor: 3.257, year: 2015

  13. DNA/MVA Vaccines for HIV/AIDS

    Directory of Open Access Journals (Sweden)

    Smita S. Iyer

    2014-02-01

    Full Text Available Since the initial proof-of-concept studies examining the ability of antigen-encoded plasmid DNA to serve as an immunogen, DNA vaccines have evolved as a clinically safe and effective platform for priming HIV-specific cellular and humoral responses in heterologous “prime-boost” vaccination regimens. Direct injection of plasmid DNA into the muscle induces T- and B-cell responses against foreign antigens. However, the insufficient magnitude of this response has led to the development of approaches for enhancing the immunogenicity of DNA vaccines. The last two decades have seen significant progress in the DNA-based vaccine platform with optimized plasmid constructs, improved delivery methods, such as electroporation, the use of molecular adjuvants and novel strategies combining DNA with viral vectors and subunit proteins. These innovations are paving the way for the clinical application of DNA-based HIV vaccines. Here, we review preclinical studies on the DNA-prime/modified vaccinia Ankara (MVA-boost vaccine modality for HIV. There is a great deal of interest in enhancing the immunogenicity of DNA by engineering DNA vaccines to co-express immune modulatory adjuvants. Some of these adjuvants have demonstrated encouraging results in preclinical and clinical studies, and these data will be examined, as well.

  14. Cloning and chromosomal assignment of a human cDNA encoding a T cell- and natural killer cell-specific trypsin-like serine protease

    International Nuclear Information System (INIS)

    Gershenfeld, H.K.; Hershberger, R.J.; Shows, T.B.; Weissman, I.L.

    1988-01-01

    A cDNA clone encoding a human T cell- and natural killer cell-specific serine protease was obtained by screening a phage λgt10 cDNA library from phytohemagglutinin-stimulated human peripheral blood lymphocytes with the mouse Hanukah factor cDNA clone. In an RNA blot-hybridization analysis, this human Hanukah factor cDNA hybridized with a 1.3-kilobase band in allogeneic-stimulated cytotoxic T cells and the Jurkat cell line, but this transcript was not detectable in normal muscle, liver, tonsil, or thymus. By dot-blot hybridization, this cDNA hybridized with RNA from three cytolytic T-cell clones and three noncytolytic T-cell clones grown in vitro as well as with purified CD16 + natural killer cells and CD3 + , CD16 - T-cell large granular lymphocytes from peripheral blood lymphocytes (CD = cluster designation). The nucleotide sequence of this cDNA clone encodes a predicted serine protease of 262 amino acids. The active enzyme is 71% and 77% similar to the mouse sequence at the amino acid and DNA level, respectively. The human and mouse sequences conserve the active site residues of serine proteases--the trypsin-specific Asp-189 and all 10 cysteine residues. The gene for the human Hanukah factor serine protease is located on human chromosome 5. The authors propose that this trypsin-like serine protease may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells

  15. Complete sequences of four plasmids of Lactococcus lactis subsp cremoris SK11 reveal extensive adaptation to the dairy environment

    NARCIS (Netherlands)

    Siezen, R.J.; Renckens, B.; Swam, van I.; Peters, S.; Kranenburg, van R.; Kleerebezem, M.; Vos, de W.M.

    2005-01-01

    Lactococcus lactis strains are known to carry plasmids encoding industrially important traits. L. lactis subsp. cremoris SK11 is widely used by the dairy industry in cheese making. Its complete plasmid complement was sequenced and found to contain the plasmids pSK11A (10,372 bp), pSK11B (13,332 bp),

  16. Application of methylation in improving plasmid transformation into Helicobacter pylori.

    Science.gov (United States)

    Zhao, Huilin; Xu, Linlin; Rong, Qianyu; Xu, Zheng; Ding, Yunfei; Zhang, Ying; Wu, Yulong; Li, Boqing; Ji, Xiaofei

