WorldWideScience

Sample records for plasma sh groups

  1. Curcumin Protects -SH Groups and Sulphate Transport after Oxidative Damage in Human Erythrocytes

    Directory of Open Access Journals (Sweden)

    Rossana Morabito

    2015-05-01

    Full Text Available Background/Aims: Erythrocytes, continuously exposed to oxygen pressure and toxic compounds, are sensitive to oxidative stress, namely acting on integral Band 3 protein, with consequences on cell membranes deformability and anion transport efficiency. The aim of the present investigation, conducted on human erythrocytes, is to verify whether curcumin (1 or 10µM, a natural compound with proved antioxidant properties, may counteract Band 3-mediated anion transport alterations due to oxidative stress. Methods: Oxidative conditions were induced by exposure to, alternatively, either 2 mM N-ethylmaleimide (NEM or pH-modified solutions (6.5 and 8.5. Rate constant for SO4= uptake and -SH groups estimation were measured to verify the effect of oxidative stress on anion transport efficiency and erythrocyte membranes. Results: After the exposure of erythrocytes to, alternatively, NEM or pH-modified solutions, a significant decrease in both rate constant for SO4= uptake and -SH groups was observed, which was prevented by curcumin, with a dose-dependent effect. Conclusions: Our results show that: i the decreased efficiency of anion transport may be due to changes in Band 3 protein structure caused by cysteine -SH groups oxidation, especially after exposure to NEM and pH 6.5; ii 10 µM Curcumin is effective in protecting erythrocytes from oxidative stress events at level of cell membrane transport.

  2. A computer program for quantification of SH groups generated after reduction of monoclonal antibodies

    International Nuclear Information System (INIS)

    Escobar, Normando Iznaga; Morales, Alejo; Nunez, Gilda

    1996-01-01

    Reduction of disulfide bonds to sulfhydryl (SH) groups for direct radiolabeling of antibodies for immunoscintigraphic studies of colorectal and other cancers continues to be of considerable research interest. We have developed a general strategy and a versatile computer program for the quantification of the number of SH per molecule of antibody (Ab) generated after the treatment of monoclonal antibodies (MAbs) with reducing agents such as 2-mercaptoethanol (2-ME), stannous chloride (SnCl 2 ), dithiothreitol (DTT), dithioerythritol (DTE), ascorbic acid (AA), and the like. The program we describe here performs an unweighted least-squares regression analysis of the cysteine standard curve and interpolates the cysteine concentration of the samples. The number of SH groups per molecule of antibody in the 2-mercaptoethanol and in the other reducing agents was calculated from the cysteine standard curve using Ellman's reagent to develop the yellow color. The linear least-squares method fit the standard data with a high degree of accuracy and with the correlation coefficient r of 0.999. A program has been written for the IBM PC compatible computer utilizing a friendly menu to interact with the users. The package allows the user to change parameters of the assay, to calculate regression coefficients slope, intercept and its standard errors, to perform statistical analysis, together with detailed analysis of variance, and to produce an output of the results in a printed format

  3. A computer program for quantification of SH groups generated after reduction of monoclonal antibodies

    Energy Technology Data Exchange (ETDEWEB)

    Escobar, Normando Iznaga; Morales, Alejo; Nunez, Gilda

    1996-07-01

    Reduction of disulfide bonds to sulfhydryl (SH) groups for direct radiolabeling of antibodies for immunoscintigraphic studies of colorectal and other cancers continues to be of considerable research interest. We have developed a general strategy and a versatile computer program for the quantification of the number of SH per molecule of antibody (Ab) generated after the treatment of monoclonal antibodies (MAbs) with reducing agents such as 2-mercaptoethanol (2-ME), stannous chloride (SnCl{sub 2}), dithiothreitol (DTT), dithioerythritol (DTE), ascorbic acid (AA), and the like. The program we describe here performs an unweighted least-squares regression analysis of the cysteine standard curve and interpolates the cysteine concentration of the samples. The number of SH groups per molecule of antibody in the 2-mercaptoethanol and in the other reducing agents was calculated from the cysteine standard curve using Ellman's reagent to develop the yellow color. The linear least-squares method fit the standard data with a high degree of accuracy and with the correlation coefficient r of 0.999. A program has been written for the IBM PC compatible computer utilizing a friendly menu to interact with the users. The package allows the user to change parameters of the assay, to calculate regression coefficients slope, intercept and its standard errors, to perform statistical analysis, together with detailed analysis of variance, and to produce an output of the results in a printed format.

  4. TROPIX plasma interactions group report

    Science.gov (United States)

    Herr, Joel L.; Chock, Ricaurte

    1993-10-01

    The purpose is to summarize the spacecraft charging analysis conducted by the plasma interactions group during the period from April 1993 to July 1993, on the proposed TROPIX spacecraft, and to make design recommendations which will limit the detrimental effects introduced by spacecraft charging. The recommendations were presented to the TROPIX study team at a Technical Review meeting held on 15 July 1993.

  5. Micromethod for quantification of SH groups generated after reduction of monoclonal antibodies

    International Nuclear Information System (INIS)

    Escobar, Normando Iznaga; Morales, Alejo; Nunez, Gilda

    1996-01-01

    A simple, rapid, and reproducible micromethod for quantification of sulfhydryl (SH) groups generated after reduction of monoclonal antibody (MAb) disulfide bonds with 2-mercaptoethanol (2-ME) is described. The number of SH groups per molecule of antibody in the 2-ME and in the other reducing agents was calculated from the cysteine standard curve using Ellman's reagent to develop the yellow color. Results were plotted as absorbance at 405 nm vs. cysteine concentration (μg/mL). After subtraction of the background due to Ellman's reagent, a straight-line relationship passing through the origin was obtained. Absorption spectrum of the yellow products was controlled, and no significative differences were found between optical density at 412 nm and 405 nm. Using a small quantity of antibody in the order of 37 μg, the lowest detection limit for cysteine quantification was 0.03 μg. An excellent linear correlation was found between both cysteine concentration and absorbance (r = 0.999), and the mean value of the relative error in the quantification of cysteine from samples was 2.8%. A statistical Student t-test showed an excellent linearity and parallelism between cysteine standard and samples

  6. Micromethod for quantification of SH groups generated after reduction of monoclonal antibodies

    Energy Technology Data Exchange (ETDEWEB)

    Escobar, Normando Iznaga; Morales, Alejo; Nunez, Gilda

    1996-07-01

    A simple, rapid, and reproducible micromethod for quantification of sulfhydryl (SH) groups generated after reduction of monoclonal antibody (MAb) disulfide bonds with 2-mercaptoethanol (2-ME) is described. The number of SH groups per molecule of antibody in the 2-ME and in the other reducing agents was calculated from the cysteine standard curve using Ellman's reagent to develop the yellow color. Results were plotted as absorbance at 405 nm vs. cysteine concentration ({mu}g/mL). After subtraction of the background due to Ellman's reagent, a straight-line relationship passing through the origin was obtained. Absorption spectrum of the yellow products was controlled, and no significative differences were found between optical density at 412 nm and 405 nm. Using a small quantity of antibody in the order of 37 {mu}g, the lowest detection limit for cysteine quantification was 0.03 {mu}g. An excellent linear correlation was found between both cysteine concentration and absorbance (r = 0.999), and the mean value of the relative error in the quantification of cysteine from samples was 2.8%. A statistical Student t-test showed an excellent linearity and parallelism between cysteine standard and samples.

  7. Tecnical report- Group of Plasma

    International Nuclear Information System (INIS)

    Sakanaka, P.H.; Boeckelmann, H.K.; Marotta, A.

    1985-01-01

    The research activities of Plasma Laboratory at UNICAMP (University of Campinas, Brazil) in the period from november 84 to july/85 are described. In the TUPA project, several works related to substructure and research programs were developed. Diagnostic techniques to analyse the theta Pinch implosion phase, a presure probe, an electrostatic ion energy analyser and laser-produced plasma spectroscopy were developed. The experimental results were obtained, using multiple magnetic probes inserted in the plasma. These results were analysed by numerical code using some MHD equations in 2 dimensions. A description of plasma dynamic was determined and the plasma parameters such as density and temperature were estimated. (M.C.K.) [pt

  8. SH groups in the alpha-naphthyl acetate esterase in the thyroid of the guinea-pig. A histochemical study

    DEFF Research Database (Denmark)

    Kirkeby, S

    1976-01-01

    ] are added to the incubation media. Thus the inhibition is by far the greatest in group I cells, which also show the greatest activity after incubation in conventional media, when long fixation and storage times are used. In all cases the inhibiting effect was complete or almost completely reversed......The alpha-naphthyl acetate esterase in both group I and group II thyroid cells is shown to contain SH groups since there is a decline in activity in both cell groups when certain sulfhydryl reagents [DTNB; 5,5'-Dithiobis-(2-nitrobenzoic acid)-AgNO3-Mersalyl-PCMB (parachloro mercuribenzoate) + urea...... if cysteine was added to the incubation media in equivalent concentrations to the SH blocker. There were great differences among the sulfhydryl reagents used in their ability to bring about enzyme inhibition. The alkylating agents NEM (N-ethylmaleimide) and iodoacetamide had no or little effect while PCMB...

  9. Nonlinear relativistic plasma resonance: Renormalization group approach

    Energy Technology Data Exchange (ETDEWEB)

    Metelskii, I. I., E-mail: metelski@lebedev.ru [Russian Academy of Sciences, Lebedev Physical Institute (Russian Federation); Kovalev, V. F., E-mail: vfkvvfkv@gmail.com [Dukhov All-Russian Research Institute of Automatics (Russian Federation); Bychenkov, V. Yu., E-mail: bychenk@lebedev.ru [Russian Academy of Sciences, Lebedev Physical Institute (Russian Federation)

    2017-02-15

    An analytical solution to the nonlinear set of equations describing the electron dynamics and electric field structure in the vicinity of the critical density in a nonuniform plasma is constructed using the renormalization group approach with allowance for relativistic effects of electron motion. It is demonstrated that the obtained solution describes two regimes of plasma oscillations in the vicinity of the plasma resonance— stationary and nonstationary. For the stationary regime, the spatiotemporal and spectral characteristics of the resonantly enhanced electric field are investigated in detail and the effect of the relativistic nonlinearity on the spatial localization of the energy of the plasma relativistic field is considered. The applicability limits of the obtained solution, which are determined by the conditions of plasma wave breaking in the vicinity of the resonance, are established and analyzed in detail for typical laser and plasma parameters. The applicability limits of the earlier developed nonrelativistic theories are refined.

  10. [Influence of extremely low frequency magnetic field on total protein and -sh groups concentrations in liver homogenates].

    Science.gov (United States)

    Ciejka, Elżbieta; Kowalczyk, Agata; Gorąca, Anna

    2014-01-01

    Free radicals are atoms, molecules or their fragments, whose excess leads to the development of oxidative stress, the cause of many neoplastic, neurodegenerative and inflammatory diseases, as well as aging of organisms. Industrial pollution, tobacco smoke, ionizing radiation, ultrasound and magnetic fields are the major exogenous sources of free radicals. The low frequency mag- netic field is commonly applied in physiotherapy. The aim of the present study was to evaluate the effect of extremely low frequency magnetic field (1L.F-MF) on the concentration ofsullhydryl groups (-SH) and proteins in liver tissues of experimental animals de- pending on the time of exposure to the field. Twenty one Sprague-D)awley male rats, aged 3-4 months were randomly divided into 3 experimental groups (each containing 7 animals): controls (group I), the rats exposed to IEI.F-MF of 40 Hz, 7 mT (this kind of the ELF-MF is mostly used in magnetotherapy), 30 min/day for 2 weeks (group II) and the rats exposed to 40 Hz, 7 mT for 60 min/day for 2 weeks (group III). The concentrations of proteins and sulfhydryl groups in the liver tissues were determined after exposure to magnetic fields. Exposure to low magnetic field: 40 Hz, 7 mT for 30 min/day and 60 min/day for 2 weeks caused a significant increase in the concentration of-SH groups and total protein levels in the liver tissues. The study results suggest that exposure to magnetic fields leads to the development of adaptive mechanisms to maintain the balance in the body oxidation-reduction and in the case of the studied parameters does not depend on the time of exposure.

  11. Influence of extremely low frequency magnetic field on total protein and –SH groups concentrations in liver homogenates

    Directory of Open Access Journals (Sweden)

    Elżbieta Ciejka

    2014-10-01

    Full Text Available Background: Free radicals are atoms, molecules or their fragments, whose excess leads to the development of oxidative stress, the cause of many neoplastic, neurodegenerative and inflammatory diseases, as well as aging of organisms. Industrial pollution, tobacco smoke, ionizing radiation, ultrasound and magnetic fields are the major exogenous sources of free radicals. The low frequency magnetic field is commonly applied in physiotherapy. The aim of the present study was to evaluate the effect of extremely low frequency magnetic field (ELF-MF on the concentration of sulfhydryl groups (–SH and proteins in liver tissues of experimental animals depending on the time of exposure to the field. Material and Methods: Twenty one Sprague-Dawley male rats, aged 3–4 months were randomly divided into 3 experimental groups (each containing 7 animals: controls (group I, the rats exposed to ELF-MF of 40 Hz, 7 mT (this kind of the ELF-MF is mostly used in magnetotherapy, 30 min/day for 2 weeks (group II and the rats exposed to 40 Hz, 7 mT for 60 min/day for 2 weeks (group III. The concentrations of proteins and sulfhydryl groups in the liver tissues were determined after exposure to magnetic fields. Results: Exposure to low magnetic field: 40 Hz, 7 mT for 30 min/day and 60 min/day for 2 weeks caused a significant increase in the concentration of –SH groups and total protein levels in the liver tissues. Conclusions: The study results suggest that exposure to magnetic fields leads to the development of adaptive mechanisms to maintain the balance in the body oxidation-reduction and in the case of the studied parameters does not depend on the time of exposure. Med Pr 2014;65(5:639–644

  12. Evolution of streamer groups in nonthermal plasma

    Energy Technology Data Exchange (ETDEWEB)

    Okubo, M., E-mail: mokubo@me.osakafu-u.ac.jp [Department of Mechanical Engineering, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 599-8531 (Japan)

    2015-12-15

    Nonthermal plasmas (NTPs) induced by atmospheric nanosecond pulsed corona discharge have been studied for controlling pollution from combustors, such as boilers, incinerators, and diesel engines. In high-speed short-width high-voltage pulsed corona discharge-induced plasmas, primary streamer evolution is followed by secondary streamer evolution. Though this phenomenon is known experimentally, the details of the structures of the streamers and their evolution mechanisms have not been fully clarified. In this letter, we perform quasi two-dimensional numerical analysis of nonequilibrium NTP induced by a nanosecond positive pulsed corona discharge. The continuum fluid equations for two-temperature nonequilibrium NTP are used as governing equations. In this study, 197 gas phase reactions for 25 chemical species and 21 surface reactions on the inner glass wall surface are considered in an air plasma under atmospheric pressure. The simulated behavior of the streamer groups agrees with experimental observations. Soon after the voltage increases on the reactor, primary streamers are formed, which may transit the complete gap, disappearing near the peak voltage. Next, second streamers appear, disappearing at the end of the applied voltage pulse. The streamer wavelength and the distance between the streamers in the axial direction are determined. Moreover, ozone generation is shown to be more significant in the secondary streamer. This simulation will allow better predictions for nanosecond positive pulsed plasma systems.

  13. Evolution of streamer groups in nonthermal plasma

    Science.gov (United States)

    Okubo, M.

    2015-12-01

    Nonthermal plasmas (NTPs) induced by atmospheric nanosecond pulsed corona discharge have been studied for controlling pollution from combustors, such as boilers, incinerators, and diesel engines. In high-speed short-width high-voltage pulsed corona discharge-induced plasmas, primary streamer evolution is followed by secondary streamer evolution. Though this phenomenon is known experimentally, the details of the structures of the streamers and their evolution mechanisms have not been fully clarified. In this letter, we perform quasi two-dimensional numerical analysis of nonequilibrium NTP induced by a nanosecond positive pulsed corona discharge. The continuum fluid equations for two-temperature nonequilibrium NTP are used as governing equations. In this study, 197 gas phase reactions for 25 chemical species and 21 surface reactions on the inner glass wall surface are considered in an air plasma under atmospheric pressure. The simulated behavior of the streamer groups agrees with experimental observations. Soon after the voltage increases on the reactor, primary streamers are formed, which may transit the complete gap, disappearing near the peak voltage. Next, second streamers appear, disappearing at the end of the applied voltage pulse. The streamer wavelength and the distance between the streamers in the axial direction are determined. Moreover, ozone generation is shown to be more significant in the secondary streamer. This simulation will allow better predictions for nanosecond positive pulsed plasma systems.

  14. Summary Report of Working Group: Laser-Plasma Acceleration

    International Nuclear Information System (INIS)

    Esarey, Eric; Schroeder, Carl B.; Tochitsky, Sergei; Milchberg, Howard M.

    2004-01-01

    A summary is given on the work presented and discussed in the Laser-Plasma Acceleration Working Group at the 2004 Advanced Accelerator Concepts Workshop, including the Plasma Acceleration Subgroup (Group-Leader: Eric Esarey; Co-Group-Leader: Sergei Tochitsky) and the Plasma Guiding Subgroup (Group-Leader: Howard Milchberg; Co-Group-Leader: Carl Schroeder)

  15. [Effect of UV-radiation on the level of ascorbic acid, SH-groups, and activity of glutathione reductase in the eye lens].

    Science.gov (United States)

    Byshneva, L N; Senchuk, V V

    2002-01-01

    The effect of UV radiation in vitro on the level of ascorbate, SH-groups and glutathione reductase activity in the soluble fraction of bovine eye lens was studied. UV-Irradiation increased NADPH-oxidoreductase activity, the level of ascorbate oxidation and decreased the content of SH-groups and activity of glutathione reductase. Significant activation of the NADPH-oxidoreductase activity in the presence of ascorbate and Cu2+ was observed after UV-irradiation. It is suggested that ascorbate may play an important role in the UV-induced lens pathology.

  16. The influence of protein on the change in taurine concentration and on the SH-groups in the trhombocytes of irradiated rats

    International Nuclear Information System (INIS)

    Bezkrovnaya, L.A.; Polozhij, E.A.; Dokshina, G.A.

    1980-01-01

    The role of proteins in the increase of taurine content and of SH-groups in thrombocytes of irradiated rats were studied. Actinomycin D, an inhibitor of the protein synthesis de novo, decreased the protein level and the protein thiols by 25% and caused a 15fold increase of the taurine content in the cells after irradiation. An analysis of protein fractions in the thrombocytes of control and irradiated animals emphasizes that the increased protein content is essentially due to an increased adsorption. Washing of the cells with trypsine and physiological saline decreased the content of protein, protein SH-groups and taurine in the cells of control animals to 1/3, in the irradiated animals to 1/10. This points to a loose binding of the adsorbed protein to the outer membrane of the thrombocytes. From that a correlation of the changes of the investigated criteria in the terminal period of radiation sickness is concluded. (author)

  17. Plasma physics group progress report for 1976

    International Nuclear Information System (INIS)

    1977-01-01

    Progress is reported on the continuing experimental programme on the Lt-3 tokamak, the completion of the new LT-4 tokamak and newly developed diagnostic techniques. Experimental work on LT-3 was generally aimed at invest-igating aspects of the disruptive instability. Magnetic probe measurements were made to obtain radial profiles of the toroidal electric field and an electrostatic probe was used to identify high frequency fluctuations in the plasma at the time of the disruption. Further measurements were also made of local variations in the poloidal magnetic field due to the development of tearing MHD modes. Some preliminary work was done in an investigation of the development of the plasma current profile as operating parameters were varied. During the initial operation of LT-4 (I) diagnostics were limited to standard electrical measurements, spectroscopic and magnetic field observations. Thomson scattering measurements are included in the longer term programme and a ruby laser system has been ordered. New diagnostic techniques used with LT-3 include a variation of the swept Langmuir probe and a method for abelisation of spectroscopic observations in toroidal geometry. (J.R.)

  18. Summary report: working group 2 on 'Plasma Based Acceleration Concepts'

    International Nuclear Information System (INIS)

    Esarey, E.; Leemans, W.P.

    1998-01-01

    A summary of the talks, papers and discussion sessions presented in the Working Group on Plasma Based Acceleration Concepts is given within the context of the progress towards a 1 GeV laser driven accelerator module. The topics covered within the Working Group were self-modulated laser wakefield acceleration, standard laser wakefield acceleration, plasma beat wave acceleration, laser guiding and wake excitation in plasma channels, plasma wakefield acceleration, plasma lenses and optical injection techniques for laser wakefield accelerators. An overview will be given of the present status of experimental and theoretical progress as well as an outlook towards the future physics and technological challenges for the development of an optimized accelerator module

  19. Summary Report of Working Group 6: Laser-Plasma Acceleration

    International Nuclear Information System (INIS)

    Leemans, Wim P.; Downer, Michael; Siders, Craig

    2006-01-01

    A summary is given of presentations and discussions in the Laser-Plasma Acceleration Working Group at the 2006 Advanced Accelerator Concepts Workshop. Presentation highlights include: widespread observation of quasi-monoenergetic electrons; good agreement between measured and simulated beam properties; the first demonstration of laser-plasma acceleration up to 1 GeV; single-shot visualization of laser wakefield structure; new methods for measuring <100 fs electron bunches; and new methods for 'machining' laser-plasma accelerator structures. Discussion of future direction includes: developing a roadmap for laser-plasma acceleration beyond 1 GeV; a debate over injection and guiding; benchmarking simulations with improved wake diagnostics; petawatt laser technology for future laser-plasma accelerators

  20. SH2/SH3 signaling proteins.

    Science.gov (United States)

    Schlessinger, J

    1994-02-01

    SH2 and SH3 domains are small protein modules that mediate protein-protein interactions in signal transduction pathways that are activated by protein tyrosine kinases. SH2 domains bind to short phosphotyrosine-containing sequences in growth factor receptors and other phosphoproteins. SH3 domains bind to target proteins through sequences containing proline and hydrophobic amino acids. SH2 and SH3 domain containing proteins, such as Grb2 and phospholipase C gamma, utilize these modules in order to link receptor and cytoplasmic protein tyrosine kinases to the Ras signaling pathway and to phosphatidylinositol hydrolysis, respectively. The three-dimensional structures of several SH2 and SH3 domains have been determined by NMR and X-ray crystallography, and the molecular basis of their specificity is beginning to be unveiled.

  1. Effect of sulfite treatment on total antioxidant capacity, total oxidant status, lipid hydroperoxide, and total free sulfydryl groups contents in normal and sulfite oxidase-deficient rat plasma.

    Science.gov (United States)

    Herken, Emine Nur; Kocamaz, Erdogan; Erel, Ozcan; Celik, Hakim; Kucukatay, Vural

    2009-08-01

    Sulfites, which are commonly used as preservatives, are continuously formed in the body during the metabolism of sulfur-containing amino acids. Sulfite oxidase (SOX) is an essential enzyme in the pathway of the oxidative degradation of sulfite to sulfate protecting cells from sulfite toxicity. This article investigated the effect of sulfite on total antioxidant capacity (TAC), total oxidant status, lipid hydroperoxide (LOOH), and total free sulfydryl groups (-SH) levels in normal and SOX-deficient male albino rat plasma. For this purpose, rats were divided into four groups: control, sulfite-treated, SOX-deficient, and sulfite-treated SOX-deficient groups. SOX deficiency was established by feeding rats a low molybdenum diet and adding to their drinking water 200 ppm tungsten. Sulfite (70 mg/kg) was administered to the animals via their drinking water. SOX deficiency together with sulfite treatment caused a significant increase in the plasma LOOH and total oxidant status levels. -SH content of rat plasma significantly decreased by both sulfite treatment and SOX deficiency compared to the control. There was also a significant decrease in plasma TAC level by sulfite treatment. In conclusion, sulfite treatment affects the antioxidant/oxidant balance of the plasma cells of the rats toward oxidants in SOX-deficient groups.

  2. Summary Report of Working Group 1: Laser-Plasma Acceleration

    Energy Technology Data Exchange (ETDEWEB)

    Geddes, C.G.R.; Clayton, C.; Lu, W.; Thomas, A.G.R.

    2010-06-01

    Advances in and physics of the acceleration of particles using underdense plasma structures driven by lasers were the topics of presentations and discussions in Working Group 1 of the 2010 Advanced Accelerator Concepts Workshop. Such accelerators have demonstrated gradients several orders beyond conventional machines, with quasi-monoenergetic beams at MeV-GeV energies, making them attractive candidates for next generation accelerators. Workshop discussions included advances in control over injection and laser propagation to further improve beam quality and stability, detailed diagnostics and physics models of the acceleration process, radiation generation as a source and diagnostic, and technological tools and upcoming facilities to extend the reach of laser-plasma accelerators.

  3. Summary Report of Working Group 1: Laser-Plasma Acceleration

    International Nuclear Information System (INIS)

    Geddes, C.G.R.; Clayton, C.; Lu, W.; Thomas, A.G.R.

    2010-01-01

    Advances in and physics of the acceleration of particles using underdense plasma structures driven by lasers were the topics of presentations and discussions in Working Group 1 of the 2010 Advanced Accelerator Concepts Workshop. Such accelerators have demonstrated gradients several orders beyond conventional machines, with quasi-monoenergetic beams at MeV-GeV energies, making them attractive candidates for next generation accelerators. Workshop discussions included advances in control over injection and laser propagation to further improve beam quality and stability, detailed diagnostics and physics models of the acceleration process, radiation generation as a source and diagnostic, and technological tools and upcoming facilities to extend the reach of laser-plasma accelerators.

  4. Recent reflectometry results from the UCLA plasma diagnostics group

    International Nuclear Information System (INIS)

    Gilmore, M.; Doyle, E.J.; Kubota, S.; Nguyen, X.V.; Peebles, W.A.; Rhodes, T.L.; Zeng, L.

    2001-01-01

    The UCLA Plasma Diagnostics Group has an active ongoing reflectometry program. The program is threefold, including 1) profile and 2) fluctuation measurements on fusion devices (DIII-D, NSTX, and others), and 3) basic reflectometry studies in linear and laboratory plasmas that seek to develop new measurement capabilities and increase the physics understanding of reflectometry. Recent results on the DIII-D tokamak include progress toward the implementation of FM reflectometry as a standard density profile diagnostic, and correlation length measurements in QDB discharges that indicate a very different scaling than normally observed in L-mode plasmas. The first reflectometry measurements in a spherical torus (ST) have also been obtained on NSTX. Profiles in NSTX show good agreement with those of Thomson scattering. Finally, in a linear device, a local magnetic field strength measurement based on O-X correlation reflectometry has been demonstrated to proof of principle level, and correlation lengths measured by reflectometry are in good agreement with probes. (author)

  5. Is group A thawed plasma suitable as the first option for emergency release transfusion? (CME).

    Science.gov (United States)

    Chhibber, Vishesh; Greene, Mindy; Vauthrin, Michelle; Bailey, Jeff; Weinstein, Robert

    2014-07-01

    Group AB plasma, which lacks anti-A and anti-B isohemagglutinins, is issued for emergency transfusion when a patient's ABO group is unknown, but the relative scarcity of group AB blood donors limits its availability. We sought to establish a thawed plasma inventory to improve the rapid availability of plasma in the emergency release setting but were concerned about potential wastage of group AB plasma. Recognizing that plasma-incompatible apheresis platelets are routinely transfused and only rarely result in hemolytic reactions if the donor is blood group O, and considering that group A plasma would be compatible with approximately 85% of our patient population, we instituted an emergency release policy whereby thawed group A plasma is issued to all patients of unknown blood group or if compatible plasma is not available. ABO-compatible plasma is then issued, if needed, once the patient's blood group is determined. We prospectively assessed the outcomes of all patients who received incompatible plasma under our policy. During the first 5 years under this policy, 385 emergency release requests for plasma were received by our blood bank. Among them, 23 group B or AB patients met criteria for receiving a median of 2 units of incompatible group A plasma. No hemolytic transfusion reactions or other adverse events related to transfusion were seen in any of these 23 patients. We propose that group A plasma may be an acceptable alternative to AB plasma as the first option in the emergency release setting. © 2014 AABB.

  6. SH2 and SH3 domains: elements that control interactions of cytoplasmic signaling proteins.

    Science.gov (United States)

    Koch, C A; Anderson, D; Moran, M F; Ellis, C; Pawson, T

    1991-05-03

    Src homology (SH) regions 2 and 3 are noncatalytic domains that are conserved among a series of cytoplasmic signaling proteins regulated by receptor protein-tyrosine kinases, including phospholipase C-gamma, Ras GTPase (guanosine triphosphatase)-activating protein, and Src-like tyrosine kinases. The SH2 domains of these signaling proteins bind tyrosine phosphorylated polypeptides, implicated in normal signaling and cellular transformation. Tyrosine phosphorylation acts as a switch to induce the binding of SH2 domains, thereby mediating the formation of heteromeric protein complexes at or near the plasma membrane. The formation of these complexes is likely to control the activation of signal transduction pathways by tyrosine kinases. The SH3 domain is a distinct motif that, together with SH2, may modulate interactions with the cytoskeleton and membrane. Some signaling and transforming proteins contain SH2 and SH3 domains unattached to any known catalytic element. These noncatalytic proteins may serve as adaptors to link tyrosine kinases to specific target proteins. These observations suggest that SH2 and SH3 domains participate in the control of intracellular responses to growth factor stimulation.

  7. Plasma insulin pattern in a Hausa-Fulani ethnic group in northern ...

    African Journals Online (AJOL)

    Plasma insulin pattern in a Hausa-Fulani ethnic group in northern Nigeria. ... Results: Although there were marked individual variations with 16.7% of individuals demonstrating fasting ... Key Words: Plasma Insulin, northern Nigeria Annals of ...

  8. The influence of Bauhinia forficata Link subsp. pruinosa tea on lipid peroxidation and non-protein SH groups in human erythrocytes exposed to high glucose concentrations.

    Science.gov (United States)

    Salgueiro, Andréia C F; Leal, Carina Q; Bianchini, Matheus C; Prado, Ianeli O; Mendez, Andreas S L; Puntel, Robson L; Folmer, Vanderlei; Soares, Félix A; Avila, Daiana S; Puntel, Gustavo O

    2013-06-21

    Bauhinia forficata (BF) has been traditionally used as tea in folk medicine of Brazil for treatment of Diabetes mellitus (DM). To evaluate the effects of BF leaf tea on markers of oxidative damage and antioxidant levels in an experimental model of hyperglycemia in human erythrocytes in vitro. Human erythrocytes were incubated with high glucose concentrations or glucose and BF tea for 24h and 48h. After incubation lipid peroxidation and non-protein SH levels were analyzed. Moreover, quantification of polyphenols and flavonoids, iron chelating property, scavenging of DPPH, and prevention of lipid peroxidation in isolated lipids were also assessed. A significant amount of polyphenols and flavonoids was observed. The main components found by LC-MS analysis were quercetin-3-O-(2-rhamnosyl) rutinoside, kaempferol-3-O-(2-rhamnosyl) rutinoside, quercetin-3-O-rutinoside and kaempferol-3-O-rutinoside. BF tea presents important antioxidant and chelating properties. Moreover, BF tea was effective to increase non-protein SH levels and reduce lipid peroxidation induced by high glucose concentrations in human erythrocytes. The antioxidant effects of BF tea could be related to the presence of different phenolic and flavonoids components. We believe that these components can be responsible to protect human erythrocytes exposed to high glucose concentrations against oxidative damage. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  9. Summary report : working group 5 on 'electron beam-driven plasma and structure based acceleration concepts'

    International Nuclear Information System (INIS)

    Conde, M. E.; Katsouleas, T.

    2000-01-01

    The talks presented and the work performed on electron beam-driven accelerators in plasmas and structures are summarized. Highlights of the working group include new experimental results from the E-157 Plasma Wakefield Experiment, the E-150 Plasma Lens Experiment and the Argonne Dielectric Structure Wakefield experiments. The presentations inspired discussion and analysis of three working topics: electron hose instability, ion channel lasers and the plasma afterburner

  10. Safety of the use of group A plasma in trauma: the STAT study.

    Science.gov (United States)

    Dunbar, Nancy M; Yazer, Mark H

    2017-08-01

    Use of universally ABO-compatible group AB plasma for trauma resuscitation can be challenging due to supply limitations. Many centers are now using group A plasma during the initial resuscitation of traumatically injured patients. This study was undertaken to evaluate the impact of this practice on mortality and hospital length of stay (LOS). Seventeen trauma centers using group A plasma in trauma patients of unknown ABO group participated in this study. Eligible patients were group A, B, and AB trauma patients who received at least 1 unit of group A plasma. Data collected included patient sex, age, mechanism of injury, Trauma Injury Severity Score (TRISS) probability of survival, and number of blood products transfused. The main outcome of this study was in-hospital mortality differences between group B and AB patients compared to group A patients. Data on early mortality (≤24 hr) and hospital LOS were also collected. There were 354 B and AB patients and 809 A patients. The two study groups were comparable in terms of age, sex, TRISS probability of survival, and total number of blood products transfused. The use of group A plasma during the initial resuscitation of traumatically injured patients of unknown ABO group was not associated with increased in-hospital mortality, early mortality, or hospital LOS for group B and AB patients compared to group A patients. These results support the practice of issuing thawed group A plasma for the initial resuscitation of trauma patients of unknown ABO group. © 2017 AABB.

  11. SH2 Domain Histochemistry.

    Science.gov (United States)

    Buhs, Sophia; Nollau, Peter

    2017-01-01

    Among posttranslational modifications, the phosphorylation of tyrosine residues is a key modification in cell signaling. Because of its biological importance, characterization of the cellular state of tyrosine phosphorylation is of great interest. Based on the unique properties of endogenously expressed SH2 domains recognizing tyrosine phosphorylated signaling proteins with high specificity we have developed an alternative approach, coined SH2 profiling, enabling us to decipher complex patterns of tyrosine phosphorylation in various normal and cancerous tissues. So far, SH2 profiling has largely been applied for the analysis of protein extracts with the limitation that information on spatial distribution and intensity of tyrosine phosphorylation within a tissue is lost. Here, we describe a novel SH2 domain based strategy for differential characterization of the state of tyrosine phosphorylation in formaldehyde-fixed and paraffin-embedded tissues. This approach demonstrates that SH2 domains may serve as very valuable tools for the analysis of the differential state of tyrosine phosphorylation in primary tissues fixed and processed under conditions frequently applied by routine pathology laboratories.

  12. Neuroprotective effects of metabotropic glutamate receptor group II and III activators against MPP(+)-induced cell death in human neuroblastoma SH-SY5Y cells: the impact of cell differentiation state.

    Science.gov (United States)

    Jantas, D; Greda, A; Golda, S; Korostynski, M; Grygier, B; Roman, A; Pilc, A; Lason, W

    2014-08-01

    Recent studies have documented that metabotropic glutamate receptors from group II and III (mGluR II/III) are a potential target in the symptomatic treatment of Parkinson's disease (PD), however, the neuroprotective effects of particular mGluR II/III subtypes in relation to PD pathology are recognized only partially. In the present study, we investigated the effect of various mGluR II/III activators in the in vitro model of PD using human neuroblastoma SH-SY5Y cell line and mitochondrial neurotoxin MPP(+). We demonstrated that all tested mGluR ligands: mGluR II agonist - LY354740, mGluR III agonist - ACPT-I, mGluR4 PAM - VU0361737, mGluR8 agonist - (S)-3,4-DCPG, mGluR8 PAM - AZ12216052 and mGluR7 allosteric agonist - AMN082 were protective against MPP(+)-evoked cell damage in undifferentiated (UN-) SH-SY5Y cells with the highest neuroprotection mediated by mGluR8-specific agents. However, in retinoic acid- differentiated (RA-) SH-SY5Y cells we found protection mediated only by mGluR8 activators. We also demonstrated the cell proliferation stimulating effect for mGluR4 and mGluR8 PAMs. Next, we showed that the protection mediated by mGluR II/III activators in UN-SH-SY5Y was not accompanied by the modulation of caspase-3 activity, however, a decrease in the number of apoptotic nuclei was found. Finally, we showed that the inhibitor of necroptosis, necrostatin-1 blocked the mGluR III-mediated protection. Altogether our comparative in vitro data add a further proof to neuroprotective effects of mGluR agonists or PAMs and point to mGluR8 as a promising target for neuroprotective interventions in PD. The results also suggest the participation of necroptosis-related molecular pathways in neuroprotective effects of mGluR III activation. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Changes in plasma membrane structure upon irradiation on thymocytes

    International Nuclear Information System (INIS)

    Dreval', V.I.

    1993-01-01

    Thymocytes were irradiated with doses of 4 to 10 4 Gy. The binding of 1-anilinonaphtalene-8-sulphonate and Ca 2+ to plasma membranes; viscosity and lipid peroxidation; Stern-Folmer constant; and the number of Sh-groups of membrane proteins were determined. The structural changes in plasma membranes after irradiation of thymocytes were found to be cooperative

  14. Plasma-related matrix effects in inductively coupled plasma--atomic emission spectrometry by group I and group II matrix-elements

    International Nuclear Information System (INIS)

    Chan, George C.-Y.; Chan, W.-T.

    2003-01-01

    The effects of Na, K, Ca and Ba matrices on the plasma excitation conditions in inductively coupled plasma-atomic emission spectrometry (ICP-AES) were studied. Normalized relative intensity was used to indicate the extent of the plasma-related matrix effects. The group I matrices have no effects on the plasma excitation conditions. In contrast, the group II matrices depress the normalized relative intensities of some spectral lines. Specifically, the Group II matrices have no effects on the normalized relative intensity of atomic lines of low upper energy level (soft lines), but reduce the normalized relative intensity of some ionic lines and atomic lines of high energy level (hard lines). The Group II matrices seem to shift the Saha balance of the analytes only; no shift in the Boltzmann balance was observed experimentally. Moreover, for some ionic lines with sum of ionization and excitation potentials close to the ionization potential of argon (15.75 eV), the matrix effect is smaller than other ionic lines of the same element. The reduced matrix effects may be attributed qualitatively to charge transfer excitation mechanism of these ionic lines. Charge transfer reaction renders ionic emission lines from the quasi-resonant levels similar in characteristics of atomic lines. The contribution of charge transfer relative to excitation by other non-specific excitation mechanisms (via Saha balance and Boltzmann balance) determines the degree of atomic behavior of a quasi-resonant level. A significant conclusion of this study is that plasma-related matrix effect depends strongly on the excitation mechanism of a spectral line. Since, in general, more than one excitation mechanism may contribute to the overall excitation of an emission line, the observed matrix effects reflect the sum of the effects due to individual excitation mechanisms. Excitation mechanisms, in addition to the often-used total excitation energy, should be considered in matrix effect studies

  15. Nef exosomes isolated from the plasma of individuals with HIV-associated dementia (HAD) can induce Aβ(1-42) secretion in SH-SY5Y neural cells.

    Science.gov (United States)

    Khan, Mahfuz B; Lang, Michelle J; Huang, Ming-Bo; Raymond, Andrea; Bond, Vincent C; Shiramizu, Bruce; Powell, Michael D

    2016-04-01

    In the era of combined antiretroviral therapy (CART), many of the complications due to HIV-1 infection have diminished. One exception is HIV-associated neurocognitive disorder (HAND). HAND is a spectrum of disorders in cognitive function that ranges from asymptomatic disease to severe dementia (HAD). The milder form of HAND has actually remained the same or slightly increased in prevalence in the CART era. Even in individuals who have maintained undetectable HIV RNA loads, viral proteins such as Nef and Tat can continue to be expressed. In this report, we show that Nef protein and nef messenger RNA (mRNA) are packaged into exosomes that remain in circulation in patients with HAD. Plasma-derived Nef exosomes from patients with HAD have the ability to interact with the neuroblastoma cell line SH-SY5Y and deliver nef mRNA. The mRNA can induce expression of Nef in target cells and subsequently increase expression and secretion of beta-amyloid (Aβ) and Aβ peptides. Increase secretion of amyloid peptide could contribute to cognitive impairment seen in HAND.

  16. Summary Report of Working Group 5: Electron Beam Driven Plasma Accelerators

    International Nuclear Information System (INIS)

    Hogan, Mark J.; Conde, Manoel E.

    2009-01-01

    Electron beam driven plasma accelerators have seen rapid progress over the last decade. Recent efforts have built on this success by constructing a concept for a plasma wakefield accelerator based linear collider. The needs for any future collider to deliver both energy and luminosity have substantial implications for interpreting current experiments and setting priorities for the future. This working group reviewed current experiments and ideas in the context of the demands of a future collider. The many discussions and presentations are summarized here.

  17. Subclinical hyperthyroidism (Sh) in atomic-bomb survivors in Japan

    International Nuclear Information System (INIS)

    Ashizawa, K.; Imaizumi, M.; Usa, T.; Tominaga, T.; Hida, A.; Ejima, E.; Neriishi, K.; Soda, M.; Fujiwara, S.; Maeda, R.; Akahoshi, M.; Nagataki, S.; Eguchi, K.

    2005-01-01

    Full text: Purpose/Background Subclinical hyperthyroidism (Sh) is defined as a biochemical abnormality characterized by a subnormal level of TSH with otherwise normal thyroid tests (F T 3 , F T 4 ) and no clinical symptoms. There are only a small number of cross-sectional studies on the prevalence of Sh. With the improvement of the sensitivity of TSH assay, it has become possible to survey the clinical significance of Sh. With regard to both Sh and subclinical hypothyroidism, discussions are being focused on such as the necessity of treatment. In order to elucidate the clinical significance of Sh, examination data of A-bomb survivors in Hiroshima and Nagasaki were analyzed. Subjects and Method Between 2000 and 2003, of 4,090 A-bomb survivors (1,352 males and 2,738 females with average age of 70.7), 75 individuals (1.83%) with Sh were found who had normal Free T 4 (0.71∼1.51 ng/dL) and TSH<0.45 m U/L. Analysis was limited to those who had not taken antithyroid drugs or thyroxin, and the Sh group (n=35; 9 males and 26 females) was compared with a control group with TSH:0.45∼4.5 m U/L (Group C; N=3,243; 1,109 males and 2,134 females). Result: Nine individuals had TSH<0.1 m U/L. In the Sh group, six individuals were TPO antibody-positive (17%) and 14 were TG antibody-positive (40%); hence, TG antibody-positive was significantly greater in number (p=0.0096). Hematological biochemical tests showed no significant difference between the two groups. Electrocardiograms indicated that more individuals had atrial fibrillation [p=0.028; Odds ratio (OR)=3.98; 95% Confidential interval (CI)=1.2-13.7] or ventricular premature contraction [p=0.016; OR=3.29; 95% CI=1.3-8.6] in the Sh group. In terms of the presence or absence of diabetes, dyslipidemia, hypertension, and hyperuricemia, there was no difference between the two groups. One individual from the Sh group was confirmed to have Graves' disease two years later. Conclusion: Since more individuals in the Sh group were

  18. Subclinical hyperthyroidism (Sh) in atomic-bomb survivors in Japan

    Energy Technology Data Exchange (ETDEWEB)

    Ashizawa, K; Imaizumi, M; Usa, T; Tominaga, T; Hida, A; Ejima, E; Neriishi, K; Soda, M; Fujiwara, S; Maeda, R; Akahoshi, M; Nagataki, S; Eguchi, K [Radiation Effects Research Foundation, Nagasaki (Japan). Nagasaki Branch

    2005-07-01

    Full text: Purpose/Background Subclinical hyperthyroidism (Sh) is defined as a biochemical abnormality characterized by a subnormal level of TSH with otherwise normal thyroid tests (F T{sub 3}, F T{sub 4}) and no clinical symptoms. There are only a small number of cross-sectional studies on the prevalence of Sh. With the improvement of the sensitivity of TSH assay, it has become possible to survey the clinical significance of Sh. With regard to both Sh and subclinical hypothyroidism, discussions are being focused on such as the necessity of treatment. In order to elucidate the clinical significance of Sh, examination data of A-bomb survivors in Hiroshima and Nagasaki were analyzed. Subjects and Method Between 2000 and 2003, of 4,090 A-bomb survivors (1,352 males and 2,738 females with average age of 70.7), 75 individuals (1.83%) with Sh were found who had normal Free T{sub 4} (0.71{approx}1.51 ng/dL) and TSH<0.45 m U/L. Analysis was limited to those who had not taken antithyroid drugs or thyroxin, and the Sh group (n=35; 9 males and 26 females) was compared with a control group with TSH:0.45{approx}4.5 m U/L (Group C; N=3,243; 1,109 males and 2,134 females). Result: Nine individuals had TSH<0.1 m U/L. In the Sh group, six individuals were TPO antibody-positive (17%) and 14 were TG antibody-positive (40%); hence, TG antibody-positive was significantly greater in number (p=0.0096). Hematological biochemical tests showed no significant difference between the two groups. Electrocardiograms indicated that more individuals had atrial fibrillation [p=0.028; Odds ratio (OR)=3.98; 95% Confidential interval (CI)=1.2-13.7] or ventricular premature contraction [p=0.016; OR=3.29; 95% CI=1.3-8.6] in the Sh group. In terms of the presence or absence of diabetes, dyslipidemia, hypertension, and hyperuricemia, there was no difference between the two groups. One individual from the Sh group was confirmed to have Graves' disease two years later. Conclusion: Since more individuals in

  19. Changes in the binding of copper in the plasma of molybdenum supplemented rats

    International Nuclear Information System (INIS)

    Nederbragt, H.; van den Hamer, C.J.

    1981-01-01

    After incubating plasma of Mo-supplemented rats (Mo-plasma) with /sup 64/Cu only part of it could be removed by dialysis against EDTA or histidine or by treatment with dithiocarbamate; this nondialyzable Cu was shown to be bound to albumin. The maximal amount of /sup 64/Cu bound this way equaled the Mo-induced increase in total plasma Cu. After addition of stable Cu, dialysis of Mo-plasma against a histidine solution showed that no extra Cu became tightly bound, suggesting that the /sup 64/Cu binding was due to an exchange between added /sup 64/Cu and stable Cu already present. Incubating Mo-plasma with Hg compounds prevented /sup 64/Cu binding and released stable Cu, indicating that Cu in Mo-plasma was sulfhydryl bound. Part of the Mo in Mo-plasma was freely dialyzable. The remaining part was shown to be SH bound as well. The estimated atomic ratio of SH-bound Cu and Mo was unity. Molybdenum increased the number of SH groups in plasma, and for each Cu atom at least one SH group was calculated to be present

  20. Working group report on beam plasmas, electronic propulsion, and active experiments using beams

    Science.gov (United States)

    Dawson, J. M.; Eastman, T.; Gabriel, S.; Hawkins, J.; Matossian, J.; Raitt, J.; Reeves, G.; Sasaki, S.; Szuszczewicz, E.; Winkler, J. R.

    1986-01-01

    The JPL Workshop addressed a number of plasma issues that bear on advanced spaceborne technology for the years 2000 and beyond. Primary interest was on the permanently manned space station with a focus on identifying environmentally related issues requiring early clarification by spaceborne plasma experimentation. The Beams Working Group focused on environmentally related threats that platform operations could have on the conduct and integrity of spaceborne beam experiments and vice versa. Considerations were to include particle beams and plumes. For purposes of definition it was agreed that the term particle beams described a directed flow of charged or neutral particles allowing single-particle trajectories to represent the characteristics of the beam and its propagation. On the other hand, the word plume was adopted to describe a multidimensional flow (or expansion) of a plasma or neutral gas cloud. Within the framework of these definitions, experiment categories included: (1) Neutral- and charged-particle beam propagation, with considerations extending to high powers and currents. (2) Evolution and dynamics of naturally occurring and man-made plasma and neutral gas clouds. In both categories, scientific interest focused on interactions with the ambient geoplasma and the evolution of particle densities, energy distribution functions, waves, and fields.

  1. Metabolism of oxycodone in human hepatocytes from different age groups and prediction of hepatic plasma clearance

    Directory of Open Access Journals (Sweden)

    Timo eKorjamo

    2012-01-01

    Full Text Available Oxycodone is commonly used to treat severe pain in adults and children. It is extensively metabolized in the liver in adults, but the maturation of metabolism is not well understood. Our aim was to study the metabolism of oxycodone in cryopreserved human hepatocytes from different age groups (3 days, 2 and 5 months, 4 years, adult pool and predict hepatic plasma clearance of oxycodone using these data. Oxycodone (0.1, 1 and 10 µM was incubated with hepatocytes for 4 hours, and 1 µM oxycodone also with CYP3A inhibitor ketoconazole (1 µM. Oxycodone and noroxycodone concentrations were determined at several time points with liquid chromatography-mass spectrometry. In vitro clearance of oxycodone was used to predict hepatic plasma clearance, using the well-stirred model and published physiological parameters. Noroxycodone was the major metabolite in all batches and ketoconazole inhibited the metabolism markedly in most cases. A clear correlation between in vitro oxycodone clearance and CYP3A4 activity was observed. The predicted hepatic plasma clearances were typically much lower than the published median total plasma clearance from pharmacokinetic studies. In general, this in vitro to in vivo extrapolation method provides valuable information on the maturation of oxycodone metabolism that can be utilized in the design of clinical pharmacokinetic studies in infants and young children.

  2. High-throughput sequencing of human plasma RNA by using thermostable group II intron reverse transcriptases

    Science.gov (United States)

    Qin, Yidan; Yao, Jun; Wu, Douglas C.; Nottingham, Ryan M.; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M.

    2016-01-01

    Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from RNA in RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. PMID:26554030

  3. Persistent organohalogen contaminants in plasma from groups of humans with different occupations in Bangladesh.

    Science.gov (United States)

    Zamir, R; Athanasiadou, M; Nahar, N; Mamun, M I R; Mosihuzzaman, M; Bergman, A

    2009-01-01

    The present study is aimed to assess persistent organic halogenated pollutants in humans living in Bangladesh. The results are compared to other similar studies in the region and globally. Human blood plasma were collected from groups of men and women with different occupations, i.e. being students, garment industry workers, employees at the Power Development Board (PDB), all groups in Dhaka, fishermen and fishermen wife's from Dhaka and another group from Barisal district. The plasma was analysed for hexachlorobenzene (HCB), the hexachlorocyclohexane isomers, alpha-HCH, beta-HCH, gamma-HCH and delta-HCH, the DDT group of chemicals, chlordane compounds, trans-chlordane, cis-chlordane, oxychlordane, trans-nonachlor, trans-heptachlorepoxide, methoxychlor and mirex. The most abundant contaminant, in all groups studied, p,p'-DDE is dominating, with p,p'-DDT/Sigma DDT ratios indicating recent and ongoing DDT exposure. Among the other pesticides analysed beta-HCH is the most abundant indicating the use of technical HCH products instead of Lindane (gamma-HCH). While the Sigma DDT is present in the low ppm range the beta-HCH is detected in up to approx. 400 ppb, lipid basis. The beta-HCH is most abundant in the groups of students. In contrast to the pesticides analysed very low concentrations of polychlorinated biphenyls (PCB) are present in all study groups, with e.g. CB-153 in the range of 5-30 ng g(-1) fat. The concentrations of the DDT group of chemical differ significantly between fishermen and fishermen's wives living and working in the Dhaka area versus those living and working in Barisal. Also, fishermen and their wives had significantly different concentrations of DDT compared to garment industry workers.

  4. Balancing risk and benefit: maintenance of a thawed Group A plasma inventory for trauma patients requiring massive transfusion.

    Science.gov (United States)

    Mehr, Chelsea R; Gupta, Rajan; von Recklinghausen, Friedrich M; Szczepiorkowski, Zbigniew M; Dunbar, Nancy M

    2013-06-01

    Transfusion of plasma and red blood cell (RBC) units in a balanced ratio approximating 1:1 has been shown in retrospective studies to be associated with improved outcomes for trauma patients. Our low-volume rural trauma center uses a trauma-activated transfusion algorithm. Plasma is thawed upon activation to avoid wastage. However, the time required for plasma thawing has made achievement of a 1:1 ratio early in resuscitation challenging. In this study, the time required for plasma thawing is characterized, and a potential solution is proposed. A retrospective chart study of 38 moderately and massively transfused (≥6 U in the first 24 hours) trauma patients admitted from January 2008 to March 2012 was performed. We evaluated the time required to dispense plasma and the number of RBCs dispensed before plasma in these patients. The average time between the dispense of RBCs and plasma was 26 minutes (median, 28; range, 0-48 minutes). The average number of RBCs dispensed before plasma was 8 U (median, 7 U; range, 0-24 U). Nearly one third of massively transfused patients had 10 RBCs or greater dispensed before plasma was available. There exists the potential for delayed plasma availability owing to time required for thawing, which may compromise the ability to provide balanced plasma to RBC transfusion to trauma patients. Maintenance of a thawed Group AB plasma inventory may not be operationally feasible for rural centers with low trauma volumes. Use of a thawed Group A plasma inventory is a potential alternative to ensure rapid plasma availability. Therapeutic study, level V.

  5. Assessment of space plasma effectsfor satellite applications:Working Group 2 overview

    Directory of Open Access Journals (Sweden)

    N. Jakowski

    2004-06-01

    Full Text Available An important part of the tasks of Working Group 2 of the COST Action 271 «Assessment of space plasma effect for satellites applications» is the assessment of novel data sources for information about the state of ionisation of the ionosphere. This report deals with those aspects which are not represented adequately in the scientific papers in this issue. Here emphasis is given to the product aspect (data and model collections, descriptions of methods and algorithms, availability of products, expected future developments and the links between the past COST Actions 238 and 251 with the present Action 271 and with possible future cooperations. Working Group 2 was leading in the transionospheric propagation aspects of possible products for the International Telecommunication Union?s Radiocommunication (ITU-R Study Group 3. This report gives a short overview emphasizing future developments.

  6. The Dense Plasma Focus Group of IFAS at Argentina: A brief history and recent direction of the investigations

    International Nuclear Information System (INIS)

    Milanese, Maria Magdalena

    2006-01-01

    This is a short review of the research done by the Dense Plasma Focus Group (GPDM) presently working in Tandil, Argentina, from its origin, more than three decades ago, as part of the Plasma Physics Laboratory of Buenos Aires University (the first one in Latin-America where experiments in plasma focus have been made) up to the present. The interest has been mainly experimental studies on plasma focus and, in general, fast electrical discharges. The plasma focus has extensively been studied as neutron producer, including its possibility to play a role in nuclear fusion. It was also researched not only for basic plasma studies, but also for other important applications. Conception, design, construction and study of devices and diagnostics suitable for each application have been made on basis of developed criteria

  7. Molecular typing for blood group antigens within 40 minutes by direct PCR from plasma or serum

    Science.gov (United States)

    Wagner, Franz Friedrich; Flegel, Willy Albert; Bittner, Rita; Döscher, Andrea

    2016-01-01

    Determining blood group antigens by serological methods may be unreliable in certain situations, such as in patients after chronic or massive transfusion. Red cell genotyping offers a complementary approach, but current methods may take much longer than conventional serological typing, limiting their utility in urgent situations. To narrow this gap, we devised a rapid method using direct polymerase chain reaction (PCR) amplification while avoiding the DNA extraction step. DNA was amplified by PCR directly from plasma or serum of blood donors followed by a melting curve analysis in a capillary rapid-cycle PCR assay. We evaluated the single nucleotide polymorphisms underlying the clinically relevant Fya, Fyb, Jka and Jkb antigens, with our analysis being completed within 40 min of receiving a plasma or serum sample. The positive predictive value was 100% and the negative predictive value at least 84%. Direct PCR with melting point analysis allowed faster red cell genotyping to predict blood group antigens than any previous molecular method. Our assay may be used as a screening tool with subsequent confirmatory testing, within the limitations of the false-negative rate. With fast turnaround times, the rapid-cycle PCR assay may eventually be developed and applied to red cell genotyping in the hospital setting. PMID:27991657

  8. Group velocity measurement from the propagation of the ionization front in a surface-wave-produced plasma

    International Nuclear Information System (INIS)

    Cotrino, J.; Gamero, A.; Sola, A.; Lao, C.

    1989-01-01

    During the first instant, previous to steady-state in a surface-wave-produced plasma, an ionization front advance front the launcher to the plasma column end. The velocity of the ionization front is much slower than the group velocity of the surface wave, this give a reflection of the incident signal on the moving ionization front. In this paper, the authors use this effect to calculate the surface wave group velocity

  9. Phosphorylation of the adaptor protein SH2B1β regulates its ability to enhance growth hormone-dependent macrophage motility

    OpenAIRE

    Su, Hsiao-Wen; Lanning, Nathan J.; Morris, David L.; Argetsinger, Lawrence S.; Lumeng, Carey N.; Carter-Su, Christin

    2013-01-01

    Previous studies have shown that growth hormone (GH) recruits the adapter protein SH2B1β to the GH-activated, GH receptor-associated tyrosine kinase JAK2, implicating SH2B1β in GH-dependent actin cytoskeleton remodeling, and suggesting that phosphorylation at serines 161 and 165 in SH2B1β releases SH2B1β from the plasma membrane. Here, we examined the role of SH2B1β in GH regulation of macrophage migration. We show that GH stimulates migration of cultured RAW264.7 macrophages, and primary cul...

  10. Derivations and comparisons of three groups of self-organization theories for magnetohydrodynamic plasmas

    International Nuclear Information System (INIS)

    Kondoh, Yoshiomi; Sato, Tetsuya.

    1994-01-01

    A theoretical investigation on self-organization theories of dissipative MHD plasmas is presented to derive three groups of theories that lead to the same relaxed state of ∇xB=λB, in order to find more essential physical picture embedded in self-organization phenomena due to nonlinear and dissipative processes. Comparisons among all of the theories treated and derived here suggest that a theory standing upon spectrum spreadings and selective dissipations of eigenmodes for the dissipative operator-∇xηj and leading to self-organized relaxed states of ∇xηj=αB/2 with the minimum dissipation rate is the most agreeable to various results obtained by experiments and by 3-D MHD simulations reported so far. (author)

  11. Dynamical renormalization group approach to transport in ultrarelativistic plasmas: The electrical conductivity in high temperature QED

    International Nuclear Information System (INIS)

    Boyanovsky, Daniel; Vega, Hector J. de; Wang Shangyung

    2003-01-01

    The dc electrical conductivity of an ultrarelativistic QED plasma is studied in real time by implementing the dynamical renormalization group. The conductivity is obtained from the real-time dependence of a dissipative kernel closely related to the retarded photon polarization. Pinch singularities in the imaginary part of the polarization are manifest as secular terms that grow in time in the perturbative expansion of this kernel. The leading secular terms are studied explicitly and it is shown that they are insensitive to the anomalous damping of hard fermions as a result of a cancellation between self-energy and vertex corrections. The resummation of the secular terms via the dynamical renormalization group leads directly to a renormalization group equation in real time, which is the Boltzmann equation for the (gauge invariant) fermion distribution function. A direct correspondence between the perturbative expansion and the linearized Boltzmann equation is established, allowing a direct identification of the self-energy and vertex contributions to the collision term. We obtain a Fokker-Planck equation in momentum space that describes the dynamics of the departure from equilibrium to leading logarithmic order in the coupling. This equation determines that the transport time scale is given by t tr =24 π/e 4 T ln(1/e). The solution of the Fokker-Planck equation approaches asymptotically the steady-state solution as ∼e -t/(4.038...t tr ) . The steady-state solution leads to the conductivity σ=15.698 T/e 2 ln(1/e) to leading logarithmic order. We discuss the contributions beyond leading logarithms as well as beyond the Boltzmann equation. The dynamical renormalization group provides a link between linear response in quantum field theory and kinetic theory

  12. Multi-Group Reductions of LTE Air Plasma Radiative Transfer in Cylindrical Geometries

    Science.gov (United States)

    Scoggins, James; Magin, Thierry Edouard Bertran; Wray, Alan; Mansour, Nagi N.

    2013-01-01

    Air plasma radiation in Local Thermodynamic Equilibrium (LTE) within cylindrical geometries is studied with an application towards modeling the radiative transfer inside arc-constrictors, a central component of constricted-arc arc jets. A detailed database of spectral absorption coefficients for LTE air is formulated using the NEQAIR code developed at NASA Ames Research Center. The database stores calculated absorption coefficients for 1,051,755 wavelengths between 0.04 µm and 200 µm over a wide temperature (500K to 15 000K) and pressure (0.1 atm to 10.0 atm) range. The multi-group method for spectral reduction is studied by generating a range of reductions including pure binning and banding reductions from the detailed absorption coefficient database. The accuracy of each reduction is compared to line-by-line calculations for cylindrical temperature profiles resembling typical profiles found in arc-constrictors. It is found that a reduction of only 1000 groups is sufficient to accurately model the LTE air radiation over a large temperature and pressure range. In addition to the reduction comparison, the cylindrical-slab formulation is compared with the finite-volume method for the numerical integration of the radiative flux inside cylinders with varying length. It is determined that cylindrical-slabs can be used to accurately model most arc-constrictors due to their high length to radius ratios.

  13. Photometric observations of nine Shakhbazian compact groups

    International Nuclear Information System (INIS)

    Tovmassian, H.M.; Tiersch, H.; Tovmassian, G.H.; Neizvestny, S.

    2010-01-01

    By observations with the 1.5m telescope at San Pedro Martir (OAN, UNAM, Mexico) the BVR magnitudes are determined for 66 member galaxies in Shakhbazian Compact Galaxy Groups ShCG 40, ShCG 176, ShCG 270, ShCG 278, ShCG 310 and ShCG 342. Three other groups were observed in two or only in one band. Seven galaxies in ShCG 298 were observed in B and R, six galaxies in ShCG 95 were observed in V and 7 galaxies in ShCG 345 were observed in V and R. The distribution of brightness of observed galaxies is determined. Signs of interaction between galaxies are detected in some groups

  14. The Abl SH2-kinase linker naturally adopts a conformation competent for SH3 domain binding.

    Science.gov (United States)

    Chen, Shugui; Brier, Sébastien; Smithgall, Thomas E; Engen, John R

    2007-04-01

    The core of the Abelson tyrosine kinase (c-Abl) is structurally similar to Src-family kinases where SH3 and SH2 domains pack against the backside of the kinase domain in the down-regulated conformation. Both kinase families depend upon intramolecular association of SH3 with the linker joining the SH2 and kinase domains for suppression of kinase activity. Hydrogen deuterium exchange (HX) and mass spectrometry (MS) were used to probe intramolecular interaction of the c-Abl SH3 domain with the linker in recombinant constructs lacking the kinase domain. Under physiological conditions, the c-Abl SH3 domain undergoes partial unfolding, which is stabilized by ligand binding, providing a unique assay for SH3:linker interaction in solution. Using this approach, we observed dynamic association of the SH3 domain with the linker in the absence of the kinase domain. Truncation of the linker before W254 completely prevented cis-interaction with SH3, while constructs containing amino acids past this point showed SH3:linker interactions. The observation that the Abl linker sequence exhibits SH3-binding activity in the absence of the kinase domain is unique to Abl and was not observed with Src-family kinases. These results suggest that SH3:linker interactions may have a more prominent role in Abl regulation than in Src kinases, where the down-regulated conformation is further stabilized by a second intramolecular interaction between the C-terminal tail and the SH2 domain.

  15. Comparison of SH3 and SH2 domain dynamics when expressed alone or in an SH(3+2) construct: the role of protein dynamics in functional regulation.

    Science.gov (United States)

    Engen, J R; Smithgall, T E; Gmeiner, W H; Smith, D L

    1999-04-02

    Protein dynamics play an important role in protein function and regulation of enzymatic activity. To determine how additional interactions with surrounding structure affects local protein dynamics, we have used hydrogen exchange and mass spectrometry to investigate the SH2 and SH3 domains of the protein tyrosine kinase Hck. Exchange rates of isolated Hck SH3 and SH2 domains were compared with rates for the same domains when part of a larger SH(3+2) construct. Increased deuterium incorporation was observed for the SH3 domain in the joint construct, particularly near the SH2 interface and the short sequence that connects SH3 to SH2, implying greater flexibility of SH3 when it is part of SH(3+2). Slow cooperative unfolding of the SH3 domain occurred at the same rate in isolated SH3 as in the SH(3+2) construct, suggesting a functional significance for this unfolding. The SH2 domain displayed relatively smaller changes in flexibility when part of the SH(3+2) construct. These results suggest that the domains influence each other. Further, our results imply a link between functional regulation and structural dynamics of SH3 and SH2 domains. Copyright 1999 Academic Press.

  16. Application of the biosurfactants produced by Bacillus spp. (SH 20 ...

    African Journals Online (AJOL)

    Application of the biosurfactants produced by Bacillus spp. (SH 20 and SH 26) and P. aeruginosa SH 29 isolated from the rhizosphere soil of an Egyptian salt marsh plant for the cleaning of oil - contaminataed vessels and enhancing the biodegradat.

  17. Palaeodemography of the Atapuerca-SH Middle Pleistocene hominid sample.

    Science.gov (United States)

    Bermúdez de Castro, J M; Nicolás, M E

    1997-01-01

    We report here on the palaeodemographic analysis of the hominid sample recovered to date from the Sima de los Huesos (SH) Middle Pleistocene cave site in the Sierra de Atapuerca (Burgos, Spain). The analysis of the mandibular, maxillary, and dental remains has made it possible to estimate that a minimum of 32 individuals, who probably belonged to the same biological population, are represented in the current SH human hypodigm. The remains of nine-individuals are assigned to males, and nine to females, suggesting that a 1:1 sex ratio characterizes this hominid sample. The survivorship curve shows a low representation of infants and children, a high mortality among the adolescents and prime-age adults, and a low older adult mortality. Longevity was probably no greater than 40 years. This mortality pattern (adolescents and adults); which in some aspects resembles that observed in Neandertals, is quite different from those reported for recent foraging human groups. The adult age-at-death distribution of the SH hominid sample appears to be neither the consequence of underaging the older adults, nor of differential preservation or of the recognition of skeletal remains. Thus if we accept that they had a life history pattern similar to that of modern humans there would appear to be a clear contradiction between the demographic distribution and the demographic viability of the population represented by the SH hominid fossils. The possible representational bias of the SH hominid sample, as well as some aspects of the reproductive biology of the Pleistocene populations are also discussed.

  18. SH2 Domains Serve as Lipid-Binding Modules for pTyr-Signaling Proteins.

    Science.gov (United States)

    Park, Mi-Jeong; Sheng, Ren; Silkov, Antonina; Jung, Da-Jung; Wang, Zhi-Gang; Xin, Yao; Kim, Hyunjin; Thiagarajan-Rosenkranz, Pallavi; Song, Seohyeon; Yoon, Youngdae; Nam, Wonhee; Kim, Ilshin; Kim, Eui; Lee, Dong-Gyu; Chen, Yong; Singaram, Indira; Wang, Li; Jang, Myoung Ho; Hwang, Cheol-Sang; Honig, Barry; Ryu, Sungho; Lorieau, Justin; Kim, You-Me; Cho, Wonhwa

    2016-04-07

    The Src-homology 2 (SH2) domain is a protein interaction domain that directs myriad phosphotyrosine (pY)-signaling pathways. Genome-wide screening of human SH2 domains reveals that ∼90% of SH2 domains bind plasma membrane lipids and many have high phosphoinositide specificity. They bind lipids using surface cationic patches separate from pY-binding pockets, thus binding lipids and the pY motif independently. The patches form grooves for specific lipid headgroup recognition or flat surfaces for non-specific membrane binding and both types of interaction are important for cellular function and regulation of SH2 domain-containing proteins. Cellular studies with ZAP70 showed that multiple lipids bind its C-terminal SH2 domain in a spatiotemporally specific manner and thereby exert exquisite spatiotemporal control over its protein binding and signaling activities in T cells. Collectively, this study reveals how lipids control SH2 domain-mediated cellular protein-protein interaction networks and suggest a new strategy for therapeutic modulation of pY-signaling pathways. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Overview on the Surface Functionalization Mechanism and Determination of Surface Functional Groups of Plasma Treated Carbon Nanotubes.

    Science.gov (United States)

    Saka, Cafer

    2018-01-02

    The use of carbon materials for many applications is due to the unique diversity of structures and properties ranging from chemical bonds between the carbon atoms of the materials to nanostructures, crystallite alignment, and microstructures. Carbon nanotubes and other nanoscale carbonaceous materials draw much attention due to their physical and chemical properties, such as high strength, high resistance to corrosion, electrical and thermal conductivity, stability and a qualified adsorbent. Carbon-based nanomaterials, which have a relatively large specific area and layered structure, can be used as an adsorbent for efficient removal of organic and inorganic contaminants. However, one of the biggest obstacles to the development of carbon-based nanomaterials adsorbents is insolubility and the lack of functional groups on the surface. There are several approaches to introduce functional groups on carbon nanotubes. One of these approaches, plasma applications, now has an important place in the creation of surface functional groups as a flexible, fast, and environmentally friendly method. This review focuses on recent information concerning the surface functionalization and modification of plasma treated carbon nanotube. This review considers the surface properties, advantages, and disadvantages of plasma-applied carbon nanotubes. It also examines the reaction mechanisms involved in the functional groups on the surface.

  20. Acute effects of nitroglycerin depend on both plasma and intracellular sulfhydryl compound levels in vivo. Effect of agents with different sulfhydryl-modulating properties

    DEFF Research Database (Denmark)

    Boesgaard, S; Poulsen, H E; Aldershvile, J

    1993-01-01

    in SH group concentrations (cysteine and glutathione [GSH]) affect the responsiveness to NTG in vivo. METHODS AND RESULTS: GSH and cysteine levels in plasma, vena cava, and aorta were measured after administration of N-acetylserine (placebo, n = 6), N-acetylcysteine (NAC, extracellular and intracellular......BACKGROUND: Changes in sulfhydryl (SH) compound availability may alter the hemodynamic effect of nitroglycerin (NTG). Data on the relation between NTG effect and thiol levels are, however, limited to in vitro experiments. The present study investigates how intracellular and extracellular changes...... SH donor, n = 6), oxothiazolidine (OXO, intracellular SH donor, n = 6), buthionine sulfoximine (BSO, intracellular GSH-depleting agent, n = 6), BSO+NAC (n = 6), and BSO+OXO (n = 6) in chronically catheterized conscious rats. In addition, the effect of 2.5 mg NTG/kg i.v. on mean arterial pressure (MAP...

  1. Enzymatic-fluorometric analyses for glutamine, glutamate and free amino groups in protein-free plasma and milk

    DEFF Research Database (Denmark)

    Larsen, Torben; Fernández, Carlos J.

    2017-01-01

    This Technical Research Communication describes new analytical methods for free, unbound glutamic acid and glutamine in protein-free blood plasma and milk and introduces the use of quantitation of free amino groups in the same matrices for descriptive and analytical purposes. The present enzymatic......-fluorometric methods are easily performed within one working day, allowing for ‘high throughput’ assays of animal trials. These assays could support and enable further studies in lactation physiology with the objective of improved metabolic health....

  2. Chemical shift assignments of the partially deuterated Fyn SH2-SH3 domain.

    Science.gov (United States)

    Kieken, Fabien; Loth, Karine; van Nuland, Nico; Tompa, Peter; Lenaerts, Tom

    2018-04-01

    Src Homology 2 and 3 (SH2 and SH3) are two key protein interaction modules involved in regulating the activity of many proteins such as tyrosine kinases and phosphatases by respective recognition of phosphotyrosine and proline-rich regions. In the Src family kinases, the inactive state of the protein is the direct result of the interaction of the SH2 and the SH3 domain with intra-molecular regions, leading to a closed structure incompetent with substrate modification. Here, we report the 1 H, 15 N and 13 C backbone- and side-chain chemical shift assignments of the partially deuterated Fyn SH3-SH2 domain and structural differences between tandem and single domains. The BMRB accession number is 27165.

