WorldWideScience

Sample records for plant-specific stilbene polyketides

  1. Prototype Stilbene Neutron Collar

    Energy Technology Data Exchange (ETDEWEB)

    Prasad, M. K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Shumaker, D. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Snyderman, N. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Verbeke, J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Wong, J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2016-10-26

    A neutron collar using stilbene organic scintillator cells for fast neutron counting is described for the assay of fresh low enriched uranium (LEU) fuel assemblies. The prototype stilbene collar has a form factor similar to standard He-3 based collars and uses an AmLi interrogation neutron source. This report describes the simulation of list mode neutron correlation data on various fuel assemblies including some with neutron absorbers (burnable Gd poisons). Calibration curves (doubles vs 235U linear mass density) are presented for both thermal and fast (with Cd lining) modes of operation. It is shown that the stilbene collar meets or exceeds the current capabilities of He-3 based neutron collars. A self-consistent assay methodology, uniquely suited to the stilbene collar, using triples is described which complements traditional assay based on doubles calibration curves.

  2. Hybrid polyketide synthases

    Energy Technology Data Exchange (ETDEWEB)

    Fortman, Jeffrey L.; Hagen, Andrew; Katz, Leonard; Keasling, Jay D.; Poust, Sean; Zhang, Jingwei; Zotchev, Sergey

    2016-05-10

    The present invention provides for a polyketide synthase (PKS) capable of synthesizing an even-chain or odd-chain diacid or lactam or diamine. The present invention also provides for a host cell comprising the PKS and when cultured produces the even-chain diacid, odd-chain diacid, or KAPA. The present invention also provides for a host cell comprising the PKS capable of synthesizing a pimelic acid or KAPA, and when cultured produces biotin.

  3. Engineering the Polyketide Cell Factory

    DEFF Research Database (Denmark)

    Mølgaard, Louise

    sufficient titers. To improve the production of polyketides biological engineering principles have been applied for the development and engineering of microbial polyketide cell factories. The two biological hosts used for heterologous polyketide production were Aspergillus nidulans and Saccharomyces...... phosphopantetheinylase (PPTase). This versatile vector system can easily be used for expression of other polyketides of interest as well as extended to express whole gene clusters. After achieving proof of principle in terms of expression, the polyketide cell factory must be optimized. The optimization can be achieved...... characterization in bioreactors revealed that the yields of 6-MSA on biomass increased albeit not significantly. As a result of this it may be argued that there is still more work to be done in terms of model building in A. nidulans. Utilizing another well-established cell factory S. cerevisiae the capabilities...

  4. Two new stilbene trimers from Cynodon dactylon.

    Science.gov (United States)

    Li, Bi-Jun; Liu, Yao; Gu, Ai-Tong; Zhang, Qing; Chen, Lei; Wang, Shu-Mei; Wang, Feng

    2017-11-01

    Many naturally occurring oligostilbenes have drawn considerable attention because of their intricate structures and diverse bioactivities. Two new stilbene trimers, cystibenetrimerol A (1) and cystibenetrimerol B (2) were isolated from the dried grass of Cynodon dactylon (L.) Pers. The planar structures and stereo configurations of them were elucidated by spectroscopic and spectrometric methods. The isolation and structures elucidation of two new stilbene trimers suggested the ordinary grass belonging to the family Poaceae may be a rich source of stilbene oligomers.

  5. Digital Data Processing of Stilbene

    International Nuclear Information System (INIS)

    AMIRI, Moslem; MATEJ, Zdenek; MRAVEC, Filip; PRENOSIL, Vaclav; CVACHOVEC, Frantisek

    2013-06-01

    Stilbene is a proven spectrometric detector for mixed fields of neutrons and gamma rays. By digital processing of shape output pulses from the detector it is possible to obtain information about the energy of the interacting neutron / photon and distinguish which of these two particles interacts in the detector. Another numerical processing of digital data can finalize the energy spectrum of both components of the mixed field. The quality of the digitized data is highly dependent on the parameters of the hardware used for digitization and on the quality of software processing. Our results also show how the quality of the particle type identification depends on the sampling rate and as well as the method of processing of the sampled data. (authors)

  6. Polyketides isolated from Penicillium herquei

    International Nuclear Information System (INIS)

    Marinho, Andrey Moacir do Rosario; Marinho, Patricia Santana Barbosa; Rodrigues Filho, Edson; Ferreira, Izabel Cristina Piloto

    2011-01-01

    In this work we are reporting the isolation of polyketides citreoserine (1), emodin (2), janthinone (3), dihydrocitrinone (4) and citrinin H-1 (5). The compounds were isolated by chromatographic procedures and identified by spectral methods of NMR 1D and 2D and MS. The compounds 1, 2 and 3 were tested against promastigotes of Leishmania brasiliensis. (author)

  7. Isomerization Intermediates In Solution Phase Photochemistry Of Stilbenes

    Science.gov (United States)

    Doany, F. E.; Hochstrasser, R. M.; Greene, B. I.

    1985-04-01

    Picosecond and subpicosecond spectroscopic studies have revealed evidence for an isomerization intermediate between cis and trans in the photoinduced isomerism of both stilbene and biindanyledene ("stiff" stilbene). In stiff stilbene, a transient absorption at 351 nm displays time evolution and viscosity dependence consistent with absorption by a twisted intermediate ("phantom" state) with a lOps lifetime. An analagous bottleneck state with a life-time of 4ps is also consistent with the ground state recovery dynamics of t-stilbene following excitation of c-stilbene when monitored with 0.1ps resolution.

  8. Producing biofuels using polyketide synthases

    Science.gov (United States)

    Katz, Leonard; Fortman, Jeffrey L; Keasling, Jay D

    2013-04-16

    The present invention provides for a non-naturally occurring polyketide synthase (PKS) capable of synthesizing a carboxylic acid or a lactone, and a composition such that a carboxylic acid or lactone is included. The carboxylic acid or lactone, or derivative thereof, is useful as a biofuel. The present invention also provides for a recombinant nucleic acid or vector that encodes such a PKS, and host cells which also have such a recombinant nucleic acid or vector. The present invention also provides for a method of producing such carboxylic acids or lactones using such a PKS.

  9. Sampling Terrestrial Environments for Bacterial Polyketides

    Directory of Open Access Journals (Sweden)

    Patrick Hill

    2017-04-01

    Full Text Available Bacterial polyketides are highly biologically active molecules that are frequently used as drugs, particularly as antibiotics and anticancer agents, thus the discovery of new polyketides is of major interest. Since the 1980s discovery of polyketides has slowed dramatically due in large part to the repeated rediscovery of known compounds. While recent scientific and technical advances have improved our ability to discover new polyketides, one key area has been under addressed, namely the distribution of polyketide-producing bacteria in the environment. Identifying environments where producing bacteria are abundant and diverse should improve our ability to discover (bioprospect new polyketides. This review summarizes for the bioprospector the state-of-the-field in terrestrial microbial ecology. It provides insight into the scientific and technical challenges limiting the application of microbial ecology discoveries for bioprospecting and summarizes key developments in the field that will enable more effective bioprospecting. The major recent efforts by researchers to sample new environments for polyketide discovery is also reviewed and key emerging environments such as insect associated bacteria, desert soils, disease suppressive soils, and caves are highlighted. Finally strategies for taking and characterizing terrestrial samples to help maximize discovery efforts are proposed and the inclusion of non-actinomycetal bacteria in any terrestrial discovery strategy is recommended.

  10. Crystallization and preliminary crystallographic analysis of an acridone-producing novel multifunctional type III polyketide synthase from Huperzia serrata

    Energy Technology Data Exchange (ETDEWEB)

    Morita, Hiroyuki [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan); Kondo, Shin; Kato, Ryohei [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Wanibuchi, Kiyofumi; Noguchi, Hiroshi [School of Pharmaceutical Sciences, University of Shizuoka and the COE21 Program, Shizuoka 422-8526 (Japan); Sugio, Shigetoshi [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Abe, Ikuro [School of Pharmaceutical Sciences, University of Shizuoka and the COE21 Program, Shizuoka 422-8526 (Japan); PRESTO, Japan Science and Technology Agency, Kawaguchi, Saitama 332-0012 (Japan); Kohno, Toshiyuki [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan)

    2007-07-01

    An acridone-producing novel type III polyketide synthase from H. serrata has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.0 Å. Polyketide synthase 1 (PKS1) from Huperzia serrata is a plant-specific type III polyketide synthase that shows an unusually versatile catalytic potential, producing various aromatic tetraketides, including chalcones, benzophenones, phlorogulucinols and acridones. Recombinant H. serrata PKS1 expressed in Escherichia coli was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 73.3, b = 85.0, c = 137.7 Å, α = β = γ = 90.0°. Diffraction data were collected to 2.0 Å resolution using synchrotron radiation at BL24XU of SPring-8.

  11. Photoinduced gelation by stilbene oxalyl amide compounds.

    Science.gov (United States)

    Miljanić, Snezana; Frkanec, Leo; Meić, Zlatko; Zinić, Mladen

    2005-03-29

    Oxalyl amide derivatives bearing 4-dodecyloxy-stilbene as a cis-trans photoisomerizing unit were synthesized. The trans derivative acted as a versatile gelator of various organic solvents, whereas the corresponding cis derivative showed a poor gelation ability or none at all. In diluted solution (c = 2.0 x10(-5) mol dm(-3), ethanol), the cis isomer was photochemically converted into the trans isomer within 4 min. Depending on the radiation wavelength, the trans isomer was stable or liable to photodecomposition. When exposed to irradiation, a concentrated solution of the cis isomer (c = 2.0 x 10(-2) mol dm(-3), ethanol) turned into a gel. The FT-Raman, FT-IR, and 1H NMR spectra demonstrated that the gelation process occurred because of a rapid cis --> trans photoisomerization followed by a self-assembly of the trans molecules. Apart from the formation of hydrogen bonding between the oxalyl amide parts of the molecules, confirmed by FT-IR spectroscopy, it was assumed that the pi-pi stacking between the trans-stilbene units of the molecule and a lipophilic interaction between long alkyl chains were the interactions responsible for gelation.

  12. Genetics of Polyketide Metabolism in Aspergillus nidulans

    Directory of Open Access Journals (Sweden)

    Marie L. Klejnstrup

    2012-01-01

    Full Text Available Secondary metabolites are small molecules that show large structural diversity and a broad range of bioactivities. Some metabolites are attractive as drugs or pigments while others act as harmful mycotoxins. Filamentous fungi have the capacity to produce a wide array of secondary metabolites including polyketides. The majority of genes required for production of these metabolites are mostly organized in gene clusters, which often are silent or barely expressed under laboratory conditions, making discovery and analysis difficult. Fortunately, the genome sequences of several filamentous fungi are publicly available, greatly facilitating the establishment of links between genes and metabolites. This review covers the attempts being made to trigger the activation of polyketide metabolism in the fungal model organism Aspergillus nidulans. Moreover, it will provide an overview of the pathways where ten polyketide synthase genes have been coupled to polyketide products. Therefore, the proposed biosynthesis of the following metabolites will be presented; naphthopyrone, sterigmatocystin, aspyridones, emericellamides, asperthecin, asperfuranone, monodictyphenone/emodin, orsellinic acid, and the austinols.

  13. Water deficit increases stilbene metabolism in Cabernet Sauvignon berries.

    Science.gov (United States)

    Deluc, Laurent G; Decendit, Alain; Papastamoulis, Yorgos; Mérillon, Jean-Michel; Cushman, John C; Cramer, Grant R

    2011-01-12

    The impact of water deficit on stilbene biosynthesis in wine grape (Vitis vinifera) berries was investigated. Water deficit increased the accumulation of trans-piceid (the glycosylated form of resveratrol) by 5-fold in Cabernet Sauvignon berries but not in Chardonnay. Similarly, water deficit significantly increased the transcript abundance of genes involved in the biosynthesis of stilbene precursors in Cabernet Sauvignon. Increased expression of stilbene synthase, but not that of resveratrol-O-glycosyltransferase, resulted in increased trans-piceid concentrations. In contrast, the transcript abundance of the same genes declined in Chardonnay in response to water deficit. Twelve single nucleotide polymorphisms (SNPs) were identified in the promoters of stilbene synthase genes of Cabernet Sauvignon, Chardonnay, and Pinot Noir. These polymorphisms resulted in eight changes within the predicted cis regulatory elements in Cabernet Sauvignon and Chardonnay. These results suggest that cultivar-specific molecular mechanisms might exist that control resveratrol biosynthesis in grapes.

  14. Engineered biosynthesis of regioselectively modified aromatic polyketides using bimodular polyketide synthases.

    Directory of Open Access Journals (Sweden)

    Yi Tang

    2004-02-01

    Full Text Available Bacterial aromatic polyketides such as tetracycline and doxorubicin are a medicinally important class of natural products produced as secondary metabolites by actinomyces bacteria. Their backbones are derived from malonyl-CoA units by polyketide synthases (PKSs. The nascent polyketide chain is synthesized by the minimal PKS, a module consisting of four dissociated enzymes. Although the biosynthesis of most aromatic polyketide backbones is initiated through decarboxylation of a malonyl building block (which results in an acetate group, some polyketides, such as the estrogen receptor antagonist R1128, are derived from nonacetate primers. Understanding the mechanism of nonacetate priming can lead to biosynthesis of novel polyketides that have improved pharmacological properties. Recent biochemical analysis has shown that nonacetate priming is the result of stepwise activity of two dissociated PKS modules with orthogonal molecular recognition features. In these PKSs, an initiation module that synthesizes a starter unit is present in addition to the minimal PKS module. Here we describe a general method for the engineered biosynthesis of regioselectively modified aromatic polyketides. When coexpressed with the R1128 initiation module, the actinorhodin minimal PKS produced novel hexaketides with propionyl and isobutyryl primer units. Analogous octaketides could be synthesized by combining the tetracenomycin minimal PKS with the R1128 initiation module. Tailoring enzymes such as ketoreductases and cyclases were able to process the unnatural polyketides efficiently. Based upon these findings, hybrid PKSs were engineered to synthesize new anthraquinone antibiotics with predictable functional group modifications. Our results demonstrate that (i bimodular aromatic PKSs present a general mechanism for priming aromatic polyketide backbones with nonacetate precursors; (ii the minimal PKS controls polyketide chain length by counting the number of atoms

  15. Characteristics evaluation of stilbene single crystal grown by vertical bridgman technique

    International Nuclear Information System (INIS)

    Jo, Kwang Ho

    2012-02-01

    As the nature of organic scintillator, stilbene single crystal's decay time is only a couple of nano seconds, which makes it suitable for fast neutron detection. However, the entire amount of stilbene single crystal being used relies on import currently. As the necessity of fast neutron detection equipment such as KSTAR and Sodium-cooled Fast Reactor system increases, the goal is to have our own domestic technology through the growth of stilbene single crystal. The emission wavelength of grown stilbene single crystal is confirmed, and the property of grown stilbene single crystal is assessed compared to commercial stilbene (Ukraine ISMA research center) through gamma ray and neutron tests. In this research, we have grown stilbenes through Bridgman technique, and obtained three stilbenes out of two amples. (Two ones of Φ 30 mm x 15 mm, and Φ 40 mm x 17 mm from the first ample, and size of Φ 25 mm x 13 mm from the other) The grown stilbene's emission wavelength and inherent property of stilbene are confirmed. As the result of gamma ray test, we have confirmed linearity of grown stilbene's scintillator, and the relative light yield ratio is proven 101% efficiency to reference stilbene. Neutron detection efficiency of the three stilbenes amounts to 80% of reference stilbene, and FOM of them is 108% efficiency to reference stilbene's one. Although Ukraine ISMA research center still holds a dominant position with world-class efficiency and performance of its stilbene, we expect to produce a better stilbene with our domestic technology development. Through this, fast neutron detection technique can be obtained, which opens up an opportunity to be used not only in neutron monitoring system in nuclear fusion reactor, but also in alternative measurement technique as the unit price of He-3 increases recently

  16. Utilization of NPP Krsko plant specific simulator

    International Nuclear Information System (INIS)

    Fifnja, I.; Pribozic, F.; Krajnc, J.

    2002-01-01

    NPP Krsko started with licensed operator training using its own plant-specific full scope simulator in April 2000. Today, two years after simulator was completed, the benefits of simulator use are visible in various fields. The simulator was effectively used to conduct licensed operator continuing training and practical examinations. Two-year continuous training program was designed to help maintain and improve operator performance. The simulator was also used to provide just-in-time training prior to plant evolutions. Together with licensed operators the non-licensed operators are also included into simulator training to provide affective team training opportunity and to foster good communication and increase scenario realism. Now, the first group of initial licensed operator training using plant-specific simulator is also almost completed. It is the first time that NPP Krsko training department conducted complete initial training and this will represent the great experience for future training. Besides training, the simulator was also utilized for procedure development and validation, operating standards development, testing of plant modifications and other activities, like emergency preparedness procedures validation and training exercises.(author)

  17. Stilbene dimer radical cations in the radiolyses of stilbenes and 1,2,3,4-tetraphenylcyclobutanes

    International Nuclear Information System (INIS)

    Tojo, Sachiko; Morishima, Kazuhiro; Ishida, Akito; Majima, Tetsuro; Takamuku, Setsuo

    1995-01-01

    The reaction of the stilbene radical cation formed by pulse radiolysis or γ-radiolyses is explained based on neutralization as well as the formation of a π-type stilbene dimer radical cation (π-St 2 +· ), converting to the σ-type St 2 +· (σ-St 2 +· ). The r-1, c-2, t-3, t-4-tetraphenylcyclobutane radical cation generated in a rigid matrix at 77 K which converted to σ-St 2 +· upon warming. Both r-1, c-2, t-3, t-4- and r-1, t-2, c-3, t-4-tetraphenylcyclobutane radical cations underwent photochemical cycloreversion to π-St 2 +· upon irradiation at wavelengths longer than 390 nm at 77 K, and converted to σ-St 2 +· upon warming. It is suggested that π-St 2 +· has overlapping arrangements of π-electrons, while σ-St 2 +· has radical and cation centers on the 1- and 4-positions of the C 4 linkage. (author)

  18. Photoisomerization of Stilbene: The Detailed XMCQDPT2 Treatment.

    Science.gov (United States)

    Ioffe, I N; Granovsky, A A

    2013-11-12

    We report the detailed XMCQDPT2/cc-pVTZ study of trans-cis photoisomerization in one of the core systems of both experimental and computational photochemistry-the stilbene molecule. For the first time, the potential energy surface (PES) of the S1 state has been directly optimized and scanned using a multistate multiconfiguration second-order perturbation theory. We characterize the trans-stilbene, pyramidalized (phantom), and DHP-cis-stilbene geometric domains of the S1 state and describe their stationary points including the transition states between them, as well as S1/S0 intersections. Also reported are the minima and the activation barriers in the ground state. Our calculations correctly predict the kinetic isotope effect due to H/D exchange at ethylenic hydrogens, the dynamic behavior of excited cis-stilbene, and trans-cis branching ratio after relaxation to S0 through a rather unsymmetric conical intersection. In general, the XMCQDPT2 results confirm the qualitative adequacy of the TDDFT (especially SF-TDDFT) picture of the excited stilbene but also reveal quantitative discrepancies that deserve further exploration.

  19. Stilbene crystalline powder in polymer base as a new fast neutron detector

    International Nuclear Information System (INIS)

    Budakovsky, S.V.; Galunov, N.Z.; Grinyov, B.V.; Karavaeva, N.L.; Kyung Kim, Jong; Kim, Yong-Kyun; Pogorelova, N.V.; Tarasenko, O.A.

    2007-01-01

    A new organic scintillation material consisting of stilbene grains in a polymer glue base is presented. The crystalline grains of stilbene are obtained by mechanical grinding of stilbene single crystals. The resulting composite scintillators have been studied as detectors for fast neutrons

  20. Genome-wide analysis of the grapevine stilbene synthase multigenic family: genomic organization and expression profiles upon biotic and abiotic stresses

    Directory of Open Access Journals (Sweden)

    Vannozzi Alessandro

    2012-08-01

    Full Text Available Abstract Background Plant stilbenes are a small group of phenylpropanoids, which have been detected in at least 72 unrelated plant species and accumulate in response to biotic and abiotic stresses such as infection, wounding, UV-C exposure and treatment with chemicals. Stilbenes are formed via the phenylalanine/polymalonate-route, the last step of which is catalyzed by the enzyme stilbene synthase (STS, a type III polyketide synthase (PKS. Stilbene synthases are closely related to chalcone synthases (CHS, the key enzymes of the flavonoid pathway, as illustrated by the fact that both enzymes share the same substrates. To date, STSs have been cloned from peanut, pine, sorghum and grapevine, the only stilbene-producing fruiting-plant for which the entire genome has been sequenced. Apart from sorghum, STS genes appear to exist as a family of closely related genes in these other plant species. Results In this study a complete characterization of the STS multigenic family in grapevine has been performed, commencing with the identification, annotation and phylogenetic analysis of all members and integration of this information with a comprehensive set of gene expression analyses including healthy tissues at differential developmental stages and in leaves exposed to both biotic (downy mildew infection and abiotic (wounding and UV-C exposure stresses. At least thirty-three full length sequences encoding VvSTS genes were identified, which, based on predicted amino acid sequences, cluster in 3 principal groups designated A, B and C. The majority of VvSTS genes cluster in groups B and C and are located on chr16 whereas the few gene family members in group A are found on chr10. Microarray and mRNA-seq expression analyses revealed different patterns of transcript accumulation between the different groups of VvSTS family members and between VvSTSs and VvCHSs. Indeed, under certain conditions the transcriptional response of VvSTS and VvCHS genes appears to be

  1. Genetics of Polyketide Metabolism in Aspergillus nidulans

    DEFF Research Database (Denmark)

    Klejnstrup, Marie L.; Frandsen, Rasmus John Normand; Holm, Dorte Koefoed

    2012-01-01

    Secondary metabolites are small molecules that show large structural diversity and a broad range of bioactivities. Some metabolites are attractive as drugs or pigments while others act as harmful mycotoxins. Filamentous fungi have the capacity to produce a wide array of secondary metabolites...... including polyketides. The majority of genes required for production of these metabolites are mostly organized in gene clusters, which often are silent or barely expressed under laboratory conditions, making discovery and analysis difficult. Fortunately, the genome sequences of several filamentous fungi...

  2. A powerful tool for plant specific simulations

    International Nuclear Information System (INIS)

    Boucau, J.; Ofstun, R.

    1988-01-01

    Following the Three Mile Island (TMI) accident, special emphasis has been placed by the Utilities and Safety Authorities on the training of plant operators and engineers to make them more familiar with the dynamic behavior of the plant in post-accident conditions. With a view to providing transient response under realistic operating conditions, concerns were raised over: the use of conservative safety analysis models for analyzing operational and accident transients; the ability to dynamically simulate the expected operator actions, and the need to simulate the plant during long term cooling recovery. To meet these requirements, an interactive, user friendly, cost efficient dynamic model capable of simulating two-phase conditions is needed. In response to these post-TMI concerns, Westinghouse has developed, the Transient Real-Time Engineering Analysis Tool (TREAT) which is a general purpose interactive thermal-hydraulic network code for thermal-hydraulic transient analysis. The applications of TREAT are numerous and range from engineering studies to plant operator training using the newly developed TREAT SIMULATOR. The purpose of this paper is to describe the TREAT program and potential applications. Special emphasis will be drawn at a plant specific training application performed for a French 4-loop plant

  3. Crystallization and preliminary crystallographic analysis of an octaketide-producing plant type III polyketide synthase

    Energy Technology Data Exchange (ETDEWEB)

    Morita, Hiroyuki [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan); Kondo, Shin; Kato, Ryohei [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Wanibuchi, Kiyofumi; Noguchi, Hiroshi [School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka 422-8526 (Japan); Sugio, Shigetoshi, E-mail: sugio.shigetoshi@mw.m-kagaku.co.jp [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Abe, Ikuro, E-mail: sugio.shigetoshi@mw.m-kagaku.co.jp [School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka 422-8526 (Japan); PRESTO, Japan Science and Technology Agency, Kawaguchi, Saitama 332-0012 (Japan); Kohno, Toshiyuki, E-mail: sugio.shigetoshi@mw.m-kagaku.co.jp [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan)

    2007-11-01

    Octaketide synthase from A. arborescens has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.6 Å. Octaketide synthase (OKS) from Aloe arborescens is a plant-specific type III polyketide synthase that produces SEK4 and SEK4b from eight molecules of malonyl-CoA. Recombinant OKS expressed in Escherichia coli was crystallized by the hanging-drop vapour-diffusion method. The crystals belonged to space group I422, with unit-cell parameters a = b = 110.2, c = 281.4 Å, α = β = γ = 90.0°. Diffraction data were collected to 2.6 Å resolution using synchrotron radiation at BL24XU of SPring-8.

  4. Plant specific basic principle simulator as a first step to plant specific full scope simulator

    International Nuclear Information System (INIS)

    Krajnc, B.; Pribozic, F.; Novsak, M.

    1996-01-01

    Nuklearna Elektrarna Krsko (NEK) decided to enhance the quality and scope of initial training of NEK technical personnel, mainly in so called Phase 1 and 2 of training for licensed personnel. This training is a prerequisite for further training on the full scope simulator for future operators and is also given to larger number of engineers, working in different important areas where thorough knowledge of nuclear technology and plant systems is required. Due to that it was decided that plant specific Basis Principle Simulators (BPS) should be developed. The other important reason for such decision was an indication that NEK specific full scope simulator will have to be purchased. Based on that it was concluded that BPS should serve as a good opportunity to learn about the state of the art approaches in the modeling area, to see in which direction development of software in conjunction with state of the art hardware is going and in particular to the extent possible verify the existence of required plant documentation in support BPS and later plant specific full scope simulator. In this paper the scope of NEK BPS simulation, experience in initial data gathering, experience with know-how transfer based on direct involvement of NEK and Izobrazevalni Center za Jedrsko Tehnnologijo (ICJT) personnel in modeling of instrumentation and control will be presented. Lessons learned, particularly in light of coming project for NEK full scope simulator, will also be addressed. The future use of the BPS in the NEK training programs will be described. It can be concluded that due to very complex technology, phase approaches in training of key NEK technical personnel, the development of NEK plant specific BPS is justifiable, regardless of the fact that NEK will also obtain specific full scope simulator. It has to be pointed out that BPS can not be supplement for plant specific full scope simulator, due to number of reasons discussed in the paper. (author)

  5. Engineered fungal polyketide biosynthesis in Pichia pastoris: a potential excellent host for polyketide production.

    Science.gov (United States)

    Gao, Limei; Cai, Menghao; Shen, Wei; Xiao, Siwei; Zhou, Xiangshan; Zhang, Yuanxing

    2013-09-08

    Polyketides are one of the most important classes of secondary metabolites and usually make good drugs. Currently, heterologous production of fungal polyketides for developing a high potential industrial application system with high production capacity and pharmaceutical feasibility was still at its infancy. Pichia pastoris is a highly successful system for the high production of a variety of heterologous proteins. In this work, we aim to develop a P. pastoris based in vivo fungal polyketide production system for first time and evaluate its feasibility for future industrial application. A recombinant P. pastoris GS115-NpgA-ATX with Aspergillus nidulans phosphopantetheinyl transferase (PPtase) gene npgA and Aspergillus terrus 6-methylsalicylic acid (6-MSA) synthase (6-MSAS) gene atX was constructed. A specific compound was isolated and identified as 6-MSA by HPLC, LC-MS and NMR. Transcription of both genes were detected. In 5-L bioreactor, the GS115-NpgA-ATX grew well and produced 6-MSA quickly until reached a high value of 2.2 g/L by methanol induction for 20 hours. Thereafter, the cells turned to death ascribing to high concentration of antimicrobial 6-MSA. The distribution of 6-MSA changed that during early and late induction phase it existed more in supernatant while during intermediate stage it mainly located intracellular. Different from 6-MSA production strain, recombinant M. purpureus pksCT expression strains for citrinin intermediate production, no matter PksCT located in cytoplasm or in peroxisomes, did not produce any specific compound. However, both npgA and pksCT transcripted effectively in cells and western blot analysis proved the expression of PPtase. Then the PPTase was expressed and purified, marked by fluorescent probes, and reacted with purified ACP domain and its mutant ACPm of PksCT. Fluoresence was only observed in ACP but not ACPm, indicating that the PPTase worked well with ACP to make it bioactive holo-ACP. Thus, some other factors may

  6. Effect of stilbene resveratrol on haematological indices of rats

    Czech Academy of Sciences Publication Activity Database

    Doubek, J.; Volný, T.; Lojek, Antonín; Knotková, Z.; Kotrbáček, V.; Scheer, P.; Holešovská, Z.

    2005-01-01

    Roč. 74, č. 2 (2005), s. 205-208 ISSN 0001-7213 Institutional research plan: CEZ:AV0Z50040507 Keywords : antioxidative capacity * stilbene-resveratrol Subject RIV: BO - Biophysics Impact factor: 0.353, year: 2005

  7. Fungal polyketide azaphilone pigments as future natural food colorants?

    DEFF Research Database (Denmark)

    Mapari, Sameer Shamsuddin; Thrane, Ulf; Meyer, Anne S.

    2010-01-01

    The recent approval of fungal carotenoids as food colorants by the European Union has strengthened the prospects for fungal cell factories for the production of polyketide pigments. Fungal production of colorants has the main advantage of making the manufacturer independent of the seasonal supply...... functionality and to expand the color palette of contemporary natural food colorants.......The recent approval of fungal carotenoids as food colorants by the European Union has strengthened the prospects for fungal cell factories for the production of polyketide pigments. Fungal production of colorants has the main advantage of making the manufacturer independent of the seasonal supply...... of raw materials, thus minimizing batch-to-batch variations. Here, we review the potential of polyketide pigments produced from chemotaxonomically selected non-toxigenic fungal strains (e.g. Penicillium and Epicoccum spp.) to serve as food colorants. We argue that the production of polyketide azaphilone...

  8. Protoplasting impact on polyketide activity and characterization of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-09-03

    Sep 3, 2008 ... Key words: Streptomyces, polyketide antibiotic, gene transfer, .... bacterial and fungal. In fact .... as a ring of pigmented mycelial growth surrounding SCB1 .... hybridization between Aspergillus niger and Trichoderma viride by.

  9. KirCII- promising tool for polyketide diversification

    DEFF Research Database (Denmark)

    Musiol-Kroll, Ewa Maria; Härtner, Thomas; Kulik, Andreas

    2014-01-01

    Kirromycin is produced by Streptomyces collinus Tü 365. This compound is synthesized by a large assembly line of type I polyketide synthases and non-ribosomal peptide synthetases (PKS I/NRPS), encoded by the genes kirAI-kirAVI and kirB. The PKSs KirAI-KirAV have no acyltransferase domains integra...... introducing the non-native substrates in an in vivo context. Thus, KirCII represents a promising tool for polyketide diversification....

  10. Antibacterial polyketides from the jellyfish-derived fungus Paecilomyces variotii.

    Science.gov (United States)

    Liu, Juan; Li, Famei; Kim, Eun La; Li, Jian Lin; Hong, Jongki; Bae, Kyung Sook; Chung, Hae Young; Kim, Hyung Sik; Jung, Jee H

    2011-08-26

    Four new polyketides (1-4) were isolated from the fungus Paecilomyces variotii, which was derived from the jellyfish Nemopilema nomurai. The planar structures and relative configurations of these polyketides were elucidated on the basis of spectroscopic analyses, including 2D NMR experiments. The compounds showed inhibitory activity against pathogenic bacteria including methicillin-resistant Staphylococcus aureus 3089 and multi-drug-resistant Vibrio parahemolyticus 7001 with MIC values in the range 5-40 μg/mL.

  11. Ultrasound-Assisted Extraction of Stilbenes from Grape Canes

    Directory of Open Access Journals (Sweden)

    Zulema Piñeiro

    2016-06-01

    Full Text Available An analytical ultrasound-assisted extraction (UAE method has been optimized and validated for the rapid extraction of stilbenes from grape canes. The influence of sample pre-treatment (oven or freeze-drying and several extraction variables (solvent, sample-solvent ratio and extraction time between others on the extraction process were analyzed. The new method allowed the main stilbenes in grape canes to be extracted in just 10 min, with an extraction temperature of 75 °C and 60% ethanol in water as the extraction solvent. Validation of the extraction method was based on analytical properties. The resulting RSDs (n = 5 for interday/intraday precision were less than 10%. Furthermore, the method was successfully applied in the analysis of 20 different grape cane samples. The result showed that grape cane byproducts are potentially sources of bioactive compounds of interest for pharmaceutical and food industries.

  12. Ultrasound-Assisted Extraction of Stilbenes from Grape Canes.

    Science.gov (United States)

    Piñeiro, Zulema; Marrufo-Curtido, Almudena; Serrano, Maria Jose; Palma, Miguel

    2016-06-16

    An analytical ultrasound-assisted extraction (UAE) method has been optimized and validated for the rapid extraction of stilbenes from grape canes. The influence of sample pre-treatment (oven or freeze-drying) and several extraction variables (solvent, sample-solvent ratio and extraction time between others) on the extraction process were analyzed. The new method allowed the main stilbenes in grape canes to be extracted in just 10 min, with an extraction temperature of 75 °C and 60% ethanol in water as the extraction solvent. Validation of the extraction method was based on analytical properties. The resulting RSDs (n = 5) for interday/intraday precision were less than 10%. Furthermore, the method was successfully applied in the analysis of 20 different grape cane samples. The result showed that grape cane byproducts are potentially sources of bioactive compounds of interest for pharmaceutical and food industries.

  13. Screening Analyses of Pinosylvin Stilbenes, Resin Acids and Lignans in Norwegian Conifers

    OpenAIRE

    Anne Fiksdahl; Karin Oyaas; Ingebjorg Leirset; Hanne Hovelstad

    2006-01-01

    The content and distribution of stilbenes and resin acids in Scots pine (Pinus sylvestris) and spruce (Picea abies), sampled in central Norway, have been examined. The contents of pinosylvin stilbenes in pine heartwood/living knots were 0.2-2/2-8 % (w/w). No stilbenes could be detected in spruce (Picea abies). The resin acid contents of pine sapwood/heartwood and knots were 1-4 and 5-10 % (w/w), respectively. Minor amounts of resin acids (

  14. Synthetic biology approaches to fluorinated polyketides.

    Science.gov (United States)

    Thuronyi, Benjamin W; Chang, Michelle C Y

    2015-03-17

    The catalytic diversity of living systems offers a broad range of opportunities for developing new methods to produce small molecule targets such as fuels, materials, and pharmaceuticals. In addition to providing cost-effective and renewable methods for large-scale commercial processes, the exploration of the unusual chemical phenotypes found in living organisms can also enable the expansion of chemical space for discovery of novel function by combining orthogonal attributes from both synthetic and biological chemistry. In this context, we have focused on the development of new fluorine chemistry using synthetic biology approaches. While fluorine has become an important feature in compounds of synthetic origin, the scope of biological fluorine chemistry in living systems is limited, with fewer than 20 organofluorine natural products identified to date. In order to expand the diversity of biosynthetically accessible organofluorines, we have begun to develop methods for the site-selective introduction of fluorine into complex natural products by engineering biosynthetic machinery to incorporate fluorinated building blocks. To gain insight into how both enzyme active sites and metabolic pathways can be evolved to manage and select for fluorinated compounds, we have studied one of the only characterized natural hosts for organofluorine biosynthesis, the soil microbe Streptomyces cattleya. This information provides a template for designing engineered organofluorine enzymes, pathways, and hosts and has allowed us to initiate construction of enzymatic and cellular pathways for the production of fluorinated polyketides.

  15. 76 FR 30967 - Certain Stilbenic Optical Brightening Agents From China and Taiwan

    Science.gov (United States)

    2011-05-27

    ... Stilbenic Optical Brightening Agents From China and Taiwan Determinations On the basis of the record \\1... is a reasonable indication that an industry in the United States is materially injured by reason of imports from China and Taiwan of certain stilbenic optical brightening agents, provided for in subheadings...

  16. In vitro biosynthesis of unnatural enterocin and wailupemycin polyketides.

    Science.gov (United States)

    Kalaitzis, John A; Cheng, Qian; Thomas, Paul M; Kelleher, Neil L; Moore, Bradley S

    2009-03-27

    Nature has evolved finely tuned strategies to synthesize rare and complex natural products such as the enterocin family of polyketides from the marine bacterium Streptomyces maritimus. Herein we report the directed ex vivo multienzyme syntheses of 24 unnatural 5-deoxyenterocin and wailupemycin F and G analogues, 18 of which are new. We have generated molecular diversity by priming the enterocin biosynthesis enzymes with unnatural substrates and have illustrated further the uniqueness of this type II polyketide synthase by way of exploiting its unusual starter unit biosynthesis pathways.

  17. Crystallization and preliminary crystallographic analysis of a novel plant type III polyketide synthase that produces pentaketide chromone

    Energy Technology Data Exchange (ETDEWEB)

    Morita, Hiroyuki [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan); Kondo, Shin [ZOEGENE Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Abe, Tsuyoshi; Noguchi, Hiroshi [School of Pharmaceutical Sciences and the COE21 Program, University of Shizuoka, Shizuoka 422-8526 (Japan); Sugio, Shigetoshi, E-mail: ssugio@rc.m-kagaku.co.jp [ZOEGENE Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Abe, Ikuro, E-mail: ssugio@rc.m-kagaku.co.jp [School of Pharmaceutical Sciences and the COE21 Program, University of Shizuoka, Shizuoka 422-8526 (Japan); PRESTO, Japan Science and Technology Agency, Kawaguchi, Saitama 332-0012 (Japan); Kohno, Toshiyuki, E-mail: ssugio@rc.m-kagaku.co.jp [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan)

    2006-09-01

    Pentaketide chromone synthase from A. arborescens has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 1.6 Å. Pentaketide chromone synthase (PCS) from Aloe arborescens is a novel plant-specific type III polyketide synthase that catalyzes the formation of 5,7-dihydroxy-2-methylchromone from five molecules of malonyl-CoA. Recombinant PCS expressed in Escherichia coli was crystallized by the hanging-drop vapour-diffusion method. The crystals belonged to space group P2{sub 1}, with unit-cell parameters a = 73.2, b = 88.4, c = 70.0 Å, α = γ = 90.0, β = 95.6°. Diffraction data were collected to 1.6 Å resolution using synchrotron radiation at BL24XU of SPring-8.

  18. Quantification of N-acetylcysteamine activated methylmalonate incorporation into polyketide biosynthesis

    Directory of Open Access Journals (Sweden)

    Stephan Klopries

    2013-04-01

    Full Text Available Polyketides are biosynthesized through consecutive decarboxylative Claisen condensations between a carboxylic acid and differently substituted malonic acid thioesters, both tethered to the giant polyketide synthase enzymes. Individual malonic acid derivatives are typically required to be activated as coenzyme A-thioesters prior to their enzyme-catalyzed transfer onto the polyketide synthase. Control over the selection of malonic acid building blocks promises great potential for the experimental alteration of polyketide structure and bioactivity. One requirement for this endeavor is the supplementation of the bacterial polyketide fermentation system with tailored synthetic thioester-activated malonates. The membrane permeable N-acetylcysteamine has been proposed as a coenzyme A-mimic for this purpose. Here, the incorporation efficiency into different polyketides of N-acetylcysteamine activated methylmalonate is studied and quantified, showing a surprisingly high and transferable activity of these polyketide synthase substrate analogues in vivo.

  19. Toblerols: Cyclopropanol-Containing Polyketide Modulators of Antibiosis in Methylobacteria.

    Science.gov (United States)

    Ueoka, Reiko; Bortfeld-Miller, Miriam; Morinaka, Brandon I; Vorholt, Julia A; Piel, Jörn

    2018-01-22

    Trans-AT polyketide synthases (PKSs) are a family of biosynthetically versatile modular type I PKSs that generate bioactive polyketides of impressive structural diversity. In this study, we detected, in the genome of several bacteria a cryptic, architecturally unusual trans-AT PKS gene cluster which eluded automated PKS prediction. Genomic mining of one of these strains, the model methylotroph Methylobacterium extorquens AM1, revealed unique epoxide- and cyclopropanol-containing polyketides named toblerols. Relative and absolute stereochemistry were determined by NMR experiments, chemical derivatization, and the comparison of CD data between the derivatized natural product and a synthesized model compound. Biosynthetic data suggest that the cyclopropanol moiety is generated by carbon-carbon shortening of a more extended precursor. Surprisingly, a knock-out strain impaired in polyketide production showed strong inhibitory activity against other methylobacteria in contrast to the wild-type producer. The activity was inhibited by complementation with toblerols, thus suggesting that these compounds modulate an as-yet unknown methylobacterial antibiotic. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Polyketides isolated from Penicillium herquei; Policetideos isolados de Penicillium herquei

    Energy Technology Data Exchange (ETDEWEB)

    Marinho, Andrey Moacir do Rosario; Marinho, Patricia Santana Barbosa, E-mail: andrey@ufpa.br [Universidade Federal do Para (UFPA), Belem, PA (Brazil). Faculdade de Quimica; Rodrigues Filho, Edson [Universidade Federal de Sao Carlos (UFSCar), SP (Brazil). Departamento de Quimica; Ferreira, Izabel Cristina Piloto [Universidade Estadual de Maringa (UEM), PR (Brazil). Departamento de Analises Clinicas

    2011-07-01

    In this work we are reporting the isolation of polyketides citreoserine (1), emodin (2), janthinone (3), dihydrocitrinone (4) and citrinin H-1 (5). The compounds were isolated by chromatographic procedures and identified by spectral methods of NMR 1D and 2D and MS. The compounds 1, 2 and 3 were tested against promastigotes of Leishmania brasiliensis. (author)

  1. The Use of Stilbene Scaffold in Medicinal Chemistry and Multi- Target Drug Design.

    Science.gov (United States)

    Giacomini, Elisa; Rupiani, Sebastiano; Guidotti, Laura; Recanatini, Maurizio; Roberti, Marinella

    2016-01-01

    The stilbene scaffold is a basic element for a number of biologically active natural and synthetic compounds, and it is considered as a privileged structure. Stilbenes exemplified by resveratrol, combretastatin A-4 and pterostilbene are of significant interest for drug research and development because of their potential in therapeutic and preventive application. Resveratrol, present in grapes and other food products, plays a role in the prevention of several human pathological processes and has been suggested as an anticancer agent. Moreover, recent evidence has revealed its potential effect on the aging process, diabetes and neurological dysfunction. Combretastatin A-4, from the bark of South African bush willow Combretum caffrum, also shows significant antitumor activity. Pterostilbene is closely related to resveratrol, sharing the same unique therapeutic potential as anti-inflammatory, antineoplastic and antioxidant agent. Therefore, research and development of stilbene-based medicinal chemistry have become rapidly evolving and increasingly active topics covering almost the whole range of therapeutic fields. In the present review, we provide an overview of the role of stilbenes in medicinal chemistry. In this context, we highlight the chemical methodologies adopted for the synthesis of stilbene derivatives, and outline the successful design of novel stilbene based hybrids in the field of cancer, Alzheimer's and other relevant diseases. This information may be useful in further design of stilbene-based molecules as new leads for the development of novel agents with clinical potential or as effective chemical probes to dissect biological processes.

  2. Superior optical nonlinearity of an exceptional fluorescent stilbene dye

    Energy Technology Data Exchange (ETDEWEB)

    He, Tingchao [College of Physics Science and Technology, Shenzhen University, Shenzhen 518060 (China); Division of Physics and Applied Physics, Centre for Disruptive Photonic Technologies (CDPT), School of Physical and Mathematical Sciences, Nanyang Technological University, 21 Nanyang Link, Singapore 637371 (Singapore); Sreejith, Sivaramapanicker; Zhao, Yanli [Division of Chemistry and Biological Chemistry, School of Physical and Mathematical Sciences, Nanyang Technological University, 21 Nanyang Link, Singapore 637371 (Singapore); Gao, Yang; Grimsdale, Andrew C. [School of Materials Science and Engineering, Nanyang Technological University, Singapore, Singapore 639798 (Singapore); Lin, Xiaodong, E-mail: linxd@szu.edu.cn, E-mail: hdsun@ntu.edu.sg [College of Physics Science and Technology, Shenzhen University, Shenzhen 518060 (China); Sun, Handong, E-mail: linxd@szu.edu.cn, E-mail: hdsun@ntu.edu.sg [Division of Physics and Applied Physics, Centre for Disruptive Photonic Technologies (CDPT), School of Physical and Mathematical Sciences, Nanyang Technological University, 21 Nanyang Link, Singapore 637371 (Singapore)

    2015-03-16

    Strong multiphoton absorption and harmonic generation in organic fluorescent chromophores are, respectively, significant in many fields of research. However, most of fluorescent chromophores fall short of the full potential due to the absence of the combination of such different nonlinear upconversion behaviors. Here, we demonstrate that an exceptional fluorescent stilbene dye could exhibit efficient two- and three-photon absorption under the excitation of femtosecond pulses in solution phase. Benefiting from its biocompatibility and strong excited state absorption behavior, in vitro two-photon bioimaging and superior optical limiting have been exploited, respectively. Simultaneously, the chromophore could generate efficient three-photon excited fluorescence and third-harmonic generation (THG) when dispersed into PMMA film, circumventing the limitations of classical fluorescent chromophores. Such chromophore may find application in the production of coherent light sources of higher photon energy. Moreover, the combination of three-photon excited fluorescence and THG can be used in tandem to provide complementary information in biomedical studies.

  3. Synthesis of amide isosteres of schweinfurthin-based stilbenes.

    Science.gov (United States)

    Stockdale, David P; Beutler, John A; Wiemer, David F

    2017-10-15

    The schweinfurthins are plant-derived stilbenes with an intriguing profile of anti-cancer activity. To obtain analogues of the schweinfurthins that might preserve the biological activity but have greater water solubility, a formal replacement of the central olefin with an amide has been explored. Two pairs of amides have been prepared, each containing the same hexahydroxanthene "left half" joined through an amide linkage to two different "right halves." In each series, the amide has been inserted in both possible orientations, placing the carbonyl group on the tricyclic ABC ring system and the amine on the D-ring, or placing the amine on the hexahydroxanthene and the carbonyl group on the D-ring. The four new schweinfurthin analogues have been tested in the NCI 60 cell line screen, and in both cases the more active isomer carried the carbonyl group on the C-ring. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Continuous flow photocyclization of stilbenes – scalable synthesis of functionalized phenanthrenes and helicenes

    Directory of Open Access Journals (Sweden)

    Quentin Lefebvre

    2013-09-01

    Full Text Available A continuous flow oxidative photocyclization of stilbene derivatives has been developed which allows the scalable synthesis of backbone functionalized phenanthrenes and helicenes of various sizes in good yields.

  5. HPLC Quantitative Analysis of Main Stilbenes and Flavones in Different Parts of Matteuccia struthiopteris

    Czech Academy of Sciences Publication Activity Database

    Li, S.; Zhang, D.; Yang, L.; Li, Y.; Zhu, X.; Kmoníčková, Eva; Zídek, Zdeněk

    -, č. 452610 (2013), s. 1-6 ISSN 2090-9063 R&D Projects: GA MŠk(CZ) ME10116 Institutional support: RVO:68378041 Keywords : flavones * alternative medicine * stilbenes Subject RIV: FR - Pharmacology ; Medidal Chemistry

  6. Effect of stilbene and chalcone scaffolds incorporation in clofibric acid on PPARα agonistic activity.

    Science.gov (United States)

    Giampietro, Letizia; D'Angelo, Alessandra; Giancristofaro, Antonella; Ammazzalorso, Alessandra; De Filippis, Barbara; Di Matteo, Mauro; Fantacuzzi, Marialuigia; Linciano, Pasquale; Maccallini, Cristina; Amoroso, Rosa

    2014-01-01

    In an effort to develop safe and efficacious compounds for the treatment of metabolic disorders, new compounds based on a combination of clofibric acid, the active metabolite of clofibrate, and trans-stilbene, chalcone, and other lipophilic groups were synthesized. They were evaluated for PPARα transactivation activity; all branched derivatives showed an increase of the transcriptional activity of receptor compared to the linear ones. Noteworthy, stilbene and benzophenone branched derivatives activated the PPARα better than clofibric acid.

  7. Preharvest methyl jasmonate and postharvest UVC treatments: increasing stilbenes in wine.

    Science.gov (United States)

    Fernández-Marín, María Isabel; Puertas, Belén; Guerrero, Raúl F; García-Parrilla, María Carmen; Cantos-Villar, Emma

    2014-03-01

    Stilbene-enriched wine is considered to be an interesting new food product with added value due to its potential health-promoting properties. Stilbene concentration in grape is highly variable and rather scarce. However, it can be increased by stress treatments. For this reason, numerous pre- and postharvest grape treatments, and some combinations of them, have been tested to maximize stilbene content in grapes. In the present manuscript, Syrah grapes were treated with (i) methyl jasmonate (MEJA), (ii) ultraviolet light (UVC), and (iii) methyl jasmonate and ultraviolet light (MEJA-UVC) and compared with untreated grapes. Afterward, winemaking was developed. Wine achieved by combination of both treatments (MEJA-UVC) contained significantly higher stilbene concentration (trans-resveratrol and piceatannol) than its respective control (2.5-fold). Wine quality was improved in color-related parameters (color intensity, L*, a*, b*, ΔE*, anthocyanins, and tannin). Moreover, MEJA-UVC wines obtained the highest score in sensorial analysis. To the best of our knowledge, this is the first time that pre- and postharvest treatments are combined to increase stilbenes in wine. The effect of treatment combination (methyl jasmonate and UVC light) on grape and wine was evaluated. Our results highlight the positive effect of the treatments in stilbene content, color parameters, and sensorial analysis. Moreover, added-value by-products were achieved. © 2014 Institute of Food Technologists®

  8. Synthesis, Biological Evaluation, and Molecular Modeling Studies of New Oxadiazole-Stilbene Hybrids against Phytopathogenic Fungi

    Science.gov (United States)

    Jian, Weilin; He, Daohang; Song, Shaoyun

    2016-08-01

    Natural stilbenes (especially resveratrol) play important roles in plant protection by acting as both constitutive and inducible defenses. However, their exogenous applications on crops as fungicidal agents are challenged by their oxidative degradation and limited availability. In this study, a new class of resveratrol-inspired oxadiazole-stilbene hybrids was synthesized via Wittig-Horner reaction. Bioassay results indicated that some of the compounds exhibited potent fungicidal activity against Botrytis cinerea in vitro. Among these stilbene hybrids, compounds 11 showed promising inhibitory activity with the EC50 value of 144.6 μg/mL, which was superior to that of resveratrol (315.6 μg/mL). Remarkably, the considerably abnormal mycelial morphology was observed in the presence of compound 11. The inhibitory profile was further proposed by homology modeling and molecular docking studies, which showed the possible interaction of resveratrol and oxadiazole-stilbene hybrids with the cytochrome P450-dependent sterol 14α-demethylase from B. cinerea (BcCYP51) for the first time. Taken together, these results would provide new insights into the fungicidal mechanism of stilbenes, as well as an important clue for biology-oriented synthesis of stilbene hybrids with improved bioactivity against plant pathogenic fungi in crop protection.

  9. Plant specific PTS analysis of Kori Unit 1

    Energy Technology Data Exchange (ETDEWEB)

    Sung-Yull, Hong; Changheui, Jang; Ill-Seok, Jeong [Korea Eletric Power Research Inst., Daejon (Korea, Republic of); Tae-Eun, Jin [Korea Power Engineering Company, Yonging (Korea, Republic of)

    1997-09-01

    Currently, a nuclear PLIM (Plant Lifetime Management) program is underway in Korea to extend the operation life of Kori-1 which was originally licensed for 30 years. For the life extension of nuclear power plants, the residual lives of major components should be evaluated for the extended operation period. According to the residual life evaluation of reactor pressure vessel, which was classified as one of the major components crucial to life extension, it was found by screening analysis that reference PTS temperature would exceed screening criteria before the target extended operation years. In order to deal with this problem, a plant-specific PTS analysis for Kori-1 RPV has been initiated. In this paper, the relationship between PTS analysis and Kori-1 PLIM program is briefly described. The plant-specific PTS analysis covers system transient analysis, downcomer mixing analysis, and probabilistic fracture mechanics analysis to check the integrity or RPV during various PTS transients. The step-by-step procedure of the analysis will be described in detail. Finally, various issues regarding RPV materials and its integrity will be briefly mentioned, and their implications on Kori-1 PTS analysis will be discussed. Despite of the screening analysis result concern, it is now expected that Kori-1 PTS issues can be handled through the plant-specific PTS analysis. (author). 14 refs, 4 figs, 2 tabs.

  10. Allergens/Antigens, toxins and polyketides of important Aspergillus species.

    Science.gov (United States)

    Bhetariya, Preetida J; Madan, Taruna; Basir, Seemi Farhat; Varma, Anupam; Usha, Sarma P

    2011-04-01

    The medical, agricultural and biotechnological importance of the primitive eukaryotic microorganisms, the Fungi was recognized way back in 1920. Among various groups of fungi, the Aspergillus species are studied in great detail using advances in genomics and proteomics to unravel biological and molecular mechanisms in these fungi. Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger, Aspergillus parasiticus, Aspergillus nidulans and Aspergillus terreus are some of the important species relevant to human, agricultural and biotechnological applications. The potential of Aspergillus species to produce highly diversified complex biomolecules such as multifunctional proteins (allergens, antigens, enzymes) and polyketides is fascinating and demands greater insight into the understanding of these fungal species for application to human health. Recently a regulator gene for secondary metabolites, LaeA has been identified. Gene mining based on LaeA has facilitated new metabolites with antimicrobial activity such as emericellamides and antitumor activity such as terrequinone A from A. nidulans. Immunoproteomic approach was reported for identification of few novel allergens for A. fumigatus. In this context, the review is focused on recent developments in allergens, antigens, structural and functional diversity of the polyketide synthases that produce polyketides of pharmaceutical and biological importance. Possible antifungal drug targets for development of effective antifungal drugs and new strategies for development of molecular diagnostics are considered.

  11. Engineering modular polyketide synthases for production of biofuels and industrial chemicals.

    Science.gov (United States)

    Cai, Wenlong; Zhang, Wenjun

    2018-04-01

    Polyketide synthases (PKSs) are one of the most profound biosynthetic factories for producing polyketides with diverse structures and biological activities. These enzymes have been historically studied and engineered to make un-natural polyketides for drug discovery, and have also recently been explored for synthesizing biofuels and industrial chemicals due to their versatility and customizability. Here, we review recent advances in the mechanistic understanding and engineering of modular PKSs for producing polyketide-derived chemicals, and provide perspectives on this relatively new application of PKSs. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Nuclear utility education and training becoming too plant specific?

    International Nuclear Information System (INIS)

    Wicks, F.

    1986-01-01

    As the Supervisor of a university nuclear reactor and operations curriculum, the author has also been offering education and training programs for nuclear utility technical support and operations personnel. Similar results have been reported by other universities offering similar programs. These programs also provide very important benefits to university nuclear engineering departments in terms of much needed revenues during this time of declining student enrollment and also by the information flow from the nuclear utility participants to the university personnel, which can yield both improved courses and identify research opportunities. University programs serve an important complementary function to plant-specific programs and should be continued and supported

  13. Pulse radiolysis of solutions of trans-stilbene

    International Nuclear Information System (INIS)

    Langan, J.R.; Salmon, G.A.

    1982-01-01

    On pulse radiolysis of solutions of trans-stilbene (t-St) in THF the radical-anion of t-St is formed by reaction of e - sub(s) with t-St. The transient absorption spectrum observed with lambdasub(max) at 500 and 720 nm is attributed to the unassociated St - . The subsequent decay of the radical-anion is accounted for by reaction with the counter-cation of THF formed on radiolysis and with radiolytically generated radicals; rate constants for these processes are estimated. Addition of sodium tetrahydridoaluminate (NAH) results in the radical-anion being associated with Na + as a contact ion-pair and a shift of lambdasub(max) to 490 nm. In the presence of the lithium salt the absorption spectrum of the radical-anion reverts to 500 nm. On pulse radiolysis of solutions containing NAH the main reaction forming St - is that of (Na + , e - sub(s))ion pairs with t-St. In addition there is a delayed formation of St - over a period of microseconds. The presence of tetrahydridoaluminate salts also greatly enhances the stability of St - and at high doses per pulse little decay was observed over 700 μs. The variation of G(St - ) with [NAH] was studied and was found to attain a plateau value of 2.0 at the higher concentrations. (author)

  14. Algal carbohydrates affect polyketide synthesis of the lichen-forming fungus Cladonia rangiferina.

    Science.gov (United States)

    Elshobary, Mostafa E; Osman, Mohamed E; Abo-Shady, Atef M; Komatsu, Emy; Perreault, Hélène; Sorensen, John; Piercey-Normore, Michele D

    2016-01-01

    Lichen secondary metabolites (polyketides) are produced by the fungal partner, but the role of algal carbohydrates in polyketide biosynthesis is not clear. This study examined whether the type and concentration of algal carbohydrate explained differences in polyketide production and gene transcription by a lichen fungus (Cladonia rangiferina). The carbohydrates identified from a free-living cyanobacterium (Spirulina platensis; glucose), a lichen-forming alga (Diplosphaera chodatii; sorbitol) and the lichen alga that associates with C. rangiferina (Asterochloris sp.; ribitol) were used in each of 1%, 5% and 10% concentrations to enrich malt yeast extract media for culturing the mycobiont. Polyketides were determined by high performance liquid chromatography (HPLC), and polyketide synthase (PKS) gene transcription was measured by quantitative PCR of the ketosynthase domain of four PKS genes. The lower concentrations of carbohydrates induced the PKS gene expression where ribitol up-regulated CrPKS1 and CrPKS16 gene transcription and sorbitol up-regulated CrPKS3 and CrPKS7 gene transcription. The HPLC results revealed that lower concentrations of carbon sources increased polyketide production for three carbohydrates. One polyketide from the natural lichen thallus (fumarprotocetraric acid) also was produced by the fungal culture in ribitol supplemented media only. This study provides a better understanding of the role of the type and concentration of the carbon source in fungal polyketide biosynthesis in the lichen Cladonia rangiferina. © 2016 by The Mycological Society of America.

  15. Photoluminescence in Carborane-Stilbene Triads: A Structural, Spectroscopic, and Computational Study.

    Science.gov (United States)

    Cabrera-González, Justo; Viñas, Clara; Haukka, Matti; Bhattacharyya, Santanu; Gierschner, Johannes; Núñez, Rosario

    2016-09-12

    A set of triads in which o- and m-carborane clusters are bonded to two stilbene units through Ccluster -CH2 bonds was synthesized, and their structures were confirmed by X-ray diffraction. A study on the influence of the o- and m- isomers on the absorption and photoluminescence properties of the stilbene units in solution revealed no charge-transfer contributions in the lowest excited state, as confirmed by (TD)DFT calculations. The presence of one or two B-I groups in m-carborane derivatives does not affect the emission properties of the stilbenes in solution, probably due to the rather large distance between the iodo substituents and the fluorophore. Nevertheless, a significant redshift of the photoluminescence (PL) emission maximum in the solid state (thin films and powder samples) compared to solution was observed; this can be traced back to PL sensitization, most probably due to more densely packed stilbene moieties. Remarkably, the PL absolute quantum yields of powder samples are significantly higher than those in solution, and this was attributed to the restricted environment and the aforementioned sensitization. Thus, the bonding of the carborane clusters to two stilbene units preserves their PL behavior in solution, but produces significant changes in the solid state. Furthermore, iodinated species can be considered to be promising precursors for theranostic agents in which both imaging and therapeutic functions could possibly be combined. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Science.gov (United States)

    Noar, Roslyn D; Daub, Margaret E

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  17. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Directory of Open Access Journals (Sweden)

    Roslyn D Noar

    Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that

  18. Plant specific severe accident management - the implementation phase

    International Nuclear Information System (INIS)

    Prior, R.

    1999-01-01

    Many plants are in the process of developing on-site guidance for technical staff to respond to a severe accident situation severe accident management guidance (SAMG). Once the guidance is developed, the SAMG must be implemented at the plant site, and this involves addressing a number of additional aspects. In this paper, approaches to this implementation phase are reviewed, including review and verification of plant specific SAMG, organizational aspects and integration with the emergency plan, training of SAMG users, validation and self-assessment and SAMG maintenance. Examples draw on experience from assisting numerous plants to implement symptom based severe accident management guidelines based on the Westinghouse Owners Group approach, in Westinghouse, non-Westinghouse and VVER plant types. It is hoped that it will be of use to those plant operators about to perform these activities.(author)

  19. Flooding PSA with Plant Specific Operating Experiences of Korean PWRs

    International Nuclear Information System (INIS)

    Choi, Sun Yeong; Yang, Joon Yull

    2006-01-01

    The purpose of this paper is to update the flooding PSA with Korean plant specific operating experience data and the appropriate estimation method for the flooding frequency to improve the PSA quality. The existing flooding PSA used the NPE (Nuclear Power Experience) database up to 1985 for the flooding frequency. They are all USA plant operating experiences. So an upgraded flooding frequency with Korean specific plant operation experience is required. We also propose a method of only using the PWR (Pressurized Water Reactor) data for the flooding frequency estimation in the case of the flooding area in the primary building even though the existing flooding PSA used both PWR and BWR (Boiled Water Reactor) data for all kinds of plant areas. We evaluate the CDF (Core Damage Frequency) with the modified flooding frequency and compare the results with that of the existing flooding PSA method

  20. Polyketide synthases from poison hemlock (Conium maculatum L.).

    Science.gov (United States)

    Hotti, Hannu; Seppänen-Laakso, Tuulikki; Arvas, Mikko; Teeri, Teemu H; Rischer, Heiko

    2015-11-01

    Coniine is a toxic alkaloid, the biosynthesis of which is not well understood. A possible route, supported by evidence from labelling experiments, involves a polyketide formed by the condensation of one acetyl-CoA and three malonyl-CoAs catalysed by a polyketide synthase (PKS). We isolated PKS genes or their fragments from poison hemlock (Conium maculatum L.) by using random amplification of cDNA ends (RACE) and transcriptome analysis, and characterized three full-length enzymes by feeding different starter-CoAs in vitro. On the basis of our in vitro experiments, two of the three characterized PKS genes in poison hemlock encode chalcone synthases (CPKS1 and CPKS2), and one encodes a novel type of PKS (CPKS5). We show that CPKS5 kinetically favours butyryl-CoA as a starter-CoA in vitro. Our results suggest that CPKS5 is responsible for the initiation of coniine biosynthesis by catalysing the synthesis of the carbon backbone from one butyryl-CoA and two malonyl-CoAs. © 2015 FEBS.

  1. Identification of olivetolic acid cyclase from Cannabis sativa reveals a unique catalytic route to plant polyketides.

    Science.gov (United States)

    Gagne, Steve J; Stout, Jake M; Liu, Enwu; Boubakir, Zakia; Clark, Shawn M; Page, Jonathan E

    2012-07-31

    Δ(9)-Tetrahydrocannabinol (THC) and other cannabinoids are responsible for the psychoactive and medicinal properties of Cannabis sativa L. (marijuana). The first intermediate in the cannabinoid biosynthetic pathway is proposed to be olivetolic acid (OA), an alkylresorcinolic acid that forms the polyketide nucleus of the cannabinoids. OA has been postulated to be synthesized by a type III polyketide synthase (PKS) enzyme, but so far type III PKSs from cannabis have been shown to produce catalytic byproducts instead of OA. We analyzed the transcriptome of glandular trichomes from female cannabis flowers, which are the primary site of cannabinoid biosynthesis, and searched for polyketide cyclase-like enzymes that could assist in OA cyclization. Here, we show that a type III PKS (tetraketide synthase) from cannabis trichomes requires the presence of a polyketide cyclase enzyme, olivetolic acid cyclase (OAC), which catalyzes a C2-C7 intramolecular aldol condensation with carboxylate retention to form OA. OAC is a dimeric α+β barrel (DABB) protein that is structurally similar to polyketide cyclases from Streptomyces species. OAC transcript is present at high levels in glandular trichomes, an expression profile that parallels other cannabinoid pathway enzymes. Our identification of OAC both clarifies the cannabinoid pathway and demonstrates unexpected evolutionary parallels between polyketide biosynthesis in plants and bacteria. In addition, the widespread occurrence of DABB proteins in plants suggests that polyketide cyclases may play an overlooked role in generating plant chemical diversity.

  2. Use of plant specific information in life management

    International Nuclear Information System (INIS)

    Simola, K.; Talja, H.

    2002-01-01

    In plant life management decisions are made on prevention and mitigation measures of ageing phenomena. In these processes, information from several sources has to be combined, and the decisions are based on data and analyses including lots of uncertainties. In order to make good decisions, the uncertainties and limitations related to both analyses and the raw data should be recognised. A schematic presentation of the information used in the decision making with an emphasis on data needs and analyses for the technical life assessment of a component is given. On the way from the raw data to the final decision on ageing management there are several steps where engineering judgement is used or more sophisticated analyses are made. In this paper we present a view upon the decision making process in managing the ageing of components, systems and structures. Further, we propose practices to improve the transparency of ageing analyses and means to improve the availability and usability of plant specific information for ageing management purposes. The availability of plant specific information and easy access to these records are vital for the efficient ageing management. Often, the data collection and record keeping has not been organised in an efficient way and the use of experience data is very laborious. As illustrated, a lot of plant specific information is needed in ageing assessment. It is also very important to ensure that the information is up-to-date, e.g. possible modifications are taken into account in lifetime predictions. As an example of improvement in the data collection practices we shortly summarise the pipeline analysis and monitoring system that VTT is developing together with TVO. The system is meant to contain all up-to-date information necessary to analyse and monitor piping systems of an operating plant. The core of the system contains five databases. Piping database contains information like geometry, material, loading, detected cracks etc. All

  3. The Catalytic Diversity of Multimodular Polyketide Synthases: Natural Product Biosynthesis Beyond Textbook Assembly Rules.

    Science.gov (United States)

    Gulder, Tobias A M; Freeman, Michael F; Piel, Jörn

    2011-03-01

    Bacterial multimodular polyketide synthases (PKSs) are responsible for the biosynthesis of a wide range of pharmacologically active natural products. These megaenzymes contain numerous catalytic and structural domains and act as biochemical templates to generate complex polyketides in an assembly line-like fashion. While the prototypical PKS is composed of only a few different domain types that are fused together in a combinatorial fashion, an increasing number of enzymes is being found that contain additional components. These domains can introduce remarkably diverse modifications into polyketides. This review discusses our current understanding of such noncanonical domains and their role in expanding the biosynthetic versatility of bacterial PKSs.

  4. Preparation of plant-specific NDA reference material

    International Nuclear Information System (INIS)

    Abedin-Zadeh, R.; Beetle, T.; Kuhn, E.; Terrey, D.; Turel, S.; Busca, G.; Guardini, S.