    2018-05-23

    Helicobacter pylori is an important gastrointestinal pathogen. Its strains possess different levels of powerful restriction modification systems, which are significant barriers to genetic tools used for studying the role of functional genes in its pathogenesis. Methylating vectors in vitro was reported as an alternative to overcome this barrier in several bacteria. In this study we used two H. pylori-E. coli shuttle plasmids and several single/double-crossover homologous recombination gene-targeting plasmids, to test the role of methylation in H. pylori transformation. According to our results, transformants could be obtained only after shuttle plasmids were methylated before transformation. It is helpful in gene complementation and over-expression although at a low frequency. The frequency of gene-targeting transformation was also increased after methylation, especially for the single-crossover recombination plasmids, the transformants of which could only be obtained after methylation. For the double-crossover recombination targeting plasmids, the initial yield of transformants was 0.3-0.8 × 10 2 CFUs per microgram plasmid DNA. With the help of methylation, the yield was increased to 0.4-1.3 × 10 2 CFUs per microgram plasmid DNA. These results suggest that in vitro methylation can improve H. pylori transformation by different plasmids, which will benefit the pathogenic mechanism research. Copyright © 2018. Published by Elsevier B.V.

  17. PCR-Based Analysis of ColE1 Plasmids in Clinical Isolates and Metagenomic Samples Reveals Their Importance as Gene Capture Platforms

    Directory of Open Access Journals (Sweden)

    Manuel Ares-Arroyo

    2018-03-01

    Full Text Available ColE1 plasmids are important vehicles for the spread of antibiotic resistance in the Enterobacteriaceae and Pasteurellaceae families of bacteria. Their monitoring is essential, as they harbor important resistant determinants in humans, animals and the environment. In this work, we have analyzed ColE1 replicons using bioinformatic and experimental approaches. First, we carried out a computational study examining the structure of different ColE1 plasmids deposited in databases. Bioinformatic analysis of these ColE1 replicons revealed a mosaic genetic structure consisting of a host-adapted conserved region responsible for the housekeeping functions of the plasmid, and a variable region encoding a wide variety of genes, including multiple antibiotic resistance determinants. From this exhaustive computational analysis we developed a new PCR-based technique, targeting a specific sequence in the conserved region, for the screening, capture and sequencing of these small plasmids, either specific for Enterobacteriaceae or specific for Pasteurellaceae. To validate this PCR-based system, we tested various collections of isolates from both bacterial families, finding that ColE1 replicons were not only highly prevalent in antibiotic-resistant isolates, but also present in susceptible bacteria. In Pasteurellaceae, ColE1 plasmids carried almost exclusively antibiotic resistance genes. In Enterobacteriaceae, these plasmids encoded a large range of traits, including not only antibiotic resistance determinants, but also a wide variety of genes, showing the huge genetic plasticity of these small replicons. Finally, we also used a metagenomic approach in order to validate this technique, performing this PCR system using total DNA extractions from fecal samples from poultry, turkeys, pigs and humans. Using Illumina sequencing of the PCR products we identified a great diversity of genes encoded by ColE1 replicons, including different antibiotic resistance

  18. Investigation of diversity of plasmids carrying the blaTEM-52 gene

    DEFF Research Database (Denmark)

    Bielak, Eliza Maria; Bergenholtz, Rikke D.; Jørgensen, Mikael Skaanning

    2011-01-01

    OBJECTIVES: To investigate the diversity of plasmids that carry blaTEM-52 genes among Escherichia coli and Salmonella enterica originating from animals, meat products and humans. METHODS: A collection of 22 blaTEM-52-encoding plasmids was characterized by restriction fragment length polymorphism...... of self-transfer to a plasmid-free E. coli recipient. CONCLUSIONS: The blaTEM-52 gene found in humans could have been transmitted on transferable plasmids originating from animal sources. Some of the blaTEM-52 plasmids carry replicons that differ from the classical ones. Two novel replicons were detected...

  19. Damage to plasmid DNA produced by 60Co-gamma radiation and subsequent repair processes in E. coli with and without SOS induction

    International Nuclear Information System (INIS)

    Bien, M.

    1986-01-01

    This study was carried out to provide information on the question as to whether radiation-induced separation of double-stranded DNA in E. coli is followed by repair processes leading to the formation of replicable material. For the detection of those double-strand breaks, E. coli was first transformed using enzymatically linearised dBR 322-DNA. This served as a reference standard to compare the transformations using radiated DNA. DNA was either exposed to increasing doses of 60 Co-gamma radiation or separated into one oc-fraction and one lin-fraction following exposure to 30 Gy. The DNA samples thus obtained were then used to transform three different strains of E. coli (wild strain, SFX, SFXrecA - ). In order to improve the repair yield, the cells were additionally SOS-induced using ultraviolet radiation. The mutation rates were a measure of the number of errors occurring during the various repair processes. Restriction analysis was carried out to characterise the resulting mutants in greater detail. (orig./MG) [de

  20. Ternary complex of plasmid DNA with NLS-Mu-Mu protein and cationic niosome for biocompatible and efficient gene delivery: a comparative study with protamine and lipofectamine.