  3. Spectral theory of differential operators M. Sh. Birman 80th anniversary collection

    CERN Document Server

    Suslina, T

    2009-01-01

    This volume is dedicated to Professor M. Sh. Birman in honor of his eightieth birthday. It contains original articles in spectral and scattering theory of differential operators, in particular, Schrodinger operators, and in homogenization theory. All articles are written by members of M. Sh. Birman's research group who are affiliated with different universities all over the world. A specific feature of the majority of the papers is a combination of traditional methods with new modern ideas.

  4. Model SH intelligent instrument for thickness measuring

    International Nuclear Information System (INIS)

    Liu Juntao; Jia Weizhuang; Zhao Yunlong

    1995-01-01

    The authors introduce Model SH Intelligent Instrument for thickness measuring by using principle of beta back-scattering and its application range, features, principle of operation, system design, calibration and specifications

  5. Diversity in peptide recognition by the SH2 domain of SH2B1.

    Science.gov (United States)

    McKercher, Marissa A; Guan, Xiaoyang; Tan, Zhongping; Wuttke, Deborah S

    2018-02-01

    SH2B1 is a multidomain protein that serves as a key adaptor to regulate numerous cellular events, such as insulin, leptin, and growth hormone signaling pathways. Many of these protein-protein interactions are mediated by the SH2 domain of SH2B1, which recognizes ligands containing a phosphorylated tyrosine (pY), including peptides derived from janus kinase 2, insulin receptor, and insulin receptor substrate-1 and -2. Specificity for the SH2 domain of SH2B1 is conferred in these ligands either by a hydrophobic or an acidic side chain at the +3 position C-terminal to the pY. This specificity for chemically disparate species suggests that SH2B1 relies on distinct thermodynamic or structural mechanisms to bind to peptides. Using binding and structural strategies, we have identified unique thermodynamic signatures for each peptide binding mode, and several SH2B1 residues, including K575 and R578, that play distinct roles in peptide binding. The high-resolution structure of the SH2 domain of SH2B1 further reveals conformationally plastic protein loops that may contribute to the ability of the protein to recognize dissimilar ligands. Together, numerous hydrophobic and electrostatic interactions, in addition to backbone conformational flexibility, permit the recognition of diverse peptides by SH2B1. An understanding of this expanded peptide recognition will allow for the identification of novel physiologically relevant SH2B1/peptide interactions, which can contribute to the design of obesity and diabetes pharmaceuticals to target the ligand-binding interface of SH2B1 with high specificity. © 2017 Wiley Periodicals, Inc.

  6. Optical and millimeter wavelength study of the complex Sh2-147/Sh2-153

    International Nuclear Information System (INIS)

    Heydari-Malayeri, M.; Testor, G.; Kahane, C.; Lucas, R.

    1982-01-01

    Sh2-147/Sh2-153 is a vast HII region-molecular cloud complex of dimension 1 0 .5 located in the Perseus arm at l approximately 109 0 . This cloud embodies the HII regions Sh2-147, 148, 149, 152 and 153. In this direction were detected several H 2 O and OH masers, a number of infrared sources, and a supernova remnant. The authors present the 13 CO map and also optical results on two of the HII regions: Sh2-152 and 148. (Auth.)

  7. H-alpha observations of Sh2-190, Sh2-222, Sh2-229, Sh2-236 HII regions

    Science.gov (United States)

    Sahan, Muhittin

    2018-02-01

    Hα spectral line (6563Å) profiles of four northern HII regions in the our galaxy (Sh2-190, Sh2-222, Sh2-229, Sh2-236) have been obtained using DEFPOS spectrometer, located at coude focus of 150 cm RTT150 telescope at TUBITAK National Observatory (TUG, Antalya, Turkey). Observations were carried out at nights of 2015 December 24-27 with long exposure times ranging from 900s to 3600s. The LSR velocities and the linewidths (Full Width Half Maximum: FWHM) of the Hα emission lines were found to be in the range of -45.46 kms-1 to +3.57 kms-1 and 38.50 kms-1 to 44.10 kms-1, respectively. The Sh2-229 HII region is the faintest one (211.16 R), while the Sh2-236 HII region (IC410) is brightest source (535.75 R). The LSR velocity and the line width (FWHM) results of the DEFPOS/RTT150 system were compared with the data by several authors given in literature and results of DEFPOS data were found to be in good agreement with data given in literature.

  8. The SH2 domain interaction landscape.

    Science.gov (United States)

    Tinti, Michele; Kiemer, Lars; Costa, Stefano; Miller, Martin L; Sacco, Francesca; Olsen, Jesper V; Carducci, Martina; Paoluzi, Serena; Langone, Francesca; Workman, Christopher T; Blom, Nikolaj; Machida, Kazuya; Thompson, Christopher M; Schutkowski, Mike; Brunak, Søren; Mann, Matthias; Mayer, Bruce J; Castagnoli, Luisa; Cesareni, Gianni

    2013-04-25

    Members of the SH2 domain family modulate signal transduction by binding to short peptides containing phosphorylated tyrosines. Each domain displays a distinct preference for the sequence context of the phosphorylated residue. We have developed a high-density peptide chip technology that allows for probing of the affinity of most SH2 domains for a large fraction of the entire complement of tyrosine phosphopeptides in the human proteome. Using this technique, we have experimentally identified thousands of putative SH2-peptide interactions for more than 70 different SH2 domains. By integrating this rich data set with orthogonal context-specific information, we have assembled an SH2-mediated probabilistic interaction network, which we make available as a community resource in the PepspotDB database. A predicted dynamic interaction between the SH2 domains of the tyrosine phosphatase SHP2 and the phosphorylated tyrosine in the extracellular signal-regulated kinase activation loop was validated by experiments in living cells. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  9. The SH2 Domain Interaction Landscape

    Directory of Open Access Journals (Sweden)

    Michele Tinti

    2013-04-01

    Full Text Available Members of the SH2 domain family modulate signal transduction by binding to short peptides containing phosphorylated tyrosines. Each domain displays a distinct preference for the sequence context of the phosphorylated residue. We have developed a high-density peptide chip technology that allows for probing of the affinity of most SH2 domains for a large fraction of the entire complement of tyrosine phosphopeptides in the human proteome. Using this technique, we have experimentally identified thousands of putative SH2-peptide interactions for more than 70 different SH2 domains. By integrating this rich data set with orthogonal context-specific information, we have assembled an SH2-mediated probabilistic interaction network, which we make available as a community resource in the PepspotDB database. A predicted dynamic interaction between the SH2 domains of the tyrosine phosphatase SHP2 and the phosphorylated tyrosine in the extracellular signal-regulated kinase activation loop was validated by experiments in living cells.

  10. Plasma homovanillic acid and treatment response in a large group of schizophrenic patients.

    Science.gov (United States)

    Chang, W H; Hwu, H G; Chen, T Y; Lin, S K; Lung, F W; Chen, H; Lin, W L; Hu, W H; Lin, H N; Chien, C P

    1993-10-01

    Plasma levels of homovanillic acid (pHVA), a metabolite of dopamine, were measured in ninety-five Chinese schizophrenic patients free of neuroleptics for at least four weeks. These patients were treated with classical antipsychotics for six weeks. Pretreatment pHVA was positively correlated with the subsequent clinical response (r = 0.408, p or = 50%, n = 47) had higher pretreatment pHVA levels than poor responders (BPRS improvement pHVA level was associated with a more consistent clinical response to the subsequent treatment. Using a pHVA level of 12 ng/ml as a demarcation point, 72% of patients (34 of 47) who had pHVA > or = 12 responded whereas 65% (31 of 48) who had pHVA levels may predict a better clinical response to antipsychotics. Based upon the pHVA findings, two hypothetical subtypes of schizophrenia are proposed.

  11. Coupled motions in the SH2 and kinase domains of Csk control Src phosphorylation.

    Science.gov (United States)

    Wong, Lilly; Lieser, Scot A; Miyashita, Osamu; Miller, Meghan; Tasken, Kjetil; Onuchic, Josè N; Adams, Joseph A; Woods, Virgil L; Jennings, Patricia A

    2005-08-05

    The C-terminal Src kinase (Csk) phosphorylates and down-regulates Src family tyrosine kinases. The Csk-binding protein (Cbp) localizes Csk close to its substrates at the plasma membrane, and increases the specific activity of the kinase. To investigate this long-range catalytic effect, the phosphorylation of Src and the conformation of Csk were investigated in the presence of a high-affinity phosphopeptide derived from Cbp. This peptide binds tightly to the SH2 domain and enhances Src recognition (lowers K(m)) by increasing the apparent phosphoryl transfer rate in the Csk active site, a phenomenon detected in rapid quench flow experiments. Previous studies demonstrated that the regulation of Csk activity is linked to conformational changes in the enzyme that can be probed with hydrogen-deuterium exchange methods. We show that the Cbp peptide impacts deuterium incorporation into its binding partner (the SH2 domain), and into the SH2-kinase linker and several sequences in the kinase domain, including the glycine-rich loop in the active site. These findings, along with computational data from normal mode analyses, suggest that the SH2 domain moves in a cantilever fashion with respect to the small lobe of the kinase domain, ordering the active site for catalysis. The binding of a small Cbp-derived peptide to the SH2 domain of Csk modifies these motions, enhancing Src recognition.

  12. Report on the joint meeting of the Division of Development and Technology Plasma/Wall Interaction and High Heat Flux Materials and Components Task Groups

    International Nuclear Information System (INIS)

    Wilson, K.L.

    1985-10-01

    This report of the Joint Meeting of the Division of Development and Technology Plasma/Wall Interaction and High Heat Flux Materials and Components Task Groups contains contributing papers in the following areas: Plasma/Materials Interaction Program and Technical Assessment, High Heat Flux Materials and Components Program and Technical Assessment, Pumped Limiters, Ignition Devices, Program Planning Activities, Compact High Power Density Reactor Requirements, Steady State Tokamaks, and Tritium Plasma Experiments. All these areas involve the consideration of High Heat Flux on Materials and the Interaction of the Plasma with the First Wall. Many of the Test Facilities are described as well

  13. Identification of SH2B2β as an Inhibitor for SH2B1- and SH2B2α-Promoted Janus Kinase-2 Activation and Insulin Signaling

    OpenAIRE

    Li, Minghua; Li, Zhiqin; Morris, David L.; Rui, Liangyou

    2007-01-01

    The SH2B family has three members (SH2B1, SH2B2, and SH2B3) that contain conserved dimerization (DD), pleckstrin homology, and SH2 domains. The DD domain mediates the formation of homo- and heterodimers between members of the SH2B family. The SH2 domain of SH2B1 (previously named SH2-B) or SH2B2 (previously named APS) binds to phosphorylated tyrosines in a variety of tyrosine kinases, including Janus kinase-2 (JAK2) and the insulin receptor, thereby promoting the activation of JAK2 or the ins...

  14. Invited and contributed papers presented by the theory group at the joint Varenna-Lausanne international workshop 'theory of fusion plasmas'

    International Nuclear Information System (INIS)

    1996-09-01

    In this report eight invited and contributed papers of the theory group are included which were presented at joint Varenna-Lausanne international workshop on 'theory of fusion plasmas'. (author) figs., tabs., refs

  15. Molecular typing for blood group antigens within 40 min by direct polymerase chain reaction from plasma or serum.

    Science.gov (United States)

    Wagner, Franz F; Flegel, Willy A; Bittner, Rita; Döscher, Andrea

    2017-03-01

    Determining blood group antigens by serological methods may be unreliable in certain situations, such as in patients after chronic or massive transfusion. Red cell genotyping offers a complementary approach, but current methods may take much longer than conventional serological typing, limiting their utility in urgent situations. To narrow this gap, we devised a rapid method using direct polymerase chain reaction (PCR) amplification while avoiding the DNA extraction step. DNA was amplified by PCR directly from plasma or serum of blood donors followed by a melting curve analysis in a capillary rapid-cycle PCR assay. We evaluated the single nucleotide polymorphisms underlying the clinically relevant Fy a , Fy b , Jk a and Jk b antigens, with our analysis being completed within 40 min of receiving a plasma or serum sample. The positive predictive value was 100% and the negative predictive value at least 84%. Direct PCR with melting point analysis allowed faster red cell genotyping to predict blood group antigens than any previous molecular method. Our assay may be used as a screening tool with subsequent confirmatory testing, within the limitations of the false-negative rate. With fast turnaround times, the rapid-cycle PCR assay may eventually be developed and applied to red cell genotyping in the hospital setting. © 2016 John Wiley & Sons Ltd.

  16. Effect of the SH3-SH2 domain linker sequence on the structure of Hck kinase.

    Science.gov (United States)

    Meiselbach, Heike; Sticht, Heinrich

    2011-08-01

    The coordination of activity in biological systems requires the existence of different signal transduction pathways that interact with one another and must be precisely regulated. The Src-family tyrosine kinases, which are found in many signaling pathways, differ in their physiological function despite their high overall structural similarity. In this context, the differences in the SH3-SH2 domain linkers might play a role for differential regulation, but the structural consequences of linker sequence remain poorly understood. We have therefore performed comparative molecular dynamics simulations of wildtype Hck and of a mutant Hck in which the SH3-SH2 domain linker is replaced by the corresponding sequence from the homologous kinase Lck. These simulations reveal that linker replacement not only affects the orientation of the SH3 domain itself, but also leads to an alternative conformation of the activation segment in the Hck kinase domain. The sequence of the SH3-SH2 domain linker thus exerts a remote effect on the active site geometry and might therefore play a role in modulating the structure of the inactive kinase or in fine-tuning the activation process itself.

  17. Therapeutic effects of lentivirus-mediated shRNA targeting of cyclin D1 in human gastric cancer

    International Nuclear Information System (INIS)

    Seo, Jin-Hee; Jeong, Eui-Suk; Choi, Yang-Kyu

    2014-01-01

    Gastric cancer is the second most common cause of cancer-related death in males and the fourth in females. Traditional treatment has poor prognosis because of recurrence and systemic side effects. Therefore, the development of new therapeutic strategies is an important issue. Lentivirus-mediated shRNA stably inhibits target genes and can efficiently transduce most cells. Since overexpressed cyclin D1 is closely related to human gastric cancer progression, inhibition of cyclin D1 using specific targeting could be an effective treatment method of human gastric cancer. The therapeutic effect of lentivirus-mediated shRNA targeting of cyclin D1 (ShCCND1) was analyzed both in vitro and in vivo experiments. In vitro, NCI-N87 cells with downregulation of cyclin D1 by ShCCND1 showed significant inhibition of cell proliferation, cell motility, and clonogenicity. Downregulation of cyclin D1 in NCI-N87 cells also resulted in significantly increased G1 arrest and apoptosis. In vivo, stable NCI-N87 cells expressing ShCCND1 were engrafted into nude mice. Then, the cancer-growth inhibition effect of lentivirus was confirmed. To assess lentivirus including ShCCND1 as a therapeutic agent, intratumoral injection was conducted. Tumor growth of the lentivirus-treated group was significantly inhibited compared to growth of the control group. These results are in accordance with the in vitro data and lend support to the mitotic figure count and apoptosis analysis of the tumor mass. The lentivirus-mediated ShCCND1 was constructed, which effectively inhibited growth of NCI-N87-derived cancer both in vitro and in vivo. The efficiency of shRNA knockdown and variation in the degree of inhibition is mediated by different shRNA sequences and cancer cell lines. These experimental results suggest the possibility of developing new gastric cancer therapies using lentivirus-mediated shRNA

  18. Buffalo plasma fibronectin: a physico-chemical study.

    Science.gov (United States)

    Ahmed, N; Chandra, R; Raj, H G

    2001-12-01

    Plasma fibronectin (FN) of buffalo (Babulis babulis) was purified to apparent homogeneity, using gelatin-Sepharose and heparin-Sepharose affinity columns. It was found to have two subunits of molecular mass 246 kDa and 228 kDa, on SDS-gel. Its immunological cross-reactivity with anti-human plasma FN was confirmed by Western blotting. The amino acid composition was found to be similar to that of human and bovine plasma FNs. Buffalo plasma FN contained 2.23% neutral hexoses and 1.18% sialic acids. No titrable sulfhydryl group could be detected in the absence of denaturant. Reaction with DTNB indicated 3.4 sulfhydryl groups in the molecule, whereas BDC-OH titration gave a value of 3.8 -SH groups in buffalo plasma FN. Stoke's radius, intrinsic viscosity, diffusion coefficient and frictional ratio indicated that buffalo plasma FN did not have a compact globular conformation at physiological pH and ionic strength. Molecular dimensions (average length, 120 nm; molar mass to length ratio, 3950 nm(-1) and mean diameter, 2.4 nm) as revealed by rotary shadowing electron microscopy further supported the extended conformation of buffalo plasma FN. These results show that buffalo plasma FN has similar properties as that of human plasma FN.

  19. Biochemical and genetic analysis of the Drk SH2/SH3 adaptor protein of Drosophila.

    OpenAIRE

    Raabe, T; Olivier, J P; Dickson, B J; Liu, X; Gish, G D; Pawson, T; Hafen, E

    1995-01-01

    The Drk SH3-SH2-SH3 adaptor protein has been genetically identified in a screen for rate-limiting components acting downstream of the Sevenless (Sev) receptor tyrosine kinase in the developing eye of Drosophila. It provides a link between the activated Sev receptor and Sos, a guanine nucleotide release factor that activates Ras1. We have used a combined biochemical and genetic approach to study the interactions between Sev, Drk and Sos. We show that Tyr2546 in the cytoplasmic tail of Sev is r...

  20. SH2 domains: modulators of nonreceptor tyrosine kinase activity.

    Science.gov (United States)

    Filippakopoulos, Panagis; Müller, Susanne; Knapp, Stefan

    2009-12-01

    The Src homology 2 (SH2) domain is a sequence-specific phosphotyrosine-binding module present in many signaling molecules. In cytoplasmic tyrosine kinases, the SH2 domain is located N-terminally to the catalytic kinase domain (SH1) where it mediates cellular localization, substrate recruitment, and regulation of kinase activity. Initially, structural studies established a role of the SH2 domain stabilizing the inactive state of Src family members. However, biochemical characterization showed that the presence of the SH2 domain is frequently required for catalytic activity, suggesting a crucial function stabilizing the active state of many nonreceptor tyrosine kinases. Recently, the structure of the SH2-kinase domain of Fes revealed that the SH2 domain stabilizes the active kinase conformation by direct interactions with the regulatory helix alphaC. Stabilizing interactions between the SH2 and the kinase domains have also been observed in the structures of active Csk and Abl. Interestingly, mutations in the SH2 domain found in human disease can be explained by SH2 domain destabilization or incorrect positioning of the SH2. Here we summarize our understanding of mechanisms that lead to tyrosine kinase activation by direct interactions mediated by the SH2 domain and discuss how mutations in the SH2 domain trigger kinase inactivation.

  1. Introduction: History of SH2 Domains and Their Applications.

    Science.gov (United States)

    Liu, Bernard A; Machida, Kazuya

    2017-01-01

    The Src Homology 2 (SH2) domain is the prototypical protein interaction module that lies at the heart of phosphotyrosine signaling. Since its serendipitous discovery, there has been a tremendous advancement in technologies and an array of techniques available for studying SH2 domains and phosphotyrosine signaling. In this chapter, we provide a glimpse of the history of SH2 domains and describe many of the tools and techniques that have been developed along the way and discuss future directions for SH2 domain studies. We highlight the gist of each chapter in this volume in the context of: the structural biology and phosphotyrosine binding; characterizing SH2 specificity and generating prediction models; systems biology and proteomics; SH2 domains in signal transduction; and SH2 domains in disease, diagnostics, and therapeutics. Many of the individual chapters provide an in-depth approach that will allow scientists to interrogate the function and role of SH2 domains.

  2. Conventional (CH) vs. stapled hemorrhoidectomy (SH) in surgical treatment of hemorrhoids. Ten years experience.

    Science.gov (United States)

    Manfredelli, Simone; Montalto, Gioacchino; Leonetti, Giovanni; Covotta, Marco; Amatucci, Chiara; Covotta, Alfredo; Forte, Angelo

    2012-01-01

    Interest about hemorrhoids is related to its high incidence and elevated social costs that derive from its treatment. Several comparative studies are reported in Literature to define a standard for ideal treatment of hemorrhoidal disease. Radical surgery is the only therapeutic option in case of III and IV stage haemorrhoids. Hemorrhoids surgical techniques are classified as Open, Closed and Stapled ones. We report our decennial experience on surgical treatment focusing on early, middle and late complications, indications and contraindications, satisfaction level of each surgical procedure for hemorrhoids. Four hundred forty-eight patients have been hospitalized in our department fom 1st January to 31st December 2008. Of these 241 underwent surgery with traditional open or closed technique and 207 with the SH technique according to Longo. This retrospective study includes only patients with symptomatic hemorrhoids at III or IV stage. There were no differences between CH and SH about both pre and post surgery hospitalization and intraoperative length. Pain is the most frequently observed early complication with a statistically significant difference in favour of SH. We obtain good results in CH group using anoderma sparing and perianal anaesthetic infiltration at the end of the surgery. In all cases, pain relief was obtained only with standard analgesic drugs (NSAIDs). We also observed that pain level influences the outcome after surgical treatment. No chronic pain cases were observed in both groups. Bleeding is another relevant early complication in particular after SH: we reported 2 cases of immediate surgical reintenvention and 2 cases treated with blood transfusion. Only in SH group we report also 5 cases of thrombosis of external haemorrhoids and 7 perianal hematoma both solved with medical therapy There were no statistical significant differences between two groups about fever, incontinence to flatus, urinary retention, fecal incontinence, substenosis and anal

  3. SH2 domains: modulators of nonreceptor tyrosine kinase activity

    OpenAIRE

    Filippakopoulos, Panagis; Müller, Susanne; Knapp, Stefan

    2009-01-01

    The Src homology 2 (SH2) domain is a sequence-specific phosphotyrosine-binding module present in many signaling molecules. In cytoplasmic tyrosine kinases, the SH2 domain is located N-terminally to the catalytic kinase domain (SH1) where it mediates cellular localization, substrate recruitment, and regulation of kinase activity. Initially, structural studies established a role of the SH2 domain stabilizing the inactive state of Src family members. However, biochemical characterization showed ...

  4. Biochemical and genetic analysis of the Drk SH2/SH3 adaptor protein of Drosophila.

    Science.gov (United States)

    Raabe, T; Olivier, J P; Dickson, B; Liu, X; Gish, G D; Pawson, T; Hafen, E

    1995-06-01

    The Drk SH3-SH2-SH3 adaptor protein has been genetically identified in a screen for rate-limiting components acting downstream of the Sevenless (Sev) receptor tyrosine kinase in the developing eye of Drosophila. It provides a link between the activated Sev receptor and Sos, a guanine nucleotide release factor that activates Ras1. We have used a combined biochemical and genetic approach to study the interactions between Sev, Drk and Sos. We show that Tyr2546 in the cytoplasmic tail of Sev is required for Drk binding, probably because it provides a recognition site for the Drk SH2 domain. Interestingly, a mutation at this site does not completely block Sev function in vivo. This may suggest that Sev can signal in a Drk-independent, parallel pathway or that Drk can also bind to an intermediate docking protein. Analysis of the Drk-Sos interaction has identified a high affinity binding site for Drk SH3 domains in the Sos tail. We show that the N-terminal Drk SH3 domain is primarily responsible for binding to the tail of Sos in vitro, and for signalling to Ras in vivo.

  5. Kinase activation through dimerization by human SH2-B.

    Science.gov (United States)

    Nishi, Masahiro; Werner, Eric D; Oh, Byung-Chul; Frantz, J Daniel; Dhe-Paganon, Sirano; Hansen, Lone; Lee, Jongsoon; Shoelson, Steven E

    2005-04-01

    The isoforms of SH2-B, APS, and Lnk form a family of signaling proteins that have been described as activators, mediators, or inhibitors of cytokine and growth factor signaling. We now show that the three alternatively spliced isoforms of human SH2-B readily homodimerize in yeast two-hybrid and cellular transfections assays, and this is mediated specifically by a unique domain in its amino terminus. Consistent with previous reports, we further show that the SH2 domains of SH2-B and APS bind JAK2 at Tyr813. These findings suggested a model in which two molecules of SH2-B or APS homodimerize with their SH2 domains bound to two JAK2 molecules, creating heterotetrameric JAK2-(SH2-B)2-JAK2 or JAK2-(APS)2-JAK2 complexes. We further show that APS and SH2-B isoforms heterodimerize. At lower levels of SH2-B or APS expression, dimerization approximates two JAK2 molecules to induce transactivation. At higher relative concentrations of SH2-B or APS, kinase activation is blocked. SH2-B or APS homodimerization and SH2-B/APS heterodimerization thus provide direct mechanisms for activating and inhibiting JAK2 and other kinases from the inside of the cell and for potentiating or attenuating cytokine and growth factor receptor signaling when ligands are present.

  6. Classification and Lineage Tracing of SH2 Domains Throughout Eukaryotes.

    Science.gov (United States)

    Liu, Bernard A

    2017-01-01

    Today there exists a rapidly expanding number of sequenced genomes. Cataloging protein interaction domains such as the Src Homology 2 (SH2) domain across these various genomes can be accomplished with ease due to existing algorithms and predictions models. An evolutionary analysis of SH2 domains provides a step towards understanding how SH2 proteins integrated with existing signaling networks to position phosphotyrosine signaling as a crucial driver of robust cellular communication networks in metazoans. However organizing and tracing SH2 domain across organisms and understanding their evolutionary trajectory remains a challenge. This chapter describes several methodologies towards analyzing the evolutionary trajectory of SH2 domains including a global SH2 domain classification system, which facilitates annotation of new SH2 sequences essential for tracing the lineage of SH2 domains throughout eukaryote evolution. This classification utilizes a combination of sequence homology, protein domain architecture and the boundary positions between introns and exons within the SH2 domain or genes encoding these domains. Discrete SH2 families can then be traced across various genomes to provide insight into its origins. Furthermore, additional methods for examining potential mechanisms for divergence of SH2 domains from structural changes to alterations in the protein domain content and genome duplication will be discussed. Therefore a better understanding of SH2 domain evolution may enhance our insight into the emergence of phosphotyrosine signaling and the expansion of protein interaction domains.

  7. Crystal structure of the Src family kinase Hck SH3-SH2 linker regulatory region supports an SH3-dominant activation mechanism.

    Science.gov (United States)

    Alvarado, John J; Betts, Laurie; Moroco, Jamie A; Smithgall, Thomas E; Yeh, Joanne I

    2010-11-12

    Most mammalian cell types depend on multiple Src family kinases (SFKs) to regulate diverse signaling pathways. Strict control of SFK activity is essential for normal cellular function, and loss of kinase regulation contributes to several forms of cancer and other diseases. Previous x-ray crystal structures of the SFKs c-Src and Hck revealed that intramolecular association of their Src homology (SH) 3 domains and SH2 kinase linker regions has a key role in down-regulation of kinase activity. However, the amino acid sequence of the Hck linker represents a suboptimal ligand for the isolated SH3 domain, suggesting that it may form the polyproline type II helical conformation required for SH3 docking only in the context of the intact structure. To test this hypothesis directly, we determined the crystal structure of a truncated Hck protein consisting of the SH2 and SH3 domains plus the linker. Despite the absence of the kinase domain, the structures and relative orientations of the SH2 and SH3 domains in this shorter protein were very similar to those observed in near full-length, down-regulated Hck. However, the SH2 kinase linker adopted a modified topology and failed to engage the SH3 domain. This new structure supports the idea that these noncatalytic regions work together as a "conformational switch" that modulates kinase activity in a manner unique to the SH3 domain and linker topologies present in the intact Hck protein. Our results also provide fresh structural insight into the facile induction of Hck activity by HIV-1 Nef and other Hck SH3 domain binding proteins and implicate the existence of innate conformational states unique to individual Src family members that "fine-tune" their sensitivities to activation by SH3-based ligands.

  8. Temporality in Manyōshū

    Directory of Open Access Journals (Sweden)

    Yamaguchi Toshiko

    2016-12-01

    Full Text Available Using the Manyōshū corpus, the paper argues that conceptual metaphor theory imposes limitations on the diversity of linguistic facts, particularly those concerning the speaker or the poet who is communicating. The paper offers explanations of the nature of time by drawing upon the inference operating within “basic sign structure”, specifically, indexicality and iconicity, both of which are at the heart of human semiotic activity.

  9. SH3 domain tyrosine phosphorylation--sites, role and evolution.

    Directory of Open Access Journals (Sweden)

    Zuzana Tatárová

    Full Text Available BACKGROUND: SH3 domains are eukaryotic protein domains that participate in a plethora of cellular processes including signal transduction, proliferation, and cellular movement. Several studies indicate that tyrosine phosphorylation could play a significant role in the regulation of SH3 domains. RESULTS: To explore the incidence of the tyrosine phosphorylation within SH3 domains we queried the PhosphoSite Plus database of phosphorylation sites. Over 100 tyrosine phosphorylations occurring on 20 different SH3 domain positions were identified. The tyrosine corresponding to c-Src Tyr-90 was by far the most frequently identified SH3 domain phosphorylation site. A comparison of sequences around this tyrosine led to delineation of a preferred sequence motif ALYD(Y/F. This motif is present in about 15% of human SH3 domains and is structurally well conserved. We further observed that tyrosine phosphorylation is more abundant than serine or threonine phosphorylation within SH3 domains and other adaptor domains, such as SH2 or WW domains. Tyrosine phosphorylation could represent an important regulatory mechanism of adaptor domains. CONCLUSIONS: While tyrosine phosphorylation typically promotes signaling protein interactions via SH2 or PTB domains, its role in SH3 domains is the opposite - it blocks or prevents interactions. The regulatory function of tyrosine phosphorylation is most likely achieved by the phosphate moiety and its charge interfering with binding of polyproline helices of SH3 domain interacting partners.

  10. MeSH Now: automatic MeSH indexing at PubMed scale via learning to rank.

    Science.gov (United States)

    Mao, Yuqing; Lu, Zhiyong

    2017-04-17

    MeSH indexing is the task of assigning relevant MeSH terms based on a manual reading of scholarly publications by human indexers. The task is highly important for improving literature retrieval and many other scientific investigations in biomedical research. Unfortunately, given its manual nature, the process of MeSH indexing is both time-consuming (new articles are not immediately indexed until 2 or 3 months later) and costly (approximately ten dollars per article). In response, automatic indexing by computers has been previously proposed and attempted but remains challenging. In order to advance the state of the art in automatic MeSH indexing, a community-wide shared task called BioASQ was recently organized. We propose MeSH Now, an integrated approach that first uses multiple strategies to generate a combined list of candidate MeSH terms for a target article. Through a novel learning-to-rank framework, MeSH Now then ranks the list of candidate terms based on their relevance to the target article. Finally, MeSH Now selects the highest-ranked MeSH terms via a post-processing module. We assessed MeSH Now on two separate benchmarking datasets using traditional precision, recall and F 1 -score metrics. In both evaluations, MeSH Now consistently achieved over 0.60 in F-score, ranging from 0.610 to 0.612. Furthermore, additional experiments show that MeSH Now can be optimized by parallel computing in order to process MEDLINE documents on a large scale. We conclude that MeSH Now is a robust approach with state-of-the-art performance for automatic MeSH indexing and that MeSH Now is capable of processing PubMed scale documents within a reasonable time frame. http://www.ncbi.nlm.nih.gov/CBBresearch/Lu/Demo/MeSHNow/ .

  11. SH2 Binding Site Protection Assay: A Method for Identification of SH2 Domain Interaction Partners by Exploiting SH2 Mediated Phosphosite Protection.

    Science.gov (United States)

    Jadwin, Joshua A

    2017-01-01

    Over the last two decades there has been a significant effort in the field to characterize the phosphosite binding specificities of SH2 domains with the goal of deciphering the pY signaling code. Although high throughput studies in various formats using most SH2 domains have collectively provided a rich resource of in vitro SH2-pTyr site specificity maps, this data can only be used approximate what is happening in the cell where protein concentrations and localization are not homogenous, as they are for in vitro experiments. Here we describe an in vivo approach, SH2 site protection assay, which can capture the pTyr binding specificity of SH2 domains in the cell. The basis of this approach is SH2-pY site protection, the ability of SH2 domains to prevent the PTP-dependent dephosphorylation of their pY site binding partners. We overexpress a tracer SH2 domain in cells and quantify the change in abundance of tyrosine phosphorylated sites using MS. Since the method is performed in vivo, it has the advantage of identifying SH2-pY interactions as they occur within in the cell.

  12. Characterizing tyrosine phosphorylation signaling in lung cancer using SH2 profiling.

    Directory of Open Access Journals (Sweden)

    Kazuya Machida

    2010-10-01

    Full Text Available Tyrosine kinases drive the proliferation and survival of many human cancers. Thus profiling the global state of tyrosine phosphorylation of a tumor is likely to provide a wealth of information that can be used to classify tumors for prognosis and prediction. However, the comprehensive analysis of tyrosine phosphorylation of large numbers of human cancer specimens is technically challenging using current methods.We used a phosphoproteomic method termed SH2 profiling to characterize the global state of phosphotyrosine (pTyr signaling in human lung cancer cell lines. This method quantifies the phosphorylated binding sites for SH2 domains, which are used by cells to respond to changes in pTyr during signaling. Cells could be grouped based on SH2 binding patterns, with some clusters correlated with EGF receptor (EGFR or K-RAS mutation status. Binding of specific SH2 domains, most prominently RAS pathway activators Grb2 and ShcA, correlated with EGFR mutation and sensitivity to the EGFR inhibitor erlotinib. SH2 binding patterns also reflected MET activation and could identify cells driven by multiple kinases. The pTyr responses of cells treated with kinase inhibitors provided evidence of distinct mechanisms of inhibition.This study illustrates the potential of modular protein domains and their proteomic binding profiles as powerful molecular diagnostic tools for tumor classification and biomarker identification.

  13. The effects of adding group-based lifestyle counselling to individual counselling on changes in plasma glucose levels in a randomized controlled trial: the Inter99 study.

    Science.gov (United States)

    Lau, C; Vistisen, D; Toft, U; Tetens, I; Glümer, C; Pedersen, O; Jørgensen, T; Borch-Johnsen, K

    2011-12-01

    This study aimed to assess whether group-based lifestyle counselling offered to a high-risk population subgroup had any effect beyond individual multifactorial interventions on fasting plasma glucose (FPG) and 2-h plasma glucose (2hPG) changes. In a population-based study of 6784 participants, 4053 were determined to be at high risk based on a risk estimate of ischaemic heart disease or the presence of risk factors (smoking, hypertension, hypercholesterolaemia, obesity, impaired glucose tolerance). Of these subjects, 90% were randomized to high-intensity intervention (group A) and 10% to low-intensity intervention (group B). All participants went through health examinations, risk assessments and individual lifestyle counselling. Participants in group A were further offered group-based lifestyle counselling. The intervention was repeated after 1 and 3 years. A total of 2738 participants free of diabetes at baseline (1999-2001) and with at least one FPG and/or 2hPG measurement during 5 years of follow-up were included in the analyses. Differences in changes of plasma glucose between groups A and B were analyzed using multilevel linear regression. For FPG, crude 5-year changes were significantly different between the two groups (group A: -0.003 mmol/L vs group B: -0.079 mmol/L; P=0.0427). After adjusting for relevant confounders, no differences in FPG changes were observed (P=0.116). Also, no significant differences in the 5-year changes in 2hPG between the two groups were observed (group A: - 0.127 mmol/L vs group B: -0.201 mmol/L; P=0.546). Offering additional group-based intervention to a high-risk population subgroup had no clinical effects on changes in plasma glucose beyond those of individualized multifactorial interventions. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  14. Crystal structure of Src-like adaptor protein 2 reveals close association of SH3 and SH2 domains through β-sheet formation.

    Science.gov (United States)

    Wybenga-Groot, Leanne E; McGlade, C Jane

    2013-12-01

    The Src-like adaptor proteins (SLAP/SLAP2) are key components of Cbl-dependent downregulation of antigen receptor, cytokine receptor, and receptor tyrosine kinase signaling in hematopoietic cells. SLAP and SLAP2 consist of adjacent SH3 and SH2 domains that are most similar in sequence to Src family kinases (SFKs). Notably, the SH3-SH2 connector sequence is significantly shorter in SLAP/SLAP2 than in SFKs. To understand the structural implication of a short SH3-SH2 connector sequence, we solved the crystal structure of a protein encompassing the SH3 domain, SH3-SH2 connector, and SH2 domain of SLAP2 (SLAP2-32). While both domains adopt typical folds, the short SH3-SH2 connector places them in close association. Strand βe of the SH3 domain interacts with strand βA of the SH2 domain, resulting in the formation of a continuous β sheet that spans the length of the protein. Disruption of the SH3/SH2 interface through mutagenesis decreases SLAP-32 stability in vitro, consistent with inter-domain binding being an important component of SLAP2 structure and function. The canonical peptide binding pockets of the SH3 and SH2 domains are fully accessible, in contrast to other protein structures that display direct interaction between SH3 and SH2 domains, in which either peptide binding surface is obstructed by the interaction. Our results reveal potential sites of novel interaction for SH3 and SH2 domains, and illustrate the adaptability of SH2 and SH3 domains in mediating interactions. As well, our results suggest that the SH3 and SH2 domains of SLAP2 function interdependently, with implications on their mode of substrate binding. © 2013.

  15. Report on the joint meeting of the Division of Development and Technology Plasma Wall Interaction and High Heat Flux Materials and Components task groups

    International Nuclear Information System (INIS)

    Nygren, R.E.

    1992-04-01

    The Plasma/Wall Interaction and High Heat Flux Materials and Components Task Groups typically hold a joint meeting each year to provide a forum for discussion of technical issues of current interest as well as an opportunity for program reviews by the Department of Energy (DOE). At the meeting in September 1990, reported here, research programs in support of the International Thermonuclear Experimental Reactor (ITER) were highlighted. The first part of the meeting was devoted to research and development (R ampersand D) for ITER on plasma facing components plus introductory presentations on some current projects and design studies. The balance of the meeting was devoted to program reviews, which included presentations by most of the participants in the Small Business Innovative Research (SBIR) Programs with activities related to plasma wall interactions. The Task Groups on Plasma/Wall Interaction and on High Heat Flux Materials and Components were chartered as continuing working groups by the Division of Development and Technology in DOE's Magnetic Fusion Program. This report is an addition to the series of ''blue cover'' reports on the Joint Meetings of the Plasma/Wall Interaction and High Heat Flux Materials and Components Task Groups. Among several preceding meetings were those in October 1989 and January 1988

  16. Effect of whole body X-irradiation on the NP-SH level of blood in rabbits

    International Nuclear Information System (INIS)

    Suh, Soo Jhi; Woo, Won Hyung

    1972-01-01

    In hope to elucidate possible changes in blood NP-SH levels when X-irradiation is made in single or fractionate dose, a whole body X-irradiation was done to rabbits either in single dose of 900 r or in fractionated dose of 300 r per day for three days. The NP-SH was measured at 1, 3, 5, 24 and 48 post-irradiation hours, and the results were compared with the normal value of the blood NP-SH. The results obtained are as follows: 1. The normal value of blood NP-SH in the rabbit was 2.11 ± 0.40 μmol/ml. 2. In the single X-irradiation group, the blood NP-SH decreased most prominently at five hours after-irradiation, and a tendency of recovery to the normal level was observed thereafter. 3. In the fractionated group, the blood NP-SH levels were higher, than in the single irradiation group throughout the experiment, and the levels were also higher than the normal in general

  17. Comparing CλaSH and VHDL by implementing a dataflow processor

    NARCIS (Netherlands)

    Niedermeier, A.; Wester, Rinse; Wester, Rinse; Baaij, C.P.R.; Kuper, Jan; Smit, Gerardus Johannes Maria

    2010-01-01

    As embedded systems are becoming increasingly complex, the design process and verification have become very time-consuming. Additionally, specifying hardware manually in a low-level hardware description language like VHDL is usually an error-prone task. In our group, a tool (the ClaSH compiler) was

  18. Probing SH2-domains using Inhibitor Affinity Purification (IAP).

    Science.gov (United States)

    Höfener, Michael; Heinzlmeir, Stephanie; Kuster, Bernhard; Sewald, Norbert

    2014-01-01

    Many human diseases are correlated with the dysregulation of signal transduction processes. One of the most important protein interaction domains in the context of signal transduction is the Src homology 2 (SH2) domain that binds phosphotyrosine residues. Hence, appropriate methods for the investigation of SH2 proteins are indispensable in diagnostics and medicinal chemistry. Therefore, an affinity resin for the enrichment of all SH2 proteins in one experiment would be desirable. However, current methods are unable to address all SH2 proteins simultaneously with a single compound or a small array of compounds. In order to overcome these limitations for the investigation of this particular protein family in future experiments, a dipeptide-derived probe has been designed, synthesized and evaluated. This probe successfully enriched 22 SH2 proteins from mixed cell lysates which contained 50 SH2 proteins. Further characterization of the SH2 binding properties of the probe using depletion and competition experiments indicated its ability to enrich complexes consisting of SH2 domain bearing regulatory PI3K subunits and catalytic phosphoinositide 3-kinase (PI3K) subunits that have no SH2 domain. The results make this probe a promising starting point for the development of a mixed affinity resin with complete SH2 protein coverage. Moreover, the additional findings render it a valuable tool for the evaluation of PI3K complex interrupting inhibitors.

  19. The effects of adding group-based lifestyle counselling to individual counselling on changes in plasma glucose levels in a randomized controlled trial: The Inter99 study

    DEFF Research Database (Denmark)

    Lau, C.; Vistisen, D.; Toft, U.

    2011-01-01

    AimThis study aimed to assess whether group-based lifestyle counselling offered to a high-risk population subgroup had any effect beyond individual multifactorial interventions on fasting plasma glucose (FPG) and 2-h plasma glucose (2hPG) changes. MethodsIn a population-based study of 6784......% to low-intensity intervention (group B). All participants went through health examinations, risk assessments and individual lifestyle counselling. Participants in group A were further offered group-based lifestyle counselling. The intervention was repeated after 1 and 3 years. A total of 2738...... participants, 4053 were determined to be at high risk based on a risk estimate of ischaemic heart disease or the presence of risk factors (smoking, hypertension, hypercholesterolaemia, obesity, impaired glucose tolerance). Of these subjects, 90% were randomized to high-intensity intervention (group A) and 10...

  20. Drosophila photoreceptor axon guidance and targeting requires the dreadlocks SH2/SH3 adapter protein.

    Science.gov (United States)

    Garrity, P A; Rao, Y; Salecker, I; McGlade, J; Pawson, T; Zipursky, S L

    1996-05-31

    Mutations in the Drosophila gene dreadlocks (dock) disrupt photoreceptor cell (R cell) axon guidance and targeting. Genetic mosaic analysis and cell-type-specific expression of dock transgenes demonstrate dock is required in R cells for proper innervation. Dock protein contains one SH2 and three SH3 domains, implicating it in tyrosine kinase signaling, and is highly related to the human proto-oncogene Nck. Dock expression is detected in R cell growth cones in the target region. We propose Dock transmits signals in the growth cone in response to guidance and targeting cues. These findings provide an important step for dissection of signaling pathways regulating growth cone motility.

  1. Electronics Research Laboratory, Plasma Theory and Simulation Group annual progress report, January 1, 1989--December 31, 1989

    International Nuclear Information System (INIS)

    Birdsall, C.K.

    1989-01-01

    This is a brief progress report, covering our research in general plasma theory and simulation, plasma-wall physics theory and simulation, and code development. Reports written in this period are included with this mailing. A publications list plus abstracts for two major meetings are included

  2. Meshable: searching PubMed abstracts by utilizing MeSH and MeSH-derived topical terms.

    Science.gov (United States)

    Kim, Sun; Yeganova, Lana; Wilbur, W John

    2016-10-01

    Medical Subject Headings (MeSH(®)) is a controlled vocabulary for indexing and searching biomedical literature. MeSH terms and subheadings are organized in a hierarchical structure and are used to indicate the topics of an article. Biologists can use either MeSH terms as queries or the MeSH interface provided in PubMed(®) for searching PubMed abstracts. However, these are rarely used, and there is no convenient way to link standardized MeSH terms to user queries. Here, we introduce a web interface which allows users to enter queries to find MeSH terms closely related to the queries. Our method relies on co-occurrence of text words and MeSH terms to find keywords that are related to each MeSH term. A query is then matched with the keywords for MeSH terms, and candidate MeSH terms are ranked based on their relatedness to the query. The experimental results show that our method achieves the best performance among several term extraction approaches in terms of topic coherence. Moreover, the interface can be effectively used to find full names of abbreviations and to disambiguate user queries. https://www.ncbi.nlm.nih.gov/IRET/MESHABLE/ CONTACT: sun.kim@nih.gov Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.

  3. Molecular dissection of the interaction between the SH3 domain and the SH2-Kinase Linker region in PTK6.

    Science.gov (United States)

    Kim, Han Ie; Jung, Jinwon; Lee, Eun-Saem; Kim, Yong-Chul; Lee, Weontae; Lee, Seung-Taek

    2007-11-03

    PTK6 (also known as Brk) is an intracellular tyrosine kinase that contains SH3, SH2, and tyrosine kinase catalytic (Kinase) domains. The SH3 domain of PTK6 interacts with the N-terminal half of the linker (Linker) region between the SH2 and Kinase domains. Site-directed mutagenesis and surface plasmon resonance studies showed that a tryptophan residue (Trp44) in the SH3 domain and proline residues in the Linker region, in the order of Pro177, Pro175, and Pro179, contribute to the interaction. The three-dimensional modeled structure of the SH3-Linker complex was in agreement with the biochemical data. Disruption of the intramolecular interaction between the SH3 domain and the Linker region by mutation of Trp44, Pro175, Pro177, and Pro179 markedly increased the catalytic activity of PTK6 in HEK 293 cells. These results demonstrate that Trp44 in the SH3 domain and Pro177, Pro175, and Pro179 in the N-terminal half of the Linker region play important roles in the SH3-Linker interaction to maintain the protein in an inactive conformation along with the phosphorylated Tyr447-SH2 interaction.

  4. MeSH key terms for validation and annotation of gene expression clusters

    Energy Technology Data Exchange (ETDEWEB)

    Rechtsteiner, A. (Andreas); Rocha, L. M. (Luis Mateus)

    2004-01-01

    associated with MeSH terms. MeSH terms can be associated with genes through co-occurrence of these in MEDLINE citations, i.e. the genes occur in titles or abstracts and the MeSH terms are assigned by experts. To identify MeSH terms associated with a group of genes we used the tool MESHGENE developed at the Information Dynamics Lab at HP Labs (http://www-idl.hpl.hp.com/meshgene/). When presented with a list of human genes, MESHGENE uses some sophisticated techniques to search for these gene symbols in the titles and abstracts of all MEDLINE citations. MeSH terms and the number of co-occurrences can be retrieved. Gene symbols that are aliases of each other are pooled from several databases. This addresses the problem of synonymy, the fact that several symbols can refer to the same gene. MESHGENE employs some sophisticated algorithms that disregards symbols that are likely to be acronyms for other concepts than a gene. This addresses the problem of polysemy, i.e. possible multiple meanings of a gene symbol. We applied our approach to gene expression data from herpes virus infected human fibroblast cells. The data contains 12 time-points, between 1/2 hrs and 48 hrs after infection. Singular Value Decomposition was used to identify the dominant modes of expression. 75% of the variance in the expression data was captured by the first two modes, the first exhibiting a monotonly increasing expression pattern and the second a more transient pattern. Projection of the gene expression vectors onto this first two modes identified 3 statistically significant clusters of co-expressed genes. 500 genes from cluster 1 and 300 genes from clusters 2 and 3 each were uploaded to MESHGENE and the MeSH terms and co-occurrence values were retrieved. MeSH terms were also obtained for 5 groups of randomly selected genes with similar numbers of genes. The log was taken of the co-occurrence values and for each MeSH term these log co-occurrence values were summed for each group over the genes in that

  5. Roles of the SH2 and SH3 domains in the regulation of neuronal Src kinase functions.

    Science.gov (United States)

    Groveman, Bradley R; Xue, Sheng; Marin, Vedrana; Xu, Jindong; Ali, Mohammad K; Bienkiewicz, Ewa A; Yu, Xian-Min

    2011-02-01

    Previous studies demonstrated that intra-domain interactions between Src family kinases (SFKs), stabilized by binding of the phosphorylated C-terminus to the SH2 domain and/or binding of the SH2 kinase linker to the SH3 domain, lock the molecules in a closed conformation, disrupt the kinase active site, and inactivate SFKs. Here we report that the up-regulation of N-methyl-D-aspartate receptors (NMDARs) induced by expression of constitutively active neuronal Src (n-Src), in which the C-terminus tyrosine is mutated to phenylalanine (n-Src/Y535F), is significantly reduced by dysfunctions of the SH2 and/or SH3 domains of the protein. Furthermore, we found that dysfunctions of SH2 and/or SH3 domains reduce auto-phosphorylation of the kinase activation loop, depress kinase activity, and decrease NMDAR phosphorylation. The SH2 domain plays a greater regulatory role than the SH3 domain. Our data also show that n-Src binds directly to the C-terminus of the NMDAR NR2A subunit in vitro, with a K(D) of 108.2 ± 13.3 nM. This binding is not Src kinase activity-dependent, and dysfunctions of the SH2 and/or SH3 domains do not significantly affect the binding. These data indicate that the SH2 and SH3 domains may function to promote the catalytic activity of active n-Src, which is important in the regulation of NMDAR functions. © 2010 The Authors Journal compilation © 2010 FEBS.

  6. Structural insights into the intertwined dimer of fyn SH2.

    Science.gov (United States)

    Huculeci, Radu; Garcia-Pino, Abel; Buts, Lieven; Lenaerts, Tom; van Nuland, Nico

    2015-12-01

    Src homology 2 domains are interaction modules dedicated to the recognition of phosphotyrosine sites incorporated in numerous proteins found in intracellular signaling pathways. Here we provide for the first time structural insight into the dimerization of Fyn SH2 both in solution and in crystalline conditions, providing novel crystal structures of both the dimer and peptide-bound structures of Fyn SH2. Using nuclear magnetic resonance chemical shift analysis, we show how the peptide is able to eradicate the dimerization, leading to monomeric SH2 in its bound state. Furthermore, we show that Fyn SH2's dimer form differs from other SH2 dimers reported earlier. Interestingly, the Fyn dimer can be used to construct a completed dimer model of Fyn without any steric clashes. Together these results extend our understanding of SH2 dimerization, giving structural details, on one hand, and suggesting a possible physiological relevance of such behavior, on the other hand. © 2015 The Protein Society.

  7. Plasma IL-8 and IL-6 levels can be used to define a group with low risk of septicaemia among cancer patients with fever and neutropenia

    NARCIS (Netherlands)

    de Bont, ESJM; Vellenga, E; Swaanenburg, JCJM; Fidler, [No Value; Visser-van Brummen, PJ; Kamps, WA

    The standard therapy for patients with fever and chemotherapy-related neutropenia is hospitalization and infusion of broad-spectrum antibiotics. Early discharge of a defined group of patients at low risk for septicaemia would be of great advantage for these patients. Ih this study plasma

  8. Plasma IL-8 and IL-6 levels can be used to define a group with low risk of septicaemia among cancer patients with fever and neutropenia

    NARCIS (Netherlands)

    de Bont, ESJM; Vellenga, E; Swaanenburg, JCJM; Fidler, [No Value; Visser-van Brummen, PJ; Kamps, WA

    1999-01-01

    The standard therapy for patients with fever and chemotherapy-related neutropenia is hospitalization and infusion of broad-spectrum antibiotics. Early discharge of a defined group of patients at low risk for septicaemia would be of great advantage for these patients. Ih this study plasma

  9. Linker length dependent binding of a focal adhesion kinase derived peptide to the Src SH3-SH2 domains.

    Science.gov (United States)

    Lindfors, Hanna E; Venkata, Bharat Somireddy; Drijfhout, Jan W; Ubbink, Marcellus

    2011-02-18

    The interaction between a peptide encompassing the SH3 and SH2 binding motifs of focal adhesion kinase (FAK) and the Src SH3-SH2 domains has been investigated with NMR spectroscopy and calorimetry. The binding to both motifs is anti-cooperative. Reduction of the long linker connecting the motifs does not lead to cooperativity. Short linkers that do not allow simultaneous intramolecular binding of the peptide to both motifs cause peptide-mediated dimerisation, even with a linker of only three amino acids. The role of the SH3 binding motif is discussed in view of the independent nature of the SH interactions. Copyright © 2011 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  10. Screening for coding variants in FTO and SH2B1 genes in Chinese patients with obesity.

    Directory of Open Access Journals (Sweden)

    Zhaojing Zheng

    Full Text Available To investigate potential functional variants in FTO and SH2B1 genes among Chinese children with obesity.Sanger sequencing of PCR products of all FTO and SH2B1 exons and their flanking regions were performed in 338 Chinese Han children with obesity and 221 age- and sex-matched lean controls.A total of seven and five rare non-synonymous variants were identified in FTO and SH2B1, respectively. The overall frequencies of FTO and SH2B1 rare non-synonymous variants were similar in obese and lean children (2.37% and 0.90% vs. 1.81% and 1.36%, P>0.05. However, four out of the seven variants in FTO were novel and all were unique to obese children (p>0.05. None of the novel variants was consistently being predicted to be deleterious. Four out of five variants in SH2B1 were novel and one was unique to obese children (p>0.05. One variant (L293R that was consistently being predicted as deleterious in SH2B1 gene was unique to lean control. While rare missense mutations were more frequently detected in girls from obesity as well as lean control than boys, the difference was not statistically significant. In addition, it's shown that the prevalence of rare missense mutations of FTO as well as SH2B1 was similar across different ethnic groups.The rare missense mutations of FTO and SH2B1 did not confer risks of obesity in Chinese Han children in our cohort.

  11. SH2B1 regulation of energy balance, body weight, and glucose metabolism

    OpenAIRE

    Rui, Liangyou

    2014-01-01

    The Src homology 2B (SH2B) family members (SH2B1, SH2B2 and SH2B3) are adaptor signaling proteins containing characteristic SH2 and PH domains. SH2B1 (also called SH2-B and PSM) and SH2B2 (also called APS) are able to form homo- or hetero-dimers via their N-terminal dimerization domains. Their C-terminal SH2 domains bind to tyrosyl phosphorylated proteins, including Janus kinase 2 (JAK2), TrkA, insulin receptors, insulin-like growth factor-1 receptors, insulin receptor substrate-1 (IRS1), and...

  12. Arabidopsis SH3P2 is an ubiquitin-binding protein that functions together with ESCRT-I and the deubiquitylating enzyme AMSH3.

    Science.gov (United States)

    Nagel, Marie-Kristin; Kalinowska, Kamila; Vogel, Karin; Reynolds, Gregory D; Wu, Zhixiang; Anzenberger, Franziska; Ichikawa, Mie; Tsutsumi, Chie; Sato, Masa H; Kuster, Bernhard; Bednarek, Sebastian Y; Isono, Erika

    2017-08-22

    Clathrin-mediated endocytosis of plasma membrane proteins is an essential regulatory process that controls plasma membrane protein abundance and is therefore important for many signaling pathways, such as hormone signaling and biotic and abiotic stress responses. On endosomal sorting, plasma membrane proteins maybe recycled or targeted for vacuolar degradation, which is dependent on ubiquitin modification of the cargos and is driven by the endosomal sorting complexes required for transport (ESCRTs). Components of the ESCRT machinery are highly conserved among eukaryotes, but homologs of ESCRT-0 that are responsible for recognition and concentration of ubiquitylated proteins are absent in plants. Recently several ubiquitin-binding proteins have been identified that serve in place of ESCRT-0; however, their function in ubiquitin recognition and endosomal trafficking is not well understood yet. In this study, we identified Src homology-3 (SH3) domain-containing protein 2 (SH3P2) as a ubiquitin- and ESCRT-I-binding protein that functions in intracellular trafficking. SH3P2 colocalized with clathrin light chain-labeled punctate structures and interacted with clathrin heavy chain in planta , indicating a role for SH3P2 in clathrin-mediated endocytosis. Furthermore, SH3P2 cofractionates with clathrin-coated vesicles (CCVs), suggesting that it associates with CCVs in planta Mutants of SH3P2 and VPS23 genetically interact, suggesting that they could function in the same pathway. Based on these results, we suggest a role of SH3P2 as an ubiquitin-binding protein that binds and transfers ubiquitylated proteins to the ESCRT machinery.

  13. Expression and Production of SH2 Domain Proteins.

    Science.gov (United States)

    Liu, Bernard A; Ogiue-Ikeda, Mari; Machida, Kazuya

    2017-01-01

    The Src Homology 2 (SH2) domain lies at the heart of phosphotyrosine signaling, coordinating signaling events downstream of receptor tyrosine kinases (RTKs), adaptors, and scaffolds. Over a hundred SH2 domains are present in mammals, each having a unique specificity which determines its interactions with multiple binding partners. One of the essential tools necessary for studying and determining the role of SH2 domains in phosphotyrosine signaling is a set of soluble recombinant SH2 proteins. Here we describe methods, based on a broad experience with purification of all SH2 domains, for the production of SH2 domain proteins needed for proteomic and biochemical-based studies such as peptide arrays, mass-spectrometry, protein microarrays, reverse-phase microarrays, and high-throughput fluorescence polarization (HTP-FP). We describe stepwise protocols for expression and purification of SH2 domains using GST or poly His-tags, two widely adopted affinity tags. In addition, we address alternative approaches, challenges, and validation studies for assessing protein quality and provide general characteristics of purified human SH2 domains.

  14. SH2 dependent autophosphorylation within the Tec family kinase Itk

    Science.gov (United States)

    Joseph, Raji E.; Severin, Andrew; Min, Lie; Fulton, D. Bruce; Andreotti, Amy H.

    2009-01-01

    The Tec family kinase, Itk, undergoes an in cis autophosphorylation on Y180 within its SH3 domain. Autophosphorylation of the Itk SH3 domain by the Itk kinase domain is strictly dependent on the presence of the intervening SH2 domain. A direct docking interaction between the Itk kinase and SH2 domains brings the Itk SH3 domain into the active site where Y180 is then phosphorylated. We now identify the residues on the surface of the Itk SH2 domain responsible for substrate docking and show that this SH2 surface mediates autophosphorylation in the full length Itk molecule. The canonical phospholigand binding site on the SH2 domain is not involved in substrate docking, instead the docking site consists of side chains from three loop regions (AB, EF and BG) and part of the βD strand. These results are extended into Btk, a Tec family kinase linked to the B cell deficiency X-linked agammaglobulinemia (XLA). Our results suggest that some XLA causing mutations might impair Btk phosphorylation. PMID:19523959

  15. Designing a dataflow processor using CλaSH

    NARCIS (Netherlands)

    Niedermeier, A.; Wester, Rinse; Wester, Rinse; Rovers, K.C.; Baaij, C.P.R.; Kuper, Jan; Smit, Gerardus Johannes Maria

    2010-01-01

    In this paper we show how a simple dataflow processor can be fully implemented using CλaSH, a high level HDL based on the functional programming language Haskell. The processor was described using Haskell, the CλaSH compiler was then used to translate the design into a fully synthesisable VHDL code.

  16. SH2-dependent autophosphorylation within the Tec family kinase Itk.

    Science.gov (United States)

    Joseph, Raji E; Severin, Andrew; Min, Lie; Fulton, D Bruce; Andreotti, Amy H

    2009-08-07

    The Tec family kinase, Itk (interleukin-2 tyrosine kinase), undergoes an in cis autophosphorylation on Y180 within its Src homology 3 (SH3) domain. Autophosphorylation of the Itk SH3 domain by the Itk kinase domain is strictly dependent on the presence of the intervening Src homology 2 (SH2) domain. A direct docking interaction between the Itk kinase and SH2 domains brings the Itk SH3 domain into the active site where Y180 is then phosphorylated. We now identify the residues on the surface of the Itk SH2 domain responsible for substrate docking and show that this SH2 surface mediates autophosphorylation in the full-length Itk molecule. The canonical phospholigand binding site on the SH2 domain is not involved in substrate docking, instead the docking site consists of side chains from three loop regions (AB, EF and BG) and part of the betaD strand. These results are extended into Btk (Bruton's tyrosine kinase), a Tec family kinase linked to the B-cell deficiency X-linked agammaglobulinemia (XLA). Our results suggest that some XLA-causing mutations might impair Btk phosphorylation.

  17. Experimental loop for SH2 (LECS)

    International Nuclear Information System (INIS)

    Strehar, N.R.; Bruzzoni, Pablo; Moras, J.J.; Cogozzo, E.O.

    1981-01-01

    An experimental loop is described for circulation of SH 2 that operates at 2 x 10 6 Pascal and 33 deg C. It was designed and constructed with the purpose of experimentally studying the hydraulic instability phenomenon that can be detected in cold isotopic exchange columns in the Girdler-Sulfide (GS) process of heavy water production. The main features of the different components of the loop are described, as well as the materials, the measurement and control instruments and the auxiliary equipment used, and finally the measuring methods to qualify and quantify the formation of froth. Furthermore, the loop's transportable metallic container is described, which allows to transport and connect it to CNEA's experimental heavy water plant or to any other heavy water plants using the GS method. Some tests made with inert gases that intended to verify the equipment's performance and to select the most adequate sieve trays for its operation are discussed. (M.E.L.) [es

  18. Influences of ABO blood group, age and gender on plasma coagulation factor VIII, fibrinogen, von Willebrand factor and ADAMTS13 levels in a Chinese population.

    Science.gov (United States)

    Wang, Zongkui; Dou, Miaomiao; Du, Xi; Ma, Li; Sun, Pan; Cao, Haijun; Ye, Shengliang; Jiang, Peng; Liu, Fengjuan; Lin, Fangzhao; Zhang, Rong; Li, Changqing

    2017-01-01

    ABO blood group is a hereditary factor of plasma levels of coagulation factor VIII (FVIII) and von Willebrand factor (VWF). Age and gender have been shown to influence FVIII, VWF, fibrinogen (Fbg), and ADAMTS13 (A disintegrin and metalloprotease with thrombospondin type 1 motif, 13). We investigated the effects of ABO type, age, and gender on plasma levels of FVIII, Fbg, VWF, and ADAMTS13 in a Chinese population. A total of 290 healthy volunteers were eligible for this study. ABO blood group was determined by indirect technique. FVIII:C and Fbg were measured by clotting assays. VWF antigen (VWF:Ag), collagen-binding activity (VWF:CBA), and ADAMTS13 antigen were assessed by ELISA, whereas VWF ristocetin cofactor activity (VWF:Rcof) was performed by agglutination of platelets with ristocetin. Mean FVIII:C and VWF levels (VWF:Ag, VWF:CBA, and VWF:Rcof) were significantly higher in non-O than in O type subjects ( p  blood group, age, and gender showed different effects on plasma levels of FVIII:C, Fbg, VWF:Ag, VWF:CBA, VWF:Rcof, and ADAMTS13 antigen. These new data on a Chinese population are quite helpful to compare with other ethnic groups.

  19. Characterization of AKT independent effects of the synthetic AKT inhibitors SH-5 and SH-6 using an integrated approach combining transcriptomic profiling and signaling pathway perturbations

    Directory of Open Access Journals (Sweden)

    Schäfer Reinhold

    2010-06-01

    Full Text Available Abstract Background Signal transduction processes mediated by phosphatidyl inositol phosphates affect a broad range of cellular processes such as cell cycle progression, migration and cell survival. The protein kinase AKT is one of the major effectors in this signaling network. Chronic AKT activation contributes to oncogenic transformation and tumor development. Therefore, analogs of phosphatidyl inositol phosphates (PIAs were designed as new small drugs to block AKT activity for cancer treatment. Here we characterize the biological effects of the PIAs SH-5 and SH-6 in colorectal cancer cell lines. Methods Serum-starved or serum-supplemented human colorectal cancer cell lines SW480, HT29 and HCT116 were exposed to SH-5 and SH-6. AKT activation was determined by western blotting. Cell viability was assessed using a colorimetric XTT-based assay, apoptosis and cell cycle changes were monitored by FACS analysis. The dynamics of cell morphology alterations was evaluated by confocal and time-lapse microscopy. Transcriptional changes due to inhibitor treatment were analyzed using Affymetrix HG-U133A microarrays and RT-PCR. Results While the PIAs clearly reduce AKT phosphorylation in serum starved cells, we did not observe a significant reduction under serum supplemented conditions, giving us the opportunity to analyze AKT independent effects of these compounds. Both inhibitors induce broadly the same morphological alterations, in particular changes in cell shape and formation of intracellular vesicles. Moreover, we observed the induction of binucleated cells specifically in the SW480 cell line. Gene expression analysis revealed transcriptional alterations, which are mostly cell line specific. In accordance to the phenotype we found a gene group associated with mitosis and spindle organization down regulated in SW480 cells, but not in the other cell lines. A bioinformatics analysis using the Connectivity Map linked the gene expression pattern of the

  20. Characterization of AKT independent effects of the synthetic AKT inhibitors SH-5 and SH-6 using an integrated approach combining transcriptomic profiling and signaling pathway perturbations

    International Nuclear Information System (INIS)

    Krech, Till; Thiede, Margarethe; Hilgenberg, Ellen; Schäfer, Reinhold; Jürchott, Karsten

    2010-01-01

    Signal transduction processes mediated by phosphatidyl inositol phosphates affect a broad range of cellular processes such as cell cycle progression, migration and cell survival. The protein kinase AKT is one of the major effectors in this signaling network. Chronic AKT activation contributes to oncogenic transformation and tumor development. Therefore, analogs of phosphatidyl inositol phosphates (PIAs) were designed as new small drugs to block AKT activity for cancer treatment. Here we characterize the biological effects of the PIAs SH-5 and SH-6 in colorectal cancer cell lines. Serum-starved or serum-supplemented human colorectal cancer cell lines SW480, HT29 and HCT116 were exposed to SH-5 and SH-6. AKT activation was determined by western blotting. Cell viability was assessed using a colorimetric XTT-based assay, apoptosis and cell cycle changes were monitored by FACS analysis. The dynamics of cell morphology alterations was evaluated by confocal and time-lapse microscopy. Transcriptional changes due to inhibitor treatment were analyzed using Affymetrix HG-U133A microarrays and RT-PCR. While the PIAs clearly reduce AKT phosphorylation in serum starved cells, we did not observe a significant reduction under serum supplemented conditions, giving us the opportunity to analyze AKT independent effects of these compounds. Both inhibitors induce broadly the same morphological alterations, in particular changes in cell shape and formation of intracellular vesicles. Moreover, we observed the induction of binucleated cells specifically in the SW480 cell line. Gene expression analysis revealed transcriptional alterations, which are mostly cell line specific. In accordance to the phenotype we found a gene group associated with mitosis and spindle organization down regulated in SW480 cells, but not in the other cell lines. A bioinformatics analysis using the Connectivity Map linked the gene expression pattern of the inhibitor treated SW480 cells to PKC signaling. Using

  1. Critical Role of the Src Homology 2 (SH2) Domain of Neuronal SH2B1 in the Regulation of Body Weight and Glucose Homeostasis in Mice

    OpenAIRE

    Morris, David L.; Cho, Kae Won; Rui, Liangyou

    2010-01-01

    SH2B1 is an SH2 domain-containing adaptor protein that plays a key role in the regulation of energy and glucose metabolism in both rodents and humans. Genetic deletion of SH2B1 in mice results in obesity and type 2 diabetes. Single-nucleotide polymorphisms in the SH2B1 loci and chromosomal deletions of the SH2B1 loci associate with obesity and insulin resistance in humans. In cultured cells, SH2B1 promotes leptin and insulin signaling by binding via its SH2 domain to phosphorylated tyrosines ...

  2. The globular cluster system of NGC 1316. II. The extraordinary object SH2

    Science.gov (United States)

    Richtler, T.; Kumar, B.; Bassino, L. P.; Dirsch, B.; Romanowsky, A. J.

    2012-07-01

    Context. SH2 has been described as an isolated HII-region, located about 6.5' south of the nucleus of NGC 1316 (Fornax A), a merger remnant in the the outskirts of the Fornax cluster of galaxies. Aims: We give a first, preliminary description of the stellar content and environment of this remarkable object. Methods: We used photometric data in the Washington system and HST photometry from the Hubble Legacy Archive for a morphological description and preliminary aperture photometry. Low-resolution spectroscopy provides radial velocities of the brightest star cluster in SH2 and a nearby intermediate-age cluster. Results: SH2 is not a normal HII-region, ionized by very young stars. It contains a multitude of star clusters with ages of approximately 108 yr. A ring-like morphology is striking. SH2 seems to be connected to an intermediate-age massive globular cluster with a similar radial velocity, which itself is the main object of a group of fainter clusters. Metallicity estimates from emission lines remain ambiguous. Conclusions: The present data do not yet allow firm conclusions about the nature or origin of SH2. It might be a dwarf galaxy that has experienced a burst of extremely clustered star formation. We may witness how globular clusters are donated to a parent galaxy. Based on observations taken at the European Southern Observatory, Cerro Paranal, Chile, under the programmes 082.B-0680, on observations taken at the Interamerican Observatory, Cerro Tololo, Chile. Furthermore based on observations made with the NASA/ESA Hubble Space Telescope (HST, PI: A. Sandage, Prop.ID: 7504), and obtained from the Hubble Legacy Archive, which is a collaboration between the Space Telescope Science Institute (STScI/NASA), the Space Telescope European Coordinating Facility (ST-ECF/ESA) and the Canadian Astronomy Data Centre (CADC/NRC/CSA).

  3. SH2B Regulation of Growth, Metabolism, and Longevity in Both Insects and Mammals

    OpenAIRE

    Song, Wei; Ren, Decheng; Li, Wenjun; Jiang, Lin; Cho, Kae Won; Huang, Ping; Fan, Chen; Song, Yiyun; Liu, Yong; Rui, Liangyou

    2010-01-01

    SH2B1 is a key regulator of body weight in mammals. Here we identified dSH2B as the Drosophila homolog of SH2B1. dSH2B bound to Chico and directly promoted insulin-like signaling. Disruption of dSH2B decreased insulin-like signaling and somatic growth in flies. dSH2B deficiency also increased hemolymph carbohydrate levels, whole body lipid levels, lifespan, and resistance to starvation and oxidative stress. Systemic overexpression of dSH2B resulted in opposite phenotypes. dSH2B overexpression...

  4. Progress towards the development of SH2 domain inhibitors.

    Science.gov (United States)

    Kraskouskaya, Dziyana; Duodu, Eugenia; Arpin, Carolynn C; Gunning, Patrick T

    2013-04-21

    Src homology 2 (SH2) domains are 100 amino acid modular units, which recognize and bind to tyrosyl-phosphorylated peptide sequences on their target proteins, and thereby mediate intracellular protein-protein interactions. This review summarizes the progress towards the development of synthetic agents that disrupt the function of the SH2 domains in different proteins as well as the clinical relevance of targeting a specific SH2 domain. Since 1986, SH2 domains have been identified in over 110 human proteins, including kinases, transcription factors, and adaptor proteins. A number of these proteins are over-activated in many diseases, including cancer, and their function is highly dependent on their SH2 domain. Thus, inhibition of a protein's function through disrupting that of its SH2 domain has emerged as a promising approach towards the development of novel therapeutic modalities. Although targeting the SH2 domain is a challenging task in molecular recognition, the progress reported here demonstrates the feasibility of such an approach.