    1983-01-01

    The importance of having suitable and well characterized non-destructive assay (NDA) reference materials for the verification activities of the safeguards control authorities is stressed. The Euratom Inspectorate and the IAEA have initiated an extensive programme for the procurement and preparation of Joint Euratom/IAEA safeguards NDA reference materials with the active participation of the Ispra Establishment of the Euratom Joint Research Centre. The different type and nature of materials, condition of measurements, and plant characteristics and provisions had to be taken into account for plant-specific NDA reference materials. The preparation of each reference material was planned case by case and specific criteria such as limitations in different facilities, measurement capabilities, conditions, product availability and population variability are being ascertained. A procurement scheme was prepared describing step-by-step procedures detailing responsibilities, measurement conditions, destructive analysis schemes, desired characteristics and methods of data evaluation. This paper describes the principles and procedures carried out for the preparation of a reference MOX pin, low enriched uranium reference rods, low enriched uranium reference drums, reference MTR assemblies, and THTR reference pebbles. The scheme for each characterization technique is presented. (author)

  5. Conformationally constrained farnesoid X receptor (FXR) agonists: alternative replacements of the stilbene.

    Science.gov (United States)

    Akwabi-Ameyaw, Adwoa; Caravella, Justin A; Chen, Lihong; Creech, Katrina L; Deaton, David N; Madauss, Kevin P; Marr, Harry B; Miller, Aaron B; Navas, Frank; Parks, Derek J; Spearing, Paul K; Todd, Dan; Williams, Shawn P; Wisely, G Bruce

    2011-10-15

    To further explore the optimum placement of the acid moiety in conformationally constrained analogs of GW 4064 1a, a series of stilbene replacements were prepared. The benzothiophene 1f and the indole 1g display the optimal orientation of the carboxylate for enhanced FXR agonist potency. Copyright © 2011 Elsevier Ltd. All rights reserved.

  6. Various Extraction Methods for Obtaining Stilbenes from Grape Cane of Vitis vinifera L

    Czech Academy of Sciences Publication Activity Database

    Soural, I.; Vrchotová, Naděžda; Tříska, Jan; Balík, J.; Horník, Štěpán; Cuřínová, Petra; Sýkora, Jan

    2015-01-01

    Roč. 20, č. 4 (2015), s. 6093-6112 ISSN 1420-3049 R&D Projects: GA MŠk(CZ) LD14038 Institutional support: RVO:67179843 ; RVO:67985858 Keywords : Vitis vinifera L * grape cane * stilbenes * accelerated solvent extraction ( ASE ) * microwave-assisted extraction (MAE) * LC-MS Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 2.465, year: 2015

  7. Effect of Dietary Stilbenes on 5-Lipoxygenase and Cyclooxygenases Activities In Vitro

    Czech Academy of Sciences Publication Activity Database

    Kutil, Zsófia; Kvasnicová, Marie; Temml, V.; Schuster, D.; Maršík, Petr; Cusimamani, E.F.; Lou, J.D.; Vaněk, Tomáš; Landa, Přemysl

    2015-01-01

    Roč. 18, č. 7 (2015), s. 1471-1477 ISSN 1094-2912 R&D Projects: GA MŠk LH12164 Institutional support: RVO:61389030 Keywords : Dietary stilbenes * Cyclooxygenase inhibition * Docking Subject RIV: EI - Biotechnology ; Bionics Impact factor: 1.586, year: 2015

  8. Aerobic methylcyclohexane-promoted epoxidation of stilbene over gold nanoparticles supported on Gd-doped titania

    KAUST Repository

    Mendez, Violaine; Guillois, Kevin; Daniè le, Sté phane; Tuel, Alain; Caps, Valerie

    2010-01-01

    Aerobic partial oxidations of alkanes and alkenes are important processes of the petrochemical industry. The radical mechanisms involved can be catalyzed by soluble salts of transition metals (Co, Cu, Mn...). We show here that the model methylcyclohexane/stilbene co-oxidation reaction can be efficiently catalyzed at lower temperature by supported gold nanoparticles. The support has little influence on gold intrinsic activity but more on the apparent reaction rates which are a combination of catalytic activity and diffusion limitations. These are here minimized by using gadolinium-doped titania nanocrystallites as support for gold nanoparticles. This material is obtained by mild hydrolysis of a new Gd4TiO(OiPr)14 bimetallic oxoalkoxide. It leads to enhanced wettability of the < 3 nm gold particles in the tert-butyl hydroperoxide (TBHP)-initiated epoxidation of stilbene in methylcyclohexane; Au/TiO2:Gd3+ is in turn as active as the state-of-the-art hydrophobic Au/SiO2 catalyst. The rate-determining step of this reaction is identified as the gold-catalyzed homolytic decomposition of TBHP generating radicals and initiating the methylcyclohexane-mediated epoxidation of stilbene, yielding a methylcyclohexan-1-ol/trans-stilbene oxide mixture. Methylcyclohexan-1-ol can also be obtained in the absence of the alkene in the gold-catalyzed solvent-free autoxidation of methylcyclohexane, evidencing the catalytic potential of gold nanoparticles for low temperature C-H activation. © 2010 The Royal Society of Chemistry.

  9. Piceatannol and Other Wine Stilbenes: A Pool of Inhibitors against α-Synuclein Aggregation and Cytotoxicity

    Directory of Open Access Journals (Sweden)

    Hamza Temsamani

    2016-06-01

    Full Text Available The aggregation of α-synuclein is one on the key pathogenic events in Parkinson’s disease. In the present study, we investigated the inhibitory capacities of stilbenes against α-synuclein aggregation and toxicity. Thioflavin T fluorescence, transmission electronic microscopy, and SDS-PAGE analysis were performed to investigate the inhibitory effects of three stilbenes against α-synuclein aggregation: piceatannol, ampelopsin A, and isohopeaphenol. Lipid vesicle permeabilization assays were performed to screen stilbenes for protection against membrane damage induced by aggregated α-synuclein. The viability of PC12 cells was examined using an MTT assay to assess the preventive effects of stilbenes against α-synuclein-induced toxicity. Piceatannol inhibited the formation of α synuclein fibrils and was able to destabilize preformed filaments. It seems to induce the formation of small soluble complexes protecting membranes against α-synuclein-induced damage. Finally, piceatannol protected cells against α-synuclein-induced toxicity. The oligomers tested (ampelopsin A and hopeaphenol were less active.

  10. Pulsed electric field treatment enhanced stilbene content in Graciano, Tempranillo and Grenache grape varieties.

    Science.gov (United States)

    López-Alfaro, Isabel; González-Arenzana, Lucía; López, Noelia; Santamaría, Pilar; López, Rosa; Garde-Cerdán, Teresa

    2013-12-15

    The purpose of this paper was to study the effect of pulsed electric fields (PEF) on the stilbene content of three grape varieties. For this purpose, four different PEF treatments were applied using a continuous system over three varieties, Graciano, Tempranillo and Grenache, destemmed and crushed. In addition, the influence of PEF on their physicochemical composition was studied. PEF treatments did not affect the pH or total acidity of Graciano, however, musts from Tempranillo and Grenache had higher pH values and lower total acidity. In the three varieties, all treatments resulted in an increase of potassium content, deeper colour intensity and total polyphenol index and lower tonality, more pronounced in the treatments with higher time and energy. The stilbene content of the must significantly increased with respect to the control. This increase depended on the variety and the treatment applied. Tempranillo increased up 200% the total stilbene concentration, Grenache 60% and Graciano 50%. For the three varieties, the treatment with the highest time and energy was the most effective on the total stilbene extraction. These results indicate that PEF could be a suitable technology for obtaining musts with deeper colour and higher phenolic content, including resveratrol and piceid. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. 76 FR 19383 - Certain Stilbenic Optical Brightening Agents From China and Taiwan

    Science.gov (United States)

    2011-04-07

    ... Stilbenic Optical Brightening Agents From China and Taiwan AGENCY: United States International Trade... reasonable indication that an industry in the United States is materially injured or threatened with material injury, or the establishment of an industry in the United States is materially retarded, by reason of...

  12. 77 FR 27079 - Certain Stilbenic Optical Brightening Agents From China and Taiwan

    Science.gov (United States)

    2012-05-08

    ... industry in the United States is materially injured by reason of imports from China and Taiwan of certain... Optical Brightening Agents From China and Taiwan Determinations On the basis of the record \\1\\ developed... that imports of certain stilbenic optical brightening agents from China and Taiwan were being sold at...

  13. Characterisation of stilbenes in California almonds (Prunus dulcis) by UHPLC-MS.

    Science.gov (United States)

    Xie, Liyang; Bolling, Bradley W

    2014-04-01

    Stilbene polyphenols are present in some fruits and nuts, but their abundance in many foods, such as almonds, is unknown. Therefore, we characterised stilbenes from Nonpareil, Butte and Carmel almond (Prunus dulcis) varieties from California. UHPLC-MS conditions were optimised to resolve cis- and trans-resveratrol, d4-resveratrol, dienestrol, hexestrol, oxyresveratrol, piceatannol, pterostilbene, and resveratrol-3-β-glucoside (polydatin). Stilbenes were isolated from ethanolic almond extracts by solid-phase extraction and identified with UHPLC-MS by comparison of retention times, mass spectra, in-source CID spectra, and enzymatic hydrolysis to authentic standards. Polydatin was identified in almond extracts, with 7.19-8.52 μg/100 g almond. Piceatannol+oxyresveratrol was tentatively identified in almond blanch water, at 0.19-2.55 μg/100 g almond. Polydatin was concentrated in almond skins, which contained 95.6-97.5% of the total almond content. Therefore, almonds contain the stilbene class of polyphenols in addition to the previously identified proanthocyanidin, hydrolysable tannin, flavonoid, and phenolic acid classes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. Varietal Distributions of Stilbenes in Grape Cane of Vitis vinifera L.

    Czech Academy of Sciences Publication Activity Database

    Soural, I.; Balík, J.; Vrchotová, Naděžda; Tříska, Jan

    2017-01-01

    Roč. 20, č. 1 (2017), s. 11-14 ISSN 1335-2563 R&D Projects: GA MŠk(CZ) LO1415; GA MŠk(CZ) LD14038 Institutional support: RVO:86652079 Keywords : Vitis vinifera L. * varieties * grape canes * stilbenes * distribution Subject RIV: EH - Ecology, Behaviour OBOR OECD: Environmental sciences (social aspects to be 5.7)

  15. Somatic mutations in stilbene estrogen-induced Syrian hamster kidney tumors identified by DNA fingerprinting

    Directory of Open Access Journals (Sweden)

    Roy Deodutta

    2004-01-01

    Full Text Available Abstract Kidney tumors from stilbene estrogen (diethylstilbestrol-treated Syrian hamsters were screened for somatic genetic alterations by Random Amplified Polymorphic DNA-polymerase chain-reaction (RAPD-PCR fingerprinting. Fingerprints from tumor tissue were generated by single arbitrary primers and compared with fingerprints for normal tissue from the same animal, as well as normal and tumor tissues from different animals. Sixty one of the arbitrary primers amplified 365 loci that contain approximately 476 kbp of the hamster genome. Among these amplified DNA fragments, 44 loci exhibited either qualitative or quantitative differences between the tumor tissues and normal kidney tissues. RAPD-PCR loci showing decreased and increased intensities in tumor tissue DNA relative to control DNA indicate that loci have undergone allelic losses and gains, respectively, in the stilbene estrogen-induced tumor cell genome. The presence or absence of the amplified DNA fragments indicate homozygous insertions or deletions in the kidney tumor DNA compared to the age-matched normal kidney tissue DNA. Seven of 44 mutated loci also were present in the kidney tissues adjacent to tumors (free of macroscopic tumors. The presence of mutated loci in uninvolved (non-tumor surrounding tissue adjacent to tumors from stilbene estrogen-treated hamsters suggests that these mutations occurred in the early stages of carcinogenesis. The cloning and sequencing of RAPD amplified loci revealed that one mutated locus had significant sequence similarity with the hamster Cyp1A1 gene. The results show the ability of RAPD-PCR to detect and isolate, in a single step, DNA sequences representing genetic alterations in stilbene estrogen-induced cancer cells, including losses of heterozygosity, and homozygous deletion and insertion mutations. RAPD-PCR provides an alternative molecular approach for studying cancer cytogenetics in stilbene estrogen-induced tumors in humans and experimental

  16. Merocyanines: polyene-polymethine transition in donor-acceptor-substituted stilbenes and polyenes

    International Nuclear Information System (INIS)

    Rettig, Wolfgang; Dekhtyar, Marina

    2003-01-01

    Three series of donor-acceptor-substituted conjugated compounds, namely, stilbenes, the open-chain polyenes of equivalent length, and the species of intermediate structure (polyenes terminated with only one phenyl ring) have been studied by the AM1 and HMO methods to elucidate and compare the structural prerequisites of the ideal polymethinic state ('cyanine limit'). The transition from polyenic to polymethinic properties has been traced in terms of bond-length (bond-order) alternation using the variation of terminal donor and acceptor substituents. Stilbenes manifest themselves as notably 'retarded' polyenes since a larger electronic asymmetry is necessary for them to reach the same degree of polymethinic character. The ground and the excited state have been shown to differ much more strongly for stilbenes than for polyenes with respect to the position of the bond equalization point on the scale of donor-acceptor difference. For the compounds containing one phenyl ring, the features revealed are intermediate between stilbenes and polyenes. The large S 0 -S 1 discrepancy in terms of bond alternation is a general property of aromatic ring-terminated chains (stilbenes) and is related to the influence of the aromatic character which can be quantified in this way. In this context, the most relevant definition for the cyanine limit (based on the bond invariance upon excitation) was selected from the existing definitions. The major trends revealed in the polyenic/polymethinic behaviour of the molecules can be interpreted on a topological basis within HMO or even simpler models with some additional influence due to the interelectronic repulsion which is taken into account in the AM1 treatment

  17. Comparative study of neutron and gamma-ray pulse shape discrimination of anthracene, stilbene, and p-terphenyl

    International Nuclear Information System (INIS)

    Yanagida, Takayuki; Watanabe, Kenichi; Fujimoto, Yutaka

    2015-01-01

    Solid state organic scintillators, such as anthracene, stilbene, and p-terphenyl were investigated on their basic scintillation properties and neutron–gamma discrimination capabilities. Scintillation wavelengths under X-ray irradiation of anthracene, stilbene, and p-terphenyl were 445–525, 400–500, and 350–450 nm, respectively. Scintillation light yields of anthracene, stilbene, and p-terphenyl under 137 Cs gamma-ray irradiation were 20100, 16000, and 19400 ph/MeV, respectively. Neutron and gamma-ray events discrimination capabilities were examined and anthracene exhibited the best figure of merit among three organic scintillators

  18. Comparative study of neutron and gamma-ray pulse shape discrimination of anthracene, stilbene, and p-terphenyl

    Energy Technology Data Exchange (ETDEWEB)

    Yanagida, Takayuki, E-mail: yanagida@lsse.kyutech.ac.jp [Kyushu Institute of Technology, 2-4 Hibikino, Wakamatsu, Kitakyushu, Fukuoka 808-0196 (Japan); Watanabe, Kenichi [Nagoya University, Furocho, Chikusa, Nagoya 464-8603 (Japan); Fujimoto, Yutaka [Kyushu Institute of Technology, 2-4 Hibikino, Wakamatsu, Kitakyushu, Fukuoka 808-0196 (Japan)

    2015-06-01

    Solid state organic scintillators, such as anthracene, stilbene, and p-terphenyl were investigated on their basic scintillation properties and neutron–gamma discrimination capabilities. Scintillation wavelengths under X-ray irradiation of anthracene, stilbene, and p-terphenyl were 445–525, 400–500, and 350–450 nm, respectively. Scintillation light yields of anthracene, stilbene, and p-terphenyl under {sup 137}Cs gamma-ray irradiation were 20100, 16000, and 19400 ph/MeV, respectively. Neutron and gamma-ray events discrimination capabilities were examined and anthracene exhibited the best figure of merit among three organic scintillators.

  19. Reconstruction of the biosynthetic pathway for the core fungal polyketide scaffold rubrofusarin in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Rugbjerg, Peter; Naesby, Michael; Mortensen, Uffe Hasbro

    2013-01-01

    production in easily fermentable and genetically engineerable organisms, such as Saccharomyces cerevisiae and Escherichia coli are desirable. Rubrofusarin is an orange polyketide pigment that is a common intermediate in many different fungal biosynthetic pathways. RESULTS: In this study, we established...

  20. Diversity of polyketides produced by Penicillium species isolated from Melia azedarach and Murraya paniculata

    International Nuclear Information System (INIS)

    Pastre, Renata; Marinho, Andrey M.R.; Rodrigues-Filho, Edson; Souza, Antonia Q.L.; Pereira, Jose Odair

    2007-01-01

    Eight compounds comprising four groups of polyketides, the xanthone fusarindin, the mixed peptide alkaloid-polyketide GKK1032, the anthraquinones crysophanol, citreoveridin and janthinone, and the azaphylones dihydrocitrinone, citrinin and citrinin H-1, were identified in Penicillium species isolated as endophytic fungi from Melia azedarach and Murraya paniculata. The antibacterial activity of the azaphylones was tested and showed that citrinin H-1 is more active than citrinin. (author)

  1. Use of heterologous expressed polyketide synthase and small molecule foldases to make aromatic and cyclic compounds

    DEFF Research Database (Denmark)

    2016-01-01

    A method for producing individual or libraries of tri- to pentadecaketide-derived aromatic compounds of interest by heterologous expression of polyketide synthase and aromatase/cyclase in a recombinant host cell.......A method for producing individual or libraries of tri- to pentadecaketide-derived aromatic compounds of interest by heterologous expression of polyketide synthase and aromatase/cyclase in a recombinant host cell....

  2. Structure and Absolute Configuration of Jurassic Polyketide-Derived Spiroborate Pigments Obtained from Microgram Quantities.

    Science.gov (United States)

    Wolkenstein, Klaus; Sun, Han; Falk, Heinz; Griesinger, Christian

    2015-10-28

    Complete structural elucidation of natural products is often challenging due to structural complexity and limited availability. This is true for present-day secondary metabolites, but even more for exceptionally preserved secondary metabolites of ancient organisms that potentially provide insights into the evolutionary history of natural products. Here, we report the full structure and absolute configuration of the borolithochromes, enigmatic boron-containing pigments from a Jurassic putative red alga, from samples of less than 50 μg using microcryoprobe NMR, circular dichroism spectroscopy, and density functional theory calculations and reveal their polyketide origin. The pigments are identified as spiroborates with two pentacyclic sec-butyl-trihydroxy-methyl-benzo[gh]tetraphen-one ligands and less-substituted derivatives. The configuration of the sec-butyl group is found to be (S). Because the exceptional benzo[gh]tetraphene scaffold is otherwise only observed in the recently discovered polyketide clostrubin from a present-day Clostridium bacterium, the Jurassic borolithochromes now can be unambiguously linked to the modern polyketide, providing evidence that the fossil pigments are almost originally preserved secondary metabolites and suggesting that the pigments in fact may have been produced by an ancient bacterium. The borolithochromes differ fundamentally from previously described boronated polyketides and represent the first boronated aromatic polyketides found so far. Our results demonstrate the potential of microcryoprobe NMR in the analysis of previously little-explored secondary metabolites from ancient organisms and reveal the evolutionary significance of clostrubin-type polyketides.

  3. The LINKS motif zippers trans-acyltransferase polyketide synthase assembly lines into a biosynthetic megacomplex.

    Science.gov (United States)

    Gay, Darren C; Wagner, Drew T; Meinke, Jessica L; Zogzas, Charles E; Gay, Glen R; Keatinge-Clay, Adrian T

    2016-03-01

    Polyketides such as the clinically-valuable antibacterial agent mupirocin are constructed by architecturally-sophisticated assembly lines known as trans-acyltransferase polyketide synthases. Organelle-sized megacomplexes composed of several copies of trans-acyltransferase polyketide synthase assembly lines have been observed by others through transmission electron microscopy to be located at the Bacillus subtilis plasma membrane, where the synthesis and export of the antibacterial polyketide bacillaene takes place. In this work we analyze ten crystal structures of trans-acyltransferase polyketide synthases ketosynthase domains, seven of which are reported here for the first time, to characterize a motif capable of zippering assembly lines into a megacomplex. While each of the three-helix LINKS (Laterally-INteracting Ketosynthase Sequence) motifs is observed to similarly dock with a spatially-reversed copy of itself through hydrophobic and ionic interactions, the amino acid sequences of this motif are not conserved. Such a code is appropriate for mediating homotypic contacts between assembly lines to ensure the ordered self-assembly of a noncovalent, yet tightly-knit, enzymatic network. LINKS-mediated lateral interactions would also have the effect of bolstering the vertical association of the polypeptides that comprise a polyketide synthase assembly line. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Bioactive and wood-associated stilbenes as multifunctional antimicrobial and health promoting agents - BIOSTIMUL

    Energy Technology Data Exchange (ETDEWEB)

    Wright, A. von (Univ. of Eastern Finland, Kuopio (Finland). Dept. of Biosciences.), Email: atte.vonWright@uef.fi

    2010-10-15

    Plant polyphenolics have a wide range of bioactivities. Coniferous trees are a rich source of stilbenes, such as pinosylvin in the genus Pinus. Pinosylvin is structurally very similar to resveratrol, a stilbene found in grapes and red berries, and which is reported to have beneficial health effects such as prevention of cardiovascular diseases, tumourigenesis, and according to recent findings, also type II diabetes. In our previous studies the bioactivities of pinosylvin (antimicrobial effects and cytotoxic activities against cancer cells) were very similar to those of resveratrol. In this project we elucidate the potential of pinosylvin and its derivatives in food applications as multifunctional antimicrobial agents with positive health effects (including prevention of type II diabetes) highlighting results. (orig.)

  5. Bioactive and wood-associated stilbenes as multifunctional antimicrobial and health promoting agents - BIOSTIMUL

    Energy Technology Data Exchange (ETDEWEB)

    Wright, A. von (Univ. of Kuopio, Dept. of Biosciences (Finland)), email: atte.vonWright@uku.fi

    2009-10-15

    Plant polyphenolics have a wide range of bioactivities. Coniferous trees are a rich source of stilbenes, such as pinosylvin in the genus Pinus. Pinosylvin is structurally very similar to resveratrol, a stilbene found in grapes and red berries, and which is reported to have beneficial health effects such as prevention of cardiovascular diseases, tumourigenesis, and according to recent findings, also type 2 diabetes. In our previous studies the bioactivities of pinosylvin (antimicrobial effects and cytotoxic activities against cancer cells) were very similar to those of resveratrol. In this project we elucidate the potential of pinosylvin and its derivatives in food applications as multifunctional antimicrobial agents with positive health effects (including prevention of type 2 diabetes) highlighting results. (orig.)

  6. Bioactive and wood-associated stilbenes as multifunctional antimicrobial and health promoting agents (BIOSTIMUL)

    Energy Technology Data Exchange (ETDEWEB)

    Wright, A. von (Kuopio Univ., Department of Biosciences (Finland))

    2008-07-01

    Plant polyphenolics have a wide range of bioactivities. Coniferous trees are a rich source of stilbenes, such as pinosylvin in the genus Pinus. Pinosylvin is structurally very similar to resveratrol, a stilbene found in grapes and red berries, and which is reported to have beneficial health effects such as prevention of cardiovascular diseases, tumourigenesis, and according to recent findings, also type II diabetes. In our previous studies the bioactivities of pinosylvin (antimicrobial effects and cytotoxic activities against cancer cells) were very similar to those of resveratrol. In this project we elucidate the potential of pinosylvin and as derivatives in food applications as multifunctional antimicrobial agents with positive health effects (including prevention of type II diabetes) highlighting results. (orig.)

  7. Factors influencing the production of stilbenes by the knotweed, Reynoutria × bohemica

    Czech Academy of Sciences Publication Activity Database

    Kovářová, Marcela; Bartůňková, Kristýna; Frantík, Tomáš; Koblihová, Helena; Prchalová, K.; Vosátka, Miroslav

    2010-01-01

    Roč. 10, č. 19 (2010), s. 1-16 ISSN 1471-2229 R&D Projects: GA MPO FT-TA3/008; GA MŠk 1M0571 Institutional research plan: CEZ:AV0Z60050516 Keywords : japanese knotweed * Reynoutria * stilbenes Subject RIV: EF - Botanics Impact factor: 4.085, year: 2010 http://www.biomedcentral.com/1471-2229/10/19

  8. Target molecular weights for red cell band 3 stilbene and mercurial binding sites

    International Nuclear Information System (INIS)

    Verkman, A.S.; Skorecki, K.L.; Jung, C.Y.; Ausiello, D.A.

    1986-01-01

    Radiation inactivation was used to measure the target sizes for binding of disulfonic stilbene anion transport inhibitor 4,4'-dibenzamido-2,2'-disulfonic stilbene (DBDS) and mercurial water transport inhibitor p-chloromercuribenzene sulfonate (pCMBS) to human erythrocytes. The measured target size for erythrocyte ghost acetylcholinesterase was 78 +/- 3 kDa. DBDS binding to ghost membranes was measured by a fluorescence enhancement technique. Radiation (0-26 Mrad) had no effect on total membrane protein and DBDS binding affinity, whereas DBDS binding stoichiometry decreased exponentially with radiation dose, giving a target size of 59 +/- 4 kDa. H2-4,4'-diisothiocyano-2,2'-disulfonic stilbene (H2-DIDS, 5 microM) blocked greater than 95% of DBDS binding at all radiation doses. pCMBS binding was measured from the time course of tryptophan fluorescence quenching in ghosts treated with the sulfhydryl reagent N-ethylmaleimide (NEM). Radiation did not affect the kinetics of tryptophan quenching, whereas the total amplitude of the fluorescence signal inactivated with radiation with a target size of 31 +/- 6 kDa. These results support the notion that DBDS and pCMBS bind to the transmembrane domain of erythrocyte band 3 in NEM-treated ghosts and demonstrate that radiation inactivation may probe a target significantly smaller than a covalently linked protein subunit. The small target size for the band 3 stilbene binding site may correspond to the intramembrane domain of the band 3 monomer (52 kDa), which is physically distinct from the cytoplasmic domain (42 kDa)

  9. Phylogenomic and functional domain analysis of polyketide synthases in Fusarium

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Daren W.; Butchko, Robert A.; Baker, Scott E.; Proctor, Robert H.

    2012-02-01

    Fusarium species are ubiquitous in nature, cause a range of plant diseases, and produce a variety of chemicals often referred to as secondary metabolites. Although some fungal secondary metabolites affect plant growth or protect plants from other fungi and bacteria, their presence in grain based food and feed is more often associated with a variety of diseases in plants and in animals. Many of these structurally diverse metabolites are derived from a family of related enzymes called polyketide synthases (PKSs). A search of genomic sequence of Fusarium verticillioides, F. graminearum, F. oxysporum and Nectria haematococca (anamorph F. solani) identified a total of 58 PKS genes. To gain insight into how this gene family evolved and to guide future studies, we conducted a phylogenomic and functional domain analysis. The resulting genealogy suggested that Fusarium PKSs represent 34 different groups responsible for synthesis of different core metabolites. The analyses indicate that variation in the Fusarium PKS gene family is due to gene duplication and loss events as well as enzyme gain-of-function due to the acquisition of new domains or of loss-of-function due to nucleotide mutations. Transcriptional analysis indicate that the 16 F. verticillioides PKS genes are expressed under a range of conditions, further evidence that they are functional genes that confer the ability to produce secondary metabolites.

  10. Antibacterial polyketides from Bacillus amyloliquefaciens associated with edible red seaweed Laurenciae papillosa.

    Science.gov (United States)

    Chakraborty, Kajal; Thilakan, Bini; Raola, Vamshi Krishna; Joy, Minju

    2017-03-01

    Heterotrophic Bacillus amyloliquefaciens associated with edible red seaweed, Laurenciae papillosa was used to isolate antibacterial polyketide compounds. Antibacterial activity studies integrated with the outcome obtained by polyketide synthetase (pks) coding genes established that seaweed-affiliated bacterial flora had a wide-ranging antibacterial activities and potential natural product diversity, which proved that the bacterium is valuable reservoir of novel bioactive metabolites. Bioactivity-guided isolation of 3-(octahydro-9-isopropyl-2H-benzo[h]chromen-4-yl)-2-methylpropyl benzoate and methyl 8-(2-(benzoyloxy)-ethyl)-hexahydro-4-((E)-pent-2-enyl)-2H-chromene-6-carboxylate of polyketide origin, with activity against human opportunistic food pathogenic microbes, have been isolated from the ethyl acetate extract of B. amyloliquefaciens. Structure-activity relationship analysis revealed that hydrophobic descriptor of the polyketide compounds significantly contribute towards its antibacterial activity. Seaweed-associated microorganisms were shown to represent a potential source of antimicrobial compounds for food and health benefits. The antibacterial polyketide compounds described in the present study may find potential applications in the food industry to reduce food-borne pathogens. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Polyketide Synthases in the Microbiome of the Marine Sponge Plakortis halichondrioides: A Metagenomic Update

    Directory of Open Access Journals (Sweden)

    Gerardo Della Sala

    2014-11-01

    Full Text Available Sponge-associated microorganisms are able to assemble the complex machinery for the production of secondary metabolites such as polyketides, the most important class of marine natural products from a drug discovery perspective. A comprehensive overview of polyketide biosynthetic genes of the sponge Plakortis halichondrioides and its symbionts was obtained in the present study by massively parallel 454 pyrosequencing of complex and heterogeneous PCR (Polymerase Chain Reaction products amplified from the metagenomic DNA of a specimen of P. halichondrioides collected in the Caribbean Sea. This was accompanied by a survey of the bacterial diversity within the sponge. In line with previous studies, sequences belonging to supA and swfA, two widespread sponge-specific groups of polyketide synthase (PKS genes were dominant. While they have been previously reported as belonging to Poribacteria (a novel bacterial phylum found exclusively in sponges, re-examination of current genomic sequencing data showed supA and swfA not to be present in the poribacterial genome. Several non-supA, non-swfA type-I PKS fragments were also identified. A significant portion of these fragments resembled type-I PKSs from protists, suggesting that bacteria may not be the only source of polyketides from P. halichondrioides, and that protistan PKSs should receive further investigation as a source of novel polyketides.

  12. Carborane-stilbene dyads: the influence of substituents and cluster isomers on photoluminescence properties.

    Science.gov (United States)

    Ferrer-Ugalde, A; Cabrera-González, J; Juárez-Pérez, E J; Teixidor, F; Pérez-Inestrosa, E; Montenegro, J M; Sillanpää, R; Haukka, M; Núñez, R

    2017-02-14

    Two novel styrene-containing meta-carborane derivatives substituted at the second carbon cluster atom (C c ) with either a methyl (Me) or a phenyl (Ph) group are introduced herein along with a new set of stilbene-containing ortho- (o-) and meta- (m-) carborane dyads. The latter set of compounds have been prepared from styrene-containing carborane derivatives via a Heck coupling reaction. High regioselectivity has been achieved for these compounds by using a combination of palladium complexes [Pd 2 (dba) 3 ]/[Pd(t-Bu 3 P) 2 ] as a catalytic system, yielding exclusively E isomers. All compounds have been fully characterised and the crystal structures of seven of them were analysed by X-ray diffraction. The absorption spectra of these compounds are similar to those of their respective fluorophore groups (styrene or stilbene), showing a very small influence of the substituent (Me or Ph) linked to the second C c atom or the cluster isomer (o- or m-). On the other hand, fluorescence spectroscopy revealed high emission intensities for Me-o-carborane derivatives, whereas their Ph-o-carborane analogues evidenced an almost total lack of fluorescence, confirming the significant role of the substituent bound to the adjacent C c in o-carboranes. In contrast, all the m-carborane derivatives display similar photoluminescence (PL) behavior regardless of the substituent attached to the second C c , demonstrating its small influence on emission properties. Additionally, m-carborane derivatives are significantly more fluorescent than their o-counterparts, reaching quantum yield values as high as 30.2%. Regarding solid state emission, only stilbene-containing Ph-o-carborane derivatives, which showed very low fluorescence in solution, exhibited notable PL emission in films attributed to aggregation-induced emission. DFT calculations were performed to successfully complement the photoluminescence studies, supporting the experimentally observed photophysical behavior of the styrene and

  13. Discovery, biosynthesis, and rational engineering of novel enterocin and wailupemycin polyketide analogues.

    Science.gov (United States)

    Kalaitzis, John A

    2013-01-01

    The marine actinomycete Streptomyces maritimus produces a structurally diverse set of unusual polyketide natural products including the major metabolite enterocin. Investigations of enterocin biosynthesis revealed that the unique carbon skeleton is derived from an aromatic polyketide pathway which is genetically coded by the 21.3 kb enc gene cluster in S. maritimus. Characterization of the enc biosynthesis gene cluster and subsequent manipulation of it via heterologous expression and/or mutagenesis enabled the discovery of other enc-based metabolites that were produced in only very minor amounts in the wild type. Also described are techniques used to harness the enterocin biosynthetic machinery in order to generate unnatural enc-derived polyketide analogues. This review focuses upon the molecular methods used in combination with classical natural products detection and isolation techniques to access minor metabolites of the S. maritimus secondary metabolome.

  14. Discriminating the reaction types of plant type III polyketide synthases.

    Science.gov (United States)

    Shimizu, Yugo; Ogata, Hiroyuki; Goto, Susumu

    2017-07-01

    Functional prediction of paralogs is challenging in bioinformatics because of rapid functional diversification after gene duplication events combined with parallel acquisitions of similar functions by different paralogs. Plant type III polyketide synthases (PKSs), producing various secondary metabolites, represent a paralogous family that has undergone gene duplication and functional alteration. Currently, there is no computational method available for the functional prediction of type III PKSs. We developed a plant type III PKS reaction predictor, pPAP, based on the recently proposed classification of type III PKSs. pPAP combines two kinds of similarity measures: one calculated by profile hidden Markov models (pHMMs) built from functionally and structurally important partial sequence regions, and the other based on mutual information between residue positions. pPAP targets PKSs acting on ring-type starter substrates, and classifies their functions into four reaction types. The pHMM approach discriminated two reaction types with high accuracy (97.5%, 39/40), but its accuracy decreased when discriminating three reaction types (87.8%, 43/49). When combined with a correlation-based approach, all 49 PKSs were correctly discriminated, and pPAP was still highly accurate (91.4%, 64/70) even after adding other reaction types. These results suggest pPAP, which is based on linear discriminant analyses of similarity measures, is effective for plant type III PKS function prediction. pPAP is freely available at ftp://ftp.genome.jp/pub/tools/ppap/. goto@kuicr.kyoto-u.ac.jp. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  15. The effect of uncertainties in nuclear reactor plant-specific failure data on core damage frequency

    International Nuclear Information System (INIS)

    Martz, H.F.

    1995-05-01

    It is sometimes the case in PRA applications that reported plant-specific failure data are, in fact, only estimates which are uncertain. Even for detailed plant-specific data, the reported exposure time or number of demands is often only an estimate of the actual exposure time or number of demands. Likewise the reported number of failure events or incidents is sometimes also uncertain because incident or malfunction reports may be ambiguous. In this report we determine the corresponding uncertainty in core damage frequency which can b attributed to such uncertainties in plant-specific data using a simple but typical nuclear power reactor example

  16. In Vitro Biosynthesis of Unnatural Enterocin and Wailupemycin Polyketides¥

    Science.gov (United States)

    Kalaitzis, John A.; Cheng, Qian; Thomas, Paul M.; Kelleher, Neil L.; Moore, Bradley S.

    2009-01-01

    Nature has evolved finely tuned strategies to synthesize rare and complex natural products such as the enterocin family of polyketides from the marine bacterium Streptomyces maritimus. Herein we report the directed ex vivo multienzyme syntheses of 24 unnatural 5-deoxyenterocin and wailupemycin F and G analogues, 18 of which are new. We have generated molecular diversity by priming the enterocin biosynthesis enzymes with unnatural substrates and have illustrated further the uniqueness of this type II polyketide synthase by way of exploiting its unusual starter unit biosynthesis pathways. PMID:19215142

  17. Plant pathogenic anaerobic bacteria use aromatic polyketides to access aerobic territory.

    Science.gov (United States)

    Shabuer, Gulimila; Ishida, Keishi; Pidot, Sacha J; Roth, Martin; Dahse, Hans-Martin; Hertweck, Christian

    2015-11-06

    Around 25% of vegetable food is lost worldwide because of infectious plant diseases, including microbe-induced decay of harvested crops. In wet seasons and under humid storage conditions, potato tubers are readily infected and decomposed by anaerobic bacteria (Clostridium puniceum). We found that these anaerobic plant pathogens harbor a gene locus (type II polyketide synthase) to produce unusual polyketide metabolites (clostrubins) with dual functions. The clostrubins, which act as antibiotics against other microbial plant pathogens, enable the anaerobic bacteria to survive an oxygen-rich plant environment. Copyright © 2015, American Association for the Advancement of Science.

  18. Holographic recording of surface relief gratings in stilbene azobenzene derivatives at 633 nm

    International Nuclear Information System (INIS)

    Ozols, A; Saharov, D; Kokars, V; Kampars, V; Maleckis, A; Mezinskis, G; Pludons, A

    2010-01-01

    Holographic recording in stilbene azobenzene derivatives by He-Ne 633 nm laser light has been experimentally studied. It was found that surface relief gratings (SRG) can be recorded by red light. Usually shorter wavelengths are used to induce the trans-cis photo-isomerization in organic materials. SRG with 2 μm period and an amplitude of 130 nm have been recorded with 0.88 W/cm 2 light in about 20 minutes in amorphous films of 3-(4-(bis(2-(trityloxy)ethyl)amino)phenyl)-2-(4-(2-bromo-4-nitrophenyl) diazenyl)phenyl)acrylonitrile spin-coated on glass substrates. Self-diffraction efficiency up to 17.4% and specific recording energy down to 114 J/(cm 2 %) were measured. The recorded SRG were stable as proved by subsequent AFM measurements. The photo-induced changes in absorption spectra did not reveal noticeable signs of trans-cis transformations. Rather, spectrally uniform bleaching of the films took place. We conclude that a photothermally stimulated photo-destruction of chromophores is responsible for the SRG recording. The recording of stable SRG in the stilbene azobenzene derivatives we studied is accompanied by the recording of relaxing volume-phase gratings due to the photo-orientation of chromophores by the linearly polarized recording light. It should also be noted that holographic recording efficiency in stilbene azobenzene derivatives exhibit an unusual non-monotonic sample storage-time dependence presumably caused by the peculiarities of structural relaxation of the films.

  19. New organic photorefractive material composed of a charge-transporting dendrimer and a stilbene chromophore

    Science.gov (United States)

    Bai, Jaeil; Ducharme, Stephen; Leonov, Alexei G.; Lu, Liu; Takacs, James M.

    1999-10-01

    In this report, we introduce new organic photorefractive composites consisting of charge transporting den-drimers highly doped with a stilbene nonlinear optic chromophore, The purpose of making these composites is to improve charge transport, by reducing inhomogeneity when compared to ordinary polymer-based systems. Because the structure of this material gives us freedom to control the orientation of charge transport agents synthetically, we can study the charge transport mechanism more systematically than in polymers. We discuss this point and present the characterization results for this material.

  20. A radioimmunoassay for the detection of diethylstilboestrol and related stilbenes in biological fluids

    International Nuclear Information System (INIS)

    Hallahan, Cornelius; McGarry, Yvonne; Collins, J.D.

    1985-01-01

    A radioimmunoassay for the measurement of the synthetic anabolic agent diethylstilboestrol (DES) is described. It is based on a commercially available antiserum and a tritiated derivative of DES. The method can detect low concentrations of residues (less than 0.5 ng/ml) in small samples (0.05 to 0.2 ml) of biological fluids. DES was measured in plasma, bile and urine obtained from a calf slaughtered 22 days after subcutaneous implantation of 24 mg DES. The assay described is suitable as a rapid screening procedure for identifying animals treated with stilbene substances. (author)

  1. Identification and quantification of stilbenes in some Tunisian red wines using UPLC-MS and HPLC-DAD

    Directory of Open Access Journals (Sweden)

    Kamel Arraki

    2017-06-01

    Full Text Available Seven Tunisian red wines mainly from the Mornag appellation were analyzed for resveratrol and analogues. The wines of each variety were evaporated, concentrated, and then subjected to fractionation and purification using XAD16 and DOWEX column chromatography. In addition to resveratrol, seven stilbenes were identified by UPLC-MS. The stilbenes derived were shown to be piceatannol, piceid, a-viniferin, e-viniferin, hopeaphenol and isohopeaphenol. From the point of view of the presence of resveratrol derivatives, one wine, Sidi Zahia, was the richest qualitatively.

  2. Antimicrobial polyketide furanoterpenoids from seaweed-associated heterotrophic bacterium Bacillus subtilis MTCC 10403.

    Science.gov (United States)

    Chakraborty, Kajal; Thilakan, Bini; Raola, Vamshi Krishna

    2017-10-01

    Brown seaweed Anthophycus longifolius (Turner) Kützing (family Sargassaceae) associated heterotrophic bacterium Bacillus subtilis MTCC 10403 was found to be a potent isolate with broad range of antibacterial activity against important perceptive food pathogens Vibrio parahaemolyticus, V. vulnificus, and Aeromonas hydrophila. This bacterium was positive for polyketide synthetase gene (KC589397), and therefore, was selected to bioprospect specialized metabolites bearing polyketide backbone. Bioactivity-guided chromatographic fractionation of the ethyl acetate extract of the seaweed-associated bacterium segregated four homologous polyketide furanoterpenoids with potential antibacterial activities against clinically important pathogens. The minimum inhibitory concentration (MIC) assay showed that the referral antibiotics tetracycline and ampicillin were active at 25 μg/mL against the test pathogens, whereas the previously undescribed (4E)-methyl 13-((16-(furan-2-yl) ethyl)-octahydro-7-hydroxy-4-((E)-23-methylbut-21-enyl)-2H-chromen-6-yl)-4-methylpent-4-enoate (compound 1) and methyl 3-(hexahydro-9-((E)-3-methylpent-1-enyl)-4H-furo[3,2-g]isochromen-6-yl) propanoate (compound 3) displayed antibacterial activities against the test pathogens at a lesser concentration (MIC subtilis MTCC 10403 demonstrated to represent a potential source of antimicrobial polyketides for pharmaceutical applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Mapping of polyketide biosynthesis pathways in Aspergillus nidulans using a genome wide PKS gene deletion library

    DEFF Research Database (Denmark)

    Larsen, Thomas Ostenfeld; Rank, Christian; Klejnstrup, Marie Louise

    In order to map new links between PKS genes and their products in Aspergillus nidulans we have systematically deleted all thirty-two individual genes predicted to encode polyketide synthases in this model organism. This number greatly exceeds the number of currently known PKs calling for new appr...

  4. Insights into natural products biosynthesis from analysis of 490 polyketide synthases from Fusarium.

    Science.gov (United States)

    Brown, Daren W; Proctor, Robert H

    2016-04-01

    Species of the fungus Fusarium collectively cause disease on almost all crop plants and produce numerous natural products (NPs), including some of the mycotoxins of greatest concern to agriculture. Many Fusarium NPs are derived from polyketide synthases (PKSs), large multi-domain enzymes that catalyze sequential condensation of simple carboxylic acids to form polyketides. To gain insight into the biosynthesis of polyketide-derived NPs in Fusarium, we retrieved 488 PKS gene sequences from genome sequences of 31 species of the fungus. In addition to these apparently functional PKS genes, the genomes collectively included 81 pseudogenized PKS genes. Phylogenetic analysis resolved the PKS genes into 67 clades, and based on multiple lines of evidence, we propose that homologs in each clade are responsible for synthesis of a polyketide that is distinct from those synthesized by PKSs in other clades. The presence and absence of PKS genes among the species examined indicated marked differences in distribution of PKS homologs. Comparisons of Fusarium PKS genes and genes flanking them to those from other Ascomycetes provided evidence that Fusarium has the genetic potential to synthesize multiple NPs that are the same or similar to those reported in other fungi, but that have not yet been reported in Fusarium. The results also highlight ways in which such analyses can help guide identification of novel Fusarium NPs and differences in NP biosynthetic capabilities that exist among fungi. Published by Elsevier Inc.

  5. Expression, purification and crystallization of a plant polyketide cyclase from Cannabis sativa.

    Science.gov (United States)

    Yang, Xinmei; Matsui, Takashi; Mori, Takahiro; Taura, Futoshi; Noguchi, Hiroshi; Abe, Ikuro; Morita, Hiroyuki

    2015-12-01

    Plant polyketides are a structurally diverse family of natural products. In the biosynthesis of plant polyketides, the construction of the carbocyclic scaffold is a key step in diversifying the polyketide structure. Olivetolic acid cyclase (OAC) from Cannabis sativa L. is the only known plant polyketide cyclase that catalyzes the C2-C7 intramolecular aldol cyclization of linear pentyl tetra-β-ketide-CoA to generate olivetolic acid in the biosynthesis of cannabinoids. The enzyme is also thought to belong to the dimeric α+β barrel (DABB) protein family. However, because of a lack of functional analysis of other plant DABB proteins and low sequence identity with the functionally distinct bacterial DABB proteins, the catalytic mechanism of OAC has remained unclear. To clarify the intimate catalytic mechanism of OAC, the enzyme was overexpressed in Escherichia coli and crystallized using the vapour-diffusion method. The crystals diffracted X-rays to 1.40 Å resolution and belonged to space group P3121 or P3221, with unit-cell parameters a = b = 47.3, c = 176.0 Å. Further crystallographic analysis will provide valuable insights into the structure-function relationship and catalytic mechanism of OAC.

  6. A proteomic survey of nonribosomal peptide and polyketide biosynthesis in actinobacteria

    Science.gov (United States)

    Actinobacteria such as streptomycetes are renowned for their ability to produce bioactive natural products including nonribosomal peptides (NRPs) and polyketides (PKs). The advent of genome sequencing has revealed an even larger genetic repertoire for secondary metabolism with most of the small mole...

  7. Various Extraction Methods for Obtaining Stilbenes from Grape Cane of Vitis vinifera L.

    Directory of Open Access Journals (Sweden)

    Ivo Soural

    2015-04-01

    Full Text Available Grape cane, leaves and grape marc are waste products from viticulture, which can be used to obtain secondary stilbene derivatives with high antioxidant value. The presented work compares several extraction methods: maceration at laboratory temperature, extraction at elevated temperature, fluidized-bed extraction, Soxhlet extraction, microwave-assisted extraction, and accelerated solvent extraction. To obtain trans-resveratrol, trans-ε-viniferin and r2-viniferin from grape cane of the V. vinifera variety Cabernet Moravia, various conditions were studied: different solvents, using powdered versus cut cane material, different extraction times, and one-step or multiple extractions. The largest concentrations found were 6030 ± 680 µg/g dry weight (d.w. for trans-resveratrol, 2260 ± 90 µg/g d.w. for trans-ε-viniferin, and 510 ± 40 µg/g d.w. for r2-viniferin. The highest amounts of stilbenes (8500 ± 1100 µg/g d.w. were obtained using accelerated solvent extraction in methanol.

  8. Digital pile-up rejection for plutonium experiments with solution-grown stilbene

    Energy Technology Data Exchange (ETDEWEB)

    Bourne, M.M., E-mail: mmbourne@umich.edu; Clarke, S.D., E-mail: clarkesd@umich.edu; Paff, M., E-mail: mpaff@umich.edu; DiFulvio, A., E-mail: difulvio@umich.edu; Norsworthy, M., E-mail: marknors@umich.edu; Pozzi, S.A., E-mail: pozzisa@umich.edu

    2017-01-11

    A solution-grown stilbene detector was used in several experiments with plutonium samples including plutonium oxide, mixed oxide, and plutonium metal samples. Neutrons from different reactions and plutonium isotopes are accompanied by numerous gamma rays especially by the 59-keV gamma ray of {sup 241}Am. Identifying neutrons correctly is important for nuclear nonproliferation applications and makes neutron/gamma discrimination and pile-up rejection necessary. Each experimental dataset is presented with and without pile-up filtering using a previously developed algorithm. The experiments were simulated using MCNPX-PoliMi, a Monte Carlo code designed to accurately model scintillation detector response. Collision output from MCNPX-PoliMi was processed using the specialized MPPost post-processing code to convert neutron energy depositions event-by-event into light pulses. The model was compared to experimental data after pulse-shape discrimination identified waveforms as gamma ray or neutron interactions. We show that the use of the digital pile-up rejection algorithm allows for accurate neutron counting with stilbene to within 2% even when not using lead shielding.

  9. Use of plant-specific PRA in an EOP scope audit

    International Nuclear Information System (INIS)

    O'Brien, J.J.

    1991-01-01

    Traditionally, decisions on which accident scenarios to proceduralize as emergency operating procedures (EOPs) have been based on existing design basis analyses, engineering judgment, and probabilistic risk assessments (PRAs) on generic plants. This approach has important strengths and limits. The major limitation of generic PRAs is their inability to account for plant-specific features. Use of plant-specific PRA to determine the impact of proceduralizing, or not proceduralizing, responses to scenarios considers plant-specific features. This helps to eliminate unnecessary EOPs, thus allowing resources to be concentrated on scenarios that are more important for a particular plant. In preparation for a US Nuclear Regulatory Commission audit, a plant-specific PRA was used to assess and quantify the plant's previous decision not to implement six reference emergency response guidelines (ERGs) as procedures. The original justification for nonimplementation of the ERGs was based on engineering judgment. The PRA provided a quantitative justification for implementation/nonimplementation of each guidelines. This analysis accounted for plant-specific design features not common to all reference plants

  10. Effect of clone selection, nitrogen supply, leaf damage and mycorrhizal fungi on stilbene and emodin production in knotweed

    Czech Academy of Sciences Publication Activity Database

    Kovářová, Marcela; Frantík, Tomáš; Koblihová, Helena; Bartůňková, Kristýna; Nývltová, Z.; Vosátka, Miroslav

    2011-01-01

    Roč. 11, č. 98 (2011), s. 1-14 ISSN 1471-2229 R&D Projects: GA MPO FT-TA3/008; GA MŠk 1M0571 Institutional research plan: CEZ:AV0Z60050516 Keywords : knotweed * stilbenes * leaf damage Subject RIV: EF - Botanics Impact factor: 3.447, year: 2011

  11. The marine sponge-derived polyketide endoperoxide plakortide F acid mediates its antifungal activity by interfering with calcium homeostasis

    Science.gov (United States)

    Plakortide F acid (PFA) is a marine-derived polyketide endoperoxide exhibiting strong inhibitory activity against several clinically important fungal pathogens. In the present study, transcriptional profiling coupled with mutant and biochemical analyses were conducted using the model organism Sacch...

  12. The polyketide components of waxes and the Cer-cqu gene cluster encoding a novel polyketide synthase, the β-diketone synthase, DKS

    DEFF Research Database (Denmark)

    von Wettstein, Penny

    2017-01-01

    The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...

  13. HSQC-TOCSY Fingerprinting for Prioritization of Polyketide- and Peptide-Producing Microbial Isolates.

    Science.gov (United States)

    Buedenbender, Larissa; Habener, Leesa J; Grkovic, Tanja; Kurtböke, D İpek; Duffy, Sandra; Avery, Vicky M; Carroll, Anthony R

    2018-04-27

    Microbial products are a promising source for drug leads as a result of their unique structural diversity. However, reisolation of already known natural products significantly hampers the discovery process, and it is therefore important to incorporate effective microbial isolate selection and dereplication protocols early in microbial natural product studies. We have developed a systematic approach for prioritization of microbial isolates for natural product discovery based on heteronuclear single-quantum correlation-total correlation spectroscopy (HSQC-TOCSY) nuclear magnetic resonance profiles in combination with antiplasmodial activity of extracts. The HSQC-TOCSY experiments allowed for unfractionated microbial extracts containing polyketide and peptidic natural products to be rapidly identified. Here, we highlight how this approach was used to prioritize extracts derived from a library of 119 ascidian-associated actinomycetes that possess a higher potential to produce bioactive polyketides and peptides.

  14. Broad Substrate Specificity of the Loading Didomain of the Lipomycin Polyketide Synthase

    Energy Technology Data Exchange (ETDEWEB)

    Yuzawa, S; Eng, CH; Katz, L; Keasling, JD

    2013-06-04

    LipPks1, a polyketide synthase subunit of the lipomycin synthase, is believed to catalyze the polyketide chain initiation reaction using isobutyryl-CoA as a substrate, followed by an elongation reaction with methylmalonyl-CoA to start the biosynthesis of antibiotic alpha-lipomycin in Streptomyces aureofaciens Tu117. Recombinant LipPks1, containing the thioesterase domain from the 6-deoxyerythronolide B synthase, was produced in Escherichia coli, and its substrate specificity was investigated in vitro. Surprisingly, several different acyl-CoAs, including isobutyryl-CoA, were accepted as the starter substrates, while no product was observed with acetyl-CoA. These results demonstrate the broad substrate specificity of LipPks1 and may be applied to producing new antibiotics.

  15. Perpendicular State of an Electronically Excited Stilbene: Observation by Femtosecond-Stimulated Raman Spectroscopy.

    Science.gov (United States)

    Quick, Martin; Dobryakov, Alexander L; Ioffe, Ilya N; Granovsky, Alex A; Kovalenko, Sergey A; Ernsting, Nikolaus P

    2016-10-20

    In the photoisomerization path of stilbene, a perpendicular state P on the S 1 potential energy surface is expected just before internal conversion through a conical intersection S 1 /S 0 . For decades the observation of P was thwarted by a short lifetime τ P in combination with slow population flow over a barrier. But these limitations can be overcome by ethylenic substitution. Following optical excitation of trans-1,1'-dicyanostilbene, P is populated significantly (τ P = 27 ps in n-hexane) and monitored by an exited-state absorption band at 370 nm. Here we report stimulated Raman lines of P. The strongest, at 1558 cm -1 , is attributed to stretching vibrations of the phenyl rings. Transient electronic states, resonance conditions, and corresponding Raman signals are discussed.

  16. Synthesis and anticancer activity of N-substituted 2-arylquinazolinones bearing trans-stilbene scaffold.

    Science.gov (United States)

    Mahdavi, Mohammad; Pedrood, Keyvan; Safavi, Maliheh; Saeedi, Mina; Pordeli, Mahboobeh; Ardestani, Sussan Kabudanian; Emami, Saeed; Adib, Mehdi; Foroumadi, Alireza; Shafiee, Abbas

    2015-05-05

    A novel series of 2-arylquinazolinones 7a-o bearing trans-stilbene moiety were designed, synthesized, and evaluated against human breast cancer cell lines including human breast adenocarcinoma (MCF-7 and MDA-MB-231) and human ductal breast epithelial tumor (T-47D). Among the tested compounds, the sec-butyl derivative 7h showed the best profile of activity (IC50 < 5 μM) against all cell lines, being 2-fold more potent than standard drug, etoposide. Our investigation revealed that the cytotoxic activity was significantly affected by N3-alkyl substituents. Furthermore, the morphological analysis by acridine orange/ethidium bromide double staining test and flow cytometry analysis indicated that the prototype compound 7h can induce apoptosis in MCF-7 and MDA-MB-231 cells. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  17. Design, Synthesis and Cytotoxic Evaluation of o-Carboxamido Stilbene Analogues

    Directory of Open Access Journals (Sweden)

    Mohamad Nurul Azmi

    2013-11-01

    Full Text Available Resveratrol, a natural stilbene found in grapes and wines exhibits a wide range of pharmacological properties. Resveratrol is also known as a good chemopreventive agent for inhibiting carcinogenesis processes that target kinases, cyclooxygenases, ribonucleotide reductase and DNA polymerases. A total of 19 analogues with an amide moiety were synthesized and the cytotoxic effects of the analogues on a series of human cancer cell lines are reported. Three compounds 6d, 6i and 6n showed potent cytotoxicity against prostate cancer DU-145 (IC50 = 16.68 µM, colon cancer HT-29 (IC50 = 7.51 µM and breast cancer MCF-7 (IC50 = 21.24 µM, respectively, which are comparable with vinblastine. The resveratrol analogues were synthesized using the Heck method.

  18. 40 CFR 60.1170 - What plant-specific training must I provide?

    Science.gov (United States)

    2010-07-01

    ...) December 6, 2001. (3) The date before an employee assumes responsibilities that affect operation of the... 40 Protection of Environment 6 2010-07-01 2010-07-01 false What plant-specific training must I provide? 60.1170 Section 60.1170 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR...

  19. 40 CFR 62.15110 - Who must complete the plant-specific training course?

    Science.gov (United States)

    2010-07-01

    ...-specific training course? All employees with responsibilities that affect how a municipal waste combustion... 40 Protection of Environment 8 2010-07-01 2010-07-01 false Who must complete the plant-specific training course? 62.15110 Section 62.15110 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY...

  20. 40 CFR 60.1655 - Who must complete the plant-specific training course?

    Science.gov (United States)

    2010-07-01

    ...-specific training course? All employees with responsibilities that affect how a municipal waste combustion... 40 Protection of Environment 6 2010-07-01 2010-07-01 false Who must complete the plant-specific training course? 60.1655 Section 60.1655 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY...

  1. DNA binding by the plant-specific NAC transcription factors in crystal and solution

    DEFF Research Database (Denmark)

    Welner, Ditte Hededam; Lindemose, Søren; Grossmann, J. Günter

    2012-01-01

    angle X-ray scattering on complexes with oligonucleotides, mutagenesis and (DNase I and uranyl photo-) footprinting, is combined to form a structural view of DNA-binding, and for the first time provide experimental evidence for the speculated relationship between plant-specific NAC proteins, WRKY...

  2. Tanzawaic acids I–L: Four new polyketides from Penicillium sp. IBWF104-06

    Directory of Open Access Journals (Sweden)

    Louis P. Sandjo

    2014-01-01

    Full Text Available Four new polyketides have been identified in culture filtrates of the fungal strain Penicillium sp. IBWF104-06 isolated from a soil sample. They are structurally based on the same trans-decalinpentanoic acid skeleton as tanzawaic acids A–H. One of the new compounds was found to inhibit the conidial germination in the rice blast fungus Magnaporthe oryzae at concentrations of 25 μg/mL.

  3. Polyketides with Immunosuppressive Activities from Mangrove Endophytic Fungus Penicillium sp. ZJ-SY₂.

    Science.gov (United States)

    Liu, Hongju; Chen, Senhua; Liu, Weiyang; Liu, Yayue; Huang, Xishan; She, Zhigang

    2016-11-25

    Nine polyketides, including two new benzophenone derivatives, peniphenone ( 1 ) and methyl peniphenone ( 2 ), along with seven known xanthones ( 3 - 9 ) were obtained from mangrove endophytic fungus Penicillium sp. ZJ-SY₂ isolated from the leaves of Sonneratia apetala . Their structures were elucidated on the basis of MS, 1D, and 2D NMR data. Compounds 1 , 3 , 5 , and 7 showed potent immunosuppressive activity with IC 50 values ranging from 5.9 to 9.3 μg/mL.

  4. Towards prediction of metabolic products of polyketide synthases: an in silico analysis.

    Directory of Open Access Journals (Sweden)

    Gitanjali Yadav

    2009-04-01

    Full Text Available Sequence data arising from an increasing number of partial and complete genome projects is revealing the presence of the polyketide synthase (PKS family of genes not only in microbes and fungi but also in plants and other eukaryotes. PKSs are huge multifunctional megasynthases that use a variety of biosynthetic paradigms to generate enormously diverse arrays of polyketide products that posses several pharmaceutically important properties. The remarkable conservation of these gene clusters across organisms offers abundant scope for obtaining novel insights into PKS biosynthetic code by computational analysis. We have carried out a comprehensive in silico analysis of modular and iterative gene clusters to test whether chemical structures of the secondary metabolites can be predicted from PKS protein sequences. Here, we report the success of our method and demonstrate the feasibility of deciphering the putative metabolic products of uncharacterized PKS clusters found in newly sequenced genomes. Profile Hidden Markov Model analysis has revealed distinct sequence features that can distinguish modular PKS proteins from their iterative counterparts. For iterative PKS proteins, structural models of iterative ketosynthase (KS domains have revealed novel correlations between the size of the polyketide products and volume of the active site pocket. Furthermore, we have identified key residues in the substrate binding pocket that control the number of chain extensions in iterative PKSs. For modular PKS proteins, we describe for the first time an automated method based on crucial intermolecular contacts that can distinguish the correct biosynthetic order of substrate channeling from a large number of non-cognate combinatorial possibilities. Taken together, our in silico analysis provides valuable clues for formulating rules for predicting polyketide products of iterative as well as modular PKS clusters. These results have promising potential for discovery of

  5. Habitat-specific type I polyketide synthases in soils and street sediments

    Czech Academy of Sciences Publication Activity Database

    Hill, P.; Piel, J.; Aris-Brosou, S.; Krištůfek, Václav; Boddy, Ch.N.; Dijkhuizen, L.

    2014-01-01

    Roč. 41, č. 1 (2014), s. 75-85 ISSN 1367-5435 R&D Projects: GA MŠk LC06066; GA MŠk 2B06154 Grant - others:NATO(NL) ESP.EAP.CLG 981785 Institutional research plan: CEZ:AV0Z60660521 Institutional support: RVO:60077344 Keywords : natural product discovery * polyketides * urban microbiology * bioprospecting * mycobactin Subject RIV: EE - Microbiology, Virology Impact factor: 2.439, year: 2014

  6. Towards Precision Engineering of Canonical Polyketide Synthase Domains: Recent Advances and Future Prospects

    Directory of Open Access Journals (Sweden)

    Carmen L. Bayly

    2017-02-01

    Full Text Available Modular polyketide synthases (mPKSs build functionalized polymeric chains, some of which have become blockbuster therapeutics. Organized into repeating clusters (modules of independently-folding domains, these assembly-line-like megasynthases can be engineered by introducing non-native components. However, poor introduction points and incompatible domain combinations can cause both unintended products and dramatically reduced activity. This limits the engineering and combinatorial potential of mPKSs, precluding access to further potential therapeutics. Different regions on a given mPKS domain determine how it interacts both with its substrate and with other domains. Within the assembly line, these interactions are crucial to the proper ordering of reactions and efficient polyketide construction. Achieving control over these domain functions, through precision engineering at key regions, would greatly expand our catalogue of accessible polyketide products. Canonical mPKS domains, given that they are among the most well-characterized, are excellent candidates for such fine-tuning. The current minireview summarizes recent advances in the mechanistic understanding and subsequent precision engineering of canonical mPKS domains, focusing largely on developments in the past year.

  7. Synthesis of stilbene derivatives via visible-light-induced cross-coupling of aryl diazonium salts with nitroalkenes using -NO2 as a leaving group.

    Science.gov (United States)

    Zhang, Na; Quan, Zheng-Jun; Zhang, Zhang; Da, Yu-Xia; Wang, Xi-Cun

    2016-12-06

    The straightforward visible-light-induced synthesis of stilbene compounds via the cross-coupling of nitroalkenes and diazonium tetrafluoroborates under transition-metal-free conditions is described. The protocol uses green LEDs as light sources and eosin Y as an organophotoredox catalyst. Broad substrate scope and exclusive selectivity for the (E)-configuration of stilbenes are observed. This protocol proceeds via a radical pathway, with nitroalkenes serving as the radical acceptor, and the nitro group is cleaved during the process.

  8. Structural basis for olivetolic acid formation by a polyketide cyclase from Cannabis sativa.

    Science.gov (United States)

    Yang, Xinmei; Matsui, Takashi; Kodama, Takeshi; Mori, Takahiro; Zhou, Xiaoxi; Taura, Futoshi; Noguchi, Hiroshi; Abe, Ikuro; Morita, Hiroyuki

    2016-03-01

    In polyketide biosynthesis, ring formation is one of the key diversification steps. Olivetolic acid cyclase (OAC) from Cannabis sativa, involved in cannabinoid biosynthesis, is the only known plant polyketide cyclase. In addition, it is the only functionally characterized plant α+β barrel (DABB) protein that catalyzes the C2-C7 aldol cyclization of the linear pentyl tetra-β-ketide CoA as the substrate, to generate olivetolic acid (OA). Herein, we solved the OAC apo and OAC-OA complex binary crystal structures at 1.32 and 1.70 Å resolutions, respectively. The crystal structures revealed that the enzyme indeed belongs to the DABB superfamily, as previously proposed, and possesses a unique active-site cavity containing the pentyl-binding hydrophobic pocket and the polyketide binding site, which have never been observed among the functionally and structurally characterized bacterial polyketide cyclases. Furthermore, site-directed mutagenesis studies indicated that Tyr72 and His78 function as acid/base catalysts at the catalytic center. Structural and/or functional studies of OAC suggested that the enzyme lacks thioesterase and aromatase activities. These observations demonstrated that OAC employs unique catalytic machinery utilizing acid/base catalytic chemistry for the formation of the precursor of OA. The structural and functional insights obtained in this work thus provide the foundation for analyses of the plant polyketide cyclases that will be discovered in the future. Structural data reported in this paper are available in the Protein Data Bank under the accession numbers 5B08 for the OAC apo, 5B09 for the OAC-OA binary complex and 5B0A, 5B0B, 5B0C, 5B0D, 5B0E, 5B0F and 5B0G for the OAC His5Q, Ile7F, Tyr27F, Tyr27W, Val59M, Tyr72F and His78S mutant enzymes, respectively. © 2016 Federation of European Biochemical Societies.

  9. Polyphenol Stilbenes from Fenugreek (Trigonella foenum-graecum L. Seeds Improve Insulin Sensitivity and Mitochondrial Function in 3T3-L1 Adipocytes

    Directory of Open Access Journals (Sweden)

    Gang Li

    2018-01-01

    Full Text Available Fenugreek (Trigonella foenum-graecum L. is a well-known annual plant that is widely distributed worldwide and has possessed obvious hypoglycemic and hypercholesterolemia characteristics. In our previous study, three polyphenol stilbenes were separated from fenugreek seeds. Here, we investigated the effect of polyphenol stilbenes on adipogenesis and insulin resistance in 3T3-L1 adipocytes. Oil Red O staining and triglyceride assays showed that polyphenol stilbenes differently reduced lipid accumulation by suppressing the expression of adipocyte-specific proteins. In addition, polyphenol stilbenes improved the uptake of 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-ylamino-2-deoxyglucose (2-NBDG by promoting the phosphorylation of protein kinase B (AKT and AMP-activated protein kinase (AMPK. In present studies, it was found that polyphenol stilbenes had the ability to scavenge reactive oxygen species (ROS. Results from adenosine triphosphate (ATP production and mitochondrial membrane potentials suggested that mitochondria play a critical role in insulin resistance and related signaling activation, such as AKT and AMPK. Rhaponticin, one of the stilbenes from fenugreek, had the strongest activity among the three compounds in vitro. Future studies will focus on mitochondrial biogenesis and function.

  10. A comparison of two methods of pulse-shape discrimination for alpha-gamma separation with trans-stilbene

    International Nuclear Information System (INIS)

    Shani, G.; Cojocaru, M.