    Science.gov (United States)

    Nematollahi, Mohammad Hadi; Torkzadeh-Mahanai, Masoud; Pardakhty, Abbas; Ebrahimi Meimand, Hossein Ali; Asadikaram, Gholamreza

    2017-10-28

    Non-viral gene delivery methods are considered due to safety and simplicity in human gene therapy. Since the use of cationic peptide and niosome represent a promising approach for gene delivery purposes we used recombinant fusion protein and cationic niosome as a gene carrier. A multi-domain fusion protein including nuclear localization motif (NLS) and two DNA-binding (Mu) domains, namely NLS-Mu-Mu (NMM) has been designed, cloned and expressed in E. coli DE3 strain. Afterward, the interested protein was purified by affinity chromatography. Binary vectors based on protein/DNA and ternary vectors based on protein/DNA/niosome were prepared. Protamine was used as a control. DNA condensing properties of NMM and protamine were evaluated by various experiments. Furthermore, we examined cytotoxicity, hemolysis and transfection potential of the binary and ternary complexes in HEK293T and MCF-7 cell lines. Protamine and Lipofectamine™2000 were used as positive controls, correspondingly. The recombinant NMM was expressed and purified successfully and DNA was condensed efficiently at charge ratios that were not harmful to cells. Peptidoplexes showed transfection efficiency (TE) but ternary complexes had higher TE. Additionally, NMM ternary complex was more efficient compared to protamine ternary vectors. Our results showed that niosomal ternary vector of NMM is a promising non-viral gene carrier to achieve an effective and safe carrier system for gene therapy.

  1. Influence of anoxia on the induction of mutations by phenylalanine radicals during gamma-irradiation of plasmid DNA in aqueous solution.

    Science.gov (United States)

    Kuipers, Gitta K; Slotman, Ben J; Reitsma-Wijker, Carola A; van Andel, Rob J; Poldervaart, Hester A; Lafleur, M Vincent M

    2004-12-21

    When DNA is irradiated in aqueous solution, most of the damage is inflicted by water-derived radicals. This is called the indirect effect of ionizing radiation. However in whole cells not only the primary formed water radicals play a role, because some cellular compounds form secondary radicals which can also damage DNA. It is known that the amino acid phenylalanine is able to react with water radicals, resulting in the production of secondary phenylalanine radicals which can damage and inactivate DNA. In a previous study the influence of the presence of phenylalanine during gamma-irradiation of DNA in aqueous solution under oxic conditions was studied. Under anoxic irradiation conditions different amounts and types of reactive water-derived radicals are formed compared to oxic conditions and also different phenylalanine radicals are formed. Therefore, this study examines the influence of the presence of phenylalanine under anoxic conditions on the gamma-radiation-induced mutation spectrum. The results indicate that phenylalanine radicals are damaging to DNA, but less effective compared to primary water radicals. On the mutational level, in the presence of phenylalanine radicals under anoxic conditions, the amount of mutations on G:C base pairs was significantly decreased as compared to oxic conditions. Furthermore, the results of this study indicate that nucleotide excision repair is involved in repair of both inactivating and mutagenic damage induced by phenylalanine radicals under anoxic conditions.

  2. Early life DNA vaccination with the H gene of Canine distemper virus induces robust protection against distemper

    DEFF Research Database (Denmark)

    Jensen, Trine Hammer; Nielsen, Line; Aasted, Bent

    2009-01-01

    Young mink kits (n = 8)were vaccinated withDNA plasmids encoding the viral haemagglutinin protein (H) of a vaccine strain of Canine distemper virus (CDV). Virus neutralising (VN) antibodieswere induced after 2 immunisations and after the third immunisation all kits had high VN antibody titres...