  5. High plasma levels of high mobility group box 1 is associated with the risk of sepsis in severe blunt chest trauma patients: a prospective cohort study.

    Science.gov (United States)

    Wang, Xiao-Wen; Karki, Avash; Zhao, Xing-Ji; Xiang, Xiao-Yong; Lu, Zhi-Qian

    2014-08-02

    High mobility group box 1 (HMGB1) is a late mediator of systemic inflammation. Extracellular HMGB1 play a central pathogenic role in critical illness. The purpose of the study was to investigate the association between plasma HMGB1 concentrations and the risk of poor outcomes in patients with severe blunt chest trauma. The plasma concentrations of HMGB1 in patients with severe blunt chest trauma (AIS ≥ 3) were measured by a quantitative enzyme-linked immunosorbent assay at four time points during seven days after admission, and the dynamic release patterns were monitored. The biomarker levels were compared between patients with sepsis and non-sepsis, and between patients with multiple organ dysfunction syndrome (MODS) and non-MODS. The related factors of prognosis were analyzed by using multivariate logistic regression analysis. The short-form 36 was used to evaluate the quality of life of patients at 12 months after injury. Plasma HMGB1 levels were significantly higher both in sepsis and MODS group on post-trauma day 3, 5, and 7 compared with the non-sepsis and non-MODS groups, respectively. Multivariate analysis showed that HMGB1 levels and ISS were independent risk factors for sepsis and MODS in patients with severe blunt chest trauma. Plasma HMGB1 levels were significantly elevated in patients with severe blunt chest trauma. HMGB1 levels were associated with the risk of poor outcome in patients with severe blunt chest trauma. Daily HMGB1 levels measurements is a potential useful tool in the early identification of post-trauma complications. Further studies are needed to determine whether HMGB1 intervention could prevent the development of sepsis and MODS in patients with severe blunt chest trauma.

  6. AAV-based shRNA silencing of NF-κB ameliorates muscle pathologies in mdx mice.

    Science.gov (United States)

    Yang, Q; Tang, Y; Imbrogno, K; Lu, A; Proto, J D; Chen, A; Guo, F; Fu, F H; Huard, J; Wang, B

    2012-12-01

    Chronic inflammation, promoted by an upregulated NF-kappa B (NF-κB) pathway, has a key role in Duchenne muscular dystrophy (DMD) patients' pathogenesis. Blocking the NF-κB pathway has been shown to be a viable approach to diminish chronic inflammation and necrosis in the dystrophin-defective mdx mouse, a murine DMD model. In this study, we used the recombinant adeno-associated virus serotype 9 (AAV9) carrying an short hairpin RNA (shRNA) specifically targeting the messenger RNA of NF-κB/p65 (p65-shRNA), the major subunit of NF-κB associated with chronic inflammation in mdx mice. We examined whether i.m. AAV9-mediated delivery of p65-shRNA could decrease NF-κB activation, allowing for amelioration of muscle pathologies in 1- and 4-month-old mdx mice. At 1 month after treatment, NF-κB/p65 levels were significantly decreased by AAV gene transfer of p65-shRNA in the two ages of treatment groups, with necrosis significantly decreased compared with controls. Quantitative analysis revealed that central nucleation (CN) of the myofibers of p65-shRNA-treated 1-month-old mdx muscles was reduced from 67 to 34%, but the level of CN was not significantly decreased in treated 4-month-old mdx mice. Moreover, delivery of the p65-shRNA enhanced the capacity of myofiber regeneration in old mdx mice treated at 4 months of age when the dystrophic myofibers were most exhausted; however, such p65 silencing diminished the myofiber regeneration in young mdx mice treated at 1 month of age. Taken together, these findings demonstrate that the AAV-mediated delivery of p65-shRNA has the capacity to ameliorate muscle pathologies in mdx mice by selectively reducing NF-κB/p65 activity.

  7. Ras-MAPK signaling in differentiating SH-SY5Y human neuroblastoma cells

    OpenAIRE

    Olsson, Anna-Karin

    2000-01-01

    Neuroblastoma is a malignant childhood cancer, originating from sympathetic neuroblasts of the peripheral nervous system. Neuroblastoma is a heterogenous group of tumours, while some are highly malignant others can spontaneosly mature into a more benign form or regress. Less than half of the patients survive and this statistics has improved only modestly over the past 20 years. SH-SY5Y is a human neuroblastoma cell line established from a highly malignant tumour. The cells have retained a ca...

  8. Determination of the pyrethroid insecticide metabolite 3-PBA in plasma and urine samples from farmer and consumer groups in northern Thailand

    Science.gov (United States)

    THIPHOM, SARUNYA; PRAPAMONTOL, TIPPAWAN; CHANTARA, SOMPORN; MANGKLABRUKS, AMPICA; SUPHAVILAI, CHAISUREE; AHN, KI CHANG; GEE, SHIRLEY J.; HAMMOCK, BRUCE D.

    2014-01-01

    In this study, the enzyme-linked immunosorbent assays (ELISA) were modified to detect 3-PBA in plasma (including the adducted form) and urine among a large group of consumers and farmers in an agricultural area. The samples were collected on the same day in the morning from 100 consumers (50 females, 50 males) and 100 farmers (50 females, 50 males) in the Fang district, Chiang Mai province, northern Thailand. The ELISA was very sensitive having an IC50 value of 26.7 and 15.3 ng/mL, a limit of quantitation of 5 and 2.5 ng/mL and a limit of detection of 1.08 and 1.94 ng/mL for plasma and urine, respectively. These methods had low (< 5%) intra- and inter-assay coefficients of variation. The extraction technique satisfactorily eliminated the matrix effect from samples before ELISA analysis, yielding good recoveries (85.9–99.4% and 87.3–98.0%, respectively). For the volunteer study, the detection rate for plasma 3-PBA was 24% in consumers and 42% in farmers, but the median and range values were similar (median 5.87 ng/mL, range 5.16–8.44 ng/mL in consumers and 6.27 ng/mL, range 4.29–9.57 ng/mL in farmers). The rate of detection in the urine was similar (76% and 69%, in consumers and in farmers), yet the median concentration was significantly higher in farmers (8.86 μg/g creatinine in consumers vs 16.1 μg/g creatinine in farmers) and the range also much wider in farmers (1.62–80.5 μg/g creatinine in consumers and 0.80–256.2 μg/g creatinine in farmers). There was no correlation between plasma 3-PBA and urinary 3-PBA concentrations in the study presumably because plasma 3-PBA is a measure of cumulative exposures while urinary 3-PBA reflects acute exposures. In addition, metabolism and excretion of pyrethroids varies by individual. Nevertheless, this study demonstrated that these volunteers were exposed to pyrethroids. To our knowledge, this is the first report that compared plasma 3-PBA and urinary 3-PBA in a large group of volunteers. The ELISA method

  9. The Cish SH2 domain is essential for PLC-γ1 regulation in TCR stimulated CD8+ T cells.

    Science.gov (United States)

    Guittard, Geoffrey; Dios-Esponera, Ana; Palmer, Douglas C; Akpan, Itoro; Barr, Valarie A; Manna, Asit; Restifo, Nicholas P; Samelson, Lawrence E

    2018-03-28

    Cish, participates within a multi-molecular E3 ubiquitin ligase complex, which ubiquitinates target proteins. It has an inhibitory effect on T cell activation mediated by PLC-γ1 regulation, and it functions as a potent checkpoint in CD8 + T cell tumor immunotherapy. To study the structural and functional relationships between Cish and PLC-γ1 during CD8 + T cell activation, we tested mutants of the Cish-SH2 (R107K) and D/BC (L222Q, C226Q) domains. We confirmed that Cish-SH2-specific binding was essential for PLC-γ1 ubiquitination and degradation. This domain was essential for the Cish-mediated inhibition of Ca 2+ release upon TCR stimulation. No effect on inhibition of cytokine release was observed with SH2 or D/BC mutants, although the absence of Cish led to an increased release of IFN-γ and TNF-α. Using imaging we showed that Cish was expressed mostly in the cytoplasm and we did not see any Cish clustering at the plasma membrane upon stimulation. We conclude that the Cish-SH2 domain is essential for PLC-γ1 regulation in TCR-stimulated CD8 + T cells.

  10. A unique set of SH3-SH3 interactions controls IB1 homodimerization

    DEFF Research Database (Denmark)

    Kristensen, Ole; Guenat, Sylvie; Dar, Imran

    2006-01-01

    Islet-brain 1 (IB1 or JIP-1) is a scaffold protein that interacts with components of the c-Jun N-terminal kinase (JNK) signal-transduction pathway. IB1 is expressed at high levels in neurons and in pancreatic beta-cells, where it controls expression of several insulin-secretory components...... reduces IB1-dependent basal JNK activity in 293T cells. Impaired dimerization also results in a reduction in glucose transporter type 2 expression and in glucose-dependent insulin secretion in pancreatic beta-cells. Taken together, these results indicate that IB1 homodimerization through its SH3 domain...

  11. Organizational structures and communications on the SH 130 project.

    Science.gov (United States)

    2006-03-01

    This product summarizes the findings from research analyzing SH 130 organizational structures and communication flows. A set of guidelines pertaining to team organization and communication improvement and the design-build environment is also included...

  12. Interproximal grooving in the Atapuerca-SH hominid dentitions.

    Science.gov (United States)

    Bermúdez de Castro, J M; Arsuaga, J L; Pérez, P J

    1997-03-01

    The dental sample recovered from the Sima de los Huesos (SH) Middle Pleistocene cave site of the Sierra de Atapuerca (Spain) includes 296 specimens. Interproximal wear grooves have been observed in 20 maxillary and mandibular posterior teeth belonging to at least five of the 32 individuals identified so far in the SH hypodigm. Interproximal grooving affected only the adults, and at an age between 25 and 40 years. The appearance, morphology, and location pattern of the SH wear grooves are similar to those reported in other fossil hominids and in more recent human populations. Two alternative proposals, the toothpicking and the fiber or sinew processing hypotheses, compete for explaining the formation of this anomalous wear. The characteristics observed in the wear grooves of the SH teeth are compatible only with the habitual probing of interdental spaces by means of hard and inflexible objects. Dietary grit may also have contributed to the abrasion of the root walls during the motion of the dental probes.

  13. Inhibition and Promotion of Pyrolysis by Hydrogen Sulfide (H2S) and Sulfanyl Radical (SH)

    DEFF Research Database (Denmark)

    Zeng, Zhe; Altarawneh, Mohammednoor; Oluwoye, Ibukun

    2016-01-01

    processes. For the three groups of hydrocarbon, Evans–Polanyi plots display linear correlations between the bond dissociation enthalpies of the abstracted hydrogens and the relevant activation energies. In the case of methane, we demonstrated that the reactivity of SH radicals toward abstracting H atoms......This study resolves the interaction of sulfanyl radical (SH) with aliphatic (C1–C4) hydrocarbons, using CBS-QB3 based calculations. We obtained the C–H dissociation enthalpies and located the weakest link in each hydrocarbon. Subsequent computations revealed that, H abstraction by SH from...... the weakest C–H sites in alkenes and alkynes, except for ethylene, appears noticeably exothermic. Furthermore, abstraction of H from propene, 1-butene, and iso-butene displays pronounced spontaneity (i.e., ΔrG° bond. However...

  14. Evolution of SH2 domains and phosphotyrosine signalling networks

    Science.gov (United States)

    Liu, Bernard A.; Nash, Piers D.

    2012-01-01

    Src homology 2 (SH2) domains mediate selective protein–protein interactions with tyrosine phosphorylated proteins, and in doing so define specificity of phosphotyrosine (pTyr) signalling networks. SH2 domains and protein-tyrosine phosphatases expand alongside protein-tyrosine kinases (PTKs) to coordinate cellular and organismal complexity in the evolution of the unikont branch of the eukaryotes. Examination of conserved families of PTKs and SH2 domain proteins provides fiduciary marks that trace the evolutionary landscape for the development of complex cellular systems in the proto-metazoan and metazoan lineages. The evolutionary provenance of conserved SH2 and PTK families reveals the mechanisms by which diversity is achieved through adaptations in tissue-specific gene transcription, altered ligand binding, insertions of linear motifs and the gain or loss of domains following gene duplication. We discuss mechanisms by which pTyr-mediated signalling networks evolve through the development of novel and expanded families of SH2 domain proteins and the elaboration of connections between pTyr-signalling proteins. These changes underlie the variety of general and specific signalling networks that give rise to tissue-specific functions and increasingly complex developmental programmes. Examination of SH2 domains from an evolutionary perspective provides insight into the process by which evolutionary expansion and modification of molecular protein interaction domain proteins permits the development of novel protein-interaction networks and accommodates adaptation of signalling networks. PMID:22889907

  15. Inhibitory effects of recombinant plasmid pshuttle-Egr1-shTRAIL transfection in combination with X-irradiation on growth of liver cancer cells SMMC7721

    International Nuclear Information System (INIS)

    Chen Zhiyong; Liu Min; Dong Lihua; Gong Shouliang

    2011-01-01

    Objective: To investigate the effect of recombinant plasmid pshuttle-Egr1-shTRAIL stable transfection in combination with X-ray irradiation on the TRAIL protein expression and the apoptosis in human SMMC7721 hepatoma cells. Methods: The pshuttle-Egr1-shTRAIL packaged with liposome was stably transfected into SMMC7721 cells in vitro. The shTRAIL protein expression were measured with ELISA assay, Annexin V-FITC kit was adopted to measure the apoptosis of pshuttle-Egr1-shTRAIL cells, and the changes in survival rate of SMMC7721 cells measured with cell cloning assay. Results: The TRAIL protein expressions in pshuttle-Egr1-shTRAIL plus different doses of irradiation groups were significantly increased compared with 0 Gy group (P<0.001). The percentage of apoptotic cells was significantly higher than that in 0 Gy group (P<0.05 or P<0.001), and the survival rate of SMMC7721 cells was decreased significantly (P<0.05 or P<0.001). Conclusion: The pshuttle-Egr1-shTRAIL stable transfection in combination with irradiation can significantly induce the apoptosis of SMMC7721 tumor cells and inhibit the cell proliferation. (authors)

  16. Division of Development and Technology Plasma/Materials Interaction and High Heat Flux Materials and Components Task Groups: Report on the joint meeting, July 9, 1986

    International Nuclear Information System (INIS)

    Watson, R.D.

    1986-09-01

    This paper contains a collection of viewgraphs from a joint meeting of the Division of Development and Technology Plasma/Materials Interaction and High Heat Flux Materials and Components Task Groups. A list of contributing topics is: PPPL update, ATF update, Los Alamos RFP program update, status of DIII-D, PMI graphite studies at ORNL, PMI studies for low atomic number materials, high heat flux materials issues, high heat flux testing program, particle confinement in tokamaks, helium self pumping, self-regenerating coatings technical planning activity and international collaboration update

  17. Neuronal SH2B1 is essential for controlling energy and glucose homeostasis

    OpenAIRE

    Ren, Decheng; Zhou, Yingjiang; Morris, David; Li, Minghua; Li, Zhiqin; Rui, Liangyou

    2007-01-01

    SH2B1 (previously named SH2-B), a cytoplasmic adaptor protein, binds via its Src homology 2 (SH2) domain to a variety of protein tyrosine kinases, including JAK2 and the insulin receptor. SH2B1-deficient mice are obese and diabetic. Here we demonstrated that multiple isoforms of SH2B1 (α, β, γ, and/or δ) were expressed in numerous tissues, including the brain, hypothalamus, liver, muscle, adipose tissue, heart, and pancreas. Rat SH2B1β was specifically expressed in neural tissue in SH2B1-tran...

  18. Chemical and microstructural characterizations of plasma polymer films by time-of-flight secondary ion mass spectrometry and principal component analysis

    Science.gov (United States)

    Cossement, Damien; Renaux, Fabian; Thiry, Damien; Ligot, Sylvie; Francq, Rémy; Snyders, Rony

    2015-11-01

    It is accepted that the macroscopic properties of functional plasma polymer films (PPF) are defined by their functional density and their crosslinking degree (χ) which are quantities that most of the time behave in opposite trends. If the PPF chemistry is relatively easy to evaluate, it is much more challenging for χ. This paper reviews the recent work developed in our group on the application of principal component analysis (PCA) to time-of-flight secondary ion mass spectrometric (ToF-SIMS) positive spectra data in order to extract the relative cross-linking degree (χ) of PPF. NH2-, COOR- and SH-containing PPF synthesized in our group by plasma enhanced chemical vapor deposition (PECVD) varying the applied radiofrequency power (PRF), have been used as model surfaces. For the three plasma polymer families, the scores of the first computed principal component (PC1) highlighted significant differences in the chemical composition supported by X-Ray photoelectron spectroscopy (XPS) data. The most important fragments contributing to PC1 (loadings > 90%) were used to compute an average C/H ratio index for samples synthesized at low and high PRF. This ratio being an evaluation of χ, these data, accordingly to the literature, indicates an increase of χ with PRF excepted for the SH-PPF. These results have been cross-checked by the evaluation of functional properties of the plasma polymers namely a linear correlation with the stability of NH2-PPF in ethanol and a correlation with the mechanical properties of the COOR-PPF. For the SH-PPF family, the peculiar evolution of χ is supported by the understanding of the growth mechanism of the PPF from plasma diagnostic. The whole set of data clearly demonstrates the potential of the PCA method for extracting information on the microstructure of plasma polymers from ToF-SIMS measurements.

  19. Critical role of the Src homology 2 (SH2) domain of neuronal SH2B1 in the regulation of body weight and glucose homeostasis in mice.

    Science.gov (United States)

    Morris, David L; Cho, Kae Won; Rui, Liangyou

    2010-08-01

    SH2B1 is an SH2 domain-containing adaptor protein that plays a key role in the regulation of energy and glucose metabolism in both rodents and humans. Genetic deletion of SH2B1 in mice results in obesity and type 2 diabetes. Single-nucleotide polymorphisms in the SH2B1 loci and chromosomal deletions of the SH2B1 loci associate with obesity and insulin resistance in humans. In cultured cells, SH2B1 promotes leptin and insulin signaling by binding via its SH2 domain to phosphorylated tyrosines in Janus kinase 2 and the insulin receptor, respectively. Here we generated three lines of mice to analyze the role of the SH2 domain of SH2B1 in the central nervous system. Transgenic mice expressing wild-type, SH2 domain-defective (R555E), or SH2 domain-alone (DeltaN503) forms of SH2B1 specifically in neurons were crossed with SH2B1 knockout mice to generate KO/SH2B1, KO/R555E, or KO/DeltaN503 compound mutant mice. R555E had a replacement of Arg(555) with Glu within the SH2 domain. DeltaN503 contained an intact SH2 domain but lacked amino acids 1-503. Neuron-specific expression of recombinant SH2B1, but not R555E or DeltaN503, corrected hyperphagia, obesity, glucose intolerance, and insulin resistance in SH2B1 null mice. Neuron-specific expression of R555E in wild-type mice promoted obesity and insulin resistance. These results indicate that in addition to the SH2 domain, N-terminal regions of neuronal SH2B1 are also required for the maintenance of normal body weight and glucose metabolism. Additionally, mutations in the SH2 domain of SH2B1 may increase the susceptibility to obesity and type 2 diabetes in a dominant-negative manner.

  20. Preparation of crystals for characterizing the Grb7 SH2 domain before and after complex formation with a bicyclic peptide antagonist.

    Science.gov (United States)

    Ambaye, Nigus D; Gunzburg, Menachem J; Traore, Daouda A K; Del Borgo, Mark P; Perlmutter, Patrick; Wilce, Matthew C J; Wilce, Jacqueline A

    2014-02-01

    Human growth factor receptor-bound protein 7 (Grb7) is an adapter protein involved in cell growth, migration and proliferation. It is now recognized that Grb7 is an emerging therapeutic target in specific cancer subtypes. Recently, the discovery of a bicyclic peptide inhibitor that targets the Grb7 SH2 domain, named G7-B1, was reported. In an attempt to probe the foundation of its interaction with Grb7, the crystallization and preliminary data collection of both the apo and G7-B1-bound forms of the Grb7 SH2 domain are reported here. Diffraction-quality crystals were obtained using the hanging-drop vapour-diffusion method. After several rounds of microseeding, crystals of the apo Grb7 SH2 domain were obtained that diffracted to 1.8 Å resolution, while those of the G7-B1-Grb7 SH2 domain complex diffracted to 2.2 Å resolution. The apo Grb7 SH2 domain crystallized in the trigonal space group P63, whereas the G7-B1-Grb7 SH2 domain complex crystallized in the monoclinic space group P21. The experimental aspects of crystallization, crystal optimization and data collection and the preliminary data are reported.

  1. Superbinder SH2 domains act as antagonists of cell signaling.

    Science.gov (United States)

    Kaneko, Tomonori; Huang, Haiming; Cao, Xuan; Li, Xing; Li, Chengjun; Voss, Courtney; Sidhu, Sachdev S; Li, Shawn S C

    2012-09-25

    Protein-ligand interactions mediated by modular domains, which often play important roles in regulating cellular functions, are generally of moderate affinities. We examined the Src homology 2 (SH2) domain, a modular domain that recognizes phosphorylated tyrosine (pTyr) residues, to investigate how the binding affinity of a modular domain for its ligand influences the structure and cellular function of the protein. We used the phage display method to perform directed evolution of the pTyr-binding residues in the SH2 domain of the tyrosine kinase Fyn and identified three amino acid substitutions that critically affected binding. We generated three SH2 domain triple-point mutants that were "superbinders" with much higher affinities for pTyr-containing peptides than the natural domain. Crystallographic analysis of one of these superbinders revealed that the superbinder SH2 domain recognized the pTyr moiety in a bipartite binding mode: A hydrophobic surface encompassed the phenyl ring, and a positively charged site engaged the phosphate. When expressed in mammalian cells, the superbinder SH2 domains blocked epidermal growth factor receptor signaling and inhibited anchorage-independent cell proliferation, suggesting that pTyr superbinders might be explored for therapeutic applications and useful as biological research tools. Although the SH2 domain fold can support much higher affinity for its ligand than is observed in nature, our results suggest that natural SH2 domains are not optimized for ligand binding but for specificity and flexibility, which are likely properties important for their function in signaling and regulatory processes.

  2. [Effect of Recombinant Adenovirus AdE-SH2-Caspase 8 on the Apoptosis of Imatinib-resistant K562/G01 Cell Line].

    Science.gov (United States)

    Wang, Lin; Fei, Chang; Huang, Zheng-Lan; Li, Hui; Liu, Zhang-Lin; Feng, Wen-Li

    2015-08-01

    To investigate the effect of SH2-Caspase 8 fusion protein expressed by recombinant adenovirus AdE-SH2-Caspase8-HA-GFP (SC) on the apoptosis of K562/G01 cell line, which is a BCR/ABL positive chronic myeloid leukemia cell line and resistant to imatinib. The K562/G01 cell line was infected with AdE-SH2-Caspase 8-HA-GFP adenovirus (SC), then the cells were divided into 3 groups: AdE-SH2m-Caspase 8-HA-GFP (SmC) group, AdE-GFP (CMV) group and PBS group as control. The infection efficiency was observed under fluorescent microscopy and by flow cytometry. The expression of fusion protein SH2-Caspase 8-HA was measured by Western blot. The morphology of the cells detected by Wright's staining. The apoptosis of the cells were detected by flow cytometry and DNA ladder. The expression of Caspase 3 and PARP were detected by Western blot. The infection efficiency of SC on K562/G01 cells was high which was confirmed by fluorescent microscopy and FCM. SH2-Caspase 8-HA fusion protein were expressed correctly in K562/G01 cells. After treatment with SC the apoptosis of K562/G01 cells could be observed by microscopy. The result of FCM showed that early apoptosis of K562/G01 cells increased significantly as compared with control groups (P SH2-Caspase 8 fusion protein can induces the apoptosis of K562/G01 cells.

  3. Neuronal SH2B1 is essential for controlling energy and glucose homeostasis.

    Science.gov (United States)

    Ren, Decheng; Zhou, Yingjiang; Morris, David; Li, Minghua; Li, Zhiqin; Rui, Liangyou

    2007-02-01

    SH2B1 (previously named SH2-B), a cytoplasmic adaptor protein, binds via its Src homology 2 (SH2) domain to a variety of protein tyrosine kinases, including JAK2 and the insulin receptor. SH2B1-deficient mice are obese and diabetic. Here we demonstrated that multiple isoforms of SH2B1 (alpha, beta, gamma, and/or delta) were expressed in numerous tissues, including the brain, hypothalamus, liver, muscle, adipose tissue, heart, and pancreas. Rat SH2B1beta was specifically expressed in neural tissue in SH2B1-transgenic (SH2B1(Tg)) mice. SH2B1(Tg) mice were crossed with SH2B1-knockout (SH2B1(KO)) mice to generate SH2B1(TgKO) mice expressing SH2B1 only in neural tissue but not in other tissues. Systemic deletion of the SH2B1 gene resulted in metabolic disorders in SH2B1(KO) mice, including hyperlipidemia, leptin resistance, hyperphagia, obesity, hyperglycemia, insulin resistance, and glucose intolerance. Neuron-specific restoration of SH2B1beta not only corrected the metabolic disorders in SH2B1(TgKO) mice, but also improved JAK2-mediated leptin signaling and leptin regulation of orexigenic neuropeptide expression in the hypothalamus. Moreover, neuron-specific overexpression of SH2B1 dose-dependently protected against high-fat diet-induced leptin resistance and obesity. These observations suggest that neuronal SH2B1 regulates energy balance, body weight, peripheral insulin sensitivity, and glucose homeostasis at least in part by enhancing hypothalamic leptin sensitivity.

  4. Steering elastic SH waves in an anomalous way by metasurface

    Science.gov (United States)

    Cao, Liyun; Yang, Zhichun; Xu, Yanlong

    2018-03-01

    Metasurface, which does not exist in nature, has exhibited exotic essence on the manipulation of both electromagnetic and acoustic waves. In this paper, the concept of metasurface is extended to the field of elastic SH waves, and the anomalous refractions of SH waves across the designed elastic SH wave metasurfaces (SHWMs) are demonstrated numerically. Firstly, a SHWM is designed with supercells, each supercell is composed of four subunits. It is demonstrated that this configuration has the ability of deflecting the vertical and oblique incident waves in an arbitrary desired direction. Then, a unique SHWM with supercell composed of only two subunits is designed. Numerical simulation shows its ability of splitting the vertical and oblique incident waves into two tunable transmitted wave beams, respectively. In the process of steering SH waves, it is also found that two kinds of leakages of transmitted waves across the designed SHWM will occur in some particular situations, which will affect the desired transmitted wave. The mechanisms of the leakages, which are different from that of the common high-order diffraction mentioned in existing literatures, are revealed. The current study can offer theoretical guidance not only for designing devices of directional ultrasonic detection and splitting SH waves but also for steering other kinds of classical waves.

  5. Simultaneous determination of platinum group elements and rhenium in rock samples using isotope dilution inductively coupled plasma mass spectrometry after cation exchange separation followed by solvent extraction

    International Nuclear Information System (INIS)

    Shinotsuka, Kazunori; Suzuki, Katsuhiko

    2007-01-01

    A simple and precise determination method for platinum group elements (PGEs) and Re in rock samples was developed using isotope dilution coupled with inductively coupled plasma mass spectrometry (ID-ICP-MS). Cation exchange separation was employed for simplicity, because it is applicable to group separation and simultaneous isotopic measurement in contrast with the widely used anion exchange separation which entails separate elution. However, its application to ID-ICP-MS has been limited due to spectral interferences from impurities retained in the PGE fraction even after ion chromatography. To overcome this limitation, solvent extraction using N-benzoyl-N-phenylhydroxylamine (BPHA) in chloroform was successfully applied for further purification. After the examination of optimum experimental parameters in cation exchange separation and solvent extraction using synthetic PGE solution, the established procedure was applied to the determination of PGEs and Re in some geochemical reference materials. The obtained results agreed well with the literature data determined using the different digestion methods (NiS fire assay and the use of a high-pressure asher) within the analytical uncertainties of each other. Significant difference in reproducibility between Ru, Ir, Pt and Os group, and Pd and Re group was observed in the results for BHVO-2 and JA-2. By considering the error factors affecting analytical reproducibility, we concluded that the difference is ascribed to the sample heterogeneity of minor minerals enriched in Ru, Ir, Pt and Os

  6. Preferred SH3 domain partners of ADAM metalloproteases include shared and ADAM-specific SH3 interactions.

    Directory of Open Access Journals (Sweden)

    Iivari Kleino

    Full Text Available A disintegrin and metalloproteinases (ADAMs constitute a protein family essential for extracellular signaling and regulation of cell adhesion. Catalytic activity of ADAMs and their predicted potential for Src-homology 3 (SH3 domain binding show a strong correlation. Here we present a comprehensive characterization of SH3 binding capacity and preferences of the catalytically active ADAMs 8, 9, 10, 12, 15, 17, and 19. Our results revealed several novel interactions, and also confirmed many previously reported ones. Many of the identified SH3 interaction partners were shared by several ADAMs, whereas some were ADAM-specific. Most of the ADAM-interacting SH3 proteins were adapter proteins or kinases, typically associated with sorting and endocytosis. Novel SH3 interactions revealed in this study include TOCA1 and CIP4 as preferred partners of ADAM8, and RIMBP1 as a partner of ADAM19. Our results suggest that common as well as distinct mechanisms are involved in regulation and execution of ADAM signaling, and provide a useful framework for addressing the pathways that connect ADAMs to normal and aberrant cell behavior.

  7. Doppler limited rotational transitions of OH and SH radicals measured by continuous-wave terahertz photomixing

    Science.gov (United States)

    Eliet, Sophie; Martin-Drumel, Marie-Aline; Guinet, Mickaël; Hindle, Francis; Mouret, Gaël; Bocquet, Robin; Cuisset, Arnaud

    2011-12-01

    A continuous-wave terahertz (CW-THz) source generated by photomixing has been employed to detect and quantify radicals produced in a cold plasma probing their spin-rotation transitions. Due to their dual interest for both atmospherists and astrophysicists, the hydroxyl OH and the mercapto SH radicals have been chosen. The photomixing technique which can access the largest range of THz frequencies of any known coherent source, allowed to resolve the Doppler-limited hyperfine transitions of OH in the 2.5 THz frequency region. Line profile analysis of the hyperfine components demonstrated that OH radicals have been detected in this region at a ppm level at a temperature close to 490 K. The hyperfine structure of SH has been resolved for the first time above 1 THz. Ten new frequency transitions have been measured in the 1.3-2.6 THz frequency range using the CW-THz synthesizer based on a frequency comb. With relative uncertainties better than 10 -7, the CW-THz frequencies measured in this study are now competitive with those measured by other instruments such as frequency multiplication chains or FT-FIR spectrometers and are now capable to improve the predictions of the complete high-resolution spectra of these radicals collected in the atmospheric and astrophysical spectroscopic databases. versioncorrigeeAC 2011-07-18 17:32 2011 Arnaud Cuisset.

  8. Modeling cometary photopolarimetric characteristics with Sh-matrix method

    Science.gov (United States)

    Kolokolova, L.; Petrov, D.

    2017-12-01

    Cometary dust is dominated by particles of complex shape and structure, which are often considered as fractal aggregates. Rigorous modeling of light scattering by such particles, even using parallelized codes and NASA supercomputer resources, is very computer time and memory consuming. We are presenting a new approach to modeling cometary dust that is based on the Sh-matrix technique (e.g., Petrov et al., JQSRT, 112, 2012). This method is based on the T-matrix technique (e.g., Mishchenko et al., JQSRT, 55, 1996) and was developed after it had been found that the shape-dependent factors could be separated from the size- and refractive-index-dependent factors and presented as a shape matrix, or Sh-matrix. Size and refractive index dependences are incorporated through analytical operations on the Sh-matrix to produce the elements of T-matrix. Sh-matrix method keeps all advantages of the T-matrix method, including analytical averaging over particle orientation. Moreover, the surface integrals describing the Sh-matrix elements themselves can be solvable analytically for particles of any shape. This makes Sh-matrix approach an effective technique to simulate light scattering by particles of complex shape and surface structure. In this paper, we present cometary dust as an ensemble of Gaussian random particles. The shape of these particles is described by a log-normal distribution of their radius length and direction (Muinonen, EMP, 72, 1996). Changing one of the parameters of this distribution, the correlation angle, from 0 to 90 deg., we can model a variety of particles from spheres to particles of a random complex shape. We survey the angular and spectral dependencies of intensity and polarization resulted from light scattering by such particles, studying how they depend on the particle shape, size, and composition (including porous particles to simulate aggregates) to find the best fit to the cometary observations.

  9. Solitons, Lie Group Analysis and Conservation Laws of a (3+1)-Dimensional Modified Zakharov-Kuznetsov Equation in a Multicomponent Magnetised Plasma

    Science.gov (United States)

    Du, Xia-Xia; Tian, Bo; Chai, Jun; Sun, Yan; Yuan, Yu-Qiang

    2017-11-01

    In this paper, we investigate a (3+1)-dimensional modified Zakharov-Kuznetsov equation, which describes the nonlinear plasma-acoustic waves in a multicomponent magnetised plasma. With the aid of the Hirota method and symbolic computation, bilinear forms and one-, two- and three-soliton solutions are derived. The characteristics and interaction of the solitons are discussed graphically. We present the effects on the soliton's amplitude by the nonlinear coefficients which are related to the ratio of the positive-ion mass to negative-ion mass, number densities, initial densities of the lower- and higher-temperature electrons and ratio of the lower temperature to the higher temperature for electrons, as well as by the dispersion coefficient, which is related to the ratio of the positive-ion mass to the negative-ion mass and number densities. Moreover, using the Lie symmetry group theory, we derive the Lie point symmetry generators and the corresponding symmetry reductions, through which certain analytic solutions are obtained via the power series expansion method and the (G'/G) expansion method. We demonstrate that such an equation is strictly self-adjoint, and the conservation laws associated with the Lie point symmetry generators are derived.

  10. Study of technical, environmental and economic assessment of the process of waste gasification by plasma torch of PlascoEnergy Group - Report

    International Nuclear Information System (INIS)

    Kunegel, Andre

    2009-10-01

    This study aims at assessing technical, environmental and economic performance of a technology developed by PlascoEnergy Group in its application to French household and similar wastes, at analysing PlascoEnergy project for their processing in a city of southern France, and at providing a global analysis of the appropriateness of plasma torch technologies to the gasification of these wastes, of other wastes to be defined, biomass and so on. After a presentation of the technology and a reference to a demonstrator project in Ottawa, the report presents the PlascoEnergy Company, the French installation and its differences with the demonstration project. Based on documents provided by PlascoEnergy, it reports an analysis of various critical points (waste preparation, gasification, waste introduction, waste movements in the oven, hot air recovery, gasification performance, syngas processing, engines, valorisation and removal of solid residues). Performance of the Ottawa plant are presented and commented. The use of the plasma torch technology in waste processing is described

  11. In-Solution SH2 Domain Binding Assay Based on Proximity Ligation.

    Science.gov (United States)

    Machida, Kazuya

    2017-01-01

    Protein-protein interactions mediated by SH2 domains confer specificity in tyrosine kinase pathways. Traditional assays for assessing interactions between an SH2 domain and its interacting protein such as far-Western and pull-down are inherently low throughput. We developed SH2-PLA, an in-solution SH2 domain binding assay, that takes advantage of the speed and sensitivity of proximity ligation and real-time PCR. SH2-PLA allows for rapid assessment of SH2 domain binding to a target protein using only a few microliters of cell lysate, thereby making it an attractive new tool to study tyrosine kinase signaling.

  12. Two-state dynamics of the SH3-SH2 tandem of Abl kinase and the allosteric role of the N-cap.

    Science.gov (United States)

    Corbi-Verge, Carles; Marinelli, Fabrizio; Zafra-Ruano, Ana; Ruiz-Sanz, Javier; Luque, Irene; Faraldo-Gómez, José D

    2013-09-03

    The regulation and localization of signaling enzymes is often mediated by accessory modular domains, which frequently function in tandems. The ability of these tandems to adopt multiple conformations is as important for proper regulation as the individual domain specificity. A paradigmatic example is Abl, a ubiquitous tyrosine kinase of significant pharmacological interest. SH3 and SH2 domains inhibit Abl by assembling onto the catalytic domain, allosterically clamping it in an inactive state. We investigate the dynamics of this SH3-SH2 tandem, using microsecond all-atom simulations and differential scanning calorimetry. Our results indicate that the Abl tandem is a two-state switch, alternating between the conformation observed in the structure of the autoinhibited enzyme and another configuration that is consistent with existing scattering data for an activated form. Intriguingly, we find that the latter is the most probable when the tandem is disengaged from the catalytic domain. Nevertheless, an amino acid stretch preceding the SH3 domain, the so-called N-cap, reshapes the free-energy landscape of the tandem and favors the interaction of this domain with the SH2-kinase linker, an intermediate step necessary for assembly of the autoinhibited complex. This allosteric effect arises from interactions between N-cap and the SH2 domain and SH3-SH2 connector, which involve a phosphorylation site. We also show that the SH3-SH2 connector plays a determinant role in the assembly equilibrium of Abl, because mutations thereof hinder the engagement of the SH2-kinase linker. These results provide a thermodynamic rationale for the involvement of N-cap and SH3-SH2 connector in Abl regulation and expand our understanding of the principles of modular domain organization.

  13. Two-state dynamics of the SH3–SH2 tandem of Abl kinase and the allosteric role of the N-cap

    Science.gov (United States)

    Corbi-Verge, Carles; Marinelli, Fabrizio; Zafra-Ruano, Ana; Ruiz-Sanz, Javier; Luque, Irene; Faraldo-Gómez, José D.

    2013-01-01

    The regulation and localization of signaling enzymes is often mediated by accessory modular domains, which frequently function in tandems. The ability of these tandems to adopt multiple conformations is as important for proper regulation as the individual domain specificity. A paradigmatic example is Abl, a ubiquitous tyrosine kinase of significant pharmacological interest. SH3 and SH2 domains inhibit Abl by assembling onto the catalytic domain, allosterically clamping it in an inactive state. We investigate the dynamics of this SH3–SH2 tandem, using microsecond all-atom simulations and differential scanning calorimetry. Our results indicate that the Abl tandem is a two-state switch, alternating between the conformation observed in the structure of the autoinhibited enzyme and another configuration that is consistent with existing scattering data for an activated form. Intriguingly, we find that the latter is the most probable when the tandem is disengaged from the catalytic domain. Nevertheless, an amino acid stretch preceding the SH3 domain, the so-called N-cap, reshapes the free-energy landscape of the tandem and favors the interaction of this domain with the SH2-kinase linker, an intermediate step necessary for assembly of the autoinhibited complex. This allosteric effect arises from interactions between N-cap and the SH2 domain and SH3–SH2 connector, which involve a phosphorylation site. We also show that the SH3–SH2 connector plays a determinant role in the assembly equilibrium of Abl, because mutations thereof hinder the engagement of the SH2-kinase linker. These results provide a thermodynamic rationale for the involvement of N-cap and SH3–SH2 connector in Abl regulation and expand our understanding of the principles of modular domain organization. PMID:23959873

  14. Degree of functionalization and stability of fluorine groups fixed to carbon nanotubes and graphite nanoplates by CF{sub 4} microwave plasma

    Energy Technology Data Exchange (ETDEWEB)

    Abdelkader-Fernández, V.K.; Morales-Lara, F. [Departamento de Química Inorgánica, Facultad de Ciencias, Universidad de Granada, 18071 Granada (Spain); Melguizo, M.; García-Gallarín, C.; López-Garzón, R.; Godino-Salido, M.L. [Departamento de Química Inorgánica y Orgánica, Facultad de Ciencias Experimentales, Universidad de Jaén, 23071 Jaén (Spain); López-Garzón, F.J., E-mail: flopez@ugr.es [Departamento de Química Inorgánica, Facultad de Ciencias, Universidad de Granada, 18071 Granada (Spain); Domingo-García, M.; Pérez-Mendoza, M.J. [Departamento de Química Inorgánica, Facultad de Ciencias, Universidad de Granada, 18071 Granada (Spain)

    2015-12-01

    Highlights: • The surface area of GNPs and MWCNTs determines the degree of fluorination by plasma. • Fluorine is bound to carbon atoms in up to eight chemical environments. • The stability of the fluorine groups varies in a wide range of temperature. • The electronic properties of MWCNTs are changed as a consequence of fluorination. • The textural characteristics of the materials are not changed after fluorination. - Abstract: The fluorination of graphite nanoplates (GNPs) and multi-wall carbon nanotubes (MWCNTs) by CF{sub 4} cold plasma is reported. The aim is to analyze the influence of the textural characteristics in the degree of fluorination and in the thermal stability of the fluorine groups. We have used thermal programmed desorption which clearly discriminates the nature of the desorbing species and their stability. The degree of fluorination of both materials is similar up to 20 min of treatment and then it decreases in GNPs at longer treatments. Nevertheless, the fluorine content in MWCNTs keeps increasing after 45 min. This different evolution of the fluorination degree with the time is related to the surface areas. The fluorine bonding is produced not only in defects and irregularities but also on the external graphene sheets of both materials, and it results in up to eight different chemical environments having different thermal stabilities from 150 °C up to temperatures higher than 900 °C. The fluorination increases the electronic states near the Fermi level of the nanotubes whereas it does not affect the electronic properties of graphite nanoplates. It is shown that no intercalation compounds are formed and that the textural characteristics of the materials remain unchanged after fluorination.

  15. Lipid domains in intact fiber-cell plasma membranes isolated from cortical and nuclear regions of human eye lenses of donors from different age groups.

    Science.gov (United States)

    Raguz, Marija; Mainali, Laxman; O'Brien, William J; Subczynski, Witold K

    2015-03-01

    The results reported here clearly document changes in the properties and the organization of fiber-cell membrane lipids that occur with age, based on electron paramagnetic resonance (EPR) analysis of lens membranes of clear lenses from donors of age groups from 0 to 20, 21 to 40, and 61 to 80 years. The physical properties, including profiles of the alkyl chain order, fluidity, hydrophobicity, and oxygen transport parameter, were investigated using EPR spin-labeling methods, which also provide an opportunity to discriminate coexisting lipid domains and to evaluate the relative amounts of lipids in these domains. Fiber-cell membranes were found to contain three distinct lipid environments: bulk lipid domain, which appears minimally affected by membrane proteins, and two domains that appear due to the presence of membrane proteins, namely boundary and trapped lipid domains. In nuclear membranes the amount of boundary and trapped phospholipids as well as the amount of cholesterol in trapped lipid domains increased with the donors' age and was greater than that in cortical membranes. The difference between the amounts of lipids in domains uniquely formed due to the presence of membrane proteins in nuclear and cortical membranes increased with the donors' age. It was also shown that cholesterol was to a large degree excluded from trapped lipid domains in cortical membranes. It is evident that the rigidity of nuclear membranes was greater than that of cortical membranes for all age groups. The amount of lipids in domains of low oxygen permeability, mainly in trapped lipid domains, were greater in nuclear than cortical membranes and increased with the age of donors. These results indicate that the nuclear fiber cell plasma membranes were less permeable to oxygen than cortical membranes and become less permeable to oxygen with age. In clear lenses, age-related changes in the lens lipid and protein composition and organization appear to occur in ways that increase fiber

  16. [Mechanism Study of the Smectite-OR-SH Compound for Reducing Cadmium Uptake by Plants in Contaminated Soils].

    Science.gov (United States)

    Zeng, Yan-jun; Zhou, Zhi-jun; Zhao, Qiu-xiang

    2015-06-01

    Adsorption and desorption experiments, pot experiments and characterization test were performed to investigate the immobilization effect and mechanism of the smectite-OR-SH compound for reducing cadmium uptake by plants in contaminated soils. The results showed that the saturated adsorption capacity for the adsorption of Cd2+ on smectite raised distinctly after functionalized. The adsorption of Cd2+ on smectite-OR-SH compound was very stable and it was difficult for Cd2+ to be desorbed from it. Crop yields promoted differently in original soil, Cd 3 mg x kg(-1) soil and Cd 10 mg x kg(-1) soil after adding the smectite-OR-SH compound. And the cadmium content of the cabbage reduced 61.00%, 62.10% and 83.73% respectively compare with the control. Characterization test analysis showed that Cd was adsorbed by the compound successfully and ligand interaction occurred between Cd and the thiol group. Floc amount on the compound surface increased correspondingly. In addition to electrostatic adsorption, ion exchange and hydroxyl ligand adsorption, the reaction mechanism of smectite-OR-SH compound with Cd was mainly sulfhydryl ligand adsorption.

  17. Al-Shāṭibīs sufismekritik:

    DEFF Research Database (Denmark)

    Riexinger, Martin Thomas

    2016-01-01

    The faqīh (Islamic legal scholar) al-Shāṭibī (d. 1388) from Granada is primarily known for his innovative approach within the field of legal theory (uṣūl al-fiqh). However, he dedicated much attention to the criticism of sufism. But like other Islamic scholars who opposed Sufism he did...

  18. Hiding State in CλaSH Hardware Descriptions

    NARCIS (Netherlands)

    Gerards, Marco Egbertus Theodorus; Baaij, C.P.R.; Kuper, Jan; Kooijman, Matthijs

    Synchronous hardware can be modelled as a mapping from input and state to output and a new state, such mappings are referred to as transition functions. It is natural to use a functional language to implement transition functions. The CaSH compiler is capable of translating transition functions to

  19. Construction of lentiviral shRNA expression vector targeting ...

    African Journals Online (AJOL)

    DNA oligo was cloned into lentiviral expression vector, and then polymerase chain reaction (PCR) and sequencing analyses were conducted to verify the constructs. The verified vectors were co-transfected into 293FT cells that could produce lentiviral. shRNA lentiviruses from the selected constructs were propagated and ...

  20. Construction of lentiviral shRNA expression vector targeting ...

    African Journals Online (AJOL)

    ajl yemi

    2011-10-26

    Oct 26, 2011 ... was then selected, while the titer of lentiviral packing PLD2-shRNA was 3.47 × 104 TU/ml and the virus was successfully ... MATERIALS AND METHODS .... such as: transfecting cells not only in mitotic active phase but also in ...

  1. Calibration of the SH134-20 Standard Gain Horn

    DEFF Research Database (Denmark)

    Pivnenko, Sergey; Breinbjerg, Olav

    This report documents the measurement of the linearly polarized SH134-20 Standard Gain Horn. The measurement comprises on-axis gain, on-axis polarization characteristics, and reflection coefficient at 111 frequencies in the frequency range from 22-33 GHz. The measurement was carried out at the DTU...

  2. Insights into Substrate Specificity of NlpC/P60 Cell Wall Hydrolases Containing Bacterial SH3 Domains

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Qingping; Mengin-Lecreulx, Dominique; Liu, Xueqian W.; Patin, Delphine; Farr, Carol L.; Grant, Joanna C.; Chiu, Hsiu-Ju; Jaroszewski, Lukasz; Knuth, Mark W.; Godzik, Adam; Lesley, Scott A.; Elsliger, Marc-André; Deacon, Ashley M.; Wilson, Ian A.

    2015-09-15

    ABSTRACT

    Bacterial SH3 (SH3b) domains are commonly fused with papain-like Nlp/P60 cell wall hydrolase domains. To understand how the modular architecture of SH3b and NlpC/P60 affects the activity of the catalytic domain, three putative NlpC/P60 cell wall hydrolases were biochemically and structurally characterized. These enzymes all have γ-d-Glu-A2pm (A2pm is diaminopimelic acid) cysteine amidase (ordl-endopeptidase) activities but with different substrate specificities. One enzyme is a cell wall lysin that cleaves peptidoglycan (PG), while the other two are cell wall recycling enzymes that only cleave stem peptides with an N-terminall-Ala. Their crystal structures revealed a highly conserved structure consisting of two SH3b domains and a C-terminal NlpC/P60 catalytic domain, despite very low sequence identity. Interestingly, loops from the first SH3b domain dock into the ends of the active site groove of the catalytic domain, remodel the substrate binding site, and modulate substrate specificity. Two amino acid differences at the domain interface alter the substrate binding specificity in favor of stem peptides in recycling enzymes, whereas the SH3b domain may extend the peptidoglycan binding surface in the cell wall lysins. Remarkably, the cell wall lysin can be converted into a recycling enzyme with a single mutation.

    IMPORTANCEPeptidoglycan is a meshlike polymer that envelops the bacterial plasma membrane and bestows structural integrity. Cell wall lysins and recycling enzymes are part of a set of lytic enzymes that target covalent bonds connecting the amino acid and amino sugar building blocks of the PG network. These hydrolases are involved in processes such as cell growth and division, autolysis, invasion, and PG turnover and recycling. To avoid cleavage of unintended substrates, these enzymes have very selective substrate specificities. Our biochemical and structural

  3. The adaptor Lnk (SH2B3): an emerging regulator in vascular cells and a link between immune and inflammatory signaling.

    Science.gov (United States)

    Devallière, Julie; Charreau, Béatrice

    2011-11-15

    A better knowledge of the process by which inflammatory extracellular signals are relayed from the plasma membrane to specific intracellular sites is a key step to understand how inflammation develops and how it is regulated. This review focuses on Lnk (SH2B3) a member, with SH2B1 and SH2B2, of the SH2B family of adaptor proteins that influences a variety of signaling pathways mediated by Janus kinase and receptor tyrosine kinases. SH2B adaptor proteins contain conserved dimerization, pleckstrin homology, and SH2 domains. Initially described as a regulator of hematopoiesis and lymphocyte differentiation, Lnk now emerges as a key regulator in hematopoeitic and non hematopoeitic cells such as endothelial cells (EC) moderating growth factor and cytokine receptor-mediated signaling. In EC, Lnk is a negative regulator of TNF signaling that reduce proinflammatory phenotype and prevent EC from apoptosis. Lnk is a modulator in integrin signaling and actin cytoskeleton organization in both platelets and EC with an impact on cell adhesion, migration and thrombosis. In this review, we discuss some recent insights proposing Lnk as a key regulator of bone marrow-endothelial progenitor cell kinetics, including the ability to cell growth, endothelial commitment, mobilization, and recruitment for vascular regeneration. Finally, novel findings also provided evidences that mutations in Lnk gene are strongly linked to myeloproliferative disorders but also autoimmune and inflammatory syndromes where both immune and vascular cells display a role. Overall, these studies emphasize the importance of the Lnk adaptor molecule not only as prognostic marker but also as potential therapeutic target. Copyright © 2011 Elsevier Inc. All rights reserved.

  4. The biologic role of ganglioside in neuronal differentiation--effects of GM1 ganglioside on human neuroblastoma SH-SY5Y cells.

    OpenAIRE

    Lee, M. C.; Lee, W. S.; Park, C. S.; Juhng, S. W.

    1994-01-01

    Human neuroblastoma SH-SY5Y cell is a cloned cell line which has many attractive features for the study of neuronal proliferation and neurite outgrowth, because it has receptors for insulin, IGF-I and PDGF. Gangliosides are sialic acid containing glycosphingolipids which form an integral part of the plasma membrane of many mammalian cells. They inhibit cell growth mediated by tyrosine kinase receptors and ligand-stimulated tyrosine kinase activity, and autophosphorylation of EGF(epidermal gro...

  5. Shear horizontal wave excitation and reception with shear horizontal piezoelectric wafer active sensor (SH-PWAS)

    International Nuclear Information System (INIS)

    Kamal, A; Giurgiutiu, V

    2014-01-01

    This article discusses shear horizontal (SH) guided-waves that can be excited with shear type piezoelectric wafer active sensor (SH-PWAS). The paper starts with a review of state of the art SH waves modelling and their importance in non-destructive evaluation (NDE) and structural health monitoring (SHM). The basic piezoelectric sensing and actuation equations for the case of shear horizontal piezoelectric wafer active sensor (SH-PWAS) with electro-mechanical coupling coefficient d 35 are reviewed. Multiphysics finite element modelling (MP-FEM) was performed on a free SH-PWAS to show its resonance modeshapes. The actuation mechanism of the SH-PWAS is predicted by MP-FEM, and modeshapes of excited structure are presented. The structural resonances are compared with experimental measurements and showed good agreement. Analytical prediction of SH waves was performed. SH wave propagation experimental study was conducted between different combinations of SH-PWAS and regular in-plane PWAS transducers. Experimental results were compared with analytical predictions for aluminium plates and showed good agreement. 2D wave propagation effects were studied by MP-FEM. An analytical model was developed for SH wave power and energy. The normal mode expansion (NME) method was used to account for superpositioning multimodal SH waves. Modal participation factors were presented to show the contribution of every mode. Power and energy transfer between SH-PWAS and the structure was analyzed. Finally, we present simulations of our developed wave power and energy analytical models. (paper)

  6. Detection and characterization of partially unfolded oligomers of the SH3 domain of α-Spectrin

    NARCIS (Netherlands)

    Casares, S.; Sadqi, M.; López-Mayorga, O.; Conejero-Lara, F.; van Nuland, N.A.J.

    2004-01-01

    For the purpose of equilibrium and kinetic folding-unfolding studies, the SH3 domain of α-spectrin (spc-SH3) has long been considered a classic two-state folding protein. In this work we have indeed observed that the thermal unfolding curves of spc-SH3 measured at pH 3.0 by differential scanning

  7. Protein-phosphotyrosine proteome profiling by superbinder-SH2 domain affinity purification mass spectrometry, sSH2-AP-MS.

    Science.gov (United States)

    Tong, Jiefei; Cao, Biyin; Martyn, Gregory D; Krieger, Jonathan R; Taylor, Paul; Yates, Bradley; Sidhu, Sachdev S; Li, Shawn S C; Mao, Xinliang; Moran, Michael F

    2017-03-01

    Recently, "superbinder" SH2 domain variants with three amino acid substitutions (sSH2) were reported to have 100-fold or greater affinity for protein-phosphotyrosine (pY) than natural SH2 domains. Here we report a protocol in which His-tagged Src sSH2 efficiently captures pY-peptides from protease-digested HeLa cell total protein extracts. Affinity purification of pY-peptides by this method shows little bias for pY-proximal amino acid sequences, comparable to that achieved by using antibodies to pY, but with equal or higher yield. Superbinder-SH2 affinity purification mass spectrometry (sSH2-AP-MS) therefore provides an efficient and economical approach for unbiased pY-directed phospho-proteome profiling without the use of antibodies. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Transferência de fatores genéticos de resistência a Hemileia vastatrix para o cultivar mundo novo Transference of the genes SH2 and SH3 for resistance to Hemileia vastatrix to the mundo novo cultivar of C. arabica

    Directory of Open Access Journals (Sweden)

    A. Carvalho

    1977-01-01

    Full Text Available Cafeeiros portadores dos fatores genéticos SH2 ou SH2 e SH3, simultaneamente, que conferem resistência a várias raças de Hemileia vastatrix, foram cruzados com plantas selecionadas do cultivar mundo novo de Coffea arabica a fim de se obter, em F2, recombinações com resistência a esse patógeno e elevada produtividade. Analisaram-se 14 populações F2 segregando apenas para o fator SH2, oito para os fatores SH2 e HS3, e três populações que dão, em sua descendência, plantas do grupo A, resistentes a todas as raças do patógeno até agora conhecidas. De 22.356 cafeeiros originalmente plantados em ensaio, a duas mudas por cova, em parcelas casualizadas, fez-se uma primeira seleção deixando apenas um cafeeiro por cova, reduzindo-se para 11.178 as plantas em estudo. Com base no aspecto vegetativo, na produtividade, na ausência de defeitos nos frutos e na reação de resistência ao agente causal da ferrugem, realizaram-se sucessivas seleções escolhendo-se finalmente, apenas 100 cafeeiros do tipo mundo novo e resistentes a H. vastatrix para derivação das populações F2 e prosseguimento da seleção.Coffee trees homozygous for the alleles SH2 or SH2 and SH3 which confer resistance to several physiological races of Hemileia vastatrix, were crossed to selected plants of Mundo Novo cultivar of Coffea arabica and the F2 generations were studied aiming to develop new high yielding and resistant coffee recombinations. A complete randomized field trial was stablished including 14 F2 populations segregating for SH2, eight populations segregating for SH2 and SH3 genes, and three populations segregating for plants of the A group of reaction to the H. vastatrix attack. A total of 22,356 F2 plants were analysed. Based on the plant vigor, yield capacity, percentage of normal developed seeds and resistance reaction to H. vastatrix, three successive series of selection were undertaken leaving only 100 coffee trees for development of F3 populations

  9. Experimental plasma physics

    International Nuclear Information System (INIS)

    Dreicer, H.; Banton, M.E.; Ingraham, J.C.; Wittman, F.; Wright, B.L.

    1976-01-01

    The Experimental Plasma Physics group's main efforts continue to be directed toward the understanding of the mechanisms of electromagnetic energy absorption in a plasma, and the resultant plasma heating and energy transport. The high-frequency spectrum of plasma waves parametrically excited by the microwave signal at high powers has been measured. The absorption of a small test microwave signal in a plasma made parametrically unstable by a separate high-power driver microwave signal was also studied

  10. Characterization of breakpoint cluster region kinase and SH2-binding activities.

    Science.gov (United States)

    Afar, D E; Witte, O N

    1995-01-01

    BCR is an interesting signaling protein, whose cellular function is currently unknown. Its biochemical properties include serine kinase activity, SH2-binding activity, and a GTPase-activating activity. The SH2-binding activity is particularly interesting because it may link BCR to signaling pathways involving SH2-containing molecules. Since tyrosine phosphorylation of BCR has been detected in CML-derived cell lines and since tyrosine-phosphorylated BCR shows increased affinity toward certain SH2 domains, it seems particularly important to further characterize this activity. This chapter described a simple purification scheme for partial purification of BCR, which can be used to assess in vitro kinase and SH2-binding activities.

  11. Alternative splicing, gene localization, and binding of SH2-B to the insulin receptor kinase domain

    OpenAIRE

    Nelms, Keats; O'Neill, Thomas J.; Li, Shiqing; Hubbard, Stevan R.; Gustafson, Thomas A.; Paul, William E.

    1999-01-01

    . The SH2-B protein is an SH2-domain-containing molecule that interacts with a number of phosphorylated kinase and receptor molecules including the insulin receptor. Two isoforms of the SH2-B have been identified and have been proposed to arise through alternate splicing. Here we have identified a third isoform of the SH2-B protein, SH2-Bγ, that interacts specifically with the insulin receptor. This interaction required phosphorylation of residue Y1146 in the triple tyrosine motif within the ...

  12. Plasma concentration of high-mobility group box 1 (HMGB1) after 100 drop to vertical jumps and after a 1200-km bicycle race.

    Science.gov (United States)

    Behringer, M; Kilian, Y; Montag, J; Geesmann, B; Mester, J

    2016-01-01

    High-mobility group box 1 (HMGB1) has recently been reported to be involved in proinflammation and tissue repair. Therefore, we hypothesized that HMGB1 is released into the bloodstream after eccentric exercises or prolonged endurance activities. Blood samples from 11 participants that performed 100 drop to vertical jumps (DVJ) and from 10 participants that took part in the 1200-km 'Paris-Brest-Paris' bicycle race (PBP) were tested for HMGB1 and creatine kinase (CK) levels. CK increased after both DVJ (pre: 150.6 ± 81.5 U/L; post: 188.8 ± 95.5 U/L 8 h: 790.5 ± 346.4 U/L) and PBP (pre: 81.3 ± 36.4 U/L; post: 725.2 ± 229.5 U/L; 12 h: 535.8 ± 188.6 U/L), indicating membrane damage. However, HMGB1 plasma levels remained below the detection limit (78 pg/mL) of the applied enzyme-linked immunosorbent assay kit for all blood samples analysed. That is, neither high intensity eccentric exercises (DVJ) nor prolonged endurance events (PBP) seemed to affect HMGB1 levels in blood at selected time points.

  13. Noninvasive determination of fetal rh blood group, D antigen status by cell-free DNA analysis in maternal plasma: experience in a Brazilian population.

    Science.gov (United States)

    Chinen, Paulo Alexandre; Nardozza, Luciano Marcondes Machado; Martinhago, Ciro Dresch; Camano, Luiz; Daher, Silvia; Pares, David Baptista da Silva; Minett, Thais; Araujo Júnior, Edward; Moron, Antonio Fernandes

    2010-11-01

    We evaluated the diagnostic accuracy of Rh blood group, D antigen (RHD) fetal genotyping, using real-time polymerase chain reaction in maternal blood samples, in a racially mixed population. We performed a prospective study conducted between January 2006 and December 2007, analyzing fetal RHD genotype in the plasma of 102 D- pregnant women by real-time polymerase chain reaction, targeting exons 7 and 10 of the RHD gene. Genotype results were compared with cord blood phenotype obtained after delivery or before the first intrauterine transfusion when necessary. Most of the participants (75.5%) were under 28 weeks of pregnancy, and 87.5% had at least one relative of black ancestry. By combining amplification of two exons, the accuracy of genotyping was 98%, sensitivity was 100%, and specificity was 92%. The positive likelihood ratio was 12.5, and the negative likelihood ratio was 0. The two false-positive cases were confirmed to be pseudogene RHD by real-time polymerase chain reaction. There were no differences between the patients with positive or negative Coombs test ( P = 0.479). Determination of fetal RHD status in maternal peripheral blood was highly sensitive in this racially mixed population and was not influenced by the presence of antierythrocyte antibodies. © Thieme Medical Publishers.

  14. Chemical and microstructural characterizations of plasma polymer films by time-of-flight secondary ion mass spectrometry and principal component analysis

    International Nuclear Information System (INIS)

    Cossement, Damien; Renaux, Fabian; Thiry, Damien; Ligot, Sylvie; Francq, Rémy; Snyders, Rony

    2015-01-01

    Graphical abstract: - Highlights: • Plasma polymer films have a chemical selectivity and a cross-linking degree which are known to vary in opposite trends. • Three plasma polymers families were used as model organic layers for cross-linking evaluation by ToF-SIMS and principal component analysis. • The data were cross-checked with related functional properties that are known to depend on the cross-linking degree (stability in solvent, mechanical properties, …). • The suggested cross-linking evaluation method was validated for different families of plasma polymers demonstrating that it can be seen as a “general” method. - Abstract: It is accepted that the macroscopic properties of functional plasma polymer films (PPF) are defined by their functional density and their crosslinking degree (χ) which are quantities that most of the time behave in opposite trends. If the PPF chemistry is relatively easy to evaluate, it is much more challenging for χ. This paper reviews the recent work developed in our group on the application of principal component analysis (PCA) to time-of-flight secondary ion mass spectrometric (ToF-SIMS) positive spectra data in order to extract the relative cross-linking degree (χ) of PPF. NH_2-, COOR- and SH-containing PPF synthesized in our group by plasma enhanced chemical vapor deposition (PECVD) varying the applied radiofrequency power (P_R_F), have been used as model surfaces. For the three plasma polymer families, the scores of the first computed principal component (PC1) highlighted significant differences in the chemical composition supported by X-Ray photoelectron spectroscopy (XPS) data. The most important fragments contributing to PC1 (loadings > 90%) were used to compute an average C/H ratio index for samples synthesized at low and high P_R_F. This ratio being an evaluation of χ, these data, accordingly to the literature, indicates an increase of χ with P_R_F excepted for the SH-PPF. These results have been cross

  15. Chemical and microstructural characterizations of plasma polymer films by time-of-flight secondary ion mass spectrometry and principal component analysis

    Energy Technology Data Exchange (ETDEWEB)

    Cossement, Damien, E-mail: damien.cossement@materianova.be [Materia Nova Research Center, Parc Initialis, 1, Avenue Nicolas Copernic, B-7000 Mons (Belgium); Renaux, Fabian [Materia Nova Research Center, Parc Initialis, 1, Avenue Nicolas Copernic, B-7000 Mons (Belgium); Thiry, Damien; Ligot, Sylvie [Chimie des Interactions Plasma-Surface (ChIPS), CIRMAP, Université de Mons, 23 Place du Parc, B-7000 Mons (Belgium); Francq, Rémy; Snyders, Rony [Materia Nova Research Center, Parc Initialis, 1, Avenue Nicolas Copernic, B-7000 Mons (Belgium); Chimie des Interactions Plasma-Surface (ChIPS), CIRMAP, Université de Mons, 23 Place du Parc, B-7000 Mons (Belgium)

    2015-11-15

    Graphical abstract: - Highlights: • Plasma polymer films have a chemical selectivity and a cross-linking degree which are known to vary in opposite trends. • Three plasma polymers families were used as model organic layers for cross-linking evaluation by ToF-SIMS and principal component analysis. • The data were cross-checked with related functional properties that are known to depend on the cross-linking degree (stability in solvent, mechanical properties, …). • The suggested cross-linking evaluation method was validated for different families of plasma polymers demonstrating that it can be seen as a “general” method. - Abstract: It is accepted that the macroscopic properties of functional plasma polymer films (PPF) are defined by their functional density and their crosslinking degree (χ) which are quantities that most of the time behave in opposite trends. If the PPF chemistry is relatively easy to evaluate, it is much more challenging for χ. This paper reviews the recent work developed in our group on the application of principal component analysis (PCA) to time-of-flight secondary ion mass spectrometric (ToF-SIMS) positive spectra data in order to extract the relative cross-linking degree (χ) of PPF. NH{sub 2}-, COOR- and SH-containing PPF synthesized in our group by plasma enhanced chemical vapor deposition (PECVD) varying the applied radiofrequency power (P{sub RF}), have been used as model surfaces. For the three plasma polymer families, the scores of the first computed principal component (PC1) highlighted significant differences in the chemical composition supported by X-Ray photoelectron spectroscopy (XPS) data. The most important fragments contributing to PC1 (loadings > 90%) were used to compute an average C/H ratio index for samples synthesized at low and high P{sub RF}. This ratio being an evaluation of χ, these data, accordingly to the literature, indicates an increase of χ with P{sub RF} excepted for the SH-PPF. These results have

  16. Pilot investigation of the circadian plasma melatonin rhythm across the menstrual cycle in a small group of women with premenstrual dysphoric disorder.

    Directory of Open Access Journals (Sweden)

    Ari Shechter

    Full Text Available Women with premenstrual dysphoric disorder (PMDD experience mood deterioration and altered circadian rhythms during the luteal phase (LP of their menstrual cycles. Disturbed circadian rhythms may be involved in the development of clinical mood states, though this relationship is not fully characterized in PMDD. We therefore conducted an extensive chronobiological characterization of the melatonin rhythm in a small group of PMDD women and female controls. In this pilot study, participants included five women with PMDD and five age-matched controls with no evidence of menstrual-related mood disorders. Participants underwent two 24-hour laboratory visits, during the follicular phase (FP and LP of the menstrual cycle, consisting of intensive physiological monitoring under "unmasked", time-isolation conditions. Measures included visual analogue scale for mood, ovarian hormones, and 24-hour plasma melatonin. Mood significantly (P≤.03 worsened during LP in PMDD compared to FP and controls. Progesterone was significantly (P = .025 increased during LP compared to FP, with no between-group differences. Compared to controls, PMDD women had significantly (P<.05 decreased melatonin at circadian phases spanning the biological night during both menstrual phases and reduced amplitude of its circadian rhythm during LP. PMDD women also had reduced area under the curve of melatonin during LP compared to FP. PMDD women showed affected circadian melatonin rhythms, with reduced nocturnal secretion and amplitude during the symptomatic phase compared to controls. Despite our small sample size, these pilot findings support a role for disturbed circadian rhythms in affective disorders. Possible associations with disrupted serotonergic transmission are proposed.

  17. Fundamental modes of new dispersive SH-waves in ...

    Indian Academy of Sciences (India)

    [3] M Fiebig, V V Pavlov and R V Pisarev, J. Opt. Soc. Am. B 22(1), 96 (2005). [4] T Kimura, Ann. Rev. Condens. Matter Phys. 3(1), 93 (2012). [5] Ch-S Park and Sh Priya, Advances in condensed matter physics (Hindawi Publishing. Corporation, 2012) Vol. 2012, 12 pages. [6] R C Pullar, Prog. Mater. Sci. 57(7), 1191 (2012).

  18. Application of shRNA-containing herpes simplex virus type 1 (HSV-1)-based gene therapy for HSV-2-induced genital herpes.

    Science.gov (United States)

    Liu, Zhihong; Xiang, Yang; Wei, Zhun; Yu, Bo; Shao, Yong; Zhang, Jie; Yang, Hong; Li, Manmei; Guan, Ming; Wan, Jun; Zhang, Wei

    2013-11-01

    HSV-1-based vectors have been widely used to achieve targeted delivery of genes into the nervous system. In the current study, we aim to use shRNA-containing HSV-1-based gene delivery system for the therapy of HSV-2 infection. Guinea pigs were infected intravaginally with HSV-2 and scored daily for 100 days for the severity of vaginal disease. HSV-2 shRNA-containing HSV-1 was applied intravaginally daily between 8 and 14 days after HSV-2 challenge. Delivery of HSV-2 shRNA-containing HSV-1 had no effect on the onset of disease and acute virus shedding in animals, but resulted in a significant reduction in both the cumulative recurrent lesion days and the number of days with recurrent disease. Around half of the animals in the HSV-2 shRNA group did not develop recurrent disease 100 days post HSV-2 infection. In conclusion, HSV-2 shRNA-containing HSV-1 particles are effective in reducing the recurrence of genital herpes caused by HSV-2. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Purification, crystallization, small-angle X-ray scattering and preliminary X-ray diffraction analysis of the SH2 domain of the Csk-homologous kinase

    International Nuclear Information System (INIS)

    Gunn, Natalie J.; Gorman, Michael A.; Dobson, Renwick C. J.; Parker, Michael W.; Mulhern, Terrence D.

    2011-01-01

    The Src-homology 2 (SH2) domain of Csk-family protein tyrosine kinases acts as a conformational switch to regulate their catalytic activity, which in turn promotes the inhibition of their proto-oncogenic targets, the Src-family kinases. Here, the expression, purification, small-angle X-ray scattering and preliminary diffraction analysis of the SH2 domain of the Csk-homologous kinase is reported. The C-terminal Src kinase (Csk) and Csk-homologous kinase (CHK) are endogenous inhibitors of the proto-oncogenic Src family of protein tyrosine kinases (SFKs). Phosphotyrosyl peptide binding to their Src-homology 2 (SH2) domains activates Csk and CHK, enhancing their ability to suppress SFK signalling; however, the detailed mechanistic basis of this activation event is unclear. The CHK SH2 was expressed in Escherichia coli and the purified protein was characterized as monomeric by synchrotron small-angle X-ray scattering in-line with size-exclusion chromatography. The CHK SH2 crystallized in 0.2 M sodium bromide, 0.1 M bis-Tris propane pH 6.5 and 20% polyethylene glycol 3350 and the best crystals diffracted to ∼1.6 Å resolution. The crystals belonged to space group P2, with unit-cell parameters a = 25.8, b = 34.6, c = 63.2 Å, β = 99.4°

  20. Coloring Jupiter's clouds: Radiolysis of ammonium hydrosulfide (NH4SH)

    Science.gov (United States)

    Loeffler, Mark J.; Hudson, Reggie L.