    1977-01-01

    A method for measurement of low level alpha particles in high level gamma background is investigated. Because of its pulse-shape-discrimination properties and being a solid scintillator, trans-stilbene seems to be the proper scintillator, for this purpose. The investigation was done by measuring the effect of different gamma background level (from very low to very high) on constant alpha count rate. Two different pulse-shape-discrimination systems were used and compared. The Ortec system measures the pulse fall time and supplies a corresponding pulse height and the Elscint system checks whether the pulse is what is expected to be the gamma pulse, or is a longer pulse. Both systems yielded good results and were found to be adequate for alpha-gamma separation with trans-stilbene. (Auth.)

  11. Use of plant specific PSA to evaluate incidents at nuclear power plants

    International Nuclear Information System (INIS)

    1991-06-01

    One of the possible applications of the plant specific probabilistic safety assessment (PSA) is its use in the analysis of operational events at the plant. The methodological development in that area was initiated recently in the framework of the IAEA's Incident Reporting System where determination of the safety significance of the event is essential for optimizing feedback of operating experience. This report provides details of the methodology and procedures to be used in event analysis. The report also contains three case studies which have been performed and summarizes lessons learned from those case studies. The results (event probabilities) obtained using plant specific PSA and the results of the analysis of the same events in the framework of the Accident Sequence Precursor (ASP) programmes (generic models) were compared and commented on. 6 refs, figs and tabs

  12. Stilbenes from Deguelia rufescens var. urucu (Ducke) A. M. G. Azevedo leaves: effects on seed germination and plant growth

    Energy Technology Data Exchange (ETDEWEB)

    Lobo, Livia T.; Silva, Geilson A. da; Freitas, Manolo C.C. de; Silva, Milton N. da; Arruda, Alberto C.; Guilhon, Giselle M.S.P.; Santos, Lourivaldo S.; Santos, Alberdan S.; Arruda, Mara S.P., E-mail: mspa@ufpa.b [Universidade Federal do Para (UFPA), Belem, PA (Brazil). Inst. de Ciencias Exatas e Naturais. Programa de Pos-Graduacao em Quimica; Souza Filho, Antonio Pedro S. [Centro de Pesquisa Agroflorestal da Amazonia Oriental (CPATU), Belem, PA (Brazil)

    2010-07-01

    The Amazon biodiversity may provide plants whose chemical substances are capable of controlling weeds. In this study we report the isolation and identification of five stilbenes from the leaves of 'timbo vermelho' (Deguelia rufescens var. urucu): 4-methoxylonchocarpene (1); 3,5-dimethoxy-4'-hydroxy-3'-prenyl-trans-stilbene (2), lonchocarpene (3), 3,5-dimethoxy-4'-Oprenyl- trans-stilbene (4) and pterostilbene (5). Compounds 2 and 4 are new natural products although 2 has been previously cited as synthesis product. Potential allelopathic activity for 1, 2 and 4 was evaluated over seed germination and plant growth of Mimosa pudica weed. The observed effects on seed germination did not vary significantly (p > 0.05) when the analysis of phytotoxicity was performed with the substances alone, the maximum inhibition did not exceed 20%. The most intense inhibitions on radicle and hypocotyl development were found for compound 4 (p < 0.05). When tested in pairs, showed antagonism for seed germination and synergism for radicle and hypocotyl development. (author)

  13. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  14. The Polyketide Components of Waxes and the Cer-cqu Gene Cluster Encoding a Novel Polyketide Synthase, the β-Diketone Synthase, DKS.

    Science.gov (United States)

    von Wettstein-Knowles, Penny

    2017-07-10

    The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c , -q and -u genes forming the 101 kb Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms long, thin crystalline tubes. A pathway branch leads to the formation of esterified alkan-2-ols.

  15. Bio-based production of fuels and industrial chemicals by repurposing antibiotic-producing type I modular polyketide synthases: opportunities and challenges

    DEFF Research Database (Denmark)

    Yuzawa, Satoshi; Keasling, Jay D.; Katz, Leonard

    2017-01-01

    Complex polyketides comprise a large number of natural products that have broad application in medicine and agriculture. They are produced in bacteria and fungi from large enzyme complexes named type I modular polyketide synthases (PKSs) that are composed of multifunctional polypeptides containin...... have applications as fuels or industrial chemicals....

  16. HSQC-TOCSY Fingerprinting-Directed Discovery of Antiplasmodial Polyketides from the Marine Ascidian-Derived Streptomyces sp. (USC-16018).

    Science.gov (United States)

    Buedenbender, Larissa; Robertson, Luke P; Lucantoni, Leonardo; Avery, Vicky M; Kurtböke, D İpek; Carroll, Anthony R

    2018-05-30

    Chemical investigations on the fermentation extract obtained from an ascidian-derived Streptomyces sp. (USC-16018) yielded a new ansamycin polyketide, herbimycin G ( 1 ), as well as a known macrocyclic polyketide, elaiophylin ( 2 ), and four known diketopiperazines ( 3 ⁻ 6 ). The structures of the compounds were elucidated based on 1D/2D NMR and MS data. The absolute configuration of 1 was established by comparison of experimental and predicted electronic circular dichroism (ECD) data. Antiplasmodial activities were tested for the natural products against chloroquine sensitive (3D7) and chloroquine resistant (Dd2) Plasmodium falciparum strains; the two polyketides ( 1 ⁻ 2 ) demonstrated an inhibition of >75% against both parasite strains and while 2 was highly cytotoxic, herbimycin G ( 1 ) showed no cytotoxicity and good predicted water solubility.

  17. Polyketide synthases of Diaporthe helianthi and involvement of DhPKS1 in virulence on sunflower.

    Science.gov (United States)

    Ruocco, Michelina; Baroncelli, Riccardo; Cacciola, Santa Olga; Pane, Catello; Monti, Maurilia Maria; Firrao, Giuseppe; Vergara, Mariarosaria; Magnano di San Lio, Gaetano; Vannacci, Giovanni; Scala, Felice

    2018-01-06

    The early phases of Diaporthe helianthi pathogenesis on sunflower are characterized by the production of phytotoxins that may play a role in host colonisation. In previous studies, phytotoxins of a polyketidic nature were isolated and purified from culture filtrates of virulent strains of D. helianthi isolated from sunflower. A highly aggressive isolate (7/96) from France contained a gene fragment of a putative nonaketide synthase (lovB) which was conserved in a virulent D. helianthi population. In order to investigate the role of polyketide synthases in D. helianthi 7/96, a draft genome of this isolate was examined. We were able to find and phylogenetically analyse 40 genes putatively coding for polyketide synthases (PKSs). Analysis of their domains revealed that most PKS genes of D. helianthi are reducing PKSs, whereas only eight lacked reducing domains. Most of the identified PKSs have orthologs shown to be virulence factors or genetic determinants for toxin production in other pathogenic fungi. One of the genes (DhPKS1) corresponded to the previously cloned D. helianthi lovB gene fragment and clustered with a nonribosomal peptide synthetase (NRPS) -PKS hybrid/lovastatin nonaketide like A. nidulans LovB. We used DhPKS1 as a case study and carried out its disruption through Agrobacterium-mediated transformation in the isolate 7/96. D. helianthi DhPKS1 deleted mutants were less virulent to sunflower compared to the wild type, indicating a role for this gene in the pathogenesis of the fungus. The PKS sequences analysed and reported here constitute a new genomic resource that will be useful for further research on the biology, ecology and evolution of D. helianthi and generally of fungal plant pathogens.

  18. Quick guide to polyketide synthase and nonribosomal synthetase genes in Fusarium

    DEFF Research Database (Denmark)

    Hansen, Jørgen T.; Sørensen, Jens L.; Giese, Henriette

    2012-01-01

    Fusarium species produce a plethora of bioactive polyketides and nonribosomal peptides that give rise to health problems in animals and may have drug development potential. Using the genome sequences for Fusarium graminearum, F. oxysporum, F. solani and F. verticillioides we developed a framework...... and NRPS genes in sequenced Fusarium species and their known products. With the rapid increase in the number of sequenced fungal genomes a systematic classification will greatly aid the scientific community in obtaining an overview of the number of different NRPS and PKS genes and their potential...

  19. Mesoporous stilbene-based lanthanide metal organic frameworks: synthesis, photoluminescence and radioluminescence characteristics.

    Science.gov (United States)

    Mathis Ii, Stephan R; Golafale, Saki T; Bacsa, John; Steiner, Alexander; Ingram, Conrad W; Doty, F Patrick; Auden, Elizabeth; Hattar, Khalid

    2017-01-03

    Ultra large pore isostructural metal organic frameworks (MOFs) which exhibit both photoluminescence and scintillation properties, were synthesized from trans-4,4'-stilbenedicarboxylic acid (H 2 L) and trivalent lanthanide (Ln) metal salts under solvothermal conditions (Ln = Er 3+ (1) and Tm 3+ (2)). This new class of mesoporous materials is a non-interpenetrating network that features ultra-large diamond shaped pores of dimensions with approximate cross-sectional dimensions of 28 Å × 12 Å. The fully deprotonated ligand, L, is isolated and rigidified as it serves as the organic linker component of the MOF structure. Its low density unit cells possess asymmetric units with two crystallographically independent Ln 3+ ions in seven coordinate arrangements. A distinct feature of the structure is the bis-bidentate carboxylate groups. They serve as a ligand that coordinates two Ln(iii) ions while each L connects four Ln(iii) ions yielding an exceptionally large diamond-shaped rectangular network. The structure exhibits ligand-based photoluminescence with increased lifetime compared to free stilbene molecules on exposure to UV radiation, and also exhibits strong scintillation characteristics, comprising of both prompt and delayed radioluminescence features, on exposure to ionizing radiation.

  20. Synergistic action of fatty acids, sulphides and stilbene against acaricide-resistant Rhipicephalus microplus ticks.

    Science.gov (United States)

    Arceo-Medina, G N; Rosado-Aguilar, J A; Rodríguez-Vivas, R I; Borges-Argaez, R

    2016-09-15

    Six compounds in a methanolic extract of Petiveria alliacea stem (cis-stilbene; benzyl disulphide; benzyl trisulphide; and methyl esters of hexadecanoic acid, octadecadienoic acid and octadecenoic acid) are known to exercise acaricide activity against cattle tick Rhipicephalus microplus larvae and adults. The synergistic effect of 57 combinations of these six compounds on acaricide activity against R. microplus was evaluated. Larvae immersion tests produced the lethal concentrations needed to kill 50% (LC 50 ) and 99% (LC 99 ) of the population. Adult immersion tests produced rates (%) for mortality, oviposition inhibition and eclosion inhibition. Individually, none of the compounds (1% concentration) exhibited acaricide activity (mortality ≤2.3%). When combined, however, nine mixtures exhibited a synergistic increase in activity, with high mortality rates (≥92%) in larvae. Values for LC 50 ranged from 0.07 to 0.51% and those for LC 99 from 0.66 to 5.16%. Thirty six compound mixtures had no significant activity (mortality ≤30%) against larvae. Two mixtures exhibited synergism against adults, with high rates (≥92%) of oviposition inhibition. The mixtures based on the benzyl disulphide+benzyl trisulphide pairing produced a synergistic effect against acaricide-resistant R. microplus larva and adults, and are therefore the most promising combination for controlling this ubiquitous ectoparasite. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Biologically active polyketides produced by Penicillium janthinellum isolated as an endophytic fungus from fruits of Melia azedarach

    International Nuclear Information System (INIS)

    Marinho, Andrey M. do Rosario; Rodrigues-Filho, Edson; Moitinho, Maria da Luz R.; Santos, Lourivaldo S.

    2005-01-01

    Penicillium janthinellum, isolated as an endophytic fungus from fruits of Melia azedarach, was cultivated over 20 days on ground and autoclaved white corn, where the known polyketides citrinin, emodin, 1,6,8-trihydroxy-3-hydroxymethylanthraquinone, and a new modified anthraquinone, named janthinone, were produced and isolated by classical chromatographic procedures and identified by MS and 1D and 2D NMR spectroscopic data. The antibacterial properties of these polyketides were investigated. Citrinin inhibited 100% of Leishmania growth after 48h at a concentration of 40 μg mL -1 . (author)

  2. Biologically active polyketides produced by Penicillium janthinellum isolated as an endophytic fungus from fruits of Melia azedarach

    Energy Technology Data Exchange (ETDEWEB)

    Marinho, Andrey M. do Rosario; Rodrigues-Filho, Edson [Sao Carlos Univ., SP (Brazil). Dept. de Quimica; Moitinho, Maria da Luz R. [Universidade Estadual de Maringa, PR (Brazil). Dept. de Analises Clinicas; Santos, Lourivaldo S. [Para Univ., Belem, PA (Brazil). Dept. de Quimica]. E-mail: edson@dq.ufscar.br

    2005-04-01

    Penicillium janthinellum, isolated as an endophytic fungus from fruits of Melia azedarach, was cultivated over 20 days on ground and autoclaved white corn, where the known polyketides citrinin, emodin, 1,6,8-trihydroxy-3-hydroxymethylanthraquinone, and a new modified anthraquinone, named janthinone, were produced and isolated by classical chromatographic procedures and identified by MS and 1D and 2D NMR spectroscopic data. The antibacterial properties of these polyketides were investigated. Citrinin inhibited 100% of Leishmania growth after 48h at a concentration of 40 {mu}g mL{sup -1}. (author)

  3. Interactions among predators and plant specificity protect herbivores from top predators.

    Science.gov (United States)

    Bosc, Christopher; Pauw, Anton; Roets, Francois; Hui, Cang

    2018-05-04

    The worldwide loss of top predators from natural and agricultural systems has heightened the need to understand how important they are in controlling herbivore abundance. The effect of top predators on herbivore species is likely to depend on 1) the importance of the consumption of intermediate predators by top predators (intra-guild predation; IGP), but also on 2) plant specificity by herbivores, because specialists may defend themselves better (enemy-free space; EFS). Insectivorous birds, as top predators, are generally known to effectively control herbivorous insects, despite also consuming intermediate predators such as spiders, but how this effect varies among herbivore species in relation to the cascading effects of IGP and EFS is not known. To explore this, we excluded birds from natural fynbos vegetation in South Africa using large netted cages and recorded changes in abundance relative to control plots for 199 plant-dwelling intermediate predator and 341 herbivore morpho-species that varied in their estimated plant specificity. We found a strong negative effect of birds on the total abundance of all intermediate predators, with especially clear effects on spiders (strong IGP). In contrast with previous studies, which document a negative effect of birds on herbivores, we found an overall neutral effect of birds on herbivore abundance, but the effect varied among species: some species were negatively affected by birds, suggesting that they were mainly consumed by birds, whereas others, likely released from spiders by IGP, were positively affected. Some species were also effectively neutrally affected by birds. These tended to be more specialized to plants compared to the other species, which may imply that some plant specialists benefited from protection provided by EFS from both birds and spiders. These results suggest that the response of herbivore species to top predators may depend on cascading effects of interactions among predators and on their degree

  4. A dual role for a polyketide synthase in dynemicin enediyne and anthraquinone biosynthesis

    Science.gov (United States)

    Cohen, Douglas R.; Townsend, Craig A.

    2018-02-01

    Dynemicin A is a member of a subfamily of enediyne antitumour antibiotics characterized by a 10-membered carbocycle fused to an anthraquinone, both of polyketide origin. Sequencing of the dynemicin biosynthetic gene cluster in Micromonospora chersina previously identified an enediyne polyketide synthase (PKS), but no anthraquinone PKS, suggesting gene(s) for biosynthesis of the latter were distant from the core dynemicin cluster. To identify these gene(s), we sequenced and analysed the genome of M. chersina. Sequencing produced a short list of putative PKS candidates, yet CRISPR-Cas9 mutants of each locus retained dynemicin production. Subsequently, deletion of two cytochromes P450 in the dynemicin cluster suggested that the dynemicin enediyne PKS, DynE8, may biosynthesize the anthraquinone. Together with 18O-labelling studies, we now present evidence that DynE8 produces the core scaffolds of both the enediyne and anthraquinone, and provide a working model to account for their formation from the programmed octaketide of the enediyne PKS.

  5. Engineering a Polyketide Synthase for In Vitro Production of Adipic Acid

    Energy Technology Data Exchange (ETDEWEB)

    Hagen, A; Poust, S; De Rond, T; Fortman, JL; Katz, L; Petzold, CJ; Keasling, JD

    2015-10-26

    Polyketides have enormous structural diversity, yet polyketide synthases (PKSs) have thus far been engineered to produce only drug candidates or derivatives thereof. Thousands of other molecules, including commodity and specialty chemicals, could be synthesized using PKSs if composing hybrid PKSs from well-characterized parts derived from natural PKSs was more efficient. Here, using modern mass spectrometry techniques as an essential part of the design–build–test cycle, we engineered a chimeric PKS to enable production one of the most widely used commodity chemicals, adipic acid. To accomplish this, we introduced heterologous reductive domains from various PKS clusters into the borrelidin PKS’ first extension module, which we previously showed produces a 3-hydroxy-adipoyl intermediate when coincubated with the loading module and a succinyl-CoA starter unit. Acyl-ACP intermediate analysis revealed an unexpected bottleneck at the dehydration step, which was overcome by introduction of a carboxyacyl-processing dehydratase domain. Appending a thioesterase to the hybrid PKS enabled the production of free adipic acid. Using acyl-intermediate based techniques to “debug” PKSs as described here, it should one day be possible to engineer chimeric PKSs to produce a variety of existing commodity and specialty chemicals, as well as thousands of chemicals that are difficult to produce from petroleum feedstocks using traditional synthetic chemistry.

  6. Plant specification of a generic human-error data through a two-stage Bayesian approach

    International Nuclear Information System (INIS)

    Heising, C.D.; Patterson, E.I.

    1984-01-01

    Expert judgement concerning human performance in nuclear power plants is quantitatively coupled with actuarial data on such performance in order to derive plant-specific human-error rate probability distributions. The coupling procedure consists of a two-stage application of Bayes' theorem to information which is grouped by type. The first information type contains expert judgement concerning human performance at nuclear power plants in general. Data collected on human performance at a group of similar plants forms the second information type. The third information type consists of data on human performance in a specific plant which has the same characteristics as the group members. The first and second information types are coupled in the first application of Bayes' theorem to derive a probability distribution for population performance. This distribution is then combined with the third information type in a second application of Bayes' theorem to determine a plant-specific human-error rate probability distribution. The two stage Bayesian procedure thus provides a means to quantitatively couple sparse data with expert judgement in order to obtain a human performance probability distribution based upon available information. Example calculations for a group of like reactors are also given. (author)

  7. An Immunosensing System Using Stilbene Glycoside as a Fluorogenic Substrate for an Enzymatic Reaction Model

    Directory of Open Access Journals (Sweden)

    Ya-Fei Tan

    2008-09-01

    Full Text Available A natural product, stilbene glycoside (2,3,5,4’-tetrahydroxydiphenylethylene-2-O-glucoside, TBG, has been evaluated for the first time as a potential substrate for horseradish peroxidase (HRP-catalyzed fluorogenic reactions. The properties of TBG as a fluorogenic substrate for HRP and its application in a fluorometric enzyme-linked immunosensing system were compared with commercially available substrates such as p-hydroxyphenylpropionic acid (pHPPA, chavicol and Amplex red using Brucella melitensis antibody (BrAb as a model analyte. The immunosensing body based on HRP-BrAb was constructed by dispersing graphite, BrAg and paraffin wax at room temperature. In a competitive immunoassay procedure, the BrAb competed with HRP-BrAb to react with the immobilized BrAg. In the enzymatic reaction, the binding HRP-BrAb on the sensing body surface can catalyze the polymerization reaction of TBG by H2O2 forming fluorescent dimers and causing an increase in fluorescence intensity. TBG showed comparable ability for HRP detection and its enzyme-linked immunosensing reaction system, in a linear detection ranging of 3.5´10-8~7.6´10-6g/L and with a detection limit of 1.7´10-9 g/L. The immobilized biocomposite surface could be regenerated with excellent reproducibility (RSD=3.8% by simply polishing with an alumina paper. The proposed immunosensing system has been used to determine the BrAb in rabbit serum samples with satisfactory results.

  8. Evidence for excited state intramolecular charge transfer in benzazole-based pseudo-stilbenes.

    Science.gov (United States)

    Santos, Fabiano da Silveira; Descalzo, Rodrigo Roceti; Gonçalves, Paulo Fernando Bruno; Benvenutti, Edilson Valmir; Rodembusch, Fabiano Severo

    2012-08-21

    Two azo compounds were obtained through the diazotization reaction of aminobenzazole derivatives and N,N-dimethylaniline using clay montmorillonite KSF as catalyst. The synthesized dyes were characterized using elemental analysis, Fourier transform infrared spectroscopy, and (13)C and (1)H NMR spectroscopy in solution. Their photophysical behavior was studied using UV-vis and steady-state fluorescence in solution. These dyes present intense absorption in the blue region. The spectral features of the azo compounds can be related to the pseudo-stilbene type as well as the E isomer of the dyes. Excitation at the absorption maxima does not produce emissive species in the excited state. However, excitation around 350 nm allowed dual emission of fluorescence, from both a locally excited (LE, short wavelength) and an intramolecular charge transfer (ICT, long wavelength) state, which was corroborated by a linear relation of the fluorescence maximum (ν(max)) versus the solvent polarity function (Δf) from the Lippert-Mataga correlation. Evidence of TICT in these dyes was discussed from the viscosity dependence of the fluorescence intensity in the ICT emission band. Theoretical calculations were also performed in order to study the geometry and charge distribution of the dyes in their ground and excited electronic states. Using DFT methods at the theoretical levels BLYP/Aug-cc-pVDZ, for geometry optimizations and frequency calculations, and B3LYP/6-311+G(2d), for single-point energy evaluations, the calculations revealed that the least energetic and most intense photon absorption leads to a very polar excited state that relaxes non-radioactively, which can be associated with photochemical isomerization.

  9. Identification of isomers in the gas phase and as adsorbates by near-edge X-ray absorption fine structure spectroscopy: Cis- and trans-stilbene

    International Nuclear Information System (INIS)

    Püttner, Ralph; Schmidt-Weber, Philipp; Kampen, Thorsten; Kolczewski, Christine; Hermann, Klaus; Horn, Karsten

    2017-01-01

    Highlights: • NEXAFS spectra of the cis- and trans-isomer of stilbene reveal distinct differences by which the isomers can be distinguished. • DFT calculations using the transition potential approach assign specific transitions that are different in the two isomers. • On Si(100), these differences in NEXAFS are also observed, suggesting that their conformations survive in the bonding situation. • NEXAFS is thus shown to be a sensitive tool to distinguish isomers in adsorbed species. - Abstract: Near-edge x-ray absorption fine structure spectra of the cis- and trans-isomers of stilbene in the gas phase reveal clear differences, which are analyzed by results from density-functional theory calculations using the transition potential approach. The differences between the two species also occur in stilbene adsorbed on Si(100), opening the way towards studying structural changes in molecules in different surface environments, and configurational switching in organic molecules on surfaces in particular.

  10. Identification of isomers in the gas phase and as adsorbates by near-edge X-ray absorption fine structure spectroscopy: Cis- and trans-stilbene

    Energy Technology Data Exchange (ETDEWEB)

    Püttner, Ralph [Department of Physics, Freie Universität Berlin, 14195 Berlin (Germany); Schmidt-Weber, Philipp [Fritz Haber Institute of the Max Planck Society, 14195 Berlin (Germany); Kampen, Thorsten [SPECS Surface Nano Analysis GmbH, 13355 Berlin (Germany); Kolczewski, Christine [Deutsches Museum München, 80538 Munich (Germany); Hermann, Klaus [Fritz Haber Institute of the Max Planck Society, 14195 Berlin (Germany); Horn, Karsten, E-mail: horn@fhi-berlin.mpg.de [Fritz Haber Institute of the Max Planck Society, 14195 Berlin (Germany)

    2017-02-15

    Highlights: • NEXAFS spectra of the cis- and trans-isomer of stilbene reveal distinct differences by which the isomers can be distinguished. • DFT calculations using the transition potential approach assign specific transitions that are different in the two isomers. • On Si(100), these differences in NEXAFS are also observed, suggesting that their conformations survive in the bonding situation. • NEXAFS is thus shown to be a sensitive tool to distinguish isomers in adsorbed species. - Abstract: Near-edge x-ray absorption fine structure spectra of the cis- and trans-isomers of stilbene in the gas phase reveal clear differences, which are analyzed by results from density-functional theory calculations using the transition potential approach. The differences between the two species also occur in stilbene adsorbed on Si(100), opening the way towards studying structural changes in molecules in different surface environments, and configurational switching in organic molecules on surfaces in particular.

  11. Interaction between Polyketide Synthase and Transporter Suggests Coupled Synthesis and Export of Virulence Lipid in M. tuberculosis.

    Directory of Open Access Journals (Sweden)

    2005-09-01

    Full Text Available Virulent mycobacteria utilize surface-exposed polyketides to interact with host cells, but the mechanism by which these hydrophobic molecules are transported across the cell envelope to the surface of the bacteria is poorly understood. Phthiocerol dimycocerosate (PDIM, a surface-exposed polyketide lipid necessary for Mycobacterium tuberculosis virulence, is the product of several polyketide synthases including PpsE. Transport of PDIM requires MmpL7, a member of the MmpL family of RND permeases. Here we show that a domain of MmpL7 biochemically interacts with PpsE, the first report of an interaction between a biosynthetic enzyme and its cognate transporter. Overexpression of the interaction domain of MmpL7 acts as a dominant negative to PDIM synthesis by poisoning the interaction between synthase and transporter. This suggests that MmpL7 acts in complex with the synthesis machinery to efficiently transport PDIM across the cell membrane. Coordination of synthesis and transport may not only be a feature of MmpL-mediated transport in M. tuberculosis, but may also represent a general mechanism of polyketide export in many different microorganisms.

  12. Identification of a polyketide synthase required for alternariol (AOH and alternariol-9-methyl ether (AME formation in Alternaria alternata.

    Directory of Open Access Journals (Sweden)

    Debjani Saha

    Full Text Available Alternaria alternata produces more than 60 secondary metabolites, among which alternariol (AOH and alternariol-9-methyl ether (AME are important mycotoxins. Whereas the toxicology of these two polyketide-based compounds has been studied, nothing is known about the genetics of their biosynthesis. One of the postulated core enzymes in the biosynthesis of AOH and AME is polyketide synthase (PKS. In a draft genome sequence of A. alternata we identified 10 putative PKS-encoding genes. The timing of the expression of two PKS genes, pksJ and pksH, correlated with the production of AOH and AME. The PksJ and PksH proteins are predicted to be 2222 and 2821 amino acids in length, respectively. They are both iterative type I reducing polyketide synthases. PksJ harbors a peroxisomal targeting sequence at the C-terminus, suggesting that the biosynthesis occurs at least partly in these organelles. In the vicinity of pksJ we found a transcriptional regulator, altR, involved in pksJ induction and a putative methyl transferase, possibly responsible for AME formation. Downregulation of pksJ and altR caused a large decrease of alternariol formation, suggesting that PksJ is the polyketide synthase required for the postulated Claisen condensations during the biosynthesis. No other enzymes appeared to be required. PksH downregulation affected pksJ expression and thus caused an indirect effect on AOH production.

  13. Genomic and transcriptomic analyses reveal differential regulation of diverse terpenoid and polyketides secondary metabolites in Hericium erinaceus.

    Science.gov (United States)

    Chen, Juan; Zeng, Xu; Yang, Yan Long; Xing, Yong Mei; Zhang, Qi; Li, Jia Mei; Ma, Ke; Liu, Hong Wei; Guo, Shun Xing

    2017-08-31

    The lion's mane mushroom Hericium erinaceus is a famous traditional medicinal fungus credited with anti-dementia activity and a producer of cyathane diterpenoid natural products (erinacines) useful against nervous system diseases. To date, few studies have explored the biosynthesis of these compounds, although their chemical synthesis is known. Here, we report the first genome and tanscriptome sequence of the medicinal fungus H. erinaceus. The size of the genome is 39.35 Mb, containing 9895 gene models. The genome of H. erinaceus reveals diverse enzymes and a large family of cytochrome P450 (CYP) proteins involved in the biosynthesis of terpenoid backbones, diterpenoids, sesquiterpenes and polyketides. Three gene clusters related to terpene biosynthesis and one gene cluster for polyketides biosynthesis (PKS) were predicted. Genes involved in terpenoid biosynthesis were generally upregulated in mycelia, while the PKS gene was upregulated in the fruiting body. Comparative genome analysis of 42 fungal species of Basidiomycota revealed that most edible and medicinal mushroom show many more gene clusters involved in terpenoid and polyketide biosynthesis compared to the pathogenic fungi. None of the gene clusters for terpenoid or polyketide biosynthesis were predicted in the poisonous mushroom Amanita muscaria. Our findings may facilitate future discovery and biosynthesis of bioactive secondary metabolites from H. erinaceus and provide fundamental information for exploring the secondary metabolites in other Basidiomycetes.

  14. Thiophene-free diphenyl-amino-stilbene-diketo-pyrrolo-pyrrole derivatives as donors for organic bulk heterojunction solar cell

    Czech Academy of Sciences Publication Activity Database

    Honová, J.; Luňák, S.; Vala, M.; Stříteský, S.; Fekete, Ladislav; Weiter, M.; Kovalenko, A.

    2016-01-01

    Roč. 70, č. 10 (2016), s. 1416-1424 ISSN 0366-6352 R&D Projects: GA MŠk LO1409; GA ČR(CZ) GA15-05095S; GA MŠk LM2015088 Institutional support: RVO:68378271 Keywords : organic solar cell * thiophene-free * diphenyl-amino-stilbene * hole mobility * molecular structure Subject RIV: BM - Solid Matter Physics ; Magnetism OBOR OECD: Condensed matter physics (including formerly solid state physics, supercond.) Impact factor: 1.258, year: 2016

  15. Stilbene induced inhibition of androgen receptor dimerization: implications for AR and ARΔLBD-signalling in human prostate cancer cells.

    Directory of Open Access Journals (Sweden)

    Wolfgang Streicher

    Full Text Available BACKGROUND: Advanced castration resistant prostate cancer (CRPC is often characterized by an increase of C-terminally truncated, constitutively active androgen receptor (AR variants. Due to the absence of a ligand binding domain located in the AR-C-terminus, these receptor variants (also termed ARΔLBD are unable to respond to all classical forms of endocrine treatments like surgical/chemical castration and/or application of anti-androgens. METHODOLOGY: In this study we tested the effects of the naturally occurring stilbene resveratrol (RSV and (E-4-(2, 6-Difluorostyryl-N, N-dimethylaniline, a fluorinated dialkylaminostilbene (FIDAS on AR- and ARΔLBD in prostate cancer cells. The ability of the compounds to modulate transcriptional activity of AR and the ARΔLBD-variant Q640X was shown by reporter gene assays. Expression of endogenous AR and ARΔLBD mRNA and protein levels were determined by qRT-PCR and Western Blot. Nuclear translocation of AR-molecules was analyzed by fluorescence microscopy. AR and ARΔLBD/Q640X homo-/heterodimer formation was assessed by mammalian two hybrid assays. Biological activity of both compounds in vivo was demonstrated using a chick chorioallantoic membrane xenograft assay. RESULTS: The stilbenes RSV and FIDAS were able to significantly diminish AR and Q640X-signalling. Successful inhibition of the Q640X suggests that RSV and FIDAS are not interfering with the AR-ligand binding domain like all currently available anti-hormonal drugs. Repression of AR and Q640X-signalling by RSV and FIDAS in prostate cancer cells was caused by an inhibition of the AR and/or Q640X-dimerization. Although systemic bioavailability of both stilbenes is very low, both compounds were also able to downregulate tumor growth and AR-signalling in vivo. CONCLUSION: RSV and FIDAS are able to inhibit the dimerization of AR and ARΔLBD molecules suggesting that stilbenes might serve as lead compounds for a novel generation of AR-inhibitors.

  16. Bio-based production of fuels and industrial chemicals by repurposing antibiotic-producing type I modular polyketide synthases: opportunities and challenges.

    Science.gov (United States)

    Yuzawa, Satoshi; Keasling, Jay D; Katz, Leonard

    2017-04-01

    Complex polyketides comprise a large number of natural products that have broad application in medicine and agriculture. They are produced in bacteria and fungi from large enzyme complexes named type I modular polyketide synthases (PKSs) that are composed of multifunctional polypeptides containing discrete enzymatic domains organized into modules. The modular nature of PKSs has enabled a multitude of efforts to engineer the PKS genes to produce novel polyketides of predicted structure. We have repurposed PKSs to produce a number of short-chain mono- and di-carboxylic acids and ketones that could have applications as fuels or industrial chemicals.

  17. Bio-based production of fuels and industrial chemicals by repurposing antibiotic-producing type I modular polyketide synthases: opportunities and challenges

    Energy Technology Data Exchange (ETDEWEB)

    Yuzawa, Satoshi [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Biological Systems and Engineering Division; Keasling, Jay D. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Biological Systems and Engineering Division; Univ. of California, Berkeley, CA (United States). QB3 Inst.; Joint BioEnergy Inst. (JBEI), Emeryville, CA (United States); Univ. of California, Berkeley, CA (United States). Dept. of Bioengineering; Univ. of California, Berkeley, CA (United States). Dept. of Chemical and Biomolecular Engineering; Technical Univ. of Denmark, Horsholm (Denmark). Novo Nordisk Foundation Center for Biosustainability; Katz, Leonard [Univ. of California, Berkeley, CA (United States). QB3 Inst.

    2016-11-16

    Complex polyketides comprise a large number of natural products that have broad application in medicine and agriculture. They are produced in bacteria and fungi from large enzyme complexes named type I modular polyketide synthases (PKSs) that are composed of multifunctional polypeptides containing discrete enzymatic domains organized into modules. The modular nature of PKSs has enabled a multitude of efforts to engineer the PKS genes to produce novel polyketides of predicted structure. Finally, we have repurposed PKSs to produce a number of short-chain mono- and di-carboxylic acids and ketones that could have applications as fuels or industrial chemicals.

  18. Evaluation of Risk Metrics for KHNP Reference Plants Using the Latest Plant Specific Data

    International Nuclear Information System (INIS)

    Jeon, Ho Jun; Hwang, Seok Won; Ghi, Moon Goo

    2010-01-01

    As Risk-Informed Applications (RIAs) are actively implemented in the nuclear industry, an issue associated with the technical adequacy of the Probabilistic Safety Assessment (PSA) arises in its data sources. The American Society of Mechanical Engineers (ASME) PRA standard suggests the use of component failure data that represent the as-built and as-operated plant conditions. Furthermore, the peer reviews for the KHNP reference plants stated that the component failure data should be updated to reflect the latest plant specific data available. For ensuring the technical adequacy in PSA data elements, we try to update component failure data to reflect the as-operated plant conditions, and a trend analysis of the failure data is implemented. In addition, by applying the updated failure data to the PSA models of the KHNP reference plants, the risk metrics of Core Damage Frequency (CDF) and Large Early Release Frequency (LERF) are evaluated

  19. Comparison and lessons learned from plant specific PSA of German NPP

    International Nuclear Information System (INIS)

    Balfanz, Hans-Peter; Berg, H.P.

    2000-01-01

    PSA are launched in frame of Periodic Safety Reviews (PSR) in Germany. The aims are to identify overall safety level and relative weak points. Some backfitting measures have been realized for older plants to remove relative weak points and to bring these plants to the state of the art. In this field PSA is well accepted today and is seen as a valuable tool supplementing the deterministic analysis. Main application of PSA within PSR is planned to become mandatory as part of the revision of the German Atomic Energy Act. According to the German PSA Guideline plant specific PSA level 1+ were performed for all 19 In comparison with international practice German PSA are very detailed. Otherwise they do not handle all external events, non-power states and accident management measures as discussed before. The New PSA guideline will cover these aspects and therefore analysts have to take them into account in further PSA. Moreover gathering of plant specific data is needed. The development in this field is driven by the utilities (for instance in frame of their so-called ZEDB project). Public discussion about quantitative risk of industrial hazards is quite limited in Germany and PSA results have only few impacts to this respect. Independent from this PSA for NPP is understood as a diverse tool in supporting the deterministic licensing and supervision process. Risk based decision making as well as informed regulation are just only of the beginning. State of PSA of NPP in Germany, comparison of PSA result of different NPP, German PSA guideline and state of discussion of further development and recommendation of further development of PSA of NPP are discussed in this paper in more detail. (S.Y.)

  20. SNF1-related protein kinases 2 are negatively regulated by a plant-specific calcium sensor.

    Science.gov (United States)

    Bucholc, Maria; Ciesielski, Arkadiusz; Goch, Grażyna; Anielska-Mazur, Anna; Kulik, Anna; Krzywińska, Ewa; Dobrowolska, Grażyna

    2011-02-04

    SNF1-related protein kinases 2 (SnRK2s) are plant-specific enzymes involved in environmental stress signaling and abscisic acid-regulated plant development. Here, we report that SnRK2s interact with and are regulated by a plant-specific calcium-binding protein. We screened a Nicotiana plumbaginifolia Matchmaker cDNA library for proteins interacting with Nicotiana tabacum osmotic stress-activated protein kinase (NtOSAK), a member of the SnRK2 family. A putative EF-hand calcium-binding protein was identified as a molecular partner of NtOSAK. To determine whether the identified protein interacts only with NtOSAK or with other SnRK2s as well, we studied the interaction of an Arabidopsis thaliana orthologue of the calcium-binding protein with selected Arabidopsis SnRK2s using a two-hybrid system. All kinases studied interacted with the protein. The interactions were confirmed by bimolecular fluorescence complementation assay, indicating that the binding occurs in planta, exclusively in the cytoplasm. Calcium binding properties of the protein were analyzed by fluorescence spectroscopy using Tb(3+) as a spectroscopic probe. The calcium binding constant, determined by the protein fluorescence titration, was 2.5 ± 0.9 × 10(5) M(-1). The CD spectrum indicated that the secondary structure of the protein changes significantly in the presence of calcium, suggesting its possible function as a calcium sensor in plant cells. In vitro studies revealed that the activity of SnRK2 kinases analyzed is inhibited in a calcium-dependent manner by the identified calcium sensor, which we named SCS (SnRK2-interacting calcium sensor). Our results suggest that SCS is involved in response to abscisic acid during seed germination most probably by negative regulation of SnRK2s activity.

  1. Comparison and lessons learned from plant specific PSA of German NPP

    Energy Technology Data Exchange (ETDEWEB)

    Balfanz, Hans-Peter [TUEV Nord, Hamburg (Germany); Berg, H.P.

    2000-07-01

    PSA are launched in frame of Periodic Safety Reviews (PSR) in Germany. The aims are to identify overall safety level and relative weak points. Some backfitting measures have been realized for older plants to remove relative weak points and to bring these plants to the state of the art. In this field PSA is well accepted today and is seen as a valuable tool supplementing the deterministic analysis. Main application of PSA within PSR is planned to become mandatory as part of the revision of the German Atomic Energy Act. According to the German PSA Guideline plant specific PSA level 1+ were performed for all 19 In comparison with international practice German PSA are very detailed. Otherwise they do not handle all external events, non-power states and accident management measures as discussed before. The New PSA guideline will cover these aspects and therefore analysts have to take them into account in further PSA. Moreover gathering of plant specific data is needed. The development in this field is driven by the utilities (for instance in frame of their so-called ZEDB project). Public discussion about quantitative risk of industrial hazards is quite limited in Germany and PSA results have only few impacts to this respect. Independent from this PSA for NPP is understood as a diverse tool in supporting the deterministic licensing and supervision process. Risk based decision making as well as informed regulation are just only of the beginning. State of PSA of NPP in Germany, comparison of PSA result of different NPP, German PSA guideline and state of discussion of further development and recommendation of further development of PSA of NPP are discussed in this paper in more detail. (S.Y.)

  2. Production of 17-O-demethyl-geldanamycin, a cytotoxic ansamycin polyketide, by Streptomyces hygroscopicus DEM20745.

    Science.gov (United States)

    Baksh, Aron; Kepplinger, Bernhard; Isah, Hadiza A; Probert, Michael R; Clegg, William; Wills, Corinne; Goodfellow, Michael; Errington, Jeff; Allenby, Nick; Hall, Michael J

    2017-08-01

    The actinomycete DEM20745, collected from non-rhizosphere soil adjacent to Paraserianthes falactaria trees (Cangkringan, Indonesia), is an efficient producer of the anticancer ansamycin polyketide 17-O-demethyl-geldanamycin (17-O-DMG), a biosynthetic precursor of the Hsp90 inhibitor geldanamycin (GDM). In DEM20745, 17-O-DMG is the major ansamycin product observed reaching a maximum titre of 17 mg/L in the fermentation broth. 17-O-DMG has the potential to be a key starting material for the semi-synthesis of GDM analogues for use in anticancer therapy. Thus, this preferential biosynthesis of 17-O-DMG facilitates easy access to this important molecule and provides further insight in the biosynthesis of the geldanamycins.

  3. Tuning Stilbene Photochemistry by Fluorination: State Reordering Leads to Sudden Polarization near the Franck-Condon Region.

    Science.gov (United States)

    Ioffe, Ilya N; Quick, Martin; Quick, Michael T; Dobryakov, Alexander L; Richter, Celin; Granovsky, Alex A; Berndt, Falko; Mahrwald, Rainer; Ernsting, Nikolaus P; Kovalenko, Sergey A

    2017-10-25

    Spontaneous polarization of a nonpolar molecule upon photoexcitation (the sudden polarization effect) earlier discussed for 90°-twisted alkenes is observed and calculated for planar ring-fluorinated stilbenes, trans-2,3,5,6,2',3',5',6'-octofluorostilbene (tF2356) and trans-2,3,4,5,6,2',3',4',5',6'-decafluorostilbene (tF23456). Due to the fluorination, Franck-Condon states S 1 FC and S 2 FC are dominated by the quasi-degenerate HOMO-1 → LUMO and HOMO-2 → LUMO excitations, while their interaction gives rise to a symmetry-broken zwitterionic S 1 state. After optical excitation of tF2356, one observes an ultrafast (∼0.06 ps) evolution that reflects relaxation from initial nonpolar S 3 FC to long-lived (1.3 ns in n-hexane and 3.4 ns in acetonitrile) polar S 1 . The polarity of S 1 is evidenced by a solvatochromic shift of its fluorescence band. The experimental results provide a sensitive test for quantum-chemical calculations. In particular, our calculations agree with the experiment, and raise concerns about the applicability of the common TDDFT approach to relatively simple stilbenic systems.

  4. Relative light yield and temporal response of a stilbene-doped bibenzyl organic scintillator for neutron detection

    Energy Technology Data Exchange (ETDEWEB)

    Brown, J. A.; Goldblum, B. L., E-mail: bethany@nuc.berkeley.edu; Brickner, N. M.; Daub, B. H.; Kaufman, G. S.; Bibber, K. van; Vujic, J. [Department of Nuclear Engineering, University of California, Berkeley, California 94720 (United States); Bernstein, L. A.; Bleuel, D. L.; Caggiano, J. A.; Hatarik, R.; Phillips, T. W.; Zaitseva, N. P. [Lawrence Livermore National Laboratory, Livermore, California 94551 (United States); Wender, S. A. [Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States)

    2014-05-21

    The neutron time-of-flight (nTOF) diagnostics used to characterize implosions at the National Ignition Facility (NIF) has necessitated the development of novel scintillators that exhibit a rapid temporal response and high light yield. One such material, a bibenzyl-stilbene mixed single-crystal organic scintillator grown in a 99.5:0.5 ratio in solution, has become the standard scintillator used for nTOF diagnostics at NIF. The prompt fluorescence lifetime and relative light yield as a function of proton energy were determined to calibrate this material as a neutron detector. The temporal evolution of the intensity of the prompt fluorescent response was modeled using first-order reaction kinetics and the prompt fluorescence decay constant was determined to be 2.46 ± 0.01 (fit) ± 0.13 (systematic) ns. The relative response of the bibenzyl-stilbene mixed crystal generated by recoiling protons was measured, and results were analyzed using Birks' relation to quantify the non-radiative quenching of excitation energy in the scintillator.

  5. Structural and kinetic analysis of the unnatural fusion protein 4-coumaroyl-CoA ligase::stilbene synthase

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Yechun; Yi, Hankuil; Wang, Melissa; Yu, Oliver; Jez, Joseph M. (WU); (Danforth)

    2012-10-24

    To increase the biochemical efficiency of biosynthetic systems, metabolic engineers have explored different approaches for organizing enzymes, including the generation of unnatural fusion proteins. Previous work aimed at improving the biosynthesis of resveratrol, a stilbene associated a range of health-promoting activities, in yeast used an unnatural engineered fusion protein of Arabidopsis thaliana (thale cress) 4-coumaroyl-CoA ligase (At4CL1) and Vitis vinifera (grape) stilbene synthase (VvSTS) to increase resveratrol levels 15-fold relative to yeast expressing the individual enzymes. Here we present the crystallographic and biochemical analysis of the 4CL::STS fusion protein. Determination of the X-ray crystal structure of 4CL::STS provides the first molecular view of an artificial didomain adenylation/ketosynthase fusion protein. Comparison of the steady-state kinetic properties of At4CL1, VvSTS, and 4CL::STS demonstrates that the fusion protein improves catalytic efficiency of either reaction less than 3-fold. Structural and kinetic analysis suggests that colocalization of the two enzyme active sites within 70 {angstrom} of each other provides the basis for enhanced in vivo synthesis of resveratrol.

  6. Fast collimated neutron flux measurement using stilbene scintillator and flashy analog-to-digital converter in JT-60U

    International Nuclear Information System (INIS)

    Ishikawa, M.; Itoga, T.; Okuji, T.; Nakhostin, M.; Shinohara, K.; Hayashi, T.; Sukegawa, A.; Baba, M.; Nishitani, T.

    2006-01-01

    A line-integrated neutron emission profile is routinely measured using the radial neutron collimator system in JT-60U tokamak. Stilbene neuron detectors (SNDs), which combine a stilbene organic crystal scintillation detector (SD) with an analog neutron-gamma pulse shape discrimination (PSD) circuit, have been used to measure collimated neutron flux. Although the SND has many advantages as a neutron detector, the maximum count rate is limited up to ∼1x10 5 counts/s due to the analog PSD circuit. To overcome this issue, a digital signal processing system (DSPS) using a flash analog-to-digital converter (Acqiris DC252, 8 GHz, 10 bits) has been developed at Cyclotron and Radioisotope Center in Tohoku University. In this system anode signals from photomultiplier of the SD are directory stored and digitized. Then, the PSD between neutrons and gamma rays is performed using software. The DSPS has been installed in the vertical neutron collimator system in JT-60U and applied to deuterium experiments. It is confirmed that the PSD is sufficiently performed and collimated neutron flux is successfully measured with count rate up to ∼5x10 5 counts/s without the effect of pileup of detected pulses. The performance of the DSPS as a neutron detector, which supersedes the SND, is demonstrated

  7. Probing the Selectivity and Protein•Protein Interactions of a Non-Reducing Fungal Polyketide Synthase Using Mechanism-Based Crosslinkers

    Science.gov (United States)

    Bruegger, Joel; Haushalter, Bob; Vagstad, Anna; Shakya, Gaurav; Mih, Nathan; Townsend, Craig A.; Burkart, Michael D.; Tsai, Shiou-Chuan

    2013-01-01

    SUMMARY Protein•protein interactions, which often involve interactions between an acyl carrier protein (ACP) and its partner enzymes, are important for coordinating polyketide biosynthesis. However, the nature of such interactions is not well understood, especially in the fungal non-reducing polyketide synthases (NR-PKSs) that biosynthesize toxic and pharmaceutically important polyketides. Here, we employ a mechanism-based crosslinker to successfully probe ACP and ketosynthase (KS) domain interactions in NR-PKSs. We found that crosslinking efficiency is closely correlated with the strength of ACP•KS interactions, and that KS demonstrates strong starter unit selectivity. We further identified positively charged surface residues by KS mutagenesis, which mediate key interactions with the negatively-charged ACP surface. Such complementary/matching contact pairs can serve as “adapter surfaces” for future efforts to generate new polyketides using NR-PKSs. PMID:23993461

  8. Biosynthesis of Akaeolide and Lorneic Acids and Annotation of Type I Polyketide Synthase Gene Clusters in the Genome of Streptomyces sp. NPS554

    Directory of Open Access Journals (Sweden)

    Tao Zhou

    2015-01-01

    Full Text Available The incorporation pattern of biosynthetic precursors into two structurally unique polyketides, akaeolide and lorneic acid A, was elucidated by feeding experiments with 13C-labeled precursors. In addition, the draft genome sequence of the producer, Streptomyces sp. NPS554, was performed and the biosynthetic gene clusters for these polyketides were identified. The putative gene clusters contain all the polyketide synthase (PKS domains necessary for assembly of the carbon skeletons. Combined with the 13C-labeling results, gene function prediction enabled us to propose biosynthetic pathways involving unusual carbon-carbon bond formation reactions. Genome analysis also indicated the presence of at least ten orphan type I PKS gene clusters that might be responsible for the production of new polyketides.

  9. Analytical support of plant specific SAMG development validation of SAMG using MELCOR 1.8.5

    International Nuclear Information System (INIS)

    Duspiva, Jiri

    2006-01-01

    They are two NPPs in operation in Czech Republic. Both of NPPs operated in CR have already implemented EOPs, developed under collaboration with the WESE. The project on SAMG development has started and follows the previous one for EOPs also with the WESE as the leading organization. Plant specific SAMGs for the Temelin as well as Dukovany NPPs are based on the WOG generic SAMGs. The analytical support of plant specific SAMGs development is performed by the NRI Rez within the validation process. Basic conditions as well as their filling by NRI Rez are focused on analyst, analytical tools and their applications. More detail description is attended to the approach of the preparation of the MELCOR code application to the evaluation of hydrogen risk, validation of recent set of hydrogen passive autocatalytic recombiners and definition of proposals to amend system of hydrogen removal. Such kind of parametric calculations will request to perform very wide set of runs. It could not be possible with the whole plant model and decoupling of such calculation with storing of mass and energy sources into the containment is only one way. The example of this decoupling for the LOCA scenario is shown. It includes seven sources - heat losses from primary and secondary circuits, fluid blowndown through cold leg break, fission products blowndown through cold leg break, fluid blowndown through break in reactor pressure vessel bottom head, fission products through break in reactor pressure vessel bottom head, melt ejection from reactor pressure vessel to cavity and gas masses and heat losses from corium in cavity. The stand alone containment analysis was tested in two configurations - with or without taking of fission products into account. Testing showed very good agreement of all calculations until lower head failure and acceptable agreement after that. Also some problematic features appeared. The stand alone test with fission product was possible only after the changes in source code

  10. Scope and limitations of the Heck-Matsuda-coupling of phenol diazonium salts and styrenes: a protecting-group economic synthesis of phenolic stilbenes.

    Science.gov (United States)

    Schmidt, Bernd; Elizarov, Nelli; Berger, René; Hölter, Frank

    2013-06-14

    4-Phenol diazonium salts undergo Pd-catalyzed Heck reactions with various styrenes to 4'-hydroxy stilbenes. In almost all cases higher yields and fewer side products were observed, compared to the analogous 4-methoxy benzene diazonium salts. In contrast, the reaction fails completely with 2- and 3-phenol diazonium salts. For these substitution patterns the methoxy-substituted derivatives are superior.

  11. Insights on the stilbenes in Raboso Piave grape (Vitis vinifera L.) as a consequence of postharvest vs on-vine dehydration.

    Science.gov (United States)

    Brillante, Luca; De Rosso, Mirko; Dalla Vedova, Antonio; Maoz, Itay; Flamini, Riccardo; Tomasi, Diego

    2018-03-01

    Grape withering is a process used to produce reinforced wines and raisins. Dehydration is usually carried out postharvest by keeping ripe grapes in special warehouses in controlled conditions of temperature, relative humidity (RH) and air flow. Alternatively, grape clusters can be left on the vines after the canes have been pruned. In general, dehydration increases stilbenes in grape, but there are few studies on the effects of on-vine withering. The stilbene profiles of Raboso Piave grape during postharvest and on-vine dehydration were studied here. High-resolution mass spectrometry (MS) was used to identify 19 stilbenes, including resveratrol monomers, dimers (viniferins), oligomers and glucoside derivatives. The two dehydration methods generally had different effects on the above nutraceuticals in grape. The samples kept in warehouses revealed significant increases in Z-ω-viniferin, E-ϵ-viniferin, δ-viniferin and another resveratrol dimer which were not observed in the plants. Trans-Resveratrol increased significantly only in samples dehydrated in the warehouse at 21 °C and 60-70% RH. The findings increase knowledge of stilbene composition in grapes subjected to withering on-vine. The choice of dehydration method affects the contents of these nutraceuticals in the grape and consequently in wines. Reasonably, it could also affect other secondary metabolites important for wine quality. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  12. On interaction of α,β-dibromo-derivatives of 1,2-diphenyl ethane and stilbene with potassium and cesium fluorides

    International Nuclear Information System (INIS)

    Kremlev, M.M.; Fialkov, Yu.A.

    1976-01-01

    The interaction is studied of trans-α, β-dibromostilbene and meso -1, 2 - dibromo -1, 2 - diphenylethane with potassium and cesium fluorides in dimethyl sulphoxide and N - methyl pyrrolidone. It has been found that in this interaction there takes place debromination of vicinal dibromides resulting in the formation of tolan and trans-stilbene, respectively, with a quantitative yield

  13. Overview of OVATE FAMILY PROTEINS, a novel class of plant-specific growth regulators

    Directory of Open Access Journals (Sweden)

    Shucai eWang

    2016-03-01

    Full Text Available OVATE FAMILY PROTEINS (OFPs are a class of proteins with a conserved OVATE domain. OVATE protein was first identified in tomato as a key regulator of fruit shape. OFPs are plant-specific proteins that are widely distributed in the plant kingdom including mosses and lycophytes. Transcriptional activity analysis of Arabidopsis OFPs (AtOFPs in protoplasts suggests that they act as transcription repressors. Functional characterization of OFPs from different plant species including Arabidopsis, rice, tomato, pepper and banana suggests that OFPs regulate multiple aspects of plant growth and development, which is likely achieved by interacting with different types of transcription factors including the KNOX and BELL classes, and/or directly regulating the expression of target genes such as Gibberellin 20 oxidase (GA20ox. Here, we examine how OVATE was originally identified, summarize recent progress in elucidation of the roles of OFPs in regulating plant growth and development, and describe possible mechanisms underpinning this regulation. Finally, we review potential new research directions that could shed additional light on the functional biology of OFPs in plants.

  14. DUF581 is plant specific FCS-like zinc finger involved in protein-protein interaction.

    Directory of Open Access Journals (Sweden)

    Muhammed Jamsheer K

    Full Text Available Zinc fingers are a ubiquitous class of protein domain with considerable variation in structure and function. Zf-FCS is a highly diverged group of C2-C2 zinc finger which is present in animals, prokaryotes and viruses, but not in plants. In this study we identified that a plant specific domain of unknown function, DUF581 is a zf-FCS type zinc finger. Based on HMM-HMM comparison and signature motif similarity we named this domain as FCS-Like Zinc finger (FLZ domain. A genome wide survey identified that FLZ domain containing genes are bryophytic in origin and this gene family is expanded in spermatophytes. Expression analysis of selected FLZ gene family members of A. thaliana identified an overlapping expression pattern suggesting a possible redundancy in their function. Unlike the zf-FCS domain, the FLZ domain found to be highly conserved in sequence and structure. Using a combination of bioinformatic and protein-protein interaction tools, we identified that FLZ domain is involved in protein-protein interaction.

  15. Nine New and Five Known Polyketides Derived from a Deep Sea-Sourced Aspergillus sp. 16-02-1

    Directory of Open Access Journals (Sweden)

    Xiu-Wen Chen

    2014-05-01

    Full Text Available Nine new C9 polyketides, named aspiketolactonol (1, aspilactonols A–F (2–7, aspyronol (9 and epiaspinonediol (11, were isolated together with five known polyketides, (S-2-(2′-hydroxyethyl-4-methyl-γ-butyrolactone (8, dihydroaspyrone (10, aspinotriol A (12, aspinotriol B (13 and chaetoquadrin F (14, from the secondary metabolites of an Aspergillus sp. 16-02-1 that was isolated from a deep-sea sediment sample. Structures of the new compounds, including their absolute configurations, were determined by spectroscopic methods, especially the 2D NMR, circular dichroism (CD, Mo2-induced CD and Mosher’s 1H NMR analyses. Compound 8 was isolated from natural sources for the first time, and the possible biosynthetic pathways for 1–14 were also proposed and discussed. Compounds 1–14 inhibited human cancer cell lines, K562, HL-60, HeLa and BGC-823, to varying extents.

  16. Identification and reconstitution of the polyketide synthases responsible for biosynthesis of the anti-malarial agent, cladosporin

    OpenAIRE

    Cochrane, Rachel V. K.; Sanichar, Randy; Lambkin, Gareth R.; Reiz, Béla; Xu, Wei; Tang, Yi; Vederas, John C.

    2015-01-01

    The anti-malarial agent cladosporin is a nanomolar inhibitor of Plasmodium falciparum lysyl-tRNA synthetase, and exhibits activity against both blood and liver stage infection. Cladosporin can be isolated from the fungus Cladosporium cladosporioides, where it was believed to be biosynthesized by a highly reducing (HR) and non-reducing (NR) iterative type I polyketide synthase (PKS) pair. Genome sequencing of the host organism, and subsequent heterologous expression of these enzymes in Sacchar...

  17. Crystallization and preliminary X-ray diffraction studies of polyketide synthase-1 (PKS-1) from Cannabis sativa

    Energy Technology Data Exchange (ETDEWEB)

    Taguchi, Chiho [Faculty of Pharmaceutical Sciences, Kyushu University (Japan); Quantum Beam Science Directorate, Japan Atomic Energy Agency (Japan); Taura, Futoshi [Faculty of Pharmaceutical Sciences, Kyushu University (Japan); Tamada, Taro; Shoyama, Yoshinari [Quantum Beam Science Directorate, Japan Atomic Energy Agency (Japan); Shoyama, Yukihiro; Tanaka, Hiroyuki [Faculty of Pharmaceutical Sciences, Kyushu University (Japan); Kuroki, Ryota [Quantum Beam Science Directorate, Japan Atomic Energy Agency (Japan); Morimoto, Satoshi [Faculty of Pharmaceutical Sciences, Kyushu University (Japan)

    2008-03-01

    Polyketide synthase-1 from C. sativa has been crystallized. The crystal diffracted to 1.55 Å resolution with sufficient quality for further structure determination. Polyketide synthase-1 (PKS-1) is a novel type III polyketide synthase that catalyzes the biosynthesis of hexanoyl triacetic acid lactone in Cannabis sativa (Mexican strain). PKS-1 was overproduced in Escherichia coli, purified and finally crystallized in two different space groups. The crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M calcium acetate and 20%(w/v) polyethylene glycol 3350 diffracted to 1.65 Å resolution and belonged to space group P1, with unit-cell parameters a = 54.3, b = 59.3, c = 62.6 Å, α = 69, β = 81, γ = 80°. Another crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M sodium chloride and 20%(w/v) polyethylene glycol 3350 diffracted to 1.55 Å resolution and belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 54.3, b = 110, c = 130 Å. These data will enable us to determine the crystal structure of PKS-1.

  18. The polyketide synthase gene pks4 is essential for sexual development and regulates fruiting body morphology in Sordaria macrospora.

    Science.gov (United States)

    Schindler, Daniel; Nowrousian, Minou

    2014-07-01

    Filamentous ascomycetes have long been known as producers of a variety of secondary metabolites, many of which have toxic effects on other organisms. However, the role of these metabolites in the biology of the fungi that produce them remains in most cases enigmatic. A major group of fungal secondary metabolites are polyketides. They are chemically diverse, but have in common that their chemical scaffolds are synthesized by polyketide synthases (PKSs). In a previous study, we analyzed development-dependent expression of pks genes in the filamentous ascomycete Sordaria macrospora. Here, we show that a deletion mutant of the pks4 gene is sterile, producing only protoperithecia but no mature perithecia, whereas overexpression of pks4 leads to enlarged, malformed fruiting bodies. Thus, correct expression levels of pks4 are essential for wild type-like perithecia formation. The predicted PKS4 protein has a domain structure that is similar to homologs in other fungi, but conserved residues of a methyl transferase domain present in other fungi are mutated in PKS4. Expression of several developmental genes is misregulated in the pks4 mutant. Surprisingly, the development-associated app gene is not downregulated in the mutant, in contrast to all other previously studied mutants with a block at the protoperithecial stage. Our data show that the polyketide synthase gene pks4 is essential for sexual development and plays a role in regulating fruiting body morphology. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Kernel based machine learning algorithm for the efficient prediction of type III polyketide synthase family of proteins

    Directory of Open Access Journals (Sweden)

    Mallika V

    2010-03-01

    Full Text Available Type III Polyketide synthases (PKS are family of proteins considered to have significant role in the biosynthesis of various polyketides in plants, fungi and bacteria. As these proteins show positive effects to human health, more researches are going on regarding this particular protein. Developing a tool to identify the probability of sequence, being a type III polyketide synthase will minimize the time consumption and manpower efforts. In this approach, we have designed and implemented PKSIIIpred, a high performance prediction server for type III PKS where the classifier is Support Vector Machine (SVM. Based on the limited training dataset, the tool efficiently predicts the type III PKS superfamily of proteins with high sensitivity and specificity. PKSIIIpred is available at http://type3pks.in/prediction/. We expect that this tool may serve as a useful resource for type III PKS researchers. Currently work is being progressed for further betterment of prediction accuracy by including more sequence features in the training dataset.

  20. Crystallization and preliminary X-ray diffraction studies of polyketide synthase-1 (PKS-1) from Cannabis sativa

    International Nuclear Information System (INIS)

    Taguchi, Chiho; Taura, Futoshi; Tamada, Taro; Shoyama, Yoshinari; Shoyama, Yukihiro; Tanaka, Hiroyuki; Kuroki, Ryota; Morimoto, Satoshi

    2008-01-01

    Polyketide synthase-1 from C. sativa has been crystallized. The crystal diffracted to 1.55 Å resolution with sufficient quality for further structure determination. Polyketide synthase-1 (PKS-1) is a novel type III polyketide synthase that catalyzes the biosynthesis of hexanoyl triacetic acid lactone in Cannabis sativa (Mexican strain). PKS-1 was overproduced in Escherichia coli, purified and finally crystallized in two different space groups. The crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M calcium acetate and 20%(w/v) polyethylene glycol 3350 diffracted to 1.65 Å resolution and belonged to space group P1, with unit-cell parameters a = 54.3, b = 59.3, c = 62.6 Å, α = 69, β = 81, γ = 80°. Another crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M sodium chloride and 20%(w/v) polyethylene glycol 3350 diffracted to 1.55 Å resolution and belonged to space group P2 1 2 1 2 1 , with unit-cell parameters a = 54.3, b = 110, c = 130 Å. These data will enable us to determine the crystal structure of PKS-1

  1. Analysis of the Sequences, Structures, and Functions of Product-Releasing Enzyme Domains in Fungal Polyketide Synthases

    Directory of Open Access Journals (Sweden)

    Lu Liu

    2017-09-01

    Full Text Available Product-releasing enzyme (PRE domains in fungal non-reducing polyketide synthases (NR-PKSs play a crucial role in catalysis and editing during polyketide biosynthesis, especially accelerating final biosynthetic reactions accompanied with product offloading. However, up to date, the systematic knowledge about PRE domains is deficient. In the present study, the relationships between sequences, structures, and functions of PRE domains were analyzed with 574 NR-PKSs of eight groups (I–VIII. It was found that the PRE domains in NR-PKSs could be mainly classified into three types, thioesterase (TE, reductase (R, and metallo-β-lactamase-type TE (MβL-TE. The widely distributed TE or TE-like domains were involved in NR-PKSs of groups I–IV, VI, and VIII. The R domains appeared in NR-PKSs of groups IV and VII, while the physically discrete MβL-TE domains were employed by most NR-PKSs of group V. The changes of catalytic sites and structural characteristics resulted in PRE functional differentiations. The phylogeny revealed that the evolution of TE domains was accompanied by complex functional divergence. The diverse sequence lengths of TE lid-loops affected substrate specificity with different chain lengths. The volume diversification of TE catalytic pockets contributed to catalytic mechanisms with functional differentiations. The above findings may help to understand the crucial catalysis of fungal aromatic polyketide biosyntheses and govern recombination of NR-PKSs to obtain unnatural target products.

  2. Policing starter unit selection of the enterocin type II polyketide synthase by the type II thioesterase EncL.

    Science.gov (United States)

    Kalaitzis, John A; Cheng, Qian; Meluzzi, Dario; Xiang, Longkuan; Izumikawa, Miho; Dorrestein, Pieter C; Moore, Bradley S

    2011-11-15

    Enterocin is an atypical type II polyketide synthase (PKS) product from the marine actinomycete 'Streptomyces maritimus'. The enterocin biosynthesis gene cluster (enc) codes for proteins involved in the assembly and attachment of the rare benzoate primer that initiates polyketide assembly with the addition of seven malonate molecules and culminates in a Favorskii-like rearrangement of the linear poly-β-ketone to give its distinctive non-aromatic, caged core structure. Fundamental to enterocin biosynthesis, which utilizes a single acyl carrier protein (ACP), EncC, for both priming with benzoate and elongating with malonate, involves maintaining the correct balance of acyl-EncC substrates for efficient polyketide assembly. Here, we report the characterization of EncL as a type II thioesterase that functions to edit starter unit (mis)priming of EncC. We performed a series of in vivo mutational studies, heterologous expression experiments, in vitro reconstitution studies, and Fourier-transform mass spectrometry-monitored competitive enzyme assays that together support the proposed selective hydrolase activity of EncL toward misprimed acetyl-ACP over benzoyl-ACP to facilitate benzoyl priming of the enterocin PKS complex. While this system resembles the R1128 PKS that also utilizes an editing thioesterase (ZhuC) to purge acetate molecules from its initiation module ACP in favor of alkylacyl groups, the enterocin system is distinct in its usage of a single ACP for both priming and elongating reactions with different substrates. Copyright © 2011 Elsevier Ltd. All rights reserved.