  3. Chemical repair activity of free radical scavenger edaravone. Reduction reactions with dGMP hydroxyl radical adducts and suppression of base lesions and AP sites on irradiated plasmid DNA

    International Nuclear Information System (INIS)

    Hata, Kuniki; Katsumura, Yosuke; Urushibara, Ayumi; Yamashita, Shinichi; Lin Mingzhang; Muroya, Yusa; Shikazono, Naoya; Yokoya, Akinari; Fu Haiying

    2015-01-01

    Reactions of edaravone (3-methyl-1-phenyl-2-pyrazolin-5-one) with deoxyguanosine monophosphate (dGMP) hydroxyl radical adducts were investigated by pulse radiolysis technique. Edaravone was found to reduce the dGMP hydroxyl radical adducts through electron transfer reactions. The rate constants of the reactions were greater than 4 × 10 8 dm 3 mol -1 s -1 and similar to those of the reactions of ascorbic acid, which is a representative antioxidant. Yields of single-strand breaks, base lesions, and abasic sites produced in pUC18 plasmid DNA by gamma ray irradiation in the presence of low concentrations (10–1000 μmol dm -3 ) of edaravone were also quantified, and the chemical repair activity of edaravone was estimated by a method recently developed by the authors. By comparing suppression efficiencies to the induction of each DNA lesion, it was found that base lesions and abasic sites were suppressed by the chemical repair activity of edaravone, although the suppression of single-strand breaks was not very effective. This phenomenon was attributed to the chemical repair activity of edaravone toward base lesions and abasic sites. However, the chemical repair activity of edaravone for base lesions was lower than that of ascorbic acid. (author)

  4. Chemical repair activity of free radical scavenger edaravone: reduction reactions with dGMP hydroxyl radical adducts and suppression of base lesions and AP sites on irradiated plasmid DNA.

    Science.gov (United States)

    Hata, Kuniki; Urushibara, Ayumi; Yamashita, Shinichi; Lin, Mingzhang; Muroya, Yusa; Shikazono, Naoya; Yokoya, Akinari; Fu, Haiying; Katsumura, Yosuke

    2015-01-01

    Reactions of edaravone (3-methyl-1-phenyl-2-pyrazolin-5-one) with deoxyguanosine monophosphate (dGMP) hydroxyl radical adducts were investigated by pulse radiolysis technique. Edaravone was found to reduce the dGMP hydroxyl radical adducts through electron transfer reactions. The rate constants of the reactions were greater than 4 × 10(8) dm(3) mol(-1) s(-1) and similar to those of the reactions of ascorbic acid, which is a representative antioxidant. Yields of single-strand breaks, base lesions, and abasic sites produced in pUC18 plasmid DNA by gamma ray irradiation in the presence of low concentrations (10-1000 μmol dm(-3)) of edaravone were also quantified, and the chemical repair activity of edaravone was estimated by a method recently developed by the authors. By comparing suppression efficiencies to the induction of each DNA lesion, it was found that base lesions and abasic sites were suppressed by the chemical repair activity of edaravone, although the suppression of single-strand breaks was not very effective. This phenomenon was attributed to the chemical repair activity of edaravone toward base lesions and abasic sites. However, the chemical repair activity of edaravone for base lesions was lower than that of ascorbic acid. © The Author 2014. Published by Oxford University Press on behalf of The Japan Radiation Research Society and Japanese Society for Radiation Oncology.

  5. Yeast transformation mediated by Agrobacterium strains harboring an Ri plasmid: comparative study between GALLS of an Ri plasmid and virE of a Ti plasmid.

    Science.gov (United States)

    Kiyokawa, Kazuya; Yamamoto, Shinji; Sato, Yukari; Momota, Naoto; Tanaka, Katsuyuki; Moriguchi, Kazuki; Suzuki, Katsunori

    2012-07-01

    Agrobacterium strains containing a Ti plasmid can transfer T-DNA not only to plants but also to fungi, including the yeast Saccharomyces cerevisiae. However, no Agrobacterium strain harboring an Ri plasmid has been evaluated in fungal transformation. Some Ri plasmids have GALLS , instead of virE1 and virE2. GALLS protein can functionally substitute in plant transformation for a structurally different protein VirE2. In this study, we compared the yeast transformation ability among Agrobacterium donors: a strain containing a Ti plasmid, strains harboring either an agropine-type or a mikimopine-type Ri plasmid, and a strain having a modified Ri plasmid supplemented with a Ti plasmid type virE operon. Agrobacterium strains possessing GALLS transformed yeast cells far less efficiently than the strain containing virE operon. Production of GALLS in recipient yeast cells improved the yeast transformation mediated by an Agrobacterium strain lacking neither GALLS nor virE operon. A reporter assay to detect mobilization of the proteins fused with Cre recombinase revealed that VirE2 protein is much more abundant in yeast cells than GALLS. Based on these results, we concluded that the low yeast transformability mediated by Agrobacterium strains having the Ri plasmid is because of low amount of mobilized GALLS in yeast cells. © 2012 The Authors Journal compilation © 2012 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.