    2018-03-01

    Here we present our recent studies on the color and spectral reflectance changes induced by ∼0.9 MeV proton irradiation of ammonium hydrosulfide, NH4SH, a compound predicted to be an important tropospheric cloud component of Jupiter and other giant planets. Ultraviolet-visible spectroscopy was used to observe and identify reaction products in the ice sample and digital photography was used to document the corresponding color changes at 10-160 K. Our experiments clearly show that the resulting color of the sample depends not only on the irradiation dose but also the irradiation temperature. Furthermore, unlike in our most recent studies of irradiation of NH4SH at 120 K, which showed that higher irradiation doses caused the sample to appear green, the lower temperature studies now show that the sample becomes red after irradiation. However, comparison of these lower temperature spectra over the entire spectral range observed by HST shows that even though the color and spectrum resemble the color and spectrum of the GRS, there is still enough difference to suggest that another component may be needed to adequately fit spectra of the GRS and other red regions of Jupiter's clouds. Regardless, the presence of NH4SH in the atmosphere of Jupiter and other gas giants, combined with this compound's clear alteration via radiolysis, suggests that its contribution to the ultraviolet-visible spectra of any of these object's clouds is significant.

  1. Wind rotor power station BONI-ShHV

    International Nuclear Information System (INIS)

    Bolotov, A.V.

    1999-01-01

    Wind rotor power station (WRPS) BONI-ShHV has following advantages : the increase of installation stability by rise of wind velocity and rotation speed of rotor due to gyroscopic effect; the absence noise and vibration; the safety for birds and animals; ability of compact installation and creation of series of wind power dams with higher capacity; the simplicity and fast assembling and putting into operation. The price of 1 k W of installing capacity is lower about 2.5-3 times compare to usual WRPS due to simple kinematic scheme. WRPS has high specific output of electrical energy due to use of low and long existing wind velocity and due to short storms, giving greater power. It has ability to be replayed when average annual wind velocity is above 5.5 m/s in comparison with propeller WRPS, which are never repaying. WRPS BONI-ShHV are made on the plants of Republic of Kazakhstan, and tested in wind velocity range up 45 m/s, have experience of 3 years of operation, showing their reliability and effectiveness. The repayment period of individual WRPS BONI-0.5/6 ShHV is from 10 month to 1 year depending on average annual velocity

  2. Preoperative plasma plasminogen activator inhibitor type-1 and serum C-reactive protein levels in patients with colorectal cancer. The RANX05 Colorectal Cancer Study Group

    DEFF Research Database (Denmark)

    Nielsen, Hans Jørgen; Christensen, Ib Jarle; Sørensen, Steen

    2000-01-01

    study we analyzed the association between plasma PAI-1 and serum CRP in patients scheduled for elective resection of colorectal cancer. In addition, the prognostic value of PAI-1 and CRP was studied in this patient cohort. METHODS: PAI-1 and CRP were analyzed in citrated plasma and serum, respectively......, excluding patients with Dukes' D disease showed serum CRP to be an independent prognostic variable (P study did not show a strong correlation between plasma PAI-1 and serum CRP in patients with colorectal cancer. Serum CRP was found to be a Dukes......BACKGROUND: Preoperative plasma plasminogen activator inhibitor-1 (PAI-1) is a prognostic variable in patients with colorectal cancer. It has been suggested, however, that plasma PAI-1 is a nonspecific prognostic parameter similar to the acute-phase reactant C-reactive protein (CRP). In the present...

  3. Abl N-terminal cap stabilization of SH3 domain dynamics.

    Science.gov (United States)

    Chen, Shugui; Dumitrescu, Teodora Pene; Smithgall, Thomas E; Engen, John R

    2008-05-27

    Crystal structures and other biochemical data indicate that the N-terminal cap (NCap) region of the Abelson tyrosine kinase (c-Abl) is important for maintaining the downregulated conformation of the kinase domain. The exact contributions that the NCap makes in stabilizing the various intramolecular interactions within c-Abl are less clear. While the NCap appears to be important for locking the SH3 and SH2 domains to the back of the kinase domain, there may be other more subtle elements of regulation. Hydrogen exchange (HX) and mass spectrometry (MS) were used to determine if the NCap contributes to intramolecular interactions involving the Abl SH3 domain. Under physiological conditions, the Abl SH3 domain underwent partial unfolding and its unfolding half-life was slowed during binding to the SH2 kinase linker, providing a unique assay for testing NCap-induced stabilization of the SH3 domain in various constructs. The results showed that the NCap stabilizes the dynamics of the SH3 domain in certain constructs but does not increase the relative affinity of the SH3 domain for the native SH2 kinase linker. The stabilization effect was absent in constructs of just the NCap and SH3 but was obvious when the SH2 domain and the SH2 kinase linker were present. These results suggest that interactions between the NCap and the SH3 domain can contribute to c-Abl stabilization in constructs that contain at least the SH2 domain, an effect that may partially compensate for the absence of the negative regulatory C-terminal tail found in the related Src family of kinases.

  4. SH2-catalytic domain linker heterogeneity influences allosteric coupling across the SFK family.

    Science.gov (United States)

    Register, A C; Leonard, Stephen E; Maly, Dustin J

    2014-11-11

    Src-family kinases (SFKs) make up a family of nine homologous multidomain tyrosine kinases whose misregulation is responsible for human disease (cancer, diabetes, inflammation, etc.). Despite overall sequence homology and identical domain architecture, differences in SH3 and SH2 regulatory domain accessibility and ability to allosterically autoinhibit the ATP-binding site have been observed for the prototypical SFKs Src and Hck. Biochemical and structural studies indicate that the SH2-catalytic domain (SH2-CD) linker, the intramolecular binding epitope for SFK SH3 domains, is responsible for allosterically coupling SH3 domain engagement to autoinhibition of the ATP-binding site through the conformation of the αC helix. As a relatively unconserved region between SFK family members, SH2-CD linker sequence variability across the SFK family is likely a source of nonredundant cellular functions between individual SFKs via its effect on the availability of SH3 and SH2 domains for intermolecular interactions and post-translational modification. Using a combination of SFKs engineered with enhanced or weakened regulatory domain intramolecular interactions and conformation-selective inhibitors that report αC helix conformation, this study explores how SH2-CD sequence heterogeneity affects allosteric coupling across the SFK family by examining Lyn, Fyn1, and Fyn2. Analyses of Fyn1 and Fyn2, isoforms that are identical but for a 50-residue sequence spanning the SH2-CD linker, demonstrate that SH2-CD linker sequence differences can have profound effects on allosteric coupling between otherwise identical kinases. Most notably, a dampened allosteric connection between the SH3 domain and αC helix leads to greater autoinhibitory phosphorylation by Csk, illustrating the complex effects of SH2-CD linker sequence on cellular function.

  5. NEAR-INFRARED IMAGING OF THE STAR-FORMING REGIONS SH2-157 AND SH2-152

    International Nuclear Information System (INIS)

    Chen Yafeng; Yang Ji; Zeng Qin; Yao Yongqiang; Sato, Shuji

    2009-01-01

    Near-infrared JHK' and H 2 v = 1-0 S (1) imaging observations of the star-forming regions Sh2-157 and Sh2-152 are presented. The data reveal a cluster of young stars associated with H 2 line emission in each region. Additionally, many IR point sources are found in the dense core of each molecular cloud. Most of these sources exhibit infrared color excesses typical of T Tauri stars, Herbig Ae/Be stars, and protostars. Several display the characteristics of massive stars. We calculate histograms of the K'-magnitude and [H - K'] color for all sources, as well as two-color and color-magnitude diagrams. The stellar populations inside and outside the clusters are similar, suggesting that these systems are rather evolved. Shock-driven H 2 emission knots are also detected, which may be related to evident subclusters in an earlier evolutionary stage.

  6. Expression, purification, crystallization and preliminary X-ray crystallographic analysis of the SH3 domain of human AHI1

    International Nuclear Information System (INIS)

    Shi, Zhuliang; Liang, Ning; Xu, Wei; Li, Kuai; Sheng, Guoqing; Liu, Jinsong; Xu, Aimin; Li, Xiao-Jiang; Wu, Donghai

    2009-01-01

    The SH3 domain of human AHI1 has been cloned and expressed in Escherichia coli. The protein was purified by affinity and size-exclusion chromatography and was crystallized using the sitting-drop vapour-diffusion method at 293 K. The SH3 domain of human AHI1 was cloned and expressed in Escherichia coli. The protein was purified by affinity and size-exclusion chromatography and was crystallized using the sitting-drop vapour-diffusion method at 293 K. A complete data set was collected to 2.5 Å resolution at 110 K. The crystal belonged to space group P4 1 2 1 2, with unit-cell parameters a = 67.377, b = 67.377, c = 98.549 Å

  7. Influence of combined use of selenious acid and SH compounds in parenteral preparations

    Energy Technology Data Exchange (ETDEWEB)

    Terada, A. [St. Marianna University School of Medicine, Kawasaki (Japan). Dept. of Public Health]|[St. Marianna University School of Medicine, Kawasaki (Japan). Dept. of Pharmacy; Yoshida, M. [St. Marianna University School of Medicine, Kawasaki (Japan). Dept. of Chemistry; Nakada, M.; Nakada, K.; Yamate, N. [St. Marianna University School of Medicine, Kawasaki (Japan). Dept. of Surgery; Kobayashi, T. [St. Marianna University School of Medicine, Kawasaki (Japan). Dept. of Pharmacy; Yoshida, K. [St. Marianna University School of Medicine, Kawasaki (Japan). Dept. of Public Health

    1997-12-31

    The influence of the combined use of selenious acid and SH compounds (glutathione (GSH) and cysteine (Cys), or ascorbic acid (Asc)) on cultured venous vascular endothelial cells was investigated experimentally. When cultured human umbilical venous vascular endothelial cells were exposed to 10 {mu}M of selenious acid combined with 0.5 mM-GSH or 0.5 mM-Cys, the release rates of [{sup 3}H]-adenine and lactate dehydrogenase (LDH) from cells into the medium increased significantly as compared with after exposure to selenious acid alone, and damage to the vascular endothelial cells was found to be intensified. Addition of 1 {mu}M of selenious acid simultaneously with 0.5 mM-GSH or 0.5 mM-Cys showed no differences in toxicity for the vascular endothelial cells as compared with the addition of selenious acid alone. On the other hand, simultaneous exposure to 10 {mu}M of selenious acid and 1 mM-Asc induced no significant differences in the release rates of [{sup 3}H]-adenine and LDH, and no damage was observed to the vascular endothelial cells. These results suggest that simultaneous addition of selenious acid together with GSH or Cys, which have the SH-group, may cause damage to the vascular endothelial cells. Therefore careful attention is warranted in total parenteral nutrition. (orig.)

  8. Physical and functional interactions between SH2 and SH3 domains of the Src family protein tyrosine kinase p59fyn

    NARCIS (Netherlands)

    Panchamoorthy, G.; Fukazawa, T.; Stolz, L.; Payne, G.; Reedquist, K.; Shoelson, S.; Songyang, Z.; Cantley, L.; Walsh, C.; Band, H.

    1994-01-01

    The Src family protein tyrosine kinases participate in signalling through cell surface receptors that lack intrinsic tyrosine kinase domains. All nine members of this family possess adjacent Src homology (SH2 and SH3) domains, both of which are essential for repression of the enzymatic activity. The

  9. Correlation of virus load in plasma and lymph node tissue in human immunodeficiency virus infection. INCAS Study Group. Italy, Netherlands, Canada, Australia, and (United) States.

    Science.gov (United States)

    Harris, M; Patenaude, P; Cooperberg, P; Filipenko, D; Thorne, A; Raboud, J; Rae, S; Dailey, P; Chernoff, D; Todd, J; Conway, B; Montaner, J S

    1997-11-01

    The impact of long-term changes in plasma viremia, produced by effective combination antiretroviral therapy, on human immunodeficiency virus (HIV) burden within tissue reservoirs is unknown. Fifteen patients who had received at least 1 year of therapy with two or three drug combinations of zidovudine, didanosine, and nevirapine had suitable samples of lymph node tissue obtained by ultrasound-guided core needle biopsy. HIV RNA was extracted from homogenized tissue samples and quantitated using a modified branched DNA assay. Results were correlated with antiretroviral treatment effect on the basis of plasma virus load measurements over the preceding 12-18 months. A statistically significant negative correlation was observed between magnitude of treatment effect on plasma viremia and lymph node virus load. These data suggest that combinations of antiretroviral drugs that produce sustained suppression of plasma HIV RNA may also be able to reduce the virus burden in lymphoid tissues.

  10. The influence of survivin shRNA on the cell cycle and the invasion of SW480 cells of colorectal carcinoma

    Directory of Open Access Journals (Sweden)

    Yu Jin

    2008-07-01

    Full Text Available Abstract Background The objective was to understand the influence of Survivin plasmid with short hairpin RNA (shRNA on the cell cycle, invasion, and the silencing effect of Survivin gene in the SW480 cell of colorectal carcinoma. Methods A eukaryotic expression vector, PGCH1/Survivin shRNA, a segment sequence of Survivin as target, was created and transfected into colorectal carcinoma cell line SW480 by the non-lipid method. The influence on the Survivin protein was analyzed by Western blotting, while the cell cycle, cell apoptosis were analyzed by flow cytometry, and invasion of the cell was analyzed by Transwell's chamber method. Results After the transfection of PGCH1/Survivin shRNA, the expression of Survivin protein in SW480 cells was dramatically decreased by 60.68%, in which the cells were stopped at G2/M phase, even though no apoptosis was detected. The number of transmembranous cells of the experimental group, negative control group, and blank control group were 14.46 ± 2.11, 25.12 ± 8.37, and 25.86 ± 7.45, respectively (P 0.05. Conclusion Survivin shRNA could significantly reduce the expression of Survivin protein and invasion of SW480 cells. Changes in cell cycle were observed, but no apoptosis was induced.

  11. Preliminary crystallographic characterization of the Grb2 SH2 domain in complex with a FAK-derived phosphotyrosyl peptide

    International Nuclear Information System (INIS)

    Chen, Hsiao-Hsin; Chen, Cuei-Wen; Chang, Yu-Yung; Shen, Tang-Long; Hsu, Chun-Hua

    2010-01-01

    Crystals of the Grb2 SH2 domain in complex with a phosphotyrosyl peptide corresponding to residues 921–930 of focal adhesion kinase (FAK) have been obtained using the sitting-drop vapour-diffusion technique. Data have been collected to 2.49 Å resolution. Growth factor receptor-bound protein 2 (Grb2) is an adaptor protein with a single SH2 domain that specifically binds to focal adhesion kinase (FAK) when residue Tyr925 of FAK is phosphorylated. The Grb2–FAK interaction is associated with cellular integrin-activated signal transduction events leading to the activation of the Ras-MAPK pathway. Crystals of the Grb2 SH2 domain in complex with a phosphopeptide corresponding to residues 921–930 of FAK have been obtained using the sitting-drop vapour-diffusion technique. The crystals belonged to space group P3 1 21, with unit-cell parameters a = b = 102.7, c = 127.6 Å, α = β = 90.0, γ = 120.0°. A diffraction data set was collected from a flash-cooled crystal at 100 K to 2.49 Å resolution using synchrotron radiation. Structure determination by molecular replacement and analysis of the detailed structure of the complex are currently in progress

  12. Applied plasma physics

    International Nuclear Information System (INIS)

    Anon.

    1979-01-01

    Applied Plasma Physics is a major sub-organizational unit of the Magnetic Fusion Energy (MFE) Program. It includes Fusion Plasma Theory and Experimental Plasma Research. The Fusion Plasma Theory group has the responsibility for developing theoretical-computational models in the general areas of plasma properties, equilibrium, stability, transport, and atomic physics. This group has responsibility for giving guidance to the mirror experimental program. There is a formal division of the group into theory and computational; however, in this report the efforts of the two areas are not separated since many projects have contributions from members of both. Under the Experimental Plasma Research Program we are developing a neutral-beam source, the intense, pulsed ion-neutral source (IPINS), for the generation of a reversed-field configuration on 2XIIB. We are also studying the feasibility of using certain neutron-detection techniques as plasma diagnostics in the next generation of thermonuclear experiments

  13. Applied plasma physics

    International Nuclear Information System (INIS)

    Anon.

    1978-01-01

    Applied Plasma Physics is a major sub-organizational unit of the MFE Program. It includes Fusion Plasma Theory and Experimental Plasma Research. The Fusion Plasma Theory group has the responsibility for developing theoretical-computational models in the general areas of plasma properties, equilibrium, stability, transport, and atomic physics. This group has responsibility for giving guidance to the mirror experimental program. There is a formal division of the group into theory and computational; however, in this report the efforts of the two areas are not separated since many projects have contributions from members of both. Under the Experimental Plasma Research Program, we are developing the intense, pulsed neutral-beam source (IPINS) for the generation of a reversed-field configuration on 2XIIB. We are also studying the feasibility of utilizing certain neutron-detection techniques as plasma diagnostics in the next generation of thermonuclear experiments

  14. Genetic loss of SH2B3 in acute lymphoblastic leukemia.

    Science.gov (United States)

    Perez-Garcia, Arianne; Ambesi-Impiombato, Alberto; Hadler, Michael; Rigo, Isaura; LeDuc, Charles A; Kelly, Kara; Jalas, Chaim; Paietta, Elisabeth; Racevskis, Janis; Rowe, Jacob M; Tallman, Martin S; Paganin, Maddalena; Basso, Giuseppe; Tong, Wei; Chung, Wendy K; Ferrando, Adolfo A

    2013-10-03

    The SH2B adaptor protein 3 (SH2B3) gene encodes a negative regulator of cytokine signaling with a critical role in the homeostasis of hematopoietic stem cells and lymphoid progenitors. Here, we report the identification of germline homozygous SH2B3 mutations in 2 siblings affected with developmental delay and autoimmunity, one in whom B-precursor acute lymphoblastic leukemia (ALL) developed. Mechanistically, loss of SH2B3 increases Janus kinase-signal transducer and activator of transcription signaling, promotes lymphoid cell proliferation, and accelerates leukemia development in a mouse model of NOTCH1-induced ALL. Moreover, extended mutation analysis showed homozygous somatic mutations in SH2B3 in 2 of 167 ALLs analyzed. Overall, these results demonstrate a Knudson tumor suppressor role for SH2B3 in the pathogenesis of ALL and highlight a possible link between genetic predisposition factors in the pathogenesis of autoimmunity and leukemogenesis.

  15. Characterizing SH2 Domain Specificity and Network Interactions Using SPOT Peptide Arrays.

    Science.gov (United States)

    Liu, Bernard A

    2017-01-01

    Src Homology 2 (SH2) domains are protein interaction modules that recognize and bind tyrosine phosphorylated ligands. Their ability to distinguish binding to over thousands of potential phosphotyrosine (pTyr) ligands within the cell is critical for the fidelity of receptor tyrosine kinase (RTK) signaling. Within humans there are over a hundred SH2 domains with more than several thousand potential ligands across many cell types and cell states. Therefore, defining the specificity of individual SH2 domains is critical for predicting and identifying their physiological ligands. Here, in this chapter, I describe the broad use of SPOT peptide arrays for examining SH2 domain specificity. An orientated peptide array library (OPAL) approach can uncover both favorable and non-favorable residues, thus providing an in-depth analysis to SH2 specificity. Moreover, I discuss the application of SPOT arrays for paneling SH2 ligand binding with physiological peptides.

  16. Distinct mechanisms of a phosphotyrosyl peptide binding to two SH2 domains.

    Science.gov (United States)

    Pang, Xiaodong; Zhou, Huan-Xiang

    2014-05-01

    Protein phosphorylation is very common post-translational modification, catalyzed by kinases, for signaling and regulation. Phosphotyrosines frequently target SH2 domains. The spleen tyrosine kinase (Syk) is critical for tyrosine phosphorylation of multiple proteins and for regulation of important pathways. Phosphorylation of both Y342 and Y346 in Syk linker B is required for optimal signaling. The SH2 domains of Vav1 and PLC-γ both bind this doubly phosphorylated motif. Here we used a recently developed method to calculate the effects of Y342 and Y346 phosphorylation on the rate constants of a peptide from Syk linker B binding to the SH2 domains of Vav1 and PLC-γ. The predicted effects agree well with experimental observations. Moreover, we found that the same doubly phosphorylated peptide binds the two SH2 domains via distinct mechanisms, with apparent rigid docking for Vav1 SH2 and dock-and-coalesce for PLC-γ SH2.

  17. Structural Characterization of Monomeric/Dimeric State of p59fyn SH2 Domain.

    Science.gov (United States)

    Huculeci, Radu; Kieken, Fabien; Garcia-Pino, Abel; Buts, Lieven; van Nuland, Nico; Lenaerts, Tom

    2017-01-01

    Src homology 2 (SH2) domains are key modulators in various signaling pathways allowing the recognition of phosphotyrosine sites of different proteins. Despite the fact that SH2 domains acquire their biological functions in a monomeric state, a multitude of reports have shown their tendency to dimerize. Here, we provide a technical description on how to isolate and characterize by gel filtration, circular dichroism (CD), and nuclear magnetic resonance (NMR) each conformational state of p59 fyn SH2 domain.

  18. The SH2D2A gene and susceptibility to multiple sclerosis

    DEFF Research Database (Denmark)

    Lorentzen, A.R.; Smestad, C.; Lie, B.A.

    2008-01-01

    We previously reported an association between the SH2D2A gene encoding TSAd and multiple sclerosis (MS). Here a total of 2128 Nordic MS patients and 2004 controls were genotyped for the SH2D2A promoter GA repeat polymorphism and rs926103 encoding a serine to asparagine substitution at amino acid...... that the SH2D2A gene may contribute to susceptibility to MS Udgivelsesdato: 2008/7/15...

  19. SH2 Ligand Prediction-Guidance for In-Silico Screening.

    Science.gov (United States)

    Li, Shawn S C; Li, Lei

    2017-01-01

    Systematic identification of binding partners for SH2 domains is important for understanding the biological function of the corresponding SH2 domain-containing proteins. Here, we describe two different web-accessible computer programs, SMALI and DomPep, for predicting binding ligands for SH2 domains. The former was developed using a Scoring Matrix method and the latter based on the Support Vector Machine model.

  20. Binding Assays Using Recombinant SH2 Domains: Far-Western, Pull-Down, and Fluorescence Polarization.

    Science.gov (United States)

    Machida, Kazuya; Liu, Bernard

    2017-01-01

    Recognition of phosphotyrosine-containing sequences by SH2 domains confers specificity in tyrosine kinase pathways. By assessing interactions between isolated SH2 domains and their binding proteins, it is possible to gain insight into otherwise inaccessible complex cellular systems. Far-Western, pull-down, and fluorescence polarization (FP) have been frequently used for characterization of phosphotyrosine signaling. Here, we outline standard protocols for these established assays using recombinant SH2 domain, emphasizing the importance of appropriate sample preparation and assay controls.

  1. Functional diversity of Csk, Chk, and Src SH2 domains due to a single residue variation.

    Science.gov (United States)

    Ayrapetov, Marina K; Nam, Nguyen Hai; Ye, Guofeng; Kumar, Anil; Parang, Keykavous; Sun, Gongqin

    2005-07-08

    The C-terminal Src kinase (Csk) family of protein tyrosine kinases contains two members: Csk and Csk homologous kinase (Chk). Both phosphorylate and inactivate Src family kinases. Recent reports suggest that the Src homology (SH) 2 domains of Csk and Chk may bind to different phosphoproteins, which provides a basis for different cellular functions for Csk and Chk. To verify and characterize such a functional divergence, we compared the binding properties of the Csk, Chk, and Src SH2 domains and investigated the structural basis for the functional divergence. First, the study demonstrated striking functional differences between the Csk and Chk SH2 domains and revealed functional similarities between the Chk and Src SH2 domains. Second, structural analysis and mutagenic studies revealed that the functional differences among the three SH2 domains were largely controlled by one residue, Glu127 in Csk, Ile167 in Chk, and Lys200 in Src. Mutating these residues in the Csk or Chk SH2 domain to the Src counterpart resulted in dramatic gain of function similar to Src SH2 domain, whereas mutating Lys200 in Src SH2 domain to Glu (the Csk counterpart) resulted in loss of Src SH2 function. Third, a single point mutation of E127K rendered Csk responsive to activation by a Src SH2 domain ligand. Finally, the optimal phosphopeptide sequence for the Chk SH2 domain was determined. These results provide a compelling explanation for the functional differences between two homologous protein tyrosine kinases and reveal a new structure-function relationship for the SH2 domains.

  2. Crystal structure of an SH2-kinase construct of c-Abl and effect of the SH2 domain on kinase activity.

    Science.gov (United States)

    Lorenz, Sonja; Deng, Patricia; Hantschel, Oliver; Superti-Furga, Giulio; Kuriyan, John

    2015-06-01

    Constitutive activation of the non-receptor tyrosine kinase c-Abl (cellular Abelson tyrosine protein kinase 1, Abl1) in the Bcr (breakpoint cluster region)-Abl1 fusion oncoprotein is the molecular cause of chronic myeloid leukaemia (CML). Recent studies have indicated that an interaction between the SH2 (Src-homology 2) domain and the N-lobe (N-terminal lobe) of the c-Abl kinase domain (KD) has a critical role in leukaemogenesis [Grebien et al. (2011) Cell 147, 306-319; Sherbenou et al. (2010) Blood 116, 3278-3285]. To dissect the structural basis of this phenomenon, we studied c-Abl constructs comprising the SH2 and KDs in vitro. We present a crystal structure of an SH2-KD construct bound to dasatinib, which contains the relevant interface between the SH2 domain and the N-lobe of the KD. We show that the presence of the SH2 domain enhances kinase activity moderately and that this effect depends on contacts in the SH2/N-lobe interface and is abrogated by specific mutations. Consistently, formation of the interface decreases slightly the association rate of imatinib with the KD. That the effects are small compared with the dramatic in vivo consequences suggests an important function of the SH2-N-lobe interaction might be to help disassemble the auto-inhibited conformation of c-Abl and promote processive phosphorylation, rather than substantially stimulate kinase activity.

  3. SH2/SH3 adaptor proteins can link tyrosine kinases to a Ste20-related protein kinase, HPK1.

    Science.gov (United States)

    Anafi, M; Kiefer, F; Gish, G D; Mbamalu, G; Iscove, N N; Pawson, T

    1997-10-31

    Ste20-related protein kinases have been implicated as regulating a range of cellular responses, including stress-activated protein kinase pathways and the control of cytoskeletal architecture. An important issue involves the identities of the upstream signals and regulators that might control the biological functions of mammalian Ste20-related protein kinases. HPK1 is a protein-serine/threonine kinase that possesses a Ste20-like kinase domain, and in transfected cells activates a protein kinase pathway leading to the stress-activated protein kinase SAPK/JNK. Here we have investigated candidate upstream regulators that might interact with HPK1. HPK1 possesses an N-terminal catalytic domain and an extended C-terminal tail with four proline-rich motifs. The SH3 domains of Grb2 bound in vitro to specific proline-rich motifs in the HPK1 tail and functioned synergistically to direct the stable binding of Grb2 to HPK1 in transfected Cos1 cells. Epidermal growth factor (EGF) stimulation did not affect the binding of Grb2 to HPK1 but induced recruitment of the Grb2.HPK1 complex to the autophosphorylated EGF receptor and to the Shc docking protein. Several activated receptor and cytoplasmic tyrosine kinases, including the EGF receptor, stimulated the tyrosine phosphorylation of the HPK1 serine/threonine kinase. These results suggest that HPK1, a mammalian Ste20-related protein-serine/threonine kinase, can potentially associate with protein-tyrosine kinases through interactions mediated by SH2/SH3 adaptors such as Grb2. Such interaction may provide a possible mechanism for cross-talk between distinct biochemical pathways following the activation of tyrosine kinases.

  4. Purification of SOCS (Suppressor of Cytokine Signaling) SH2 Domains for Structural and Functional Studies.

    Science.gov (United States)

    Liau, Nicholas P D; Laktyushin, Artem; Babon, Jeffrey J

    2017-01-01

    Src Homology 2 (SH2) domains are protein domains which have a high binding affinity for specific amino acid sequences containing a phosphorylated tyrosine residue. The Suppressors of Cytokine Signaling (SOCS) proteins use an SH2 domain to bind to components of certain cytokine signaling pathways to downregulate the signaling cascade. The recombinantly produced SH2 domains of various SOCS proteins have been used to undertake structural and functional studies elucidating the method of how such targeting occurs. Here, we describe the protocol for the recombinant production and purification of SOCS SH2 domains, with an emphasis on SOCS3.

  5. Distinct ubiquitin binding modes exhibited by SH3 domains: molecular determinants and functional implications.

    Directory of Open Access Journals (Sweden)

    Jose L Ortega Roldan

    Full Text Available SH3 domains constitute a new type of ubiquitin-binding domains. We previously showed that the third SH3 domain (SH3-C of CD2AP binds ubiquitin in an alternative orientation. We have determined the structure of the complex between first CD2AP SH3 domain and ubiquitin and performed a structural and mutational analysis to decipher the determinants of the SH3-C binding mode to ubiquitin. We found that the Phe-to-Tyr mutation in CD2AP and in the homologous CIN85 SH3-C domain does not abrogate ubiquitin binding, in contrast to previous hypothesis and our findings for the first two CD2AP SH3 domains. The similar alternative binding mode of the SH3-C domains of these related adaptor proteins is characterised by a higher affinity to C-terminal extended ubiquitin molecules. We conclude that CD2AP/CIN85 SH3-C domain interaction with ubiquitin constitutes a new ubiquitin-binding mode involved in a different cellular function and thus changes the previously established mechanism of EGF-dependent CD2AP/CIN85 mono-ubiquitination.

  6. Interaction between human BAP31 and respiratory syncytial virus small hydrophobic (SH) protein

    International Nuclear Information System (INIS)

    Li, Yan; Jain, Neeraj; Limpanawat, Suweeraya; To, Janet; Quistgaard, Esben M.; Nordlund, Par; Thanabalu, Thirumaran; Torres, Jaume

    2015-01-01

    The small hydrophobic (SH) protein is a short channel-forming polypeptide encoded by the human respiratory syncytial virus (hRSV). Deletion of SH protein leads to the viral attenuation in mice and primates, and delayed apoptosis in infected cells. We have used a membrane-based yeast two-hybrid system (MbY2H) and a library from human lung cDNA to detect proteins that bind SH protein. This led to the identification of a membrane protein, B-cell associated protein 31 (BAP31). Transfected SH protein co-localizes with transfected BAP31 in cells, and pulls down endogenous BAP31. Titration of purified C-terminal endodomain of BAP31 against isotopically labeled SH protein in detergent micelles suggests direct interaction between the two proteins. Given the key role of BAP31 in protein trafficking and its critical involvement in pro- and anti-apoptotic pathways, this novel interaction may constitute a potential drug target. - Highlights: • A yeast two-hybrid system (MbY2H) detected BAP31 as a binder of RSV SH protein. • Transfected SH and BAP31 co-localize in lung epithelial cells. • Endogenous BAP31 is pulled down by RSV SH protein. • BAP31 endodomain interacts with the N-terminal α-helix of SH protein in micelles. • This interaction is proposed to be a potential drug target

  7. Interaction between human BAP31 and respiratory syncytial virus small hydrophobic (SH) protein

    Energy Technology Data Exchange (ETDEWEB)

    Li, Yan; Jain, Neeraj; Limpanawat, Suweeraya; To, Janet [School of Biological Sciences, Nanyang Technological University, 637551 (Singapore); Quistgaard, Esben M. [Department of Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm (Sweden); Nordlund, Par [School of Biological Sciences, Nanyang Technological University, 637551 (Singapore); Department of Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm (Sweden); Thanabalu, Thirumaran [School of Biological Sciences, Nanyang Technological University, 637551 (Singapore); Torres, Jaume, E-mail: jtorres@ntu.edu.sg [School of Biological Sciences, Nanyang Technological University, 637551 (Singapore)

    2015-08-15

    The small hydrophobic (SH) protein is a short channel-forming polypeptide encoded by the human respiratory syncytial virus (hRSV). Deletion of SH protein leads to the viral attenuation in mice and primates, and delayed apoptosis in infected cells. We have used a membrane-based yeast two-hybrid system (MbY2H) and a library from human lung cDNA to detect proteins that bind SH protein. This led to the identification of a membrane protein, B-cell associated protein 31 (BAP31). Transfected SH protein co-localizes with transfected BAP31 in cells, and pulls down endogenous BAP31. Titration of purified C-terminal endodomain of BAP31 against isotopically labeled SH protein in detergent micelles suggests direct interaction between the two proteins. Given the key role of BAP31 in protein trafficking and its critical involvement in pro- and anti-apoptotic pathways, this novel interaction may constitute a potential drug target. - Highlights: • A yeast two-hybrid system (MbY2H) detected BAP31 as a binder of RSV SH protein. • Transfected SH and BAP31 co-localize in lung epithelial cells. • Endogenous BAP31 is pulled down by RSV SH protein. • BAP31 endodomain interacts with the N-terminal α-helix of SH protein in micelles. • This interaction is proposed to be a potential drug target.

  8. New investigation on THz spectra of OH and SH radicals (X∏)

    Science.gov (United States)

    Martin-Drumel, M. A.; Eliet, S.; Pirali, O.; Guinet, M.; Hindle, F.; Mouret, G.; Cuisset, A.

    2012-10-01

    Pure rotational transitions of OH and SH radicals have been recorded in the THz spectral range using cw-THz and synchrotron-based FT-FIR techniques. Line lists on these radicals have been completed in the three and two lowest vibrational states for OH and SH, respectively. Furthermore, the hyperfine structure of OH and SH has been observed for the first time using infrared IR FT-spectroscopy, and at frequencies higher than 1 THz, respectively. A combined fit has been made for each of these radicals including v = 0, 1 and 2 for OH and v = 0 and 1 for SH.

  9. Bayesian modeling of the yeast SH3 domain interactome predicts spatiotemporal dynamics of endocytosis proteins.

    Directory of Open Access Journals (Sweden)

    Raffi Tonikian

    2009-10-01

    Full Text Available SH3 domains are peptide recognition modules that mediate the assembly of diverse biological complexes. We scanned billions of phage-displayed peptides to map the binding specificities of the SH3 domain family in the budding yeast, Saccharomyces cerevisiae. Although most of the SH3 domains fall into the canonical classes I and II, each domain utilizes distinct features of its cognate ligands to achieve binding selectivity. Furthermore, we uncovered several SH3 domains with specificity profiles that clearly deviate from the two canonical classes. In conjunction with phage display, we used yeast two-hybrid and peptide array screening to independently identify SH3 domain binding partners. The results from the three complementary techniques were integrated using a Bayesian algorithm to generate a high-confidence yeast SH3 domain interaction map. The interaction map was enriched for proteins involved in endocytosis, revealing a set of SH3-mediated interactions that underlie formation of protein complexes essential to this biological pathway. We used the SH3 domain interaction network to predict the dynamic localization of several previously uncharacterized endocytic proteins, and our analysis suggests a novel role for the SH3 domains of Lsb3p and Lsb4p as hubs that recruit and assemble several endocytic complexes.

  10. Differential sensitivity of Src-family kinases to activation by SH3 domain displacement.

    Directory of Open Access Journals (Sweden)

    Jamie A Moroco

    Full Text Available Src-family kinases (SFKs are non-receptor protein-tyrosine kinases involved in a variety of signaling pathways in virtually every cell type. The SFKs share a common negative regulatory mechanism that involves intramolecular interactions of the SH3 domain with the PPII helix formed by the SH2-kinase linker as well as the SH2 domain with a conserved phosphotyrosine residue in the C-terminal tail. Growing evidence suggests that individual SFKs may exhibit distinct activation mechanisms dictated by the relative strengths of these intramolecular interactions. To elucidate the role of the SH3:linker interaction in the regulation of individual SFKs, we used a synthetic SH3 domain-binding peptide (VSL12 to probe the sensitivity of downregulated c-Src, Hck, Lyn and Fyn to SH3-based activation in a kinetic kinase assay. All four SFKs responded to VSL12 binding with enhanced kinase activity, demonstrating a conserved role for SH3:linker interaction in the control of catalytic function. However, the sensitivity and extent of SH3-based activation varied over a wide range. In addition, autophosphorylation of the activation loops of c-Src and Hck did not override regulatory control by SH3:linker displacement, demonstrating that these modes of activation are independent. Our results show that despite the similarity of their downregulated conformations, individual Src-family members show diverse responses to activation by domain displacement which may reflect their adaptation to specific signaling environments in vivo.

  11. Where is the happy Ending of Shāhnāma?

    OpenAIRE

    بهروز چمن آرا

    2015-01-01

    The renowned proverb “Shāhnāma axarash xoš ast” has implicit question which its answer may change our understanding of the nature and function of Shāhnāma. The end of Shāhnāma contains numerous tragic events in Sassanid age. Also it does not seem to be normal if the Iranians have deemed the bitter adventure of the Shahs and Pahlavāns as a happy ending like what Firdausi narrates at the end of his Shāhnāma. This article tries to reply the main question using an illustration on the story platfo...

  12. Reengineering of MeSH thesauri for term selection to optimize literature retrieval and knowledge reconstruction in support of stem cell research.

    Science.gov (United States)

    Su, Yan; Andrews, James; Huang, Hong; Wang, Yue; Kong, Liangliang; Cannon, Peter; Xu, Ping

    2016-05-23

    PubMed is a widely used database for scientists to find biomedical-related literature. Due to the complexity of the selected research subject and its interdisciplinary nature, as well as the exponential growth in the number of disparate pieces of biomedical literature, it is an overwhelming challenge for scientists to define the right search strategies and quickly locate all related information. Specialized subsets and groupings of controlled vocabularies, such as Medical Subject Headings (MeSH), can enhance information retrieval in specialized domains, such as stem cell research. There is a need to develop effective search strategies and convenient solutions for knowledge organization in stem cell research. The understanding of the interrelationships between these MeSH terms also facilitates the building of knowledge organization systems in related subject fields. This study collected empirical data for MeSH-related terms from stem cell literature and developed a novel approach that uses both automation and expert-selection to create a set of terms that supports enhanced retrieval. The selected MeSH terms were reconstructed into a classified thesaurus that can guide researchers towards a successful search and knowledge organization of stem cell literature. First, 4253 MeSH terms were harvested from a sample of 5527 stem cell related research papers from the PubMed database. Next, unrelated terms were filtered out based on term frequency and specificity. Precision and recall measures were used to help identify additional valuable terms, which were mostly non-MeSH terms. The study identified 15 terms that specifically referred to stem cell research for information retrieval, which would yield a higher precision (97.7 %) and recall (94.4 %) rates in comparison to other approaches. In addition, 128 root MeSH terms were selected to conduct knowledge organization of stem cell research in categories of anatomy, disease, and others. This study presented a novel strategy

  13. Plasma properties

    International Nuclear Information System (INIS)

    Weitzner, H.

    1989-08-01

    A cursory examination of the research activities of the Magneto-Fluid Dynamics Division for the calendar year 1988 shows the effects of the gradual transformation of the group. Although our principal activity, fusion plasma physics research, is unchanged, the work shows closer ties to problems relevant to present experiments than previously. Most notable is the concentrated effort on tokamak equilibrium and transport. We are exploring the implication of turbulence induced transport, resistive MHD effects, neoclassical transport, and possible interpretations of transport based on classical phenomena. In addition, one of our members has chosen to focus on problems of enhanced statistical methods for interpretation of experiments. All of this activity preceded the Tokamak Transport Initiative and reflects our active involvement and concern with the world-wide tokamak program. Since equilibrium and transport are by no means the only theoretical plasma physics problems affecting fusion devices we continue substantial efforts in wave propagation and heating, particle simulation of plasmas, stability theory, enhancement of numerical algorithms, and general plasma physics. We are attempting to develop effective numerical schemes for the Boltzmann equation, adaptive grid methods for MHD, and particle simulation of boundary and antenna effects. Many of these topics reflect our continuing concern to maintain a modest effort in the development of theoretical models and tools for problems of real significance to fusion, but not necessarily of immediate highest priority. We select problems which we expect to become extremely important in the future. Our space plasma physics activities, funded by agencies other than DOE, transfers knowledge learned in fusion plasma physics to another area and conversely stimulates work also relevant to fusion problems

  14. Paralog-Specific Patterns of Structural Disorder and Phosphorylation in the Vertebrate SH3-SH2-Tyrosine Kinase Protein Family.

    Science.gov (United States)

    Dos Santos, Helena G; Siltberg-Liberles, Jessica

    2016-09-19

    One of the largest multigene families in Metazoa are the tyrosine kinases (TKs). These are important multifunctional proteins that have evolved as dynamic switches that perform tyrosine phosphorylation and other noncatalytic activities regulated by various allosteric mechanisms. TKs interact with each other and with other molecules, ultimately activating and inhibiting different signaling pathways. TKs are implicated in cancer and almost 30 FDA-approved TK inhibitors are available. However, specific binding is a challenge when targeting an active site that has been conserved in multiple protein paralogs for millions of years. A cassette domain (CD) containing SH3-SH2-Tyrosine Kinase domains reoccurs in vertebrate nonreceptor TKs. Although part of the CD function is shared between TKs, it also presents TK specific features. Here, the evolutionary dynamics of sequence, structure, and phosphorylation across the CD in 17 TK paralogs have been investigated in a large-scale study. We establish that TKs often have ortholog-specific structural disorder and phosphorylation patterns, while secondary structure elements, as expected, are highly conserved. Further, domain-specific differences are at play. Notably, we found the catalytic domain to fluctuate more in certain secondary structure elements than the regulatory domains. By elucidating how different properties evolve after gene duplications and which properties are specifically conserved within orthologs, the mechanistic understanding of protein evolution is enriched and regions supposedly critical for functional divergence across paralogs are highlighted. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  15. Selective Targeting of SH2 Domain–Phosphotyrosine Interactions of Src Family Tyrosine Kinases with Monobodies

    Energy Technology Data Exchange (ETDEWEB)

    Kükenshöner, Tim; Schmit, Nadine Eliane; Bouda, Emilie; Sha, Fern; Pojer, Florence; Koide, Akiko; Seeliger, Markus; Koide, Shohei; Hantschel, Oliver

    2017-05-01

    The binding of Src-homology 2 (SH2) domains to phosphotyrosine (pY) sites is critical for the autoinhibition and substrate recognition of the eight Src family kinases (SFKs). The high sequence conservation of the 120 human SH2 domains poses a significant challenge to selectively perturb the interactions of even the SFK SH2 family against the rest of the SH2 domains. We have developed synthetic binding proteins, termed monobodies, for six of the SFK SH2 domains with nanomolar affinity. Most of these monobodies competed with pY ligand binding and showed strong selectivity for either the SrcA (Yes, Src, Fyn, Fgr) or SrcB subgroup (Lck, Lyn, Blk, Hck). Interactome analysis of intracellularly expressed monobodies revealed that they bind SFKs but no other SH2-containing proteins. Three crystal structures of monobody–SH2 complexes unveiled different and only partly overlapping binding modes, which rationalized the observed selectivity and enabled structure-based mutagenesis to modulate inhibition mode and selectivity. In line with the critical roles of SFK SH2 domains in kinase autoinhibition and T-cell receptor signaling, monobodies binding the Src and Hck SH2 domains selectively activated respective recombinant kinases, whereas an Lck SH2-binding monobody inhibited proximal signaling events downstream of the T-cell receptor complex. Our results show that SFK SH2 domains can be targeted with unprecedented potency and selectivity using monobodies. They are excellent tools for dissecting SFK functions in normal development and signaling and to interfere with aberrant SFK signaling networks in cancer cells.

  16. Selective Targeting of SH2 Domain-Phosphotyrosine Interactions of Src Family Tyrosine Kinases with Monobodies.

    Science.gov (United States)

    Kükenshöner, Tim; Schmit, Nadine Eliane; Bouda, Emilie; Sha, Fern; Pojer, Florence; Koide, Akiko; Seeliger, Markus; Koide, Shohei; Hantschel, Oliver

    2017-05-05

    The binding of Src-homology 2 (SH2) domains to phosphotyrosine (pY) sites is critical for the autoinhibition and substrate recognition of the eight Src family kinases (SFKs). The high sequence conservation of the 120 human SH2 domains poses a significant challenge to selectively perturb the interactions of even the SFK SH2 family against the rest of the SH2 domains. We have developed synthetic binding proteins, termed monobodies, for six of the SFK SH2 domains with nanomolar affinity. Most of these monobodies competed with pY ligand binding and showed strong selectivity for either the SrcA (Yes, Src, Fyn, Fgr) or SrcB subgroup (Lck, Lyn, Blk, Hck). Interactome analysis of intracellularly expressed monobodies revealed that they bind SFKs but no other SH2-containing proteins. Three crystal structures of monobody-SH2 complexes unveiled different and only partly overlapping binding modes, which rationalized the observed selectivity and enabled structure-based mutagenesis to modulate inhibition mode and selectivity. In line with the critical roles of SFK SH2 domains in kinase autoinhibition and T-cell receptor signaling, monobodies binding the Src and Hck SH2 domains selectively activated respective recombinant kinases, whereas an Lck SH2-binding monobody inhibited proximal signaling events downstream of the T-cell receptor complex. Our results show that SFK SH2 domains can be targeted with unprecedented potency and selectivity using monobodies. They are excellent tools for dissecting SFK functions in normal development and signaling and to interfere with aberrant SFK signaling networks in cancer cells. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  17. Profiling of tryptophan-related plasma indoles in patients with carcinoid tumors by automated, on-line, solid-phase extraction and HPLC with fluorescence detection.

    Science.gov (United States)

    Kema, I P; Meijer, W G; Meiborg, G; Ooms, B; Willemse, P H; de Vries, E G

    2001-10-01

    Profiling of the plasma indoles tryptophan, 5-hydroxytryptophan (5-HTP), serotonin, and 5-hydroxyindoleacetic acid (5-HIAA) is useful in the diagnosis and follow-up of patients with carcinoid tumors. We describe an automated method for the profiling of these indoles in protein-containing matrices as well as the plasma indole concentrations in healthy controls and patients with carcinoid tumors. Plasma, cerebrospinal fluid, and tissue homogenates were prepurified by automated on-line solid-phase extraction (SPE) in Hysphere Resin SH SPE cartridges containing strong hydrophobic polystyrene resin. Analytes were eluted from the SPE cartridge by column switching. Subsequent separation and detection were performed by reversed-phase HPLC combined with fluorometric detection in a total cycle time of 20 min. We obtained samples from 14 healthy controls and 17 patients with metastasized midgut carcinoid tumors for plasma indole analysis. In the patient group, urinary excretion of 5-HIAA and serotonin was compared with concentrations of plasma indoles. Within- and between-series CVs for indoles in platelet-rich plasma were 0.6-6.2% and 3.7-12%, respectively. Results for platelet-rich plasma serotonin compared favorably with those obtained by single-component analysis. Plasma 5-HIAA, but not 5-HTP was detectable in 8 of 17 patients with carcinoid tumors. In the patient group, platelet-rich plasma total tryptophan correlated negatively with platelet-rich plasma serotonin (P = 0.021; r = -0.56), urinary 5-HIAA (P = 0.003; r = -0.68), and urinary serotonin (P manual, single-component analyses.

  18. Doppler-Guided Transanal Hemorrhoidal Dearterialization (DG-THD) Versus Stapled Hemorrhoidopexy (SH) in the Treatment of Third-Degree Hemorrhoids: Clinical Results at Short and Long-Term Follow-Up.

    Science.gov (United States)

    Leardi, S; Pessia, B; Mascio, M; Piccione, F; Schietroma, M; Pietroletti, R

    2016-11-01

    The stapled hemorrhoidopexy (SH) and the Doppler-guided transanal hemorrhoidal dearterialization (DG-THD) are minimally invasive procedures for the surgical treatment of hemorrhoids. This study aims to verify the efficacy of the DG-THD versus the SH in the treatment of third-degree hemorrhoids. One hundred consecutive patients were causally allocated to either procedure, obtaining two groups of 50 pts. A clinical examination was performed at 3, 7, 15, and 30 days after the operation. Quality of life, anal symptoms, recurrence of hemorrhoids, and reoperation were assessed by means of a questionnaire and of a clinical examination at long-term follow-up (7.0 year average). At short-term follow-up, the median postoperative pain score was significantly lower in DG-THD group compared to SH group, (V.A.S 2 vs 6; t = 2.65, p hemorrhoids.

  19. CARMA2sh and ULK2 control pathogen-associated molecular patterns recognition in human keratinocytes: psoriasis-linked CARMA2sh mutants escape ULK2 censorship.

    Science.gov (United States)

    Scudiero, Ivan; Mazzone, Pellegrino; D'Andrea, Luca E; Ferravante, Angela; Zotti, Tiziana; Telesio, Gianluca; De Rubis, Gabriele; Reale, Carla; Pizzulo, Maddalena; Muralitharan, Shanmugakonar; Vito, Pasquale; Stilo, Romania

    2017-02-23

    The molecular complexes formed by specific members of the family of CARMA proteins, the CARD domain-containing adapter molecule BCL10 and MALT1 (CBM complex) represent a central hub in regulating activation of the pleiotropic transcription factor NF-κB. Recently, missense mutations in CARMA2sh have been shown to cause psoriasis in a dominant manner and with high penetrancy. Here, we demonstrate that in human keratinocytes CARMA2sh plays an essential role in the signal transduction pathway that connects pathogen-associated molecular patterns recognition to NF-κB activation. We also find that the serine/threonine kinase ULK2 binds to and phosphorylates CARMA2sh, thereby inhibiting its capacity to activate NF-κB by promoting lysosomal degradation of BCL10, which is essential for CARMA2sh-mediated NF-κB signaling. Remarkably, CARMA2sh mutants associated with psoriasis escape ULK2 inhibition. Finally, we show that a peptide blocking CARD-mediated BCL10 interactions reduces the capacity of psoriasis-linked CARMA2sh mutants to activate NF-κB. Our work elucidates a fundamental signaling mechanism operating in human keratinocytes and opens to novel potential tools for the therapeutical treatment of human skin disorders.

  20. Understanding the role of BAR and SH3 domain-containing proteins in fungi

    NARCIS (Netherlands)

    Gkourtsa, A.

    2017-01-01

    This thesis addresses the role of SH3 and BAR domain-containing proteins in different fungal species. SH3 domains are small modules that mediate protein-protein interactions and BAR domains are dimerization domains with membrane binding and bending properties. It is known that the ScRvs167 protein

  1. Design of potentially active ligands for SH2 domains by molecular modeling methods

    Directory of Open Access Journals (Sweden)

    Hurmach V. V.

    2014-07-01

    Full Text Available Search for new chemical structures possessing specific biological activity is a complex problem that needs the use of the latest achievements of molecular modeling technologies. It is well known that SH2 domains play a major role in ontogenesis as intermediaries of specific protein-protein interactions. Aim. Developing an algorithm to investigate the properties of SH2 domain binding, search for new potential active compounds for the whole SH2 domains class. Methods. In this paper, we utilize a complex of computer modeling methods to create a generic set of potentially active compounds targeting universally at the whole class of SH2 domains. A cluster analysis of all available three-dimensional structures of SH2 domains was performed and general pharmacophore models were formulated. The models were used for virtual screening of collection of drug-like compounds provided by Enamine Ltd. Results. The design technique for library of potentially active compounds for SH2 domains class was proposed. Conclusions. The original algorithm of SH2 domains research with molecular docking method was developed. Using our algorithm, the active compounds for SH2 domains were found.

  2. SH3 Domains Differentially Stimulate Distinct Dynamin I Assembly Modes and G Domain Activity.

    Directory of Open Access Journals (Sweden)

    Sai Krishnan

    Full Text Available Dynamin I is a highly regulated GTPase enzyme enriched in nerve terminals which mediates vesicle fission during synaptic vesicle endocytosis. One regulatory mechanism involves its interactions with proteins containing Src homology 3 (SH3 domains. At least 30 SH3 domain-containing proteins bind dynamin at its proline-rich domain (PRD. Those that stimulate dynamin activity act by promoting its oligomerisation. We undertook a systematic parallel screening of 13 glutathione-S-transferase (GST-tagged endocytosis-related SH3 domains on dynamin binding, GTPase activity and oligomerisation. No correlation was found between dynamin binding and their potency to stimulate GTPase activity. There was limited correlation between the extent of their ability to stimulate dynamin activity and the level of oligomerisation, indicating an as yet uncharacterised allosteric coupling of the PRD and G domain. We examined the two variants, dynamin Iab and Ibb, which differ in the alternately splice middle domain α2 helix. They responded differently to the panel of SH3s, with the extent of stimulation between the splice variants varying greatly between the SH3s. This study reveals that SH3 binding can act as a heterotropic allosteric regulator of the G domain via the middle domain α2 helix, suggesting an involvement of this helix in communicating the PRD-mediated allostery. This indicates that SH3 binding both stabilises multiple conformations of the tetrameric building block of dynamin, and promotes assembly of dynamin-SH3 complexes with distinct rates of GTP hydrolysis.

  3. A simple and robust vector-based shRNA expression system used for RNA interference.

    Science.gov (United States)

    Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi

    2013-01-01

    RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

  4. A simple and robust vector-based shRNA expression system used for RNA interference.

    Directory of Open Access Journals (Sweden)

    Xue-jun Wang

    Full Text Available BACKGROUND: RNA interference (RNAi mediated by small interfering RNAs (siRNAs or short hairpin RNAs (shRNAs has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. RESULTS: In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. CONCLUSION: This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

  5. Structural coupling of SH2-kinase domains links Fes and Abl substrate recognition and kinase activation.

    Science.gov (United States)

    Filippakopoulos, Panagis; Kofler, Michael; Hantschel, Oliver; Gish, Gerald D; Grebien, Florian; Salah, Eidarus; Neudecker, Philipp; Kay, Lewis E; Turk, Benjamin E; Superti-Furga, Giulio; Pawson, Tony; Knapp, Stefan

    2008-09-05

    The SH2 domain of cytoplasmic tyrosine kinases can enhance catalytic activity and substrate recognition, but the molecular mechanisms by which this is achieved are poorly understood. We have solved the structure of the prototypic SH2-kinase unit of the human Fes tyrosine kinase, which appears specialized for positive signaling. In its active conformation, the SH2 domain tightly interacts with the kinase N-terminal lobe and positions the kinase alphaC helix in an active configuration through essential packing and electrostatic interactions. This interaction is stabilized by ligand binding to the SH2 domain. Our data indicate that Fes kinase activation is closely coupled to substrate recognition through cooperative SH2-kinase-substrate interactions. Similarly, we find that the SH2 domain of the active Abl kinase stimulates catalytic activity and substrate phosphorylation through a distinct SH2-kinase interface. Thus, the SH2 and catalytic domains of active Fes and Abl pro-oncogenic kinases form integrated structures essential for effective tyrosine kinase signaling.

  6. Systematic characterization of the specificity of the SH2 domains of cytoplasmic tyrosine kinases.

    Science.gov (United States)

    Zhao, Bing; Tan, Pauline H; Li, Shawn S C; Pei, Dehua

    2013-04-09

    Cytoplasmic tyrosine kinases (CTK) generally contain a Src-homology 2 (SH2) domain, whose role in the CTK family is not fully understood. Here we report the determination of the specificity of 25 CTK SH2 domains by screening one-bead-one-compound (OBOC) peptide libraries. Based on the peptide sequences selected by the SH2 domains, we built Support Vector Machine (SVM) models for the prediction of binding ligands for the SH2 domains. These models yielded support for the progressive phosphorylation model for CTKs in which the overlapping specificity of the CTK SH2 and kinase domains has been proposed to facilitate targeting of the CTK substrates with at least two potential phosphotyrosine (pTyr) sites. We curated 93 CTK substrates with at least two pTyr sites catalyzed by the same CTK, and showed that 71% of these substrates had at least two pTyr sites predicted to bind a common CTK SH2 domain. More importantly, we found 34 instances where there was at least one pTyr site predicted to be recognized by the SH2 domain of the same CTK, suggesting that the SH2 and kinase domains of the CTKs may cooperate to achieve progressive phosphorylation of a protein substrate. This article is part of a Special Issue entitled: From protein structures to clinical applications. Copyright © 2012 Elsevier B.V. All rights reserved.

  7. Structure determination of human Lck unique and SH3 domains by nuclear magnetic resonance spectroscopy

    Directory of Open Access Journals (Sweden)

    Willbold Dieter

    2003-05-01

    Full Text Available Abstract Background Protein tyrosine kinases are involved in signal transduction pathways that regulate cell growth, differentiation, activation and transformation. Human lymphocyte specific kinase (Lck is a 56 kDa protein involved in T-cell- and IL2-receptor signaling. Three-dimensional structures are known for SH3, SH2 and kinase domains of Lck as well as for other tyrosine kinases. No structure is known for the unique domain of any Src-type tyrosine kinase. Results Lck(1–120 comprising unique and SH3 domains was structurally investigated by nuclear magnetic resonance spectroscopy. We found the unique domain, in contrast to the SH3 part, to have basically no defined structural elements. The solution structure of the SH3 part could be determined with very high precision. It does not show significant differences to Lck SH3 in the absence of the unique domain. Minor differences were observed to the X-ray structure of Lck SH3. Conclusion The unique domain of Lck does not contain any defined structure elements in the absence of ligands and membranes. Presence of the unique domain is not relevant to the three-dimensional structure of the Lck SH3 domain.

  8. Effects and mechanism of integrin-β1 gene expression inhibited by shRNA in invasion of pancreatic carcinoma PANC-1 cells.

    Science.gov (United States)

    Yu, Feng; Li, Hua; Bu, Xuefeng; Zhang, Yongjun

    2012-01-01

    To investigate the effects of integrin-β1 gene expression inhibited by shRNA on invasion of pancreatic carcinoma PANC-1 cells in vitro. The eukaryotic expression plasmid of short hairpin RNA (shRNA) targeting integrin-β1 gene (integrin-β1-shRNA) was constructed and transfected into PANC-1 cells. The expressions of integrin-β1 mRNA and protein were detected by real-time quantitative polymerase chain reaction (PCR) and western blot assay, respectively. The invasive ability of PANC-1 cells was observed with a transwell cell culture chamber and the expressions of MMP-2 and MMP-9 were assayed. Compared to the untransfected group, recombinant expression plasmid integrin-β1-shRNA resulted in reduction of integrin-β1 mRNA and protein by 78.58%±7.24% and 92.88%±3.18%, respectively and the average number of invading PANC-1 cells were decreased from 52±5 to 21±4 (pPANC-1 cells in vitro significantly.

  9. Star Formation and Young Population of the H II Complex Sh2-294

    Science.gov (United States)

    Samal, M. R.; Pandey, A. K.; Ojha, D. K.; Chauhan, N.; Jose, J.; Pandey, B.

    2012-08-01

    The Sh2-294 H II region ionized by a single B0V star features several infrared excess sources, a photodissociation region, and also a group of reddened stars at its border. The star formation scenario in this region seems to be quite complex. In this paper, we present follow-up results of Sh2-294 H II region at 3.6, 4.5, 5.8, and 8.0 μm observed with the Spitzer Space Telescope Infrared Array Camera (IRAC), coupled with H2 (2.12 μm) observation, to characterize the young population of the region and to understand its star formation history. We identified 36 young stellar object (YSO, Class I, Class II, and Class I/II) candidates using IRAC color-color diagrams. It is found that Class I sources are preferentially located at the outskirts of the H II region and associated with enhanced H2 emission; none of them are located near the central cluster. Combining the optical to mid-infrared (MIR) photometry of the YSO candidates and using the spectral energy distribution fitting models, we constrained stellar parameters and the evolutionary status of 33 YSO candidates. Most of them are interpreted by the model as low-mass (<4 M ⊙) YSOs; however, we also detected a massive YSO (~9 M ⊙) of Class I nature, embedded in a cloud of visual extinction of ~24 mag. Present analysis suggests that the Class I sources are indeed a younger population of the region relative to Class II sources (age ~ 4.5 × 106 yr). We suggest that the majority of the Class I sources, including the massive YSOs, are second-generation stars of the region whose formation is possibly induced by the expansion of the H II region powered by a ~4 × 106 yr B0 main-sequence star.

  10. STAR FORMATION AND YOUNG POPULATION OF THE H II COMPLEX Sh2-294

    International Nuclear Information System (INIS)

    Samal, M. R.; Pandey, A. K.; Chauhan, N.; Jose, J.; Ojha, D. K.; Pandey, B.

    2012-01-01

    The Sh2-294 H II region ionized by a single B0V star features several infrared excess sources, a photodissociation region, and also a group of reddened stars at its border. The star formation scenario in this region seems to be quite complex. In this paper, we present follow-up results of Sh2-294 H II region at 3.6, 4.5, 5.8, and 8.0 μm observed with the Spitzer Space Telescope Infrared Array Camera (IRAC), coupled with H 2 (2.12 μm) observation, to characterize the young population of the region and to understand its star formation history. We identified 36 young stellar object (YSO, Class I, Class II, and Class I/II) candidates using IRAC color-color diagrams. It is found that Class I sources are preferentially located at the outskirts of the H II region and associated with enhanced H 2 emission; none of them are located near the central cluster. Combining the optical to mid-infrared (MIR) photometry of the YSO candidates and using the spectral energy distribution fitting models, we constrained stellar parameters and the evolutionary status of 33 YSO candidates. Most of them are interpreted by the model as low-mass ( ☉ ) YSOs; however, we also detected a massive YSO (∼9 M ☉ ) of Class I nature, embedded in a cloud of visual extinction of ∼24 mag. Present analysis suggests that the Class I sources are indeed a younger population of the region relative to Class II sources (age ∼ 4.5 × 10 6 yr). We suggest that the majority of the Class I sources, including the massive YSOs, are second-generation stars of the region whose formation is possibly induced by the expansion of the H II region powered by a ∼4 × 10 6 yr B0 main-sequence star.

  11. S.H. and others v. Austria and circumvention tourism.

    Science.gov (United States)

    Glenn Cohen, I

    2012-12-01

    This commentary discusses the decision in S.H. and Others v. Austria from a political theoretical and bioethical perspective. I focus on the opinion's discussion of what I call 'circumvention tourism', travelling abroad for the purpose of circumventing domestic prohibitions, especially as to medical services. The majority opinion in the case touts Austria's allowance of circumvention tourism for reproductive technology services that are illegal on Austrian soil as a reason to find as lawful Austria's prohibition on using those services on Austrian soil. To the contrary, I show that, in many ways, permitting circumvention tourism for these services while prohibiting them domestically is deeply problematic. Copyright © 2012 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

  12. Generation and relaxation of high rank coherences in AX3 systems in a selectively methionine labelled SH2 domain

    International Nuclear Information System (INIS)

    Kloiber, Karin; Fischer, Michael; Ledolter, Karin; Nagl, Michael; Schmid, Walther; Konrat, Robert

    2007-01-01

    The usefulness of selective isotope labelling patterns is demonstrated using the C-terminal SH2 domain of PLC-γ1 selectively 13 C labelled at methionine methyl groups. We demonstrate the generation and relaxation of coherences that are second rank in protons and first rank in carbons that derive from quadrupolar order in protons. The decay rates of second rank double quantum proton coherences are measured. These terms exhibit fewer channels for cross-correlated relaxation compared to single quantum coherences. Our results indicate the potential application of the measurement of high order proton coherences to the analysis of dynamics in methyl-bearing side chains

  13. Molecular epidemiology of the SH (small hydrophobic) gene of human respiratory syncytial virus (HRSV), over 2 consecutive years.

    Science.gov (United States)

    Lima, Hildenêr Nogueira; Botosso, Viviane Fongaro; Oliveira, Danielle Bruna Leal; Campos, Angélica Cristine de Almeida; Leal, Andrea Lima; Silva, Tereza Souza; Bosso, Patrícia Alves Ramos; Moraes, Claudia Trigo Pedroso; Filho, Claudionor Gomes da Silva; Vieira, Sandra Elisabete; Gilio, Alfredo Elias; Stewien, Klaus Eberhard; Durigon, Edison Luiz

    2012-01-01

    Human respiratory syncytial virus (HRSV) strains were isolated from nasopharyngeal aspirates collected from 965 children between 2004 and 2005, yielding 424 positive samples. We sequenced the small hydrophobic protein (SH) gene of 117 strains and compared them with other viruses identified worldwide. Phylogenetic analysis showed a low genetic variability among the isolates but allowed us to classify the viruses into different genotypes for both groups, HRSVA and HRSVB. It is also shown that the novel BA-like genotype was well segregated from the others, indicating that the mutations are not limited to the G gene. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. Solution structure of the Grb2 SH2 domain complexed with a high-affinity inhibitor

    International Nuclear Information System (INIS)

    Ogura, Kenji; Shiga, Takanori; Yokochi, Masashi; Yuzawa, Satoru; Burke, Terrence R.; Inagaki, Fuyuhiko

    2008-01-01

    The solution structure of the growth factor receptor-bound protein 2 (Grb2) SH2 domain complexed with a high-affinity inhibitor containing a non-phosphorus phosphate mimetic within a macrocyclic platform was determined by nuclear magnetic resonance (NMR) spectroscopy. Unambiguous assignments of the bound inhibitor and intermolecular NOEs between the Grb2 SH2 domain and the inhibitor was accomplished using perdeuterated Grb2 SH2 protein. The well-defined solution structure of the complex was obtained and compared to those by X-ray crystallography. Since the crystal structure of the Grb2 SH2 domain formed a domain-swapped dimer and several inhibitors were bound to a hinge region, there were appreciable differences between the solution and crystal structures. Based on the binding interactions between the inhibitor and the Grb2 SH2 domain in solution, we proposed a design of second-generation inhibitors that could be expected to have higher affinity

  15. In Vitro Evaluation of Beneficial Properties of Bacteriocinogenic Lactobacillus plantarum ST8Sh.

    Science.gov (United States)

    Todorov, Svetoslav Dimitrov; Holzapfel, Wilhelm; Nero, Luis Augusto

    2017-06-01

    Lactobacillus plantarum ST8Sh, isolated from Bulgarian salami "shpek" and previously characterized as bacteriocin producer, was evaluated for its beneficial properties. Based on the PCR analysis, Lb. plantarum ST8Sh was shown to host a gene related to the production of adhesion proteins such as Mab, Mub, EF, and PrgB. Genetic and physiological tests suggest Lb. plantarum ST8Sh to represent a potential probiotic candidate, including survival in the presence of low levels of pH and high levels of ox bile, production of β-galactosidase, bile salt deconjugation, high level of hydrophobicity, functional auto- and co-aggregation properties, and adhesion to cell lines. Application of semi-purified bacteriocin produced by Lb. plantarum ST8Sh in combination with ciprofloxacin presented synergistic effect on inhibition of Listeria monocytogenes Scott A. Based on observed properties, Lb. plantarum ST8Sh can be considered as a potential probiotic candidate with additional bacteriocinogenic properties.

  16. JNK signaling pathway regulates sorbitol-induced Tau proteolysis and apoptosis in SH-SY5Y cells by targeting caspase-3.

    Science.gov (United States)

    Olivera Santa-Catalina, Marta; Caballero Bermejo, Montaña; Argent, Ricardo; Alonso, Juan C; Centeno, Francisco; Lorenzo, María J

    2017-12-15

    Growing evidence suggests that Diabetes Mellitus increases the risk of developing Alzheimer's disease. It is well known that hyperglycemia, a key feature of Diabetes Mellitus, may induce plasma osmolarity disturbances. Both hyperglycemia and hyperosmolarity promote the altered post-translational regulation of microtubule-associated protein Tau. Interestingly, abnormal hyperphosphorylation and cleavage of Tau have been proven to lead to the genesis of filamentous structures referred to as neurofibrillary tangles, the main pathological hallmark of Alzheimer's disease. We have previously described that hyperosmotic stress induced by sorbitol promotes Tau proteolysis and apoptosis in SH-SY5Y cells via caspase-3 activation. In order to gain insights into the regulatory mechanisms of such processes, in this work we explored the intracellular signaling pathways that regulate these events. We found that sorbitol treatment significantly enhanced the activation of conventional families of MAPK in SH-SY5Y cells. Tau proteolysis was completely prevented by JNK inhibition but not affected by either ERK1/2 or p38 MAPK blockade. Moreover, inhibition of JNK, but not ERK1/2 or p38 MAPK, efficiently prevented sorbitol-induced apoptosis and caspase-3 activation. In summary, we provide evidence that JNK signaling pathway is an upstream regulator of hyperosmotic stress-induced Tau cleavage and apoptosis in SH-SY5Y through the control of caspase-3 activation. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Apolipoprotein B knockdown by AAV-delivered shRNA lowers plasma cholesterol in mice

    NARCIS (Netherlands)

    Koornneef, Annemart; Maczuga, Piotr; van Logtenstein, Richard; Borel, Florie; Blits, Bas; Ritsema, Tita; van Deventer, Sander; Petry, Harald; Konstantinova, Pavlina

    2011-01-01

    Serum low-density lipoprotein cholesterol (LDL-C) levels are proportionate to the risk of atherosclerotic cardiovascular disease. In order to reduce serum total cholesterol and LDL-C levels in mice, RNA interference (RNAi) was used to inhibit expression of the structural protein of LDL-C,

  18. Electrostatic effects in the folding of the SH3 domain of the c-Src tyrosine kinase: pH-dependence in 3D-domain swapping and amyloid formation.

    Directory of Open Access Journals (Sweden)

    Julio Bacarizo

    Full Text Available The SH3 domain of the c-Src tyrosine kinase (c-Src-SH3 aggregates to form intertwined dimers and amyloid fibrils at mild acid pHs. In this work, we show that a single mutation of residue Gln128 of this SH3 domain has a significant effect on: (i its thermal stability; and (ii its propensity to form amyloid fibrils. The Gln128Glu mutant forms amyloid fibrils at neutral pH but not at mild acid pH, while Gln128Lys and Gln128Arg mutants do not form these aggregates under any of the conditions assayed. We have also solved the crystallographic structures of the wild-type (WT and Gln128Glu, Gln128Lys and Gln128Arg mutants from crystals obtained at different pHs. At pH 5.0, crystals belong to the hexagonal space group P6₅22 and the asymmetric unit is formed by one chain of the protomer of the c-Src-SH3 domain in an open conformation. At pH 7.0, crystals belong to the orthorhombic space group P2₁2₁2₁, with two molecules at the asymmetric unit showing the characteristic fold of the SH3 domain. Analysis of these crystallographic structures shows that the residue at position 128 is connected to Glu106 at the diverging β-turn through a cluster of water molecules. Changes in this hydrogen-bond network lead to the displacement of the c-Src-SH3 distal loop, resulting also in conformational changes of Leu100 that might be related to the binding of proline rich motifs. Our findings show that electrostatic interactions and solvation of residues close to the folding nucleation site of the c-Src-SH3 domain might play an important role during the folding reaction and the amyloid fibril formation.