  3. Conceptual Framework for Physical Protection Against Sabotage Considering Plant-specific Radiological Consequences

    International Nuclear Information System (INIS)

    Lee, Joung Hoon; Yu, Dong Han

    2010-01-01

    According to the Generation IV (Gen IV) Technology Roadmap, Gen IV nuclear energy systems (NESs) should highlight proliferation resistance and physical protection (PR and PP) as one of the four goals along with sustainability, safety and reliability, and economics. Especially, physical protection (PP) is the typical important characteristic of an NES that impedes the theft of materials suitable for nuclear explosives or radiation dispersal devices (RDD) and the sabotage of facilities and transportation by subnation entities and other non-Host State adversaries. These two subjects have been studied separately. Proliferation is commonly considered as an international concern and the past work on the PR assessments can be found. On the other hands, PP is regarded as a State security concern, much of which is classified and facility-dependent. Recently, more concern has been focused on the PP design and regulation because of rapid environment changes including radiological consequences by internal sabotage and nuclear terrorism by RDDs. The current PP Regulation has been applied intensively to the existing nuclear facilities and could be a possible guidance for the future GEN-IV NESs. This paper first reviews the IAEA guide document, INFCIRC/225, which was accepted as the standard international guideline in the physical protection area. It has been updated several times up to now, and is undergoing another revision. The paper introduces current substantial changes in the document regarding PP including the national nuclear security and sabotage in the nuclear facilities. Then, it presents a conceptual framework for physical protection against sabotage considering plant-specific radiological consequence after malicious acts within certain vital areas. The framework combines the newly developed method of vital area identification, the current PSA level 2 works, and physical protection concepts. This would help to improve a design concept of new physical protection

  4. Cernavoda NPP Unit 1: Operating experience program and plant specific performance indicators (level 2)

    International Nuclear Information System (INIS)

    Teodor, Vasile; Popa, Viorel

    1998-01-01

    The basis for the Operating Experience Program was set in place since early stages of the commissioning phase (1993), when a system based on the Canadian approach was implemented for reporting, reviewing, assessing and establishing of the necessary corrective action for unplanned events. This system provided excellent opportunity to train staff in unplanned event assessment methodology, and prepare the station for the formal reporting process following criticality in accordance with the licensing requirements. The formal process, set in place after criticality is described in Station Instruction Procedure SI-01365-P13 'Unplanned Event Report' and was developed under the supervision of Safety and Compliance Department. In parallel, a program for information exchange and trending of performance indicators was developed by Technical Services Department. The WANO recommendations following August 1997 Peer Review provided the opportunity for a better understanding and reconsideration of the Operating Experience Program. As a result, all the activities related to this topic were assigned to a new structure, within Safety and Compliance Department. As such an Operating Experience Group was created and a new program is now being developed in an integrated and centralized manner. The content of the paper is the following: - Overview; - Operating Experience Program; - Event Analysis (Unplanned Events Assessment System - UEIR Process- and Systematic Analysis of Operational Events - ACR Process); - Information Exchange Program; - Monitoring of Operating Experience - Plant Specific Performance Indicators; - Purpose; - Level 2 Performance Indicators. Four appendices are added containing: - A. Station performance indicators/targets (Level 2); - B. SPI (Station Performance Indicators - Level 2) - Graphics; - C. UEIR, LRS (Safety and Licensing Review Sheet), UEFR (Unplanned Event Follow-up Report), ACR and OPEX forms. (authors)

  5. Conceptual Framework for Physical Protection Against Sabotage Considering Plant-specific Radiological Consequences

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Joung Hoon; Yu, Dong Han [Korea Institute of Nuclear Nonproliferation and Control, Daejeon (Korea, Republic of)

    2010-10-15

    According to the Generation IV (Gen IV) Technology Roadmap, Gen IV nuclear energy systems (NESs) should highlight proliferation resistance and physical protection (PR and PP) as one of the four goals along with sustainability, safety and reliability, and economics. Especially, physical protection (PP) is the typical important characteristic of an NES that impedes the theft of materials suitable for nuclear explosives or radiation dispersal devices (RDD) and the sabotage of facilities and transportation by subnation entities and other non-Host State adversaries. These two subjects have been studied separately. Proliferation is commonly considered as an international concern and the past work on the PR assessments can be found. On the other hands, PP is regarded as a State security concern, much of which is classified and facility-dependent. Recently, more concern has been focused on the PP design and regulation because of rapid environment changes including radiological consequences by internal sabotage and nuclear terrorism by RDDs. The current PP Regulation has been applied intensively to the existing nuclear facilities and could be a possible guidance for the future GEN-IV NESs. This paper first reviews the IAEA guide document, INFCIRC/225, which was accepted as the standard international guideline in the physical protection area. It has been updated several times up to now, and is undergoing another revision. The paper introduces current substantial changes in the document regarding PP including the national nuclear security and sabotage in the nuclear facilities. Then, it presents a conceptual framework for physical protection against sabotage considering plant-specific radiological consequence after malicious acts within certain vital areas. The framework combines the newly developed method of vital area identification, the current PSA level 2 works, and physical protection concepts. This would help to improve a design concept of new physical protection

  6. Gold-catalyzed aerobic epoxidation of trans-stilbene in methylcyclohexane. Part I: Design of a reference catalyst

    KAUST Repository

    Guillois, Kevin

    2012-02-01

    The kinetics of the heterogeneous gold-catalyzed aerobic epoxidation of stilbene in the liquid phase has been shown to be hindered by diffusion limitations, due to the use of supports which are unsuitable to apolar reaction media. The choice of these supports is generally dictated by the ability of standard methods of preparation to stabilize highly dispersed gold nanoparticles on them. Hence, new methods need to be designed in order to produce catalytically active gold nanoparticles on hydrophobic supports in general and on passivated silicas in particular. By investigating Tsukuda\\'s method to produce colloidal solutions of gold nanoparticles upon reduction of the triphenylphosphine gold chloride complex in solution, we found that direct reduction of AuPPh3Cl in the presence of a commercially available silica support functionalized with dimethylsiloxane, Aerosil R972, leads, in a highly reproducible and potentially scalable way, to the best catalyst ever reported for this reaction. (C) 2011 Elsevier BM. All rights reserved.

  7. Gold-catalyzed aerobic epoxidation of trans-stilbene in methylcyclohexane. Part I: Design of a reference catalyst

    KAUST Repository

    Guillois, Kevin; Burel, Laurence; Tuel, Alain; Caps, Valerie

    2012-01-01

    The kinetics of the heterogeneous gold-catalyzed aerobic epoxidation of stilbene in the liquid phase has been shown to be hindered by diffusion limitations, due to the use of supports which are unsuitable to apolar reaction media. The choice of these supports is generally dictated by the ability of standard methods of preparation to stabilize highly dispersed gold nanoparticles on them. Hence, new methods need to be designed in order to produce catalytically active gold nanoparticles on hydrophobic supports in general and on passivated silicas in particular. By investigating Tsukuda's method to produce colloidal solutions of gold nanoparticles upon reduction of the triphenylphosphine gold chloride complex in solution, we found that direct reduction of AuPPh3Cl in the presence of a commercially available silica support functionalized with dimethylsiloxane, Aerosil R972, leads, in a highly reproducible and potentially scalable way, to the best catalyst ever reported for this reaction. (C) 2011 Elsevier BM. All rights reserved.

  8. Identification and functional characterization of three type III polyketide synthases from Aquilaria sinensis calli

    International Nuclear Information System (INIS)

    Wang, Xiaohui; Zhang, Zhongxiu; Dong, Xianjuan; Feng, Yingying; Liu, Xiao; Gao, Bowen; Wang, Jinling; Zhang, Le; Wang, Juan; Shi, Shepo; Tu, Pengfei

    2017-01-01

    Type III polyketide synthases (PKSs) play an important role in biosynthesis of various plant secondary metabolites and plant adaptation to environmental stresses. Aquilaria sinensis (A. sinensis) is the main plant species for production of agarwood, little is known about its PKS family. In this study, AsCHS1 and two new type III PKSs, AsPKS1 and AsPKS2, were isolated and characterized in A. sinensis calli. The comparative sequence and phylogenetic analysis indicated that AsPKS1 and AsPKS2 belonged to non-CHS group different from AsCHS1. The recombinant AsPKS1 and AsPKS2 produced the lactone-type products, suggesting their different enzyme activities from AsCHS1. Three PKS genes had a tissues-specific pattern in A. sinensis. Moreover, we examined the expression profiles of three PKS genes in calli under different abiotic stresses and hormone treatments. AsCHS1 transcript was most significantly induced by salt stress, AsPKS1 abundance was most remarkably enhanced by CdCl 2 treatment, while AsPKS2 expression was most significantly induced by mannitol treatment. Furthermore, AsCHS1, AsPKS1 and AsPKS2 expression was enhanced upon gibberellins (GA3), methyl jasmonate (MeJA), or salicylic acid (SA) treatment, while three PKS genes displayed low transcript levels at the early stage under abscisic acid (ABA) treatment. In addition, three GFP:PKSs fusion proteins were localized in the cytoplasm and cell wall in Nicotiana benthamiana cells. These results indicated the multifunctional role of three type III PKSs in polyketide biosynthesis, plant resistance to abiotic stresses and signal transduction. - Highlights: • Two new PKS genes (AsPKS1 and AsPKS2) were isolated and characterized from A. sinensis. • The recombinant AsPKS1 and AsPKS2 catalyzed lactone-type products in vitro. • AsCHS1, AsPKS1 and AsPKS2 were involved in plant responses to abiotic stresses and hormone stimuli. • Our results also indicated that AsCHS1, AsPKS1 and AsPKS2 were predominantly localized

  9. Identification and characterization of the polyketide synthase involved in ochratoxin A biosynthesis in Aspergillus carbonarius

    Energy Technology Data Exchange (ETDEWEB)

    Gallo, Antonia; Knox, Benjamin P.; Bruno, Kenneth S.; Solfrizzo, Michele; Baker, Scott E.; Perrone, Giancarlo

    2014-06-02

    Ochratoxin A (OTA) is a potent mycotoxin produced by Aspergillus and Penicillium species and is a common contaminant of a wide variety of food commodities, with Aspergillus carbonarius being the main producer of OTA contamination in grapes and wine. The molecular structure of OTA is composed of a dihydroisocoumarin ring linked to phenylalanine and, as shown in different producing fungal species, a polyketide synthase (PKS) is a component of the OTA biosynthetic pathway. Similar to observations in other filamentous ascomycetes, the genome sequence of A. carbonarius contains a large number of genes predicted to encode PKSs. In this work a pks gene identified within the putative OTA cluster of A. carbonarius, designated as AcOTApks, was inactivated and the resulting mutant strain was unable to produce OTA, confirming the role of AcOTApks in this biosynthetic pathway. AcOTApks protein is characteristic of the highly reduced (HR)-PKS family, and also contains a putative methyltransferase domain likely responsible for the addition of the methyl group to the OTA polyketide structure. AcOTApks is different from the ACpks protein that we previously described which showed an expression profile compatible with OTA production. We performed phylogenetic analyses of the β-ketosynthase and acyl-transferase domains of the OTA PKSs which had been identified and characterized in different OTA producing fungal species. The phylogenetic results were similar for both the two domains analyzed and showed that OTA PKS of A. carbonarius, Aspergillus niger, and Aspergillus ochraceus clustered in a monophyletic group with 100% bootstrap support suggesting a common origin, while the other OTA PKSs analyzed were phylogenetically distant. A qRT-PCR assay monitored AcOTApks expression during fungal growth and concomitant production of OTA by A. carbonarius in synthetic grape medium. A clear correlation between the expression profile of AcOTApks and kinetics of OTA production was observed with

  10. Relocation of the disulfonic stilbene sites of AE1 (band 3) on the basis of fluorescence energy transfer measurements.

    Science.gov (United States)

    Knauf, Philip A; Law, Foon-Yee; Leung, Tze-Wah Vivian; Atherton, Stephen J

    2004-09-28

    Previous fluorescence resonance energy transfer (FRET) measurements, using BIDS (4-benzamido-4'-isothiocyanostilbene-2,2'-disulfonate) as a label for the disulfonic stilbene site and FM (fluorescein-5-maleimide) as a label for the cytoplasmic SH groups on band 3 (AE1), combined with data showing that the cytoplasmic SH groups lie about 40 A from the cytoplasmic surface of the lipid bilayer, would place the BIDS sites very near the membrane's inner surface, a location that seems to be inconsistent with current models of AE1 structure and mechanism. We reinvestigated the BIDS-FM distance, using laser single photon counting techniques as well as steady-state fluorescence of AE1, in its native membrane environment. Both techniques agree that there is very little energy transfer from BIDS to FM. The mean energy transfer (E), based on three-exponential fits to the fluorescence decay data, is 2.5 +/- 0.7% (SEM, N = 12). Steady-state fluorescence measurements also indicate BIDS to FM. These data indicate that the BIDS sites are probably over 63 A from the cytoplasmic SH groups, placing them near the middle or the external half of the lipid bilayer. This relocation of the BIDS sites fits with other evidence that the disulfonic stilbene sites are located farther toward the external membrane surface than Glu-681, a residue near the inner membrane surface whose modification affects the pH dependence and anion selectivity of band 3. The involvement of two relatively distant parts of the AE1 protein in transport function suggests that the transport mechanism requires coordinated large-scale conformational changes in the band 3 protein.

  11. 77 FR 29391 - An Approach for Probabilistic Risk Assessment in Risk-Informed Decisions on Plant-Specific...

    Science.gov (United States)

    2012-05-17

    ... NUCLEAR REGULATORY COMMISSION [NRC-2012-0110] An Approach for Probabilistic Risk Assessment in Risk-Informed Decisions on Plant-Specific Changes to the Licensing Basis AGENCY: Nuclear Regulatory Commission. ACTION: Draft regulatory guide; request for comment. SUMMARY: The U.S. Nuclear Regulatory...

  12. Identification of potentially safe promising fungal cell factories for the production of polyketide natural food colorants using chemotaxonomic rationale

    Directory of Open Access Journals (Sweden)

    Frisvad Jens C

    2009-04-01

    Full Text Available Abstract Background Colorants derived from natural sources look set to overtake synthetic colorants in market value as manufacturers continue to meet the rising demand for clean label ingredients – particularly in food applications. Many ascomycetous fungi naturally synthesize and secrete pigments and thus provide readily available additional and/or alternative sources of natural colorants that are independent of agro-climatic conditions. With an appropriately selected fungus; using in particular chemotaxonomy as a guide, the fungal natural colorants could be produced in high yields by using the optimized cultivation technology. This approach could secure efficient production of pigments avoiding use of genetic manipulation. Results Polyketide pigment producing ascomycetous fungi were evaluated for their potential as production organisms based on a priori knowledge on species-specific pigment and potential mycotoxin production and BioSafety level (BSL classification. Based on taxonomic knowledge, we pre-selected ascomycetous fungi belonging to Penicillium subgenus Biverticillium that produced yellow, orange or red pigments while deselecting Penicillium marneffei; a well known human pathogen in addition to other mycotoxigenic fungi belonging to the same group. We identified 10 strains belonging to 4 species; viz. P. purpurogenum, P. aculeatum, P. funiculosum, and P. pinophilum as potential pigment producers that produced Monascus-like pigments but no known mycotoxins. The selection/deselection protocol was illustrated in the pigment extracts of P. aculeatum IBT 14259 and P. crateriforme IBT 5015 analysed by HPLC-DAD-MS. In addition, extracellular pigment producing ability of some of the potential pigment producers was evaluated in liquid media with a solid support and N-glutarylmonascorubramine was discovered in the partially purified pigment extract of P. purpurogenum IBT 11181 and IBT 3645. Conclusion The present work brought out that the use

  13. Construction of ivermectin producer by domain swaps of avermectin polyketide synthase in Streptomyces avermitilis.

    Science.gov (United States)

    Zhang, Xiaolin; Chen, Zhi; Li, Meng; Wen, Ying; Song, Yuan; Li, Jilun

    2006-10-01

    Ivermectin, 22, 23-dihydroavermectin B1, is commercially important in human, veterinary medicine, and pesticides. It is currently synthesized by chemical reduction of the double bond between C22 and C23 of avermectins B1, which are a mixture of B1a (>80%) and B1b (produced by fermentation of Streptomyces avermitilis. The cost of ivermectin is much higher than that of avermectins B1 owing to the necessity of region-specific hydrogenation at C22-C23 of avermectins B1 with rhodium chloride as the catalyst for producing ivermectin. Here we report that ivermectin can be produced directly by fermentation of recombinant strains constructed through targeted genetic engineering of the avermectin polyketide synthase (PKS) in S. avermitilis Olm73-12, which produces only avermectins B and not avermectins A and oligomycin. The DNA region encoding the dehydratase (DH) and ketoreductase (KR) domains of module 2 from the avermectin PKS in S. avermitilis Olm73-12 was replaced by the DNA fragment encoding the DH, enoylreductase, and KR domains from module 4 of the pikromycin PKS of Streptomyces venezuelae ATCC 15439 using a gene replacement vector pXL211. Twenty-seven of mutants were found to produce a small amount of 22, 23-dihydroavermectin B1a and avermectin B1a and B2a by high performance liquid chromatography and liquid chromatography mass spectrometry analysis. This study might provide a route to the low-cost production of ivermectin by fermentation.

  14. Antifouling and antibacterial polyketides from marine gorgonian coral-associated fungus Penicillium sp. SCSGAF 0023.

    Science.gov (United States)

    Bao, Jie; Sun, Yu-Lin; Zhang, Xiao-Yong; Han, Zhuang; Gao, Hai-Chun; He, Fei; Qian, Pei-Yuan; Qi, Shu-Hua

    2013-04-01

    Two new polyketides, 6,8,5'6'-tetrahydroxy-3'-methylflavone (1) and paecilin C (2), together with six known analogs secalonic acid D (3), secalonic acid B (4) penicillixanthone A (5), emodin (6), citreorosein (7) and isorhodoptilometrin (8) were obtained from a broth of gorgonian coral-associated fungus Penicillium sp. SCSGAF 0023. Compounds 1 and 6-8 had significant antifouling activity against Balanus amphitrite larvae settlement with EC50 values of 6.7, 6.1, 17.9 and 13.7 μg ml(-1), respectively, and 3-5 showed medium antibacterial activity against four tested bacterial strains. This was the first report of antibacterial activity of 3-5 against marine bacteria and antifouling activity of 6-8 against marine biofouling organism's larvae. The results indicated that gorgonian coral-associated fungus Penicillium sp. SCSGAF 0023 strain could produce antifouling and antibacterial compounds that might aid the host gorgonian coral in protection against marine pathogen bacteria, biofouling organisms and other intruders.

  15. SCREENING OF ANTIMICROBIAL ACTIVITY AND GENES CODING POLYKETIDE SYNTHETASE AND NONRIBOSOMAL PEPTIDE SYNTHETASE OF ACTINOMYCETE ISOLATES

    Directory of Open Access Journals (Sweden)

    Silvia Kovácsová

    2013-12-01

    Full Text Available The aim of this study was to observe antimicrobial activity using agar plate diffusion method and screening genes coding polyketide synthetase (PKS-I and nonribosomal peptide synthetase (NRPS from actinomycetes. A total of 105 actinomycete strains were isolated from arable soil. Antimicrobial activity was demonstrated at 54 strains against at least 1 of total 12 indicator organisms. Antifungal properties were recorded more often than antibacterial properties. The presence of PKS-I and NRPS genes were founded at 61 of total 105 strains. The number of strains with mentioned biosynthetic enzyme gene fragments matching the anticipated length were 19 (18% and 50 (47% respectively. Overall, five actinomycete strains carried all the biosynthetical genes, yet no antimicrobial activity was found against any of tested pathogens. On the other hand, twenty-one strains showed antimicrobial activity even though we were not able to amplify any of the PKS or NRPS genes from them. Combination of the two methods showed broad-spectrum antimicrobial activity of actinomycetes isolated from arable soil, which indicate that actinomycetes are valuable reservoirs of novel bioactive compounds.

  16. Preclinical characterization of naturally occurring polyketide cyclophilin inhibitors from the sanglifehrin family.

    Science.gov (United States)

    Gregory, Matthew A; Bobardt, Michael; Obeid, Susan; Chatterji, Udayan; Coates, Nigel J; Foster, Teresa; Gallay, Philippe; Leyssen, Pieter; Moss, Steven J; Neyts, Johan; Nur-e-Alam, Mohammad; Paeshuyse, Jan; Piraee, Mahmood; Suthar, Dipen; Warneck, Tony; Zhang, Ming-Qiang; Wilkinson, Barrie

    2011-05-01

    Cyclophilin inhibitors currently in clinical trials for hepatitis C virus (HCV) are all analogues of cyclosporine (CsA). Sanglifehrins are a group of naturally occurring cyclophilin binding polyketides that are structurally distinct from the cyclosporines and are produced by a microorganism amenable to biosynthetic engineering for lead optimization and large-scale production by fermentation. Preclinical characterization of the potential utility of this class of compounds for the treatment of HCV revealed that the natural sanglifehrins A to D are all more potent than CsA at disrupting formation of the NS5A-CypA, -CypB, and -CypD complexes and at inhibition of CypA, CypB, and CypD isomerase activity. In particular, sanglifehrin B (SfB) was 30- to 50-fold more potent at inhibiting the isomerase activity of all Cyps tested than CsA and was also shown to be a more potent inhibitor of the 1b subgenomic replicon (50% effective concentrations [EC50s] of 0.070 μM and 0.16 μM in Huh 5-2 and Huh 9-13 cells, respectively). Physicochemical and mouse pharmacokinetic analyses revealed low oral bioavailability (F5 h). These data demonstrate that naturally occurring sanglifehrins are suitable lead compounds for the development of novel analogues that are less immunosuppressive and that have improved metabolism and pharmacokinetic properties.

  17. Preclinical Characterization of Naturally Occurring Polyketide Cyclophilin Inhibitors from the Sanglifehrin Family▿†

    Science.gov (United States)

    Gregory, Matthew A.; Bobardt, Michael; Obeid, Susan; Chatterji, Udayan; Coates, Nigel J.; Foster, Teresa; Gallay, Philippe; Leyssen, Pieter; Moss, Steven J.; Neyts, Johan; Nur-e-Alam, Mohammad; Paeshuyse, Jan; Piraee, Mahmood; Suthar, Dipen; Warneck, Tony; Zhang, Ming-Qiang; Wilkinson, Barrie

    2011-01-01

    Cyclophilin inhibitors currently in clinical trials for hepatitis C virus (HCV) are all analogues of cyclosporine (CsA). Sanglifehrins are a group of naturally occurring cyclophilin binding polyketides that are structurally distinct from the cyclosporines and are produced by a microorganism amenable to biosynthetic engineering for lead optimization and large-scale production by fermentation. Preclinical characterization of the potential utility of this class of compounds for the treatment of HCV revealed that the natural sanglifehrins A to D are all more potent than CsA at disrupting formation of the NS5A-CypA, -CypB, and -CypD complexes and at inhibition of CypA, CypB, and CypD isomerase activity. In particular, sanglifehrin B (SfB) was 30- to 50-fold more potent at inhibiting the isomerase activity of all Cyps tested than CsA and was also shown to be a more potent inhibitor of the 1b subgenomic replicon (50% effective concentrations [EC50s] of 0.070 μM and 0.16 μM in Huh 5-2 and Huh 9-13 cells, respectively). Physicochemical and mouse pharmacokinetic analyses revealed low oral bioavailability (F 5 h). These data demonstrate that naturally occurring sanglifehrins are suitable lead compounds for the development of novel analogues that are less immunosuppressive and that have improved metabolism and pharmacokinetic properties. PMID:21383094

  18. A novel polyketide biosynthesis gene cluster is involved in fruiting body morphogenesis in the filamentous fungi Sordaria macrospora and Neurospora crassa.

    Science.gov (United States)

    Nowrousian, Minou

    2009-04-01

    During fungal fruiting body development, hyphae aggregate to form multicellular structures that protect and disperse the sexual spores. Analysis of microarray data revealed a gene cluster strongly upregulated during fruiting body development in the ascomycete Sordaria macrospora. Real time PCR analysis showed that the genes from the orthologous cluster in Neurospora crassa are also upregulated during development. The cluster encodes putative polyketide biosynthesis enzymes, including a reducing polyketide synthase. Analysis of knockout strains of a predicted dehydrogenase gene from the cluster showed that mutants in N. crassa and S. macrospora are delayed in fruiting body formation. In addition to the upregulated cluster, the N. crassa genome comprises another cluster containing a polyketide synthase gene, and five additional reducing polyketide synthase (rpks) genes that are not part of clusters. To study the role of these genes in sexual development, expression of the predicted rpks genes in S. macrospora (five genes) and N. crassa (six genes) was analyzed; all but one are upregulated during sexual development. Analysis of knockout strains for the N. crassa rpks genes showed that one of them is essential for fruiting body formation. These data indicate that polyketides produced by RPKSs are involved in sexual development in filamentous ascomycetes.

  19. Gold-catalyzed aerobic epoxidation of trans-stilbene in methylcyclohexane. Part II: Identification and quantification of a key reaction intermediate

    KAUST Repository

    Guillois, Kevin

    2013-03-01

    The gold-catalyzed aerobic oxidations of alkenes are thought to rely on the in situ synthesis of hydroperoxide species, which have however never been clearly identified. Here, we show direct experimental evidence for the presence of 1-methylcyclohexyl hydroperoxide in the aerobic co-oxidation of stilbene and methylcyclohexane catalyzed by the Au/SiO2-R972 optimized catalyst prepared in Part I. Determination of its response in gas chromatography, by triphenylphosphine titration followed by 31P NMR, allows to easily follow its concentration throughout the co-oxidation process and to clearly highlight the simultaneous existence of the methylcyclohexane autoxidation pathway and the stilbene epoxidation pathway. © 2012 Elsevier B.V. All rights reserved.

  20. Gold-catalyzed aerobic epoxidation of trans-stilbene in methylcyclohexane. Part II: Identification and quantification of a key reaction intermediate

    KAUST Repository

    Guillois, Kevin; Mangematin, Sté phane; Tuel, Alain; Caps, Valerie

    2013-01-01

    The gold-catalyzed aerobic oxidations of alkenes are thought to rely on the in situ synthesis of hydroperoxide species, which have however never been clearly identified. Here, we show direct experimental evidence for the presence of 1-methylcyclohexyl hydroperoxide in the aerobic co-oxidation of stilbene and methylcyclohexane catalyzed by the Au/SiO2-R972 optimized catalyst prepared in Part I. Determination of its response in gas chromatography, by triphenylphosphine titration followed by 31P NMR, allows to easily follow its concentration throughout the co-oxidation process and to clearly highlight the simultaneous existence of the methylcyclohexane autoxidation pathway and the stilbene epoxidation pathway. © 2012 Elsevier B.V. All rights reserved.

  1. Preparative isolation and purification of three stilbene glycosides from the tibetan medicinal plant Rheum tanguticum maxim. Ex Balf. by high-speed counter-current chromatography.

    Science.gov (United States)

    Zhao, Xiao-Hui; Han, Fa; Li, Yu-Lin; Yue, Hui-Lan

    2013-02-01

    Stilbene glycosides are the primary constituents of Rheum tanguticum Maxim. ex Balf., to which different bioactivities has been attributed, including: anti-HIV, anti-oxidant, anti-tumour, anti-malarial, and anti-allergy activity. However, effective methods for the isolation and purification of stilbene glycosides, such as trans-rhapontin, cis-rhapontin and trans-desoxyrhaponticin, from this herb are not currently available. To develop an efficient method for the preparative isolation and purification of three stilbene glycosides from Rheum tanguticum Maxim. ex Balf. via high-speed counter-current chromatography (HSCCC). A solvent system composed of chloroform:n-butanol:methanol:water (4:1:3:2, v/v/v/v) was developed for the separation. The upper phase was used as the stationary phase, and the lower phase was used as the mobile phase. The flow rate was 1.8 mL/min. The apparatus was controlled at 800 rpm and 25 °C, and the effluent was monitored at 280 nm. Chemical constituents were analysed by high-performance liquid chromatography (HPLC), and their structures were identified by ¹H- and ¹³C-NMR. Under the optimised conditions, 25.5 mg trans-rhapontin, 16.0 mg cis-rhapontin and 20.5 mg trans-desoxyrhaponticin were separated from 80 mg crude sample; the isolates had purities of 99.6, 97.2 and 99.2%, respectively. A simple and efficient HSCCC method has been optimised for the preparative separation of stilbene glycosides from Rheum tanguticum Maxim. ex Balf. Copyright © 2012 John Wiley & Sons, Ltd.

  2. Simultaneous determination of five characteristic stilbene glycosides in root bark of Morus albus L. (Cortex Mori) using high-performance liquid chromatography.

    Science.gov (United States)

    Piao, Shu-juan; Chen, Li-xia; Kang, Ning; Qiu, Feng

    2011-01-01

    Cortex Mori, one of the well-known traditional Chinese herbal medicines, is derived from the root bark of Morus alba L. according to the China Pharmacopeia. Stilbene glycosides are the main components isolated from aqueous extracts of Morus alba and their content varies depending on where Cortex Mori was collected. We have established a qualitative and quantitative method based on the bioactive stilbene glycosides for control of the quality of Cortex Mori from different sources. To develop a high-performance liquid chromatography coupled with ultraviolet absorption detection for simultaneous quantitative determination of five major characteristic stilbene glycosides in 34 samples of the root bark of Morus alba L. (Cortex Mori) from different sources. The analysis was performed on an ODS column using methanol-water-acetic acid (18: 82: 0.1, v/v/v) as the mobile phase and the peaks were monitored at 320 nm. All calibration curves showed good linearity (r ≥ 0.9991) within test ranges. This method showed good repeatability for the quantification of these five components in Cortex Mori with intra- and inter-day standard deviations less than 2.19% and 1.45%, respectively. The validated method was successfully applied to quantify the five investigated components, including a pair of cis-trans-isomers 1 and 2 and a pair of isomers 4 and 5 in 34 samples of Cortex Mori from different sources. Copyright © 2010 John Wiley & Sons, Ltd.

  3. Polyketide synthase chemistry does not direct biosynthetic divergence between 9- and 10-membered enediynes

    Science.gov (United States)

    Horsman, Geoff P.; Chen, Yihua; Thorson, Jon S.; Shen, Ben

    2010-01-01

    Enediynes are potent antitumor antibiotics that are classified as 9- or 10-membered according to the size of the enediyne core structure. However, almost nothing is known about enediyne core biosynthesis, and the determinants of 9- versus 10-membered enediyne core biosynthetic divergence remain elusive. Previous work identified enediyne-specific polyketide synthases (PKSEs) that can be phylogenetically distinguished as being involved in 9- versus 10-membered enediyne biosynthesis, suggesting that biosynthetic divergence might originate from differing PKSE chemistries. Recent in vitro studies have identified several compounds produced by the PKSE and associated thioesterase (TE), but condition-dependent product profiles make it difficult to ascertain a true catalytic difference between 9- and 10-membered PKSE-TE systems. Here we report that PKSE chemistry does not direct 9- versus 10-membered enediyne core biosynthetic divergence as revealed by comparing the products from three 9-membered and two 10-membered PKSE-TE systems under identical conditions using robust in vivo assays. Three independent experiments support a common catalytic function for 9- and 10-membered PKSEs by the production of a heptaene metabolite from: (i) all five cognate PKSE-TE pairs in Escherichia coli; (ii) the C-1027 and calicheamicin cognate PKSE-TEs in Streptomyces lividans K4-114; and (iii) selected native producers of both 9- and 10-membered enediynes. Furthermore, PKSEs and TEs from different 9- and 10-membered enediyne biosynthetic machineries are freely interchangeable, revealing that 9- versus 10-membered enediyne core biosynthetic divergence occurs beyond the PKSE-TE level. These findings establish a starting point for determining the origins of this biosynthetic divergence. PMID:20534556

  4. Structural and evolutionary relationships of "AT-less" type I polyketide synthase ketosynthases.

    Science.gov (United States)

    Lohman, Jeremy R; Ma, Ming; Osipiuk, Jerzy; Nocek, Boguslaw; Kim, Youngchang; Chang, Changsoo; Cuff, Marianne; Mack, Jamey; Bigelow, Lance; Li, Hui; Endres, Michael; Babnigg, Gyorgy; Joachimiak, Andrzej; Phillips, George N; Shen, Ben

    2015-10-13

    Acyltransferase (AT)-less type I polyketide synthases (PKSs) break the type I PKS paradigm. They lack the integrated AT domains within their modules and instead use a discrete AT that acts in trans, whereas a type I PKS module minimally contains AT, acyl carrier protein (ACP), and ketosynthase (KS) domains. Structures of canonical type I PKS KS-AT didomains reveal structured linkers that connect the two domains. AT-less type I PKS KSs have remnants of these linkers, which have been hypothesized to be AT docking domains. Natural products produced by AT-less type I PKSs are very complex because of an increased representation of unique modifying domains. AT-less type I PKS KSs possess substrate specificity and fall into phylogenetic clades that correlate with their substrates, whereas canonical type I PKS KSs are monophyletic. We have solved crystal structures of seven AT-less type I PKS KS domains that represent various sequence clusters, revealing insight into the large structural and subtle amino acid residue differences that lead to unique active site topologies and substrate specificities. One set of structures represents a larger group of KS domains from both canonical and AT-less type I PKSs that accept amino acid-containing substrates. One structure has a partial AT-domain, revealing the structural consequences of a type I PKS KS evolving into an AT-less type I PKS KS. These structures highlight the structural diversity within the AT-less type I PKS KS family, and most important, provide a unique opportunity to study the molecular evolution of substrate specificity within the type I PKSs.

  5. Structural and evolutionary relationships of “AT-less” type I polyketide synthase ketosynthases

    Science.gov (United States)

    Lohman, Jeremy R.; Ma, Ming; Osipiuk, Jerzy; Nocek, Boguslaw; Kim, Youngchang; Chang, Changsoo; Cuff, Marianne; Mack, Jamey; Bigelow, Lance; Li, Hui; Endres, Michael; Babnigg, Gyorgy; Joachimiak, Andrzej; Phillips, George N.; Shen, Ben

    2015-01-01

    Acyltransferase (AT)-less type I polyketide synthases (PKSs) break the type I PKS paradigm. They lack the integrated AT domains within their modules and instead use a discrete AT that acts in trans, whereas a type I PKS module minimally contains AT, acyl carrier protein (ACP), and ketosynthase (KS) domains. Structures of canonical type I PKS KS-AT didomains reveal structured linkers that connect the two domains. AT-less type I PKS KSs have remnants of these linkers, which have been hypothesized to be AT docking domains. Natural products produced by AT-less type I PKSs are very complex because of an increased representation of unique modifying domains. AT-less type I PKS KSs possess substrate specificity and fall into phylogenetic clades that correlate with their substrates, whereas canonical type I PKS KSs are monophyletic. We have solved crystal structures of seven AT-less type I PKS KS domains that represent various sequence clusters, revealing insight into the large structural and subtle amino acid residue differences that lead to unique active site topologies and substrate specificities. One set of structures represents a larger group of KS domains from both canonical and AT-less type I PKSs that accept amino acid-containing substrates. One structure has a partial AT-domain, revealing the structural consequences of a type I PKS KS evolving into an AT-less type I PKS KS. These structures highlight the structural diversity within the AT-less type I PKS KS family, and most important, provide a unique opportunity to study the molecular evolution of substrate specificity within the type I PKSs. PMID:26420866

  6. Mechanism and Stereochemistry of Polyketide Chain Elongation and Methyl Group Epimerization in Polyether Biosynthesis.

    Science.gov (United States)

    Xie, Xinqiang; Garg, Ashish; Khosla, Chaitan; Cane, David E

    2017-03-01

    The polyketide synthases responsible for the biosynthesis of the polyether antibiotics nanchangmycin (1) and salinomycin (4) harbor a number of redox-inactive ketoreductase (KR 0 ) domains that are implicated in the generation of C2-epimerized (2S)-2-methyl-3-ketoacyl-ACP intermediates. Evidence that the natural substrate for the polyether KR 0 domains is, as predicted, a (2R)-2-methyl-3-ketoacyl-ACP intermediate, came from a newly developed coupled ketosynthase (KS)-ketoreductase (KR) assay that established that the decarboxylative condensation of methylmalonyl-CoA with S-propionyl-N-acetylcysteamine catalyzed by the Nan[KS1][AT1] didomain from module 1 of the nanchangmycin synthase generates exclusively the corresponding (2R)-2-methyl-3-ketopentanoyl-ACP (7a) product. In tandem equilibrium isotope exchange experiments, incubation of [2- 2 H]-(2R,3S)-2-methyl-3-hydroxypentanoyl-ACP (6a) with redox-active, epimerase-inactive EryKR6 from module 6 of the 6-deoxyerythronolide B synthase and catalytic quantities of NADP + in the presence of redox-inactive, recombinant NanKR1 0 or NanKR5 0 , from modules 1 and 5 of the nanchangmycin synthase, or recombinant SalKR7 0 from module 7 of the salinomycin synthase, resulted in first-order, time-dependent washout of deuterium from 6a. Control experiments confirmed that this washout was due to KR 0 -catalyzed isotope exchange of the reversibly generated, transiently formed oxidation product [2- 2 H]-(2R)-2-methyl-3-ketopentanoyl-ACP (7a), consistent with the proposed epimerase activity of each of the KR 0 domains. Although they belong to the superfamily of short chain dehydrogenase-reductases, the epimerase-active KR 0 domains from polyether synthases lack one or both residues of the conserved Tyr-Ser dyad that has previously been implicated in KR-catalyzed epimerizations.

  7. Structural and evolutionary relationships of "AT-less" type I polyketide synthase ketosynthases

    Energy Technology Data Exchange (ETDEWEB)

    Lohman, Jeremy; Ma, Ming; Osipiuk, Jerzy; Nocek, Boguslaw; Kim, Youngchang; Chang, Changsoo; Cuff, Marianne E.; Mack, Jamey; Bigelow, Lance; Li, Hui; Endres, Michael; Babnigg, Gyorgy; Joachimiak, Andrzej; Phillips, George N.; Shen, B G

    2015-10-13

    Acyltransferase (AT)-less type I polyketide synthases (PKSs) break the type I PKS paradigm. They lack the integrated AT domains within their modules and instead use a discrete AT that acts in trans, whereas a type I PKS module minimally contains AT, acyl carrier protein (ACP), and ketosynthase (KS) domains. Structures of canonical type I PKS KS-AT didomains reveal structured linkers that connect the two domains. AT-less type I PKS KSs have remnants of these linkers, which have been hypothesized to be AT docking domains. Natural products produced by AT-less type I PKSs are very complex because of an increased representation of unique modifying domains. AT-less type I PKS KSs possess substrate specificity and fall into phylogenetic clades that correlate with their substrates, whereas canonical type I PKS KSs are monophyletic. We have solved crystal structures of seven AT-less type I PKS KS domains that represent various sequence clusters, revealing insight into the large structural and subtle amino acid residue differences that lead to unique active site topologies and substrate specificities. One set of structures represents a larger group of KS domains from both canonical and AT-less type I PKSs that accept amino acid-containing substrates. One structure has a partial AT-domain, revealing the structural consequences of a type I PKS KS evolving into an AT-less type I PKS KS. These structures highlight the structural diversity within the AT-less type I PKS KS family, and most important, provide a unique opportunity to study the molecular evolution of substrate specificity within the type I PKSs.

  8. Nonthmicin, a Polyether Polyketide Bearing a Halogen-Modified Tetronate with Neuroprotective and Antiinvasive Activity from Actinomadura sp.

    Science.gov (United States)

    Igarashi, Yasuhiro; Matsuoka, Noriaki; In, Yasuko; Kataura, Tetsushi; Tashiro, Etsu; Saiki, Ikuo; Sudoh, Yuri; Duangmal, Kannika; Thamchaipenet, Arinthip

    2017-03-17

    Nonthmicin (1), a new polyether polyketide bearing a chlorinated tetronic acid, was isolated from the culture extract of a soil-derived Actinomadura strain. The structure of 1 was elucidated by interpretation of NMR and MS spectroscopic data, and the absolute configuration of 1 was proposed on the basis of the crystal structure of its dechloro congener ecteinamycin (2) also isolated from the same strain. Tetronic acids modified by halogenation have never been reported from natural products. Compounds 1 and 2 were found to have neuroprotective activity and antimetastatic properties at submicromolar concentrations in addition to antibacterial activity.

  9. The Post-polyketide Synthase Steps in iso-Migrastatin Biosynthesis Featuring Tailoring Enzymes with Broad Substrate Specificity

    Science.gov (United States)

    Ma, Ming; Kwong, Thomas; Lim, Si-Kyu; Ju, Jianhua; Lohman, Jeremy R.; Shen, Ben

    2013-01-01

    The iso-migrastatin (iso-MGS) biosynthetic gene cluster from Streptomyces platensis NRRL 18993 consists of 11 genes, featuring an acyltransferase (AT)-less type I polyketide synthase (PKS) and three tailoring enzymes MgsIJK. Systematic inactivation of mgsIJK in S. platensis enabled us to (i) identify two nascent products (10 and 13) of the iso-MGS AT-less type I PKS, establishing an unprecedented novel feature for AT-less type I PKSs, and (ii) account for the formation of all known post-PKS biosynthetic intermediates (10-17) generated by the three tailoring enzymes MgsIJK, which possessed significant substrate promiscuities. PMID:23394593

  10. Antiviral Stilbene 1,2-Diamines Prevent Initiation of Hepatitis C Virus RNA Replication at the Outset of Infection▿

    Science.gov (United States)

    Gastaminza, Pablo; Pitram, Suresh M.; Dreux, Marlene; Krasnova, Larissa B.; Whitten-Bauer, Christina; Dong, Jiajia; Chung, Josan; Fokin, Valery V.; Sharpless, K. Barry; Chisari, Francis V.

    2011-01-01

    The recent development of a cell culture model of hepatitis C virus (HCV) infection based on the JFH-1 molecular clone has enabled discovery of new antiviral agents. Using a cell-based colorimetric screening assay to interrogate a 1,200-compound chemical library for anti-HCV activity, we identified a family of 1,2-diamines derived from trans-stilbene oxide that prevent HCV infection at nontoxic, low micromolar concentrations in cell culture. Structure-activity relationship analysis of ∼300 derivatives synthesized using click chemistry yielded compounds with greatly enhanced low nanomolar potency and a >1,000:1 therapeutic ratio. Using surrogate models of HCV infection, we showed that the compounds selectively block the initiation of replication of incoming HCV RNA but have no impact on viral entry, primary translation, or ongoing HCV RNA replication, nor do they suppress persistent HCV infection. Selection of an escape variant revealed that NS5A is directly or indirectly targeted by this compound. In summary, we have identified a family of HCV inhibitors that target a critical step in the establishment of HCV infection in which NS5A translated de novo from an incoming genomic HCV RNA template is required to initiate the replication of this important human pathogen. PMID:21430055

  11. Carbon-11 labeled stilbene derivatives from natural products for the imaging of Aβ plaques in the brain

    Energy Technology Data Exchange (ETDEWEB)

    Cui, Mengchao; Tang, Ruikun; Li, Zijing; Jia, Hongmei; Liu, Boli [Beijing Normal Univ. (China). Key Laboratory of Radiopharmaceuticals; Zhang, Jinming; Zhang, Xiaojun [Chinese PLA General Hospital, Beijing (China). Dept. of Nuclear Medicine

    2014-04-01

    Four stilbene derivatives from natural products were screened as novel β-amyloid (Aβ) imaging ligands. In vitro binding assay showed that the methylated ligand, (E)-1-methoxy-4-styrylbenzene (8) displayed high binding affinity to Aβ{sub 1-42} aggregates (K{sub i} = 19.5 nM). Moreover, the {sup 11}C-labeled ligand, [{sup 11}C]8 was prepared through an O-methylation reaction using [{sup 11}C]CH{sub 3}OTf. In vitro autoradiography with sections of transgenic mouse brain also confirmed the high and specific binding of [{sup 11}C]8 to Aβ plaques. In vivo biodistribution experiments in normal mice indicated that [{sup 11}C]8 displayed high initial uptake (9.41 ± 0.51% ID/g at 5 min post-injection) into and rapid washout from the brain, with a brain{sub 5} {sub min}/brain{sub 30} {sub min} ratio of 6.63. These preliminary results suggest that [{sup 11}C]8 may be served as a novel Aβ imaging probe for PET. (orig.)

  12. Effects of trans-stilbene and terphenyl compounds on different strains of Leishmania and on cytokines production from infected macrophages.

    Science.gov (United States)

    Bruno, Federica; Castelli, Germano; Vitale, Fabrizio; Giacomini, Elisa; Roberti, Marinella; Colomba, Claudia; Cascio, Antonio; Tolomeo, Manlio

    2018-01-01

    Most of the antileishmanial modern therapies are not satisfactory due to high toxicity or emergence of resistance and high cost of treatment. Previously, we observed that two compounds of a small library of trans-stilbene and terphenyl derivatives, ST18 and TR4, presented the best activity and safety profiles against Leishmania infantum promastigotes and amastigotes. In the present study we evaluated the effects of ST18 and the TR4 in 6 different species of Leishmania and the modifications induced by these two compounds in the production of 8 different cytokines from infected macrophages. We observed that TR4 was potently active in all Leishmania species tested in the study showing a leishmanicidal activity higher than that of ST18 and meglumine antimoniate in the most of the species. Moreover, TR4 was able to decrease the levels of IL-10, a cytokine able to render the host macrophage inactive allowing the persistence of parasites inside its phagolysosome, and increase the levels of IL-1β, a cytokine important for host resistance to Leishmania infection by inducible iNOS-mediated production of NO, and IL-18, a cytokine implicated in the development of Th1-type immune response. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Multiomics in Grape Berry Skin Revealed Specific Induction of the Stilbene Synthetic Pathway by Ultraviolet-C Irradiation1

    Science.gov (United States)

    Suzuki, Mami; Nakabayashi, Ryo; Ogata, Yoshiyuki; Sakurai, Nozomu; Tokimatsu, Toshiaki; Goto, Susumu; Suzuki, Makoto; Jasinski, Michal; Martinoia, Enrico; Otagaki, Shungo; Matsumoto, Shogo; Saito, Kazuki; Shiratake, Katsuhiro

    2015-01-01

    Grape (Vitis vinifera) accumulates various polyphenolic compounds, which protect against environmental stresses, including ultraviolet-C (UV-C) light and pathogens. In this study, we looked at the transcriptome and metabolome in grape berry skin after UV-C irradiation, which demonstrated the effectiveness of omics approaches to clarify important traits of grape. We performed transcriptome analysis using a genome-wide microarray, which revealed 238 genes up-regulated more than 5-fold by UV-C light. Enrichment analysis of Gene Ontology terms showed that genes encoding stilbene synthase, a key enzyme for resveratrol synthesis, were enriched in the up-regulated genes. We performed metabolome analysis using liquid chromatography-quadrupole time-of-flight mass spectrometry, and 2,012 metabolite peaks, including unidentified peaks, were detected. Principal component analysis using the peaks showed that only one metabolite peak, identified as resveratrol, was highly induced by UV-C light. We updated the metabolic pathway map of grape in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database and in the KaPPA-View 4 KEGG system, then projected the transcriptome and metabolome data on a metabolic pathway map. The map showed specific induction of the resveratrol synthetic pathway by UV-C light. Our results showed that multiomics is a powerful tool to elucidate the accumulation mechanisms of secondary metabolites, and updated systems, such as KEGG and KaPPA-View 4 KEGG for grape, can support such studies. PMID:25761715

  14. Study of sampling rate influence on neutron-gamma discrimination with stilbene coupled to a silicon photomultiplier.

    Science.gov (United States)

    Zhang, Jinglong; Moore, Michael E; Wang, Zhonghai; Rong, Zhou; Yang, Chaowen; Hayward, Jason P

    2017-10-01

    Choosing a digitizer with an appropriate sampling rate is often a trade-off between performance and economy. The influence of sampling rates on the neutron-gamma Pulse Shape Discrimination (PSD) with a solid stilbene scintillator coupled to a Silicon Photomultiplier was investigated in this work. Sampling rates from 125MSPS to 2GSPS from a 10-bit digitizer were used to collect detector pulses produced by the interactions of a Cf-252 source. Due to the decreased signal-to-noise ratio (SNR), the PSD performance degraded with reduced sampling rates. The reason of PSD performance degradation was discussed. Then, an efficient combination of filtering and digital signal processing (DSP) was then applied to suppress the timing noise and electronic background noise. The results demonstrate an improved PSD performance especially at low sampling rates, down to 125MSPS. Using filtering and DSP, the ascribed Figure of Merit (FOM) at 125keV ee (± 10keV ee ) increased from 0.95 to 1.02 at 125MSPS. At 300keV ee and above, all the FOMs are better than 2.00. Our study suggests that 250MSPS is a good enough sampling rate for neutron-gamma discrimination in this system in order to be sensitive to neutrons at and above ~ 125keV ee . Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Identification and regulation of fusA, the polyketide synthase gene responsible for fusarin production in Fusarium fujikuroi.

    Science.gov (United States)

    Díaz-Sánchez, Violeta; Avalos, Javier; Limón, M Carmen

    2012-10-01

    Fusarins are a class of mycotoxins of the polyketide family produced by different Fusarium species, including the gibberellin-producing fungus Fusarium fujikuroi. Based on sequence comparisons between polyketide synthase (PKS) enzymes for fusarin production in other Fusarium strains, we have identified the F. fujikuroi orthologue, called fusA. The participation of fusA in fusarin biosynthesis was demonstrated by targeted mutagenesis. Fusarin production is transiently stimulated by nitrogen availability in this fungus, a regulation paralleled by the fusA mRNA levels in the cell. Illumination of the cultures results in a reduction of the fusarin content, an effect partially explained by a high sensitivity of these compounds to light. Mutants of the fusA gene exhibit no external phenotypic alterations, including morphology and conidiation, except for a lack of the characteristic yellow and/or orange pigmentation of fusarins. Moreover, the fusA mutants are less efficient than the wild type at degrading cellophane on agar cultures, a trait associated with pathogenesis functions in Fusarium oxysporum. The fusA mutants, however, are not affected in their capacities to grow on plant tissues.

  16. An overview of insights gained and lessons learned from U.S. plant-specific PRA studies

    International Nuclear Information System (INIS)

    Joksimovich, V.

    1985-01-01

    Probabilistic Risk Assessment (PRA) has been under development for over twenty years, but it has reached the level of widespread use only in the aftermath of the TMI accident. Over thirty PRAs have now been completed in the U.S. PRAs have been in the mainstream of many licensing decisions because the NRC recognizes that they provide independent and comprehensive plant safety audit. Some difficulties have been experienced leading to interpretive and intercomparison studies. Numerous global and plant-specific insights have been derived. A new application termed risk management is clearly emerging. (orig./HP)

  17. Synergistic Cytotoxicity Effect by Combination Treatment of Polyketide Derivatives from Annona muricata Linn Leaves and Doxorubicin as Potential Anticancer Material on Raji Cell Line

    Science.gov (United States)

    Artanti, A. N.; Astirin, O. P.; Prayito, A.; Fisma, R.; Prihapsara, F.

    2018-03-01

    Nasopharynx cancer is one of the most deadly cancer. The main priority of nasopharynx cancer treatment is the use of chemotherapeutic agents, especially doxorubicin. However, doxorubicin might also lead to diverse side effect. An approach recently develop to overcome side effect of doxorubicin is to used of combined chemotherapeutic agent. One of the compounds found effication as an anticancer agent on nasopharynx cancer is acetogenin, a polyketide compound that is abundant in Annona muricata L. leaves. This study has been done to examine polyketide derivatives was isolated from Annona muricata L. which has potency to induce apoptosis by p53 expression on raji cell line. The determination of cytotoxic combination activity from polyketide derivative and doxorubicin was evaluated using MTT assay to obtain the value of CI (combination index). Data analysis showed that combination of polyketide derivative from Annona muricata L. (14,4 µg/ml) and doxorubicin with all of concentration performed synergistic effect on raji cell line with CI value from 0.13 – 0.65.

  18. Transcriptional expression of Stilbene synthase genes are regulated developmentally and differentially in response to powdery mildew in Norton and Cabernet Sauvignon grapevine.

    Science.gov (United States)

    Dai, Ru; Ge, Hui; Howard, Susanne; Qiu, Wenping

    2012-12-01

    Stilbenic compounds are natural phytoalexins that have antimicrobial activities in plant defense against pathogens. Stilbene synthase (STS) is the key enzyme that catalyzes the biosynthesis of stilbenic compounds. Grapevine genome contains a family of preliminarily annotated 35 STS genes, the regulation of each STS gene needs to be studied to define their roles. In this study, we selected eight STS genes, STS8, STS27/31, STS16/22, STS13/17/23, and applied quantitative polymerase chain reaction (qPCR) to characterize their transcriptional expression profiles in leaf tissues upon infection by the powdery mildew fungus (PM), Erysiphe necator (Schw.) Burr. Their transcripts were also compared in young and old leaves as well as in the berry skin at five developmental stages in Vitis vinifera 'Cabernet Sauvignon' and Vitis aestivalis 'Norton'. The results showed that transcripts of selected STS genes increased significantly in Cabernet Sauvignon leaves at 24 and 48 h post inoculation with PM spores and remained unchanged in Norton leaves in response to the PM infection. Transcripts of STS8, STS27/31 and STS13/17/23 were more abundant in the old leaves of Norton than in Cabernet Sauvignon. STS genes showed lower expression levels in young leaves than in old leaves. Transcript levels of the eight STS genes increased drastically in the berry skin of Cabernet Sauvignon and Norton post véraison. In addition, the content of trans-resveratrol in the berry skin rapidly increased post véraison and reached the highest level at harvest. These assays demonstrated that individual STS genes are regulated differentially in response to PM infection and during development in the two grape varieties. The present study yields basic knowledge for further investigation of the regulation and function of each STS gene in grapevine and provides experimental evidences for the functional annotation of the STS gene family in the grapevine genome. Copyright © 2012 Elsevier Ireland Ltd. All

  19. A stilbene synthase allele from a Chinese wild grapevine confers resistance to powdery mildew by recruiting salicylic acid signalling for efficient defence.

    Science.gov (United States)

    Jiao, Yuntong; Xu, Weirong; Duan, Dong; Wang, Yuejin; Nick, Peter

    2016-10-01

    Stilbenes are central phytoalexins in Vitis, and induction of the key enzyme stilbene synthase (STS) is pivotal for disease resistance. Here, we address the potential for breeding resistance using an STS allele isolated from Chinese wild grapevine Vitis pseudoreticulata (VpSTS) by comparison with its homologue from Vitis vinifera cv. 'Carigane' (VvSTS). Although the coding regions of both alleles are very similar (>99% identity on the amino acid level), the promoter regions are significantly different. By expression in Arabidopsis as a heterologous system, we show that the allele from the wild Chinese grapevine can confer accumulation of stilbenes and resistance against the powdery mildew Golovinomyces cichoracearum, whereas the allele from the vinifera cultivar cannot. To dissect the upstream signalling driving the activation of this promoter, we used a dual-luciferase reporter system in a grapevine cell culture. We show elevated responsiveness of the promoter from the wild grape to salicylic acid (SA) and to the pathogen-associated molecular pattern (PAMP) flg22, equal induction of both alleles by jasmonic acid (JA), and a lack of response to the cell death-inducing elicitor Harpin. This elevated SA response of the VpSTS promoter depends on calcium influx, oxidative burst by RboH, mitogen-activated protein kinase (MAPK) signalling, and JA synthesis. We integrate the data in the context of a model where the resistance of V. pseudoreticulata is linked to a more efficient recruitment of SA signalling for phytoalexin synthesis. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  20. Heterologous gene expression and functional analysis of a type III polyketide synthase from Aspergillus niger NRRL 328

    Energy Technology Data Exchange (ETDEWEB)

    Kirimura, Kohtaro, E-mail: kkohtaro@waseda.jp; Watanabe, Shotaro; Kobayashi, Keiichi

    2016-05-13

    Type III polyketide synthases (PKSs) catalyze the formation of pyrone- and resorcinol-types aromatic polyketides. The genomic analysis of the filamentous fungus Aspergillus niger NRRL 328 revealed that this strain has a putative gene (chr-8-2: 2978617–2979847) encoding a type III PKS, although its functions are unknown. In this study, for functional analysis of this putative type III PKS designated as An-CsyA, cloning and heterologous expression of the An-CsyA gene (An-csyA) in Escherichia coli were performed. Recombinant His-tagged An-CsyA was successfully expressed in E. coli BL21 (DE3), purified by Ni{sup 2+}-affinity chromatography, and used for in vitro assay. Tests on the substrate specificity of the His-tagged An-CsyA with myriad acyl-CoAs as starter substrates and malonyl-CoA as extender substrate showed that His-tagged An-CsyA accepted fatty acyl-CoAs (C2-C14) and produced triketide pyrones (C2-C14), tetraketide pyrones (C2-C10), and pentaketide resorcinols (C10-C14). Furthermore, acetoacetyl-CoA, malonyl-CoA, isobutyryl-CoA, and benzoyl-CoA were also accepted as starter substrates, and both of triketide pyrones and tetraketide pyrones were produced. It is noteworthy that the His-tagged An-CsyA produced polyketides from malonyl-CoA as starter and extender substrates and produced tetraketide pyrones from short-chain fatty acyl-CoAs as starter substrates. Therefore, this is the first report showing the functional properties of An-CsyA different from those of other fungal type III PKSs. -- Highlights: •Type III PKS from Aspergillus niger NRRL 328, An-CsyA, was cloned and characterized. •An-CsyA produced triketide pyrones, tetraketide pyrones and pentaketide resorcinols. •Functional properties of An-CsyA differs from those of other fungal type III PKSs.

  1. Heterologous gene expression and functional analysis of a type III polyketide synthase from Aspergillus niger NRRL 328

    International Nuclear Information System (INIS)

    Kirimura, Kohtaro; Watanabe, Shotaro; Kobayashi, Keiichi

    2016-01-01

    Type III polyketide synthases (PKSs) catalyze the formation of pyrone- and resorcinol-types aromatic polyketides. The genomic analysis of the filamentous fungus Aspergillus niger NRRL 328 revealed that this strain has a putative gene (chr-8-2: 2978617–2979847) encoding a type III PKS, although its functions are unknown. In this study, for functional analysis of this putative type III PKS designated as An-CsyA, cloning and heterologous expression of the An-CsyA gene (An-csyA) in Escherichia coli were performed. Recombinant His-tagged An-CsyA was successfully expressed in E. coli BL21 (DE3), purified by Ni"2"+-affinity chromatography, and used for in vitro assay. Tests on the substrate specificity of the His-tagged An-CsyA with myriad acyl-CoAs as starter substrates and malonyl-CoA as extender substrate showed that His-tagged An-CsyA accepted fatty acyl-CoAs (C2-C14) and produced triketide pyrones (C2-C14), tetraketide pyrones (C2-C10), and pentaketide resorcinols (C10-C14). Furthermore, acetoacetyl-CoA, malonyl-CoA, isobutyryl-CoA, and benzoyl-CoA were also accepted as starter substrates, and both of triketide pyrones and tetraketide pyrones were produced. It is noteworthy that the His-tagged An-CsyA produced polyketides from malonyl-CoA as starter and extender substrates and produced tetraketide pyrones from short-chain fatty acyl-CoAs as starter substrates. Therefore, this is the first report showing the functional properties of An-CsyA different from those of other fungal type III PKSs. -- Highlights: •Type III PKS from Aspergillus niger NRRL 328, An-CsyA, was cloned and characterized. •An-CsyA produced triketide pyrones, tetraketide pyrones and pentaketide resorcinols. •Functional properties of An-CsyA differs from those of other fungal type III PKSs.

  2. Identification of potentially safe promising fungal cell factories for the production of polyketide natural food colorants using chemotaxonomic rationale

    DEFF Research Database (Denmark)

    Mapari, Sameer Shamsuddin; Meyer, Anne S.; Thrane, Ulf

    2009-01-01

    Background: Colorants derived from natural sources look set to overtake synthetic colorants in market value as manufacturers continue to meet the rising demand for clean label ingredients-particularly in food applications. Many ascomycetous fungi naturally synthesize and secrete pigments and thus...... has not yet been examined in detail. In addition, 4 out of the 10 chemotaxonomically selected promising Penicillium strains were shown to produce extracellular pigments in the liquid media using a solid support indicating future cell factory possibilities for polyketide natural food colorants....... provide readily available additional and/or alternative sources of natural colorants that are independent of agro-climatic conditions. With an appropriately selected fungus; using in particular chemotaxonomy as a guide, the fungal natural colorants could be produced in high yields by using the optimized...

  3. Exploring Protein Interactions on a Minimal Type II Polyketide Synthase Using a Yeast Two-Hybrid System

    Directory of Open Access Journals (Sweden)

    Gaetano Castaldo

    2005-01-01

    Full Text Available Interactions between proteins that form the ’minimal’ type II polyketide synthase in the doxorubicin producing biosynthetic pathway from Streptomyces peucetius were investigated using a yeast two-hybrid system (Y2H. Proteins that function as the so called ’chain length factor’ (DpsB and putative transacylase (DpsD were found to interact with the ketosynthase subunit (DpsA, which can also interact with itself. On the basis of these results we propose a head-to-tail homodimeric structure, which is consistent with previously published in vivo mutagenesis studies. No interactions were found between the acyl-carrier protein (DpsG and any of the other constituents of the complex, however, transient interactions, not detectable using the Y2H system, cannot be discounted and warrant further investigation.

  4. Discovery Strategies of Bioactive Compounds Synthesized by Nonribosomal Peptide Synthetases and Type-I Polyketide Synthases Derived from Marine Microbiomes

    Science.gov (United States)

    Amoutzias, Grigoris D.; Chaliotis, Anargyros; Mossialos, Dimitris

    2016-01-01

    Considering that 70% of our planet’s surface is covered by oceans, it is likely that undiscovered biodiversity is still enormous. A large portion of marine biodiversity consists of microbiomes. They are very attractive targets of bioprospecting because they are able to produce a vast repertoire of secondary metabolites in order to adapt in diverse environments. In many cases secondary metabolites of pharmaceutical and biotechnological interest such as nonribosomal peptides (NRPs) and polyketides (PKs) are synthesized by multimodular enzymes named nonribosomal peptide synthetases (NRPSes) and type-I polyketide synthases (PKSes-I), respectively. Novel findings regarding the mechanisms underlying NRPS and PKS evolution demonstrate how microorganisms could leverage their metabolic potential. Moreover, these findings could facilitate synthetic biology approaches leading to novel bioactive compounds. Ongoing advances in bioinformatics and next-generation sequencing (NGS) technologies are driving the discovery of NRPs and PKs derived from marine microbiomes mainly through two strategies: genome-mining and metagenomics. Microbial genomes are now sequenced at an unprecedented rate and this vast quantity of biological information can be analyzed through genome mining in order to identify gene clusters encoding NRPSes and PKSes of interest. On the other hand, metagenomics is a fast-growing research field which directly studies microbial genomes and their products present in marine environments using culture-independent approaches. The aim of this review is to examine recent developments regarding discovery strategies of bioactive compounds synthesized by NRPS and type-I PKS derived from marine microbiomes and to highlight the vast diversity of NRPSes and PKSes present in marine environments by giving examples of recently discovered bioactive compounds. PMID:27092515

  5. Discovery Strategies of Bioactive Compounds Synthesized by Nonribosomal Peptide Synthetases and Type-I Polyketide Synthases Derived from Marine Microbiomes

    Directory of Open Access Journals (Sweden)

    Grigoris D. Amoutzias

    2016-04-01

    Full Text Available Considering that 70% of our planet’s surface is covered by oceans, it is likely that undiscovered biodiversity is still enormous. A large portion of marine biodiversity consists of microbiomes. They are very attractive targets of bioprospecting because they are able to produce a vast repertoire of secondary metabolites in order to adapt in diverse environments. In many cases secondary metabolites of pharmaceutical and biotechnological interest such as nonribosomal peptides (NRPs and polyketides (PKs are synthesized by multimodular enzymes named nonribosomal peptide synthetases (NRPSes and type-I polyketide synthases (PKSes-I, respectively. Novel findings regarding the mechanisms underlying NRPS and PKS evolution demonstrate how microorganisms could leverage their metabolic potential. Moreover, these findings could facilitate synthetic biology approaches leading to novel bioactive compounds. Ongoing advances in bioinformatics and next-generation sequencing (NGS technologies are driving the discovery of NRPs and PKs derived from marine microbiomes mainly through two strategies: genome-mining and metagenomics. Microbial genomes are now sequenced at an unprecedented rate and this vast quantity of biological information can be analyzed through genome mining in order to identify gene clusters encoding NRPSes and PKSes of interest. On the other hand, metagenomics is a fast-growing research field which directly studies microbial genomes and their products present in marine environments using culture-independent approaches. The aim of this review is to examine recent developments regarding discovery strategies of bioactive compounds synthesized by NRPS and type-I PKS derived from marine microbiomes and to highlight the vast diversity of NRPSes and PKSes present in marine environments by giving examples of recently discovered bioactive compounds.

  6. Diversity of polyketides produced by Penicillium species isolated from Melia azedarach and Murraya paniculata; Diversidade de policetideos produzidos por especies de penicillium isolados de Melia azedarach e Murraya paniculata

    Energy Technology Data Exchange (ETDEWEB)

    Pastre, Renata; Marinho, Andrey M.R.; Rodrigues-Filho, Edson [Universidade Federal de Sao Carlos (UFSCar), SP (Brazil). Dept. de Quimica]. E-mail: edson@dq.ufscar.br; Souza, Antonia Q.L.; Pereira, Jose Odair [Universidade Federal de Sao Carlos (UFSCar), SP (Brazil). Dept. de Genetica e Evolucao

    2007-07-01

    Eight compounds comprising four groups of polyketides, the xanthone fusarindin, the mixed peptide alkaloid-polyketide GKK1032, the anthraquinones crysophanol, citreoveridin and janthinone, and the azaphylones dihydrocitrinone, citrinin and citrinin H-1, were identified in Penicillium species isolated as endophytic fungi from Melia azedarach and Murraya paniculata. The antibacterial activity of the azaphylones was tested and showed that citrinin H-1 is more active than citrinin. (author)

  7. The plant-specific impact of different pressurization rates in the probabilistic estimation of containment failure modes

    International Nuclear Information System (INIS)

    Ahn, Kwang Il; Yang, Joon Eon; Ha, Jae Joo

    2003-01-01

    The explicit consideration of different pressurization rates in estimating the probabilities of containment failure modes has a profound effect on the confidence of containment performance evaluation that is so critical for risk assessment of nuclear power plants. Except for the sophisticated NUREG-1150 study, many of the recent containment performance analyses (through level 2 PSAs or IPE back-end analyses) did not take into account an explicit distinction between slow and fast pressurization in their analyses. A careful investigation of both approaches shows that many of the approaches adopted in the recent containment performance analyses exactly correspond to the NUREG-1150 approach for the prediction of containment failure mode probabilities in the presence of fast pressurization. As a result, it was expected that the existing containment performance analysis results would be subjected to greater or less conservatism in light of the ultimate failure mode of the containment. The main purpose of this paper is to assess potential conservatism of a plant-specific containment performance analysis result in light of containment failure mode probabilities

  8. Plant-specific Histone Deacetylases HDT½ Regulate GIBBERELLIN 2-OXIDASE 2 Expression to Control Arabidopsis Root Meristem Cell Number

    KAUST Repository

    Li, Huchen

    2017-08-31

    Root growth is modulated by environmental factors and depends on cell production in the root meristem (RM). New cells in the meristem are generated by stem cells and transit-amplifying cells, which together determine RM cell number. Transcription factors and chromatin-remodelling factors have been implicated in regulating the switch from stem cells to transit-amplifying cells. Here we show that two Arabidopsis thaliana paralogs encoding plant-specific histone deacetylases, HDT1 and HDT2, regulate a second switch from transit-amplifying cells to expanding cells. Knockdown of HDT½ (hdt1,2i) results in an earlier switch and causes a reduced RM cell number. Our data show that HDT½ negatively regulate the acetylation level of the C19-GIBBERELLIN 2-OXIDASE 2 (GA2ox2) locus and repress the expression of GA2ox2 in the RM and elongation zone. Overexpression of GA2ox2 in the RM phenocopies the hdt1,2i phenotype. Conversely, knockout of GA2ox2 partially rescues the root growth defect of hdt1,2i. These results suggest that by repressing the expression of GA2ox2, HDT½ likely fine-tune gibberellin metabolism and they are crucial for regulating the switch from cell division to expansion to determine RM cell number. We propose that HDT½ function as part of a mechanism that modulates root growth in response to environmental factors.