  6. Molecular cloning and characterization of the full-length cDNA encoding the tree shrew (tupaia belangeri) CD28

    Science.gov (United States)

    Huang, Xiaoyan; Yan, Yan; Wang, Sha; Wang, Qinying; Shi, Jian; Shao, Zhanshe; Dai, Jiejie

    2017-11-01

    CD28 is one of the most important co-stimulatory molecules expressed by naive and primed T cells. The tree shrews (Tupaia belangeri), as an ideal animal model for analyzing mechanism of human diseases receiving extensive attentions, demands essential research tools, in particular in the study of cellular markers and monoclonal antibodies for immunological studies. However, little is known about tree shrew CD28 (tsCD28) until now. In this study, a 663 bp of the full-length CD28 cDNA, encoding a polypeptide of 220 amino acids was cloned from tree shrew spleen lymphocytes. The nucleotide sequence of the tsCD28 showed 85%, 76%, and 75% similarities with human, rat, and mouse, respectively, which showed the affinity relationship between tree shrew and human is much closer than between human and rodents. The open reading frame (ORF) sequence of tsCD28 gene was predicted to be in correspondence with the signal sequence, immunoglobulin variable-like (IgV) domain, transmembrane domain and cytoplasmic tail, respectively.We also analyzed its molecular characteristics with other mammals by using biology software such as Clustal W 2.0 and so forth. Our results showed that tsCD28 contained many features conserved in CD28 genes from other mammals, including conserved signal peptide and glycosylation sites, and several residues responsible for binding to the CD28R, and the tsCD28 amino acid sequence were found a close genetic relationship with human and monkey. The crystal structure and surface charge revealed most regions of tree shrew CD28 molecule surface charges are similar as human. However, compared with human CD28 (hCD28) regions, in some areas, the surface positive charge of tsCD28 was less than hCD28, which may affect antibody binding. The present study is the first report of cloning and characterization of CD28 in tree shrew. This study provides a theoretical basis for the further study the structure and function of tree shrew CD28 and utilize tree shrew as an effective

  7. Vaccination with a DNA vaccine encoding Toxoplasma gondii ROP54 induces protective immunity against toxoplasmosis in mice.

    Science.gov (United States)

    Yang, Wen-Bin; Zhou, Dong-Hui; Zou, Yang; Chen, Kai; Liu, Qing; Wang, Jin-Lei; Zhu, Xing-Quan; Zhao, Guang-Hui

    2017-12-01

    Toxoplasma gondii is an obligatory intracellular protozoan, which infects most of the warm-blooded animals, causing serious public health problems and enormous economic losses worldwide. The rhoptry effector protein 54 (ROP54) has been indicated as a virulence factor that promotes Toxoplasma infection by modulating GBP2 loading onto parasite-containing vacuoles, which can modulate some aspects of the host immune response. In order to evaluate the immuno-protective value of ROP54, we constructed a eukaryotic recombinant plasmid expressing T. gondii ROP54 and intramuscularly immunized Kunming mice with this recombinant plasmid against acute and chronic toxoplasmosis. All mice immunized with pVAX-ROP54 elicited a high level of specific antibody responses, a significant increase of lymphocyte proliferation, and a significant level of Th1-type cytokines (IFN-γ, IL-2 and IL-12p70), in addition to an increased production of Th2-type cytokines (IL-4 and IL-10). These results demonstrated that pVAX-ROP54 induced significant cellular and humoral (Th1/Th2) immune responses, which extended the survival time (13.0±1.15days for pVAX-ROP54 vs 6.7±0.48days for pVAX I, 6.8±0.42days for PBS and 6.5±0.53 for blank control) and significantly reduced cyst burden (35.9% for pVAX-ROP54, 1% for pVAX I and 2% for PBS, compared with blank control) of immunized mice. These results indicate that the recombinant ROP54 plasmid can provide partial protection and might be a potential vaccine candidate against acute and chronic toxoplasmosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Influence of anoxia on the induction of mutations by phenylalanine radicals during gamma-irradiation of plasmid DNA in aqueous solution.