  19. Modeling and validating HL7 FHIR profiles using semantic web Shape Expressions (ShEx).

    Science.gov (United States)

    Solbrig, Harold R; Prud'hommeaux, Eric; Grieve, Grahame; McKenzie, Lloyd; Mandel, Joshua C; Sharma, Deepak K; Jiang, Guoqian

    2017-03-01

    HL7 Fast Healthcare Interoperability Resources (FHIR) is an emerging open standard for the exchange of electronic healthcare information. FHIR resources are defined in a specialized modeling language. FHIR instances can currently be represented in either XML or JSON. The FHIR and Semantic Web communities are developing a third FHIR instance representation format in Resource Description Framework (RDF). Shape Expressions (ShEx), a formal RDF data constraint language, is a candidate for describing and validating the FHIR RDF representation. Create a FHIR to ShEx model transformation and assess its ability to describe and validate FHIR RDF data. We created the methods and tools that generate the ShEx schemas modeling the FHIR to RDF specification being developed by HL7 ITS/W3C RDF Task Force, and evaluated the applicability of ShEx in the description and validation of FHIR to RDF transformations. The ShEx models contributed significantly to workgroup consensus. Algorithmic transformations from the FHIR model to ShEx schemas and FHIR example data to RDF transformations were incorporated into the FHIR build process. ShEx schemas representing 109 FHIR resources were used to validate 511 FHIR RDF data examples from the Standards for Trial Use (STU 3) Ballot version. We were able to uncover unresolved issues in the FHIR to RDF specification and detect 10 types of errors and root causes in the actual implementation. The FHIR ShEx representations have been included in the official FHIR web pages for the STU 3 Ballot version since September 2016. ShEx can be used to define and validate the syntax of a FHIR resource, which is complementary to the use of RDF Schema (RDFS) and Web Ontology Language (OWL) for semantic validation. ShEx proved useful for describing a standard model of FHIR RDF data. The combination of a formal model and a succinct format enabled comprehensive review and automated validation. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Identification of the kinase that activates a nonmetazoan STAT gives insights into the evolution of phosphotyrosine-SH2 domain signaling.

    Science.gov (United States)

    Araki, Tsuyoshi; Kawata, Takefumi; Williams, Jeffrey G

    2012-07-10

    SH2 domains are integral to many animal signaling pathways. By interacting with specific phosphotyrosine residues, they provide regulatable protein-protein interaction domains. Dictyostelium is the only nonmetazoan with functionally characterized SH2 domains, but the cognate tyrosine kinases are unknown. There are no orthologs of the animal tyrosine kinases, but there are very many tyrosine kinase-like kinases (TKLs), a group of kinases which, despite their family name, are classified mainly as serine-threonine kinases. STATs are transcription factors that dimerize via phosphotyrosine-SH2 domain interactions. STATc is activated by phosphorylation on Tyr922 when cells are exposed to the prestalk inducer differentiation inducing factor (DIF-1), a chlorinated hexaphenone. We show that in a null mutant for Pyk2, a tyrosine-specific TKL, exposure to DIF-1 does not activate STATc. Conversely, overexpression of Pyk2 causes constitutive STATc activation. Pyk2 phosphorylates STATc on Tyr922 in vitro and complexes with STATc both in vitro and in vivo. This demonstration that a TKL directly activates a STAT has significant implications for understanding the evolutionary origins of SH2 domain-phosphotyrosine signaling. It also has mechanistic implications. Our previous work suggested that a predicted constitutive STATc tyrosine kinase activity is counterbalanced in vivo by the DIF-1-regulated activity of PTP3, a Tyr922 phosphatase. Here we show that the STATc-Pyk2 complex is formed constitutively by an interaction between the STATc SH2 domain and phosphotyrosine residues on Pyk2 that are generated by autophosphorylation. Also, as predicted, Pyk2 is constitutively active as a STATc kinase. This observation provides further evidence for this highly atypical, possibly ancestral, STAT regulation mechanism.

  1. Plasma turbulence

    International Nuclear Information System (INIS)

    Horton, W.

    1998-07-01

    The origin of plasma turbulence from currents and spatial gradients in plasmas is described and shown to lead to the dominant transport mechanism in many plasma regimes. A wide variety of turbulent transport mechanism exists in plasmas. In this survey the authors summarize some of the universally observed plasma transport rates

  2. An Efficient Semi-supervised Learning Approach to Predict SH2 Domain Mediated Interactions.

    Science.gov (United States)

    Kundu, Kousik; Backofen, Rolf

    2017-01-01

    Src homology 2 (SH2) domain is an important subclass of modular protein domains that plays an indispensable role in several biological processes in eukaryotes. SH2 domains specifically bind to the phosphotyrosine residue of their binding peptides to facilitate various molecular functions. For determining the subtle binding specificities of SH2 domains, it is very important to understand the intriguing mechanisms by which these domains recognize their target peptides in a complex cellular environment. There are several attempts have been made to predict SH2-peptide interactions using high-throughput data. However, these high-throughput data are often affected by a low signal to noise ratio. Furthermore, the prediction methods have several additional shortcomings, such as linearity problem, high computational complexity, etc. Thus, computational identification of SH2-peptide interactions using high-throughput data remains challenging. Here, we propose a machine learning approach based on an efficient semi-supervised learning technique for the prediction of 51 SH2 domain mediated interactions in the human proteome. In our study, we have successfully employed several strategies to tackle the major problems in computational identification of SH2-peptide interactions.

  3. Study on expression of SH2 domain-containing protein tyrosine phosphatase SHP-1 and SHP-2 in γ-ray irradiation-induced thymus lymphoma in mice

    International Nuclear Information System (INIS)

    Huang Dingde; Chen Qi; Han Ling; Cai Jianming; Li Bailong; Huang Yuecheng; Gao Jianguo; Sun Suping

    2003-01-01

    Objective: To investigate the expression of SH2 domain containing-protein tyrosine phosphatase SHP-1 and SHP-2 in γ-ray irradiation-induced thymus lymphoma in mice. Methods: Altogether 338 BALB/c mice were randomly divided into irradiation groups and controls. Irradiation groups which were irradiated with γ-rays included canceration groups confirmed with histology and uncanceration groups. The controls were fed synchronistically with irradiation groups. The expression of SHP-1 and SHP-2 was detected with Western blot in thymus cells. Results: The expression of SHP-1 in canceration groups was much higher than that in uncanceration groups and controls significantly, while the expression of SHP-2 in canceration groups was higher than that in uncanceration groups and controls. When authors detected the expression of SHP-2 with Western blot, the authors found another protein with a molecular weight of 55x10 3 , which expression in canceration groups was higher than that in uncanceration groups and controls. Conclusion: The expression of SH2 domain-containing protein tyrosine phosphatase SHP-1 and SHP-2 is significantly increased in canceration groups, suggesting that SHP-1 and SHP-2 may be related with γ-ray induced thymus lymphoma in mice. Further research is expected on the relationship between development of cancer and SHP-1 and SHP-2

  4. Examining transition metal hydrosulfides: The pure rotational spectrum of ZnSH (X̃2A').

    Science.gov (United States)

    Bucchino, M P; Adande, G R; Halfen, D T; Ziurys, L M

    2017-10-21

    The pure rotational spectrum of the ZnSH (X̃ 2 A') radical has been measured using millimeter-wave direct absorption and Fourier transform microwave (FTMW) methods across the frequency range 18-468 GHz. This work is the first gas-phase detection of ZnSH by any spectroscopic technique. Spectra of the 66 ZnSH, 68 ZnSH, and 64 ZnSD isotopologues were also recorded. In the mm-wave study, ZnSH was synthesized in a DC discharge by the reaction of zinc vapor, generated by a Broida-type oven, with H 2 S; for FTMW measurements, the radical was made in a supersonic jet expansion by the same reactants but utilizing a discharge-assisted laser ablation source. Between 7 and 9 rotational transitions were recorded for each isotopologue. Asymmetry components with K a = 0 through 6 were typically measured in the mm-wave region, each split into spin-rotation doublets. In the FTMW spectra, hyperfine interactions were also resolved, arising from the hydrogen or deuterium nuclear spins of I = 1/2 or I = 1, respectively. The data were analyzed using an asymmetric top Hamiltonian, and rotational, spin-rotation, and magnetic hyperfine parameters were determined for ZnSH, as well as the quadrupole coupling constant for ZnSD. The observed spectra clearly indicate that ZnSH has a bent geometry. The r m (1) structure was determined to be r Zn-S = 2.213(5) Å, r S-H = 1.351(3) Å, and θ Zn-S-H = 90.6(1)°, suggesting that the bonding occurs primarily through sulfur p orbitals, analogous to H 2 S. The hyperfine constants indicate that the unpaired electron in ZnSH primarily resides on the zinc nucleus.

  5. Conformational determinants of phosphotyrosine peptides complexed with the Src SH2 domain.

    Directory of Open Access Journals (Sweden)

    Joseph Nachman

    2010-06-01

    Full Text Available The inhibition of specific SH2 domain mediated protein-protein interactions as an effective chemotherapeutic approach in the treatment of diseases remains a challenge. That different conformations of peptide-ligands are preferred by different SH2 domains is an underappreciated observation from the structural analysis of phosphotyrosine peptide binding to SH2 domains that may aid in future drug design. To explore the nature of ligand binding, we use simulated annealing (SA to sample the conformational space of phosphotyrosine-containing peptides complexed with the Src SH2 domain. While in good agreement with the crystallographic and NMR studies of high-affinity phosphopeptide-SH2 domain complexes, the results suggest that the structural basis for phopsphopeptide- Src SH2 interactions is more complex than the "two-pronged plug two-hole socket" model. A systematic study of peptides of type pYEEX, where pY is phosphotyrosine and X is a hydrophobic residue, indicates that these peptides can assume two conformations, one extended and one helical, representing the balance between the interaction of residue X with the hydrophobic hole on the surface of the Src SH2 domain, and its contribution to the inherent tendency of the two glutamic acids to form an alpha-helix. In contrast, a beta-turn conformation, almost identical to that observed in the crystal structure of pYVNV bound to the Grb2 SH2 domain, predominates for pYXNX peptides, even in the presence of isoleucine at the third position. While peptide binding affinities, as measured by fluorescence polarization, correlate with the relative proportion of extended peptide conformation, these results suggest a model where all three residues C-terminal to the phosphotyrosine determine the conformation of the bound phosphopeptide. The information obtained in this work can be used in the design of specific SH2 domain inhibitors.

  6. Short Hairpin RNA (shRNA): Design, Delivery, and Assessment of Gene Knockdown

    Science.gov (United States)

    Moore, Chris B.; Guthrie, Elizabeth H.; Huang, Max Tze-Han; Taxman, Debra J.

    2013-01-01

    Shortly after the cellular mechanism of RNA interference (RNAi) was first described, scientists began using this powerful technique to study gene function. This included designing better methods for the successful delivery of small interfering RNAs (siRNAs) and short hairpin RNAs (shRNAs) into mammalian cells. While the simplest method for RNAi is the cytosolic delivery of siRNA oligonucleotides, this technique is limited to cells capable of transfection and is primarily utilized during transient in vitro studies. The introduction of shRNA into mammalian cells through infection with viral vectors allows for stable integration of shRNA and long-term knockdown of the targeted gene; however, several challenges exist with the implementation of this technology. Here we describe some well-tested protocols which should increase the chances of successful design, delivery, and assessment of gene knockdown by shRNA. We provide suggestions for designing shRNA targets and controls, a protocol for sequencing through the secondary structure of the shRNA hairpin structure, and protocols for packaging and delivery of shRNA lentiviral particles. Using real-time PCR and functional assays we demonstrate the successful knockdown of ASC, an inflammatory adaptor molecule. These studies demonstrate the practicality of including two shRNAs with different efficacies of knockdown to provide an additional level of control and to verify dose dependency of functional effects. Along with the methods described here, as new techniques and algorithms are designed in the future, shRNA is likely to include further promising application and continue to be a critical component of gene discovery. PMID:20387148

  7. The Spectrum of Jupiters Great Red Spot: the Case for Ammonium Hydrosulfide (NH4SH)

    Science.gov (United States)

    Loeffler, Mark J.; Hudson, Reggie L.; Chanover, Nancy J.; Simon, Amy A.

    2016-01-01

    Here we present new ultraviolet-visible spectra of irradiated ammonium hydrosul?de (NH4SH), a reported Jovian atmospheric cloud component, for a range of temperatures and radiation doses and make assignments to the spectral features. We show that the combination of radiolysis and thermal annealing of NH4SH causes the originally featureless ultraviolet-visible re?ectance spectrum to evolve into one that absorbs in the ultraviolet-visible region. Furthermore, we ?nd that our laboratory spectra resemble HST (Hubble Space Telescope) spectra below 500 nanometers, suggesting that the more stable reaction products of NH4SH radiolysis are likely an important component of the Great Red Spot.

  8. The Spectrum of Jupiter's Great Red Spot: The Case for Ammonium Hydrosulfide (NH4SH)

    Science.gov (United States)

    Loeffler, Mark J.; Hudson, Reggie L.; Chanover, Nancy J.; Simon, Amy A.

    2016-01-01

    Here we present new ultraviolet-visible spectra of irradiated ammonium hydrosul?de (NH4SH), a reported Jovian atmospheric cloud component, for a range of temperatures and radiation doses and make assignments to the spectral features. We show that the combination of radiolysis and thermal annealing of NH4SH causes the originally featureless ultraviolet-visible re?ectance spectrum to evolve into one that absorbs in the ultraviolet-visible region. Furthermore, we ?nd that our laboratory spectra resemble HST (Hubble Space Telescope) spectra below 500 nanometers, suggesting that the more stable reaction products of NH4SH radiolysis are likely an important component of the Great Red Spot.

  9. Energy in elastic fiber embedded in elastic matrix containing incident SH wave

    Science.gov (United States)

    Williams, James H., Jr.; Nagem, Raymond J.

    1989-01-01

    A single elastic fiber embedded in an infinite elastic matrix is considered. An incident plane SH wave is assumed in the infinite matrix, and an expression is derived for the total energy in the fiber due to the incident SH wave. A nondimensional form of the fiber energy is plotted as a function of the nondimensional wavenumber of the SH wave. It is shown that the fiber energy attains maximum values at specific values of the wavenumber of the incident wave. The results obtained here are interpreted in the context of phenomena observed in acousto-ultrasonic experiments on fiber reinforced composite materials.

  10. Kit W-sh Mutation Prevents Cancellous Bone Loss during Calcium Deprivation.

    Science.gov (United States)

    Lotinun, Sutada; Suwanwela, Jaijam; Poolthong, Suchit; Baron, Roland

    2018-01-01

    Calcium is essential for normal bone growth and development. Inadequate calcium intake increases the risk of osteoporosis and fractures. Kit ligand/c-Kit signaling plays an important role in regulating bone homeostasis. Mice with c-Kit mutations are osteopenic. The present study aimed to investigate whether impairment of or reduction in c-Kit signaling affects bone turnover during calcium deprivation. Three-week-old male WBB6F1/J-Kit W /Kit W-v /J (W/W v ) mice with c-Kit point mutation, Kit W-sh /HNihrJaeBsmJ (W sh /W sh ) mice with an inversion mutation in the regulatory elements upstream of the c-Kit promoter region, and their wild-type controls (WT) were fed either a normal (0.6% calcium) or a low calcium diet (0.02% calcium) for 3 weeks. μCT analysis indicated that both mutants fed normal calcium diet had significantly decreased cortical thickness and cancellous bone volume compared to WT. The low calcium diet resulted in a comparable reduction in cortical bone volume and cortical thickness in the W/W v and W sh /W sh mice, and their corresponding controls. As expected, the low calcium diet induced cancellous bone loss in the W/W v mice. In contrast, W sh /W sh cancellous bone did not respond to this diet. This c-Kit mutation prevented cancellous bone loss by antagonizing the low calcium diet-induced increase in osteoblast and osteoclast numbers in the W sh /W sh mice. Gene expression profiling showed that calcium deficiency increased Osx, Ocn, Alp, type I collagen, c-Fms, M-CSF, and RANKL/OPG mRNA expression in controls; however, the W sh mutation suppressed these effects. Our findings indicate that although calcium restriction increased bone turnover, leading to osteopenia, the decreased c-Kit expression levels in the W sh /W sh mice prevented the low calcium diet-induced increase in cancellous bone turnover and bone loss but not the cortical bone loss.

  11. Cordyceps sinensis Oral Liquid Inhibits Damage Induced by Oxygen and Glucose Deprivation in SH-SY5Y Cells.

    Science.gov (United States)

    Zou, Ying-Xin; Liu, Yu-Xiang; Ruan, Ming-Hua; Zhou, Yi; Wang, Jia-Chun; Chu, Zhi-Yong

    2016-01-01

    Cordyceps sinensis has been used in traditional Chinese medicine for thousands of years. It has been demonstrated to have a variety of biological activities, and an extract of it has been demonstrated to possess a protective effect in occlusion-induced focal cerebral ischemia of the middle cerebral artery in rats. It could be explored as an agent for treatment of ischemic stroke, and the mechanisms need to be studied further. The study intended to investigate the protective effects of the Cordyceps sinensis oral liquid (CSOL) against damage induced by oxygen and glucose deprivation (OGD) in SH-SY5Y cells. DESIGN • The research team designed an in vitro study. The study occurred at the Naval Medical Research Institute in Shanghai, China. SH-SY5Y cells were exposed to CSOL in doses of 0.01, 0.03, 0.10, 0.30, and 1.00 mg/mL, creating 5 intervention groups. The OGD condition was induced by transfer of the cells from high-glucose Dulbecco's Modified Eagle's medium (DMEM) in a box gassed with air containing 5% CO2 to glucose-free DMEM in a box gassed with 94% N2, 5% CO2, and 1% O2. Like the cells for the interventions groups, the cells for a model group were cultured with high-glucose DMEM and were transferred to the OGD, but they received no dose of COSL. Cells in a control group were cultured with high-glucose DMEM, were not transferred to the OGD condition, and did not receive any dose of COSL. Cell viability was assayed using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) method. The apoptosis and the mitochondrial membrane potential (MMP) were detected by flow cytometry, and the protein expression of caspase-3 was observed by western blot. After exposure to OGD, the cell viability of cells treated with 0.01, 0.03, 0.10, 0.30, and 1.00 mg/mL of CSOL increased in a dose-effect relationship. Compared with the cells in the model group, the treatment of CSOL at all the experimental concentrations significantly inhibited both the cell apoptosis

  12. Plasma properties

    International Nuclear Information System (INIS)

    Weitzner, H.

    1990-06-01

    This paper discusses the following topics: MHD plasma activity: equilibrium, stability and transport; statistical analysis; transport studies; edge physics studies; wave propagation analysis; basic plasma physics and fluid dynamics; space plasma; and numerical methods

  13. SH2-inositol phosphatase 1 negatively influences early megakaryocyte progenitors.

    Directory of Open Access Journals (Sweden)

    Lia E Perez

    Full Text Available The SH2-containing-5'inositol phosphatase-1 (SHIP influences signals downstream of cytokine/chemokine receptors that play a role in megakaryocytopoiesis, including thrombopoietin, stromal-cell-derived-Factor-1/CXCL-12 and interleukin-3. We hypothesize that SHIP might control megakaryocytopoiesis through effects on proliferation of megakaryocyte progenitors (MKP and megakaryocytes (MK.Herein, we report the megakaryocytic phenotype and MK functional assays of hematopoietic organs of two strains of SHIP deficient mice with deletion of the SHIP promoter/first exon or the inositol phosphatase domain. Both SHIP deficient strains exhibit a profound increase in MKP numbers in bone marrow (BM, spleen and blood as analyzed by flow cytometry (Lin(-c-Kit+CD41+ and functional assays (CFU-MK. SHIP deficient MKP display increased phosphorylation of Signal Transducers and Activators of Transcription 3 (STAT-3, protein kinase B (PKB/AKT and extracellular signal-regulated kinases (ERKs. Despite increased MKP content, total body number of mature MK (Lin(-c-kit(-CD41+ are not significantly changed as SHIP deficient BM contains reduced MK while spleen MK numbers are increased. Reduction of CXCR-4 expression in SHIP deficient MK may influence MK localization to the spleen instead of the BM. Endomitosis, process involved in MK maturation, was preserved in SHIP deficient MK. Circulating platelets and red blood cells are also reduced in SHIP deficient mice.SHIP may play an important role in regulation of essential signaling pathways that control early megakaryocytopoiesis in vivo.

  14. Plasma accelerators

    International Nuclear Information System (INIS)

    Bingham, R.; Angelis, U. de; Johnston, T.W.

    1991-01-01

    Recently attention has focused on charged particle acceleration in a plasma by a fast, large amplitude, longitudinal electron plasma wave. The plasma beat wave and plasma wakefield accelerators are two efficient ways of producing ultra-high accelerating gradients. Starting with the plasma beat wave accelerator (PBWA) and laser wakefield accelerator (LWFA) schemes and the plasma wakefield accelerator (PWFA) steady progress has been made in theory, simulations and experiments. Computations are presented for the study of LWFA. (author)

  15. Association between receptor protein-tyrosine phosphatase RPTPalpha and the Grb2 adaptor. Dual Src homology (SH) 2/SH3 domain requirement and functional consequences

    DEFF Research Database (Denmark)

    Su, J; Yang, L T; Sap, J

    1996-01-01

    domain in Grb2 (, ). We show here that association of Grb2 with RPTPalpha also involves a critical function for the C-terminal SH3 domain of Grb2. Furthermore, Grb2 SH3 binding peptides interfere with RPTPalpha-Grb2 association in vitro, and the RPTPalpha protein can dissociate the Grb2-Sos complex...... in vivo. These observations constitute a novel mode of Grb2 association and suggest a model in which association with a tyrosine-phosphorylated protein restricts the repertoire of SH3 binding proteins with which Grb2 can simultaneously interact. The function of the Tyr798 tyrosine phosphorylation/Grb2...... binding site in RPTPalpha was studied further by expression of wild type or mutant RPTPalpha proteins in PC12 cells. In these cells, wild type RPTPalpha interferes with acidic fibroblast growth factor-induced neurite outgrowth; this effect requires both the catalytic activity and the Grb2 binding Tyr798...

  16. Replication analysis of genetic association of the NCAN-CILP2 region with plasma lipid levels and non-alcoholic fatty liver disease in Asian and Pacific ethnic groups.

    Science.gov (United States)

    Boonvisut, Supichaya; Nakayama, Kazuhiro; Makishima, Saho; Watanabe, Kazuhisa; Miyashita, Hiroshi; Lkhagvasuren, Munkhtulga; Kagawa, Yasuo; Iwamoto, Sadahiko

    2016-01-13

    The Neurocan-cartilage intermediate layer protein 2 (NCAN-CILP2) region forms a tight linkage disequilibrium (LD) block and is associated with plasma lipid levels and non-alcoholic fatty liver disease (NAFLD) in individuals of European descent but not in the Malay and Japanese ethnic groups. Recent genome-wide resequence studies identified a missense single-nucleotide polymorphism (SNP) (rs58542926) of the transmembrane 6 superfamily member 2 (TM6SF2) gene in the NCAN-CILP2 region related to hepatic triglyceride content. This study aims to analyze the influences of SNPs in this region on NAFLD and plasma lipid levels in the Asian and Pacific ethnic groups and to reveal the reasons behind positive and negative genetic associations dependent on ethnicity. Samples and characteristic data were collected from 3,013 Japanese, 119 Palauan, 947 Mongolian, 212 Thai and 401 Chinese people. Hepatic sonography data was obtained from the Japanese individuals. Genotyping data of five SNPs, rs58542926, rs735273, rs1009136, rs1858999, and rs16996148, were used to verify the effect on serum lipid levels by multiple linear regression, and the association with NAFLD in the Japanese population was examined by logistic regression analysis. rs58542926 showed significant association with the plasma triglyceride (TG) level in Japanese (P = 0.0009, effect size = 9.5 (± 3.25) mg/dl/allele) and Thai (P = 0.0008, effect size = 31.6 (± 11.7) mg/dl/allele) study subjects. In Mongolian individuals, there was a significant association of rs58542926 with total cholesterol level (P = 0.0003, 11.7 (± 3.2) mg/dl/allele) but not with TG level. In multiple comparisons in Chinese individuals, rs58542926 was weakly (P = 0.022) associated with TG levels, although the threshold for statistical significance was not reached. In Palauan individuals, there was no significant association with the studied SNPs. rs58542926 also showed significant association with Japanese NAFLD. The minor allele (t) increased

  17. Effects of Ginkgo biloba extract on the apoptosis of oxygen and glucose-deprived SH-SY5Y cells and its mechanism.

    Science.gov (United States)

    Ba, Xiao-Hong; Min, Lian-Qiu

    2015-01-01

    The aim was to observe the effects of the extract of Ginkgo biloba (EGb761) on the apoptosis of oxygen and glucose-deprived (OGD) human neuroblastoma cells (SH-SY5Y) cells and explore its mechanism. SH-SY5Y cells were divided into normal control group, OGD group, OGD for 4 h and EGb761-pretreated groups including very low-concentration (20 μg/ml), low-concentration group (25 μg/ml), moderate-concentration group (50 μg/ml) and high-concentration group (100 μg/ml). Twenty four hours after reoxygenation, cell viability was determined with 3-[4, 5-dimehyl-2-thiazolyl]-2, 5-diphenyl-2H-tetrazolium bromide assay, apoptosis rate was detected with annexin V-fluorescein isothiocyanate/propidium iodide double staining flow cytometry and the protein level of apoptosis-inducing factor (AIF) was observed with immunofluorescence technique in each group. Cell viability was significantly lower in OGD group than in EGb761-pretreated groups, especially in moderate-concentration group (50 μg/ml) (P cells probably through inhibiting AIF nuclear translocation. This study provides a theoretical basis for the application of EGb761 in clinical practice.

  18. Infrared Spectra and Band Strengths of CH3SH, an Interstellar Molecule

    Science.gov (United States)

    Hudson, R. L.

    2016-01-01

    Three solid phases of CH3SH (methanethiol or methyl mercaptan) have been prepared and their mid-infrared spectra recorded at 10-110 degrees Kelvin, with an emphasis on the 17-100 degrees Kelvin region. Refractive indices have been measured at two temperatures and used to estimate ice densities and infrared band strengths. Vapor pressures for the two crystalline phases of CH3SH at 110 degrees Kelvin are estimated. The behavior of amorphous CH3SH on warming is presented and discussed in terms of Ostwald's step rule. Comparisons to CH3OH under similar conditions are made, and some inconsistencies and ambiguities in the CH3SH literature are examined and corrected.

  19. Polymorphisms in sh2b1 and spns1 loci are associated with ...

    Indian Academy of Sciences (India)

    SH2B1, which encodes a signal transduction adaptor protein ... Here, we studied the associa- tion of eight single ... Health Study (NSPHS) cohort, consisting of 719 individuals ... mate can lower triglyceride levels, and elevate high-density.

  20. USAF TPS L-23 Shear Wind Observed Optimized Path Investigation for NASA (SENIOR ShWOOPIN)

    National Research Council Canada - National Science Library

    Gordon, Randy; Fails, Robert; Baase, Solomon; Eckberg, Jason; Ryan, Charles; Smith, Chris

    2006-01-01

    The SENIOR ShWOOPIN TMP was conducted at the request of the USAF TPS as part of a NASA investigation into the viability of aircraft endurance enhancement through the extraction of energy from horizontal wind gradients...

  1. Deciphering Phosphotyrosine-Dependent Signaling Networks in Cancer by SH2 Profiling

    Science.gov (United States)

    Machida, Kazuya; Khenkhar, Malik

    2012-01-01

    It has been a decade since the introduction of SH2 profiling, a modular domain-based molecular diagnostics tool. This review covers the original concept of SH2 profiling, different analytical platforms, and their applications, from the detailed analysis of single proteins to broad screening in translational research. Illustrated by practical examples, we discuss the uniqueness and advantages of the approach as well as its limitations and challenges. We provide guidance for basic researchers and oncologists who may consider SH2 profiling in their respective cancer research, especially for those focusing on tyrosine phosphoproteomics. SH2 profiling can serve as an alternative phosphoproteomics tool to dissect aberrant tyrosine kinase pathways responsible for individual malignancies, with the goal of facilitating personalized diagnostics for the treatment of cancer. PMID:23226573

  2. Semi-supervised prediction of SH2-peptide interactions from imbalanced high-throughput data.

    Science.gov (United States)

    Kundu, Kousik; Costa, Fabrizio; Huber, Michael; Reth, Michael; Backofen, Rolf

    2013-01-01

    Src homology 2 (SH2) domains are the largest family of the peptide-recognition modules (PRMs) that bind to phosphotyrosine containing peptides. Knowledge about binding partners of SH2-domains is key for a deeper understanding of different cellular processes. Given the high binding specificity of SH2, in-silico ligand peptide prediction is of great interest. Currently however, only a few approaches have been published for the prediction of SH2-peptide interactions. Their main shortcomings range from limited coverage, to restrictive modeling assumptions (they are mainly based on position specific scoring matrices and do not take into consideration complex amino acids inter-dependencies) and high computational complexity. We propose a simple yet effective machine learning approach for a large set of known human SH2 domains. We used comprehensive data from micro-array and peptide-array experiments on 51 human SH2 domains. In order to deal with the high data imbalance problem and the high signal-to-noise ration, we casted the problem in a semi-supervised setting. We report competitive predictive performance w.r.t. state-of-the-art. Specifically we obtain 0.83 AUC ROC and 0.93 AUC PR in comparison to 0.71 AUC ROC and 0.87 AUC PR previously achieved by the position specific scoring matrices (PSSMs) based SMALI approach. Our work provides three main contributions. First, we showed that better models can be obtained when the information on the non-interacting peptides (negative examples) is also used. Second, we improve performance when considering high order correlations between the ligand positions employing regularization techniques to effectively avoid overfitting issues. Third, we developed an approach to tackle the data imbalance problem using a semi-supervised strategy. Finally, we performed a genome-wide prediction of human SH2-peptide binding, uncovering several findings of biological relevance. We make our models and genome-wide predictions, for all the 51 SH2

  3. Src binds cortactin through an SH2 domain cystine-mediated linkage

    Science.gov (United States)

    Evans, Jason V.; Ammer, Amanda G.; Jett, John E.; Bolcato, Chris A.; Breaux, Jason C.; Martin, Karen H.; Culp, Mark V.; Gannett, Peter M.; Weed, Scott A.

    2012-01-01

    Summary Tyrosine-kinase-based signal transduction mediated by modular protein domains is critical for cellular function. The Src homology (SH)2 domain is an important conductor of intracellular signaling that binds to phosphorylated tyrosines on acceptor proteins, producing molecular complexes responsible for signal relay. Cortactin is a cytoskeletal protein and tyrosine kinase substrate that regulates actin-based motility through interactions with SH2-domain-containing proteins. The Src kinase SH2 domain mediates cortactin binding and tyrosine phosphorylation, but how Src interacts with cortactin is unknown. Here we demonstrate that Src binds cortactin through cystine bonding between Src C185 in the SH2 domain within the phosphotyrosine binding pocket and cortactin C112/246 in the cortactin repeats domain, independent of tyrosine phosphorylation. Interaction studies show that the presence of reducing agents ablates Src-cortactin binding, eliminates cortactin phosphorylation by Src, and prevents Src SH2 domain binding to cortactin. Tandem MS/MS sequencing demonstrates cystine bond formation between Src C185 and cortactin C112/246. Mutational studies indicate that an intact cystine binding interface is required for Src-mediated cortactin phosphorylation, cell migration, and pre-invadopodia formation. Our results identify a novel phosphotyrosine-independent binding mode between the Src SH2 domain and cortactin. Besides Src, one quarter of all SH2 domains contain cysteines at or near the analogous Src C185 position. This provides a potential alternative mechanism to tyrosine phosphorylation for cysteine-containing SH2 domains to bind cognate ligands that may be widespread in propagating signals regulating diverse cellular functions. PMID:23097045

  4. A photoaffinity scan maps regions of the p85 SH2 domain involved in phosphoprotein binding.

    Science.gov (United States)

    Williams, K P; Shoelson, S E

    1993-03-15

    Src homology 2 (SH2) domains are modular phosphotyrosine binding pockets found within a wide variety of cytoplasmic signaling molecules. Here we develop a new approach to analyzing protein-protein interfaces termed photoaffinity scanning, and apply the method to map regions of the phosphatidylinositol 3-kinase p85 SH2 domain that participate in phospho-protein binding. Each residue except phosphotyrosine (pY) within a tightly binding, IRS-1-derived phosphopeptide (GNGDpYMPMSPKS) was substituted with the photoactive amino acid, benzoylphenylalanine (Bpa). Whereas most substitutions had little effect on binding affinity, Bpa substitution of either Met (+1 and +3 with respect to pY) reduced affinity 50-100-fold to confirm their importance in the pYMXM recognition motif. In three cases photolysis of SH2 domain/Bpa phosphopeptide complexes led to cross-linking of > 50% of the SH2 domain; cross-link positions were identified by microsequence, amino acid composition, and electrospray mass spectrometric analyses. Bpa-1 cross-links within alpha-helix I, whereas Bpa+1 and Bpa+4 cross-link the SH2 domain within the flexible loop C-terminal to alpha-helix II. Moreover, cross-linking at any position prevents SH2 domain cleavage at a trypsin-sensitive site within the flexible loop between beta-strands 1 and 2. Therefore, at least three distinct SH2 regions in addition to the beta-sheet participate in phosphoprotein binding; the loop cross-linked by phosphopeptide residues C-terminal to pY appears to confer specificity to the phosphoprotein/SH2 domain interaction.

  5. Abl N-terminal Cap stabilization of SH3 domain dynamics†

    OpenAIRE

    Chen, Shugui; Dumitrescu, Teodora Pene; Smithgall, Thomas E.; Engen, John R.

    2008-01-01

    Crystal structures and other biochemical data indicate that the N-terminal cap (NCap) region of the Abelson tyrosine kinase (c-Abl) is important for maintaining the downregulated conformation of the kinase domain. The exact contributions that NCap makes in stabilizing the various intramolecular interactions within c-Abl are less clear. While the NCap appears important for locking the SH3/SH2 domains to the back of the kinase domain, there may be other more subtle elements of regulation. Hydro...

  6. Dental size variation in the Atapuerca-SH Middle Pleistocene hominids.

    Science.gov (United States)

    Bermúdez de Castro, J M; Sarmiento, S; Cunha, E; Rosas, A; Bastir, M

    2001-09-01

    The Middle Pleistocene Atapuerca-Sima de los Huesos (SH) site in Spain has yielded the largest sample of fossil hominids so far found from a single site and belonging to the same biological population. The SH dental sample includes a total of 452 permanent and deciduous teeth, representing a minimum of 27 individuals. We present a study of the dental size variation in these hominids, based on the analysis of the mandibular permanent dentition: lateral incisors, n=29; canines, n=27; third premolars, n=30; fourth premolars, n=34; first molars, n=38; second molars, n=38. We have obtained the buccolingual diameter and the crown area (measured on occlusal photographs) of these teeth, and used the bootstrap method to assess the amount of variation in the SH sample compared with the variation of a modern human sample from the Museu Antropologico of the Universidade of Coimbra (Portugal). The SH hominids have, in general terms, a dental size variation higher than that of the modern human sample. The analysis is especially conclusive for the canines. Furthermore, we have estimated the degree of sexual dimorphism of the SH sample by obtaining male and female dental subsamples by means of sexing the large sample of SH mandibular specimens. We obtained the index of sexual dimorphism (ISD=male mean/female mean) and the values were compared with those obtained from the sexed modern human sample from Coimbra, and with data found in the literature concerning several recent human populations. In all tooth classes the ISD of the SH hominids was higher than that of modern humans, but the differences were generally modest, except for the canines, thus suggesting that canine size sexual dimorphism in Homo heidelbergensis was probably greater than that of modern humans. Since the approach of sexing fossil specimens has some obvious limitations, these results should be assessed with caution. Additional data from SH and other European Middle Pleistocene sites would be necessary to test

  7. Cold collisions of SH- with He: Potential energy surface and rate coefficients

    Science.gov (United States)

    Bop, C. T.; Trabelsi, T.; Hammami, K.; Mogren Al Mogren, M.; Lique, F.; Hochlaf, M.

    2017-09-01

    Collisional energy transfer under cold conditions is of great importance from the fundamental and applicative point of view. Here, we investigate low temperature collisions of the SH- anion with He. We have generated a three-dimensional potential energy surface (PES) for the SH-(X1Σ+)-He(1S) van der Waals complex. The ab initio multi-dimensional interaction PES was computed using the explicitly correlated coupled cluster approach with simple, double, and perturbative triple excitation in conjunction with the augmented-correlation consistent-polarized valence triple zeta Gaussian basis set. The PES presents two minima located at linear geometries. Then, the PES was averaged over the ground vibrational wave function of the SH- molecule and the resulting two-dimensional PES was incorporated into exact quantum mechanical close coupling calculations to study the collisional excitation of SH- by He. We have computed inelastic cross sections among the 11 first rotational levels of SH- for energies up to 2500 cm-1. (De-)excitation rate coefficients were deduced for temperatures ranging from 1 to 300 K by thermally averaging the cross sections. We also performed calculations using the new PES for a fixed internuclear SH- distance. Both sets of results were found to be in reasonable agreement despite differences existing at low temperatures confirming that accurate predictions require the consideration of all internal degrees of freedom in the case of molecular hydrides. The rate coefficients presented here may be useful in interpreting future experimental work on the SH- negative ion colliding with He as those recently done for the OH--He collisional system as well as for possible astrophysical applications in case SH- would be detected in the interstellar medium.

  8. Src binds cortactin through an SH2 domain cystine-mediated linkage.

    Science.gov (United States)

    Evans, Jason V; Ammer, Amanda G; Jett, John E; Bolcato, Chris A; Breaux, Jason C; Martin, Karen H; Culp, Mark V; Gannett, Peter M; Weed, Scott A

    2012-12-15

    Tyrosine-kinase-based signal transduction mediated by modular protein domains is critical for cellular function. The Src homology (SH)2 domain is an important conductor of intracellular signaling that binds to phosphorylated tyrosines on acceptor proteins, producing molecular complexes responsible for signal relay. Cortactin is a cytoskeletal protein and tyrosine kinase substrate that regulates actin-based motility through interactions with SH2-domain-containing proteins. The Src kinase SH2 domain mediates cortactin binding and tyrosine phosphorylation, but how Src interacts with cortactin is unknown. Here we demonstrate that Src binds cortactin through cystine bonding between Src C185 in the SH2 domain within the phosphotyrosine binding pocket and cortactin C112/246 in the cortactin repeats domain, independent of tyrosine phosphorylation. Interaction studies show that the presence of reducing agents ablates Src-cortactin binding, eliminates cortactin phosphorylation by Src, and prevents Src SH2 domain binding to cortactin. Tandem MS/MS sequencing demonstrates cystine bond formation between Src C185 and cortactin C112/246. Mutational studies indicate that an intact cystine binding interface is required for Src-mediated cortactin phosphorylation, cell migration, and pre-invadopodia formation. Our results identify a novel phosphotyrosine-independent binding mode between the Src SH2 domain and cortactin. Besides Src, one quarter of all SH2 domains contain cysteines at or near the analogous Src C185 position. This provides a potential alternative mechanism to tyrosine phosphorylation for cysteine-containing SH2 domains to bind cognate ligands that may be widespread in propagating signals regulating diverse cellular functions.

  9. The effect of tryptophan supplemented diets on brain serotonergic activity and plasma cortisol under undisturbed and stressed conditions in grouped-housed Nile tilapia Oreochromis niloticus

    DEFF Research Database (Denmark)

    Martins, C.I.M.; Silva, P.I.M.; Costas, B.

    2013-01-01

    -term supplementation with TRP supplemented diets changes brain serotonergic activity and the stress response associated with slaughter handling in grouped-housed Nile tilapia Oreochromis niloticus. Adult fish (n. =. 108, 490.6. ±. 4.0. g, 12 individuals per tank) were exposed to one of the three treatments...

  10. Application of a fiber Fabry-Perot interferometer sensor for receiving SH-EMAT signals

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jin Hyuk; Kim, Dae Hyun; Park, Ik Keun [Seoul National University of Technology, Seoul (Korea, Republic of)

    2014-04-15

    Shear horizontal (SH) waves propagate as a type of plate wave in a thin sheet. The dispersion characteristics of SH waves can be used for signal analysis. Therefore, SH-waves are useful for monitoring the structural health of a thin-sheet-structure. An electromagnetic acoustic transducer (EMAT), which is a non-contact ultrasonic transducer, can generate SH-waves easily by varying the shape and array of magnets and coils. Therefore, an EMAT can be applied to an automated ultrasonic testing system for structural health monitoring. When used as a sensor, however, the EMAT has a weakness in that electromagnetic interference (EMI) noise can occur easily in the automated system because of motors and electric devices. Alternatively, a fiber optic sensor works well in the same environment with EMI noise because it uses a light signal instead of an electric signal. In this paper, a fiber Fabry-Prot interferometer (FFPI) was proposed as a sensor to receive the SH-waves generated by an EMAT. A simple test was performed to verify the performance of the FFPI sensor. It is thus shown that the FFPI can receive SH-wave signals clearly.

  11. Rosette Assay: Highly Customizable Dot-Blot for SH2 Domain Screening.

    Science.gov (United States)

    Ng, Khong Y; Machida, Kazuya

    2017-01-01

    With a growing number of high-throughput studies, structural analyses, and availability of protein-protein interaction databases, it is now possible to apply web-based prediction tools to SH2 domain-interactions. However, in silico prediction is not always reliable and requires experimental validation. Rosette assay is a dot blot-based reverse-phase assay developed for the assessment of binding between SH2 domains and their ligands. It is conveniently customizable, allowing for low- to high-throughput analysis of interactions between various numbers of SH2 domains and their ligands, e.g., short peptides, purified proteins, and cell lysates. The binding assay is performed in a 96-well plate (MBA or MWA apparatus) in which a sample spotted membrane is incubated with up to 96 labeled SH2 domains. Bound domains are detected and quantified using a chemiluminescence or near-infrared fluorescence (IR) imaging system. In this chapter, we describe a practical protocol for rosette assay to assess interactions between synthesized tyrosine phosphorylated peptides and a library of GST-tagged SH2 domains. Since the methodology is not confined to assessment of SH2-pTyr interactions, rosette assay can be broadly utilized for ligand and drug screening using different protein interaction domains or antibodies.

  12. Evolution of Src Homology 2 (SH2) Domain to Recognize Sulfotyrosine.

    Science.gov (United States)

    Ju, Tong; Niu, Wei; Guo, Jiantao

    2016-09-16

    Protein tyrosine O-sulfation is considered as the most common type of post-translational tyrosine modification in nature and plays important roles in extracellular biomolecular interactions. To facilitate the mapping, biological study, and medicinal application of this type of post-translational modification, we seek to evolve a small protein scaffold that recognizes sulfotyrosine with high affinity. We focused our efforts on the engineering of the Src Homology 2 (SH2) domain, which represents the largest class of known phosphotyrosine-recognition domain in nature and has a highly evolvable binding pocket. By using phage display, we successfully engineered the SH2 domain to recognize sulfotyrosine with high affinity. The best mutant, SH2-60.1, displayed more than 1700 fold higher sulfotyrosine-binding affinity than that of the wild-type SH2 domain. We also demonstrated that the evolved SH2 domain mutants could be used to detect sulfoprotein levels on the cell surface. These evolved SH2 domain mutants can be potentially applied to the study of protein tyrosine O-sulfation with proper experimental designs.

  13. Platelet rich Plasma in Achilles Tendon Healing 2 (PATH-2) trial: protocol for a multicentre, participant and assessor-blinded, parallel-group randomised clinical trial comparing platelet-rich plasma (PRP) injection versus placebo injection for Achilles tendon rupture.

    Science.gov (United States)

    Alsousou, Joseph; Keene, David J; Hulley, Philippa A; Harrison, Paul; Wagland, Susan; Byrne, Christopher; Schlüssel, Michael Maia; Dutton, Susan J; Lamb, Sarah E; Willett, Keith

    2017-11-16

    Achilles tendon injuries give rise to substantial long-lasting morbidity and pose considerable challenges for clinicians and patients during the lengthy healing period. Current treatment strategies struggle to curb the burden of this injury on health systems and society due to lengthy rehabilitation, work absence and reinjury risk. Platelet-rich plasma (PRP) is an autologous preparation that has been shown to improve the mechanobiological properties of tendons in laboratory and animal studies. The use of PRP in musculoskeletal injuries is on the increase despite the lack of adequately powered clinical studies. This is a multicentre randomised controlled trial to evaluate the efficacy and mechanism of PRP in patients with acute Achilles tendon rupture (ATR). All adults with acute ATR presenting within 12 days of the injury who are to be treated non-operatively are eligible. A total of 230 consenting patients will be randomly allocated via a remote web-based service to receive PRP injection or placebo injection to the site of the injury. All participants will be blinded to the intervention and will receive standardised rehabilitation to reduce efficacy interference.Participants will be followed up with blinded assessments of muscle-tendon function, quality of life, pain and overall patient's functional goals at 4, 7, 13, 24 weeks and 24 months post-treatment. The primary outcome is the heel-rise endurance test (HRET), which will be supervised by a blinded assessor at 24 weeks. A subgroup of 16 participants in one centre will have needle biopsy under ultrasound guidance at 6 weeks. Blood and PRP will be analysed for cell count, platelet activation and growth factor concentrations. The protocol has been approved by the Oxfordshire Research Ethics Committee (Oxfordshire Research Ethics Committee A, reference no 14/SC/1333). The trial will be reported in accordance with the CONSORT statement and published in peer-reviewed scientific journals. ISRCTN: 54992179, assigned

  14. Pharmacological Characterization of the Mechanisms Involved in Delayed Calcium Deregulation in SH-SY5Y Cells Challenged with Methadone

    Directory of Open Access Journals (Sweden)

    Sergio Perez-Alvarez

    2012-01-01

    Full Text Available Previously, we have shown that SH-SY5Y cells exposed to high concentrations of methadone died due to a necrotic-like cell death mechanism related to delayed calcium deregulation (DCD. In this study, we show that, in terms of their Ca2+ responses to 0.5 mM methadone, SH-SY5Y cells can be pooled into four different groups. In a broad pharmacological survey, the relevance of different Ca2+-related mechanisms on methadone-induced DCD was investigated including extracellular calcium, L-type Ca2+ channels, μ-opioid receptor, mitochondrial inner membrane potential, mitochondrial ATP synthesis, mitochondrial Ca2+/2Na+-exchanger, reactive oxygen species, and mitochondrial permeability transition. Only those compounds targeting mitochondria such as oligomycin, FCCP, CGP 37157, and cyclosporine A were able to amend methadone-induced Ca2+ dyshomeostasis suggesting that methadone induces DCD by modulating the ability of mitochondria to handle Ca2+. Consistently, mitochondria became dramatically shorter and rounder in the presence of methadone. Furthermore, analysis of oxygen uptake by isolated rat liver mitochondria suggested that methadone affected mitochondrial Ca2+ uptake in a respiratory substrate-dependent way. We conclude that methadone causes failure of intracellular Ca2+ homeostasis, and this effect is associated with morphological and functional changes of mitochondria. Likely, this mechanism contributes to degenerative side effects associated with methadone treatment.

  15. Effect of graphene oxide on undifferentiated and retinoic acid-differentiated SH-SY5Y cells line

    Science.gov (United States)

    Lv, Min; Zhang, Yujie; Liang, Le; Wei, Min; Hu, Wenbing; Li, Xiaoming; Huang, Qing

    2012-06-01

    Graphene oxide (GO), has created an unprecedented opportunity for development and application in biology, due to its abundant functional groups and well water solubility. Recently, the potential toxicity of GO in the environment and in humans has garnered more and more attention. In this paper, we systematically studied the cytotoxicity of GO nanosheets via examining the effect of GO on the morphology, viability and differentiation of a human neuroblastoma SH-SY5Y cell line, which was an ideal model used to study neuronal disease in vitro. The results suggested that GO had no obvious cytotoxicity at low concentration (cells exhibited dose- and time-dependent decreases at high concentration (>=80 μg mL-1). Moreover, GO did not induce apoptosis. Very interestingly, GO significantly enhanced the differentiation of SH-SY5Y induced-retinoic acid (RA) by evaluating neurite length and the expression of neuronal marker MAP2. These data provide a promising application for neurodegenerative diseases.

  16. Quantum spin Hall insulator BiXH (XH = OH, SH) monolayers with a large bulk band gap.

    Science.gov (United States)

    Hu, Xing-Kai; Lyu, Ji-Kai; Zhang, Chang-Wen; Wang, Pei-Ji; Ji, Wei-Xiao; Li, Ping

    2018-05-16

    A large bulk band gap is critical for the application of two-dimensional topological insulators (TIs) in spintronic devices operating at room temperature. On the basis of first-principles calculations, we predict BiXH (X = OH, SH) monolayers as TIs with an extraordinarily large bulk gap of 820 meV for BiOH and 850 meV for BiSH, and propose a tight-binding model considering spin-orbit coupling to describe the electronic properties of BiXH. These large gaps are entirely due to the strong spin-orbit interaction related to the pxy orbitals of the Bi atoms of the honeycomb lattice. The orbital filtering mechanism can be used to understand the topological properties of BiXH. The XH groups simply remove one branch of orbitals (pz of Bi) and reduce the trivial 6-band lattice into a 4-band, which is topologically non-trivial. The topological characteristics of BiXH monolayers are confirmed by nonzero topological invariant Z2 and a single pair of gapless helical edge states in the bulk gap. Owing to these features, the BiXH monolayers of the large-gap TIs are an ideal platform to realize many exotic phenomena and fabricate new quantum devices working at room temperature.

  17. Plasma device

    International Nuclear Information System (INIS)

    Thode, L.E.

    1981-01-01

    A method is described for electron beam heating of a high-density plasma to drive a fast liner. An annular or solid relativistic electron beam is used to heat a plasma to kilovolt temperatures through streaming instabilities in the plasma. Energy deposited in the plasma then converges on a fast liner to explosively or ablatively drive the liner to implosion. (U.K.)

  18. Plasma Modes

    Science.gov (United States)

    Dubin, D. H. E.

    This chapter explores several aspects of the linear electrostatic normal modes of oscillation for a single-species non-neutral plasma in a Penning trap. Linearized fluid equations of motion are developed, assuming the plasma is cold but collisionless, which allow derivation of the cold plasma dielectric tensor and the electrostatic wave equation. Upper hybrid and magnetized plasma waves in an infinite uniform plasma are described. The effect of the plasma surface in a bounded plasma system is considered, and the properties of surface plasma waves are characterized. The normal modes of a cylindrical plasma column are discussed, and finally, modes of spheroidal plasmas, and finite temperature effects on the modes, are briefly described.

  19. Characterization of Durham virus, a novel rhabdovirus that encodes both a C and SH protein.

    Science.gov (United States)

    Allison, A B; Palacios, G; Travassos da Rosa, A; Popov, V L; Lu, L; Xiao, S Y; DeToy, K; Briese, T; Lipkin, W I; Keel, M K; Stallknecht, D E; Bishop, G R; Tesh, R B

    2011-01-01

    The family Rhabdoviridae is a diverse group of non-segmented, negative-sense RNA viruses that are distributed worldwide and infect a wide range of hosts including vertebrates, invertebrates, and plants. Of the 114 currently recognized vertebrate rhabdoviruses, relatively few have been well characterized at both the antigenic and genetic level; hence, the phylogenetic relationships between many of the vertebrate rhabdoviruses remain unknown. The present report describes a novel rhabdovirus isolated from the brain of a moribund American coot (Fulica americana) that exhibited neurological signs when found in Durham County, North Carolina, in 2005. Antigenic characterization of the virus revealed that it was serologically unrelated to 68 other known vertebrate rhabdoviruses. Genomic sequencing of the virus indicated that it shared the highest identity to Tupaia rhabdovirus (TUPV), and as only previously observed in TUPV, the genome encoded a putative C protein in an overlapping open reading frame (ORF) of the phosphoprotein gene and a small hydrophobic (SH) protein located in a novel ORF between the matrix and glycoprotein genes. Phylogenetic analysis of partial amino acid sequences of the nucleoprotein and polymerase protein indicated that, in addition to TUPV, the virus was most closely related to avian and small mammal rhabdoviruses from Africa and North America. In this report, we present the morphological, pathological, antigenic, and genetic characterization of the new virus, tentatively named Durham virus (DURV), and discuss its potential evolutionary relationship to other vertebrate rhabdoviruses. Copyright © 2010 Elsevier B.V. All rights reserved.

  20. SH Oxidation Stimulates Calcium Release Channels (Ryanodine Receptors From Excitable Cells

    Directory of Open Access Journals (Sweden)

    CECILIA HIDALGO

    2000-01-01

    Full Text Available The effects of redox reagents on the activity of the intracellular calcium release channels (ryanodine receptors of skeletal and cardiac muscle, or brain cortex neurons, was examined. In lipid bilayer experiments, oxidizing agents (2,2'-dithiodipyridine or thimerosal modified the calcium dependence of all single channels studied. After controlled oxidation channels became active at sub µM calcium concentrations and were not inhibited by increasing the calcium concentration to 0.5 mM. Subsequent reduction reversed these effects. Channels purified from amphibian skeletal muscle exhibited the same behavior, indicating that the SH groups responsible for modifying the calcium dependence belong to the channel protein. Parallel experiments that measured calcium release through these channels in sarcoplasmic reticulum vesicles showed that following oxidation, the channels were no longer inhibited by sub mM concentrations of Mg2+. It is proposed that channel redox state controls the high affinity sites responsible for calcium activation as well as the low affinity sites involved in Mg2+ inhibition of channel activity. The possible physiological and pathological implications of these results are discussed

  1. The SH2 and SH3 domains of mammalian Grb2 couple the EGF receptor to the Ras activator mSos1.

    Science.gov (United States)

    Rozakis-Adcock, M; Fernley, R; Wade, J; Pawson, T; Bowtell, D

    1993-05-06

    Many tyrosine kinases, including the receptors for hormones such as epidermal growth factor (EGF), nerve growth factor and insulin, transmit intracellular signals through Ras proteins. Ligand binding to such receptors stimulates Ras guanine-nucleotide-exchange activity and increases the level of GTP-bound Ras, suggesting that these tyrosine kinases may activate a guanine-nucleotide releasing protein (GNRP). In Caenorhabditis elegans and Drosophila, genetic studies have shown that Ras activation by tyrosine kinases requires the protein Sem-5/drk, which contains a single Src-homology (SH) 2 domain and two flanking SH3 domains. Sem-5 is homologous to the mammalian protein Grb2, which binds the autophosphorylated EGF receptor and other phosphotyrosine-containing proteins such as Shc through its SH2 domain. Here we show that in rodent fibroblasts, the SH3 domains of Grb2 are bound to the proline-rich carboxy-terminal tail of mSos1, a protein homologous to Drosophila Sos. Sos is required for Ras signalling and contains a central domain related to known Ras-GNRPs. EGF stimulation induces binding of the Grb2-mSos1 complex to the autophosphorylated EGF receptor, and mSos1 phosphorylation. Grb2 therefore appears to link tyrosine kinases to a Ras-GNRP in mammalian cells.

  2. New approaches to high-throughput structure characterization of SH3 complexes: the example of Myosin-3 and Myosin-5 SH3 domains from S. cerevisiae.

    Science.gov (United States)

    Musi, Valeria; Birdsall, Berry; Fernandez-Ballester, Gregorio; Guerrini, Remo; Salvatori, Severo; Serrano, Luis; Pastore, Annalisa

    2006-04-01

    SH3 domains are small protein modules that are involved in protein-protein interactions in several essential metabolic pathways. The availability of the complete genome and the limited number of clearly identifiable SH3 domains make the yeast Saccharomyces cerevisae an ideal proteomic-based model system to investigate the structural rules dictating the SH3-mediated protein interactions and to develop new tools to assist these studies. In the present work, we have determined the solution structure of the SH3 domain from Myo3 and modeled by homology that of the highly homologous Myo5, two myosins implicated in actin polymerization. We have then implemented an integrated approach that makes use of experimental and computational methods to characterize their binding properties. While accommodating their targets in the classical groove, the two domains have selectivity in both orientation and sequence specificity of the target peptides. From our study, we propose a consensus sequence that may provide a useful guideline to identify new natural partners and suggest a strategy of more general applicability that may be of use in other structural proteomic studies.

  3. A Discovery Strategy for Selective Inhibitors of c-Src in Complex with the Focal Adhesion Kinase SH3/SH2-binding Region.

    Science.gov (United States)

    Moroco, Jamie A; Baumgartner, Matthew P; Rust, Heather L; Choi, Hwan Geun; Hur, Wooyoung; Gray, Nathanael S; Camacho, Carlos J; Smithgall, Thomas E

    2015-08-01

    The c-Src tyrosine kinase co-operates with the focal adhesion kinase to regulate cell adhesion and motility. Focal adhesion kinase engages the regulatory SH3 and SH2 domains of c-Src, resulting in localized kinase activation that contributes to tumor cell metastasis. Using assay conditions where c-Src kinase activity required binding to a tyrosine phosphopeptide based on the focal adhesion kinase SH3-SH2 docking sequence, we screened a kinase-biased library for selective inhibitors of the Src/focal adhesion kinase peptide complex versus c-Src alone. This approach identified an aminopyrimidinyl carbamate compound, WH-4-124-2, with nanomolar inhibitory potency and fivefold selectivity for c-Src when bound to the phospho-focal adhesion kinase peptide. Molecular docking studies indicate that WH-4-124-2 may preferentially inhibit the 'DFG-out' conformation of the kinase active site. These findings suggest that interaction of c-Src with focal adhesion kinase induces a unique kinase domain conformation amenable to selective inhibition. © 2014 John Wiley & Sons A/S.

  4. Roles for SH2 and SH3 domains in Lyn kinase association with activated FcepsilonRI in RBL mast cells revealed by patterned surface analysis.

    Science.gov (United States)

    Hammond, Stephanie; Wagenknecht-Wiesner, Alice; Veatch, Sarah L; Holowka, David; Baird, Barbara

    2009-10-01

    In mast cells, antigen-mediated cross-linking of IgE bound to its high-affinity surface receptor, FcepsilonRI, initiates a signaling cascade that culminates in degranulation and release of allergic mediators. Antigen-patterned surfaces, in which the antigen is deposited in micron-sized features on a silicon substrate, were used to examine the spatial relationship between clustered IgE-FcepsilonRI complexes and Lyn, the signal-initiating tyrosine kinase. RBL mast cells expressing wild-type Lyn-EGFP showed co-redistribution of this protein with clustered IgE receptors on antigen-patterned surfaces, whereas Lyn-EGFP containing an inhibitory point mutation in its SH2 domain did not significantly accumulate with the patterned antigen, and Lyn-EGFP with an inhibitory point mutation in its SH3 domain exhibited reduced interactions. Our results using antigen-patterned surfaces and quantitative cross-correlation image analysis reveal that both the SH2 and SH3 domains contribute to interactions between Lyn kinase and cross-linked IgE receptors in stimulated mast cells.

  5. Interactions of polyomavirus middle T with the SH2 domains of the pp85 subunit of phosphatidylinositol-3-kinase.

    Science.gov (United States)

    Yoakim, M; Hou, W; Liu, Y; Carpenter, C L; Kapeller, R; Schaffhausen, B S

    1992-01-01

    The binding of phosphatidylinositol-3-kinase to the polyomavirus middle T antigen is facilitated by tyrosine phosphorylation of middle T on residue 315. The pp85 subunit of phosphatidylinositol-3-kinase contains two SH2 domains, one in the middle of the molecule and one at the C terminus. When assayed by blotting with phosphorylated middle T, the more N-terminal SH2 domain is responsible for binding to middle T. When assayed in solution with glutathione S transferase fusions, both SH2s are capable of binding phosphorylated middle T. While both SH2 fusions can compete with intact pp85 for binding to middle T, the C-terminal SH2 is the more efficient of the two. Interaction between pp85 or its SH2 domains and middle T can be blocked by a synthetic peptide comprising the tyrosine phosphorylation sequence around middle T residue 315. Despite the fact that middle T can interact with both SH2s, these domains are not equivalent. Only the C-terminal SH2-middle T interaction was blocked by anti-SH2 antibody; the two SH2 fusions also interact with different cellular proteins. Images PMID:1380095

  6. The development and application of a quantitative peptide microarray platform to SH2 domain specificity space

    Science.gov (United States)

    Engelmann, Brett Warren

    The Src homology 2 (SH2) domains evolved alongside protein tyrosine kinases (PTKs) and phosphatases (PTPs) in metazoans to recognize the phosphotyrosine (pY) post-translational modification. The human genome encodes 121 SH2 domains within 111 SH2 domain containing proteins that represent the primary mechanism for cellular signal transduction immediately downstream of PTKs. Despite pY recognition contributing to roughly half of the binding energy, SH2 domains possess substantial binding specificity, or affinity discrimination between phosphopeptide ligands. This specificity is largely imparted by amino acids (AAs) adjacent to the pY, typically from positions +1 to +4 C-terminal to the pY. Much experimental effort has been undertaken to construct preferred binding motifs for many SH2 domains. However, due to limitations in previous experimental methodologies these motifs do not account for the interplay between AAs. It was therefore not known how AAs within the context of individual peptides function to impart SH2 domain specificity. In this work we identified the critical role context plays in defining SH2 domain specificity for physiological ligands. We also constructed a high quality interactome using 50 SH2 domains and 192 physiological ligands. We next developed a quantitative high-throughput (Q-HTP) peptide microarray platform to assess the affinities four SH2 domains have for 124 physiological ligands. We demonstrated the superior characteristics of our platform relative to preceding approaches and validated our results using established biophysical techniques, literature corroboration, and predictive algorithms. The quantitative information provided by the arrays was leveraged to investigate SH2 domain binding distributions and identify points of binding overlap. Our microarray derived affinity estimates were integrated to produce quantitative interaction motifs capable of predicting interactions. Furthermore, our microarrays proved capable of resolving

  7. Investigation of phosphotyrosine recognition by the SH2 domain of the Src kinase.

    Science.gov (United States)

    Bradshaw, J M; Mitaxov, V; Waksman, G

    1999-11-05

    The binding of tyrosine phosphorylated targets by SH2 domains is required for propagation of many cellular signals in higher eukaryotes; however, the determinants of phosphotyrosine (pTyr) recognition by SH2 domains are not well understood. In order to identify the attributes of pTyr required for high affinity interaction with SH2 domains, the binding of the SH2 domain of the Src kinase (Src SH2 domain) to a dephosphorylated peptide, a phosphoserine-containing peptide, and the amino acid pTyr was studied using titration calorimetry and compared with the binding of a high affinity tyrosyl phosphopeptide. The dephosphorylated peptide and the phosphoserine containing peptide both bind extremely weakly to the Src SH2 domain (DeltaGo (dephosphorylated)=-3.6 kcal/mol, DeltaGo (phosphoserine) >-3.7 kcal/mol); however, the DeltaGo value of pTyr binding is more favorable (-4.7 kcal/mol, or 50 % of the entire binding free energy of a high affinity tyrosyl phosphopeptide). These results indicate that both the phosphate and the tyrosine ring of the pTyr are critical determinants of high affinity binding. Alanine mutagenesis was also used to evaluate the energetic contribution to binding of ten residues located in the pTyr-binding site. Mutation of the strictly conserved Arg betaB5 resulted in a large increase in DeltaGo (DeltaDeltaGo=3.2 kcal/mol) while elimination of the other examined residues each resulted in a significantly smaller (DeltaDeltaGoSH2 domain, surprisingly increased affinity by eightfold (DeltaDeltaGo=-1.1 kcal/mol). Using a double mutant cycle analysis, it was revealed that residues of the pTyr-binding pocket are not coupled to the peptide residues C-terminal to the pTyr. In addition, comparison of each residue's DeltaDeltaGo value upon mutation with that residue's sequence conservation among SH2 domains revealed only a modest correlation between a residue's energetic contribution to pTyr recognition and its conservation throughout evolution. The results of

  8. New function of the adaptor protein SH2B1 in brain-derived neurotrophic factor-induced neurite outgrowth.

    Directory of Open Access Journals (Sweden)

    Chien-Hung Shih

    Full Text Available Neurite outgrowth is an essential process for the establishment of the nervous system. Brain-derived neurotrophic factor (BDNF binds to its receptor TrkB and regulates axonal and dendritic morphology of neurons through signal transduction and gene expression. SH2B1 is a signaling adaptor protein that regulates cellular signaling in various physiological processes. The purpose of this study is to investigate the role of SH2B1 in the development of the central nervous system. In this study, we show that knocking down SH2B1 reduces neurite formation of cortical neurons whereas overexpression of SH2B1β promotes the development of hippocampal neurons. We further demonstrate that SH2B1β promotes BDNF-induced neurite outgrowth and signaling using the established PC12 cells stably expressing TrkB, SH2B1β or SH2B1β mutants. Our data indicate that overexpressing SH2B1β enhances BDNF-induced MEK-ERK1/2, and PI3K-AKT signaling pathways. Inhibition of MEK-ERK1/2 and PI3K-AKT pathways by specific inhibitors suggest that these two pathways are required for SH2B1β-promoted BDNF-induced neurite outgrowth. Moreover, SH2B1β enhances BDNF-stimulated phosphorylation of signal transducer and activator of transcription 3 at serine 727. Finally, our data indicate that the SH2 domain and tyrosine phosphorylation of SH2B1β contribute to BDNF-induced signaling pathways and neurite outgrowth. Taken together, these findings demonstrate that SH2B1β promotes BDNF-induced neurite outgrowth through enhancing pathways involved MEK-ERK1/2 and PI3K-AKT.

  9. Thymidylate synthase genetic polymorphism and plasma total homocysteine level in a group of Turkish patients with rheumatoid arthritis: relationship with disease activity and methotrexate toxicity.

    Science.gov (United States)

    Borman, Pınar; Taşbaş, Özgur; Karabulut, Halil; Tukun, Ajlan; Yorgancıoğlu, Rezan

    2015-01-01

    The polymorphism of thymidylate synthase (TS) gene and homocysteine are reported to have a relationship to methotrexate (MTX) metabolism, with conflicting results. The aim of this study was to determine homocysteine levels and the frequency of TS gene triple repeat (TS3R) and double repeat (TS2R) polymorphisms in a group of Turkish RA patients and evaluate its association with MTX toxicity and disease activity. Sixty-four patients with RA and 31 control subjects with a mean age of 48.7 ± 12.5 and 46.2 ± 13.4 years, were enrolled to the study. Demographic characteristics were obtained and number of patients with MTX-related adverse affects, were recorded in the patient group. The homocysteine levels and TS2R/TS3R polymorphisms of the TS gene were analyzed and the distribution of genotypes according to MTX toxicity and disease activity, were determined. The demographic properties were similar between the patient and control subjects. Folic acid supplementation with a mean dose of 5mg folic acid/week, was present in all patients. Thirty-six of the 64 patients showed adverse effects to MTX treatment. The frequency of TS2R and TS3R polymorphisms were found to be similar in the patient and control groups. TS2R and TS3R gene polymorphisms were found to be similar in patients with and without MTX-related adverse events. The mean homocysteine level was also similar in patients with and without TS gene polymorphism, but was found to be higher (12.45μmol/L vs 10.7μmol/L) in patients with MTX-related side effects than in patients without side effects. The mean level of homocysteine was correlated with levels of ESR in the patient group. In conclusion, homocysteine levels might effect the disease activity and toxicity of MTX but 2R and 3R polymorphisms in the TS gene, were not related with MTX-related toxicity in RA patients receiving folate supplementation. Further studies are needed to illuminate the polymorphisms in other enzymes that might be responsible from the MTX

  10. ExoMol molecular line lists - XXVI: spectra of SH and NS

    Science.gov (United States)

    Yurchenko, Sergei N.; Bond, Wesley; Gorman, Maire N.; Lodi, Lorenzo; McKemmish, Laura K.; Nunn, William; Shah, Rohan; Tennyson, Jonathan

    2018-07-01

    Line lists for the sulphur-containing molecules SH (the mercapto radical) and NS are computed as part of the ExoMol project. These line lists consider transitions within the X2Π ground state for 32SH, 33SH, 34SH,36SH and, 32SD, and 14N32S, 14N33S, 14N34S, 14N36S, and 15N32S. Ab initio potential energy (PEC) and spin-orbit coupling (SOC) curves are computed and then improved by fitting to experimentally observed transitions. Fully ab initio dipole moment curves (DMCs) computed at high level of theory are used to produce the final line lists. For SH, our fit gives a root-mean-square (rms) error of 0.03 cm-1 between the observed (vmax = 4, Jmax = 34.5) and calculated transitions wavenumbers; this is extrapolated such that all X2Π rotational-vibrational-electronic (rovibronic) bound states are considered. For 32SH the resulting line list contains about 81 000 transitions and 2300 rovibronic states, considering levels up to vmax = 14 and Jmax = 60.5. For NS the refinement used a combination of experimentally determined frequencies and energy levels and led to an rms-fitting error of 0.002 cm-1. Each NS-calculated line list includes around 2.8 million transitions and 31 000 rovibronic states with a vibrational range up to v = 53 and rotational range up to J = 235.5, which covers up to 23 000 cm-1. Both line lists should be complete for temperatures up to 5000 K. Example spectra simulated using this line list are shown and comparisons made to the existing data in the CDMS data base. The line lists are available from the CDS (http://cdsarc.u-strasbg.fr) and ExoMol (www.exomol.com) data bases.

  11. SH003 suppresses breast cancer growth by accumulating p62 in autolysosomes.

    Science.gov (United States)

    Choi, Youn Kyung; Cho, Sung-Gook; Choi, Yu-Jeong; Yun, Yee Jin; Lee, Kang Min; Lee, Kangwook; Yoo, Hye-Hyun; Shin, Yong Cheol; Ko, Seong-Gyu

    2017-10-24

    Drug markets revisits herbal medicines, as historical usages address their therapeutic efficacies with less adverse effects. Moreover, herbal medicines save both cost and time in development. SH003, a modified version of traditional herbal medicine extracted from Astragalus membranaceus (Am), Angelica gigas (Ag), and Trichosanthes Kirilowii Maximowicz (Tk) with 1:1:1 ratio (w/w) has been revealed to inhibit tumor growth and metastasis on highly metastatic breast cancer cells, both in vivo and in vitro with no toxicity. Meanwhile, autophagy is imperative for maintenance cellular homeostasis, thereby playing critical roles in cancer progression. Inhibition of autophagy by pharmacological agents induces apoptotic cell death in cancer cells, resulting in cancer treatment. In this study, we demonstrate that SH003-induced autophagy via inhibiting STAT3 and mTOR results in an induction of lysosomal p62/SQSTM1 accumulation-mediated reactive oxygen species (ROS) generation and attenuates tumor growth. SH003 induced autophagosome and autolysosome formation by inhibiting activation of STAT3- and mTOR-mediated signaling pathways. However, SH003 blocked autophagy-mediated p62/SQSTM1 degradation through reducing of lysosomal proteases, Cathepsins, resulting in accumulation of p62/SQSTM1 in the lysosome. The accumulation of p62/SQSTM1 caused the increase of ROS, which resulted in the induction of apoptotic cell death. Therefore, we conclude that SH003 suppresses breast cancer growth by inducing autophagy. In addition, SH003-induced p62/SQSTM1 could function as an important mediator for ROS generation-dependent cell death suggesting that SH003 may be useful for treating breast cancer.