  9. Marine myxobacteria as a source of antibiotics--comparison of physiology, polyketide-type genes and antibiotic production of three new isolates of Enhygromyxa salina.

    Science.gov (United States)

    Schäberle, Till F; Goralski, Emilie; Neu, Edith; Erol, Ozlem; Hölzl, Georg; Dörmann, Peter; Bierbaum, Gabriele; König, Gabriele M

    2010-09-03

    Three myxobacterial strains, designated SWB004, SWB005 and SWB006, were obtained from beach sand samples from the Pacific Ocean and the North Sea. The strains were cultivated in salt water containing media and subjected to studies to determine their taxonomic status, the presence of genes for the biosynthesis of polyketides and antibiotic production. 16S rDNA sequence analysis revealed the type strain Enhygromyxa salina SHK-1(T) as their closest homolog, displaying between 98% (SWB005) and 99% (SWB004 and SWB006) sequence similarity. All isolates were rod-shaped cells showing gliding motility and fruiting body formation as is known for myxobacteria. They required NaCl for growth, with an optimum concentration of around 2% [w/v]. The G + C-content of genomic DNA ranged from 63.0 to 67.3 mol%. Further, the strains were analyzed for their potential to produce polyketide-type structures. PCR amplified ketosynthase-like gene fragments from all three isolates enhances the assumption that these bacteria produce polyketides. SWB005 was shown to produce metabolites with prominent antibacterial activity, including activity towards methicillin resistant Staphylococcus aureus (MRSA) and Staphylococcus epidermidis (MRSE).

  10. Aromatic Polyketide GTRI-02 is a Previously Unidentified Product of the act Gene Cluster in Streptomyces coelicolor A3(2).

    Science.gov (United States)

    Wu, Changsheng; Ichinose, Koji; Choi, Young Hae; van Wezel, Gilles P

    2017-07-18

    The biosynthesis of aromatic polyketides derived from type II polyketide synthases (PKSs) is complex, and it is not uncommon that highly similar gene clusters give rise to diverse structural architectures. The act biosynthetic gene cluster (BGC) of the model actinomycete Streptomyces coelicolor A3(2) is an archetypal type II PKS. Here we show that the act BGC also specifies the aromatic polyketide GTRI-02 (1) and propose a mechanism for the biogenesis of its 3,4-dihydronaphthalen-1(2H)-one backbone. Polyketide 1 was also produced by Streptomyces sp. MBT76 after activation of the act-like qin gene cluster by overexpression of the pathway-specific activator. Mining of this strain also identified dehydroxy-GTRI-02 (2), which most likely originated from dehydration of 1 during the isolation process. This work shows that even extensively studied model gene clusters such as act of S. coelicolor can still produce new chemistry, offering new perspectives for drug discovery. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Marine Myxobacteria as a Source of Antibiotics—Comparison of Physiology, Polyketide-Type Genes and Antibiotic Production of Three New Isolates of Enhygromyxa salina

    Directory of Open Access Journals (Sweden)

    Gabriele Bierbaum

    2010-09-01

    Full Text Available Three myxobacterial strains, designated SWB004, SWB005 and SWB006, were obtained from beach sand samples from the Pacific Ocean and the North Sea. The strains were cultivated in salt water containing media and subjected to studies to determine their taxonomic status, the presence of genes for the biosynthesis of polyketides and antibiotic production. 16S rDNA sequence analysis revealed the type strain Enhygromyxa salina SHK-1T as their closest homolog, displaying between 98% (SWB005 and 99% (SWB004 and SWB006 sequence similarity. All isolates were rod-shaped cells showing gliding motility and fruiting body formation as is known for myxobacteria. They required NaCl for growth, with an optimum concentration of around 2% [w/v]. The G + C-content of genomic DNA ranged from 63.0 to 67.3 mol%. Further, the strains were analyzed for their potential to produce polyketide-type structures. PCR amplified ketosynthase-like gene fragments from all three isolates enhances the assumption that these bacteria produce polyketides. SWB005 was shown to produce metabolites with prominent antibacterial activity, including activity towards methicillin resistant Staphylococcus aureus (MRSA and Staphylococcus epidermidis (MRSE.

  12. United States Department of Agriculture-Agricultural Research Service studies on polyketide toxins of Fusarium oxysporum f sp vasinfectum: potential targets for disease control.

    Science.gov (United States)

    Bell, Alois A; Wheeler, Michael H; Liu, Jinggao; Stipanovic, Robert D; Puckhaber, Lorraine S; Orta, Heather

    2003-01-01

    A group of 133 isolates of the cotton wilt pathogen Fusarium oxysporum Schlecht f sp vasinfectum (Atk) Sny & Hans, representing five races and 20 vegetative compatibility groups within race 1 were used to determine the identity, biosynthetic regulation and taxonomic distribution of polyketide toxins produced by this pathogen. All isolates of F oxysporum f sp vasinfectum produced and secreted the nonaketide naphthazarin quinones, bikaverin and norbikaverin. Most isolates of race 1 (previously denoted as races 1, 2 and 6; and also called race A) also synthesized the heptaketide naphthoquinones, nectriafurone, anhydrofusarubin lactol and 5-O-methyljavanicin. Nine avirulent isolates of F oxysporum from Upland cotton roots, three isolates of race 3 of F oxysporum f sp vasinfectum, and four isolates of F oxysporum f sp vasinfectum from Australia, all of which previously failed to cause disease of Upland cotton (Gossypium hirsutum L) in stem-puncture assays, also failed to synthesize or secrete more than trace amounts of the heptaketide compounds. These results indicate that the heptaketides may have a unique role in the virulence of race 1 to Upland cotton. The synthesis of all polyketide toxins by ATCC isolate 24908 of F oxysporum f sp vasinfectum was regulated by pH, carbon/nitrogen ratios, and availability of calcium in media. Synthesis was greatest below pH 7.0 and increased progressively as carbon/nitrogen ratios were increased by decreasing the amounts of nitrogen added to media. The nonaketides were the major polyketides accumulated in synthetic media at pH 4.5 and below, whereas the heptaketides were predominant at pH 5.0 and above. The heptaketides were the major polyketides formed when 10 F oxysporum f sp vasinfectum race 1 isolates were grown on sterilized stems of Fusarium wilt-susceptible cotton cultivars, but these compounds were not produced on sorghum grain cultures. Both groups of polyketide toxins were apparently secreted by F oxysporum f sp vasinfectum

  13. Stilbene Glucoside, a Putative Sleep Promoting Constituent from Polygonum multiflorum Affects Sleep Homeostasis by Affecting the Activities of Lactate Dehydrogenase and Salivary Alpha Amylase.

    Science.gov (United States)

    Wei, Qian; Ta, Guang; He, Wenjing; Wang, Wei; Wu, Qiucheng

    2017-01-01

    Chinese herbal medicine (CHM) has been used for treating insomnia for centuries. The most used CHM for insomnia was Polygonum multiflorum. However, the molecular mechanism for CHM preventing insomnia is unknown. Stilbene glucoside (THSG), an important active component of P. multiflorum, may play an important role for treating insomnia. To test the hypothesis, Kunming mice were treated with different dosages of THSG. To examine the sleep duration, a computer-controlled sleep-wake detection system was implemented. Electroencephalogram (EEG) and electromyogram (EMG) electrodes were implanted to determine sleep-wake state. RT-PCR and Western blot was used to measure the levels of lactate dehydrogenase (LDH) and saliva alpha amylase. Spearman's rank correlation coefficient was used to identify the strength of correlation between the variables. The results showed that THSG significantly prolonged the sleep time of the mice (palpha amylase (palpha amylase (pamylase were negatively associated with sleep duration (palpha amylase.

  14. A single source precursor route to group 13 homo- and heterometallic oxides as highly active supports for gold-catalyzed aerobic epoxidation of trans-stilbene

    KAUST Repository

    Mishra, Shashank K.; Mendez, Violaine; Jeanneau, Erwann; Caps, Valerie; Daniè le, Sté phane

    2012-01-01

    A new Mitsubishi-type of star-shaped homoleptic derivative of indium(III), In4(mdea)6 (2, mdeaH2 = N-methyldiethanolamine) , was synthesized by the chloro-aminoalkoxo exchange reaction of a heteroleptic complex In6Cl6(mdea)6 (1) and used as a facile single source molecular precursor for the sol-gel preparation of high surface area indium oxide. Successful deposition of gold nanoparticles (1 wt.-%) of average size 3.3 nm on the above metal oxide by using HAuCl4· 3H2O afforded a highly efficient Au/In2O3 catalyst for the aerobic epoxidation of trans-stilbene at low temperature. The above single source precursor approach was further extended to obtain other group 13 homo- and heterometallic oxides, namely, α-Ga2O 3, β-Ga2O3 and Al4Ga 2O9, as highly active supports for gold catalysts. The obtained Au/M2O3 (M = Ga, In) and Au/Al4Ga 2O9 catalysts were thoroughly characterized by using several physicochemical techniques such as XRD, high resolution transmission electron microscopy (HR-TEM), energy-dispersive X-ray (EDX) spectroscopy, and X-ray photoelectron spectroscopy (XPS). A comparative study of the above catalysts for the model aerobic oxidation of stilbene in methylcyclohexane was undertaken. Highly efficient catalysts for aerobic oxidation reactions were obtained by depositing gold nanoparticles on group 13 mono- or mixed metal oxides prepared from the hydrolysis of well-characterized homo- and heterometallic N-methyldiethanolaminate derivatives. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. A single source precursor route to group 13 homo- and heterometallic oxides as highly active supports for gold-catalyzed aerobic epoxidation of trans-stilbene

    KAUST Repository

    Mishra, Shashank K.

    2012-12-14

    A new Mitsubishi-type of star-shaped homoleptic derivative of indium(III), In4(mdea)6 (2, mdeaH2 = N-methyldiethanolamine) , was synthesized by the chloro-aminoalkoxo exchange reaction of a heteroleptic complex In6Cl6(mdea)6 (1) and used as a facile single source molecular precursor for the sol-gel preparation of high surface area indium oxide. Successful deposition of gold nanoparticles (1 wt.-%) of average size 3.3 nm on the above metal oxide by using HAuCl4· 3H2O afforded a highly efficient Au/In2O3 catalyst for the aerobic epoxidation of trans-stilbene at low temperature. The above single source precursor approach was further extended to obtain other group 13 homo- and heterometallic oxides, namely, α-Ga2O 3, β-Ga2O3 and Al4Ga 2O9, as highly active supports for gold catalysts. The obtained Au/M2O3 (M = Ga, In) and Au/Al4Ga 2O9 catalysts were thoroughly characterized by using several physicochemical techniques such as XRD, high resolution transmission electron microscopy (HR-TEM), energy-dispersive X-ray (EDX) spectroscopy, and X-ray photoelectron spectroscopy (XPS). A comparative study of the above catalysts for the model aerobic oxidation of stilbene in methylcyclohexane was undertaken. Highly efficient catalysts for aerobic oxidation reactions were obtained by depositing gold nanoparticles on group 13 mono- or mixed metal oxides prepared from the hydrolysis of well-characterized homo- and heterometallic N-methyldiethanolaminate derivatives. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Expanding the chemical diversity of natural esters by engineering a polyketide-derived pathway into Escherichia coli.

    Science.gov (United States)

    Menendez-Bravo, Simón; Comba, Santiago; Sabatini, Martín; Arabolaza, Ana; Gramajo, Hugo

    2014-07-01

    Microbial fatty acid (FA)-derived molecules have emerged as promising alternatives to petroleum-based chemicals for reducing dependence on fossil hydrocarbons. However, native FA biosynthetic pathways often yield limited structural diversity, and therefore restricted physicochemical properties, of the end products by providing only a limited variety of usually linear hydrocarbons. Here we have engineered into Escherichia coli a mycocerosic polyketide synthase-based biosynthetic pathway from Mycobacterium tuberculosis and redefined its biological role towards the production of multi-methyl-branched-esters (MBEs) with novel chemical structures. Expression of FadD28, Mas and PapA5 enzymes enabled the biosynthesis of multi-methyl-branched-FA and their further esterification to an alcohol. The high substrate tolerance of these enzymes towards different FA and alcohol moieties resulted in the biosynthesis of a broad range of MBE. Further metabolic engineering of the MBE producer strain coupled this system to long-chain-alcohol biosynthetic pathways resulting in de novo production of branched wax esters following addition of only propionate. Copyright © 2014 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

  17. Chemistry and Selective Tumor Cell Growth Inhibitory Activity of Polyketides from the South China Sea Sponge Plakortis sp.

    Science.gov (United States)

    Li, Jiao; Li, Cui; Riccio, Raffaele; Lauro, Gianluigi; Bifulco, Giuseppe; Li, Tie-Jun; Tang, Hua; Zhuang, Chun-Lin; Ma, Hao; Sun, Peng; Zhang, Wen

    2017-05-03

    Simplextone E ( 1 ), a new metabolite of polyketide origin, was isolated with eight known analogues ( 2 - 9 ) from the South China Sea sponge Plakortis sp. The relative configuration of the new compound was elucidated by a detailed analysis of the spectroscopic data and quantum mechanical calculation of NMR chemical shifts, aided by the newly reported DP4+ approach. Its absolute configuration was determined by the TDDFT/ECD calculation. Simplextone E ( 1 ) is proven to be one of the isomers of simplextone D. The absolute configuration at C-8 in alkyl chain of plakortone Q ( 2 ) was also assigned based on the NMR calculation. In the preliminary in vitro bioassay, compounds 6 and 7 showed a selective growth inhibitory activity against HCT-116 human colon cancer cells with IC 50 values of 8.3 ± 2.4 and 8.4 ± 2.3 μM, corresponding to that of the positive control, adriamycin (IC 50 4.1 μM). The two compounds also showed selective activities towards MCF-7 human breast cancer and K562 human erythroleukemia cells while compound 3 only displayed weak activity against K562 cells.

  18. Production and New Extraction Method of Polyketide Red Pigments Produced by Ascomycetous Fungi from Terrestrial and Marine Habitats.

    Science.gov (United States)

    Lebeau, Juliana; Venkatachalam, Mekala; Fouillaud, Mireille; Petit, Thomas; Vinale, Francesco; Dufossé, Laurent; Caro, Yanis

    2017-06-28

    The use of ascomycetous fungi as pigment producers opens the way to an alternative to synthetic dyes, especially in the red-dye industries, which have very few natural pigment alternatives. The present paper aimed to bio-prospect and screen out 15 selected ascomycetous fungal strains, originating from terrestrial and marine habitats belonging to seven different genera ( Penicillium , Talaromyces , Fusarium , Aspergillus , Trichoderma , Dreschlera , and Paecilomyces ). We identified four strains, Penicillium purpurogenum rubisclerotium , Fusarium oxysporum , marine strains identified as Talaromyces spp., and Trichoderma atroviride , as potential red pigment producers. The extraction of the pigments is a crucial step, whereby the qualitative and quantitative compositions of each fungal extract need to be respected for reliable identification, as well as preserving bioactivity. Furthermore, there is a growing demand for more sustainable and cost-effective extraction methods. Therefore, a pressurized liquid extraction technique was carried out in this study, allowing a greener and faster extraction step of the pigments, while preserving their chemical structures and bioactivities in comparison to conventional extraction processes. The protocol was illustrated with the production of pigment extracts from P. purpurogenum rubisclerotium and Talaromyces spp. Extracts were analyzed by high-performance liquid-chromatography combined with photodiode array-detection (HPLC-DAD) and high-resolution mass spectrometry (UHPLC-HRMS). The more promising strain was the isolate Talaromyces spp. of marine origin. The main polyketide pigment produced by this strain has been characterized as N -threoninerubropunctamine, a non-toxic red Monascus -like azaphilone pigment.

  19. Targeting a polyketide synthase gene for Aspergillus carbonarius quantification and ochratoxin A assessment in grapes using real-time PCR

    International Nuclear Information System (INIS)

    Atoui, A.; Mathieu, F.; Lebrihi, A.

    2007-01-01

    Aspergillus carbonarius is an ochratoxin producing fungus that has been considered to be responsible of the ochratoxin A (OTA) contamination in grapes and wine. In order to monitor and quantify A. carbonarius, a specific primer pair Ac12RL O TAF/Ac12RL O TAR has been designed from the acyltransferase (AT) domain of the polyketide synthase sequence Ac12RL3 to amplify 141 bp PCR product. Among the mycotoxigenic fungi tested, only A. carbonarius gave a positive result. This specific primer pair was also successfully employed in real-time PCR conjugated with SYBR Green I dye for the direct quantification of this fungus in grape samples. A positive correlation (R2 = 0.81) was found between A. carbonarius DNA content and OTA concentration in 72 grape samples, allowing for the estimation of the potential risk from OTA contamination. Consequently, this work offers a quick alternative to conventional methods of OTA quantification and mycological detection and quantification of A. carbonarius in grapes. (author)

  20. An In Planta-Expressed Polyketide Synthase Produces (R)-Mellein in the Wheat Pathogen Parastagonospora nodorum

    Science.gov (United States)

    Krill, Christian; Barrow, Russell A.; Chen, Shasha; Trengove, Robert; Oliver, Richard P.; Solomon, Peter S.

    2014-01-01

    Parastagonospora nodorum is a pathogen of wheat that affects yields globally. Previous transcriptional analysis identified a partially reducing polyketide synthase (PR-PKS) gene, SNOG_00477 (SN477), in P. nodorum that is highly upregulated during infection of wheat leaves. Disruption of the corresponding SN477 gene resulted in the loss of production of two compounds, which we identified as (R)-mellein and (R)-O-methylmellein. Using a Saccharomyces cerevisiae yeast heterologous expression system, we successfully demonstrated that SN477 is the only enzyme required for the production of (R)-mellein. This is the first identification of a fungal PKS that is responsible for the synthesis of (R)-mellein. The P. nodorum ΔSN477 mutant did not show any significant difference from the wild-type strain in its virulence against wheat. However, (R)-mellein at 200 μg/ml inhibited the germination of wheat (Triticum aestivum) and barrel medic (Medicago truncatula) seeds. Comparative sequence analysis identified the presence of mellein synthase (MLNS) homologues in several Dothideomycetes and two sodariomycete genera. Phylogenetic analysis suggests that the MLNSs in fungi and bacteria evolved convergently from fungal and bacterial 6-methylsalicylic acid synthases. PMID:25326302

  1. Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome.

    Science.gov (United States)

    Müller, Christina A; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C A; Wellington, Elizabeth M H; Berg, Gabriele

    2015-08-01

    Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  2. Condensation of Macrocyclic Polyketides Produced by Penicillium sp. DRF2 with Mercaptopyruvate Represents a New Fungal Detoxification Pathway.

    Science.gov (United States)

    de Castro, Marcos V; Ióca, Laura P; Williams, David E; Costa, Bruna Z; Mizuno, Carolina M; Santos, Mario F C; de Jesus, Karen; Ferreira, Éverton L F; Seleghim, Mirna H R; Sette, Lara D; Pereira Filho, Edenir R; Ferreira, Antonio G; Gonçalves, Natália S; Santos, Raquel A; Patrick, Brian O; Andersen, Raymond J; Berlinck, Roberto G S

    2016-06-24

    Application of a refined procedure of experimental design and chemometric analysis to improve the production of curvularin-related polyketides by a marine-derived Penicillium sp. DRF2 resulted in the isolation and identification of cyclothiocurvularins 6-8 and cyclosulfoxicurvularins 10 and 11, novel curvularins condensed with a mercaptolactate residue. Two additional new curvularins, 3 and 4, are also reported. The structures of the sulfur-bearing curvularins were unambiguously established by analysis of spectroscopic data and by X-ray diffraction analysis. Analysis of stable isotope feeding experiments with [U-(13)C3(15)N]-l-cysteine confirmed the presence of the 2-hydroxy-3-mercaptopropanoic acid residue in 6-8 and the oxidized sulfoxide in 10 and 11. Cyclothiocurvularins A (6) and B (7) are formed by spontaneous reaction between 10,11-dehydrocurvularin (2) and mercaptopyruvate (12) obtained by transamination of cysteine. High ratios of [U-(13)C3(15)N]-l-cysteine incorporation into cyclothiocurvularin B (7), the isolation of two diastereomers of cyclothiocurvularins, the lack of cytotoxicity of cyclothiocurvularin B (7) and its methyl ester (8), and the spontaneous formation of cyclothiocurvularins from 10,11-dehydrocurvularin and mercaptopyruvate provide evidence that the formation of cyclothiocurvularins may well correspond to a 10,11-dehydrocurvularin detoxification process by Penicillium sp. DRF2.

  3. Production of New Cladosporin Analogues by Reconstitution of the Polyketide Synthases Responsible for the Biosynthesis of this Antimalarial Agent.

    Science.gov (United States)

    Cochrane, Rachel V K; Sanichar, Randy; Lambkin, Gareth R; Reiz, Béla; Xu, Wei; Tang, Yi; Vederas, John C

    2016-01-11

    The antimalarial agent cladosporin is a nanomolar inhibitor of the Plasmodium falciparum lysyl-tRNA synthetase, and exhibits activity against both blood- and liver-stage infection. Cladosporin can be isolated from the fungus Cladosporium cladosporioides, where it is biosynthesized by a highly reducing (HR) and a non-reducing (NR) iterative type I polyketide synthase (PKS) pair. Genome sequencing of the host organism and subsequent heterologous expression of these enzymes in Saccharomyces cerevisiae produced cladosporin, confirming the identity of the putative gene cluster. Incorporation of a pentaketide intermediate analogue indicated a 5+3 assembly by the HR PKS Cla2 and the NR PKS Cla3 during cladosporin biosynthesis. Advanced-intermediate analogues were synthesized and incorporated by Cla3 to furnish new cladosporin analogues. A putative lysyl-tRNA synthetase resistance gene was identified in the cladosporin gene cluster. Analysis of the active site emphasizes key structural features thought to be important in resistance to cladosporin. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Evaluating the influence of plant-specific physiological parameterizations on the partitioning of land surface energy fluxes

    Science.gov (United States)

    Sulis, Mauro; Langensiepen, Matthias; Shrestha, Prabhakar; Schickling, Anke; Simmer, Clemens; Kollet, Stefan

    2015-04-01

    Vegetation has a significant influence on the partitioning of radiative forcing, the spatial and temporal variability of soil water and soil temperature. Therefore plant physiological properties play a key role in mediating and amplifying interactions and feedback mechanisms in the soil-vegetation-atmosphere continuum. Because of the direct impact on latent heat fluxes, these properties may also influence weather generating processes, such as the evolution of the atmospheric boundary layer (ABL). In land surface models, plant physiological properties are usually obtained from literature synthesis by unifying several plant/crop species in predefined vegetation classes. In this work, crop-specific physiological characteristics, retrieved from detailed field measurements, are included in the bio-physical parameterization of the Community Land Model (CLM), which is a component of the Terrestrial Systems Modeling Platform (TerrSysMP). The measured set of parameters for two typical European mid-latitudinal crops (sugar beet and winter wheat) is validated using eddy covariance measurements (sensible heat and latent heat) over multiple years from three measurement sites located in the North Rhine-Westphalia region, Germany. We found clear improvements of CLM simulations, when using the crop-specific physiological characteristics of the plants instead of the generic crop type when compared to the measurements. In particular, the increase of latent heat fluxes in conjunction with decreased sensible heat fluxes as simulated by the two new crop-specific parameter sets leads to an improved quantification of the diurnal energy partitioning. These findings are cross-validated using estimates of gross primary production extracted from net ecosystem exchange measurements. This independent analysis reveals that the better agreement between observed and simulated latent heat using the plant-specific physiological properties largely stems from an improved simulation of the

  5. Identification of PaPKS1, a polyketide synthase involved in melanin formation and its use as a genetic tool in Podospora anserina.

    Science.gov (United States)

    Coppin, Evelyne; Silar, Philippe

    2007-08-01

    In the filamentous fungus Podospora anserina, many pigmentation mutations map to the median region of the complex locus '14', called segment '29'. The data presented in this paper show that segment 29 corresponds to a gene encoding a polyketide synthase, designated PaPKS1, and identifies two mutations that completely or partially abolish the activity of the PaPKS1 polypeptide. We present evidence that the P. anserina green pigment is a (DHN)-melanin. Using the powerful genetic system of PaPKS1 cloning, we demonstrate that in P. anserina trans-duplicated sequences are subject to the RIP process as previously demonstrated for the cis-duplicated regions.

  6. Amplification and diversity analysis of keto synthase domains of putative polyketide synthase genes in Aspergillus ochraceus and Aspergillus carbonarius producers of ochratoxin A

    International Nuclear Information System (INIS)

    Atoui, A.; Phong Dao, H.; Mathieu, F.; Lebrihi, A.

    2006-01-01

    The diversity of polyketide synthase (PKS) genes in Aspergillus ochraceus NRRL 3174 and Aspergil- lus carbonarius 2Mu134 has been investigated using different primer pairs previously developed for the ketosynthase (KS) domain of fungal PKSs. Nine different KS domain sequences in A. ochraceus NRRL 3174 as well as five different KS domain sequences in A. carbonarius 2Mu134 have been identified. The identified KS fragments were distributed in five different clusters on the phylogenetic tree, indicating that they most probably represent PKSs responsible for different functions. (author)

  7. Failure cause and failure rate evaluation on pumps of BWR plants in PSA. Hypothesis testing for typical or plant specific failure rate of pumps

    International Nuclear Information System (INIS)

    Sanada, Takahiro; Nakamura, Makoto

    2009-01-01

    In support of domestic nuclear industry effort to gather and analyze failure data of components concerning nuclear power plants, Nuclear Information Archives (NUCIA) are published for useful information to help PSA. This report focuses on NUCIA pertaining to pumps in domestic nuclear power plants, and provides the reliable estimation on failure rate of pumps resulting from failure cause analysis and hypothesis testing of classified and plant specific failure rate of pumps for improving quality in PSA. The classified and plant specific failure rate of pumps are estimated by analyzing individual domestic nuclear power plant's data of 26 Boiling Water Reactors (BWRs) concerning functionally structurally classified pump failures reported from beginning of commercial operation to March 31, 2007. (author)

  8. Characterization of a polyketide synthase in Aspergillus niger whose product is a precursor for both dihydroxynaphthalene (DHN) melanin and naphtho-γ-pyrone.

    Energy Technology Data Exchange (ETDEWEB)

    Chiang, Yi Ming; Meyer, Kristen M; Praseuth, Michael; Baker, Scott E; Bruno, Kenneth S; Wang, Clay C

    2010-12-06

    The genome sequencing of the fungus Aspergillus niger, an industrial workhorse, uncovered a large cache of genes encoding enzymes thought to be involved in the production of secondary metabolites yet to be identified. Identification and structural characterization of many of these predicted secondary metabolites are hampered by their low concentration relative to the known A. niger metabolites such as the naphtho-γ-pyrone family of polyketides. We deleted a nonreducing PKS gene in A. niger strain ATCC 11414, a daughter strain of A. niger ATCC strain 1015 whose genome was sequenced by the DOE Joint Genome Institute. This PKS encoding gene is a predicted ortholog of alb1 from Aspergillus fumigatus which is responsible for production of YWA1, a precursor of fungal DHN melanin. Our results show that the A. niger alb1 PKS is responsible for the production of the polyketide precursor for DHN melanin biosynthesis. Deletion of alb1 elimnates the production of major metabolites, naphtho-γ-pyrones. The generation of an A. niger strain devoid of naphtho-γ-pyrones will greatly facilitate the elucidation of cryptic biosynthetic pathways in this organism.

  9. A Polyketide Synthase Encoded by the Gene An15g07920 Is Involved in the Biosynthesis of Ochratoxin A in Aspergillus niger.

    Science.gov (United States)

    Zhang, Jian; Zhu, Liuyang; Chen, Haoyu; Li, Min; Zhu, Xiaojuan; Gao, Qiang; Wang, Depei; Zhang, Ying

    2016-12-28

    The polyketide synthase gene An15g07920 was known in Aspergillus niger CBS 513.88 as putatively involved in the production of ochratoxin A (OTA). Genome resequencing analysis revealed that the gene An15g07920 is also present in the ochratoxin-producing A. niger strain 1062. Disruption of An15g07920 in A. niger 1062 removed its capacity to biosynthesize ochratoxin β (OTβ), ochratoxin α (OTα), and OTA. These results indicate that the polyketide synthase encoded by An15g07920 is a crucial player in the biosynthesis of OTA, in the pathway prior to the phenylalanine ligation step. The gene An15g07920 reached its maximum transcription level before OTA accumulation reached its highest level, confirming that gene transcription precedes OTA production. These findings will not only help explain the mechanism of OTA production in A. niger but also provide necessary information for the development of effective diagnostic, preventive, and control strategies to reduce the risk of OTA contamination in foods.

  10. Role of Modular Polyketide Synthases in the Production of Polyether Ladder Compounds in Ciguatoxin-Producing Gambierdiscus polynesiensis and G. excentricus (Dinophyceae).

    Science.gov (United States)

    Kohli, Gurjeet S; Campbell, Katrina; John, Uwe; Smith, Kirsty F; Fraga, Santiago; Rhodes, Lesley L; Murray, Shauna A

    2017-09-01

    Gambierdiscus, a benthic dinoflagellate, produces ciguatoxins that cause the human illness Ciguatera. Ciguatoxins are polyether ladder compounds that have a polyketide origin, indicating that polyketide synthases (PKS) are involved in their production. We sequenced transcriptomes of Gambierdiscus excentricus and Gambierdiscus polynesiensis and found 264 contigs encoding single domain ketoacyl synthases (KS; G. excentricus: 106, G. polynesiensis: 143) and ketoreductases (KR; G. excentricus: 7, G. polynesiensis: 8) with sequence similarity to type I PKSs, as reported in other dinoflagellates. In addition, 24 contigs (G. excentricus: 3, G. polynesiensis: 21) encoding multiple PKS domains (forming typical type I PKSs modules) were found. The proposed structure produced by one of these megasynthases resembles a partial carbon backbone of a polyether ladder compound. Seventeen contigs encoding single domain KS, KR, s-malonyltransacylase, dehydratase and enoyl reductase with sequence similarity to type II fatty acid synthases (FAS) in plants were found. Type I PKS and type II FAS genes were distinguished based on the arrangement of domains on the contigs and their sequence similarity and phylogenetic clustering with known PKS/FAS genes in other organisms. This differentiation of PKS and FAS pathways in Gambierdiscus is important, as it will facilitate approaches to investigating toxin biosynthesis pathways in dinoflagellates. © 2017 The Author(s) Journal of Eukaryotic Microbiology © 2017 International Society of Protistologists.

  11. Evolution of Chemical Diversity in a Group of Non-Reduced Polyketide Gene Clusters: Using Phylogenetics to Inform the Search for Novel Fungal Natural Products

    Directory of Open Access Journals (Sweden)

    Kurt Throckmorton

    2015-09-01

    Full Text Available Fungal polyketides are a diverse class of natural products, or secondary metabolites (SMs, with a wide range of bioactivities often associated with toxicity. Here, we focus on a group of non-reducing polyketide synthases (NR-PKSs in the fungal phylum Ascomycota that lack a thioesterase domain for product release, group V. Although widespread in ascomycete taxa, this group of NR-PKSs is notably absent in the mycotoxigenic genus Fusarium and, surprisingly, found in genera not known for their secondary metabolite production (e.g., the mycorrhizal genus Oidiodendron, the powdery mildew genus Blumeria, and the causative agent of white-nose syndrome in bats, Pseudogymnoascus destructans. This group of NR-PKSs, in association with the other enzymes encoded by their gene clusters, produces a variety of different chemical classes including naphthacenediones, anthraquinones, benzophenones, grisandienes, and diphenyl ethers. We discuss the modification of and transitions between these chemical classes, the requisite enzymes, and the evolution of the SM gene clusters that encode them. Integrating this information, we predict the likely products of related but uncharacterized SM clusters, and we speculate upon the utility of these classes of SMs as virulence factors or chemical defenses to various plant, animal, and insect pathogens, as well as mutualistic fungi.

  12. Comprehensive in Vitro Analysis of Acyltransferase Domain Exchanges in Modular Polyketide Synthases and Its Application for Short-Chain Ketone Production

    Energy Technology Data Exchange (ETDEWEB)

    Yuzawa, Satoshi [Univ. of California, Berkeley, CA (United States); Deng, Kai [Joint BioEnergy Inst. (JBEI), Emeryville, CA (United States); Sandia National Lab. (SNL-CA), Livermore, CA (United States); Wang, George [Joint BioEnergy Inst. (JBEI), Emeryville, CA (United States); Baidoo, Edward E. K. [Joint BioEnergy Inst. (JBEI), Emeryville, CA (United States); Northen, Trent R. [Joint BioEnergy Inst. (JBEI), Emeryville, CA (United States); Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Adams, Paul D. [Joint BioEnergy Inst. (JBEI), Emeryville, CA (United States); Univ. of California, Berkeley, CA (United States); Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Katz, Leonard [Univ. of California, Berkeley, CA (United States); Synthetic Biology Research Center, Emeryville, CA (United States); Keasling, Jay D. [Univ. of California, Berkeley, CA (United States); Joint BioEnergy Inst. (JBEI), Emeryville, CA (United States); Synthetic Biology Research Center, Emeryville, CA (United States); Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2016-08-22

    Type I modular polyketide synthases (PKSs) are polymerases that utilize acyl-CoAs as substrates. Each polyketide elongation reaction is catalyzed by a set of protein domains called a module. Each module usually contains an acyltransferase (AT) domain, which determines the specific acyl-CoA incorporated into each condensation reaction. Although a successful exchange of individual AT domains can lead to the biosynthesis of a large variety of novel compounds, hybrid PKS modules often show significantly decreased activities. Using monomodular PKSs as models, we have systematically analyzed in this paper the segments of AT domains and associated linkers in AT exchanges in vitro and have identified the boundaries within a module that can be used to exchange AT domains while maintaining protein stability and enzyme activity. Importantly, the optimized domain boundary is highly conserved, which facilitates AT domain replacements in most type I PKS modules. To further demonstrate the utility of the optimized AT domain boundary, we have constructed hybrid PKSs to produce industrially important short-chain ketones. Our in vitro and in vivo analysis demonstrated production of predicted ketones without significant loss of activities of the hybrid enzymes. Finally, these results greatly enhance the mechanistic understanding of PKS modules and prove the benefit of using engineered PKSs as a synthetic biology tool for chemical production.

  13. Postharvest stilbenes and flavonoids enrichment of table grape cv Redglobe (Vitis vinifera L.) as affected by interactive UV-C exposure and storage conditions.

    Science.gov (United States)

    Crupi, Pasquale; Pichierri, Arianna; Basile, Teodora; Antonacci, Donato

    2013-11-15

    Flavonoids and stilbenes are secondary metabolites produced in plants that can play an important health-promoting role. The biosynthesis of these compounds generally increases as a response to biotic or abiotic stress; therefore, in order to achieve as high phenolic accumulation as possible, the interactive effects of storage conditions (temperature and time) and UV-C radiation on polyphenols content in postharvest Redglobe table grape variety were investigated. During a storage time longer than 48h, both cold storage (4°C) and UV-C exposure of almost 3min (2.4kJm(-2)) positively enhanced the content of cis- and trans-piceid (34 and 90μgg(-1) of skin, respectively) together with quercetin-3-O-galactoside and quercetin-3-O-glucoside (15 and 140μgg(-1) of skin, respectively) up to three fold respect to control grape samples. Conversely, catechin was not significantly affected by irradiation and storage treatments. With regard anthocyanins, the highest concentrations of cyanidin-3-O-glucoside and peonidin-3-Oglucoside were observed in Redglobe, stored at both room temperature and 4°C, after 5min (4.1kJm(-2)) of UV-C treatment and 24h of storage. Gathered findings showed that combined postharvest treatments can lead to possible "functional" grapes, within normal conditions of market commercialization, responding to the rising consumers demand to have foods that support and promote health. Copyright © 2013. Published by Elsevier Ltd.

  14. Photoinduced Ultrafast Intramolecular Excited-State Energy Transfer in the Silylene-Bridged Biphenyl and Stilbene (SBS) System: A Nonadiabatic Dynamics Point of View.

    Science.gov (United States)

    Wang, Jun; Huang, Jing; Du, Likai; Lan, Zhenggang

    2015-07-09

    The photoinduced intramolecular excited-state energy-transfer (EET) process in conjugated polymers has received a great deal of research interest because of its important role in the light harvesting and energy transport of organic photovoltaic materials in photoelectric devices. In this work, the silylene-bridged biphenyl and stilbene (SBS) system was chosen as a simplified model system to obtain physical insight into the photoinduced intramolecular energy transfer between the different building units of the SBS copolymer. In the SBS system, the vinylbiphenyl and vinylstilbene moieties serve as the donor (D) unit and the acceptor (A) unit, respectively. The ultrafast excited-state dynamics of the SBS system was investigated from the point of view of nonadiabatic dynamics with the surface-hopping method at the TDDFT level. The first two excited states (S1 and S2) are characterized by local excitations at the acceptor (vinylstilbene) and donor (vinylbiphenyl) units, respectively. Ultrafast S2-S1 decay is responsible for the intramolecular D-A excitonic energy transfer. The geometric distortion of the D moiety play an essential role in this EET process, whereas the A moiety remains unchanged during the nonadiabatic dynamics simulation. The present work provides a direct dynamical approach to understand the ultrafast intramolecular energy-transfer dynamics in SBS copolymers and other similar organic photovoltaic copolymers.

  15. Ab initio Investigation to Model Stilbene Photo-Physical Properties by Combining CC2 Topological Investigation and CASPT2 Energy Corrections

    International Nuclear Information System (INIS)

    Tomasello, Gaia; Altoe, Piero; Garavelli, Marco; Orlandi, Giorgio

    2007-01-01

    Stilbene photoexcitation and consequent decay to the ground state has been investigated by mapping the Minimum Energy Path (MEP) from S 1 spectroscopic state triggering an almost barrierless reaction pathway to an S 1 /S 0 degenerate region. The particular influence of the σ-π excitation on the S 1 wave function, dominated by a π→π* character, reveals how the non-dynamical correlation energy was important to correctly describe the excited state behaviour and the topological aspect of its potential energy surface. Several strategies of calculations, by using CASSCF//CASPT2 methods, were performed trying to improve the photochemical description nowadays known. Both symmetry and non symmetry preserving computations were performed; systematically was concluded that, because of the limit of CASSCF description enables only to introduce the correlation effect such as the ones due to σ-π excitations, CASSCF and CASPT2 topologies are probably often not in agreement. Thus CC2 methodology was adopted o optimize the S 1 geometries and obtain reasonable structures for the minima. Two S 1 /S 0 accessible conical intersections featured by pyramidalized carbons were located on the first excited state explaining the ultrafast radiationless decay to the ground state and the photoproducts observed within the timescale of ps

  16. Heterologous Gene Expression of N-Terminally Truncated Variants of LipPks1 Suggests a Functionally Critical Structural Motif in the N-terminus of Modular Polyketide Synthase

    DEFF Research Database (Denmark)

    Yuzawa, Satoshi; Bailey, Constance B.; Fujii, Tatsu A.

    2017-01-01

    Streptomyces-derived, Well-characterized modular, polyketide synthase (PKS). Using this enzyme as a model, we experimentally investigated the effects of alternative TSSs using a heterologous host, Streptomyces venezuelae. One of the TSSs employed boosted the protein level by 59-fold and the product yield by 23...

  17. Uncovering the formation and selection of benzylmalonyl-CoA from the biosynthesis of splenocin and enterocin reveals a versatile way to introduce amino acids into polyketide carbon scaffolds.

    Science.gov (United States)

    Chang, Chenchen; Huang, Rong; Yan, Yan; Ma, Hongmin; Dai, Zheng; Zhang, Benying; Deng, Zixin; Liu, Wen; Qu, Xudong

    2015-04-01

    Selective modification of carbon scaffolds via biosynthetic engineering is important for polyketide structural diversification. Yet, this scope is currently restricted to simple aliphatic groups due to (1) limited variety of CoA-linked extender units, which lack aromatic structures and chemical reactivity, and (2) narrow acyltransferase (AT) specificity, which is limited to aliphatic CoA-linked extender units. In this report, we uncovered and characterized the first aromatic CoA-linked extender unit benzylmalonyl-CoA from the biosynthetic pathways of splenocin and enterocin in Streptomyces sp. CNQ431. Its synthesis employs a deamination/reductive carboxylation strategy to convert phenylalanine into benzylmalonyl-CoA, providing a link between amino acid and CoA-linked extender unit synthesis. By characterization of its selection, we further validated that AT domains of splenocin, and antimycin polyketide synthases are able to select this extender unit to introduce the phenyl group into their dilactone scaffolds. The biosynthetic machinery involved in the formation of this extender unit is highly versatile and can be potentially tailored for tyrosine, histidine and aspartic acid. The disclosed aromatic extender unit, amino acid-oriented synthetic pathway, and aromatic-selective AT domains provides a systematic breakthrough toward current knowledge of polyketide extender unit formation and selection, and also opens a route for further engineering of polyketide carbon scaffolds using amino acids.

  18. Polyketide synthase from Fusarium

    DEFF Research Database (Denmark)

    Kvesel, Kasper; Wimmer, Reinhard; Sørensen, Jens Laurids

    described, even fewer from fungi and none from Fusarium species. Multidomain proteins can be quite challenging to work with, which is why the project intends to solve the 3D-structures of single domains of PKS’s. In this project, the plan is to clone, express and purify the Acyl-carrier protein (ACP) domain...... from PKS6 in Fusarium graminearum for structural analysis....

  19. Synthesis and structural and photoswitchable properties of novel chiral host molecules: axis chiral 2,2'-dihydroxy-1,1'-binaphthyl-appended stiff-stilbene.

    Science.gov (United States)

    Shimasaki, Toshiaki; Kato, Shin-ichiro; Ideta, Keiko; Goto, Kenta; Shinmyozu, Teruo

    2007-02-16

    Novel photoswitchable chiral hosts having an axis chiral 2,2'-dihydroxy-1,1'-binaphthyl (BINOL)-appended stiff-stilbene, trans-(R,R)- and -(S,S)-1, were synthesized by palladium-catalyzed Suzuki-Miyaura coupling and low-valence titanium-catalyzed McMurry coupling as key steps, and they were fully characterized by various NMR spectral techniques. The enantiomers of trans-1 showed almost complete mirror images in the CD spectra, where two split Cotton effects (exciton coupling) were observed in the beta-transitions of the naphthyl chromophore at 222 and 235 nm, but no Cotton effect was observed in the stiff-stilbene chromophore at 365 nm. The structures of (R)-10 and trans-(R,R)-1 were confirmed by X-ray structural analysis. The optimized structure of cis-1 by MO calculations has a wide chiral cavity of 7-8 A in diameter, whereas trans-1 cannot form an intramolecular cavity based on the X-ray data. Irradiation of (R,R)-trans-1 with black light (lambda = 365 nm) in CH3CN or benzene at 23 degrees C led to the conversion to the corresponding cis-isomer, as was monitored by 1H NMR, UV-vis, and CD spectra. At the photostationary state, the cis-1/trans-1 ratio was 86/14 in benzene or 75/25 in CH3CN. On the other hand, irradiation of the cis-1/trans-1 (75/25) mixture in CH3CN with an ultra-high-pressure Hg lamp at 23 degrees C (lambda = 410 nm) led to the photostationary state, where the cis-1/trans-1 ratio was estimated to be 9/91 on the basis of the 1H NMR spectra. The cis-trans and trans-cis interconversions could be repeated 10 times without decomposition of the C=C double bond. Thus, a new type of photoswitchable molecule has been developed, and trans-1 and cis-1 were quite durable under irradiation conditions. The guest binding properties of the BINOL moieties of trans- and cis-(R,R)-1 with F-, Cl-, and H2PO4- were examined by 1H NMR titration in CDCl3. Similar interaction with F- and Cl- was observed in trans-1 (host/guest = 1/1, Kassoc = (1.0 +/- 0.13) x 103 for F

  20. [Expression of enterotoxigenic Bacteroides fragilis and polyketide synthase gene-expressing Escherichia coli in colorectal adenoma patients].

    Science.gov (United States)

    Xie, L L; Wu, N; Zhu, Y M; Qiu, X Y; Chen, G D; Zhang, L M; Liu, Y L

    2016-03-29

    To investigate the distribution of various bacteria in adenoma tissue of colorectal adenoma (T/CRA), normal colonic mucosa tissue adjacent to the adenoma (N/CRA), and healthy colonic mucosa tissue (N/H) by comparing the number of total bacteria, Bacteroides fragilis (BF), enterotoxigenic Bacteroides fragilis (ETBF), polyketide synthase (pks) gene-expressing Escherichia coli(E.coli)(pks(+) E. coli)among the above 3 types of tissues. A total of 36 patients diagnosed with colorectal adenoma by colonoscopy and pathology in Department of Gastroenterology, Peking University People's Hospital from September 2011 to September 2013 were selected into this study. T/CRA and N/CRA tissues from the 36 patients and N/H tissues from 18 healthy controls were collected for DNA extraction. The number of total bacteria, BF, ETBF, pks(+) E. coli was detected by quantitative real time PCR, and their correlation with colorectal adenoma was analyzed. (1) The number of total bacteria decreased gradually from N/H, N/CRA, to T/CRA, with the median values being 3.18×10(8,) 1.57×10(8,) and 7.91×10(7) copies/g, respectively, and with significant difference among the three groups and between each two groups (all PCRA, to T/CRA, the median values being 6.03×10(5,) 4.28×10(4,) and 5.48×10(3) copies/g, respectively, and with significant difference among the three groups and between each two groups (all PCRA, to T/CRA, the relative expression being 1.73±0.30, 6.15±1.52, and 8.54±1.80, respectively. Significant difference was found between the T/CRA and N/H tissue (P=0.003), but not between any other two groups. (4) The expression of clbB in pks(+) E.coli was highest in T/CRA colonic tissue (2.96±0.28), followed by the N/CRA (2.79±0.19) and N/H tissue (1.06±0.08). Significant difference was found between T/CRA and N/H tissues, as well as between N/CRA and N/H tissues (both PCRA and N/CRA tissues. The number of total bacteria is markedly reduced in the colonic mucosa of CRA patients

  1. Multiple anti-inflammatory and anti-atherosclerotic properties of red wine polyphenolic extracts: differential role of hydroxycinnamic acids, flavonols and stilbenes on endothelial inflammatory gene expression.

    Science.gov (United States)

    Calabriso, Nadia; Scoditti, Egeria; Massaro, Marika; Pellegrino, Mariangela; Storelli, Carlo; Ingrosso, Ilaria; Giovinazzo, Giovanna; Carluccio, Maria Annunziata

    2016-03-01

    The aim of the study was to evaluate the vascular anti-inflammatory effects of polyphenolic extracts from two typical South Italy red wines, the specific contribution of individual polyphenols and the underlying mechanisms of action. Human endothelial cells were incubated with increasing concentrations (1-50 μg/mL) of Primitivo and Negroamaro polyphenolic extracts (PWPE and NWPE, respectively) or pure polyphenols (1-25 μmol/L), including hydroxycinnamic acids (p-coumaric, caffeic and caftaric acids), flavonols (kaempferol, quercetin, myricetin) or stilbenes (trans-resveratrol, trans-piceid) before stimulation with lipopolysaccharide. Through multiple assays, we analyzed the endothelial-monocyte adhesion, the endothelial expression of adhesion molecules (ICAM-1, VCAM-1 and E-Selectin), monocyte chemoattractant protein-1 (MCP-1) and macrophage colony-stimulating factor (M-CSF), as well as ROS intracellular levels and the activation of NF-κB and AP-1. Both PWPE and NWPE, already at 1 μg/mL, inhibited monocyte adhesion to stimulated endothelial cells, a key event in triggering vascular inflammation. They down-regulated the expression of adhesion molecules, ICAM-1, VCAM-1, E-Selectin, as well as MCP-1 and M-CSF, at mRNA and protein levels. All polyphenols reduced intracellular ROS, and everything, except caftaric acid, inhibited the endothelial expression of adhesion molecules and MCP-1, although with different potency. Flavonols and resveratrol significantly reduced also the endothelial expression and release of M-CSF. The decrease in endothelial inflammatory gene expression was related to the inhibition of NF-κB and AP-1 activation but not to intracellular oxidative stress. This study showed multiple anti-inflammatory and anti-atherosclerotic properties of red wine polyphenolic extracts and indentified specific bioactive polyphenols which could counteract inflammatory diseases including atherosclerosis.

  2. Efficient {pi} electrons delocalization in prospective push-pull non-linear optical chromophore 4-[N,N-dimethylamino]-4'-nitro stilbene (DANS): A vibrational spectroscopic study

    Energy Technology Data Exchange (ETDEWEB)

    Vijayakumar, T.; Hubert Joe, I. [Centre for Molecular and Biophysics Research, Department of Physics, Mar Ivanios College, Thiruvananthapuram 695 015, Kerala (India); Reghunadhan Nair, C.P. [Polymers and Special Chemicals Division, Vikram Sarabhai Space Centre, Thiruvananthapuram 695 022, Kerala (India); Jayakumar, V.S. [Centre for Molecular and Biophysics Research, Department of Physics, Mar Ivanios College, Thiruvananthapuram 695 015, Kerala (India)], E-mail: vsjk@vsnl.net

    2008-01-22

    A comprehensive investigation on the intramolecular charge transfer (ICT) of an efficient {pi}-conjugated potential push-pull NLO chromophore, 4-[N,N-dimethylamino]-4'-nitro stilbene (DANS), from a strong electron-donor group (dimethylamino-N(CH{sub 3}){sub 2}) to a strong electron-acceptor group (nitro-NO{sub 2}) through the {pi}-conjugated bridge (trans-stilbene) has been carried out from their vibrational spectra. The NIR FT-Raman and FT-IR spectra supported by the density functional theory (DFT) quantum chemical computations have been employed to analyze the effects of intramolecular charge transfer on the geometries and the vibrational modes contributing to the linear electro-optic effect of the organic NLO material. It has been observed that the changes in the endocyclic and exocyclic angles result from the charge-transfer interaction of the phenyl ring and the amino group in the electron-donor side of the NLO chromophore. The strongest vibrational modes contributing to the electro-optic effect have been identified and examined from the concurrent IR and Raman activation of {nu}(C=C/C-C) mode, ring C=C stretching modes, in-plane deformation modes, nitro modes and the umbrella mode of methyl groups. Furthermore, the splitting of the vinyl stretching modes and the electronic effects such as hyperconjugation and backdonation on the methyl hydrogen atoms causing the decrease of stretching frequencies and infrared intensities have also been analyzed in detail. The effect of frontier orbitals transition of electron density transfer and the influence of planarity between the phenyl rings of the stilbene moiety on the first hyperpolarizability have also been discussed.

  3. The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes

    DEFF Research Database (Denmark)

    Schneider, Lizette Marais; Adamski, Nikolai M.; Christensen, Caspar Elo

    2016-01-01

    identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified...... alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed...... five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase...

  4. An Sfp-type PPTase and associated polyketide and nonribosomal peptide synthases in Agrobacterium vitis are essential for induction of tobacco hypersensitive response and grape necrosis.

    Science.gov (United States)

    Zheng, Desen; Burr, Thomas J

    2013-07-01

    An Sfp-type phosphopantetheinyl transferase (PPTase) encoding gene F-avi5813 in Agrobacterium vitis F2/5 was found to be required for the induction of a tobacco hypersensitive response (HR) and grape necrosis. Sfp-type PPTases are post-translation modification enzymes that activate acyl-carry protein (ACP) domains in polyketide synthases (PKS) and peptidyl-carrier protein (PCP) domains of nonribosomal peptide synthases (NRPS). Mutagenesis of PKS and NRPS genes in A. vitis led to the identification of a PKS gene (F-avi4330) and NRPS gene (F-avi3342) that are both required for HR and necrosis. The gene immediately downstream of F-avi4330 (F-avi4329) encoding a predicted aminotransferase was also found to be required for HR and necrosis. Regulation of F-avi4330 and F-avi3342 by quorum-sensing genes avhR, aviR, and avsR and by a lysR-type regulator, lhnR, was investigated. It was determined that F-avi4330 expression is positively regulated by avhR, aviR, and lhnR and negatively regulated by avsR. F-avi3342 was found to be positively regulated by avhR, aviR, and avsR and negatively regulated by lhnR. Our results suggest that a putative hybrid peptide-polyketide metabolite synthesized by F-avi4330 and F-avi3342 is associated with induction of tobacco HR and grape necrosis. This is the first report that demonstrates that NRPS and PKS play essential roles in conferring the unique ability of A. vitis to elicit a non-host-specific HR and host-specific necrosis.

  5. Isolation and Assessment of the in Vitro Anti-Tumor Activity of Smenothiazole A and B, Chlorinated Thiazole-Containing Peptide/Polyketides from the Caribbean Sponge, Smenospongia aurea

    Directory of Open Access Journals (Sweden)

    Germana Esposito

    2015-01-01

    Full Text Available The study of the secondary metabolites contained in the organic extract of Caribbean sponge Smenospongia aurea led to the isolation of smenothiazole A (3 and B (4, hybrid peptide/polyketide compounds. Assays performed using four solid tumor cell lines showed that smenothiazoles exert a potent cytotoxic activity at nanomolar levels, with selectivity over ovarian cancer cells and a pro-apoptotic mechanism.

  6. First discovery of two polyketide synthase genes for mitorubrinic acid and mitorubrinol yellow pigment biosynthesis and implications in virulence of Penicillium marneffei.

    Directory of Open Access Journals (Sweden)

    Patrick C Y Woo

    Full Text Available BACKGROUND: The genome of P. marneffei, the most important thermal dimorphic fungus causing respiratory, skin and systemic mycosis in China and Southeast Asia, possesses 23 polyketide synthase (PKS genes and 2 polyketide synthase nonribosomal peptide synthase hybrid (PKS-NRPS genes, which is of high diversity compared to other thermal dimorphic pathogenic fungi. We hypothesized that the yellow pigment in the mold form of P. marneffei could also be synthesized by one or more PKS genes. METHODOLOGY/PRINCIPAL FINDINGS: All 23 PKS and 2 PKS-NRPS genes of P. marneffei were systematically knocked down. A loss of the yellow pigment was observed in the mold form of the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants. Sequence analysis showed that PKS11 and PKS12 are fungal non-reducing PKSs. Ultra high performance liquid chromatography-photodiode array detector/electrospray ionization-quadruple time of flight-mass spectrometry (MS and MS/MS analysis of the culture filtrates of wild type P. marneffei and the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants showed that the yellow pigment is composed of mitorubrinic acid and mitorubrinol. The survival of mice challenged with the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants was significantly better than those challenged with wild type P. marneffei (P<0.05. There was also statistically significant decrease in survival of pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants compared to wild type P. marneffei in both J774 and THP1 macrophages (P<0.05. CONCLUSIONS/SIGNIFICANCE: The yellow pigment of the mold form of P. marneffei is composed of mitorubrinol and mitorubrinic acid. This represents the first discovery of PKS genes responsible for mitorubrinol and mitorubrinic acid biosynthesis. pks12 and pks11 are probably responsible for sequential use in the biosynthesis of mitorubrinol and mitorubrinic acid

  7. Advanced methods for a probabilistic safety analysis of fires. Development of advanced methods for performing as far as possible realistic plant specific fire risk analysis (fire PSA)

    International Nuclear Information System (INIS)

    Hofer, E.; Roewekamp, M.; Tuerschmann, M.

    2003-07-01

    In the frame of the research project RS 1112 'Development of Methods for a Recent Probabilistic Safety Analysis, Particularly Level 2' funded by the German Federal Ministry of Economics and Technology (BMWi), advanced methods, in particular for performing as far as possible realistic plant specific fire risk analyses (fire PSA), should be developed. The present Technical Report gives an overview on the methodologies developed in this context for assessing the fire hazard. In the context of developing advanced methodologies for fire PSA, a probabilistic dynamics analysis with a fire simulation code including an uncertainty and sensitivity study has been performed for an exemplary scenario of a cable fire induced by an electric cabinet inside the containment of a modern Konvoi type German nuclear power plant taking into consideration the effects of fire detection and fire extinguishing means. With the present study, it was possible for the first time to determine the probabilities of specified fire effects from a class of fire events by means of probabilistic dynamics supplemented by uncertainty and sensitivity analyses. The analysis applies a deterministic dynamics model, consisting of a dynamic fire simulation code and a model of countermeasures, considering effects of the stochastics (so-called aleatory uncertainties) as well as uncertainties in the state of knowledge (so-called epistemic uncertainties). By this means, probability assessments including uncertainties are provided to be used within the PSA. (orig.) [de

  8. Risk-based technical specifications: Development and application of an approach to the generation of a plant specific real-time risk model

    International Nuclear Information System (INIS)

    Puglia, B.; Gallagher, D.; Amico, P.; Atefi, B.

    1992-10-01

    This report describes a process developed to convert an existing PRA into a model amenable to real time, risk-based technical specification calculations. In earlier studies (culminating in NUREG/CR-5742), several risk-based approaches to technical specification were evaluated. A real-time approach using a plant specific PRA capable of modeling plant configurations as they change was identified as the most comprehensive approach to control plant risk. A master fault tree logic model representative of-all of the core damage sequences was developed. Portions of the system fault trees were modularized and supercomponents comprised of component failures with similar effects were developed to reduce the size of the model and, quantification times. Modifications to the master fault tree logic were made to properly model the effect of maintenance and recovery actions. Fault trees representing several actuation systems not modeled in detail in the existing PRA were added to the master fault tree logic. This process was applied to the Surry NUREG-1150 Level 1 PRA. The master logic mode was confirmed. The model was then used to evaluate frequency associated with several plant configurations using the IRRAS code. For all cases analyzed computational time was less than three minutes. This document Volume 2, contains appendices A, B, and C. These provide, respectively: Surry Technical Specifications Model Database, Surry Technical Specifications Model, and a list of supercomponents used in the Surry Technical Specifications Model

  9. Role of the plant-specific endoplasmic reticulum stress-inducible gene TIN1 in the formation of pollen surface structure in Arabidopsis thaliana

    KAUST Repository

    Iwata, Yuji; Nishino, Tsuneyo; Iwano, Megumi; Takayama, Seiji; Koizumi, Nozomu

    2012-01-01

    Accumulation of unfolded proteins in the endoplasmic reticulum (ER) of eukaryotic cells triggers the transcriptional activation of ER-resident molecular chaperones and folding enzymes to maintain cellular homeostasis. This process is known as the ER stress response or the unfolded protein response. We have identified tunicamycin induced 1 (TIN1), a plant-specific ER stress-inducible Arabidopsis thaliana gene. The TIN1 protein is localized in the ER; however, its molecular function has yet to be clarified. In this study, we performed functional analysis of TIN1 in planta. RT-PCR analysis showed that TIN1 is highly expressed in pollen. Analysis using the β-glucuronidase reporter gene demonstrated that the TIN1 promoter is active throughout pollen development, peaking at the time of flowering and in an ovule of an open flower. Although a T-DNA insertion mutant of TIN1 grows normally under ambient laboratory conditions, abnormal pollen surface morphology was observed under a scanning electron microscope. Based on the current and previous observations, a possible physiological function of TIN1 during pollen development is discussed. © 2012 The Japanese Society for Plant Cell and Molecular Biology.

  10. Polyketide family of novel antibacterial 7-O-methyl-5'-hydroxy-3'-heptenoate-macrolactin from seaweed-associated Bacillus subtilis MTCC 10403.

    Science.gov (United States)

    Chakraborty, Kajal; Thilakan, Bini; Raola, Vamshi Krishna

    2014-12-17

    Seaweed-associated heterotrophic bacterial communities were screened to isolate potentially useful antimicrobial strains, which were characterized by phylogenetic analysis. The bacteria were screened for the presence of metabolite genes involved in natural product biosynthetic pathway, and the structural properties of secondary metabolites were correlated with the genes. Bioactivity-guided isolation of polyene antibiotic 7-O-methyl-5'-hydroxy-3'-heptenoate-macrolactin from Bacillus subtilis MTCC10403 associated with seaweed Anthophycus longifolius using mass spectrometry and extensive 2D-NMR studies was carried out. The newly isolated macrolactin compound is a bactericidal antibiotic with broad spectrum activity against human opportunistic clinical pathogens. The biosynthetic pathway of 7-O-methyl-5'-hydroxy-3'-heptenoate-macrolactin by means of a stepwise, decarboxylative condensation pathway established the PKS-assisted biosynthesis of the parent macrolactin and the side-chain 5-hydroxyhept-3-enoate moiety attached to the macrolactin ring system at C-7. Antimicrobial activity analysis combined with the results of amplifying genes encoding for polyketide synthetase and nonribosomal peptide synthetase showed that seaweed-associated bacteria had broad-spectrum antimicrobial activity. The present work may have an impact on the exploitation of macrolactins for pharmaceutical and biotechnological applications.

  11. Phylogenetic diversity of culturable endophytic fungi in Dongxiang wild rice (Oryza rufipogon Griff), detection of polyketide synthase gene and their antagonistic activity analysis.

    Science.gov (United States)

    Wang, Ya; Gao, Bo Liang; Li, Xi Xi; Zhang, Zhi Bin; Yan, Ri Ming; Yang, Hui Lin; Zhu, Du

    2015-11-01

    The biodiversity of plant endophytic fungi is enormous, numerous competent endophytic fungi are capable of providing different forms of fitness benefits to host plants and also could produce a wide array of bioactive natural products, which make them a largely unexplored source of novel compounds with potential bioactivity. In this study, we provided a first insights into revealing the diversity of culturable endophytic fungi in Dongxiang wild rice (Oryza rufipogon Griff.) from China using rDNA-ITS phylogenetic analysis. Here, the potential of fungi in producing bioactive natural products was estimated based on the beta-ketosynthase detected in the polyketide synthase (PKS) gene cluster and on the bioassay of antagonistic activity against two rice phytopathogens Thanatephorus cucumeris and Xanthomonas oryzae. A total of 229 endophytic fungal strains were validated in 19 genera. Among the 24 representative strains, 13 strains displayedantagonistic activity against the phytopathogens. Furthermore, PKS genes were detected in 9 strains, indicating their potential for synthesising PKS compounds. Our study confirms the phylogenetic diversity of endophytic fungi in O. rufipogon G. and highlights that endophytic fungi are not only promising resources of biocontrol agents against phytopathogens of rice plants, but also of bioactive natural products and defensive secondary metabolites. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  12. Penicyrones A and B, an epimeric pair of α-pyrone-type polyketides produced by the marine-derived Penicillium sp.

    Science.gov (United States)

    Bu, Ying-Yue; Yamazaki, Hiroyuki; Takahashi, Ohgi; Kirikoshi, Ryota; Ukai, Kazuyo; Namikoshi, Michio

    2016-01-01

    Two polyketides containing an α-pyrone unit, named penicyrones A (1) and B (2), were isolated from a culture broth of the marine-derived Penicillium sp. TPU1271 together with nine known compounds: verrucosidin (3), fructigenine A (4), verrucofortine (5), cyclo-(L-Trp-L-Phe) (6), cyclopenol (7), cyclopenin (8), penipratynolene (9), aspterric acid (10) and viridicatol (11). The structures of 1 and 2 were elucidated by analyzing the spectroscopic data of 1, 2 and their O-acetyl derivatives (1a and 2a). Compounds 1 and 2 were epimers of each other at the C-9 position. The absolute configurations of 1 and 2 were assigned on the basis of NOESY data for 1, 2, 1a and 2a, a conformational analysis and the identity of the biogenetic pathway with verrucosidin (3). The planar structure of penicyrones was found in the SciFinder as a compound in the commercial chemical libraries; however, the stereostructure and spectroscopic data were not available. Therefore, this is the first study on the isolation and structure elucidation, including the absolute configurations, of penicyrones A (1) and B (2) as fungal metabolites. Compound 3 exhibited growth inhibitory activity against Mycobacterium smegmatis at 40 μg per disc (inhibition zone of 11 mm). This is the first study to demonstrate that verrucosidin (3) exhibited anti-mycobacterial activity.

  13. Endoperoxide polyketides from a Chinese Plakortis simplex: further evidence of the impact of stereochemistry on antimalarial activity of simple 1,2-dioxanes.

    Science.gov (United States)

    Chianese, Giuseppina; Persico, Marco; Yang, Fan; Lin, Hou-Wen; Guo, Yue-Wei; Basilico, Nicoletta; Parapini, Silvia; Taramelli, Donatella; Taglialatela-Scafati, Orazio; Fattorusso, Caterina

    2014-09-01

    Chemical investigation of the organic extract obtained from the sponge Plakortis simplex collected in the South China Sea afforded five new polyketide endoperoxides (2 and 4-7), along with two known analogues (1 and 3). The stereostructures of these metabolites have been deduced on the basis of spectroscopic analysis and chemical conversion. The isolated endoperoxide derivatives have been tested for their in vitro antimalarial activity against Plasmodium falciparum strains, showing IC50 values in the low micromolar range. The structure-activity relationships were analyzed by means of a detailed computational investigation and rationalized in the light of the mechanism of action proposed for this class of simple antimalarials. The relative orientation of the atoms involved in the putative radical generation and transfer reaction was demonstrated to have a great impact on the antimalarial activity. The resulting 3D pharmacophoric model can be a useful guide to design simple and effective antimalarial lead compounds belonging to the class of 1,2-dioxanes. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Poly[bis(N,N-dimethylformamidetris(μ4-trans-stilbene-4,4′-dicarboxylatotricadmium(II]: a two-dimensional network with an unusual 36 topology

    Directory of Open Access Journals (Sweden)

    Gyungse Park

    2008-07-01

    Full Text Available In the title compound, [Cd3(C16H10O43(C3H7NO2]n or [Cd3(SDA3(DMF2]n (H2SDA is trans-stilbene-4,4′-dicarboxylic acid and DMF is dimethylformamide, the linear dicarboxylate ligand forms a two-dimensionally layered metal–organic network with the relatively uncommon 36 topology. The structure reveals trinuclear secondary building units and has an octahedral geometry at a central metal ion (occupying a overline{3} symmetry site and tetrahedral geometries at two surrounding symmetrically equivalent metal ions lying on a threefold axis. The six-connected planar trinuclear CdII centers, Cd3(O2CR6, play a role as potential nodes in generation of the relatively uncommon 36 topology. The coordinated DMF unit is disordered around the threefold axis.