    NARCIS (Netherlands)

    Kuipers, G.K.; Slotman, B.J.; Reitsma-Wijker, CA; Andel, R.J.; Poldervaart, H.A.; Lafleur, M.V.M.

    2004-01-01

    When DNA is irradiated in aqueous solution, most of the damage is inflicted by water-derived radicals. This is called the indirect effect of ionizing radiation. However in whole cells not only the primary formed water radicals play a role, because some cellular compounds form secondary radicals

  9. Microarray-based analysis of IncA/C plasmid-associated genes from multidrug-resistant Salmonella enterica.

    Science.gov (United States)

    Lindsey, Rebecca L; Frye, Jonathan G; Fedorka-Cray, Paula J; Meinersmann, Richard J

    2011-10-01

    In the family Enterobacteriaceae, plasmids have been classified according to 27 incompatibility (Inc) or replicon types that are based on the inability of different plasmids with the same replication mechanism to coexist in the same cell. Certain replicon types such as IncA/C are associated with multidrug resistance (MDR). We developed a microarray that contains 286 unique 70-mer oligonucleotide probes based on sequences from five IncA/C plasmids: pYR1 (Yersinia ruckeri), pPIP1202 (Yersinia pestis), pP99-018 (Photobacterium damselae), pSN254 (Salmonella enterica serovar Newport), and pP91278 (Photobacterium damselae). DNA from 59 Salmonella enterica isolates was hybridized to the microarray and analyzed for the presence or absence of genes. These isolates represented 17 serovars from 14 different animal hosts and from different geographical regions in the United States. Qualitative cluster analysis was performed using CLUSTER 3.0 to group microarray hybridization results. We found that IncA/C plasmids occurred in two lineages distinguished by a major insertion-deletion (indel) region that contains genes encoding mostly hypothetical proteins. The most variable genes were represented by transposon-associated genes as well as four antimicrobial resistance genes (aphA, merP, merA, and aadA). Sixteen mercury resistance genes were identified and highly conserved, suggesting that mercury ion-related exposure is a stronger pressure than anticipated. We used these data to construct a core IncA/C genome and an accessory genome. The results of our studies suggest that the transfer of antimicrobial resistance determinants by transfer of IncA/C plasmids is somewhat less common than exchange within the plasmids orchestrated by transposable elements, such as transposons, integrating and conjugative elements (ICEs), and insertion sequence common regions (ISCRs), and thus pose less opportunity for exchange of antimicrobial resistance.

  10. Adding to Yersinia enterocolitica Gene Pool Diversity: Two Cryptic Plasmids from a Biotype 1A Isolate

    Directory of Open Access Journals (Sweden)

    Daniela Lepka

    2009-01-01

    Full Text Available We report the nucleotide sequence of two novel cryptic plasmids (4357 and 14 662 base pairs carried by a Yersinia enterocolitica biotype 1A strain isolated from pork. As distinguished from most biotype 1A strains, this isolate, designated 07-04449, exhibited adherence to eukaryotic cells. The smaller plasmid pYe4449-1 carries five attributable open reading frames (ORFs encoding the first CcdA/CcdB-like antitoxin/toxin system described for a Yersinia plasmid, a RepA-like replication initiation protein, and mobilizing factors MobA and MobC. The deduced amino acid sequences showed highest similarity to proteins described in Salmonella (CcdA/B, Klebsiella (RepA, and Plesiomonas (MobA/C indicating genomic fluidity among members of the Enterobacteriaceae. One additional ORF with unknown function, termed ORF5, was identified with an ancestry distinct from the rest of the plasmid. While the C+G content of ORF5 is 38.3%, the rest of pYe4449-1 shows a C+G content of 55.7%. The C+G content of the larger plasmid pYe4449-2 (54.9% was similar to that of pYe4449-1 (53.7% and differed from that of the Y. enterocolitica genome (47.3%. Of the 14 ORFs identified on pYe4449-2, only six ORFs showed significant similarity to database entries. For three of these ORFs likely functions could be ascribed: a TnpR-like resolvase and a phage replication protein, localized each on a low C+G island, and DNA primase TraC. Two ORFs of pYe4449-2, ORF3 and ORF7, seem to encode secretable proteins. Epitope-tagging of ORF3 revealed protein expression at 4°C but not at or above 27°C suggesting adaptation to a habitat outside swine. The hypothetical protein encoded by ORF7 is the member of a novel repeat protein family sharing the DxxGN(xnDxxGN motif. Our findings illustrate the exceptional gene pool diversity within the species Y. enterocolitica driven by horizontal gene transfer events.