  12. Towards Antiviral shRNAs Based on the AgoshRNA Design.

    Directory of Open Access Journals (Sweden)

    Ying Poi Liu

    Full Text Available RNA interference (RNAi can be induced by intracellular expression of a short hairpin RNA (shRNA. Processing of the shRNA requires the RNaseIII-like Dicer enzyme to remove the loop and to release the biologically active small interfering RNA (siRNA. Dicer is also involved in microRNA (miRNA processing to liberate the mature miRNA duplex, but recent studies indicate that miR-451 is not processed by Dicer. Instead, this miRNA is processed by the Argonaute 2 (Ago2 protein, which also executes the subsequent cleavage of a complementary mRNA target. Interestingly, shRNAs that structurally resemble miR-451 can also be processed by Ago2 instead of Dicer. The key determinant of these "AgoshRNA" molecules is a relatively short basepaired stem, which avoids Dicer recognition and consequently allows alternative processing by Ago2. AgoshRNA processing yields a single active RNA strand, whereas standard shRNAs produce a duplex with guide and passenger strands and the latter may cause adverse off-target effects. In this study, we converted previously tested active anti-HIV-1 shRNA molecules into AgoshRNA. We tested several designs that could potentially improve AgoshRNA activity, including extension of the complementarity between the guide strand and the mRNA target and reduction of the thermodynamic stability of the hairpins. We demonstrate that active AgoshRNAs can be generated. However, the RNAi activity is reduced compared to the matching shRNAs. Despite reduced RNAi activity, comparison of an active AgoshRNA and the matching shRNA in a sensitive cell toxicity assay revealed that the AgoshRNA is much less toxic.

  13. Theoretical Insights Reveal Novel Motions in Csk's SH3 Domain That Control Kinase Activation.

    Directory of Open Access Journals (Sweden)

    Sulyman Barkho

    Full Text Available The Src family of tyrosine kinases (SFKs regulate numerous aspects of cell growth and differentiation and are under the principal control of the C-terminal Src Kinase (Csk. Although Csk and SFKs share conserved kinase, SH2 and SH3 domains, they differ considerably in three-dimensional structure, regulatory mechanism, and the intrinsic kinase activities. Although the SH2 and SH3 domains are known to up- or down-regulate tyrosine kinase function, little is known about the global motions in the full-length kinase that govern these catalytic variations. We use a combination of accelerated Molecular Dynamics (aMD simulations and experimental methods to provide a new view of functional motions in the Csk scaffold. These computational studies suggest that high frequency vibrations in the SH2 domain are coupled through the N-terminal lobe of the kinase domain to motions in the SH3 domain. The effects of these reflexive movements on the kinase domain can be viewed using both Deuterium Exchange Mass Spectrometry (DXMS and steady-state kinetic methods. Removal of several contacts, including a crystallographically unobserved N-terminal segment, between the SH3 and kinase domains short-circuit these coupled motions leading to reduced catalytic efficiency and stability of N-lobe motifs within the kinase domain. The data expands the model of Csk's activation whereby separate domains productively interact with two diametrically opposed surfaces of the kinase domain. Such reversible transitions may organize the active structure of the tyrosine kinase domain of Csk.

  14. Global transformation of erythrocyte properties via engagement of an SH2-like sequence in band 3.

    Science.gov (United States)

    Puchulu-Campanella, Estela; Turrini, Francesco M; Li, Yen-Hsing; Low, Philip S

    2016-11-29

    Src homology 2 (SH2) domains are composed of weakly conserved sequences of ∼100 aa that bind phosphotyrosines in signaling proteins and thereby mediate intra- and intermolecular protein-protein interactions. In exploring the mechanism whereby tyrosine phosphorylation of the erythrocyte anion transporter, band 3, triggers membrane destabilization, vesiculation, and fragmentation, we discovered a SH2 signature motif positioned between membrane-spanning helices 4 and 5. Evidence that this exposed cytoplasmic sequence contributes to a functional SH2-like domain is provided by observations that: (i) it contains the most conserved sequence of SH2 domains, GSFLVR; (ii) it binds the tyrosine phosphorylated cytoplasmic domain of band 3 (cdb3-PO 4 ) with K d = 14 nM; (iii) binding of cdb3-PO 4 to erythrocyte membranes is inhibited both by antibodies against the SH2 signature sequence and dephosphorylation of cdb3-PO 4 ; (iv) label transfer experiments demonstrate the covalent transfer of photoactivatable biotin from isolated cdb3-PO 4 (but not cdb3) to band 3 in erythrocyte membranes; and (v) phosphorylation-induced binding of cdb3-PO 4 to the membrane-spanning domain of band 3 in intact cells causes global changes in membrane properties, including (i) displacement of a glycolytic enzyme complex from the membrane, (ii) inhibition of anion transport, and (iii) rupture of the band 3-ankyrin bridge connecting the spectrin-based cytoskeleton to the membrane. Because SH2-like motifs are not retrieved by normal homology searches for SH2 domains, but can be found in many tyrosine kinase-regulated transport proteins using modified search programs, we suggest that related cases of membrane transport proteins containing similar motifs are widespread in nature where they participate in regulation of cell properties.

  15. Plasma centrifuges

    International Nuclear Information System (INIS)

    Karchevskij, A.I.; Potanin, E.P.

    2000-01-01

    The review of the most important studies on the isotope separation processes in the rotating plasma is presented. The device is described and the characteristics of operation of the pulse plasma centrifuges with weakly and strongly ionized plasma as well as the stationary plasma centrifuges with the medium weak ionization and devices, applying the stationary vacuum arc with the high ionization rate and the stationary beam-plasma discharge with complete ionization, are presented. The possible mechanisms of the isotope separation in plasma centrifuges are considered. The specific energy consumption for isotope separation in these devices is discussed [ru

  16. Plasma astrophysics

    CERN Document Server

    Kaplan, S A; ter Haar, D

    2013-01-01

    Plasma Astrophysics is a translation from the Russian language; the topics discussed are based on lectures given by V.N. Tsytovich at several universities. The book describes the physics of the various phenomena and their mathematical formulation connected with plasma astrophysics. This book also explains the theory of the interaction of fast particles plasma, their radiation activities, as well as the plasma behavior when exposed to a very strong magnetic field. The text describes the nature of collective plasma processes and of plasma turbulence. One author explains the method of elementary

  17. Plasma waves

    CERN Document Server

    Swanson, DG

    1989-01-01

    Plasma Waves discusses the basic development and equations for the many aspects of plasma waves. The book is organized into two major parts, examining both linear and nonlinear plasma waves in the eight chapters it encompasses. After briefly discussing the properties and applications of plasma wave, the book goes on examining the wave types in a cold, magnetized plasma and the general forms of the dispersion relation that characterize the waves and label the various types of solutions. Chapters 3 and 4 analyze the acoustic phenomena through the fluid model of plasma and the kinetic effects. Th

  18. Purification, crystallization, small-angle X-ray scattering and preliminary X-ray diffraction analysis of the SH2 domain of the Csk-homologous kinase.

    Science.gov (United States)

    Gunn, Natalie J; Gorman, Michael A; Dobson, Renwick C J; Parker, Michael W; Mulhern, Terrence D

    2011-03-01

    The C-terminal Src kinase (Csk) and Csk-homologous kinase (CHK) are endogenous inhibitors of the proto-oncogenic Src family of protein tyrosine kinases (SFKs). Phosphotyrosyl peptide binding to their Src-homology 2 (SH2) domains activates Csk and CHK, enhancing their ability to suppress SFK signalling; however, the detailed mechanistic basis of this activation event is unclear. The CHK SH2 was expressed in Escherichia coli and the purified protein was characterized as monomeric by synchrotron small-angle X-ray scattering in-line with size-exclusion chromatography. The CHK SH2 crystallized in 0.2 M sodium bromide, 0.1 M bis-Tris propane pH 6.5 and 20% polyethylene glycol 3350 and the best crystals diffracted to ∼1.6 Å resolution. The crystals belonged to space group P2, with unit-cell parameters a=25.8, b=34.6, c=63.2 Å, β=99.4°.

  19. “Girls are dancin’”: shōjo culture and feminism in contemporary Japanese art

    OpenAIRE

    Emily Jane Wakeling

    2011-01-01

    This article explores the gender-transgressive expressions found in shōjo culture in order to highlight the potential for feminist analysis in the prevalence of the shōjo motif in contemporary Japanese art. Shōjo culture is a fascinating cultural space, within contemporary Japanese culture, which fosters creative expressions of gender that negate or make complex hegemonic categories. Departing from stereotypes of Japanese girls, this article will pay particular interest to an emerging wave of...

  20. In vivo binding properties of SH2 domains from GTPase-activating protein and phosphatidylinositol 3-kinase.

    Science.gov (United States)

    Cooper, J A; Kashishian, A

    1993-01-01

    We have used a transient expression system and mutant platelet-derived growth factor (PDGF) receptors to study the binding specificities of the Src homology 2 (SH2) regions of the Ras GTPase-activator protein (GAP) and the p85 alpha subunit of phosphatidylinositol 3-kinase (PI3 kinase). A number of fusion proteins, each tagged with an epitope allowing recognition by a monoclonal antibody, were expressed at levels comparable to those of endogenous GAP. Fusion proteins containing the central SH2-SH3-SH2 region of GAP or the C-terminal region of p85 alpha, which includes two SH2 domains, bound to PDGF receptors in response to PDGF stimulation. Both fusion proteins showed the same requirements for tyrosine phosphorylation sites in the PDGF receptor as the full-length proteins from which they were derived, i.e., binding of the GAP fusion protein was reduced by mutation of Tyr-771, and binding of the p85 fusion protein was reduced by mutation of Tyr-740, Tyr-751, or both residues. Fusion proteins containing single SH2 domains from either GAP or p85 alpha did not bind detectably to PDGF receptors in this system, suggesting that two SH2 domains in a single polypeptide cooperate to raise the affinity of binding. The sequence specificities of individual SH2 domains were deduced from the binding properties of fusion proteins containing one SH2 domain from GAP and another from p85. The results suggest that the C-terminal GAP SH2 domain specifies binding to Tyr-771, the C-terminal p85 alpha SH2 domain binds to either Tyr-740 or Tyr-751, and each protein's N-terminal SH2 domain binds to unidentified phosphorylation sites.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:8382774

  1. Chaotic phenomena in plasmas

    International Nuclear Information System (INIS)

    Kawai, Y.

    1991-08-01

    It has recently been recognized that the research on various aspects of chaotic dynamics grows rapidly as one of some areas in nonlinear science. On the other hands, the plasma has long been called a treasure-house of nonlinear phenomena, so it is easy to imagine that the plasma is abundant in chaotic phenomena. In fact, the research on plasma chaos is going on, such as the research on the stochastic magnetic field and the chaotic orbit in the toroidal helical system, as well as the research in other experiments. To review the present status of the research on plasma chaos and to make clear the basic common physics, a working group was organized in 1990 as a collaboration research of National Institute for Fusion Science. This is the report on its activity in 1990, with a stress on experimental data obtained in basic plasma experiments and RFP, and on the relaxed theories and computer simulations. (author)

  2. Antimatter plasmas and antihydrogen

    International Nuclear Information System (INIS)

    Greaves, R.G.; Surko, C.M.

    1997-01-01

    Recent successes in confining antimatter in the form of positron and antiproton plasmas have created new scientific and technological opportunities. Plasma techniques have been the cornerstone of experimental work in this area, and this is likely to be true for the foreseeable future. Work by a number of groups on trapping antimatter plasmas is summarized, and an overview of the promises and challenges in this field is presented. Topics relating to positron plasmas include the use of positrons to study the unique properties of electron endash positron plasmas, the interaction between positrons and ordinary matter, and the laboratory modeling of positron-annihilation processes in interstellar media. The availability of cold, trapped antiprotons and positrons makes possible the production of neutral antimatter in the form of antihydrogen. This is expected to enable precise comparisons of the properties of matter and antimatter, including tests of fundamental symmetries and the measurement of the interaction of antimatter with gravity. copyright 1997 American Institute of Physics

  3. Fusion protein based on Grb2-SH2 domain for cancer therapy

    International Nuclear Information System (INIS)

    Saito, Yuriko; Furukawa, Takako; Arano, Yasushi; Fujibayashi, Yasuhisa; Saga, Tsuneo

    2010-01-01

    Research highlights: → Grb2 mediates EGFR signaling through binding to phosphorylate EGFR with SH2 domain. → We generated fusion proteins containing 1 or 2 SH2 domains of Grb2 added with TAT. → The one with 2 SH2 domains (TSSF) interfered ERK phosphorylation. → TSSF significantly delayed the growth of EGFR overexpressing tumor in a mouse model. -- Abstract: Epidermal growth factor receptor (EGFR) is one of the very attractive targets for cancer therapy. In this study, we generated fusion proteins containing one or two Src-homology 2 (SH2) domains of growth factor receptor bound protein 2 (Grb2), which bind to phosphorylated EGFR, added with HIV-1 transactivating transcription for cell membrane penetration (termed TSF and TSSF, respectively). We examined if they can interfere Grb2-mediated signaling pathway and suppress tumor growth as expected from the lack of SH3 domain, which is necessary to intermediate EGFR-Grb2 cell signaling, in the fusion proteins. The transduction efficiency of TSSF was similar to that of TSF, but the binding activity of TSSF to EGFR was higher than that of TSF. Treatment of EGFR-overexpressing cells showed that TSSF decreased p42-ERK phosphorylation, while TSF did not. Both the proteins delayed cell growth but did not induce cell death in culture. TSSF also significantly suppressed tumor growth in vivo under consecutive administration. In conclusion, TSSF showed an ability to inhibit EGFR-Grb2 signaling and could have a potential to treat EGFR-activated cancer.

  4. Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision.

    Science.gov (United States)

    Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu

    2014-02-04

    TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.

  5. Pomegranate inhibits neuroinflammation and amyloidogenesis in IL-1β-stimulated SK-N-SH cells.

    Science.gov (United States)

    Velagapudi, Ravikanth; Baco, Gina; Khela, Sunjeet; Okorji, Uchechukwu; Olajide, Olumayokun

    2016-06-01

    Pomegranate fruit, Punica granatum L. (Punicaceae), and its constituents have been shown to inhibit inflammation. In this study, we aimed to assess the effects of freeze-dried pomegranate (PWE) on PGE2 production in IL-1β-stimulated SK-N-SH cells. An enzyme immunoassay (EIA) was used to measure prostaglandin E2 (PGE2) production from supernatants of IL-1β-stimulated SK-N-SH cells. Expression of COX-2, phospho-IκB, and phospho-IKK proteins was evaluated, while NF-κB reporter gene assay was carried out in TNFα-stimulated HEK293 cells to determine the effect of PWE on NF-κB transactivation. Levels of BACE-1 and Aβ in SK-N-SH cells stimulated with IL-1β were measured with an in cell ELISA. PWE (25-200 μg/ml) dose dependently reduced COX-2-dependent PGE2 production in SK-N-SH cells stimulated with IL-1β. Phosphorylation of IκB and IKK was significantly (p pomegranate inhibits inflammation, as well as amyloidogenesis in IL-1β-stimulated SK-N-SH cells. We propose that pomegranate is a potential nutritional strategy in slowing the progression of neurodegenerative disorders such as Alzheimer's disease.

  6. Estrogen Receptor Folding Modulates cSrc Kinase SH2 Interaction via a Helical Binding Mode.

    Science.gov (United States)

    Nieto, Lidia; Tharun, Inga M; Balk, Mark; Wienk, Hans; Boelens, Rolf; Ottmann, Christian; Milroy, Lech-Gustav; Brunsveld, Luc

    2015-11-20

    The estrogen receptors (ERs) feature, next to their transcriptional role, important nongenomic signaling actions, with emerging clinical relevance. The Src Homology 2 (SH2) domain mediated interaction between cSrc kinase and ER plays a key role in this; however the molecular determinants of this interaction have not been elucidated. Here, we used phosphorylated ER peptide and semisynthetic protein constructs in a combined biochemical and structural study to, for the first time, provide a quantitative and structural characterization of the cSrc SH2-ER interaction. Fluorescence polarization experiments delineated the SH2 binding motif in the ER sequence. Chemical shift perturbation analysis by nuclear magnetic resonance (NMR) together with molecular dynamics (MD) simulations allowed us to put forward a 3D model of the ER-SH2 interaction. The structural basis of this protein-protein interaction has been compared with that of the high affinity SH2 binding sequence GpYEEI. The ER features a different binding mode from that of the "two-pronged plug two-hole socket" model in the so-called specificity determining region. This alternative binding mode is modulated via the folding of ER helix 12, a structural element directly C-terminal of the key phosphorylated tyrosine. The present findings provide novel molecular entries for understanding nongenomic ER signaling and targeting the corresponding disease states.

  7. Crystal Structure of the FERM-SH2 Module of Human Jak2.

    Science.gov (United States)

    McNally, Randall; Toms, Angela V; Eck, Michael J

    2016-01-01

    Jak-family tyrosine kinases mediate signaling from diverse cytokine receptors. Binding of Jaks to their cognate receptors is mediated by their N-terminal region, which contains FERM and SH2 domains. Here we describe the crystal structure of the FERM-SH2 region of Jak2 at 3.0Å resolution. The structure reveals that these domains and their flanking linker segments interact intimately to form an integrated structural module. The Jak2 FERM-SH2 structure closely resembles that recently described for Tyk2, another member of the Jak family. While the overall architecture and interdomain orientations are preserved between Jak2 and Tyk2, we identify residues in the putative receptor-binding groove that differ between the two and may contribute to the specificity of receptor recognition. Analysis of Jak mutations that are reported to disrupt receptor binding reveals that they lie in the hydrophobic core of the FERM domain, and are thus expected to compromise the structural integrity of the FERM-SH2 unit. Similarly, analysis of mutations in Jak3 that are associated with severe combined immunodeficiency suggests that they compromise Jak3 function by destabilizing the FERM-SH2 structure.

  8. Structural basis for activation of ZAP-70 by phosphorylation of the SH2-kinase linker.

    Science.gov (United States)

    Yan, Qingrong; Barros, Tiago; Visperas, Patrick R; Deindl, Sebastian; Kadlecek, Theresa A; Weiss, Arthur; Kuriyan, John

    2013-06-01

    Serial activation of the tyrosine kinases Lck and ZAP-70 initiates signaling downstream of the T cell receptor. We previously reported the structure of an autoinhibited ZAP-70 variant in which two regulatory tyrosine residues (315 and 319) in the SH2-kinase linker were replaced by phenylalanine. We now present a crystal structure of ZAP-70 in which Tyr 315 and Tyr 319 are not mutated, leading to the recognition of a five-residue sequence register error in the SH2-kinase linker of the original crystallographic model. The revised model identifies distinct roles for these two tyrosines. As seen in a recently reported structure of the related tyrosine kinase Syk, Tyr 315 of ZAP-70 is part of a hydrophobic interface between the regulatory apparatus and the kinase domain, and the integrity of this interface would be lost upon engagement of doubly phosphorylated peptides by the SH2 domains. Tyr 319 is not necessarily dislodged by SH2 engagement, which activates ZAP-70 only ∼5-fold in vitro. In contrast, phosphorylation by Lck activates ZAP-70 ∼100-fold. This difference is due to the ability of Tyr 319 to suppress ZAP-70 activity even when the SH2 domains are dislodged from the kinase domain, providing stringent control of ZAP-70 activity downstream of Lck.

  9. Solution structure, dynamics and thermodynamics of the three SH3 domains of CD2AP

    Energy Technology Data Exchange (ETDEWEB)

    Roldan, Jose L. Ortega [Universidad de Granada, Departamento de Quimica Fisica e Instituto de Biotecnologia, Facultad de Ciencias (Spain); Blackledge, Martin [Institut de Biologie Structurale Jean-Pierre Ebel, CEA, CNRS, UJF UMR 5075, Protein Dynamics and Flexibility by NMR (France); Nuland, Nico A. J. van, E-mail: nvnuland@vub.ac.be [Vrije Universiteit Brussel, Structural Biology Brussels (Belgium); Azuaga, Ana I. [Universidad de Granada, Departamento de Quimica Fisica e Instituto de Biotecnologia, Facultad de Ciencias (Spain)

    2011-06-15

    CD2 associated protein (CD2AP) is an adaptor protein that plays an important role in cell to cell union needed for the kidney function. It contains three N-terminal SH3 domains that are able to interact among others with CD2, ALIX, c-Cbl and Ubiquitin. To understand the role of the individual SH3 domains of this adaptor protein we have performed a complete structural, thermodynamic and dynamic characterization of the separate domains using NMR and DSC. The energetic contributions to the stability and the backbone dynamics have been related to the structural features of each domain using the structure-based FoldX algorithm. We have found that the N-terminal SH3 domain of both adaptor proteins CD2AP and CIN85 are the most stable SH3 domains that have been studied until now. This high stability is driven by a more extensive network of intra-molecular interactions. We believe that this increased stabilization of N-terminal SH3 domains in adaptor proteins is crucial to maintain the necessary conformation to establish the proper interactions critical for the recruitment of their natural targets.

  10. SH1 leaf rust and bacterial halo blight coffee resistances are genetically independent

    Directory of Open Access Journals (Sweden)

    Lucas Mateus Rivero Rodrigues

    Full Text Available ABSTRACT Coffee resistance to Pseudomonas syringae pv. garcae has been associated to pleiotropic effect of SH1 allele, present in coffee plants resistant to certain races of Hemileia vastatrix, the causal agent of leaf rust, or genetic linkage between resistance alleles to both pathogens. To validate this hypothesis, 63 coffee plants in F2 generation were evaluated for resistance to 2 isolates of H. vastatrix carriers of alleles, respectively, v2, v5 (isolate I/2015 and v1; v2; v5 (isolate II/2015 with the objective to confirm presence of SH1 allele in resistant plants to isolate I/2015. The same coffee plants were evaluated for resistance to a mixture of P. syringae pv. garcae strains highly pathogenic to coffee. Results showed that, among F2 coffee allele SH1 carriers, resistant to isolate I/2015, resistant and susceptible plants to bacterial halo blight were found; the same segregation occurs between F2 homozygous for SH1 allele, susceptible to the same isolate (I/2015 of H. vastatrix. Results also indicate that there is no pleiotropic effect of gene or allele SH1 connection between genes conferring resistance to leaf rust caused by H. vastatrix and bacterial halo blight caused by P. syringae pv. garcae.

  11. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  12. Solution structure of tensin2 SH2 domain and its phosphotyrosine-independent interaction with DLC-1.

    Directory of Open Access Journals (Sweden)

    Kun Dai

    Full Text Available Src homology 2 (SH2 domain is a conserved module involved in various biological processes. Tensin family member was reported to be involved in tumor suppression by interacting with DLC-1 (deleted-in-liver-cancer-1 via its SH2 domain. We explore here the important questions that what the structure of tensin2 SH2 domain is, and how it binds to DLC-1, which might reveal a novel binding mode.Tensin2 SH2 domain adopts a conserved SH2 fold that mainly consists of five β-strands flanked by two α-helices. Most SH2 domains recognize phosphorylated ligands specifically. However, tensin2 SH2 domain was identified to interact with nonphosphorylated ligand (DLC-1 as well as phosphorylated ligand.We determined the solution structure of tensin2 SH2 domain using NMR spectroscopy, and revealed the interactions between tensin2 SH2 domain and its ligands in a phosphotyrosine-independent manner.

  13. Quality of pharmacy-specific Medical Subject Headings (MeSH) assignment in pharmacy journals indexed in MEDLINE.

    Science.gov (United States)

    Minguet, Fernando; Salgado, Teresa M; van den Boogerd, Lucienne; Fernandez-Llimos, Fernando

    2015-01-01

    The Medical Subject Headings (MeSH) is the National Library of Medicine (NLM) controlled vocabulary for indexing articles. Inaccuracies in the MeSH thesaurus have been reported for several areas including pharmacy. To assess the quality of pharmacy-specific MeSH assignment to articles indexed in pharmacy journals. The 10 journals containing the highest number of articles published in 2012 indexed under the MeSH 'Pharmacists' were identified. All articles published over a 5-year period (2008-2012) in the 10 previously selected journals were retrieved from PubMed. MeSH terms used to index these articles were extracted and pharmacy-specific MeSH terms were identified. The frequency of use of pharmacy-specific MeSH terms was calculated across journals. A total of 6989 articles were retrieved from the 10 pharmacy journals, of which 328 (4.7%) were articles not fully indexed and therefore did not contain any MeSH terms assigned. Among the 6661 articles fully indexed, the mean number of MeSH terms was 10.1 (SD = 4.0), being 1.0 (SD = 1.3) considered as Major MeSH. Both values significantly varied across journals. The mean number of pharmacy-specific MeSH terms per article was 0.9 (SD = 1.2). A total of 3490 (52.4%) of the 6661 articles were indexed in pharmacy journals without a single pharmacy-specific MeSH. Of the total 67193 MeSH terms assigned to articles, on average 10.5% (SD = 13.9) were pharmacy-specific MeSH. A statistically significant different pattern of pharmacy-specific MeSH assignment was identified across journals (Kruskal-Wallis P journals can be improved to further enhance evidence gathering in pharmacy. Over half of the articles published in the top-10 journals publishing pharmacy literature were indexed without a single pharmacy-specific MeSH. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. Identification of SH2-Bbeta as a substrate of the tyrosine kinase JAK2 involved in growth hormone signaling.

    OpenAIRE

    Rui, L; Mathews, L S; Hotta, K; Gustafson, T A; Carter-Su, C

    1997-01-01

    Activation of the tyrosine kinase JAK2 is an essential step in cellular signaling by growth hormone (GH) and multiple other hormones and cytokines. Murine JAK2 has a total of 49 tyrosines which, if phosphorylated, could serve as docking sites for Src homology 2 (SH2) or phosphotyrosine binding domain-containing signaling molecules. Using a yeast two-hybrid screen of a rat adipocyte cDNA library, we identified a splicing variant of the SH2 domain-containing protein SH2-B, designated SH2-Bbeta,...

  15. Time-resolved multimodal analysis of Src Homology 2 (SH2) domain binding in signaling by receptor tyrosine kinases.

    Science.gov (United States)

    Jadwin, Joshua A; Oh, Dongmyung; Curran, Timothy G; Ogiue-Ikeda, Mari; Jia, Lin; White, Forest M; Machida, Kazuya; Yu, Ji; Mayer, Bruce J

    2016-04-12

    While the affinities and specificities of SH2 domain-phosphotyrosine interactions have been well characterized, spatio-temporal changes in phosphosite availability in response to signals, and their impact on recruitment of SH2-containing proteins in vivo, are not well understood. To address this issue, we used three complementary experimental approaches to monitor phosphorylation and SH2 binding in human A431 cells stimulated with epidermal growth factor (EGF): 1) phospho-specific mass spectrometry; 2) far-Western blotting; and 3) live cell single-molecule imaging of SH2 membrane recruitment. Far-Western and MS analyses identified both well-established and previously undocumented EGF-dependent tyrosine phosphorylation and binding events, as well as dynamic changes in binding patterns over time. In comparing SH2 binding site phosphorylation with SH2 domain membrane recruitment in living cells, we found in vivo binding to be much slower. Delayed SH2 domain recruitment correlated with clustering of SH2 domain binding sites on the membrane, consistent with membrane retention via SH2 rebinding.

  16. Plasma device

    International Nuclear Information System (INIS)

    Thode, L.E.

    1981-01-01

    A method is described of providing electron beam heating of a high-density plasma to drive a fast liner to implode a structured microsphere. An annular relativistic electron beam is used to heat an annular plasma to kilovolt temperatures through streaming instabilities in the plasma. Energy deposited in the annular plasma then converges on a fast liner to explosively or ablatively drive the liner to convergence to implode the structured microsphere. (U.K.)

  17. Effects of SH-reagents of different molecular size upon glucose metabolism in isolated rat fat cells

    International Nuclear Information System (INIS)

    Kather, H.; Simon, B.

    1975-01-01

    To study the role of membrane SH-groups in glucose transport of isolated rat fat cells we compared the effects of a small organic mercurial reagent p-CMB with those of a large p-CMB-derivative - p-CMB-Dextran, MW approximately 10,000 -. It could be shown that both compounds were of almost identical reactivity on fat cell homogenate metabolism. When applied to intact fat cells uncoupled p-CMB showed an 1) insulin-like enhancement of 14 C incorporation from (U- 14 C) glucose into CO 2 and triglyceride, 2) inhibition of the insulin-stimulatory effect on these parameters and 3) inhibition of basal glucose uptake dependent on the concentrations used. Identical concentrations of p-CMB-Dextran, however, failed to influence basal glucose uptake as well as the insulin mediated increase in glucose metabolism. (orig.) [de

  18. Effects of SH-reagents of different molecular size upon glucose metabolism in isolated rat fat cells

    Energy Technology Data Exchange (ETDEWEB)

    Kather, H; Simon, B [Heidelberg Univ. (F.R. Germany). Klinisches Inst. fuer Herzinfarktforschung

    1975-09-01

    To study the role of membrane SH-groups in glucose transport of isolated rat fat cells we compared the effects of a small organic mercurial reagent p-CMB with those of a large p-CMB-derivative - p-CMB-Dextran, MW approximately 10,000 -. It could be shown that both compounds were of almost identical reactivity on fat cell homogenate metabolism. When applied to intact fat cells uncoupled p-CMB showed an 1) insulin-like enhancement of /sup 14/C incorporation from (U-/sup 14/C) glucose into CO/sub 2/ and triglyceride, 2) inhibition of the insulin-stimulatory effect on these parameters and 3) inhibition of basal glucose uptake dependent on the concentrations used. Identical concentrations of p-CMB-Dextran, however, failed to influence basal glucose uptake as well as the insulin mediated increase in glucose metabolism.

  19. Particle modeling of plasmas computational plasma physics

    International Nuclear Information System (INIS)

    Dawson, J.M.

    1991-01-01

    Recently, through the development of supercomputers, a powerful new method for exploring plasmas has emerged; it is computer modeling of plasmas. Such modeling can duplicate many of the complex processes that go on in a plasma and allow scientists to understand what the important processes are. It helps scientists gain an intuition about this complex state of matter. It allows scientists and engineers to explore new ideas on how to use plasma before building costly experiments; it allows them to determine if they are on the right track. It can duplicate the operation of devices and thus reduce the need to build complex and expensive devices for research and development. This is an exciting new endeavor that is in its infancy, but which can play an important role in the scientific and technological competitiveness of the US. There are a wide range of plasma models that are in use. There are particle models, fluid models, hybrid particle fluid models. These can come in many forms, such as explicit models, implicit models, reduced dimensional models, electrostatic models, magnetostatic models, electromagnetic models, and almost an endless variety of other models. Here the author will only discuss particle models. He will give a few examples of the use of such models; these will be taken from work done by the Plasma Modeling Group at UCLA because he is most familiar with work. However, it only gives a small view of the wide range of work being done around the US, or for that matter around the world

  20. Ultraviolet absorption spectra and kinetics of CH3S and CH2SH radicals

    DEFF Research Database (Denmark)

    Anastasi, C.; Broomfield, M.; Nielsen, O.J.

    1991-01-01

    The ultraviolet absorption spectra of CH3S and CH2SH radicals have been measured between 215 and 380 nm using the pulse-radiolysis/kinetic-absorption method. One absorption band between 250 and 300 nm and one around 215 nm have been tentatively assigned to the CH2SH and CH3S radicals, respectively....... This spectrum has been used to measure the self-reaction rates of these radicals. Rate constants of 4 x 10(-11) and 7 x 10(-11) cm3 molecule-1 s-1 have been measured at 298 K for CH3S and CH2SH recombination, respectively. The possible reaction pathways are discussed....

  1. Identification of Tyrosine Phosphorylated Proteins by SH2 Domain Affinity Purification and Mass Spectrometry.

    Science.gov (United States)

    Buhs, Sophia; Gerull, Helwe; Nollau, Peter

    2017-01-01

    Phosphotyrosine signaling plays a major role in the control of many important biological functions such as cell proliferation and apoptosis. Deciphering of phosphotyrosine-dependent signaling is therefore of great interest paving the way for the understanding of physiological and pathological processes of signal transduction. On the basis of the specific binding of SH2 domains to phosphotyrosine residues, we here present an experimental workflow for affinity purification and subsequent identification of tyrosine phosphorylated proteins by mass spectrometry. In combination with SH2 profiling, a broadly applicable platform for the characterization of phosphotyrosine profiles in cell extracts, our pull down strategy enables researchers by now to identify proteins in signaling cascades which are differentially phosphorylated and selectively recognized by distinct SH2 domains.

  2. Hydrogen Peroxide Toxicity Induces Ras Signaling in Human Neuroblastoma SH-SY5Y Cultured Cells

    Directory of Open Access Journals (Sweden)

    Jirapa Chetsawang

    2010-01-01

    Full Text Available It has been reported that overproduction of reactive oxygen species occurs after brain injury and mediates neuronal cells degeneration. In the present study, we examined the role of Ras signaling on hydrogen peroxide-induced neuronal cells degeneration in dopaminergic neuroblastoma SH-SY5Y cells. Hydrogen peroxide significantly reduced cell viability in SH-SY5Y cultured cells. An inhibitor of the enzyme that catalyzes the farnesylation of Ras proteins, FTI-277, and a competitive inhibitor of GTP-binding proteins, GDP-beta-S significantly decreased hydrogen peroxide-induced reduction in cell viability in SH-SY5Y cultured cells. The results of this study might indicate that a Ras-dependent signaling pathway plays a role in hydrogen peroxide-induced toxicity in neuronal cells.

  3. Strong SH-to-Love wave scattering off the Southern California Continental Borderland

    Science.gov (United States)

    Yu, Chunquan; Zhan, Zhongwen; Hauksson, Egill; Cochran, Elizabeth S.

    2017-01-01

    Seismic scattering is commonly observed and results from wave propagation in heterogeneous medium. Yet, deterministic characterization of scatterers associated with lateral heterogeneities remains challenging. In this study, we analyze broadband waveforms recorded by the Southern California Seismic Network and observe strongly scattered Love waves following the arrival of teleseismic SH wave. These scattered Love waves travel approximately in the same (azimuthal) direction as the incident SH wave at a dominant period of ~10 s but at an apparent velocity of ~3.6 km/s as compared to the ~11 km/s for the SH wave. Back-projection suggests that this strong scattering is associated with pronounced bathymetric relief in the Southern California Continental Borderland, in particular the Patton Escarpment. Finite-difference simulations using a simplified 2-D bathymetric and crustal model are able to predict the arrival times and amplitudes of major scatterers. The modeling suggests a relatively low shear wave velocity in the Continental Borderland.

  4. An assessment of the visibility of MeSH-indexed medical web catalogs through search engines.

    Science.gov (United States)

    Zweigenbaum, P; Darmoni, S J; Grabar, N; Douyère, M; Benichou, J

    2002-01-01

    Manually indexed Internet health catalogs such as CliniWeb or CISMeF provide resources for retrieving high-quality health information. Users of these quality-controlled subject gateways are most often referred to them by general search engines such as Google, AltaVista, etc. This raises several questions, among which the following: what is the relative visibility of medical Internet catalogs through search engines? This study addresses this issue by measuring and comparing the visibility of six major, MeSH-indexed health catalogs through four different search engines (AltaVista, Google, Lycos, Northern Light) in two languages (English and French). Over half a million queries were sent to the search engines; for most of these search engines, according to our measures at the time the queries were sent, the most visible catalog for English MeSH terms was CliniWeb and the most visible one for French MeSH terms was CISMeF.

  5. The MeSH model for hospital-physician joint ventures.

    Science.gov (United States)

    Anderson, J G

    1985-01-01

    The MeSH (Medical Staff-Hospital Joint Venture Company) concept has arisen to meet the perceived need for hospital-physician cooperation in a modern age of prospective payment systems, increased supply of health-care providers, cost conscious consumers, corporate health care organizations, and a general trend toward industrialization of health care. Supply and demand economics have created a situation which threatens the autonomy and financial integrity of both hospitals ans physicians, forcing cooperation or mutual destruction. MeSH seeks to preserve the autonomy and financial integrity of both parties through the creation of a free-standing business entity jointly owned by a hospital and those members of its medical staff who choose to participate. This article presents reasons for the need for cooperation, the objectives of MeSH, a description of its structure and operation, and a list of potential projects the program could include.

  6. A novel mutation in the SH3BP2 gene causes cherubism: case report

    Directory of Open Access Journals (Sweden)

    Yu Shi-Feng

    2006-12-01

    Full Text Available Abstract Background Cherubism is a rare hereditary multi-cystic disease of the jaws, characterized by its typical appearance in early childhood, and stabilization and remission after puberty. It is genetically transmitted in an autosomal dominant fashion and the gene coding for SH3-binding protein 2 (SH3BP2 may be involved. Case presentation We investigated a family consisting of 21 members with 3 female affected individuals with cherubism from Northern China. Of these 21 family members, 17 were recruited for the genetic analysis. We conducted the direct sequence analysis of the SH3BP2 gene among these 17 family members. A disease-causing mutation was identified in exon 9 of the gene. It was an A1517G base change, which leads to a D419G amino acid substitution. Conclusion To our knowledge, the A1517G mutation has not been reported previously in cherubism. This finding is novel.

  7. Annotating patents with Medline MeSH codes via citation mapping.

    Science.gov (United States)

    Griffin, Thomas D; Boyer, Stephen K; Councill, Isaac G

    2010-01-01

    Both patents and Medline are important document collections for discovering new relationships between chemicals and biology, searching for prior art for patent applications and retrieving background knowledge for current research activities. Finding relevance to a topic within patents is often made difficult by poor categorization, badly written descriptions, and even intentional obfuscation. Unlike patents, the Medline corpus has Medical Subject Heading (MeSH) keywords manually added to their articles, giving a medically relevant taxonomy to the 18 million article abstracts. Our work attempts to accurately recognize the citations made in patents to Medline-indexed articles, linking them to their corresponding PubMed ID and exploiting the associated MeSH to enhance patent search by annotating the referencing patents with their Medline citations' MeSH codes. The techniques, system features, and benefits are explained.

  8. The T-cell-specific adapter protein family: TSAd, ALX, and SH2D4A/SH2D4B.

    Science.gov (United States)

    Lapinski, Philip E; Oliver, Jennifer A; Bodie, Jennifer N; Marti, Francesc; King, Philip D

    2009-11-01

    Adapter proteins play key roles in intracellular signal transduction through complex formation with catalytically active signaling molecules. In T lymphocytes, the role of several different types of adapter proteins in T-cell antigen receptor signal transduction is well established. An exception to this is the family of T-cell-specific adapter (TSAd) proteins comprising of TSAd, adapter protein of unknown function (ALX), SH2D4A, and SH2D4B. Only recently has the function of these adapters in T-cell signal transduction been explored. Here, we discuss advances in our understanding of the role of this family of adapter proteins in T cells. Their function as regulators of signal transduction in other cell types is also discussed.

  9. Creating Transgenic shRNA Mice by Recombinase-Mediated Cassette Exchange

    Science.gov (United States)

    Premsrirut, Prem K.; Dow, Lukas E.; Park, Youngkyu; Hannon, Gregory J.; Lowe, Scott W.

    2014-01-01

    RNA interference (RNAi) enables sequence-specific, experimentally induced silencing of virtually any gene by tapping into innate regulatory mechanisms that are conserved among most eukaryotes. The principles that enable transgenic RNAi in cell lines can also be used to create transgenic animals, which express short-hairpin RNAs (shRNAs) in a regulated or tissue-specific fashion. However, RNAi in transgenic animals is somewhat more challenging than RNAi in cultured cells. The activities of promoters that are commonly used for shRNA expression in cell culture can vary enormously in different tissues, and founder lines also typically vary in transgene expression due to the effects of their single integration sites. There are many ways to produce mice carrying shRNA transgenes and the method described here uses recombinase-mediated cassette exchange (RMCE). RMCE permits insertion of the shRNA transgene into a well-characterized locus that gives reproducible and predictable expression in each founder and enhances the probability of potent expression in many cell types. This procedure is more involved and complex than simple pronuclear injection, but if even a few shRNA mice are envisioned, for example, to probe the functions of several genes, the effort of setting up the processes outlined below are well worthwhile. Note that when creating a transgenic mouse, one should take care to use the most potent shRNA possible. As a rule of thumb, the sequence chosen should provide >90% knockdown when introduced into cultured cells at single copy (e.g., on retroviral infection at a multiplicity of ≤0.3). PMID:24003198

  10. Synthesis and in vitro cytotoxicity of mPEG-SH modified gold nanorods

    Science.gov (United States)

    Didychuk, Candice L.; Ephrat, Pinhas; Belton, Michelle; Carson, Jeffrey J. L.

    2008-02-01

    Plasmon-resonant gold nanorods show great potential as an agent for contrast-enhanced biomedical imaging or for phototherapeutics. This is primarily due to the high molar extinction coefficient at the absorption maximum and the dependence of the wavelength of the absorption maximum on the aspect ratio, which is tunable in the near-infrared (NIR) during synthesis. Although gold nanorods can be produced in high-yield through the seed-mediated growth technique, the presence of residual cetyltrimethylammonium bromide (CTAB), a stabilizing surfactant required for nanorod growth, interferes with cell function and causes cytotoxicity. To overcome this potential obstacle to in vivo use, we synthesized gold nanorods and conjugated them to a methoxy (polyethylene glycol)-thiol (mPEG (5000)-SH). This approach yielded mPEG-SH modified gold nanorods with optical and morphometric properties that were similar to raw (CTAB) nanorods. Both the CTAB and mPEG-SH nanorods were tested for cytotoxicity against the HL-60 human leukemia cell line by trypan blue exclusion, and the mPEG-SH modified gold nanorods were also tested against a rat insulinoma (RIN-38) and squamous cell carcinoma (SCCVII) cell line. Cells incubated for 24 h with the mPEG-SH modified nanorods had little change in cell viability compared to cells incubated with vehicle alone. This was in contrast to cytotoxicity of CTAB nanorods on HL-60 cells. These results suggest that mPEG-SH modified gold nanorods are better suited for cell loading protocols and injection into animals and facilitate their use for imaging and phototherapeutic purposes.

  11. ExoMol molecular line lists - XXVI: spectra of SH and NS

    Science.gov (United States)

    Yurchenko, Sergei N.; Bond, Wesley; Gorman, Maire N.; Lodi, Lorenzo; McKemmish, Laura K.; Nunn, William; Shah, Rohan; Tennyson, Jonathan

    2018-04-01

    Line lists for the sulphur-containing molecules SH (the mercapto radical) and NS are computed as part of the ExoMol project. These line lists consider transitions within the X 2Π ground state for 32SH, 33SH, 34SH and 32SD, and 14N32S, 14N33S, 14N34S, 14N36S and 15N32S. Ab initio potential energy (PEC) and spin-orbit coupling (SOC) curves are computed and then improved by fitting to experimentally observed transitions. Fully ab initio dipole moment curves (DMCs) computed at high level of theory are used to produce the final line lists. For SH, our fit gives a root-mean-square (rms) error of 0.03 cm-1 between the observed (vmax = 4, Jmax = 34.5) and calculated transitions wavenumbers; this is extrapolated such that all X 2Π rotational-vibrational-electronic (rovibronic) bound states are considered. For 32SH the resulting line list contains about 81 000 transitions and 2 300 rovibronic states, considering levels up to vmax = 14 and Jmax = 60.5. For NS the refinement used a combination of experimentally determined frequencies and energy levels and led to an rms fitting error of 0.002 cm-1. Each NS calculated line list includes around 2.8 million transitions and 31 000 rovibronic states with a vibrational range up to v = 53 and rotational range to J = 235.5, which covers up to 23 000 cm-1. Both line lists should be complete for temperatures up to 5000 K. Example spectra simulated using this line list are shown and comparisons made to the existing data in the CDMS database. The line lists are available from the CDS (http://cdsarc.u-strasbg.fr) and ExoMol (www.exomol.com) data bases.

  12. Dusty plasmas

    International Nuclear Information System (INIS)

    Jones, M.E.; Winske, D.; Keinigs, R.; Lemons, D.

    1996-01-01

    This is the final report of a three-year, Laboratory-Directed Research and Development (LDRD) project at the Los Alamos National Laboratory (LANL). The objective of this project has been to develop a fundamental understanding of dusty plasmas at the Laboratory. While dusty plasmas are found in space in galactic clouds, planetary rings, and cometary tails, and as contaminants in plasma enhanced fabrication of microelectronics, many of their properties are only partially understood. Our work has involved both theoretical analysis and self-consistent plasma simulations to understand basic properties of dusty plasmas related to equilibrium, stability, and transport. Such an understanding can improve the control and elimination of plasma dust in industrial applications and may be important in the study of planetary rings and comet dust tails. We have applied our techniques to the study of charging, dynamics, and coagulation of contaminants in plasma processing reactors for industrial etching and deposition processes and to instabilities in planetary rings and other space plasma environments. The work performed in this project has application to plasma kinetics, transport, and other classical elementary processes in plasmas as well as to plasma waves, oscillations, and instabilities

  13. Plasma chromatography

    International Nuclear Information System (INIS)

    Anon.

    1984-01-01

    This book examines the fundamental theory and various applications of ion mobility spectroscopy. Plasma chromatography developed from research on the diffusion and mobility of ions. Topics considered include instrument design and description (e.g., performance, spectral interpretation, sample handling, mass spectrometry), the role of ion mobility in plasma chromatography (e.g., kinetic theory of ion transport), atmospheric pressure ionization (e.g., rate equations), the characterization of isomers by plasma chromatography (e.g., molecular ion characteristics, polynuclear aromatics), plasma chromatography as a gas chromatographic detection method (e.g., qualitative analysis, continuous mobility monitoring, quantitative analysis), the analysis of toxic vapors by plasma chromatography (e.g., plasma chromatograph calibration, instrument control and data processing), the analysis of semiconductor devices and microelectronic packages by plasma chromatography/mass spectroscopy (e.g., analysis of organic surface contaminants, analysis of water in sealed electronic packages), and instrument design and automation (hardware, software)

  14. MEDLINE MeSH Indexing: Lessons Learned from Machine Learning and Future Directions

    DEFF Research Database (Denmark)

    Jimeno-Yepes, Antonio; Mork, James G.; Wilkowski, Bartlomiej

    2012-01-01

    and analyzed the issues when using standard machine learning algorithms. We show that in some cases machine learning can improve the annotations already recommended by MTI, that machine learning based on low variance methods achieves better performance and that each MeSH heading presents a different behavior......Map and a k-NN approach called PubMed Related Citations (PRC). Our motivation is to improve the quality of MTI based on machine learning. Typical machine learning approaches fit this indexing task into text categorization. In this work, we have studied some Medical Subject Headings (MeSH) recommended by MTI...

  15. NH4SH and cloud cover in the atmospheres of the giant planets

    Science.gov (United States)

    Ibragimov, K. Iu.; Solodovnik, A. A.

    1991-02-01

    The probability of the formation of NH4SH and (NH4)2S is examined on the basis of the Le Chatelier principle. It is shown that it is very doubtful if NH4SH can be created in the atmospheres of the giant planets in quantities sufficient for cloud formation. Thus (NH4)2S is considered as a more likely candidate for cloud formation in the atmospheres of these planets, inasmuch as the conditions for its production there are more favorable.

  16. Envisioning the Shôjo Aesthetic in Illustrations of Miyazawa Kenji’s Literature.

    Directory of Open Access Journals (Sweden)

    Helen Claire Kilpatrick

    2013-01-01

    Full Text Available Despite an ever-growing body of scholarship on the shôjo (girl in manga and anime, little has been written about representations of the ‘girl’ in Japanese picture books. Shôjo literature and culture have grown exponentially in Japan since about the 1980s, but there has been a tendency in popular media to overemphasise the 'cute', disempowering aspects of the ‘girl’. By using Takahara Eiri's (1999 concept of “girl consciousness” and Honda Masuko's (1992 envisioning of the girl’s imagined freedom through a hirahira (fluttering aesthetic, notions of the powerless or mindlessly consuming shôjo can be dispelled. Such concepts help demonstrate that the girl ‘has her own creative, critical and cultural, if not social or political, power’ (Aoyama 2008: 286. This paper examines the shôjo tropes in contemporary illustrations that were produced to accompany two tales by the renowned author Miyazawa Kenji (1896-1933, Futago no Hoshi (Twin Stars and Ginga Tetsudô no Yoru (Night of the Milky Way Railway. Although Kenji (as he is known is not generally considered a shôjo author, some of his works incorporate gently transgressive shôjo themes reminiscent of, for example, Yoshiya Nobuko’s Hana Monogatari (Flower Tales from the 1920s. I argue that the current artwork of two award-winning artists, Makino Suzuko and Azuma Itsuko, reflects and enhances Kenji’s ‘girlish’ verbal images, bringing them to the fore in their accompanying imagery for Futago and Ginga by drawing on shôjo art, manga and literature. The artists thus bring into play intertextual references that occur not only across different historical temporalities but also through relations between the author, the artist, the text(s, the protagonists and the reading/viewing audience. The analysis of their striking artwork shows how they bring Kenji’s 1920s’ works firmly into the arena of the contemporary ‘girl’, expanding the abstract consciousness of the shôjo to

  17. Sleep of reason? The practices of reading shônen manga

    OpenAIRE

    Gallacher, Lesley-Anne

    2011-01-01

    In this thesis, I explore the practices of English-speaking readers of shônen manga (Japanese comics written primarily for an audience of teenage boys). I concentrate on three series in particular: Hiromu Arakawa’s Fullmetal Alchemist (2001–2010), Tite Kubo’s Bleach (2001–ongoing), and Masashi Kishimoto’s Naruto (1999–ongoing). I argue that, although it may appear to be inherently imbued with (authorial) meaning, the shônen manga text emerges from a curious ‘alchemy’ through...

  18. Structure of the SH3 domain of human osteoclast-stimulating factor at atomic resolution

    International Nuclear Information System (INIS)

    Chen, Liqing; Wang, Yujun; Wells, David; Toh, Diana; Harold, Hunt; Zhou, Jing; DiGiammarino, Enrico; Meehan, Edward J.

    2006-01-01

    The crystal structure of the SH3 domain of human osteoclast-stimulating factor has been determined and refined to the ultrahigh resolution of 1.07 Å. The structure at atomic resolution provides an accurate framework for structure-based design of its inhibitors. Osteoclast-stimulating factor (OSF) is an intracellular signaling protein, produced by osteoclasts themselves, that enhances osteoclast formation and bone resorption. It is thought to act via an Src-related signaling pathway and contains SH3 and ankyrin-repeat domains which are involved in protein–protein interactions. As part of a structure-based anti-bone-loss drug-design program, the atomic resolution X-ray structure of the recombinant human OSF SH3 domain (hOSF-SH3) has been determined. The domain, residues 12–72, yielded crystals that diffracted to the ultrahigh resolution of 1.07 Å. The overall structure shows a characteristic SH3 fold consisting of two perpendicular β-sheets that form a β-barrel. Structure-based sequence alignment reveals that the putative proline-rich peptide-binding site of hOSF-SH3 consists of (i) residues that are highly conserved in the SH3-domain family, including residues Tyr21, Phe23, Trp49, Pro62, Asn64 and Tyr65, and (ii) residues that are less conserved and/or even specific to hOSF, including Thr22, Arg26, Thr27, Glu30, Asp46, Thr47, Asn48 and Leu60, which might be key to designing specific inhibitors for hOSF to fight osteoporosis and related bone-loss diseases. There are a total of 13 well defined water molecules forming hydrogen bonds with the above residues in and around the peptide-binding pocket. Some of those water molecules might be important for drug-design approaches. The hOSF-SH3 structure at atomic resolution provides an accurate framework for structure-based design of its inhibitors

  19. Dissection of the BCR-ABL signaling network using highly specific monobody inhibitors to the SHP2 SH2 domains.

    Science.gov (United States)

    Sha, Fern; Gencer, Emel Basak; Georgeon, Sandrine; Koide, Akiko; Yasui, Norihisa; Koide, Shohei; Hantschel, Oliver

    2013-09-10

    The dysregulated tyrosine kinase BCR-ABL causes chronic myelogenous leukemia in humans and forms a large multiprotein complex that includes the Src-homology 2 (SH2) domain-containing phosphatase 2 (SHP2). The expression of SHP2 is necessary for BCR-ABL-dependent oncogenic transformation, but the precise signaling mechanisms of SHP2 are not well understood. We have developed binding proteins, termed monobodies, for the N- and C-terminal SH2 domains of SHP2. Intracellular expression followed by interactome analysis showed that the monobodies are essentially monospecific to SHP2. Two crystal structures revealed that the monobodies occupy the phosphopeptide-binding sites of the SH2 domains and thus can serve as competitors of SH2-phosphotyrosine interactions. Surprisingly, the segments of both monobodies that bind to the peptide-binding grooves run in the opposite direction to that of canonical phosphotyrosine peptides, which may contribute to their exquisite specificity. When expressed in cells, monobodies targeting the N-SH2 domain disrupted the interaction of SHP2 with its upstream activator, the Grb2-associated binder 2 adaptor protein, suggesting decoupling of SHP2 from the BCR-ABL protein complex. Inhibition of either N-SH2 or C-SH2 was sufficient to inhibit two tyrosine phosphorylation events that are critical for SHP2 catalytic activity and to block ERK activation. In contrast, targeting the N-SH2 or C-SH2 revealed distinct roles of the two SH2 domains in downstream signaling, such as the phosphorylation of paxillin and signal transducer and activator of transcription 5. Our results delineate a hierarchy of function for the SH2 domains of SHP2 and validate monobodies as potent and specific antagonists of protein-protein interactions in cancer cells.

  20. Discussing the low fraction of disk-bearing T Tauri stars discovered near to the Sh2-296 nebula

    Science.gov (United States)

    Gregorio-Hetem, Jane

    2015-08-01

    A multiband study has been developed by our team in the direction of young star clusters associated to the Sh2-296 nebula aiming to unveil the star formation history of this galactic molecular cloud that shows a mixing of different age stellar groups. A sample of 58 pre-main sequence stars has been recently discovered by us in this region (Fernandes et al. 2015, MNRAS in press), based on optical spectral features. Only 41% of the sample shows evidence of IR excess revealing the presence of circumstellar disks. It is interesting to note that the targets were revealed by their strong X-ray emission, typically found in T Tauri stars (TTs) (Santos-Silva et al. 2015, in preparation) . In this case, it would be expected a larger number of disk-bearing stars and also the fraction of circumstellar emission (fc = Ldisk/Ltotal ) should be more significant in these objects. However, we verified that only 12% of the sample has fc > 30%. This low fraction is quite rare compared to most young star-forming regions, suggesting that some external factor has accelerated the disc dissipation. In the present work we explore the circumstellar structure of a subsample of 8 TTs associated to Sh2-296. The TTs were selected on the basis of their high circumstellar emission, which is estimated by SED fitting that uses near- to mid-IR data extracted from available catalogues (WISE, AKARI, MSX). The circumstellar characteristics are confronted to interstellar environment by comparing the stellar spatial distribution with 12CO maps (Nanten Survey, Fukui et al. ). Most of the TTs are projected against moderate molecular emission (33 Jy), but some of them are found in regions of lower levels of gas distribution (3.8 Jy). The similarities and differences found among the studied objects are discussed in order to better understand the formation and evolution of protostellar disks of the selected sample and their role in the star formation scenario nearby Sh2-296

  1. Influence of Expression Plasmid of Connective Tissue Growth Factor and Tissue Inhibitor of Metalloproteinase-1 shRNA on Hepatic Precancerous Fibrosis in Rats.

    Science.gov (United States)

    Zhang, Qun; Shu, Fu-Li; Jiang, Yu-Feng; Huang, Xin-En

    2015-01-01

    In this study, influence caused by expression plasmids of connective tissue growth factor (CTGF) and tissue inhibitor of metalloproteinase-1 (TIMP-1) short hairpin RNA (shRNA) on mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII in hepatic tissue with hepatic fibrosis, a precancerous condition, in rats is analyzed. To screen and construct shRNA expression plasimid which effectively interferes RNA targets of CTGF and TIMP-1 in rats. 50 cleaning Wistar male rats are allocated randomly at 5 different groups after precancerous fibrosis models and then injection of shRNA expression plasimids. Plasmid psiRNA-GFP-Com (CTGF and TIMP-1 included), psiRNA-GFP-CTGF, psiRNA-GFP-TIMP-1 and psiRNA- DUO-GFPzeo of blank plasmid are injected at group A, B, C and D, respectively, and as model control group that none plasimid is injected at group E. In 2 weeks after last injection, to hepatic tissue at different groups, protein expression of CTGF, TIMP-1, procol-α1and PC III is tested by immunohistochemical method and,mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII is measured by real-time PCR. One-way ANOVA is used to comparison between-groups. Compared with model group, there is no obvious difference of mRNA expression among CTGF,TIMP-1,procol-α1,PC III and of protein expression among CTGF, TIMP-1, procol-α1, PC III in hepatic tissue at group injected with blank plasmid. Expression quantity of mRNA of CTGF, TIMP-1, procol-α1 and PCIII at group A, B and C decreases, protein expression of CTGF, TIMP-1, procol-α1, PC III in hepatic tissue is lower, where the inhibition of combination RNA interference group (group A) on procol-α1 mRNA transcription and procol-α1 protein expression is superior to that of single interference group (group B and C) (P<0.01 or P<0.05). RNA interference on CTGF and/or TIMP-1 is obviously a inhibiting factor for mRNA and protein expression of CTGF, TIMP-1, procol-α1 and PCIII. Combination RNA interference on genes of CTGF and TIMP-1 is superior

  2. Progress report for 1975 - plasma physics group

    International Nuclear Information System (INIS)

    1975-01-01

    The year's activities have been dominated by the construction of components for the new toroidal device LT-4. This device was originally conceived as a successor to LT-3 which would provide improved geometry, better diagnostic accessibility and a considerably higher toroidal magnetic field (3.0T) powered by the department's homopolar generator. In order to get it operating as soon as possible it was decided to power it initially (Stage I) with the LT-3 capacitor banks. Connection of the toroidal field winding will be made to the HPG(Stage II) as soon as practicable. By the end of the year all components for Stage I of LT-4 were essentially completed and the machine was ready for final assembly and testing. Experiments which are proceeding with the LT-3 include measurements of diamagnetism, construction of magnetic probes, diffusion studies of runaway electrons, and the determination of ion temperatures from Doppler broadening measurements. (R.L.)

  3. The SH2 Domain–Containing Proteins in 21 Species Establish the Provenance and Scope of Phosphotyrosine Signaling in Eukaryotes

    Science.gov (United States)

    Liu, Bernard A.; Shah, Eshana; Jablonowski, Karl; Stergachis, Andrew; Engelmann, Brett; Nash, Piers D.

    2014-01-01

    The Src homology 2 (SH2) domains are participants in metazoan signal transduction, acting as primary mediators for regulated protein-protein interactions with tyrosine-phosphorylated substrates. Here, we describe the origin and evolution of SH2 domain proteins by means of sequence analysis from 21 eukaryotic organisms from the basal unicellular eukaryotes, where SH2 domains first appeared, through the multicellular animals and increasingly complex metazoans. On the basis of our results, SH2 domains and phosphotyrosine signaling emerged in the early Unikonta, and the numbers of SH2 domains expanded in the choanoflagellate and metazoan lineages with the development of tyrosine kinases, leading to rapid elaboration of phosphotyrosine signaling in early multicellular animals. Our results also indicated that SH2 domains coevolved and the number of the domains expanded alongside protein tyrosine kinases and tyrosine phosphatases, thereby coupling phosphotyrosine signaling to downstream signaling networks. Gene duplication combined with domain gain or loss produced novel SH2-containing proteins that function within phosphotyrosine signaling, which likely have contributed to diversity and complexity in metazoans. We found that intra- and intermolecular interactions within and between SH2 domain proteins increased in prevalence along with organismal complexity and may function to generate more highly connected and robust phosphotyrosine signaling networks. PMID:22155787

  4. Tyrosine Phosphorylation of the Lyn Src Homology 2 (SH2) Domain Modulates Its Binding Affinity and Specificity*

    Science.gov (United States)

    Jin, Lily L.; Wybenga-Groot, Leanne E.; Tong, Jiefei; Taylor, Paul; Minden, Mark D.; Trudel, Suzanne; McGlade, C. Jane; Moran, Michael F.

    2015-01-01

    Src homology 2 (SH2) domains are modular protein structures that bind phosphotyrosine (pY)-containing polypeptides and regulate cellular functions through protein-protein interactions. Proteomics analysis showed that the SH2 domains of Src family kinases are themselves tyrosine phosphorylated in blood system cancers, including acute myeloid leukemia, chronic lymphocytic leukemia, and multiple myeloma. Using the Src family kinase Lyn SH2 domain as a model, we found that phosphorylation at the conserved SH2 domain residue Y194 impacts the affinity and specificity of SH2 domain binding to pY-containing peptides and proteins. Analysis of the Lyn SH2 domain crystal structure supports a model wherein phosphorylation of Y194 on the EF loop modulates the binding pocket that engages amino acid side chains at the pY+2/+3 position. These data indicate another level of regulation wherein SH2-mediated protein-protein interactions are modulated by SH2 kinases and phosphatases. PMID:25587033

  5. SH2 domains of the p85 alpha subunit of phosphatidylinositol 3-kinase regulate binding to growth factor receptors.

    Science.gov (United States)

    McGlade, C J; Ellis, C; Reedijk, M; Anderson, D; Mbamalu, G; Reith, A D; Panayotou, G; End, P; Bernstein, A; Kazlauskas, A

    1992-01-01

    The binding of cytoplasmic signaling proteins such as phospholipase C-gamma 1 and Ras GTPase-activating protein to autophosphorylated growth factor receptors is directed by their noncatalytic Src homology region 2 (SH2) domains. The p85 alpha regulatory subunit of phosphatidylinositol (PI) 3-kinase, which associates with several receptor protein-tyrosine kinases, also contains two SH2 domains. Both p85 alpha SH2 domains, when expressed individually as fusion proteins in bacteria, bound stably to the activated beta receptor for platelet-derived growth factor (PDGF). Complex formation required PDGF stimulation and was dependent on receptor tyrosine kinase activity. The bacterial p85 alpha SH2 domains recognized activated beta PDGF receptor which had been immobilized on a filter, indicating that SH2 domains contact autophosphorylated receptors directly. Several receptor tyrosine kinases within the PDGF receptor subfamily, including the colony-stimulating factor 1 receptor and the Steel factor receptor (Kit), also associate with PI 3-kinase in vivo. Bacterially expressed SH2 domains derived from the p85 alpha subunit of PI 3-kinase bound in vitro to the activated colony-stimulating factor 1 receptor and to Kit. We infer that the SH2 domains of p85 alpha bind to high-affinity sites on these receptors, whose creation is dependent on receptor autophosphorylation. The SH2 domains of p85 are therefore primarily responsible for the binding of PI 3-kinase to activated growth factor receptors. Images PMID:1372092

  6. Tyrosine phosphorylation of the Lyn Src homology 2 (SH2) domain modulates its binding affinity and specificity.

    Science.gov (United States)

    Jin, Lily L; Wybenga-Groot, Leanne E; Tong, Jiefei; Taylor, Paul; Minden, Mark D; Trudel, Suzanne; McGlade, C Jane; Moran, Michael F

    2015-03-01

    Src homology 2 (SH2) domains are modular protein structures that bind phosphotyrosine (pY)-containing polypeptides and regulate cellular functions through protein-protein interactions. Proteomics analysis showed that the SH2 domains of Src family kinases are themselves tyrosine phosphorylated in blood system cancers, including acute myeloid leukemia, chronic lymphocytic leukemia, and multiple myeloma. Using the Src family kinase Lyn SH2 domain as a model, we found that phosphorylation at the conserved SH2 domain residue Y(194) impacts the affinity and specificity of SH2 domain binding to pY-containing peptides and proteins. Analysis of the Lyn SH2 domain crystal structure supports a model wherein phosphorylation of Y(194) on the EF loop modulates the binding pocket that engages amino acid side chains at the pY+2/+3 position. These data indicate another level of regulation wherein SH2-mediated protein-protein interactions are modulated by SH2 kinases and phosphatases. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Combining biophysical methods to analyze the disulfide bond in SH2 domain of C-terminal Src kinase.

    Science.gov (United States)

    Liu, Dongsheng; Cowburn, David

    2016-01-01

    The Src Homology 2 (SH2) domain is a structurally conserved protein domain that typically binds to a phosphorylated tyrosine in a peptide motif from the target protein. The SH2 domain of C-terminal Src kinase (Csk) contains a single disulfide bond, which is unusual for most SH2 domains. Although the global motion of SH2 domain regulates Csk function, little is known about the relationship between the disulfide bond and binding of the ligand. In this study, we combined X-ray crystallography, solution NMR, and other biophysical methods to reveal the interaction network in Csk. Denaturation studies have shown that disulfide bond contributes significantly to the stability of SH2 domain, and crystal structures of the oxidized and C122S mutant showed minor conformational changes. We further investigated the binding of SH2 domain to a phosphorylated peptide from Csk-binding protein upon reduction and oxidation using both NMR and fluorescence approaches. This work employed NMR, X-ray cryptography, and other biophysical methods to study a disulfide bond in Csk SH2 domain. In addition, this work provides in-depth understanding of the structural dynamics of Csk SH2 domain.

  8. Hydrophobic interaction between the SH2 domain and the kinase domain is required for the activation of Csk.

    Science.gov (United States)

    Mikkola, Esa T; Gahmberg, Carl G

    2010-06-18

    The protein tyrosine kinase C-terminal Src kinase (Csk) is activated by the engagement of its Src homology (SH) 2 domain. However, the molecular mechanism required for this is not completely understood. The crystal structure of the active Csk indicates that Csk could be activated by contact between the SH2 domain and the beta3-alphaC loop in the N-terminal lobe of the kinase domain. To study the importance of this interaction for the SH2-domain-mediated activation of Csk, we mutated the amino acid residues forming the contacts between the SH2 domain and the beta3-alphaC loop. The mutation of the beta3-alphaC loop Ala228 to glycine and of the SH2 domain Tyr116, Tyr133, Leu138, and Leu149 to alanine resulted in the inability of the SH2 domain ligand to activate Csk. Furthermore, the overexpressed Csk mutants A228G, Y133A/Y116A, L138A, and L149A were unable to efficiently inactivate endogenous Src in human embryonic kidney 293 cells. The results suggest that the SH2-domain-mediated activation of Csk is dependent on the binding of the beta3-alphaC loop Ala228 to the hydrophobic pocket formed by the side chains of Tyr116, Tyr133, Leu138, and Leu149 on the surface of the SH2 domain. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  9. Use of the shrunken-2 (sh2) mutant to study source-sink relations in maize during reproductive development

    International Nuclear Information System (INIS)

    Ritchie, S.W.

    1987-01-01

    Leaf metabolism, 14 C-assimilate distribution, and kernel (sink) metabolism were compared in a normal wild-type (homozygous sh2) inbred (Oh43) of maize (Zea mays L.) and a genetically related shrunken-2 (homozygous sh2) inbred of Oh43. In comparison to normal starchy kernels, kernels from the shrunken-2 (sh2) mutant showed highly decreased starch contents and subsequently decreased total kernel dry matter. As measured by dry matter accumulation and 14 C-assimilate distribution patterns, sh2 kernel assimilate demand did not differ from normal kernel assimilate demand throughout most of the early linear grain-fill period. However, sh2 kernel demand began to decrease toward the end of early grain-fill and was highly decreased during all of the middle grain-fill period. During the late grain-fill period, sh2 kernel assimilate demand was non-existent. The initial evidence for decreased sh2 kernel assimilate demand was a change in 14 C label distribution in the sh2 ear tissues (husks, shank, cob, and kernels) toward the end of early grain-fill

  10. Activation of PI3K/Akt signaling by n-terminal SH2 domain mutants of the p85α regulatory subunit of PI3K is enhanced by deletion of its c-terminal SH2 domain.

    Science.gov (United States)

    Hofmann, Bianca T; Jücker, Manfred

    2012-10-01

    The phosphoinositide 3-kinase (PI3K) is frequently activated in human cancer cells due to gain of function mutations in the catalytic (p110) and the regulatory (p85) subunits. The regulatory subunit consists of an SH3 domain and two SH2 domains. An oncogenic form of p85α named p65 lacking the c-terminal SH2 domain (cSH2) has been cloned from an irradiation-induced murine thymic lymphoma and transgenic mice expressing p65 in T lymphocytes develop a lymphoproliferative disorder. We have recently detected a c-terminal truncated form of p85α named p76α in a human lymphoma cell line lacking most of the cSH2 domain due to a frame shift mutation. Here, we report that the deletion of the cSH2 domain enhances the activating effects of the n-terminal SH2 domain (nSH2) mutants K379E and R340E on the PI3K/Akt pathway and micro tumor formation in a focus assay. Further analysis revealed that this transforming effect is mediated by activation of the catalytic PI3K isoform p110α and downstream signaling through mTOR. Our data further support a mechanistic model in which mutations of the cSH2 domain of p85α can abrogate its negative regulatory function on PI3K activity via the nSH2 domain of p85α. Copyright © 2012 Elsevier Inc. All rights reserved.

  11. Conformation of an Shc-derived phosphotyrosine-containing peptide complexed with the Grb2 SH2 domain

    International Nuclear Information System (INIS)

    Ogura, Kenji; Tsuchiya, Shigeo; Terasawa, Hiroaki; Yuzawa, Satoru; Hatanaka, Hideki; Mandiyan, Valsan; Schlessinger, Joseph; Inagaki, Fuyuhiko

    1997-01-01

    We have determined the structure of an Shc-derived phosphotyrosine-containing peptide complexed with Grb2 SH2 based on intra-and intermolecular NOE correlations observed by a series of isotope-filtered NMR experiments using a PFG z-filter. In contrast to an extended conformation of phosphotyrosine-containing peptides bound to Src, Syp and PLC γ SH2s, the Shc-derived peptide formed a turn at the +1 and +2 positions next to the phosphotyrosine residue. Trp 121 , located at the EF1 site of Grb2 SH2, blocked the peptide binding in an extended conformation. The present study confirms that each phosphotyrosine-containing peptide binds to the cognate SH2 with a specific conformation, which gives the structural basis for the binding specificity between SH2s and target proteins

  12. Use of NLM medical subject headings with the MeSH2010 thesaurus in the PORTAL-DOORS system.

    Science.gov (United States)

    Taswell, Carl

    2010-01-01

    The NLM MeSH Thesaurus has been incorporated for use in the PORTAL-DOORS System (PDS) for resource metadata management on the semantic web. All 25588 descriptor records from the NLM 2010 MeSH Thesaurus have been exposed as web accessible resources by the PDS MeSH2010 Thesaurus implemented as a PDS PORTAL Registry operating as a RESTful web service. Examples of records from the PDS MeSH2010 PORTAL are demonstrated along with their use by records in other PDS PORTAL Registries that reference the concepts from the MeSH2010 Thesaurus. Use of this important biomedical terminology will greatly enhance the quality of metadata content of other PDS records thus improving cross-domain searches between different problem oriented domains and amongst different clinical specialty fields.

  13. Silencing effect of shRNA expression vectors with stem length of 21 ...

    African Journals Online (AJOL)

    Then, the recombinant plasmids were transfected into mouse embryonic fibroblast with lipofection and injected into leg muscle of mouse. The mRNA expression level of the green fluorescent protein gene was checked by real-time quantitative polymerase chain reaction (RT-PCR). The silencing effect of the 29 bp shRNA ...

  14. Novel high-throughput screening system for identifying STAT3-SH2 antagonists

    International Nuclear Information System (INIS)

    Uehara, Yutaka; Mochizuki, Masato; Matsuno, Kenji; Haino, Takeharu; Asai, Akira

    2009-01-01

    Constitutive activation of the oncogenic transcription factor STAT3 frequently occurs in various human malignancies. STAT3 activation involves dimerization via intermolecular pTyr-SH2 interaction. Thus, antagonizing this interaction is a feasible approach to inhibit STAT3 activation for cancer therapy. In order to identify selective STAT3 inhibitors, we developed a biochemical HTS system based on AlphaScreen technology, which measures the abilities of test compounds to antagonize pTyr-SH2 interactions. We screened our chemical libraries using this system and identified 5,15-diphenylporphyrin (5,15-DPP) as a selective STAT3-SH2 antagonist. Selective inhibition of STAT3 nuclear translocation and DNA biding activity was observed in cells treated with 5,15-DPP. IL-6-dependent dimerization of STAT3, c-myc promoter binding and c-myc protein expression were all suppressed by 5,15-DPP, whereas no decrement in either expression or phosphorylation level of STAT3 was observed. Thus, the HTS assay system represented herein may be useful for identifying novel STAT3-SH2 antagonists.