  15. Genome-wide survey and expression analysis of the plant-specific NAC transcription factor family in soybean during development and dehydration stress.

    Science.gov (United States)

    Le, Dung Tien; Nishiyama, Rie; Watanabe, Yasuko; Mochida, Keiichi; Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo; Tran, Lam-Son Phan

    2011-08-01

    Plant-specific NAC transcription factors (TFs) play important roles in regulating diverse biological processes, including development, senescence, growth, cell division and responses to environmental stress stimuli. Within the soybean genome, we identified 152 full-length GmNAC TFs, including 11 membrane-bound members. In silico analysis of the GmNACs, together with their Arabidopsis and rice counterparts, revealed similar NAC architecture. Next, we explored the soybean Affymetrix array and Illumina transcriptome sequence data to analyse tissue-specific expression profiles of GmNAC genes. Phylogenetic analysis using stress-related NAC TFs from Arabidopsis and rice as seeding sequences identified 58 of the 152 GmNACs as putative stress-responsive genes, including eight previously reported dehydration-responsive GmNACs. We could design gene-specific primers for quantitative real-time PCR verification of 38 out of 50 newly predicted stress-related genes. Twenty-five and six GmNACs were found to be induced and repressed 2-fold or more, respectively, in soybean roots and/or shoots in response to dehydration. GmNAC085, whose amino acid sequence was 39%; identical to that of well-known SNAC1/ONAC2, was the most induced gene upon dehydration, showing 390-fold and 20-fold induction in shoots and roots, respectively. Our systematic analysis has identified excellent tissue-specific and/or dehydration-responsive candidate GmNAC genes for in-depth characterization and future development of improved drought-tolerant transgenic soybeans.

  16. Inhibition of Grape Crown Gall by Agrobacterium vitis F2/5 Requires Two Nonribosomal Peptide Synthetases and One Polyketide Synthase.

    Science.gov (United States)

    Zheng, Desen; Burr, Thomas J

    2016-02-01

    Agrobacterium vitis nontumorigenic strain F2/5 is able to inhibit crown gall disease on grapevines. The mechanism of grape tumor inhibition (GTI) by F2/5 has not been fully determined. In this study, we demonstrate that two nonribosomal peptide synthetase (NRPS) genes (F-avi3342 and F-avi5730) and one polyketide synthase gene (F-avi4330) are required for GTI. Knockout of any one of them resulted in F/25 losing GTI capacity. We previously reported that F-avi3342 and F-avi4330 but not F-avi5730 are required for induction of grape tissue necrosis and tobacco hypersensitive response. F-avi5730 is predicted to encode a single modular NRPS. It is located in a cluster that is homologous to the siderophore vicibactin biosynthesis locus in Rhizobium species. Individual disruption of F-avi5730 and two immediate downstream genes, F-avi5731 and F-avi5732, all resulted in reduced siderophore production; however, only F-avi5730 was found to be required for GTI. Complemented F-avi5730 mutant (ΔF-avi5730(+)) restored a wild-type level of GTI activity. It was determined that, over time, populations of ΔF-avi4330, ΔF-avi3342, and ΔF-avi5730 at inoculated wound sites on grapevine did not differ from those of ΔF-avi5730(+) indicating that loss of GTI was not due to reduced colonization of wound sites by mutants.

  17. Molecular dynamics simulation and binding free energy studies of novel leads belonging to the benzofuran class inhibitors of Mycobacterium tuberculosis Polyketide Synthase 13.

    Science.gov (United States)

    Cruz, Jorddy N; Costa, José F S; Khayat, André S; Kuca, Kamil; Barros, Carlos A L; Neto, A M J C

    2018-05-04

    In this work, the binding mechanism of new Polyketide Synthase 13 (Pks13) inhibitors has been studied through molecular dynamics simulation and free energy calculations. The drug Tam1 and its analogs, belonging to the benzofuran class, were submitted to 100 ns simulations, and according to the results obtained for root mean square deviation, all the simulations converged from approximately 30 ns. For the analysis of backbone flotation, the root mean square fluctuations were plotted for the Cα atoms; analysis revealed that the greatest fluctuation occurred in the residues that are part of the protein lid domain. The binding free energy value (ΔG bind ) obtained for the Tam16 lead molecule was of -51.43 kcal/mol. When comparing this result with the ΔG bind values for the remaining analogs, the drug Tam16 was found to be the highest ranked: this result is in agreement with the experimental results obtained by Aggarwal and collaborators, where it was verified that the IC 50 for Tam16 is the smallest necessary to inhibit the Pks13 (IC 50  = 0.19 μM). The energy decomposition analysis suggested that the residues which most interact with inhibitors are: Ser1636, Tyr1637, Asn1640, Ala1667, Phe1670, and Tyr1674, from which the greatest energy contribution to Phe1670 was particularly notable. For the lead molecule Tam16, a hydrogen bond with the hydroxyl of the phenol not observed in the other analogs induced a more stable molecular structure. Aggarwal and colleagues reported this hydrogen bonding as being responsible for the stability of the molecule, optimizing its physic-chemical, toxicological, and pharmacokinetic properties.

  18. Plant polyketide synthases: a chalcone synthase-type enzyme which performs a condensation reaction with methylmalonyl-CoA in the biosynthesis of C-methylated chalcones.

    Science.gov (United States)

    Schröder, J; Raiber, S; Berger, T; Schmidt, A; Schmidt, J; Soares-Sello, A M; Bardshiri, E; Strack, D; Simpson, T J; Veit, M; Schröder, G

    1998-06-09

    Heterologous screening of a cDNA library from Pinusstrobus seedlings identified clones for two chalcone synthase (CHS) related proteins (PStrCHS1 and PStrCHS2, 87.6% identity). Heterologous expression in Escherichia coli showed that PStrCHS1 performed the typical CHS reaction, that it used starter CoA-esters from the phenylpropanoid pathway, and that it performed three condensation reactions with malonyl-CoA, followed by the ring closure to the chalcone. PstrCHS2 was completely inactive with these starters and also with linear CoA-esters. Activity was detected only with a diketide derivative (N-acetylcysteamine thioester of 3-oxo-5-phenylpent-4-enoic acid) that corresponded to the CHS reaction intermediate postulated after the first condensation reaction. PstrCHS2 performed only one condensation, with 6-styryl-4-hydroxy-2-pyrone derivatives as release products. The enzyme preferred methylmalonyl-CoA against malonyl-CoA, if only methylmalonyl-CoA was available. These properties and a comparison with the CHS from Pinus sylvestris suggested for PstrCHS2 a special function in the biosynthesis of secondary products. In contrast to P. sylvestris, P. strobus contains C-methylated chalcone derivatives, and the methyl group is at the position predicted from a chain extension with methylmalonyl-CoA in the second condensation of the biosynthetic reaction sequence. We propose that PstrCHS2 specifically contributes the condensing reaction with methylmalonyl-CoA to yield a methylated triketide intermediate. We discuss a model that the biosynthesis of C-methylated chalcones represents the simplest example of a modular polyketide synthase.

  19. The Insect Pathogen Serratia marcescens Db10 Uses a Hybrid Non-Ribosomal Peptide Synthetase-Polyketide Synthase to Produce the Antibiotic Althiomycin

    Science.gov (United States)

    Challis, Gregory L.; Stanley-Wall, Nicola R.; Coulthurst, Sarah J.

    2012-01-01

    There is a continuing need to discover new bioactive natural products, such as antibiotics, in genetically-amenable micro-organisms. We observed that the enteric insect pathogen, Serratia marcescens Db10, produced a diffusible compound that inhibited the growth of Bacillis subtilis and Staphyloccocus aureus. Mapping the genetic locus required for this activity revealed a putative natural product biosynthetic gene cluster, further defined to a six-gene operon named alb1–alb6. Bioinformatic analysis of the proteins encoded by alb1–6 predicted a hybrid non-ribosomal peptide synthetase-polyketide synthase (NRPS-PKS) assembly line (Alb4/5/6), tailoring enzymes (Alb2/3) and an export/resistance protein (Alb1), and suggested that the machinery assembled althiomycin or a related molecule. Althiomycin is a ribosome-inhibiting antibiotic whose biosynthetic machinery had been elusive for decades. Chromatographic and spectroscopic analyses confirmed that wild type S. marcescens produced althiomycin and that production was eliminated on disruption of the alb gene cluster. Construction of mutants with in-frame deletions of specific alb genes demonstrated that Alb2–Alb5 were essential for althiomycin production, whereas Alb6 was required for maximal production of the antibiotic. A phosphopantetheinyl transferase enzyme required for althiomycin biosynthesis was also identified. Expression of Alb1, a predicted major facilitator superfamily efflux pump, conferred althiomycin resistance on another, sensitive, strain of S. marcescens. This is the first report of althiomycin production outside of the Myxobacteria or Streptomyces and paves the way for future exploitation of the biosynthetic machinery, since S. marcescens represents a convenient and tractable producing organism. PMID:23028578

  20. The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes.

    Science.gov (United States)

    Schneider, Lizette M; Adamski, Nikolai M; Christensen, Caspar Elo; Stuart, David B; Vautrin, Sonia; Hansson, Mats; Uauy, Cristobal; von Wettstein-Knowles, Penny

    2016-03-09

    Aliphatic compounds on plant surfaces, called epicuticular waxes, are the first line of defense against pathogens and pests, contribute to reducing water loss and determine other important phenotypes. Aliphatics can form crystals affecting light refraction, resulting in a color change and allowing identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase and Cer-u is a P450 enzyme. All were highly expressed in pertinent leaf sheath tissue of wild type. A physical map revealed the order Cer-c, Cer-u, Cer-q with the flanking genes 101kb apart, confirming they are a gene cluster, Cer-cqu. Homology-based modeling suggests that many of the mutant alleles affect overall protein structure or specific active site residues. The rich diversity of identified mutations will facilitate future studies of three key enzymes involved in synthesis of plant apoplast waxes. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  1. Improvement of FK506 Production in Streptomyces tsukubaensis by Genetic Enhancement of the Supply of Unusual Polyketide Extender Units via Utilization of Two Distinct Site-Specific Recombination Systems

    Science.gov (United States)

    Chen, Dandan; Zhang, Qi; Zhang, Qinglin; Cen, Peilin

    2012-01-01

    FK506 is a potent immunosuppressant that has a wide range of clinical applications. Its 23-member macrocyclic scaffold, mainly with a polyketide origin, features two methoxy groups at C-13 and C-15 and one allyl side chain at C-21, due to the region-specific incorporation of two unusual extender units derived from methoxymalonyl-acyl carrier protein (ACP) and allylmalonyl-coenzyme A (CoA), respectively. Whether their intracellular formations can be a bottleneck for FK506 production remains elusive. In this study, we report the improvement of FK506 yield in the producing strain Streptomyces tsukubaensis by the duplication of two sets of pathway-specific genes individually encoding the biosyntheses of these two extender units, thereby providing a promising approach to generate high-FK506-producing strains via genetic manipulation. Taking advantage of the fact that S. tsukubaensis is amenable to two actinophage (ΦC31 and VWB) integrase-mediated recombination systems, we genetically enhanced the biosyntheses of methoxymalonyl-ACP and allylmalonyl-CoA, as indicated by transcriptional analysis. Together with the optimization of glucose supplementation, the maximal FK506 titer eventually increased by approximately 150% in comparison with that of the original strain. The strategy of engineering the biosynthesis of unusual extender units described here may be applicable to improving the production of other polyketide or nonribosomal peptide natural products that contain pathway-specific building blocks. PMID:22582065

  2. Identification of Select Fumonisin Forming Fusarium Species Using PCR Applications of the Polyketide Synthase Gene and its Relationship to Fumonisin Production in vitro

    Directory of Open Access Journals (Sweden)

    Mary Scruggs

    2008-04-01

    Full Text Available A polymerase chain reaction (PCR based diagnostic assay was used to develop markers for detection of Fusarium verticillioides (=F. moniliforme, a fumonisin producing fungus in maize tissues. Species-specific primers were designed based on sequence data from the polyketide synthase (PKS gene (FUM1- previously FUM5 responsible for fumonisin production in fungi. Four sets of oligonucleotide primers were tested for their specificity using 24 strains of F. verticillioides, 10 F. proliferatum, and 12 of other Fusarium species. In addition, 13 species of other fungal genera, from four phyla, were tested as negative controls. Among the four sets, primer set B consistently amplified a 419- bp fragment from the DNA 96% of all F. verticillioides strains and 83% of F. proliferatum. All other fungi tested were negative using primer set B. A total of 38% of the F. verticillioides strains grown on a selective liquid medium produced fumonisin and 92% formed the toxin on standard rice medium. When fumonisin formed in culture, PCR assay using primer set B detected every strain of F. verticillioides, but only amplified 80% of F. proliferatum strains that produced the toxin. PCR detection was consistent at 100 pg/μl concentration of genomic DNA from 4 F. verticillioides strains, but varied at 10 pg/μl. Two duplicate greenhouse tests using artificially inoculated maize plants, had greater levels of F. verticillioides detected after re-evaluting using primer set B than from culturing of the tissues. The molecular protocols described in this study requires only 1 day for completion compared to approximately 10 days for cultural work and morphological determination. In conclusion, conventional PCR assay using primer set B provides a sensitive and accurate detection assay that can be used as a primary or secondary confirmation method for identification and occurrence of F. verticillioides within the maize tissues. However, studies using primer set B for

  3. Genome based analysis of type-I polyketide synthase and nonribosomal peptide synthetase gene clusters in seven strains of five representative Nocardia species.

    Science.gov (United States)

    Komaki, Hisayuki; Ichikawa, Natsuko; Hosoyama, Akira; Takahashi-Nakaguchi, Azusa; Matsuzawa, Tetsuhiro; Suzuki, Ken-ichiro; Fujita, Nobuyuki; Gonoi, Tohru

    2014-04-30

    Actinobacteria of the genus Nocardia usually live in soil or water and play saprophytic roles, but they also opportunistically infect the respiratory system, skin, and other organs of humans and animals. Primarily because of the clinical importance of the strains, some Nocardia genomes have been sequenced, and genome sequences have accumulated. Genome sizes of Nocardia strains are similar to those of Streptomyces strains, the producers of most antibiotics. In the present work, we compared secondary metabolite biosynthesis gene clusters of type-I polyketide synthase (PKS-I) and nonribosomal peptide synthetase (NRPS) among genomes of representative Nocardia species/strains based on domain organization and amino acid sequence homology. Draft genome sequences of Nocardia asteroides NBRC 15531(T), Nocardia otitidiscaviarum IFM 11049, Nocardia brasiliensis NBRC 14402(T), and N. brasiliensis IFM 10847 were read and compared with published complete genome sequences of Nocardia farcinica IFM 10152, Nocardia cyriacigeorgica GUH-2, and N. brasiliensis HUJEG-1. Genome sizes are as follows: N. farcinica, 6.0 Mb; N. cyriacigeorgica, 6.2 Mb; N. asteroides, 7.0 Mb; N. otitidiscaviarum, 7.8 Mb; and N. brasiliensis, 8.9 - 9.4 Mb. Predicted numbers of PKS-I, NRPS, and PKS-I/NRPS hybrid clusters ranged between 4-11, 7-13, and 1-6, respectively, depending on strains, and tended to increase with increasing genome size. Domain and module structures of representative or unique clusters are discussed in the text. We conclude the following: 1) genomes of Nocardia strains carry as many PKS-I and NRPS gene clusters as those of Streptomyces strains, 2) the number of PKS-I and NRPS gene clusters in Nocardia strains varies substantially depending on species, and N. brasiliensis strains carry the largest numbers of clusters among the species studied, 3) the seven Nocardia strains studied in the present work have seven common PKS-I and/or NRPS clusters, some of whose products are yet to be studied

  4. Modeling holo-ACP:DH and holo-ACP:KR complexes of modular polyketide synthases: a docking and molecular dynamics study

    Directory of Open Access Journals (Sweden)

    Anand Swadha

    2012-05-01

    Full Text Available Abstract Background Modular polyketide synthases are multifunctional megasynthases which biosynthesize a variety of secondary metabolites using various combinations of dehydratase (DH, ketoreductase (KR and enoyl-reductase (ER domains. During the catalysis of various reductive steps these domains act on a substrate moiety which is covalently attached to the phosphopantetheine (P-pant group of the holo-Acyl Carrier Protein (holo-ACP domain, thus necessitating the formation of holo-ACP:DH and holo-ACP:KR complexes. Even though three dimensional structures are available for DH, KR and ACP domains, no structures are available for DH or KR domains in complex with ACP or substrate moieties. Since Ser of holo-ACP is covalently attached to a large phosphopantetheine group, obtaining complexes involving holo-ACP by standard protein-protein docking has been a difficult task. Results We have modeled the holo-ACP:DH and holo-ACP:KR complexes for identifying specific residues on DH and KR domains which are involved in interaction with ACP, phosphopantetheine and substrate moiety. A novel combination of protein-protein and protein-ligand docking has been used to first model complexes involving apo-ACP and then dock the phosphopantetheine and substrate moieties using covalent connectivity between ACP, phosphopantetheine and substrate moiety as constraints. The holo-ACP:DH and holo-ACP:KR complexes obtained from docking have been further refined by restraint free explicit solvent MD simulations to incorporate effects of ligand and receptor flexibilities. The results from 50 ns MD simulations reveal that substrate enters into a deep tunnel in DH domain while in case of KR domain the substrate binds a shallow surface exposed cavity. Interestingly, in case of DH domain the predicted binding site overlapped with the binding site in the inhibitor bound crystal structure of FabZ, the DH domain from E.Coli FAS. In case of KR domain, the substrate binding site

  5. Synthesis, structure, and properties of supramolecular charge-transfer complexes between bis(18-crown-6)stilbene and ammonioalkyl derivatives of 4,4'-bipyridine and 2,7-diazapyrene.

    Science.gov (United States)

    Vedernikov, Artem I; Ushakov, Evgeny N; Efremova, Asya A; Kuz'mina, Lyudmila G; Moiseeva, Anna A; Lobova, Natalia A; Churakov, Andrei V; Strelenko, Yuri A; Alfimov, Michael V; Howard, Judith A K; Gromov, Sergey P

    2011-08-19

    4,4'-Bipyridine and 2,7-diazapyrene derivatives (A) having two ammonioalkyl N-substituents were synthesized. The complex formation of these compounds with bis(18-crown-6)stilbene (D) was studied by spectrophotometry, cyclic voltammetry, (1)H NMR spectroscopy, and X-ray diffraction analysis. In MeCN, π-donor D and π-acceptors A form supramolecular 1:1 (D·A) and 2:1 (D·A·D) charge-transfer complexes. The D·A complexes have a pseudocyclic structure as a result of ditopic binding of the ammonium groups to the crown-ether fragments. The better the geometric matching between the components, the higher the stability of the D·A complexes (log K up to 9.39). A key driving force of the D·A·D complex formation is the excessive steric strain in the precursor D·A complexes. The pseudocyclic D·A complexes involving the ammoniopropyl derivative of 4,4'-bipyridine were obtained as single crystals. Crystallization of the related ammonioethyl derivative was accompanied by transition of the D·A complexes to a structure of the (D·A)(m) coordination polymer type.

  6. Synthetic biology of polyketide synthases

    DEFF Research Database (Denmark)

    Yuzawa, Satoshi; Backman, Tyler W.H.; Keasling, Jay D.

    2018-01-01

    ). The modules are composed of enzymatic domains that share sequence and functional similarity across all known PKSs. We have used the nomenclature of synthetic biology to classify the enzymatic domains and modules as parts and devices, respectively, and have generated detailed lists of both. In addition, we...... realize the potential that synthetic biology approaches bring to this class of molecules....

  7. Catalogue of requirements for a plant-specific safety inspection of German nuclear power plants taking into account the Fukushima-I (Japan) events; Anforderungskatalog fuer anlagenbezogene Ueberpruefungen deutscher Kernkraftwerke unter Beruecksichtigung der Ereignisse in Fukushima-I (Japan)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2011-03-30

    The catalogue of requirements for a plant-specific safety inspection of German nuclear power plants taking into account the Fukushima-I (Japan) events worked out by the German RSK (reactor safety commission) includes the following inspection topics: natural events like earth quakes, floods, weather-based consequences and possible superposition; civilization-based events like airplane crash, gas release, reactor accident consequences for neighboring units, terroristic impacts, external attacks on computer-based control systems. Further event-independent assumptions have to be considered: station blackout, long-term emergency power supply requirement, failure of auxiliary cooling water supply, efficacy of preventive measures, aggravating boundary conditions for the performance of emergency measures.

  8. A hybrid non-ribosomal peptide/polyketide synthetase containing fatty-acyl ligase (FAAL synthesizes the β-amino fatty acid lipopeptides puwainaphycins in the Cyanobacterium Cylindrospermum alatosporum.

    Directory of Open Access Journals (Sweden)

    Jan Mareš

    Full Text Available A putative operon encoding the biosynthetic pathway for the cytotoxic cyanobacterial lipopeptides puwainphycins was identified in Cylindrospermum alatosporum. Bioinformatics analysis enabled sequential prediction of puwainaphycin biosynthesis; this process is initiated by the activation of a fatty acid residue via fatty acyl-AMP ligase and continued by a multidomain non-ribosomal peptide synthetase/polyketide synthetase. High-resolution mass spectrometry and nuclear magnetic resonance spectroscopy measurements proved the production of puwainaphycin F/G congeners differing in FA chain length formed by either 3-amino-2-hydroxy-4-methyl dodecanoic acid (4-methyl-Ahdoa or 3-amino-2-hydroxy-4-methyl tetradecanoic acid (4-methyl-Ahtea. Because only one puwainaphycin operon was recovered in the genome, we suggest that the fatty acyl-AMP ligase and one of the amino acid adenylation domains (Asn/Gln show extended substrate specificity. Our results provide the first insight into the biosynthesis of frequently occurring β-amino fatty acid lipopeptides in cyanobacteria, which may facilitate analytical assessment and development of monitoring tools for cytotoxic cyanobacterial lipopeptides.

  9. Genome Sequence of Dickeya solani, a New soft Rot Pathogen of Potato, Suggests its Emergence May Be Related to a Novel Combination of Non-Ribosomal Peptide/Polyketide Synthetase Clusters

    Directory of Open Access Journals (Sweden)

    Linda Garlant

    2013-12-01

    Full Text Available Soft rot Enterobacteria in the genera Pectobacterium and Dickeya cause rotting of many crop plants. A new Dickeya isolate has been suggested to form a separate species, given the name Dickeya solani. This bacterium is spreading fast and replacing the closely related, but less virulent, potato pathogens. The genome of D. solani isolate D s0432-1 shows highest similarity at the nucleotide level and in synteny to D. dadantii strain 3937, but it also contains three large polyketide/fatty acid/non-ribosomal peptide synthetase clusters that are not present in D. dadantii 3937. These gene clusters may be involved in the production of toxic secondary metabolites, such as oocydin and zeamine. Furthermore, the D. solani genome harbors several specific genes that are not present in other Dickeya and Pectobacterium species and that may confer advantages for adaptation to new environments. In conclusion, the fast spreading of D. solani may be related to the acquisition of new properties that affect its interaction with plants and other microbes in the potato ecosystem.

  10. Effects of disrupting the polyketide synthase gene WdPKS1 in Wangiella [Exophiala] dermatitidis on melanin production and resistance to killing by antifungal compounds, enzymatic degradation, and extremes in temperature

    Directory of Open Access Journals (Sweden)

    Mandal Piyali

    2006-06-01

    Full Text Available Abstract Background Wangiella dermatitidis is a human pathogenic fungus that is an etiologic agent of phaeohyphomycosis. W. dermatitidis produces a black pigment that has been identified as a dihydroxynaphthalene melanin and the production of this pigment is associated with its virulence. Cell wall pigmentation in W. dermatitidis depends on the WdPKS1 gene, which encodes a polyketide synthase required for generating the key precursor for dihydroxynaphthalene melanin biosynthesis. Results We analyzed the effects of disrupting WdPKS1 on dihydroxynaphthalene melanin production and resistance to antifungal compounds. Transmission electron microscopy revealed that wdpks1Δ-1 yeast had thinner cell walls that lacked an electron-opaque layer compared to wild-type cells. However, digestion of the wdpks1Δ-1 yeast revealed small black particles that were consistent with a melanin-like compound, because they were acid-resistant, reacted with melanin-binding antibody, and demonstrated a free radical signature by electron spin resonance analysis. Despite lacking the WdPKS1 gene, the mutant yeast were capable of catalyzing the formation of melanin from L-3,4-dihyroxyphenylalanine. The wdpks1Δ-1 cells were significantly more susceptible to killing by voriconazole, amphotericin B, NP-1 [a microbicidal peptide], heat and cold, and lysing enzymes than the heavily melanized parental or complemented strains. Conclusion In summary, W. dermatitidis makes WdPKS-dependent and -independent melanins, and the WdPKS1-dependent deposition of melanin in the cell wall confers protection against antifungal agents and environmental stresses. The biological role of the WdPKS-independent melanin remains unclear.

  11. Inactivation of the β(1,2)-xylosyltransferase and the α(1,3)-fucosyltransferase genes in Nicotiana tabacum BY-2 Cells by a Multiplex CRISPR/Cas9 Strategy Results in Glycoproteins without Plant-Specific Glycans.

    Science.gov (United States)

    Mercx, Sébastien; Smargiasso, Nicolas; Chaumont, François; De Pauw, Edwin; Boutry, Marc; Navarre, Catherine

    2017-01-01

    Plants or plant cells can be used to produce pharmacological glycoproteins such as antibodies or vaccines. However these proteins carry N -glycans with plant-typical residues [β(1,2)-xylose and core α(1,3)-fucose], which can greatly impact the immunogenicity, allergenicity, or activity of the protein. Two enzymes are responsible for the addition of plant-specific glycans: β(1,2)-xylosyltransferase (XylT) and α(1,3)-fucosyltransferase (FucT). Our aim consisted of knocking-out two XylT genes and four FucT genes (12 alleles altogether) in Nicotiana tabacum BY-2 suspension cells using CRISPR/Cas9. Three XylT and six FucT sgRNAs were designed to target conserved regions. After transformation of N. tabacum BY-2 cells with genes coding for sgRNAs, Cas9, and a selectable marker ( bar ), transgenic lines were obtained and their extracellular as well as intracellular protein complements were analyzed by Western blotting using antibodies recognizing β(1,2)-xylose and α(1,3)-fucose. Three lines showed a strong reduction of β(1,2)-xylose and α(1,3)-fucose, while two lines were completely devoid of them, indicating complete gene inactivation. The absence of these carbohydrates was confirmed by mass spectrometry analysis of the extracellular proteins. PCR amplification and sequencing of the targeted region indicated small INDEL and/or deletions between the target sites. The KO lines did not show any particular morphology and grew as the wild-type. One KO line was transformed with genes encoding a human IgG2 antibody. The IgG2 expression level was as high as in a control transformant which had not been glycoengineered. The IgG glycosylation profile determined by mass spectrometry confirmed that no β(1,2)-xylose or α(1,3)-fucose were present on the glycosylation moiety and that the dominant glycoform was the GnGn structure. These data represent an important step toward humanizing the glycosylation of pharmacological proteins expressed in N. tabacum BY-2 cells.

  12. A dominant mutation in mediator of paramutation2, one of three second-largest subunits of a plant-specific RNA polymerase, disrupts multiple siRNA silencing processes.

    Science.gov (United States)

    Sidorenko, Lyudmila; Dorweiler, Jane E; Cigan, A Mark; Arteaga-Vazquez, Mario; Vyas, Meenal; Kermicle, Jerry; Jurcin, Diane; Brzeski, Jan; Cai, Yu; Chandler, Vicki L

    2009-11-01

    Paramutation involves homologous sequence communication that leads to meiotically heritable transcriptional silencing. We demonstrate that mop2 (mediator of paramutation2), which alters paramutation at multiple loci, encodes a gene similar to Arabidopsis NRPD2/E2, the second-largest subunit of plant-specific RNA polymerases IV and V. In Arabidopsis, Pol-IV and Pol-V play major roles in RNA-mediated silencing and a single second-largest subunit is shared between Pol-IV and Pol-V. Maize encodes three second-largest subunit genes: all three genes potentially encode full length proteins with highly conserved polymerase domains, and each are expressed in multiple overlapping tissues. The isolation of a recessive paramutation mutation in mop2 from a forward genetic screen suggests limited or no functional redundancy of these three genes. Potential alternative Pol-IV/Pol-V-like complexes could provide maize with a greater diversification of RNA-mediated transcriptional silencing machinery relative to Arabidopsis. Mop2-1 disrupts paramutation at multiple loci when heterozygous, whereas previously silenced alleles are only up-regulated when Mop2-1 is homozygous. The dramatic reduction in b1 tandem repeat siRNAs, but no disruption of silencing in Mop2-1 heterozygotes, suggests the major role for tandem repeat siRNAs is not to maintain silencing. Instead, we hypothesize the tandem repeat siRNAs mediate the establishment of the heritable silent state-a process fully disrupted in Mop2-1 heterozygotes. The dominant Mop2-1 mutation, which has a single nucleotide change in a domain highly conserved among all polymerases (E. coli to eukaryotes), disrupts both siRNA biogenesis (Pol-IV-like) and potentially processes downstream (Pol-V-like). These results suggest either the wild-type protein is a subunit in both complexes or the dominant mutant protein disrupts both complexes. Dominant mutations in the same domain in E. coli RNA polymerase suggest a model for Mop2-1 dominance

  13. cis-Stilbene and (1 alpha,2 beta,3 alpha)-(2-ethenyl-3-methoxycyclopropyl)benzene as mechanistic probes in the Mn(III)(salen)-catalyzed epoxidation: influence of the oxygen source and the counterion on the diastereoselectivity of the competitive concerted and radical-type oxygen transfer.

    Science.gov (United States)

    Adam, Waldemar; Roschmann, Konrad J; Saha-Möller, Chantu R; Seebach, Dieter

    2002-05-08

    cis-Stilbene (1) has been epoxidized by a set of diverse oxygen donors [OxD], catalyzed by the Mn(III)(salen)X complexes 3 (X = Cl, PF(6)), to afford a mixture of cis- and trans-epoxides 2. The cis/trans ratios range from 29:71 (extensive isomerization) to 92:8, which depends both on the oxygen source [OxD] and on the counterion X of the catalyst. When (1 alpha,2 beta,3 alpha)-(2-ethenyl-3-methoxycyclopropyl)-benzene (4) is used as substrate, a mechanistic probe which differentiates between radical and cationic intermediates, no cationic ring-opening products are found in this epoxidation reaction; thus, isomerized epoxide product arises from intermediary radicals. The dependence of the diastereoselectivity on the oxygen source is rationalized in terms of a bifurcation step in the catalytic cycle, in which concerted Lewis-acid-activated oxygen transfer competes with stepwise epoxidation by the established Mn(V)(oxo) species. The experimental counterion effect is attributed to the computationally assessed ligand-dependent reaction profiles and stereoselectivities of the singlet, triplet, and quintet spin states available to the manganese species.

  14. Biosynthetic potential for polyketides in Talaromyces atroroseus

    DEFF Research Database (Denmark)

    Rasmussen, Kasper Bøwig; Mortensen, Uffe Hasbro; Thrane, Ulf

    11, and deletion of PKS11 results in the loss of Monascus pigment production. T. atroroseus PKS11 is delivering a precursor for both the mitorubrins and the Monascus pigments. Based on this finding we propose hypothetical models for the evolution of azaphilone pigment PKS clusters in Talaromyces......Talaromyces atroroseus is an efficient producer of red Monascus pigments. We genome sequenced Talaromyces atroroseus IBT11181 and found it to lack the Monascus pigment PKS with the rest of the Monascus pigment cluster intact. The PKS closest related to the Monascus pigment PKS is the mitorubrin PKS...

  15. Accelerating spirocyclic polyketide synthesis using flow chemistry.

    Science.gov (United States)

    Newton, Sean; Carter, Catherine F; Pearson, Colin M; de C Alves, Leandro; Lange, Heiko; Thansandote, Praew; Ley, Steven V

    2014-05-05

    Over the past decade, the integration of synthetic chemistry with flow processing has resulted in a powerful platform for molecular assembly that is making an impact throughout the chemical community. Herein, we demonstrate the extension of these tools to encompass complex natural product synthesis. We have developed a number of novel flow-through processes for reactions commonly encountered in natural product synthesis programs to achieve the first total synthesis of spirodienal A and the preparation of spirangien A methyl ester. Highlights of the synthetic route include an iridium-catalyzed hydrogenation, iterative Roush crotylations, gold-catalyzed spiroketalization and a late-stage cis-selective reduction. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Polyketide synthases in Cannabis sativa L.

    NARCIS (Netherlands)

    Flores Sanchez, Isvett Josefina

    2008-01-01

    Cannabis sativa L. plants produce a diverse array of secondary metabolites, which have been grouped in cannabinoids, flavonoids, stilbenoids, terpenoids, alkaloids and lignans; the cannabinoids are the best known group of natural products from this plant. The pharmacological aspects of this

  17. NRC wants plant-specific responses on Thermo-Lag

    International Nuclear Information System (INIS)

    Anon.

    1994-01-01

    Dissatisfied with recent industry-backed efforts to assure fire safety at nuclear power plants, the Nuclear Regulatory Commission announced on November 24 that it would direct all nuclear plant owners to specify the actions they would take to assure that the use of the Thermo-Lag 330 fire barrier material would not lead to insufficient protection of electrical cables connected to safe-shutdown systems. Previously, the NRC had been content to let the matter wait until tests sponsored by the Nuclear Management and Resources Council (Numarc) could show whether Thermo-Lag, used and installed in certain ways, would provide sufficient protection, but the NRC and Numarc have disagreed over the test methodology, and the Numarc tests are now considered to be several months behind schedule

  18. Functional analyses of plant-specific histone deacetylases

    NARCIS (Netherlands)

    Li, Huchen

    2017-01-01

    Plants have a sessile lifestyle. To ensure survival, they develop a potential to respond to environmental cues to set up an adaptive growth and development. This adaptation involves transcriptional reprogramming of the genome through chromatin-based mechanisms relying on the dynamic interplay of

  19. Development of Nuclear Plant Specific Analysis Simulators with ATLAS

    International Nuclear Information System (INIS)

    Jakubowski, Z.; Draeger, P.; Horche, W.; Pointner, W.

    2006-01-01

    The simulation software ATLAS, based on the best-estimate code ATHLET, has been developed by the GRS for a range of applications in the field of nuclear plant safety analysis. Through application of versatile simulation tools and graphical interfaces the user should be able to analyse with ATLAS all essential accident scenarios. Detailed analysis simulators for several German and Russian NPPs are being constructed on the basis of ATLAS. An overview of the ATLAS is presented in the paper, describing its configuration, functions performed by main components and relationships among them. A significant part of any power plant simulator are the balance-of-plant (BOP) models, not only because all the plant transients and non-LOCA accidents can be initiated by operation of BOP systems, but also because the response of the plant to transients or accidents is strongly influenced by the automatic operation of BOP systems. Modelling aspects of BOP systems are shown in detail, also the interface between the process model and BOP systems. Special emphasis has been put on the BOP model builder based on the methodology developed in the GRS. The BOP modeler called GCSM-Generator is an object oriented tool which runs on the online expert system G2. It is equipped with utilities to edit the BOP models, to verification them and to generate a GCSM code, specific for the ATLAS. The communication system of ATLAS presents graphically the results of the simulation and allows interactively influencing the execution of the simulation process (malfunctions, manual control). Displays for communications with simulated processes and presentation of calculations results are also presented. In the framework of the verification of simulation models different tools are used e.g. the PC-codes MATHCAD for the calculation and documentation, ATLET-Input-Graphic for control of geometry data and the expert system G2 for development of BOP-Models. The validation procedure and selected analyses results compared to measured plant data are presented. (author)

  20. [Plant-specific pressured thermal shock safety analysis report

    International Nuclear Information System (INIS)

    Selby, D.L.

    1985-01-01

    Information is presented concerning plant data; determination of detailed PTS sequences for analysis; fracture mechanics analysis; integration of analysis; sensitivity and uncertainty analyses of through-wall crack frequencies; and effect of corrective actions on vessel through-wall crack frequency

  1. Production of medically valuable stilbenes and emodin in knotweed

    Czech Academy of Sciences Publication Activity Database

    Frantík, Tomáš; Kovářová, M.; Koblihová, Helena; Bartůňková, Kristýna; Nývltová, Z.; Vosátka, Miroslav

    2013-01-01

    Roč. 50, oct.2013 (2013), s. 237-243 ISSN 0926-6690 R&D Projects: GA MŠk 1M0571 Institutional support: RVO:67985939 Keywords : knokweed * resveratrol * emodin Subject RIV: EF - Botanics Impact factor: 3.208, year: 2013

  2. [Homoisoflavanones and stilbenes from fresh bulb of Scilla scilloides].

    Science.gov (United States)

    Wang, Yan-Min; Fan, Meng-Yang; Li, Juan; Wang, Zhi-Min; Gao, Hui-Min

    2014-10-01

    Mian-Zao-Er was collected from the bulbs of Scilla scilloides (Lindl. ) Druce, belonging to the Hyacinthaceae family. 17 compounds were obtained using various column chromatographies on macroporus resin (HPD100), silica gel, Sephadex LH-20 and ODS, as well as semi-preparative HPLC. Their structures were elucidated on the basis of physicochemical properties and spectral data as 2-hydroxy-7-methoxyscillascillin (1), scillascillin (2), 5,7-dihydroxy-3',4'-dimethoxyspiro 2H-1-benzopyran-7'-bicyclo[4.2.0 ] octa [1,3,5 ] -trien } -4-one (3), socialinone (4), 4-methylresveratrol (5), (E)-resveratrol (6), scillavoneA (7), 3,9-di- hydroeucomnalin (8), 3-(3-hydroxy-4-methoxybenzyl) -5,7-dihydroxychroman-4-one (9), (3R)-5,7,3'-trihydroxy-4'-methoxyspiro (2H-1-benzopyran-7'-bicyclo[4, 2, 0] octa [1, 3, 5]-trien} -4-one (10), scillabene A (11), 2-hydroxyscillascillin (12), 3-(4-hydroxybenzyl) -5,7-dihydroxychroman-4-one (13), 3-( 4-hydroxybenzylidene) -5, 7-dihydroxychroman-4-one (14), 3-( 4-hydroxybenzyl) -5-hydroxy-7,8-dimethoxychroman-4-one (15), 3-(4-hydroxybenzyl) -5-hydroxy-6, 7-dimethoxychroman-4-one (16), and 3-(4-hydroxybenzyl)-5,8-hydroxy-7-methoxychroman-4-one (17). Among them, compounds 3, 4, 6, 9, 13 and 15-17 were isolated from this plant for the first time.

  3. Allergens/Antigens, Toxins and Polyketides of Important Aspergillus Species

    OpenAIRE

    Bhetariya, Preetida J.; Madan, Taruna; Basir, Seemi Farhat; Varma, Anupam; Usha, Sarma P.

    2011-01-01

    The medical, agricultural and biotechnological importance of the primitive eukaryotic microorganisms, the Fungi was recognized way back in 1920. Among various groups of fungi, the Aspergillus species are studied in great detail using advances in genomics and proteomics to unravel biological and molecular mechanisms in these fungi. Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger, Aspergillus parasiticus, Aspergillus nidulans and Aspergillus terreus are some of the important specie...

  4. Extraction of fungal polyketide pigments using ionic liquids.

    OpenAIRE

    Lebeau , Juliana ,; Venkatachalam , Mekala; Fouillaud , Mireille; Dufossé , Laurent; Caro , Yanis

    2016-01-01

    Poster communication, 8th International Conference of Pigments in Food, “Coloured foods for health benefits”, Cluj-Napoca, Romania, June 28 - July 01, 2016.; International audience; Filamentous fungi have been widely recognized as promising sources of various types ofbiomolecules and are therefore highly investigated. The production of fungal pigments is oneintensively studied domain in order to respond to the growing demand for natural colorants assubstitutes to synthetic dyes used in food, ...

  5. Protoplasting impact on polyketide activity and characterization of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-09-03

    Sep 3, 2008 ... processes also affected on the strain resistance to some antibiotics but had no effect on the components of the ... The study of genetics of Streptomyces is important not ... myces species are mycelial, gram-positive bacteria that.

  6. Plant-specific responses to zinc contamination in a semi-field lysimeter and on hydroponics

    International Nuclear Information System (INIS)

    Bernhard, Roland; Verkleij, Jos A.C.; Nelissen, Hans J.M.; Vink, Jos P.M.

    2005-01-01

    The species Agrostis stolonifera, Brassica napus and Trifolium repens representing different ecological strategies, were selected to study the effect of Zn contamination on Zn tolerance, uptake and accumulation patterns. Parallel tests were carried out with increasing concentrations of Zn in a semi-field lysimeter and hydroponics in the climate chamber. A significant reduction in biomass production or root length and an increase in shoot Zn concentration was observed for all species at increasing external Zn concentrations. However, shoot biomass production, Zn tolerance and Zn accumulation differed significantly among the tested species. The results in both experimental set-ups were quite similar concerning Zn tolerance and accumulation and improved the validity of the findings. The rather specific responses of the different plant species to Zn contamination interfere with the more generic approach used in risk assessment studies. Maximum amounts of Zn in shoot are not likely to cause a risk to herbivores. - Effects of Zn contamination showed different responses in uptake and accumulation patterns of site-specific plant species, which were similar in a semi-field experiment and under controlled conditions

  7. Plant-specific responses to zinc contamination in a semi-field lysimeter and on hydroponics

    Energy Technology Data Exchange (ETDEWEB)

    Bernhard, Roland [Department of Ecology and Physiology of Plants, Vrije Universiteit, De Boelelaan 1085, NL-1081 HV Amsterdam (Netherlands); Verkleij, Jos A.C. [Department of Ecology and Physiology of Plants, Vrije Universiteit, De Boelelaan 1085, NL-1081 HV Amsterdam (Netherlands)]. E-mail: jos.verkleij@falw.vu.nl; Nelissen, Hans J.M. [Department of Ecology and Physiology of Plants, Vrije Universiteit, De Boelelaan 1085, NL-1081 HV Amsterdam (Netherlands); Vink, Jos P.M. [Department of Chemistry and Ecotoxicology, RIZA, PO Box 17, NL-8200 AA Lelystad (Netherlands)

    2005-11-15

    The species Agrostis stolonifera, Brassica napus and Trifolium repens representing different ecological strategies, were selected to study the effect of Zn contamination on Zn tolerance, uptake and accumulation patterns. Parallel tests were carried out with increasing concentrations of Zn in a semi-field lysimeter and hydroponics in the climate chamber. A significant reduction in biomass production or root length and an increase in shoot Zn concentration was observed for all species at increasing external Zn concentrations. However, shoot biomass production, Zn tolerance and Zn accumulation differed significantly among the tested species. The results in both experimental set-ups were quite similar concerning Zn tolerance and accumulation and improved the validity of the findings. The rather specific responses of the different plant species to Zn contamination interfere with the more generic approach used in risk assessment studies. Maximum amounts of Zn in shoot are not likely to cause a risk to herbivores. - Effects of Zn contamination showed different responses in uptake and accumulation patterns of site-specific plant species, which were similar in a semi-field experiment and under controlled conditions.

  8. Plant-specific volatile organic compound emission rates from young and mature leaves of Mediterranean vegetation

    Science.gov (United States)

    Bracho-Nunez, Araceli; Welter, Saskia; Staudt, Michael; Kesselmeier, Jürgen

    2011-08-01

    The seasonality of vegetation, i.e., developmental stages and phenological processes, affects the emission of volatile organic compounds (VOCs). Despite the potential significance, the contributions of seasonality to VOC emission quality and quantity are not well understood and are therefore often ignored in emission simulations. We investigated the VOC emission patterns of young and mature leaves of several Mediterranean plant species in relation to their physiological and developmental changes during the growing period and estimated Es. Foliar emissions of isoprenoids and oxygenated VOCs like methanol and acetone were measured online by means of a proton transfer reaction mass spectrometer (PTR-MS) and offline with gas chromatography coupled with a mass spectrometer and flame ionization detector. The results suggest that VOC emission is a developmentally regulated process and that quantitative and qualitative variability is plant species specific. Leaf ontogeny clearly influenced both the VOC Es and the relative importance of different VOCs. Methanol was the major compound contributing to the sum of target VOC emissions in young leaves (11.8 ± 10.4 μg g-1 h-1), while its contribution was minor in mature leaves (4.1 ± 4.1 μg g-1 h-1). Several plant species showed a decrease or complete subsidence of monoterpene, sesquiterpene, and acetone emissions upon maturity, perhaps indicating a potential response to the higher defense demands of young emerging leaves.

  9. Design of Instrumentation and Control Systems for Nuclear Power Plants. Specific Safety Guide

    International Nuclear Information System (INIS)

    2016-01-01

    This publication is a revision and combination of two Safety Guides, IAEA Safety Standards Series No. NS-G-1.1 and No. NS-G-1.3. The revision takes into account developments in instrumentation and control (I&C) systems since the publication of the earlier Safety Guides. The main changes relate to the continuing development of computer applications and the evolution of the methods necessary for their safe, secure and practical use. In addition, account is taken of developments in human factors engineering and the need for computer security. This Safety Guide references and takes into account other IAEA Safety Standards and Nuclear Security Series publications that provide guidance relating to I&C design

  10. Chemistry Programme for Water Cooled Nuclear Power Plants. Specific Safety Guide

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2011-01-15

    This publication provides guidance on establishing a high standard chemistry programme in accordance with plant safety policy and regulatory requirements. It will be useful to managers of operating organizations and other staff responsible for supporting or monitoring plant activities and for oversight of the plant chemistry programme, as well as to regulatory bodies. Contents: 1. Introduction; 2. Functions, responsibilities and interfaces; 3. Chemistry programme; 4. Chemistry control; 5. Chemistry aspects of radiation exposure optimization; 6. Chemistry surveillance; 7. Management of chemistry data; 8. Training and qualification; 9. Quality control of chemicals and other substances.

  11. 77 FR 58421 - Model Safety Evaluation for Plant-Specific Adoption of Technical Specifications Task Force...

    Science.gov (United States)

    2012-09-20

    ... Item Improvement Process AGENCY: Nuclear Regulatory Commission. ACTION: Notice of availability. SUMMARY... Agencywide Documents Access and Management System (ADAMS): You may access publicly available documents online... currently require operating the ventilation system for at least 10 continuous hours with the heaters...

  12. Development of Genome Engineering Tools from Plant-Specific PPR Proteins Using Animal Cultured Cells.

    Science.gov (United States)

    Kobayashi, Takehito; Yagi, Yusuke; Nakamura, Takahiro

    2016-01-01

    The pentatricopeptide repeat (PPR) motif is a sequence-specific RNA/DNA-binding module. Elucidation of the RNA/DNA recognition mechanism has enabled engineering of PPR motifs as new RNA/DNA manipulation tools in living cells, including for genome editing. However, the biochemical characteristics of PPR proteins remain unknown, mostly due to the instability and/or unfolding propensities of PPR proteins in heterologous expression systems such as bacteria and yeast. To overcome this issue, we constructed reporter systems using animal cultured cells. The cell-based system has highly attractive features for PPR engineering: robust eukaryotic gene expression; availability of various vectors, reagents, and antibodies; highly efficient DNA delivery ratio (>80 %); and rapid, high-throughput data production. In this chapter, we introduce an example of such reporter systems: a PPR-based sequence-specific translational activation system. The cell-based reporter system can be applied to characterize plant genes of interested and to PPR engineering.

  13. DCD – a novel plant specific domain in proteins involved in development and programmed cell death

    Directory of Open Access Journals (Sweden)

    Doerks Tobias

    2005-07-01

    Full Text Available Abstract Background Recognition of microbial pathogens by plants triggers the hypersensitive reaction, a common form of programmed cell death in plants. These dying cells generate signals that activate the plant immune system and alarm the neighboring cells as well as the whole plant to activate defense responses to limit the spread of the pathogen. The molecular mechanisms behind the hypersensitive reaction are largely unknown except for the recognition process of pathogens. We delineate the NRP-gene in soybean, which is specifically induced during this programmed cell death and contains a novel protein domain, which is commonly found in different plant proteins. Results The sequence analysis of the protein, encoded by the NRP-gene from soybean, led to the identification of a novel domain, which we named DCD, because it is found in plant proteins involved in development and cell death. The domain is shared by several proteins in the Arabidopsis and the rice genomes, which otherwise show a different protein architecture. Biological studies indicate a role of these proteins in phytohormone response, embryo development and programmed cell by pathogens or ozone. Conclusion It is tempting to speculate, that the DCD domain mediates signaling in plant development and programmed cell death and could thus be used to identify interacting proteins to gain further molecular insights into these processes.

  14. Deterministic Safety Analysis for Nuclear Power Plants. Specific Safety Guide (Russian Edition)

    International Nuclear Information System (INIS)

    2014-01-01

    The objective of this Safety Guide is to provide harmonized guidance to designers, operators, regulators and providers of technical support on deterministic safety analysis for nuclear power plants. It provides information on the utilization of the results of such analysis for safety and reliability improvements. The Safety Guide addresses conservative, best estimate and uncertainty evaluation approaches to deterministic safety analysis and is applicable to current and future designs. Contents: 1. Introduction; 2. Grouping of initiating events and associated transients relating to plant states; 3. Deterministic safety analysis and acceptance criteria; 4. Conservative deterministic safety analysis; 5. Best estimate plus uncertainty analysis; 6. Verification and validation of computer codes; 7. Relation of deterministic safety analysis to engineering aspects of safety and probabilistic safety analysis; 8. Application of deterministic safety analysis; 9. Source term evaluation for operational states and accident conditions; References

  15. PIP-II Cryogenic System and the evolution of Superfluid Helium Cryogenic Plant Specifications

    Energy Technology Data Exchange (ETDEWEB)

    Chakravarty, Anindya [Fermilab; Rane, Tejas [Fermilab; Klebaner, Arkadiy [Fermilab

    2017-07-06

    The PIP-II cryogenic system consists of a Superfluid Helium Cryogenic Plant (SHCP) and a Cryogenic Distribution System (CDS) connecting the SHCP to the Superconducting (SC) Linac consisting of 25 cryomodules. The dynamic heat load of the SC cavities for continuous wave (CW) as well as pulsed mode of operation has been listed out. The static heat loads of the cavities along with the CDS have also been discussed. Simulation study has been carried out to compute the supercritical helium (SHe) flow requirements for each cryomodule. Comparison between the flow requirements of the cryomodules for the CW and pulsed modes of operation have also been made. From the total computed heat load and pressure drop values in the CDS, the basic specifications for the SHCP, required for cooling the SC Linac, have evolved.

  16. The use of plant-specific pyrolysis products as biomarkers in peat deposits

    Science.gov (United States)

    Schellekens, Judith; Bradley, Jonathan A.; Kuyper, Thomas W.; Fraga, Isabel; Pontevedra-Pombal, Xabier; Vidal-Torrado, Pablo; Abbott, Geoffrey D.; Buurman, Peter

    2015-09-01

    Peatlands are archives of environmental change that can be driven by climate and human activity. Proxies for peatland vegetation composition provide records of (local) environmental conditions that can be linked to both autogenic and allogenic factors. Analytical pyrolysis offers a molecular fingerprint of peat, and thereby a suite of environmental proxies. Here we investigate analytical pyrolysis as a method for biomarker analysis. Pyrolysates of 48 peatland plant species were compared, comprising seventeen lichens, three Sphagnum species, four non-Sphagnum mosses, eleven graminoids (Cyperaceae, Juncaceae, Poaceae), five Ericaceae and six species from other families. This resulted in twenty-one potential biomarkers, including new markers for lichens (3-methoxy-5-methylphenol) and graminoids (ferulic acid methyl ester). The potential of the identified biomarkers to reconstruct vegetation composition is discussed according to their depth records in cores from six peatlands from boreal, temperate and tropical biomes. The occurrence of markers for Sphagnum, graminoids and lichens in all six studied peat deposits indicates that they persist in peat of thousands of years old, in different vegetation types and under different conditions. In order to facilitate the quantification of biomarkers from pyrolysates, typically expressed as proportion (%) of the total quantified pyrolysis products, an internal standard (5-α-androstane) was introduced. Depth records of the Sphagnum marker 4-isopropenylphenol from the upper 3 m of a Sphagnum-dominated peat, from samples analysed with and without internal standard showed a strong positive correlation (r2 = 0.72, P use of analytical pyrolysis in biomarker research by avoiding quantification of a high number of products.

  17. The use of plant-specific pyrolysis products as biomarkers in peat deposits

    NARCIS (Netherlands)

    Schellekens, J.; Bradley, J.A.; Kuyper, T.W.; Fraga, I.; Pontevedra Pombal, X.; Buurman, P.

    2015-01-01

    Peatlands are archives of environmental change that can be driven by climate and human activity. Proxies for peatland vegetation composition provide records of (local) environmental conditions that can be linked to both autogenic and allogenic factors. Analytical pyrolysis offers a molecular

  18. Overview of plant specific source terms and their impact on risk

    International Nuclear Information System (INIS)

    Desaedeleer, G.

    2004-01-01

    Probabilistic risk assesment and safety assessment focuses on systems and measures to prevent core meltdown, and it integrates many aspects of design and operation. It provides mapping of initiating event, frequencies onto plant damage state and through plant systems analysis, utilizes fault tree and event tree logic models, may include 'external event' analysis such as fire, flood, wind, seismic events. Percent contribution of sequences to the core damage frequency are shown for the following plants, taken as examples ZION, EDISON, OCONEE 3, SEABROOK, SIZEWELL B, MILLSTONE 3, RINGHALS 2. The presentation includes comparison of the following initiating event frequencies: loss of off-site power; small LOCA; large LOCA, steam generator tube rupture; loss of feedwater; turbine trip; reactor trip. Consequence analysis deals with: dispersion and depletion of radioactivity in the atmosphere, health effects, factors in the off-site emergency plan analyzed with codes that address the weather conditions; provision of mapping of source terms; risk diagram for early fatalities and for latent cancer fatalities

  19. Preliminary design of the Carrisa Plains solar central receiver power plant. Volume II. Plant specifications

    Energy Technology Data Exchange (ETDEWEB)

    Price, R. E.

    1983-12-31

    The specifications and design criteria for all plant systems and subsystems used in developing the preliminary design of Carrisa Plains 30-MWe Solar Plant are contained in this volume. The specifications have been organized according to plant systems and levels. The levels are arranged in tiers. Starting at the top tier and proceeding down, the specification levels are the plant, system, subsystem, components, and fabrication. A tab number, listed in the index, has been assigned each document to facilitate document location.

  20. Deterministic Safety Analysis for Nuclear Power Plants. Specific Safety Guide (Spanish Edition)

    International Nuclear Information System (INIS)

    2012-01-01

    The IAEA's Statute authorizes the Agency to establish safety standards to protect health and minimize danger to life and property - standards which the IAEA must use in its own operations, and which a State can apply by means of its regulatory provisions for nuclear and radiation safety. A comprehensive body of safety standards under regular review, together with the IAEA's assistance in their application, has become a key element in a global safety regime. In the mid-1990s, a major overhaul of the IAEA's safety standards programme was initiated, with a revised oversight committee structure and a systematic approach to updating the entire corpus of standards. The new standards that have resulted are of a high calibre and reflect best practices in Member States. With the assistance of the Commission on Safety Standards, the IAEA is working to promote the global acceptance and use of its safety standards. Safety standards are only effective, however, if they are properly applied in practice. The IAEA's safety services - which range in scope from engineering safety, operational safety, and radiation, transport and waste safety to regulatory matters and safety culture in organizations - assist Member States in applying the standards and appraise their effectiveness. These safety services enable valuable insights to be shared and I continue to urge all Member States to make use of them. Regulating nuclear and radiation safety is a national responsibility, and many Member States have decided to adopt the IAEA's safety standards for use in their national regulations. For the contracting parties to the various international safety conventions, IAEA standards provide a consistent, reliable means of ensuring the effective fulfilment of obligations under the conventions. The standards are also applied by designers, manufacturers and operators around the world to enhance nuclear and radiation safety in power generation, medicine, industry, agriculture, research and education. The IAEA takes seriously the enduring challenge for users and regulators everywhere: that of ensuring a high level of safety in the use of nuclear materials and radiation sources around the world. Their continuing utilization for the benefit of humankind must be managed in a safe manner, and the IAEA safety standards are designed to facilitate the achievement of that goal.

  1. Development and Application of Level 2 Probabilistic Safety Assessment for Nuclear Power Plants. Specific Safety Guide

    International Nuclear Information System (INIS)

    2010-01-01

    The objective of this Safety Guide is to provide recommendations for meeting the IAEA safety requirements in performing or managing a level 2 probabilistic safety assessment (PSA) project for a nuclear power plant; thus it complements the Safety Guide on level 1 PSA. One of the aims of this Safety Guide is to promote a standard framework, standard terms and a standard set of documents for level 2 PSAs to facilitate regulatory and external peer review of their results. It describes all elements of the level 2 PSA that need to be carried out if the starting point is a fully comprehensive level 1 PSA. Contents: 1. Introduction; 2. PSA project management and organization; 3. Identification of design aspects important to severe accidents and acquisition of information; 4. Interface with level 1 PSA: Grouping of sequences; 5. Accident progression and containment analysis; 6. Source terms for severe accidents; 7. Documentation of the analysis: Presentation and interpretation of results; 8. Use and applications of the PSA; Annex I: Example of a typical schedule for a level 2 PSA; Annex II: Computer codes for simulation of severe accidents; Annex III: Sample outline of documentation for a level 2 PSA study.

  2. Plant specific risk informed decision making -a vision for Indian PHWR

    International Nuclear Information System (INIS)

    Guptan, Rajee; Mohan, Nalini; Ghadge, S.G.; Bajaj, S.S.

    2006-01-01

    The objective of Nuclear Power Plant (NPP) safety is to ensure and demonstrate that the risk from NPP to public and plant personnel is acceptably low. As a supplement to the deterministic approach, use of probabilistic techniques has been gaining grounds. Probabilistic Safety Assessment (PSA) is a popular international practice to calculate plant risk to the public, environment and plant personnel, in the event of an accident taking place in the plant. The risk posed by Nuclear Reactors to the Public at large is a very important issue in the public acceptance of a Nuclear Power Programme in any country. Risk Definition, generally accepted at present as the measure of possibility for an accidental event and severity of its effects to occur, simultaneously comprises both the probability (frequency) of potential damage occurrence and extent of this damage. NPCIL' s vision is to provide safe, reliable and cost effective energy to the nation by ensuring safe operation of the plants, limiting radiation exposure to plant personnel and public within prescribed limits. To achieve this vision our mission is to enhance the technical competency, resources and the awareness towards improved safety culture specific to Probabilistic Safety Assessment for applying PSA Studies to Risk Informed Decision making. This mission translates into the goal of completion of full scope PSA, with the co-operation and synergetic efforts of the Head quarters and Operating Station experts. NPCIL will then be self sufficient in applying Probabilistic Studies in Risk Informed Decision making to minimize risk and back fitting design changes to optimize the existing design and operating practices, thus providing for safe, reliable and cost effective energy to the nation. (author)

  3. Optimal test intervals of standby components based on actual plant-specific data

    International Nuclear Information System (INIS)

    Jones, R.B.; Bickel, J.H.

    1987-01-01

    Based on standard reliability analysis techniques, both under testing and over testing affect the availability of standby components. If tests are performed too often, unavailability is increased since the equipment is being used excessively. Conversely if testing is performed too infrequently, the likelihood of component unavailability is also increased due to the formation of rust, heat or radiation damage, dirt infiltration, etc. Thus from a physical perspective, an optimal test interval should exist which minimizes unavailability. This paper illustrates the application of an unavailability model that calculates optimal testing intervals for components with a failure database. (orig./HSCH)

  4. Chemistry Programme for Water Cooled Nuclear Power Plants. Specific Safety Guide (Russian Edition)

    International Nuclear Information System (INIS)

    2014-01-01

    This publication provides guidance on establishing a high standard chemistry programme in accordance with plant safety policy and regulatory requirements. It will be useful to managers of operating organizations and other staff responsible for supporting or monitoring plant activities and for oversight of the plant chemistry programme, as well as to regulatory bodies. Contents: 1. Introduction; 2. Functions, responsibilities and interfaces; 3. Chemistry programme; 4. Chemistry control; 5. Chemistry aspects of radiation exposure optimization; 6. Chemistry surveillance; 7. Management of chemistry data; 8. Training and qualification; 9. Quality control of chemicals and other substances

  5. Comparison of plant-specific probabilistic safety assessments and lessons learned

    International Nuclear Information System (INIS)

    Balfanz, H.P.; Berg, H.P.; Steininger, U.

    2001-01-01

    Probabilistic safety assessments (PSA) have been performed for all German nuclear power plants in operation. These assessments are mainly based on the recent German PSA guide and an earlier draft, respectively. However, comparison of these PSA show differences in the results which are discussed in this paper. Lessons learned from this comparison and further development of the PSA methodology are described. (orig.) [de

  6. Comparison of plant-specific probabilistic safety assessments and lessons learned

    Energy Technology Data Exchange (ETDEWEB)

    Balfanz, H.P. [TUeV Nord, Hamburg (Germany); Berg, H.P. [Bundesamt fuer Strahlenschutz, Salzgitter (Germany); Steininger, U. [TUeV Energie- und Systemtechnik GmbH, Unternehmensgruppe TUeV Sueddeutschland, Muenchen (Germany)

    2001-11-01

    Probabilistic safety assessments (PSA) have been performed for all German nuclear power plants in operation. These assessments are mainly based on the recent German PSA guide and an earlier draft, respectively. However, comparison of these PSA show differences in the results which are discussed in this paper. Lessons learned from this comparison and further development of the PSA methodology are described. (orig.) [German] Probabilistische Sicherheitsanalysen (PSA) sind fuer alle in Betrieb befindlichen deutschen Kernkraftwerke durchgefuehrt worden. Diese Analysen basierten in der Regel auf dem aktuellen deutschen PSA-Leitfaden bzw. einem frueheren Entwurf. Ein Vergleich dieser PSA zeigt Unterschiede in den Ergebnissen, die in diesem Beitrag diskutiert werden. Erfahrungen und Erkenntnisse, die aus diesem Vergleich abgeleitet werden koennen, und weitere Entwicklungen der PSA-Methoden werden beschrieben. (orig.)

  7. Plant-specific evaluations of Transamerica Delaval diesel engines for nuclear service

    International Nuclear Information System (INIS)

    Dingee, D.A.; Laity, W.W.; Nesbitt, J.F.

    1985-03-01

    This paper discusses the approach taken to evlauate the readiness of Transamerica Delaval, Inc. (TDI) diesel generators for nuclear service at five power plants: Catawba, Comanche Peak, Grand Gulf, San Onofre, and Shoreham. TDI engines in these and other nuclear power plants have been the subject of a coordinated effort by 13 nuclear utilities to address reliability and quality issues. The utilities formed the TDI Diesel Generator Owners' Group and prepared a comprehensive plan for requalifying the engines as emergency power sources. Prior to full implementation of the plan by the Owners' Group and final review of the findings by the US Nuclear Regulatory Commission, several member plants became candidates for operating licenses. The TDI engines in those plants, including the five listed above, were evaluated on a case-by-case basis, taking into consideration the factors discussed in this paper. 2 refs

  8. Digital I and C system pre-tests using plant specific simulators

    International Nuclear Information System (INIS)

    Holl, B.; Probst, H.; Wischert, W.

    2006-01-01

    The paper focuses on strategic aspects of the implementation of modern digital instrumentation and control system (I and C) in nuclear power plant (NPP) training simulators and points out the way to identify the most appropriate implementation method of the digital I and C system in the simulator development environment which fulfils the requirement imposed by the nuclear power plants. This regards mainly training aspects, simulator as a test bed for design verification and validation (V and V), and software maintenance aspects with respect to future evolutions of the digital I and C system. (author)

  9. Consistency of plant-specific n-alkane patterns in plaggen ecosystems: a review

    NARCIS (Netherlands)

    Kirkels, F.M.S.A.; Jansen, B.; Kalbitz, K.

    2013-01-01

    Plaggen soils, formed by various vegetational inputs during century-long plaggen (i.e. sod) application, comprise remarkably stable organic matter. Source identification could contribute to a better understanding of carbon stabilization mechanisms in soils and reconstruction of Holocene vegetation

  10. GABA signalling modulates plant growth by directly regulating the activity of plant-specific anion transporters.

    Science.gov (United States)

    Ramesh, Sunita A; Tyerman, Stephen D; Xu, Bo; Bose, Jayakumar; Kaur, Satwinder; Conn, Vanessa; Domingos, Patricia; Ullah, Sana; Wege, Stefanie; Shabala, Sergey; Feijó, José A; Ryan, Peter R; Gilliham, Matthew; Gillham, Matthew

    2015-07-29

    The non-protein amino acid, gamma-aminobutyric acid (GABA) rapidly accumulates in plant tissues in response to biotic and abiotic stress, and regulates plant growth. Until now it was not known whether GABA exerts its effects in plants through the regulation of carbon metabolism or via an unidentified signalling pathway. Here, we demonstrate that anion flux through plant aluminium-activated malate transporter (ALMT) proteins is activated by anions and negatively regulated by GABA. Site-directed mutagenesis of selected amino acids within ALMT proteins abolishes GABA efficacy but does not alter other transport properties. GABA modulation of ALMT activity results in altered root growth and altered root tolerance to alkaline pH, acid pH and aluminium ions. We propose that GABA exerts its multiple physiological effects in plants via ALMT, including the regulation of pollen tube and root growth, and that GABA can finally be considered a legitimate signalling molecule in both the plant and animal kingdoms.

  11. Chemical and radiochemical specifications - PWR power plants; Specifications chimiques et radiochimiques - Centrales REP

    Energy Technology Data Exchange (ETDEWEB)

    Stutzmann, A [Electricite de France (EDF), 93 - Saint-Denis (France)

    1997-07-01

    Published by EDF this document gives the chemical specifications of the PWR (Pressurized Water Reactor) nuclear power plants. Among the chemical parameters, some have to be respected for the safety. These parameters are listed in the STE (Technical Specifications of Exploitation). The values to respect, the analysis frequencies and the time states of possible drops are noticed in this document with the motion STE under the concerned parameter. (A.L.B.)

  12. Chemistry Programme for Water Cooled Nuclear Power Plants. Specific Safety Guide

    International Nuclear Information System (INIS)

    2011-01-01

    This publication provides guidance on establishing a high standard chemistry programme in accordance with plant safety policy and regulatory requirements. It will be useful to managers of operating organizations and other staff responsible for supporting or monitoring plant activities and for oversight of the plant chemistry programme, as well as to regulatory bodies. Contents: 1. Introduction; 2. Functions, responsibilities and interfaces; 3. Chemistry programme; 4. Chemistry control; 5. Chemistry aspects of radiation exposure optimization; 6. Chemistry surveillance; 7. Management of chemistry data; 8. Training and qualification; 9. Quality control of chemicals and other substances

  13. 76 FR 23554 - Certain Stilbenic Optical Brightening Agents From the People's Republic of China and Taiwan...