  11. The extended regulatory networks of SXT/R391 integrative and conjugative elements and IncA/C conjugative plasmids.

    Science.gov (United States)

    Poulin-Laprade, Dominic; Carraro, Nicolas; Burrus, Vincent

    2015-01-01

    Nowadays, healthcare systems are challenged by a major worldwide drug resistance crisis caused by the massive and rapid dissemination of antibiotic resistance genes and associated emergence of multidrug resistant pathogenic bacteria, in both clinical and environmental settings. Conjugation is the main driving force of gene transfer among microorganisms. This mechanism of horizontal gene transfer mediates the translocation of large DNA fragments between two bacterial cells in direct contact. Integrative and conjugative elements (ICEs) of the SXT/R391 family (SRIs) and IncA/C conjugative plasmids (ACPs) are responsible for the dissemination of a broad spectrum of antibiotic resistance genes among diverse species of Enterobacteriaceae and Vibrionaceae. The biology, diversity, prevalence and distribution of these two families of conjugative elements have been the subject of extensive studies for the past 15 years. Recently, the transcriptional regulators that govern their dissemination through the expression of ICE- or plasmid-encoded transfer genes have been described. Unrelated repressors control the activation of conjugation by preventing the expression of two related master activator complexes in both types of elements, i.e., SetCD in SXT/R391 ICEs and AcaCD in IncA/C plasmids. Finally, in addition to activating ICE- or plasmid-borne genes, these master activators have been shown to specifically activate phylogenetically unrelated mobilizable genomic islands (MGIs) that also disseminate antibiotic resistance genes and other adaptive traits among a plethora of pathogens such as Vibrio cholerae and Salmonella enterica.

  12. The extended regulatory networks of SXT/R391 integrative and conjugative elements and IncA/C conjugative plasmids.

    Directory of Open Access Journals (Sweden)

    Dominic ePoulin-Laprade

    2015-08-01

    Full Text Available Nowadays, healthcare systems are challenged by a major worldwide drug resistance crisis caused by the massive and rapid dissemination of antibiotic resistance genes and associated emergence of multidrug resistant pathogenic bacteria, in both clinical and environmental settings. Conjugation is the main driving force of gene transfer among microorganisms. This mechanism of horizontal gene transfer mediates the translocation of large DNA fragments between two bacterial cells in direct contact. Integrative and conjugative elements (ICEs of the SXT/R391 family (SRIs and IncA/C conjugative plasmids (ACPs are responsible for the dissemination of a broad spectrum of antibiotic resistance genes among diverse species of Enterobacteriaceae and Vibrionaceae. The biology, diversity, prevalence and distribution of these two families of conjugative elements have been the subject of extensive studies for the past 15 years. Recently, the transcriptional regulators that govern their dissemination through the expression of ICE- or plasmid-encoded transfer genes have been described. Unrelated repressors control the activation of conjugation by preventing the expression of two related master activator complexes in both types of elements, i.e. SetCD in SXT/R391 ICEs and AcaCD in IncA/C plasmids. Finally, in addition to activating ICE- or plasmid-borne genes, these master activators have been shown to specifically activate phylogenetically unrelated mobilizable genomic islands (MGIs that also disseminate antibiotic resistance genes and other adaptive traits among a plethora of pathogens such as Vibrio cholerae and Salmonella enterica.

  13. Immunization with a DNA vaccine encoding Toxoplasma gondii Superoxide dismutase (TgSOD) induces partial immune protection against acute toxoplasmosis in BALB/c mice.