  15. Energetic particles in the heliosphere and GCR modulation: Reviewing of SH-posters

    International Nuclear Information System (INIS)

    Struminsky, Alexei

    2013-01-01

    This rapporteur paper addresses the SH poster session titled 'Energetic particles in the heliosphere (solar and anomalous CRs, GCR modulation)' of the 23rd European Cosmic Ray Symposium (ECRS) and the 32nd Russian Cosmic Ray Conference (RCRC). The 65 posters presented are tentatively divided into five sections: Instruments and Methods; Solar Energetic Particles; Short Term Variations; Long Term Variations; Heliosphere.

  16. The Eighty Six Hα Spectra from the Orion Nebula (M42, Sh2-281)

    Indian Academy of Sciences (India)

    ∼40′×40′) of the Orion Nebula (NGC1976, M42, Sh2-281) have been obtained using DEFPOS spectrometer with a circular field of view of 4′ at TUBITAK National Observatory (TUG, Antalya, Turkey). Measurements provide information ...

  17. Fast evaluation of complete synthetic SH seismograms based on asymptotic mode theory

    NARCIS (Netherlands)

    Bastians, M.W.J.M.

    1986-01-01

    In this thesis we have developed an asymptotic mode theory with the following features. 1) Complete synthetic SH seismograms can be evaluated for both realistic models of Earth and crust. 2) The method is of practical value and can be used even on small computers wi th reasonable computation

  18. Fast evaluation of complete synthetic SH seismograms based on asymptotic mode theory

    NARCIS (Netherlands)

    Bastians, M.W.J.M.

    1986-01-01

    In this thesis we have developed an asymptotic mode theory with the following features. 1) Complete synthetic SH seismograms can be evaluated for both realistic models of Earth and crust. 2) The method is of practical value and can be used even on small computers wi th reasonable computation times

  19. The SH-SY5Y cell line in Parkinson's disease research: a systematic review.

    Science.gov (United States)

    Xicoy, Helena; Wieringa, Bé; Martens, Gerard J M

    2017-01-24

    Parkinson's disease (PD) is a devastating and highly prevalent neurodegenerative disease for which only symptomatic treatment is available. In order to develop a truly effective disease-modifying therapy, improvement of our current understanding of the molecular and cellular mechanisms underlying PD pathogenesis and progression is crucial. For this purpose, standardization of research protocols and disease models is necessary. As human dopaminergic neurons, the cells mainly affected in PD, are difficult to obtain and maintain as primary cells, current PD research is mostly performed with permanently established neuronal cell models, in particular the neuroblastoma SH-SY5Y lineage. This cell line is frequently chosen because of its human origin, catecholaminergic (though not strictly dopaminergic) neuronal properties, and ease of maintenance. However, there is no consensus on many fundamental aspects that are associated with its use, such as the effects of culture media composition and of variations in differentiation protocols. Here we present the outcome of a systematic review of scientific articles that have used SH-SY5Y cells to explore PD. We describe the cell source, culture conditions, differentiation protocols, methods/approaches used to mimic PD and the preclinical validation of the SH-SY5Y findings by employing alternative cellular and animal models. Thus, this overview may help to standardize the use of the SH-SY5Y cell line in PD research and serve as a future user's guide.

  20. Adsorption of Pb2+ on Thiol-functionalized Mesoporous Silica, SH-MCM-48

    Science.gov (United States)

    Taba, P.; Mustafa, R. D. P.; Ramang, L. M.; Kasim, A. H.

    2018-03-01

    Modification of mesoporous silica, MCM-48, by using 3- mercaptopropyltrimethoxysilane has been successfully conducted. MCM-48 and SH-MCM-48 were characterized using XRD and FTIR. SH-MCM-48 was used as an adsorbent of Pb2+ ions from solution. A number of Pb2+ ions adsorbed were studied as the function of time, pH, and concentration. The concentration of the ions after adsorption was determined by an Atomic Absorption Spectrophotometer. The removal of the adsorbed ions from the SH-MCM-48 was also studied using several desorbing agents. The result showed that the optimum time was 20 minutes and optimum pH was 4. The adsorption of Pb(II) ion followed the pseudo-second-order with the rate constant of 0,2632 g•mg-1•min-1. Adsorption of Pb(II) ion fitted the Langmuir isotherm with the adsorption capacity of 0,1088 mmol/g. The best desorbing agent to remove the adsorbed ion from SH-MCM-48 was 0.3 M HCl solution with the desorption percentage of 58.6%.

  1. Challenges and Opportunities for Mainstreaming Climate Change Adaptation into WaSH Development Planning in Ghana.

    Science.gov (United States)

    Alhassan, Salley; Hadwen, Wade L

    2017-07-10

    Climate change threatens water, sanitation and hygiene (WaSH) facilities and services, as these are intimately linked to the water cycle and are vulnerable to changes in the quantity and quality of available water resources. Floods and droughts, which pollute and reduce water delivery respectively, have now become a perennial issue to deal with in the northern regions of Ghana. This study aimed to assess the degree to which climate change adaptation measures are mainstreamed into the water, sanitation and hygiene (WaSH) development planning process in Ghana. Stakeholders from government and non-government agencies were interviewed to gain perspectives on the threat of climate change, the inclusion of climate change in WaSH planning and the barriers preventing mainstreaming. Despite awareness of climate change, adaptation measures have not been considered, and the immediate WaSH needs remain the priority. Overall, stakeholders felt the adaptive capacity of the Municipality was low and that mainstreaming has not yet occurred. Despite the lack of progress, there are great opportunities for mainstreaming climate change adaptation into planning through increasing awareness and capacity, legislative and institutional changes and the development of participatory systems to provide early warning systems and disaster risk analyses that will inform future planning.

  2. Comparative Genomics and Disorder Prediction Identify Biologically Relevant SH3 Protein Interactions.

    Directory of Open Access Journals (Sweden)

    2005-08-01

    Full Text Available Protein interaction networks are an important part of the post-genomic effort to integrate a part-list view of the cell into system-level understanding. Using a set of 11 yeast genomes we show that combining comparative genomics and secondary structure information greatly increases consensus-based prediction of SH3 targets. Benchmarking of our method against positive and negative standards gave 83% accuracy with 26% coverage. The concept of an optimal divergence time for effective comparative genomics studies was analyzed, demonstrating that genomes of species that diverged very recently from Saccharomyces cerevisiae(S. mikatae, S. bayanus, and S. paradoxus, or a long time ago (Neurospora crassa and Schizosaccharomyces pombe, contain less information for accurate prediction of SH3 targets than species within the optimal divergence time proposed. We also show here that intrinsically disordered SH3 domain targets are more probable sites of interaction than equivalent sites within ordered regions. Our findings highlight several novel S. cerevisiae SH3 protein interactions, the value of selection of optimal divergence times in comparative genomics studies, and the importance of intrinsic disorder for protein interactions. Based on our results we propose novel roles for the S. cerevisiae proteins Abp1p in endocytosis and Hse1p in endosome protein sorting.

  3. Comparative genomics and disorder prediction identify biologically relevant SH3 protein interactions.

    Directory of Open Access Journals (Sweden)

    Pedro Beltrao

    2005-08-01

    Full Text Available Protein interaction networks are an important part of the post-genomic effort to integrate a part-list view of the cell into system-level understanding. Using a set of 11 yeast genomes we show that combining comparative genomics and secondary structure information greatly increases consensus-based prediction of SH3 targets. Benchmarking of our method against positive and negative standards gave 83% accuracy with 26% coverage. The concept of an optimal divergence time for effective comparative genomics studies was analyzed, demonstrating that genomes of species that diverged very recently from Saccharomyces cerevisiae(S. mikatae, S. bayanus, and S. paradoxus, or a long time ago (Neurospora crassa and Schizosaccharomyces pombe, contain less information for accurate prediction of SH3 targets than species within the optimal divergence time proposed. We also show here that intrinsically disordered SH3 domain targets are more probable sites of interaction than equivalent sites within ordered regions. Our findings highlight several novel S. cerevisiae SH3 protein interactions, the value of selection of optimal divergence times in comparative genomics studies, and the importance of intrinsic disorder for protein interactions. Based on our results we propose novel roles for the S. cerevisiae proteins Abp1p in endocytosis and Hse1p in endosome protein sorting.

  4. Challenges and Opportunities for Mainstreaming Climate Change Adaptation into WaSH Development Planning in Ghana

    Directory of Open Access Journals (Sweden)

    Salley Alhassan

    2017-07-01

    Full Text Available Climate change threatens water, sanitation and hygiene (WaSH facilities and services, as these are intimately linked to the water cycle and are vulnerable to changes in the quantity and quality of available water resources. Floods and droughts, which pollute and reduce water delivery respectively, have now become a perennial issue to deal with in the northern regions of Ghana. This study aimed to assess the degree to which climate change adaptation measures are mainstreamed into the water, sanitation and hygiene (WaSH development planning process in Ghana. Stakeholders from government and non-government agencies were interviewed to gain perspectives on the threat of climate change, the inclusion of climate change in WaSH planning and the barriers preventing mainstreaming. Despite awareness of climate change, adaptation measures have not been considered, and the immediate WaSH needs remain the priority. Overall, stakeholders felt the adaptive capacity of the Municipality was low and that mainstreaming has not yet occurred. Despite the lack of progress, there are great opportunities for mainstreaming climate change adaptation into planning through increasing awareness and capacity, legislative and institutional changes and the development of participatory systems to provide early warning systems and disaster risk analyses that will inform future planning.

  5. Isolation and characterization of an isoproturon mineralizing Sphingomonas sp. strain SH from a French agricultural soil.

    Science.gov (United States)

    Hussain, Sabir; Devers-Lamrani, Marion; El Azhari, Najoi; Martin-Laurent, Fabrice

    2011-06-01

    The phenylurea herbicide isoproturon, 3-(4-isopropylphenyl)-1,1-dimethylurea (IPU), was found to be rapidly mineralized in an agricultural soil in France that had been periodically exposed to IPU. Enrichment cultures from samples of this soil isolated a bacterial strain able to mineralize IPU. 16S rRNA sequence analysis showed that this strain belonged to the phylogeny of the genus Sphingomonas (96% similarity with Sphingomonas sp. JEM-14, AB219361) and was designated Sphingomonas sp. strain SH. From this strain, a partial sequence of a 1,2-dioxygenase (catA) gene coding for an enzyme degrading catechol putatively formed during IPU mineralization was amplified. Phylogenetic analysis revealed that the catA sequence was related to Sphingomonas spp. and showed a lack of congruence between the catA and 16S rRNA based phylogenies, implying horizontal gene transfer of the catA gene cluster between soil microbiota. The IPU degrading ability of strain SH was strongly influenced by pH with maximum degradation taking place at pH 7.5. SH was only able to mineralize IPU and its known metabolites including 4-isopropylaniline and it could not degrade other structurally related phenylurea herbicides such as diuron, linuron, monolinuron and chlorotoluron or their aniline derivatives. These observations suggest that the catabolic abilities of the strain SH are highly specific to the metabolism of IPU.

  6. The Janus Kinase (JAK) FERM and SH2 Domains: Bringing Specificity to JAK-Receptor Interactions.

    Science.gov (United States)

    Ferrao, Ryan; Lupardus, Patrick J

    2017-01-01

    The Janus kinases (JAKs) are non-receptor tyrosine kinases essential for signaling in response to cytokines and interferons and thereby control many essential functions in growth, development, and immune regulation. JAKs are unique among tyrosine kinases for their constitutive yet non-covalent association with class I and II cytokine receptors, which upon cytokine binding bring together two JAKs to create an active signaling complex. JAK association with cytokine receptors is facilitated by N-terminal FERM and SH2 domains, both of which are classical mediators of peptide interactions. Together, the JAK FERM and SH2 domains mediate a bipartite interaction with two distinct receptor peptide motifs, the proline-rich "Box1" and hydrophobic "Box2," which are present in the intracellular domain of cytokine receptors. While the general sidechain chemistry of Box1 and Box2 peptides is conserved between receptors, they share very weak primary sequence homology, making it impossible to posit why certain JAKs preferentially interact with and signal through specific subsets of cytokine receptors. Here, we review the structure and function of the JAK FERM and SH2 domains in light of several recent studies that reveal their atomic structure and elucidate interaction mechanisms with both the Box1 and Box2 receptor motifs. These crystal structures demonstrate how evolution has repurposed the JAK FERM and SH2 domains into a receptor-binding module that facilitates interactions with multiple receptors possessing diverse primary sequences.

  7. Estrogen Receptor Folding Modulates cSrc Kinase SH2 Interaction via a Helical Binding Mode

    NARCIS (Netherlands)

    Nieto, Lidia; Tharun, Inga M; Balk, Mark; Wienk, Hans; Boelens, Rolf; Ottmann, Christian; Milroy, Lech-Gustav; Brunsveld, Luc

    2015-01-01

    The estrogen receptors (ERs) feature, next to their transcriptional role, important nongenomic signaling actions, with emerging clinical relevance. The Src Homology 2 (SH2) domain mediated interaction between cSrc kinase and ER plays a key role in this; however the molecular determinants of this

  8. Estrogen receptor folding modulates cSrc kinase SH2 interaction via a helical binding mode

    NARCIS (Netherlands)

    Nieto, L.; Tharun, I.M.; Balk, M.; Wienk, H.; Boelens, R.; Ottmann, C.; Milroy, L.-G.; Brunsveld, L.

    2015-01-01

    The estrogen receptors (ERs) feature, next to their transcriptional role, important nongenomic signaling actions, with emerging clinical relevance. The Src Homology 2 (SH2) domain mediated interaction between cSrc kinase and ER plays a key role in this; however the molecular determinants of this

  9. Targeting the SH2-kinase interface in Bcr-Abl inhibits leukemogenesis.

    Science.gov (United States)

    Grebien, Florian; Hantschel, Oliver; Wojcik, John; Kaupe, Ines; Kovacic, Boris; Wyrzucki, Arkadiusz M; Gish, Gerald D; Cerny-Reiterer, Sabine; Koide, Akiko; Beug, Hartmut; Pawson, Tony; Valent, Peter; Koide, Shohei; Superti-Furga, Giulio

    2011-10-14

    Chronic myelogenous leukemia (CML) is caused by the constitutively active tyrosine kinase Bcr-Abl and treated with the tyrosine kinase inhibitor (TKI) imatinib. However, emerging TKI resistance prevents complete cure. Therefore, alternative strategies targeting regulatory modules of Bcr-Abl in addition to the kinase active site are strongly desirable. Here, we show that an intramolecular interaction between the SH2 and kinase domains in Bcr-Abl is both necessary and sufficient for high catalytic activity of the enzyme. Disruption of this interface led to inhibition of downstream events critical for CML signaling and, importantly, completely abolished leukemia formation in mice. Furthermore, disruption of the SH2-kinase interface increased sensitivity of imatinib-resistant Bcr-Abl mutants to TKI inhibition. An engineered Abl SH2-binding fibronectin type III monobody inhibited Bcr-Abl kinase activity both in vitro and in primary CML cells, where it induced apoptosis. This work validates the SH2-kinase interface as an allosteric target for therapeutic intervention. Copyright © 2011 Elsevier Inc. All rights reserved.

  10. The SH2 domain of Abl kinases regulates kinase autophosphorylation by controlling activation loop accessibility

    Science.gov (United States)

    Lamontanara, Allan Joaquim; Georgeon, Sandrine; Tria, Giancarlo; Svergun, Dmitri I.; Hantschel, Oliver

    2014-11-01

    The activity of protein kinases is regulated by multiple molecular mechanisms, and their disruption is a common driver of oncogenesis. A central and almost universal control element of protein kinase activity is the activation loop that utilizes both conformation and phosphorylation status to determine substrate access. In this study, we use recombinant Abl tyrosine kinases and conformation-specific kinase inhibitors to quantitatively analyse structural changes that occur after Abl activation. Allosteric SH2-kinase domain interactions were previously shown to be essential for the leukemogenesis caused by the Bcr-Abl oncoprotein. We find that these allosteric interactions switch the Abl activation loop from a closed to a fully open conformation. This enables the trans-autophosphorylation of the activation loop and requires prior phosphorylation of the SH2-kinase linker. Disruption of the SH2-kinase interaction abolishes activation loop phosphorylation. Our analysis provides a molecular mechanism for the SH2 domain-dependent activation of Abl that may also regulate other tyrosine kinases.

  11. Molecular dynamics simulations from putative transition states of alpha-spectrin SH3 domain

    NARCIS (Netherlands)

    Periole, Xavier; Vendruscolo, Michele; Mark, Alan E.

    2007-01-01

    A series of molecular dynamics simulations in explicit solvent were started from nine structural models of the transition state of the SH3 domain of alpha-spectrin, which were generated by Lindorff Larsen et al. (Nat Struct Mol Biol 2004;11:443-449) using molecular dynamics simulations in which

  12. On the Performance of Medical Information Retrieval using MeSH Terms – A Survey

    Directory of Open Access Journals (Sweden)

    Swetha S

    2014-09-01

    Full Text Available Internet users have increased everywhere. Searching and retrieving documents is a common thing nowadays. Retrieving related documents from the search engines are difficult task. To retrieve correct documents, knowledge about the search topic is essential. Even though separate search engines are there to retrieve medical documents the users are not familiar with MeSH terms (Medical Subject Heading. So, both the search browser and the MeSH terms have to be integrated to make the search effective and efficient. To implement this integration, SimpleMed and MeSHMed were introduced. The MeSH terms have to be ranked to know how frequently it has been used and to know the importance of the MeSH terms. To rank it a semi – automated tool called MeSHy was developed. The terms were extracted, filtered, ranked and displayed to the user. Classifiers have to be constructed to label the documents as health and non – health. Three strategies were used to classify them. The errors that are commonly done by the users have to be found out. It was calculated based on the queries presented by the user to the search browser.

  13. Plasma physics

    CERN Document Server

    Drummond, James E

    1961-01-01

    A historic snapshot of the field of plasma physics, this fifty-year-old volume offers an edited collection of papers by pioneering experts in the field. In addition to assisting students in their understanding of the foundations of classical plasma physics, it provides a source of historic context for modern physicists. Highly successful upon its initial publication, this book was the standard text on plasma physics throughout the 1960s and 70s.Hailed by Science magazine as a ""well executed venture,"" the three-part treatment ranges from basic plasma theory to magnetohydrodynamics and microwa

  14. Plasma generator

    International Nuclear Information System (INIS)

    Omichi, Takeo; Yamanaka, Toshiyuki.

    1976-01-01

    Object: To recycle a coolant in a sealed hollow portion formed interiorly of a plasma limiter itself to thereby to cause direct contact between the coolant and the plasma limiter and increase of contact area therebetween to cool the plasma limiter. Structure: The heat resulting from plasma generated during operation and applied to the body of the plasma limiter is transmitted to the coolant, which recycles through an inlet and outlet pipe, an inlet and outlet nozzle and a hollow portion to hold the plasma limiter at a level less than a predetermined temperature. On the other hand, the heater wire is, at the time of emergency operation, energized to heat the plasma limiter, but this heat is transmitted to the limiter body to increase the temperature thereof. However, the coolant recycling the hollow portion comes into direct contact with the limiter body, and since the plasma limiter surround the hollow portion, the heat amount transmitted from the limiter body to the coolant increases to sufficiently cool the plasma limiter. (Yoshihara, H.)

  15. Paracrine Maturation and Migration of SH-SY5Y Cells by Dental Pulp Stem Cells.

    Science.gov (United States)

    Gervois, P; Wolfs, E; Dillen, Y; Hilkens, P; Ratajczak, J; Driesen, R B; Vangansewinkel, T; Bronckaers, A; Brône, B; Struys, T; Lambrichts, I

    2017-06-01

    Neurological disorders are characterized by neurodegeneration and/or loss of neuronal function, which cannot be adequately repaired by the host. Therefore, there is need for novel treatment options such as cell-based therapies that aim to salvage or reconstitute the lost tissue or that stimulate host repair. The present study aimed to evaluate the paracrine effects of human dental pulp stem cells (hDPSCs) on the migration and neural maturation of human SH-SY5Y neuroblastoma cells. The hDPSC secretome had a significant chemoattractive effect on SH-SY5Y cells as shown by a transwell assay. To evaluate neural maturation, SH-SY5Y cells were first induced toward neuronal cells, after which they were exposed to the hDPSC secretome. In addition, SH-SY5Y cells subjected to the hDPSC secretome showed increased neuritogenesis compared with nonexposed cells. Maturated cells were shown to increase immune reactivity for neuronal markers compared with controls. Ultrastructurally, retinoic acid (RA) signaling and subsequent exposure to the hDPSC secretome induced a gradual rise in metabolic activity and neuronal features such as multivesicular bodies and cytoskeletal elements associated with cellular communication. In addition, electrophysiological recordings of differentiating cells demonstrated a transition toward a neuronal electrophysiological profile based on the maximum tetrodotoxin (TTX)-sensitive, Na + current. Moreover, conditioned medium (CM)-hDPSC-maturated SH-SY5Y cells developed distinct features including, Cd 2+ -sensitive currents, which suggests that CM-hDPSC-maturated SH-SY5Y acquired voltage-gated Ca 2+ channels. The results reported in this study demonstrate the potential of hDPSCs to support differentiation and recruitment of cells with neuronal precursor characteristics in a paracrine manner. Moreover, this in vitro experimental design showed that the widely used SH-SY5Y cell line can improve and simplify the preclinical in vitro research on the molecular

  16. Three new shRNA expression vectors targeting the CYP3A4 coding sequence to inhibit its expression

    Directory of Open Access Journals (Sweden)

    Siyun Xu

    2014-10-01

    Full Text Available RNA interference (RNAi is useful for selective gene silencing. Cytochrome P450 3A4 (CYP3A4, which metabolizes approximately 50% of drugs in clinical use, plays an important role in drug metabolism. In this study, we aimed to develop a short hairpin RNA (shRNA to modulate CYP3A4 expression. Three new shRNAs (S1, S2 and S3 were designed to target the coding sequence (CDS of CYP3A4, cloned into a shRNA expression vector, and tested in different cells. The mixture of three shRNAs produced optimal reduction (55% in CYP3A4 CDS-luciferase activity in both CHL and HEK293 cells. Endogenous CYP3A4 expression in HepG2 cells was decreased about 50% at both mRNA and protein level after transfection of the mixture of three shRNAs. In contrast, CYP3A5 gene expression was not altered by the shRNAs, supporting the selectivity of CYP3A4 shRNAs. In addition, HepG2 cells transfected with CYP3A4 shRNAs were less sensitive to Ginkgolic acids, whose toxic metabolites are produced by CYP3A4. These results demonstrate that vector-based shRNAs could modulate CYP3A4 expression in cells through their actions on CYP3A4 CDS, and CYP3A4 shRNAs may be utilized to define the role of CYP3A4 in drug metabolism and toxicity.

  17. Functional analysis of SH3 domain containing ring finger 2 during the myogenic differentiation of quail myoblast cells

    Directory of Open Access Journals (Sweden)

    Si Won Kim

    2017-08-01

    Full Text Available Objective Owing to the public availability of complete genome sequences, including avian species, massive bioinformatics analyses may be conducted for computational gene prediction and the identification of gene regulatory networks through various informatics tools. However, to evaluate the biofunctional activity of a predicted target gene, in vivo and in vitro functional genomic analyses should be a prerequisite. Methods Due to a lack of quail genomic sequence information, we first identified the partial genomic structure and sequences of the quail SH3 domain containing ring finger 2 (SH3RF2 gene. Subsequently, SH3RF2 was knocked out using clustered regularly interspaced short palindromic repeat/Cas9 technology and single cell-derived SH3RF2 mutant sublines were established to study the biofunctional activity of SH3RF2 in quail myoblast (QM7 cells during muscle differentiation. Results Through a T7 endonuclease I assay and genotyping analysis, we established an SH3RF2 knockout (KO QM7#4 subline with 61 and 155 nucleotide deletion mutations in SH3RF2. After the induction of myotube differentiation, the expression profiles were analyzed and compared between regular QM7 and SH3RF2 KO QM7#4 cells by global RNA sequencing and bioinformatics analysis. Conclusion We did not detect any statistically significant role of SH3RF2 during myotube differentiation in QM7 myoblast cells. However, additional experiments are necessary to examine the biofunctional activity of SH3RF2 in cell proliferation and muscle growth.

  18. Expression and isotopic labelling of the potassium channel blocker ShK toxin as a thioredoxin fusion protein in bacteria.

    Science.gov (United States)

    Chang, Shih Chieh; Galea, Charles A; Leung, Eleanor W W; Tajhya, Rajeev B; Beeton, Christine; Pennington, Michael W; Norton, Raymond S

    2012-10-01

    The polypeptide toxin ShK is a potent blocker of Kv1.3 potassium channels, which play a crucial role in the activation of human effector memory T-cells (T(EM)). Selective blockers constitute valuable therapeutic leads for the treatment of autoimmune diseases mediated by T(EM) cells, such as multiple sclerosis, rheumatoid arthritis, and type-1 diabetes. We have established a recombinant peptide expression system in order to generate isotopically-labelled ShK and various ShK analogues for in-depth biophysical and pharmacological studies. ShK was expressed as a thioredoxin fusion protein in Escherichia coli BL21 (DE3) cells and purified initially by Ni²⁺ iminodiacetic acid affinity chromatography. The fusion protein was cleaved with enterokinase and purified to homogeneity by reverse-phase HPLC. NMR spectra of ¹⁵N-labelled ShK were similar to those reported previously for the unlabelled synthetic peptide, confirming that recombinant ShK was correctly folded. Recombinant ShK blocked Kv1.3 channels with a K(d) of 25 pM and inhibited the proliferation of human and rat T lymphocytes with a preference for T(EM) cells, with similar potency to synthetic ShK in all assays. This expression system also enables the efficient production of ¹⁵N-labelled ShK for NMR studies of peptide dynamics and of the interaction of ShK with Kv1.3 channels. Copyright © 2012 Elsevier Ltd. All rights reserved.

  19. Novel multiplexed assay for identifying SH2 domain antagonists of STAT family proteins.

    Science.gov (United States)

    Takakuma, Kazuyuki; Ogo, Naohisa; Uehara, Yutaka; Takahashi, Susumu; Miyoshi, Nao; Asai, Akira

    2013-01-01

    Some of the signal transducer and activator of transcription (STAT) family members are constitutively activated in a wide variety of human tumors. The activity of STAT depends on their Src homology 2 (SH2) domain-mediated binding to sequences containing phosphorylated tyrosine. Thus, antagonizing this binding is a feasible approach to inhibiting STAT activation. We have developed a novel multiplexed assay for STAT3- and STAT5b-SH2 binding, based on amplified luminescent proximity homogeneous assay (Alpha) technology. AlphaLISA and AlphaScreen beads were combined in a single-well assay, which allowed the binding of STAT3- and STAT5b-SH2 to phosphotyrosine peptides to be simultaneously monitored. Biotin-labeled recombinant human STAT proteins were obtained as N- and C-terminal deletion mutants. The spacer length of the DIG-labeled peptide, the reaction time, and the concentration of sodium chloride were optimized to establish a HTS system with Z' values of greater than 0.6 for both STAT3- and STAT5b-SH2 binding. We performed a HTS campaign for chemical libraries using this multiplexed assay and identified hit compounds. A 2-chloro-1,4-naphthalenedione derivative, Compound 1, preferentially inhibited STAT3-SH2 binding in vitro, and the nuclear translocation of STAT3 in HeLa cells. Initial structure activity relationship (SAR) studies using the multiplexed assay showed the 3-substituent effect on both the activity and selectivity of STAT3 and STAT5b inhibition. Therefore, this multiplexed assay is useful for not only searching for potential lead compounds but also obtaining SAR data for developing new STAT3/STAT5b inhibitors.

  20. MERTK interactions with SH2-domain proteins in the retinal pigment epithelium.

    Science.gov (United States)

    Shelby, Shameka J; Colwill, Karen; Dhe-Paganon, Sirano; Pawson, Tony; Thompson, Debra A

    2013-01-01

    The receptor tyrosine kinase MERTK plays an essential role in the phagocytic uptake of shed photoreceptor membranes by the retinal pigment epithelium (RPE). A fundamental aspect of signal transduction by receptor tyrosine kinases involves autophosphorylation of tyrosine residues that recruit Src-homology 2 (SH2)-domain proteins to the receptor intracellular domain. The goal of the current study was to evaluate the interactions of human MERTK with SH2-domain proteins present in the RPE. The MERTK intracellular domain was expressed as a 6xHis-fusion protein (6xHis-rMERTK(571-999)), purified and phosphorylated. Ni(2+)-NTA pull downs were performed using 6xHis-rMERTK(571-999) in incubations with recombinant phosphotyrosine-recognition sequences expressed as GST-fusion proteins. In addition, pull downs of native SH2-domain proteins were performed using 6xHis-rMERTK(571-999) and protein homogenates from rat RPE/choroid. For both recombinant and native proteins, western analysis detected MERTK interactions with GRB2, PIK3R1 (P85α), VAV3, and SRC. Immunohistochemical analysis localized each protein to mouse RPE. In cultured RPE-J cells incubated with rod outer segments (OS), siRNA knockdown of Grb2 had no effect on OS binding, but significantly reduced OS uptake. Pik3r1 localized to early phagosomes along with Rab5 and Eea1. Phosphorylation and activation of Src was detected downstream of phagocytosis and Mertk activation. These findings suggest that MERTK signaling in the RPE involves a cohort of SH2-domain proteins with the potential to regulate both cytoskeletal rearrangement and membrane movement. Identification of the SH2-domain signaling partners of MERTK is an important step toward further defining the mechanism of RPE phagocytosis that is central to the function and survival of the retina.

  1. MERTK interactions with SH2-domain proteins in the retinal pigment epithelium.

    Directory of Open Access Journals (Sweden)

    Shameka J Shelby

    Full Text Available The receptor tyrosine kinase MERTK plays an essential role in the phagocytic uptake of shed photoreceptor membranes by the retinal pigment epithelium (RPE. A fundamental aspect of signal transduction by receptor tyrosine kinases involves autophosphorylation of tyrosine residues that recruit Src-homology 2 (SH2-domain proteins to the receptor intracellular domain. The goal of the current study was to evaluate the interactions of human MERTK with SH2-domain proteins present in the RPE. The MERTK intracellular domain was expressed as a 6xHis-fusion protein (6xHis-rMERTK(571-999, purified and phosphorylated. Ni(2+-NTA pull downs were performed using 6xHis-rMERTK(571-999 in incubations with recombinant phosphotyrosine-recognition sequences expressed as GST-fusion proteins. In addition, pull downs of native SH2-domain proteins were performed using 6xHis-rMERTK(571-999 and protein homogenates from rat RPE/choroid. For both recombinant and native proteins, western analysis detected MERTK interactions with GRB2, PIK3R1 (P85α, VAV3, and SRC. Immunohistochemical analysis localized each protein to mouse RPE. In cultured RPE-J cells incubated with rod outer segments (OS, siRNA knockdown of Grb2 had no effect on OS binding, but significantly reduced OS uptake. Pik3r1 localized to early phagosomes along with Rab5 and Eea1. Phosphorylation and activation of Src was detected downstream of phagocytosis and Mertk activation. These findings suggest that MERTK signaling in the RPE involves a cohort of SH2-domain proteins with the potential to regulate both cytoskeletal rearrangement and membrane movement. Identification of the SH2-domain signaling partners of MERTK is an important step toward further defining the mechanism of RPE phagocytosis that is central to the function and survival of the retina.

  2. Quantifying information transfer by protein domains: Analysis of the Fyn SH2 domain structure

    Directory of Open Access Journals (Sweden)

    Serrano Luis

    2008-10-01

    Full Text Available Abstract Background Efficient communication between distant sites within a protein is essential for cooperative biological response. Although often associated with large allosteric movements, more subtle changes in protein dynamics can also induce long-range correlations. However, an appropriate formalism that directly relates protein structural dynamics to information exchange between functional sites is still lacking. Results Here we introduce a method to analyze protein dynamics within the framework of information theory and show that signal transduction within proteins can be considered as a particular instance of communication over a noisy channel. In particular, we analyze the conformational correlations between protein residues and apply the concept of mutual information to quantify information exchange. Mapping out changes of mutual information on the protein structure then allows visualizing how distal communication is achieved. We illustrate the approach by analyzing information transfer by the SH2 domain of Fyn tyrosine kinase, obtained from Monte Carlo dynamics simulations. Our analysis reveals that the Fyn SH2 domain forms a noisy communication channel that couples residues located in the phosphopeptide and specificity binding sites and a number of residues at the other side of the domain near the linkers that connect the SH2 domain to the SH3 and kinase domains. We find that for this particular domain, communication is affected by a series of contiguous residues that connect distal sites by crossing the core of the SH2 domain. Conclusion As a result, our method provides a means to directly map the exchange of biological information on the structure of protein domains, making it clear how binding triggers conformational changes in the protein structure. As such it provides a structural road, next to the existing attempts at sequence level, to predict long-range interactions within protein structures.

  3. Pretreatment of MQA, a caffeoylquinic acid derivative compound, protects against H2O2-induced oxidative stress in SH-SY5Y cells.

    Science.gov (United States)

    Tian, Xing; Gao, Lingyue; An, Li; Jiang, Xiaowen; Bai, Junpeng; Huang, Jian; Meng, Weihong; Zhao, Qingchun

    2016-12-01

    Compound MQA (1,5-O-dicaffeoyl-3-O-[4-malic acid methyl ester]-quinic acid) is a natural caffeoylquinic acid derivative isolated from Arctium lappa L. roots. This study aims to explore the neuroprotective effects of MQA against hydrogen peroxide (H 2 O 2 )-induced oxidative stress in SH-SY5Y neuroblastoma cells. The SH-SY5Y cells were divided into four groups, including control, 20 μM MQA, 200 μM H2O2, 200 μM H2O2 + 20 μM MQA groups. The effects of MQA on H 2 O 2 -induced cell death were measured by MTT and LDH assays. Hoechst 33342 and Annexin V-PI double staining were used to observed H2O2-induced apoptosis. Also, the effects of MQA on antioxidant system and mitochondrial pathway were explored. Further, steady-state phosphorylation levels of ERK1/2, Akt and GSK-3β were examined by Western blot analysis. Pretreatment with MQA prevented cell death in SH-SY5Y cells exposed to 200 μM H2O2 for 3 h. Meanwhile, Hoechst 33342 and Annexin V-PI double staining showed that MQA attenuated H 2 O 2 -induced apoptosis. These changes are related to elevation in SOD activity, reduction in MDA production and ROS formation, and increases in mitochondrial membrane potential (MMP). In addition, the potential mechanisms of MQA against H 2 O 2 -induced apoptosis are associated with increases in the Bcl-2/Bax ratio, decreases in cytochrome c release, caspase-3 and caspase-9 expressions, phosphorylation of ERK1/2, and dephosphorylation of AKT and GSK-3β. These findings suggest that protective effects of MQA against H 2 O 2 -induced apoptosis might be associated with mitochondrial apoptosis, ERK1/2 and AKT/GSK-3β pathway.

  4. Isotope dilution inductively coupled plasma quadrupole mass spectrometry in connection with a chromatographic separation for ultra trace determinations of platinum group elements (Pt, Pd, Ru, Ir) in environmental samples.

    Science.gov (United States)

    Müller, M; Heumann, K G

    2000-09-01

    An isotope dilution inductively coupled plasma quadrupole mass spectrometric (ID-ICP-QMS) method was developed for the simultaneous determination of the platinum group elements Pt, Pd, Ru, and Ir in environmental samples. Spike solutions, enriched with the isotopes 194Pt, 108Pd, 99Ru, and 191Ir, were used for the isotope dilution step. Interfering elements were eliminated by chromatographic separation using an anion-exchange resin. Samples were dissolved with aqua regia in a high pressure asher. Additional dissolution of possible silicate portions by hydrofluoric acid was usually not necessary. Detection limits of 0.15 ng x g(-1), 0.075 ng x g(-1), and 0.015 ng x g(-1) were achieved for Pt, Pd, Ru, and Ir, respectively, using sample weights of only 0.2 g. The reliability of the ID-ICP-QMS method was demonstrated by analyzing a Canadian geological reference material and by participating in an interlaboratory study for the determination of platinum and palladium in a homogenized road dust sample. Surface soil, sampled at different distances from a highway, showed concentrations in the range of 0.1-87 ng x g(-1). An exponential decrease of the platinum and palladium concentration with increasing distance and a small anthropogenic contribution to the natural background concentration of ruthenium and iridium was found in these samples.

  5. Bridge between fusion plasma and plasma processing

    International Nuclear Information System (INIS)

    Ohno, Noriyasu; Takamura, Shuichi

    2008-01-01

    In the present review, relationship between fusion plasma and processing plasma is discussed. From boundary-plasma studies in fusion devices new applications such as high-density plasma sources, erosion of graphite in a hydrogen plasma, formation of helium bubbles in high-melting-point metals and the use of toroidal plasmas for plasma processing are emerging. The authors would like to discuss a possibility of knowledge transfer from fusion plasmas to processing plasmas. (T. Ikehata)

  6. Plasma waves

    National Research Council Canada - National Science Library

    Swanson, D. G

    1989-01-01

    ... Swanson, D.G. (Donald Gary), D a t e - Plasma waves. Bibliography: p. Includes index. 1. Plasma waves. QC718.5.W3S43 1989 ISBN 0-12-678955-X I. Title. 530.4'4 88-34388 Printed in the United Sta...

  7. Plasma properties

    International Nuclear Information System (INIS)

    Weitzner, H.

    1991-06-01

    The Magneto-Fluid Dynamics Division continues to study a broad range of problems originating in plasma physics. Its principal focus is fusion plasma physics, and most particularly topics of particular significance for the world magnetic fusion program. During the calendar year 1990 we explored a wide range of topics including RF-induced transport as a plasma control mechanism, edge plasma modelling, further statistical analysis of L and H mode tokamak plasmas, antenna design, simulation of the edge of a tokamak plasma and the L-H transition, interpretation of the CCT experimental results at UCLA, turbulent transport, studies in chaos, the validity of moment approximations to kinetic equations and improved neoclassical modelling. In more basic studies we examined the statistical mechanisms of Coulomb systems and applied plasma ballooning mode theory to conventional fluids in order to obtain novel fluid dynamics stability results. In space plasma physics we examined the problem of reconnection, the effect of Alfven waves in space environments, and correct formulation of boundary conditions of the Earth for waves in the ionosphere

  8. Plasma container

    International Nuclear Information System (INIS)

    Ebisawa, Katsuyuki.

    1985-01-01

    Purpose: To enable to easily detect that the thickness of material to be abraded is reduced to an allowable limit from the outerside of the plasma container even during usual operation in a plasma vessel for a thermonuclear device. Constitution: A labelled material is disposed to the inside or rear face of constituent members of a plasma container undergoing the irradiation of plasma particles. A limiter plate to be abraded in the plasma container is composed of an armour member and heat removing plate, in which the armour member is made of graphite and heat-removing plate is made of copper. If the armour member is continuously abraded under the effect of sputtering due to plasma particles, silicon nitride embedded so far in the graphite at last appears on the surface of the limiter plate to undergo the impact shocks of the plasma particles. Accordingly, abrasion of the limiter material can be detected by a detector comprising gas chromatography and it can easily be detected from the outside of the plasma content even during normal operation. (Horiuchi, T.)

  9. Cosmic plasma

    Energy Technology Data Exchange (ETDEWEB)

    Alfven, H [California Univ., San Diego, La Jolla (USA)

    1981-01-01

    The properties of space plasmas are analyzed, based on laboratory results and data obtained by in situ measurements in the magnetosphere (including the heliosphere). Attention is given to the question of how much knowledge can be gained by a systematic comparison of different regions of plasma, and plasmas are considered with linear dimensions varying from laboratory size up to the Hubble distance. The traditional magnetic field description of plasmas is supplemented by an electric current description and it is demonstrated that many problems are easier to understand with a dualistic approach. Using the general plasma properties obtained, the origin and evolution of the solar system is summarized and the evolution and present structure of the universe (cosmology) is discussed.

  10. Plasma device

    International Nuclear Information System (INIS)

    Thode, L.E.

    1981-01-01

    A relativistic electron beam generator or accelerator produces a high-voltage electron beam which is modulated to initiate electron bunching within the beam which is then applied to a high-density target plasma which typically comprises DT, DD, or similar thermonuclear gas at a density of 10 17 to 10 20 electrons per cubic centimeter. As a result, relativistic streaming instabilities are initiated within the high-density target plasma causing the relativistic electron beam to efficiently deposit its energy into a small localized region of the high-density plasma target. The high-temperature plasma can be used to heat a high Z material to generate radiation. Alternatively, a tunable radiation source is produced by using a moderate Z gas or a mixture of high Z and low Z gas as the target plasma. (author)

  11. Partial Correction of Psoriasis upon Genetic Knock-Down of Human TNF-α by Lentivirus-Encoded shRNAs in a Xenograft Mouse Model

    DEFF Research Database (Denmark)

    Jakobsen, Maria; Stenderup, Karin; Rosada, Cecilia

    samples treated with irrelevant shRNAs, were selected and cloned into lentiviral vectors. The lentiviral vectors expressing TNF- shRNAs were used to transduce HEK-293 cells and verify vector-derived knock-down of stable TNF- expression in vitro. The most efficient TNF- -directed shRNA, which in cell lines...

  12. Protein flexibility and ligand rigidity : a thermodynamic and kinetic study of ITAM-based ligand binding to Syk tandem SH2

    NARCIS (Netherlands)

    de Mol, Nico J; Catalina, M Isabel; Dekker, Frank J; Fischer, Marcel J E; Heck, Albert J R; Liskamp, Rob M J; Dekker, Frank

    2005-01-01

    The Syk tandem Src homology 2 domain (Syk tSH2) constitutes a flexible protein module involved in the regulation of Syk kinase activity. The Syk tSH2 domain is assumed to function by adapting the distance between its two SH2 domains upon bivalent binding to diphosphotyrosine ligands. A thermodynamic

  13. Superconducting plasmas

    International Nuclear Information System (INIS)

    Ohnuma, Toshiro; Ohno, J.

    1994-01-01

    Superconducting (SC) plasmas are proposed and investigated. The SC plasmas are not yet familiar and have not yet been studied. However, the existence and the importance of SC plasmas are stressed in this report. The existence of SC plasmas are found as follows. There is a fundamental property of Meissner effect in superconductors, which shows a repulsive effect of magnetic fields. Even in that case, in a microscopic view, there is a region of magnetic penetration. The penetration length λ is well-known as London's penetration depth, which is expressed as δ = (m s /μ 0 n s q s 2 ) 1/2 where m s , n s , q s and μ o show the mass, the density, the charge of SC electron and the permeability in free space, respectively. Because this expression is very simple, no one had tried it into more simple and meaningful form. Recently, one of the authors (T.O.) has found that the length can be expressed into more simple and understandable fundamental form as λ = c/ω ps where c = (ε 0 μ 0 ) -1/2 and ω ps = (n s q s 2 /m s ε 0 ) 1/2 are the light velocity and the superconducting plasma frequency. From this simple expression, the penetration depth of the magnetic field to SC is found as a SC plasma skin depth, that is, the fundamental property of SC can be expressed by the SC plasmas. This discovery indicates an importance of the studies of superconducting plasmas. From these points, several properties (propagating modes et al) of SC plasmas, which consist of SC electrons, normal electrons and lattice ions, are investigated in this report. Observations of SC plasma frequency is also reported with a use of Terahertz electromagnet-optical waves

  14. Plasma theory and simulation research

    International Nuclear Information System (INIS)

    Birdsall, C.K.

    1989-01-01

    Our research group uses both theory and simulation as tools in order to increase the understanding of instabilities, heating, diffusion, transport and other phenomena in plasmas. We also work on the improvement of simulation, both theoretically and practically. Our focus has been more and more on the plasma edge (the ''sheath''), interactions with boundaries, leading to simulations of whole devices (someday a numerical tokamak)

  15. A novel disulfide bond in the SH2 Domain of the C-terminal Src kinase controls catalytic activity.

    Science.gov (United States)

    Mills, Jamie E; Whitford, Paul C; Shaffer, Jennifer; Onuchic, Jose N; Adams, Joseph A; Jennings, Patricia A

    2007-02-02

    The SH2 domain of the C-terminal Src kinase [Csk] contains a unique disulfide bond that is not present in other known SH2 domains. To investigate whether this unusual disulfide bond serves a novel function, the effects of disulfide bond formation on catalytic activity of the full-length protein and on the structure of the SH2 domain were investigated. The kinase activity of full-length Csk decreases by an order of magnitude upon formation of the disulfide bond in the distal SH2 domain. NMR spectra of the fully oxidized and fully reduced SH2 domains exhibit similar chemical shift patterns and are indicative of similar, well-defined tertiary structures. The solvent-accessible disulfide bond in the isolated SH2 domain is highly stable and far from the small lobe of the kinase domain. However, reduction of this bond results in chemical shift changes of resonances that map to a cluster of residues that extend from the disulfide bond across the molecule to a surface that is in direct contact with the small lobe of the kinase domain in the intact molecule. Normal mode analyses and molecular dynamics calculations suggest that disulfide bond formation has large effects on residues within the kinase domain, most notably within the active-site cleft. Overall, the data indicate that reversible cross-linking of two cysteine residues in the SH2 domain greatly impacts catalytic function and interdomain communication in Csk.

  16. Giant-Planet Chemistry: Ammonium Hydrosulfide (NH4SH), Its IR Spectra and Thermal and Radiolytic Stabilities

    Science.gov (United States)

    Loeffler, Mark J.; Hudson, Reggie L.; Chanover, Nancy J.; Simon, Amy A.

    2015-01-01

    Here we present our recent studies of proton-irradiated and unirradiated ammonium hydrosulfide, NH4SH, a compound predicted to be an important tropospheric cloud component of Jupiter and other giant planets. We irradiated both crystalline and amorphous NH4SH at 10-160 K and used IR spectroscopy to observe and identify reaction products in the ice, specifically NH3 and long-chained sulfur-containing ions. Crystalline NH4SH was amorphized during irradiation at all temperatures studied with the rate being the fastest at the lowest temperatures. Irradiation of amorphous NH4SH at approximately 10-75 K showed that 60-80% of the NH4 + remained when equilibrium was reached, and that NH4SH destruction rates were relatively constant within this temperature range. Irradiations at higher temperatures produced different dose dependence and were accompanied by pressure outbursts that, in some cases, fractured the ice. The thermal stability of irradiated NH4SH was found to be greater than that of unirradiated NH4SH, suggesting that an irradiated giant-planet cloud precipitate can exist at temperatures and altitudes not previously considered.

  17. Suppression of human breast tumors in NOD/SCID mice by CD44 shRNA gene therapy combined with doxorubicin treatment

    Directory of Open Access Journals (Sweden)

    Pham PV

    2012-05-01

    Full Text Available Phuc Van Pham1, Ngoc Bich Vu1, Thuy Thanh Duong1, Tam Thanh Nguyen1, Nhung Hai Truong1, Nhan Lu Chinh Phan1, Tue Gia Vuong1, Viet Quoc Pham1, Hoang Minh Nguyen1, Kha The Nguyen1, Nhung Thi Nguyen1, Khue Gia Nguyen1, Lam Tan Khat1, Dong Van Le2, Kiet Dinh Truong1, Ngoc Kim Phan11Laboratory of Stem Cell Research and Application, University of Science, Vietnam National University, HCM City, 2Military Medical University, Ha Noi, VietnamBackground: Breast cancer stem cells with a CD44+CD24- phenotype are the origin of breast tumors. Strong CD44 expression in this population indicates its important role in maintaining the stem cell phenotype. Previous studies show that CD44 down-regulation causes CD44+CD24- breast cancer stem cells to differentiate into non-stem cells that are sensitive to antitumor drugs and lose many characteristics of the original cells. In this study, we determined tumor suppression in non-obese severe combined immunodeficiency mice using CD44 shRNA therapy combined with doxorubicin treatment.Methods: Tumor-bearing non-obese severe combined immunodeficiency mice were established by injection of CD44+CD24- cells. To track CD44+CD24- cells, green fluorescence protein was stably transduced using a lentiviral vector prior to injection into mice. The amount of CD44 shRNA lentiviral vector used for transduction was based on CD44 down-regulation by in vitro CD44 shRNA transduction. Mice were treated with direct injection of CD44 shRNA lentiviral vector into tumors followed by doxorubicin administration after 48 hours. The effect was evaluated by changes in the size and weight of tumors compared with that of the control.Results: The combination of CD44 down-regulation and doxorubicin strongly suppressed tumor growth with significant differences in tumor sizes and weights compared with that of CD44 down-regulation or doxorubicin treatment alone. In the combination of CD44 down-regulation and doxorubicin group, the tumor weight was

  18. 10th International Conference and School on Plasma Physics and Controlled Fusion. Book of Abstracts

    International Nuclear Information System (INIS)

    Anon

    2004-01-01

    About 240 abstracts by Ukrainian and foreign authors submitted to 10-th International Conference and School on Plasma Physics and Controlled fusion have been considered by Conference Program Committee members. All the abstracts have been divided into 8 groups: magnetic confinement systems: stellarators, tokamaks, alternative conceptions; ITER and Fusion reactor aspects; basic plasma physics; space plasma; plasma dynamics and plasma-wall interaction; plasma electronics; low temperature plasma and plasma technologies; plasma diagnostics

  19. Loss of Sh3gl2/Endophilin A1 Is a Common Event in Urothelial Carcinoma that Promotes Malignant Behavior

    Directory of Open Access Journals (Sweden)

    Shyama Majumdar

    2013-07-01

    Full Text Available Urothelial carcinoma (UC causes substantial morbidity and mortality worldwide. However, the molecular mechanisms underlying urothelial cancer development and tumor progression are still largely unknown. Using informatics analysis, we identified Sh3gl2 (endophilin A1 as a bladder urothelium-enriched transcript. The gene encoding Sh3gl2 is located on chromosome 9p, a region frequently altered in UC. Sh3gl2 is known to regulate endocytosis of receptor tyrosine kinases implicated in oncogenesis, such as the epidermal growth factor receptor (EGFR and c-Met. However, its role in UC pathogenesis is unknown. Informatics analysis of expression profiles as well as immunohistochemical staining of tissue microarrays revealed Sh3gl2 expression to be decreased in UC specimens compared to nontumor tissues. Loss of Sh3gl2 was associated with increasing tumor grade and with muscle invasion, which is a reliable predictor of metastatic disease and cancer-derived mortality. Sh3gl2 expression was undetectable in 19 of 20 human UC cell lines but preserved in the low-grade cell line RT4. Stable silencing of Sh3gl2 in RT4 cells by RNA interference 1 enhanced proliferation and colony formation in vitro, 2 inhibited EGF-induced EGFR internalization and increased EGFR activation, 3 stimulated phosphorylation of Src family kinases and STAT3, and 4 promoted growth of RT4 xenografts in subrenal capsule tissue recombination experiments. Conversely, forced re-expression of Sh3gl2 in T24 cells and silenced RT4 clones attenuated oncogenic behaviors, including growth and migration. Together, these findings identify loss of Sh3gl2 as a frequent event in UC development that promotes disease progression.

  20. Plasma universe

    International Nuclear Information System (INIS)

    Alfven, H.

    1986-04-01

    Traditionally the views in our cosmic environment have been based on observations in the visual octave of the electromagnetic spectrum, during the last half-century supplemented by infrared and radio observations. Space research has opened the full spectrum. Of special importance are the X-ray-gamma-ray regions, in which a number of unexpected phenomena have been discovered. Radiations in these regions are likely to originate mainly from magnetised cosmic plasma. Such a medium may also emit synchrotron radiation which is observable in the radio region. If we try to base a model of the universe on the plasma phenomena mentioned we find that the plasma universe is drastically different from the traditional visual universe. Information about the plasma universe can also be obtained by extrapolation of laboratory experiments and magnetospheric in situ measurements of plasma. This approach is possible because it is likely that the basic properties of plasma are the same everywhere. In order to test the usefulness of the plasma universe model we apply it to cosmogony. Such an approach seems to be rather successful. For example, the complicated structure of the Saturnian C ring can be accounted for. It is possible to reconstruct certain phenomena 4-5 bilions years ago with an accuracy of better than 1 percent

  1. Improving MeSH classification of biomedical articles using citation contexts.

    Science.gov (United States)

    Aljaber, Bader; Martinez, David; Stokes, Nicola; Bailey, James

    2011-10-01

    Medical Subject Headings (MeSH) are used to index the majority of databases generated by the National Library of Medicine. Essentially, MeSH terms are designed to make information, such as scientific articles, more retrievable and assessable to users of systems such as PubMed. This paper proposes a novel method for automating the assignment of biomedical publications with MeSH terms that takes advantage of citation references to these publications. Our findings show that analysing the citation references that point to a document can provide a useful source of terms that are not present in the document. The use of these citation contexts, as they are known, can thus help to provide a richer document feature representation, which in turn can help improve text mining and information retrieval applications, in our case MeSH term classification. In this paper, we also explore new methods of selecting and utilising citation contexts. In particular, we assess the effect of weighting the importance of citation terms (found in the citation contexts) according to two aspects: (i) the section of the paper they appear in and (ii) their distance to the citation marker. We conduct intrinsic and extrinsic evaluations of citation term quality. For the intrinsic evaluation, we rely on the UMLS Metathesaurus conceptual database to explore the semantic characteristics of the mined citation terms. We also analyse the "informativeness" of these terms using a class-entropy measure. For the extrinsic evaluation, we run a series of automatic document classification experiments over MeSH terms. Our experimental evaluation shows that citation contexts contain terms that are related to the original document, and that the integration of this knowledge results in better classification performance compared to two state-of-the-art MeSH classification systems: MeSHUP and MTI. Our experiments also demonstrate that the consideration of Section and Distance factors can lead to statistically

  2. Plasma physics

    International Nuclear Information System (INIS)

    1979-01-01

    This report contains the papers delivered at the AEB - Natal University summer school on plasma physics held in Durban during January 1979. The following topics were discussed: Tokamak devices; MHD stability; trapped particles in tori; Tokamak results and experiments; operating regime of the AEB Tokamak; Tokamak equilibrium; high beta Tokamak equilibria; ideal Tokamak stability; resistive MHD instabilities; Tokamak diagnostics; Tokamak control and data acquisition; feedback control of Tokamaks; heating and refuelling; neutral beam injection; radio frequency heating; nonlinear drift wave induced plasma transport; toroidal plasma boundary layers; microinstabilities and injected beams and quasilinear theory of the ion acoustic instability

  3. Plasma centrifuge

    International Nuclear Information System (INIS)

    Ikehata, Takashi; Mase, Hiroshi

    1998-01-01

    The plasma centrifuge is one of statistical isotope separation processes which uses the centrifugal force of a J x B driven rotating plasma in a magnetic field to give rise to the mass-dependent radial transport of isotopic ions. The system has been developed as an alternative to the gas centrifuge because a much higher rotational velocity and separation factor have been achieved. In this review, the physical aspects of the plasma centrifuge followed by the recent experimental achievements are described, especially in comparison with the gas centrifuge. (author)

  4. Morphological Differentiation Towards Neuronal Phenotype of SH-SY5Y Neuroblastoma Cells by Estradiol, Retinoic Acid and Cholesterol

    OpenAIRE

    Teppola, Heidi; Sarkanen, Jertta-Riina; Jalonen, Tuula O.; Linne, Marja-Leena

    2015-01-01

    Human SH-SY5Y neuroblastoma cells maintain their potential for differentiation and regression in culture conditions. The induction of differentiation could serve as a strategy to inhibit cell proliferation and tumor growth. Previous studies have shown that differentiation of SH-SY5Y cells can be induced by all-trans-retinoic-acid (RA) and cholesterol (CHOL). However, signaling pathways that lead to terminal differentiation of SH-SY5Y cells are still largely unknown. The goal of this study was...

  5. Morphological Differentiation Towards Neuronal Phenotype of SH-SY5Y Neuroblastoma Cells by Estradiol, Retinoic Acid and Cholesterol

    OpenAIRE

    Teppola, Heidi; Sarkanen, Jertta-Riina; Jalonen, Tuula; Linne, Marja-Leena

    2016-01-01

    Human SH-SY5Y neuroblastoma cells maintain their potential for differentiation and regression in culture conditions. The induction of differentiation could serve as a strategy to inhibit cell proliferation and tumor growth. Previous studies have shown that differentiation of SH-SY5Y cells can be induced by all-trans-retinoic-acid (RA) and cholesterol (CHOL). However, signaling pathways that lead to terminal differentiation of SH-SY5Y cells are still largely unknown. The goal of this study was...

  6. Interactions of polyomavirus middle T with the SH2 domains of the pp85 subunit of phosphatidylinositol-3-kinase.

    OpenAIRE

    Yoakim, M; Hou, W; Liu, Y; Carpenter, C L; Kapeller, R; Schaffhausen, B S

    1992-01-01

    The binding of phosphatidylinositol-3-kinase to the polyomavirus middle T antigen is facilitated by tyrosine phosphorylation of middle T on residue 315. The pp85 subunit of phosphatidylinositol-3-kinase contains two SH2 domains, one in the middle of the molecule and one at the C terminus. When assayed by blotting with phosphorylated middle T, the more N-terminal SH2 domain is responsible for binding to middle T. When assayed in solution with glutathione S transferase fusions, both SH2s are ca...

  7. Intramolecular dynamics within the N-Cap-SH3-SH2 regulatory unit of the c-Abl tyrosine kinase reveal targeting to the cellular membrane.

    Science.gov (United States)

    de Oliveira, Guilherme A P; Pereira, Elen G; Ferretti, Giulia D S; Valente, Ana Paula; Cordeiro, Yraima; Silva, Jerson L

    2013-09-27

    c-Abl is a key regulator of cell signaling and is under strict control via intramolecular interactions. In this study, we address changes in the intramolecular dynamics coupling within the c-Abl regulatory unit by presenting its N-terminal segment (N-Cap) with an alternative function in the cell as c-Abl becomes activated. Using small angle x-ray scattering, nuclear magnetic resonance, and confocal microscopy, we demonstrate that the N-Cap and the Src homology (SH) 3 domain acquire μs-ms motions upon N-Cap association with the SH2-L domain, revealing a stabilizing synergy between these segments. The N-Cap-myristoyl tether likely triggers the protein to anchor to the membrane because of these flip-flop dynamics, which occur in the μs-ms time range. This segment not only presents the myristate during c-Abl inhibition but may also trigger protein localization inside the cell in a functional and stability-dependent mechanism that is lost in Bcr-Abl(+) cells, which underlie chronic myeloid leukemia. This loss of intramolecular dynamics and binding to the cellular membrane is a potential therapeutic target.

  8. Determination of platinum group elements and gold in reference materials by instrumental neutron activation analysis and inductively coupled plasma-mass spectrometry with nickel sulphide fire-assay collection

    International Nuclear Information System (INIS)

    Morcelli, C.P.R.; Figueiredo, A.M.G.; Sarkis, J.E.S.; Kakazu, M.; Enzweiler, J.

    2002-01-01

    Instrumental Neutron Activation Analysis (INAA) and Inductively Coupled Plasma-Mass Spectrometry (ICP-MS) after NiS fire assay were used to determine platinum group elements (PGE) and Au in the geological reference materials peridotite GPt-3 and pyroxene peridotite GPt-4 (IGGE, China). INAA has been one of the most useful analytical techniques for PGEs and Au determination, due to its high sensitivity and accuracy. After the fire assay, the NiS button is dissolved in concentrated hydrochloric acid, leaving a residue of insoluble PGE sulphides; the solution is filtered and the filter is directly irradiated with neutrons. In more recent years, ICP-MS with nickel fire assay collection and tellurium coprecipitation has been used as a mean of analysing PGE, with the main advantage of avoiding problems of losses of PGE during the HCl digestion of the NiS button. Buttons were prepared by mixing the sample (10-15 g) with fluxes, nickel and sulphur in a fire clay crucible and fused at temperatures around 1000 deg C. For NAA, the filters containing the PGEs and Au were irradiated at the IEA-R1 research nuclear reactor at IPEN. The measurements of the induced gamma-ray activity were carried out in an hyperpure Ge detector. In general, the results obtained by the two techniques were in good agreement with recommended values. INAA results exhibited higher values than the recommended values for Pd and Pt in GPt-3, while the opposite effect was observed for GPt-4 sample. Ru was not detected by INAA. On the other hand, Rh and Ir were determined more accurately by INAA (relative errors better than 10%). The ICP-MS analytical technique showed better detection limits, and all the PGE were determined. Results obtained for Pt and Pd presented accuracy better than 5% while losses were observed for Os and Ir. (author)

  9. SH2-Balpha is an insulin-receptor adapter protein and substrate that interacts with the activation loop of the insulin-receptor kinase.

    OpenAIRE

    Kotani, K; Wilden, P; Pillay, T S

    1998-01-01

    We identified SH2-Balpha as an insulin-receptor-binding protein based on interaction screening in yeast hybrid systems and co-precipitation in cells. SH2-Balpha contains pleckstrin-homology ('PH') and Src homology 2 (SH2) domains and is closely related to APS (adapter protein with a PH domain and an SH2 domain) and lnk, adapter proteins first identified in lymphocytes. SH2-Balpha is ubiquitously expressed and is present in rat epididymal adipose tissue, liver and skeletal muscle, physiologica...

  10. Plasma Cleaning

    Science.gov (United States)

    Hintze, Paul E.

    2016-01-01

    NASA's Kennedy Space Center has developed two solvent-free precision cleaning techniques: plasma cleaning and supercritical carbon dioxide (SCCO2), that has equal performance, cost parity, and no environmental liability, as compared to existing solvent cleaning methods.

  11. Laser Plasmas

    Indian Academy of Sciences (India)

    -focusing in a plasma ... Center for Energy Studies, Indian Institute of Technology, New Delhi 110 016, India; Tata Consultancy Services, Gurgaon, India; Ideal Institute of Technology, Ghaziabad, India; Center for Research in Cognitive, ...

  12. Plasma will…

    Czech Academy of Sciences Publication Activity Database

    Lunov, Oleg

    2016-01-01

    Roč. 174, č. 3 (2016), s. 486-487 ISSN 0007-0963 Institutional support: RVO:68378271 Keywords : plasma * ionized gas Subject RIV: BO - Biophysics OBOR OECD: Biophysics Impact factor: 4.706, year: 2016

  13. Plasma technology

    International Nuclear Information System (INIS)

    Drouet, M.G.

    1984-03-01

    IREQ was contracted by the Canadian Electrical Association to review plasma technology and assess the potential for application of this technology in Canada. A team of experts in the various aspects of this technology was assembled and each team member was asked to contribute to this report on the applications of plasma pertinent to his or her particular field of expertise. The following areas were examined in detail: iron, steel and strategic-metals production; surface treatment by spraying; welding and cutting; chemical processing; drying; and low-temperature treatment. A large market for the penetration of electricity has been identified. To build up confidence in the technology, support should be provided for selected R and D projects, plasma torch demonstrations at full power, and large-scale plasma process testing

  14. Suppression of IL-6 Gene by shRNA Augments Gemcitabine Chemosensitization in Pancreatic Adenocarcinoma Cells

    Directory of Open Access Journals (Sweden)

    Hai-Bo Xing

    2018-01-01

    Full Text Available Pancreatic adenocarcinoma has an exceedingly poor prognosis, accounting for five-year survival of less than 5%. Presently, improving the efficacy of pancreatic adenocarcinoma treatment has been the focus of medical researchers worldwide. Recently, it has been suggested that deregulation of interleukin- (IL- 6 is caused by a key gene involved in the beginning and development of pancreatic adenocarcinoma. Herein, we investigated whether suppression of IL-6 could augment gemcitabine sensitivity in the PANC-1 cells. We found considerably higher expression of IL-6 in pancreatic adenocarcinoma tissues than that in the adjacent nontumorous tissues. Suppression of IL-6 by shRNA resulted in apoptosis as well as inhibition of cell proliferation and tumorigenicity. In addition, suppression of IL-6 remarkably promoted antitumor effect of gemcitabine, indicating that the combination of shRNA targeting IL-6 with gemcitabine may provide a potential clinical approach for pancreatic cancer therapy.

  15. Quantifying information transfer by protein domains: Analysis of the Fyn SH2 domain structure

    DEFF Research Database (Denmark)

    Lenaerts, Tom; Ferkinghoff-Borg, Jesper; Stricher, Francois

    2008-01-01

    instance of communication over a noisy channel. In particular, we analyze the conformational correlations between protein residues and apply the concept of mutual information to quantify information exchange. Mapping out changes of mutual information on the protein structure then allows visualizing how...... distal communication is achieved. We illustrate the approach by analyzing information transfer by the SH2 domain of Fyn tyrosine kinase, obtained from Monte Carlo dynamics simulations. Our analysis reveals that the Fyn SH2 domain forms a noisy communication channel that couples residues located......Background: Efficient communication between distant sites within a protein is essential for cooperative biological response. Although often associated with large allosteric movements, more subtle changes in protein dynamics can also induce long-range correlations. However, an appropriate formalism...

  16. El medio interestelar en los alrededores de la region HII Sh2-183

    Science.gov (United States)

    Cichowolski, S.; Cappa, C. E.; Blanco, A.; Eppens, L.; Ertini, K.; Leiva, M. M.

    2017-10-01

    We present a multiwavelength study of the HII region Sh2-183, located at (,) = (123.3,+3.0) at a distance of 7.0 1.5 kpc from the Sun. Based on the radio continuum data we estimated the amount of ionized gas, the electronic density, and the number of ionizing photons needed to keep the region ionized, which is important since the star/s responsible of the region was/were not detected yet. On the other hand, based on IRAS data we have analyzed the dust temperature and distribution. The Hi line data allowed the detection of a shell-like structure surrounding the ionized gas and the CO data revealed the presence of 6 molecular clouds probably related to Sh2-183, which harbor several young stellar object candidates.

  17. Desiderata for an authoritative Representation of MeSH in RDF.

    Science.gov (United States)

    Winnenburg, Rainer; Bodenreider, Olivier

    2014-01-01

    The Semantic Web provides a framework for the integration of resources on the web, which facilitates information integration and interoperability. RDF is the main representation format for Linked Open Data (LOD). However, datasets are not always made available in RDF by their producers and the Semantic Web community has had to convert some of these datasets to RDF in order for these datasets to participate in the LOD cloud. As a result, the LOD cloud sometimes contains outdated, partial and even inaccurate RDF datasets. We review the LOD landscape for one of these resources, MeSH, and analyze the characteristics of six existing representations in order to identify desirable features for an authoritative version, for which we create a prototype. We illustrate the suitability of this prototype on three common use cases. NLM intends to release an authoritative representation of MeSH in RDF (beta version) in the Fall of 2014.

  18. Plasma metallization

    International Nuclear Information System (INIS)

    Crowther, J.M.

    1997-09-01

    Many methods are currently used for the production of thin metal films. However, all of these have drawbacks associated with them, for example the need for UHV conditions, high temperatures, exotic metal precursors, or the inability to coat complex shaped objects. Reduction of supported metal salts by non-isothermal plasma treatment does not suffer from these drawbacks. In order to produce and analyse metal films before they become contaminated, a plasma chamber which could be attached directly to a UHV chamber with XPS capability was designed and built. This allowed plasma treatment of supported metal salts and surface analysis by XPS to be performed without exposure of the metal film to the atmosphere. Non-equilibrium plasma treatment of Nylon 66 supported gold(lll) chloride using hydrogen as the feed gas resulted in a 95% pure gold film, the remaining 5% of the film being carbon. If argon or helium were used as the feed gases during plasma treatment the resultant gold films were 100% pure. Some degree of surface contamination of the films due to plasma treatment was observed but was easily removed by argon ion cleaning. Hydrogen plasma reduction of glass supported silver(l) nitrate and palladium(ll) acetate films reveals that this metallization technique is applicable to a wide variety of metal salts and supports, and has also shown the ability of plasma reduction to retain the complex 'fern-like' structures seen for spin coated silver(l) nitrate layers. Some metal salts are susceptible to decomposition by X-rays. The reduction of Nylon 66 supported gold(lll) chloride films by soft X-rays to produce nanoscopic gold particles has been studied. The spontaneous reduction of these X-ray irradiated support gold(lll) chloride films on exposure to the atmosphere to produce gold rich metallic films has also been reported. (author)

  19. Plasma confinement

    CERN Document Server

    Hazeltine, R D

    2003-01-01

    Detailed and authoritative, this volume examines the essential physics underlying international research in magnetic confinement fusion. It offers readable, thorough accounts of the fundamental concepts behind methods of confining plasma at or near thermonuclear conditions. Designed for a one- or two-semester graduate-level course in plasma physics, it also represents a valuable reference for professional physicists in controlled fusion and related disciplines.

  20. Plasma Diagnostics

    Energy Technology Data Exchange (ETDEWEB)

    Zaveryaev, V [Kurchatov Institute, Moscow (Russian Federation); others, and

    2012-09-15

    The success in achieving peaceful fusion power depends on the ability to control a high temperature plasma, which is an object with unique properties, possibly the most complicated object created by humans. Over years of fusion research a new branch of science has been created, namely plasma diagnostics, which involves knowledge of almost all fields of physics, from electromagnetism to nuclear physics, and up-to-date progress in engineering and technology (materials, electronics, mathematical methods of data treatment). Historically, work on controlled fusion started with pulsed systems and accordingly the methods of plasma parameter measurement were first developed for short lived and dense plasmas. Magnetically confined hot plasmas require the creation of special experimental techniques for diagnostics. The diagnostic set is the most scientifically intensive part of a plasma device. During many years of research operation some scientific tasks have been solved while new ones arose. New tasks often require significant changes in the diagnostic system, which is thus a very flexible part of plasma machines. Diagnostic systems are designed to solve several tasks. As an example here are the diagnostic tasks for the International Thermonuclear Experimental Reactor - ITER: (1) Measurements for machine protection and basic control; (2) Measurements for advanced control; (3) Additional measurements for performance evaluation and physics. Every new plasma machine is a further step along the path to the main goal - controlled fusion - and nobody knows in advance what new phenomena will be met on the way. So in the planning of diagnostic construction we should keep in mind further system upgrading to meet possible new scientific and technical challenges. (author)

  1. Nature of the three-electron bond in H2S∴SH2+

    NARCIS (Netherlands)

    Bickelhaupt, F. Matthias; Diefenbach, Axel; De Visser, Sam P.; De Koning, Leo J.; Nibbering, Nico M.M.

    1998-01-01

    We have investigated the model system H2S∴-SH2+, i.e., the sulfur-sulfur bound dimer radical cation of H2S, using both density functional theory (LDA, BP86, PW91) and traditional ab initio theory (up to CCSD-(T)). Our purpose is to better understand the nature of the three-electron bond. The S-S

  2. SNJ-1945, a calpain inhibitor, protects SH-SY5Y cells against MPP+ and rotenone

    OpenAIRE

    Knaryan, Varduhi H.; Samantaray, Supriti; Sookyoung, Park; Azuma, Mitsuyoshi; Inoue, Jun; Banik, Naren L.