    Science.gov (United States)

    2011-04-27

    ... (ii) determine industry support using a statistically valid sampling method if there is a large number.... Although the HTSUS subheadings are provided for convenience and customs purposes, the written description...

  14. Different effect of two synthetic coumarin-stilbene hybrid compounds on phagocyte activity

    Czech Academy of Sciences Publication Activity Database

    Drábiková, K.; Perečko, T.; Nosál, R.; Račková, L.; Ambrožová, Gabriela; Lojek, Antonín; Šmidrkal, J.; Harmatha, Juraj; Jančinová, V.

    2010-01-01

    Roč. 31, č. 2 (2010), s. 73-78 ISSN 0172-780X R&D Projects: GA MŠk(CZ) MEB0810013 Grant - others:GA ČR(CZ) GA203/07/1227 Program:GA Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702; CEZ:AV0Z40550506 Keywords : reactive species * phagocytosis * coumarin Subject RIV: BO - Biophysics Impact factor: 1.621, year: 2010

  15. 77 FR 17436 - Certain Stilbenic Optical Brightening Agents From the People's Republic of China: Final...

    Science.gov (United States)

    2012-03-26

    ... Brightening Agents From the People's Republic of China: Final Determination of Sales at Less Than Fair Value...'') published its preliminary determination of sales at less than fair value (``LTFV'') in the antidumping... People's Republic of China: Preliminary Determination of Sales at Less Than Fair Value and Postponement...

  16. 77 FR 27423 - Certain Stilbenic Optical Brightening Agents From the People's Republic of China: Amended Final...

    Science.gov (United States)

    2012-05-10

    ... Department published the final determination of sales at less than fair value in the antidumping duty... Brightening Agents from the People's Republic of China: Final Determination of Sales at Less Than Fair Value... Determination of Sales at Less Than Fair Value and Postponement of Final Determination, 76 FR 68148 (November 3...

  17. 76 FR 49443 - Certain Stilbenic Optical Brightening Agents From the People's Republic of China, and Taiwan...

    Science.gov (United States)

    2011-08-10

    ... Optical Brightening Agents From the People's Republic of China, and Taiwan: Postponement of Preliminary... 5; Maisha Cryor at (202) 482-5831 or Shaun Higgins at (202) 482-0679 (People's Republic of China.... Department of Commerce, 14th Street and Constitution Avenue, NW., Washington, DC 20230. SUPPLEMENTARY...

  18. 77 FR 17027 - Certain Stilbenic Optical Brightening Agents From Taiwan: Final Determination of Sales at Less...

    Science.gov (United States)

    2012-03-23

    ... provided for convenience and customs purposes, the written description of the merchandise is dispositive... comparison market, in the Preliminary Determination we determined selling expenses and profit under section... to derive the constructed value profit. We have also excluded movement expenses and direct-selling...

  19. Oxyresveratrol, a Stilbene Compound from Morus alba L. Twig Extract Active Against Trichophyton rubrum.

    Science.gov (United States)

    Lu, Hai-Peng; Jia, Ya-Nan; Peng, Ya-Lin; Yu, Yan; Sun, Si-Long; Yue, Meng-Ting; Pan, Min-Hui; Zeng, Ling-Shu; Xu, Li

    2017-12-01

    Morus alba L. (mulberry) twig is known to have an inhibitory effect on pathogens in traditional Chinese medicine. In the present study, the dermophytic fungus, Trichophyton rubrum, was used to evaluate the inhibitory effect of total M. alba twig extract and extracts obtained using solvents with different polarities by the method of 96-well MTT colorimetry. The main active substance was isolated and identified by tracking its activity. In addition, the inhibitory effects of active extracts and a single active substance were investigated in combination with miconazole nitrate. Our data indicated that ethyl acetate extracts of mulberry twig (TEE) exhibited a desired inhibitory activity on T. rubrum with the minimum inhibitory concentration (MIC) of 1.000 mg/mL. With activity tracking, the main substance showing antimicrobial activity was oxyresveratrol (OXY), which was isolated from TEE. Its MIC for inhibiting the growth of T. rubrum was 0.500 mg/mL. The combined use of miconazole nitrate and OXY showed a synergistic inhibitory effect, as shown by a significant decrease in the MIC of both components. Based on the OXY content in TEE, the contribution rate of OXY to the inhibitory effect of TEE on T. rubrum was 80.52%, so it was determined to be the main antimicrobial substance in M. alba twig. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  20. 77 FR 27419 - Certain Stilbenic Optical Brightening Agents From Taiwan: Amended Final Determination of Sales at...

    Science.gov (United States)

    2012-05-10

    ... are materially injuring a U.S. industry, all unliquidated entries of such merchandise from Taiwan... Brightening Agents From Taiwan: Amended Final Determination of Sales at Less Than Fair Value and Antidumping... Taiwan. In addition, the Department is amending its final determination to correct a ministerial error...

  1. 76 FR 68148 - Certain Stilbenic Optical Brightening Agents From the People's Republic of China: Preliminary...

    Science.gov (United States)

    2011-11-03

    ...\\ \\58\\ See id. We valued international freight using data obtained from the Descartes Carrier Rate Retrieval Database (``Descartes''), which can be accessed via http://descartes.com/ .\\59\\ The Descartes..., the Descartes data reflect rates for multiple carriers, report rates on a daily basis, the price data...

  2. 76 FR 68154 - Certain Stilbenic Optical Brightening Agents From Taiwan: Preliminary Determination of Sales at...

    Science.gov (United States)

    2011-11-03

    ... Retail Carrier Bags From Taiwan: Preliminary Determination of Sales at Less Than Fair Value and... did not appear to experience significant changes in the cost of manufacturing during the period of... by exporters or producers ``in connection with the sale, for consumption in the foreign country, of...

  3. Chemical analysis of a genome wide polyketide synthase gene deletion library in Aspergillus nidulans

    DEFF Research Database (Denmark)

    Larsen, Thomas Ostenfeld; Klejnstrup, Marie Louise; Nielsen, Jakob Blæsbjerg

    . This may reflect that many PKs are either produced in small amounts, under special conditions or in developmental stages that are rarely observed under laboratory conditions. In order to trigger expression of “silent” genes we are currently pursuing several approaches; i) stimulation of A. nidulans wild...

  4. Structure and absolute configuration of Jurassic polyketide-derived spiroborate pigments obtained from microgram quantities.

    OpenAIRE

    Wolkenstein, K.; Sun , H.; Falk, H.; Griesinger, C.

    2015-01-01

    Complete structural elucidation of natural products is often challenging due to structural complexity and limited availability. This is true for present-day secondary metabolites, but even more for exceptionally preserved secondary metabolites of ancient organisms that potentially provide insights into the evolutionary history of natural products. Here, we report the full structure and absolute configuration of the borolithochromes, enigmatic boron-containing pigments from a Jurassic putative...

  5. Studies of the Production of Fungal Polyketides in Aspergillus nidulans by Using Systems Biology Tools

    DEFF Research Database (Denmark)

    Panagiotou, Gianni; Andersen, Mikael Rørdam; Grotkjær, Thomas

    2009-01-01

    characterized on glucose, xylose, glycerol, and ethanol media in controlled bioreactors. Glucose was found to be the preferred carbon source for 6-MSA production, and 6-MSA concentrations up to 455 mg/liter were obtained for the recombinant strain harboring the 6-MSA gene. Our findings indicate...

  6. Anti-mycobacterial activity of polyketides from Penicillium sp. endophyte isolated from Garcinia nobilis against Mycobacteriumsmegmatis.

    Science.gov (United States)

    Jouda, Jean Bosco; Mawabo, Isabelle Kamga; Notedji, Augustin; Mbazoa, Céline Djama; Nkenfou, Jean; Wandji, Jean; Nkenfou, Céline Nguefeu

    2016-06-01

    According to estimates by the World Health Organization, there were 9.6 million new tuberculosis (TB) cases in 2014: 5.4 million among men, 3.2 million among women, and 1.0 million among children. There were also 1.5 million TB deaths. Although there are potent anti-TB molecules, the misuse of these drugs in addition to inconsistent or partial treatment have led to the development of multidrug-resistant TB and extensively drug-resistant TB. It is established that plants harbor microorganisms, collectively known as endophytes, which also produce metabolites. Exploring the as-yet untapped natural products from the endophytes increases the chances of finding novel and active compounds. The present study was aimed to investigate the antimycobacterial activity of the crude extract and compounds isolated from Penicillium sp. endophyte associated with Garcinia nobilis against Mycobacterium smegmatis. Liquid culture obtained from the fermentation of Penicillium sp. was extracted using ethylacetate and the liquid chromatography-mass spectrometry monitored fractionation of crude extracts yielded six compounds. Their structures were elucidated with spectroscopic analyses including two-dimensional nuclear magnetic resonance, high resolution mass spectrometry by dereplication using Antibase, and by comparison to literature data. All compounds and the crude extract from the liquid medium were evaluated for their antimycobacterial activity against M. smegmatis. In this study, the activity of penialidins A-C (1-3), citromycetin (4), p-hydroxy phenyl glyoxalaldoxime (5), and Brefeldin A (6) were tested against nonpathogenic M. smegmatis. Penialidin C was the most active compound with a minimum inhibitory concentration of 15.6μg/mL. Isolated compounds from Penicillium sp. harbored in G. nobilis exhibited promising antimycobacterial activity against M. smegmatis thus supporting the immensity of the potential of antimycobacterial drug discovery from endophytes from medicinal plants. Penialidin C could further be investigated for antimycobacterial drug development. Copyright © 2016 Asian-African Society for Mycobacteriology. Published by Elsevier Ltd. All rights reserved.

  7. Production of novel fusarielins by ectopic activation of the polyketide synthase 9 cluster in Fusarium graminearum

    DEFF Research Database (Denmark)

    Sørensen, Jens Laurids; Hansen, Frederik Teilfeldt; Sondergaard, Teis Esben

    2012-01-01

    specific transcription factors. We have developed a system in which an expression cassette containing the transcription factor from the targeted PKS cluster disrupts the production of the red mycelium pigment aurofusarin. This aids with identification of mutants as they appear as white colonies...... and metabolite analyses where aurofusarin and its intermediates are normally among the most abundant compounds. The system was used for constitutive expression of the local transcription factor from the PKS9 cluster (renamed FSL) leading to production of three novel fusarielins, F, G and H. This group...

  8. Biosynthesis of two dihydropyrrole-polyketides from a marine-derived Penicillium citrinum

    Energy Technology Data Exchange (ETDEWEB)

    Romminger, Stelamar; Pimenta, Eli F.; Berlinck, Roberto G.S., E-mail: rgsberlinck@iqsc.usp.br [Universidade de Sao Paulo (USP), Sao Carlos, SP (Brazil). Inst. de Quimica; Nascimento, Eduardo S.; Ferreira, Antonio G. [Universidade Federal de Sao Carlos (UFSCAR), SP (Brazil). Dept. de Quimica

    2012-10-15

    Feeding experiments with {sup 13}C-labeled precursors were performed in order to establish the biosynthesis of two N-acylated dihydro pyrroles, (8E)-1-(2,3-dihydro-1H-pyrrol-1-yl)-2-methyldec- 8-ene-1,3-dione (1) and 1-(2,3-dihydro-1H-pyrrol-1-yl)-2-methyldecane-1,3-dione (2), isolated from the cultures of a marine-derived Penicillium citrinum. The biosynthesis of both, 1 and 2, involves the incorporation of acetate, methionine and ornithine. (author)

  9. ClusterCAD: a computational platform for type I modular polyketide synthase design

    DEFF Research Database (Denmark)

    Eng, Clara H.; Backman, Tyler W. H.; Bailey, Constance B.

    2018-01-01

    barrier to the design of active variants, and identifying strategies to reliably construct functional PKS chimeras remains an active area of research. In this work, we formalize a paradigm for the design of PKS chimeras and introduce ClusterCAD as a computational platform to streamline and simplify...

  10. Isolation and expression of two polyketide synthase genes from Trichoderma harzianum 88 during mycoparasitism.

    Science.gov (United States)

    Yao, Lin; Tan, Chong; Song, Jinzhu; Yang, Qian; Yu, Lijie; Li, Xinling

    2016-01-01

    Metabolites of mycoparasitic fungal species such as Trichoderma harzianum 88 have important biological roles. In this study, two new ketoacyl synthase (KS) fragments were isolated from cultured Trichoderma harzianum 88 mycelia using degenerate primers and analysed using a phylogenetic tree. The gene fragments were determined to be present as single copies in Trichoderma harzianum 88 through southern blot analysis using digoxigenin-labelled KS gene fragments as probes. The complete sequence analysis in formation of pksT-1 (5669bp) and pksT-2 (7901bp) suggests that pksT-1 exhibited features of a non-reducing type I fungal PKS, whereas pksT-2 exhibited features of a highly reducing type I fungal PKS. Reverse transcription polymerase chain reaction indicated that the isolated genes are differentially regulated in Trichoderma harzianum 88 during challenge with three fungal plant pathogens, which suggests that they participate in the response of Trichoderma harzianum 88 to fungal plant pathogens. Furthermore, disruption of the pksT-2 encoding ketosynthase-acyltransferase domains through Agrobacterium-mediated gene transformation indicated that pksT-2 is a key factor for conidial pigmentation in Trichoderma harzianum 88. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  11. Data in support of substrate flexibility of a mutated acyltransferase domain and implications for polyketide biosynthesis

    Directory of Open Access Journals (Sweden)

    Stephan Klopries

    2015-12-01

    Full Text Available Enzyme-directed mutasynthesis is an emerging strategy for the targeted derivatization of natural products. Here, data on the synthesis of malonic acid derivatives for feeding studies in Saccharopolyspora erythraea , the mutagenesis of DEBS and bioanalytical data on the experimental investigation of studies on the biosynthetic pathway towards erythromycin are presented.

  12. Biosynthesis of two dihydropyrrole-polyketides from a marine-derived Penicillium citrinum

    International Nuclear Information System (INIS)

    Romminger, Stelamar; Pimenta, Eli F.; Berlinck, Roberto G.S.; Nascimento, Eduardo S.; Ferreira, Antonio G.

    2012-01-01

    Feeding experiments with 13 C-labeled precursors were performed in order to establish the biosynthesis of two N-acylated dihydro pyrroles, (8E)-1-(2,3-dihydro-1H-pyrrol-1-yl)-2-methyldec- 8-ene-1,3-dione (1) and 1-(2,3-dihydro-1H-pyrrol-1-yl)-2-methyldecane-1,3-dione (2), isolated from the cultures of a marine-derived Penicillium citrinum. The biosynthesis of both, 1 and 2, involves the incorporation of acetate, methionine and ornithine. (author)

  13. Identification of a polyketide synthase involved in sorbicillin biosynthesis by Penicillium chrysogenum

    NARCIS (Netherlands)

    Salo, Oleksandr; Guzmán-Chávez, Fernando; Ries, Marco I; Lankhorst, Peter P; Bovenberg, Roel A L; Vreeken, Rob J; Driessen, Arnold J M

    2016-01-01

    Secondary metabolism in Penicillium chrysogenum was intensively subjected to classical strain improvement (CSI) resulting industrial strains producing high levels of β-lactams. During this process, the production of yellow pigments including sorbicillinoids was eliminated as part of a strategy to

  14. Two Marine Cyanobacterial Aplysiatoxin Polyketides, Neo-debromoaplysiatoxin A and B, with K+ Channel Inhibition Activity.

    Science.gov (United States)

    Han, Bing-Nan; Liang, Ting-Ting; Keen, Lawrence Jordan; Fan, Ting-Ting; Zhang, Xiao-Dan; Xu, Lin; Zhao, Qi; Wang, Shu-Ping; Lin, Hou-Wen

    2018-02-02

    The isolation and structure elucidation of two cyanobacterial debromoaplysiatoxin (DAT) analogues, neo-debromoaplysiatoxin A (1) and neo-debromoaplysiatoxin B (2), were reported and found to possess 6/10/6 and 6/6/6 fused-ring systems, respectively, which are rarely seen among aplysiatoxins. Both compounds exhibited potent blocking activity against Kv1.5 with IC 50 values of 6.94 ± 0.26 and 0.30 ± 0.05 μM, respectively. These findings suggest the potential of aplysiatoxin analogues in modulating ionic channels and also provide links between the DAT target, protein kinase C, and cell regulation.

  15. Protoplasting impact on polyketide activity and characterization of the interspecific fusants from Streptomyces spp

    International Nuclear Information System (INIS)

    Slama, N.; Lazim, H.; Barkallah, Insaf; Abbassi, M.; Ben Hassen, A.; Limam, F.

    2009-01-01

    Streptomycetes are gram-positive, soil-inhabiting bacteria of the order Actinomycetales. These organisms exhibit an unusual, developmentally complex life cycle and produce many economically important secondary metabolites, such as antibiotics, immunosuppressants, insecticides, and antitumor agents. Streptomyces species have been the subject of genetic investigation for over 50 years, with many studies focusing on the production of bioactives compounds. The protoplast formation and regeneration are important processes, and they are a major step following genetic manipulations such as fusion and DNA-mediated transformation, which can improve antibiotic production. The protoplast fusion, transformation and improved fermentation features can be used to regenerate strains with increased antibiotic activity. Local Streptomyces spp. CN207 produce a broad range of secondary metabolites which is active against bacteria and fungi. This strain was used as a donor and S. coelicolor strain M145 was used as a recipient host for protoplast fusion. The protoplast fusion resulted in increased isolation of variants with higher antibiotic activity. Recombinant Streptomyces coelicolor PF04 was increased 10 times more than the wild strain. The antimicrobial activity from PF04 strain was studied using the disc method agar. TLC analysis confirmed that the Rf of cell extract for PF04 strain is identical to antimicrobial compound of Streptomyces CN207. Our results confirm the possibility of transferring antibiotics cluster genes by fusion. In fact, many of the selective markers such as Ticarcillin, Cefalotin, Oxacillin and Cefotaxim were transferred during the protoplast fusion. PFGE analysis and DNA-hybridization confirmed the presence of homologous fragments between a wild-type Streptomyces CN207 and a recombinant S. coelicolor PF04

  16. Enhancement of anti-inflammatory activity of Aloe vera adventitious root extracts through the alteration of primary and secondary metabolites via salicylic acid elicitation.

    Directory of Open Access Journals (Sweden)

    Yun Sun Lee

    Full Text Available Aloe vera (Asphodeloideae is a medicinal plant in which useful secondary metabolites are plentiful. Among the representative secondary metabolites of Aloe vera are the anthraquinones including aloe emodin and chrysophanol, which are tricyclic aromatic quinones synthesized via a plant-specific type III polyketide biosynthesis pathway. However, it is not yet clear which cellular responses can induce the pathway, leading to production of tricyclic aromatic quinones. In this study, we examined the effect of endogenous elicitors on the type III polyketide biosynthesis pathway and identified the metabolic changes induced in elicitor-treated Aloe vera adventitious roots. Salicylic acid, methyl jasmonate, and ethephon were used to treat Aloe vera adventitious roots cultured on MS liquid media with 0.3 mg/L IBA for 35 days. Aloe emodin and chrysophanol were remarkably increased by the SA treatment, more than 10-11 and 5-13 fold as compared with untreated control, respectively. Ultra-performance liquid chromatography-electrospray ionization mass spectrometry analysis identified a total of 37 SA-induced compounds, including aloe emodin and chrysophanol, and 3 of the compounds were tentatively identified as tricyclic aromatic quinones. Transcript accumulation analysis of polyketide synthase genes and gas chromatography mass spectrometry showed that these secondary metabolic changes resulted from increased expression of octaketide synthase genes and decreases in malonyl-CoA, which is the precursor for the tricyclic aromatic quinone biosynthesis pathway. In addition, anti-inflammatory activity was enhanced in extracts of SA-treated adventitious roots. Our results suggest that SA has an important role in activation of the plant specific-type III polyketide biosynthetic pathway, and therefore that the efficacy of Aloe vera as medicinal agent can be improved through SA treatment.

  17. Enhancement of anti-inflammatory activity of Aloe vera adventitious root extracts through the alteration of primary and secondary metabolites via salicylic acid elicitation.

    Science.gov (United States)

    Lee, Yun Sun; Ju, Hyun Kyoung; Kim, Yeon Jeong; Lim, Tae-Gyu; Uddin, Md Romij; Kim, Yeon Bok; Baek, Jin Hong; Kwon, Sung Won; Lee, Ki Won; Seo, Hak Soo; Park, Sang Un; Yang, Tae-Jin

    2013-01-01

    Aloe vera (Asphodeloideae) is a medicinal plant in which useful secondary metabolites are plentiful. Among the representative secondary metabolites of Aloe vera are the anthraquinones including aloe emodin and chrysophanol, which are tricyclic aromatic quinones synthesized via a plant-specific type III polyketide biosynthesis pathway. However, it is not yet clear which cellular responses can induce the pathway, leading to production of tricyclic aromatic quinones. In this study, we examined the effect of endogenous elicitors on the type III polyketide biosynthesis pathway and identified the metabolic changes induced in elicitor-treated Aloe vera adventitious roots. Salicylic acid, methyl jasmonate, and ethephon were used to treat Aloe vera adventitious roots cultured on MS liquid media with 0.3 mg/L IBA for 35 days. Aloe emodin and chrysophanol were remarkably increased by the SA treatment, more than 10-11 and 5-13 fold as compared with untreated control, respectively. Ultra-performance liquid chromatography-electrospray ionization mass spectrometry analysis identified a total of 37 SA-induced compounds, including aloe emodin and chrysophanol, and 3 of the compounds were tentatively identified as tricyclic aromatic quinones. Transcript accumulation analysis of polyketide synthase genes and gas chromatography mass spectrometry showed that these secondary metabolic changes resulted from increased expression of octaketide synthase genes and decreases in malonyl-CoA, which is the precursor for the tricyclic aromatic quinone biosynthesis pathway. In addition, anti-inflammatory activity was enhanced in extracts of SA-treated adventitious roots. Our results suggest that SA has an important role in activation of the plant specific-type III polyketide biosynthetic pathway, and therefore that the efficacy of Aloe vera as medicinal agent can be improved through SA treatment.

  18. Heterogeneity of soil surface ammonium concentration and other characteristics, related to plant specific variability in a Mediterranean-type ecosystem

    International Nuclear Information System (INIS)

    Cruz, Cristina; Bio, Ana M.F.; Jullioti, Aldo; Tavares, Alice; Dias, Teresa; Martins-Loucao, Maria Amelia

    2008-01-01

    Heterogeneity and dynamics of eight soil surface characteristics essential for plants-ammonium and nitrate concentrations, water content, temperature, pH, organic matter, nitrification and ammonification rates-were studied in a Mediterranean-type ecosystem on four occasions over a year. Soil properties varied seasonally and were influenced by plant species. Nitrate and ammonium were present in the soil at similar concentrations throughout the year. The positive correlation between them at the time of greatest plant development indicates that ammonium is a readily available nitrogen source in Mediterranean-type ecosystems. The results presented here suggest that plant cover significantly affects soil surface characteristics. - In Mediterranean-type ecosystems ammonium is present in the soil throughout the year and its concentration is dependent on plant cover

  19. 77 FR 16869 - Proposed Models for Plant-Specific Adoption of Technical Specifications Task Force Traveler TSTF...

    Science.gov (United States)

    2012-03-22

    ... system. This TS improvement is part of the consolidated line item improvement process (CLIIP). Additional... NRC-2012-0071. NRC's Agencywide Documents Access and Management System (ADAMS): You may access... continuous hours every 31 days, would be changed to require at least 15 continuous minutes of heater...

  20. 75 FR 75705 - Notice of Availability of the Models for Plant-Specific Adoption of Technical Specifications Task...

    Science.gov (United States)

    2010-12-06

    ..., Rockville, Maryland. NRC's Agencywide Documents Access and Management System (ADAMS): Publicly available documents created or received at the NRC are available electronically at the NRC's Electronic Reading Room... and Management System (ADAMS) under Accession Number ML093570241. The proposed changes revise the...

  1. Plant specific safety inspection of German nuclear power plants taking into account the Fukushima-I (Japan) events

    International Nuclear Information System (INIS)

    2011-01-01

    The German Parliament requested (17 March 2011) a comprehensive inspection of German nuclear power plants. For this purpose independent expert commissions should perform a new risk analysis of all German NPPS and nuclear installations with respect to the lessons learned from the Fukushima (Japan) events and other extraordinary damage scenarios. The Reactor safety commission (RSK) was assigned by the German Bundesamt fuer Strahlenschutz to develop a catalogue of requirements for this safety inspection. The contribution summarizes the required inspection volume (status 30.03.2011) including the following events: natural events like earth quakes, floods, weather-based consequences and possible superposition. Additionally the following assumptions have to be considered: event independent postulated common failures or systematic faults, station blackout larger than 2 hours, long-term failure of the auxiliary cooling water supply; aggravating boundary conditions for the performance of emergency measures (non-availability of power supply), hydrogen generation and detonation hazard, restricted personnel availability, non-accessibility due to high radiation levels, impeded technical support from outside. (orig.)

  2. Plant-specific Histone Deacetylases HDT½ Regulate GIBBERELLIN 2-OXIDASE 2 Expression to Control Arabidopsis Root Meristem Cell Number

    KAUST Repository

    Li, Huchen; Torres-Garcia, Jesus; latrasse, David; Benhamed, Moussa; Schilderink, Stefan; Zhou, Wenkun; Kulikova, Olga; Hirt, Heribert; Bisseling, Ton

    2017-01-01

    Root growth is modulated by environmental factors and depends on cell production in the root meristem (RM). New cells in the meristem are generated by stem cells and transit-amplifying cells, which together determine RM cell number. Transcription

  3. Seedling lethality in Nicotiana plumbaginifolia conferred by Ds transposable element insertion into a plant-specific gene.

    Science.gov (United States)

    Majira, Amel; Domin, Monique; Grandjean, Olivier; Gofron, Krystyna; Houba-Hérin, Nicole

    2002-10-01

    A seedling lethal mutant of Nicotiana plumbaginifolia (sdl-1) was isolated by transposon tagging using a maize Dissociation (Ds) element. The insertion mutation was produced by direct co-transformation of protoplasts with two plasmids: one containing Ds and a second with an Ac transposase gene. sdl-1 seedlings exhibit several phenotypes: swollen organs, short hypocotyls in light and dark conditions, and enlarged and multinucleated cells, that altogether suggest cell growth defects. Mutant cells are able to proliferate under in vitro culture conditions. Genomic DNA sequences bordering the transposon were used to recover cDNA from the normal allele. Complementation of the mutant phenotype with the cDNA confirmed that the transposon had caused the mutation. The Ds element was inserted into the first exon of the open reading frame and the homozygous mutant lacked detectable transcript. Phenocopies of the mutant were obtained by an antisense approach. SDL-1 encodes a novel protein found in several plant genomes but apparently missingfrom animal and fungal genomes; the protein is highly conserved and has a potential plastid targeting motif.

  4. 78 FR 13100 - Models for Plant-Specific Adoption of Technical Specifications Task Force Traveler TSTF-535...

    Science.gov (United States)

    2013-02-26

    ... Rulemaking Web site: Go to http://www.regulations.gov and search for Docket ID NRC-2012-0280. Address..., select ``ADAMS Public Documents'' and then select ``Begin Web- based ADAMS Search.'' For problems with... calculation of SDM at the reactor moderator temperature corresponding to the most reactive state throughout...

  5. 76 FR 189 - Notice of Availability of the Models for Plant-Specific Adoption of Technical Specifications Task...

    Science.gov (United States)

    2011-01-03

    ... [pressurized water reactor] Operability Requirements and Actions for RCS [reactor coolant system] Leakage... Specifications (STS) to define a new time limit for restoring inoperable RCS leakage detection instrumentation to... operability of the RCS leakage detection instrumentation. The CLIIP model SE will facilitate expedited...

  6. 75 FR 79048 - Notice of Availability of the Models for Plant-Specific Adoption of Technical Specifications Task...

    Science.gov (United States)

    2010-12-17

    ... [boiling water reactor] Operability Requirements and Actions for RCS [reactor coolant system] Leakage... Specifications (STS) to define a new time limit for restoring inoperable RCS leakage detection instrumentation to... operability of the RCS leakage detection instrumentation. The CLIIP model SE will facilitate expedited...

  7. 76 FR 19510 - Notice of Availability (NOA) of the Models For Plant-Specific Adoption of Technical...

    Science.gov (United States)

    2011-04-07

    ... the addition of a Note to prohibit the use of the provisions of Limiting Condition for Operation 3.0.4... in the Federal Register on May 4, 2005 (70 FR 23238). Federal Rulemaking Web site: Supporting...

  8. 76 FR 66763 - Models for Plant-Specific Adoption of Technical Specifications Task Force Traveler TSTF-510...

    Science.gov (United States)

    2011-10-27

    ....'' TSTF-510, Revision 2, is available in the Agencywide Documents Access and Management System (ADAMS... SG Tube Integrity specification (Limiting Condition for Operation (LCO) 3.4.17, LCO 3.4.20, and LCO 3... address implementation issues associated with the inspection periods, and address other administrative...

  9. An approach for using risk assessment in risk-informed decisions on plant-specific changes to the licensing basis

    International Nuclear Information System (INIS)

    Caruso, Mark A.; Cheok, Michael C.; Cunningham, Mark A.; Holahan, Gary M.; King, Thomas L.; Parry, Gareth W.; Ramey-Smith, Ann M.; Rubin, Mark P.; Thadani, Ashok C.

    1999-01-01

    This paper discusses an acceptable approach that the US Nuclear Regulatory Commission staff has proposed for using Probabilistic Risk Assessment in making decisions on changes to the licensing basis of a nuclear power plant. First, the overall philosophy of risk-informed decision-making, and the process framework are described. The philosophy is encapsulated in five principles, one of which states that, if the proposed change leads to an increase in core damage frequency or risk, the increases must be small and consistent with the intent of the Nuclear Regulatory Commission's Safety Goal Policy Statement. The second part of the paper discusses the use of PRA to demonstrate that this principle has been met. The discussion focuses on the acceptance guidelines, and on comparison of the PRA results with those guidelines. The difficulties that arise because of limitations in scope and analytical uncertainties are discussed and approaches to accommodate these difficulties in the decision-making are described

  10. Root isolations of Metarhizium spp. from crops reflect diversity in the soil and indicate no plant specificity

    DEFF Research Database (Denmark)

    Steinwender, Bernhardt M.; Enkerli, Jürg; Widmer, Franco

    2015-01-01

    elongation factor 1-alpha and characterized by simple sequence repeat (SSR) analysis of 14 different loci. Metarhizium brunneum was the most common species isolated from plant roots (84.1% of all isolates), while M. robertsii (11.1%) and M. majus (4.8%) comprised the remainder. The SSR analysis revealed...

  11. Photo-isomerization induced rapid photo-degradation of optical nonlinearity in cyano substituted stilbene derivative doped poled polymer

    International Nuclear Information System (INIS)

    Yan Jieyun; Liu Liying; Ji Liyong; Ye Mingxin; Xu Lei; Wang Wencheng

    2004-01-01

    We found that, although alpha'-cyano-4'-nitro-4-N, N-dimethylaminostilbene has larger hyperpolarizability than that of conventional 4'-N, N-dimethylamino-nitrostilbene, the addition of the cyano group makes it much more easy to photo-isomerize, thus destroying the molecular ordering in poled chromophore doped polymers. Experimental evidence was obtained by monitoring the second-harmonic generation intensity, UV-Vis absorption spectrum, and FTIR spectrum. The photo-isomerization reaction process was monitored by optical pump induced absorption anisotropy measurement. Comparisons with the behaviour of a azobenzene dye are also made

  12. Pilot trials with a fluorescent whitening agent of the bis(triazoly) stilbene-disulfonic acid type in golden orfes.

    Science.gov (United States)

    Hamburger, B; Maul, W; Patzschke, K; Theidel, H; Wegner, L A

    1975-01-01

    Golden orfes were examined for uptake, distribution, and elimination of radioactivity administered in the form of a 14C-labelled fluorescent whitening agent (FWA) of the bis(triazolyl)stilbenedisulfonic acid type. Results of these studies are given below. Pilot trials using FWA concentrations of 10 and 100 ppb and a population density of 1 fish per liter show that an equilibrium between uptake and elimination of the FWA develops in the animals within a period of one week; i.e., the incorporated traces of the FWA are not irreversibly bound. The radioactivity is mainly located in the gall bladder and in the intestinal contents, as well as in the liver, throat, and gills. The muscular system (filet) is virtually free from activity. Approximately 1-2% of the FWA amount administered per animal (corresponding to the concentration factors of 7-14) can be temporarily detected in the fish. Radioactivity is eliminated comparatively quickly. Two days following the transfer of the fish into water free from FWA a concentration factor as low as 1 is reached, i.e. from this time the FWA concentration in the animals decreases to less than 10 resp. 100 ppb.

  13. Induced changes in phenolic acids and stilbenes in embryogenic cell cultures of Norway spruce by culture filtrate of Ascocalyx abietina

    Czech Academy of Sciences Publication Activity Database

    Cvikrová, Milena; Malá, J.; Hrubcová, Marie; Eder, Josef; Foretová, Soňa

    2008-01-01

    Roč. 115, č. 2 (2008), s. 57-62 ISSN 1861-3829 R&D Projects: GA ČR GA206/04/0999 Institutional research plan: CEZ:AV0Z50380511 Keywords : astringin * isorhapontin * Picea abies Subject RIV: GK - Forestry Impact factor: 0.566, year: 2008 www.jpdp-online.com/QUlEPTYwMjI0NSZNSUQ9NTE4MDImVElYPTAmQVJPT1Q9NjUwMjMmVEVNUF9NQUlOPUpQRFBfUG9ydHJhaXQuaHRt.html?UID=466CB39FC0B29D76D720FE29DE06FB0322678558FE1AD824

  14. 76 FR 72719 - Certain Stilbenic Optical Brightening Agents From China and Taiwan; Scheduling of the Final Phase...

    Science.gov (United States)

    2011-11-25

    ... Optical Brightening Agents From China and Taiwan; Scheduling of the Final Phase of Antidumping... whether an industry in the United States is materially injured or threatened with material injury, or the establishment of an industry in the United States is materially retarded, by reason of less-than-fair-value...

  15. Combining UHPLC-High Resolution MS and Feeding of Stable Isotope Labeled Polyketide Intermediates for Linking Precursors to End Products

    DEFF Research Database (Denmark)

    Klitgaard, Andreas; Frandsen, Rasmus John Normand; Holm, Dorte Koefoed

    2015-01-01

    acid (6-MSA) and 13C14-YWA1, both produced in-house, as well as commercial 13C7-benzoic acid and 2H7-cinnamic acid, in species of Fusarium, Byssochlamys, Aspergillus, and Penicillium. Incorporation of 6-MSA into terreic acid or patulin was not observed in any of six evaluated species covering three...... genera, because the 6-MSA was shunted into (2Z,4E)-2-methyl-2,4-hexadienedioic acid. This indicates that patulin and terreic acid may be produced in a closed compartment of the cell and that (2Z,4E)-2-methyl-2,4-hexadienedioic acid is a detoxification product toward terreic acid and patulin. In Fusarium...

  16. A Mononuclear Iron-Dependent Methyltransferase Catalyzes Initial Steps in Assembly of the Apratoxin A Polyketide Starter Unit.

    Science.gov (United States)

    Skiba, Meredith A; Sikkema, Andrew P; Moss, Nathan A; Tran, Collin L; Sturgis, Rebecca M; Gerwick, Lena; Gerwick, William H; Sherman, David H; Smith, Janet L

    2017-12-15

    Natural product biosynthetic pathways contain a plethora of enzymatic tools to carry out difficult biosynthetic transformations. Here, we discover an unusual mononuclear iron-dependent methyltransferase that acts in the initiation steps of apratoxin A biosynthesis (AprA MT1). Fe 3+ -replete AprA MT1 catalyzes one or two methyl transfer reactions on the substrate malonyl-ACP (acyl carrier protein), whereas Co 2+ , Fe 2+ , Mn 2+ , and Ni 2+ support only a single methyl transfer. MT1 homologues exist within the "GNAT" (GCN5-related N-acetyltransferase) loading modules of several modular biosynthetic pathways with propionyl, isobutyryl, or pivaloyl starter units. GNAT domains are thought to catalyze decarboxylation of malonyl-CoA and acetyl transfer to a carrier protein. In AprA, the GNAT domain lacks both decarboxylation and acyl transfer activity. A crystal structure of the AprA MT1-GNAT di-domain with bound Mn 2+ , malonate, and the methyl donor S-adenosylmethionine (SAM) reveals that the malonyl substrate is a bidentate metal ligand, indicating that the metal acts as a Lewis acid to promote methylation of the malonyl α-carbon. The GNAT domain is truncated relative to functional homologues. These results afford an expanded understanding of MT1-GNAT structure and activity and permit the functional annotation of homologous GNAT loading modules both with and without methyltransferases, additionally revealing their rapid evolutionary adaptation in different biosynthetic contexts.

  17. Anti-mycobacterial activity of polyketides from Penicillium sp. endophyte isolated from Garcinia nobilis against Mycobacterium smegmatis

    Directory of Open Access Journals (Sweden)

    Jean Bosco Jouda

    2016-01-01

    Conclusion: Isolated compounds from Penicillium sp. harbored in G. nobilis exhibited promising antimycobacterial activity against M. smegmatis thus supporting the immensity of the potential of antimycobacterial drug discovery from endophytes from medicinal plants. Penialidin C could further be investigated for antimycobacterial drug development.

  18. Anti-mycobacterial activity of polyketides from Penicillium sp. endophyte isolated from Garcinia nobilis against Mycobacterium smegmatis

    OpenAIRE

    Jean Bosco Jouda; Isabelle Kamga Mawabo; Augustin Notedji; Céline Djama Mbazoa; Jean Nkenfou; Jean Wandji; Céline Nguefeu Nkenfou

    2016-01-01

    Objective/background: According to estimates by the World Health Organization, there were 9.6 million new tuberculosis (TB) cases in 2014: 5.4 million among men, 3.2 million among women, and 1.0 million among children. There were also 1.5 million TB deaths. Although there are potent anti-TB molecules, the misuse of these drugs in addition to inconsistent or partial treatment have led to the development of multidrug-resistant TB and extensively drug-resistant TB. It is established that plants ...

  19. Mutational analysis of the myxovirescin biosynthetic gene cluster reveals novel insights into the functional elaboration of polyketide backbones.

    Science.gov (United States)

    Simunovic, Vesna; Müller, Rolf

    2007-07-23

    It has been proposed that two acyl carrier proteins (ACPs)-TaB and TaE--and two 3-hydroxy-3-methylglutaryl synthases (HMGSs)--TaC and TaF--could constitute two functional ACP-HMGS pairs (TaB/TaC and TaE/TaF) responsible for the incorporation of acetate and propionate units into the myxovirescin A scaffold, leading to the formation of beta-methyl and beta-ethyl groups, respectively. It has been suggested that three more proteins--TaX and TaY, which are members of the superfamily of enoyl-CoA hydratases (ECHs), and a variant ketosynthase (KS) TaK--are shared between two ACP-HMGS pairs, to give the complete set of enzymes required to perform the beta-alkylations. The beta-methyl branch is presumably further hydroxylated (by TaH) and methylated to produce the methoxymethyl group observed in myxovirescin A. To substantiate this hypothesis, a series of gene-deletion mutants were created, and the effects of these mutations on myxovirescin production were examined. As predicted, DeltataB and DeltataE ACP mutants revealed similar phenotypes to their associated HMGS mutants DeltataC and DeltataF, respectively, thus providing direct evidence for the role of TaE/TaF in the formation of the beta-ethyl branch and implying a role for TaB/TaC in the formation of the beta-methyl group. Production of myxovirescin A was dramatically reduced in a DeltataK mutant and abolished in both the DeltataX and the DeltataY mutant backgrounds. Analysis of a DeltataH mutant confirmed the role of the cytochrome P450 TaH in hydroxylation of the beta-methyl group. Taken together, these experiments support a model in which the discrete ACPs TaB and TaE are compatible only with their associated HMGSs TaC and TaF, respectively, and function in a substrate-specific manner. Both TaB and TaC are essential for myxovirescin production, and the TaB/TaC pair can rescue antibiotic production in the absence of either TaE or TaF. Finally, the reduced level of myxovirescin production in the DeltataE mutant, relative to the DeltataF strain, suggests an additional function of the TaE ACP.

  20. Polyketides with α-Glucosidase Inhibitory Activity from a Mangrove Endophytic Fungus, Penicillium sp. HN29-3B1.

    Science.gov (United States)

    Liu, Yayue; Yang, Qin; Xia, Guoping; Huang, Hongbo; Li, Hanxiang; Ma, Lin; Lu, Yongjun; He, Lei; Xia, Xuekui; She, Zhigang

    2015-08-28

    Five new compounds, pinazaphilones A and B (1, 2), two phenolic compounds (4, 5), and penicidone D (6), together with the known Sch 1385568 (3), (±)-penifupyrone (7), 3-O-methylfunicone (8), 5-methylbenzene-1,3-diol (9), and 2,4-dihydroxy-6-methylbenzoic acid (10) were obtained from the culture of the endophytic fungus Penicillium sp. HN29-3B1, which was isolated from a fresh branch of the mangrove plant Cerbera manghas collected from the South China Sea. Their structures were determined by analysis of 1D and 2D NMR and mass spectroscopic data. Structures of compounds 4 and 7 were further confirmed by a single-crystal X-ray diffraction experiment using Cu Kα radiation. The absolute configurations of compounds 1-3 were assigned by quantum chemical calculations of the electronic circular dichroic spectra. Compounds 2, 3, 5, and 7 inhibited α-glucosidase with IC50 values of 28.0, 16.6, 2.2, and 14.4 μM, respectively, and are thus more potent than the positive control, acarbose.

  1. Penicyclones A-E, Antibacterial Polyketides from the Deep-Sea-Derived Fungus Penicillium sp. F23-2.

    Science.gov (United States)

    Guo, Wenqiang; Zhang, Zhenzhen; Zhu, Tianjiao; Gu, Qianqun; Li, Dehai

    2015-11-25

    Five new ambuic acid analogues, penicyclones A-E (1-5), were isolated from the extract of the deep-sea-derived fungus Penicillium sp. F23-2. The structures including the absolute configurations were established by interpretation of NMR and MS data, as well as the application of ECD, X-ray crystallography, and a chemical conversion, as well as the TDDFT-ECD calculations. Penicyclones A-E (1-5) exhibited antimicrobial activity against the Gram-positive bacterium Staphylococcus aureus with MIC values ranging from 0.3 to 1.0 μg/mL.

  2. Batch-processing of imaging or liquid-chromatography mass spectrometry datasets and De Novo sequencing of polyketide siderophores

    Czech Academy of Sciences Publication Activity Database

    Novák, Jiří; Sokolová, Lucie; Lemr, Karel; Pluháček, Tomáš; Palyzová, Andrea; Havlíček, Vladimír

    2017-01-01

    Roč. 1865, č. 7 (2017), s. 768-775 ISSN 1570-9639 R&D Projects: GA ČR(CZ) GA16-20229S; GA MŠk(CZ) LO1509 Institutional support: RVO:61388971 Keywords : Mass spectrometry imaging * De novo sequencing * Siderophores Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 2.773, year: 2016

  3. Epigenetic control of root and nodule development : the role of plant-specific histone deacetylases and LHP1 in root cell reprogramming

    NARCIS (Netherlands)

    Schilderink, S.

    2012-01-01

    In plants, unlike in animals, most organs develop post embryonically. These organs originate from clusters of undifferentiated dividing cells that form so-called meristems. Differentiated cells can be re-activated to enter the cell cycle and to ultimately give rise to new meristems. These

  4. Deterministic Safety Analysis for Nuclear Power Plants. Specific Safety Guide (Spanish Edition); Analisis determinista de seguridad para centrales nucleares. Guia de Seguridad Especifica

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2012-12-15

    The IAEA's Statute authorizes the Agency to establish safety standards to protect health and minimize danger to life and property - standards which the IAEA must use in its own operations, and which a State can apply by means of its regulatory provisions for nuclear and radiation safety. A comprehensive body of safety standards under regular review, together with the IAEA's assistance in their application, has become a key element in a global safety regime. In the mid-1990s, a major overhaul of the IAEA's safety standards programme was initiated, with a revised oversight committee structure and a systematic approach to updating the entire corpus of standards. The new standards that have resulted are of a high calibre and reflect best practices in Member States. With the assistance of the Commission on Safety Standards, the IAEA is working to promote the global acceptance and use of its safety standards. Safety standards are only effective, however, if they are properly applied in practice. The IAEA's safety services - which range in scope from engineering safety, operational safety, and radiation, transport and waste safety to regulatory matters and safety culture in organizations - assist Member States in applying the standards and appraise their effectiveness. These safety services enable valuable insights to be shared and I continue to urge all Member States to make use of them. Regulating nuclear and radiation safety is a national responsibility, and many Member States have decided to adopt the IAEA's safety standards for use in their national regulations. For the contracting parties to the various international safety conventions, IAEA standards provide a consistent, reliable means of ensuring the effective fulfilment of obligations under the conventions. The standards are also applied by designers, manufacturers and operators around the world to enhance nuclear and radiation safety in power generation, medicine, industry, agriculture, research and education. The IAEA takes seriously the enduring challenge for users and regulators everywhere: that of ensuring a high level of safety in the use of nuclear materials and radiation sources around the world. Their continuing utilization for the benefit of humankind must be managed in a safe manner, and the IAEA safety standards are designed to facilitate the achievement of that goal.

  5. Plant-specific histone deacetylases HDT1/2 regulate GIBBERELLIN 2-OXIDASE2 expression to control arabidopsis root meristem cell number

    NARCIS (Netherlands)

    Li, Huchen; Torres-Garcia, Jesus; Latrasse, David; Benhamed, Moussa; Schilderink, Stefan; Zhou, Wenkun; Kulikova, Olga; Hirt, Heribert; Bisseling, Ton

    2017-01-01

    Root growth is modulated by environmental factors and depends on cell production in the root meristem (RM). New cells in the meristem are generated by stem cells and transit-amplifying cells, which together determine RM cell number. Transcription factors and chromatin-remodeling factors have been

  6. Step-wise and lineage-specific diversification of plant RNA polymerase genes and origin of the largest plant-specific subunits.

    Science.gov (United States)

    Wang, Yaqiong; Ma, Hong

    2015-09-01

    Proteins often function as complexes, yet little is known about the evolution of dissimilar subunits of complexes. DNA-directed RNA polymerases (RNAPs) are multisubunit complexes, with distinct eukaryotic types for different classes of transcripts. In addition to Pol I-III, common in eukaryotes, plants have Pol IV and V for epigenetic regulation. Some RNAP subunits are specific to one type, whereas other subunits are shared by multiple types. We have conducted extensive phylogenetic and sequence analyses, and have placed RNAP gene duplication events in land plant history, thereby reconstructing the subunit compositions of the novel RNAPs during land plant evolution. We found that Pol IV/V have experienced step-wise duplication and diversification of various subunits, with increasingly distinctive subunit compositions. Also, lineage-specific duplications have further increased RNAP complexity with distinct copies in different plant families and varying divergence for subunits of different RNAPs. Further, the largest subunits of Pol IV/V probably originated from a gene fusion in the ancestral land plants. We propose a framework of plant RNAP evolution, providing an excellent model for protein complex evolution. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  7. Reduced uncertainty of regional scale CLM predictions of net carbon fluxes and leaf area indices with estimated plant-specific parameters

    Science.gov (United States)

    Post, Hanna; Hendricks Franssen, Harrie-Jan; Han, Xujun; Baatz, Roland; Montzka, Carsten; Schmidt, Marius; Vereecken, Harry

    2016-04-01

    Reliable estimates of carbon fluxes and states at regional scales are required to reduce uncertainties in regional carbon balance estimates and to support decision making in environmental politics. In this work the Community Land Model version 4.5 (CLM4.5-BGC) was applied at a high spatial resolution (1 km2) for the Rur catchment in western Germany. In order to improve the model-data consistency of net ecosystem exchange (NEE) and leaf area index (LAI) for this study area, five plant functional type (PFT)-specific CLM4.5-BGC parameters were estimated with time series of half-hourly NEE data for one year in 2011/2012, using the DiffeRential Evolution Adaptive Metropolis (DREAM) algorithm, a Markov Chain Monte Carlo (MCMC) approach. The parameters were estimated separately for four different plant functional types (needleleaf evergreen temperate tree, broadleaf deciduous temperate tree, C3-grass and C3-crop) at four different sites. The four sites are located inside or close to the Rur catchment. We evaluated modeled NEE for one year in 2012/2013 with NEE measured at seven eddy covariance sites in the catchment, including the four parameter estimation sites. Modeled LAI was evaluated by means of LAI derived from remotely sensed RapidEye images of about 18 days in 2011/2012. Performance indices were based on a comparison between measurements and (i) a reference run with CLM default parameters, and (ii) a 60 instance CLM ensemble with parameters sampled from the DREAM posterior probability density functions (pdfs). The difference between the observed and simulated NEE sum reduced 23% if estimated parameters instead of default parameters were used as input. The mean absolute difference between modeled and measured LAI was reduced by 59% on average. Simulated LAI was not only improved in terms of the absolute value but in some cases also in terms of the timing (beginning of vegetation onset), which was directly related to a substantial improvement of the NEE estimates in spring. In order to obtain a more comprehensive estimate of the model uncertainty, a second CLM ensemble was set up, where initial conditions and atmospheric forcings were perturbed in addition to the parameter estimates. This resulted in very high standard deviations (STD) of the modeled annual NEE sums for C3-grass and C3-crop PFTs, ranging between 24.1 and 225.9 gC m-2 y-1, compared to STD = 0.1 - 3.4 gC m-2 y-1 (effect of parameter uncertainty only, without additional perturbation of initial states and atmospheric forcings). The higher spread of modeled NEE for the C3-crop and C3-grass indicated that the model uncertainty was notably higher for those PFTs compared to the forest-PFTs. Our findings highlight the potential of parameter and uncertainty estimation to support the understanding and further development of land surface models such as CLM.

  8. Arabidopsis RecQsim, a plant-specific member of the RecQ helicase family, can suppress the MMS hypersensitivity of the yeast sgs1 mutant

    NARCIS (Netherlands)

    Bagherieh-Najjar, MB; de Vries, OMH; Kroon, JTM; Wright, EL; Elborough, KM; Hille, J; Dijkwel, PP

    The Arabidopsis genome contains seven genes that belong to the RecQ family of ATP-dependent DNA helicases. RecQ members in Saccharomyces cerevisiae (SGS1) and man (WRN, BLM and RecQL4) are involved in DNA recombination, repair and genome stability maintenance, but little is known about the function

  9. The nucleobase cation symporter 1 of Chlamydomonas reinhardtii and that of the evolutionarily distant Arabidopsis thaliana display parallel function and establish a plant-specific solute transport profile.

    Science.gov (United States)

    Schein, Jessica R; Hunt, Kevin A; Minton, Janet A; Schultes, Neil P; Mourad, George S

    2013-09-01

    The single cell alga Chlamydomonas reinhardtii is capable of importing purines as nitrogen sources. An analysis of the annotated C. reinhardtii genome reveals at least three distinct gene families encoding for known nucleobase transporters. In this study the solute transport and binding properties for the lone C. reinhardtii nucleobase cation symporter 1 (CrNCS1) are determined through heterologous expression in Saccharomyces cerevisiae. CrNCS1 acts as a transporter of adenine, guanine, uracil and allantoin, sharing similar - but not identical - solute recognition specificity with the evolutionary distant NCS1 from Arabidopsis thaliana. The results suggest that the solute specificity for plant NCS1 occurred early in plant evolution and are distinct from solute transport specificities of single cell fungal NCS1 proteins. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  10. Epoxide hydrolase-catalyzed enantioselective conversion of trans-stilbene oxide: Insights into the reaction mechanism from steady-state and pre-steady-state enzyme kinetics

    Czech Academy of Sciences Publication Activity Database

    Archelas, A.; Zhao, W.; Faure, B.; Iacazio, G.; Kotík, Michael

    2016-01-01

    Roč. 591, FEB 2016 (2016), s. 66-75 ISSN 0003-9861 Institutional support: RVO:61388971 Keywords : Catalytic mechanism * Epoxide hydrolase * Electrophilic catalysis Subject RIV: CE - Biochemistry Impact factor: 3.165, year: 2016

  11. Changes in phenolic acids and stilbenes induced in embryogenic cell cultures of Norway spruce by two fractions of Sirococcus strobilinus mycelia

    Czech Academy of Sciences Publication Activity Database

    Malá, J.; Hrubcová, Marie; Máchová, P.; Cvrčková, H.; Martincová, Olga; Cvikrová, Milena

    2011-01-01

    Roč. 57, č. 1 (2011), s. 1-7 ISSN 1212-4834 R&D Projects: GA MZe QH82303 Institutional research plan: CEZ:AV0Z50380511 Keywords : defence response * Norway spruce * phenylpropanoids Subject RIV: GK - Forestry http://www.agriculturejournals.cz/publicFiles/33920.pdf

  12. Benzalacetone Synthase

    Directory of Open Access Journals (Sweden)

    Ikuro eAbe

    2012-03-01

    Full Text Available Benzalacetone synthase, from the medicinal plant Rheum palmatum (Polygonaceae (RpBAS, is a plant-specific chalcone synthase (CHS superfamily of type III polyketide synthase (PKS. RpBAS catalyzes the one-step, decarboxylative condensation of 4-coumaroyl-CoA with malonyl-CoA to produce the C6-C4 benzalacetone scaffold. The X-ray crystal structures of RpBAS confirmed that the diketide-forming activity is attributable to the characteristic substitution of the conserved active-site "gatekeeper" Phe with Leu. Furthermore, the crystal structures suggested that RpBAS employs novel catalytic machinery for the thioester bond cleavage of the enzyme-bound diketide intermediate and the final decarboxylation reaction to produce benzalacetone. Finally, by exploiting the remarkable substrate tolerance and catalytic versatility of RpBAS, precursor-directed biosynthesis efficiently generated chemically and structurally divergent, unnatural novel polyketide scaffolds. These findings provided a structural basis for the functional diversity of the type III PKS enzymes.

  13. Synthetic Studies on Bioactive Natural Polyketides: Intramolecular Nitrile Oxide-Olefin Cycloaddition Approach for Construction of a Macrolactone Skeleton of Macrosphelide B

    Directory of Open Access Journals (Sweden)

    Seung-Mann Paek

    2011-06-01

    Full Text Available Studies on the synthesis of macrosphelide B via an intramolecular nitrile oxide-olefin cycloaddition (INOC is described. In particular, an asymmetric INOC approach using phase transfer catalysts seems to be a potentially efficient and versatile procedure for the construction of the macrolactone skeleton of macrosphelide B in terms of facial selectivity. Our preliminary and unprecedented stereoselective procedure is anticipated to be usefully applied through further studies for the synthesis of the macrosphelide family.

  14. Phenolic polyketides from the co-cultivation of marine-derived Penicillium sp. WC-29-5 and Streptomyces fradiae 007.

    Science.gov (United States)

    Wang, Yi; Wang, Liping; Zhuang, Yibin; Kong, Fandong; Zhang, Cuixian; Zhu, Weiming

    2014-04-04

    Penicillium sp. WC-29-5 was co-cultured with Streptomyces fradiae 007 to produce five natural products (1-3, 4a and 4b) that were isolated and characterized by spectroscopic analysis. Interestingly, these compounds were found to be different from those produced in discrete fungal and bacterial controls. Among these compounds, the absolute configurations of compounds 4a and 4b were determined for the first time by X-ray single crystal diffraction experiments and electronic circular dichroism (ECD) calculations. An evaluation of the cytotoxic activities of these compounds revealed that 4b was moderately cytotoxic towards HL-60 and H1975 tumor cells with IC₅₀ values of 3.73 and 5.73 µM, respectively, whereas compound 4a was only moderately cytotoxic towards H1975 cells with an IC₅₀ value of 3.97 µM.

  15. Phenolic Polyketides from the Co-Cultivation of Marine-Derived Penicillium sp. WC-29-5 and Streptomyces fradiae 007

    Directory of Open Access Journals (Sweden)

    Yi Wang

    2014-04-01

    Full Text Available Penicillium sp. WC-29-5 was co-cultured with Streptomyces fradiae 007 to produce five natural products (1–3, 4a and 4b that were isolated and characterized by spectroscopic analysis. Interestingly, these compounds were found to be different from those produced in discrete fungal and bacterial controls. Among these compounds, the absolute configurations of compounds 4a and 4b were determined for the first time by X-ray single crystal diffraction experiments and electronic circular dichroism (ECD calculations. An evaluation of the cytotoxic activities of these compounds revealed that 4b was moderately cytotoxic towards HL-60 and H1975 tumor cells with IC50 values of 3.73 and 5.73 µM, respectively, whereas compound 4a was only moderately cytotoxic towards H1975 cells with an IC50 value of 3.97 µM.

  16. Comprehensive in Vitro Analysis of Acyltransferase Domain Exchanges in Modular Polyketide Synthases and Its Application for Short-Chain Ketone Production

    DEFF Research Database (Denmark)

    Yuzawa, Satoshi; Deng, Kai; Wang, George

    2017-01-01

    AT domain replacements in most type I PKS modules. To further demonstrate the utility of the optimized AT domain boundary, we have constructed hybrid PKSs to produce industrially important short-chain ketones. Our in vitro and in vivo analysis demonstrated production of predicted ketones without significant...

  17. Chemistry Programme for Water Cooled Nuclear Power Plants. Specific Safety Guide (Russian Edition); Programma po vodno-khimicheskomu rezhimu dlya atomnykh ehlektrostantsij s vodookhlazhdaemymi reaktorami. Spetsial'noe rukovodstvo po bezopasnosti

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2014-02-15

    This publication provides guidance on establishing a high standard chemistry programme in accordance with plant safety policy and regulatory requirements. It will be useful to managers of operating organizations and other staff responsible for supporting or monitoring plant activities and for oversight of the plant chemistry programme, as well as to regulatory bodies. Contents: 1. Introduction; 2. Functions, responsibilities and interfaces; 3. Chemistry programme; 4. Chemistry control; 5. Chemistry aspects of radiation exposure optimization; 6. Chemistry surveillance; 7. Management of chemistry data; 8. Training and qualification; 9. Quality control of chemicals and other substances.

  18. Interactions between plant RING-H2 and plant-specific NAC (NAM/ATAF1/2/CUC2) proteins: RING-H2 molecular specificity and cellular localization

    DEFF Research Database (Denmark)

    Greve, Krestine; Bravo Munoz, Tanja La Cour; Jensen, Michael Krogh

    2003-01-01

    RING miduler, NAC transkriptionsfatorer, abscisinsyre inducerbar, proteinnedbrydning, subcellulær lo......RING miduler, NAC transkriptionsfatorer, abscisinsyre inducerbar, proteinnedbrydning, subcellulær lo...

  19. NCBI nr-aa BLAST: CBRC-TNIG-22-0115 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TNIG-22-0115 ref|YP_001104909.1| putative exporter of polyketide antibiotics-l...ike protein [Saccharopolyspora erythraea NRRL 2338] emb|CAM01984.1| putative exporter of polyketide antibiotics

  20. ORF Alignment: NC_002945 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available ... Crystal Structure Of A Type Iii Polyketide Synthase ... Pks18 From Mycobacterium Tuberculosis... Type Iii Polyketide Synthase ... Pks18 From Mycobacterium Tuberculosis pdb|1TED|A Chain ... A..., Crystal Structure Of A Type Iii Polyketide Synthase ... Pks18 From Mycobacterium Tuberculosis emb|C... pdb|1TED|C Chain ... C, Crystal Structure Of A Type Iii Polyketide Synthase ... Pks18 From Mycobacterium Tuberculos...is pdb|1TED|B Chain ... B, Crystal Structure Of A

  1. ORF Alignment: NC_002755 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available ... Crystal Structure Of A Type Iii Polyketide Synthase ... Pks18 From Mycobacterium Tuberculosis... Type Iii Polyketide Synthase ... Pks18 From Mycobacterium Tuberculosis pdb|1TED|A Chain ... A..., Crystal Structure Of A Type Iii Polyketide Synthase ... Pks18 From Mycobacterium Tuberculosis emb|C... pdb|1TED|C Chain ... C, Crystal Structure Of A Type Iii Polyketide Synthase ... Pks18 From Mycobacterium Tuberculos...is pdb|1TED|B Chain ... B, Crystal Structure Of A

  2. ORF Alignment: NC_000962 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available ... Crystal Structure Of A Type Iii Polyketide Synthase ... Pks18 From Mycobacterium Tuberculosis... Type Iii Polyketide Synthase ... Pks18 From Mycobacterium Tuberculosis pdb|1TED|A Chain ... A..., Crystal Structure Of A Type Iii Polyketide Synthase ... Pks18 From Mycobacterium Tuberculosis emb|C... pdb|1TED|C Chain ... C, Crystal Structure Of A Type Iii Polyketide Synthase ... Pks18 From Mycobacterium Tuberculos...is pdb|1TED|B Chain ... B, Crystal Structure Of A

  3. Binuclear new complexes of dioxouranium (VI) and thorium (IV) with some Schiff bases derived from 4,4'-diamino stilbene-2,2'-disulphonic acid-vanillin and O-vanillin

    International Nuclear Information System (INIS)

    Pujar, M.A.; Siddappa, K.

    1992-01-01

    Dioxouranium (VI) and thorium (IV) form 1:1 (metal:ligand) complexes with some Schiff bases. The complexes have been characterized through elemental analyses, conductance, UV-Visible, IR, NMR, TG data and magnetic susceptibility measurements. They are found to be dimeric with hexa or octa-coordinated arrangement around metal ion moiety. The Fsub(U-O) (mdyn A o ) and the length R UO (A o ) of U-O bond are calculated from the IR data. (author). 8 refs., 1 tab

  4. Mining and polishing of the treasure trove in the bacterial genus streptomyces.

    Science.gov (United States)

    Horinouchi, Sueharu

    2007-02-01

    The complex morphogenesis of the bacterial genus Streptomyces has made this genus a model prokaryote for study of multicellular differentiation, and its ability to produce a wide variety of secondary metabolites has made it an excellent supplier of biologically active substances, including antibiotics. This review summarizes our study of these two characteristics of Streptomyces, focusing on the A-factor regulatory cascade and work derived from the A-factor study. A microbial hormone, A-factor (2-isocapryloyl-3R-hydroxymethyl-gamma-butyrolactone), triggers morphological differentiation and secondary metabolism in Streptomyces griseus. The key steps in the A-factor regulatory cascade, including afsA, encoding the key enzyme for A-factor biosynthesis, arpA, encoding the A-factor receptor, and adpA, encoding a transcriptional activator, are elucidated. The target genes of the regulatory cascade include genes of various functions required for morphological development and secondary metabolite formation. The biosynthesis gene clusters for grixazone and hexahydroxyperylenequinone are examples. The former contains the enzymes for novel benzene ring formation and phenoxazinone formation, and the latter contains enzymes belonging to a type III polyketide synthase and a cytochrome P-450. Enzymes of various catalytic functions in Streptomyces are useful as members of an artificial gene cluster constructed in Escherichia coli for fermentative production of plant-specific flavonoids, including isoflavones and unnatural compounds.

  5. A hybrid non-ribosomal peptide/polyketide synthetase containing fatty-acyl ligase (FAAL) synthesizes the β-amino fatty acid lipopeptides puwainaphycins in the cyanobacterium Cylindrospermum alatosporum

    Czech Academy of Sciences Publication Activity Database

    Mareš, Jan; Hájek, Jan; Urajová, P.; Kopecký, J.; Hrouzek, P.

    2014-01-01

    Roč. 9, č. 11 (2014), e111904 E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GA14-18067S Institutional support: RVO:60077344 Keywords : cyanobacteria * lipopeptides * biosynthesis Subject RIV: CE - Biochemistry Impact factor: 3.234, year: 2014

  6. A Hybrid Non-Ribosomal Peptide/Polyketide Synthetase Containing Fatty-Acyl Ligase (FAAL) Synthesizes the beta-Amino Fatty Acid Lipopeptides Puwainaphycins in the Cyanobacterium Cylindrospermum alatosporum

    Czech Academy of Sciences Publication Activity Database

    Mareš, J.; Hájek, J.; Urajová, Petra; Kopecký, Jiří; Hrouzek, Pavel

    2014-01-01

    Roč. 9, č. 11 (2014) E-ISSN 1932-6203 R&D Projects: GA MŠk ED2.1.00/03.0110; GA ČR GA14-18067S Institutional support: RVO:61388971 Keywords : blue green alga * FAAL * Cylindrospermum alatosporum Subject RIV: CE - Biochemistry Impact factor: 3.234, year: 2014

  7. Aerobic Epoxidation of Olefins Catalyzed by the Cobalt‐Based Metal–Organic Framework STA‐12(Co)

    DEFF Research Database (Denmark)

    Beier, Matthias Josef; Kleist, Wolfgang; Wharmby, Michael T.

    2012-01-01

    , (E)‐stilbene was converted with high selectivities between 80 and 90 %. Leaching of Co was low and the reaction was found to proceed mainly heterogeneously. The catalyst was reusable with only a small loss of activity. The catalytic epoxidation of stilbene with the MOF featured an induction period...

  8. Safeguards Technology Development Program 1st Quarter FY 2018 Report

    Energy Technology Data Exchange (ETDEWEB)

    Prasad, Manoj K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2018-01-10

    LLNL will evaluate the performance of a stilbene-based scintillation detector array for IAEA neutron multiplicity counting (NMC) applications. This effort will combine newly developed modeling methodologies and recently acquired high-efficiency stilbene detector units to quantitatively compare the prototype system performance with the conventional He-3 counters and liquid scintillator alternatives.

  9. FUBT, a putative MFS transporter, promotes secretion of fusaric acid in the cotton pathogen Fusarium oxysporum f.sp. vasinfectum

    Science.gov (United States)

    Fusaric acid (FA), a phytotoxic polyketide produced by Fusarium oxysporum f. sp. vasinfectum (FOV), has been shown to be associated with disease symptoms on cotton. A gene located upstream of the polyketide synthase gene responsible for the biosynthesis of FA is predicted to encode a member of the ...

  10. Microbial platform for production of aromatic compounds

    DEFF Research Database (Denmark)

    Skovbjerg, Christine Alexandra Egaa; Olsen, Kresten Jon Kromphardt; Larsen, Thomas Ostenfeld

    2017-01-01

    Polyketides form the basic building blocks of numerous natural products, which are in use in pharmaceuticals, food additives and other fine chemicals. Many of these polyketides possess very specific cyclic and aromatic conformations. The programmable platform we aim to create will be able...

  11. Biosynthesis of furanochromones in Pimpinella monoica

    Indian Academy of Sciences (India)

    polyketide origin of their aromatic and pyrone rings while the furan ring originates via an acetate-mevalonate pathway. The plant also utilises glycine and leucine as substrate via acetate. Biotransformation of 3-H-visnagin to (6) but not to (2) was also observed. Keywords. Biosynthesis; furochromones; polyketide origin; ...