    Science.gov (United States)

    Liu, Yuan; Cao, Aiping; Li, Yawen; Li, Xun; Cong, Hua; He, Shenyi; Zhou, Huaiyu

    2017-06-07

    Toxoplasma gondii (T. gondii) is an obligate intracellular protozoan parasite that infects all warm-blooded animals including humans and causes toxoplasmosis. An effective vaccine could be an ideal choice for preventing and controlling toxoplasmosis. T. gondii Superoxide dismutase (TgSOD) might participate in affecting the intracellular growth of both bradyzoite and tachyzoite forms. In the present study, the TgSOD gene was used to construct a DNA vaccine (pEGFP-SOD). TgSOD gene was amplified and inserted into eukaryotic vector pEGFP-C1 and formed the DNA vaccine pEGFP-SOD. Then the BALB/c mice were immunized intramuscularly with the DNA vaccine and those injected with pEGFP-C1, PBS or nothing were treated as controls. Four weeks after the last immunization, all mouse groups followed by challenging intraperitoneally with tachyzoites of T. gondii ME49 strain. Results showed higher levels of total IgG, IgG2α in the sera and interferon gamma (IFN-γ) in the splenocytes from pEGFP-SOD inoculated mice than those unvaccinated, or inoculated with either empty plasmid vector or PBS. The proportions of CD4 + T cells and CD8 + T cells in the spleen from pEGFP-SOD inoculated mice were significantly (p < 0.05) increased compared to control groups. In addition, the survival time of mice immunized with pEGFP-SOD was significantly prolonged as compared to the controls (p < 0.05) although all the mice died. The present study revealed that the DNA vaccine triggered strong humoral and cellular immune responses, and aroused partial protective immunity against acute T. gondii infection in BALB/c mice. The collective data suggests the SOD may be a potential vaccine candidate for further development.

  14. Comparative Sequence Analysis of Plasmids from Lactobacillus delbrueckii and Construction of a Shuttle Cloning Vector▿

    Science.gov (United States)

    Lee, Ju-Hoon; Halgerson, Jamie S.; Kim, Jeong-Hwan; O'Sullivan, Daniel J.

    2007-01-01

    While plasmids are very commonly associated with the majority of the lactic acid bacteria, they are only very rarely associated with Lactobacillus delbrueckii, with only four characterized to date. In this study, the complete sequence of a native plasmid, pDOJ1, from a strain of Lactobacillus delbrueckii subsp. bulgaricus was determined. It consisted of a circular DNA molecule of 6,220 bp with a G+C content of 44.6% and a characteristic ori and encoded six open reading frames (ORFs), of which functions could be predicted for three—a mobilization (Mob) protein, a transposase, and a fused primase-helicase replication protein. Comparative analysis of pDOJ1 and the other available L. delbrueckii plasmids (pLBB1, pJBL2, pN42, and pLL1212) revealed a very similar organization and amino acid identities between 85 and 98% for the putative proteins of all six predicted ORFs from pDOJ1, reflecting a common origin for L. delbrueckii plasmids. Analysis of the fused primase-helicase replication gene found a similar fused organization only in the theta replicating group B plasmids from Streptococcus thermophilus. This observation and the ability of the replicon to function in S. thermophilus support the idea that the origin of plasmids in L. delbrueckii was likely from S. thermophilus. This may reflect the close association of these two species in dairy fermentations, particularly yogurt production. As no vector based on plasmid replicons from L. delbrueckii has previously been constructed, an Escherichia coli-L. delbrueckii shuttle cloning vector, pDOJ4, was constructed from pDOJ1, the p15A ori, the chloramphenicol resistance gene of pCI372, and the lacZ polylinker from pUC18. This cloning vector was successfully introduced into E. coli, L. delbrueckii subsp. bulgaricus, S. thermophilus, and Lactococcus lactis. This shuttle cloning vector provides a new tool for molecular analysis of Lactobacillus delbrueckii and other lactic acid bacteria. PMID:17526779

  15. Comparative Immunogenicity in Rhesus Monkeys of DNA Plasmid, Recombinant Vaccinia Virus, and Replication-Defective Adenovirus Vectors Expressing a Human Immunodeficiency Virus Type 1 gag Gene

    OpenAIRE

    Casimiro, Danilo R.; Chen, Ling; Fu, Tong-Ming; Evans, Robert K.; Caulfield, Michael J.; Davies, Mary-Ellen; Tang,