    2013-01-01

    Complex pathophysiology of Parkinson’s disease (PD) involves multiple CNS cell types. Degeneration in spinal cord neurons alongside brain has been shown to be involved in PD and evidenced in experimental parkinsonism. However, the mechanisms of these degenerative pathways are not well understood. In order to unravel these mechanisms SH-SY5Y neuroblastoma cells were differentiated into dopaminergic and cholinergic phenotypes respectively and used as cell culture model following exposure to two...

  3. Regulation of lifespan, metabolism, and stress responses by the Drosophila SH2B protein, Lnk.

    Directory of Open Access Journals (Sweden)

    Cathy Slack

    2010-03-01

    Full Text Available Drosophila Lnk is the single ancestral orthologue of a highly conserved family of structurally-related intracellular adaptor proteins, the SH2B proteins. As adaptors, they lack catalytic activity but contain several protein-protein interaction domains, thus playing a critical role in signal transduction from receptor tyrosine kinases to form protein networks. Physiological studies of SH2B function in mammals have produced conflicting data. However, a recent study in Drosophila has shown that Lnk is an important regulator of the insulin/insulin-like growth factor (IGF-1 signaling (IIS pathway during growth, functioning in parallel to the insulin receptor substrate, Chico. As this pathway also has an evolutionary conserved role in the determination of organism lifespan, we investigated whether Lnk is required for normal lifespan in Drosophila. Phenotypic analysis of mutants for Lnk revealed that loss of Lnk function results in increased lifespan and improved survival under conditions of oxidative stress and starvation. Starvation resistance was found to be associated with increased metabolic stores of carbohydrates and lipids indicative of impaired metabolism. Biochemical and genetic data suggest that Lnk functions in both the IIS and Ras/Mitogen activated protein Kinase (MapK signaling pathways. Microarray studies support this model, showing transcriptional feedback onto genes in both pathways as well as indicating global changes in both lipid and carbohydrate metabolism. Finally, our data also suggest that Lnk itself may be a direct target of the IIS responsive transcription factor, dFoxo, and that dFoxo may repress Lnk expression. We therefore describe novel functions for a member of the SH2B protein family and provide the first evidence for potential mechanisms of SH2B regulation. Our findings suggest that IIS signaling in Drosophila may require the activity of a second intracellular adaptor, thereby yielding fundamental new insights into the

  4. Structure of lipid kinase p110β/p85β elucidates an unusual SH2-domain-mediated inhibitory mechanism.

    Science.gov (United States)

    Zhang, Xuxiao; Vadas, Oscar; Perisic, Olga; Anderson, Karen E; Clark, Jonathan; Hawkins, Phillip T; Stephens, Len R; Williams, Roger L

    2011-03-04

    Phosphoinositide 3-kinases (PI3Ks) are essential for cell growth, migration, and survival. The structure of a p110β/p85β complex identifies an inhibitory function for the C-terminal SH2 domain (cSH2) of the p85 regulatory subunit. Mutagenesis of a cSH2 contact residue activates downstream signaling in cells. This inhibitory contact ties up the C-terminal region of the p110β catalytic subunit, which is essential for lipid kinase activity. In vitro, p110β basal activity is tightly restrained by contacts with three p85 domains: the cSH2, nSH2, and iSH2. RTK phosphopeptides relieve inhibition by nSH2 and cSH2 using completely different mechanisms. The binding site for the RTK's pYXXM motif is exposed on the cSH2, requiring an extended RTK motif to reach and disrupt the inhibitory contact with p110β. This contrasts with the nSH2 where the pY-binding site itself forms the inhibitory contact. This establishes an unusual mechanism by which p85 SH2 domains contribute to RTK signaling specificities. Copyright © 2011 Elsevier Inc. All rights reserved.

  5. Computational dissection of allosteric inhibition of the SH2 domain of Bcr-Abl kinase by the monobody inhibitor AS25.

    Science.gov (United States)

    Ji, Mingfei; Zheng, Guodong; Li, Xiaolong; Zhang, Zhongqin; Jv, Guanqun; Wang, Xiaowei; Wang, Jialin

    2017-06-01

    The deregulated breakpoint cluster region (Bcr)-Abelson tyrosine kinase (Abl) fusion protein represents an attractive pharmacological target for the treatment of chronic myeloid leukemia (CML). The high affinity of monobody AS25 was designed to target the Src homology 2 (SH2) domain of Bcr-Abl, leading to allosteric inhibition of Bcr-Abl through formation of protein-protein interactions. An I164E mutation in the SH2 domain disrupts AS25 binding to the SH2 domain of Bcr-Abl. The detailed mechanisms, however, remain to be unresolved. Here, molecular dynamics (MD) simulations and binding free energy calculations were performed to explore the conformational and energetic differences between the wild-type (WT) complexes of Bcr-Abl SH2 domain and AS25 (SH2 WT -AS25) as well as the mutated complexes (SH2 I164E -AS25). The results revealed that I164E mutation not only caused an increase in the conformational flexibility of SH2-AS25 complexes, but also weakened the binding affinity of AS25 to SH2. The comparative binding modes of SH2-AS25 complexes between WT and the I164E mutant were comprehensively analyzed to unravel the disruption of hydrophobic and hydrogen bonding interactions in the interface of the SH2-AS25 complex triggered by the I164E mutation. The results obtained may help to design the next generation of higher affinity Bcr-Abl SH2-specific peptide inhibitors.

  6. Plasma diagnostic reflectometry

    International Nuclear Information System (INIS)

    Cohen, B.I.; Afeyan, B.B.; Garrison, J.C.; Kaiser, T.B.; Luhmann, N.C. Jr.; Domier, C.W.; Chou, A.E.; Baang, S.

    1996-01-01

    Theoretical and experimental studies of plasma diagnostic reflectometry have been undertaken as a collaborative research project between the Lawrence Livermore National Laboratory (LLNL) and the University of California Department of Applied Science Plasma Diagnostics Group under the auspices of the Laboratory Directed Research and Development Program at LLNL. Theoretical analyses have explored the basic principles of reflectometry to understand its limitations, to address specific gaps in the understanding of reflectometry measurements in laboratory experiments, and to explore extensions of reflectometry such as ultra-short-pulse reflectometry. The theory has supported basic laboratory reflectometry experiments where reflectometry measurements can be corroborated by independent diagnostic measurements

  7. Expression, refolding and crystallizations of the Grb2-like (GADS) C-terminal SH3 domain complexed with a SLP-76 motif peptide

    International Nuclear Information System (INIS)

    Faravelli, Alessandro; Dimasi, Nazzareno

    2005-01-01

    Several crystals of the Grb2-like C-terminal SH3 domain in complex with a motif peptide from the SLP-76 protein were obtained and characterized. The Grb2-like adaptor protein GADS is composed of an N-terminal SH3 domain, an SH2 domain, a proline-rich region and a C-terminal SH3 domain. GADS interacts through its C-terminal SH3 domain with the adaptor protein SLP-76, thus recruiting this protein and other associated molecules to the linker for activation of T-cell (LAT) protein. The DNA encoding the C-terminal SH3 domain of GADS (GADS-cSH3) was assembled synthetically using a recursive PCR technique and the protein was overexpressed in Escherichia coli, refolded and purified. Several crystals of this domain in complex with the SLP-76 peptide were obtained and characterized

  8. Development of an SH Wave Magnetostrictive Transducer Module for Guided Wave Testing of Plate Structures

    International Nuclear Information System (INIS)

    Cho, Seung Hyun; Park, Jae Ha; Kwon Hyu Sang; Ahn, Bong Young; Lee, Seung Seok

    2009-01-01

    Recently much attention has been paid to a guided wave due to its effective applicability to long range and fast inspection of structures. In guided wave based NDE, the appropriate selection of wave modes is one of important factors since the test performance is highly dependent on which mode of guided waves is employed. As far as plate-like structures are concerned, so far, SH guided wave has not been frequently applied compared to Lamb waves, which is mostly caused by the lack of proper and convenient transducers to generate and measure the SH waves. In this investigation, a new small-sized SH guided wave transducer based on magnetostriction is proposed. The present transducer was designed to be modular and be used with shear couplant to avoid the inconvenience of the existing magnetostrictive patch transducers, which comprises the ferromagnetic patch tightly bonded to a structure. The wave transduction mechanism and the detailed configuration of the present transducer are presented. Experimental verification is also conducted on test specimens and the results confirm the good performance of the present transducer module

  9. Development of an SH Wave Magnetostrictive Transducer Module for Guided Wave Testing of Plate Structures

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Seung Hyun; Park, Jae Ha; Kwon Hyu Sang; Ahn, Bong Young; Lee, Seung Seok [Korea Research Institute of Standards and Science, Daejeon (Korea, Republic of)

    2009-04-15

    Recently much attention has been paid to a guided wave due to its effective applicability to long range and fast inspection of structures. In guided wave based NDE, the appropriate selection of wave modes is one of important factors since the test performance is highly dependent on which mode of guided waves is employed. As far as plate-like structures are concerned, so far, SH guided wave has not been frequently applied compared to Lamb waves, which is mostly caused by the lack of proper and convenient transducers to generate and measure the SH waves. In this investigation, a new small-sized SH guided wave transducer based on magnetostriction is proposed. The present transducer was designed to be modular and be used with shear couplant to avoid the inconvenience of the existing magnetostrictive patch transducers, which comprises the ferromagnetic patch tightly bonded to a structure. The wave transduction mechanism and the detailed configuration of the present transducer are presented. Experimental verification is also conducted on test specimens and the results confirm the good performance of the present transducer module

  10. Telaah Fenomenologis Patrimonialisme Budaya Politik Terhadap Konflik Sunnî-Shî‘Ah Madura

    Directory of Open Access Journals (Sweden)

    Jatim Jatim

    2016-11-01

    Full Text Available The article attempts to discover the violence conflict between the Sunnî and the Shî‘ah Muslim communities in Karang Gayam and Blu’uran, Sampang, Madura. The conflict between the two communities has occurred since 2005 to 2013, and has escalated from one event to another. The conflict has caused the expulsion of Shî‘ah people out of Madura island to the refugee’s flats of Puspa Agro Sidoarjo on June 20, 2013. Based on the evidences found, the research is intended to study the phenomenon using phenomenological and patrimonial-political-cultural approa-ches. The study finds that the conflict itself has been caused by a set of hatred discourses and accusation of being heretic, which have been intensely propagated by the local religious elites, i.e. kiai against the Shî‘ah community led by Tajul Muluk. Moreover, the conflict escalation was, among other, due mainly to the strength of patronage relations of the kiais to infiltrate their hegemony and produce the mass to commit violent actions. Incongruously, the power of patronage has been also benefited by the government and many political elites to maintain their political electability and votes. As a result, the government seems to be reluctant to show a firm attitude by enforcing the existing rules to deal with the issue.

  11. Presence of an SH2 domain in the actin-binding protein tensin.

    Science.gov (United States)

    Davis, S; Lu, M L; Lo, S H; Lin, S; Butler, J A; Druker, B J; Roberts, T M; An, Q; Chen, L B

    1991-05-03

    The molecular cloning of the complementary DNA coding for a 90-kilodalton fragment of tensin, an actin-binding component of focal contacts and other submembraneous cytoskeletal structures, is reported. The derived amino acid sequence revealed the presence of a Src homology 2 (SH2) domain. This domain is shared by a number of signal transduction proteins including nonreceptor tyrosine kinases such as Abl, Fps, Src, and Src family members, the transforming protein Crk, phospholipase C-gamma 1, PI-3 (phosphatidylinositol) kinase, and guanosine triphosphatase-activating protein (GAP). Like the SH2 domain found in Src, Crk, and Abl, the SH2 domain of tensin bound specifically to a number of phosphotyrosine-containing proteins from v-src-transformed cells. Tensin was also found to be phosphorylated on tyrosine residues. These findings suggest that by possessing both actin-binding and phosphotyrosine-binding activities and being itself a target for tyrosine kinases, tensin may link signal transduction pathways with the cytoskeleton.

  12. The role of SH3BP2 in the pathophysiology of cherubism

    Directory of Open Access Journals (Sweden)

    Reichenberger Ernst J

    2012-05-01

    Full Text Available Abstract Cherubism is a rare bone dysplasia that is characterized by symmetrical bone resorption limited to the jaws. Bone lesions are filled with soft fibrous giant cell-rich tissue that can expand and cause severe facial deformity. The disorder typically begins in children at ages of 2-5 years and the bone resorption and facial swelling continues until puberty; in most cases the lesions regress spontaneously thereafter. Most patients with cherubism have germline mutations in the gene encoding SH3BP2, an adapter protein involved in adaptive and innate immune response signaling. A mouse model carrying a Pro416Arg mutation in SH3BP2 develops osteopenia and expansile lytic lesions in bone and some soft tissue organs. In this review we discuss the genetics of cherubism, the biological functions of SH3BP2 and the analysis of the mouse model. The data suggest that the underlying cause for cherubism is a systemic autoinflammatory response to physiologic challenges despite the localized appearance of bone resorption and fibrous expansion to the jaws in humans.

  13. Holomorphic field realization of SH"c and quantum geometry of quiver gauge theories

    International Nuclear Information System (INIS)

    Bourgine, Jean-Emile; Matsuo, Yutaka; Zhang, Hong

    2016-01-01

    In the context of 4D/2D dualities, SH"c algebra, introduced by Schiffmann and Vasserot, provides a systematic method to analyse the instanton partition functions of N=2 supersymmetric gauge theories. In this paper, we rewrite the SH"c algebra in terms of three holomorphic fields D_0(z), D_±_1(z) with which the algebra and its representations are simplified. The instanton partition functions for arbitrary N=2 super Yang-Mills theories with A_n and A_n"("1") type quiver diagrams are compactly expressed as a product of four building blocks, Gaiotto state, dilatation, flavor vertex operator and intertwiner which are written in terms of SH"c and the orthogonal basis introduced by Alba, Fateev, Litvinov and Tarnopolskiy. These building blocks are characterized by new conditions which generalize the known ones on the Gaiotto state and the Carlsson-Okounkov vertex. Consistency conditions of the inner product give algebraic relations for the chiral ring generating functions defined by Nekrasov, Pestun and Shatashvili. In particular we show the polynomiality of the qq-characters which have been introduced as a deformation of the Yangian characters. These relations define a second quantization of the Seiberg-Witten geometry, and, accordingly, reduce to a Baxter TQ-equation in the Nekrasov-Shatashvili limit of the Omega-background.

  14. Ritual Pengikut Tarekat Shâdhilîyah di Tambak Beras, Jombang-Jawa Timur

    Directory of Open Access Journals (Sweden)

    Abdullah Safik

    2015-10-01

    Full Text Available This article tries to phenomenologically examines the existence of the Shâdhilîyah tarekat supervised by KH. Djamaluddin in Tambak Beras, Jombang. The Shâdhîlîyah tarekat, that had been initiated by Abû Hasan al-Shâdhilî, is an exceptional and consistent in holding and practicing its tawhid principle as well as dhikr rituals. In Indonesia, this tarekat has rapidly evolved. One of its murshid is KH. Abdul Jalil Mustaqim in Tulungagung, the murshid to KH. Djamaluddin. The tarekat has two main doctrines, are: firstly, ‘ubûdîyah realm where its followers are obliged to phisically and mentally obey Allah swt and His messenger, i.e. the prophet Muhammad, in all their sayings and deeds. Secondly, mu‘âmalah aspect where each follower is taught to interact with other people and creatures only for the sake of Allah. It means that the tarekat is a medium of self approaching to Allah. One of special rites (khusûsîyah conducted by this tarekat is an every-Tuesday agenda where dhikr, tawassul, tahlîl, and tahmîd activities are held. Technically, a sâlik when s/he recites dhikr should be followed by breathing in which is concentrated in the navel and going on top through thoracic cavity and coming out through the mouth then retracting it back to tongue.

  15. Emerging medical informatics research trends detection based on MeSH terms.

    Science.gov (United States)

    Lyu, Peng-Hui; Yao, Qiang; Mao, Jin; Zhang, Shi-Jing

    2015-01-01

    The aim of this study is to analyze the research trends of medical informatics over the last 12 years. A new method based on MeSH terms was proposed to identify emerging topics and trends of medical informatics research. Informetric methods and visualization technologies were applied to investigate research trends of medical informatics. The metric of perspective factor (PF) embedding MeSH terms was appropriately employed to assess the perspective quality for journals. The emerging MeSH terms have changed dramatically over the last 12 years, identifying two stages of medical informatics: the "medical imaging stage" and the "medical informatics stage". The focus of medical informatics has shifted from acquisition and storage of healthcare data by integrating computational, informational, cognitive and organizational sciences to semantic analysis for problem solving and clinical decision-making. About 30 core journals were determined by Bradford's Law in the last 3 years in this area. These journals, with high PF values, have relative high perspective quality and lead the trend of medical informatics.

  16. CH{sup +} and SH{sup +} in the diffuse interstellar medium: Tracers of turbulent dissipation

    Energy Technology Data Exchange (ETDEWEB)

    Edith, Falgarone; Maryvonne, Gerin; Massimo, De Luca [Observatoire de Paris and Ecole Normale Supérieure, Paris (France); Benjamin, Godard [Centro de Astrobiologia, CSIC-INTA, Madrid (Spain)

    2015-01-22

    Absorption spectroscopy performed with Herschel/HIFI against the dust continuum emission of bright galactic star-forming regions has allowed the detection of the ground-state transitions of several hydride cations, CH{sup +}, OH{sup +}, H{sub 2}O{sup +}, and SH{sup +} in the intervening diffuse medium. These hydrides, that need H{sub 2} to form but are also destroyed by H{sub 2}, appear to be most sensitive tracers of a poorly known component of the interstellar medium (ISM): molecular gas weakly shielded from UV radiation. Among them, because their formation routes are so highly endoenergic, the CH{sup +} and SH{sup +} cations are proposed to be specific tracers of turbulent dissipation occurring in diffuse gas. Their elusive origin in the diffuse ISM is therefore much more than a chemical riddle: it is rooted in the physics of the diffuse ISM, its turbulent dissipation rate and connects with the far broader issue of galaxy evolution. The Herschel/HIFI observations of CH{sup +} and SH{sup +} are compared with the predictions of chemical models that include the non-equilibrium effects of turbulent dissipation.

  17. Dynamically Coupled Residues within the SH2 Domain of FYN Are Key to Unlocking Its Activity.

    Science.gov (United States)

    Huculeci, Radu; Cilia, Elisa; Lyczek, Agatha; Buts, Lieven; Houben, Klaartje; Seeliger, Markus A; van Nuland, Nico; Lenaerts, Tom

    2016-11-01

    Src kinase activity is controlled by various mechanisms involving a coordinated movement of kinase and regulatory domains. Notwithstanding the extensive knowledge related to the backbone dynamics, little is known about the more subtle side-chain dynamics within the regulatory domains and their role in the activation process. Here, we show through experimental methyl dynamic results and predicted changes in side-chain conformational couplings that the SH2 structure of Fyn contains a dynamic network capable of propagating binding information. We reveal that binding the phosphorylated tail of Fyn perturbs a residue cluster near the linker connecting the SH2 and SH3 domains of Fyn, which is known to be relevant in the regulation of the activity of Fyn. Biochemical perturbation experiments validate that those residues are essential for inhibition of Fyn, leading to a gain of function upon mutation. These findings reveal how side-chain dynamics may facilitate the allosteric regulation of the different members of the Src kinase family. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. CH+ and SH+ in the diffuse interstellar medium: Tracers of turbulent dissipation

    International Nuclear Information System (INIS)

    Edith, Falgarone; Maryvonne, Gerin; Massimo, De Luca; Benjamin, Godard

    2015-01-01

    Absorption spectroscopy performed with Herschel/HIFI against the dust continuum emission of bright galactic star-forming regions has allowed the detection of the ground-state transitions of several hydride cations, CH + , OH + , H 2 O + , and SH + in the intervening diffuse medium. These hydrides, that need H 2 to form but are also destroyed by H 2 , appear to be most sensitive tracers of a poorly known component of the interstellar medium (ISM): molecular gas weakly shielded from UV radiation. Among them, because their formation routes are so highly endoenergic, the CH + and SH + cations are proposed to be specific tracers of turbulent dissipation occurring in diffuse gas. Their elusive origin in the diffuse ISM is therefore much more than a chemical riddle: it is rooted in the physics of the diffuse ISM, its turbulent dissipation rate and connects with the far broader issue of galaxy evolution. The Herschel/HIFI observations of CH + and SH + are compared with the predictions of chemical models that include the non-equilibrium effects of turbulent dissipation

  19. Interaction with the Src homology (SH3-SH2) region of the Src-family kinase Hck structures the HIV-1 Nef dimer for kinase activation and effector recruitment.

    Science.gov (United States)

    Alvarado, John Jeff; Tarafdar, Sreya; Yeh, Joanne I; Smithgall, Thomas E

    2014-10-10

    HIV-1 Nef supports high titer viral replication in vivo and is essential for AIDS progression. Nef function depends on interactions with multiple host cell effectors, including Hck and other Src-family kinases. Here we describe the x-ray crystal structure of Nef in complex with the Hck SH3-SH2 regulatory region to a resolution of 1.86 Å. The complex crystallized as a dimer of complexes, with the conserved Nef PXXPXR motif engaging the Hck SH3 domain. A new intercomplex contact was found between SH3 Glu-93, and Nef Arg-105. Mutagenesis of Hck SH3 Glu-93 interfered with Nef·Hck complex formation and kinase activation in cells. The Hck SH2 domains impinge on the N-terminal region of Nef to stabilize a dimer conformation that exposes Asp-123, a residue critical for Nef function. Our results suggest that in addition to serving as a kinase effector for Nef, Hck binding may reorganize the Nef dimer for functional interaction with other signaling partners. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Interaction with the Src Homology (SH3-SH2) Region of the Src-family Kinase Hck Structures the HIV-1 Nef Dimer for Kinase Activation and Effector Recruitment*

    Science.gov (United States)

    Alvarado, John Jeff; Tarafdar, Sreya; Yeh, Joanne I.; Smithgall, Thomas E.

    2014-01-01

    HIV-1 Nef supports high titer viral replication in vivo and is essential for AIDS progression. Nef function depends on interactions with multiple host cell effectors, including Hck and other Src-family kinases. Here we describe the x-ray crystal structure of Nef in complex with the Hck SH3-SH2 regulatory region to a resolution of 1.86 Å. The complex crystallized as a dimer of complexes, with the conserved Nef PXXPXR motif engaging the Hck SH3 domain. A new intercomplex contact was found between SH3 Glu-93, and Nef Arg-105. Mutagenesis of Hck SH3 Glu-93 interfered with Nef·Hck complex formation and kinase activation in cells. The Hck SH2 domains impinge on the N-terminal region of Nef to stabilize a dimer conformation that exposes Asp-123, a residue critical for Nef function. Our results suggest that in addition to serving as a kinase effector for Nef, Hck binding may reorganize the Nef dimer for functional interaction with other signaling partners. PMID:25122770

  1. Propagation of SH waves in a piezoelectric/piezomagnetic plate: Effects of interfacial imperfection couplings and the related physical mechanisms

    Energy Technology Data Exchange (ETDEWEB)

    Wei, Hong-Xing [Beijing Advanced Innovation Center for Imaging Technology, Capital Normal University, Beijing 100048 (China); Li, Yong-Dong, E-mail: LYDbeijing@163.com [Beijing Advanced Innovation Center for Imaging Technology, Capital Normal University, Beijing 100048 (China); Department of Mechanical Engineering, Academy of Armored Force Engineering, Beijing 100072 (China); Xiong, Tao [Department of Mechanical Engineering, Academy of Armored Force Engineering, Beijing 100072 (China); Guan, Yong [Beijing Advanced Innovation Center for Imaging Technology, Capital Normal University, Beijing 100048 (China)

    2016-09-07

    The problem of dispersive SH wave in a piezoelectric/piezomagnetic plate that contains an imperfect interface is considered in the present work. An imperfection coupling model is adopted to describe the magnetic, electric and mechanical imperfections on the interface. A transcendental dispersion equation is derived and numerically solved to get the phase velocity. The validity of the numerical procedure is verified in a degenerated case. The effects of the coupled interfacial imperfections on the dispersion behavior of SH waves are discussed in detail and the related underlying physical mechanisms are explained. - Highlights: • SH-wave is investigated in a multiferroic plate with coupled interfacial imperfections. • SH-wave is affected by both interfacial imperfections and their inter-couplings. • Physical mechanisms of the effects are explained via energy transformations.

  2. J-GLOBAL MeSH Dictionary: Edwardsiella tarda [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Edwardsiella tarda 名詞 一般 * * * * Edwar...dsiella tarda ... MeSH D020609 200906083854859187 C LS07 UNKNOWN_2 Edwardsiella tarda

  3. J-GLOBAL MeSH Dictionary: Edwardsiella ictaluri [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Edwardsiella ictaluri 名詞 一般 * * * * Edwar...dsiella ictaluri ... MeSH D020610 200906051921978774 C LS07 UNKNOWN_2 Edwardsiella ictaluri

  4. J-GLOBAL MeSH Dictionary: Ralstonia solanacearum [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Ralstonia solanacearum 名詞 一般 * * * * Ralstonia sol...anacearum ... MeSH D043368 200906091329391991 C LS07 UNKNOWN_2 Ralstonia solanacearum

  5. J-GLOBAL MeSH Dictionary: Sulfolobus solfataricus [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Sulfolobus solfataricus 名詞 一般 * * * * Sulfolobus solfataricus ... MeSH D048229 200906045592943760 C LS07 UNKNOWN_2 Sulfolobus solfataricus

  6. A relationship between SNR G109.1-1.0 and the molecular cloud of Sh2-152

    International Nuclear Information System (INIS)

    Heydari-Malayeri, M.; Kahane, C.; Lucas, R.

    1981-01-01

    The possible association of the supernova remnant SNR G109.1 - 1.0 and the x-ray source GF2259 + 586 with the molecular cloud of Sh2 - 152 has been investigated by observing the molecular line 13 CO (J = 1 → 0) of the complex Sh2 - 147/Sh2 - 153. The present results are compared with those of previous workers. It is shown that although the various estimates of distance for the SNR, the x-ray source, the H II region Sh2 - 152 and the molecular cloud are in relatively good agreement, because of the uncertainties of distance evaluation in the Perseus arm this cannot be regarded as conclusive proof of the association of these objects. (U.K.)

  7. J-GLOBAL MeSH Dictionary: Dirofilaria immitis [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Dirofilaria immitis 名詞 一般 * * * * Dirofilaria immit...is ... MeSH D004183 200906050138784430 C LS05 UNKNOWN_2 Dirofilaria immitis

  8. J-GLOBAL MeSH Dictionary: Actinobacillus actinomycetemcomitans [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Actinobacillus actinomycetemcomit...ans 名詞 一般 * * * * Actinobacillus actinomycetemcomitans ... MeSH D016976 200906016161948020 C LS07 UNKNOWN_2 Actinobacillus actinomycetemcomitans

  9. J-GLOBAL MeSH Dictionary: Streptococcus mitis [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Streptococcus mitis 名詞 一般 * * * * Streptococcus mit...is ... MeSH D034361 200906051281920120 C LS07 UNKNOWN_2 Streptococcus mitis

  10. J-GLOBAL MeSH Dictionary: Thiocapsa roseopersicina [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Thiocapsa roseopersicina 名詞 一般 * * * * Thiocapsa rose...opersicina ... MeSH D020616 200906079314739029 C LS07 UNKNOWN_2 Thiocapsa roseopersicina

  11. J-GLOBAL MeSH Dictionary: Sphingomonadaceae [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Sphingomonadaceae 名詞 一般 * * * * Sphi...ngomonadaceae ... MeSH D042301 200906094653102667 C LS07 UNKNOWN_1 Sphingomonadaceae

  12. J-GLOBAL MeSH Dictionary: Campylobacter upsaliensis [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Campylobacter upsaliensis 名詞 一般 *... * * * Campylobacter upsaliensis ... MeSH D044885 200906036434053162 C LS07 UNKNOWN_2 Campylobacter upsaliensis

  13. J-GLOBAL MeSH Dictionary: Morganella morganii [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Morganella morganii 名詞 一般 * * * * Morganella morg...anii ... MeSH D020613 200906053401612729 C LS07 UNKNOWN_2 Morganella morganii

  14. J-GLOBAL MeSH Dictionary: Corynebacterium pseudotuberculosis [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Corynebacterium pseudotuberculosis... 名詞 一般 * * * * Corynebacterium pseudotuberculosis ... MeSH D016925 200906025325177003 C LS07 UNKNOWN_2 Corynebacterium pseudotuberculosis

  15. J-GLOBAL MeSH Dictionary: Yersinia pseudotuberculosis [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Yersinia pseudotuberculosis 名詞 一般... * * * * Yersinia pseudotuberculosis ... MeSH D015011 200906011755952514 C LS07 UNKNOWN_2 Yersinia pseudotuberculosis

  16. J-GLOBAL MeSH Dictionary: von Willebrand病 [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term von Willebrand病 名詞 一般 * * * * von Willebrand...病 ... MeSH D014842 200906053707829497 C LS51 UNKNOWN_2 von Willebrand 病

  17. A YOUNG ECLIPSING BINARY AND ITS LUMINOUS NEIGHBORS IN THE EMBEDDED STAR CLUSTER Sh 2-252E

    Energy Technology Data Exchange (ETDEWEB)

    Lester, Kathryn V.; Gies, Douglas R.; Guo, Zhao, E-mail: lester@chara.gsu.edu, E-mail: gies@chara.gsu.edu, E-mail: guo@chara.gsu.edu [Center for High Angular Resolution Astronomy and Department of Physics and Astronomy, Georgia State University, P.O. Box 5060, Atlanta, GA 30302-5060 (United States)

    2016-12-01

    We present a photometric and light curve analysis of an eccentric eclipsing binary in the K2 Campaign 0 field, which resides in Sh 2-252E, a young star cluster embedded in an H ii region. We describe a spectroscopic investigation of the three brightest stars in the crowded aperture to identify which is the binary system. We find that none of these stars are components of the eclipsing binary system, which must be one of the fainter nearby stars. These bright cluster members all have remarkable spectra: Sh 2-252a (EPIC 202062176) is a B0.5 V star with razor sharp absorption lines, Sh 2-252b is a Herbig A0 star with disk-like emission lines, and Sh 2-252c is a pre-main-sequence star with very red color.

  18. J-GLOBAL MeSH Dictionary: Brucella melitensis [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Brucella melitensis 名詞 一般 * * * * Brucella melitens...is ... MeSH D017347 200906028294406644 C LS07 UNKNOWN_2 Brucella melitensis

  19. J-GLOBAL MeSH Dictionary: Phoradendron属 [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Phoradendron属 名詞 サ変接続 * * * * Phoradendron...属 ... MeSH D028184 200906006893995689 C LS06 UNKNOWN_2 Phoradendron 属

  20. Propagation of SH waves in a piezoelectric/piezomagnetic plate: Effects of interfacial imperfection couplings and the related physical mechanisms

    International Nuclear Information System (INIS)

    Wei, Hong-Xing; Li, Yong-Dong; Xiong, Tao; Guan, Yong

    2016-01-01

    The problem of dispersive SH wave in a piezoelectric/piezomagnetic plate that contains an imperfect interface is considered in the present work. An imperfection coupling model is adopted to describe the magnetic, electric and mechanical imperfections on the interface. A transcendental dispersion equation is derived and numerically solved to get the phase velocity. The validity of the numerical procedure is verified in a degenerated case. The effects of the coupled interfacial imperfections on the dispersion behavior of SH waves are discussed in detail and the related underlying physical mechanisms are explained. - Highlights: • SH-wave is investigated in a multiferroic plate with coupled interfacial imperfections. • SH-wave is affected by both interfacial imperfections and their inter-couplings. • Physical mechanisms of the effects are explained via energy transformations.

  1. J-GLOBAL MeSH Dictionary: Aeromonas salmonicida [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Aeromonas salmonicida 名詞 一般 * * * * Aeromonas salmon...icida ... MeSH D048409 200906081596351600 C LS07 UNKNOWN_2 Aeromonas salmonicida

  2. J-GLOBAL MeSH Dictionary: Aliivibrio salmonicida [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Aliivibrio salmonicida 名詞 一般 * * * * Aliivibrio salmon...icida ... MeSH D044165 200906023365578059 C LS07 UNKNOWN_2 Aliivibrio salmonicida

  3. J-GLOBAL MeSH Dictionary: Heligmosomatoidea [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Heligmosomatoidea 名詞 一般 * * * * Heligmos...omatoidea ... MeSH D006369 200906085224079623 C LS05 UNKNOWN_1 Heligmosomatoidea

  4. J-GLOBAL MeSH Dictionary: Neorickettsia risticii [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Neorickettsia risticii 名詞 一般 * * * * Neorickettsia... risticii ... MeSH D041103 200906043905068374 C LS07 UNKNOWN_2 Neorickettsia risticii

  5. J-GLOBAL MeSH Dictionary: Piscirickettsiaceae [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Piscirickettsiaceae 名詞 一般 * * * * Piscirickettsia...ceae ... MeSH D044147 200906033138096892 C LS07 UNKNOWN_1 Piscirickettsiaceae

  6. J-GLOBAL MeSH Dictionary: Neorickettsia sennetsu [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Neorickettsia sennetsu 名詞 一般 * * * * Neorickettsia... sennetsu ... MeSH D041101 200906077083053908 C LS07 UNKNOWN_2 Neorickettsia sennetsu

  7. J-GLOBAL MeSH Dictionary: Mycoplasma ovipneumoniae [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Mycoplasma ovipneumoniae 名詞 一般 * * * * Mycoplasma ovipneum...oniae ... MeSH D045802 200906092922912910 C LS07 UNKNOWN_2 Mycoplasma ovipneumoniae

  8. J-GLOBAL MeSH Dictionary: Chlamydophila pneumoniae [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Chlamydophila pneumoniae 名詞 一般 * * * * Chlamydophila pneum...oniae ... MeSH D016993 200906005356438556 C LS07 UNKNOWN_2 Chlamydophila pneumoniae

  9. J-GLOBAL MeSH Dictionary: Mycoplasma pneumoniae [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Mycoplasma pneumoniae 名詞 一般 * * * * Mycoplasma pneumonia...e ... MeSH D009177 200906010320106380 C LS07 UNKNOWN_2 Mycoplasma pneumoniae

  10. J-GLOBAL MeSH Dictionary: Actinobacillus pleuropneumoniae [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Actinobacillus pleuropneumoniae 名...詞 一般 * * * * Actinobacillus pleuropneumoniae ... MeSH D016977 200906089064706214 C LS07 UNKNOWN_2 Actinobacillus pleuropneumoniae

  11. J-GLOBAL MeSH Dictionary: Mycoplasma hyopneumoniae [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Mycoplasma hyopneumoniae 名詞 一般 * * * * Mycoplasma hyopneum...oniae ... MeSH D045705 200906033834508852 C LS07 UNKNOWN_2 Mycoplasma hyopneumoniae

  12. J-GLOBAL MeSH Dictionary: Prevotella melaninogenica [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Prevotella melaninogenica 名詞 一般 * * * * Prevotella mela...ninogenica ... MeSH D001443 200906099099181179 C LS07 UNKNOWN_2 Prevotella melaninogenica

  13. J-GLOBAL MeSH Dictionary: Tetrahymena pyriformis [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Tetrahymena pyriformis 名詞 一般 * * * * Tetrahymena... pyriformis ... MeSH D013769 200906097287118996 C LS07 UNKNOWN_2 Tetrahymena pyriformis

  14. J-GLOBAL MeSH Dictionary: Tetrahymena thermophila [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Tetrahymena thermophila 名詞 一般 * * * * Tetrahymena... thermophila ... MeSH D016808 200906086486381246 C LS07 UNKNOWN_2 Tetrahymena thermophila

  15. J-GLOBAL MeSH Dictionary: Bacillus stearothermophilus [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Bacillus stearothermophilus 名詞 一般 * * * * Bacillus stea...rothermophilus ... MeSH D001411 200906079736943583 C LS07 UNKNOWN_2 Bacillus stearothermophilus

  16. Regulation of the interaction between the neuronal BIN1 isoform 1 and Tau proteins - role of the SH3 domain.

    Science.gov (United States)

    Malki, Idir; Cantrelle, François-Xavier; Sottejeau, Yoann; Lippens, Guy; Lambert, Jean-Charles; Landrieu, Isabelle

    2017-10-01

    Bridging integrator 1 (bin1) gene is a genetic determinant of Alzheimer's disease (AD) and has been reported to modulate Alzheimer's pathogenesis through pathway(s) involving Tau. The functional impact of Tau/BIN1 interaction as well as the molecular details of this interaction are still not fully resolved. As a consequence, how BIN1 through its interaction with Tau affects AD risk is also still not determined. To progress in this understanding, interaction of Tau with two BIN1 isoforms was investigated using Nuclear Magnetic Resonance spectroscopy. 1 H, 15 N spectra showed that the C-terminal SH3 domain of BIN1 isoform 1 (BIN1Iso1) is not mobile in solution but locked with the core of the protein. In contrast, the SH3 domain of BIN1 isoform 9 (BIN1Iso9) behaves as an independent mobile domain. This reveals an equilibrium between close and open conformations for the SH3 domain. Interestingly, a 334-376 peptide from the clathrin and AP-2-binding domain (CLAP) domain of BIN1Iso1, which contains a SH3-binding site, is able to compete with BIN1-SH3 intramolecular interaction. For both BIN1 isoforms, the SH3 domain can interact with Tau(210-240) sequence. Tau(210-240) peptide can indeed displace the intramolecular interaction of the BIN1-SH3 of BIN1Iso1 and form a complex with the released domain. The measured K d were in agreement with a stronger affinity of Tau peptide. Both CLAP and Tau peptides occupied the same surface on the BIN1-SH3 domain, showing that their interaction is mutually exclusive. These results emphasize an additional level of complexity in the regulation of the interaction between BIN1 and Tau dependent of the BIN1 isoforms. © 2017 Federation of European Biochemical Societies.

  17. SH-SY5Y human neuroblastoma cell line: in vitro cell model of dopaminergic neurons in Parkinson's disease.

    Science.gov (United States)

    Xie, Hong-rong; Hu, Lin-sen; Li, Guo-yi

    2010-04-20

    To evaluate the human neuroblastoma SH-SY5Y cell line as an in vitro model of dopaminergic (DAergic) neurons for Parkinson's disease (PD) research and to determine the effect of differentiation on this cell model. The data of this review were selected from the original reports and reviews related to SH-SY5Y cells published in Chinese and foreign journals (Pubmed 1973 to 2009). After searching the literature, 60 articles were selected to address this review. The SH-SY5Y cell line has become a popular cell model for PD research because this cell line posses many characteristics of DAergic neurons. For example, these cells express tyrosine hydroxylase and dopamine-beta-hydroxylase, as well as the dopamine transporter. Moreover, this cell line can be differentiated into a functionally mature neuronal phenotype in the presence of various agents. Upon differentiation, SH-SY5Y cells stop proliferating and a constant cell number is subsequently maintained. However, different differentiating agents induce different neuronal phenotypes and biochemical changes. For example, retinoic acid induces differentiation toward a cholinergic neuronal phenotype and increases the susceptibility of SH-SY5Y cells to neurotoxins and neuroprotective agents, whereas treatment with retinoic acid followed by phorbol ester 12-O-tetradecanoylphorbol-13-acetate results in a DAergic neuronal phenotype and decreases the susceptibility of cells to neurotoxins and neuroprotective agents. Some differentiating agents also alter kinetics of 1-methyl-4-phenyl-pyridinium (MPP(+)) uptake, making SH-SY5Y cells more similar to primary mesencephalic neurons. Differentiated and undifferentiated SH-SY5Y cells have been widely used as a cell model of DAergic neurons for PD research. Some differentiating agents afford SH-SY5Y cells with more potential for studying neurotoxicity and neuroprotection and are thus more relevant to experimental PD research.

  18. Rayleigh SAW-Assisted SH-SAW Immunosensor on X-Cut 148-Y LiTaO3.

    Science.gov (United States)

    Kogai, Takashi; Yatsuda, Hiromi; Kondoh, Jun

    2017-09-01

    In this paper, we describe a shear horizontal surface acoustic wave (SH-SAW) immunosensor that utilizes induce agitation by a Rayleigh SAW (R-SAW) on an X-cut 148-Y LiTaO 3 substrate. On this substrate, SH-SAWs and R-SAWs with different frequencies can be effectively generated at an interdigital transducer (IDT). First, to consider the power flow angles of SH-SAWs and R-SAWs on this substrate, the 360-MHz delay lines with six different tilt angles were designed and fabricated. From the experiments, an optimal power flow angle of 9° for the SH-SAW on this substrate is obtained. Second, in order to consider the immunoreactions of the SH-SAW immunosensors, a delay line with a tilt angle of 9° was designed and fabricated on this substrate. The delay line, which can generate two SAWs, namely, a 100-MHz SH-SAW and an 88.8-MHz R-SAW, has a propagation area covered with antigens of human serum albumin between transmitting and receiving IDTs. The immunoreactions caused by antigen-antibody binding events on the surface of the delay line were investigated on the basis of the velocity changes of the SH-SAWs for sensing with and without the assistance of an R-SAW. As a result, it was confirmed that the SH-SAW velocity changes due to antigen-antibody reactions can be markedly increased by the assistance of R-SAW agitation.

  19. Autophagy regulates chlorpyrifos-induced apoptosis in SH-SY5Y cells

    International Nuclear Information System (INIS)

    Park, Jae Hyeon; Lee, Jeong Eun; Shin, In Chul; Koh, Hyun Chul

    2013-01-01

    Recent studies have shown that up-regulation of autophagy may be a tractable therapeutic intervention for clearing disease-causing proteins, including α-synuclein, ubiquitin, and other misfolded or aggregated proteins in pesticide-induced neurodegeneration. In a previous study, we reported that chlorpyrifos (CPF)-induced mitochondria-dependent apoptosis is mediated through reactive oxygen species in SH-SY5Y cells. In this study, we explored a novel pharmacotherapeutic approach to prevent CPF neurotoxicity involving the regulation of autophagy. We investigated the modulation of CPF-induced apoptosis according to autophagy regulation. We found that CPF induced apoptosis in SH-SY5Y cells, as demonstrated by the activation of caspase-3 and nuclear condensation. In addition, we observed that cells treated with CPF underwent autophagic cell death by monitoring the expression of LC3-II and p62. Pretreatment with the autophagy inducer rapamycin significantly enhanced the cell viability of CPF-exposed cells, and the enhancement of cell viability was partially due to alleviation of CPF-induced apoptosis via a decrease in levels of cleaved caspase-3. Specifically, rapamycin pretreatment decreased Bax and increased Bcl-2 expression in mitochondria. In addition, rapamycin significantly decreased cytochrome c release in from mitochondria into the cytosol. However, pretreatment of cells with the autophagy inhibitor, 3-methyladenine (3MA), remarkably increased CPF toxicity in these cells; this with correlated with increased expression of Bax and decreased expression of Bcl-2 in mitochondria. Our results suggest that CPF-induced cytotoxicity is modified by autophagy regulation and that rapamycin protects against CPF-induced apoptosis by enhancing autophagy. Pharmacologic induction of autophagy by rapamycin may be a useful treatment strategy in neurodegenerative disorders. - Highlights: ► Chlorpyrifos (CPF) is cytotoxic to SH-SY5Y cells ► CPF-induced cytotoxicity is mediated by

  20. Autophagy regulates chlorpyrifos-induced apoptosis in SH-SY5Y cells

    Energy Technology Data Exchange (ETDEWEB)

    Park, Jae Hyeon [Department of Pharmacology, College of Medicine, Hanyang University (Korea, Republic of); Hanyang Biomedical Research Institute, Seoul (Korea, Republic of); Graduate School of Biomedical Science and Engineering, Hanyang University, Seoul (Korea, Republic of); Lee, Jeong Eun [Department of Pharmacology, College of Medicine, Hanyang University (Korea, Republic of); Hanyang Biomedical Research Institute, Seoul (Korea, Republic of); Shin, In Chul [Department of Pharmacology, College of Medicine, Hanyang University (Korea, Republic of); Koh, Hyun Chul, E-mail: hckoh@hanyang.ac.kr [Department of Pharmacology, College of Medicine, Hanyang University (Korea, Republic of); Hanyang Biomedical Research Institute, Seoul (Korea, Republic of); Graduate School of Biomedical Science and Engineering, Hanyang University, Seoul (Korea, Republic of)

    2013-04-01

    Recent studies have shown that up-regulation of autophagy may be a tractable therapeutic intervention for clearing disease-causing proteins, including α-synuclein, ubiquitin, and other misfolded or aggregated proteins in pesticide-induced neurodegeneration. In a previous study, we reported that chlorpyrifos (CPF)-induced mitochondria-dependent apoptosis is mediated through reactive oxygen species in SH-SY5Y cells. In this study, we explored a novel pharmacotherapeutic approach to prevent CPF neurotoxicity involving the regulation of autophagy. We investigated the modulation of CPF-induced apoptosis according to autophagy regulation. We found that CPF induced apoptosis in SH-SY5Y cells, as demonstrated by the activation of caspase-3 and nuclear condensation. In addition, we observed that cells treated with CPF underwent autophagic cell death by monitoring the expression of LC3-II and p62. Pretreatment with the autophagy inducer rapamycin significantly enhanced the cell viability of CPF-exposed cells, and the enhancement of cell viability was partially due to alleviation of CPF-induced apoptosis via a decrease in levels of cleaved caspase-3. Specifically, rapamycin pretreatment decreased Bax and increased Bcl-2 expression in mitochondria. In addition, rapamycin significantly decreased cytochrome c release in from mitochondria into the cytosol. However, pretreatment of cells with the autophagy inhibitor, 3-methyladenine (3MA), remarkably increased CPF toxicity in these cells; this with correlated with increased expression of Bax and decreased expression of Bcl-2 in mitochondria. Our results suggest that CPF-induced cytotoxicity is modified by autophagy regulation and that rapamycin protects against CPF-induced apoptosis by enhancing autophagy. Pharmacologic induction of autophagy by rapamycin may be a useful treatment strategy in neurodegenerative disorders. - Highlights: ► Chlorpyrifos (CPF) is cytotoxic to SH-SY5Y cells ► CPF-induced cytotoxicity is mediated by

  1. “Girls are dancin’”: shōjo culture and feminism in contemporary Japanese art

    Directory of Open Access Journals (Sweden)

    Emily Jane Wakeling

    2011-12-01

    Full Text Available This article explores the gender-transgressive expressions found in shōjo culture in order to highlight the potential for feminist analysis in the prevalence of the shōjo motif in contemporary Japanese art. Shōjo culture is a fascinating cultural space, within contemporary Japanese culture, which fosters creative expressions of gender that negate or make complex hegemonic categories. Departing from stereotypes of Japanese girls, this article will pay particular interest to an emerging wave of figurative contemporary art practices in which the figure of the shōjo is utilised for a new generation of feminist critique. Aoshima Chiho, Kunikata Mahomi, Takano Aya, Sawada Tomoko and Yanagi Miwa are among the current artists who feature the shōjo motif in contexts that foreground female subjectivities found paralleled in shōjo culture. These works will then be contextualised in the greater picture of current trends and themes in global contemporary feminist art.

  2. High resolution crystal structure of the Grb2 SH2 domain with a phosphopeptide derived from CD28.

    Directory of Open Access Journals (Sweden)

    Kunitake Higo

    Full Text Available Src homology 2 (SH2 domains play a critical role in cellular signal transduction. They bind to peptides containing phosphotyrosine (pY with various specificities that depend on the flanking amino-acid residues. The SH2 domain of growth-factor receptor-bound protein 2 (Grb2 specifically recognizes pY-X-N-X, whereas the SH2 domains in phosphatidylinositol 3-kinase (PI3K recognize pY-X-X-M. Binding of the pY site in CD28 (pY-M-N-M by PI3K and Grb2 through their SH2 domains is a key step that triggers the CD28 signal transduction for T cell activation and differentiation. In this study, we determined the crystal structure of the Grb2 SH2 domain in complex with a pY-containing peptide derived from CD28 at 1.35 Å resolution. The peptide was found to adopt a twisted U-type conformation, similar to, but distinct from type-I β-turn. In all previously reported crystal structures, the peptide bound to the Grb2 SH2 domains adopts a type-I β-turn conformation, except those with a proline residue at the pY+3 position. Molecular modeling also suggests that the same peptide bound to PI3K might adopt a very different conformation.

  3. The Src SH2 domain interacts dynamically with the focal adhesion kinase binding site as demonstrated by paramagnetic NMR spectroscopy.

    Science.gov (United States)

    Lindfors, Hanna E; Drijfhout, Jan Wouter; Ubbink, Marcellus

    2012-06-01

    The interaction between the tyrosine kinases Src and focal adhesion kinase (FAK) is a key step in signaling processes from focal adhesions. The phosphorylated tyrosine residue 397 in FAK is able to bind the Src SH2 domain. To establish the extent of the FAK binding motif, the binding affinity of the SH2 domain for phosphorylated and unphosphorylated FAK-derived peptides of increasing length was determined and compared with that of the internal Src SH2 binding site. It is shown that the FAK peptides have higher affinity than the internal binding site and that seven negative residues adjacent to the core SH2 binding motif increase the binding constant 30-fold. A rigid spin-label incorporated in the FAK peptides was used to establish on the basis of paramagnetic relaxation enhancement whether the peptide-protein complex is well defined. A large spread of the paramagnetic effects on the surface of the SH2 domain suggests that the peptide-protein complex exhibits dynamics, despite the high affinity of the peptide. The strong electrostatic interaction between the positive side of the SH2 domain and the negative peptide results in a high affinity but may also favor a dynamic interaction. Copyright © 2012 Wiley Periodicals, Inc.

  4. High resolution crystal structure of the Grb2 SH2 domain with a phosphopeptide derived from CD28.

    Science.gov (United States)

    Higo, Kunitake; Ikura, Teikichi; Oda, Masayuki; Morii, Hisayuki; Takahashi, Jun; Abe, Ryo; Ito, Nobutoshi

    2013-01-01

    Src homology 2 (SH2) domains play a critical role in cellular signal transduction. They bind to peptides containing phosphotyrosine (pY) with various specificities that depend on the flanking amino-acid residues. The SH2 domain of growth-factor receptor-bound protein 2 (Grb2) specifically recognizes pY-X-N-X, whereas the SH2 domains in phosphatidylinositol 3-kinase (PI3K) recognize pY-X-X-M. Binding of the pY site in CD28 (pY-M-N-M) by PI3K and Grb2 through their SH2 domains is a key step that triggers the CD28 signal transduction for T cell activation and differentiation. In this study, we determined the crystal structure of the Grb2 SH2 domain in complex with a pY-containing peptide derived from CD28 at 1.35 Å resolution. The peptide was found to adopt a twisted U-type conformation, similar to, but distinct from type-I β-turn. In all previously reported crystal structures, the peptide bound to the Grb2 SH2 domains adopts a type-I β-turn conformation, except those with a proline residue at the pY+3 position. Molecular modeling also suggests that the same peptide bound to PI3K might adopt a very different conformation.

  5. Cold plasmas

    International Nuclear Information System (INIS)

    Franz, G.

    1990-01-01

    This textbook discusses the following topics: Phenomenological description of a direct current glow discharge; the plasma (temperature distribution and measurement, potential variation, electron energy distribution function, charge neutralization, wall potentials, plasma oscillations); Production of charge carriers (ions, electrons, ionization in the cathode zone, negative glowing zone, Faraday dark space, positive column, anode zone, hollow cathode discharges); RF-discharges (charge carrier production, RF-Shields, scattering mechanisms); Sputtering (ion-surface interaction, kinetics, sputtering yield and energy distribution, systems and conditions, film formation and stresses, contamination, bias techniques, multicomponent film deposition, cohesion, magnetrons, triode systems, plasma enhanced chemical vapor deposition); Dry etching (sputter etching, reactive etching, topography, process control, quantitative investigations); Etching mechanisms (etching of Si and SiO 2 with CF 4 , of III/V-compound-semiconductors, combination of isotrope and anisotrope etching methods, surface cleaning); ion beam systems (applications, etching); Dyclotron-resonance-systems (electron cyclotron resonance systems, whistler-sources and 'resonant inductive plasma etching'); Appendix (electron energy distribution functions, Bohm's transition zone, plasma oscillations, scattering cross sections and mean free path, metastable states, Child-Langmuir-Schottky equation, loss mechanisms, charge carrier distribution in the positive column, breakdown at high frequencies, motion in a magnetic field, skin depth of an electric field for a HF-discharge, whistler waves, dispersion relations for plane wave propagation). (orig.) With 138 figs

  6. Plasma heating

    International Nuclear Information System (INIS)

    Wilhelm, R.

    1989-01-01

    Successful plasma heating is essential in present fusion experiments, for the demonstration of DpT burn in future devices and finally for the fusion reactor itself. This paper discusses the common heating systems with respect to their present performance and their applicability to future fusion devices. The comparative discussion is oriented to the various function of heating, which are: - plasma heating to fusion-relevant parameters and to ignition in future machines, -non-inductive, steady-pstate current drive, - plasma profile control, -neutral gas breakdown and plasma build-up. In view of these different functions, the potential of neutral beam injection (NBI) and the various schemes of wave heating (ECRH, LH, ICRH and Alven wave heating) is analyzed in more detail. The analysis includes assessments of the present physical and technical state of these heating methods, and makes suggestions for future developments and about outstanding problems. Specific attention is given to the still critical problem of efficient current drive, especially with respect to further extrapolation towards an economically operating tokamak reactor. Remarks on issues such as reliability, maintenance and economy conclude this comparative overview on plasma heating systems. (author). 43 refs.; 13 figs.; 3 tabs

  7. Preparation and crystallization of the Grb7 SH2 domain in complex with the G7-18NATE nonphosphorylated cyclic inhibitor peptide

    International Nuclear Information System (INIS)

    Yap, Min Y.; Wilce, Matthew C. J.; Clayton, Daniel J.; Perlmutter, Patrick; Aguilar, Marie-Isabel; Wilce, Jacqueline A.

    2010-01-01

    The preparation and successful crystallization of the Grb7 SH2 domain in complex with the specific cyclic peptide inhibitor G7-18NATE are reported. This structure is anticipated to reveal the basis of the binding affinity and specificity and to assist with the development of second-generation inhibitors of Grb7, which is involved in cancer progression. Grb7 is an adapter protein that is involved in signalling pathways that mediate eukaryotic cell proliferation and migration. Its overexpression in several cancer types has implicated it in cancer progression and led to the development of the G7-18NATE cyclic peptide inhibitor. Here, the preparation of crystals of G7-18NATE in complex with its Grb7 SH2 domain target is reported. Crystals of the complex were grown by the hanging-drop vapour-diffusion method using PEG 3350 as the precipitant at room temperature. X-ray diffraction data were collected from crystals to 2.4 Å resolution using synchrotron X-ray radiation at 100 K. The diffraction was consistent with space group P2 1 , with unit-cell parameters a = 52.7, b = 79.1, c = 54.7 Å, α = γ = 90.0, β = 104.4°. The structure of the G7-18NATE peptide in complex with its target will facilitate the rational development of Grb7-targeted cancer therapeutics

  8. Neuroprotective effect of Demethoxycurcumin, a natural derivative of Curcumin on rotenone induced neurotoxicity in SH-SY 5Y Neuroblastoma cells.

    Science.gov (United States)

    Ramkumar, Muthu; Rajasankar, Srinivasagam; Gobi, Veerappan Venkatesh; Dhanalakshmi, Chinnasamy; Manivasagam, Thamilarasan; Justin Thenmozhi, Arokiasamy; Essa, Musthafa Mohamed; Kalandar, Ameer; Chidambaram, Ranganathan

    2017-04-18

    Mitochondrial dysfunction and oxidative stress are the main toxic events leading to dopaminergic neuronal death in Parkinson's disease (PD) and identified as vital objective for therapeutic intercession. This study investigated the neuro-protective effects of the demethoxycurcumin (DMC), a derivative of curcumin against rotenone induced neurotoxicity. SH-SY5Y neuroblastoma cells are divided into four experimental groups: untreated cells, cells incubated with rotenone (100 nM), cells treated with DMC (50 nM) + rotenone (100 nM) and DMC alone treated. 24 h after treatment with rotenone and 28 h after treatment with DMC, cell viability was assessed using the MTT assay, and levels of ROS and MMP, plus expression of apoptotic protein were analysed. Rotenone induced cell death in SH-SY5Y cells was significantly reduced by DMC pretreatment in a dose-dependent manner, indicating the potent neuroprotective effects of DMC. Rotenone treatment significantly increases the levels of ROS, loss of MMP, release of Cyt-c and expression of pro-apoptotic markers and decreases the expression of anti-apoptotic markers. Even though the results of the present study indicated that the DMC may serve as a potent therapeutic agent particularly for the treatment of neurodegenerative diseases like PD, further pre-clinical and clinical studies are required.

  9. PLASMA DEVICE

    Science.gov (United States)

    Gow, J.D.; Wilcox, J.M.

    1961-12-26

    A device is designed for producing and confining highenergy plasma from which neutrons are generated in copious quantities. A rotating sheath of electrons is established in a radial electric field and axial magnetic field produced within the device. The electron sheath serves as a strong ionizing medium to gas introdueed thereto and also functions as an extremely effective heating mechanism to the resulting plasma. In addition, improved confinement of the plasma is obtained by ring magnetic mirror fields produced at the ends of the device. Such ring mirror fields are defined by the magnetic field lines at the ends of the device diverging radially outward from the axis of the device and thereafter converging at spatial annular surfaces disposed concentrically thereabout. (AFC)

  10. Characterization of oxidation end product of plasma albumin 'in vivo'.

    Science.gov (United States)

    Musante, Luca; Bruschi, Maurizio; Candiano, Giovanni; Petretto, Andrea; Dimasi, Nazzareno; Del Boccio, Piero; Urbani, Andrea; Rialdi, Giovanni; Ghiggeri, Gian Marco

    2006-10-20

    Anti-oxidants are paradoxically much lower in plasma than inside cells even blood is comparably exposed to the oxidative stress. 'In vitro' models suggest a critical role of albumin as substitutive anti-oxidant in plasma but no proof for this role is available 'in vivo.' Herein, we demonstrate by LC/MS/MS that plasma albumin undergoes massive oxidation in primary nephrotic syndrome, involving stable sulphonation SO3- of the free SH of Cys 34 with +48Da increase in exact mass of the protein (ESI-MS) and formation of a fast moving isoform in the pH range between 5 and 7. Physical-chemical experiments with DSC and fluorescence spectra indicate a thermal stabilization of the structure upon oxidation. This is the first demonstration of massive oxidation of albumin 'in vivo' that reflects a functional role of the protein. Free radicals should be implicated in the pathogenesis of proteinuria in human FSGS.

  11. Assessment of intravenous pbi-shRNA PDX1 nanoparticle (OFHIRNA-PDX1) in yucatan swine.

    Science.gov (United States)

    Jay, C M; Ruoff, C; Kumar, P; Maass, H; Spanhel, B; Miller, M; Arrington, A; Montalvo, N; Gresham, V; Rao, D D; Evans, C; Wang, Z; Brunicardi, F C; Liu, S-H; Zhou, G; Senzer, N; Nemunaitis, J; King, L; Weeks, B; Clubb, F J; Fossum, T W; Maples, P B

    2013-12-01

    PDX1 (pancreatic and duodenal homeobox 1) is overexpressed in pancreatic cancer, and its reduction results in tumor regression. Bi-functional pbi-shRNA PDX1 nanoparticle (OFHIRNA-PDX1) utilizes the endogenous micro-RNA biogenesis pathway to effect cleavage- and non-cleavage-dependent degradation of PDX1 mRNA. We have shown that OFHIRNA-PDX1 reduces pancreatic tumor volume in xenograft models. Thus, we are now exploring biorelevant large animal safety of OFHIRNA-PDX1. Mini pigs were chosen as the biorelevant species based on the similarity of human and pig PDX1 target sequence. In the initial study, animals developed fever, lethargy, hyporexia and cutaneous hyperemia following administration of OFHIRNA-PDX1. Twenty-one days later, the same animals demonstrated less toxicity with a second OFHIRNA-PDX1 infusion in conjunction with a prophylactic regimen involving dexamethasone, diphenhydramine, Indocin and ranitidine. In a new group of animals, PDX1 protein (31 kDa) expression in the pancreas was significantly repressed at 48 and 72 h (85%, P=0.018 and 88%, P=0.013; respectively) following a single infusion of OFHIRNA-PDX1 but recovered to normal state within 7 days. In conclusion, a single intravenous infusion of OFHIRNA-PDX1 in conjunction with premedication in pigs was well tolerated and demonstrated significant PDX1 knockdown.

  12. SH2 Domain-Based FRET Biosensor for Measuring BCR-ABL Activity in Living CML Cells.

    Science.gov (United States)

    Fujioka, Mari; Asano, Yumi; Nakada, Shigeyuki; Ohba, Yusuke

    2017-01-01

    Fluorescent proteins (FPs) displaying distinct spectra have shed their light on a wide range of biological functions. Moreover, sophisticated biosensors engineered to contain single or multiple FPs, including Förster resonance energy transfer (FRET)-based biosensors, spatiotemporally reveal the molecular mechanisms underlying a variety of pathophysiological processes. However, their usefulness for applied life sciences has yet to be fully explored. Recently, our research group has begun to expand the potential of FPs from basic biological research to the clinic. Here, we describe a method to evaluate the responsiveness of leukemia cells from patients to tyrosine kinase inhibitors using a biosensor based on FP technology and the principle of FRET. Upon phosphorylation of the tyrosine residue of the biosensor, binding of the SH2 domain to phosphotyrosine induces conformational change of the biosensor and brings the donor and acceptor FPs into close proximity. Therefore, kinase activity and response to kinase inhibitors can be monitored by an increase and a decrease in FRET efficiency, respectively. As in basic research, this biosensor resolves hitherto arduous tasks and may provide innovative technological advances in clinical laboratory examinations. State-of-the-art detection devices that enable such innovation are also introduced.

  13. Electron plasma waves and plasma resonances

    International Nuclear Information System (INIS)

    Franklin, R N; Braithwaite, N St J

    2009-01-01

    In 1929 Tonks and Langmuir predicted of the existence of electron plasma waves in an infinite, uniform plasma. The more realistic laboratory environment of non-uniform and bounded plasmas frustrated early experiments. Meanwhile Landau predicted that electron plasma waves in a uniform collisionless plasma would appear to be damped. Subsequent experimental work verified this and revealed the curious phenomenon of plasma wave echoes. Electron plasma wave theory, extended to finite plasmas, has been confirmed by various experiments. Nonlinear phenomena, such as particle trapping, emerge at large amplitude. The use of electron plasma waves to determine electron density and electron temperature has not proved as convenient as other methods.

  14. ''Dusty plasmas''

    International Nuclear Information System (INIS)

    Tsytovich, V.N.; Bingham, R.; Angelis, U. de

    1989-09-01

    The field of ''dusty plasmas'' promises to be a very rewarding topic of research for the next decade or so, not only from the academic point of view where the emphasis is on developing the theory of the often complex collective and non-linear processes, but also from the point of view of applications in astrophysics, space physics, environmental and energy research. In this ''comment'' we should like to sketch the current development of this fast growing and potentially very important research area. We will discuss the new features of ''dusty'' plasmas in the most general terms and then briefly mention some successful applications and effects which have already been examined. (author)

  15. Changes in the concentration of sulfhydryl groups in tissues of rats under the influence of gamma-radiation and adeturon

    International Nuclear Information System (INIS)

    Pantev, T.; Bychvarova, K.

    1984-01-01

    The concentration of SH-groups in the spleen, liver and bone marrow in rats was determined using the method of Sedlak and Lindsey. The changes in thiol level have been traced under the single influence of Adeturon and combined influence of radiation with 7,5 Gy and of Adeturon introduced 15 min before radiation. The animals were killed on 30th, 45th and 90th minute after the exerted influence. The control animals had physiological solution introduced. under the single influence of Adeturon there was increase in SH-groups mainly in the bone marrow in later terms after the exerted influence (the 90th minute), while P-SH in the spleen and liver decrease within the same term. The changes of NP-SH in the spleen and liver are opposite in nature. Under the influence of radiation P-SH in the liver and the spleen slightly decrease, while those in the bone marrow considerably increase on the 60th minute. NP-SH abruptly decrease on the 45th minute in the liver, while those in the spleen and bone marrow slightly differentiate from the control values. In animals protected by Adeturon P-SH in the bone marrow increase on the 30th and 45th minute, while those in the spleen decrease on the 90th minute. NP-SH decrease in the liver. The results obtained show that under the influence of Adeturon some changes occur in the level of thiols in tissues of both nonradiated and radiated animals

  16. Characterization of a novel weak interaction between MUC1 and Src-SH3 using nuclear magnetic resonance spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Gunasekara, Nirosha [Department of Laboratory Medicine and Pathology, University of Alberta, 5B4.21 WCM Health Science Centre, 8440-112th Street, Edmonton, Alberta, Canada T6G 2R7 (Canada); Sykes, Brian, E-mail: brian.sykes@ualberta.ca [Department of Biochemistry, 4-19B Medical Sciences Bldg., University of Alberta Edmonton, Alberta, Canada T6G 2H7 (Canada); Hugh, Judith, E-mail: judithh@ualberta.ca [Department of Laboratory Medicine and Pathology, University of Alberta, 5B4.21 WCM Health Science Centre, 8440-112th Street, Edmonton, Alberta, Canada T6G 2R7 (Canada)

    2012-05-18

    Highlights: Black-Right-Pointing-Pointer MUC1 binds the Src-SH3 domain potentially triggering Src dependent cell migration. Black-Right-Pointing-Pointer NMR Spectroscopy was used to monitor MUC1-CD and Src SH3 domain titrations. Black-Right-Pointing-Pointer MUC1-CD peptides bind with a low affinity (K{sub d} of 2-3 mM) to a non-canonical site. Black-Right-Pointing-Pointer Weak interactions may mediate dynamic processes like migration. Black-Right-Pointing-Pointer The MUC1-CD and Src-SH3 interaction may be a prime target to inhibit cell migration. -- Abstract: Breast cancer causes death through cancer cell migration and subsequent metastasis to distant organs. In vitro, the MUC1 mucin can mediate breast cancer cell migration by binding to intercellular adhesion molecule-1 (ICAM-1). This migration is dependent on MUC1 cytoplasmic domain (MUC1-CD) activation of the non-receptor tyrosine kinase, Src, possibly through competitive displacement of an inhibitory Src intramolecular SH3 binding. Therefore, we characterized the binding site and affinity of the MUC1-CD for Src-SH3 using multidimensional nuclear magnetic resonance (NMR) spectroscopy to monitor the titration of the {sup 15}N labeled Src-SH3 domain with synthetic native and mutant peptides of MUC1-CD. The results revealed that the dissociation constant (K{sub d}) for the interaction of the native MUC1-CD peptides and Src-SH3 domain was weak with a K{sub d} of 2-3 mM. Notably, the SH3 residues most perturbed upon peptide binding were located outside the usual hydrophobic binding cleft in a previously described alternate binding site on the Src-SH3, suggesting that MUC1-CD binds to a non-canonical site. The binding characteristics outlined here suggest that the interaction between Src-SH3 and MUC1-CD represents a novel weak electrostatic interaction of the type which is increasingly recognized as important in transient and dynamic protein complexes required for cell migration and signal transduction. As such, this

  17. Plasma physics and engineering

    CERN Document Server

    Fridman, Alexander

    2011-01-01

    Part I: Fundamentals of Plasma Physics and Plasma ChemistryPlasma in Nature, in the Laboratory, and in IndustryOccurrence of Plasma: Natural and Man MadeGas DischargesPlasma Applications, Plasmas in IndustryPlasma Applications for Environmental ControlPlasma Applications in Energy ConversionPlasma Application for Material ProcessingBreakthrough Plasma Applications in Modern TechnologyElementary Processes of Charged Species in PlasmaElementary Charged Particles in Plasma and Their Elastic and Inelastic CollisionsIonization ProcessesMechanisms of Electron Losses: The Electron-Ion RecombinationEl

  18. Plasma chromograninx

    DEFF Research Database (Denmark)

    Goetze, Jens P; Hilsted, Linda M; Rehfeld, Jens F

    2014-01-01

    Cardiovascular risk assessment remains difficult in elderly patients. We examined whether chromogranin A (CgA) measurement in plasma may be valuable in assessing risk of death in elderly patients with symptoms of heart failure in a primary care setting. A total of 470 patients (mean age 73 years...

  19. Burning plasmas

    International Nuclear Information System (INIS)

    Furth, H.P.; Goldston, R.J.; Zweben, S.J.

    1990-10-01

    The fraction of fusion-reaction energy that is released in energetic charged ions, such as the alpha particles of the D-T reaction, can be thermalized within the reacting plasma and used to maintain its temperature. This mechanism facilitates the achievement of very high energy-multiplication factors Q, but also raises a number of new issues of confinement physics. To ensure satisfactory reaction operation, three areas of energetic-ion interaction need to be addressed: single-ion transport in imperfectly symmetric magnetic fields or turbulent background plasmas; energetic-ion-driven (or stabilized) collective phenomena; and fusion-heat-driven collective phenomena. The first of these topics is already being explored in a number of tokamak experiments, and the second will begin to be addressed in the D-T-burning phase of TFTR and JET. Exploration of the third topic calls for high-Q operation, which is a goal of proposed next-generation plasma-burning projects. Planning for future experiments must take into consideration the full range of plasma-physics and engineering R ampersand D areas that need to be addressed on the way to a fusion power demonstration

  20. Specific phosphopeptide binding regulates a conformational change in the PI 3-kinase SH2 domain associated with enzyme activation.

    Science.gov (United States)

    Shoelson, S E; Sivaraja, M; Williams, K P; Hu, P; Schlessinger, J; Weiss, M A

    1993-01-01

    SH2 (src-homology 2) domains define a newly recognized binding motif that mediates the physical association of target phosphotyrosyl proteins with downstream effector enzymes. An example of such phosphoprotein-effector coupling is provided by the association of phosphatidylinositol 3-kinase (PI 3-kinase) with specific phosphorylation sites within the PDGF receptor, the c-Src/polyoma virus middle T antigen complex and the insulin receptor substrate IRS-1. Notably, phosphoprotein association with the SH2 domains of p85 also stimulates an increase in catalytic activity of the PI 3-kinase p110 subunit, which can be mimicked by phosphopeptides corresponding to targeted phosphoprotein phosphorylation sites. To investigate how phosphoprotein binding to the p85 SH2 domain stimulates p110 catalytic activation, we have examined the differential effects of phosphotyrosine and PDGF receptor-, IRS-1- and c-Src-derived phosphopeptides on the conformation of an isolated SH2 domain of PI 3-kinase. Although phosphotyrosine and both activating and non-activating phosphopeptides bind to the SH2 domain, activating phosphopeptides bind with higher affinity and induce a qualitatively distinct conformational change as monitored by CD and NMR spectroscopy. Amide proton exchange and protease protection assays further show that high affinity, specific phosphopeptide binding induces non-local dynamic SH2 domain stabilization. Based on these findings we propose that specific phosphoprotein binding to the p85 subunit induces a change in SH2 domain structure which is transmitted to the p110 subunit and regulates enzymatic activity by an allosteric mechanism. Images PMID:8382612