  12. FXR agonist activity of conformationally constrained analogs of GW 4064.

    Science.gov (United States)

    Akwabi-Ameyaw, Adwoa; Bass, Jonathan Y; Caldwell, Richard D; Caravella, Justin A; Chen, Lihong; Creech, Katrina L; Deaton, David N; Madauss, Kevin P; Marr, Harry B; McFadyen, Robert B; Miller, Aaron B; Navas, Frank; Parks, Derek J; Spearing, Paul K; Todd, Dan; Williams, Shawn P; Bruce Wisely, G

    2009-08-15

    Two series of conformationally constrained analogs of the FXR agonist GW 4064 1 were prepared. Replacement of the metabolically labile stilbene with either benzothiophene or naphthalene rings led to the identification of potent full agonists 2a and 2g.

  13. Tree nut phytochemicals: composition, antioxidant capacity, bioactivity, impact factors. A systematic review of almonds, Brazils, cashews, hazelnuts, macadamias, pecans, pine nuts, pistachios and walnuts

    Science.gov (United States)

    Tree nuts contain an array of phytochemicals including carotenoids, phenolic acids, phytosterols and polyphenolic compounds such as flavonoids, proanthocyanidins (PAC) and stilbenes, all of which are included in nutrient databases, as well as phytates, sphingolipids, alkylphenols and lignans, which ...

  14. Estrogenic activity of constituents from the rhizomes of Rheum undulatum Linné.

    Science.gov (United States)

    Park, SeonJu; Kim, Yun Na; Kwak, Hee Jae; Jeong, Eun Ju; Kim, Seung Hyun

    2018-02-15

    Stilbenes have been reported to be phytoestrogen compounds owing to its structural similarity to the estrogenic agent diethylstilbestrol. To find new stilbene-derivative phytoestrogens, isolation of stilbene-rich R. undulatum was performed and led to identify six new compounds (1-5 and 28), one newly determined absolute configurations compound (27) together with 21 previously reported compounds (6-26). The structures of compounds were determined on the basis of extensive spectroscopic methods including 1D and 2D NMR and CD spectra data. All the isolated compounds were tested for their estrogenic activities in HepG2 cells transiently transfected with ERα, ERβ and ERE-reporter plasmid. Among them, stilbene-derivatives, piceatannol 3'-O-β-d-xylopyranoside (12), cis-rhaponticin (16) and rhapontigenin 3'-O-β-d-glucopyranoside (17), showed the more potent binding affinity for estrogen receptors than 17β-estrodiol. Copyright © 2018 Elsevier Ltd. All rights reserved.

  15. Biosynthesis of the major tetrahydroxystilbenes in spruce, astringin and isorhapontin, proceeds via resveratrol and is enhanced by fungal infection.

    Science.gov (United States)

    Hammerbacher, Almuth; Ralph, Steven G; Bohlmann, Joerg; Fenning, Trevor M; Gershenzon, Jonathan; Schmidt, Axel

    2011-10-01

    Stilbenes are dibenzyl polyphenolic compounds produced in several unrelated plant families that appear to protect against various biotic and abiotic stresses. Stilbene biosynthesis has been well described in economically important plants, such as grape (Vitis vinifera), peanut (Arachis hypogaea), and pine (Pinus species). However, very little is known about the biosynthesis and ecological role of stilbenes in spruce (Picea), an important gymnosperm tree genus in temperate and boreal forests. To investigate the biosynthesis of stilbenes in spruce, we identified two similar stilbene synthase (STS) genes in Norway spruce (Picea abies), PaSTS1 and PaSTS2, which had orthologs with high sequence identity in sitka (Picea sitchensis) and white (Picea glauca) spruce. Despite the conservation of STS sequences in these three spruce species, they differed substantially from angiosperm STSs. Several types of in vitro and in vivo assays revealed that the P. abies STSs catalyze the condensation of p-coumaroyl-coenzyme A and three molecules of malonyl-coenzyme A to yield the trihydroxystilbene resveratrol but do not directly form the dominant spruce stilbenes, which are tetrahydroxylated. However, in transgenic Norway spruce overexpressing PaSTS1, significantly higher amounts of the tetrahydroxystilbene glycosides, astringin and isorhapontin, were produced. This result suggests that the first step of stilbene biosynthesis in spruce is the formation of resveratrol, which is further modified by hydroxylation, O-methylation, and O-glucosylation to yield astringin and isorhapontin. Inoculating spruce with fungal mycelium increased STS transcript abundance and tetrahydroxystilbene glycoside production. Extracts from STS-overexpressing lines significantly inhibited fungal growth in vitro compared with extracts from control lines, suggesting that spruce stilbenes have a role in antifungal defense.

  16. Identification of the Biosynthetic Gene Clusters for the Lipopeptides Fusaristatin A and W493 B in Fusarium graminearum and F. pseudograminearum

    DEFF Research Database (Denmark)

    Sørensen, Jens Laurids; Sondergaard, Teis Esben; Covarelli, Lorenzo

    2014-01-01

    The closely related species Fusarium graminearum and Fusarium pseudograminearum differ in that each contains a gene cluster with a polyketide synthase (PKS) and a nonribosomal peptide synthetase (NRPS) that is not present in the other species. To identify their products, we deleted PKS6 and NRPS7...... Fusarium species. On the basis of genes in the putative gene clusters we propose a model for biosynthesis where the polyketide product is shuttled to the NPRS via a CoA ligase and a thioesterase in F. pseudograminearum. In F. graminearum the polyketide is proposed to be directly assimilated by the NRPS....

  17. Associateship | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Fellowship; Associateship. Associate Profile. Period: 2002–2006. Ranganathan, Dr Anand. Date of birth: 4 December 1972. Specialization: Polyketide Syntheses, Mycobacterium Tuberculosis Pathogenesis Address during Associateship: International Centre for Genetic, Engineering & Biotechnology, P.B. No. 10504 ...

  18. Biogenesis of antibiotics-viewing its history and glimpses of the future

    Czech Academy of Sciences Publication Activity Database

    Spížek, Jaroslav; Sigler, Karel; Řezanka, Tomáš; Demain, A.

    2016-01-01

    Roč. 61, č. 4 (2016), s. 347-358 ISSN 0015-5632 Institutional support: RVO:61388971 Keywords : STREPTOMYCES-GLAUCESCENS * POLYKETIDE SYNTHASE * SYNTHETIC BIOLOGY Subject RIV: EI - Biotechnology ; Bionics Impact factor: 1.521, year: 2016

  19. Genome-Wide Transposon Mutagenesis Indicates that Mycobacterium marinum Customizes Its Virulence Mechanisms for Survival and Replication in Different Hosts

    KAUST Repository

    Weerdenburg, Eveline M.; Abdallah, Abdallah; Rangkuti, Farania; Abd El Ghany, Moataz; Otto, Thomas D.; Adroub, Sabir; Molenaar, Douwe; Ummels, Roy; ter Veen, Kars; van Stempvoort, Gunny; van der Sar, Astrid M.; Ali, Shahjahan; Langridge, Gemma C.; Thomson, Nicholas R.; Pain, Arnab; Bitter, Wilbert

    2015-01-01

    the type VII protein secretion system ESX-1, biosynthesis of polyketide lipids, and utilization of sterols. However, we were also able to show that M. marinum contains an even larger set of host-specific virulence determinants, including proteins involved

  20. Biosynthetic Studies of 13-Desmethylspirolide C Produced by Alexandrium ostenfeldii (= A. peruvianum): Rationalization of the Biosynthetic Pathway Following Incorporation of (13)C-Labeled Methionine and Application of the Odd-Even Rule of Methylation.

    Science.gov (United States)

    Anttila, Matthew; Strangman, Wendy; York, Robert; Tomas, Carmelo; Wright, Jeffrey L C

    2016-03-25

    Understanding the biosynthesis of dinoflagellate polyketides presents many unique challenges. Because of the remaining hurdles to dinoflagellate genome sequencing, precursor labeling studies remain the only viable way to investigate dinoflagellate biosynthesis. However, prior studies have shown that polyketide chain assembly does not follow any of the established processes. Additionally, acetate, the common precursor for polyketides, is frequently scrambled, thus compromising interpretation. These factors are further compounded by low production yields of the compounds of interest. A recent report on the biosynthesis of spirolides, a group belonging to the growing class of toxic spiroimines, provided some insight into the polyketide assembly process based on acetate labeling studies, but many details were left uncertain. By feeding (13)C methyl-labeled methionine to cultures of Alexandrium ostenfeldii, the producing organism of 13-desmethylspirolide C, and application of the odd-even methylation rule, the complete biosynthetic pathway has been established.

  1. Quantum chemical study of the structure and properties of citrinin

    Science.gov (United States)

    Citrinin is a well known polyketide mycotoxin produced by fungal species that naturally occur in certain agricultural commodities, including red yeast rice. This toxin possesses complex intramolecular hydrogen bonding interactions which influence its mode of action and selective detection. Detailed ...

  2. The enzymology of polyether biosynthesis.

    Science.gov (United States)

    Liu, Tiangang; Cane, David E; Deng, Zixin

    2009-01-01

    Polyether ionophore antibiotics are a special class of polyketides widely used in veterinary medicine, and as food additives in animal husbandry. In this article, we review current knowledge about the mechanism of polyether biosynthesis, and the genetic and biochemical strategies used for its study. Several clear differences distinguish it from traditional type I modular polyketide biosynthesis: polyether backbones are assembled by modular polyketide synthases but are modified by two key enzymes, epoxidase and epoxide hydrolase, to generate the product. All double bonds involved in the oxidative cyclization in the polyketide backbone are of E geometry. Chain release in the polyether biosynthetic pathway requires a special type II thioesterase which specifically hydrolyzes the polyether thioester. All these discoveries should be very helpful for a deep understanding of the biosynthetic mechanism of this class of important natural compounds, and for the targeted engineering of polyether derivatives.

  3. Identification of biomarkers for genotyping Aspergilli using non-linear methods for clustering and classification

    DEFF Research Database (Denmark)

    Kouskoumvekaki, Irene; Yang, Zhiyong; Jonsdottir, Svava Osk

    2008-01-01

    Background: In the present investigation, we have used an exhaustive metabolite profiling approach to search for biomarkers in recombinant Aspergillus nidulans (mutants that produce the 6- methyl salicylic acid polyketide molecule) for application in metabolic engineering. Results: More than 450...

  4. Dicty_cDB: Contig-U03221-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available e) Botryotinia fuckeliana polyketide ... 53 2e-05 AF079138_6( AF079138 |pid:none) Streptomyces venezuelae me...id:none) Saccharopolyspora erythraea NRR... 52 5e-05 AF079138_3( AF079138 |pid:none) Streptomyces venezuelae...Gibberella moniliformis polyketide... 51 8e-05 AF015823_1( AF015823 |pid:none) Streptomyces venezuelae venA

  5. Biosynthesis of fusarielins in Fusarium graminearum

    DEFF Research Database (Denmark)

    Saei, Wagma; Søndergaard, Teis; Giese, Henriette

    Polyketide synthase 9 (PKS9) is one of the 15 identified polyketide synthase (PKS) genes in Fusarium graminearum. The gene is coregulated along with five neighboring genes by a single transcription factor (TF). An overexpression of the transcription factor led to production of three novel...... by this cluster in Fusarium graminearum., deletion mutant of each gene was created in the overexpressed mutant by targeted gene replacemen...

  6. Variability in the Content of Trans-Resveratrol, Trans-ε-Viniferin and R2-Viniferin in Grape Cane of Seven Vitis vinifera L. Varieties during a Three-Year Study.

    Science.gov (United States)

    Tříska, Jan; Vrchotová, Naděžda; Balík, Josef; Soural, Ivo; Sotolář, Radek

    2017-06-03

    Grape canes are a waste product from viticulture that show potential as an industrially extractable source of stilbenes, which are valuable for medical and other purposes. In this work, grape canes collected in three consecutive years (2014-2016) at six different places in South Moravia, Czech Republic were extracted, and the contents of trans -resveratrol, trans -ε-viniferin, and r2-viniferin were determined by high-performance liquid chromatography. The study included three blue grape varieties of Vitis vinifera L. (Cabernet Moravia, Blaufränkisch, and Piwi variety Laurot) and four white grape varieties (Chardonnay, Green Veltliner, Piwi variety Hibernal, and Piwi variety Malverina). From the viewpoint of producing extracts with high stilbenes content, the Hibernal variety is clearly the best. The mean amounts of the stilbenes for this variety at all localities and for all three years were 4.99 g/kg for trans -resveratrol, 3.24 g/kg for trans -ε-viniferin, and 1.73 g/kg for r2-viniferin. The influence of vintage, locality, and variety on the amounts of stilbenes was studied using PCA analysis. In contrast to expectations, there was no strong impact of locality on stilbenes content. The differences were varietal for most varieties, regardless of the area of cultivation. Laurot and Hibernal varieties did differ significantly in that respect, however, as they exhibited clear dependence on location.

  7. The O-methyltransferase PMT2 mediates methylation of pinosylvin in Scots pine.

    Science.gov (United States)

    Paasela, Tanja; Lim, Kean-Jin; Pietiäinen, Milla; Teeri, Teemu H

    2017-06-01

    Heartwood extractives are important determinants of the natural durability of pine heartwood. The most important phenolic compounds affecting durability are the stilbenes pinosylvin and its monomethylether, which in addition have important functions as phytoalexins in active defense. A substantial portion of the synthesized pinosylvin is 3-methoxylated but the O-methyltransferase responsible for this modification has not been correctly identified. We studied the expression of the stilbene pathway during heartwood development as well as in response to wounding of xylem and UV-C treatment of needles. We isolated and enzymatically characterized a novel O-methyltransferase, PMT2. The methylated product was verified as pinosylvin monomethylether using ultra performance liquid chromatography-tandem mass spectrometry and high performance liquid chromatography analyses. The PMT2 enzyme was highly specific for stilbenes as substrate, in contrast to caffeoyl-CoA O-methyltransferase (CCoAOMT) and PMT1 that were multifunctional. Expression profile and multifunctional activity of CCoAOMT suggest that it might have additional roles outside lignin biosynthesis. PMT1 is not involved in the stilbene pathway and its biological function remains an open question. We isolated a new specific O-methyltransferase responsible for 3-methoxylation of pinosylvin. Expression of PMT2 closely follows stilbene biosynthesis during developmental and stress induction. We propose that PMT2 is responsible for pinosylvin methylation in Scots pine (Pinus sylvestris), instead of the previously characterized methyltransferase, PMT1. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  8. The use of dendrimers as high-performance shells for round-trip energy transfer: efficient trans-cis photoisomerization from an excited triplet state produced within a dendrimer shell.

    Science.gov (United States)

    Miura, Yousuke; Momotake, Atsuya; Takeuchi, Keiichirou; Arai, Tatsuo

    2011-01-01

    A series of stilbene-cored poly(benzyl ether) dendrimers with benzophenone peripheries were synthesized and their photophysical and photochemical properties were studied. Fluorescence studies revealed that singlet-singlet energy transfer (SSET) from the stilbene core to the benzophenone units took place efficiently in dendrimers of all generations. Similarly, phosphorescence and time-resolved spectroscopic measurements indicated efficient triplet-triplet energy transfer (TTET) from the benzophenone periphery to the stilbene core. Upon excitation at 310 nm, the stilbene core isomerizes via an energy round trip within the dendrimer shell. The quantum yields for the energy round trip (Φ(ERT)), defined as the product of the quantum yields of SSET, intersystem crossing, and TTET (Φ(ERT) = Φ(SS)Φ(isc)Φ(TT)), were extremely high for all generations--99%, 95% and 94% for G1, G2, and G3, respectively--which means that the excitation energy of the dendrimer core was transferred to the dendrimer periphery and back to the core almost quantitatively. The quantum yield for photoisomerization of G1-G3 via an energy round trip was higher than for other stilbene-cored dendrimers, which mainly isomerize from the excited singlet state. Photostability in the dendrimers was also demonstrated and discussed.

  9. Synthesis and characterization of tunable coumarin- linked glasses as new class of organic/inorganic phosphors

    Energy Technology Data Exchange (ETDEWEB)

    Luridiana, Alberto; Pretta, Gianluca; Secci, Francesco; Frongia, Angelo [Dipartimento di Scienze Chimiche e Geologiche, Università degli Studi di Cagliari, Complesso universitario di Monserrato, SS 554, bivio per Sestu, Monserrato (Canada) (Italy); Chiriu, Daniele; Carbonaro, Carlo Maria; Corpino, Riccardo [Dipartimento di Fisica, Università degli Studi di Cagliari, Complesso universitario di Monserrato, SS 554, bivio per Sestu, Monserrato (Canada) (Italy); Ricci, Pier Carlo, E-mail: carlo.ricci@dsf.unica.it [Dipartimento di Fisica, Universitá degli Studi di Cagliari, S.P. Monserrato-Sestu Km 0,700, 09042 Monserrato (Canada) (Italy)

    2014-10-21

    It is well known that stilbene with a trans conformation is highly fluorescent. From the viewpoint of molecular structure, coumarins bear a carbon-carbon double bond which is fixed as trans conformation as in trans-stilbene through a lactone structure. This can help to avoid the trans-cis transformation of the double bond under ultraviolet (UV) irradiation as observed in stilbene compounds and results in strong fluorescence and high fluorescence quantum yield and photostability in most of coumarin derivatives. Herein we report some preliminary results about the synthesis and spectroscopic characterization of tunable coumarins and the development of a new linkage protocol for the obtainment of monolayer coumarin-covalently linked glasses. The resulting organic/inorganic coumarin/silica based Self-Assembled Monolayer (SMA) film is proposed as new phosphors for the substituting of critical raw materials, like rare earths, in photonics applications.

  10. Neutron spectrometry with organic scintillation detector; Espectrometria de nuetrones con cristales de centelleo organicos

    Energy Technology Data Exchange (ETDEWEB)

    Butragueno Casdo, J L

    1972-07-01

    This work describes a fast neutron spectrometer using a stilbene crystal as head detector with pulse shape discrimination (P.S.D.) to reject gamma background. Tre experimental procedure involves the P.S.D., the measurements to calibrate the spectrometer and the corrections for several factors, mainly the non-linear response of the stilbene. Results of the measurements with the reaction D{sup 2}(d,n)He{sup 3}, and with an Am-Be neutron source are presented. It is also presented the measurement of the spectrum of the fast reactor CCRAl-1. (Author) 17 refs.

  11. Fast neutron spectrometer with pulse shape discrimination

    International Nuclear Information System (INIS)

    Verbitsky, S.S.

    1978-01-01

    A fast neutron spectrometer with a stilbene single crystal designed to operate at high pulsed count rate has been described. Making use of identification and rejection of events, accompanied by pile-up, allowed to increase permissible count rates by an order of magnitude. The results of energy dependence of signal amplitude and shape relative anisotropy in stilbene in the range 4-10 and 2-8 MeV respectively have been presented. Taking into account anisotropy of the detector-scintillation properties allowed to improve particle discrimination. (Auth.)

  12. Graphene oxide catalyzed cis-trans isomerization of azobenzene

    Directory of Open Access Journals (Sweden)

    Dongha Shin

    2014-09-01

    Full Text Available We report the fast cis-trans isomerization of an amine-substituted azobenzene catalyzed by graphene oxide (GO, where the amine functionality facilitates the charge transfer from azobenzene to graphene oxide in contrast to non-substituted azobenzene. This catalytic effect was not observed in stilbene analogues, which strongly supports the existence of different isomerization pathways between azobenzene and stilbene. The graphene oxide catalyzed isomerization is expected to be useful as a new photoisomerization based sensing platform complementary to GO-based fluorescence quenching methods.

  13. Neutron spectrometry with organic scintillation detector

    International Nuclear Information System (INIS)

    Butragueno Casado, J. L.

    1972-01-01

    This work describes a fast neutron spectrometer using a stilbene crystal as head detector with pulse shape discrimination (P.S.D.) to reject gamma background. Tre experimental procedure involves the P.S.D., the measurements to calibrate the spectrometer and the corrections for several factors, mainly the non-linear response of the stilbene. Results of the measurements with the reaction D 2 (d,n)He 3 , and with an Am-Be neutron source are presented. It is also presented the measurement of the spectrum of the fast reactor CCRAl-1. (Author) 17 refs

  14. Measurements of angular and energy distributions of gamma-rays resulting from neutron interactions in shielding barriers

    International Nuclear Information System (INIS)

    Makarious, A.S.; Maayouf, R.M.A.; Megahid, R.

    1978-01-01

    Measurements of both angular and energy distributions of secondary gamma resulting from interactions of neutrons emerging from one of the ET-RR-1 reactor beam holes, in barriers from iron, lead and water are reported. The measurements were carried out, both with a bare neutron beam and with the beam being transmitted through a B4C. Filter, using a stilbene crystal gamma spectrometer. The spectrometer applies discrimination between neutrons and gammas according to the difference in decay times of the scintillations produced by them in stilbene. The described angular distributions resulted from measurements made at different angles of neutron incidence and with three different thicknesses of each sample

  15. A versatile route to benzodiazocine and spiropyran derivatives ...

    Indian Academy of Sciences (India)

    The photolytic reaction with trans-stilbene resulted in the exclusive formation of spiro{2 ,5 ,6 -triphenyl-2H-pyran-. 4 ,3}-benzo[b]thiophene-2-one derivatives. Theoretical calculations have been performed to study the mecha- nism and stereoselectivity of products. Good yield and broad scope of usable substrates of industrial ...

  16. Journal of Chemical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    The photolytic reaction with trans-stilbene resulted in the exclusive formation of spiro{2',5',6'-triphenyl-2H-pyran-4',3}-benzo[b]thiophene-2-one derivatives. Theoretical calculations have been performed to study the mechanism and stereoselectivity of products. Good yield and broad scope of usable substrates of industrial ...

  17. Effects of diterpene acids on components of a conifer bark beetle-fungal interaction : tolerance by Ips pini and sensitivity by its associate Ophiostoma ips

    Science.gov (United States)

    Brian J. Kopper; Barbara L. Illman; Philip J. Kersten; Kier D. Klepzig; Kenneth F. Raffa

    2005-01-01

    Conifer resin and phloem tissue contain several phytochemical groups, composed primarily of monoterpenes, diterpene acids, and stilbene phenolics. The effects of monoterpenes and phenolics on stem-colonizing bark beetles and their associated microorganisms have been studied to some extent, but the roles of diterpene acids are largely unknown. Diterpene acids are known...

  18. Effects of diterpene acids on components of a conifer bark beetle–fungal interaction: tolerance by Ips pini and sensitivity by its associate Ophiostoma ips

    Science.gov (United States)

    Brian J. Kopper; Barbara L. Illman; Philip J. Kersten; Kier D. Klepzig; Kenneth F. Raffa

    2005-01-01

    Conifer resin and phloem tissue contain several phytochemical groups,composed primarily of monoterpenes,diterpene acids, and stilbene phenolics. The effects of monoterpenes and phenolics on stem-colonizing bark beetles and their associated microorganisms have been studied to some extent, but the roles of diterpene acids are largely unknown. Diterpene acids are known to...

  19. Partitioning of resveratrol between pentane and DMSO

    DEFF Research Database (Denmark)

    Shen, Chen; Stein, Paul C.; Klösgen-Buchkremer, Beate Maria

    2015-01-01

    Partitioning of trans-3,5,4′-trihydroxy-stilbene (resveratrol) between n-pentane and DMSO was investigated as a contribution to understand the interaction between resveratrol and biomembranes. In order to determine the partition coefficient P* of resveratrol between pentane and DMSO, resveratrol ...

  20. Uji Aktivitas Antioksidan Ekstrak Air dan Ekstrak Etanol Daun Kelor (Moringa Oleifera LAM)

    OpenAIRE

    Rizkayanti, Rizkayanti; Diah, Anang Wahid M; Jura, Minarni Rama

    2017-01-01

    Moringa (moringa oleifera Lam) leaves contains many molecules as inhibitors for free radicals such as phenolic compounds (phenolic acids, flavonoids, quinones, coumarins, lignans, stilbenes, tannins), nitrogen compounds (alkaloids, amines, betalain), vitamins, terpenoids (including carotenoids), and several other endogenous metabolites as antioxidants. This study aimed to determine the antioxidant potency of water and ethanol extracts of moringa (moringa oleifera Lam) leave obtained by macera...

  1. Resveratrol and pterostilbene epigenetically restore PTEN expression by targeting OncomiRs of the miR-17 family in prostate cancer

    Science.gov (United States)

    In recent years, not only has the role of miRNAs in cancer become increasingly clear but also their utilization as potential biomarkers and therapeutic targets has also gained ground. Although the importance of dietary stilbenes such as resveratrol and pterostilbene as anti-cancer agents is well rec...

  2. Antimicrobial Activity of Resveratrol Analogues

    Directory of Open Access Journals (Sweden)

    Malik Chalal

    2014-06-01

    Full Text Available Stilbenes, especially resveratrol and its derivatives, have become famous for their positive effects on a wide range of medical disorders, as indicated by a huge number of published studies. A less investigated area of research is their antimicrobial properties. A series of 13 trans-resveratrol analogues was synthesized via Wittig or Heck reactions, and their antimicrobial activity assessed on two different grapevine pathogens responsible for severe diseases in the vineyard. The entire series, together with resveratrol, was first evaluated on the zoospore mobility and sporulation level of Plasmopara viticola (the oomycete responsible for downy mildew. Stilbenes displayed a spectrum of activity ranging from low to high. Six of them, including the most active ones, were subsequently tested on the development of Botrytis cinerea (fungus responsible for grey mold. The results obtained allowed us to identify the most active stilbenes against both grapevine pathogens, to compare the antimicrobial activity of the evaluated series of stilbenes, and to discuss the relationship between their chemical structure (number and position of methoxy and hydroxy groups and antimicrobial activity.

  3. Conformationally constrained farnesoid X receptor (FXR) agonists: Naphthoic acid-based analogs of GW 4064.

    Science.gov (United States)

    Akwabi-Ameyaw, Adwoa; Bass, Jonathan Y; Caldwell, Richard D; Caravella, Justin A; Chen, Lihong; Creech, Katrina L; Deaton, David N; Jones, Stacey A; Kaldor, Istvan; Liu, Yaping; Madauss, Kevin P; Marr, Harry B; McFadyen, Robert B; Miller, Aaron B; Navas, Frank; Parks, Derek J; Spearing, Paul K; Todd, Dan; Williams, Shawn P; Wisely, G Bruce

    2008-08-01

    Starting from the known FXR agonist GW 4064 1a, a series of stilbene replacements were prepared. The 6-substituted 1-naphthoic acid 1b was an equipotent FXR agonist with improved developability parameters relative to 1a. Analog 1b also reduced the severity of cholestasis in the ANIT acute cholestatic rat model.

  4. Mississippi CaP HBCU Undergraduate Research Training Program

    Science.gov (United States)

    2015-09-01

    risk for African-Americans, obesity and medical distrust contribute to high rates of PCa in Mississippi. The scarcity of minority physicians and...Blue Fighting Prostate Cancer in the Mississippi Delta”. Anait S. Levenson, M.D., Ph.D., UMMC-CI, “Novel epigenetic mechanisms of dietary stilbenes

  5. RAMBAs for Breast Cancer Prevention and Treatment

    Science.gov (United States)

    2009-01-01

    have shown promise for this indication. Recently, the flavonoid kaempferol (Fig. 10a) was shown to inhibit agonist binding to AhR, as well as agonist...that have been identified as potent inhibitors come from diverse chem- ical families including synthetic aromatics, coumarins, flavonoids , and stilbenes

  6. The Oxygenase CAO-1 of Neurospora crassa Is a Resveratrol Cleavage Enzyme

    KAUST Repository

    Diaz-Sanchez, V.; F. Estrada, A.; Limon, M. C.; Al-Babili, Salim; Avalos, J.

    2013-01-01

    The genome of the ascomycete Neurospora crassa encodes CAO-1 and CAO-2, two members of the carotenoid cleavage oxygenase family that target double bonds in different substrates. Previous studies demonstrated the role of CAO-2 in cleaving the C40 carotene torulene, a key step in the synthesis of the C35 apocarotenoid pigment neurosporaxanthin. In this work, we investigated the activity of CAO-1, assuming that it may provide retinal, the chromophore of the NOP-1 rhodopsin, by cleaving β-carotene. For this purpose, we tested CAO-1 activity with carotenoid substrates that were, however, not converted. In contrast and consistent with its sequence similarity to family members that act on stilbenes, CAO-1 cleaved the interphenyl Cα-Cβ double bond of resveratrol and its derivative piceatannol. CAO-1 did not convert five other similar stilbenes, indicating a requirement for a minimal number of unmodified hydroxyl groups in the stilbene background. Confirming its biological function in converting stilbenes, adding resveratrol led to a pronounced increase in cao-1 mRNA levels, while light, a key regulator of carotenoid metabolism, did not alter them. Targeted Δcao-1 mutants were not impaired by the presence of resveratrol, a phytoalexin active against different fungi, which did not significantly affect the growth and development of wild-type Neurospora. However, under partial sorbose toxicity, the Δcao-1 colonies exhibited faster radial growth than control strains in the presence of resveratrol, suggesting a moderate toxic effect of resveratrol cleavage products.

  7. Anti-inflammatory activity of natural stilbenoids: A review

    Czech Academy of Sciences Publication Activity Database

    Dvořáková, Marcela; Landa, Přemysl

    2017-01-01

    Roč. 124, OCT (2017), s. 126-145 ISSN 1043-6618 R&D Projects: GA ČR(CZ) GA16-07193S Institutional support: RVO:61389030 Keywords : Bioavailability * Encapsulation * Inflammation * Metabolites * Multi-targeted therapy * Natural stilbenes Subject RIV: GM - Food Processing OBOR OECD: Biochemistry and molecular biology Impact factor: 4.480, year: 2016

  8. High-performance liquid chromatography separation of unsaturated organic compounds by a monolithic silica column embedded with silver nanoparticles.

    Science.gov (United States)

    Zhu, Yang; Morisato, Kei; Hasegawa, George; Moitra, Nirmalya; Kiyomura, Tsutomu; Kurata, Hiroki; Kanamori, Kazuyoshi; Nakanishi, Kazuki

    2015-08-01

    The optimization of a porous structure to ensure good separation performances is always a significant issue in high-performance liquid chromatography column design. Recently we reported the homogeneous embedment of Ag nanoparticles in periodic mesoporous silica monolith and the application of such Ag nanoparticles embedded silica monolith for the high-performance liquid chromatography separation of polyaromatic hydrocarbons. However, the separation performance remains to be improved and the retention mechanism as compared with the Ag ion high-performance liquid chromatography technique still needs to be clarified. In this research, Ag nanoparticles were introduced into a macro/mesoporous silica monolith with optimized pore parameters for high-performance liquid chromatography separations. Baseline separation of benzene, naphthalene, anthracene, and pyrene was achieved with the theoretical plate number for analyte naphthalene as 36,000 m(-1). Its separation function was further extended to cis/trans isomers of aromatic compounds where cis/trans stilbenes were chosen as a benchmark. Good separation of cis/trans-stilbene with separation factor as 7 and theoretical plate number as 76,000 m(-1) for cis-stilbene was obtained. The trans isomer, however, is retained more strongly, which contradicts the long- established retention rule of Ag ion chromatography. Such behavior of Ag nanoparticles embedded in a silica column can be attributed to the differences in the molecular geometric configuration of cis/trans stilbenes. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Influence of UV and Ozonised Water Treatment on Trans-resveratrol Content in Berry Skins and Juices of Franc and Green Veltliner Grapes

    Czech Academy of Sciences Publication Activity Database

    Landfeld, A.; Tříska, Jan; Balík, J.; Strohalm, J.; Novotná, P.; Vrchotová, Naděžda; Totušek, J.; Lefnerová, D.; Híc, P.; Tománková, E.; Halama, R.; Houška, M.

    2015-01-01

    Roč. 33, č. 3 (2015), s. 267-276 ISSN 1212-1800 R&D Projects: GA MZe QI91B094 Institutional support: RVO:67179843 Keywords : grape juices * stilbens content * UV irradiation * ozonisation Subject RIV: GM - Food Processing Impact factor: 0.728, year: 2015

  10. Selenium-mediated synthesis of biaryls through rearrangement.

    Science.gov (United States)

    Shahzad, Sohail A; Vivant, Clotilde; Wirth, Thomas

    2010-03-19

    A new cyclization of beta-keto ester substituted stilbene derivatives using selenium electrophiles in the presence of Lewis acids is described. Substituted naphthols are obtained through cyclization and subsequent 1,2-rearrangement of aryl groups under very mild reaction conditions.

  11. Antileishmanial activity of piceatannol isolated from Euphorbia lagascae seeds

    NARCIS (Netherlands)

    Duarte, Noelia; Kayser, Oliver; Abreu, Pedro; Ferreira, Maria-Jose U.

    In the search for biologically active compounds from Euphorbia lagascae Spreng, an herbaceous plant native to southeast of Iberic Peninsula, a stilbene, two coumarins and two 1-2-deoxyphorbol diterpene esters were isolated by chromatographic methods, from the methanol extracts of its defatted seeds.

  12. Synthesis of 10-(/sup 3/H)-5H-dibenz(b,f) azepine-5-carboxamide ((/sup 3/H)-carbamazepine)

    Energy Technology Data Exchange (ETDEWEB)

    Brundish, D.E. (Ciba Lab., Horsham (UK))

    1985-01-01

    The title compound has been prepared from bromo derivative at a specific activity of 27 Ci mmol/sup -1/ with radiochemical purity of 98.4% by a selective catalytic reduction with tritium gas. Bromine was replaced without reduction of the stilbene double bond using a poisoned, deactivated catalyst.

  13. The Oxygenase CAO-1 of Neurospora crassa Is a Resveratrol Cleavage Enzyme

    KAUST Repository

    Diaz-Sanchez, V.

    2013-07-26

    The genome of the ascomycete Neurospora crassa encodes CAO-1 and CAO-2, two members of the carotenoid cleavage oxygenase family that target double bonds in different substrates. Previous studies demonstrated the role of CAO-2 in cleaving the C40 carotene torulene, a key step in the synthesis of the C35 apocarotenoid pigment neurosporaxanthin. In this work, we investigated the activity of CAO-1, assuming that it may provide retinal, the chromophore of the NOP-1 rhodopsin, by cleaving β-carotene. For this purpose, we tested CAO-1 activity with carotenoid substrates that were, however, not converted. In contrast and consistent with its sequence similarity to family members that act on stilbenes, CAO-1 cleaved the interphenyl Cα-Cβ double bond of resveratrol and its derivative piceatannol. CAO-1 did not convert five other similar stilbenes, indicating a requirement for a minimal number of unmodified hydroxyl groups in the stilbene background. Confirming its biological function in converting stilbenes, adding resveratrol led to a pronounced increase in cao-1 mRNA levels, while light, a key regulator of carotenoid metabolism, did not alter them. Targeted Δcao-1 mutants were not impaired by the presence of resveratrol, a phytoalexin active against different fungi, which did not significantly affect the growth and development of wild-type Neurospora. However, under partial sorbose toxicity, the Δcao-1 colonies exhibited faster radial growth than control strains in the presence of resveratrol, suggesting a moderate toxic effect of resveratrol cleavage products.

  14. Novel Photochrome Aptamer Switch Assay (PHASA) for adaptive binding to aptamers.

    Science.gov (United States)

    Papper, Vladislav; Pokholenko, Oleksandr; Wu, Yuanyuan; Zhou, Yubin; Jianfeng, Ping; Steele, Terry W J; Marks, Robert S

    2014-11-01

    A novel Photochrome-Aptamer Switch Assay (PHASA) for the detection and quantification of small environmentally important molecules such as toxins, explosives, drugs and pollutants, which are difficult to detect using antibodies-based assays with high sensitivity and specificity, has been developed. The assay is based on the conjugation of a particular stilbene-analyte derivative to any aptamer of interest. A unique feature of the stilbene molecule is its reporting power via trans-cis photoisomerisation (from fluorescent trans-isomer to non-fluorescent cis-isomer) upon irradiation with the excitation light. The resulting fluorescence decay rate for the trans-isomer of the stilbene-analyte depends on viscosity and spatial freedom to rotate in the surrounding medium and can be used to indicate the presence of the analyte. Quantification of the assay is achieved by calibration of the fluorescence decay rate for the amount of the tested analyte. Two different formats of PHASA have been recently developed: direct conjugation and adaptive binding. New stilbene-maleimide derivatives used in the adaptive binding format have been prepared and characterised. They demonstrate effective binding to the model thiol compound and to the thiolated Malachite Green aptamer.

  15. Botanical Extracts as Medical Countermeasures for Radiation Induced DNA Damage

    Science.gov (United States)

    2012-03-01

    20 Figure 9: CYP3A4 inhibition HPLC assay for GSE4 and LT ..................................................... 21...the final stages of this project, Dr. John Arnason at the University of Ottawa for preliminary botanicals information and HPLC data, Aimee Jones for...flavanols, flavonols, stilbenes (resveratrol) and phenolic acids (31, 32). Previous studies have shown that proanthocyanidin (oligomer chain of flavonoid

  16. Synthesis of pterostilbene by Julie Olefination

    Science.gov (United States)

    A simple, stereoselective route for the synthesis of the biologically active compounds trans-pterostilbene and tetramethoxy stilbene from the readily available starting materials 3,5-dimethoxy benzyl alcohol and 4-hydroxy benzaldehyde was developed using Julia olefination as a key reaction....

  17. E-Combretastatin and E-Resveratrol Structural Modifications: Antimicrobial and Cancer Cell Growth Inhibitory Beta-E-Nitrostyrenes

    Science.gov (United States)

    As part of a broad-based SAR investigation of E-resveratrol (strong sirtuin activator and antineoplastic) and the anticancer vascular-targeting combretastatin-type stilbenes, a series of twenty-three beta-E-nitrostyrenes was synthesized in order to evaluate potential antineoplastic, antitubulin poly...

  18. The molecular and genetic basis of conidial pigmentation in Aspergillus niger

    DEFF Research Database (Denmark)

    Jørgensen, Thomas R.; Park, Joohae; Arentshorst, Mark

    2011-01-01

    A characteristic hallmark of Aspergillus niger is the formation of black conidiospores. We have identified four loci involved in spore pigmentation of A. niger by using a combined genomic and classical complementation approach. First, we characterized a newly isolated color mutant, colA, which......-γ-pyrone subclass of polyketides were specifically dependent on fwnA, and funalenone on fwnA, olvA and brnA. Thus, secondary metabolite profiling of the color mutants revealed a close relationship between polyketide synthesis and conidial pigmentation in A. niger....

  19. Draft genome sequence of Penicillium marneffei strain PM1.

    Science.gov (United States)

    Woo, Patrick C Y; Lau, Susanna K P; Liu, Bin; Cai, James J; Chong, Ken T K; Tse, Herman; Kao, Richard Y T; Chan, Che-Man; Chow, Wang-Ngai; Yuen, Kwok-Yung

    2011-12-01

    Penicillium marneffei is the most important thermal dimorphic, pathogenic fungus endemic in China and Southeast Asia and is particularly important in HIV-positive patients. We report the 28,887,485-bp draft genome sequence of P. marneffei, which contains its complete mitochondrial genome, sexual cycle genes, a high diversity of Mp1p homologues, and polyketide synthase genes.

  20. Antagonistic roles of solanapyrone A during sporulation of the chickpea Ascochyta rabiei

    Science.gov (United States)

    Fungi are noted for production of a diverse array of secondary metabolites, many of which are of pharmacological importance. However, the biological roles of these molecules during the fungal life cycle in nature remain elusive. Solanapyrones are polyketide-derived secondary metabolites produced by ...

  1. Dereplication-guided isolation of depsides thielavins S-T and lecanorins D-F from the endophytic fungus Setophoma sp

    DEFF Research Database (Denmark)

    de Medeiros, Livia S.; Abreu, Lucas M.; Nielsen, Anita

    2015-01-01

    highly C-alkylated depsides were isolated and identified as polyketides thielavins S, T, U and V and lecanorins D, E and F. Their structures were elucidated through spectroscopic methods including NMR, HRMS and especially with assistance of HRMS/MS experiments. The compounds were tested for quorum...

  2. Molecular and Chemical Characterization of the Biosynthesis of the 6-MSA-Derived Meroterpenoid Yanuthone D in Aspergillus niger

    DEFF Research Database (Denmark)

    Holm, Dorte Koefoed; Petersen, Lene Maj; Klitgaard, Andreas

    2014-01-01

    Secondary metabolites in filamentous fungi constitute a rich source of bioactive molecules. We have deduced the genetic and biosynthetic pathway of the antibiotic yanuthone D from Aspergillus niger. Our analyses show that yanuthone D is a meroterpenoid derived from the polyketide 6-methylsalicylic...

  3. Molecular characterization of two alkylresorcylic acid synthases from Sordariomycetes fungi

    DEFF Research Database (Denmark)

    Ramakrishnan, Dhivya; Tiwari, Manish Kumar; Manoharan, Gomathi

    2018-01-01

    Two putative type III polyketide synthase genes (PKS) were identified from Sordariomycetes fungi. These two type III PKS genes from Sordaria macrospora (SmPKS) and Chaetomium thermophilum (CtPKS), shared 59.8% sequence identity. Both, full-length and truncated versions of type III PKSs were...

  4. Filling the Gaps in the Kirromycin Biosynthesis: Deciphering the Role of Genes Involved in Ethylmalonyl-CoA Supply and Tailoring Reactions

    DEFF Research Database (Denmark)

    Robertsen, Helene L.; Musiol-Kroll, Ewa M.; Ding, Ling

    2018-01-01

    Kirromycin is the main product of the soil-dwelling Streptomyces collinus Tü 365. The elucidation of the biosynthetic pathway revealed that the antibiotic is synthesised via a unique combination of trans-/cis-AT type I polyketide synthases and non-ribosomal peptide synthetases (PKS I/NRPS). This ...

  5. Utilization of high performance liquid chromatography coupled to tandem mass spectrometry for characterization of 8-O-methylbostrycoidin production by species of the fungus Fusarium

    Science.gov (United States)

    The pigment, 8-O-methylbostrycoidin is a polyketide metabolite produced by multiple species of the fungus Fusarium that infects plant crops, including maize. A technique was developed for the analysis of 8-O-methylbostrycoidin by high performance liquid chromatography coupled to electrospray ionizat...

  6. Development of scalable high throughput fermentation approaches for physiological characterisation of yeast and filamentous fungi

    DEFF Research Database (Denmark)

    Knudsen, Peter Boldsen

    producing the heterologous model polyketide, 6-methylsalicylic acid (6-MSA). An automated methodology for high throughput screening focusing on growth rates, together with a fully automated method for quantitative physiological characterisation in microtiter plates, was established for yeast. Full...

  7. Bioinformatics and structural characterization of a hypothetical protein from Streptococcus mutans

    DEFF Research Database (Denmark)

    Nan, Jie; Brostromer, Erik; Liu, Xiang-Yu

    2009-01-01

    . From the interlinking structural and bioinformatics studies, we have concluded that SMU.440 could be involved in polyketide-like antibiotic resistance, providing a better understanding of this hypothetical protein. Besides, the combination of multiple methods in this study can be used as a general...

  8. On the biosynthetic origin of carminic acid

    DEFF Research Database (Denmark)

    Rasmussen, Silas A.; Kongstad, Kenneth T; Khorsand-Jamal, Paiman

    2018-01-01

    provides solid evidence of a polyketide, rather than a shikimate, origin of coccid pigments. Based on the newly identified compounds, we present a detailed biosynthetic scheme that accounts for the formation of carminic acid (CA) in D. coccus and all described coccid pigments which share a flavokermesic...... distribution suggests a common evolutionary origin for the trait in all coccid dye producing insect species....

  9. Quantitative detection of Fusarium spp. and its correlation with fumonisin content in maize from South African subsistence farmers

    NARCIS (Netherlands)

    Waalwijk, C.; Koch, S.H.; Ncube, E.; Allwood, J.; Flett, B.; Vries, de P.M.; Kema, G.H.J.

    2008-01-01

    A quantitative detection tool was developed to enable the monitoring of fumonisin-producing fungi in food and feed commodities. To this end, a quantitative PCR (TaqMan) was developed that targets a conserved region in the polyketide synthase gene fum1, which is involved in the biosynthesis of

  10. Trichothecenes and aspinolides produced by Trichoderma arundinaceum regulate expression of Botrytis cinerea genes involved in virulence and growth

    Science.gov (United States)

    Trichoderma arundinaceum (Ta37) and Botrytis cinerea (B05.10) produce the sesquiterpenoids harzianum A (HA) and botrydial (BOT), respectively. Ta'Tri5, an HA non-producer mutant, produces high levels of the polyketide compounds aspinolides (Asp) B and C. We analyzed the role of HA and Asp in the B. ...

  11. Ability of secondary metabolites from trichoderma virens to mediate communication during mutualistic or pathogenic interactions

    Science.gov (United States)

    A bioinformatic study was conducted to identify the putative genes in the biocontrol agent Trichoderma virens that encode for non-ribosomal peptide synthetases (NRPS). Gene expression analysis of 22 putative NRPSs and 4 NRPS/PKS (polyketide synthase) hybrid enzymes was conducted in the presence and...

  12. Botrydial and botcinins produced by Botrytis cinerea regulate expression of Trichoderma arundinaceum genes involved in trichothecene biosynthesis

    Science.gov (United States)

    Trichoderma arundinaceum (Ta37) and Botrytis cinerea produce the sesquiterpenes harzianum A (HA) and botrydial (BOT), respectively, and also the polyketides aspinolides (Asp) and botcinines (Botc), respectively. In the present work, we analyzed the role of BOT and Botcs in the T. arundinaceum-B. cin...

  13. Two novel classes of enzymes are required for the biosynthesis of aurofusarin in Fusarium graminearum

    DEFF Research Database (Denmark)

    Frandsen, Rasmus John Normand; Schütt, Claes; Lund, Birgitte W.

    2011-01-01

    genes, aurZ and aurS. Targeted gene replacement of aurZ resulted in the discovery that the compound YWA1, rather than nor-rubrofusarin, is the primary product of F. graminearum polyketide synthase 12 (FgPKS12). AurZ is the first representative of a novel class of dehydratases that act on hydroxylated γ...

  14. Deletion of a regulatory gene within the cpk gene cluster reveals novel antibacterial activity in Streptomyces coelicolor A3(2)

    NARCIS (Netherlands)

    Gottelt, Marco; Kol, Stefan; Gomez-Escribano, Juan Pablo; Bibb, Mervyn; Takano, Eriko

    Genome sequencing of Streptomyces coelicolor A3(2) revealed an uncharacterized type I polyketide synthase gene cluster (cpk) Here we describe the discovery of a novel antibacterial activity (abCPK) and a yellow-pigmented secondary metabolite (yCPK) after deleting a presumed pathway-specific

  15. Insights into horizontal acquisition patterns of dormancy and ...

    Indian Academy of Sciences (India)

    2016-07-22

    Jul 22, 2016 ... ed the horizontal acquisition of fatty acid synthesis genes from α-proteobacteria .... of the genes related to fatty acid, polyketide or lipoprotein metabolism in M. ..... Basic local alignment search tool. J. Mol. Biol. 215 403–410.

  16. Redirection of pigment biosynthesis to isocoumarins in Fusarium

    DEFF Research Database (Denmark)

    Sørensen, Jens Laurids; Nielsen, Kristian Fog; Sondergaard, Teis Esben

    2012-01-01

    Colonies of Fusarium species often appear red due to production of pigments, such as aurofusarin or bikaverin. The primary compounds in these biosynthetic pathways are YWA1 and pre-bikaverin, respectively, catalyzed by two multidomain polyketide synthases (PKSs), which both have a claisen...

  17. Synthesis of complex intermediates for the study of a dehydratase from borrelidin biosynthesis

    Directory of Open Access Journals (Sweden)

    Frank Hahn

    2014-03-01

    Full Text Available Herein, we describe the syntheses of a complex biosynthesis-intermediate analogue of the potent antitumor polyketide borrelidin and of reference molecules to determine the stereoselectivity of the dehydratase of borrelidin polyketide synthase module 3. The target molecules were obtained from a common precursor aldehyde in the form of N-acetylcysteamine (SNAc thioesters and methyl esters in 13 to 15 steps. Key steps for the assembly of the polyketide backbone of the dehydratase substrate analogue were a Yamamoto asymmetric carbocyclisation and a Sakurai allylation as well as an anti-selective aldol reaction. Reference compounds representing the E- and Z-configured double bond isomers as potential products of the dehydratase reaction were obtained from a common precursor aldehyde by Wittig olefination and Still–Gennari olefination. The final deprotection of TBS ethers and methyl esters was performed under mildly acidic conditions followed by pig liver esterase-mediated chemoselective hydrolysis. These conditions are compatible with the presence of a coenzyme A or a SNAc thioester, suggesting that they are generally applicable to the synthesis of complex polyketide-derived thioesters suited for biosynthesis studies.

  18. Heterologous Expression of the Oxytetracycline Biosynthetic Pathway in Myxococcus xanthus▿

    Science.gov (United States)

    Stevens, D. Cole; Henry, Michael R.; Murphy, Kimberly A.; Boddy, Christopher N.

    2010-01-01

    New natural products for drug discovery may be accessed by heterologous expression of bacterial biosynthetic pathways in metagenomic DNA libraries. However, a “universal” host is needed for this experiment. Herein, we show that Myxococcus xanthus is a potential “universal” host for heterologous expression of polyketide biosynthetic gene clusters. PMID:20208031

  19. Metabolic Interplay between the Asian Citrus Psyllid and Its Profftella Symbiont: An Achilles' Heel of the Citrus Greening Insect Vector.

    Directory of Open Access Journals (Sweden)

    John S Ramsey

    Full Text Available 'Candidatus Liberibacter asiaticus' (CLas, the bacterial pathogen associated with citrus greening disease, is transmitted by Diaphorina citri, the Asian citrus psyllid. Interactions among D. citri and its microbial endosymbionts, including 'Candidatus Profftella armatura', are likely to impact transmission of CLas. We used quantitative mass spectrometry to compare the proteomes of CLas(+ and CLas(- populations of D. citri, and found that proteins involved in polyketide biosynthesis by the endosymbiont Profftella were up-regulated in CLas(+ insects. Mass spectrometry analysis of the Profftella polyketide diaphorin in D. citri metabolite extracts revealed the presence of a novel diaphorin-related polyketide and the ratio of these two polyketides was changed in CLas(+ insects. Insect proteins differentially expressed between CLas(+ and CLas(- D. citri included defense and immunity proteins, proteins involved in energy storage and utilization, and proteins involved in endocytosis, cellular adhesion, and cytoskeletal remodeling which are associated with microbial invasion of host cells. Insight into the metabolic interdependence between the insect vector, its endosymbionts, and the citrus greening pathogen reveals novel opportunities for control of this disease, which is currently having a devastating impact on citrus production worldwide.

  20. Evolutionary history of the phl gene cluster in the plant-associated bacterium Pseudomonas fluorescens

    NARCIS (Netherlands)

    Moynihan, J.A.; Morrissey, J.P.; Coppoolse, E.; Stiekema, W.J.; O'Gara, F.; Boyd, E.F.

    2009-01-01

    Pseudomonas fluorescens is of agricultural and economic importance as a biological control agent largely because of its plant-association and production of secondary metabolites, in particular 2, 4-diacetylphloroglucinol (2, 4-DAPG). This polyketide, which is encoded by the eight gene phl cluster,

  1. Linking fungal secondary metabolites and pathways to their genes in Aspergillus

    DEFF Research Database (Denmark)

    Petersen, Lene Maj

    . oryzae metabolites, however, revealed the chemical link between the two species. In two parallel projects, involving A. niger and A. aculeatus respectively, the polyketide 6-methyl salicylic acid (6-MSA), and corresponding biosynthetic pathways, were investigated. In A. niger, 6-MSA was converted...

  2. Functional Reconstitution of a Fungal Natural Product Gene Cluster by Advanced Genome Editing

    DEFF Research Database (Denmark)

    Weber, Jakob; Valiante, Vito; Nødvig, Christina Spuur

    2017-01-01

    is not produced among different isolates. Combining computational analysis with targeted gene editing, we could link a single nucleotide insertion in the polyketide synthase of the trypacidin biosynthetic pathway and reconstitute its production in a nonproducing strain. Thus, we present a CRISPR/Cas9-based tool...... for advanced molecular genetic studies in filamentous fungi, exploiting selectable markers separated from the edited locus....

  3. Draft genome sequence and chemical profiling of Fusarium langsethiae, an emerging producer of type A trichothecenes

    DEFF Research Database (Denmark)

    Lysøe, Erik; Frandsen, Rasmus John Normand; Divon, Hege H.

    2016-01-01

    . The assembly was fragmented, but reveals a genome of approximately 37.5 Mb, with a GC content around 48%, and 12,232 predicted protein-coding genes. Focusing on secondary metabolism we identified candidate genes for 12 polyketide synthases, 13 non-ribosomal peptide synthetases, and 22 genes for terpene/isoprenoid...

  4. The regulation of microcystin biosynthesis pathways and genetic mechanisms

    OpenAIRE

    Serap YALÇIN

    2012-01-01

    The cyanobacteria (blue-green algae), as they arecommonly named, comprise a diverse group of oxygenicphotosynthetic bacteria that inhabit a wide rangeof aquatic and terrestrial environments, and displayincredible morphological diversity. Cyanobacteriaproduce bioactive secondary metabolites, includingalkaloids, polyketides and non-ribosomal peptides, someof which are potent toxins. The common occurrenceof toxic cyanobacteria causes problems for health ofanimals and human. Cyanobacterial toxins...

  5. Evaluation of the detection techniques of toxigenic Aspergillus isolates

    African Journals Online (AJOL)

    Aflatoxins are difuranocoumarin derivatives produced by some Aspergillus species through a polyketide pathway. Mycotoxins are considered hazardous and there is a need for accurate detection of each toxin. Several screening methods for direct visual determination of aflatoxins and ochratoxin A (OTA) production have ...

  6. Leveraging microbial biosynthetic pathways for the generation of 'drop-in' biofuels

    DEFF Research Database (Denmark)

    Zargar, Amin; Bailey, Constance B.; Haushalter, Robert W.

    2017-01-01

    Advances in retooling microorganisms have enabled bioproduction of 'drop-in' biofuels, fuels that are compatible with existing spark-ignition, compression-ignition, and gas-turbine engines. As the majority of petroleum consumption in the United States consists of gasoline (47%), diesel fuel...... acid, terpene, and polyketide synthases for the production of bio-based gasoline, diesel and jet fuel....

  7. Journal of Biosciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Non-ribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs) present in bacteria and fungi are themajor multi-modular enzyme complexes which synthesize secondary metabolites like the pharmacologically importantantibiotics and siderophores. Each of the multiple modules of an NRPS activates a ...

  8. Total synthesis of (-)-basiliskamide A and NMR studies on the conversion of basiliskamide A to basiliskamide B

    International Nuclear Information System (INIS)

    Dias, Luiz C.; Goncalves, Caroline C.S.

    2010-01-01

    We describe herein our approach to the total synthesis of the antifungal polyketide (-)-basiliskamide A, as well as 1 H NMR studies on the migration of the cinnamoyl side chain of basiliskamide A to form basiliskamide B in CDCl 3 solution. (author)

  9. Reprogramming Acyl Carrier Protein Interactions of an Acyl-CoA Promiscuous trans-Acyltransferase

    DEFF Research Database (Denmark)

    Ye, Zhixia; Musiol-Kroll, Ewa Maria; Weber, Tilmann

    2014-01-01

    Protein interactions between acyl carrier proteins (ACPs) and trans-acting acyltransferase domains (trans-ATs) are critical for regioselective extender unit installation by many polyketide synthases, yet little is known regarding the specificity of these interactions, particularly for trans-ATs w...

  10. A simple approach to the construction of the core structure present

    Indian Academy of Sciences (India)

    A convenient route for the synthesis of oxacyclobutapentalene, the tricyclic bridged core structure present in bioactive marine diterpene bielschowskysin and the polyketide hippolachnin A, is reported. The key steps involve ring closing metathesis of a triene derived from D-mannitol to produce selectively the dihydrofuran ...

  11. Biosynthesis and regulation of coronatine, a non-host-specific phytotoxin produced by Pseudomonas syringae.

    Science.gov (United States)

    Bender, C L; Palmer, D A; Peñaloza-Vázquez, A; Rangaswamy, V; Ullrich, M

    1998-01-01

    Many P. syringae pathovars are known to produce low-molecular-weight, diffusible toxins in infected host plants. These phytotoxins reproduce some of the symptoms of the relevant bacterial disease and are effective at very low concentrations. Phytotoxins generally enhance the virulence of the P. syringae pathovar which produces them, but are not required for pathogenesis. Genes encoding phytotoxin production have been identified and cloned from several P. syringae pathovars. With the exception of coronatine, toxin biosynthetic gene clusters are generally chromosomally encoded. In several pathovars, the toxin biosynthetic gene cluster also contains a resistance gene which functions to protect the producing strain from the biocidal effects of the toxin. In the case of phaseolotoxin, a resistance gene (argK) has been utilized to engineer phaseolotoxin-resistant tobacco plants. Although P. syringae phytotoxins can induce very similar effects in plants (chlorosis and necrosis), their biosynthesis and mode of action can be quite different. Knowledge of the biosynthetic pathways to these toxins and the cloning of the structural genes for their biosynthesis has relevance to the development of new bioactive compounds with altered specificity. For example, polyketides constitute a huge family of structurally diverse natural products including antibiotics, chemotherapeutic compounds, and antiparasitics. Most of the research on polyketide synthesis in bacteria has focused on compounds synthesized by Streptomyces or other actinomycetes. It is also important to note that it is now possible to utilize a genetic rather than synthetic approach to biosynthesize novel polyketides with altered biological properties (Hutchinson and Fujii, 1995; Kao et al., 1994; Donadio et al., 1993; Katz and Donadio, 1993). Most of the reprogramming or engineering of novel polyketides has been done using actinomycete PKSs, but much of this technology could also be applied to polyketides synthesized by

  12. Ancient horizontal gene transfer from bacteria enhances biosynthetic capabilities of fungi.

    Directory of Open Access Journals (Sweden)

    Imke Schmitt

    Full Text Available Polyketides are natural products with a wide range of biological functions and pharmaceutical applications. Discovery and utilization of polyketides can be facilitated by understanding the evolutionary processes that gave rise to the biosynthetic machinery and the natural product potential of extant organisms. Gene duplication and subfunctionalization, as well as horizontal gene transfer are proposed mechanisms in the evolution of biosynthetic gene clusters. To explain the amount of homology in some polyketide synthases in unrelated organisms such as bacteria and fungi, interkingdom horizontal gene transfer has been evoked as the most likely evolutionary scenario. However, the origin of the genes and the direction of the transfer remained elusive.We used comparative phylogenetics to infer the ancestor of a group of polyketide synthase genes involved in antibiotic and mycotoxin production. We aligned keto synthase domain sequences of all available fungal 6-methylsalicylic acid (6-MSA-type PKSs and their closest bacterial relatives. To assess the role of symbiotic fungi in the evolution of this gene we generated 24 6-MSA synthase sequence tags from lichen-forming fungi. Our results support an ancient horizontal gene transfer event from an actinobacterial source into ascomycete fungi, followed by gene duplication.Given that actinobacteria are unrivaled producers of biologically active compounds, such as antibiotics, it appears particularly promising to study biosynthetic genes of actinobacterial origin in fungi. The large number of 6-MSA-type PKS sequences found in lichen-forming fungi leads us hypothesize that the evolution of typical lichen compounds, such as orsellinic acid derivatives, was facilitated by the gain of this bacterial polyketide synthase.

  13. Resveratrol anti-ultraviolet-induced guinea pig skin injury

    International Nuclear Information System (INIS)

    Li Wenxing; Zhao Ying

    2014-01-01

    Objective: To Estimate on the protection effect of Stilbene on skin damage induced by ultraviolet radiation. Methods: After the normal skin in guinea pig under the intervene of Resveratrol was irradiated with over- dose of ultraviolet rays (UVB and UVA), the samples in every group were matched and compared. Results: The skin tissue in the Resveratrol intervene group irradiated by ultraviolet rays didn't change obviously as compared with that in the self-control group. But, the damage skin tissue in the control group irradiated by ultraviolet did change significantly as compared with that in the Stilbene intervene group. Conclusion: Resveratrol is a good material to protect the skin from damage effect by ultraviolet radiation. (authors)

  14. A Derivative Method with Free Radical Oxidation to Predict Resveratrol Metabolites by Tandem Mass Spectrometry.

    Science.gov (United States)

    Liu, Wangta; Shiue, Yow-Ling; Lin, Yi-Reng; Lin, Hugo You-Hsien; Liang, Shih-Shin

    2015-10-01

    In this study, we demonstrated an oxidative method with free radical to generate 3,5,4'-trihydroxy- trans -stilbene ( trans -resveratrol) metabolites and detect sequentially by an autosampler coupling with liquid chromatography electrospray ionization tandem mass spectrometer (LC-ESI-MS/MS). In this oxidative method, the free radical initiator, ammonium persulfate (APS), was placed in a sample bottle containing resveratrol to produce oxidative derivatives, and the reaction progress was tracked by autosampler sequencing. Resveratrol, a natural product with purported cancer preventative qualities, produces metabolites including dihydroresveratrol, 3,4'-dihydroxy- trans -stilbene, lunularin, resveratrol monosulfate, and dihydroresveratrol monosulfate by free radical oxidation. Using APS free radical, the concentrations of resveratrol derivatives differ as a function of time. Besides simple, convenient and time- and labor saving, the advantages of free radical oxidative method of its in situ generation of oxidative derivatives followed by LC-ESI-MS/MS can be utilized to evaluate different metabolites in various conditions.

  15. Resveratrol in peanuts.

    Science.gov (United States)

    Sales, Jocelyn M; Resurreccion, Anna V A

    2014-01-01

    Peanuts are important dietary food source of resveratrol with potent antioxidant properties implicated in reducing risk of cancer, cardiovascular and Alzheimer's disease, and delaying aging. Resveratrol is a naturally occurring stilbene phytoalexin phenolic compound produced in response to a variety of biotic and abiotic stresses. This paper is a review of trans-resveratrol and related stilbenes from peanuts--their chemical structures, mechanisms for their biosynthesis, and concentrations in comparison with other major food sources. It will also discuss trans-resveratrol's absorption, bioavailability, and major health benefits; processes to enhance their biosynthesis in peanuts by biotic and abiotic stresses; process optimization for enhanced levels in peanuts and their potential food applications; and methods used for its extraction and analysis.

  16. Excited state dynamics & optical control of molecular motors

    Science.gov (United States)

    Wiley, Ted; Sension, Roseanne

    2014-03-01

    Chiral overcrowded alkenes are likely candidates for light driven rotary molecular motors. At their core, these molecular motors are based on the chromophore stilbene, undergoing ultrafast cis/trans photoisomerization about their central double bond. Unlike stilbene, the photochemistry of molecular motors proceeds in one direction only. This unidirectional rotation is a result of helicity in the molecule induced by steric hindrance. However, the steric hindrance which ensures unidirectional excited state rotation, has the unfortunate consequence of producing large ground state barriers which dramatically decrease the overall rate of rotation. These molecular scale ultrafast motors have only recently been studied by ultrafast spectroscopy. Our lab has studied the photochemistry and photophysics of a ``first generation'' molecular motor with UV-visible transient absorption spectroscopy. We hope to use optical pulse shaping to enhance the efficiency and turnover rate of these molecular motors.

  17. Pterostilbene Is a Potential Candidate for Control of Blackleg in Canola.

    Directory of Open Access Journals (Sweden)

    Joshua C O Koh

    Full Text Available Two stilbenes, resveratrol and pterostilbene, exhibit antifungal activity against Leptosphaeria maculans, the fungal pathogen responsible for blackleg (stem canker in canola (Brassica napus. In vitro studies on the effect of these stilbenes on L. maculans mycelial growth and conidia germination showed that pterostilbene is a potent fungicide and sporicide, but resveratrol only exerted minor inhibition on L. maculans. Cell viability of hyphae cultures was markedly reduced by pterostilbene and SYTOX green staining showed that cell membrane integrity was compromised. We demonstrate that pterostilbene exerts fungicidal activity across 10 different L. maculans isolates and the compound confers protection to the blackleg-susceptible canola cv. Westar seedlings. The potential of pterostilbene as a control agent against blackleg in canola is discussed.

  18. Targeting Mycobacterium tuberculosis nucleoid-associated protein HU with structure-based inhibitors

    Science.gov (United States)

    Bhowmick, Tuhin; Ghosh, Soumitra; Dixit, Karuna; Ganesan, Varsha; Ramagopal, Udupi A.; Dey, Debayan; Sarma, Siddhartha P.; Ramakumar, Suryanarayanarao; Nagaraja, Valakunja

    2014-06-01

    The nucleoid-associated protein HU plays an important role in maintenance of chromosomal architecture and in global regulation of DNA transactions in bacteria. Although HU is essential for growth in Mycobacterium tuberculosis (Mtb), there have been no reported attempts to perturb HU function with small molecules. Here we report the crystal structure of the N-terminal domain of HU from Mtb. We identify a core region within the HU-DNA interface that can be targeted using stilbene derivatives. These small molecules specifically inhibit HU-DNA binding, disrupt nucleoid architecture and reduce Mtb growth. The stilbene inhibitors induce gene expression changes in Mtb that resemble those induced by HU deficiency. Our results indicate that HU is a potential target for the development of therapies against tuberculosis.

  19. Estudo teórico de propriedades ópticas não-lineares de nanotubos de carbono de parede única quimicamente modificados Theoretical analysis of non-linear optical properties for chemically modified single wall carbon nanotubes

    Directory of Open Access Journals (Sweden)

    Antônio M. Da Silva Jr.

    2009-01-01

    Full Text Available Structure and first hyperpolarizability for a series of armchair a(5,5 chemically modified carbon nanotubes (CNT were calculated at semiempirical and density functional levels of theory. The 4,4´-substituted stilbenes were selected as chromophore with substituents at position 4´ set to X=NO2, H, Cl, OH and NH2. The calculated values for static first hyperpolarizability (β were almost linearly dependent on the electronic effect of the group X, increasing from NO2 to NH2. At DFT level the effect of inserting the chromophore in the CNT surface was to enhance the β value up to 70% relative to the free 4,4´-substituted stilbene.

  20. Summary of neutron measurements for the Viking Program

    International Nuclear Information System (INIS)

    Anderson, M.E.

    1975-01-01

    The results of neutron measurements for 238 Pu-fueled, 683-W (thermal) capsules fabricated for the Viking Program (Mars Lander) are presented. These results include, for each capsule, the total neutron emission rate and neutron multiplication and, for one capsule, the neutron energy spectrum. A precision long counter was used for the neutron emission rate measurements and a single stilbene crystal for the neutron spectrum measurement. (U.S.)